WO1996011212A1

WO1996011212A1 - Novel receptor-type tyrosine kinase ligand

Info

Publication number: WO1996011212A1
Application number: PCT/JP1995/002069
Authority: WO
Inventors: Seiji Sakano; Mitsuharu Ohno
Original assignee: Asahi Kasei Kogyo Kabushiki Kaisha
Priority date: 1994-10-07
Filing date: 1995-10-09
Publication date: 1996-04-18
Also published as: AU3619895A

Abstract

A novel receptor-type tyrosine kinase ligand binding to the extracellular part of a specified receptor-type tyrosine kinase to enhance the enzymatic activity of the tyrosine kinase in the intracellular part to thereby induce tyrosine kinase phosphorylation, which specified kinase is one that expresses in undifferentiated blood cells but suffers from a lowering in the expression level with the progress of the differentiation of the blood cells and that participates in the differentiation and growth of the undifferentiated cells; a complex of the above novel ligand with at least one member selected from the group consisting of the ligand and other compounds; a DNA coding for the ligand; a genetic-engineering process for producing the ligand; and an antibody that specifically recognizes the ligand. The effect of the ligand in accelerating the growth of undifferentiated blood cells is based on the acceleration of colony formation of human cord blood monocytes. As the ligand and complex thereof have the effect of accelerating the differentiation and growth of undifferentiated blood cells, they are useful for the study of the problems related to undifferentiated blood cells including hematopoietic stem cells, such as leukemia and bone marrow transplantation, and for the therapy.

Description

Title of invention

New receptor tyrosine kinase ligand

Background of the Invention

Technical field

The present invention relates to a novel receptor pig tyrosine kinase type ligand. More specifically, the present invention binds to the extracellular portion of a specific receptor tyrosine kinase involved in the differentiation and proliferation of blood undifferentiated cells, and reduces the tyrosine kinase activity of the intracellular portion. The present invention relates to a novel receptor tyrosine kinase ligand that is activated to cause phosphorylation of the tyrosine kinase. The present invention also provides a complex comprising the novel receptor tyrosine kinase ligand described above, and at least one member selected from the group consisting of the ligand and a compound other than the ligand. A DNA encoding the ligand; a method for producing the ligand by genetic engineering; and an antibody that specifically recognizes the ligand.

Conventional technology

There are many types of cells in human blood, each of which plays an important role. For example, red blood cells carry oxygen in the body, platelets provide a haemostatic effect, and white blood cells make up the immune system to protect against infection. These diverse cells are derived from hematopoietic stem cells in the bone marrow. In recent years, hematopoietic stem cells have been clearly influenced by various hematopoietic factors and environmental factors in the body and differentiated into various blood cells, osteoclasts, mast cells, and the like. As a hematopoietic factor, Erythropoietin (EPO) for differentiation into red blood cells, granulocyte colony-stimulating factor (G-CSF) for differentiation into leukocytes, and platelet growth factor for differentiation into platelet-producing megakaryocytes (Mp 1 -L) was discovered, and the former two are already in clinical use. However, the mechanism of differentiation and proliferation of blood undifferentiated cells such as bone marrow cells including hematopoietic stem cells, peripheral blood cells, and umbilical cord blood cells is still not known. There are many unclear points.

Tyrosine kinase, an enzyme that specifically phosphorylates tyrosine, an amino acid present in proteins, transmits signals from the outside of the cell to the inside of the cell, and the gene in the cell nucleus. It is an important substance that controls transcription. Recent studies have revealed that tyrosine kinases and activators that activate tyrosine kinase enzyme activity are significantly involved in the development and differentiation of animals and insects. It is considered that tyrosine kinase and its activator are greatly involved in cell differentiation and proliferation.

The physiologically active site of tyrosine kinase is composed of about 250 amino acid residues. Among the amino acid sequences of the tyrosine kinase group, there is a very conserved amino acid sequence (Hanks et a 1. Science 241: 42, 1988). By designing a DNA sequence corresponding to the sequence and using it as a primer in the RT (Reverse Transcription) PCR method, New tyrosine kinase gene fragment can be obtained

(Wi 1 ks. Methods in Enzymo 1 ogy 200: 533, 1991).

C-kit, which is a type of receptor pig type 1 osteosynkinase and is expressed on the surface of blood undifferentiated cells, is a mast cell growth factor and one of the growth factors of blood undifferentiated cells. It has been found that stem cell factor (SCF) is activated by binding to its extracellular portion (Witte. Cell 63: 5, 1992). Cell differentiation is controlled through the tyrosine kinase kit.

In addition, ELK, a receptor type 1 tyrosine kinase, is a ligand, LERK-2 (Bee kmanna et al., EMBO J. 13: 3757, 1994; Fletche reta, Oncogene 9: 321, 1994; (See International Patent Publication No. W094Z111384)).

Summary of the Invention

The present inventors have previously described a novel receptor tyrosine kinase gene different from the receptor tyrosine kinase c-kit described above, which is involved in the differentiation and proliferation of blood undifferentiated cells. Cloning was performed from the blast leukemia cell line UT-7, and the entire nucleotide sequence was determined. Then, a method for genetically producing the receptor type 1 tyrosine kinase was established [refer to International Patent Publication No. WO 95/15386 (this receptor type tyrosine kinase). Nucleotide sequence and amino acid sequence The sequence considered to be the same is also described in Bennett el a 1., J. Βiο 1. Chem., 269, 14211-14218 ·, 1994)]).

In general, a ligand for a receptor tyrosine kinase specifically binds to an extracellular portion of a certain receptor tyrosine kinase, activates a tyrosine kinase enzyme activity in that intracellular portion, and It is defined as a substance having the property of inducing the phosphorylation of tyrosine kinases. Usually, one kind of receptor-type tyrosine kinase has one kind of ligand in the living body. In addition, organs expressing the receptor tyrosine kinase, specific cells expressing the same, and changes in expression due to some stimuli are detected by the antisense oligonucleotide of the receptor tyrosine kinase. In situ using a nucleotide Detecting by a staining method using hybridization, Northern blot, or an antibody, etc., in the body where the ligand acts Since the site and the cell can be specified, it is possible to estimate the physiological action of the ligand to some extent.

As described in Reference Example 7, when the undifferentiated blood-derived cell line loses its proliferative ability by re-differentiating with an stimulant, as described in Reference Example 7, mRNA expression is no longer observed. Therefore, it is presumed that this receptor type 1 tyrosin kinase is particularly a receptor / growth factor of unknown differentiation / growth factor of undifferentiated blood cells. Therefore, the present inventors Is a substance that specifically binds to the extracellular portion of the receptor tyrosine kinase, activates tyrosine kinase enzyme activity in the intracellular portion, and causes phosphorylation of the tyrosine kinase. (Ligand) I did intensive research to find out. As a result, the extracellular domain of the receptor pig type 1 ostium syncinase polypeptide containing the amino acid sequence of SEQ ID NO: 1 in the attached sequence listing previously disclosed by the present inventors was specific. Cells that express a novel compound (ligand) that bind specifically and promote the proliferation of blood undifferentiated cells were successfully identified, and the ligand was purified and isolated from the expressed cells. Then, the amino acid sequence of the amino terminal (N-terminal) of the ligand is determined, a primer is prepared based on the amino acid sequence, and c A DNA probe was prepared and cDNA encoding the full-length amino acid sequence was isolated. Using this cDNA, a cell expressing the ligand was prepared, and the ligand was further isolated. The resettiva type 1 tyrosine kinase ligand of the present invention significantly promoted the proliferation of blood undifferentiated cells. In addition, the extracellular domain of the receptor type 1 oral synthase polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 is added to other known receptor type tyrosine kinase ligands. The receptor tyrosine kinase ligand of the present invention bound very tightly, causing phosphorylation of the tyrosine kinase, compared to almost no binding. As described above, the ribose pig type 1 tyrosine kinase ligand of the present invention comprises the amino acid sequence of SEQ ID NO: 1. Activates the intracellular tyrosine kinase activity by binding to the extracellular domain of the receptor pig type 1 osteosynkinase polypeptide, represented by the sequence. Therefore, the receptor tyrosine kinase ligand of the present invention is one of the factors that significantly promote the differentiation and proliferation of blood undifferentiated cells. In addition, the present inventors further provide a complex of one or more molecules of the ligand of the present invention with a heterologous protein or a complex comprising two or more molecules of the ligand of the present invention (dimer or more) Was found to have an activity equal to or greater than the physiological activity of one molecule of the ligand. Furthermore, an antibody was produced that specifically recognizes and binds to the novel receptor pig type 1 tyrosine kinase ligand described above. The present invention has been completed based on the above findings.

Accordingly, one object of the present invention is to provide a novel ligand that specifically binds to a specific receptor tyrosine kinase involved in the differentiation of blood undifferentiated cells and activates the tyrosine kinase activity, And a DNA encoding the same. Another object of the present invention is to provide one or more molecules of the above-mentioned receptor type tyrosine kinase ligand having a bioactivity equivalent to or higher than that of the above-mentioned receptor type 1 tyrosine kinase ligand and a heterologous protein. And a complex comprising two or more molecules of the ligand.

Still another object of the present invention is to specifically bind to the ligand of the present invention, which can be advantageously used for purification of the ligand. To provide an antibody.

Still another object of the present invention is to provide a sense DNA fragment and an antisense which can be advantageously used for confirming the gene expression of the ligand of the present invention and for regulating gene expression in cells. An object of the present invention is to provide a DNA fragment and a derivative thereof, and a sense RNA fragment and an antisense RNA fragment and a derivative thereof.

The above and other objects, features and advantages of the present invention will become apparent from the following detailed description and the appended claims, with reference to the accompanying Sequence Listing.

Brief description of the sequence listing

In the sequence listing:

The amino acid sequence of SEQ ID NO: 1 is the sequence of the extracellular domain of the receptor pig type 1 tyrosine kinase to which the ligand of the present invention specifically binds, excluding the signal peptide. The amino acid sequence of the receptor type 1 tyrosine kinase shown in SEQ ID NO: 3 corresponds to amino acid numbers 1 to 522 of the entire amino acid sequence;

The amino acid sequence of SEQ ID NO: 2 corresponds to the extracellular domain and membrane permeation of the ribosomal type 1 lipoprotein kinase to which the ligand of the present invention specifically binds, excluding signal peptide. In the sequence of the whole domain of the domain and the intracellular domain, the amino acid numbers 1 to 1 of the entire amino acid sequence of the receptor pig type 1 tyrosine kinase shown in SEQ ID NO: 3 9 7 Equivalent to number 2; SEQ ID NO: 3 is the entire amino acid sequence of the receptor tyrosine kinase to which the ligand of the present invention specifically binds, and the entire cDNA sequence of the receptor tyrosine kinase. ;

SEQ ID NO: 4 is the sequence of the 8 amino acid residues at the N-terminal side of the ligand of the present invention, and the amino acid sequence of the entire amino acid sequence of the ligand of the present invention shown in SEQ ID NO: 7 is SEQ ID NO: 7. SEQ ID NO: 5 corresponds to the amino acid Nos. 1 to 8; SEQ ID NO: 5 is the sequence of the extracellular domain of the ligand of the present invention excluding the signal peptide, and is represented by SEQ ID NO: 7. The amino acids corresponding to amino acid numbers 1 to 195 of the entire amino acid sequence of the ligand of the present invention shown;

SEQ ID NO: 6 is the sequence of all the domains of the extracellular domain, transmembrane domain, and intracellular domain of the ligand of the present invention except for the signal peptide. 7 corresponds to amino acid numbers 1 to 308 of the entire amino acid sequence of the ligand of the present invention shown in FIG. 7;

SEQ ID NO: 7 is the entire amino acid sequence and the entire cDNA sequence of the ligand of the present invention;

SEQ ID NO: 8 is a nucleotide sequence of sense primer used in Reference Example 2;

SEQ ID NO: 9 is the base sequence of antisense primer used in Reference Example 2;

SEQ ID NO: 10 is the nucleotide sequence of primer 11 used in Reference Example 8; SEQ ID NO: 11 is the nucleotide sequence of primer 2 used in Reference Example 8;

SEQ ID NO: 12 is the nucleotide sequence of primer 3 used in Reference Example 8;

SEQ ID NO: 13 is the nucleotide sequence used in Reference Example 8 and the amino acid sequence of the oligopeptide FLAG which it encodes; SEQ ID NO: 14 is the primer sequence used in Reference Example 8. A sequence of 14 bases;

SEQ ID NO: 15 is the nucleotide sequence of primer 15 used in Reference Example 8;

SEQ ID NO: 16 is the base sequence of primer 6 used in Reference Example 8;

SEQ ID NO: 17 is the nucleotide sequence of primer 7 used in Reference Example 8;

SEQ ID NO: 18 is the nucleotide sequence of primer 8 used in Reference Example 8;

SEQ ID NO: 19 is the N-terminal sequence of the ligand of the present invention determined by the peptide sequencer in Example 9, and comprises the entirety of the ligand of the present invention shown in SEQ ID NO: 7. The amino acid sequence corresponding to amino acid numbers 1 to 48 in the amino acid sequence;

SEQ ID NO: 20 is the nucleotide sequence of primer 19 used in Example 10;

SEQ ID NO: 21 is a fragment of the primer 10 used in Example 10 In base sequence;

SEQ ID NO: 22 is the nucleotide sequence of the cDNA probe prepared in Example 10 and the amino acid sequence encoded by it. SEQ ID NO: 23 is the LERK-2 gene of Example 19 in Example 19. A sense primer used for crossing; and

SEQ ID NO: 24 is an antisense primer used in Example 19 to close the LERK-2 gene.

The left and right ends of each amino acid sequence represented by SEQ ID NOs: 1 to 4 and 7 are the N-terminal and C-terminal, respectively, and the base sequence represented by SEQ ID NOs: 4 to 7 Are the 5 'and 3' ends, respectively.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a graph showing the results of measuring the binding activity of the ligand in the cell supernatant of C-11 cells (unstimulated) to ostium synkinase in Example 2;

FIG. 2 is a graph showing the results of measurement of the fluorescence peak of the cells expressing the ligand of the present invention by the flow site meter in Example 3;

FIG. 3 is a photograph of a Western blot of cells expressing the ligand of the present invention by phosphorylation in Example 4;

FIG. 4 is a photograph showing the result of electrophoresis of the primary purified ligand of the present invention in Example 5;

FIG. 5 is a graph showing a chromatographic pattern obtained by gel filtration in Example 6.

FIG. 6 is a graph showing the measurement results of the ligand binding activity of each fraction of the separated solution by gel filtration in Example 6;

FIG. 7 is a photograph showing the result of electrophoresis of the ligand of the present invention purified by gel filtration in Example 6;

FIG. 8 is a photograph showing the result of electrophoresis of the finally purified ligand of the present invention in Example 7;

FIG. 9 is a graph showing the result of comparing the ligand binding activity of the ligand of the present invention and LERK-2 in Example 19; FIG. 10 shows a photograph of a Western blot comparing the ligand of the present invention with LERK-2 · for phosphorylation activity.

Detailed description of the invention

According to one embodiment of the present invention, an isolated amino acid sequence having a receptor tyrosine kinase activity and containing an amino acid sequence selected from the group consisting of SEQ ID NOS: 1 and 2 in the sequence listing is provided. Has the ability to bind to a polypeptide and a homologous mutant having a receptor tyrosine kinase activity of the polypeptide, and is analyzed by polyacrylamide gel electrophoresis. An isolated compound characterized in that it has a measured molecular weight of at least 410,000 ± 7,500 daltons and is capable of undergoing a poly (coomassie brilliant blue) staining reaction Is provided.

Further, according to another embodiment of the present invention, an isolated polypeptide comprising at least a portion of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing is provided. Compounds are provided.

According to another embodiment of the present invention, a compound containing at least a part of a polypeptide containing an amino acid sequence of SEQ ID NO: 6 in a sequence listing,

At least one kind of the compound containing at least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing and the amino acid of SEQ ID NO: 6 in the above sequence listing At least one member selected from the group consisting of compounds other than compounds containing at least a part of the polypeptide containing an acid sequence; A conjugate comprising:

According to still another aspect of the present invention, there is provided an isolated DNA encoding at least a part of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing.

According to still another embodiment of the present invention, there is provided a method for producing an isolated compound comprising at least a portion of a polypeptide containing an amino acid sequence of SEQ ID NO: 6 in the sequence listing. By the way:

(a) DNA encoding at least a part of the polypeptide is linked to a replicable expression vector, and the DNA is incorporated in the replicable expression vector so as to be expressible. Obtaining replicable recombinant DNA,

(b) transforming a eukaryotic or prokaryotic cell with the replicable recombinant DNA to form a transformant;

(c) selecting the transformant from the eukaryotic cell or prokaryotic cell as a parent cell,

(d) incubating the transformant to express the DNA in the transformant to produce a compound containing at least a part of the polypeptide; And

(e) isolating the compound from the incubated transformant,

A method is provided.

According to still another embodiment of the present invention, it comprises the above-described compound of the present invention or the amino acid sequence of SEQ ID NO: 5 in the sequence listing. The present invention provides an antibody that specifically recognizes a compound containing at least a part of the polypeptides.

Next, in order to facilitate understanding of the present invention, first, basic features and preferred embodiments of the present invention will be listed.

1. An isolated polypeptide having receptor tyrosine kinase activity and containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 and 2 in the sequence listing; Has the ability to bind the peptide to a homologous mutant having receptor type 1 tyrosine kinase activity, and has a molecular weight of at least 415,000 as measured by polyacrylamide gel electrophoresis. An isolated compound characterized by being capable of undergoing a polyprimprion blue stain reaction at ± 750 daltons.

2. An isolated polypeptide having the receptor pig type 1 tyrosine kinase activity and containing the amino acid sequence of SEQ ID NO: 2 in the sequence listing, or a peptide of the polypeptide. Item 1 having the property of phosphorylating at least one tyrosine residue of the polypeptide when reacted with a cell expressing a homologous mutant having a septa type 1 tyrosine kinase activity. Compound.

3. The compound according to item 1, which includes a polypeptide containing the amino acid sequence described in SEQ ID NO: 4 in the sequence listing.

4. The compound according to item 3, wherein the amino acid sequence described in SEQ ID NO: 4 in the sequence listing is located at the amino terminal of the polypeptide.

5. Coomassie brilliant blue staining reaction and PAS staining reaction The compound according to item 1, which can receive both of the following.

6. The compound according to item 1, comprising at least a portion of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing,

7. At least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is at least partially containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing. 7. The compound according to item 6, wherein the compound is at least part of a compound.

8. An isolated compound comprising at least a portion of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing.

9. At least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is at least partially derived from the polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing. Item 9. The compound according to Item 8, which is at least a part thereof.

10. A compound containing at least a part of a polypeptide having the amino acid sequence of SEQ ID NO: 6 in the sequence listing,

At least one kind of a compound containing at least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing and the amino acid of SEQ ID NO: 6 in the above sequence listing At least one member selected from the group consisting of compounds other than compounds containing at least a part of a polypeptide having an acid sequence;

A complex consisting of

11 1. At least a portion of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is at least partially a protein of SEQ ID NO: 5 in the sequence listing. 21. The complex according to item 10, which is at least a part of a polypeptide containing a amino acid sequence.

12. An isolated DNA encoding at least part of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing.

13 3. At least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is a polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing. Item 12. The compound DNA according to Item 12, which is at least part of a peptide.

14. A method for producing an isolated compound comprising at least a portion of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing:

(a) DNA encoding at least a part of the polypeptide is linked to a replicable expression vector, and the DNA is operably incorporated into the replicable expression vector. To obtain a recombinant DNA that can be made

(d) incubating the transformant to express the DNA in the transformant to produce a compound containing at least a part of the polypeptide; And then

(e) isolating the compound from the incubated transformants; Isolate,

A method characterized by this.

15 5. At least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is a polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing. The method of item 14 which is at least part of the code.

16. An antibody that specifically recognizes the compound according to item 1, or a compound containing at least a part of a polypeptide having the amino acid sequence of SEQ ID NO: 5 in the sequence listing.

17. A single DNA selected from the group consisting of a sense DNA containing at least 12 consecutive nucleotide sequences of the nucleotide sequence of SEQ ID NO: 7 in the sequence listing, and an antisense DNA complementary to the sense DNA The isolated DNA fragment, and the sense DNA and the antisense DNA are methylated, methylphosphorylated, thiophosphorylated, or deaminated, respectively. An isolated DNA fragment selected from the group consisting of said sense DNA and said antisense DNA derivative.

18. An antisense RNA comprising at least 12 consecutive nucleotide sequences complementary to the nucleotide sequence of SEQ ID NO: 7 in the sequence listing, and a sense RNA complementary to the antisense RNA. The selected isolated RNA fragment, and the antisense RNA and the sense RNA are methylated, methylphosphorated, thiophosphorylated, or deamino, respectively. Become An isolated RNA fragment selected from the group consisting of the antisense RNA and a derivative of the sense RNA. In the present invention, preparation of cDNA necessary for gene manipulation, examination of expression by Northern blot, screening by hybridization, preparation of recombinant DNA, determination of DNA base sequence, A series of molecular biology experiments, such as preparation of a cDNA library, can be performed by the method described in an ordinary experiment manual. For example, the usual test book mentioned above is, for example,

O lecul ar Cloning, Al aboratory manua l, 1989, Eds., Sambrook, J., Fr it sch, E.F., and Maniatis, T., Cold Spring, edited by Man i at is et al. The Harbor Laborator Press can be mentioned.

The receptor tyrosine kinase ligand of the present invention has an amino acid sequence selected from the group consisting of SEQ ID NOS: 1 and 2 in the sequence listing, having receptor type 1 tyrosine kinase activity. And has the ability to bind to the isolated polypeptide and a homologous mutant of the polypeptide having a receptor-type thymic synthase activity, and is capable of binding to a polyacrylamide gel. A single sculpted compound characterized by having a molecular weight measured by electrophoresis of at least 4150 ± 7500 danoletone and being capable of undergoing a Kumasi-prilian blue staining reaction; Alternatively, it is defined as an isolated compound containing at least a part of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing. In the present invention, the term “receptor tyrosine kinase activity” refers to an enzyme activity that tyrosine kinase originally possesses for phosphorylating tyrosine residues, and the extracellular domain of receptor tyrosine kinase. It recognizes and binds ligands, and phosphorylates amino acid residues (mainly tyrosine residues) in the intracellular domain of receptor tyrosine kinases. It shall contain at least one of the functions of binding to other intracellular proteins at the oxidized site and phosphorylating the intracellular protein at the binding site.

Further, in the present invention, the “reset pig type 1 tyrosine kinase ligand activity” refers to a receptor type 1 tyrosine kinase having at least the amino acid sequence of SEQ ID NO: 1 in the sequence listing. An activity of binding to a polypeptide (that is, an extracellular domain of the receptor pig type 1 tyrosine kinase) or a receptor type containing the amino acid sequence of SEQ ID NO: 2 in the sequence listing Tyrosine kinase lipopeptide (ie, a polypeptide composed of an extracellular domain, a transmembrane domain, and an intracellular domain excluding the signal peptide of the receptor-type tyrosine kinase). ) By binding to at least at least one of the polypeptides.

It shall include any activity that phosphorylates one tyrosine residue.

In the present invention, mutations such as intra-species mutations and allelic mutations that are known to occur in nature and can be artificially produced Homologous mutants having a receptor tyrosine kinase ligand activity, which are caused by mutations such as point mutations, are also included in the receptor tyrosine kinase ligand of the present invention. In addition, even if there is no mutation at the amino acid level, the chromosomal DNA or cDNA isolated from the natural environment can cause the amino acid sequence encoded by the DNA to be reduced due to the degeneracy of the genetic code. There are often cases where the DNA base sequence is mutated without change. In addition, since the 5 'untranslated region and the 3' untranslated region do not participate in the definition of the amino acid sequence of the polypeptide, the DNA sequences of those regions are easily mutated. The nucleotide sequence obtained by such degeneracy or mutation of the gene, and the amino acid sequence of the above-described ligand homologous mutant having the receptor type 1 tyrosine kinase activity are described below. The nucleotide sequence to be coded is also included in the DNA of the present invention. The step of obtaining the cDNA of the receptor type 1 tyrosine kinase used in the present invention is performed as described in Reference Examples 1 to 6 described below. You. That is, PCR is performed using primers corresponding to the amino acid sequence characteristic of the tyrosine kinase gene. Preparation of PCR primers and PCR can be performed by the method of Wi 1 ks (Proc. Nat 1. Acad. Sci. USA 86: 1603, 1989). Specifically, an oligonucleotide is synthesized and purified using a commercially available DNA synthesizer to obtain a primer for PCR. Next, the PCR primer was used to transform human megakaryoblastic leukemia cell line UT-7 (Japan, Kumamoto University School of Medicine, Division of Developmental Medicine, Division of Developmental Medicine, Toshio Suda (Available from Lecturer, Department of Hematology, Jichi Medical University, Japan, Lecturer Norio Komatsu) and perform PCR to amplify specific sites. As a result, about 200 bp, which is a part of a specific tyrosine kinase, can be expanded. The PCR product DNA fragment is separated by agarose gel electrophoresis or the like, and purified and recovered. When the recovered DNA fragment was cloned and its gene sequence was determined, it corresponds to nucleotides 2644 to 2812 of the nucleotide sequence of SEQ ID NO: 3 in the sequence listing. This sequence encodes the central portion of the active site of the chicokinase enzyme and encodes an amino acid sequence that plays an important role in intracellular signaling.

For the cloning of the whole sequence of the cDNA of the human swine type 1 synthase kinase used in the present invention, the cDNA fragment cloned by the method described above is labeled with an isotobe, and the cDNA of the UT-7 cell line is cloned. It can be obtained by screening a DNA library by a method such as hybridization. Is a labeling eye Seo bets Ichipu was example, if ^[32 P] y - how to label the end with ATP and T 4 port I J click Reochi Dokina one peptidase and other two click DOO Labeling methods such as the lanceration method or the primer extension method can be used.

The cDNA base sequence of the receptor tyrosine kinase used in the present invention is shown as SEQ ID NO: 3 in the sequence listing together with the amino acid sequence encoded by it. The nucleotide sequence is longer than 409 bases. 5 'untranslated region, followed by a region coding for the receptor tyrosine kinase consisting of 2961 bases, and further followed by 3' consisting of 919 bases Consists of untranslated regions. The amino acid sequence of this receptor tyrosine kinase is a signal peptide composed of 15 amino acids corresponding to amino acids 15 to 11 of SEQ ID NO: 3 in the sequence listing. And the extracellular portion composed of amino acids 5 to 22 of amino acid sequence No. 1 to SEQ ID No. 3 in the sequence listing, amino acid sequence of SEQ ID No. 3 in the sequence listing The transmembrane portion composed of 26 amino acids corresponding to Nos. 52 3 to 54 8 of the amino acid sequence of SEQ ID NO: 3 in the sequence listing The intracellular portion composed of 4 2 4 amino acids is composed of the same. Furthermore, in the intracellular portion, 260 amino acid corresponding to amino acids 600 to 859 of the amino acid sequence of SEQ ID NO: 3 in the sequence listing is a tyrosine kinase enzyme active portion. The transformed cell obtained by transfecting Escherichia coli JM109 (manufactured by Toyobo, Japan) with the vector pBSRTKFULL containing the entire nucleotide sequence of this resettle pig type 1 tyrosine kinase cDNA was produced by the Ministry of International Trade and Industry of Japan. Deposited at the National Institute of Advanced Industrial Science and Technology, National Institute of Biotechnology, under the deposit number FE RM BP—4883, on January 11, 1994.

The polypeptide having the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing is obtained by removing the amino acid in the portion excluding the signal peptide in the extracellular portion of the receptor type 1 lipoprotein kinase. Has an acid sequence Equivalent to a polypeptide. In addition, the polypeptide having the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing is a polypeptide having an amino acid sequence excluding the signal peptide of the receptor tyrosine kinase described above. Equivalent to a peptide.

The receptor tyrosine kinase used in the present invention is human EPH (Hirai eta, Science, 238, 1717—1720, 1987), a cloned receptor type 1 tyrosine kinase. ECK (Lindberg and Hunter, Mo 1. Cel l.

Biol., 10, 6316-6324, 1990), rat ELK (Lhotak eta 1., o 1. Cell. Biol., 11, 2496-2502, 1991), human HEK (Wicks eta 1., USA., 89, 1611-1615, 1992), mouse SEK (Gi 1 ardi-He benstreit et a 1., Oncogene, 7, 2499-2506, 1992). ), Chicken C ek — 5

(Pasqua 1 e, Cell Regulation, 2, 523-534, 1991), but the homologue of the amino acid sequence has the highest ELK of 56.3%. However, this is a novel receptor pig type 1 tyrosine kinase having an amino acid sequence different from these substances, and is the first substance identified by the present inventors.

The methods for obtaining the receptor tyrosine kinase gene used in the present invention include the methods described in Reference Examples 1 to 6 and commercially available human placenta or fetal liver cDNA. Uses the cDNA library directly as a template, and A sense primer and an antisense primer of about 2 O mer of the DNA sequence described in No. 3 are prepared and subjected to PCR, or by using this PCR product as a probe. The library can be obtained by screening using the method described in Reference Examples 1 to 6. Furthermore, the cDNA of the receptor type 1 tyrosine kinase used in the present invention is not only UT-7 but also a human chronic myelogenous leukemia cell line, K5662, a blood cell line. RCB 027) and human acute megakaryoblastic leukemia cell line CMK (Blood 74: 42, 1989), and liver for non-blood cell lines. Cell carcinoma cell line Hep3B [American 'Type' Culture 'Collection (hereinafter referred to as ATCC) available as HB8064] and human fetal lung fibroblast cell line MRC — 5 (available from the National Institute of Physical and Chemical Research, Cell Development Bank, No. RCB0211), etc., and can be obtained in substantially the same manner as Reference Examples 1 to 6 described below. You. Further, according to a method of artificially producing oligonucleotides by the synthetic DNA method and linking them to prepare synthetic DNA, the degeneracy of the gene code causes The desired recombinant DNA can be prepared by changing the gene sequence without changing the acid sequence. The properties of the receptor tyrosine kinase used in the present invention are as described in Reference Example 7. That is, when an undifferentiated blood-derived cell line is differentiated by a stimulator and loses its proliferative ability, Expression of mRNA of receptor tyrosine kinase gene is not observed. Therefore, it is presumed that this receptor-type tyrosine kinase is a receptor for a differentiation / growth factor of particularly unknown blood undifferentiated cells.

In addition, the method for expressing the receptor tyrosine kinase gene and the method for producing and purifying the polypeptide required for identifying the ligand used in the present invention are described in Reference Examples 8 to 10. It is. That is, DNAs encoding polypeptides having the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence listing are respectively incorporated into appropriate expression vectors, and the microorganisms or cells (for example, insects) Cell or animal cell) as a host, and the transformant can produce a receptor tyrosine kinase polypeptide. Furthermore, when the receptor type 1 tyrosine kinase is to be expressed under more stable conditions, it is preferable to use a nucleated cell, particularly an animal cultured cell, as a host. The polypeptide outside the cell can be purified by affinity chromatography, and an antibody can be produced by using this as an antigen. In addition, three mouse monoclonal antibody-producing hybridomas that specifically recognize this receptor type 1 tyrosine kinase, namely, clones 38-1E and 66-6-3 6 8 — 38 are deposit numbers FERBP—4884, BP—4885, and BP—488 at the Research Institute of Biotechnology, Industrial Technology, Institute of Industrial Science and Technology, Ministry of International Trade and Industry of Japan. 6 deposited on January 11, 1974.

A method for obtaining a ligand that specifically binds to the receptor tyrosine kinase obtained as described above will be described below.

First, cells producing ligands that specifically bind to the receptor tyrosine kinase are identified and selected. Examples of the method include a method using a biosensor BIACORE (manufactured by FANORE Masia Co., Sweden), as described in Example 1, Cara 4. This instrument can detect protein binding based on the principle of plasmon resonance on the surface of a substance. That is, a ligand molecule present in the culture of various human cell lines or on the cell membrane and a receptor type 1 tyrosine kinase containing the amino acid sequence described in SEQ ID NO: 1 in the sequence listing. By examining the binding to the peptide, a cell line producing a substance that binds to the receptor tyrosine kinase polypeptide can be selected.

Alternatively, as another method, a supernatant or cells of various cell lines and a cell line expressing the receptor type 1 lipoprotein kinase polypeptide described in SEQ ID NO: 2 in the sequence listing may be used. Were cultured together and the presence or absence of phosphorylation of tyrosine residues in the intracellular domain of the receptor type 1 tyrosine synthase polypeptide was determined. You can select a cell line that expresses the ligand that binds to the kinase. As still another method, an antibody recognition site, for example, an antibody recognition site such as a receptor tyrosine kinase polypeptide described in SEQ ID NO: 1 in the sequence listing or a nucleotide sequence encoding this polypeptide is used. The Fc portion of human IgG described in the Examples and IBIFLAG (Kodak, USA; see Epitope. 1, 1, 1992 as a reference) (IBIFLAG (Hereinafter often simply referred to as “FLAG”), and expressing a sequence obtained by linking nucleotide sequences coding for an amino acid sequence such that the reading frame of the sequence matches, is fused. Get the peptide. By binding to the ligand-expressing cells, the stained cells can be identified.

In Examples 1 to 4 of the present application, as the ligand-expressing cell of the present invention, a human colon cancer-derived cell line C-1 (reproducible from the Japan Institute of Immunology and Biology, Inc. Te Sato medicine Ayumi, 9 6:. 8 7 6, 1 9 7 6 years) _t identified the

Next, the ligand of the present invention is purified from cells expressing the same. Purification of the ligand, measurement of molecular weight, evaluation of physical properties, and identification of the N-terminal amino acid sequence in the present invention are described in Example 5. This is the communication described in Nos. To 9. That is, a culture supernatant or a cell membrane fraction of a ligand-expressing cell line, a solution prepared by treating cells with a specific enzyme, or the like contains an amino acid sequence represented by SEQ ID NO: 1 in the sequence listing. And purified using a carrier such as affinity gel to which the polypeptide is bound, and further purified by using the amino acid sequence of SEQ ID NO: 1 in the sequence listing. It reacts with cells expressing the amino acid sequence-containing polypeptide described in SEQ ID NO: 2 as an indicator of the binding activity to the polypeptide containing the amino acid sequence or as an indicator. The ligand of the present invention can be purified by a separation operation such as gel filtration or ion exchange using the activity of phosphorylating the cysteine synthyl residue of the polypeptide as an index. It can be.

The thus purified compound (ligand) of the present invention is an isolated polypeptide containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 and 2 in the sequence listing. And a binding ability of the polypeptide to a homologous mutant having a receptor tyrosine kinase activity, and having a molecular weight of at least 4 as measured by polyacrylamide gel electrophoresis. An isolated compound capable of undergoing a 500,000 ± 7500 dalton, persimmon-brilliant-single-stain reaction. The above physicochemical properties are different from the physicochemical properties of any known compounds reported so far.

As the ligand of the present invention, an isolated polypeptide having a receptor type 1 tyrosine kinase activity and containing the amino acid sequence of SEQ ID NO: 2 in the sequence listing, Alternatively, when the polypeptide is reacted with a cell expressing a homologous mutant having a receptor tyrosine kinase activity, at least one tyrosine residue of the polypeptide is phosphorylated. Those having characteristics are preferred. Preferably, the ligand of the present invention also includes a polypeptide containing the amino acid sequence described in SEQ ID NO: 4 in the sequence listing, and the amino acid sequence is preferably More preferably, it is located at the amino terminal of the above-mentioned polypeptide. The ligand of the present invention is preferably capable of undergoing both a Coomassie brilliant staining reaction and a PAS staining reaction (detecting the presence or absence of sugar chain binding). The amino acid sequence described in SEQ ID NO: 4 in the sequence listing was determined by the Protein Sequencer (manufactured by Applied Biosystems, USA), and the amino terminal (N The amino acid sequence of amino acid Nos. 1 to 8 of the sequence at the end) is shown. The amino acid sequence of SEQ ID NO: 4 in this sequence listing was converted into a protein database, NBRF-PDB (National Institute of Biomedical Research, Research Foundation, Release 4.0, 1). March 1994) and SWISS — PROT (Eurobian 'Molecular' Biology 'Laboratories, Release 29.0, June 1994). At that time, no known protein having the same sequence was found, and it was a novel amino acid sequence.

In view of the above, the ligand of the present invention, that is, an isolated polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 and 2 in the sequence listing, It has the ability to bind the peptide to a homologous mutant having receptor type 1 tyrosine kinase activity, and has a molecular weight of at least 41 measured by polyacrylamide gel electrophoresis. A compound that can be stained with 500,000 ± 700,000 daltons, and can be stained with Coomassie Priliant. It was demonstrated that the compound containing the polypeptide of the sequence described in No. 4 was a novel compound different from known compounds.

SEQ ID NO: 19 in the sequence listing contains the purified ligase of the present invention. The amino acid sequence identified from the N-terminus of the protein by the protein sequencer is shown. As will be described later, a sense primer and an antisense primer were synthesized based on the amino acid sequence of SEQ ID NO: 19 in the sequence listing, and the cDNA of the entire cDNA sequence of the ligand of the present invention was synthesized. Can be used for cloning.

If desired, the ligands can be fragmented by treatment with a protease such as trypsin or a chemical treatment to determine their amino acid sequences, or to determine the amino acid sequence at the carboxyl terminus (C-terminus). It is possible to determine the acid sequence.

As described below, the ligand of the present invention is a cell membrane-associated protein as evident from the analysis results of the amino acid sequence, but as shown in Examples 5 to 7, The ligands of the invention can be purified from the cell culture supernatant of the expression cells. This is considered to be because extracellular domains were released into the cell supernatant due to cleavage of the amino acid sequence on the cell membrane by a protease such as metalob lipase.

In addition, the ligand-expressing cell of the present invention also contains the amino acid sequence of SEQ ID NO: 2 (which has the amino acid sequence of SEQ ID NO: 3) of the receptor type 1 tyrosine kinase. (Excluding extracellular domains, transmembrane domains, and intracellular domains, excluding domains), and binding to polypeptides; A receptor containing the amino acid sequence described in SEQ ID NO: 3 (the entire amino acid sequence of the receptor type 1 tyrosine kinase); When a cell expressing the tyrosine kinase polypeptide is reacted with a cell expressing the ligand, the tyrosine residue of the receptor tyrosine kinase zepolipide is phosphorylated; As shown, the results of analysis of the amino acid sequence deduced from the total cDNA sequence of the ligand indicate that the ligand of the present invention has a transmembrane portion. It is clear that the gand is bound. Therefore, the ligand of the present invention can be purified from cell membranes. When the ligand of the present invention is purified from cell membranes, it contains not only extracellular domains but also transmembrane domains and intracellular domains. The size also increases.

In order to obtain the ligand of the present invention in a large amount and at low cost, as described in Examples 10 and 11, the amino acid sequence of the ligand is modified by a genetic engineering technique. The gene can be obtained by obtaining the gene to be cloned, introducing the gene into a nucleated cell such as an animal cell, or a prokaryotic cell such as Escherichia coli, producing and isolating the ligand. .

First, for example, based on the amino acid sequence described in SEQ ID NO: 19 in the sequence listing determined in Example 9, an oligo DNA probe was prepared according to the method described in Example 10. Designed PCR primers to produce cDNA or cDNA libraries from cell lines expressing ligands, or genomic DNA or genomic libraries, hybridases. One-shot method or PC The gene encoding the amino acid sequence of the full length of the ligand can be screened by the method or a method combining the both.

As another method for obtaining the ligand gene of the present invention, a cDNA library of a ligand-expressing cell is incorporated into an appropriate expression vector and expressed in a COS cell or the like. An example of a method for isolating the cDNA of the ligand of the present invention is an expression cloning technique for screening genes. The expression cloning is performed by a cell sorter utilizing the binding of the receptor-type tyrosin kinase polypeptide containing the amino acid sequence described in SEQ ID NO: 1 in the sequence listing to the ligand. A method such as a fractionation method, a detection method using a film emulsion using a radioisotope, or a cell line transfected with the cDNA library itself or its cell culture. By co-culturing with a cell line expressing a receptor tyrosine kinase polypeptide containing the amino acid sequence of SEQ ID NO: 2 in the sequence listing, the tyrosine residue of the polypeptide was reduced. A method based on the fact that phosphorylation is used can be used.

The cDNA base sequence coding for the ligand thus obtained is shown in the Sequence Listing along with the non-coding region before and after it and the amino acid sequence coding for it. Figure 7 shows the results. The amino acid sequence predicted from the cDNA sequence was determined by the method of Kyte — Doo 1 itt 1 e U. Mol. Biol. 157: 105, 19 82), the hydrophobic part and the hydrophilic part were analyzed. As a result, the ligand of the present invention has a permeable domain consisting of a hydrophobic amino acid sequence and an intracellular and extracellular domain consisting of a hydrophilic amino acid sequence. It was revealed that it was a peptide anchor type cell membrane protein. Therefore, by binding the extracellular domain of the ligand to the extracellular domain of the receptor type 1 tyrosine kinase, the extracellular domain of the receptor type 1 tyrosine kinase is released from the intracellular domain of the receptor type 1 tyrosine kinase. May cause oxidation.

Specifically, the amino acid sequence of the ligand of the present invention is obtained from the amino acid sequence of SEQ ID NO: 7 from the 25th amino acid residue to the 25th amino acid residue of the 1st amino acid sequence. Signal peptide; extracellular domain consisting of 1-95 amino acid residues from amino acids 1 to 195 in the amino acid sequence of SEQ ID NO: 7 in the sequence listing, SEQ ID NO in the sequence listing The amino acid sequence of No. 7 is a transmembrane ifi domain consisting of amino acids Nos. 196 and 225 of the amino acid sequence No. 22 and No. 25 of the amino acid sequence No. 7 in the sequence listing. It is composed of an intracellular domain consisting of 83 amino acid residues from No.226 to No.308. However, each part other than the signal peptide part has the domain configuration deduced from the amino acid sequence, and its actual form may be slightly different from the above configuration. In some cases, the constituent amino acids of each domain specified above may be around 5 to 10 amino acids.

The amino acid sequence described in SEQ ID NO: 5 in the sequence listing is the amino acid sequence of amino acids 1 to 195 of the amino acid sequence in SEQ ID NO: 7 in the sequence listing. Amino acid sequence, ie, the amino acid sequence of the above-mentioned extracellular domain excluding the signal peptide, and the amino acid sequence of SEQ ID NO: 6 in the sequence listing is SEQ ID NO: 7 in the sequence listing. 1 shows the amino acid sequence from No. 1 to No. 308 of the amino acid sequence of the present invention, that is, the amino acid sequence of the entire ligand of the present invention excluding the signal peptide.

The amino acid sequence at the N-terminus determined by the above-described blot sequencer, that is, an amino acid sequence consisting of 48 amino acid residues shown in SEQ ID NO: 19, and a sequence number deduced from the cDNA sequence The amino acid sequences Nos. 1 to 48 of the amino acid sequence No. 7 are the same as those of the amino acid sequence No. 19 in the sequence listing except for the three XXX portions that could not be determined. The noic acid sequences were completely identical.

The transformed cell obtained by transfecting Escherichia coli DH5α with vector pUCMEKL containing the entire nucleotide sequence of the receptor type 1 tyrosine kinase ligand of the present invention was produced by the Ministry of International Trade and Industry of Japan. Deposit number FER Μ at Biotechnology Research Institute

Deposited on February 21, 1995 as B P—508.

As described above, the polypeptide that is an extracellular domain of the receptor type 1 tyrosine kinase containing the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing contains At least a part of the extracellular domain of the ligand of the invention, that is, the polypeptide containing the amino acid sequence shown in SEQ ID NO: 5 binds to the receptor type 1 tyrosome. It is thought to activate receptor tyrosine kinase activity of synkinase. The term “part” used herein refers to at least 12 consecutive amino acid residues that are the active centers of ligands having receptor-type synthase ligand kinase activity. Can be used as an indicator to identify polyreceptor tyrosine kinase activity.

Also, from the amino acid sequence of the ligand of the present invention, it is expected that sugar chains are added to some of the amino acid residues. For example, N-acetyl-D-darcosamine is a part capable of N-glycosidic bond, and is defined as amino acids 11 and 114 of the amino acid sequence of SEQ ID NO: 7 in the sequence listing. Asparagine residue. However, the asparagine No. 11 did not affect the measurement at all in the amino acid sequence analysis by the protein sequencer performed in Example 9 and thus at least C-paragine used in the present invention was not used. In the ligand produced by one cell, it is considered that no sugar chain is added to the asparagine residue at position 11 in the amino acid sequence of SEQ ID NO: 7. In addition, N-acetyl-D-galactosamine is an O-dalicoside-bondable moiety, and the amino acid of SEQ ID NO: 7 in the frequently occurring sequence list of serine or threonine residues is used. Extracellular domains from the 144th serine in the acid sequence. In particular, the most probable parts are the threonine at position 155 and the serine from position 168 to position 172 of the amino acid sequence of SEQ ID NO: 7 in the sequence listing. Serine residue or threonine And a serine residue from serine No. 18 to threonine No. 183 or a threonine residue. In general, the polypeptides to which these sugar chains have been added are more stable to degradation in vivo and have stronger bioactivity than those without sugar chains. It is considered that

As described above, in Examples 5 to 7, the ligand of the present invention is purified from the cell culture supernatant, and this ligand is produced by proteolytic enzymes such as metalloproteases. By cleaving the amino acid sequence on the cell membrane, the extracellular domain is considered to be a molecule released into the cell supernatant. For example, the cleavage site is located between the extracellular domain and the transmembrane domain described above, that is, isoleucine 195 and 196 in the amino acid sequence of SEQ ID NO: 7 in the sequence listing. It is thought to be between the lysines, but it may have been digested and digested with proteolytic enzymes in other parts as well.

The gene sequence of the ligand and the amino acid sequence disclosed in the present invention were searched in Genbank (Release 85), Genbank (October 19, 1994). The most similar substance is LERK-2 (Beckmann et al., EMBO J. 13: 3757, 1994., Fl et cher eta 1., Oncogene 9: 324, 1994, and International Application Publication No. 94. Z 111384), but the homologue is as low as 54% in the entire amino acid sequence, indicating that the ligand of the present invention and LERK-2 are different. A completely different substance It is. Further, this LERK-2 is a binding type of receptor type 1 tyrosine kinase ELK having a relatively homologous receptor type 1 tyrosine kinase to which the ligand of the present invention specifically binds. It is a substance identified as a protein or ligand.

The common points between the amino acid sequence encoded by the entire cDNA sequence of the ligand of the present invention and the above amino acid sequence of LERK-2 are as follows. First, four cysteine residues expected to have a disulfide bond, that is, amino acids 37, 64, 76, and 12 of the amino acid sequence of SEQ ID NO: 7 in the sequence listing The position of cystine residue 8 on the amino acid sequence is common. Also, the amino acid at the portion where N-acetyl-D-dalcosamine can bind N-glycosidic, ie, the asparagine residue at position 114 of the amino acid sequence of SEQ ID NO: 7 in the sequence listing. The positions on the array are also common. In addition, the sequence consisting of 33 amino acid residues from amino acids 276 to 308 of the amino acid sequence of SEQ ID NO: 7 in the sequence listing, which is an intracellular domain, is completely absent. It is the same.

From the above, since the ligand of the present invention and LERK-2 may have the same physiological action, as shown in Example 19, the ligand of the present invention and the above LERK-2 For the purpose of comparing 2, the gene of LERK-2 was obtained from human placenta cDNA by PCR and expressed, and the effect on the receptor tyrosine kinase bound by the ligand of the present invention was obtained. Analysis was performed. As a result, although the receptor was weakly bound to the receptor type 1 tyrosine kinase, the binding was much weaker than that of the ligand of the present invention, and the action of causing the phosphorylation of the receptor was extremely low. It was weak. Therefore, LERK-2 is a substance that has structural similarity to the ligand of the present invention, but has a completely different physiological action.

As shown in Examples 13 to 14, the ligand of the present invention is preferably at least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing. Alternatively, using an isolated DNA encoding at least a portion of the polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing, a genetic engineering technique may be used. It can be prepared as at least a part of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 or 5.

That is, a method for producing an isolated compound containing at least a portion of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing:

(a) ligating a DNA encoding at least a part of the polypeptide to a replicable expression vector, and incorporating the DNA in the replicable expression vector in an expressible manner. To obtain a replicable recombinant DNA

(c) the eukaryotic cell or primordial cell as a parent cell of the transformant Sort from nuclear cells,

(e) isolating the compound from the transformed transformant;

According to the method characterized by this, the ligand of the present invention can be produced by genetic engineering techniques. The obtained ligand can be purified by the above-mentioned known method. For more stable production conditions, it is desirable to use animal cells as hosts.

As described in Example 13, the ligand of the present invention expresses cDNA encoding a polypeptide having an amino acid sequence described in SEQ ID NO: 6 in the sequence listing. However, in this state, it is a membrane-bound type, and it takes time for purification, preparation and formulation. Therefore, in order to perform purification and formulation more efficiently, as described in Examples 17 and 18, SEQ ID No. 5 in the sequence listing, which is a domain containing a bioactive center, was used. It is preferable to produce only the amino acid sequence, ie, the extracellular domain of the ligand. That is, it is preferable to use DNA encoding at least a part of the amino acid sequence described in SEQ ID NO: 5 in the sequence listing, and to produce the protein as a secretory protein.

Further, the form in which the ligand of the present invention is expressed may be a ligand. The compound may be a single compound, or may be in the form of a complex. In the present invention, the “complex” refers to a compound containing at least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6, preferably SEQ ID NO: 5 in the sequence listing. When,

At least one of the compounds containing at least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6, preferably SEQ ID NO: 5 in the sequence listing, At least one member selected from the group consisting of compounds other than compounds containing at least a portion of the polypeptide containing the amino acid sequence;

And a complex consisting of The conjugate of the present invention can be preferably used because it has the same or higher physiological activity as compared with one molecule of the ligand described above.

As an example of the complex of the present invention, as described in the Examples, the ligand is expressed as a chimera protein of the Fc portion of human IgG, Furthermore, a dimer that forms a disulfide bond with the Hinge region of the IgG Fc; a specific antigen (for example, Fc portion of human IgG, FLAG, etc.) is added to the ligand. It is expressed as a chimera protein expressed at the C-terminal or N-terminal side of the amino acid sequence, and reacted with an antibody that specifically recognizes the antigen to form an antigen-antibody complex. A complex obtained by expressing chimera protein with only the Hinge region of human IgG Fc and forming a dimer by disulfide bonds; ligand A peptide that has no effect on the activity of the ligand A chimera protein designed to be expressed at the C-terminal, N-terminal or other site of the protein to finally form a disulfide bond; SEQ ID NO: 6 in the sequence listing, preferably May be a multimer obtained by linking two or more DNAs encoding at least a part of the amino acid sequence of SEQ ID NO: 5 so as to match the reading frame of translation.

In addition, the complex of the present invention is obtained by cross-linking the extracellular domain of the ligand, which is expressed and purified, using a cross-linking agent, in addition to the above. No. For example, dimethylsimidate dihydrochloride which bridges lysine residues, N- (γ-maleimidbutyryloxy) succinimide which crosslinks with thiol groups of cysteine residues, Using a cross-linking agent such as Daltar aldehyde that cross-links amino and amino groups, it is possible to form a ligand complex by performing a cross-linking reaction of protein and carbohydrate. .

As shown in Example 13 and Example 16, when expressed using an expression vector having a DNA encoding the amino acid sequence of SEQ ID NO: 6 in the sequence listing, it was expressed on a natural cell membrane. A ligand having the same physiological activity as the existing ligand is obtained. For example, an amino acid having a hydrophobic amino acid at the C-terminal of the amino acid sequence of SEQ ID NO: 6 in the sequence listing or the amino acid sequence of SEQ ID NO: 5 in the sequence listing. Polypeptide having sequence has micellar or liposomal morphology by mimicking biological membranes such as lipids, phospholipids, etc. When present on a substance, it can exert the same physiological activity as when expressed as a molecule on the cell membrane.

Since the ligand of the present invention and the complex containing the ligand have an action of promoting the differentiation and proliferation of undifferentiated blood cells, they are effective for leukemia, an early recovery agent at the time of bone marrow transplantation, and a bone marrow at the time of administration of an anticancer agent. Suppression It is useful as an active ingredient of pharmaceuticals such as a recovery agent and its preventive agent. Further, as described above, a substance in which the ligand is present on a substance having a morphology similar to a biological membrane (eg, micellar liposome) is also useful as an active ingredient of a similar drug. It is.

As a method for providing the ligand of the present invention on micellar liposomes, for example, a lipid is covalently bonded to a part of the ligand, and this part is ligated to the lipid of the liposome micelle. There is a method of putting it in a layer, or a method of connecting a peptide having an α-helix to a ligand, and putting that part in the lipid layer of liposomal micelles.

In addition, the ligand of the present invention can be used for a medical method in which blood cells extracted from a human body are proliferated and activated in an extracorporeal medium, and the cells are returned to the body again. In such a case, the ligand of the present invention can be added directly to the medium, but it is desirable that the ligand be immobilized in a cell culture vessel. For the immobilization, the ligand is shared with the culture vessel by using the amino group / carboxyl group of the ligand and using an appropriate spacer. It can be immobilized by bonding. Examples of the spacer when an amino group of a ligand is used include an ω-carboxyalkyl group derivative, a bromoacetyl derivative, a diazonium derivative and the like. An example of a spacer when the carboxyl group of the ligand is used is an ω-aminoalkyl derivative / hydrazide derivative. As another immobilization method, there is a method based on CNB r activation. For details of the ligand immobilization method, see, for example, “Experiment and Application Affinity Chromatography” Chiba

Ichiro Chihata et al., Kodansha, Japan, 1976, pp. 31-95. Thus, it has a form immobilized on a solid surface, has receptor tyrosine kinase ligand activity, and further contains an amino acid sequence of SEQ ID NO: 6 or 5 in the sequence listing. The present invention also includes a compound containing at least a part of the polypeptide.

As described above, the ligand of the present invention produced by a genetic engineering technique can utilize the polypeptide of the extracellular portion of the receptor type 1 tyrosinase used in the present invention as described above. It can be purified, but as shown in Example 15, a polyclonal mono- or monoclonal antibody prepared by immunizing a suitable animal with the ligand. Purification can also be performed by using an affinity-based matrix using antibodies.

The ligand of the present invention has an effect of promoting colony formation of human cord blood mononuclear cells, thereby promoting the proliferation of undifferentiated blood cells _(the ligand of the present invention and the ligand). Since it has the effect of promoting the differentiation and proliferation of complex blood undifferentiated cells containing gand, it can be used as an early recovery agent for leukemia bone marrow transplantation, a myelosuppressive recovery agent for administration of anticancer drugs and its preventive agent. When the ligand of the present invention is used as a pharmaceutical, the ligand of the present invention is useful. It is desirable to use the lyophilized product of the solution dissolved or suspended in distilled water for injection. For example, it is convenient to provide injections and infusions prepared from 0.1 to l OOO g Z m 1. Furthermore, when blood cells are used to proliferate and activate blood cells outside the body, lyophilized products and solutions are prepared in the same manner as pharmaceuticals, and added to the medium as described above for culture. It can be used by fixing it to the container to be used. In addition, in an experiment in which 1 μg / kg of the ligand of the present invention was intraperitoneally administered to a mouse, the mouse did not die, confirming that the mouse can be used as a pharmaceutical. .

In addition, the physiological activity of the inviting mouth of the ligand of the present invention can be confirmed by administering various disease model mice or animals such as rats and monkeys exhibiting symptoms similar to those of a similar disease. To recover their physical and physiological functions and to check for abnormalities. For example, regarding the physiological activity of the ligand of the present invention for abnormalities related to hematopoietic cells, a bone marrow suppression model mouse was prepared by administering a 5-FU anticancer drug, and the compound of the present invention was administered to this mouse. This is clarified by examining the number of bone marrow cells and peripheral blood cells and the physiological function of each group. Furthermore, when culturing and culturing of undifferentiated blood cells including hematopoietic stem cells in vitro, mouse bone marrow cells were cultured using an incubator or the like, and the compound of the present invention was added at that time. After culture in the group and the group without Cells can be transplanted to a lethal irradiation mouse, and the degree of recovery can be examined by using the survival rate, blood cell count fluctuation, etc. as indicators. Since the results of these experiments can be extrapolated to humans, they can be used as effective data for evaluating the efficacy of the compound of the present invention.

In addition, the results of Example 12 which showed in which organ the mRNA encoding the polypeptide of the compound of the present invention is expressed, and in which organ the mRNA of the receptor was expressed Comparing the results of Reference Example 7 showing whether or not the compound is expressed, lung and kidney are mentioned as organs in which the compound of the present invention may produce some physiological activity or a similar drug effect. Organ-related diseases are expected to be treated with the compounds of the present invention. Regarding the liver, it was found that the receptor type 1 tyrosine kinase gene of the present invention was strongly expressed in liver cancer. 3 B Northern blot results and a paper by Bennett et al. (Bennetteta 1., J. Bio 1. Chem., 26 9, 14 21 1 1-14 21 8, 19 9 4), and in the specification of WO 95/153886 by the present inventors. Therefore, the ligand of the present invention is related to liver cancer, the growth of normal liver tissue, etc., and is a drug effective for diseases related to these, or a screening system for an effective drug. Applicable to

As described above, the compounds of the present invention are used as pharmaceuticals In this case, drugs for diseases associated with hematopoietic cells, such as leukemia, an early recovery agent at the time of bone marrow transplantation, a bone marrow suppression / recovery agent at the time of administration of an anticancer agent, and a prophylactic agent thereof, may be used. The dosage at this time depends on the form of the drug and the activity of the ligand, but the dose may be about 0.1 mg / kg to 10 Omg / kg.

In addition, as shown in Example 12, an isolated antisense DNA fragment paired with a sequence from 12 mer to 16 mer or more, which is a part of the gene sequence of SEQ ID NO: 7 in the sequence listing. And the antisense RNA fragments and derivatives thereof that are methylated, methylphosphorylated, deaminated, or thiophosphorylated, and the ligands of the present invention. Gene expression can be examined by Northern blot. In a manner similar to that described in Example 12, it can be used for detection of homologues of the gene of the present invention in other organisms such as mice and rats, and for gene cloning. . Furthermore, the present invention can be similarly used for detection and cloning of genes on genomics including human genomics. More detailed functions of the inventive ligand can also be revealed. For example, with the use of recent gene manipulation techniques, all methods such as transgenic mice, jet-getting mice, and double knockouts in which the gene related to the gene of the present invention is inactivated are used. You can do this. If there is an abnormality in a portion on the genome corresponding to the gene of the present invention, Applications to gene diagnosis and gene therapy are also possible. In addition, an isolated sense DNA fragment and an antisense DNA fragment having a part of the base sequence of SEQ ID NO: 7 in the sequence listing or derivatives thereof, and an isolated sense RNA fragment and an antisense having a sequence corresponding thereto Gene expression in cells can also be regulated by RNA fragments or their derivatives.

Further, by using the antibody specifically recognizing the compound of the present invention shown in Example 15, the compounds of the present invention can be detected and measured, and the above-mentioned diseases and the like can be diagnosed. Useful as medicine,

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be more specifically described with reference to Reference Examples and Examples, but the present invention is not limited thereto.

Reference Example 1 Po 1 y (A) ⁺ RN of human blood cell line UT-7

Preparation of A

The culture and subculture of UT-7 cells contain 10% fetal bovine serum (FCS; all FCSs used in this patent are manufactured by Finoletron, Australia) as a medium. Human granulocyte macrophage colony stimulating factor (hGM-CSF) (Intergen, USA) was prepared using Skov-modified Dulbecco's medium (IMDM) (GIBCO-BRL, USA) ) To a concentration of 2 ng / ml, and performed in a C にて₂ incubator at 37 ° C. As unstimulated cells, cells cultured under the same conditions were used. To differentiate into megakaryocytes, dilute to a cell concentration of 2 × 10 ⁵ ce 11 s / ml, calorie the hGM-CSF to 2 ng Zml, and add porbol 1 2 — Myristate 13 — Acetate (PMA: sigma, USA) was added to a concentration of 1 ng / ml, and the cells were collected after 3 days of culture. Cells cultured under these conditions were collected at a cell count of 1 × 10 ⁸ cells, washed three times with PBS (−) (Nissi Corporation, Japan), and used for RNA extraction.

Lithium Chloride / U Tota 1 RNA was extracted by the rea method (Eur. J. Biochei 107: 303 (1980)). Next, Poly (A) + RNA was separated and purified using Oligotex-dT30 (Takara Shuzo, Japan).

Reference Example 2 Creation of primer specific to tyrosine kinase

USA 86: 1603, 1989) according to the method of Wi 1 ks (Proc. Natl. Acad. Sci. USA 86: 1603, 1989) and linked to the tyrosine kinase subdomains 7 and 9 and the restriction enzyme recognition site. Mixed primer, ie, sense primer PTKI: 5'-TTGTCGACAC (AC) G (AG) GA (CT) (CT) T (CG) GC (ACGT) GC (ACGT) (AC) G-3 ', (27 mer: S a1I site is added as a recognition site for restriction enzyme. See SEQ ID NO: 8 in the sequence listing) and antisense primer PTKII: 3'-CT (AG) CA (CG) ACC (AT) (CG) (AG) A (AT) ACCTTAA GGT-5 '(24mer: An EcoRI site is added as a recognition site for restriction enzymes. Described as SEQ ID NO: 9 in Sequence Listing ) Was used to perform the following PCR.

Synthetic oligonucleotides were prepared using a fully automatic DNA synthesizer based on the solid-phase method. As a fully automatic DNA synthesizer, Applied Biosystems Inc. 39.1 PCR-MATE in the United States was used. Nucleotide, 3'-nucleotide-immobilized carriers, solutions, and reagents were used according to the company's instructions. Complete the specified coupling reaction, and remove the 5'-terminal protecting group with trichloroacetic acid to remove the oligonucleotide carrier in concentrated ammonia. The oligonucleotide was released from the carrier by allowing to stand at room temperature for 1 hour at room temperature. Next, in order to release the protecting groups of the nucleic acid and the phosphoric acid, the reaction solution containing the nucleic acid is left in a sealed vial at 55 ° C for 14 hours or more in a concentrated ammonia solution in a sealed vial. Was. Purification of each of the oligonucleotides from which the carrier and protecting groups were released was performed using an OPC force cartridge from Applied Biosystems in the United States and detrityled with 2% trifluoroacetic acid. It has become. The purified primer was dissolved in deionized water to a final concentration of 1 μg / μβ and used for PCR.

Reference Example 3 Synthesis of cDNA

CDNA was synthesized using the Po1y (A) ⁺ RNA obtained in Reference Example 1. That is, 2 g of Poly (A) ⁺ RNA was dissolved in 12.3 £ of deionized water, and 10X buffer solution (500 mM MKC 1, 100 mM MTris — HC)

(P H 8. 3), 1 5 mM M g C 1 2, 0. 0 1% gelatin) 2 μ β, d NTPM ixture ( Japan, Takara Shuzo Co., Ltd.) 4 mu beta, the aforementioned switch deadman kinase Antisense primer specific for Ρ Τ Τ Κ Ι I (1 μg / μΆ) 1 μβ, Avian myeloblastosis cis vinores reverse transcriptase Science: 32 μ / μβ) 0.2 μβ and RNase inhibitor (Boehringer, Germany: 40υ / μβ) After adding 0.5 μβ, the mixture was left at 37 ° C. for 75 minutes, and then left at 65 ° C. for 10 minutes.

Reference Example 4 P by primer specific for tyrosine kinase

C R

Amplification by PCR was performed as follows. Using 20 × of the cDNA solution obtained in Reference Example 3, 10 × buffer (500 mM MKC 1, 100 mM M ris—HC 1 (pH 8.3), 1 × _{5 mM g C 1 2, 0} . 0 1% gelatin) 8 μ β, d NTPM ixture ( Japan, Takara Shuzo) 6. 4 μ Ά, sense primer specific for the above-mentioned tyrosine kinases [rho T kappa

1 (1 μg / μβ) 1.5 β and Taq DNA polymerase (Amplitaq: Perkin — Elmer, USA, 5 U / / i £) 0.2 Add £, and finally add deionized water to bring the total volume to 100 μβ, a process consisting of 94 ° C for 1 minute, 37 ° C for 2 minutes, and 72 ° C for 3 minutes This cycle was performed for 40 cycles, and PCR was performed by leaving the mixture at 72 ° C. for 7 minutes. A portion of this PCR product was subjected to 2% agarose gel electrophoresis, stained with Etch Dumbu Mide (manufactured by Nippon Gene, Japan), and observed under ultraviolet light to obtain a cDNA of approximately 210 bp. It was confirmed that was amplified.

Reference Example 5 Cloning of PCR product and determination of nucleotide sequence

The entire amount of the PCR product was electrophoresed on a 2% agarose gel prepared using low melting point agarose (GIBCO-BRL, USA). After staining with Etudemub mouth, a band of about 210 bp was cut out under UV irradiation, and the same volume of distilled water as the gel was added. After heating for 1 minute to completely dissolve the gel, add an equal volume of TE-saturated phenol (manufactured by Nippon Gene, Japan), centrifuge at 1500 rpm for 5 minutes, and remove the supernatant. Separation was performed, and the same separation operation was performed using a TE-saturated phenol: chloroform (1: 1) solution, and furthermore, chlorophore. From the finally obtained solution, cDNA was recovered by ethanol precipitation. The recovered cDNA was digested with restriction enzymes EcoRI (Takara Shuzo, Japan) and Sa1I (Takara Shuzo, Japan), and then used for incorporation into vectors.

Using pBIuescript IIKS (manufactured by Stratagene, USA; hereinafter, referred to as pBluescript) as the vector, digest with the restriction enzymes EcoRI and Sa1I before incorporating the cDNA above. Then, it was refined by the above method. A mixture of the vector subjected to these treatments and the preceding cDNA in a molar ratio of 1: 5 was mixed with T4 DNA ligase manufactured by New England BioLab in the United States. The cDNA was incorporated into the vector with the enzyme. pBIuescript into which E. coli was incorporated was introduced into E. coli JM109 (manufactured by Toyobo Co., Ltd., Japan), and L-protein containing 50 / g / ml of ampicillin (manufactured by Sigma, USA) was used. Broth (Takara Shuzo Co., Ltd., Japan) Seed on a plate of semi-solid medium, about 12 hours 37 ° C The colonies that appeared were randomly selected, and the fact that the cDNA had been incorporated was digested with the restriction enzymes EcoRI and Sa1I to obtain a 210 bp cDNA. After confirming that the clone had been cut, the nucleotide sequence of the incorporated cDNA was determined for the confirmed clone using a fluorescence sequencer of Applied Biosystems, Inc. of the United States. As a result, a tyrosine kinase gene fragment was obtained that was cloned from unstimulated UT-7 cells, but was not cloned when UT-7 was differentiated into megakaryocytes. This gene fragment was No. 2664 of the SEQ ID No. 3 in the sequence listing, and No. 2812 of the sequence.

Reference Example 6 Preparation of cDNA Library and Full-length Cloning of Tyrosin Kinase Gene and Its Analysis Unstimulated UT-7— Poly (A) ⁺ RNA isolated and purified by the method described above was used. A cDNA library was prepared. To create a UT-7 cDNA library: Use the ip C: 'M8 vector cDNA library creation kit (Olanda In Vitr o gen) to attach it Created according to Further, Poy (A) ⁺ RNA was purified from human placenta according to the method described above to prepare a cDNA library. The human placenta cDNA library was prepared using an LZAP cDNA library preparation kit (Stratagene, USA) according to the attached preparation method.

Next, these cDNA libraries are Li Daizesho down of also rather plaque hive Li Daizeshi ® ⁵ X 1 0 5 corresponding to the search phrase loans with a total length c DNA in emissions co-Roni one also properly went from plaque. The resulting colonies or plaques were transferred to nylon finole letters (Hybond N +: manufactured by Amersham, UK), and the transcribed nylon finole letters were treated with alkali (1.5 MNaCl, 0.1 M NaCl).

Leave on a filter paper impregnated with 5 M NaOH for 7 minutes, and then neutralize (1.5 M Na Cl, 0.5 MT ris — HC 1 (pH 7.2), ImM ED Twice on the filter paper impregnated with Ding A) and then the SSPE solution (0.3

6 M NaCl, 0.02 M sodium phosphate (pH 7.

7) After shaking for 5 minutes in a 2 × solution of 2 mM EDTA), the plate was washed, and air-dried. Then, it was left on a filter paper impregnated with 0.4 M NaOH for 20 minutes, shaken with a 5-fold concentration of SSPE solution for 5 minutes, washed, and air-dried again. Using this filter, screening was performed with a cDNA probe labeled with ³² P of radioisotope.

A cDNA probe labeled with ³² P radioisotope was prepared as follows. That is, pB1uescript in which the partial cDNA of tyrosine kinase was incorporated was cut out from vector with Sa1I and EcoRI, and the DNA fragment was obtained from the low melting point agarose gel. Was purified and recovered. The obtained cDNA fragment was used as a DNA labeling kit (Megaprime DNA). labeling system: Amersham, UK). That is, to 5 ng of DNA, add 5 μl of the primer solution and deionized water to make a total volume of 33 μβ, perform a boiling water bath for 5 minutes, and then add 10 mL of reaction buffer containing dNT 1. ^{i fi, α - 3 2 P} - d CTP 5 / fi, and T 4 DNA polynucleotidyl click Reochi Dokinaze solution 2 mu £ was added, and a water bath for 10 minutes at 3 7 ° C, further followed, Joseph Ade' click Ska Purified by rum (Quick Spin Column Sephadex G — 50: Behringer Mannheim, Germany), used in a boiling water bath for 5 minutes, and then cooled on ice for 2 minutes before use.

The filter prepared by the above method is used for the SSP E solution with the final concentration of each component of 5 times and the Denhardt solution with the 5 times concentration.

(Manufactured by Wako Pure Chemical Industries, Japan), 0.5% SDS (sodium dodecyl sulfate), and pre-hybridase, a denatured salmon sperm DNA denatured in a lOmg Z ml boiling water bath. After immersion in shaking solution and shaking at 65 ° C for 2 hours, a prehybridization solution containing the ³² P-labeled probe by the above-mentioned method was used. The sample was immersed in the rehydration solution, shaken at 65 ° C for 16 hours, and subjected to hybridization.

Next, the final letter was immersed in an SSPE solution containing 0.1% SDS, shaken at 65 ° C, washed twice, and further diluted 10-fold containing 0.1% SDS. It was immersed in the SSPE solution and washed four times at 65 ° C.增した洗浄增增增增增 Autoradiography was performed using As a result, the strongly exposed part of the clone was picked up, the colony and the black were sown again, and the screening was performed in the manner described above, thereby completely separating the single clone. .

Two clones with a large insert size from clones isolated from the UT-7 library were purified from plasmid according to the method described in the experimental book by Maniatis et al. After digestion with ho I, cDNA was purified by low melting point agarose electrophoresis and incorporated into pB1uescript. The size of the incorporated cDNA was approximately 3.0 kbp and 1.6 kbp. Furthermore, phage DNA was purified from two clones isolated from the human placenta library, which had a large insert size, according to the method described in the experimental manual by Maniatis et al. It was digested with coRI and similarly incorporated into pB1uescript. The size of the incorporated cDNA was approximately 3.8 kbp (clone 2) and 3.5 kbp (clone 9).

The gene sequences at both ends of the cDNAs of these clones were used for labeling kits for ALFDNA Sequencer (Swedish, Pharmacia) and ALF Sequencer (Swedish, Pharmacia) using the attached kit. The decision was made according to the book. In order to determine the full-length nucleotide sequence, there is also a delugetion module for kilosequence manufactured by Takara Shuzo Co., Ltd. in Japan. Using a kit, according to the attached instruction manual, a dilution medium was prepared, and the nucleotide sequence in both directions of the cDNA was determined.

As a result, it was found that the full-length cDNA had not been cloned.In addition, about 200 bp of the 5 'portion from the XhoI site of the c10ne2 restriction enzyme (sequence list (SEQ ID NO: 3, No. 484 to No. 696)) and commercially available human fetal liver cDNA library; Lgt11 (manufactured by CIontech, USA) in the same manner As a result of screening, a clone containing cDNA in the 5 'direction of the Xh0I site (c10neM1, sequence No. 1 to No. 124 of SEQ ID NO: 3 in the sequence listing) Was cloned, and the gene sequence was sequenced to determine the nucleotide sequence of the full-length cDNA gene of the present invention. To prepare a DNA having a full-length gene sequence, use the XhoI site of the DNA described in SEQ ID NO: 3 in the Sequence Listing to connect the above c1one2 and c1oneMl, and to prepare a library. It was prepared by subcloning the EcoRI site of pBluescript using the EcoRI site of the linker. Hereinafter, this vector is referred to as pBSRTKFULL.

The nucleotide sequence of the gene prepared as described above is shown in SEQ ID NO: 3 in the sequence listing.

The amino acid sequence deduced from this nucleotide sequence was converted to human EPH (Hi rai el a, Science, 238, 1717-1720, 1987), human ECK

(Lindberg and Hunter, Mo 1. Cell. Biol., 10, 6316-6324, 1990), Rat ELK (Lhotaketa, Mo. Cell. Bio, 11, 2496-2502, 1991) ), Human HEK (Wickseta, Proc. Nat 1. Acad. Sc i. USA., 89, 1611-1615, 1992), mouse SEK (Gi Iar (1 i-Heb en streiteta) 1., Oncogene, 7, 2499-2506,

1992) and chicken C ek — 5 (Pasqua 1 e, Cell Regu lation, 2, 523-534, 1991) .As a result, the homologue of the amino acid sequence was the highest in ELK. It was found to be a receptor-type tyrosin kinase having an amino acid sequence different from these substances, which was as low as 56.3% (in the following Reference Examples and Examples, it is often referred to simply as Type 1 tyrosine kinase "or

"Tyrosine kinase").

Reference Example 7_ Expression of mRNA by Northern blotting of receptor type 1 tyrosine kinase gene

In order to examine the expression of the mRNA of the receptor type 1 liposomal synthase obtained in Reference Example 6, the mRNA was transcribed. ltiple Ti ssue Nor thern Blot, Human Mu ltiple Ti ssue Nor thern Blot 11, Human Fetal Mu ltip le Ti ssue Nort hern Blot Electrophoresis and use a filter prepared by transducing Zeta-Prob (Bio-Rad, USA) p BSRTKFULL is digested with the restriction enzyme SmaI, electrophoresed on a 1% agarose gel, and a 746 bp fragment (positions 610 to 1355 of SEQ ID NO: 3 in the sequence listing) And a gene fragment purified using Geneclean II (manufactured by BIO101, USA), DNA labeling kit, MegaPrime DNA labeling system: Amersham, UK In), ³² P was labeled by the method described above and the expression was examined.

As a result, expression was observed in the heart, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, prostate and ovary of adult human tissues. However, expression was not observed in brain, thymus, testis, small intestine, large intestine, or peripheral blood lymphocytes. In human fetal tissues, expression was observed in the heart, lung, liver, and kidney, but not in the brain.

In addition, among the blood cell lines, the myelomegakaryoblastic leukemia cell line UT-7 described above and the human chronic myeloid leukemia cell line K5662 (available from RIKEN, Japan, and the Cell Development Bank, No. RCBO027) and the human acute megakaryoblastic leukemia cell line CMK (B100 d 74:42, 1989), and the non-blood cell line is a hepatocellular carcinoma cell line Hep3B ( Available from the American Type 'Culture' Collection (hereinafter referred to as ATCC), HB8064) and the human fetal lung fibroblast cell line MRC-5 (Japan) RCBO, available from RIKEN, Cell Development Bank, No. RCBO Expression was observed in 2 1 1). In addition, it was confirmed that expression of UT-7 and K562 CMK almost completely disappeared when cell differentiation was induced by PMA. However, KMT-2, a cell line established from human cord blood

(Available from RIKEN, Cell Development Bank, Japan, No RCCB072), Human Chronic Myeloid Leukemia Cell Line KG1a

(Available from ATCC, CCL 246.1), but no expression was observed in the acute lymphocytic leukemia cell line MOLT-4 (available from ATCC, CCL1582) .

From the above, it was inferred that this gene was expressed in an undifferentiated state of blood cells, and its expression disappeared as blood cells differentiated. Therefore, it was considered that this receptor type 1 tyrosine kinase is linked to fV: maintenance of blood stem cells and megakaryocyte differentiation.

Reference Example 8 Preparation of receptor-type tyrosinkinase lipobutin cell line

(Step 1) A cell line expressing a receptor tyrosine kinase polypeptide having an amino acid sequence of SEQ ID NO: 2 in the sequence listing, Ba /

Preparation of F 3 Z F U L L, B a / F 3 / F U L L F L A G, B a b b F F L L and B a 1 b Z F U L L F L A G:

Using the DNA encoding the receptor-type tyrosine kinase zepo-libeptide described in SEQ ID NO: 2 of the Sequence Listing and IBIFLAG manufactured by Kodak, USA, the amino acid of SEQ ID NO: 2 in the Sequence Listing was used. 8 amino acids, that is, a polypeptide having Asp Tyr Lys Asp Asp Asp Asp Lys as amino acid sequence (FLAG, described in SEQ ID NO: 13 in Sequence Listing) is added to the C-terminal of the acid sequence. DNA encoding the polypeptide was transformed into an expression vector containing the SRct promoter and the neomycin resistance gene pMK IT neo (Maruyama et al., Proceedings of the 91st Molecular Biology Society of Japan, (Available from Tokyo Medical and Dental University Maruyama), respectively, to produce expression vectors.

In preparing an expression vector for a polypeptide-expressing cell containing the amino acid sequence of SEQ ID NO: 2 in the sequence listing, the restriction enzyme EcoRI was used except for the 3 'non-transcribed region of SEQ ID NO: 3 in the sequence listing. To add a site, 5'-AACTCGAGATCTCTGCTGAGGACCTG-3 ', Origo DNA, which is the iJi system iJ (primer 1, described in SEQ ID NO: 10 in the sequence listing), 5'-AAGAATTCTCAGTACTGCGGGGCCGGTC-3 The oligo DNA (primer 1 and listed in SEQ ID NO: 11 in the sequence listing), which is a system of IJ, is designated as a lab 7! : PCR was performed using ppBBSϋRKTIKKFFUULLLL as a template. D N of approximately 1 650 b p

After confirming that A is amplified by agarose gel electrophoresis, the PCR product is purified by the method described in Reference Example 5, and treated with the restriction enzymes XhoI and EcoRI. The purified gene was ligated to the treated pBluescript using T4 DNA ligase manufactured by New England BioLab, USA, and subcloned. Then four clones The plasmid DNA is purified from the colony and sequenced to confirm the gene sequence.The gene sequence is correct and the target gene sequence, that is, the DNA sequence of SEQ ID NO: 3 in the sequence listing It was confirmed that the fragment had the sequence from No. 3230 to No. 3337. Hereinafter, the vector having this fragment is referred to as p BSF1.

In addition, the receptor type tyrosine kinase of SEQ ID NO: 2 in the sequence listing—8 amino acids, ie, Asp Ty, is located at the C-terminus of the polypeptide in the full-length amino acid sequence. r Lys Asp Asp Asp Asp Asp An expression vector having a gene sequence encoding a polypeptide to which a polypeptide (FLAG, described in SEQ ID NO: 13 in the sequence listing) is added. In the preparation, primers were used in the same manner as described above, and the primers were primers of the primers 1 and 5'-GGGAATTCATTTATCATCATCATCTTTATAATCGTACTG CGGGGCCGGTCCTCCTGT-3 '(primer 13 and SEQ ID NO: 12 in the sequence listing). PCR, subcloning into pB1uescript, sequencing the 4 clones, confirming the gene sequence, and confirming the gene sequence of interest, that is, the DNA sequence of SEQ ID NO: 3 in the Sequence Listing. 3 2 3 0 3 to 3 3 0 It was confirmed that the fragment was a fragment having a sequence in which 5′—GATTATA AAGATGATGATGATAAATGA-3 ′ (described in Iris No. 13 of Iris system in the Iris system list) was linked to the sequence. Hereinafter, the vector having this fragment is referred to as PBSF2. Next, p BSRTKFULL was digested with the restriction enzyme BamHI (Takara Shuzo Co., Ltd., Japan) and purified by the same method as described above. A roughly 3 kbp gene fragment, that is, the DNA sequence of SEQ ID NO: 3 in the sequence listing, was obtained. The linker used for preparing the ZAP cDNA library at the 3 'end of the gene having the sequence from No. 384 to No. 4290, that is, EcoRI-NotI manufactured by Takara Shuzo Co., Ltd., Japan — A DNA fragment having a sequence in which the BamHI portion of the BamHIA daptor is linked to PUC19 (Takara Shuzo Co., Ltd., Japan), which was similarly digested with BamHI and dephosphorylated. 4 Connected with DNA ligase and subcloned. In the gene direction, the BamHI portion in the 5 'direction of the DNA sequence of SEQ ID NO: 3 in the sequence listing is aligned on the Sa1I side of the multi-cloning site of pUC19, and the 3' direction is EcoRI. You selected a clone that was confirmed to be on the side. Hereinafter, this vector is referred to as p UCRTKFULL.

The PUCRTKFULL thus prepared is digested with the restriction enzymes Sa1I and Bg1II, and the fragment of about 3 kbp is subjected to agarose gel electrophoresis. Fragment in which the portion from Sa1I to BamHI of the restriction enzyme site for PUC19 is connected to the end of the 5th end of the sequence from No. 384 to No. 3230 of the DNA sequence No. 3 The sample was cut out and purified by the method described above. This gene fragment is designated as F 3. Similarly, restriction enzymes Sa1I and Bg1II were digested with pBSF1 and PBSF2, and the fragment Bg1II in the vector from the Sa1I siteka of the multi-cloning site. The gene fragment except for the 30 bP gene fragment was purified by the above method. These gene fragments are referred to as F 1 and F 2, respectively. Then, F1 and F3, and F2 and F3 are connected by the above-described method, respectively, and the polypeptide of SEQ ID NO: 3 in the sequence listing is coded by restriction enzymes Sa1I and NotI. The vector from which the gene fragment is cut out is p FLAG amino acid sequence at the C-terminus of the polypeptide of SEQ ID NO: 2 with BSFULLl and restriction enzymes Sa1I and N0tI. A vector PBSFULL2 from which a gene fragment corresponding to a portion coding for a polypeptide having the above was cut out was prepared.

The thus prepared vectors-PBSFULLl and pBSFULL2-are digested with restriction enzymes Sa1I, NotI and Pvul, and a gene fragment of approximately 3 kbp is obtained by electrophoresis. That is, a gene fragment containing the gene fragment encoding the amino acid sequence of receptor type 1 tyrosine kinase was separated and purified. These two gene fragments were treated with the above-mentioned pMKIT neo using the restriction enzymes Sa1I and NotI to remove a portion of the staff, and then subjected to T4 DNA ligation. As a result, an expression vector for the receptor tyrosine kinase was constructed. The vector prepared without the FLAG sequence as described above is referred to as p MK FULL, and the vector including the FLAG sequence is referred to as p MK FULLFLAG. The cell lines to be transfected are mouse pro-Bce11 1 ineBano F3 (available from RIKEN, Cell Development Bank, Japan, No. RCB0805) and mouse. Fibroblast B alb // 3 T 3 clone A 31 (available from RIKEN, Cell Development Bank, Japan, No. RCB 005). For cell culture before gene transfer, Ba / F3 was RPM 1 1640 (GIBCO—BRL, USA), 10% FCS, 100 OOig / ml mouse IL—3 (US, Intergen Ba1bZ3T3 was cultured in D-MEM (Dalbecco's modified MEM medium, GIBCO-BRL, USA) 10% FCS.

The expression vector was digested with a restriction enzyme NruI (Takara Shuzo Co., Ltd., Japan) to make it into a linear form and then transfected.

Production of a transgenic cell line using Ba / F3 is performed as follows. Was. That is, the medium of the cells was changed the day before, and the cells were cultured at 5 XI 0 ⁵ ce 11 s Zml. The next day, to precipitate the cells by centrifugation, PBS (-) 2 times after centrifugation washed with, earthenware pots by the ^{1 X 1 0 7 eel I s} / ml in 1 mM M g C 1 2, PBS ( I) The cells were prepared as follows. Gene transfer was carried out by an electroporation method using a gene transfer device Gene Pulser manufactured by Bio-Rad, USA. Take the above cell suspension into a 5Ο θβ electrophoresis dedicated senor (◦ .4 mm), add the expression vector at 20 / g, and leave it on ice for 5 minutes. Then, a voltage was first applied under the condition of 600 V, left at room temperature for 1 minute, and then a voltage was applied under the condition of 960 F and 250 V for the second time. Then, after leaving it on ice for 5 minutes, diameter 1

The cells were cultivated in a 0 cm cell culture dish with 10 ml of the above medium. The next day, centrifuge the above medium into G418 (US, S

(1 gma) was added to 20 ml of a medium supplemented with lmg Zml, and cultured in 24 ml cell culture plates in 1 ml portions. Using a similar medium containing lmg Zm1 and G4 18, half the medium was replaced every two days, and cultivation was performed for about 10 days. After reducing the cell concentration to about 1 X 10 ⁶ ce 11 s / ml with 10 ml, a 96-well plate is used to bring the cell concentration to 0.05 cells / ml from 0.02 force. Cultivation is carried out by limiting dilution to, and cells that stably express cloned genes were obtained. A cell line which transfects the thus-produced Ba / F3 and stably expresses the polypeptide containing the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing is obtained from Ba / F3 / FULL, stable expression of a polypeptide having a FLAG amino acid sequence at the C-terminus of a polypeptide containing the amino acid sequence described in SEQ ID NO: 2 in the sequence listing The cell line was named BanoF3 / FULLFLAG. In the same manner, a control transformed cell line into which 1 ^ 1: 1 1116 itself was transfected was prepared and named Ba / F3ZCON.

Preparation of a transgenic cell line using Ba1b / 3T3 was carried out as follows. That is, the medium of the cells was changed the day before, the number of cells was changed to 5 × 10 ⁶ cells for a cell culture dish with a diameter of 10 cm, 10 ml of the above medium was added, and the cells were cultured overnight. . The next day, to precipitate the cells by centrifugation fraction away, PBS (-) 2 times after centrifugation washed ^{with, 1 m MM g C 1 2} , PBS - a to ^{1 X 1 0 7 eel 1 s} Z ml () Thus, cells were prepared. Gene transfer was performed by an electroporation method using a gene transfer device manufactured by Bio-Rad, USA. Transfer the above cell suspension (500 μfi) to a dedicated electroporation cell (0.4 mm), add 20 / g of the expression vector, and place on ice for 5 minutes. put. Thereafter, the soda was allowed to stand at room temperature for 1 minute, and two 3 F, 450 V voltages were applied. Then, after leaving it on ice for 5 minutes, it is cultured for 3 days in the above culture medium (10 ml) in a 10 cm diameter cell culture dish. I got it. Three days later, the medium was replaced with a medium containing G418 (Sigma, USA) at a concentration of 400 μg / m \, and the medium was replaced every other day with 1Z3 The culture was continued for about 10 days after the exchange. After 10 days, the colonies formed on the dish were peeled off using a Tribsin solution (GIBCO — BRL, USA) to obtain a cell line stably expressing the cloned gene. . The cell line that stably expresses the polypeptide containing the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing of Ba1b / 3T3 prepared in this manner was transformed into Ba1FULL. And a cell line that stably expresses a polypeptide having a FLAG amino acid sequence at the C-terminus of the polypeptide containing the amino acid sequence described in SEQ ID NO: 2 in the sequence listing. Was named Balb ZFULLFLAG. In the same manner, a control-transformed cell line into which PMKIT neo itself was transfected was prepared, and named Ba1bZCON.

(Step 2) Preparation of a cell line expressing a receptor tyrosine kinase polypeptide having the amino acid sequence of SEQ ID NO: 1 in the sequence listing Also, the extracellular portion of receptor type 1 tyrosine kinase, namely, An expression vector was constructed which allows animal cells to produce a polypeptide containing the polypeptide described in SEQ ID NO: 1 of the Sequence Listing.

That is, at the C-terminus of the polypeptide of the receptor-type tyrosine kinase extracellular partial amino acid sequence of SEQ ID NO: 1 in the sequence listing, 8 Amino acid, that is, a polypeptide to which a polypeptide having Asp Tyr Lys Asp Asp Asp Asp Lys as an amino acid sequence (described in SEQ ID NO: 13 in the FLAG sequence list) is added. In the preparation of an expression vector having a gene sequence that encodes 5'-CGGAATTCGTGCGGTTCCTGAAGACGTCAG-3 'in the same way as in the case of full-length, No. 14) and 5'-GGGAATTCATTTATCATCATCATCTTTATAATCCTGCTC CCGCCAGCCCTCGCTCTCA-3, the oligo DNA (primer 15, described in SEQ ID NO: 15 in the sequence listing) as the primer. PCR was performed using pB1uescript containing the gene of SEQ ID NO: 3 in the column list as a template. After confirming that a DNA of about 150 bp is amplified by agarose gel electrophoresis, the PCR product is purified by the method described in Reference Example 5 and digested with the restriction enzyme EcoRI. restriction enzyme treatment was, by connecting gene p B 1 uescript that was de-phosphate processing terminal in United States N ew E ngland B io L ab Co. T 4 DA ligase subcloned the _c Thereafter, 10 Purify the plasmid DNA from the colony's colony power, confirm the gene sequence by sequencing, and confirm that the gene sequence is correct. No. 5 at the 3 'end of the sequence No. 18 5 3 of the DNA sequence of No. 3 in the sequence No. 205 5 No. 3, -GATTATAAAGATGATGATGATAAATGA-3' (described in No. 13 ) Is a fragment that has a connected sequence. I was sure that. In addition, the direction of the PB 1 uescript-linked gene fragment was confirmed upstream of the 5 ′ terminal of the sequence shown in SEQ ID NO: 3 in the sequence listing when confirming the gene sequence.

A clone was selected so that the S a1 I site of the 1 pt multi-cloning site and the N0tI site were located downstream of the gene sequence encoding the 3 'FLAG sequence. . Hereinafter, this vector is referred to as pBSF4.

The above vector pUCRTKFULL was digested with restriction enzymes Sa1I and AatII (Toyobo, Japan), and a gene fragment of about 1.6 kbp was purified by the above method. This gene fragment contains the sequence from No. 384 to No. 182 of the DNA sequence of SEQ ID NO: 3 in the Sequence Listing. Similarly, PBSF3 was digested with the restriction enzymes Sa1I and AatII, and approximately 3.

The 2 kbp gene fragment was purified. The vector prepared by connecting these two gene fragments was further digested with restriction enzymes Sa1I and NotI and connected to the above-mentioned expression vector PMKIT neo. A vector producing a polypeptide having a FLAG sequence at the C-terminus of the amino acid sequence was prepared. This expression vector is designated as PMKEXFLAG.

Similarly, the Fc portion of the polypeptide below the hinge portion of the immunoglobulin IgG1 is located at the C-terminus of the polypeptide having the amino acid sequence described in SEQ ID NO: 1 in the sequence listing. A vector capable of producing a polypeptide having an amino acid sequence was prepared as follows. 73

That is, at the C-terminus of the polypeptide of the extracellular partial amino acid sequence of the receptor type 1 tyrosine kinase of SEQ ID NO: 1 in the sequence listing, the Fc portion below the hinge portion of human IgG was added. In preparing an expression vector having a gene sequence encoding a polypeptide to which a amino acid sequence was added, primers 4, 5'-AAGGATCCTGCTCCCGCCAGCCCTCGCTCTCA-3 'were prepared in the same manner as described above. Oligo DNA (primer 16, described in SEQ ID NO: 16 in the Sequence Listing) as a primer is used as a primer, and PB1uescript containing the gene of SEQ ID NO: 3 in the Sequence Listing is used as a template. Was used to perform PCR. After confirming that approximately 150 bp of DNA was amplified by agarose gel electrophoresis, the PCR product was purified by the method described in Reference Example 5, and the restriction enzymes EcoRI and BamHI were used. Then, the gene was subcloned to PB1uescript treated with the same restriction enzymes using T4 DNA ligase manufactured by New England BioLa, USA. After that, the obtained 10-clones colony or plasmid DNA was purified and sequenced to confirm the gene sequence. It was confirmed that the fragment had a sequence, that is, a fragment having a sequence from No. 1853 to No. 220 of the DNA sequence of SEQ ID NO: 3 in the sequence listing. Hereinafter, this vector is referred to as PBSF5.

Next, imno globulin F c tanno ,. The fusion protein was synthesized with the method of Zett 1 meiss 1 et al. (Zet t lmeissl eta 1. A gene using intron-containing genomic DNA was used in accordance with DNA Cell Bio, 9, 347-354, 1990), and the gene was prepared by PCR. That is, using the human genome DNA as a template, the gene sequence encoding the human IgGI Fc portion was replaced with the 5'-A ACCATCCCCGAGGGTGTCTGCTGGAAGCCAGGCTCA with restriction enzyme BamHI site. -3 'oligo DNA (primer 7, described in SEQ ID NO: 17 in the sequence listing), restriction enzyme XbaI site, 5'-CCTCTAGAGTCGCGGCCGT CGCACTCATTTACC-3, PCR was performed using oligo DNA (primer—8, described in SEQ ID NO: 18 in the sequence listing) having a systematic primer as a primer, and a band of about 1.4 kbp was purified. Treated with HI and XbaI (Takara Shuzo Co., Ltd., Japan) and sent to the same restriction enzyme-treated PB1uescript using T4 DNA1 igase from New England BioLab, USA. The child was connected and sub-cropped. Then, the brassmid DNA was purified and sequenced to confirm the gene sequence, confirming that the gene sequence was indeed genomic DNA corresponding to the hinge portion of the heavy chain of human IgGI. (See Kabateta I., Sequence of Immunological Interest, NIH pub cat ion No 91-3242, 1991 for the sequence.) Hereinafter, this vector is referred to as p BS hlg F c.

The above vector p BSF5 is replaced with the restriction enzymes BamHI and Ec o Digestion with RI, purify a gene fragment of approximately 150 bp by the above method, and then convert the above vector pBShIgFc to restriction enzymes BamHI and EcoRI. Then, a gene fragment of about 4.4 kbp is purified by the above method, and the both are ligated to each other with T4D Α ligase manufactured by New England BioLab in the United States. The vector thus prepared was digested with restriction enzymes Sa1I and AatII, and a gene fragment of about 4.4 kbp was purified by the above method. At the same time, the above vector PUCRTKFULL was digested with restriction enzymes Sa1I and AatII, and a gene fragment of about 1.6 kb P was purified by the above method. The vector prepared by connecting these two gene fragments was further digested with restriction enzymes Sa1I and N0tI, and connected to the above-described expression vector PMKIT neo. A polypeptide production vector having the amino acid sequence of human IgGI Fc at the C-terminus of the amino acid sequence was prepared. This expression vector is referred to as pMKEXIg.

The expression vectors pMKEXFLAG and pMKEXIg were transfected with COS-7 (RCB0539, available from RIKEN, Cell Development Bank, Japan). The method of culturing COS-7 and introducing the gene were performed in the same manner as in BaIb / 3T3, and cells into which the gene had been introduced were obtained.

The day after gene transfer, cell culture supernatant serum-free D-MEM (GIBCO-BRL, USA) was replaced every 4 days, and the culture supernatant was collected for 2 weeks. Each of the collected culture supernatants was exchanged with PBS (-) from the medium and centrifuged 10 times with Centricon 30 (Amicon, USA).

In order to confirm that the polypeptide containing the polypeptide shown in SEQ ID NO: 1 in the sequence listing was produced in the cell line, it was confirmed using a Western blot as follows. . That is, the concentrated culture supernatant was purified using an SDS-PAGE electrophoresis tank and SDS-PAGE polyacrylamide gel (gradient gel 5 to 10%) manufactured by ACI Japan of Japan. SDS-PAGE was performed in accordance with the instructions. The sample was prepared by adding 2-mercaptoethanol (2-ME) and heat-treating the sample under non-reducing conditions, and the non-reducing sample under non-reducing conditions. The sample was prepared using a Rainbow Marker 1 (for high molecular weight) manufactured by Amersham, Inc., according to the instruction manual attached to the sample, the electrophoresis buffer, and the end plate. After completion of SDS—PAGE, acrylamide gel is applied to the PVDF membrane label.

(Manufactured by Bi0Rad, USA) using a mini Blot cell manufactured by US Bi0Rad.

The filter thus prepared was subjected to 5% BSA (manufactured by Sigma, USA), TBS-T (20 mM MTris, 1337 mNaC1 (pH 7.6)) , 0.1% T weem 20) Blocked while rubbing at 4 ° C. When the target protein is FLAG chimera, mouse monoclonal antibody Anti-FLAG 2 (manufactured by Kodak, USA) as the primary antibody, and peroxidase-labeled anti-mouse as the secondary antibody Ig sheep antibody

(Manufactured by Amérsham, UK). In the case of IgG chimera, peroxidase-labeled anti-human Ig sheep antibody

(Manufactured by Amérsham, UK). The reaction time of each antibody was 1 hour at room temperature, and between each reaction, the operation of washing with PBS once for 10 minutes at room temperature was repeated three times. After the last wash, filters are soaked for 5 minutes in the reaction solution of the UK CL blotting detection system from Amer 5 3111, UK, wrapped in polyvinylidene wrap and transformed into an X-ray film. It was exposed. As a result, the FLAG chimera had about 80 kDa protein in each case, and the IgG chimera had 2 O-ME dalton and 11 Ok dalton, In this case, a protein of 220 kDa was detected. From the above results, a polypeptide-producing cell containing the amino acid sequence described in SEQ ID NO: 1 of the target sequence listing was obtained. The extracellular portion was approximately 20 kilodaltons larger than the molecular weight expected from the amino acid composition, and was expected to be glycosylated.

Reference Example 9 Purification of extracellular partial protein of res butte type 1 tyrosine kinase

The vectors PMKEXFLAG obtained in Step 2 of Reference Example 8 and Five liters of each of the culture supernatants of the cells transformed with pKEXIg were prepared. These culture supernatants were applied to an Anti-FLAGM 2 Affinity Gel column manufactured by Kodak, USA and a pr0tein G Sepharose column or a Protein A Sepharose column manufactured by Pharmacia, Sweden. Each protein was absorbed into the column. The size of each column was 1 cm × 3 cm, the volume was about 2 ml, and the flow rate was all 1 ml Zmin. After the adsorption, the column was washed with PBS (-) 2 O ml, and then eluted with 0.5 Tris-glycine (PH 3.0). Eluted fractions were collected in 2 ml aliquots, 0.5 MT ris — HCI (pH 9.5) 200 μβ was added, and each fraction was subjected to SDS-PAGE according to the method described above. . After the electrophoresis was completed, staining was carried out using a silver dye kit (Koichi II) manufactured by Wako Pure Chemical Industries, Ltd. in Japan according to the attached instructions. As a result, it was confirmed that both the FLAG chimera and the IgGFc chimera were able to obtain purified proteins in the same size band as the result of the western plot described in Reference Example 8. From these results, the polypeptide described in SEQ ID NO: 1 in the sequence listing could be obtained as a pure product. To obtain highly pure polypeptides, the FLAG chimera and IgGFc chimera protein purified by the above method were purified by gel filtration. The eluate from the affinity column is exchanged for buffer with PBS (-) at Centricon 30 manufactured by Amicon, USA. The gel flow was carried out using a FPLC system manufactured by Pharmacia in Sweden and at the company's Superose 12 column. Reference Example 8-2 — The main peak eluted at the same molecular weight position as the result of the Western blot under the condition without ME was collected. Hereinafter, the chimeric proteins of the polypeptide having the amino acid sequence described in SEQ ID NO: 1 and the FLAG or IgGFc described in SEQ ID NO: 1 in the thus-purified sequence listing are referred to as EXFLAG — PTN. EXI g — Shown as PTN.

Reference Example 10 Establishment of a monoclonal antibody that recognizes receptor type 1 thyrokinase and confirmation of expression of receptor type thycosine kinase

Using the purified EXFLAG-PTN as an immunogen, a mouse monoclonal antibody was prepared according to the method described in the written document. Immunization was performed three times, and one animal was immunized with 30 / ig each time. Blood was collected before the third immunization, blood samples were collected, and the antibody titer using the immunized EXFLAG-PTN was used. The cell culture supernatant was used for screening, and the cell culture supernatant was used to recognize both EXFLAG-PTN and EXIg-PTN. As a result, three hybridomas producing mouse monoclonal antibodies, namely clones 38-1E, 66-3A and 68-3A, were established. The following experiments were performed using the monoclonal antibody 38 produced by the clone 38-1E. Using the monoclonal antibody thus prepared, XJT_7, MRC-5, and the above-mentioned transformed cell lines BaZF3 / FULL, Ba / F3 / FULLFLAG, Balb FULL and Ba1bZFULLFLAG were subjected to cell surface antigen analysis using a flow cytometer EPICS Elite manufactured by Coulter, USA. Antibody staining was performed according to the method described in the written literature. The antibody was purified from the hybridoma culture supernatant as a primary antibody using Matratra GII (Pharmacia, Sweden) according to the attached instructions, and the secondary antibody was used as a secondary antibody. The assay was performed with a goat anti-mouse Ig FITC label manufactured by Incorporated. As a result, it was confirmed that cells transfected with UT-7, MRC-5, and Receptor type 1 osteosynkinase gene were stained with the above-mentioned monoclonal antibody.

Further, using the cell lysate of BaZF3NOFULL, B3 / F3 / FULLFLAG, Ba1b / FULL and Ba1b / FULLFLAG, the same monoclonal antibody was used as a tester. A blot was performed.

The preparation of the cell lysate was performed as follows.

The 2 X 1 0 ⁶ cells cells re Shisuba' file one (5 0 mM H epes (p H 7. 5), 1% T riton X 1 0 0, 1 0% glycerol, 1 0 mM N a 4 P 407, 100 mM NaF, 4 mM EDTA, 2 mM Na3VO4, 50 μg / m \ A protinin, 100 μML eupe ptin, 25 μPepstatin A, 1 m MPMSF) Suspend in 200 / fi, leave on ice for 20 minutes, centrifuge at 140 rpm for 20 minutes, remove supernatant, and disrupt cells Thing was obtained.

The various cell lysates thus obtained were subjected to Western blotting by the method described in Reference Example 8 using the same mouse monoclonal antibody. As a result, it was confirmed that the band of 130 kilodaltons was specifically recognized.

From the above results, a monoclonal antibody that recognizes receptor tyrosine kinase was established, and a polypeptide-producing cell line containing the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing was confirmed. It was confirmed that it was manufactured in

Example 1 Separation and concentration purification of various human cell cultures

Using the chimera protein of the extracellular domain of the ligand having the amino acid sequence shown in SEQ ID NO: 1 of the sequence listing purified by the above method, and each of FLAG and IgGFc In order to identify the cells expressing the ligand with the biosensor BIA c0re (Pharmacia, Sweden), a sample to be measured with the BIA core was prepared as follows. .

Table 1 summarizes cell names, cell types, culture media for cell culture passages, and cell sources.

Culture the cells as shown in Table 1. When adherent cells become confluent in Corning T-125 flasks, the culture medium of each cell line is replaced with serum-free IDMM (GIBC, USA). Ο—BRL), IDMM containing lOng ZmlPMA, and IMDM containing 100 U / ml human TNF were exchanged for each medium, and cultured for 4 days.淸 was recovered. In the case of suspension cells, the cells were cultured for 4 days under the above conditions so that the cell concentration was 5 × 10 ⁵ ce 1] s Zml, and the culture supernatant was collected. The collected culture supernatant was concentrated with a Centriprep 10 manufactured by Amicon, USA, and the solution was exchanged. Samples were obtained with the solution exchange ratio from 40 to 200 times in the fan.

Example 2 Screening of cell culture supernatant using biosensor BIAcore

Identification of the cells expressing the ligand was performed using Biosensor BIAcore (manufactured by Pharmacia, Sweden) according to the attached instruction manual.

EXI g — PTN and EXFLAG — PTN prepared and purified by the method described in Reference Example 9 were combined with 100 mM sodium acetate buffer (pH 4) to give a concentration of 100 / g Zml. 0) and activated BIA core sensor chip CC-certified (Fanoremasia, Sweden) according to the instructions in the attached instruction manual. And bonded. Injection was performed twice with 5Oβ, combined, blocked with ethanolamine, and washed with HSB buffer until the baseline was stable. The flow rate was 5 μβ min, including the measurement of the following samples. The difference between the response unit (RU) before and after binding of SenShip to EXIg-PTN and EXFLAG-PTN was about 100 RU.

The conditions for sample introduction and measurement of BIA c 0 re were as follows. A flow of 30 μβ (6 min) was applied to the sensor chip to which the above peptide was bound. As a representative profile, a graph showing the measurement results of the binding activity of ligand contained in the culture supernatant of C-11 cells (unstimulated) to tyrosine kinase is shown in Fig. 1. Shown in The RU value is the part of the baseline before the sample is introduced, the mass transit due to the entry of the sample (the top of the baseline is re-aligned) and the ligand is " t: Changes occur in the part that binds to the tyrosine kinase, which is a puter, and in the part that is replaced by the normal HSB buffer, as indicated by the two points indicated by the arrows in Fig. 1. The value of the baseline (30 seconds before sample introduction; indicated by arrow A in Figure 1) and the value immediately after the final replacement with HSB buffer (ie, 6 minutes after sample introduction) The difference between the two values of the value after 10 seconds (indicated by arrow B in Fig. 1) was defined as the ligand binding activity.Every time the sample was measured once, 5 OmM sodium acetate was added. 0.5 M Flow N a C 1 (pH 4.0) by 15 μβ

¾t.

Table 2 shows the measurement results.

As can be seen from Table 2, C-1 is a typical cell line of candidate ligand-expressing cells that showed high ligand binding activity to both EXIg—PTN and EXFLAG—PTN. BT-20 cells were revealed as a cell line that did not express the cells or ligand.

Example 3 Identification of Ligand-expressing Cells Using Extracellular Proteins

In Example 2, the ligand-expressing cells were identified by examining various cell culture conditions.If the ligand was also present on the cell membrane, cells were prepared in Reference Example 9. Ligand-expressing cells should be stained with polypeptides containing the extracellular portion of the receptor tyrosine kinase. Therefore, identification of a ligand-expressing cell was carried out using a polypeptide EXIg—PTN containing the amino acid sequence of SEQ ID NO: 1 in the sequence listing prepared as shown in Reference Example 9. It was performed at a low-site meter.

For C-1 and BT-20, which were considered as non-expressed ligand-expressing cells in Example 2, 5X

1 0 ⁶ cells were prepared, first by Kaka渴in PBS (I) (hereinafter referred to as PBS-F) containing 2% FCS, centrifuged under the conditions of centrifugation 3 0 0 0 rpm, 1 minute Separated and washed. Then, these cells were suspended in 50β of a solution of normal mouse serum (manufactured by Organontech Niki, USA) diluted 100-fold with PBS-F and left on ice for 1 hour. After that, the cells were washed once by the above method, and then the solution prepared in Example 9 with PBS-F at a concentration of 500 ng / μβ was used for the Ε Χ § §—? Was suspended in 50 μβ of 50 μβ or 50 μβ of PBS-F, and allowed to stand on ice for 30 minutes. Then, after washing twice as described above, FITC-labeled anti-human IgG (manufactured by Binding Site, UK) Was reacted in the same manner, washed twice, and finally suspended in 20 μl of PBS-F and analyzed by a flow cytometer. The flow site meter used EPICS Elite manufactured by Coulter, Inc. in the United States.

Figure 2 shows the results. The vertical axis in FIG. 2 indicates the number of cells. The horizontal axis shows the relative fluorescence intensity, which becomes stronger as going to the right. From this result, a shift in the fluorescence peak was observed for C-1 as compared to the control to which EXIg-PTN was not added, and it was found that ligand was also present on the cell surface. With respect to BT-20, such a shift of the peak was not observed, indicating that the ligand was not expressed on the cell membrane.

From the above results, it was found that at least the colon cancer-derived cell line C-11 also expressed candidate ligand molecules on the cell surface. Example 4 Identification of Ligand-Expressing Cells by Phosphorylated Atssay System Using Receptor Type 1 Tyrosine Kinase Gene-Transfected Cells

As a result of Examples 2 and 3, C-1 cells, which are one of the cell lines that are considered to express the ligand, are not only bound, but also transformed cells B described in Step 1 of Reference Example 8 The following experiment was performed to determine whether the phosphorylation of receptor type 1 tyrosin kinase expressed on the cell membrane surface of a / F3ZFULLFLAG was caused.

That is, the C-1 cell prepared by the method described in Example 2 Cell culture supernatant concentrate, C-11 cells themselves, and mouse anti-blood sample collected at the time of antibody titer measurement during monoclonal antibody production described in Reference Example 10 react with receptor tyrosine kinase. And examined whether it could be phosphorylated.

Was replaced with fresh medium the day before performing re phosphorylation, cell number ⁵ X 1 0 5 cells / ml in the B a ZFS / experiment an equivalent number of days cells FULLFLAG 5 X 1 0 ⁶ or Fetch to the following Suspend the five solutions in 500 μβ and incubate at 37 for 20 minutes. 0 was allowed to react at ₂ in Lee down Kyubeta scratch.

Reaction solution 1: Medium (RPMI 1640, 10% FCS, 100 / g Zml mouse IL-13) only;

Reaction mixture 2: suspension of 5 × 10 ⁶ C-11 cells in the medium of reaction mixture 1;

Reaction solution 3: A solution obtained by diluting the mouse anti-blood serum described in Reference Example 10 100-fold with the medium of reaction solution 1;

Reaction Solution 4: A solution obtained by diluting the mouse antiserum described in Reference Example 10 by 500 times with the medium of Reaction Solution 1; and

Reaction solution 5: The cell culture supernatant of C-11 cells prepared by the method described in Example 2 was concentrated 50-fold with Centriprep 10 (Amicon, USA). And the solution was exchanged for the medium of Reaction Solution 1.

After the reaction, the cells are immediately placed on ice, and the cells containing 2 mM sodium vanadate (Na ₃ VO „), which has been cooled in advance, are added. Add lml of BS (-), centrifuge at 3 ° C for 1 minute at 4 ° C to sediment the cells, and perform the same operation once more. A cell disruption solution was obtained in the manner described.

Add 30 μβ of Anti-FLAGM 2 Affinity Gel from Kodak, U.S.A. to this cell disruption solution, and rotate to 4 ° C while rotating slowly to prevent precipitation. The gel was allowed to adsorb the polypeptide having the amino acid sequence of SEQ ID NO: 2 in the sequence listing having the FLAG amino acid sequence on the gel. After the reaction, the mixture was centrifuged at 4 ° C and 500 rpm for 3 minutes to precipitate the gel, and the supernatant was removed so as not to absorb the gel.The cell lysis buffer described in Reference Example 10 Was added and suspended. Further, the same centrifugation operation and suspension operation were performed three times to obtain a gel precipitate. The same experiment as described above was performed not only for BaZF3 / FULLFLAG but also for Ba / F3 / CON to obtain the same gel precipitate.

This gel precipitate was subjected to Western blotting according to the method described in Reference Example 8. Gel precipitate 30 μβ SDS-PAGE sample buffer was added, and the mixture was subjected to a boiling water bath for 5 minutes in the presence of 2—ME, and 15 μβ was passed through one lane for SDS-PAGE. Was. Two sets of PVDF membranes to which the same sample was transcribed were prepared, and one set was a polypeptide having the amino acid sequence of SEQ ID NO: 2 in the sequence listing having the target FLAG sequence. On the other hand, the presence of phosphorylation of tyrosine residues It was used for the judgment of nothing.

Figure 3 shows a photograph of this Western blot. A and B are the results of the polypeptide B a ZF3 ZFULLFLAG containing the amino acid sequence of SEQ ID NO: 2 in the target sequence listing, and C and D are the controls thereof, Ba / This is the result of F 3 CON. Antibody staining was performed with A and C using an anti-phosphorylated tyrosine antibody (UBI, USA), and B and D with Anti-FLAGM2 (Kodak, USA). The number of each lane corresponds to the number of the reaction solution described above. The arrow indicates the position of the polypeptide described in SEQ ID NO: 2 in the sequence listing having the FLAG sequence.

These results indicate that the co-culture with C-1 cells or the stimulation of mouse antiserum activates the tyrosine kinase activity of the receptor type 1 tyrosine synthase, resulting in its own tyrosine residue. It was found to cause phosphoric acid. However, no phosphorylation of such tyrosine residues was observed in the medium alone.

Furthermore, even when the concentration condition of mouse antiserum was changed, it was not phosphorylated as strongly as co-culture with C-1 cells. The effect of the ligand of the present invention is apparently stronger than that of the ligand of the present invention, but it clearly increases the enzymatic activity of receptor tyrosine kinase and strongly reduces the phosphorylation of tyrosine residues. It is thought to cause a bioactive effect on cells through receptor tyrosine kinase.

On the other hand, in the result of BIA c 0 re of Example 2, the ligand was narrow. It can be seen that it is present in the cell culture supernatant, but the 50-fold concentrate from the culture of C-11 cells caused only very weak phosphorylation of tyrosine residues. This is powerful because the amount of ligand in the cell culture supernatant is extremely small and a concentration of about 50-fold concentration does not sufficiently increase the tyrosine kinase activity of the intracellular portion of the receptor type 1 tyrosine kinase. It is unknown whether the ligand has a high activity, which is partially high on the cell surface, but it is presumed that the result was very weak phosphorylation. Was.

Similar experiments were performed on human normal serum, mouse normal serum, FCS, and BT-20 as a cell strain, but phosphorylation of tyrosine residues could not be confirmed. This was thought to be due to the action of a specific ligand on the C-11 cell membrane on receptor type 1 tyrosine kinase.

From the results of Examples 2, 3 and 4 above, at least C-1 cells were mentioned as the ligand-expressing cells, and the ligand was present on the cell culture and on the cell membrane. It was shown that they could be refined from these.

Example 5 Purification of receptor tyrosine kinase ligand using affinity column

From the results up to Example 4, it is considered that the colon cancer-derived cell line C-11 surely expresses the receptor tyrosine kinase ligand. — PT An attempt was made to purify using an N-linked affinity gel column.

The supernatant of C-11 was prepared by the method described in Example 1 and finally collected in an amount of 54 O ml. The concentrated solution obtained in Step 1 was used. The value of BIAc0 ree of this concentrated liquid measured by the method described in Example 2 was 134 RU.

The affinity column was prepared using CNBr-activated Sepharose 4B manufactured by Pharmacia, Sweden, according to the attached instruction manual. Finally, an affinity gel in which 4.1 mg of EXIg-PTN was bound to a 3.5 ml gel was produced. The coupling efficiency was 99.6%. A column with a size of 2 cm ² × 1 cm was prepared from 2 ml of this gel.

The above cell culture supernatant concentrate is passed through the column at a flow rate of 20 m 1 / hr, and then washed with the same flow of PBS (-) at a flow rate of 15 m 1. Eluted with sodium, 0.5 MNaCl (PH 4.0). The eluate was fractionated at a rate of 1 ml, and each fraction was neutralized by adding 200 μβ of lMTris-HCl (pH9.5) to each fraction.

The molecular weight of the protein molecules contained in the solution purified and fractionated by the affinity column was confirmed by SDS-PAGE. Sample buffer at that time The gel was run under non-reducing conditions without heating, without using 2-ME, and the gel was run using a 15-20% gradient gel. As a molecular weight marker, LMW Kit E manufactured by Pharmacia of Sweden was used. After completion of the electrophoresis, silver staining was performed using Wako Pure Chemical Industries Co., Ltd. Japan Silver Staining Kit II according to the attached staining method. Figure 4 shows the results. Various bands were eluted immediately after being replaced with the eluate, but it was unknown at this time which of these bands was hitting the target ligand. Therefore, each column of the column before washing, the washing solution, and the fractionated eluate (in this case, one-fifth dilution) was transferred to Ultraflow by Millipore, USA. The solution was exchanged into the HBS buffer using C 3 LGC (10 K cuts), and the measurement was carried out again with the BIA c 0 re by the method described in Example 2.

The results are shown in Table 3.

From these results, it was confirmed that a compound considered to be a ligand that binds to a polypeptide including the polypeptide having the amino acid sequence described in SEQ ID NO: 1 in the sequence listing is certainly a fraction. It was confirmed that the fraction with the protein number 4 was concentrated and purified as a peak.

Example 6 Gel filtration purification of receptor tyrosine kinase ligand and measurement of molecular weight

Next, 300 μβ of the fraction of fraction No. 4 of the purified peak shown in Example 5 was transferred to Millipore in the United States. The solution was exchanged with PBS (-) containing 0.02% Tween 20 by using a non-refractive C3 LGC (10 K cut) manufactured by the company, and simultaneously concentrated 6 times. Gel filtration was performed.

The column for gel filtration used was Superdex 75 HR10Z30, manufactured by Pharmacia, Sweden, and the separation buffer used was PBS (-) containing 0.02% Tween20. The flow rate was 40 μβ Ζπι η η. Before separation of the sample, the molecular weight at the elution position was measured using a molecular weight marker measurement kit LMW manufactured by Pharmacia, Sweden, and gel filtration of the sample was performed. fractionated into β.

The sample thus fractionated in molecular weight was diluted 10-fold with an HBS buffer, and BIAc0 ree was measured.

FIG. 5 shows the change in the absorbance of the gel fraction at 214 nm, and FIG. 6 shows the measurement results of the BIA core of each fraction. From this result, the peak of the ligand binding to the polypeptide having the amino acid sequence of SEQ ID NO: 2 in the sequence listing having peaks at the fraction numbers 13 and 14 was found. was detected. In addition, small peaks were similarly observed in the fraction numbers 21 and 22. Based on the results of the molecular weight marker performed in advance, the fraction between fraction numbers 11 and 12 is 63 000 daltons and the force between 13 and 14 ί 540 000 danoletone , 15 and 16 S 4 3 0 0 Daltons, fraction numbers 13 and 14 The molecular weight of the receptor type 1 tyrosine kinase ligand of the present invention having a peak of was determined to be 540,000 soil, 900,000 daltons from the results of gel filtration.

Further, the compounds contained in the same fraction samples were analyzed by SDS-PAGE in the same manner as described in Example 5 for each fraction. Figure 7 shows the results.

From this result, three types of bands were confirmed to be contained in the active surface (fraction numbers 11 to 16). From the correlation with the BIAcore measurement result, it was determined that the ligand of the present invention was a smear band (shown by the right arrow in FIG. 7) at approximately 42 K daltons. Therefore, the molecular weight of the receptor type 1 tyrosin kinase ligand of the present invention was estimated to be 4150 ± 7500 daltons.

The result of gel filtration does not match the molecular weight value of SDS-PAGE, but the estimated molecular weight of gel filtration may differ from the actual substance due to interaction with the gel. It was inferred that 410,000 ± 750 daltons was the molecular weight of the receptor tyrosine kinase ligand of the present invention.

Example 1 Purification of receptor type 1 tyrosine kinase ligand using affinity column

Further, the active fractions (fraction numbers 12 to 15) of the above gel filtration were collected and sequenced again by the method described in Example 5. Purification was carried out with an affinity column using a polypeptide containing the amino acid sequence shown in SEQ ID NO: 2 in the table.

The column was eluted by gravity flow using a small-scale, 150-µβ bet volume. The above active fraction fraction numbers 12 to 15 were collected and loaded on the small-scale column described above. After that, washing was performed by flowing 8 times of PBS (-) containing 150% of 0.02% Tween 20 and then washing with 150M of 0.1 M sodium acetate, 0.5%. MNaCl (PH4.0) was flowed four times to fractionate and elute each fraction. The eluate was neutralized by adding 30 μβ of lMTris-HCl (pH9.5). In order to confirm the purity of the final purified ligand in this way, each fraction was subjected to Ultrafree C3 LGC (10 K cut from Millipore, USA). After concentration to に μμβ using), the substances contained in each fraction were confirmed by SDS-PAGE. The sample buffer used here did not contain 2-ME, was used under non-reducing conditions without heating, and the gel was used using a 15-20% gradient gel. As the molecular weight marker, LMW KitE manufactured by Pharmacia, Sweden was used. After completion of the electrophoresis, silver staining was performed using a silver staining kit II manufactured by Wako Pure Chemical Industries, Japan according to the attached staining method.

Figure 8 shows the results. In Figure 7, one of the three mixtures was one of four hundred and fifty-five ± seven hundred and fifty-five danoleston banding force; fraction number It was confirmed in 1 and 2 that it was purified as a single substance. The above results indicate that the receptor tyrosine kinase ligand of the present invention can be purified by these methods, and a pure product can be obtained.

Example 8 Color reaction of receptor tyrosine kinase ligand

The pure product of the ligand purified by the method described in Example 7 was subjected to SDS-PAGE in the same manner as described in Example 5.

The polyacrylamide gel, on which the new ligand has been migrated in this way, is used for the protein staining method, Kumasi-Pri Lant Blue, a Wako Pure Chemical Industries, Japan When staining was carried out using a Quick CBB kit manufactured in accordance with the attached experimental method, the band of about 420,000 daltons, which is the ligand of the present invention, was stained. It was found that the ligand of the invention contained protein.

Furthermore, the polyacrylamide gel prepared in the same manner was detected by PAS staining, which is a specific staining method for sugar chains. That is, the polyacrylamide amide gel on which the new receptor type 1 tyrosine kinase ligand was run was immersed in a 12.5% trichloroacetic acid solution with shaking for 30 minutes. Then, the sample was immersed in distilled water while shaking for 30 seconds, and then immersed in a 3% acetic acid solution containing 1% periodic acid for 50 minutes. Thereafter, washing was performed by shaking well with distilled water. Wash once for 10 minutes I went eight times. After washing, fuchsin solution (1 g of basic fuchsin (Wako Pure Chemical Industries, Japan)) was dissolved in 200 ml of distilled water heated to 60 ° C in a dark place. On the other hand, it was prepared by adding lg of sodium bisulfite and 20 ml of 1N HCl 1.) for about 1 hour to stain. Finally, the plate was washed by shaking with a 0.5% sodium sulfite solution for 10 minutes, and this was repeated twice. Finally, the band was placed in distilled water and the band was observed. On the other hand, a red band stained with PAS was confirmed to have a molecular weight of about 42,000 daltons. From these results, it was found that the ligand of the present invention contains sugar.

From the results of the two color reactions described above, it was found that the ligand of the present invention was a compound containing a glycoprotein.

Example 9 Determination of amino acid sequence from N-terminal of novel receptor type 1 tyrosine kinase ligand

The solution containing the ligand purified according to the method described in Example 7 was placed on a prospin (manufactured by Applied Biosystems, USA), centrifuged, and the PVDF in the prospin was removed using a special punch. Removed the final note. The final letter was thoroughly washed with a 50% aqueous methanol solution and purified water, and then the N-terminal sequence was determined using a peptide sequencer analyzer. The peptide sensor was analyzed according to the attached instruction manual using Protein 'theta enhancer mode 1492 of ABB Biosystems, Inc. of the United States. As a result of analysis from the N-terminal, the amino acid sequence described in SEQ ID NO: 19 in the sequence listing, that is, Lys-Se r- Π e-Vat Leu-Glu-Pro-l e-Tyr from the N-terminal -Trp-Asn-Ser-Ser-Asn-Se r-Lys-Phe-Leu-Pro-Gi y-Gln-Gl y-Leu-Val-Leu-Tyr-Pro-Gln-l l e-Gl- Asp-Lys- Le u-As pI 1 e-1 I e-XXX-Pro -L ys -V a 1 -A sp -XXX-L ys -Th r -V a 1-G 1 y-XXX- Tyr It was shown to have the following sequence: However, in this amino acid sequence, there were three residues for which amino acid residues could not be determined, and these residues were indicated as XXX, respectively. This result indicated that the ligand of the present invention was a compound containing a polypeptide having the amino acid sequence of SEQ ID NO: 1 in the sequence listing.

Regarding the part where the amino acid residue is unknown, the amino acid sequence before and after the amino acid residue No. 37 in the amino acid sequence No. 19 in the sequence listing can be clearly determined. Therefore, amino acids that have undergone some modification, such as disulfide-bonded cystine residues or amino acid residues that have been modified with sugar chains, etc., have undergone some modification. It is probable that the sequence could not be determined.

Example 10 Preparation of cDNA probe for ligand by PCR method

Based on the amino acid sequence from the N-terminus performed in Example 9, a cDNA probe was prepared by a PCR method using an oligonucleotide mixed primer. That is, the mRNA of the C-11 cells cultured under the conditions containing the PMA described in Example 1 NA was prepared, and a mixed primer of sense and antisense 2 O mer was synthesized from the amino acid sequence found in Example 9, RT-PCR was performed, and subcloning was performed to pB1uescript The gene sequence was determined, the amino acid sequence encoded by the gene was compared with the amino acid sequence determined in Example 9, and the amino acid sequence of the ligand was certainly determined. It was confirmed that the cDNA probe partially encoded.

Separation and purification of mRNA, ie, Po y (A) ⁺ RNA, from C-1 cells were performed as follows. The C-11 cells cultured under the conditions of Example 1 were detached with a cell scraper (manufactured by Corning, USA) and washed twice by centrifugation with PBS (-). Cell Number 3 X 1 0 ⁸ pieces of 4 M guanidine-I O Shiane preparative This cell precipitate, 2 0 mM acetate Na Application Benefits um (p H 5. 2), 0. 1 MDTT, 0. 5% N — Suspend in 20 ml of total RNA extraction solution composed of Raurirsarco silka, and completely dissolve and disperse by passing through a 20 G needle manufactured by Terumo of Japan. Centrifugation was performed at 500 g for 20 minutes, and the supernatant was recovered. Next, after adjusting the total volume to 25 ml with the above total RNA extraction solution, centrifugation was performed with 12 ml of 5.7 M cesium chloride and 0.1 MEDTA (pH 80) solution. The mixture was layered on a tube and centrifuged at 250 ° C at 180 ° C. As a result of centrifugation, a precipitate containing total RNA was recovered. Apply 720 μβ of TES solution (10 mM Tris (pH 7.4), 5 mM MEDTA, 1% SDS), dissolve by leaving at room temperature for 10 minutes, and dissolve this solution. Transfer to a 5 ml eppendorf tube, add the same volume of chloroform / ^ 1-butanol (4: 1) to the solution, mix well, and shake well. After centrifugation for one minute, the upper layer was recovered and the same operation was repeated once more to recover the upper layer.

Next, an equal volume of the recovered solution is dispensed into two Eppendorf tubes, and a 3 M sodium acetate solution (pH 5.2) is added at 30 μβ and ethanol is added at 850 μl each. (5) After the mixture was left at 180 ° C. for 30 minutes, centrifugation was performed at 4 ° C. at 1500 rpm for 15 minutes to precipitate total RNA. Similarly, each of the precipitates containing the total RNA was dissolved in 360 μl of sterile distilled water, and 3 mg of sodium acid solution (PH5.2) was added to 36 μβ of ethanol and ethanol. Was added to the mixture, and the mixture was allowed to stand at −80 ° C. for 30 minutes, centrifuged at 4 ° C. at 150 U0 rotation for 15 minutes, and the total RNA was again precipitated and purified.

The total RNA thus obtained was washed with 70% ethanol, air-dried, and then dissolved in 10 μl of sterile distilled water, and the absorbance was measured at 260: 1111. 1 ^ 1 ^ octamer was determined. As a result, it was confirmed that 24 mg of the total RNA was recovered.

Next, mRNA, that is, Poy (A) ⁺ RNA, was isolated from total RNA of C-1 cells obtained by the above method. Separation was performed using an oligo dT column according to the attached instruction using an mRNA purification Kit manufactured by Phanolemasia, Sweden. As a result, 60 μg of the total RNA 15 / ig of Poly (A) ⁺ RNA was recovered.

In this manner, the purified Po1y (A) ⁺ RNA was purified using Life Sciences, Inc.'s First—strandc DNAS synthesis Kit (purchased from Takara Shuzo Co., Ltd., Japan). CDNA was synthesized according to the attached instruction manual. That is, 2 μg of the above Po1y (A) * RNA was diluted to a final body contamination of 16 μβ, whereas the oligo d attached to this kit was Apply T (12-18) solution (0.5 yg / fi) or random hexamer (100 ng / μΆ) for 10 minutes at 70 ° C. The mixture was allowed to stand, and then left on ice for 10 minutes.

Next, the 5X buffer solution supplied with the kit was added for 5 £, the RNase inhibitor RN asin solution was 1 μβ, 0.25 Μ DTT was 1 β, and Abiamero Avianmyeloblastosis reverse transcriptase (25 / μβ) solution was added to each of 1 μβ, and left at 41 ° C for 60 minutes to synthesize cDNA.Then, at 72 ° C The enzyme was inactivated by leaving it for 10 minutes, and this was used for the next PCR. PCR for preparing a cDNA probe encoding a part of the amino acid sequence of the ligand was performed as follows. That is, the amino acid sequence from the N-terminus of the ligand described in SEQ ID NO: 19 to the 5th leucine to 11th asparagine in the amino acid sequence, ie, Leu-Gl U- Pro-11 Encodes the amino acid sequence of e-Tyr-Trp-Asn. A 20-mer oligonucleotide mixed-sense primer corresponding to all possibilities of cDNA sequence, i.e. Synthesis having the sequence described in SEQ ID NO: 20 in the column list (5 ′-(TC) T (ACGT) GA (AG) CC (ACGT) AT (TCA) TA (TC) TGGAA-3 ′, Bleima-1 9) DNA, furthermore, the amino acid sequence in the C-terminal direction of this amino acid sequence, that is, the amino acid sequence of amino acid sequence shown in SEQ ID NO: 19, SEQ ID NO: 19, from amino acid sequence 3 to amino acid sequence 41 to amino acid sequence 41 The amino acid sequence up to valine, that is, the amino acid sequence of Asp-I 1 e-1 Ie-XXX-Pro-Lys-Va 1 is unknown. About Because, which is expected to been made impossible analysis Jisurufu I de bound to have Shisuti down residues in § Li, in Pebu Ji Doshikuensa one Li cancer Dogauchi portion cormorants by shown in Example 9,

Asp-11 e-1 I 20-mer oligonucleotide corresponding to all possibilities of cDNA sequence encoding amino acid sequence of e-Cys-Pro-Lys-VaI Mixed antisense primer, that is, the sequence shown in SEQ ID NO: 21 in the sequence listing (5'-AC (TC) TT (ACGT) GG (AG) CA (AGT) AT (AGT) AT (AG) TC-3 ', The above two types of synthetic DNAs having primers 10) were prepared according to the method described in Reference Example 2. Probe production by PCR was performed as follows. Mix two kinds of C-11 cDNA solutions prepared by the above method and use 混合 Ο β of this mixture to prepare a 10-fold concentration buffer solution (500 mM

KC 1, 100 mM MT ris — HCl (pH 8.3), 15 mM MgC 12, 0.01% gelatin) 10 μβ, d NTPM ixture (Takara Shuzo, Japan) 8 / ζβ, and Taq DNA polymerase (Ampli Taq: Perkin-Elmer, USA, 5υ / μβ) 0.5 μβ, and the above primer 9 And 10 to a final concentration of 10 and finally add deionized water to bring the total volume to 100 μβ, at 95 ° C for 0.5 min at 42 ° C. A cycle consisting of 0.5 minute and 72 ° C for 1 minute was taken as one cycle, and this cycle was performed for 5 cycles, followed by 0.5 minute at 48 ° C at 95 ° C. The process consisting of 0.5 min at 72 ° C for 1 minute is defined as 1 cycle, this process is performed for 35 cycles, and finally the PCR is left at 72 ° C for 7 minutes. Was done. A portion of this PCR product was subjected to 3% agarose gel electrophoresis, stained with Etch Dumbu Mide (manufactured by Nippon Gene, Japan), and observed under ultraviolet light. It was confirmed that the DNA was amplified.

Next, the entire amount of this PCR product was electrophoresed on a 3% agarose gel prepared with low-melting point agarose, stained with ethidium bromide, and then subjected to a band of about 11 Obp under ultraviolet irradiation. And add 3 times the volume of the TE solution to the gel. After heating for 1 minute to completely dissolve the gel, add an equal volume of TE-saturated phenol (Nippon Gene, Japan), and centrifuge at 1500 rpm for 5 minutes to separate the upper layer. Further, the same separation work was performed using a TE-saturated phenol: chlorophonolem (1: 1) solution, and furthermore, a cologloform. The DNA was recovered from the final solution by ethanol precipitation. The recovered DNA is blunt-ended using the DNAB1 unting Kit from Takara Shuzo, Japan, according to the attached instruction manual, and then T4P01 ynuc 1 eotide from Takara Shuzo, Japan Using Kinase, terminal phosphorylation was performed according to the method described in the company's Guide to Genetic Engineering Products (1991-1995 edition).

The blunt-ended and phosphorylated PCR product is digested beforehand with the restriction enzyme Eco RV (Takara Shuzo, Japan), and the end is Alka 1ine Phosphatasase from Takara Shuzo, Japan. At (CIAP), the terminally dephosphorylated PB 1 uescript according to the method described in the Genetic Engineering Product Guide (1994--1995 version) issued by Takara Shuzo Co., Ltd. Ligation was performed using igation Kit Ver 2 according to the attached instruction manual.

2 / i β of this ligase solution was transfected into E. coli JM109 (Toyobo, Japan), and L-Broth (ampicillin containing 50 / ig Zml) was added. Country, Takara Shuzo Co., Ltd.) Seed on a ground plate, leave at 37 ° C for about 12 hours, randomly select the colonies that appear, and confirm that the cDNA has been incorporated. A primer (the sequences of these primers and the like were prepared by the method described in Reference Example 2 with reference to the instruction manual for pB1euscript from Stratagene, USA) was used. In the PCR method, clones containing inserts and containing a large band of pB1uescript or 11 Obp were confirmed. For the confirmed clone, the nucleotide sequence of the incorporated cDNA was determined using a fluorescent DNA sequencer of Applied Biosystems, Inc. of the United States.

As a result, it was confirmed that a PCR product having a gene fragment having a sequence from No. 13 to No. 204 of the DNA sequence described in SEQ ID NO: 7 in the sequence listing was cloned, A probe of a cDNA fragment encoding a part of the amino acid sequence of the ligand was prepared. The DNA sequence of the DNA probe is shown in SEQ ID NO: 22 in the sequence listing together with the amino acid sequence it encodes. This DNA sequence differs from the DNA sequence from No. 118 to No. 222 in the sequence listing at SEQ ID No. 5 at five positions, which correspond to the DNA sequence derived from the PCR primer. It is thought that it is derived from those artificially produced by PCR.

Example 11 Preparation and Retrieval of 11 C-11 Cell cDNA Library Gland full-length cDNA cloning and analysis

Using the cDNA probe prepared in Example 10, cloning of cDNA encoding the entire length of the ligand amino acid sequence was performed.

First, a cDNA library of C-11 cells was prepared using the PoIyA ⁺ RNA purified in Example 10. c DNA preparation is performed by GIBCO in the United States.

Scrit IIRNase H— was used. Dilute 2 μg of the PoIyA ⁺ RNA purified in Example 10 with 5 mM MTris (pH 7.5) to a final volume force of 6 μβ, After standing at 65 ° C for 5 minutes and then on ice for 5 minutes, the following solution was added. That is, 5 XR reverse Transcriptase attached to Superscript IIRNase H- of GIBCO-BRL in the United States described above (0.25 MT ris — HC 1 (pH 8.3), 0.375 M potassium chloride, 15 mM magnesium chloride) at 5 μH, 0.1 MDTT at 2.5 μβ, 1 OmM dNTP solution (Berlingermannheim, Germany) Prepare 10 OmM dATP, dCTP, dGTP, and dTTP solutions by mixing equal volumes and dilute with distilled water to a final concentration of 10 mM. Prepared solution), 1.5 μβ of RNase inhibitor solution from Promega, USA, and GIBC A solution of 500 g of O—BRL manufactured by Oligo dT (12—18), 2.5 μβ, and 10.5 μβ of sterile distilled water were added. Then, the mixture was allowed to stand at room temperature for 10 minutes, and then added with a β-Script IIRNase H—enzyme solution from GIBCO—BRL, USA, and left at 37 ° C. for 1 hour. Then, 1 μβ of the enzyme solution was further added, and the mixture was left at 45 ° C. for 30 minutes, and then left on ice for 20 minutes. Through the above process, a single-stranded cDNA was prepared.

Next, 1 O x Sec 0 nd -Strand reaction buffer (180 mM Tris — HC1 (pH 8.3), 96 mM calcium chloride, 4 6 mM magnesium chloride), 20 μβ of 0.1 MDTT, 7.5 μβ of the above lOmM d NTP solution, and 34.4 μβ of sterile distilled water. In addition, after standing on ice for 5 minutes, 2 μβ of RNase H (2 units / μ 0,) manufactured by Phanolemasia of Sweden and DNA polymerase (5 μm) of Pharmacia of Sweden were added. O unit / μβ) and 8.Ιμβ were added, and the mixture was left at 16 ° C for 2.5 hours. After that, add 200 μβ of phenol chlorophore (1: 1) solution, mix well, centrifuge at 1500 rpm for 5 minutes, and collect the upper layer. Further, chloroform was added at 200 / iβ, and the mixture was similarly centrifuged to collect the upper layer. Next, add 16.7 μβ of sodium triacetate solution (Ρ5.2) and 43.4 / χβ of ethanol, and leave at -80 ° C for 30 minutes. After that, the mixture was centrifuged at 1500 rpm at 4 ° C for 15 minutes to precipitate double-stranded C-11 cDNA. Then, after washing with 70% ethanol, air-dry and diluted with sterile distilled water to 1Z10 to TE buffer (manufactured by Nippon Gene Co., Ltd., Japan) at 30 μm. Dissolved.

Next, the cDNA was blunt-ended using a DNAB1 unting Kit manufactured by Takara Shuzo Co., Ltd. in Japan according to the attached instruction manual, and finally a 20 μβ TE buffer was used. Dissolved. Using this cDNA, a cDNA cloning system manufactured by Amersham in the UK; Igt10, C-11 cells; Lgtl Oc DNA library according to the attached experimental method. Was prepared. Thai data one finally fabricated c DNA is (attached to the kit) NM 5 1 4 as a host and were determined using rollers, approximately ^{1 X 1 0 8 pfu / μ} gpoly A ⁺ RNA.

The cDNA library prepared by the above method was screened by the black hybridization method in the same manner as described in Reference Example 6. Plaques number of the found line bra rie is 4 X 1 0 to ^five, making the DNA pro one blanking used in disk cleanings is having a DNA sequence set forth in SEQ ID NO: 2: 2 in the sequence listing by PCR and were ³² P labeled with the label-ring method label-ring method described in the same manner as in reference example 6.

As a result of the screening, it was finally separated by 4 clones. The clone names were T2, T3, T5, and Τ6. The phage DNA of each clone was purified according to the method described in the above-mentioned compiling, edited by Maniatis et al. These four types of DNAs are digested with the restriction enzyme Ec0RI, and the insert part of the cDNA of the ligand is cut out from λgt10 by agarol gel electrophoresis, and then agarol gel electrophoresis is performed. When the size was examined at, three bands were confirmed for all clones. Approximately their size of the DDNN AA is TT22 respectively; 3300 000 bbpp, 50 Obp, 180 bp, T3 force; 3 0 bp, 800 bP,

At 400 bp, it was 300 bp, 800 bp, 1500 bp, and it was 300 bp, 800 bp, and 2000 bp. Therefore, these 12 bands were cut out from the agarose gel, purified by the above-mentioned method, digested with the restriction enzyme EcoRI in advance, and digested with pB1uescript, which had been subjected to terminal phosphorylation. Ligation was performed by the method described above, and the gene was introduced into E. coli JM109. After confirming that each gene fragment was subcloned in these clones, the brassmid DNA was purified, and a DNA sequencer manufactured by Applied Biosystems Inc. of the United States and a fluorescent label of the company were used. The gene sequence was determined using a ring kit. In addition, for DNA of the above size of 300 bp or more, each restriction enzyme site is mapped, and the resulting gene fragment is subjected to subcloning by the above method. And Kilo Kiense made by Takara Shuzo in Japan Using a Drilling Mutant kit, a combination of manufacturing a Drilling Mutant in accordance with the attached instruction manual, and transmitting the wire from both directions The sequence was determined.

As a result, based on the revealed gene sequence, a gene fragment of about 300 bP, which was common to the four clones T2, T3, Τ5, and Τ6, was identified in the sequence listing. It was clarified that this was a gene fragment having the 2466 bP gene sequence corresponding to the portion from No. 135 to No. 381 of the DNA sequence of SEQ ID NO: 7. Therefore, just these gene fragments are the size of the restriction enzyme Ec0RI at positions 135 to 140 and 376 to 381 of the DNA sequence of SEQ ID NO: 7 in the sequence listing. It was clear that it had been cut out with a bird. Next, a match was found in the gene sequence in one direction: 500 bp for T2, 800 bp for T3, 800 bp for T5, and 500 bp for T6. In the direction that did not match, the adapter sequence of gt10, a cDNA cloning system manufactured by Amersham in the UK, which was used for library production, was found. Also, in the case of 180 bp of T2, 400 bp of T3, 1500 bp of T5, and 20000 bP of T6, the part corresponding to the gene sequence in one direction is also the same. For the direction that did not match, the sequence of the adapter of gt10, a cDNA cloning system manufactured by Amersham of the United Kingdom used for library production, was also found. Was found. Also, about 400 bp of the largest gene fragment T3 As for the gene fragment, the sequence of Po1yA was found following the adapter sequence.

From these gene sequences, the directions of each gene fragment of the clone are connected to the direction of each gene fragment using the PCR method and the above-described mapping of the phage DNA restriction enzyme sites, and furthermore, those genes. As a result of determining the sequences and comparing them, the cDNA obtained by coding for the ligand is a gene fragment of about 500 to 800 bp of each clone in the 5 'direction. , Then a gene fragment of about 300 bp is located, and the remaining gene fragment of about 1500 to 400 bp is located in the 3 ′ direction. Or it becomes.

Compare the amino acid sequence encoding the cDNA gene sequence arranged as described above with the N-terminal amino acid sequence of the ligand described in SEQ ID NO: 19 in the sequence listing. As a result, it became clear that the amino acid sequence obtained by translating the ligand as a protein was the amino acid sequence described in SEQ ID NO: W No. 7 in the sequence listing. _c the above-described clone T 3 from the a Mi acid sequence of code to the gene sequence of c DNA and its gene sequence a Mi Roh acid co was - de to have portions and the preceding and gene The sequence was similarly set forth in SEQ ID NO: 7 in the sequence listing.

Since the cDNA having the full length of the present gene sequence is the above-described clone T3, the cDNAs should be connected in the same orientation at each restriction enzyme Ec0RI site (about 500 bP). , The plasmid prepared by connecting it to the pB1uescript multi-cloning site is called PBS-LIG-FULL, and another vector, PUC 18 (Pharmacia, Sweden) In the same way, the plasmid created by subcloning was called PUCMEKL. In addition, a plasmid prepared by connecting only a gene fragment (approximately 1000 bp) having the DNA sequence of SEQ ID NO: 7 in the sequence listing to the pB1uescript p BS—LIG—CODE.

Example 12 2 mR of ligand by Northern blotting

Analysis of NA expression

In order to examine the expression of mRNA encoding the ligand of the present invention, human ulti- ple tissue is a final letter to which mRNA is transcribed in advance. Using the Human Mult iple Tissue Northern Blot II and Human Fetal Mult iple Tissue Northern Blot, the DNA sequence of SEQ ID NO: 7 in the sequence listing separated in Example 11 was used. Using a gene fragment of 46 bP, that is, a gene fragment of approximately 300 bP which is cut out with the restriction enzyme EcoRI at the portion encoding the amino acid sequence of the ligand, as described above. The size of the mRNA and the expression organ were examined after ³² P labeling by the method described above.

As a result, the size of the mRNA is approximately 520b, Only one band was identified. As for the expression organs, expression is observed in the heart, brain, placenta, lung, skeletal muscle, kidney, spleen, prostate, testis, ovary, and small intestine of human adult tissues. However, expression was slightly stronger in the kidney. However, no extremely weak or no expression was observed in liver, pancreas, thymus, large intestine, and peripheral blood lymphocytes. In human fetal tissues, expression was observed in the heart, brain, lung, and kidney, but not in the liver.

In addition, when the expression of the rat organs was examined in the same manner using the same probe and using the Rat Multiple Tissue Northern Blot (C 1tech, USA), the size of the mRNA was approximately 50%. The expression was 00b, and expression was observed in the heart, brain, spleen, lung, skeletal muscle, and testis, and particularly strong expression was observed in the lung. However, expression was not observed in liver and kidney.

From these results, it is expected that the clone T3 of the cDNA cloned in Example 11 contains almost the entire mRNA sequence.

Example 13 Preparation of ligand-expressing cells by gene transfer

Using the gene described in SEQ ID NO: 7 in the above sequence listing, a ligand expression vector and a chimera protein expression vector with the ligand were prepared, and the ligand gene was prepared. Was expressed. The morphology and method of expression were raised in 1) to 5). 1) The DNA sequence described in SEQ ID NO: 7 in the sequence listing, that is, the full-length cDNA was transfected into animal cells using an expression vector to form a membrane-bound type containing a signal peptide. And finally expressed on the cell surface as a ligand that does not contain a signal peptide, that is, a form that contains the amino acid sequence of SEQ ID NO: 6 in the sequence listing, and is finally cultured A method for expressing in the supernatant.

2) In order to facilitate the detection of the expressed ligand, before the termination codon of the DNA sequence described in SEQ ID NO: 7 of the sequence listing, that is, one of the DNA sequences of SEQ ID NO: 7 in the sequence listing. A DNA having a gene sequence in which a DNA having the DNA sequence of SEQ ID NO: 13 in the sequence listing was inserted between C of No. 29 and T of No. 130 using an expression vector, A method in which expression is carried out in the same manner as in 1), and expression is carried out so as to have a form having the amino acid sequence of SEQ ID NO: 13 in the sequence listing, ie, the FLAG sequence, at the C-terminal of the intracellular portion.

3) DNA having a gene sequence with a stop codon inserted at the 3 'end of the DNA sequence from No. 31 to No. 69 of the DNA sequence described in SEQ ID NO: 7 in the sequence listing, that is, SEQ ID NO: 7 in the sequence listing Using an expression vector, a gene encoding only the amino acid sequence Nos. 25 to 195 of the amino acid sequence described in It is expressed as a secreted form containing a signal peptide, and finally a form that does not contain a signal peptide. That is, a method of expressing in a culture supernatant as a ligand containing the amino acid sequence described in SEQ ID NO: 5 in the sequence listing.

4) A DNA having the DNA sequence of SEQ ID NO: 13 at the 3 'end of the DNA sequence of No. 31 to No. 69 of the DNA sequence of SEQ ID NO: 7 in the sequence listing, and then a stop codon is inserted No. 13 to SEQ ID NO: 13 at the C-terminus of the amino acid sequence from No. 25 to No. 19 of the amino acid sequence described in SEQ ID NO: 7 in the sequence listing The DNA encoding the amino acid sequence to which the amino acid sequence is bound is expressed using an expression vector in the same manner as in 3), and finally contains no signal peptide. In other words, culturing as a ligand having a form having the amino acid sequence of SEQ ID NO: 13 in the sequence listing at the C-terminus of the amino acid sequence described in SEQ ID NO: 5 in the sequence listing, that is, the FLAG sequence A method of expressing in the supernatant.

5) The human IgG Fc portion prepared by the method shown in Reference Example 8 was added to the 3 'end of the DNA sequence from No. 31 to No. 69 of the DNA sequence described in SEQ ID NO: 7 in the sequence listing. Genome gene to be coded DNA having a linked sequence of DNA, that is, the amino acid sequence of amino acids Nos. 25 to 195 of SEQ ID NO: 7 in the sequence listing Using an expression vector, a DNA encoding the amino acid sequence and a DNA encoding the amino acid sequence of the Fc portion of human IgG Gl at the C-terminus in an intron-containing form were prepared using an expression vector. And expressed in the same manner as in 3), and finally a form that does not contain a signal peptide. That is, it is expressed in a form having the amino acid sequence of the Fc portion of human IgGl at the C-terminus of the amino acid sequence described in SEQ ID NO: 5 in the sequence listing, and finally the IgGF A method in which a disulfide bond formed by a cysteine residue in the Hinge region of part c is expressed in the culture supernatant as a ligand having a dimerized form.

Expression vectors capable of taking the forms 1) to 5) were prepared using the expression vector pMKITNeo shown in Reference Example 8. The details of the fabrication were in accordance with the same method as that shown in Reference Example 8, and fabricated by using the PCR method or the like.

The expression vectors of 1) carapara 5) were prepared, 1) pama p MK Lig FULL FLAG, 2) pMK Lig FULLFLAG, 3) pMK Lig EX, 4) p MKLig EXFLAG, 5) is pMKLig EXIg.

Gene transfer was performed on the COS-7 cells and C-1 cells for pMKLig FULL, and the rest was performed only on the COS-7 cells. The gene transfer method was described in Reference Example 8. The electrophoresis was performed, and other culture conditions were performed under the conditions of COS-7 cells described in Reference Example 8.

1) After the gene transfer, the C-11 cells prepared by the method described in 1) were cultured for 1 day in a condition containing 10% FCS, and then replaced with a serum-free medium, and the culture medium was replaced every 4 days. Three times were taken. The same procedure was used to perform gene transfer using an expression vector that did not contain the ligand gene, and used as a control. The two cultures prepared in this way were concentrated 10-fold by the method described in Example 1 and their binding A using a BIA core according to the method described in Example 2. ctivity was measured on EX lg — PTN conjugated chips. As a result, the binding activity was 98 RU in the control, and the binding activity was 310 RU in the ligand-transfected sample.

Furthermore, when the two culture supernatants were purified by the same method as described in Examples 5 to 7, the ligand was purified. The ligand was purified. The amount of purified ligand was visually confirmed based on the results of silver staining on a polyacrylamide gel electrophoresis gel. About three times that of Was. In addition, when the binding affinity of the purified ligand was measured again using a BIA core, the binding activity was approximately three times higher than that of the control. It was clear that I was working. These results clearly show that the transgenic cell line of SEQ ID NO: 7 in the sequence listing can produce ligands more efficiently.

In a similar experiment, the above-described introduction of the gene, separation of the culture supernatant, and purification of the ligand from the culture supernatant were carried out in COS-7 cells. Samples were prepared by SDS-PAGE, SDS-PAGE was performed, and silver staining was performed to confirm the band. In the control, the band of 415 000 ± 750 dalton was confirmed. However, in the transgenic cells, a band of 410,000 ± 750,000 danoletone was found in the same bale. When the N-terminal amino acid sequence of this purified ligand was determined by the method described in Example 9, it had the amino acid sequence described in SEQ ID NO: 4 in the sequence listing. Was. These results indicate that the ligand can be produced by introducing the gene of SEQ ID NO: 7 into a cell line that does not express or weakly express the ligand. What I can do is clearly better. Next, COS-7 cells transfected with the gene using the expression vector described in 2) were cultured for 4 days in FCS-containing medium, followed by cell disruption by the method described in Reference Example 9. And described in Reference Example 8. Prepare a sample under reducing conditions according to the method, perform Western blotting by SDS-PAGE and antibody staining using an anti-FLAG antibody, and obtain a sequence It was examined whether a ligand containing the amino acid sequence of SEQ ID NO: 6 was expressed on cells. As a result, an extremely wide part with a molecular weight of about 300,000 daltons was stained. However, the control COS-7 cells did not show such a band, indicating that the present ligand has an extremely broad molecular weight when expressed on cells. It has been clarified that it is expressed as a substance.

Next, C-1 cells prepared by the method described in 3) were cultured under the conditions of 10% FCS for 1 day after gene transfer, and replaced with a serum-free medium. Three samples were taken every day. The culture supernatant thus prepared is concentrated 10-fold by the method described in Example 1, and the ligand is purified by the same method as described in Examples 5 to 7. When performed, a ligand of 410,000 ± 750,000 daltons was purified. When the N-terminal amino acid sequence of this purified ligand was determined by the method described in Example 9, it had the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing. Was. From these results, it was found that the ligand was expressed by introducing at least the gene described in 3) into a cell line that does not express or weakly express the ligand. It was clear that it could be produced. Next, the C _ 1 cells prepared by the method described in 4) were cultured under the conditions of 10% FCS for 1 day after the gene transfer, and replaced with a serum-free medium, and the culture supernatant was replaced for 4 days. Three samples were taken at intervals. The culture supernatant thus prepared was concentrated 10-fold by the method described in Example 1. A sample was prepared from this concentrated solution under non-reducing conditions according to the method described in Reference Example 8, and subjected to Western blotting by SDS-PAGE and an antibody staining method using an anti-FLAG antibody. In this way, the ligand containing the polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing having the FLAG sequence at the C-terminus shown in 4) above was contained in the culture supernatant. Was examined. As a result, an extremely wide range of the molecular weight from about 20000 to 500,000 daltons was dyed, and especially strong dyed areas were centered at 420,000 daltons. Part and a part centered at 240,000 daltons. However, since no such band was observed in the culture of COS-7 cells of the control, the strain having a FLAG sequence at the C-terminal shown in 4) above was used. When DNA encoding the amino acid sequence of SEQ ID NO: 5 in the sequence listing is transfected into animal cells, approximately 200,000 to 500,000 daltons of ligand and ligands are introduced. It was clarified that at least the molecular weight contained a ligand with a molecular weight of around 4200 daltons and around 24,000 daltons.

Next, the C-1 cells produced by the method described in 5) were After the introduction of the cells, the cells were cultured under the conditions of 10% FCS for 1 day, then replaced with a serum-free medium, and the culture was collected three times every 4 days. The culture supernatant thus prepared was concentrated 10-fold by the method described in Example 1. The concentrated solution was subjected to Western blotting by SDS-PAGE and an antibody staining method using a peroxidase-labeled anti-human Ig sheep antibody described in Reference Example 8. However, two sample preparation conditions were used for SDS-PAGE: a sample under reducing conditions and a sample under non-reducing conditions. In this manner, the port containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing having the amino acid sequence of the Fc portion of human IgG at the C-terminus shown in 5) above was obtained. It was examined whether the ligand containing the receptor was expressed in the culture supernatant. As a result, under a reducing condition, a band of an extremely wide band having a center of a molecular weight of about 800,000 daltons was stained, and under a non-reducing condition, a band of about 2,000 daltons was obtained. A very wide band was stained. However, since no such band was observed in the culture supernatant of control COS-7 cells, human Ig was added to the C-terminus shown in 5) above. When DNA encoding the amino acid sequence of SEQ ID NO: 5 in the sequence listing having the amino acid sequence of the Fc portion of G is transfected into animal cells, the center of molecular weight is approximately reduced under reducing conditions. The Fc portion of human IgG, the ligand and the fusion product were produced in the culture supernatant at about 800,000 daltons or about 20000 daltons under non-reducing conditions. And the molecular weight and human The structure of the amino acid sequence in the Fc portion of IgG revealed that the fusion had a dimer or higher multimer structure.

From the results shown above, it is possible to improve the production efficiency of the ligand and to produce the ligand in the non-ligand-producing cells by using the methods 1) to 5) above. Furthermore, a compound containing a part or all of a polypeptide having the amino acid sequence of SEQ ID NO: 5 or 6 in the sequence listing can be prepared, and a dimer of the compound can be prepared. It has been shown that a complex having a multimeric structure higher than that can be produced.

Example 14 Purification of Extracellular Ligand Produced by Transgenic Cells

Using the culture supernatant of COS-17 prepared by the methods 4) and 5) described in Example 13 and from the respective cell culture supernatants according to the method described in Reference Example 9, the affinity was determined. The fusion protein with ligand was purified by column.

Regarding the culture step 4), 51 of the culture supernatant was passed through an Anti-FLAGM 2 Affinity Gel column manufactured by Kodak Co., USA, and the ligand was added to the C-terminal FLAG. The column was adsorbed to the column. The size of each column was 1 cm X 3 cm, approximately 2 m1, and the flow rate was 1 ml / min. After adsorption, the column was washed with 2 O ml of PBS (-), and then 0.5 MT ris-glycine (p H 3.0). The eluted fractions were collected in 2 ml portions, and 0.5 MT ris -HC1 (pH 9.5) 200 / i fi was added thereto to neutralize each fraction. Regarding the culture supernatant of 5), 51 of the culture supernatant was passed through a Protein A Sepharose scalar manufactured by Pharmacia, Sweden, to obtain the same strength as above. The size and flow rate were used. In addition, washing and elution were performed in the same manner.

Furthermore, a ligand containing a polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing having a FLAG sequence at the C-terminus purified by the above method, and a human at the C-terminus The ligand containing the polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing having the amino acid sequence of the Fc portion of IgG was purified by gel filtration. . The eluate from the affinity column is concentrated and centrifuged to PBS (-) with Centricon 30 manufactured by Amicon of the United States, and gel filtration is performed by Pharmacia, Sweden. Using FPLC system manufactured by the company, the Superose 12 column was used. Using the BIA core described in Example 2, their eluted fractions were measured for their binding activity with a chip to which EXIg-PTN was bound. Next, the fractions with high binding activity were separately collected from the culture supernatant of 4) and from the culture supernatant of 5), and further concentrated by the above method. Perform SDS-PAGE using the method described in 14 and further stain with silver. Was done. As a result, the portion corresponding to the portion stained as a result of the Western plot obtained in Example 14 was silver-stained. Therefore, a ligand containing a polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing having a FLAG sequence at the C-terminus (hereinafter referred to as Lig FLAG-PTN) and C Ligand containing a polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing having the amino acid sequence of the Fc portion of human IgG at the end (hereinafter referred to as “the amino acid sequence”). Purified material (Lig Ig-PTN) was obtained.

When the N-terminal amino acid sequence of these purified products was determined by the method described in Example 9, both amino acids had the amino acid sequence described in SEQ ID NO: 4 in the sequence listing. Thus, it was shown that LigFLAG-PTN and LigIg-PTN could be purified.

Example 15 Preparation of antibody recognizing 5 ligand and confirmation of protein expression

Oligopeptide consisting of amino acid sequence Nos. 11 to 37 of the amino acid sequence described in SEQ ID NO: 7 in the Sequence Listing can be obtained from Applied Biosystems, U.S.A. in a conventional manner. It is prepared by a mosquito synthesizer and conjugated to the horseshoe crab hemosyanin (KLH) (Sigma, USA) with terminal cystine residues, and immunized to rabbits as an immunogen. After measuring the antibody titer, the whole blood is collected, the blood is collected, and the attached handling is performed using an Econopack serum IgG purification kit manufactured by BioRad Inc. of the United States. According to the instructions, an anti-ligand rabbit polyclonal antibody was purified and produced.

In addition, Lig FLAG-PTN purified by the method described in Example 14 was used as an immunogen, and in the same manner as described above, rabbits were immunized with an anti-ligand rabbit polyclonal antibody. Produced.

In addition, mouse monoclonal antibodies were prepared in accordance with the method described in a written document using LigFLAG-PTN purified by the method described in Example 14 as an immunogen. That is, 1 g of Lig FLAG- PTN purified as described above is applied subcutaneously or intradermally to a Ba1b / c mouse (manufactured by Yomoto SLC, Japan). Immunized. After the second immunization, blood was collected from the fundus and an increase in the antibody titer in the serum was observed. After the third immunization, the spleen cells of the mouse were removed, and the mouse myeloma cell line P 3 X Cell fusion was performed with 63 Ag8 (ATCCTIB 9) by the polyethylene glycol method. Hybridomas are selected in HAT medium (Japan Institute for Immunity and Biological Sciences, Japan), and hybridoma strains producing antibodies that recognize the extracellular part of the ligand in the medium by enzyme-linked immunosorbent assay And a hybridoma-producing strain that produces a mouse monoclonal antibody that specifically recognizes the ligand was established.

The culture of the thus-established hybridomas was carried out using MaabTrap GII manufactured by Pharmacia, Sweden and in accordance with the attached instruction manual. Oral antibodies were purified and prepared.

Using these antibodies, the ligand purified in Example 7 and the cell culture of the transfected COS-7 cells prepared by the methods of 1), 2) and 3) of Example 13 were used. The concentrates of the respective ligands purified by the methods described in Examples 5 to 7 were subjected to Western blotting under the conditions described in Reference Example 8. However, as for the polyclonal antibody produced by Persian, an anti-Persian Ig sheep antibody manufactured by Amersham, UK was used as the secondary antibody. As a result, it was possible to stain all bands at a broad portion near 420 000 daltons, and it was clarified that all of these antibodies could specifically recognize ligands. . Similarly, Lig FLAG-PTN and Lig Ig-PTN prepared by the method described in 4) and 5) of Example 13 and prepared by the method described in Example 14 A dot blot was performed using a PVDF membrane manufactured by ioRad according to the attached instruction manual. That is, 5 / xβ of the solution of Lig FLAG-PTN and LigIg-PTN was dropped on PVDF manufactured by BioRad in the United States, air-dried, and then subjected to the Western blotting method described in Example 8. Antibody staining was performed in the same manner as in the above conditions. As a result, it was evident that both were not stained with the control antibody, but were stained with all the purified antibodies.

Furthermore, the gene was transfected with the C-1 cells and the method of Example 13-1), particularly for the above monoclonal antibody, and 4 days later. For COS-7 cells, the expression of ligand on the cell surface was analyzed using a flow site meter EPICS Elite manufactured by Coulter, USA in the same manner as described in Reference Example 10. Staining with the antibody was performed according to the method described in the written literature. The purified monoclonal antibody described above was used as a primary antibody, and a goat anti-mouse Ig FITC label manufactured by Vector Dockton Sons, Inc. of the United States was used as a secondary antibody. As a result, it was confirmed that all of the C-11 cells and about 20% of the transfected COS-7 cells were stained with the above-mentioned monoclonal antibody.

From the above results, the antibody shown in this example was expressed under the conditions of the ligand purified in Example 7, the ligand present on C-1 cells, and the conditions of Example 13 respectively. It was confirmed that the recognized ligand was recognized specifically.

Example 16 Phosphorylation of Tyrosine Residue by Ligand

Ligand purified in Example 7 and LigFLAG-PTN and LigIg-PTN obtained in Example 14 are reference examples.

The following experiments were performed to determine whether the autologous phosphorylation of receptor pig type 1 tyrosine kinase expressed on the cell membrane surface of the transformed cell Ba / F3 / FULLFLAG described in 8 was performed. Was done.

Change to fresh medium the day before phosphorylation and use 5X cells

On the day of the experiment, 5 × 10 ⁶ cells were picked from Ba ZF 3 FULLFLAG that had been adjusted to 10 ⁵ ce 11 s Zml, and the following eight Suspended in liquid 5 0 0 / chi beta, 2 0 minutes, and reacted at at 3 7 ° O O 0 ₂ in Lee down Kyubeta scratch. Reaction solution 1: Medium (RPMI 1640, 10% FCS, 100 / ig / ml mouse IL-13) only;

Reaction mixture 2: suspension of 5 × 10 ⁶ C-1 cells suspended in the medium of reaction mixture 1;

Reaction solution 3: Medium of reaction solution 1 containing the ligand purified in Example 7 at a concentration of 500 μg / m 1;

Reaction solution 4: Medium of reaction solution 1 containing the ligand purified in Example 7 at a concentration of 100 g / m 1;

Reaction solution 5: Medium of reaction solution 1 containing LigFLAG-PTN at a concentration of gZml;

Reaction Solution 6: Medium of Reaction Solution 1 containing Lig FLAG— {Ρ} at a concentration of 100 g / ml;

Reaction solution 7: Medium of reaction solution 1 containing Lig Ig-PTN at a concentration of 500 g / m];

Reaction solution 8: Liglg — Medium of reaction solution 1 containing PTN at lOOg / ml

After the reaction, immediately place the cells on ice, add 1 ml of PBS (-) containing 2 mM Na ₃ VO, previously cooled, centrifuge at 4 ° After dropping and performing the same operation once more, a cell disruption solution was obtained by the method described in Reference Example 10. Add 30 β of Anti-FLAGM 2 Affinity Gel (Kodak, USA) to this cell disruption solution, and rotate at 4 ° C while rotating slowly to prevent sinking. After the reaction, the gel was allowed to adsorb the polypeptide containing the amino acid sequence of SEQ ID NO: 3 having the FLAG amino acid sequence on the gel. After the reaction, centrifugation was performed for 3 minutes at 4 ° C and 500 rpm to precipitate the gel, and the supernatant was removed so as not to absorb the gel. Sysbuffer was added and suspended in 200 μβ. Further, the same centrifugation operation and suspension operation were performed three times to obtain a gel precipitate. In a similar manner, a control experiment was performed not only for Ba / F3 / FULLFLAG but also for BaZF3ZCON to obtain a similar gel precipitate.

The gel precipitate was subjected to a Westcut by the method described in Reference Example 8. The SDS-PAGE was carried out by adding a SDS-PAGE sample buffer of 30 β of the gel precipitate, running a boiling water bath for 5 minutes in the presence of 2—ME, and flowing 15 μβ into one lane. Two sets of PVDF membranes to which the same sample was transcribed were prepared, and one set was obtained from a polypeptide having the amino acid sequence of SEQ ID NO: 3 in the sequence listing having the target FLAG sequence. And the other was used to determine if the tyrosine residue was phosphorylated.

As a result, phosphorylation was confirmed in reaction solutions 2, 3, 5, 7, 7 and 8, and the extent of phosphorylation was in reaction solutions 2, 7, and 8 was strong, and reaction solutions 3 and 5 were weaker, and were visually less than about half. Therefore, the ligand purified in Example 8 as well as the co-culture with C-1 cells, the ig FLAG-PTN and LigIg-PTN obtained in Example 14 were It has been shown that it activates the synthase activity of the synkinase, causing phosphorylation of its own tyrosine residue. However, no phosphorylation of such tyrosine residues was observed in the medium alone. However, the ligand purified in Example 8 and the Lig FLAG-PTN obtained in Example 14 did not cause phosphorylation under the diluted conditions, that is, the conditions of Reaction Solutions 4 and 6. . On the other hand, LigIg-PTN had sufficient phosphorylation activity even under the condition diluted to the same concentration, and had stronger activity than the former two.

Further, in order to analyze this point in detail, the reaction solution 9 (compared to the reaction solution 5 with Monodox manufactured by Kodak Corporation in the United States) was used for the Lig FLAG-PTN obtained in Example 14. Reaction solution 10 (reaction solution with the addition of the lonal antibody Anti-FLAGM 2 so as to obtain 100 g Zml). Antibody Anti-FLAGM2 was added to the reaction solution to give a concentration of 100 g / ml), and the reaction was performed using reaction solution 11 (reaction solution 1 in the United States). Reaction mixture containing Monoclonal Antibody Anti-FLAGM 2 manufactured by Duck Co., Ltd. to make 100 g Zml) Experiment was performed.

As a result, the reaction solutions 9 and 10 were sufficiently phosphorylated and had the same level of phosphorylation activity as the reaction solutions 2, 7, and 8. No phosphorus oxidation was observed in the reaction solution 11 of the control.

Therefore, it was revealed that the ligand purified by the method of Example 8 had an activity of phosphorylating a polypeptide containing the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing. Mosquito The same was true for LigFLAG-PTN and LigIg-PTN obtained in Example 14. Among them, the form having the highest activity is the form of LigIg-PTN, and the LigFLAG-PTN is also administered with an anti-FLAG antibody that recognizes the C-terminal part. Since these compounds exhibit similar strong activities, the form having a dimer or multimer structure is the form of a ligand having a stronger activity. What I wanted was clear.

Therefore, these compounds are compounds that can act on cells expressing the type I tyrosine kinase of the receptor to promote the phosphorylation of tyrosine residues and transmit a signal for proliferation. Was shown.

Example 17 Bioactivity of 7-ligand

Using the ligand purified in Example 7 and Lig FLAG-PTN and Lig Ig-PTN obtained in Example 14 The physiological activity was confirmed.

An equal amount of PBS (-) is added to the cord blood to which heparin has been added, and the mononuclear cells in the cord blood are centrifuged using Fikonorenock (Fanore Macia, Sweden). Well separated.

The cells separated in this manner are further washed twice by centrifugation in PBS (-) twice, and finally the cell density is 5 × 10 ⁶ ce 11 s / m 1 in IMDM medium. This was suspended to prepare a cord blood mononuclear cell suspension.

The reagents required for Koguchi Nee Assy were previously prepared as follows. A 3% methylcellulose solution was prepared by dissolving methylcellulose (Wako Pure Chemical Industries, Japan) with stirring in boiling water, cooling to about body temperature, and preparing a double-concentration I prepared in advance. An equal amount of MDM medium was added and left at 4 ° C for about 5 days to prepare. The 10% BSA solution was prepared by adding Sigma BSA in distilled water to distilled water and leaving it at 4 ° C for 2 days with gentle stirring. It was prepared by framing with a πι's Membrane Final Letter (Millipore, USA). Immediately before use, a 7.5% sodium bicarbonate solution (manufactured by GIBCO-BRL, USA) was added to this solution at a concentration of 20 μm β 2 in 5 ml of a 10% BSA solution. The condition medium (5663C C) is 10% from the human cell line 56637 manufactured by Coning, Inc. of the United States. ? 5 containing 1 ~ ^ 1 1 16 40 medium in 50 ml for 5 days. It was prepared by filtration through a 22 μπι membrane finoletter (Millipore, USA).

30 μβ of the cord blood mononuclear cell suspension prepared for colony tssii as described above, 300 μβ of the 10% BSA solution, and 1 μm of the 10 mM 2-menolecaptoethanol solution 5 β, 400 U / ml of a solution of human erythropoietin (manufactured by Chugai Pharmaceutical Co., Ltd., Japan) was used as a reaction solution 1 (IMMD M medium). ), Reaction solution 2 (600 μH of 5637 CM), reaction solution 3 (900 μg of the ligand purified in Example 7), reaction solution 4 (Example 14 And the reaction solution 5 (Liglg—PTN obtained in Example 14 is 300 / ig), respectively, of the Lig FLAG-PTN obtained in the above, and the final volume. IMDM medium was added so that the volume became 1.8 ml.

To these three, add 1.2 ml of the 3% methylcellulose solution prepared as described above, stir well, stir evenly, and allow the syringe to come out after bubbles have escaped. And spread the lml evenly over a 35-inch dish made by Falcon, USA.

3 7 ° C 0 ₂ Lee Nkyube data one C in cultured for 2 weeks.

After culturing for 2 weeks, the number of colonies in one dish was measured with an inverted microscope (Olympus, Japan). As a result, the formation of colonies was extremely small (1 and 0 pieces) in IMDM of reaction solution 1 alone, and the formation of colonies was large in 5637 CM of reaction solution 2 (56 pieces). And 4 8) In the dish containing Gand, the formation of colonies with an intermediate value (28 and 31) was observed.

In addition, from experiments using different cord blood samples, the formation of colonies was extremely small (1 and 0) in the reaction solution 1 IMDM alone, and the colony formation was low in the reaction solution 2 563 CM. The formation of a mixture containing the ligand of reaction mixture 3 was intermediate (10 and 15), and the formation of a mixture containing the ligand of reaction mixture 3 was significant (35 and 28). For FLAG-PTN-containing dishes, it is almost the same as 3 (12 and 14 pieces), and in reaction mixture 5 LigIg-PTN-containing dishes, it is slightly more (20 and 2 pieces). (2) colonies were observed.

In another experiment, in a different sample of cord blood, colony formation of human interleukin 3 (IL-3), which is known to promote colony formation, has been reported. Under the conditions to which human GM-CSF (Intagen, USA) and human SCF (Intagen, USA) were added, it was investigated whether further formation of colonies could be promoted. Was. That is, in addition to the above reaction solution 1, reaction solution 3, and reaction solution 4, reaction solution 5 (final concentration: IL-13 force; I ng, GM-CSF force 20 ng, SCF force 200 ηg ), Reaction solution 6 (500 g of the ligand purified in Example 7 under the conditions of reaction solution 5), and reaction solution 7 (Lig I obtained in Example 14 under the conditions of reaction solution 5). g—PTN was set to 100 μg), and a similar mouth assay was performed in each reaction solution. As a result, reaction solution 1 was 0 and 0, reaction solution 3 was 7 and 10, reaction solution 4 was 15 and 12, reaction solution 5 was 55 and 68, and reaction solution was 5 and 68. The number 6 was 63 and 75, and the number of reaction solutions 7 was 80 and 89. In addition, as a result of observation under a microscope, the colony of the reaction solution 7 was about 20 to 50% larger than that of the other reaction solutions, as judged visually.

These results indicate that the ligand promotes the proliferation of undifferentiated blood cells, has a colony-forming effect, and is more active in a structure having a dimer or a multimer. And were found.

Example 18 Cell Proliferation by Liquid Culture

The following experiment was performed to examine the effect of the ligand on the growth of blood cells in a liquid medium.

As the cells used for the proliferation assay, cord blood mononuclear cells expressing the receptor type 1 tyrosine kinase used in the present application were used. For detection and separation of the tyrosine kinase-expressing cells, the cells were stained with the 38 antibody described in Reference Example 10, and a FACSV antage (Vectin Deckinson, USA) was used. The cells were analyzed and separated according to the instruction manual attached. As a result, receptor type 1 tyrosine kinase was expressed in about a few percent of bone marrow mononuclear cells, and these cells were weakly positive for CD34, a marker for hematopoietic stem cells. , C — Kit positive cells. Similarly, it was evident that about 0.05% of the cells in cord blood mononuclear cells were also expressed. In addition, bone marrow and cord blood mononuclear cells were treated with 100 ng / m 1 stem self-actor (International, Inc., USA) to obtain 10% fetal bovine serum (ICN Japan, Japan). Lee scan co full modification da behenate Tsu co medium containing (US, GIBCO-BRL Inc.) at ^{1 X 1 0 7 ce 1 1} s / 1 5 ml in the culture is performed when re ceptor first die tyrosinate Nkinaze expressing cells And the proportion of the tyrosin kinase-expressing cells is increased by about 10 times or more in the culture for about one week as compared to before the culture. After one week of culture under the above conditions, to separate cells expressing the tyrosine kinase at FACSV antae _e Was. Similarly, the cells expressing the tyrosine kinase before culturing were isolated in the same manner.

In order to examine the cells thus isolated in detail, a specimen was prepared with Cytospin 3 (Shandon, UK), stained with Meigwald-Giemsa, and examined under a microscope. The cells were examined at. When the cells were identified with reference to the blood cell atlas (Bunkodo, Japan), it was revealed that the ostium-synkinase-expressing cells were undifferentiated blood cells.

Thus, the separated cells were cultured in the presence or absence of the ligand, and the increase in the number of cells was examined. The culture conditions were as follows: 1 ng / m 1 of Interlokin 3 (Intagen, USA) and 2 Unit / ml of erythropoietin (Japan) And Chugai Pharmaceutical Co., Ltd.). In the ligand presence area, 500 ng / m 1 of Lig Ig — PTN and 5 g of anti-human Ig GF c goat antibody prepared by the above method were added. μg / m 1 (Organontech Nikisha, USA) was added, and the same amount of IgG from human blood (OrganontechNikisha, U.S.A.) was used in the control area instead of the ligand. added. Culture was performed under these conditions for 5 days. The number of cells was performed in ^{2. 4 X 1 0 A ce} 1 1 s / of 6 m 1 condition.

As a result, the number of cells increased to about 1.76 × 10 ⁵ ce 11 s / 6 m 1 approximately 5-fold in the ligand presence section, and increased to 7.0 in the comparison section.

X 10 ′ eel 1 s Z 6 ml, stayed in half of the ligand existing area. Also, to examine cells in detail, When the cells were stained, the previous trait was retained. From these results, it was found that the ligand of the present application has an effect of growing blood undifferentiated cells.

Example 1 Comparison with 9 L E R K-2

The new receptor pig type 1 tyrosine kinase ligand has a 54% homologue with LERK-2, a known molecule, and is supposed to have the same effect as the ligand. The effect on the receptor was compared.

The LERK-2 gene was obtained as follows. That is, based on the gene sequence described in the paper of Beckmann et al. (EMBO J, 13, 3757-3762, 1994) or in the specification of W094Z113384, the sequence in the sequence listing is used. No. 23 (corresponding to the sequence of the sense strand 20 bases from the gene sequence 29 bases upstream from the first methionine encoding amino acid of LERK-2) and SEQ ID Nos. 24 ( LERK—corresponds to the sequence of the 23-base antisense strand from the gene sequence upstream of the 23 base upstream of the termination codon to the termination codon of the amino acid sequence coding portion of LERK-2) Using the oligonucleotide having the gene sequence of SEQ ID NO: 1 as a primer, and using human placenta cDNA (Ciontech, USA) as a template, the PCR method described above was used to generate the gene. Lone link.

The LERK-2 gene isolated in this manner was purified using a method completely similar to that described in Examples 13 and 8. A LERK-2 recombinant protein expression vector was constructed in the same manner as the ligand, produced by gene transfer, and further purified from the cell culture supernatant by the method described in Reference Example 9. And purified. These expression vectors are the extracellular portion of LERK-2, that is, the portion up to the amino acid at position 237 of the amino acid sequence of LERK-2 described in Beekmann et al., Supra. Two vectors that express a molecule in which the amino acid sequence of the Fc portion of human IgG is linked to the amino acid sequence of human IgG or a molecule in which the FLAG sequence is linked to the amino acid sequence of human IgG. The molecules are LERK-2Ig-PTN and LERK-2FLAG-PTN.

First, the binding ability of the ligand and LERK-2 to receptor type 1 tyrosine kinase was examined by BIAcore. To the sensor chip to which EXI g was bound by the method described in Example 2, extracellular portions of the ligand, that is, LigIg—PTN and LigFLAG—PTN, —2 extracellular partial proteins, ie, LERK-2Ig—PTN and LERK-2FLAG—PTN, were flowed at a step of 1 to 100 ig / ml and measured. Bovine blood albumin (BSA) (Sigma, USA) was used as a control.

The result is shown in FIG. The results were measured at a Lig FLAG-PTN force of 5 μg / m 1, LERK-2 FLAG-PTN force of 50 μg / ml, and BSA at a concentration of 100 μg Zml. The result. As is evident from this graph, LERK-2 shows weak binding to the receptor tyrosine kinase even at a high concentration of kana, while the ligand is extremely small. It became clear that the bond was strong. In addition, measurement was performed using different concentrations and IgG chimera proteins, and the respective binding constants were determined based on the data. The calculation method was calculated in accordance with the computer software BIA eva 1 ation 2.1 attached to BIA c0 re and the harmful explanation of its handling. As a result, K d values of該Ri cancer de is 1. LERK- 2 is ^{2 3 X 1 0- 9 M 1} . 3 5 X 1 0- 7 M der Li, the Li cancer de The LERK- 2 The ability to bind approximately 100 times as much as possible was clearly demonstrated.

Next, the phosphorylation activity of the tyrosine kinase was examined using the methods of Example 16 and Reference Example 8. The results are shown in FIG. In each lane sample, 1 was a control, 2 lig Ig — PTN, 100 ng / m 1 and 100 μg / ml of anti-human Ig GF c goat antibody manufactured by Organon Techniki, USA 1 μg Zml, 3 μg ig_PTN, 1 μg / m1 with anti-human Ig GFc goat antibody manufactured by Organon Techni Riki, USA 1 O jug / m 1, 4 LERK — 2 Ig — PTN, 1 OO ng / ml, 1 μg / m 1, 5 of anti-human Ig gc goat antibody manufactured by Organontech Niki, USA is LERK-2 I g — PTN, 1 μg / m \ against anti-human Ig GF c 1 4 1

The antibody was added to each of I 0 jug / ml and reacted with the reaction solution described in Example 16 to carry out the reaction. A in Fig. 10 is stained with antiphosphorylated tyrosine monoclonal antibody (UBI, USA), and B is stained with anti-FLA GM2 monoclonal antibody (Kodak, USA). The film was printed on the X-ray film under the conditions of Example 8. In addition, the tyrosin kinase that has been blotted from the molecular weight is indicated by an arrow.

The results clearly show that LERK-2 in lanes 4 and 5 causes the phosphorylation of the lip synthase, albeit very weakly, which is associated with the ligands in lanes 2 and 3. The effect is not high even under conditions of high sea level, that is, at 1 μg / m 1 in lane 5, so it is not a matter of quantity, but the effect itself is extremely weak. Is clear.

Therefore, it was concluded from the above results that LERK-2 does not have the physicochemical properties possessed by the resebuta-type tyrosine kinase ligand of the present application, and thus does not have the physiological action as shown in the present application.

table

C

IN Ormffl Λα-ti

1 丄 Γ Λ¾ / Βi ^ n *-4 τftΒΟ 1 '1 u ΑΤΓ CHTRQ)

o SEKI HINO ^v 11 / V Epidemiological Research Institute -b

UT-7 r s bou 1 1 UDU + 10¾FrS + GU-rS F ffB

OT

HP-1 h * &. Disease DPU I + 10 RfS ΑΤΓΓ ίΤΙ R202

c

O Dau d i k ρ · ヤ Yano k Γ S I) z z, 4 ISS H 1 / ATpr (CC \? 1 * Π

Les

(Juikal € i M 13 :: SO II W1¾r ： i1 = 11111 ^? ^ G tsui 1 ku τνί

o

o CCRF-CEU Γ 1 Reno, ti plate K 1 lUTtf し Λ1 and ρ (r and e

k Sfr M lb D

y r W i 1dϊ: W ιϊ: H plate K p ru 1 U t *;;)

1 ui -en τ ftfr 1 / ffifi D

U K Γ-l nU¾ ρrρς Λ A

丄丄 Π C P D Γ AT ¾B η ΑΤ iΓΓ CHiiRuXoOuRu 4s) 丄 L hh A. ΤΠ U— Q ill ΑΤΓΓ f HTR 1 ni)

1 o I1RC-5 k TP ¾f ftfc UFU + 10% FCS ATCC (CCl 171)

Λ A Raj i Human Kit Kit Rinno flS RPUI +10 FCS ATCC (CCL86)

1 x U937 Human bone fl £ leukemia RPU1 + 10% FCS ATCC (CRL1593)

X u MKN-74 Human II (RPC) RPUI + 10XFCS Institute for Immunobiology

1 1 KN-28 G Stomach cancer (well differentiated tubular) RPU1 + 10% FCS

R o UKN-1 Human evening ^ (Pseudosquamous pain) Rpui-o% FCS

Ί Q A431

(ICRI 1555)

c

Υ ci Γ iFp W TO D pu I-n¾pf

L 丄 HeLa k air K sea bass ^T i U ^ Γ 1 n 1

2 2 HeLa-OHIO Human gffi part ft KrM 1 + 1U to tS Large H

2 3 COLO-205 Human colorectal cancer (Adelushi / -ma) RPMI + 10 FCS ATCC (CCL222)

2 4 H-1 Human Bile Duct «RPyi + 10% FCS Immune Biological Laboratory

2 5 BT-20 Human milk ft Pyi + 10% FCS ATCC (HTB19)

26 PC-14 Human lung cancer RPIII + 10XFCS RIKEN (RCB0446)

2 7 PC-9 Human lung cancer (differentiated adenocarcinoma) RPMI + 10% FCS

2 8 KB Human nasopharyngeal carcinoma RPU1 + 10% FCS ATCC (CCLH)

2 9 T-24 Human bladder cancer RPMI + 10 FCS ATCC (HTB4)

Table 2

Ligand binding activity (RU

Cell name Stimulus Exlg-PTN EXFLAG-PTN

5637 96 45 57

PMA 117 x43 SEKI 196 112 xll8

PMA 153 xl28 UT-7 67 xl33

PMA 67 xl30 567 97 xl38

PMA 161 100 xl38 THP-1 143 132 x63

PMA 142 x65 Daudi 64 x65

PMA 110 x56 Jurkat 108 xll3

PMA 93 xl88 CCRF-CEM 151 86 xlll

PMA 107 xlll KG-la 90 xll3

PMA 83 33 x94 HL-60 25 x89

PMA 32 x80 Hep3B 63 x59

PMA 48 x 48 KATOm 158 116 x 52

PMA 167 x55 MRC-5 26 x77

PMA 45 x59 TNF 62 x49 aji 32 x67

PMA 20 x94 U937 124 73 xl36

PMA 135 xl68 MKN-74 12 xl02

PMA 37 x83 TNF 90 x97

MKN-28 36 x64

PMA 80 x69 TNF 83 x73

(Govern) Table 2

Ligand binding activity (RU)

No. Cell name Exfoliation Exlg-PTN EXFLAG-PT Box magnification

18 M -1 '61 x9l

PMA 80 xlOO TNF 63 xl03

19 A431 44 x50

PMA 74 x54 TNF 139 86 x65

20 C-1 160 60 x65

PMA 385 154 x89 TNF 227 87 x78

21 Hcla 94 x83

PMA 77 x81 TNF 117 x81

22 Hela-OHIO 81 xl24

PMA 100 xl43 23 COLO-205 180 75 x58

PMA 160 92 x60 TNF 192 x81

24 H-l 163 77 x92

PMA 194 111 x94 TNF 146 77 S 100

25 BT-20 x78

PMA 15 x91 TNF 13 x83

26 PC- 14 86 x79

PMA 72 x70 TNF 89 x72

27 PC-9 35 x83

PMA 41 xlOO TNF 61 x91

28 KB 94 x73

PMA 225 328 x84

29 T24 76 x75

PMA 33 x89 TNF 88 x61 4 5

Table 3

Samble ligand binding activity (RU) Fraction before purification 134 Fraction through column 30

Wash fraction 4 Elution surface (1/5 dilution)

fraction No.

1 -8

2 -8

3 25

4 258

5 230

6 42

7 9

8 2

Industrial applicability

Specific receptor involved in differentiation and proliferation of undifferentiated blood cells Specific receptor type 1 binds to the extracellular portion of tyrosine kinase, activates the tyrosine kinase enzyme activity of the intracellular portion, and activates the tyrosine kinase. Since the ligand of the present invention that causes oxidation and the complex containing the ligand have an action of promoting the differentiation and proliferation of undifferentiated blood cells, they can enhance blood-producing stem cells such as leukemia and bone marrow transplantation. It can be used for research and treatment of problems related to undifferentiated blood cells.

Sequence listing

SEQ ID NO: 1

Array length: 5 2 2

Sequence type: amino acid

Topology: linear

Sequence type: Protein

Origin

Organism name: human

Array

Leu Glu Glu Th 【Leu Leu Asn Th r Lys Leu Glu Thr Ala As p Leu Lys

1 5 10 15

Trp Ya 1 Thi Phe Pro Gin Va 1 Asp Gly GID Tip Glu Glu Leu Ser G

20 25 30

Leu Asp Glu Glu Gin His Ser Va 1 Arg Thr Tyr Glu Va 1 Cys Asp Va 1

35 40 45

Gin Arg Ala Pro Gly Gin Ala His Trp Leu Arg Thr Gly Ttp Val Pro

50 55 60

Arg Arg G only Ala Val His Val Tyr Ala Thr Leu Arg Phe Thr Met Leu 65 70 75 80

Glu Cys Leu Ser Leu Pro Arg Ala Gl Arg Sei Cys Lys Glu Thr Phe

85 90 95

Th r Val Pbe Tyr Tyr Glu Ser Asp Ala Asp Thr Ala Thr Ala Leu Thr

100 105 110

Pro Ala Trp Met Glu Asn Pro Tyr lye Lys Val Asp Thr Val Ala Ala

115 120 125

Glu His Leu Tht Arg Lys Arg Pro Gly Ala Glu Ala Thr Gly Lys Va 1

130 135 NO

Asn Va I Lys Thr Leu Arg Leu CI y Pro Leu Ser Lys Ala Gly Phe Ty r 145 150 155 160 Leu Ala Phe Gin Asp Gin Gly y Ala Cys Met Ala Leu Leu Ser r Leu His

165 170 175

Leu Phe T "Lys Lys Cys Ala Glo Leu Thr Va 1 Asn Leu Thr Arg Phe

180 185 190

Pro Glu Thr Va 1 Pro Aig Glu Leu Va 1 Va 1 Pro Va 1 Ala G only Ser Cys

195 200 205

Va 1 Va I Asp Ala Va 1 Pro Ala Pro Gly P [o Ser Pro Ser Leu Ty [Cys

210 215 220

Arg Glu Asp Gly Gin Trp Ala Glu Gin Pro Va 1 Thr Gly Cys Ser Cys 225 230 235 240

Ala Pro Gly Phe Glu Ala Ala Glu Gly Asn Thr Lys Cys Arg Ala Cys

245 250 255

Ala Glo Gly Thr Phe Lys Pro Leu Ser Gly Glu Gly Ser Cys Gin Pro

260 265 270

Cys Pro Ala Aso Ser His Ser Asn Thr lie Gl Ser Ala Va 1 Cys Gin

275 280 285

Cys Arg Va 1 Gl Tyr Phe Arg Ala Arg Thr Asp Pro Arg Gl Ala Pro

290 295 300

Cys Tb [Th [Pro Pro Ser Ala Pro Arg Sei Va 1 Va 1 Ser Arg Leu Asn 305 310 315 320

Gly Ser Ser Leu His Leu Glu Tip Ser Ala Pro Leu Glu Ser Gly Gly

325 330 335

Arg Glu Asp Leu Thr Tyr Ala Leu Arg Cys Ar Glu Cys Ar Pro Gly

340 345 350

Gl Ser Cys Ala Pro Cys Gly Gl Asp Leu Thr Phe Asp Pro Gly Pro

355 360 365

Ai g Asp Leu Va 1 Glu Pro Trp Va 1 Va 1 Va I Arg Gly Leu Arg Pro Asp

370 375 380

Phe Thr Tyr Thr Phe Glu Va 1 Thr Ala Leu Asn Gl Va I Ser Ser Leu 385 390 395 400

Ala Thr Gly Pro Va I Pro Phe Gl u Pro Va 1 Asn Va 1 Th r Tbr Asp Ar g

405 410 415

Gl u Va 1 Pro Pro Ala Va I Ser Asp I 1 e Arg Va 1 Tbr Ar g Ser Ser Pro

420 425 430

Ser S e r Leu Ser u Ala T r p Ala Va 1 Pro Arg A I a Pro Ser Gly Ala

435 440 445

Va 1 Leu Asp Tyr Gl u Va 1 Lys Tyr His Gl u Lys Gly Ala Gl u Gl Pro

450 455 460

Ser Ser Va 1 Arg Phe Leu Lys Thr Ser Glu Asn Arg Ala Glu Leu Arg 465 470 475 480

Gl Leu Lys Arg Gly Ala Ser Tyr Leu Va 1 Gin Va 1 Arg Ala Arg Ser

485 490 495

Glu Ala Gly Tyr Gl Pro Phe Gly Gin Glu His His Ser Gin Thi Gin

500 505 510

Leu Asp Glu Ser Glu Gly Tr p Arg Glu Gin

515 520 SEQ ID NO: 2

Array length: 9 7 2

Sequence type: amino acid

Number of chains: single strand

Topology: linear

Sequence type: amino acid

Origin

Organism name: human

Array

Leu Glu Glu Thr Leu Leu Asn Tb i Lys Leu Glu Thr A 1 a Asp Leu Lys Tr p Va 1 Thr Phe Pro Gin Va 1 Asp Gly y Gin Trp Glu Glu Leu Ser Gly

20 25 30

Leu Asp Glu Glu Gin His Ser Va 1 Arg Thr Tyr Glu Va 1 Cys Asp Va I

35 40 45

Gin Arg Ala Pro G Gin Ala His Trp Leu Arg Thr Gl Trp Va 1 Pro

50 55 60

Arg Arg Gly Ala Va 1 His Ya 1 T t Ala Thr Leu Arg Phe Thr Met Leu 65 70 75 80

Glu Cys Leu Ser Leu Pro Arg Ala Gly Arg Ser Cys Lys Glu Thr Phe

85 90 95

Thr Va I Phe Tyr Tyr Glu Ser Asp Ala Asp Thr Ala Thr Ala Leu Thr

100 105 110

Pro Ala Trp Met Glu Asn Pro Tyr lie Lys Va 1 Asp Thr Va 1 Ala Ala

115 120 125

Glu His Leu Th 【A 【g Lys Arg Pro Gl Ala Glu Ala Thr G Lys Va 1

130 135 140

Asn Va 1 Lys Th r Leu Arg Leu Gly Pro Leu Ser Lys Ala Gly Phe Tyr 145 150 155 160

Leu Ala Phe Gin Asp Gin Gly Ala Cys Met Ala Leu Leu Ser Leu His

165 170 175

Leu Phe Tyr L Lys Cys Ala Gin Leu Thr Va 1 Asn Leu Thr Arg Pbe

180 185 190

Pro Glu Thr Va 1 Pro Arg Glu Leu Va I Va 1 Pro Va 1 Ala Gly Ser Cys

195 200 205

Va I Va 1 Asp Ala Va 1 Pro Ala Pro Gly Pro Ser Pro Ser Leu Tyr Cys

210 215 220

Arg Glu Asp Gl Gin Trp Ala Glu Gin Pro Va 1 Thr Gly Cys Ser Cys 225 230 235 240

Ala Pro CI y Phe Glu Ala Ala Glu Gly Asn Thr Lys Cys Arg Ala Cys 08C S 0 S9 ^

Ϊ JV nai ti | 3 e | V "∑V n | o J» s ¹ U s ^ l aqj 3】 VI ' ^a S' »S

09 ^ S5i- OS ^ oi JX 10 "10 MV ^ 10 n | o S! H 丄 s ^ l 1" 19] 丄 "V i> ⁸ 1 I

9t Ot S fr

e IV <I0 ^{I 3} S 0 B IV 3] V o] d Λ Π V d B IV ^{Π ί} Ί] ^a S ⁿ ] ^a S '^ S

QZi S 0

oii ias I3S 3 JV J m I 3 JV »1 I d sy s $ 1 B I V <> U. I "10

S KE 0 0 ^

3】 V dsy J qi i qi 1 ΒΛ "SV 1 ⁰¹ i" 10 »] d 1 ^Β Λ <>] d ^ 10" 11 MV

OOi S6E 06C S8G

Π3ΐ ias 13S I n ^ 10 nsy nai t iv iqi I »10 3Rd iRl

dsy o] <i 3 JV I> »1 I 0 Ϊ 'V Λ I ΒΛ [丄 OIJ nig [EA ^{a 3} l dsy 2iV

9ε 09e S e

oii lO 0 J dd sv sq j jq 丄 na dsy X [0 O 3 ^{0 J} d V s ^ D 5 | Q

OSS 0

10 ^{0 i} i 8 JV son [o 3] v ") 2 e iv J 丄 J q 丄 nai dsy" 10 2] V sec οεε 92

O ^ 13) 3S n 10 na 0 J je 1 y J «S 丄 n | Q nsq S! H naq iss J as ^ 10

^{asv nai v J 3 SI! 2} JV B IV J 3 S o'd 0 J j ] q丄^J卩丄

OOC S6Z 06Z

<d ε IV <10 3 ^J V oid 1 m Ϊ ε IV 3 'di 19 ¹⁵ Λ Ϊ ^J V sX [)

982 082 SZ2

a (9 s ^ D 1 ΒΛ ^e IV ί 10 311 Jqi asy i 3S s! H ^{I 3} Susy «IV】 d

OLZ S9Z 09Z

⁰¹ d «10 s D] as O" ID 9] ^a S nsi OJJ »m im Xio D] 9 MV S9Z 0S3 S

T g T

69020 / S6dT / X3d rilII / 96 ΟΛΑ. as 1 ηιο ε 1 V 3'V 1 »H <19 J» S ε 1 »! I ^ 10 Ϊ» "» 1 1 »R

OOi S69 069 OI ΒΛ "31 uio 3 [[1 ΕΛ J <U» m aiO <10 V DSV ^na l V "'I» qd

S89 089 S! 9

dsy nsi e i v ί [9 asy n | o 13 «sqj n | HJL naq a [| 13» A °

0Z9 S99 099

law jag osy iqi [ΕΛ Λ 10 "10 ^Η3 Ί 3ιγ» Ι I »IIV s! H" 10

SS9 0S9 SH

aqd ni 10! 31 I J as e (V nio J as nj s j no 3 jy 2 JV D [3 iV

OH SC9 0C9 5Z9 O><10 ^! 9 ^S n »l J lsl 31 I MV I s ias n | o

0Z9 SI9 019 s ^ l <10 oid MV si na 3 ιγ i 3 Y s <D 1 ⁿ 10 O »dnio 10

S09 009 S6S e IV O a II 18A "19" 10 ³ 1 II J3S Λ dsV »[njo s

06S S89 089

e IV »qd n l 3 JV Λ V n [g nsy OIJ dsy nig" qj_ aqj o JJ d sy

SZS OZS S9S

³ 1 I ^J Λ "Ί ii OS! H I9 a II n» i α [lO ∑! H dsy 09S SSS OSS SiS

¹⁸ S "Mo EI v no j iv 10 ° ^S V ^a S" 10 sX "] I jy nso nsq

OH SSS OCS

^B IV II a II Λ I i> 31 ISA nsq 11 J! ID Ι ^Ε Λ MV MV

, SZS 02S SIS

^ 13 HV 311 131 «IV ^{η 3} Ί DIO" 10 «JV d! 9 n ιο as njg d sy naq

OIS S09 005

"10 ° I0 as si.H ^S ! H HO" 10 <10 ⁰¹ d O ^J ^ IO ε IVO

06 ^ 58 ^

"s 3 J V e I V Ϊ JV 16Λ a 10 I e | y i o Ϊ JV« "'l ^ 10

2 g I

lO / S6dT / XDd ZIZIT / 960A 705 710 715 720

Tyi Va 1 His Ar g Asp Leu Al a Ala Arg Asn I 1 e Leu Va 1 Asn Ser r Asn

725 730 735

Leu Va 1 Cys Lys Va 1 Ser Asp Phe Gl y Leu Ser r Arg Phe Leu Glu Glu

740 745 750

Asn Ser Ser As p Pro Thr Tyr Th r Ser Ser Leu Gl G

755 760 765

l i e Arg Trp Th r Ala Pro Glu Ala l ie Al a Phe Arg Lys Phe Thr Ser

770 775 780

Ala Ser Asp Ala Trp Ser T "G lie Va 1 Met Trp Glu Va 1 Met Ser 785 790 795 800

Pbe Gl Glu Arg Pro Tyi Trp Asp Met Ser Asn Gin Asp Va I lie Asn

805 810 815

Ala I 1 «Glu Gin Asp Tyr Arg Leu Pro Pro Pro Pro Asp Cys Pro Thr

820 825 830

Se I Leu His Gin Leu Met Leu Asp Cys Trp Gin Lys Asp Arg Asn Ala

835 840 845

Arg Pro Arg Phe Pro Gin Va 1 Va 1 Ser Ala Leu Asp Lys Met lie Arg

850 855 860

Asn Pro Ala Ser Leu Lys lie Va 1 Ala Arg Glu Asn Gl Gly y Ala Ser 865 870 875 880

Hi s Pro Leu Leu As Gin Arg Gin Pro His s Tr Ser Ala Phe Gly Ser

885 890 895

Va 1 CI y Glu Trp Leu Arg Ala I 1 e Lys Met Gl Arg Tyr Glu Glu Ser

900 905 910

Phe Al a Ala Ala G-ke Phe Gl Ser Phe Glu Leu Va 1 Ser Gin l ie Ser

915 920 925

Ala Glu Asp Leu Leu Arg lie G 1 Va 1 Thr Leu Ala Gly His Gin Lys 930 935 940 54

Lys lie Leu Ala Se r Va 1 Gin His Met Lys Se r Gin Ala Lys Pi Gly

945 950 955 960

Thr Pro Gly G Thr G-ke G Pro Ala Pro Gin Tyr

965 970 SEQ ID NO: 3

Sequence length: 4 2 9 0 and 9 8 7

Sequence type: nucleic acid and amino acid

Number of chains: double-stranded and single-stranded

Topology: linear

Sequence type: c DNA to mRNA, and amino acid

Origin

Organism name: human

However, for X in the gene sequence, the gene sequence has not been determined.

Array

GCGCTGGCG GGGAGGGAAC ACAGGTCAGT GTGGCGACAG GGGTCACGGT 49 GGACACGGGG GTGGGCTGTC TCAGGGGGGG ACACCGCGAG CGGCCGGCTC ACCCCCCGCC 109 ACCCGGGGCG GGACCCCGAG GCCCCGGAGG GACCCCAACT CCACCCACGT CTTGCTGCGC 169 GCCCGCCCGG CGCGGCCACT GCCAGCACGC TCCGGGCCCG CCGCCCGCGC GCGCGCACAG 229 ACGCGGGGCC ACACTTGGCG CCGCCGCCCG GTGCCCCGCA CGCTCGCATC GGCCCGCGCT 289 GAGCGCCCGA CGAGGAGTCC CGCGCGGAGT ATCGGCGTCC ACCCGCCCAG GGAGAGTCAG 349 ACCTXXXXXG GCGAGGCCCC CCCAAACTCA GTTCGGATCC TACCCGAGTG AGGCGGCGCC 409 ATG GAG CTC CGG GTG CTG CTC TGC TGG GCT TCG TTG GCC GCA GCT TTC 457 Met Gl u Leu Arg Va 1 Leu Leu Cys Trp Ala Ser Leu Ala Ala Ala Leu -15 -10 -5 -1 1

GAA GAG ACC CTG CTG AAC ACA AAA TTG GAA ACT GCT GAT CTG AAG TGC 505 Glu G I u Thr Leu Leu Asn Th r Lys Leu Glu Thr Ala Asp Leu Lys Tr

5 10 15

GTG ACA TTC CCT CAG GTG GAC GGG CAG TGG GAG GAA CTC AGC GGC CTG 553 . 56

TTC TAC AAA AAG TGC GCC CAG CTG ACT CTG AAC CTG ACT CGA TTC CCG 1033 Phe Tyr Lys Lys Cys Ala Gin Leu Tin Va 1 Asn Leu Thr Arg Phe Pro

180 185 190

GAG ACT GTG CCT CGG GAG CTG GTT GTG CCC CTG GCC CGT AGC TGC GTG 1081

Glu Thr Va 1 Pro Arg Glu Leu Val Val Pro Val Ala Gly Ser Cys Val

195 200 205

GTG GAT GCC GTC CCC GCC CCT GGC CCC AGC CCC AGC CTC TAC TGC CGT 1129 Va 1 Asp Ala Va 1 Pro Ala Pro Gly Pro Ser Pio Ser Leu Tyr Cys Arg 210 215 220 225

GAG GAT GGC CAG TGC GCC GAA CAG CCG GTC ACG GGC TGC ACC TGT GCT 1177

Glu Asp G Gin Trp Ala Glu Gin Pio Val Th [G Cys Ser Cys Ala

230 235 240

CCG GGG TTC GAG GCA CCT GAG GGG AAC ACC AAG TGC CGA GCC TGT GCC 1225 Pro Gl Phe Glu Ala Ala Glu C 1 Asn Thr Lys Cys Arg Ala Crs Ala

245 250 255

CAG GGC ACC TTC AAG CCC CTG TCA GGA GAA GGG TCC TGC CAG CCA TGC 1273 Gin Gly Thr Phe Lys Pro Leu Ser Gly Glu Gly Ser Cys Gin Pro Cys

260 265 270

CCA CCC AAT AGC CAC TCT AAC ACC ATT GGA TCA GCC GTC TGC CAC TCC 1321 Pro Ala Aso Ser His Ser As Q Thr lie Gly Ser Ala Val Cys C i D Cys

275 280 285

CGC GTC GGG TAC TTC CGG GCA CGC ACA GAC CCC CGG GGT CCA CCC TGC 1369 A [g Va 1 Gly Tyr Phe Arg A 1 a Ac g Thr Asp Pro Ai g Gl Ma Pro Cys 290 295 300 305

ACA ACC CCT CCT TCG GCT CCG CGG AGC GTG GTT TCG CGC CTG AAC GGC

Thr Thr Pro Pro Se I Ala Pro Arg Ser Val Val Ser Arg Leu Aso Gly

310 315 320

TCC TCC CTC CAC CTC GAA TGG ACT GCC CCC CTG GAG TCT GCT GGC CGA 1465

Ser r Se Leu H is Leu Glu Trp Ser Ala Pro Leu Glu Ser Gly Gly Arg SKI OVO 丄 :) 丄 33;) 030 003 V10 9V3 010 91D :) VI 33V DDO VOO OOD OVV 013 o S 0

ίΙΟ 3】 vn »1 n | o B 1 V Ϊ JV ^US V JiU Π9 _Ί

68I 000 903 3 丄 3 9V0 V30 000 DVV VVO 丄 9DV OVV 3JJ 311 OOD 3 丄 3 30V

J »S o'ii O" 10 «IV O" "ID s! H] s ri ΙΒΛ MO]"

6 DDV D33 100 OVO 330 390 OVV 0V9 丄 V3 3V1 VVV 310 0V9 DV1 DVO 01D

I n MV ^ 10 ^J «S oid VV fJd Λ e IV dU e 1 V na 1 J as nai J as

1081 OiO IDD 000 丄 3V 333 VDO 003 ODD 110 丄 :) 3 001 DDO 010 DOV 911 DOV

0 0

J ³ S o 3】 V »II dsy】 as i ΒΛ eiv o oid I Si I DOV ODD VD1 DDJ. OOD 9DV 010 003 DIV DV9 131 019 VDO IDD

S Ke 0 Ke SOf

n 19 3 V jqi! n usv A o i d "13 aqj 0Jd \ n o

SOZI OVO V90 0V9 丄;) v 33V 010 丄 VV :) 丄;) IDD OVO 111 V33 310 DDO 000 03V

00 S6E 06ε

\ o usv E ly] U ni »qd] q 丄" L 丄

ZS9I 3D0 Vil 031 DDI V10 000 DVV 3 丄丄 VDO 丄 :) V :) 丄;) 9V0 111 ODV 丄 V 丄 DDV S8C 08C sze QLZ old 2 J V m I [i J ni3 Λ n a dsy

6091 3 丄丄 DVO V1D 000 V03 «L 0 iJ tL 0 3 丄;) 33 丄 :) :) :) 0V9 3 丄 3 3 丄 :) DVO

S9C 09C SSC dsv aqj 1U tisq dsy ^ 19 ^ 10 s ^ D oid f IV s O Jag

1991 OOD ODD DOO DDD DVO 丄丄丄) :) V OJ.D DVD VM 000 3 :) 丄 33D 030 »L 0> L 3

OSS S O

^ 10 XI9 oij 3 jy s nio a JV E ly "丄 jq 丄 nai d sy" 10 ei? I 300 VOO 33D V03 :);) 丄! ) V3 OOD one;) 丄 33 013 330 3V1 33V DID OVD OVO

SCC OCC SZC

L 1

Z0 / S6dT / XDd Leu Lys Arg Gly Ala Ser Tyr Leu Val Gin Val Arg At a Arg Se Glu 485 490 495

GCC CGC TAC GGG CCC TTC GGC CAG GAA CAT CAC AGC CAG ACC CAA CTG 1993

Ala Gl Tyr Gly Pro Phe Gly Gin Glu His His Ser Gin Thr Gin Leu

500 505 510

GAT GAG AGC GAG GCC TGG CGG GAG CAC CTG GCC CTG ATT GCG GGC ACG 2041

As p G 1 u Ser Glu Gl Trp Arg Glu Gin Leu A 1 a Leu lie Ala Gl Thr

515 520 525

GCA GTC GTG CGT GTG GTC CTG GTC CTG GTG GTC ATT GTG GTC GCA GTT 2089 Ala Va 1 Va 1 Gly Va 1 Val Leu Val Leu Val Va 1 lie Val Val Ala Va 1 530 535 540 540 545

CTC TGC CTC AGG AAG CAG AGC AAT GGG AGA GAA GCA GAA TAT TCG GAC 2137

Leu Cys Leu Ar Lys Gin Ser As n Gly Arg Glu Ala Glu Tyr Ser Asp

550 555 560

AAA CAC GGA CAG TAT CTC ATC GGA CAT GGT ACT AAG GTC TAC ATC GAC 2185 Lys His Gl Gin T t Leu lie Gly His Gl Thi Lys Val Tyr l ie Asp

565 570 575

CCC TTC ACT TAT GAA GAC CCT AAT GAG GCT GTG AGG GAA TTT GCA AAA 2233 Pro Phe Thr T "Glu A p Pro A a Glu Ala Val Arg Glu Phe Ala Lys

580 585 590

GAG ATC GAT GTC TCC TAC GTC AAG ATT GAA GAG GTG ATT GGT GCA GCT 2281 Gl u lie Asp Va 1 Ser Tyr Val Lys lie Glu Glu Val lie Gl Ala Gl

595 600 605

GAG TTT GGC GAG GTC TGT CGG GGG CGG CTC AAG GCC CCA GGG AAG AAG 2329 Glu Phe Gly Glu Val Cys Arg Gly Arg Leu Lys A I a Pro Gly Lys Lys 610 615 620 620 625

GAG AGC TGT GTG GCA ATC AAG ACC CTG AAG GCT GGC TAC ACG GAG CGC 2377 Glu u Ser r Cys Va 1 Ala lie Lys Thr Leu Lys Gl Gl Tyr Thr Glu Arg

630 635 640 ] 3S 1Ή iio ii »n \ n ³ i] ^ 10 ^J U ¹⁹ S d】丄 eiv dsy 135

ZS8Z 丄丄丄 VOI 01V 010 OVO 901 91V 3 丄 3 11V 000;) VI 丄;) V 3;) 丄 339 1V0 丄. V

on 0Π

B! V 3D d V sqd MV «II BIV ηιο ojj ιιν du Ϊ JV

608Z 330 DDI 丄 :) V Dll OVV 003 311 DDO 丄丄 V DDO OVO ODD 3D0 丄;) V 33 丄 V3 :)

S9 092

I 0 X13 10 n »l iu jqi ° u dsy】》 S】 ³ S

\ 9Ll 31V DDD 丄丄 V ovv VDO VOO 013;):) 丄 33V 03V :) VI 33V DDD 1V0 DDI 131

09Z OH

usv "19 ⁿ I 0 n a-] aqd 3】 V" S] >> S Λ

Z \ LZ DVV 0V9 OVO 01D :) 丄丄 vo :) 001 HD 399 丄丄丄 DVO J »L 0 0 VVV D91 010

OCi

n sq n sv J 3 g nsv Λ η »Ί» I I asy 3】 V E IV E IV 3'V s! H \

999Z :) 丄 :) DVV DOV DVV :) 丄 :) V 丄 :) 3 丄 V OVV 30D 1D0 130 010 3V0 VOD DVD 310 QZL S1Z OU

] X 丄] a _S law "10 BIV n» l] 8 JV 1 HV »II I3 2 JV n» l

ZI9Z 3V1 30V 01V 9V0 DDO 113 0V1 90D 01V 3D0 031 300 D1V DOD 003 013 SO! OOi S69 069 i »o i ΕΛ n a i ° I0» l I Λ 010 O dsy Dsy n a 'j 2】 Y n 3i

69SZ;) 丄 V D90 3 丄 3 DID 0V3 31V 310 VDV Dll OVD vao DVD DVV VXD 03D DID

S89 089 SZ9 aqd J3S dsy MV ^ 10 usv "10 J« H aqd "10 jq 丄 ii3,« II HH 1 ΕΛ IZSZ :) 丄丄 33 丄 010 DDD 300 DVV OVO;) 丄 V Dll OVO VDV DID 丄丄 V 31V D13

0Z9 999 099 o 』d】 as u sv Λ I! O"! 0 n «l 3JV« I I »I I asv <Jd s! H

ZLiZ 330 OIV DOV DVV DDV DID 010 300 9V0;) 丄 :) 303 :) 丄 V 31V 丄 VV 300 OVD

SS9 0S9 SH

"19 ai) <i uio ^ 10 1» H 9 !! J9S ί IV ni9 J »S n« l »qd niO ¾iV V" ID DVO Dll OVD 300 31V 31V 31) :) :) 丄 ODD OVO DOV 3 丄;) ；;) V3 丄 33 003 OVD

6 9 1

Z0 / S6df / XDiI ζτειτ / 96θΛλ 790 795 800

GGG GAG AGG CCG TAC TGG GAC ATG AGC AAT CAC GAC GTG ATC AAT CCC 2905 GI Glu Aig Pro Tyi Trp Asp Met Ser ASD Gin Asp Va 1 lie Asn Ala

805 810 815

ATT GAA CAG GAC TAC CGG CTG CCC CCG CCC CCA GAC TGT CCC ACC TCC 2953 I 1 e Glu Gin Asp Tyi K: g Leu Pro P o Pro Pro Asp Cys P [o Tbi Set

820 825 830

CTC CAC CAG CTC ATG CTG GAC TGT TGG CAG AAA GAC CGG AAT GCC CGG 3001 Leu His Gin Leu Met Leu Asp Cys Trp Gin Lys Asp Arg Asn Ala Arg

835 840 845

CCC CCC TTC CCC CAG GTG GTC AGC GCC CTG GAC AAG ATG ATC CGG AAC 3049 Pro Arg Phe Pro Gin Val Va 1 Ser Ala Leu Asp Lys Met lie Arg Asn 850 855 860 865

CCC GCC AGC CTC AAA ATC GTG GCC CGG GAG AAT GCC GGG GCC TCA CAC 3097 Pro Ala Sei Leu Lys lie Val Ala Arg Glu Asn Gly Gly Ala Ser His

870 875 880

CCT CTC CTG GAC CAG CGG CAG CCT CAC TAC TCA CCT TTT GGC TCT GTG 3145 Pro Leu Leu Asp Gin Arg Gin Pro His Tyr Ser Ala Phe G I y Ser Val

885 890 895

GGC CAC TGG CTT CGG GCC ATC AAA ATC GGA AGA TAC GAA GAA ACT TTC 3193 Gl Glu Trp Leu Arg Ala lie Lys Met Gly Arg Tyr Glu Glu Se Phe

900 905 910

GCA GCC GCT GGC TTT GGC TCC TTC GAG CTG GTC AGC CAG ATC TCT GCT 3241 A 1 a Ala Ala Gly Phe Gly Ser Phe Glu Leu Va 1 Ser Gin lie Ser Ala

915 920 925

GAG GAC CTG CTC CGA ATC GGA GTC ACT CTG GCG GGA CAC CAG AAG AAA 3289 Glu Asp Leu Leu Arg lie Gly Val Thr Leu Ala Gly His Gin Lys Lys 930 935 940 945

ATC TTG GCC ACT GTC CAG CAC ATG AAC TCC CAG GCC AAC CCG GGA ACC 3337 1 6 1

I 1 e Leu Ala Se r Va 1 Gin His Met Lys Ser r Gin Ala Lys Pro Gly Th r

950 955 960

CCG GGT GGG ACA GGA GGA CCC CCC CCG CAG TAC 3370 Pro Gly G 1 y Th r Gly Gly Pro Ala Pro Gin Ty r

965 970

TGACCTGCAG CAACTCCCCA CCCCAGCCAC ACCGCCTCCC CATTTTCCGG GGCAGAGTGG 3430

GGACTCACAG AGGCCCCCAG CCCTGTGCCC CGCTGCATTG CACTTTGAGC CCGTGGGGTG 3490

AGGAGTTGGC AATTTGGAGA GACAGGATTT GGGGGGTTCT CCCATAATAG GAGGGGAAAA 3550

TCACCCCCCC AGCCACCTCG GGGAACTCCA GACCAAGGCT GAGGGCGCCT TTCCCTCAGG 3610

ACTGGGTGTG ACCAGAGGAA AAGGAAGTGC CCAACATCTC CCAGCCTCCC CCAGGTGCCC 3670

CCCCTCACCT TGATGCGTGC GTTCCCGCAG ACCAAAGAGA CTGTGACTCC CTTGCCAGCT 3730

CCAGAGTGGG GGGGCTGTCC CAGGGCGCAA GAAGGGGTGT CAGGGCCCAG TGACAAAATC 3790

ATTGGGGTTT GTAGTCCCAA CTTGCTGCTG TCACCACCAA ACTCAATCAT TTTTTTCCCT 3850

TGTAAATCCC CCTCCCCCAG CTCCTGCCTT CATATTGAAG GTTTTTGAGT TTTGTTTTTG 3910

GTCTTAATTT TTCTCCCCGT TCCCTTTTTG TTTCTTCGTT TTGTTTTTCT ACCGTCCTTG 3970

TCATAACTTT GTCTTGGAGG GAACCTGTTT CACTATGGCC TCCTTTGCCC AAGTTGAAAC 4030

AGGGGCCCAT CATCATGTCT GTTTCCAGAA CAGTGCCTTG GTCATCCCAC ATCCCCGGAC 4090

CCCGCCTGGG ACCCCCAAGC TGTGTCCTAT GAAGGGGTGT GGGGTGAGGT AGTGAAAAGG 4150

GCGGTAGTTG GTGGTGGAAC CCAGAAACGG ACCCCGGTGC TTGGAGGGGT TCTTAAATTA 4210

TATTTAAAAA AGTAACTTTT TGTATAAATA AAAGAAAATG GGACGTGTCC CAGCTCCAGG 4270

GGTGAAAAAA AAAAAAAAAA 4290 SEQ ID NO: 4

Array length: 8

Sequence type: amino acid

Topology: linear

Sequence type: Protein

Origin

Organism name: human Sequence: Lys Ser lie Va 1 Leu Glu Pro lie

SEQ ID NO: 5

Array length: 1 9 5

Sequence type: amino acid

Number of chains: single mineral

Topology: linear

Sequence type: amino acid

Origin

Organism name: human

Array

Lys Ser lie Va 1 Leu Glu Pro lie Tyt Trp Asn Ser Ser Asn Ser Lys

1 5 10 15

Pbe Leu Pro Gl Gin Gly Leu Va 1 Leu Tyr Pro Gin lie CI y Asp Lys

20 25 30

Lea Asp lie lie Cys Pro Lys Va 1 Asp Ser l y% Thr Va 1 Gly Gin Tyr

35 40 45

Glu Tyr Tyr Lys Va I Tyr Met Va 1 Asp Lys Asp Gin Ala Asp Arg Cys

50 55 60

Thr lie Lys Lys Glu Asn Tht Pro Leu Leu Asn Cys Ala Lys Pro As 65 70 75 80

Gin Asp lie Lys Pbe Thr I 1 e Lys Phe Gin Glu Phe Ser Pro Asn Leu

85 90 95

Trp Gly Leu Glu Pbe Gin Lys Asn Lys Asp T "Tyr lie lie Ser Thr

100 105 110

Ser Asn Gly Ser Leu Glu Gly Leu Asp Asn Gin Glu Gly Gly Va 1 Cys

115 120 125

Gin Thr ^ ^ l Ala Met Lys lie Leu Met Lys Va 1 Gly Gin Asp Ala Ser 130 135 140 1

Ser Ala Gly Sei Th r Arg Asn Lys Asp Pro Thi Ai g Ar g Pro G I u Leu 145 150 155 160

Glu u Ala Gly Thr Asn Gly Arg Ser Ser Thr Thr Ser Pro Phe Val Lys

165 170 175

Pro Asn Pro Gly Ser Ser Tbr Asp G 1 Asn Ser Ala Gl His Ser Gly

180 185 190

Asn Asn I 1 e

195 SEQ ID NO: 6

Array length: 3 0 8

Sequence type: amino acid

Number of chains: single strand

Topology: linear

Sequence type: amino acid

Origin

Organism name: human

Array

Lys Ser lie Val Leu C 1 u Pro lie Ty r Tr p Asn Ser Ser Asn Ser Lys

1 5 10 15

Phe Leu Pro G Gin Gl Leu Val Leu Tyr Pro Gin lie CI Asp Lys

20 25 30

Leu Asp lie i 1 e Cys Pro Lys Val Asp Ser Lys Thr Val Gly Gin Tyr

35 40 45

Glu u Tyr Tyr Lys Val Tyr Met Val Asp Lys Asp Gin Ala Asp Arg Cys

50 55 60

Th r lye Lys Lys G I u Asn Th r Pro Leu Leu Asn Cys A I a Lys Pro Asp 65 70 75 80

Gin Asp lie Lys Phe Thr lie Lys Phe Gin Glu Phe Ser Pro Asn Leu soc

! s i Hi 丄

OOC S6Z 062 a! I usy I vo jj J 3S | on J | 9 A ⁹ 1 II o ^J d

S82 ΟΠ S! Z

s! HO JU dsy lO J 'SI «Λ sXl nio! s'H »'J s ri aqj Λ] ^a S

OLZ S9Z 09Z

VB [V J¾l 3 JV "'I o [II a |! Dsy J5S ⁰ ] d" ID J ^ S ^ 10 n ^ V

99Z 0S2 S

tisv asy ^ 10] ³ S? so iqi e [vn «l iq 丄] nai nai iq 丄 0 SCZ 0 £ Z SZ2 iq 丄丄 s! H n 19 js! H s ^ l Ϊ iy s! H Ϊ 'V« JV s ^ l ns

OZZ SI2 OIZ n ³ l ⁿ³ l Λ I nn »l iqi 11! a [| 11 3 \ \ aq <j! an s ^ D 19

S03 OOZ S6I

las V i O nV »1d naq B | v I ΒΛ" 10 J »S Ji 10 ^η3 Ί» II QSV QSV

061 S81 081

^ 10 ¹³ SS! H ^ 19 e [V i »SV ^ 10 dsy] q_L] ^A S ^{I 3} S ^ 10 nsy 0 JJ

921 0Π S9I

sXl l ΒΛ aqj oi j JSJ] "U l] ^a S 3] V ^! 0 nsy Jqi [Q« IV n 10 091 SSI OS! SH rin 10 0 J j 3 iv «JV 'm oij dsv s ^ l nsy 3】 v iqi υς 9 V 1 »S

OH SCI 0Π

^{J 8} S Π V dsv! 0 i (IO 1 ^ε Λ l »H n [jsi 1 B [y 3] V lu 1

SZ1 OZl 911 s ^ D I ΕΛ ^ 10 ^ 10 n! 0 ° I0 Dsy "v 1 n | 3 πa ^: 35 Xio nsy

Oil SOI 001

¹ m J »S 1 Ia II 丄 dsv s nsy si 010» m njo nai λ 10 "丄

S6 06 98

69020 / S6dT / X3d ΓΙΙΪΙ / 96 1 6 5 SEQ ID NO: 7

Sequence length: 1 0 5 1 and 3 3 3

Sequence type: nucleic acid and amino acid

Number of chains: double-stranded and single-stranded

Topology: linear

Sequence type: c DNA to m RNA, and amino acid

Origin

Organism name: human

Array

GGAGTGCGCG GAGCTGGGAG TGGCTTCGCC 30

ATG GCT GTG AGA AGG GAC TCC GTG TGG AAG TAC TGC TGG GGT GTT TTG 78

Met Ala Va 1 Arg Arg Asp Set Val Trp Lys Ty [C "Trp G Va 1 Leu

-25 -20 -15 -10

ATG GTT TTA TGC AGA ACT GCG ATT TCC AAA TCG ATA GTT TTA GAG CCT 126

Met Val Leu Cys Arg Thr Ala lie Ser Lys Ser lie Val Leu Glu Pro

-5 -1 1 5

ATC TAT TGG AAT TCC TCG AAC TCC AAA TTT CTA CCT GGA CAA GGA CTG 174 lie T "Trp Asn Ser Ser Asn Se [L" Phe Leu Pro Gl Gin G 1 y Leu

10 15 20

GTA CTA TAC CCA CAG ATA GGA GAC AAA TTG GAT ATT ATT TGC CCC AAA 222

Val Leu Tyr Pro Gin lie Gly Asp Lys Leu Asp lie lie Cys Pro Lys

25 30 35

GTG GAC TCT AAA ACT GTT GGC CAG TAT GAA TAT TAT AAA GTT TAT ATC 270

Va 1 Asp Ser Lys Thr Val Gly Gin Tyr Glu Tyr Tyr Lys Val Tyr Met

40 45 50 55

GTT GAT AAA GAC CAA GCA GAC AGA TGC ACT ATT AAG AAC CAA AAT ACC 318

Val Asp Lys As Gin A 1 a Asp Arg Cys Thr lie Lys Lys Glu Asn Thr 1 6 6

60 65 70

CCT CTC CTC AAC TCT GCC AAA CCA GAC CAA GAT ATC AAA TTC ACC ATC 366 Pro Leu Leu Asn Cys Ala Lys Pro Asp Gin Asp lie Lys Phe Thr lie

75 80 85

AAG TTT CAA GAA TTC AGC CCT AAC CTC TGG GGT CTA GAA TTT CAG AAG 414 Lys Phe Gin Glu Phe Ser Pro As. Leu Tip G Leu Gl u Phe Gin Lys

90 95 100

AAC AAA GAT TAT TAC ATT ATA TCT ACA TCA AAT GGG TCT TTG GAG GGC 462 Asn Lys Asp Tyr Tyr lie lie Ser Tbr Set Asn Gly Ser Leu Glu Gl

105 110 115

CTG GAT AAC CAG GAG GCA GGG CTG TGC CAG ACA AGA GCC ATG AAG ATC 510 Leu As p Asn Gin Glu Gl G Va 1 Cys Gin Tin Arg Ala Met Lys lie 120 125 130 135

CTC ATG AAA GTT GGA CAA GAT GCA ACT TCT GCT GGA TCA ACC AGG AAT 558 Leu Met Lys Va 1 Gl GID Asp Ala Ser Se [Ala G I Ser Tin Arg ASD

140 145 150

AAA GAT CCA ACA AGA CGT CCA GAA CTA GAA GCT GGT ACA AAT GGA AGA 606 Lys Asp Pro Thr Arg A Pro Glu Leu Glu Ala Gly Tbr Asn Gl Arg

155 160 165

ACT TCG ACA ACA ACT CCC TTT GTA AAA CCA AAT CCA GGT TCT AGC ACA 654 Ser Ser Thr Thr Ser Pro Phe Va 1 Lys Pro Asn Pro Gly Ser Ser Thr

170 175 180

GAC GGC AAC ACC GCC GGA CAT TCG GGG AAC AAC ATC CTC GGT TCC GAA 702 Asp Gly Asn Ser Ala Gly His Ser G I y Asn Asn lie Leu Gl Ser Glu

185 190 195

GTG GCC TTA TTT GCA GGG ATT GCT TCA GGA TGC ATC ATC TTC ATC GTC 750 Va 1 Ala Leu Phe Ala Gly lie Ala Ser Gly Cys lie lie Phe lie Va 1 200 205 210 215

ATC ATC ATC ACG CTG GTG GTC CTC TTG CTG AAG TAC CGG AGC AGA CAC 798 1 6 7

lie l ie l ie Th r Leu Va 1 Va 1 Leu Leu Leu Lys Ty r Ar g Ar g A [g His

220 225 230

AGG AAG CAC TCG CCG CAG CAC ACG ACC ACG CTG TCC CTC AGC ACA CTG 846 Ar g Lys His Ser Pro Gin His Th 【Tin Th r Leu Ser r Leu Ser r Thr Leu

235 240 245

GCC ACA CCC AAG CGC AGC GGC AAC AAC AAC GGC TCA GAG CCC ACT GAC 894 Ala Thr Pro Lys Arg Ser Gly Asn Aso Asn G Iy Ser Glu Pro Ser Asp

250 255 260

ATT ATC ATC CCC CTA AGG ACT GCG GAC AGC GTC TTC TGC CCT CAC TAC 942 lie lie lie Pro Leu Arg Thi Ala Asp Ser Va I Phe Cys Pro His T "

265 270 275

GAG AAG GTC AGC GGG GAC TAC GGG CAC CCG GTG TAC ATC GTC CAG GAG 990 Glu Lys Val Set Gly Asp Tyi Gl His Pro Va 1 Tyr lie Va I C I D Glu 280 285 290 295

ATG CCC CCG CAG AGC CCG GCG AAC ATT TAC TAC AAC CTC 1029 Met Pro Pro Gin Ser Pro Ala Asn l ie Tyr Tyr Lys Val

300 305

TGAGAGGGAC CCTCGTGGTA CC 1051 SEQ ID NO: 8

Array length: 2 7

Sequence type: nucleic acid

Number of chains: single strand

Topology: Linear

Sequence type: D N A

Origin: by chemical synthesis

Sequence: 5'-TTGTCGACAC (AC) G (AG) GA (CT) (CT) T (CC) GC (ACGT) GC (ACGT) (AC) G-3 'SEQ ID NO: 9 6 8

Array length: 2 4

Sequence type: nucleic acid

Number of chains: single mineral

Topology: linear

Sequence type: D N A

Origin: by chemical synthesis

Sequence: 5'-TGGAATTCCA (AT) A (AG) (CG) (AT) CCA (CG) AC (AG) TC-3 'SEQ ID NO: 10

Array length: 2 6

Sequence type: nucleic acid

Number of chains: single strand

Topology: straight

Sequence type: D N A

Origin: by chemical synthesis

System IJ: 5'-AACTCGAGATCTCTGCTGAGGACCTG-3 'SEQ ID NO: 11

Array length: 2 8

Sequence type: nucleic acid

Number of chains: single

Topology: linear

Sequence type: D N A

Origin: by chemical synthesis

System IJ: 5'-AAGAATTCTCAGTACTCCCGGGCCCGTC-3 'SEQ ID NO: 1 2

SS column length: 5

Sequence type: nucleic acid 1 6 9

Number of chains: single strand

Topology: linear

Sequence type: D N A

Origin: by chemical synthesis

System IJ: 5'-GGGAATTCATTTATCATCATCATCTTTATAATCGTACTGCGGGGCCGGTCCTCCTGT-3 '

SEQ ID NO: 1 3

Sequence length: 2 7 and 8

Sequence type: nucleic acid and amino acid

Number of chains: single strand

Topology: linear

Sequence type: DNA and amino acid

Origin: by chemical synthesis

Sequence: 5'-GAT TAT AAA GAT GAT GAT GAT AAA TGA-3 '

Asp Ty r Lys Asp Asp Asp Asp Lys SEQ ID NO: 14

Array length: 30

Sequence type: nucleic acid

Number of chains: single strand

Topology: linear

Sequence type: D N A

Origin: by chemical synthesis

Distribution system: 5'-CGGAATTCGTGCGCTTCCTGAAGACGTCAG-3 'SEQ ID NO: 15

Array length: 5 8

Sequence type: nucleic acid

Number of chains: single strand Topology

Sequence type: D N A

Origin: by chemical synthesis

System IJ: 5'-GCGAATTCATTTATCATCATCATCTTTATAATCCTGCTCCCGCCAGCCCTCGCTCTCA-3 'SEQ ID NO: 16

Array length: 3 2

Sequence type: nucleic acid

Number of chains: single strand

Topology: linear

Type of row BH: D N A

Origin: by chemical synthesis

Sequence: 5'-AAGGATCCTGCTCCCGCCAGCCCTCGCTCTCA-3 'SEQ ID NO: 17

Array length: 3 7

Sequence type: nucleic acid

Number of chains: single strand

Topology: linear

Sequence type: D N A

Origin: by chemical synthesis

System: 5'-AACCATCCCCGAGGGTCTCTGCTGGAAGCCAGGCTCA-3 'SEQ ID NO: 18

Array length: 3 3

Sequence type: nucleic acid

Number of chains: single strand

Topology: linear

Sequence type: DNA Origin: by chemical synthesis

Sequence: 5'-CCTCTAGAGTCCCGGCCGTCGCACTCATTTACC-3 'SEQ ID NO: 19

Array length:

Sequence type: amino acid

Topology: linear

Sequence type: Protein

Origin

Organism name: human

However, XXX indicates a residue whose sequence could not be determined.

Array

Lys Se r lie Va I Leu Glu Pro lie Tyr Trp Asn Ser Ser ASD Set Lys

1 5 10 15

Phe Leu Pro CI Gin Gl Leu Va 1 Leu Tyr Pro Gin l ie CI Asp Lys

20 25 30

Leu Asp lie lie XXX Pro Lys Va 1 Asp XXX Lys Thi Va 1 Gly y XXX Tyr

35 40 45 SEQ ID NO: 20

Array length: 20

Sequence type: nucleic acid

Number of chains: single strand

Topology: Direct letter

Sequence type: D N A

Origin: by chemical synthesis

Sequence: 5 '-(TOT (ACGT) GA (AG) CC (ACGT) AT (TCA) TA (TO TGGAA-3' SEQ ID NO: 21 72

Array length: 20

Sequence type: nucleic acid

Number of minerals: single strand

Topology: linear

Sequence type: D N A

Origin: by chemical synthesis

Sequence: 5'-AC (TC) TT (ACCT) GG (AG) CA (ACT) AT (AGT) AT (AG) TC-3 'SEQ ID NO: 22

Sequence length: 107 and 35

Sequence type: nucleic acid and amino acid

Number of vines: single strand

Topology: linear

Sequence type: DNA and amino acid

Origin: Chemical synthesis method and human

Array

CTT GAG CCG ATC TAT TGG AAT TCC TCG AAC TCC AAA TTT CTA CCT GGA 48 Leu Gl u Pro lie Tyr Trp Asn Ser Ser Asn Ser Lys Pbe Leu Pro Gly

1 5 10 15

CAA GGA CTG GTA CTA TAC CCA CAG ATA GGA GAC AAA TTG GAT ATA ATT 96 Gin G 1 Leu Vat Leu Tyr Pro Ginlie Gl Asp Lys Leu Asp 1 le I 1 e

20 25 30

TGC CCG AAA GT 107 Cys Pro Lys

35 SEQ ID NO: 2 3

Array length: 20

Sequence type: nucleic acid Number of chains: single strand

Topology: linear

Sequence type: D N A

Origin: by chemical synthesis

Sequence: 5'-ATCCCGAAGTGCAGTCTGCC-3 'SEQ ID NO: 24

Array length: 2 3

Sequence type: nucleic acid

Number of chains: single strand

Topology: linear

Sequence type: D N A

Origin: by chemical synthesis

Sequence: 5'-TCAGACCTTGTAGTAGATGTTCG-3 '

Claims

The scope of the claims

1. An isolated polypeptide having an receptor tyrosine kinase activity and containing an amino acid sequence selected from the group consisting of SEQ ID NOS: 1 and 2 in the sequence listing; It has the ability to bind polypeptide to a homologous mutant having receptor type 1 tyrosine kinase activity and has a molecular weight of at least 41 as measured by polyacrylamide gel electrophoresis. An isolated compound characterized by the fact that it is 500 ± 750 daltons and is capable of undergoing a Coomassie prillant blue staining reaction.

2. An isolated polypeptide having the receptor type 1 tyrosine kinase activity and containing the amino acid sequence of SEQ ID NO: 2 in the sequence listing, or a peptide of the polypeptide. Claims: A cell having the property of phosphorylating at least one tyrosine residue of the polypeptide when reacted with a cell expressing a homologous mutant having a sceptor-type tyrosinase activity. 2. The compound according to 1.

3. The compound according to claim 1, which comprises a polypeptide containing the amino acid sequence described in SEQ ID NO: 4 in the sequence listing.

4. The compound according to claim 3, wherein the amino acid sequence described in SEQ ID NO: 4 in the sequence listing is located at the amino terminal of the polypeptide.

5. The compound of claim 1, which is capable of undergoing both a Coomassie Priliable single staining reaction and a PAS staining reaction.

6. The compound according to claim 1, which comprises at least a part of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing.

7. At least a portion of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is at least partially contained in the amino acid sequence of SEQ ID NO: 5 in the sequence listing. A compound according to claim 6 wherein the compound is at least part of:

9. At least a portion of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is at least partially containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing. The compound of claim 8 wherein the compound is at least part of a compound.

10. A compound containing at least a part of a polypeptide having the amino acid sequence of SEQ ID NO: 6 in the sequence listing;

At least one kind of compound containing at least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing, and the amino acid of SEQ ID NO: 6 in the above sequence listing At least one member selected from the group consisting of compounds other than compounds containing at least some of the polypeptides containing an acid sequence; A complex consisting of

11 1. At least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is a polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing. 10. The conjugate of claim 10, wherein the conjugate is at least a portion of the compound.

12. An isolated DNA encoding at least a portion of a polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the sequence listing.

1 3. At least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is a polypeptide having the amino acid sequence of SEQ ID NO: 5 in the sequence listing. The compound DNA according to claim 12, which is at least a part of the compound DNA.

(a) DNA encoding at least a part of the polypeptide is linked to a replicable expression vector, and the DNA is operably incorporated into the replicable expression vector. To obtain a replicable recombinant DNA

(d) incubating the transformant, expressing the DNA in the transformant, and producing a compound containing at least a part of the polypeptide; , And

(e) isolating the compound from the incubated transformant,

A method characterized by this.

15 5. At least a part of the polypeptide containing the amino acid sequence of SEQ ID NO: 6 in the above sequence listing is a polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing. The method of claim 14, wherein the method is at least part of:

16. An antibody that specifically recognizes the compound according to claim 1 or a compound containing at least a part of a polypeptide containing the amino acid sequence of SEQ ID NO: 5 in the sequence listing.

17. Selected from the group consisting of a sense DNA containing at least 12 consecutive nucleotide sequences of the nucleotide sequence of SEQ ID NO: 7 in the sequence listing, and an antisense DNA complementary to the sense DNA The isolated DNA fragment, and the sense DNA and the antisense DNA can be obtained by methylation, methylphosphatation, thiophosphatization, or deamination, respectively. From the sense DNA and the derivative of the antisense DNA. An isolated DNA fragment selected from the group consisting of:

18. A group consisting of an antisense RNA containing at least 12 consecutive nucleotide sequences complementary to the nucleotide sequence of SEQ ID NO: 7 in the sequence listing, and a sense RNA complementary to the antisense RNA. The selected RNA fragment, the antisense RNA and the sense RNA are methylated, methylphosphated, thiophos- phate-converted, or deaminated, respectively. An isolated RNA fragment selected from the group consisting of said antisense RNA and a derivative of said sense RNA.