WO1996003527A2 - Diagnostic method and probe - Google Patents
Diagnostic method and probe Download PDFInfo
- Publication number
- WO1996003527A2 WO1996003527A2 PCT/GB1995/001721 GB9501721W WO9603527A2 WO 1996003527 A2 WO1996003527 A2 WO 1996003527A2 GB 9501721 W GB9501721 W GB 9501721W WO 9603527 A2 WO9603527 A2 WO 9603527A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- probe
- intron
- exon
- nucleic acids
- gene
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70585—CD44
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- Eukaryotic gene expression begins with assembly of a homologous RNA strand on the DNA template.
- the RNA transcript is then edited in the cell nucleus so that non-coding regions (introns) are
- the gene is some 50-60kb in size, resides on chromosome 11 and is known to be composed of at least 20 exons, 10 or more of which can be alternatively spliced to produce various
- P 3 isoforms (9) are the variant exons.
- the abnormal products of the gene can be detected with the technique of reverse-transcription/PCR followed by
- this invention provides a probe comprising an oligonucleotide which is substantially homologous or hybridises to a complementary strand synthesised on an intron of a mammalian gene and which is labelled with a signal moiety.
- the probe comprises a mixture of two or more such oligonucleotides.
- oligonucleotide is here used to describe single stranded chains of at least 8 e.g. tens, hundreds or even thousands of nucleotides.
- a probe is substantially homologous or hybridises to the RNA which is a complementary strand synthesised on an intron of a mammalian gene.
- RNA would be removed and broken down during the editing and splicing process which takes place in a normal cell; its continuing and accumulating presence is therefore characteristic of a tumour cell.
- the probe is labelled with a signal moiety, whose nature is not material to the invention.
- Suitable probes include radioactive isotopes, haptens of antigens for binding to antibody, biotin for binding to avidin or streptavidin, fluorescent moieties, or components of light- or colour- generating enzyme systems.
- the technology for labelling oligonucleotides with signal moieties is well established.
- the invention provides a diagnostic method which comprises recovering nucleic acids from a sample of mammalian cells, contacting the nucleic acids under hybridising conditions with a probe which comprises at least one oligonucleotide which is substantially homologous or hybridises to a complementary strand synthesised on an intron of a mammalian gene and detecting whether hybridisation has taken place.
- the method is generally performed in order to diagnose neoplasia or metastasis.
- the mammalian cells are usually human cells.
- the mammalian gene is preferably a human gene, e.g. the CD44 gene as discussed above.
- the nucleic acids may be of extranuclear origin, e.g. messenger RNA.
- the nucleic acids may be amplified, e.g. by use of the reverse transcriptase polymerase chain reaction, prior to being contacted with the probe.
- the nucleic acids may advantageously be immobilised, e.g. in a gel or by blotting on a membrane, prior to being contacted with the probe.
- the probe may be labelled with a signal moiety as discussed above, and this labelling may be effected before or after hybridisation with the target nucleic acids.
- messenger RNA of intron-based sequences carries further implications for diagnosis and therapy. Such intron-based sequences are expected to be translated into novel polypeptide chains.
- intron-based sequences may alter the reading frame of the mRNA so that a wide variety of novel tumour-specific proteins and polypeptides may be generated by translation. These proteins and polypeptides will themselves be antigenic. It will be possible to develop antibodies, polyclonal or monoclonal, and to use those antibodies for assays or destruction of tumour cells. In all such assays, both hybridisation assays using oligonucleotide probes, and also immunoassays using antibody probes, the use of a mixture or cocktail of probes rather than a single probe is expected to yield more specific and sensitive results. Similarly for destroying tumours, the use of a mixture or cocktail of antibodies rather than a single antibody is expected to yield superior results.
- Figure 2 is the sequence of the intron In-9.
- Figure 3 is the sequence of Exon 9a.
- Figure 4 is a partial sequence at the 5 ' -end of the intron In-15.
- Figure 5 is a partial sequence at the 3 ' -end of the intron In-15.
- Figures 6 and 7 are ethidium bromide electrophoresis gels.
- the CD44 gene is a complex one, with at least 20 exons already known and more still being discovered. About half of the 20 exons are constitutive with the remainder (Nos. 6-15) being variable and alternatively spliced. The structure and numbering are shown in Figure 1.
- intron In-10 The intron following exon 10 for example is herein called intron In-10.
- Figure 4 shows a partial sequence at the 5'- end of the intron In-15.
- Figure 5 shows a partial sequence at the 3 ' - end of the intron In-15.
- Figure 3 shows a new Exon 9a described below. This was first thought to be an intron In-8. But it has emerged that the sequence shown in Figure 3 is not an intron at all, but rather the 5 '-end of exon 9 which is sometimes edited out following transcription and which is herein called Exon 9a.
- the invention provides nucleic acids which consist of or comprise sequences substantially the same as, or substantially complementary to, all or a characteristic part of any of these sequences. Each has been used successfully to discriminate between cancer cells and normal cells.
- the sample on which the assay is performed may be a small piece of tissue, a fine needle aspirate of cells from a tumour or a sample of urine, stool, sputum or other body fluid.
- Fresh urine samples were obtained from 14 patients with bladder cancer and from 14 volunteers with no known urological condition or symptoms.
- the cells were sedimented by centrifugation and the messenger RNA from the cell pellet extracted using a MicroFast Track Kit.
- Complementary DNA was synthesised from the messenger RNA template using the complementary DNA Cycle Kit (Invitrogen) and amplification was performed with appropriate primers and parameters using 2.5 units of Taq poly ⁇ nerase in 50/ ⁇ l reaction mixture.
- the primers used in the study, at 1 pmol/ ⁇ l reaction were P3 (5 ' -TGGATCACCGACAGCACAGAC) , P4 (5 ⁇ -GATGCCAAGATGATCAGCCATTCTGGAAT) .
- the intron sequence used as a probe labelled with the ECL detection kit (Amersha ) was that following exon 9 (In-9) of the CD44 gene. This is 474 bp long and we have identified its base sequence to be as shown in Figure 2.
- the 474bp insert between exons 9 and 10 was found to correspond exactly to the whole of intron 9 (i.e. the intron following exon 9 - see Figure 2) of the CD44 genomic clone c2311, demonstrating that this intron was not edited out during intra-nuclear processing of the poly A RNA transcribed from the CD44 gene of the RT112 cell line.
- a specific probe for intron 9 was obtained by PCR of genomic clone c2311 DNA with primers designed to anneal to exon 9 and exon 10. This hybridised to the larger (700bp) band seen on ethidium bromide gels (see legend for Fig. 2) , confirming the retention of this region in the abnormal transcripts from this cancer cell line.
- samples from 18(60%) of 30 patients with bladder cancer showed positive bands and smear patterns (Table 1) .
- two tumour urine samples which showed a smear pattern with intron 9 were from patients with very early stage (pTaGl) bladder cancer.
- preliminary studies in this laboratory further show that introns 14 and 15 (following exons 14 and 15 respectively) of the variant region and introns between the 5 constitutively expressed exons at the 5 ' end of the gene, are also incorporated in transcripts from tumour samples in various patients and in cell lines (data not shown) .
- the presence and intensity of the smear obtained with any of the probes was not simply related to the numbers of cells present (Table ID .
- intronic inserts could result in the incorporation of specific new peptide sequences in the corresponding proteins, in truncated variants (if new stop codons are introduced) , or in shifts in the reading frame, downstream from the inserted elements.
- the consequences of such profound disturbances in protein assembly are hard to predict, but could be very useful diagnostically and therapeutically.
- RNA extraction kit which we used cannot cope with more than 5 x 10 6 cells simultaneously, because of the amount of ribonuclease released during the extraction procedure; the other being that the PCR primers annealed mainly to the mRNA from the numerous lymphocytes and other blood leukocytes in the sample, which only express the standard part of the CD44 molecule.
- competition by abundant "standard form" transcripts, for the available supplies of this primer set (competitive PCR) , could interfere with amplification of the relatively small numbers of variant exons or introns contributed by the tumour cells (11) .
- intron 9 has also been detected in colon cancer cell lines (SW480 and HT-29) and in fresh tissue samples from colon carcinomas by RT-PCR.
- SW480 and HT-29 colon cancer cell lines
- PI is GACACATATTGCTTCAATGCTTCAGC.
- the presence of the intron 9 sequence in amplified transcripts in HT-29 and SW 480 colon carcinoma cell lines was detected on blots of the electrophoresed PCR products using a probe complementary to intron 9. The sizes of the bands were above 1.3 kb.
- the amplicon consists of exon 8, exons 9a and 9b and intron 9. Accordingly, a probe for exon 9b was used for detection of specific amplicons after electrophoresis of PCR products. The results showed that much higher expression of intron 9 was observed in all 5 tumours than in normal mucosas. The presence of weak signals from some of the normal colon tissue samples is explained by the presence of some nuclear pre mRNA. These results corroborate the work described above on intron retention in mRNA transcripts from bladder cancer specimens. This shows that the abnormal CD44 splicing process which results in this phenomenon also occurs in cancers of other tissues.
- intron 9 In the colon cancer cell lines the presence of intron 9 could be detected using total cellular RNA as the template for amplification. This sufficed because such lines are pure cultures of cancer cells. However, more sensitive methods were needed for colon cancer tissue specimens, because of the presence of many normal cells diluting the abnormal signal.
- Intron retention and sequence of CD 4 Intron 9 mRNA was purified from 100 ⁇ g total RNA of RT112 cells using Oligotex dT (Qiagen) and cDNA was synthesised using the cDNA Cycle Kit (Invitrogen) . cDNA was amplified by PCR with primer Vp2 and Vp3.
- Vp2 TCAACCACACCACGGGCTTTTGAC and
- Vp3 GCTTGTAGAATGTGGGGTCTCTTC Thirty five cycles PCR were then conducted.
- the cycle conditions were 94° 30 seconds, 55°C 1 minute, 72°C 2 minutes.
- a Hot Start procedure was adopted.
- a 700bp band was obtained in addition to the expected 225bp band . The latter corresponds in size to exon 9 plus exon 10.
- a 700bp band was also obtained by PCR with the same primer set when the genomic CD44 clone c2311 was used as a template.
- the genomic clone c2311 was screened from a PI genomic library using PCR (Genome Systems Inc) with the following primer set, which anneals to CD44 exon 5.
- 5' sense primer AGTGAAAGGAGCAGCACTTCACGA and 5' antisense primer: AGCAGGGATTCTGTCTGTGCTGTC
- Both of these 700bp bands were extracted from the gel, reamplified with the same primer set and subcloned into the TA vector. Determination of the nucleotide sequence for each 700bp band revealed that the amplified DNA in each case contained the whole 474bp intron 9.
- New CD44 exon 9a and sequence cDNA was amplified by PCR with primers Vpl and Vp4 to study the sequence of the junction between exon 8 and intron 9 as described in (13) .
- a 109Obp band (a) was obtained in addition to the expected 650bp band. The latter corresponded to the combined sizes of exons 8 & 9 (b) .
- each band was extracted and re-amplified by PCR with primers Vpl and Vp5. This resulted in a 600bp band as well as the expected 177bp band confirming that they are truncated versions of (a) and (b) .
- the 600bp band was subcloned into the TA vector and sequenced. The new 436 base nucleotide was obtained between exon 8 and exon 9.
- Spl TGGATCACCGACAGCACAGACAGA and Sp2 : GATGCCAAGATGATCAGCCATTCTGGAAT
- the membrane was hybridised with peroxidase labelled probes (ECL direct nucleic acid labelling and detection systems, Amersham) . Each probe was made by amplifying the TA plasmid clones containing variant exons, standard exons or introns of CD44 using related primers. Each PCR product was then extracted and directly labelled with peroxidase to produce the chemiluminescence probe, used in the ECL System. The lengths of the probes used were:
- FIG. 7 Southern hybridisation of urinary samples amplified with primer Spl and Sp2. Tracks 1-14 show results with urine samples from tumour-free people. Tracks 15-28 show results with urine samples from bladder cancer patients. Naturally voided urine samples (of about 50ml) were collected and processed both for PCR and for counting of viable cells after fluorescein diacetate/ethidium bromide staining as described previously (2) . In PCR studies thirty five cycles were performed. The cycle conditions were the same as above. Panel A, B, C, D, E and F show the results of hybridization of the same filter with intron 9, exon 9a, exon 7, exon 12, exon 15 and standard section probe respectively. The filter was stripped of the previous probe between each fresh hybridization. Patient details are given in Table 1.
- IUCC International Union against Cancer
- Urine samples were concentrated 10- fold by dilution. The viability and quantity of cells in the sample were assessed by fluorescence microscopy with fluorescein diacetate and eihidium bromide as described previously (4). In samples with haematuria the numbers of viable ceUs are increased by leukocytes from the contaminating blood and the numbers of live urothelial cells are difficult to measure. TABLE II Results of molecular analysis of urine samples from 30 patients with bladder cancer and 41 controls related to cell number in urine. Values are numbers of subjects unless stated otherwise. Urine samples were concentrated 10-fold by centrifugation.
Abstract
Description
Claims
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP95925936A EP0771361A2 (en) | 1994-07-21 | 1995-07-21 | Diagnostic method and probe |
JP8505569A JPH10504188A (en) | 1994-07-21 | 1995-07-21 | Diagnostic methods and probes |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB9414704A GB9414704D0 (en) | 1994-07-21 | 1994-07-21 | Diagnostic method and probe |
GB9420878A GB9420878D0 (en) | 1994-10-17 | 1994-10-17 | Diagnostic method and probe |
GBGB9509881.0A GB9509881D0 (en) | 1994-07-21 | 1995-05-16 | Diagnostic method & probe |
GB9420878.2 | 1995-05-16 | ||
GB9414704.8 | 1995-05-16 | ||
GB9509881.0 | 1995-05-16 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1996003527A2 true WO1996003527A2 (en) | 1996-02-08 |
WO1996003527A3 WO1996003527A3 (en) | 1996-03-28 |
Family
ID=27267290
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB1995/001721 WO1996003527A2 (en) | 1994-07-21 | 1995-07-21 | Diagnostic method and probe |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP0771361A2 (en) |
JP (1) | JPH10504188A (en) |
CA (1) | CA2195404A1 (en) |
WO (1) | WO1996003527A2 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999004036A1 (en) * | 1997-07-14 | 1999-01-28 | Isis Innovation Limited | Cd44 based cancer detection |
WO2005001126A1 (en) * | 2003-06-12 | 2005-01-06 | Korea Research Institute Of Bioscience And Biotechnology | Detection kit for gastric cancer and metastatic gastric cancer |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1988002783A1 (en) * | 1986-10-16 | 1988-04-21 | Nordisk Insulinlaboratorium | A process and an agent for detection of gene structures in humans having a great tendency to develop iddm |
WO1991010734A1 (en) * | 1990-01-12 | 1991-07-25 | Hsc Research Development Corporation | Introns and exons of the cystic fibrosis gene and mutations at various positions of the gene |
EP0558257A1 (en) * | 1992-02-24 | 1993-09-01 | The Scripps Research Institute | Gaucher's disease: detection of a new mutation in intron 2 of the glucocerebrosidase gene |
WO1993022458A1 (en) * | 1992-04-24 | 1993-11-11 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | A predictive assay for suicidal behavior |
WO1994002633A1 (en) * | 1992-07-21 | 1994-02-03 | Isis Innovation Limited | Diagnostic method |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH02109982A (en) * | 1988-10-18 | 1990-04-23 | Teijin Ltd | Gene fragment, probe and detection of chromosomal aberration |
-
1995
- 1995-07-21 EP EP95925936A patent/EP0771361A2/en not_active Withdrawn
- 1995-07-21 JP JP8505569A patent/JPH10504188A/en active Pending
- 1995-07-21 CA CA002195404A patent/CA2195404A1/en not_active Abandoned
- 1995-07-21 WO PCT/GB1995/001721 patent/WO1996003527A2/en not_active Application Discontinuation
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1988002783A1 (en) * | 1986-10-16 | 1988-04-21 | Nordisk Insulinlaboratorium | A process and an agent for detection of gene structures in humans having a great tendency to develop iddm |
WO1991010734A1 (en) * | 1990-01-12 | 1991-07-25 | Hsc Research Development Corporation | Introns and exons of the cystic fibrosis gene and mutations at various positions of the gene |
EP0558257A1 (en) * | 1992-02-24 | 1993-09-01 | The Scripps Research Institute | Gaucher's disease: detection of a new mutation in intron 2 of the glucocerebrosidase gene |
WO1993022458A1 (en) * | 1992-04-24 | 1993-11-11 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | A predictive assay for suicidal behavior |
WO1994002633A1 (en) * | 1992-07-21 | 1994-02-03 | Isis Innovation Limited | Diagnostic method |
Non-Patent Citations (2)
Title |
---|
JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 17g, - 1993 pages 173-185, TARIN D ET AL 'derranged activity of the CD44 gene and other loci as biomarkers for progression to metastatic stability' * |
PATENT ABSTRACTS OF JAPAN vol. 014, no. 318 & JP,A,02 109 982 (TEIJIN LTD) 23 April 1990 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999004036A1 (en) * | 1997-07-14 | 1999-01-28 | Isis Innovation Limited | Cd44 based cancer detection |
WO2005001126A1 (en) * | 2003-06-12 | 2005-01-06 | Korea Research Institute Of Bioscience And Biotechnology | Detection kit for gastric cancer and metastatic gastric cancer |
Also Published As
Publication number | Publication date |
---|---|
CA2195404A1 (en) | 1996-02-08 |
WO1996003527A3 (en) | 1996-03-28 |
JPH10504188A (en) | 1998-04-28 |
EP0771361A2 (en) | 1997-05-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Matsumura et al. | Unusual retention of introns in CD44 gene transcripts in bladder cancer provides new diagnostic and clinical oncological opportunities | |
US7709233B2 (en) | Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer | |
US6291163B1 (en) | Method for detecting cell proliferative disorders | |
US20030236632A1 (en) | Biomarkers for breast cancer | |
EP1126034A2 (en) | Coding sequences of the human BRCA1 gene | |
CN103764676A (en) | Fusion gene of KIF5B gene and RET gene, and method for determining effectiveness of cancer treatment targeting fusion gene | |
JPH03244400A (en) | Cancer evaluation | |
CN106434870A (en) | ncRNA and uses thereof | |
WO2006047482A2 (en) | Method for determining the diagnosis, malignant potential, and biologic behavior of pancreatic cysts using cyst aspirate | |
WO1994010343A9 (en) | Methods of detecting micrometastasis of prostate cancer | |
US6087098A (en) | Enhanced reverse transcriptase polymerase chain assay to detect MN in patients with renal cell carcinoma | |
Weiss et al. | Preoperative diagnosis of thyroid papillary carcinoma by reverse transcriptase polymerase chain reaction of the MUC1 gene | |
WO1998046798A9 (en) | Enhanced reverse transcriptase polymerase chain assay to detect mn in patients with renal cell carcinoma | |
CA2269664C (en) | Diagnostic assay for breast cancer susceptibility | |
CN108315422A (en) | A kind of CLTC-TFEB fusions and its detection primer and application | |
JP2800850B2 (en) | Methods for detecting neoplasia | |
EP0771361A2 (en) | Diagnostic method and probe | |
US20060263806A1 (en) | Biomarkers for breast cancer | |
CN110747275B (en) | Tumor cell marker molecule and application thereof | |
WO2014140788A1 (en) | Methods for the detection of sequence amplification in the brca1 locus | |
CN110438210B (en) | Multiple enrichment detection method for non-small cell lung cancer targeted drug related low-frequency mutation | |
US5650278A (en) | Compositions and diagnostic kits for identifying alveolar rhabdomyosarcoma | |
EP1717320A1 (en) | Identification of human gene sequences of cancer antigens expressed in metastatic carcinoma and involved in metastasis formation, and their use in cancer diagnosis, prognosis and therapy | |
JP4315812B2 (en) | Molecular diagnosis and prognosis of carcinoma | |
US20020142295A1 (en) | Sequence-based mutation analysis of neoplastic tissue for diagnosis or prognosis of the neoplasia |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): CA JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE |
|
AK | Designated states |
Kind code of ref document: A3 Designated state(s): CA JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1995925936 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 1996 750854 Country of ref document: US Date of ref document: 19961223 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2195404 Country of ref document: CA |
|
WWP | Wipo information: published in national office |
Ref document number: 1995925936 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1995925936 Country of ref document: EP |