WO1995021023A1

WO1995021023A1 - Enclosed reaction container and method of use

Info

Publication number: WO1995021023A1
Application number: PCT/GB1995/000215
Authority: WO
Inventors: Ronnie Aurun Ray
Original assignee: Inceltec Limited
Priority date: 1994-02-04
Filing date: 1995-02-02
Publication date: 1995-08-10
Also published as: GB9519732D0; AU1543195A; GB9402205D0

Abstract

A method for conducting a small scale reaction which comprises providing a heat stable, heat transmitting planar element (1) and means for forming a heat stable heat transmitting liquid-tight but gas permeable chamber (2, 26, 27) for operative interengagement with said planar element, securing a solid sample to the contact face of the planar element, interengaging said planar element with said solid sample facing downwardly into said chamber into which a liquid reactant has been introduced and inverting the assembly so as to commence or arrest a reaction between the solid sample and the liquid reactant. Preferably the gas permeability is provided by means of a vent (16) disposed in the chamber.

Description

ENCLOSED REACTION CONTAINER AND METHOD OF USE

The present invention relates to improvements in and relating to enclosed reaction containers and to methods for their use. It relates particularly to containers which are suitable for small scale reactions, for example those which take place on a microscope slide.

We have previously described a method for synthesising a target nucleic acid sequence within a cell by replication and/or amplification, or primed in situ extension reaction (PRINS) which method comprises:

1) maintaining cells including the target nucleic acid or extracellular nucleic acid and a replication and/or amplification and/or PRINS mixture in a well formed in part by a biocompatible semi-adhesive filler such as a gum applied to a first surface;

2) covering the well with a second surface and synthesising target nucleic acid sequences therein.

This method is particularly suited to polymerase chain reactions (PCR) , reverse transcription (RT) , ligase chain reaction (LCR) , self-sustained sequence replication (3SR) or nucleic acid sequence based amplification (NASBA) , primed in situ extension reaction (PRINS) for example.

Methods in the art depend on preventing evaporation for successful performance of intracellular nucleic acid reactions, for example in situ PCR. Therefore relatively small volumes of undiluted reaction mixtures are frequently used which may produce less specific reaction, limit sample size and increase costs. Furthermore, if the seal of a relatively small volume of reaction mixture, constructed to prevent evaporation, is broken inadvertently or by poor design, complete evaporation may occur after relatively few cycles of reaction. The present invention provides a means for allowing evaporation in a controlled manner by overcoming these serious problems and enhancing the reaction process. In the present invention, substantially diluted, isosmotic reaction solutions are used. This allows large samples such as cellular or tissue samples or extracellular nucleic acids such as chromosomes to be examined, as well as increasing reaction specificity due to specific sequences being targeted in the first few cycles of the reaction with the diluted reaction mixture, and reducing overall costs since less materials are required. Controlled evaporation during the amplification phase progressively concentrates reaction reagents in proportion thereby progressively increasing reaction efficiency and counteracting effects of lost reagent activity. This progressive concentration of reagents during reaction is particularly valuable for reactions where the target nucleic acid sequence increases in an exponential manner as in PCR, but may also be used in reactions where the target nucleic acid sequence increases in a linear manner as in repeated PRINS reactions (cycling PRINS) . One or more sequences may be amplified simultaneously as desired. Each or a combination of nucleic acid synthesis reactions may be performed successively if desired. Reaction results may be evaluated by observers or by automated means.

Another aspect of such reactions is the formation of a reaction chamber on a microscope slide for intracellular reactions, for example, which is often time consuming and difficult to achieve without the necessary skill.

Previously it has been the case that in situ PCR reactions have been performed on microscope slides using a hard bead of nail polish or similar material to contain the liquid reactants during the reaction procedure; a cover slide being superimposed on the nail polish or similar material. Considerable skill is required in order to effect this since the nail polish and similar materials tend to set hard thereby either preventing evaporation entirely or allowing excessive evaporation which leads to drying out of the samples. Nail polish and similar materials are also unable to maintain relatively large reaction solution volumes therein, and therefore frequently require use of liquid vapour barrier above the reaction mixture and are generally confined to examination of small cellular or tissue samples. Removal of the nail polish after completion of the reaction often requires the use of organic solvents which may themselves disrupt the cellular morphology.

The present invention is directed in part to an alleviation of these problems by providing an adhesive capable of being formed into an endless bead but retaining and enhancing its resilient characteristics during heat cycling. Since the cover slip associated to the bead of this invention is most preferably transparent, it is quite possible for those skilled to leave one or more small vents at the conjuncture of the adhesive surface between the bead and the cover slip. Additionally or alternatively, it is possible to insert one or more syringe needles through the bead which has a measure of resilience to extract or insert reactant liquids into the reaction space during the reaction procedure. Either way, one or more vents of a reasonably controllable size is provided along with means for topping up the reactants during the reaction procedure without disturbing the sample under test as required. Alternatively one or more perforations may be present in the coverslip according to a defined manner, in order that evaporation may be controlled and reactants may be added as desired.

Reaction chambers are available in the art for other purposes such as cell culture experiments, for example those sold under the Trade Name Lab-Tek by Gibco BRL. However, these rely on adhesive beads being disposed between adjacent pieces. When carefully assembled these can provide a liquid-tight seal on the first occasion they are used. But a) the assembly is not susceptible to reliable second use; b) inexpert assembly as by an inexperienced technician can result all too easily in an uncontrolled non-liquid-tight seal; c) an inexpert assembly may result in uncontrollable gas paths being formed to the exterior due to increase in pressure within the chamber, d) they are not designed for inversion, (e) they have not been designed primarily to withstand high temperatures, for example those found during the PCR reactions, and (f) reaction cannot be monitored microscopically during heat cycling.

Further it is often desirable for reactions to be effected for a predetermined length of time and then to be terminated without the possibility of a loss of liquid reactants. Further it is desirable to prevent the exposure of target tissues after reaction to unwanted oxidation in the air, contaminants, reaction inhibitors or nucleic acid degrading enzymes. The present invention allows more reproducible PCR reactions and particularly in situ PCR reactions due to the inventive concept of controlling the amount of evaporation, rather than relying on preventing evaporation or arbitrary and uncontrollable evaporation as in the prior art. The invention may allow for monitoring the amount of evaporation by a gradation means on the apparatus. The invention also may include means for subdividing the reaction chamber into individual compartments thus dividing the sample to allow test reactions and control reactions to be performed on the same sample. This is preferable in terms of scientific methodology since some variables are reduced. The cellular preservation of the cellular or tissue sample may be evaluated by microscopic examination through the coverslip or a flat surface of the reaction container, even during reaction.

Further, it is advantageous to maintain the sample in a horizontal position, since performance of a reaction by placing the first surface vertically or sideways may result in gravity-mediated uneven distribution of reagents and uneven reaction efficiency. If the reaction reagents are maintained by a physical force against gravity onto a first surface in a vertical or sideways disposition, there may still be some gravity-mediated uneven distribution of reagents with a risk of damage to the sample on the first surface due to any or a combination of the following: application or removal of surface tension where evaporation may be excluded entirely; variation of surface tension with heat; inability to add reagents during reaction; poor convection currents reducing the mixing of reagents during reaction; and the requirement for small volumes of relatively concentrated solutions which are not isosmotic with cells and increase risk of misprimed initiated reactions; surface tension forces may be difficult to control particularly in cyclical heat-mediated reactions; and finally there is no method of agitating the reaction mixture to permit even distribution of reagents on samples where possible.

Nested amplification reactions (e.g. nested PCR) has been developed to overcome some problems associated with single round multi-cycle amplification reactions (e.g. PCR) . Standard PCR techniques involve using one set of primers to amplify the desired portion of DNA. The amplification of the DNA occurs over a number of cycles commonly between 20 and 40. However using a single primer pair leads to problems of non¬ specific inter-reactions. In order to increase the specificity of the reaction, a second primer pair can be used to amplify a sequence amplified by a prior amplification reaction. This second amplification using another associated primer is called nested PCR and allows more specific amplification of an already amplified DNA where the matter contains unrequired sequences. Nested reactions increase specificity and are common for extra cellular DNA.

It will be appreciated that the nested reaction can be performed in situ within cells or extracellular nucleic acid on a surface using the method and apparatus of the present invention. This is particularly so because the method allows for detection of relatively longer strands of amplified DNA which remain in the cell since because of their large size they have extreme difficulty in defusing out of the cell, although the smaller molecules such as the primer DNA may enter the cell with relative ease.

It is common practice to remove an aliquot of material containing amplified DNA from the first round of PCR and to place the same into a new container adding the new mixture containing the second primer pair. In this invention as described below, if the first primer pair is limited such that it is completely exhausted after the first round of PCR, then the second primer pair can be directly added via the port or ports in the container or using the syringe to pierce the resilient biocompatible semi-adhesive filler material such as cow gum by instituting nested PCR within cells tissues or extracellular nucleic acids, on a surface such as a microscope slide.

Accordingly therefore to a first feature of the present invention, there is provided a method of conducting a small scale reaction which method comprises; providing a heat or microwave stable, heat or microwave transmitting, planar element and means for forming a heat or microwave stable, heat transmitting liquid tight but gas permeable chamber for operative inter-engagement with said planar element; securing said sample to the contact face of the planar element, inter-engaging said planar element with the solid sample facing downwardly within said chamber into which a liquid reactant has been introduced, and inverting the assembly so formed to commence or arrest a reaction between the solid sample and the liquid reactant.

In a particularly preferred form of the invention, the means for forming the chamber may comprise a layer of a resilient adhesive material disposed as an endless bead overlaid by a cover slip, said endless bead being adapted to allow introduction or extraction of liquid reactants via a syringe or similar which is adapted to pass through a bead with at least an element of resealing to provide a liquid-tight but gas permeable seal therebetween. A bead may be of defined size or fit contours of a sample as desired. Alternatively, one or more vents or perforations in the coverslip may be used for introduction or extraction of liquid reactants, or to control the amount of evaporation. The perforated coverslip may be placed over a resilient single bead layer such as adhesive or nail polish.

According to another aspect of the present invention there is provided: a heat transmitting, heat stable planar element, a heat transmitting, heat stable reaction chamber for operative inter-engagement with said planar element, and means formed in said planar element and/or in said chamber to provide a liquid-tight but gas permeable seal therebetween.

The planar element may be coated with a layer of an adhesive material to secure a sample to the surface thereof, for example to secure a tissue sample thereto, for example during in situ PCR. Further the planar element may be formed with a channel therein, the channel being provided preferably with a rib portion extending throughout the length of the channel and preferably equidistant from the channel walls. This provides, therefore, a convolute interface between the chamber and the planar element which can readily provide a liquid- tight seal. A vent or vents which is closed at normal temperature pressure but is readily opened at super atmospheric pressures may be provided to allow steam and gaseous by-products to escape during heating in a controlled manner.

The chamber may be formed with a dimension such that it interfits in said channel. Preferably in such an arrangement said channel is provided with a rib or slot for co-operation with a corresponding rib or slot on the face of the planar element. The slot and rib, and/or the free edges of the chamber and the channel, may be an interference fit with each other and/or may have an adhesive layer disposed therebetween to ensure a liquid-tight fit (for example a gum such as cowgum) . Where the assembly is adapted for a second and subsequent use an interference fit is to be preferred.

The chamber, and/or optionally the planar element, may be provided with a pressure release valve. The valve may be a rubber or plastics insert, with a preformed aperture therein sealed by a resealable resilient material such as rubber, such that only when pressure in said reaction chamber in use exceeds a given value will the aperture open to the atmosphere. The pressure release valve may be calibrated to release pressure in a defined or controlled manner.

Such an arrangement has the additional advantage that reactants can be added to or subtracted from the reaction mixture in use by means of a syringe. The reaction chamber may be formed with separable side and lid portions, each provided with an interengaging rib and slot assembly for liquid-tight interengagement in use.

The reaction may be heat or radiant or microwave energy mediated. The reaction may be terminated by re-inversion of the chamber/planar element assembly.

The positioning of a resealable valve in the chamber allows the liquid reactant to be positioned therein without leaking while allowing addition of further reactants during reaction for example, but also allows the reaction to generate a gas which can escape from the assembly in use without prejudicing the seal between the planar element and the free edges of the chamber.

The above arrangement allows small scale reaction to take place without loss of reactants or reaction products, without drying of the solid samples, and with the likelihood of reuse of the components if desired, particularly the heat- transmitting heat-stable reaction chamber, relatively large samples may be used for reaction.

The planar element may be generally in the form of a microscope slide, but preferably with a suitable channel inscribed therein. Such a planar element may optionally be coated with an adhesive to secure a solid sample, for example a tissue sample, thereupon. The said planar element or slide may be formed in glass or a clear plastics material. Where an adhesive is used it may be one which is current in the art so long as it is maintained and stable throughout any reaction, for example a poly-L-lysine adhesive.

In an alternative embodiment, the planar element may be overlaid by a pair of beads, one superimposed onto the other. The first bead may be a hard setting gum or similar adhesive means and this is overlaid by an endless bead of a second resilient adhesive such as "Cowgum". This provides a ready means of providing a gas permeable facility in the apparatus. Further, this inventive assembly allows for performance of successive reactions on the same sample as originally applied to the surface since the resilient adhesive can be reapplied along the pre-set sample periphery.

The valve may be formed of a resilient rubber bung with a preformed bore therein. This is optionally formed of a natural rubber suitably aged with a preformed aperture therethrough. Such a bung may be provided with a peripheral annular channel arranged for co-operation with a bore in the chamber or planar element in a liquid-tight fashion. The bore is usually on the face of the chamber parallel to the planar element, or in the walls of the chamber. However, in some circumstances, the bore may be found in the planar element itself. The valve allows excess pressure to vent as well as allowing the removal or addition, via a syringe, of further reactants. The chamber is preferably formed of a single moulding, but may comprise a separate removable lid so long as this is readily resealable in a liquid-tight fashion, as by providing an interengagement between the body of the chamber and the chamber lid which is similar to that described above for the interengagement between the planar element and the chamber. This arrangement is preferable for small scale reactions involving calls in suspension and a reaction mixture, or liberated nucleic acid and a reaction mixture.

The invention will now be described, by way of illustration only, with reference to the accompanying drawings and in the subsequent Examples of the invention.

Figure 1 shows a vertical section through an assembled chamber according to the invention immediately prior to initiation of a reaction;

Figure 2A shows a vertical section through a chamber of Figure 1 after reaction initiation,

Figure 2B shows in a plan from above a tissue sample on a microscope slide immediately prior to assembly with a chamber,

Figures 3A and 3B show in vertical section a second embodiment wherein the chamber is formed of two elements, and

Figure 4 shows the another embodiment of the invention in a vertical section.

With reference first to the arrangement shown in Figures l and 2, a generally planar slide (1), formed of a clear plastics or glass material, is provided on the underside (as shown in Figure 1 with a channel (3) . The channel (3) contains a continuous rib (4) which extends along the length of the channel. The portion of the slide (1) disposed between the channel (3) is coated with an adhesive (8) in a continuous layer. This layer may be an adhesive which may be current in the art and is maintained and stable throughout reactions. The adhesive (8) which may be poly-L-lysine or 3-amino-propyl-tri- ethoxy silane (APES) secures a cellular or tissue sample (9) .

As also seen in Figure 1 a generally cup-shaped chamber (2) is provided at its free edges with a slot (5) providing an outer protrusion portion (6) and an inner protrusion portion (7) . The chamber (2) is formed with side walls (11) and a lid portion (12) in which is mounted a vent of defined size which may be opened or closed as required or resilient rubber bung (16) with a resiliently closed bore throughout. Prior to initiation of any reaction, a reaction solution (13) is disposed as shown in Figure 1 within the chamber (2) , said liquid does not flow through the bore in the bung (16) because the bore is only opened at higher pressures such as those engendered by super atmospheric reactants, or through the vent (16) which is kept closed.

As can be seen in Figure 1, a convolute interface (10) is formed by means of the channel and the free ends of the chamber (2) when these are pressed together. In a preferred form of the invention the rib (4) will fit within the slot (5) such as to be an interference fit so that slide (1) is retained upon the chamber (2) until forced to part. A biocompatible semi adhesive filler may optionally be disposed into the channel of the planar surface (3) and the protruding portions of the chamber (6) (7) for a liquid-tight fit. Gradations 1 to 7 are provided on the chamber to allow monitoring of evaporation.

Immediately prior to assembly of the slide (1) with the chamber (2) , as shown in Figure (1) , the slide (1) is provided, as stated previously, with an adhesive layer (8) within the bounds of the channel (3) and a tissue sample (9) is disposed thereupon. The chamber (2) is then placed with its lid portion downwardly and the reaction solution (13) in an appropriate amount is added thereto. The slide (1) , with a tissue sample (9) adhering thereto, is then placed thereover as shown in Figure 2 and pressed down so that the free edges of the chamber locate in, and securely interfit with, the channel portions (3) of the slide (1) . With this completed the assembly is inverted such that the reaction solution comes into contact with the tissue sample (9) Figure 2. The reaction mixture may then be subjected to heating, for example by microwave or radiant or convected heat which may be continuous, or intermittent, without the problems of uncontrolled evaporation of the limited amount of reaction solution. Cooling of the sample may be continuous or intermittent, this arrangement being particularly suited to intra-cellular reactions. By this means, the evaporation of the reactants may be controlled by careful design of the bung or valve (16) . During the course of the reaction, the reactants may be extracted in whole or in part and indeed new or additional reactants may be introduced by means of a syringe which may fit through the bore in the bung or valve (16).

When it is desired to terminate the reaction it is only necessary to re-invert the assembly into a position as shown in Figure 1, and disassemble the heat-transmitting heat-stable chamber (2) from the heat or microwave transmitting heat or microwave stable planar surface (1) . Alternatively, the said chamber (2) may be disassembled from the heat or microwave transmitting heat or microwave stable planar surface (1) without prior inversion to terminate a reaction.

With reference to Figure 3A, an arrangement substantially as shown in Figure 1 and Figure 2 is shown but the chamber (2) is formed in two parts. The parts are wall portions (11) and lid portion (12) , which lid portion (12) extends preferably beyond the periphery of the wall portions (11) , and is provided with downturned lip portions (14) . An adhesive layer such as a biocompatible semi adhesive filler, for example cowgum (15) , is secured to the upper edges of the wall portions (11) to secure the same in a liquid-tight but gas permeable fashion to the lid (12) . This arrangement can be useful, but care must be taken to ensure a liquid-tight but gas permeable seal by means of the adhesive layer (15) . It is more preferred to provide the lid (12) and the peripheral portions of the wall (11) with an engagement arrangement as shown in Figure 3 between the planar surface (1) and the chamber (2) , or to provide a bung or valve (16) as shown in Figure 1.

An alternative arrangement of Figure 3B is a liquid-tight seal between the upper edges of the wall portions (11) and lid portion (12) may be a convoluted interface, preferably comprising a slot (X) disposed within the upper edges of the wall portions (11) in a continuous manner, into which is placed a continuous rib (Y) formed on the undersurface of the lid portion (12) ; this continuous rib may fit into the slot thereby forming a liquid-tight seal. A biocompatible semi- adhesive filler may optionally be placed between the slot (X) and rib (Y) to promote a liquid-tight, but gas permeable, seal. This arrangement is particularly advantageous for performing small scale chemical reactions for cells in suspension or on liberated substrate for reaction; for example liberated DNA or RNA.

The valve bore (16) disposed through the chamber lid (12) , may be formed of a resilient resealable valve, preferably formed of a natural rubber. The valve (16) may be provided with a central bore (17) which is sealed by means of the resilience of the rubber from which it is formed. It will thus be seen that if the pressure within the chamber (2) of Figure 1 exceeds a certain given value, gas will escape via the bore in the valve. Further if reactants are required to be added or withdrawn from the reaction mixture this can be effected by means of a syringe without effecting the seal between the channel (3) and the protrusions (6, 7). Another embodiment of the invention is applied to a standard microscope slide (20) over which is laid an adhesive layer 21 in accordance with prior art practices.

Before commencing in any reaction, an endless bead of a first hard material, for example nail polish is laid about the adhesive layer (21) and subsequently overlaid by a second layer of "Cowgum" of similar (26) which remains resilient even at high temperatures and after cycling.

Subsequently a tissue sample (22) is adhered to the adhesive (21) and a. small amount of liquid reactant (25) is positioned thereabout so as to cover the sample (22) . With the liquid reactants in situ a cover slip (23) is placed thereover in accordance with the usual practices thereby to restrict evaporation during heat cycling.

With skill, the resilient adhesive material (26) may be formed with one or more small vents or perforations as can be seen when the cover slip (23) is pressed onto the material forming the endless bead (26) . This allows a certain level of controlled evaporation. Control being exercisable throughout the reaction by pressing down on the cover slip at the appropriate point. Alternatively, some degree of controlled evaporation may be produced when the coverslip (23) is directly placed onto the resilient adhesive material (26) , since evaporation can take place through the resilient adhesive material (26) and coverslip (23) interface during cycling.

Additionally and/or alternatively the adhesive bead (26) may be pierced by means of a syringe needle (24) which has the effect of allowing venting of super atmospheric contents of the chamber (28) . Even if the syringe is withdrawn a small vent may be left, if desired, in the adhesive material (26) to accommodate a similar purpose. It will be noted therefore that by means of this arrangement, the inventive concepts of the present invention may be achieved without the use of specially formed enclosed reaction containers.

The invention provides, therefore, a facile means of conducting an intra-cellular reaction without uncontrolled loss of materials, and a process for effecting the same.

A practical exemplification of this is set forth in the following Examples:-

EXAMPLE 1

MATERIALS AND METHODS FOR IN SITU PCR AND DETECTION OF CYTOMEGALOVIRUS (CMV) (DNA VIRUS) IN CELL SUSPENSIONS AND IN TISSUES

Formalin-fixed, paraffin-embeddedCMV-infected (oruninfected) MRC-5 fibroblast cell line, CMV-lung infected tissue and uninfected tissue were obtained from histological archives. Samples were examined using routine haematoxylin/eosin stain, and by an im unohistochemistry (CMV) antibody technique (Dako Ltd, High Wycombe, UK) . Cell line or lung sections shall be referred to as "tissue" sections for Example 1.

Preparation of Tissue Sections

Tissue sections on APES or poly-L-lysine adhesive coated slides were cut from blocks of formalin-fixed, paraffin- embedded CMV-infected (or uninfected) MRC-5 fibroblast cell line and lung (CMV infected or uninfected) tissue. These sections were subsequently deparaffinised by successive washes with xylene and progressively diluted alcohol solutions and after washing in PBS (phosphate-buffered saline) were treated with proteinase K (10 μg/ml) for 15 minutes, then placed in 0.2% glycine for 15 minutes, washed once more in PBS and allowed to air dry before being stored at -20°C before use. Effect of DNAse digestion before reaction was evaluated.

Preparation of Tissue Sections for In Situ PCR for CMV Stored tissue sections were placed upon, and adhered to, an adhesive coated slide which was subsequently assembled with a chamber as hereinbefore described. Tissue sections on the slide and chamber assemblies were placed onto the flat surface block of a thermal cycling machine (GENEE Thermal cycler, Techne Ltd. , Cambridge, UK) .

DNA was also extracted from CMV infected and uninfected MRC-5 fibroblast cell line by standard techniques, and submitted for PCR analysis as controls.

An isotonic PCR mixture was prepared according to the following specifications in order to produce a final volume of approximately 436 μl/slide: 25 Mm MgCl₂ 20 μl , 10 x PCR buffer 40 μl, each 10 Mm dNTP 10 μl , distilled deionised water 327 μl , each CMV primer (100 mg/ l) primer 4 μl , Amplitaq (Trade Name) DNA polymerase 7.5 U, with optional addition of phosphate buffered saline 200 μl . Primer sequences used were (5^,-3') :

(1) ACCACCGCACTGAGGAATGTCAG and

(2) TCAATCATGCGTTTGAAGAGGTA, producing amplificant produce size of 100 base pairs (Cranage et al (1986) EMBO J 5.:3057-3063) . The PCR mixture was placed into the upturned chamber. The plastics adhesive coated slide, with a tissue sample secured thereto, was then inter-fitted with the chamber sealing in the PCR mixture, and the assembly was then inverted. Intracellular PCR fin Situ PCR.

Optimal temperature settings found previously were used: denaturation: 94°C, 1 minute/Reannealing: 58°C, 2 minutes, extension: 74°C, 1.5 minutes with a 5 second extension added to each consecutive cycle, 40 cycles. A measure of evaporation occurred but this liquid loss was recharged via vent (16) as necessary in some experiments but not in others. The assembly was simply disassembled after PCR and cleaned before reuse. Weight change was measured before or after reaction where no liquid was reintroduced during reaction.

Gel Analysis of PCR Products

The non-evaporated mix overlying the tissue sections after the

PCR reaction, was collected in the re-inverted chamber. 12 μl of the non-evaporated mix was mixed with 4 μl DNA-loading dye, and electrophoresed on a 1.5-3% agarose gel in TBE buffer (Trisborate EDTAelectrophoresis-buffer) with ethidiumbromide (10 mg/ml) . Molecular weight markers (eg PUC 19 cut with Dde T) were included with each gel, and results recorded on Polaroid (Trade Mark) photographs using ultraviolet fluorescence.

In Situ Hybridisation (ISH) with Biotinylated CMV DNA Probes After removal of non-evaporated mix, the tissue sections were air-dried and stored at -20°C before ISH. In situ hybridisation (ISH) using virus specific biotinylated probes (Cambridge Bioscience, Cambridge, UK) was performed according to the method of Gall et al (1971) Methods Enzy ol .38.: 470- 473. Known positive and negative control samples were included in each ISH. Samples were treated with Proteinase K (l mg/ml) or various dilutions thereof or left untreated. Evaluation was performed by double blinded studies with experienced histopathologists. In addition, the numbers of positively reacting cells were counted using a chromatic Image Analysis System (Leading Edge, Science Park, Adelaide, Australia) . Fields containing cells were defined interactively and the cells detected by automatic thresholding. The numbers of cells were counted automatically and the density of staining of each cell assessed also automatically on the basis of grey level measurements. A magnification of 250 times was used.

RESULTS

Cvtopathic Changes and Immunostaining for Cvtomeσalovirus CMV-infected fibroblasts and lung exhibited cytopathic effects characteristic of CMV when examined after routine haematoxylin and eosin staining. Tissue sections of CMV-infected fibroblasts and lung immunostained for CMV were positive with satisfactory controls. Immunostaining for CMV on known positive and negative control samples gave expected results.

Specificity of PCR Primers

The primer pair for CMV was tested on cell lysates and extracted DNA of CMV-infected cultured MRC-5 fibroblasts. A single band of the expected size (100 bp) was observed on gel electrophoresis. An identical band was found after nested PCR using outer flanking primers (Cranage et al (1986) EMBO J 5_: 3067-3063) and identical inner flanking primers to those used.

Weight Change Significant weight changes before and after a reaction where no reaction solution was replaced, coincident with decreased volume reaction solution was evident. The weight loss was determined by the size of aperture into the chamber i.e between the internal and external surfaces of the container.

Gel Electrophoresis

No definite band was identified when residual PCR mixture was removed from the assembly after PCR and gel electrophoresis performed. Extraction of amplified products from samples on slides was not performed in these experiments (see Example 2) since tissue samples were preserved for automated analysis. In situ Hybridisation (ISH)

In situ hybridisation performed using commercially available double-stranded DNA probes (Cambridge Bioscience Ltd, Cambridge, UK) revealed a markedly increased signal after in situ PCR on CMV-infected lung and fibroblast tissue sections relative to unamplified control tissue sections. A stronger signal was noted where evaporation occurred in a controlled manner compared to samples where evaporation was prevented entirely. This was found both by blind study examination by experienced histopathologists.

ISH on known positive and negative samples gave expected results. DNAse digestion of positive samples before reaction dramatically decreased the signal as detected by ISH. Negative control (uninfected) specimens submitted for in situ PCR gave negative staining by ISH.

Proteinase K treatment was helpful for performing ISH on CMV- infected formalin-fixed, paraffin-embedded lung and fibroblast sections on slides, since the probe apparently could not penetrate the section without Proteinase K predigestion.

Image Analysis Results for CMV-infected Tissues

A statistically significant difference was found between test tissue sections on assemblies of the invention (in situ PCR followed by ISH) and control slides (in situ PCR mixture and thermal cycling but no TAQ polymerase or no primers added followed by ISH) , both for intensity of signal and for the number of positive cells detected.

EXAMPLE 2

MATERIALS AND METHODS FOR COMBINED IN SITU REVERSE TRANSCRIPTION (RT) AND IN SITU PCR, OR IN SITU NESTED PCR, FOR MEASLES (RNA VIRUS) WITHIN CELLS AND TISSUES ON A MICROSCOPE SLIDE.

Cells and Tissues

Archival brain tissue showing histological evidence of subacute sclerosing panencephalitis (SSPE) of known measles aetiology or uninfected normal brain was obtained. Tissues were examined for cytopathic effect by haematoxylin-eosin stain, and by immunohistochemistry using a monoclonal anti-measles antibody (Serolab, Crawley, Sussex) . Human Vero cells were also cultured, left uninfected or infected with measles virus and used for experiments when 80% of cells had a prominent cytopathic effect, fixed in formalin and embedded according to standard techniques, or spun directly onto slides before reaction.

Cellular or tissue sections on Poly-L-lysine (PLL) or APES- coated slides for investigation were deparaffinised under RNase free conditions, after being cut from formalin-fixed paraffin-embedded tissue blocks. Deparaffinisation (RNase- free conditions) consisted of successive washes in xylene and progressively diluted alcohol conditions, before air-drying.

Proteinase K (10 micrograms/ml for 10-25 minutes at 37°C) was used for permeabilisation of cellular or tissue sections or cellular preparations on slides before a reaction.

DNA was also extracted from measles infected and uninfected tissue by standard techniques, and submitted for standard reverse transcriptase / polymerase chain reaction (RT/PCR) analysis as controls.

Method for Intracellular Reverse Transcription (in situ RT) in Cell or Tissue Sections on Slides for Measles Virus.

The deparaffinised cellular or tissue section or cellular preparation on a slide was surrounded by gum and allowed to set. An RT mixture was placed within the "well" created by the gum (Cow Gum Unit No. 133, Cow Proofing Ltd, Slough, UK), so that the mixture covered the tissue. A plastic cover slip which was intact or perforated was then placed onto the gum. The slide was placed onto the flat heating block of the PCR machine (GENEE Thermal Cycler, Techne Ltd, Cambridge, UK) . Reverse transcription was performed as follows: 10 minutes at 28° C; 60 minutes at 42°C; 5 minutes at 95°C; 5 minutes at 0°C. After the reaction was completed, the cover slip was removed, the gum was scraped off and the section washed. The RT mixture used was prepared according to the following specifications per slid: 10 μl 25 mM MgCLj, 5 μl of 10 x PCR buffer, each dNTP 5 μl 10 mM, 5 μl distilled water, reverse transcriptase (reco binant Moloney Murine leukaemia virus) 5.0 μl (50 units/μl) , RNase inhibitor 5.0 μl (20 units/μl) , random hexamers 5.0 μl (50 Mm solution).

Intracellular PCR on cDNA of measles Within Tissue Sections. Tissue sections or cytospins were surrounded by heat-resistant gum (Cowgum Unit No. 1133, Cow Proofing Ltd, Slough, UK) to form a well and the gum allowed to set. Subsequently, the tissue sections on slides were placed onto the flat surface heating block of a thermal cycling machine GENEE, Techne Ltd, UK) .

An isotonic PCR mixture was prepared according to the following specification per slide: 20 μl 25 Mm MgCl₂, 40 μl 10 x PCR buffer, 10 μl 10 mM each dNTP, 328 μl dH_.0, 4 μl each primer pair 460 μg/ml, (labelled at 5' end with digoxigenin or unlabelled) , 1 μl 5 U/μl Taq polymerase. The isotonic PCR mixture was then placed onto the slide within the well so that it adequately covered the tissue sample or cellular material of interest, and a heat resistant intact or variably perforated plastic coverslip was placed onto the gum covering the PCR mixture. Cycling conditions were identical to those used for CMV (Example 1) . After the thermal cycling was completed, the coverslip was lifted off, the residual PC mixture overlying the tissue section or cells stored for subsequent gel electrophoresis, then the gum was scraped off. The slide was washed in PBS and air-dried and stored at -20°C or used for further experiment. Standard primers used were for single round experiments where inner flanking primers MV3 5' AGC ATC TGA ACT CGG TAT CAC 3' and MV4 5' AGC TCT CGC ATC ACT TGC TCT 3' (J. Gen Virol 1991: 72;83-88, MJ Taylor et al.).

For ISH detection unlabelled primers were used. For detection of incorporated label into amplified product with one round in situ PCR, either labelled primer MV3, or unlabelled primers with addition of 5 μl dTTP and 4 μl digoxigenin-labelled dUTP (25 nmol) (Dig-11-dUTP) replacing 10 μl dTTP previously described.

Alterations in weight before and after thermal cycling according to intact or perforated coverslip, the use of reduced volume (50 μl, 100 μl and 200 μl reaction solutions) ; or undiluted reactions solutions were examined. Signal intensity of a reaction was evaluated by blinded studies. Use of irrelevant unlabelled CMV primers was used with DIG-11-dUTP experiments as controls, and irrelevant labelled CMV primers was used in labelled primer experiments as controls.

A "well" formed with nail polish was poorly able to contain relatively large volumes used and therefore was unsuitable to surround large tissue sections.

In nested PCR reactions, for first round PCR outer flanking primers MV1 and MV2 instead of inner flanking primers MV3 and MV4 were used, and the slide preparation for reaction and PCR mixture components were otherwise identical to the above for non-nested PCR reactions. The sequences of MV1 and MV2 were 5' TTA GGG CAA GAG ATG GTA AGG 3' and 5' GTT CTT CCG AGA TTC CTG CCA 3' respectively. After first round thermal cycling was completed, the coverslip was lifted off, the residual PCR mix overlying the tissue section or cells stored for subsequent gel electrophoresis, then the gum was scraped off, and the slide washed in PBS and air-dried. In nested PCR reactions, for second round PCR inner flanking primers (MV3, MV4) were used, and then either 10 μl 10 mM dTTP was replaced by 5 μl 10 mM dTTP and 4 μl (25 nmol) Dig-11-dUTP, or using digoxigenin-labelled MV3 primer whilst maintaining 10 μl lOmM dTTP in the reaction mixture. Otherwise the slide preparation for reaction and PCR mixture components were identical to that described above. After the second round thermal cycling was completed, the coverslip was lifted off, the residual PCR mix overlying the tissue or cells stored for subsequent gel electrophoresis. Then the gum was scraped off, and the slide washed in PBS and air dried and stored at -20°C prior to detection of digoxigenin incorporated into amplificant material.

Extraction of Nucleic Acids from Samples on Slides after a Reaction

Using unlabelled primers, in situ RT followed by in situ nested PCR was performed. After reactions, nucleic acids were extracted and gel electrophoresis and Southern blotting performed according to standard techniques.

ISH Detection of Measles Amplificants Using Digoxigenin- Labelled Riboprobe

ISH detection was performed according to standard protocols (WAKEFIELD AJ et al, J MED VIROL (1993) 39: 345-353.

Controls

Controls included identical measles-infected cellular samples but without reverse transcriptase enzyme added for the reverse transcription stage; and no Taq polymerase enzyme or no primers or inappropriate primers added for the PCR stage respectively. Other controls included use of uninfected samples. RNAse digestion before and after in situ RT was examined.

Simultaneous solution-phase reaction was performed with identical reagents under identical reaction conditions on cell lysates or nucleic acid extracted before reaction or intact alcohol-fixed cells. Alcohol-fixed cells were fixed onto slides after reaction in suspension and analyzed as described, apart from aliquots which were lysed and gel electrophoresis or Southern blotting or sequencing studies performed according to standard techniques.

In addition, for the ISH detection, dissimilar probes to the test samples were employed. For the correct probe, known positive and negative control samples were examined simultaneously.

For in situ nested PCR with Dig-11-dUTP incorporation into the second round alcohol-fixed cells in suspension, additional controls included in situ RT with and without Dig-11-dUTP, in situ PCR first round with and without Dig-11-dUTP, and in situ nested PCR without Dig-11-dUTP incorporation in the second round of PCR.

Measles amplificants were sequenced from alcohol-fixed cells in suspension, lysed after reaction. Protocols for such sequencing are well known.

RESULTS ON MEASLES INFECTED CELLS AND TISSUES

Cellular Preservation

Cellular morphology was remarkably well preserved with only slight loss of detail after in situ combined RT/nested PCR. Antibody staining revealed expected results. Gel Electrophoresis. Southern Blot and Solution Controls Residual PCR mix overlying tissue or cellular specimens on slides where no extraction was performed either gave no bands, a blush or rarely feint bands of correct size after in situ RT/PCR.

Extraction of nucleic acid from cellular sections after in situ RT/nested section revealed a blush by gel electrophoresis but a strongly positive result by Southern Blotting with specific probes.

Solution phase or alcohol-fixed cell suspension reaction controls were run in parallel, under the same experimental conditions and gave expected results upon gel electrophoresis and Southern blotting. Amplified products liberated from alcohol-fixed cells in suspension lysed after reaction were found to be specific for measles by sequencing studies. Other controls gave expected results. direct incorporation into amplified products within control alcohol-fixed cells in suspension gave expected results.

Combined In Situ RT/in Situ single Round PCR with ISH Detection.

A strikingly superior signal was obtained after combined in situ RT/in situ single round PCR followed by ISH using a measles specific riboprobe performed on infected vero cells, compared to the signal obtained after in situ RT only. Other controls gave expected results.

Direct Incorporation of Label into Amplified Products

With direct incorporation of labelled primers into amplified product, an almost exclusively cytoplasmic signal was obtained with specific primers but not with irrelevant primers. No signals were produced in control experiments on uninfected cells where the solution contained either irrelevant labelled primers or no enzyme or specific primers and run for 30 cycles. RNAse digestion before reaction abolished the signal; RNAse digestion after in situ RT did not affect the signal.

Effect of Different Reaction Volumes and Concentrations with Labelled Primers

At 30 cycles of PCR with the described reaction mixture using an intact coverslip (2cm x 3cm) , approximately 60-70% (w/v) of reaction solution evaporated.

The reaction container was prepared as follows:- on a glass slide containing the fixed tissue section, the Cowgum was applied to a height of approximately 4mm around the sample and capable of containing approximately 425 μl of solution and allowed to set hard for 15 minutes. A second layer of Cowgum of the correct consistency was applied on top of the hard set layer in a skilled manner such that few or no air bubbles were formed, and the intact or perforated coverslip placed on top almost immediately. The size of the reaction chamber may be varied according to the amount of sample and sample solution required in a given reaction. The degree of evaporation, as required by the volume of sample solution, may be controlled by the number of perforations in the coverslip. Where hard bead materials (e.g. araldite) is used to accommodate smaller volumes for example, then the perforations in the coverslip are generally essential to achieve the desired evaporation. The number of perforations is determined by the volume of solution and the amount of evaporation required.

At 30 cycles, progressively poor results were noted as the solution volume was decreased. No residual solution was present at 30 cycles with 200 μl solution.

At 30 cycles, with a labelled primer, undiluted reaction solutions and diluted reaction solutions were compared with identical volumes. Diluted solutions revealed an obvious difference, in terms of detectable signals, between use of specific and control reactions using irrelevant primers. The specific primer reaction produced a detectable signal whereas the irrelevant (control) primer reaction had a minimal or absent signal. This difference between specific and control reactions was less obvious or absent with undiluted solutions as used in the prior art. This indicates that the specificity of the reaction increases when comparatively dilute reaction solutions are used.

Claims

1. A method of conducting a small scale reaction which method comprises: providing a heat or microwave stable, heat or microwave transmitting, planar element and means for forming a heat or microwave stable, heat or microwave transmitting liquid-tight but gas permeable chamber for operative interengagement with said planar element, securing a solid sample to the contact face of the planar element, interengaging said planar element with the solid sample facing downwardly with said chamber into which a liquid reactant has been introduced, and inverting the assembly there formed to commence or arrest a reaction between the solid sample and the liquid reactant.

2. A method according to claim 1 wherein the means for forming the chamber comprises a layer of a resilient adhesive material disposed as an endless bead overlaid by an intact or perforated cover slip, said endless bead being adapted to allow introduction or extraction of liquid reactants via a syringe or similar adapted to pass through the bead or coverslip, said bead exhibiting at least an element of resealing.

3. A method according to claim 1 wherein the means forming the chamber comprises a preformed reaction chamber adapted to interfit with said planar element, and wherein the reaction chamber so formed comprises a pressure release valve which optionally allows the addition or extraction of reactants.

4. A method according to any preceding claim wherein the reaction is a nucleic acid synthesis reaction, a derivative thereof or other polymerisation reactions and wherein the method comprises subjecting the reactants to heat or microwave cycling over a period of time.

5. An enclosed reaction container comprising; a heat transmitting, heat or microwave stable, planar element, a heat transmitting, heat or microwave stable, reaction chamber for operative interengagement with said planar element, characterised by means formed in said element and/or in said chamber to provide a liquid-tight but gas-permeable seal therebetween.

6. A container according to Claims 5 wherein the planar element is.formed with a channel therein for co-operation with the free edges of said chamber, and wherein the liquid tight seal is achieved by providing an interference fit between the planar element and the reaction chamber.

7. A container according to Claim 6 wherein the channel and/or free edges of the chamber comprise an interengaging rib and slot extending over the whole length of their interfitting faces.

8. A container according to any of Claims 5 to 7 wherein the gas permeability is provided by a combined pressure relief valve of defined size and a reactant introduction port.

9. A container according to either of Claims 7 to 8 wherein the reaction chamber is formed with separable side and lid portions, and wherein an interengaging rib and slot assembly is additionally provided between said side portion and the lid portion.

10. An analysis kit comprising an enclosed reaction chamber according to any one of claims 1 to 9 further comprising at least one nucleic acid synthesis reagent.