WO1995017413A1 - Process for the evolutive design and synthesis of functional polymers based on designer elements and codes - Google Patents
Process for the evolutive design and synthesis of functional polymers based on designer elements and codes Download PDFInfo
- Publication number
- WO1995017413A1 WO1995017413A1 PCT/EP1994/004240 EP9404240W WO9517413A1 WO 1995017413 A1 WO1995017413 A1 WO 1995017413A1 EP 9404240 W EP9404240 W EP 9404240W WO 9517413 A1 WO9517413 A1 WO 9517413A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- elements
- reaction
- functional
- synthesis
- mold
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/04—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length on carriers
- C07K1/047—Simultaneous synthesis of different peptide species; Peptide libraries
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
Abstract
A process for the production of oligomeric or polymeric functional elements from designer elements in which the functional elements are obtainable by the linking of at least two designer elements, at least one of which is itself made up of at least two monomers which are linked by at least one chemical bond which corresponds to the chemical bond between two designer elements.
Description
Verfahren zum evolutiven Design und Synthese funktionaler Polymere auf der Basis von Formenelementen und FormencodesProcess for the evolutionary design and synthesis of functional polymers based on shape elements and shape codes
Gegenstand der vorliegenden Erfindung ist ein Verfahren gemäß Anspruch 1.The present invention relates to a method according to claim 1.
Die rasante Entwicklung der letzten Jahre im Bereich der Bio¬ wissenschaften hat nicht nur die Grundlagenforschung, sondern gerade auch die angewandte Forschung in diesem Feld stimu¬ liert. Proteine spielen hier aufgrund ihres breiten Wirkungs- spektrums eine herausragende Rolle. Ein ganzer Zweig der modernen Biotechnologie beschäftigt sich heute mit dem sog. "Protein Engineering", d.h. der Herstellung von Designer- Proteinen, die entweder auf der Grundlage bekannter Proteine durch graduelles Abändern oder durch vollständige Neusynthese entwickelt werden. Man unterscheidet hier vor allem zwei Ansätze, das rationale und das irrationale Design.The rapid development in the field of life sciences in recent years has stimulated not only basic research, but also applied research in this field. Proteins play an outstanding role here due to their broad spectrum of activity. A whole branch of modern biotechnology today deals with so-called "protein engineering", i.e. the production of designer proteins, which are developed either on the basis of known proteins by gradual modification or by completely new synthesis. A distinction is made between two approaches, the rational and the irrational design.
Rationales Design ist darauf aus, eine Aminosäuresequenz zu produzieren, die sich in eine gewünschte Struktur faltet, und zusätzlich die erhoffte Funktion aufweist. Damit hängt diese Strategie ganz offensichtlich von einem tiefen Ver¬ ständnis des "Protein folding" ab. Fortschritte in de letzten Jahren betrafen u.a. das rationale Design einfache
Struktur-Domänen. Das Design größerer Proteine mit komplexen oder gar beispiellos neuen Eigenschaften liegt jedoch immer noch außerhalb der Möglichkeiten dieses Ansatzes. Dem¬ gegenüber setzt irrationales Design keine Informationen über die Proteinstruktur, Proteinfaltung etc. voraus. Einzig die Kenntnis der gewünschten Eigenschaft und eine Möglichkeit, Molekülpopulationen gemessen an dieser Eigenschaft zu be¬ werten, sind hier Voraussetzung. Ausgehend von einer "com- binatorial library" aus Peptiden oder Proteinen werden Moleküle mit der gewünschten Eigenschaft selektiert und erst im Nachhinein analysiert. Hier wird also der Mechanismus, nachdem ein Molekül die gestellte Aufgabe meistert, nicht im voraus determiniert .Rational design aims to produce an amino acid sequence that folds into a desired structure and also has the desired function. This strategy therefore obviously depends on a deep understanding of "protein folding". Advances in recent years have involved, among other things, rational design Structure domains. However, the design of larger proteins with complex or unprecedented new properties is still beyond the scope of this approach. In contrast, irrational design does not require any information about the protein structure, protein folding, etc. The only requirement here is knowledge of the desired property and a possibility of evaluating molecular populations measured by this property. Starting from a "combinatorial library" of peptides or proteins, molecules with the desired property are selected and only analyzed afterwards. Here the mechanism after a molecule has mastered the task is not determined in advance.
Obwohl dieser Ansatz in sehr eleganter Weise gerade auch in jüngster Zeit Peptide mit einfachen und z. T. neuen Eigen¬ schaften hervorgebracht hat, stellt sich auch hier das Problem, wie man zu größeren Proteinen mit komplexeren Funktionen kommen kann. Schon eine vollständige Bank eines 20mers liefert mit 2020 = 1026 verschiedenen Sequenzen eine astronomisch hohe Zahl zu untersuchender Moleküle. Soll die Peptidsequenz auch noch durch eine Nucleinsäure codiert werden, stellt sich das Problem in noch gravierender Weise. Da der genetische Code degeneriert ist, d.h. eine Aminosäure u.U. durch mehrere verschiedene Codons repräsentiert wird, ergibt sich hier eine Zahl von mindestens 460 = 103S Mole¬ külen, die synthetisiert werden. Normalerweise wird an der dritten Codonposition nur G oder C zugelassen, um Stopcodons weitgehend zu vermeiden. Die verbleibende Zahl von 1030 Molekülen übersteigt noch immer die Standardausbeute eine kommerziellen DNA-Synthese um 12 Größenordnungen. Eine weitere Reduktion der pro Position zugelassenen Codons wurd von Youvan vorgeschlagen. Ob diese Methode den meßbaren Se¬ quenzraum nicht in unzulänglicher Weise einschränkt, gerad bei der Suche nach neuen Funktionen, bleibt abzuwarten.
Zum Aufbau funktionaler Strukturen arbeitet die Natur mit modularen Systemen. Bekannt sind die Nucleotidbausteine, die Aminosäure-Bausteine (als Nucleotidtripletts kodiert) und Exon-Domänen (aus Aminosäurebausteinen aufgebaut) . Die evo- lutive Optimierung funktionaler Biopolymere entsprechend der Patentanmeldung WO 92/18645 geht von der Vorstellung aus, durch kontinuierliche Verbesserung bestehender Basiseigen¬ schaften, z. B. eines Enzyms, bei der kontinuierlichen Anpassung an erwünschte Reaktionsbedingungen wie Ionenstärke, Temperatur, pH-Wert eine optimale Struktur zu finden. Sind vorteilhafte oder mindestens neutrale Mutationen möglich, so sind durch mehrmalige Wiederholungen von Selektion und Mutation auch entfernte Bereiche des Sequenzraumes zugäng¬ lich, die durch die Ausgangspopulation nicht abgedeckt waren. Von der ursprünglichen, bereits funktionsfähigen Struktur entfernt man sich jedoch bei diesem Vorgehen in keinem Schritt. Optimiert wird eine Eigenschaft des Aus¬ gangsmoleküls, die bereits - wenn auch in bescheidenem Maße - im ursprünglichen Molekül inhärent ist. Der "Pfad", den eine solche Evolution durch den Sequenzraum nimmt, ist bestimmt durch die zugänglichen, in Richtung der Optima führenden Grate in der unterliegenden Wertelandschaft. Wie bei allen Methoden, die den Sequenzraum nicht vollständig erschließen, besteht bei diesem Vorgehen die nur schwer einzuschätzende Gefahr, in einem lokalen Optimum stecken¬ zubleiben. Für die Praxis bedeutet dies, daß bestimmte Regionen des Sequenzraumes einschließlich der dort befind¬ lichen Optima, durch breite und tiefe "Täler" abgetrennt sind. Bei der begrenzten Populationsgröße von Molekülspezies in Experimenten (P 43 22 147, WO 92/18645) ist aber die Wahr¬ scheinlichkeit zu niedrig, entfernte Vielfehlermutanten zu erzeugen, die sich jenseits dieser Schranke befinden und den Weg zu diesen neuen Optima anzeigen.Although this approach has been used very elegantly, especially recently, peptides with simple and z. T. has brought new properties, the problem arises how to get larger proteins with more complex functions. Even a complete bank of a 20m with 20 20 = 10 26 different sequences provides an astronomically high number of molecules to be examined. If the peptide sequence is also to be encoded by a nucleic acid, the problem is even more serious. Since the genetic code is degenerate, ie an amino acid may be represented by several different codons, this results in a number of at least 4 60 = 10 3S molecules that are synthesized. Usually only G or C is permitted at the third codon position in order to largely avoid stop codons. The remaining number of 10 30 molecules still exceeds the standard yield of commercial DNA synthesis by 12 orders of magnitude. Youvan proposed a further reduction in codons allowed per position. It remains to be seen whether this method does not inadequately restrict the measurable sequence space, especially when searching for new functions. Nature works with modular systems to build functional structures. Known are the nucleotide building blocks, the amino acid building blocks (encoded as nucleotide triplets) and exon domains (composed of amino acid building blocks). The evolutionary optimization of functional biopolymers according to patent application WO 92/18645 is based on the idea of continuously improving existing basic properties, e.g. B. an enzyme to find an optimal structure in the continuous adaptation to desired reaction conditions such as ionic strength, temperature, pH. If advantageous or at least neutral mutations are possible, repeated repetitions of the selection and mutation also make it possible to access distant regions of the sequence space that were not covered by the starting population. With this procedure, however, one step does not move away from the original, already functional structure. A property of the starting molecule is optimized which is already inherent - albeit to a modest degree - in the original molecule. The "path" that such an evolution takes through the sequence space is determined by the accessible ridges leading in the direction of the optima in the underlying value landscape. As with all methods that do not fully open up the sequence space, there is a risk of getting stuck in a local optimum with this procedure that is difficult to assess. In practice, this means that certain regions of the sequence space, including the optima located there, are separated by wide and deep "valleys". Given the limited population size of molecular species in experiments (P 43 22 147, WO 92/18645), however, the probability is too low to generate distant multi-error mutants that are beyond this barrier and indicate the path to these new optima.
Die Natur hat eine Anzahl von Mechanismen entwickelt, mit dieser Problematik umzugehen: lange Entwicklungszeiträume, Rekombinationsverfahren (horizontaler Gentransfer, Crossing-
over, Genkonversion, Exon-Rekombination (exon-shuffling) , Virusshuttles, mobile Elemente (Transposons) , Untereinheiten- Struktur von komplexen Proteinen) ) sowie Multigenfamilien mit Pseudogenen.Nature has developed a number of mechanisms to deal with this problem: long development periods, recombination processes (horizontal gene transfer, crossing over, gene conversion, exon recombination (exon shuffling), virus shuttles, mobile elements (transposons), subunit structure of complex proteins)) and multi-gene families with pseudogenes.
Mit der Anzahl der parallel geführten Mutantenbildung und Selektion läßt sich die Chance auf Erzeugung einer ge¬ wünschten Vielfehlermutante erhöhen; durch Rekombination lassen sich mutierte Gensegmente effizient mischen. Funktionslose Pseudogene als Mitglieder einer funktions¬ fähigen Multigenfamilie lassen sich als Vielfehlermutanten auch über längere Entwicklungszeiträume ohne Gegenselektion in ihrer Existenz erhalten, um eventuell bei Rückerhaltung einer Funktion wieder positiv selektierbar zu werden.The number of mutant formation and selection carried out in parallel can increase the chance of generating a desired multi-fault mutant; by recombination, mutated gene segments can be mixed efficiently. Functionless pseudogenes as members of a functional multi-gene family can be maintained as multi-fault mutants even over longer development periods without counter-selection in order to be able to be positively selected again if a function is retained.
Die Übertragung dieser Mechanismen auf eine effiziente in vitro Optimierung ist offensichtlich nicht ohne weiteres möglich. Die Schwierigkeiten müssen jedoch in jedem Falle für solche Aufgabenstellungen gelöst werden, bei denen eine kontinuierliche Optimierung nicht erwartet werden kann. Dies trifft insbesondere für solche -Anpassungsprozesse zu, bei denen eine Funktion vollständig neu etabliert werden muß.The transfer of these mechanisms to an efficient in vitro optimization is obviously not easily possible. In any case, the difficulties must be solved for tasks in which continuous optimization cannot be expected. This is especially true for those adaptation processes in which a function has to be completely re-established.
Das der Erfindung zugrundeliegende technische Problem be¬ trifft die Bereitstellung eines Verfahrens zur Herstellung oligomerer oder polymerer Funktionselemente wie Biopolymere mit funktionalen Eigenschaften, beispielsweise Enzymen, Ribozymen, Wirkstoffen, etc. Dabei soll unter Ausnutzung evolutiver Strategien ein den herkömmlichen Screening-Ver- fahren überlegenes Verfahren bereitgestellt werden.The technical problem on which the invention is based relates to the provision of a process for the production of oligomeric or polymeric functional elements such as biopolymers with functional properties, for example enzymes, ribozymes, active substances, etc. A process superior to conventional screening processes is to be used here using evolutionary strategies to be provided.
Gelöst wird dieses Problem durch ein Verfahren mit den Merkmalen des Anspruchs 1. Die sich daran anschließenden Unteransprüche betreffen bevorzugte Ausführungsformen des erfindungsgemäßen Verfahrens.
Erfindungsgemäß werden zur Herstellung oligomerer oder polymerer Funktionselemente aus Formenelementen zunächst Formenelemente durch chemische oder enzymatische Verknüpfung von mindestens zwei Monomeren aufgebaut und die so erhält¬ lichen Formenelemente dann zu Funktionselementen verknüpft. Dabei entspricht die Natur der chemischen Bindung zwischen den Monomeren derjenigen zwischen den jeweiligen Formen¬ elementen. Die so erhältlichen Funktionselemente können dann auf die bestimmten potentiellen Funktionen getestet werden. Die Vorteile der erfindungsgemäßen Vorgehensweise werden durch die nachfolgende Beschreibung weiter verdeutlicht.This problem is solved by a method with the features of claim 1. The subsequent subclaims relate to preferred embodiments of the method according to the invention. According to the invention, for the production of oligomeric or polymeric functional elements from mold elements, mold elements are first built up by chemical or enzymatic linking of at least two monomers, and the mold elements obtainable in this way are then linked to form functional elements. The nature of the chemical bond between the monomers corresponds to that between the respective shaped elements. The functional elements obtainable in this way can then be tested for the specific potential functions. The advantages of the procedure according to the invention are further illustrated by the following description.
Bevorzugt wird die Verknüpfung der Formenelemente unter Einsatz einer festen Phase als Reaktionsträger durchgeführt . Die Verknüpfung der Formenelemente kann chemisch und/oder enzymatisch erfolgen. Die Verknüpfung der Formenelemente zu den Funktionselementen kann entweder planmäßig durch gezielte Zugabe der einzelnen Formenelemente und nachfolgender Ver¬ knüpfung oder auch statistisch durch zufällig gesteuerte Zugabe der Funktionselemente und deren Verknüpfung erfolgen. Es ist dabei möglich, die Verknüpfung schrittweise aufbauend stereospezifisch und/oder gerichtet durchzuführen.The linking of the shaped elements is preferably carried out using a solid phase as a reaction carrier. The linking of the form elements can take place chemically and / or enzymatically. The linking of the form elements to the functional elements can either take place according to plan by adding the individual form elements in a targeted manner and subsequent linking, or else statistically by adding randomly controlled addition of the functional elements and their linking. It is possible to build the link step-by-step in a stereospecific and / or directional manner.
Als Formenelemente kommen vorzugsweise Nucleinsäuren, doppel- strängige oder einzelsträngige DNA und/oder RNA und/oder modifizierte Nucleinsäuren in Frage. Als Formenelemente kommen auch Peptide und/oder Polypeptide und/oder sonstige kopplungsfähige chemische Oligomer-Formenelemente in Frage. Dazu können auch Oligo- oder Polysaccharide gehören.Preferred form elements are nucleic acids, double-stranded or single-stranded DNA and / or RNA and / or modified nucleic acids. Peptides and / or polypeptides and / or other couplable chemical oligomer mold elements are also suitable as mold elements. This can include oligosaccharides or polysaccharides.
In einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens werden die Formenelemente als bereits syntheti¬ sierte Oligomerbausteine eingesetzt oder im Reaktionsgefäß quasi in situ hergestellt.In a preferred embodiment of the process according to the invention, the mold elements are used as already synthesized oligomer building blocks or are produced quasi in situ in the reaction vessel.
Es ist vorteilhaft, die Reaktion der Formenelemente in parallel geführten Mikroreaktionsansätzen (wie in P 43 22
147.5 vorgeschlagen) durchzuführen, bei denen die Formen¬ elemente in vorbestimmter Reihenfolge verknüpft werden. Insbesondere werden nach erfolgter Synthese die Reaktions- produkte wie Funktionselemente oder Vorstufen davon an der festen Phase gebunden bleiben und nach Abtrennung der Reaktionspartner weiter verarbeitet oder von der Festphase entkoppelt. Es ist jedoch ebenfalls möglich, die Reaktion in geeigneten, dem Fachmann bekannten Reaktionsbedingungen in Lösung durchzuführen oder die festphasengekoppelte oder in homogener Lösung durchgeführte Reaktion miteinander zu kombinieren.It is advantageous to react the mold elements in parallel microreaction approaches (as in P 43 22 147.5 proposed) in which the shaped elements are linked in a predetermined order. In particular, after the synthesis has taken place, the reaction products, such as functional elements or precursors thereof, remain bound to the solid phase and, after the reaction partners have been separated off, are further processed or decoupled from the solid phase. However, it is also possible to carry out the reaction in suitable reaction conditions known to those skilled in the art or to combine the solid-phase-coupled reaction or a reaction carried out in homogeneous solution.
Durch Einsatz der Fluoreszenzkorrelationsspektroskopie (FCS) (PCT/EP 93/01291) wird es ermöglicht, die Funktionsweise der Funktionselemente im gleichen Volumenelement direkt zu bewerten, in dem auch die Synthese abläuft. Dies bedeutet eine sehr direkte Möglichkeit, das Ergebnis einer aufbauenden Funktionselementsynthese zu kontrollieren.The use of fluorescence correlation spectroscopy (FCS) (PCT / EP 93/01291) makes it possible to directly evaluate the functioning of the functional elements in the same volume element in which the synthesis also takes place. This means a very direct way to control the result of a functional element synthesis.
Vorzugsweise wird pro Reaktionsschritt, bei der schrittweisen Verknüpfung der Formenelement, jeweils ein Formenelement als Reaktionspartner an fester Phase gekoppelt. Es können auch Mischungen von Formenelementen eingesetzt werden und/oder im Reaktionsgefäß direkt generiert werden. Werden als Formen¬ elemente Nucleinsäuren verwendet, so ist es vorteilhaft, wenigstens einen Reaktionspartner mit einer Schnittstelle eines Restriktionsenzym zu versehen oder ein Nucleinsäure- formenelement zu verwenden, welches frei von Start- und/oder Stopcodons ist . Vorzugsweise sind die Reaktionsschnittstellen solche, die von Restriktionsenzymen der Klasse IIS erkannt werden können. Die Einführung von Restriktionsschnittstellen dieser Enzymklasse ist vorteilhaft, da beliebige Sequenzen gerichtet verknüpft werden können, ohne daß die Wahl des Reaktionsenzyτns die Sequenzerfordernisse des Endproduktes beeinfluß .
Sind in den zu verknüpfenden Formenelemente einzelsträngige Überhänge eingeführt, so können darüber beliebige Sequenzen gerichtet verknüpft werden, ohne daß dabei irgendwelche Anforderungen an die Sequenz des gewünschten Endproduktes gestellt werden müssen. Dieses Erfordernis kann auch durch selektive und reversible chemische und/oder enzymatische Modifkation der 3'- und/oder 5'-Enden der Nucleinsäuren, zum Beispiel durch Phosphorylierung anstelle und in Kombination mit der Einführung der einzelsträngigen Überhänge erzielt werden.Preferably, one mold element is coupled as a reaction partner to the solid phase for each reaction step in the step-wise connection of the mold element. Mixtures of mold elements can also be used and / or generated directly in the reaction vessel. If nucleic acids are used as shaped elements, it is advantageous to provide at least one reaction partner with an interface of a restriction enzyme or to use a nucleic acid shaped element which is free of start and / or stop codons. The reaction interfaces are preferably those which can be recognized by class IIS restriction enzymes. The introduction of restriction sites of this enzyme class is advantageous since any sequences can be linked in a directed manner without the choice of the reaction enzyme influencing the sequence requirements of the end product. If single-stranded overhangs have been introduced into the shaped elements to be linked, any sequences can be linked in a directed manner without having to make any demands on the sequence of the desired end product. This requirement can also be achieved by selective and reversible chemical and / or enzymatic modification of the 3 'and / or 5' ends of the nucleic acids, for example by phosphorylation instead of and in combination with the introduction of the single-stranded overhangs.
Als Beispiel für eine reversible chemische Modifikation ist das Ankoppeln einer Trityl-Schutzgruppe, die durch Behandlung mit Essigsäure abspaltbar ist, zu nennen. Die Einführung der Tritylgruppe am 3 ' - oder 5'-Ende des Nucleotids führt zur Blockade der Ligation der Formen- und/oder Funktionscodes bzw. -elemente.An example of a reversible chemical modification is the coupling of a trityl protective group which can be split off by treatment with acetic acid. The introduction of the trityl group at the 3 'or 5' end of the nucleotide leads to the blocking of the ligation of the form and / or function codes or elements.
Durch Behandlung eines Oligo- oder Polynucleotids mit Nuclease kann ein 3'- oder 5'-Ende modifiziert werden, zum Beispiel wird durch Behandlung mit Exonuclease III das 3'- Ende durch Abdauung modifiziert. Wenn in das entsprechende Oligo- oder Polynucleotid (z. B. DNA) Nucleotidtriphosphate eingebaut werden, so stoppt die Exonuclease am ersten Thio- Nucleotid die Abdauung. Damit ergibt sich eine regulierbare Modifizierung des Endes des Oligo- oder Polynucleotids.Treatment of an oligonucleotide or polynucleotide with nuclease can modify a 3 'or 5' end, for example treatment of exonuclease III modifies the 3 'end by digestion. If nucleotide triphosphates are incorporated into the corresponding oligo- or polynucleotide (eg DNA), the exonuclease on the first thio-nucleotide stops the digestion. This results in an adjustable modification of the end of the oligonucleotide or polynucleotide.
Das erfindungsgemäße Verfahren erlaubt den Einsatz von Formenelementen, die nach röntgen-kristallographisch analy¬ sierten natürlichen Funktionsdomänen von Proteinen und Polypeptiden bekannt sind. Es können so bereits bekannte Bausteine bzw. Module von in der Natur bereits vorkommenden Funktionselementen benutzt werden.The method according to the invention allows the use of shaped elements which are known from X-ray crystallographically analyzed natural functional domains of proteins and polypeptides. In this way, already known building blocks or modules of functional elements already occurring in nature can be used.
Die zu verwendenden Formenelemente können auch aus Selektionsexperimenten gewonnen werden.
Insbesondere vorteilhaft ist die Verwendung von Formenelemen¬ ten in einer Länge von 1 bis 60 Aminosäuren oder Nucleotid- sequenzen entsprechender Kodierungslänge. Die Formenelemente können auch an bestimmten Positionen degeneriert sein und/oder Deletionen oder Insertionen tragen, insbesondere bei Verwendung von Nucleotiden als Formenelemente.The shape elements to be used can also be obtained from selection experiments. The use of form elements with a length of 1 to 60 amino acids or nucleotide sequences of corresponding coding length is particularly advantageous. The shape elements can also be degenerate at certain positions and / or carry deletions or insertions, especially when using nucleotides as shape elements.
Es wird auch die Verwendung des erfindungsgemäßen Verfahrens wie oben beschrieben zur Synthese parallel aufgebauter Formen-Bibliotheken funktionaler Oligomere oder Polymere beansprucht .The use of the method according to the invention as described above for the synthesis of parallel form libraries of functional oligomers or polymers is also claimed.
Die ursprüngliche Aufgabe von "combinatorial libraries" ist eher das Angebot einer Funktionen-Vielfalt als einer Sequenz¬ vielfalt . Es ist heute eine Tatsache, daß die drei¬ dimensionale Struktur von Proteinen relativ stabil gegen Substitutionen einzelner Aminosäuren ist. Durch die große Zahl aufgeklärter Proteinstrukturen gewann man die Er¬ kenntnis, daß Proteine zwar keine oder nur sehr geringe Sequenzhomologie aufweisen können, aber trotzdem die gleiche oder sehr ähnliche 3D-Struktur einnehmen können. Dies beruht möglicherweise darauf, daß nur eine begrenzte Anzahl mög¬ licher Faltungsweisen von Aminosäureketten unter biologischen Bedingungen stabil ist . Strukturelle Verwandtschaft spiegelt aber auch die Evolution rezenter Proteine aus einer relati begrenzten Zahl von Ur-Strukturen, -Modulen heraus wieder. Diese Module können als kleine, funktionelle Domänen ode kompakte Struktureinheiten verstanden werden und können auc in heutigen Genen leicht aufgespürt werden. In der Hypothese des "Exon-shuffling" wird vermutet, daß die Evolution z komplexeren Proteinen gerade durch die Kombination von Exons, also Modulen im oben beschriebenen Sinn enorm beschleunig wurde. Wenn man annimmt, daß die Zahl der Exons, die di Konstruktion aller heute bekannten Proteine erlauben würde, zwischen 1000 und 7000 zu suchen ist, eröffnet eine hier¬ archische Strategie des "Protein Design" mit Bausteine zunehmender Komplexität die Möglichkeit der viel schnellere
Durchmessung eines "shape space" mit zugehörigerer "fitness landscape" als es die Suche in einer traditionellen "combinatorial library" gestatten würde. Ein Protein aus 150 Aminosäuren (die Größe einer klassischen Nucleotid- bindungsstelle, der sog. "Rossman fold") müßte nach herkömm¬ lichem Verfahren aus einer Bibliothek von 20150 = 10195 ver¬ schiedenen Aminosäuresequenzen selektiert werden. Kombi¬ nationen von 1000 verschiedenen Modulen der Länge 30 Amino¬ säuren ergeben hingegen nur eine Komplexität von 10005 = 1015 Molekülen.The original task of "combinatorial libraries" is to offer a variety of functions rather than a variety of sequences. It is a fact today that the three-dimensional structure of proteins is relatively stable against substitutions of individual amino acids. The large number of elucidated protein structures gave rise to the knowledge that proteins may have little or no sequence homology, but can still have the same or very similar 3D structure. This may be due to the fact that only a limited number of possible ways of folding amino acid chains is stable under biological conditions. Structural relationships also reflect the evolution of recent proteins from a relatively limited number of original structures and modules. These modules can be understood as small, functional domains or compact structural units and can also be easily found in today's genes. In the hypothesis of "exon shuffling" it is assumed that the evolution of more complex proteins was accelerated enormously by the combination of exons, ie modules in the sense described above. If one assumes that the number of exons that would allow the construction of all proteins known today should be sought between 1000 and 7000, a hierarchical strategy of "protein design" with building blocks of increasing complexity opens up the possibility of much faster Dimensioning of a "shape space" with a corresponding "fitness landscape" than the search in a traditional "combinatorial library" would allow. A protein of 150 amino acids (the size of a classic nucleotide binding site, the so-called "Rossman fold") would have to be selected from a library of 20 150 = 10 195 different amino acid sequences by conventional methods. Combinations of 1000 different modules with a length of 30 amino acids, on the other hand, only result in a complexity of 1000 5 = 10 15 molecules.
Das erfindungsgemäße Verfahren ist ein hierarchisches Ver¬ fahren zum Design von Proteinen, Nucleinsäuren deren Derivaten oder chemischer Oligo- oder Polymere mit bestimmten gewünschten Eigenschaften, ausgehend von Modul-Bibliotheken, im folgenden als Formenelemente bezeichnet. Erfindungsgemäß können die Formenelemente auch Gensegmente sein, die für Formenelemente kodieren. Die als Module fungierenden Formen¬ elemente sollen zufällig kombinierbar sein. Kleinere Proteine oder Untereinheiten für größere Proteine mit bestimmten Eigenschaften werden in einem anschließenden Selektions- schritt aus dem Pool von Modulkombinationen herausgesondert und können ihrerseits wieder als Bausteine in einer Unterein¬ heits-Bibliothek dienen, u.s.w.The method according to the invention is a hierarchical method for the design of proteins, nucleic acids, their derivatives or chemical oligo- or polymers with certain desired properties, starting from module libraries, hereinafter referred to as shape elements. According to the invention, the shape elements can also be gene segments which code for shape elements. The mold elements functioning as modules should be able to be combined at random. Smaller proteins or subunits for larger proteins with certain properties are separated from the pool of module combinations in a subsequent selection step and can in turn serve as building blocks in a subunit library, etc.
Auf jeder Konstruktionsstufe kann durch fehlerhafte Kopierung einzelner Bausteine zusätzlich ein "Rauschen" auf Aminosäure- sequenzebene eingeführt werden. Dies ermöglicht die Modu¬ lierung der dreidimensionalen Anordnung chemischer Gruppen und somit eine weitere funktioneile Optimierung selektierter Moleküle. Die vorgeschlagene Strategie erfordert eine neue Art von "Artificial Gene Assembly" .At each design stage, faulty copying of individual components can also introduce "noise" at the amino acid sequence level. This enables the three-dimensional arrangement of chemical groups to be modulated and thus a further functional optimization of selected molecules. The proposed strategy requires a new type of artificial gene assembly.
Bisher werden vor allem zwei Methoden angewandt, denen gemeinsam ist, daß die DNA in einer bestimmten Orientierung ligiert wird, um damit auch die Abfolge der Aminosäuren festzulegen. Die wohl älteste Methode - von Khorana und
seinen Mitarbeitern entwickelt - arbeitet mit überlappend komplementären einzelsträngigen DNA Molekülen, die vor der Ligation miteinander hybridisiert werden. Die zweite Methode nutzt Schnittstellen von Restriktionsenzymen im zu konstruierenden Gen, um an diesen Stellen das Gen in Blöcke zu unterteilen, die dann in mehreren aufeinanderfolgenden Schritten zusammengesetzt werden. Durch beide Methoden wird die Sequenz an den Übergängen der verwendeten Oligo-DNAs bzw. Blöcke methodisch bedingt festgelegt. Dies aber entspricht gerade nicht der Anforderung nach beliebiger Austauschbarkeit der einzelnen Module schon in der Konstruktionsphase des Gens. Bestandteil der vorliegenden Erfindung ist also not¬ wendigerweise auch eine neue Art des "Artificial Gene Assembly" . Erfindungsgemäß wird in allgemeiner Form wie folgt verfahren:So far, two methods have mainly been used, which have in common that the DNA is ligated in a certain orientation in order to determine the sequence of the amino acids. Probably the oldest method - from Khorana and developed by his team - works with overlapping complementary single-stranded DNA molecules that are hybridized with each other before ligation. The second method uses interfaces of restriction enzymes in the gene to be constructed in order to divide the gene into blocks at these locations, which are then assembled in several successive steps. Both methods determine the sequence at the transitions of the oligo-DNAs or blocks used, depending on the method. However, this does not meet the requirement for any interchangeability of the individual modules already in the design phase of the gene. A new type of "artificial gene assembly" is therefore necessarily part of the present invention. The general procedure according to the invention is as follows:
Das Verfahren des "Artificial Gene Assembly" arbeitet analog des in der WO 92/18645 beschriebenen Verfahrens;The "artificial gene assembly" method works analogously to the method described in WO 92/18645;
das Verfahren erschließt nicht den Umgang mit der Varianz im Sequenzraum sondern mit der Varianz im sogenannten Formenraum. Der Formenraum, gebildet aus Basiselementen definierter stabiler Formenelemente, reduziert die Komplexität der Varianten der Bauelemente des Sequenzraumes;the method does not open up dealing with the variance in the sequence space but with the variance in the so-called form space. The mold space, formed from basic elements of defined stable mold elements, reduces the complexity of the variants of the components of the sequence space;
das Verfahren erschließt den Funktionsraum über eine Variation von Bausteinen des Formenraumes;the process opens up the functional space via a variation of building blocks of the mold space;
als Bausteine werden Bausteine des Form-Codes (siehe unten) eingesetzt;blocks of the form code (see below) are used as blocks;
für die Auswahl der Bausteine werden bestimmte Aus¬ wahlkriterien zur Vorselektion eingesetzt, die theoretischen Annahmen entsprechen oder natürlichen Formen-Analoga entsprechen.
Als Module zur parallel geführten Variation (Mutation) und Selektion stehen bislang nur die Nucleotide oder Aminosäuren als synthetisch oder enzymatisch handhabbare Bausteine eines Polymers für gerichtete Kopplungsprozesse zur Verfügung. Der direkte Zugang zu einer funktionalen Oberflächenstruktur eines Polymers scheitert wie oben angeführt in vielen Fällen am Problem der großen Zahlen der Varianten des Sequenzraumes .For the selection of the building blocks, certain selection criteria for preselection are used which correspond to theoretical assumptions or correspond to natural form analogues. So far, only the nucleotides or amino acids as synthetically or enzymatically manageable building blocks of a polymer for directed coupling processes are available as modules for parallel variation (mutation) and selection. In many cases, the direct access to a functional surface structure of a polymer fails because of the problem of the large number of variants of the sequence space.
Gegenstand dieses evolutiven Anpassungsprozesses ist der Einsatz modularer Bausteine, dem Formencode, bestehend aus den Formenelementen. Der Formencode umfaßt Formenelemente, aufgebaut aus Elementen des Sequenzraumes. Der Formencode, wie er beispielsweise aus natürlichen Polymeren wie Proteinen, Polypeptiden oder funktionalen Nucleinsäuren abgeleitet werden kann, kodiert unter festgesetzten äußeren Bedingungen stabile Formenelemente (Sekundärstrukturen, eventuell Tertiärstrukturelemente enthaltend) . Dabei ist bemerkenswert, daß sehr unterschiedliche Sequenzen (Primär¬ strukturen) für sehr ähnliche Formenelemente kodieren können. Mit anderen Worten, im Formenraum sehr eng benachbarte Elemente können im Sequenzraum sehr weit voneinander entfernt liegen (große Hamming Distanz) . Das gleiche gilt für den umgekehrten Fall. Im erfindungsgemäßen Sinne erklärt eben diese Eigenschaft, daß bereits der Austausch formenmäßig gleicher Sequenzen im Sequenzraum einen großen Schritt im Sinne einer Vielfehlermutante bedeuten kann. Mit Hilfe der erfindungsgemäßen angesprochenen Syntheseverfahren ist diese Anforderung technisch umsetzbar. Die Erstellung der ent¬ sprechenden Verteilungen gelingt durch programmierte Synthese. Sie ist nicht, wie in WO 92/18645 beschrieben, durch fehlerhafte Replikation im Sinne fehlerbehaftete PCR-Verfahren zu erreichen.The subject of this evolutionary adaptation process is the use of modular components, the shape code, consisting of the shape elements. The form code comprises form elements, built up from elements of the sequence space. The shape code, as can be derived from natural polymers such as proteins, polypeptides or functional nucleic acids, encodes stable shape elements (secondary structures, possibly containing tertiary structure elements) under specified external conditions. It is noteworthy that very different sequences (primary structures) can code for very similar form elements. In other words, elements that are very closely adjacent in the mold space can be very far apart in the sequence space (large Hamming distance). The same applies to the reverse case. In the sense of the invention, this property explains that the exchange of identical sequences in the sequence space can mean a major step in the sense of a multi-fault mutant. This requirement can be implemented technically with the aid of the synthesis methods addressed according to the invention. The corresponding distributions can be created by programmed synthesis. As described in WO 92/18645, it cannot be achieved by faulty replication in the sense of faulty PCR methods.
Bei der linearen Kombination von Formencodes können hetereo- loge wie auch zumindest teilweise homologe Formencode verwendet werden, die genotypisch durch einen Formencod natürlichen oder künstlichen Ursprungs definiert werden.
Unter natürlichem Ursprung wird erfindungsgemäß verstanden, daß auf schon vorhandene genetische Informationen zurückge¬ griffen wird, wie sie beispielsweise im Genom von Organismen niedergelegt ist. Unter Formcodes künstlichen Ursprungs wir auf Nucleinsäureebene erfindungsgemäß insbesondere ver¬ standen, daß Sequenzen durch Algorithmen mittels Datenver¬ arbeitungsanlagen generiert werden können, um anschließen nach diesen Anweisungen chemisch synthetisiert zu werden. Schließlich ist auch eine Herstellung durch de novo-Synthese möglich, indem Polymeraεen mit den dazugehörigen Substraten wie Nucleotiden umgesetzt werden. Dabei kann die Polymerase- reaktion matrizenabhängig oder -unabhängig durchgeführt werden.With the linear combination of shape codes, heterologous as well as at least partially homologous shape codes can be used, which are genotypically defined by a shape code of natural or artificial origin. According to the invention, natural origin means that existing genetic information is used, such as that which is stored, for example, in the genome of organisms. According to the invention, shape codes of artificial origin are understood at the nucleic acid level in particular to mean that sequences can be generated by algorithms using data processing systems in order to then be synthesized chemically according to these instructions. Finally, production by de novo synthesis is also possible in that polymerases are reacted with the associated substrates such as nucleotides. The polymerase reaction can be carried out as a function of the template or independently of the template.
Die Formenelemente und Funktionselemente, wie sie gemäß de Erfindung insbesondere verstanden werden, sind beispielsweise in Proteinen oder Peptiden als Phänotypen auffaßbar. Die entsprechenden Genotypen, beispielsweise auf Nucleinsäure¬ ebene, sind dazu die entsprechenden Formen- und Funktions¬ codes. Bleibt man zum Beispiel auf der Nucleinsäureebene so wird der "Phänotyp" mit Funktionselementen und/oder Formen¬ elementen, zum Beispiel durch ein Ribozym verkörpert, welches genotypisch in einer Nucleinsäuresequenz als Formencode und/oder Funktionscode entsprechend reflektiert wird. Dies bedeutet, daß erfindungsgemäß die Begriffe Funktions-/Formen¬ element (Phänotyp) stets quasi als komplementär mit de Begriff Funktions-/Formencode (Genotyp) verstanden werden.The form elements and functional elements, as they are understood in particular according to the invention, can be understood, for example, in proteins or peptides as phenotypes. The corresponding genotypes, for example at the nucleic acid level, are the corresponding form and function codes. If, for example, one stays at the nucleic acid level, the "phenotype" is embodied with functional elements and / or form elements, for example by a ribozyme which is reflected genotypically in a nucleic acid sequence as a form code and / or function code. This means that, according to the invention, the terms function / form element (phenotype) are always understood to be quasi complementary to the term function / form code (genotype).
Die Formenelemente und/oder Funktionselemente bzw. Formen- codes und/oder Funktionscodes können, sofern sie Nuclein¬ säuren sind, durch verschiedene Verfahren gewonnen werden, wie dies weiter oben angegebenen ist, nämlich durch Rückgrif auf schon bekannte Nucleinsäuresequenzen, durch Generierun künstlicher Sequenzen in Datenverarbeitungsanlagen oder durc de novo-Synthese.
Die Figur 8 erläutert die Begriff Sequenzraum, Formenraum und Funktionsraum. Analog der betrachteten Beziehung von Formenraum und Sequenzraum gilt für die Beziehung von Formen¬ raum und Funktionsraum, daß eng benachbarte, homologe Ele¬ mente im Formenraum im Funktionsraum weit voneinander ent¬ fernt sein können. Wie in Figur 8 schematisch angedeutet, ist für die Funktion eines Polymers die Geometrie und die physicochemische Topologie und Dynamik der Moleküloberfläche maßgebend, die mit einem zweiten Molekül in Wechselwirkung tritt. Die darunterliegende Struktur, definiert aus dem Formencode, könnte sehr unterschiedlicher chemischer Natur sein. Ähnliche Funktionen im Funktionenraum erklären sich durch ähnliche Grenzflächen-Topologien.The shape elements and / or function elements or shape codes and / or function codes, provided they are nucleic acids, can be obtained by various methods, as indicated above, namely by using already known nucleic acid sequences, by generating artificial sequences in Data processing systems or durc de novo synthesis. FIG. 8 explains the terms sequence space, form space and functional space. Analogously to the relationship between mold space and sequence space, it applies to the relationship between mold space and functional space that closely adjacent, homologous elements in the mold space in the functional space can be far removed from one another. As indicated schematically in FIG. 8, the geometry and the physicochemical topology and dynamics of the molecular surface, which interacts with a second molecule, are decisive for the function of a polymer. The underlying structure, defined from the shape code, could be of very different chemical nature. Similar functions in the functional space can be explained by similar interface topologies.
Gerade im Hinblick auf die in Experimenten realisierbaren relativ kleinen Molekülpopulationen, ist es von ent¬ scheidender Bedeutung, daß die erzeugte Variation im Formen¬ raum in viel effizienterer Weise als etwa die Variation im Sequenzraum die mögliche Funktionenvielfalt im Funktionsraum repräsentiert .With regard to the relatively small molecular populations that can be realized in experiments, it is of crucial importance that the variation in the mold space represents the possible variety of functions in the functional space in a much more efficient manner than, for example, the variation in the sequence space.
Die folgenden Figurenbeschreibungen erläutern an Beispielen schematisch die Erfindung näher.The following description of the figures schematically explains the invention in more detail using examples.
Die Figur 1 betrifft zwei einzelsträngige DNA bzw. RNA- Moleküle, die chemisch oder enzymatisch (z.B. T4 RNA Ligase) ligiert werden, wobei eines der Moleküle über einen spalt¬ baren Linker (z.B. Biotin-Streptavidin) an fester Phase immobilisiert ist, während das andere Molekül frei in Lösung vorliegt .Figure 1 relates to two single-stranded DNA or RNA molecules that are ligated chemically or enzymatically (e.g. T4 RNA ligase), one of the molecules being immobilized on a solid phase via a cleavable linker (e.g. biotin-streptavidin), while the other molecule is free in solution.
Es stehen dazu heute eine ganze Reihe von Festphasen¬ materialien (z.B. magnetische, oberflächenaktivierte Kunst¬ stoffkugeln) zur Verfügung. Dieses Verfahren gestattet de schrittweisen Aufbau von größeren DNAs bzw. RNAs. Nach jede Ligationsschritt werden nicht umgesetzte RNAs weggewasche und die an fester Phase befindlichen Ligationsprodukte i
den nächsten Ligationsansatz transferiert. Vorteilhafterweis ist die Handhabung, insbesondere die Reinigung der jeweilige Ligationsprodukte sehr einfach.A whole series of solid phase materials (for example magnetic, surface-activated plastic balls) are available today for this purpose. This method allows the step-by-step construction of larger DNAs or RNAs. After each ligation step, unreacted RNAs are washed away and the solid phase ligation products i transferred the next ligation approach. The handling, in particular the cleaning of the respective ligation products is advantageously very simple.
Nach Abschluß der letzten Ligation wird das Produkt direk als Effektormolekül eingesetzt oder in einer (in vitro) Translationsreaktion zunächst in die entsprechende Protein¬ struktur übersetzt, welche dann als Effektormolekül fungiert.After completion of the last ligation, the product is used directly as an effector molecule or is first translated in an (in vitro) translation reaction into the corresponding protein structure, which then acts as an effector molecule.
Die Figur 2 betrifft zwei vollständig doppelsträngige DNA- Moleküle, die chemisch oder enzymatisch (z.B. T4 DNA Ligase) "blunt end" ligiert werden, wobei eines über einen spaltbare Linker an fester Phase immobilisiert ist, während das ander frei in Lösung vorliegt. Auf diese Weise können schrittweis größere doppelsträngige DNA Moleküle aufgebaut werden. Di gerichtete Ligation wird durch unterschiedliche Phosphory- lierung der Reaktionspartner erreicht. Modul A und das letzt Modul sind so entworfen, daß sie jeweils eine Schnittstell für ein Restriktionsenzym enthalten. Dies ermöglicht ersten die Abspaltung des Produktes von der festen Phase und zweit¬ ens die anschließende, gerichtete Klonierung der DNA (sieh auch Figur 5) .Figure 2 relates to two completely double-stranded DNA molecules that are chemically or enzymatically (e.g. T4 DNA ligase) ligated "blunt end", one being immobilized on a solid phase via a cleavable linker, while the other is freely in solution. In this way, larger double-stranded DNA molecules can be built up step by step. The directed ligation is achieved by different phosphorylation of the reactants. Module A and the last module are designed so that they each contain an interface for a restriction enzyme. This enables first the cleavage of the product from the solid phase and second the subsequent, directed cloning of the DNA (see also FIG. 5).
Zu Figur 3 : DNA-Moleküle können gemäß Figur 2 ebenfall ligiert werden, wenn das in Lösung befindliche Molekül a einer Seite ein einzelsträngiges Ende besitzt, d.h. 'nich vollständig doppelsträngig vorliegt. Dieses Ende steht au diese Weise nicht für die Doppelstrang-spezifische Ligation, z.B. mit T4 DNA Ligase zur Verfügung. In Kombination mit de schon erwähnten Phosphorylierungsstrategien (Figur 2, insbe sondere Variante 1) ergibt sich die Möglichkeit, die Ligatio ohne unerwünschte Nebenprodukte durchzuführen. Das in Lösun befindliche DNA-Molekül kann so entworfen sein, daß es vo seinem einzelsträngigen Ende noch die Schnittstelle eine Restriktionsenzyms vorzugsweise die eines Class IIS Enzym (z.B. Alwl) mit Erkennungsstelle in dem abzuschneidenden teilweise einzelsträngigen DNA-Stück) besitzt. Nach de
Ligation kann das Ligationsprodukt an fester Phase mit dem Restriktionsenzym geschnitten werden. Auf diese Weise entsteht wieder ein vollständig doppelsträngiges DNA-Molekül an fester Phase. Alternativ kann das einzelsträngige Ende mit einer Polymerase zum Doppelstrang aufgefüllt oder mit einer Exonuclease abverdaut werden.To 3: 2 DNA molecules can be ligated just case according to when the molecule in solution a one side of a single-stranded end has, that is' Not present fully double-stranded. In this way, this end is not available for double-strand-specific ligation, for example with T4 DNA ligase. In combination with the phosphorylation strategies already mentioned (FIG. 2, in particular variant 1) there is the possibility of performing the ligatio without undesired by-products. The DNA molecule in solution can be designed so that from its single-stranded end it still has the interface of a restriction enzyme, preferably that of a Class IIS enzyme (for example Alwl) with a recognition site in the partially single-stranded DNA piece to be cut off. According to de In ligation, the solid phase ligation product can be cut with the restriction enzyme. In this way, a completely double-stranded DNA molecule is formed on the solid phase. Alternatively, the single-stranded end can be filled up to the double strand with a polymerase or digested with an exonuclease.
Zu Figur 4 : Restriktionsschnittstellen können (überlappend) auch entstehen, indem zwei doppelsträngige DNA-Moleküle miteinander ligiert werden.Regarding Figure 4: Restriction interfaces can also arise (overlapping) by ligating two double-stranded DNA molecules together.
Zu Figur 5: Vollständig oder teilweise doppelsträngige DNA-Moleküle können gemäß Figuren 1 - 4 ligiert werden, auch wenn Mischungen von Molekülen (z. B. B, C, D) verwendet werden. Auf diese Weise entstehen Mischungen von immobi¬ lisierten Molekülen, die jeweils verschiedenen Kombinationen der eingesetzten Bausteine entsprechen. Am Ende des letzten Ligationsschrittes kann die Gesamt-DNA oder ein Teil davon mit Hilfe von Restriktionsenzymen, die innerhalb des Kon- struktes schneiden, von der festen Phase abgespalten und ggf. in ein Phagen- oder Bakteriendisplay-System kloniert werden, die DNA kann aber auch in einem kombinierten in vitro Trans¬ kriptions- und Translationssystem exprimiert werden.Regarding FIG. 5: Completely or partially double-stranded DNA molecules can be ligated according to FIGS. 1-4, even if mixtures of molecules (eg B, C, D) are used. In this way, mixtures of immobilized molecules are formed, each of which corresponds to different combinations of the building blocks used. At the end of the last ligation step, all or part of the DNA can be cleaved from the solid phase using restriction enzymes that cut within the construct and, if necessary, cloned into a phage or bacterial display system, but the DNA can can also be expressed in a combined in vitro transcription and translation system.
Zu Figur 6: Ausgehend von Modul-Bibliotheken können Peptide, Proteindomänen und kleine Proteine durch zufällige Kom¬ bination von einzelnen Modulen erzeugt werden. Entsprechend einem hierarchischen Verfahren zum Proteindesign können in einer weiteren Stufe dann auch Proteindomänen als Bausteine kombiniert werden. Auf jeder Komplexitätsstufe können Mutationen eingefügt werden, die - ohne die globale Struktur zu verändern - eine Feinabstimmung der dreidimensionalen An¬ ordnung chemischer Gruppen erlauben.6: Starting from module libraries, peptides, protein domains and small proteins can be generated by random combination of individual modules. According to a hierarchical method for protein design, protein domains can then also be combined as building blocks in a further stage. At any level of complexity, mutations can be inserted which - without changing the global structure - allow fine-tuning of the three-dimensional arrangement of chemical groups.
Figur 7 erläutert schematisch, daß verschiedene Proteine trotz unterschiedlicher, katalytisch aktiver Aminosäuren im aktiven Zentrum in Bezug auf das Substrat homologe Funktionen
besitzen (Chymotrypsin/Trypsin) oder trotz ähnlicher räum¬ licher Anordnung der Aminosäuren im aktiven Zentrum gänzlich unterschiedliche Reaktionen katalysieren (Trypsin/Elastase) können.FIG. 7 schematically explains that different proteins, despite different, catalytically active amino acids in the active center, have homologous functions with respect to the substrate possess (chymotrypsin / trypsin) or, despite a similar spatial arrangement of the amino acids in the active center, can catalyze completely different reactions (trypsin / elastase).
Figur 8 erläutert den Zusammenhang der Begriffe Sequenzraum- Formenraum-Funktionsraum.FIG. 8 explains the relationship between the terms sequence space, form space and functional space.
Fig. 9 - 11Figures 9-11
Oligomere oder Polymere werden durch matrizenabhängige, enzymatische oder chemische Synthese durch Verlängerung von stochastischen (randomisierten) oder ausgewählten (kon¬ struierten) Primer-Molekülen hergestellt. Die Primer können komplementär zu 1.) diskreten Sequenzen ausschließlich am Ende des ursprünglichen Matrizen-Moleküls (Figur 9/10) diskreten Sequenzen überall im ursprünglichen Matrizen- Molekül sein (Figur 10/11) aus einer Mischung von Zufalls¬ sequenzen bestehen, die die Synthese je nach (teilweiser) Komplementarität zufällig an vielen Stellen beginnen lassen (Fig. 10) .Oligomers or polymers are produced by matrix-dependent, enzymatic or chemical synthesis by extending stochastic (randomized) or selected (designed) primer molecules. The primers can be complementary to 1.) discrete sequences exclusively at the end of the original template molecule (FIG. 9/10). Discrete sequences anywhere in the original template molecule (FIG. 10/11) consist of a mixture of random sequences which consist of the Depending on the (partial) complementarity, let the synthesis start randomly at many places (Fig. 10).
Entweder die Primer oder, wie in der Figur gezeigt, auch die Matrizen-DNA können zur Vereinfachung späterer Aufreinigungs- prozeduren biotinyliert sein. Dies würde insbesondere bei der Strangtrennung (z. B. an Streptavidin-Dynabeads) zur Aufreinigung der verlängerten Primer günstig sein.Either the primers or, as shown in the figure, also the template DNA can be biotinylated to simplify later purification procedures. This would be particularly advantageous for strand separation (e.g. on streptavidin-Dynabeads) for the purification of the extended primers.
Fig. 12Fig. 12
Statt normaler dNTPs (Desoxy-Nucleosidtriphosphate) werden insbesondere thio-NTPs eingesetzt. Kettenabbruchmoleküle können dann zum Beispiel normale ddNTPs (Didesoxy-Nucleosid- triphosphate) sein. Es ist bekannt, daß Phosphodiester- bindungen leicht durch Exonuclease III in 50 mM Tris/HCl, 5 mM MgCl2, bei pH 10,0 spezifisch in Minuten gespalten werden können. Thiophosphat-Bindungen werden dagegen nicht gespalten (Labeit et al . , DNA 5:173, 1986) . Auf diese Weise kann man nach Inaktivierung der Polymerase die Enden der
entstandenen Polymere durch enzymatisches Entfernen der ddNTPs "entschützen" .Instead of normal dNTPs (deoxy-nucleoside triphosphates), thio-NTPs in particular are used. Chain termination molecules can then be, for example, normal ddNTPs (dideoxy nucleoside triphosphates). It is known that phosphodiester bonds can easily be cleaved specifically in minutes by exonuclease III in 50 mM Tris / HCl, 5 mM MgCl 2 , at pH 10.0. In contrast, thiophosphate bonds are not cleaved (Labeit et al., DNA 5: 173, 1986). In this way, the ends of the "Deprotect the resulting polymers by enzymatic removal of the ddNTPs.
Fig. 13Fig. 13
Die entstandenen und entschützten Polymere können entweder thermisch oder chemisch, z. B. mit NaOH, getrennt werden, wobei sich die Biotin-gekoppelten Moleküle z. B. an Streptavidin-Dynabeads abtrennen lassen. Nach Einstellen physiologischer Bedingungen hybridisieren die entschützten Polymere zu teilweise überlappenden Duplices.The resulting and deprotected polymers can be either thermally or chemically, e.g. B. with NaOH, separated, the biotin-coupled molecules z. B. on streptavidin-Dynabeads. After physiological conditions have been set, the deprotected polymers hybridize to partially overlapping duplexes.
Fig. 14Fig. 14
PCR ohne Primer führt zur eigentlichen (Re-) Kombination der Polymere und zur weiteren Verlängerung derselben. Nachdem die teilweise überlappenden Duplices vervollständigt wurden, findet eine weitere PCR mit (endständigen) Primern Staat, die wieder Produkte der ursprünglichen Länge erzeugt. Darunter befinden sich auch solche Sequenzen, in denen mehrere Marker vereinigt, neu kombiniert sind.PCR without a primer leads to the actual (re) combination of the polymers and to a further extension of the same. After the partially overlapping duplexes have been completed, another PCR with (terminal) primers finds state, which again produces products of the original length. These include sequences in which several markers are combined and newly combined.
Der Sequenzraum ist durch die linearen Nachbarschafts¬ beziehungen der Polymer-Bauelemente einer Polymerstruktur definiert. Homologien beschreiben Ähnlichkeiten (in %) in der Abfolge der Bauelemente einer chemischen Stoffklasse. Je höher der Verwandtschaftsgrad zweier Sequenzen desto geringer der Abstand im Sequenzraum.The sequence space is defined by the linear neighborhood relationships of the polymer components of a polymer structure. Homologies describe similarities (in%) in the sequence of the components of a chemical substance class. The higher the degree of relationship between two sequences, the smaller the distance in the sequence space.
a) ... AATAATGCGCAATATTAGGCCT... b) ... AATAAAAAGCAATATTAAGCCT... c) ... TTAGCTAGCGATGCGCGCCGGG ...a) ... AATAATGCGCAATATTAGGCCT ... b) ... AATAAAAAGCAATATTAAGCCT ... c) ... TTAGCTAGCGATGCGCGCCGGG ...
Zum Beispiel weisen die Sequenzen a) und b) eine erhebliche Homologie auf, während Sequenz c) keinerlei Ähnlichkeiten mit a) und b) zeigt.For example, sequences a) and b) show considerable homology, while sequence c) shows no similarities with a) and b).
Der Formenraum ist definiert durch die "räumlichen" Nach¬ bai rhaftsbeziehungen der durch ihn repräsentierten Polymere.
Der Abstand zweier Sequenzen ist durch den Verwandtschafts¬ grad ihrer Strukturen bestimmt. Homologie bedeutet hier Ähnlichkeit der Gesamtstrukturen von Polymeren, die wiederum aus chemisch verknüpften Bauelementen bestehen. Im Formenraum benachbarte Moleküle können im Sequenzraum durchaus weit voneinander entfernt liegen und umgekehrt. [Analog s. o. : Struktur a) 3 alpha-Helices, Struktur b) 2 Alpha-Helices plus unstrukturierter Bereich mit endständiger, kurzer Helix, c) antiparalleles beta-Faltblatt aus 4 Blättern] Der Funktionen¬ raum ist definiert durch die geometrische, dynamische und physikalisch/chemische Oberflächenstruktur, die mit einem weiteren Molekül in spezifische Wechselwirkung treten kann. Homologien beschreiben Ähnlichkeiten der Oberflächenstruktur und den damit verbundenen Wechselwirkungseigenschaften.The mold space is defined by the "spatial" neighboring relationships of the polymers represented by it. The distance between two sequences is determined by the degree of relationship between their structures. Homology here means similarity of the overall structures of polymers, which in turn consist of chemically linked components. Molecules adjacent in the mold space can be far apart in the sequence space and vice versa. [Analogous to this: structure a) 3 alpha helices, structure b) 2 alpha helices plus unstructured area with terminal, short helix, c) antiparallel beta sheet from 4 sheets] The functional space is defined by the geometric, dynamic and physical / chemical surface structure that can interact with another molecule. Homologies describe similarities in the surface structure and the associated interaction properties.
Im folgenden werden lineare Kombinationen von Formencodes über in vitro Rekombination von Formencodes aus natürlichen oder in vitro hergestellten Muteinen beschrieben.Linear combinations of shape codes via in vitro recombination of shape codes from natural or in vitro produced muteins are described below.
Bei der linearen Kombination von Formencodes können hetero- loge wie auch zumindest teilweise homologe Formencodes verwendet werden. Sequenzhomologe For encodes können zufällig in einer zu rekombinierenden Mischung vorhanden sein oder bewußt ausgewählt werden. Diese Mischung kann beispielsweise, wie bei Eigen & Henco WO 92/18645 beschrieben, homolog auseinander hervorgegangene Mutantenkollektive einer Aus- gangssequenz, oder homologe Gene verwandter oder unterschied¬ licher Organismen enthalten. Dabei können ähnliche Sequenzen, z. B. bezüglich ihrer Funktionscodes, sehr unterschiedlich sein.With the linear combination of shape codes, heterologous as well as at least partially homologous shape codes can be used. Sequence homologs for encodes can be randomly present in a mixture to be recombined or can be deliberately selected. This mixture can, for example, as described in Eigen & Henco WO 92/18645, contain mutually collective mutant groups of an initial sequence, or homologous genes of related or different organisms. Similar sequences, e.g. B. be very different in terms of their function codes.
Die Natur hat für ein und dieselbe oder sehr ähnliche Reaktionen, für verschiedene Wirtssystem ähnliche oder mole¬ kular unterschiedliche Enzyme evolviert, von denen angenommen werden kann, daß sie für die jeweilige Umgebung, für die sie angepaßt wurden, optimale Lösungen bieten. Dafür ist die Penicillinacylase beispielhaft. Dieses Enzym ist für die
industrielle Anwendung im Bereich der Synthese von zentrale Bedeutung. Vor einer Synthese halbsynthetischer Derivate de Penicillin-Grundköpers muß in natürlicher Weise synthe tisiertes Penicillin zunächst schonend einer Acylase-Reaktio unterworfen werden, bevor es in einer Umkehrung des Prozesse wiederum mit künstlichen Derivaten reacyliert werden kann. Für beide Reaktionen kann die Penicillinacylase eingesetz werden. Für diese Reaktion sind bestimmte Reaktions bedingungen und Substrate erwünscht . Diese Bedingunge unterscheiden sich jedoch von der in vivo Situation de Mikroorganismus, aus dem jeweils Penicillinacylasen isolier wurden. Dies trifft zum Beispiel auf die optimale Lage de Gleichgewichtes für das acylierte Syntheseprodukt oder fü die hydrolytische Spaltung zu. Es ist gewünscht, das Enzy bezogen auf die Umsatzzahl unter den industriell am beste geeigneten Bedingungen zu optimieren.Nature has developed similar or molecularly different enzymes for one and the same or very similar reactions, for different host systems, which enzymes can be assumed to offer optimal solutions for the particular environment for which they were adapted. Penicillin acylase is an example of this. This enzyme is for that industrial application in the field of synthesis of central importance. Before a synthesis of semi-synthetic derivatives of the basic penicillin body, synthetic penicillin must first be gently subjected to an acylase reaction before it can be reactivated with artificial derivatives in a process reversal. Penicillin acylase can be used for both reactions. Certain reaction conditions and substrates are desired for this reaction. However, these conditions differ from the in vivo situation of the microorganism from which penicillin acylases were isolated in each case. This applies, for example, to the optimal position of the equilibrium for the acylated synthesis product or for the hydrolytic cleavage. It is desirable to optimize the enzyme based on the number of sales under the industrially most suitable conditions.
Insbesondere kann von einem Gen einer bestimmten natürlic vorkommenden Acylase ausgegangen und diese konsekutive Mutations- und Selektionszyklen unterworfen werden. Wen verschiedene, aktive Mutanten gefunden sind, lassen sich di als positiv selektierten unterschiedlichen Varianten bezoge auf die jeweils selektierten Punktmutationen über Re kombination ein weiteres Mal durchmischen. Die so z mischenden Varianten können wie in WO 92/18645 beschriebe gewonnen werden. Die Natur verfügt häufig bereits über ein Kollektion von positiv selektierten Muteinen in Form de Enzymgene aus verschiedenen Mikroorganismen, die beispiels weise den gewünschten Reaktionstyp katalysieren. Von diese Kollektionen ausgehend, lassen sich bereits Spektren rekombi nierter Formencodes und Funktionscodes erzeugen, bevo eventuell wieder im weiteren Verlauf Mutations- oder ein Kombination von Mutations-/Rekombinationszyklen durchlaufe werden. Es ist durchaus vorteilhaft, am Anfang eines solche Prozesses von möglichst umfangreichen Formencodes auszugehen deren Mutationen sich in einem bestimmten Kontext des je weiligen Gens als positiv oder neutral erwiesen haben.
Die in vitro-Rekombination wird dabei vorzugsweise nach zwei unterschiedlichen Strategien durchgeführt.In particular, one can start from a gene of a certain naturally occurring acylase and subject it to consecutive mutation and selection cycles. Whom different active mutants are found can be mixed again as positive selected different variants related to the selected point mutations via recombination. The variants mixing in this way can be obtained as described in WO 92/18645. Nature often already has a collection of positively selected muteins in the form of enzyme genes from various microorganisms that catalyze the desired type of reaction, for example. Starting from these collections, spectra of recombined form codes and function codes can already be generated, before mutation cycles or a combination of mutation / recombination cycles may be run again in the further course. At the beginning of such a process, it is entirely advantageous to start with the most extensive possible form codes, the mutations of which have proven to be positive or neutral in a specific context of the respective gene. The in vitro recombination is preferably carried out according to two different strategies.
Rekombination kann ein in der Regel unerwünschtes Neben¬ produkt einer Amplifikationsreaktion im Sinne einer PCR- Reaktion sein. Wenn in der Sättigungsphase einer PCR-Reaktion nach dem Durchlaufen vieler Zyklen die Lösung an Reagentien oder Enzym verarmt und die Reaktion unterhalb des Km-Wertes für bestimmte Nucleotidtriphosphate verläuft, kommt es zwangsläufig zu nicht fertiggestellten Syntheseprodukten. Solche Ereignisse sind als unerwünschte Artefakte bereits von Simon Wain-Hobson diskutiert worden, um HIV-Varianten als mögliche Artefakte nach erfolgter PCR-Amplifikation zu beschreiben. Dieser Effekt wird aber erfindungsgemäß einge¬ setzt und gesteuert, insbesondere noch verstärkt, daß wunsch¬ gemäß unvollständig synthetisierte Produkte dominant werden. Wenn gleichzeitig die Primer-induzierte Neusynthese unvoll¬ ständig erfolgt, hybridisieren maßgeblich unvollständige Syntheseprodukte mit vollständig oder ebenfalls unvollständig synthetisierten Gegensträngen. Dabei kommt es zu molekularen Rekombinationsereignissen, bei denen verschiedene Gensegmente im Sinne einer Rekombination von Formencodes miteinander rekombiniert werden.Recombination can be a generally undesirable by-product of an amplification reaction in the sense of a PCR reaction. If, in the saturation phase of a PCR reaction, after many cycles have been run through, the solution becomes depleted of reagents or enzyme and the reaction is below the Km value for certain nucleotide triphosphates, unfinished synthesis products inevitably result. Such events have already been discussed by Simon Wain-Hobson as undesirable artifacts in order to describe HIV variants as possible artifacts after PCR amplification. However, this effect is used and controlled according to the invention, in particular further intensified, that products which are incompletely synthesized as desired become dominant. If at the same time the primer-induced resynthesis is incomplete, significantly incomplete synthesis products hybridize with completely or likewise incompletely synthesized counter-strands. This leads to molecular recombination events in which different gene segments are recombined with one another in the sense of a recombination of shape codes.
Erfindungsgemaß läßt sich nach einer weiteren spezifischen Vorgehensweise die Rekombination während und nicht nur nach einer PCR-Reaktion steuern. Hierbei werden der standard¬ mäßigen PCR-Reaktion kurze Oligomere zugesetzt, die nur dann als PCR-Primer fungieren, wenn die Initiation der Synthese mittels thermostabiler Polymerase bei vergleichsweise tiefen Temperaturen erfolgt. Wann immer die korrekte PCR-Reaktion dominieren soll, wird ein normaler Temperaturzyklus ausge¬ führt. Wenn es zu internen Startreaktionen kommen soll, werden einige Zyklen bei niedriger Temperatur initiiert, eventuell unter Zusatz von Polymerasen wie DNA-Polymerase I, wie sei bei Oligomer-gestarteten Markierungsreaktionen eingesetzt wird (Sambrook, Fritsch, Maniatis, "Molecular
cloning") . Die entstehenden unvollständigen Sequenzen können sich bei weiteren A plifikationsrunden zusammenlagern, wobei die überhängenden Enden jeweils am 3'-Ende aufgefüllt werden können. Bei diesen Reaktionen muß gemäß an sich bekannten Reassoziationskinetik von Nucleinsäuren darauf geachtet werden, daß die für eine Rekombination bestimmten Sequenzen in hinreichender Konzentration zur Verfügung stehen, um in wenigen Sekunden bis Minuten die unvollständig gepaarten Duplices auszubilden. Um zu vermeiden, daß bei der matrizen¬ vermittelten Neusynthese unerwünscht eine Strangverdrängung anstelle eines Rekombinationsereignisses stattfindet, werden insbesondere solche Poly erasen verwendet, die keine Strang¬ verdrängung induzieren oder keine 5' -3' -Exonucleaseaktivität aufweisen. Stattdessen lassen sich bevorzugt thermostabile Ligasen einsetzen, so daß Rekombinationsereignisse durch kovalente Verknüpfung der Fragmente fixiert werden.According to the invention, the recombination can be controlled during a further specific procedure and not only after a PCR reaction. Short oligomers are added to the standard PCR reaction, which only act as PCR primers when the synthesis is initiated by means of thermostable polymerase at comparatively low temperatures. Whenever the correct PCR reaction should dominate, a normal temperature cycle is carried out. If internal start reactions are to occur, a few cycles are initiated at low temperature, possibly with the addition of polymerases such as DNA polymerase I, as is used in oligomer-started labeling reactions (Sambrook, Fritsch, Maniatis, "Molecular cloning "). The resulting incomplete sequences can aggregate in further rounds of amplification, the overhanging ends being able to be filled in at the 3 'end. In these reactions, in accordance with known kinetics of association of nucleic acids, care must be taken to ensure that those for recombination Certain sequences are available in sufficient concentration to form the incompletely paired duplexes in a few seconds to minutes ¬ induce displacement or have no 5 '-3' exonuclease activity, instead thermostable ligases can be used instead, so that recombination events are fixed by covalently linking the fragments.
Im erfindungsgemäßen Verfahren zur Rekombination von Formen- codes setzt man Elemente mit zumindest teilweisen Sequenz¬ homologien, wie sie oben beschrieben wurden, ein. Mit Hilfe matrizenabhängiger chemischer oder enzymatischer DNA- oder RNA-Synthese durch Verlängerung von erzeugten (randomi- sierten) Primern oder ausgewählten (konstruierten) Primern wird eine Vielzahl von Fragmenten mindestens einer ursprüng¬ lichen Sequenz erzeugt (s. Fig. 9 - 11) . Ausgewählte Primer mit definierter Sequenz können dabei so positioniert werden, daß bestimmte Bereiche der zu bearbeitenden DNA- ode rRNA- Moleküle, z. B. aktiven Zentren, Endonuclease-spezifische Spaltstellen oder genregulatorische Elemente, vom Rekom¬ binationsprozeß ausgeschlossen sind und somit unverändert erhalten bleiben. Der Einsatz teilweise randomisierter Primer in Bereichen (partieller) Komplementarität analog Mutagani- sierungs-Primern, kann dazu verwendet werden, zusätzlich eine erhöhte Mutationsrate einzuführen. Durch den Einsatz einer kleinen, subinhibitorischen Menge von Kettenabbruchmonomeren, in der DNA-Synthese von vorzugsweise Dideoxynucleotiden, wir ein zufälliger Abbruch der Verlängerungsreaktion und damit
eine Längenvarianz der synthetisierten Polymere erreicht. Mittels des Verhältnisses der Konzentration des Abbruch¬ reagenz zu den Konzentrationen der Nucleotidmonomeren läßt sich wie bei einer Sequenzierungsreaktion die durchschnitt¬ liche Kettenlänge des Syntheseproduktes steuern. Nach Ab¬ trennung des polymerisierenden Agenz, beispielsweise einer Inaktivierung des Enzyms, kann die endständige Schutzgruppe, d. h. das Kettenabbruchmonomer ganz oder teilweise wiede abgespalten werden, damit die entstehenden Polymere wieder gute Substrate für die Verlängerungsreaktion sind (Fig. 12) . Die so entschützten DNA- oder RNA-Polymere werden dan mindestens einem Zyklus aus Denaturierung/Hybridisierun teilweise komplementärer Stränge gefolgt von einer Auffüll- reaktion unterzogen. Am Schluß des Verfahrens wird das entstandene Gemisch verlängerter Polymere einer Polymerase- Kettenreaktion unterzogen, wobei die Primer vorzugsweise komplementär zu den Enden der ursprünglich eingesetzte Sequenz liegen sollten. Auf diese Weise entstehen wiede Produkte der ursprünglichen Länge. Diese enthalten jetzt abe Kombinationen von Sequenzabschnitten verschiedener vorteil¬ hafter, bereits selektierter, einzelner Punktionmutatione in sehr effizienter Weise zu kombinieren, statt sie sequentiell in einem stochastischen Prozeß erst erzeugen z müssen
In the method according to the invention for the recombination of shape codes, elements with at least partial sequence homologies as described above are used. A large number of fragments of at least one original sequence are generated with the aid of template-dependent chemical or enzymatic DNA or RNA synthesis by extending generated (randomized) primers or selected (constructed) primers (see FIGS. 9-11). Selected primers with a defined sequence can be positioned so that certain areas of the DNA or rRNA molecules to be processed, eg. B. active centers, endonuclease-specific cleavage sites or gene regulatory elements are excluded from the recombination process and thus remain unchanged. The use of partially randomized primers in areas of (partial) complementarity analogous to mutaganization primers can also be used to introduce an increased mutation rate. By using a small, sub-inhibitory amount of chain termination monomers in the DNA synthesis of preferably dideoxynucleotides, we randomly terminate the extension reaction and thus achieved a variance in length of the synthesized polymers. By means of the ratio of the concentration of the termination reagent to the concentrations of the nucleotide monomers, as in a sequencing reaction, the average chain length of the synthesis product can be controlled. After separation of the polymerizing agent, for example inactivation of the enzyme, the terminal protective group, ie the chain termination monomer, can be split off in whole or in part so that the resulting polymers are again good substrates for the extension reaction (FIG. 12). The DNA or RNA polymers deprotected in this way are then subjected to at least one cycle of denaturation / hybridization of partially complementary strands, followed by a replenishment reaction. At the end of the process, the resulting mixture of extended polymers is subjected to a polymerase chain reaction, the primers should preferably be complementary to the ends of the originally used sequence. In this way, products of the original length are created. These now contain a number of combinations of sequence sections of different advantageous, already selected, individual puncture mutations in a very efficient manner, instead of having to generate them sequentially in a stochastic process
Claims
1. Verfahren zur Herstellung oligomerer oder polymerer Funktion¬ selemente aus Formenelementen, wobei die Funktionselemente erhältlich sind durch Verknüpfung von mindestens zwei Formen¬ elementen, von denen mindestens ein Formenelement selbst aus mindestens zwei Monomeren aufgebaut ist, die durch mindestens eine chemische Bindung verknüpft sind, die der chemischen Bindung zwischen zwei Formenelementen entspricht .1. Process for the production of oligomeric or polymeric functional elements from molded elements, the functional elements being obtainable by linking at least two molded elements, of which at least one molded element itself is composed of at least two monomers which are linked by at least one chemical bond, which corresponds to the chemical bond between two form elements.
2. Verfahren gemäß Anspruch 1, wobei die Verknüpfung der Formen¬ elemente unter Einsatz einer festen Phase als Reaktionsträger durchgeführt wird.2. The method according to claim 1, wherein the linking of the mold elements is carried out using a solid phase as a reaction carrier.
3. Verfahren gemäß Anspruch 1 und/oder 2, wobei die Verknüpfung der Formenelemente chemisch und/oder enzymatisch erfolgt .3. The method according to claim 1 and / or 2, wherein the linking of the shaped elements is carried out chemically and / or enzymatically.
4. Verfahren gemäß mindestens einem der Ansprüche 1 - 3 , wobei die Verknüpfung von Formenelementen zu Funktionselemente planmäßig und/oder stochastisch erfolgt.4. The method according to at least one of claims 1-3, wherein the linking of form elements to functional elements takes place according to plan and / or stochastically.
5. Verfahren gemäß mindestens einem der Ansprüche 1 - 4 , wobei die Verknüpfung schrittweise aufbauend, stereospezifisc und/oder gerichtet erfolgt.5. The method according to at least one of claims 1-4, wherein the link is step-by-step, stereospecific and / or directional.
6. Verfahren gemäß mindestens einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, daß die Formenelemente zur Stoff- klasse der Nucleinsäuren, doppelsträngiger und/oder einzel- strängiger DNA und/oder RNA und/oder modifizierten Nuclein¬ säuren und/oder Peptiden und/oder Polypeptiden gehöre und/oder aus sonstigen kopplungsfähigen chemischen Oligomer- Formenelementen aufgebaut sind.6. The method according to at least one of claims 1 to 5, characterized in that the shaped elements to the substance class of the nucleic acids, double-stranded and / or single-stranded DNA and / or RNA and / or modified nucleic acids and / or peptides and / or belong to polypeptides and / or are constructed from other couplable chemical oligomer shaped elements.
7. Verfahren gemäß mindestens einem der Ansprüche 1 - 6, dadurc gekennzeichnet, daß die Formenelemente als bereits synthe tisierte Oligomer-Bausteine eingesetzt werden oder zunächs im Reaktionsgefäß generiert werden. 7. The method according to at least one of claims 1-6, characterized in that the mold elements are used as already synthesized oligomer building blocks or are initially generated in the reaction vessel.
8. Verfahren gemäß mindestens einem der Ansprüche 1 - 7, dadurch gekennzeichnet, daß die Reaktionen in parallel geführten Micro-Reaktionsansätzen durchgeführt werden, bei denen Formenelemente in vorbestimmter Reihenfolge verknüpft werden.8. The method according to at least one of claims 1-7, characterized in that the reactions are carried out in parallel micro-reaction batches in which mold elements are linked in a predetermined order.
9. Verfahren gemäß mindestens einem der Ansprüche 1 - 8, dadurch gekennzeichnet, daß nach erfolgter Synthese die Reaktions¬ produkte, wie Funktionselemente oder Vorstufen davon fest- phasengekoppelt bleiben oder in die lösliche Phase entkoppelt werden.9. The method according to at least one of claims 1-8, characterized in that after the synthesis, the reaction products, such as functional elements or precursors thereof, remain solid-phase-coupled or are decoupled into the soluble phase.
10. Verfahren nach Anspruch 9, wobei die Reaktionsprodukte mit einem biologischen Testsystem vereinigt werden, wobei die Funktion im gleichen Volumenelement wie die Synthese be¬ wertend gemessen wird, z.B. durch den Einsatz der FCS-- Analysetechnik.10. The method according to claim 9, wherein the reaction products are combined with a biological test system, the function being measured in the same volume element as the synthesis, e.g. through the use of FCS analysis technology.
11. Verfahren gemäß mindestens einem der Ansprüche 1 - 10, dadurch gekennzeichnet, daß pro Reaktionsschritt bei der schrittweisen Verknüpfung der Formenelemente jeweils ein Formenelement als Reaktionspartner an fester Phase gekoppelt ist .11. The method according to at least one of claims 1-10, characterized in that for each reaction step in the stepwise linking of the mold elements, a mold element is coupled as a reaction partner to a solid phase.
12. Verfahren gemäß mindestens einem der Ansprüche 1 - 11, dadurch gekennzeichnet, daß Mischungen von Formenelementen eingesetzt werden und/oder generiert werden können.12. The method according to at least one of claims 1-11, characterized in that mixtures of mold elements are used and / or can be generated.
13. Verfahren gemäß mindestens einem der Ansprüche 1 - 12, dadurch gekennzeichnet, daß im Falle des Aufbaues von Nucleinsäure-Formenelementen und/oder der Verknüpfung von Nucleinsäure-Formenelementen wenigstens ein Reaktionspartner eine Schnittstelle für ein Restriktionsenzym enthält und/oder frei von Start- und/ oder Stopcodons ist.13. The method according to at least one of claims 1-12, characterized in that in the case of the construction of nucleic acid form elements and / or the linkage of nucleic acid form elements at least one reaction partner contains an interface for a restriction enzyme and / or free of start and / or stop codons.
14. Verfahren gemäß mindestens einem der Ansprüche 1 - 13, dadurch gekennzeichnet, daß über die Einführung von Restrik- tionsschnittstellen, insbesondere solchen für Enzyme der Klasse IIS beliebige Sequenzen gerichtet verknüpft werden können, ohne daß Sequenzerfordernisse des erwünschten Endpro¬ duktes die Wahl des Reaktionsenzyms beeinflußen.14. The method according to at least one of claims 1-13, characterized in that the introduction of restriction interfaces, in particular those for enzymes Class IIS can be linked to any sequence in a directed manner, without sequence requirements of the desired end product influencing the choice of the reaction enzyme.
15. Verfahren gemäß mindestens einem der Ansprüche 1 - 14, dadurch gekennzeichnet, daß über die Einführung von einzelst¬ rängigen Überhängen und/oder selektive und reversible chemische und/oder enzymatische Modifikation der 3 '-Enden und/oder der 5'-Enden der Nucleinsäuren, zum Beispiel Phosphorylierung, beliebige Sequenzen gerichtet verknüpft werden können, ohne daß dabei irgendwelche Anforderungen an die Sequenz des erwünschten Endproduktes entstehen.15. The method according to at least one of claims 1-14, characterized in that the introduction of single-ranked overhangs and / or selective and reversible chemical and / or enzymatic modification of the 3 'ends and / or the 5' ends of the Nucleic acids, for example phosphorylation, can be linked to any sequence in a directed manner, without any requirements being placed on the sequence of the desired end product.
16. Verfahren gemäß mindestens einem der Ansprüche 1 - 15, dadurch gekennzeichnet, daß Formenelemente nach dem Vorbild röntgenkristallografisch analysierter natürlicher Proteine oder Polypeptide eingesetzt werden.16. The method according to at least one of claims 1-15, characterized in that mold elements are used along the lines of X-ray crystallographically analyzed natural proteins or polypeptides.
17. Verfahren gemäß mindestens einem der Ansprüche 1 - 16, dadurch gekennzeichnet, daß mindestens eines der verwendeten Formenelemente aus Selektionsexperimenten stammt.17. The method according to at least one of claims 1-16, characterized in that at least one of the shape elements used comes from selection experiments.
18. Verfahren gemäß mindestens einem der Ansprüche 1 - 17, dadurch gekennzeichnet, daß die Formenelemente zwischen 1 und 60 Aminosäuren enthalten oder Nucleotide entsprechender Kodierungslänge.18. The method according to at least one of claims 1-17, characterized in that the shaped elements contain between 1 and 60 amino acids or nucleotides of the appropriate coding length.
19. Verfahren gemäß mindestens einem der Ansprüche 1 - 18, dadurch gekennzeichnet, daß Formenelemente eingesetzt werden, die an bestimmten Positionen degeneriert sind und/oder Deletionen oder Insertionen tragen.19. The method according to at least one of claims 1-18, characterized in that mold elements are used which are degenerate at certain positions and / or carry deletions or insertions.
20. Verfahren gemäß einem der Ansprüche 1 bis 19, dadurch gekenn¬ zeichnet, daß die Funktions- und/oder Formenelemente bzw. Funktionscodes und/oder Formencodes als Oligo- oder Poly- nucleotide niedergelegt sind, die erhältlich sind durch Generierung aus Algorithmen, insbesondere evo- lutiver Algorithmen, durch Übernahme oder Modifizierung natürlich vorkommen¬ der Nucleinsäuren und/oder,20. The method according to any one of claims 1 to 19, characterized gekenn¬ characterized in that the functional and / or shape elements or function codes and / or shape codes are deposited as oligo- or polynucleotides that are available by generating from algorithms, in particular evolutionary algorithms, by adopting or modifying naturally occurring nucleic acids and / or,
Generierung mittels de novo Synthese von Oligo-/Poly- nucleotiden durch matrizenabhängige oder -unabhängige Reaktionen von Polymerasen mit Nucleotiden.Generation by means of de novo synthesis of oligo- / polynucleotides through template-dependent or template-independent reactions of polymerases with nucleotides.
21. Verwendung des Verfahrens gemäß mindestens einem der Ansprüche 1 - 20 zur Synthese parallel aufgebauter Formen- Bibliotheken funktionaler Oligomere oder Polymere. 21. Use of the method according to at least one of claims 1-20 for the synthesis of parallel form libraries of functional oligomers or polymers.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DEP4343591.2 | 1993-12-21 | ||
DE19934343591 DE4343591A1 (en) | 1993-12-21 | 1993-12-21 | Process for the evolutionary design and synthesis of functional polymers based on shape elements and shape codes |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1995017413A1 true WO1995017413A1 (en) | 1995-06-29 |
Family
ID=6505604
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP1994/004240 WO1995017413A1 (en) | 1993-12-21 | 1994-12-20 | Process for the evolutive design and synthesis of functional polymers based on designer elements and codes |
Country Status (2)
Country | Link |
---|---|
DE (1) | DE4343591A1 (en) |
WO (1) | WO1995017413A1 (en) |
Cited By (608)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998005765A1 (en) * | 1996-08-07 | 1998-02-12 | Novo Nordisk A/S | Double-stranded dna with cohesive end(s), and method of shuffling dna using the same |
WO1998005764A1 (en) * | 1996-08-07 | 1998-02-12 | Novo Nordisk A/S | Nucleic acid pool and method for producing the same |
US5811238A (en) * | 1994-02-17 | 1998-09-22 | Affymax Technologies N.V. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
WO1998041622A1 (en) | 1997-03-18 | 1998-09-24 | Novo Nordisk A/S | Method for constructing a library using dna shuffling |
US5837458A (en) * | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
DE19800899A1 (en) * | 1998-01-13 | 1999-07-15 | Biotecon Ges Fuer Biotechnologische Entwicklung & Consulting Mbh | Preparation of oligo-ligands for macromolecules with optionally unknown composition of building blocks |
US5965408A (en) * | 1996-07-09 | 1999-10-12 | Diversa Corporation | Method of DNA reassembly by interrupting synthesis |
WO2000049142A1 (en) * | 1999-02-19 | 2000-08-24 | Febit Ferrarius Biotechnology Gmbh | Method for producing polymers |
US6117679A (en) * | 1994-02-17 | 2000-09-12 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US6153410A (en) * | 1997-03-25 | 2000-11-28 | California Institute Of Technology | Recombination of polynucleotide sequences using random or defined primers |
US6159687A (en) * | 1997-03-18 | 2000-12-12 | Novo Nordisk A/S | Methods for generating recombined polynucleotides |
US6159688A (en) * | 1997-03-18 | 2000-12-12 | Novo Nordisk A/S | Methods of producing polynucleotide variants |
WO2000075368A2 (en) * | 1999-06-07 | 2000-12-14 | Sloning Biotechnology Gmbh | Method for the synthesis of dna fragments |
US6165793A (en) * | 1996-03-25 | 2000-12-26 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US6291165B1 (en) | 1997-03-18 | 2001-09-18 | Novo Nordisk A/S | Shuffling of heterologous DNA sequences |
US6303344B1 (en) | 1996-12-18 | 2001-10-16 | Maxygen, Inc. | Methods and compositions for polypeptide engineering |
US6309883B1 (en) | 1994-02-17 | 2001-10-30 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
WO2002099091A2 (en) | 2001-06-06 | 2002-12-12 | Novozymes A/S | Endo-beta-1,4-glucanase from bacillus |
EP1411122A1 (en) * | 2002-10-18 | 2004-04-21 | Sloning BioTechnology GmbH | Method for the manufacture of nucleic acid molecules |
WO2005047499A1 (en) | 2003-10-28 | 2005-05-26 | Novozymes Inc. | Polypeptides having beta-glucosidase activity and polynucleotides encoding same |
WO2005066339A2 (en) | 2004-01-06 | 2005-07-21 | Novozymes A/S | Polypeptides of alicyclobacillus sp. |
WO2005074647A2 (en) | 2004-01-30 | 2005-08-18 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2005121351A2 (en) | 2004-05-27 | 2005-12-22 | Novozymes, Inc. | Methods for transforming and expression screening of filamentous fungal cells with a dna library |
WO2006037327A2 (en) | 2004-10-04 | 2006-04-13 | Novozymes A/S | Polypeptides having phytase activity and polynucleotides encoding same |
WO2006037328A1 (en) | 2004-10-04 | 2006-04-13 | Novozymes A/S | Polypeptides having phytase activity and polynucleotides encoding same |
WO2006039541A2 (en) | 2004-09-30 | 2006-04-13 | Novozymes, Inc. | Polypeptides having lipase activity and polynucleotides encoding same |
WO2006053565A2 (en) | 2004-11-19 | 2006-05-26 | Novozymes A/S | Polypeptides having antimicrobial activity and polynucleotides encoding same |
WO2006069289A2 (en) | 2004-12-22 | 2006-06-29 | Novozymes North America, Inc | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2006097110A2 (en) | 2005-03-18 | 2006-09-21 | Novozymes A/S | Polypeptides having antimicrobial activity and polynucleotides encoding same |
WO2006116682A2 (en) | 2005-04-27 | 2006-11-02 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2007023163A1 (en) | 2005-08-26 | 2007-03-01 | Novozymes A/S | Polypeptides having antimicrobial activity and polynucleotides encoding same |
WO2007109441A2 (en) | 2006-03-20 | 2007-09-27 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2008022789A2 (en) | 2006-08-23 | 2008-02-28 | Febit Holding Gmbh | Programmable oligonucleotide synthesis |
WO2008037757A1 (en) | 2006-09-29 | 2008-04-03 | Novozymes A/S | Xylanases for animal feed |
WO2008067423A2 (en) | 2006-11-29 | 2008-06-05 | Novozymes, Inc. | Methods of improving the introduction of dna into bacterial cells |
EP1967584A1 (en) | 2005-08-16 | 2008-09-10 | Novozymes A/S | Polypeptides of strain bacillus SP. P203 |
WO2008116878A1 (en) | 2007-03-26 | 2008-10-02 | Novozymes A/S | Hafnia phytase |
EP1982732A2 (en) | 2000-02-11 | 2008-10-22 | Maxygen Holdings Ltd. | Factor VII or VIIA-like molecules |
WO2009037253A2 (en) | 2007-09-18 | 2009-03-26 | Novozymes A/S | Polypeptides having tyrosinase activity and polynucleotides encoding same |
WO2009068565A1 (en) | 2007-11-27 | 2009-06-04 | Novozymes A/S | Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same |
WO2009068554A1 (en) | 2007-11-29 | 2009-06-04 | Novozymes A/S | Synthase inhibitor screening method |
WO2009073709A1 (en) | 2007-12-06 | 2009-06-11 | Novozymes A/S | Polypeptides having acetylxylan esterase activity and polynucleotides encoding same |
WO2009085935A2 (en) | 2007-12-19 | 2009-07-09 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2009147210A1 (en) | 2008-06-06 | 2009-12-10 | Novozymes A/S | Variants of a family 44 xyloglucanase |
EP2133098A1 (en) | 2000-01-10 | 2009-12-16 | Maxygen Holdings Ltd | G-CSF conjugates |
WO2010059413A2 (en) | 2008-11-20 | 2010-05-27 | Novozymes, Inc. | Polypeptides having amylolytic enhancing activity and polynucleotides encoding same |
WO2010065830A1 (en) | 2008-12-04 | 2010-06-10 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
US7737088B1 (en) | 1998-08-28 | 2010-06-15 | Febit Holding Gmbh | Method and device for producing biochemical reaction supporting materials |
WO2010068650A1 (en) | 2008-12-12 | 2010-06-17 | Novozymes, Inc. | Polypeptides having lipase activity and polynucleotides encoding same |
WO2010068800A1 (en) | 2008-12-12 | 2010-06-17 | Novozymes, Inc. | Polypeptides having aspartic endopeptidase activity and polynucleotides encoding same |
WO2010070110A2 (en) | 2008-12-19 | 2010-06-24 | Novozymes A/S | Use of enzymes having silicase activity |
WO2010074972A1 (en) | 2008-12-15 | 2010-07-01 | Novozymes, Inc. | Polypeptides having catalase activity and polynucleotides encoding same |
WO2010074955A1 (en) | 2008-12-16 | 2010-07-01 | Novozymes, Inc. | Polypeptides having carboxypeptidase activity and polynucleotides encoding same |
WO2010077775A1 (en) | 2008-12-16 | 2010-07-08 | Novozymes, Inc. | Polypeptides having alpha-mannosidase activity and polynucleotides encoding same |
EP2210898A1 (en) | 2006-11-29 | 2010-07-28 | Novozymes Inc. | Bacillus Licheniformis chromosome |
WO2010084086A1 (en) | 2009-01-21 | 2010-07-29 | Novozymes A/S | Polypeptides having esterase activity and nucleic acids encoding the same |
WO2010088463A2 (en) | 2009-01-30 | 2010-08-05 | Novozymes, Inc. | Polypeptides having expansin activity and polynucleotides encoding same |
WO2010088387A1 (en) | 2009-01-28 | 2010-08-05 | Novozymes, Inc. | Polypeptides having beta-glucosidase activity and polynucleotides encoding same |
WO2010088447A1 (en) | 2009-01-30 | 2010-08-05 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2010091221A1 (en) | 2009-02-06 | 2010-08-12 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2010089302A1 (en) | 2009-02-06 | 2010-08-12 | University Of Chile | Protein and dna sequence encoding a cold adapted xylanase |
EP2221366A1 (en) | 2004-06-29 | 2010-08-25 | Novozymes Inc. | Polypeptides having alpha-glucosidase activity and polynucleotides encoding same |
WO2010094772A1 (en) | 2009-02-20 | 2010-08-26 | Febit Holding Gmbh | Synthesis of sequence-verified nucleic acids |
WO2010097436A1 (en) | 2009-02-27 | 2010-09-02 | Novozymes A/S | Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production |
US7795030B2 (en) | 1994-02-17 | 2010-09-14 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
EP2228440A1 (en) | 2003-05-02 | 2010-09-15 | Novozymes Inc. | Variants of beta-glucosidases |
WO2010106068A1 (en) | 2009-03-17 | 2010-09-23 | Novozymes A/S | Polypeptides having tyrosinase activity and polynucleotides encoding same |
WO2010108918A1 (en) | 2009-03-24 | 2010-09-30 | Novozymes A/S | Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same |
EP2248893A1 (en) | 2009-05-06 | 2010-11-10 | Novozymes A/S | DFPase Enzymes from Octopus Vulgaris |
WO2010138754A1 (en) | 2009-05-29 | 2010-12-02 | Novozymes, Inc. | Methods for enhancing the degradation or conversion of cellulosic material |
WO2010141325A1 (en) | 2009-06-02 | 2010-12-09 | Novozymes, Inc. | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
EP2261359A1 (en) | 1998-06-10 | 2010-12-15 | Novozymes A/S | Mannanases |
WO2010151787A1 (en) | 2009-06-26 | 2010-12-29 | Novozymes North America, Inc. | Heat-stable carbonic anhydrases and their use |
WO2011005867A1 (en) | 2009-07-07 | 2011-01-13 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same |
WO2011009747A1 (en) | 2009-07-24 | 2011-01-27 | Novozymes A/S | Carbohydrate oxidases |
WO2011014458A1 (en) | 2009-07-28 | 2011-02-03 | Novozymes, Inc. | Polypeptides having phytase activity and polynucleotides encoding same |
WO2011020910A1 (en) | 2009-08-21 | 2011-02-24 | Novozymes A/S | Polypeptides having isoamylase activity and polynucleotides encoding same |
WO2011028643A1 (en) | 2009-09-01 | 2011-03-10 | Novozymes, Inc. | Methods for improving malic acid production in filamentous fungi |
WO2011035029A1 (en) | 2009-09-18 | 2011-03-24 | Novozymes, Inc. | Polypeptides having beta-glucosidase activity and polynucleotides encoding same |
WO2011035027A2 (en) | 2009-09-17 | 2011-03-24 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP2302046A1 (en) | 2002-10-01 | 2011-03-30 | Novozymes A/S | Family GH 61 polypeptides |
WO2011036263A1 (en) | 2009-09-25 | 2011-03-31 | Novozymes A/S | Subtilase variants |
WO2011036264A1 (en) | 2009-09-25 | 2011-03-31 | Novozymes A/S | Use of protease variants |
EP2305808A1 (en) | 2001-06-20 | 2011-04-06 | Nuevolution A/S | Templated molecules and methods for using such molecules |
WO2011041405A1 (en) | 2009-09-29 | 2011-04-07 | Novozymes, Inc. | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2011041397A1 (en) | 2009-09-29 | 2011-04-07 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011041504A1 (en) | 2009-09-30 | 2011-04-07 | Novozymes, Inc. | Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011039319A1 (en) | 2009-09-30 | 2011-04-07 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011050037A1 (en) | 2009-10-23 | 2011-04-28 | Novozymes, Inc. | Cellobiohydrolase variants and polynucleotides encoding same |
WO2011051489A2 (en) | 2009-10-30 | 2011-05-05 | Novozymes Biopharma Dk A/S | Albumin variants |
WO2011057086A1 (en) | 2009-11-06 | 2011-05-12 | Novozymes, Inc. | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2011057083A1 (en) | 2009-11-06 | 2011-05-12 | Novozymes, Inc. | Polypeptides having xylanase activity and polynucleotides encoding same |
EP2322630A2 (en) | 2004-02-12 | 2011-05-18 | Novozymes Inc. | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2011059740A1 (en) | 2009-10-29 | 2011-05-19 | Novozymes, Inc. | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2011066560A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2011066576A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2011067349A1 (en) | 2009-12-03 | 2011-06-09 | Novozymes A/S | Variants of a polypeptide with lipolytic activity and improved stability |
WO2011068803A1 (en) | 2009-12-01 | 2011-06-09 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2011067335A1 (en) | 2009-12-02 | 2011-06-09 | Novozymes A/S | Use of defensins for treatment of infective endocarditis |
WO2011070032A1 (en) | 2009-12-11 | 2011-06-16 | Novozymes A/S | Arenicin-3 for use in the treatment of urinary tract infections |
WO2011070101A1 (en) | 2009-12-09 | 2011-06-16 | Novozymes A/S | Methods of producing gh8 xylanase variants |
WO2011080354A1 (en) | 2010-01-04 | 2011-07-07 | Novozymes A/S | Alpha-amylases |
WO2011080267A2 (en) | 2009-12-29 | 2011-07-07 | Novozymes A/S | Polypetides having detergency enhancing effect |
WO2011104284A1 (en) | 2010-02-25 | 2011-09-01 | Novozymes A/S | Polypeptides having antimicrobial activity |
WO2011104339A1 (en) | 2010-02-25 | 2011-09-01 | Novozymes A/S | Variants of a lysozyme and polynucleotides encoding same |
WO2011109524A2 (en) | 2010-03-03 | 2011-09-09 | Novozymes, Inc. | Xylanase variants and polynucleotides encoding same |
WO2011123450A1 (en) | 2010-03-31 | 2011-10-06 | Novozymes, Inc. | Cellobiohydrolase variants and polynucleotides encoding same |
WO2011120938A2 (en) | 2010-03-28 | 2011-10-06 | Novozymes A/S | Enzymatic hydroxylation of aliphatic hydrocarbon |
WO2011123505A1 (en) | 2010-03-30 | 2011-10-06 | Novozymes North America, Inc. | Processes of producing a fermentation product |
EP2374877A2 (en) | 2006-03-30 | 2011-10-12 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2011127802A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
EP2385110A2 (en) | 2005-09-30 | 2011-11-09 | Novozymes, Inc. | Methods for enhancing the degradation or conversion of cellulosic material |
WO2011153317A1 (en) | 2010-06-04 | 2011-12-08 | Novozymes, Inc. | C4 dicarboxylic acid production in filamentous fungi |
WO2011154525A1 (en) | 2010-06-12 | 2011-12-15 | Novozymes A/S | Antimicrobial peptide variants and polynucleotides encoding same |
EP2399600A1 (en) | 2008-07-18 | 2011-12-28 | Novozymes Adenium Biotech A/S | Treatment of inflammatory bowel diseases with mammal beta defensins |
WO2011163270A1 (en) | 2010-06-21 | 2011-12-29 | Novozymes, Inc. | Methods for improved c4-dicarboxylic acid production in filamentous fungi |
WO2011163269A1 (en) | 2010-06-21 | 2011-12-29 | Novozymes, Inc. | Aspergillus aculeatus derived polypeptides having c4-dicarboxylic acid transporter activity and polynucleotides encoding same |
WO2012003379A1 (en) | 2010-06-30 | 2012-01-05 | Novozymes A/S | Polypeptides having beta-glucosidase activity and polynucleotides encoding same |
US8092991B2 (en) | 2004-01-23 | 2012-01-10 | Cloning Biotechnology GmbH | De novo enzymatic production of nucleic acid molecules |
WO2012021399A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and a nitrogen-containing compound and uses thereof |
WO2012022777A1 (en) | 2010-08-19 | 2012-02-23 | Novozymes A/S | Induced sporulation screening method |
WO2012025577A1 (en) | 2010-08-24 | 2012-03-01 | Novozymes A/S | Heat-stable persephonella carbonic anhydrases and their use |
WO2012030811A1 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012030849A1 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2012030844A1 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2012030845A2 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same |
WO2012030858A2 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having hemicellulolytic activity and polynucleotides encoding same |
WO2012030799A1 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
US8137906B2 (en) | 1999-06-07 | 2012-03-20 | Sloning Biotechnology Gmbh | Method for the synthesis of DNA fragments |
WO2012035103A1 (en) | 2010-09-16 | 2012-03-22 | Novozymes A/S | Lysozymes |
WO2012044835A1 (en) | 2010-09-30 | 2012-04-05 | Novozymes, Inc. | Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012044836A1 (en) | 2010-09-30 | 2012-04-05 | Novozymes, Inc. | Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012044915A2 (en) | 2010-10-01 | 2012-04-05 | Novozymes, Inc. | Beta-glucosidase variants and polynucleotides encoding same |
WO2012042037A1 (en) | 2010-10-01 | 2012-04-05 | Novozymes A/S | Polypeptides having endopeptidase activity and polynucleotides encoding same |
WO2012058566A1 (en) | 2010-10-29 | 2012-05-03 | Novozymes A/S | Polypeptides having succinyl-coa:aceto acetate transferase activity and polynucleotides encoding same |
WO2012058603A1 (en) | 2010-10-29 | 2012-05-03 | Novozymes A/S | Recombinant n-propanol and isopropanol production |
WO2012058293A1 (en) | 2010-10-26 | 2012-05-03 | Novozymes North America, Inc. | Methods of saccharifying sugarcane trash |
WO2012059053A1 (en) | 2010-11-04 | 2012-05-10 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012061517A1 (en) | 2010-11-02 | 2012-05-10 | Novozymes, Inc. | Methods of pretreating cellulosic material with a gh61 polypeptide |
WO2012064350A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same |
WO2012062220A1 (en) | 2010-11-12 | 2012-05-18 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2012064351A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2012062817A1 (en) | 2010-11-12 | 2012-05-18 | Novozymes A/S | Polypeptides having phospholipase c activity and polynucleotides encoding same |
WO2012068509A1 (en) | 2010-11-18 | 2012-05-24 | Novozymes, Inc. | Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012078656A1 (en) | 2010-12-06 | 2012-06-14 | Novozymes North America, Inc. | Methods of hydrolyzing oligomers in hemicellulosic liquor |
US8202831B2 (en) | 2008-06-06 | 2012-06-19 | The Procter & Gamble Company | Detergent composition comprising a variant of a family 44 xyloglucanase |
EP2468852A1 (en) | 2007-03-30 | 2012-06-27 | Novozymes A/S | Fungal peroxygenases and methods of application |
WO2012103288A1 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012103350A1 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012101206A2 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Novel glycoside hydrolases from thermophilic fungi |
WO2012103322A1 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2012103293A1 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012110562A2 (en) | 2011-02-16 | 2012-08-23 | Novozymes A/S | Detergent compositions comprising metalloproteases |
WO2012110563A1 (en) | 2011-02-16 | 2012-08-23 | Novozymes A/S | Detergent compositions comprising metalloproteases |
WO2012110564A1 (en) | 2011-02-16 | 2012-08-23 | Novozymes A/S | Detergent compositions comprising m7 or m35 metalloproteases |
WO2012113340A1 (en) | 2011-02-23 | 2012-08-30 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012118848A1 (en) | 2011-02-28 | 2012-09-07 | Novozymes, Inc. | Microorganism for c4-dicarboxylic acid production |
WO2012122518A1 (en) | 2011-03-09 | 2012-09-13 | Novozymes A/S | Methods of increasing the cellulolytic enhancing activity of a polypeptide |
WO2012122477A1 (en) | 2011-03-10 | 2012-09-13 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012127001A1 (en) | 2011-03-23 | 2012-09-27 | Novozymes A/S | Methods for producing secreted polypeptides |
WO2012127002A1 (en) | 2011-03-23 | 2012-09-27 | Novozymes A/S | Sweet-tasting polypeptide from gram-positive bacteria |
WO2012134626A2 (en) | 2011-01-31 | 2012-10-04 | Novozymes North America, Inc. | Processes for enzymatic refining of pretreated cellulosic material for saccharification |
WO2012135719A1 (en) | 2011-03-31 | 2012-10-04 | Novozymes, Inc. | Cellulose binding domain variants and polynucleotides encoding same |
WO2012135659A2 (en) | 2011-03-31 | 2012-10-04 | Novozymes A/S | Methods for enhancing the degradation or conversion of cellulosic material |
WO2012149192A1 (en) | 2011-04-28 | 2012-11-01 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2012149344A1 (en) | 2011-04-29 | 2012-11-01 | Novozymes, Inc. | Methods for enhancing the degradation or conversion of cellulosic material |
WO2012150319A1 (en) | 2011-05-05 | 2012-11-08 | Novozymes Biopharma Dk A/S | Albumin variants |
WO2012159007A1 (en) | 2011-05-19 | 2012-11-22 | Novozymes, Inc. | Methods for enhancing the degradation of cellulosic material with chitin binding proteins |
WO2012159009A1 (en) | 2011-05-19 | 2012-11-22 | Novozymes, Inc. | Methods for enhancing the degradation of cellulosic material with chitin binding proteins |
EP2527432A1 (en) | 2011-05-23 | 2012-11-28 | Novozymes A/S | Bi-directional cytosine deaminase-encoding selection marker |
EP2527448A1 (en) | 2011-05-23 | 2012-11-28 | Novozymes A/S | Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi |
WO2012175708A2 (en) | 2011-06-24 | 2012-12-27 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
EP2540824A1 (en) | 2011-06-30 | 2013-01-02 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants reference to a sequence listing |
WO2013001078A1 (en) | 2011-06-30 | 2013-01-03 | Novozymes A/S | Alpha-amylase variants |
WO2013001087A2 (en) | 2011-06-30 | 2013-01-03 | Novozymes A/S | Method for screening alpha-amylases |
WO2013006756A2 (en) | 2011-07-06 | 2013-01-10 | Novozymes A/S | Alpha amylase variants and polynucleotides encoding same |
WO2013004639A2 (en) | 2011-07-07 | 2013-01-10 | Novozymes A/S | Enzymatic preparation of diols |
WO2013007596A2 (en) | 2011-07-08 | 2013-01-17 | Novozymes A/S | Oral treatment of inflammatory bowel disease |
WO2013010783A1 (en) | 2011-07-15 | 2013-01-24 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2013016115A1 (en) | 2011-07-22 | 2013-01-31 | Novozymes North America, Inc. | Processes for pretreating cellulosic material and improving hydrolysis thereof |
WO2013019827A2 (en) | 2011-08-04 | 2013-02-07 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2013019780A2 (en) | 2011-08-04 | 2013-02-07 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2013021065A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021064A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021062A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021063A2 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021060A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021059A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021061A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013024021A1 (en) | 2011-08-15 | 2013-02-21 | Novozymes A/S | Polypeptides having cellulase activity and polynucleotides encoding same |
WO2013026794A1 (en) | 2011-08-19 | 2013-02-28 | Novozymes | Novel immunomodulatory peptide |
WO2013026796A1 (en) | 2011-08-19 | 2013-02-28 | Novozymes A/S | Polypeptides having protease activity |
WO2013028512A1 (en) | 2011-08-19 | 2013-02-28 | Novozymes, Inc. | Recombinant microorganisms for production c4-dicarboxylic acids |
WO2013029496A1 (en) | 2011-08-26 | 2013-03-07 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2013036898A2 (en) | 2011-09-09 | 2013-03-14 | Novozymes A/S | Improving properties of paper materials |
WO2013034106A1 (en) | 2011-09-09 | 2013-03-14 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2013036526A1 (en) | 2011-09-06 | 2013-03-14 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2013039776A1 (en) | 2011-09-13 | 2013-03-21 | Novozymes North America, Inc. | Methods of hydrolyzing and fermenting cellulosic material |
WO2013040991A1 (en) | 2011-09-23 | 2013-03-28 | Novozymes A/S | Color modification of textile |
WO2013041689A1 (en) | 2011-09-22 | 2013-03-28 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2013043910A1 (en) | 2011-09-20 | 2013-03-28 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2013049073A1 (en) | 2011-09-30 | 2013-04-04 | Novozymes, Inc. | Dehydrogenase variants and polynucleotides encoding same |
WO2013044867A1 (en) | 2011-09-30 | 2013-04-04 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2013053801A1 (en) | 2011-10-11 | 2013-04-18 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2013057141A2 (en) | 2011-10-17 | 2013-04-25 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2013057143A2 (en) | 2011-10-17 | 2013-04-25 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2013064075A1 (en) | 2011-10-31 | 2013-05-10 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2013064195A1 (en) | 2011-11-04 | 2013-05-10 | Enel Ingegneria E Ricerca S.P.A. | A new heat-stable carbonic anhydrase and uses thereof |
WO2013068309A1 (en) | 2011-11-08 | 2013-05-16 | Novozymes A/S | Methods for production of archeae protease in yeast |
WO2013074956A2 (en) | 2011-11-18 | 2013-05-23 | Novozymes, Inc. | Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same |
WO2013076259A2 (en) | 2011-11-25 | 2013-05-30 | Novozymes A/S | Polypeptides having lysozyme activity and polynucleotides encoding same |
WO2013075644A1 (en) | 2011-11-22 | 2013-05-30 | Novozymes, Inc. | Polypeptides having beta-xylosidase activity and polynucleotides encoding same |
WO2013076269A1 (en) | 2011-11-25 | 2013-05-30 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2013079531A2 (en) | 2011-12-02 | 2013-06-06 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013079533A1 (en) | 2011-12-02 | 2013-06-06 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013079015A1 (en) | 2011-12-01 | 2013-06-06 | Novozymes, Inc. | Polypeptides having beta-xylosidase activity and polynucleotides encoding same |
EP2607468A1 (en) | 2011-12-20 | 2013-06-26 | Henkel AG & Co. KGaA | Detergent compositions comprising subtilase variants |
WO2013096603A2 (en) | 2011-12-20 | 2013-06-27 | Novozymes, Inc. | Cellobiohydrolase variants and polynucleotides encoding same |
WO2013092635A1 (en) | 2011-12-20 | 2013-06-27 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2013091547A1 (en) | 2011-12-19 | 2013-06-27 | Novozymes, Inc. | Polypeptides having catalase activity and polynucleotides encoding same |
WO2013098185A1 (en) | 2011-12-28 | 2013-07-04 | Novozymes A/S | Polypeptides having protease activity |
WO2013110766A1 (en) | 2012-01-26 | 2013-08-01 | Novozymes A/S | Use of polypeptides having protease activity in animal feed and detergents |
EP2623586A2 (en) | 2012-02-03 | 2013-08-07 | The Procter & Gamble Company | Compositions and methods for surface treatment with lipases |
WO2013113622A1 (en) | 2012-02-03 | 2013-08-08 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2013119302A2 (en) | 2011-11-21 | 2013-08-15 | Novozymes, Inc. | Gh61 polypeptide variants and polynucleotides encoding same |
EP2628785A1 (en) | 2012-02-17 | 2013-08-21 | Henkel AG & Co. KGaA | Detergent compositions comprising subtilase variants |
WO2013120948A1 (en) | 2012-02-17 | 2013-08-22 | Novozymes A/S | Subtilisin variants and polynucleotides encoding same |
WO2013123871A1 (en) | 2012-02-20 | 2013-08-29 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2013135896A1 (en) | 2012-03-16 | 2013-09-19 | Novozymes Biopharma Dk A/S | Albumin variants |
WO2013144105A1 (en) | 2012-03-31 | 2013-10-03 | Novozymes A/S | Epoxidation using peroxygenase |
WO2013149858A1 (en) | 2012-04-02 | 2013-10-10 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2013160247A2 (en) | 2012-04-23 | 2013-10-31 | Novozymes A/S | Polypeptides having glucuronyl esterase activity and polynucleotides encoding same |
WO2013160248A2 (en) | 2012-04-23 | 2013-10-31 | Novozymes A/S | Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same |
WO2013163590A2 (en) | 2012-04-27 | 2013-10-31 | Novozymes, Inc. | Gh61 polypeptide variants and polynucleotides encoding same |
WO2013160370A1 (en) | 2012-04-25 | 2013-10-31 | Novozymes A/S | Method of baking |
WO2013167581A1 (en) | 2012-05-07 | 2013-11-14 | Novozymes A/S | Polypeptides having xanthan degrading activity and polynucleotides encoding same |
WO2013173711A1 (en) | 2012-05-18 | 2013-11-21 | Novozymes A/S | Bacterial mutants with improved transformation efficiency |
WO2013178808A2 (en) | 2012-05-31 | 2013-12-05 | Novozymes A/S | Polypeptides having organophosphorous hydrolase activity |
WO2013178699A1 (en) | 2012-05-31 | 2013-12-05 | Novozymes A/S | Isopropanol production by bacterial hosts |
WO2013189972A2 (en) | 2012-06-20 | 2013-12-27 | Novozymes A/S | Use of polypeptides having protease activity in animal feed and detergents |
WO2013189802A1 (en) | 2012-06-19 | 2013-12-27 | Novozymes A/S | Enzymatic reduction of hydroperoxides |
WO2014009473A1 (en) | 2012-07-12 | 2014-01-16 | Novozymes A/S | Polypeptides having lipase activity and polynucleotides encoding same |
WO2014015256A2 (en) | 2012-07-20 | 2014-01-23 | Novozymes A/S | Enzymatic oxidation of 5-hydroxymethylfurfural and derivatives thereof |
WO2014012506A1 (en) | 2012-07-18 | 2014-01-23 | Novozymes A/S | Method of treating polyester textile |
WO2014027062A1 (en) | 2012-08-17 | 2014-02-20 | Novozymes A/S | Thermostable asparaginase variants and polynucleotides encoding same |
WO2014029819A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Metalloprotease from exiguobacterium |
WO2014029821A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Metalloproteases from alicyclobacillus sp. |
WO2014029820A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Detergent compositions comprising metalloproteases |
WO2014037438A1 (en) | 2012-09-05 | 2014-03-13 | Novozymes A/S | Polypeptides having protease activity |
WO2014052630A1 (en) | 2012-09-27 | 2014-04-03 | Novozymes, Inc. | Bacterial mutants with improved transformation efficiency |
WO2014053594A1 (en) | 2012-10-05 | 2014-04-10 | Novozymes A/S | Preventing adhesion of bacteria |
WO2014056916A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056920A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056921A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056922A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056919A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056917A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014058896A1 (en) | 2012-10-08 | 2014-04-17 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2014056927A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014066141A2 (en) | 2012-10-24 | 2014-05-01 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2014068010A1 (en) | 2012-10-31 | 2014-05-08 | Novozymes A/S | Isopropanol production by bacterial hosts |
WO2014076232A2 (en) | 2012-11-19 | 2014-05-22 | Novozymes A/S | Isopropanol production by recombinant hosts using an hmg-coa intermediate |
WO2014085330A1 (en) | 2012-11-30 | 2014-06-05 | Novozymes, Inc. | 3-hydroxypropionic acid production by recombinant yeasts |
EP2740840A1 (en) | 2012-12-07 | 2014-06-11 | Novozymes A/S | Improving drainage of paper pulp |
WO2014086706A1 (en) | 2012-12-07 | 2014-06-12 | Novozymes A/S | Method for generating site-specific mutations in filamentous fungi |
WO2014087011A1 (en) | 2012-12-07 | 2014-06-12 | Novozymes A/S | Preventing adhesion of bacteria |
WO2014092832A2 (en) | 2012-09-19 | 2014-06-19 | Novozymes, Inc. | Methods for enhancing the degradation or conversion of cellulosic material |
WO2014090940A1 (en) | 2012-12-14 | 2014-06-19 | Novozymes A/S | Removal of skin-derived body soils |
WO2014093835A1 (en) | 2012-12-14 | 2014-06-19 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2014090161A1 (en) | 2012-12-11 | 2014-06-19 | Novozymes A/S | Polypeptides having phospholipase c activity and polynucleotides encoding same |
WO2014099798A1 (en) | 2012-12-19 | 2014-06-26 | Novozymes A/S | Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same |
WO2014099653A1 (en) | 2012-12-17 | 2014-06-26 | Novozymes A/S | Alpha-amylases and polynucleotides encoding same |
WO2014096259A1 (en) | 2012-12-21 | 2014-06-26 | Novozymes A/S | Polypeptides having protease activiy and polynucleotides encoding same |
WO2014101753A1 (en) | 2012-12-24 | 2014-07-03 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2014122109A1 (en) | 2013-02-05 | 2014-08-14 | Novozymes A/S | Enzymatic preparation of indigo dyes and intermediates |
WO2014122161A2 (en) | 2013-02-06 | 2014-08-14 | Novozymes A/S | Polypeptides having protease activity |
WO2014138672A1 (en) | 2013-03-08 | 2014-09-12 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
WO2014147127A1 (en) | 2013-03-21 | 2014-09-25 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2014147219A1 (en) | 2013-03-21 | 2014-09-25 | Novozymes A/S | Polypeptides having phospholipase a activity and polynucleotides encoding same |
WO2014170218A1 (en) | 2013-04-18 | 2014-10-23 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2014177541A2 (en) | 2013-04-30 | 2014-11-06 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2014182990A1 (en) | 2013-05-10 | 2014-11-13 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2014183921A1 (en) | 2013-05-17 | 2014-11-20 | Novozymes A/S | Polypeptides having alpha amylase activity |
WO2014184164A1 (en) | 2013-05-14 | 2014-11-20 | Novozymes A/S | Detergent compositions |
WO2014202793A1 (en) | 2013-06-21 | 2014-12-24 | Novozymes A/S | Production of polypeptides without secretion signal in bacillus |
WO2014207227A1 (en) | 2013-06-27 | 2014-12-31 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2014207224A1 (en) | 2013-06-27 | 2014-12-31 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2015001017A2 (en) | 2013-07-04 | 2015-01-08 | Novozymes A/S | Polypeptides having anti-redeposition effect and polynucleotides encoding same |
WO2015004102A1 (en) | 2013-07-09 | 2015-01-15 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2015007639A1 (en) | 2013-07-17 | 2015-01-22 | Novozymes A/S | Pullulanase chimeras and polynucleotides encoding same |
EP2832853A1 (en) | 2013-07-29 | 2015-02-04 | Henkel AG&Co. KGAA | Detergent composition comprising protease variants |
WO2015017721A1 (en) | 2013-07-31 | 2015-02-05 | Novozymes A/S | 3-hydroxypropionic acid production by recombinant yeasts expressing an insect aspartate 1-decarboxylase |
WO2015022429A1 (en) | 2013-08-15 | 2015-02-19 | Novozymes A/S | Polypeptides having beta-1,3-galactanase activity and polynucleotides encoding same |
WO2015049370A1 (en) | 2013-10-03 | 2015-04-09 | Novozymes A/S | Detergent composition and use of detergent composition |
WO2015059133A1 (en) | 2013-10-22 | 2015-04-30 | Novozymes A/S | Cellobiose dehydrogenase variants and polynucleotides encoding same |
EP2876156A1 (en) | 2013-11-26 | 2015-05-27 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | New enzymes and method for preparing hydroxylated L-lysine or L-ornithine and analogs thereof |
WO2015079064A2 (en) | 2013-11-29 | 2015-06-04 | Novozymes A/S | Peroxygenase variants |
WO2015085920A1 (en) | 2013-12-11 | 2015-06-18 | Novozymes A/S | Cutinase variants and polynucleotides encoding same |
EP2886656A1 (en) | 2013-12-18 | 2015-06-24 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | New enzyme and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof |
WO2015109972A1 (en) | 2014-01-22 | 2015-07-30 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
US9115352B2 (en) | 2008-03-31 | 2015-08-25 | Sloning Biotechnology Gmbh | Method for the preparation of a nucleic acid library |
WO2015143144A1 (en) | 2014-03-19 | 2015-09-24 | Novozymes A/S | Method for enhancing activity of an x143 polypeptide |
WO2015150457A1 (en) | 2014-04-01 | 2015-10-08 | Novozymes A/S | Polypeptides having alpha amylase activity |
WO2015158237A1 (en) | 2014-04-15 | 2015-10-22 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2015158800A1 (en) | 2014-04-17 | 2015-10-22 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Recombinant host cell for expressing proteins of interest |
WO2015158808A2 (en) | 2014-04-17 | 2015-10-22 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Recombinant host cell engineered to overexpress helper proteins |
WO2015173426A1 (en) | 2014-05-15 | 2015-11-19 | Novozymes A/S | Compositions comprising polypeptides having phospholipase c activity and use thereof |
WO2015181119A2 (en) | 2014-05-27 | 2015-12-03 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2015183710A1 (en) | 2014-05-30 | 2015-12-03 | Novozymes A/S | Variants of gh family 11 xylanase and polynucleotides encoding same |
EP2952585A1 (en) | 2014-06-04 | 2015-12-09 | Boehringer Ingelheim RCV GmbH & Co KG | Improved protein production in fungi or yeasts |
WO2015189371A1 (en) | 2014-06-12 | 2015-12-17 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2015200659A1 (en) | 2014-06-25 | 2015-12-30 | Novozymes A/S | Xylanase variants and polynucleotides encoding same |
WO2016001319A1 (en) | 2014-07-03 | 2016-01-07 | Novozymes A/S | Improved stabilization of non-protease enzyme |
EP2987857A1 (en) | 2003-08-25 | 2016-02-24 | Novozymes, Inc. | Variants of glycoside hydrolases |
WO2016028999A1 (en) | 2014-08-20 | 2016-02-25 | Novozymes A/S | Xyloglucan endotransglycosylase variants and polynucleotides encoding same |
WO2016037096A1 (en) | 2014-09-05 | 2016-03-10 | Novozymes A/S | Carbohydrate binding module variants and polynucleotides encoding same |
US9295965B2 (en) | 2010-11-12 | 2016-03-29 | Gen9, Inc. | Methods and devices for nucleic acid synthesis |
WO2016062875A2 (en) | 2014-10-23 | 2016-04-28 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2016073610A1 (en) | 2014-11-07 | 2016-05-12 | Novozymes A/S | Xylanase based bleach boosting |
WO2016079305A1 (en) | 2014-11-20 | 2016-05-26 | Novozymes A/S | Alicyclobacillus variants and polynucleotides encoding same |
WO2016090059A1 (en) | 2014-12-02 | 2016-06-09 | Novozymes A/S | Laccase variants and polynucleotides encoding same |
WO2016087327A1 (en) | 2014-12-01 | 2016-06-09 | Novozymes A/S | Polypeptides having pullulanase activity comprising the x25, x45 and cbm41 domains |
WO2016087401A1 (en) | 2014-12-05 | 2016-06-09 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2016100910A1 (en) | 2014-12-19 | 2016-06-23 | Novozymes A/S | Recombinant host cells for the production of 3-hydroxypropionic acid |
WO2016095856A1 (en) | 2014-12-19 | 2016-06-23 | Novozymes A/S | Compositions comprising polypeptides having xylanase activity and polypeptides having arabinofuranosidase activity |
WO2016096996A1 (en) | 2014-12-16 | 2016-06-23 | Novozymes A/S | Polypeptides having n-acetyl glucosamine oxidase activity |
WO2016138303A1 (en) | 2015-02-27 | 2016-09-01 | Novozymes A/S | Mutant host cells for the production of 3-hydroxypropionic acid |
WO2016138315A1 (en) | 2015-02-25 | 2016-09-01 | Danisco Us Inc | Alpha-glucosidase, compositions & methods |
WO2016138167A2 (en) | 2015-02-24 | 2016-09-01 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
WO2016146473A1 (en) | 2015-03-19 | 2016-09-22 | Novozymes A/S | A brewing method |
WO2016162558A1 (en) | 2015-04-10 | 2016-10-13 | Novozymes A/S | Detergent composition |
WO2016162556A1 (en) | 2015-04-10 | 2016-10-13 | Novozymes A/S | Laundry method, use of dnase and detergent composition |
WO2016180748A1 (en) | 2015-05-08 | 2016-11-17 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2016180792A1 (en) | 2015-05-08 | 2016-11-17 | Novozymes A/S | Alpha-amylase variants having improved performance and stability |
WO2016180749A1 (en) | 2015-05-08 | 2016-11-17 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2016188459A1 (en) | 2015-05-27 | 2016-12-01 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2016196202A1 (en) | 2015-05-29 | 2016-12-08 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2016193420A1 (en) | 2015-06-04 | 2016-12-08 | Novozymes A/S | Use of m4 metalloprotease in wort production |
EP3106508A1 (en) | 2015-06-18 | 2016-12-21 | Henkel AG & Co. KGaA | Detergent composition comprising subtilase variants |
WO2016205127A1 (en) | 2015-06-18 | 2016-12-22 | Novozymes A/S | Polypeptides having trehalase activity and the use thereof in process of producing fermentation products |
WO2016202739A1 (en) | 2015-06-16 | 2016-12-22 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2016207384A1 (en) | 2015-06-26 | 2016-12-29 | Novozymes A/S | Method for producing a coffee extract |
WO2016206621A1 (en) | 2015-06-26 | 2016-12-29 | Novozymes A/S | Biofinishing system |
WO2016207373A1 (en) | 2015-06-26 | 2016-12-29 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2017000922A1 (en) | 2015-07-02 | 2017-01-05 | Novozymes A/S | Animal feed compositions and uses thereof |
WO2017019491A1 (en) | 2015-07-24 | 2017-02-02 | Novozymes Inc. | Polypeptides having beta-xylosidase activity and polynucleotides encoding same |
WO2017019490A1 (en) | 2015-07-24 | 2017-02-02 | Novozymes Inc. | Polypeptides having arabinofuranosidase activity and polynucleotides encoding same |
WO2017035270A1 (en) | 2015-08-24 | 2017-03-02 | Novozymes A/S | Beta-alanine aminotransferases for the production of 3-hydroxypropionic acid |
WO2017050242A1 (en) | 2015-09-22 | 2017-03-30 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2017060505A1 (en) | 2015-10-07 | 2017-04-13 | Novozymes A/S | Polypeptides |
WO2017064269A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Polypeptide variants |
WO2017066255A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2017064253A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2017066510A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Cleaning of water filtration membranes |
WO2017070219A1 (en) | 2015-10-20 | 2017-04-27 | Novozymes A/S | Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same |
WO2017089366A1 (en) | 2015-11-24 | 2017-06-01 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2017093318A1 (en) | 2015-12-01 | 2017-06-08 | Novozymes A/S | Methods for producing lipases |
WO2017100240A1 (en) | 2015-12-07 | 2017-06-15 | Eastman Chemical Company | Calb variants |
WO2017112847A1 (en) | 2015-12-22 | 2017-06-29 | Albumedix A/S | Improved protein expression strains |
WO2017129754A1 (en) | 2016-01-29 | 2017-08-03 | Novozymes A/S | Beta-glucanase variants and polynucleotides encoding same |
WO2017140807A1 (en) | 2016-02-16 | 2017-08-24 | Monaghan Mushrooms Group | Fungal polypeptides having lysozyme activity |
WO2017151957A1 (en) | 2016-03-02 | 2017-09-08 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
WO2017165760A1 (en) | 2016-03-24 | 2017-09-28 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
WO2017186250A1 (en) | 2016-04-29 | 2017-11-02 | Defensin Therapeutics Aps | Treatment of liver, biliary tract and pancreatic disorders |
WO2017186943A1 (en) | 2016-04-29 | 2017-11-02 | Novozymes A/S | Detergent compositions and uses thereof |
WO2017191160A1 (en) | 2016-05-03 | 2017-11-09 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding the same |
WO2017194487A1 (en) | 2016-05-09 | 2017-11-16 | Novozymes A/S | Variant polypeptides with improved performance and use of the same |
EP3246401A1 (en) | 2016-05-20 | 2017-11-22 | Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives | New fatty acid decarboxylase and its uses |
WO2017205535A1 (en) | 2016-05-27 | 2017-11-30 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2017202966A1 (en) | 2016-05-24 | 2017-11-30 | Novozymes A/S | Polypeptides having alpha-galactosidase activity and polynucleotides encoding same |
WO2017202997A1 (en) | 2016-05-24 | 2017-11-30 | Novozymes A/S | Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity |
WO2017202979A1 (en) | 2016-05-24 | 2017-11-30 | Novozymes A/S | Polypeptides having alpha-galactosidase activity and polynucleotides encoding same |
WO2017202946A1 (en) | 2016-05-24 | 2017-11-30 | Novozymes A/S | Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity |
WO2017207762A1 (en) | 2016-06-03 | 2017-12-07 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2017210188A1 (en) | 2016-05-31 | 2017-12-07 | Novozymes A/S | Stabilized liquid peroxide compositions |
WO2017211803A1 (en) | 2016-06-07 | 2017-12-14 | Novozymes A/S | Co-expression of heterologous polypeptides to increase yield |
WO2018001959A1 (en) | 2016-06-30 | 2018-01-04 | Novozymes A/S | Lipase variants and compositions comprising surfactant and lipase variant |
WO2018002379A2 (en) | 2016-07-01 | 2018-01-04 | Novozymes A/S | Enzymatic preparation of indigo dyes and in situ dyeing process |
WO2018002261A1 (en) | 2016-07-01 | 2018-01-04 | Novozymes A/S | Detergent compositions |
WO2018007573A1 (en) | 2016-07-08 | 2018-01-11 | Novozymes A/S | Detergent compositions with galactanase |
WO2018007153A1 (en) | 2016-07-08 | 2018-01-11 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2018007154A1 (en) | 2016-07-08 | 2018-01-11 | Novozymes A/S | Xylanase variants and polynucleotides encoding same |
WO2018007435A1 (en) | 2016-07-05 | 2018-01-11 | Novozymes A/S | Pectate lyase variants and polynucleotides encoding same |
WO2018011276A1 (en) | 2016-07-13 | 2018-01-18 | The Procter & Gamble Company | Bacillus cibi dnase variants and uses thereof |
EP3272862A1 (en) | 2011-12-16 | 2018-01-24 | Novozymes, Inc. | Polypeptides having laccase activity and polynucleotides encoding same |
WO2018015295A1 (en) | 2016-07-18 | 2018-01-25 | Novozymes A/S | Lipase variants, polynucleotides encoding same and the use thereof |
WO2018015303A1 (en) | 2016-07-21 | 2018-01-25 | Novozymes A/S | Serine protease variants and polynucleotides encoding same |
WO2018015444A1 (en) | 2016-07-22 | 2018-01-25 | Novozymes A/S | Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi |
WO2018017792A1 (en) | 2016-07-20 | 2018-01-25 | Novozymes A/S | Heat-stable metagenomic carbonic anhydrases and their use |
WO2018015304A1 (en) | 2016-07-21 | 2018-01-25 | Novozymes A/S | Serine protease variants and polynucleotides encoding same |
WO2018026868A1 (en) | 2016-08-01 | 2018-02-08 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
US9890364B2 (en) | 2012-05-29 | 2018-02-13 | The General Hospital Corporation | TAL-Tet1 fusion proteins and methods of use thereof |
WO2018037062A1 (en) | 2016-08-24 | 2018-03-01 | Novozymes A/S | Gh9 endoglucanase variants and polynucleotides encoding same |
WO2018037064A1 (en) | 2016-08-24 | 2018-03-01 | Henkel Ag & Co. Kgaa | Detergent compositions comprising xanthan lyase variants i |
WO2018037065A1 (en) | 2016-08-24 | 2018-03-01 | Henkel Ag & Co. Kgaa | Detergent composition comprising gh9 endoglucanase variants i |
WO2018037061A1 (en) | 2016-08-24 | 2018-03-01 | Novozymes A/S | Xanthan lyase variants and polynucleotides encoding same |
WO2018060475A1 (en) | 2016-09-29 | 2018-04-05 | Novozymes A/S | Spore containing granule |
EP3309249A1 (en) | 2013-07-29 | 2018-04-18 | Novozymes A/S | Protease variants and polynucleotides encoding same |
US9957502B2 (en) | 2001-11-22 | 2018-05-01 | Sloning Biotechnology Gmbh | Nucleic acid synthesis methods |
WO2018077938A1 (en) | 2016-10-25 | 2018-05-03 | Novozymes A/S | Detergent compositions |
WO2018085370A1 (en) | 2016-11-02 | 2018-05-11 | Novozymes A/S | Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material |
EP3321360A2 (en) | 2013-01-03 | 2018-05-16 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2018094181A1 (en) | 2016-11-21 | 2018-05-24 | Novozymes A/S | Yeast cell extract assisted construction of dna molecules |
WO2018098124A1 (en) | 2016-11-23 | 2018-05-31 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2018102348A1 (en) | 2016-11-29 | 2018-06-07 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2018099965A1 (en) | 2016-11-30 | 2018-06-07 | Novozymes A/S | Method of baking |
EP3333258A2 (en) | 2011-03-25 | 2018-06-13 | Novozymes A/S | Method for degrading or converting cellulosic material |
WO2018106792A1 (en) | 2016-12-06 | 2018-06-14 | Novozymes A/S | Improved processes for production of ethanol from xylose-containing cellulosic substrates using engineered yeast strains |
WO2018108971A2 (en) | 2016-12-13 | 2018-06-21 | Defensin Therapeutics Aps | Methods for treating inflammatory conditions of the lungs |
WO2018114973A1 (en) | 2016-12-20 | 2018-06-28 | Novozymes A/S | Recombinant yeast strains for pentose fermentation |
EP3357994A1 (en) | 2017-02-01 | 2018-08-08 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants |
WO2018141707A2 (en) | 2017-02-01 | 2018-08-09 | Novozymes A/S | Alpha-amylase variants |
WO2018150021A1 (en) | 2017-02-20 | 2018-08-23 | Novozymes A/S | Lipolytic enzyme for use in baking |
EP3372680A1 (en) | 2013-04-30 | 2018-09-12 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2018164737A1 (en) | 2017-03-07 | 2018-09-13 | Danisco Us Inc. | Thermostable glucoamylase and methods of use, thereof |
US10081807B2 (en) | 2012-04-24 | 2018-09-25 | Gen9, Inc. | Methods for sorting nucleic acids and multiplexed preparative in vitro cloning |
WO2018177938A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having dnase activity |
WO2018177936A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having dnase activity |
WO2018178126A1 (en) | 2017-03-29 | 2018-10-04 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Recombinant host cell with altered membrane lipid composition |
WO2018178061A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having rnase activity |
WO2018185152A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Polypeptide compositions and uses thereof |
WO2018185181A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Glycosyl hydrolases |
WO2018185150A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Polypeptides |
WO2018191215A1 (en) | 2017-04-11 | 2018-10-18 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2018202846A1 (en) | 2017-05-05 | 2018-11-08 | Novozymes A/S | Compositions comprising lipase and sulfite |
WO2018206535A1 (en) | 2017-05-08 | 2018-11-15 | Novozymes A/S | Carbohydrate-binding domain and polynucleotides encoding the same |
WO2018206300A1 (en) | 2017-05-08 | 2018-11-15 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2018206302A1 (en) | 2017-05-08 | 2018-11-15 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2018220116A1 (en) | 2017-05-31 | 2018-12-06 | Novozymes A/S | Xylose fermenting yeast strains and processes thereof for ethanol production |
WO2018222990A1 (en) | 2017-06-02 | 2018-12-06 | Novozymes A/S | Improved yeast for ethanol production |
WO2018224544A1 (en) | 2017-06-08 | 2018-12-13 | Novozymes A/S | Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions |
EP3415624A1 (en) | 2014-01-22 | 2018-12-19 | Novozymes A/S | Pullulanase variants and polynucleotides encoding same |
WO2018234465A1 (en) | 2017-06-22 | 2018-12-27 | Novozymes A/S | Xylanase variants and polynucleotides encoding same |
WO2018234349A1 (en) | 2017-06-20 | 2018-12-27 | Albumedix Ltd | Improved protein expression strains |
WO2019005755A1 (en) | 2017-06-28 | 2019-01-03 | Novozymes A/S | Polypeptides having trehalase activity and polynucleotides encoding same |
WO2019002356A1 (en) | 2017-06-30 | 2019-01-03 | Novozymes A/S | Enzyme slurry composition |
WO2019023222A1 (en) | 2017-07-24 | 2019-01-31 | Novozymes A/S | Gh5 and gh30 in wet milling |
US10202608B2 (en) | 2006-08-31 | 2019-02-12 | Gen9, Inc. | Iterative nucleic acid assembly using activation of vector-encoded traits |
WO2019030165A1 (en) | 2017-08-08 | 2019-02-14 | Novozymes A/S | Polypeptides having trehalase activity and the use thereof in process of producing fermentation products |
WO2019038060A1 (en) | 2017-08-24 | 2019-02-28 | Henkel Ag & Co. Kgaa | Detergent composition comprising xanthan lyase variants ii |
WO2019038059A1 (en) | 2017-08-24 | 2019-02-28 | Henkel Ag & Co. Kgaa | Detergent compositions comprising gh9 endoglucanase variants ii |
WO2019038058A1 (en) | 2017-08-24 | 2019-02-28 | Novozymes A/S | Gh9 endoglucanase variants and polynucleotides encoding same |
WO2019038057A1 (en) | 2017-08-24 | 2019-02-28 | Novozymes A/S | Xanthan lyase variants and polynucleotides encoding same |
WO2019043191A1 (en) | 2017-09-01 | 2019-03-07 | Novozymes A/S | Animal feed additives comprising a polypeptide having protease activity and uses thereof |
WO2019046703A1 (en) | 2017-09-01 | 2019-03-07 | Novozymes A/S | Methods for improving genome editing in fungi |
WO2019043088A1 (en) | 2017-08-31 | 2019-03-07 | Novozymes A/S | Polypeptides having d-psicose 3-epimerase activity and polynucleotides encoding same |
WO2019042971A1 (en) | 2017-08-29 | 2019-03-07 | Novozymes A/S | Baker's yeast expressing anti-staling/freshness amylases |
WO2019043189A1 (en) | 2017-09-01 | 2019-03-07 | Novozymes A/S | Animal feed additives comprising polypeptide having protease activity and uses thereof |
EP3453757A1 (en) | 2013-12-20 | 2019-03-13 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2019050754A1 (en) | 2017-09-11 | 2019-03-14 | Danisco Us Inc | Glucoamylase and methods of use, thereof |
US10233228B2 (en) | 2010-04-09 | 2019-03-19 | Albumedix Ltd | Albumin derivatives and variants |
EP3461881A1 (en) | 2013-05-03 | 2019-04-03 | Novozymes A/S | Microencapsulation of detergent enzymes |
WO2019067390A1 (en) | 2017-09-27 | 2019-04-04 | The Procter & Gamble Company | Detergent compositions comprising lipases |
WO2019063499A1 (en) | 2017-09-27 | 2019-04-04 | Novozymes A/S | Lipase variants and microcapsule compositions comprising such lipase variants |
WO2019068715A1 (en) | 2017-10-02 | 2019-04-11 | Novozymes A/S | Polypeptides having mannanase activity and polynucleotides encoding same |
WO2019068713A1 (en) | 2017-10-02 | 2019-04-11 | Novozymes A/S | Polypeptides having mannanase activity and polynucleotides encoding same |
WO2019070883A1 (en) | 2017-10-04 | 2019-04-11 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
US10273271B2 (en) | 2011-07-15 | 2019-04-30 | The General Hospital Corporation | Methods of transcription activator like effector assembly |
WO2019081721A1 (en) | 2017-10-27 | 2019-05-02 | Novozymes A/S | Dnase variants |
DE102017125560A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANSING COMPOSITIONS CONTAINING DISPERSINE III |
DE102017125559A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANSING COMPOSITIONS CONTAINING DISPERSINE II |
WO2019084350A1 (en) | 2017-10-27 | 2019-05-02 | The Procter & Gamble Company | Detergent compositions comprising polypeptide variants |
WO2019083818A1 (en) | 2017-10-23 | 2019-05-02 | Novozymes A/S | Improving expression of a protease by co-expression with propeptide |
DE102017125558A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANING COMPOSITIONS CONTAINING DISPERSINE I |
WO2019092201A2 (en) | 2017-11-10 | 2019-05-16 | Defensin Therapeutics Aps | Maturation of mucosal defense and gut/lung function in the preterm infant |
WO2019092042A1 (en) | 2017-11-10 | 2019-05-16 | Novozymes A/S | Temperature-sensitive cas9 protein |
WO2019096903A1 (en) | 2017-11-20 | 2019-05-23 | Novozymes A/S | New galactanases (ec 3.2.1.89) for use in soy processing |
WO2019099235A1 (en) | 2017-11-14 | 2019-05-23 | Danisco Us Inc | Alpha-amylase, composition and method |
WO2019101773A2 (en) | 2017-11-24 | 2019-05-31 | Defensin Therapeutics Aps | Prevention and treatment of graft-versus-host-disease with defensins |
US10308931B2 (en) | 2012-03-21 | 2019-06-04 | Gen9, Inc. | Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis |
WO2019110462A1 (en) | 2017-12-04 | 2019-06-13 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2019113413A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2019113415A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2019122083A1 (en) | 2017-12-22 | 2019-06-27 | Novozymes A/S | Wheat milling process and gh8 xylanases |
WO2019125804A1 (en) | 2017-12-20 | 2019-06-27 | Basf Se | Nucleases and methods for making and using them |
WO2019148192A1 (en) | 2018-01-29 | 2019-08-01 | Novozymes A/S | Microorganisms with improved nitrogen utilization for ethanol production |
EP3521434A1 (en) | 2014-03-12 | 2019-08-07 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2019154954A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipase variants and compositions thereof |
WO2019154951A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipases, lipase variants and compositions thereof |
WO2019168650A1 (en) | 2018-02-28 | 2019-09-06 | The Procter & Gamble Company | Methods of cleaning |
WO2019173424A1 (en) | 2018-03-09 | 2019-09-12 | Danisco Us Inc | Glucoamylases and methods of use thereof |
WO2019175240A1 (en) | 2018-03-13 | 2019-09-19 | Novozymes A/S | Microencapsulation using amino sugar oligomers |
WO2019185726A1 (en) | 2018-03-29 | 2019-10-03 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
EP3550015A1 (en) | 2014-04-10 | 2019-10-09 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
EP3553172A1 (en) | 2012-08-16 | 2019-10-16 | Novozymes A/S | Method for treating textile with endoglucanase |
WO2019197318A1 (en) | 2018-04-09 | 2019-10-17 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2019201783A1 (en) | 2018-04-19 | 2019-10-24 | Novozymes A/S | Stabilized cellulase variants |
WO2019201785A1 (en) | 2018-04-19 | 2019-10-24 | Novozymes A/S | Stabilized cellulase variants |
US10457935B2 (en) | 2010-11-12 | 2019-10-29 | Gen9, Inc. | Protein arrays and methods of using and making the same |
EP3569611A1 (en) | 2013-04-23 | 2019-11-20 | Novozymes A/S | Liquid automatic dish washing detergent compositions with stabilised subtilisin |
WO2019229228A1 (en) | 2018-05-31 | 2019-12-05 | Novozymes A/S | Method for treating dissolving pulp using lytic polysaccharide monooxygenase |
US10501524B2 (en) | 2012-11-08 | 2019-12-10 | Albumedix Ltd | Albumin variants |
WO2020002494A1 (en) | 2018-06-27 | 2020-01-02 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Means and methods for increased protein expression by use of transcription factors |
WO2020002575A1 (en) | 2018-06-28 | 2020-01-02 | Novozymes A/S | Polypeptides having pectin lyase activity and polynucleotides encoding same |
WO2020010101A2 (en) | 2018-07-04 | 2020-01-09 | Danisco Us Inc | Glucoamylases and methods of use, thereof |
WO2020023411A1 (en) | 2018-07-25 | 2020-01-30 | Novozymes A/S | Enzyme-expressing yeast for ethanol production |
EP3611260A1 (en) | 2013-07-29 | 2020-02-19 | Novozymes A/S | Protease variants and polynucleotides encoding same |
WO2020043836A1 (en) | 2018-08-31 | 2020-03-05 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2020070199A1 (en) | 2018-10-03 | 2020-04-09 | Novozymes A/S | Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same |
WO2020076697A1 (en) | 2018-10-08 | 2020-04-16 | Novozymes A/S | Enzyme-expressing yeast for ethanol production |
US10633428B2 (en) | 2015-08-20 | 2020-04-28 | Albumedix Ltd | Albumin variants and conjugates |
WO2020092608A1 (en) | 2018-10-31 | 2020-05-07 | Novozymes A/S | Genome editing by guided endonuclease and single-stranded oligonucleotide |
US10676749B2 (en) | 2013-02-07 | 2020-06-09 | The General Hospital Corporation | Tale transcriptional activators |
WO2020123463A1 (en) | 2018-12-12 | 2020-06-18 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2020127796A2 (en) | 2018-12-21 | 2020-06-25 | Novozymes A/S | Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same |
US10711050B2 (en) | 2011-11-18 | 2020-07-14 | Albumedix Ltd | Variant serum albumin with improved half-life and other properties |
EP3690037A1 (en) | 2014-12-04 | 2020-08-05 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2020160126A1 (en) | 2019-01-31 | 2020-08-06 | Novozymes A/S | Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed |
WO2020188095A1 (en) | 2019-03-21 | 2020-09-24 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2020197400A1 (en) | 2019-03-27 | 2020-10-01 | Umc Utrecht Holding B.V. | Engineered iga antibodies and methods of use |
WO2020201403A1 (en) | 2019-04-03 | 2020-10-08 | Novozymes A/S | Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions |
EP3722406A1 (en) | 2014-04-11 | 2020-10-14 | Novozymes A/S | Detergent composition |
WO2020208056A1 (en) | 2019-04-12 | 2020-10-15 | Novozymes A/S | Stabilized glycoside hydrolase variants |
WO2020207944A1 (en) | 2019-04-10 | 2020-10-15 | Novozymes A/S | Polypeptide variants |
EP3739029A1 (en) | 2014-07-04 | 2020-11-18 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2020229191A1 (en) | 2019-05-15 | 2020-11-19 | Novozymes A/S | Temperature-sensitive rna-guided endonuclease |
EP3741849A2 (en) | 2014-12-19 | 2020-11-25 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP3741848A2 (en) | 2014-12-19 | 2020-11-25 | Novozymes A/S | Protease variants and polynucleotides encoding same |
WO2020264552A1 (en) | 2019-06-24 | 2020-12-30 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants |
WO2020260223A1 (en) | 2019-06-24 | 2020-12-30 | Novozymes A/S | Alpha-amylase variants |
WO2021001400A1 (en) | 2019-07-02 | 2021-01-07 | Novozymes A/S | Lipase variants and compositions thereof |
WO2021013464A1 (en) | 2019-07-25 | 2021-01-28 | Novozymes A/S | Filamentous fungal expression system |
WO2021018751A1 (en) | 2019-07-26 | 2021-02-04 | Novozymes A/S | Enzymatic treatment of paper pulp |
WO2021021458A1 (en) | 2019-07-26 | 2021-02-04 | Novozymes A/S | Microorganisms with improved nitrogen transport for ethanol production |
WO2021025872A1 (en) | 2019-08-06 | 2021-02-11 | Novozymes A/S | Fusion proteins for improved enzyme expression |
WO2021032881A1 (en) | 2019-08-22 | 2021-02-25 | Basf Se | Amylase variants |
EP3786269A1 (en) | 2013-06-06 | 2021-03-03 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2021055395A1 (en) | 2019-09-16 | 2021-03-25 | Novozymes A/S | Polypeptides having beta-glucanase activity and polynucleotides encoding same |
WO2021064068A1 (en) | 2019-10-03 | 2021-04-08 | Novozymes A/S | Polypeptides comprising at least two carbohydrate binding domains |
WO2021119304A1 (en) | 2019-12-10 | 2021-06-17 | Novozymes A/S | Microorganism for improved pentose fermentation |
WO2021123184A2 (en) | 2019-12-19 | 2021-06-24 | Novozymes A/S | Alpha-amylase variants |
WO2021122867A2 (en) | 2019-12-19 | 2021-06-24 | Novozymes A/S | Xylanase variants and polynucleotides encoding same |
WO2021127319A1 (en) | 2019-12-19 | 2021-06-24 | The Procter & Gamble Company | Cleaning compositions comprising polypeptides having alpha amylase activity |
WO2021123307A2 (en) | 2019-12-20 | 2021-06-24 | Novozymes A/S | Polypeptides having proteolytic activity and use thereof |
US11072789B2 (en) | 2012-06-25 | 2021-07-27 | Gen9, Inc. | Methods for nucleic acid assembly and high throughput sequencing |
WO2021148278A1 (en) | 2020-01-24 | 2021-07-29 | Novozymes A/S | Mutants of a filamentous fungal cell having increased productivity in the production of a polypeptide |
WO2021152123A1 (en) | 2020-01-31 | 2021-08-05 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2021152120A1 (en) | 2020-01-31 | 2021-08-05 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2021163011A2 (en) | 2020-02-10 | 2021-08-19 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2021163015A1 (en) | 2020-02-10 | 2021-08-19 | Novozymes A/S | Process for producing ethanol from raw starch using alpha-amylase variants |
WO2021163030A2 (en) | 2020-02-10 | 2021-08-19 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
EP3872175A1 (en) | 2015-06-18 | 2021-09-01 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2021170559A1 (en) | 2020-02-26 | 2021-09-02 | Novozymes A/S | Polypeptide variants |
EP3878960A1 (en) | 2014-07-04 | 2021-09-15 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2021204838A1 (en) | 2020-04-08 | 2021-10-14 | Novozymes A/S | Carbohydrate binding module variants |
WO2021212095A1 (en) | 2020-04-17 | 2021-10-21 | Danisco Us Inc. | Glucoamylase and methods of use thereof |
WO2021214059A1 (en) | 2020-04-21 | 2021-10-28 | Novozymes A/S | Cleaning compositions comprising polypeptides having fructan degrading activity |
EP3929285A2 (en) | 2015-07-01 | 2021-12-29 | Novozymes A/S | Methods of reducing odor |
EP3950939A2 (en) | 2015-07-06 | 2022-02-09 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP3957711A2 (en) | 2015-10-28 | 2022-02-23 | Novozymes A/S | Detergent composition comprising amylase and protease variants |
WO2022037836A1 (en) | 2020-08-18 | 2022-02-24 | Novozymes A/S | Dispersins expressed with amylase signal peptides |
WO2022043321A2 (en) | 2020-08-25 | 2022-03-03 | Novozymes A/S | Variants of a family 44 xyloglucanase |
WO2022043547A1 (en) | 2020-08-28 | 2022-03-03 | Novozymes A/S | Protease variants with improved solubility |
WO2022053706A1 (en) | 2020-09-14 | 2022-03-17 | Aesculus Bio Aps | Defensin fragment derived lipopeptides for treatment of drug-resistant microorganisms |
WO2022074037A2 (en) | 2020-10-07 | 2022-04-14 | Novozymes A/S | Alpha-amylase variants |
WO2022078910A1 (en) | 2020-10-13 | 2022-04-21 | Novozymes A/S | Glycosyltransferase variants for improved protein production |
WO2022090555A1 (en) | 2020-11-02 | 2022-05-05 | Novozymes A/S | Leader peptides and polynucleotides encoding the same |
WO2022090320A1 (en) | 2020-10-28 | 2022-05-05 | Novozymes A/S | Use of lipoxygenase |
WO2022090361A2 (en) | 2020-10-29 | 2022-05-05 | Novozymes A/S | Lipase variants and compositions comprising such lipase variants |
WO2022090564A1 (en) | 2020-11-02 | 2022-05-05 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2022106404A1 (en) | 2020-11-18 | 2022-05-27 | Novozymes A/S | Combination of proteases |
WO2022106400A1 (en) | 2020-11-18 | 2022-05-27 | Novozymes A/S | Combination of immunochemically different proteases |
WO2022129166A1 (en) | 2020-12-15 | 2022-06-23 | Novozymes A/S | Mutated host cells with reduced cell motility |
WO2022162043A1 (en) | 2021-01-28 | 2022-08-04 | Novozymes A/S | Lipase with low malodor generation |
WO2022171780A2 (en) | 2021-02-12 | 2022-08-18 | Novozymes A/S | Alpha-amylase variants |
EP4047088A1 (en) | 2021-02-22 | 2022-08-24 | Basf Se | Amylase variants |
WO2022175440A1 (en) | 2021-02-18 | 2022-08-25 | Novozymes A/S | Inactive heme polypeptides |
WO2022175435A1 (en) | 2021-02-22 | 2022-08-25 | Basf Se | Amylase variants |
US11441140B2 (en) | 2015-12-07 | 2022-09-13 | Henkel Ag & Co. Kgaa | Dishwashing compositions comprising polypeptides having beta-glucanase activity and uses thereof |
WO2022189521A1 (en) | 2021-03-12 | 2022-09-15 | Novozymes A/S | Polypeptide variants |
EP4060036A1 (en) | 2021-03-15 | 2022-09-21 | Novozymes A/S | Polypeptide variants |
EP4060010A2 (en) | 2021-03-15 | 2022-09-21 | The Procter & Gamble Company | Cleaning compositions containing polypeptide variants |
WO2022194673A1 (en) | 2021-03-15 | 2022-09-22 | Novozymes A/S | Dnase variants |
WO2022199418A1 (en) | 2021-03-26 | 2022-09-29 | Novozymes A/S | Detergent composition with reduced polymer content |
WO2022218863A1 (en) | 2021-04-12 | 2022-10-20 | Novozymes A/S | Method for producing a meat analogue product |
WO2022251056A1 (en) | 2021-05-27 | 2022-12-01 | Novozymes A/S | Transcriptional regulators and polynucleotides encoding the same |
WO2022261003A1 (en) | 2021-06-07 | 2022-12-15 | Novozymes A/S | Engineered microorganism for improved ethanol fermentation |
WO2022263553A1 (en) | 2021-06-16 | 2022-12-22 | Novozymes A/S | Method for controlling slime in a pulp or paper making process |
US11555061B2 (en) | 2009-02-11 | 2023-01-17 | Albumedix, Ltd | Albumin variants and conjugates |
WO2023288294A1 (en) | 2021-07-16 | 2023-01-19 | Novozymes A/S | Compositions and methods for improving the rainfastness of proteins on plant surfaces |
WO2023285348A1 (en) | 2021-07-13 | 2023-01-19 | Novozymes A/S | Recombinant cutinase expression |
EP4163354A2 (en) | 2014-03-19 | 2023-04-12 | Novozymes A/S | Polypeptides having phospholipase c activity and polynucleotides encoding same |
WO2023061928A1 (en) | 2021-10-12 | 2023-04-20 | Novozymes A/S | Endoglucanase with improved stability |
WO2023064905A1 (en) | 2021-10-15 | 2023-04-20 | Danisco Us Inc. | Glucoamylase variants and methods for use thereof |
US11667941B2 (en) | 2018-01-12 | 2023-06-06 | Camena Bioscience Limited | Compositions and methods for template-free geometric enzymatic nucleic acid synthesis |
WO2023104846A1 (en) | 2021-12-10 | 2023-06-15 | Novozymes A/S | Improved protein production in recombinant bacteria |
WO2023118565A1 (en) | 2021-12-23 | 2023-06-29 | Novozymes A/S | Reduction of residual dna in microbial fermentation products |
WO2023118436A1 (en) | 2021-12-22 | 2023-06-29 | Novozymes A/S | Method of producing a milk-based product |
US11702662B2 (en) | 2011-08-26 | 2023-07-18 | Gen9, Inc. | Compositions and methods for high fidelity assembly of nucleic acids |
EP4219702A2 (en) | 2015-12-30 | 2023-08-02 | Novozymes A/S | Enzyme variants and polynucleotides encoding the same |
WO2023152220A1 (en) | 2022-02-10 | 2023-08-17 | Novozymes A/S | Improved expression of recombinant proteins |
WO2023161245A1 (en) | 2022-02-22 | 2023-08-31 | Novozymes A/S | Oral care composition comprising enzymes |
WO2023165507A1 (en) | 2022-03-02 | 2023-09-07 | Novozymes A/S | Use of xyloglucanase for improvement of sustainability of detergents |
EP4242303A1 (en) | 2022-03-08 | 2023-09-13 | Novozymes A/S | Fusion polypeptides with deamidase inhibitor and deamidase domains |
WO2023170177A1 (en) | 2022-03-08 | 2023-09-14 | Novozymes A/S | Fusion polypeptides with deamidase inhibitor and deamidase domains |
EP4273249A2 (en) | 2023-07-07 | 2023-11-08 | Novozymes A/S | Improved expression of recombinant proteins |
WO2023222648A2 (en) | 2022-05-17 | 2023-11-23 | Novozymes A/S | Process for reducing free fatty acids |
WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
WO2023247514A1 (en) | 2022-06-22 | 2023-12-28 | Novozymes A/S | Recombinant mannanase expression |
WO2023247664A2 (en) | 2022-06-24 | 2023-12-28 | Novozymes A/S | Lipase variants and compositions comprising such lipase variants |
WO2023247348A1 (en) | 2022-06-21 | 2023-12-28 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2024003143A1 (en) | 2022-06-30 | 2024-01-04 | Novozymes A/S | Mutanases and oral care compositions comprising same |
WO2024012912A1 (en) | 2022-07-15 | 2024-01-18 | Novozymes A/S | Polypeptides having deamidase inhibitor activity |
US11891631B2 (en) | 2012-10-12 | 2024-02-06 | The General Hospital Corporation | Transcription activator-like effector (tale) - lysine-specific demethylase 1 (LSD1) fusion proteins |
WO2024033134A1 (en) | 2022-08-11 | 2024-02-15 | Basf Se | Enzyme compositions comprising protease, mannanase, and/or cellulase |
WO2024033133A2 (en) | 2022-08-11 | 2024-02-15 | Basf Se | Enzyme compositions comprising an amylase |
EP4339282A2 (en) | 2014-12-04 | 2024-03-20 | Novozymes A/S | Liquid cleaning compositions comprising protease variants |
WO2024056643A1 (en) | 2022-09-15 | 2024-03-21 | Novozymes A/S | Fungal signal peptides |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE19619373A1 (en) * | 1996-05-14 | 1997-11-20 | Hoechst Ag | New substance library and the resulting supramolecular complexes |
US5942609A (en) * | 1998-11-12 | 1999-08-24 | The Porkin-Elmer Corporation | Ligation assembly and detection of polynucleotides on solid-support |
US6479262B1 (en) | 2000-05-16 | 2002-11-12 | Hercules, Incorporated | Solid phase enzymatic assembly of polynucleotides |
WO2016007604A1 (en) | 2014-07-09 | 2016-01-14 | Gen9, Inc. | Compositions and methods for site-directed dna nicking and cleaving |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1990000626A1 (en) * | 1988-07-14 | 1990-01-25 | Baylor College Of Medicine | Solid phase assembly and reconstruction of biopolymers |
WO1992018645A1 (en) * | 1991-04-16 | 1992-10-29 | Diagen Institut Für Molekularbiologische Diagnostik Gmbh | Method for preparing new biopolymers |
-
1993
- 1993-12-21 DE DE19934343591 patent/DE4343591A1/en not_active Withdrawn
-
1994
- 1994-12-20 WO PCT/EP1994/004240 patent/WO1995017413A1/en active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1990000626A1 (en) * | 1988-07-14 | 1990-01-25 | Baylor College Of Medicine | Solid phase assembly and reconstruction of biopolymers |
WO1992018645A1 (en) * | 1991-04-16 | 1992-10-29 | Diagen Institut Für Molekularbiologische Diagnostik Gmbh | Method for preparing new biopolymers |
Non-Patent Citations (1)
Title |
---|
MUTTER M. ET AL: "The Construction of New Proteins Part III", HELVETICA CHIMICA ACTA, vol. 71, 1988, BASEL CH, pages 835 - 847 * |
Cited By (763)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7795030B2 (en) | 1994-02-17 | 2010-09-14 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
US6413774B1 (en) | 1994-02-17 | 2002-07-02 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US6391640B1 (en) | 1994-02-17 | 2002-05-21 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
US6309883B1 (en) | 1994-02-17 | 2001-10-30 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
US6291242B1 (en) | 1994-02-17 | 2001-09-18 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US5837458A (en) * | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
US7105297B2 (en) | 1994-02-17 | 2006-09-12 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
US6180406B1 (en) | 1994-02-17 | 2001-01-30 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US5830721A (en) * | 1994-02-17 | 1998-11-03 | Affymax Technologies N.V. | DNA mutagenesis by random fragmentation and reassembly |
US8048674B2 (en) | 1994-02-17 | 2011-11-01 | Codexis Mayflower Holdings, Llc | Methods and compositions for cellular and metabolic engineering |
US6117679A (en) * | 1994-02-17 | 2000-09-12 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US6132970A (en) * | 1994-02-17 | 2000-10-17 | Maxygen, Inc. | Methods of shuffling polynucleotides |
US5811238A (en) * | 1994-02-17 | 1998-09-22 | Affymax Technologies N.V. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US6165793A (en) * | 1996-03-25 | 2000-12-26 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US5965408A (en) * | 1996-07-09 | 1999-10-12 | Diversa Corporation | Method of DNA reassembly by interrupting synthesis |
US6440668B1 (en) | 1996-07-09 | 2002-08-27 | Diversa Corporation | Method of DNA shuffling with polynucleotides produced by blocking or interrupting a synthesis or amplification process |
WO1998005765A1 (en) * | 1996-08-07 | 1998-02-12 | Novo Nordisk A/S | Double-stranded dna with cohesive end(s), and method of shuffling dna using the same |
WO1998005764A1 (en) * | 1996-08-07 | 1998-02-12 | Novo Nordisk A/S | Nucleic acid pool and method for producing the same |
US6303344B1 (en) | 1996-12-18 | 2001-10-16 | Maxygen, Inc. | Methods and compositions for polypeptide engineering |
US6541207B1 (en) | 1997-03-18 | 2003-04-01 | Novozymes A/S | Methods for generating recombined polynucleotides |
US6159688A (en) * | 1997-03-18 | 2000-12-12 | Novo Nordisk A/S | Methods of producing polynucleotide variants |
US6159687A (en) * | 1997-03-18 | 2000-12-12 | Novo Nordisk A/S | Methods for generating recombined polynucleotides |
US6291165B1 (en) | 1997-03-18 | 2001-09-18 | Novo Nordisk A/S | Shuffling of heterologous DNA sequences |
WO1998041622A1 (en) | 1997-03-18 | 1998-09-24 | Novo Nordisk A/S | Method for constructing a library using dna shuffling |
US6368805B1 (en) | 1997-03-18 | 2002-04-09 | Novozymes A/S | Methods of producing polynucleotide variants |
US6153410A (en) * | 1997-03-25 | 2000-11-28 | California Institute Of Technology | Recombination of polynucleotide sequences using random or defined primers |
US6177263B1 (en) * | 1997-03-25 | 2001-01-23 | California Institute Of Technology | Recombination of polynucleotide sequences using random or defined primers |
WO1999036430A1 (en) * | 1998-01-13 | 1999-07-22 | BioteCon Gesellschaft für Biotechnologische Entwicklung und Consulting mbH | Oligoligands with a binding capacity |
DE19800899A1 (en) * | 1998-01-13 | 1999-07-15 | Biotecon Ges Fuer Biotechnologische Entwicklung & Consulting Mbh | Preparation of oligo-ligands for macromolecules with optionally unknown composition of building blocks |
EP2284272A1 (en) | 1998-06-10 | 2011-02-16 | Novozymes A/S | Mannanases |
EP2287318A1 (en) | 1998-06-10 | 2011-02-23 | Novozymes A/S | Mannanases |
EP2261359A1 (en) | 1998-06-10 | 2010-12-15 | Novozymes A/S | Mannanases |
US7737088B1 (en) | 1998-08-28 | 2010-06-15 | Febit Holding Gmbh | Method and device for producing biochemical reaction supporting materials |
US6586211B1 (en) | 1999-02-19 | 2003-07-01 | Febit Ferrarius Biotechnology Gmbh | Method for producing polymers |
US7790369B2 (en) | 1999-02-19 | 2010-09-07 | Febit Holding Gmbh | Method for producing polymers |
EP1728860A1 (en) * | 1999-02-19 | 2006-12-06 | febit biotech GmbH | Method for producing polymers |
US9568839B2 (en) | 1999-02-19 | 2017-02-14 | Synthetic Genomics, Inc. | Method for producing polymers |
WO2000049142A1 (en) * | 1999-02-19 | 2000-08-24 | Febit Ferrarius Biotechnology Gmbh | Method for producing polymers |
WO2000075368A3 (en) * | 1999-06-07 | 2001-05-17 | Diavir Gmbh | Method for the synthesis of dna fragments |
US8137906B2 (en) | 1999-06-07 | 2012-03-20 | Sloning Biotechnology Gmbh | Method for the synthesis of DNA fragments |
JP4756805B2 (en) * | 1999-06-07 | 2011-08-24 | スローニング・ビオテヒノロギー・ゲーエムベーハー | DNA fragment synthesis method |
JP2003501069A (en) * | 1999-06-07 | 2003-01-14 | スローニング・ビオテヒノロギー・ゲーエムベーハー | Method for synthesizing DNA fragments |
WO2000075368A2 (en) * | 1999-06-07 | 2000-12-14 | Sloning Biotechnology Gmbh | Method for the synthesis of dna fragments |
EP2133098A1 (en) | 2000-01-10 | 2009-12-16 | Maxygen Holdings Ltd | G-CSF conjugates |
EP1982732A2 (en) | 2000-02-11 | 2008-10-22 | Maxygen Holdings Ltd. | Factor VII or VIIA-like molecules |
EP2319541A1 (en) | 2000-02-11 | 2011-05-11 | Bayer HealthCare LLC | Factor VII or VIIA-like conjugates |
WO2002099091A2 (en) | 2001-06-06 | 2002-12-12 | Novozymes A/S | Endo-beta-1,4-glucanase from bacillus |
EP2305808A1 (en) | 2001-06-20 | 2011-04-06 | Nuevolution A/S | Templated molecules and methods for using such molecules |
US9957502B2 (en) | 2001-11-22 | 2018-05-01 | Sloning Biotechnology Gmbh | Nucleic acid synthesis methods |
EP2302046A1 (en) | 2002-10-01 | 2011-03-30 | Novozymes A/S | Family GH 61 polypeptides |
EP1411122A1 (en) * | 2002-10-18 | 2004-04-21 | Sloning BioTechnology GmbH | Method for the manufacture of nucleic acid molecules |
WO2004035781A1 (en) * | 2002-10-18 | 2004-04-29 | Sloning Biotechnology Gmbh | Method for the manufacture of nucleic acid molecules |
US7695906B2 (en) | 2002-10-18 | 2010-04-13 | Octavian Schatz | Method for the manufacture of nucleic acid molecules |
EP2228440A1 (en) | 2003-05-02 | 2010-09-15 | Novozymes Inc. | Variants of beta-glucosidases |
EP2987857A1 (en) | 2003-08-25 | 2016-02-24 | Novozymes, Inc. | Variants of glycoside hydrolases |
WO2005047499A1 (en) | 2003-10-28 | 2005-05-26 | Novozymes Inc. | Polypeptides having beta-glucosidase activity and polynucleotides encoding same |
WO2005066339A2 (en) | 2004-01-06 | 2005-07-21 | Novozymes A/S | Polypeptides of alicyclobacillus sp. |
US8092991B2 (en) | 2004-01-23 | 2012-01-10 | Cloning Biotechnology GmbH | De novo enzymatic production of nucleic acid molecules |
WO2005074647A2 (en) | 2004-01-30 | 2005-08-18 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP2314605A1 (en) | 2004-01-30 | 2011-04-27 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP2301958A1 (en) | 2004-01-30 | 2011-03-30 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP2305702A1 (en) | 2004-01-30 | 2011-04-06 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP2305703A1 (en) | 2004-01-30 | 2011-04-06 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP2308890A1 (en) | 2004-01-30 | 2011-04-13 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP2322630A2 (en) | 2004-02-12 | 2011-05-18 | Novozymes Inc. | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2005121351A2 (en) | 2004-05-27 | 2005-12-22 | Novozymes, Inc. | Methods for transforming and expression screening of filamentous fungal cells with a dna library |
EP2221366A1 (en) | 2004-06-29 | 2010-08-25 | Novozymes Inc. | Polypeptides having alpha-glucosidase activity and polynucleotides encoding same |
EP2302042A2 (en) | 2004-09-30 | 2011-03-30 | Novozymes A/S | Polypeptides having lipase activity and polynucleotides encoding same |
EP2298872A2 (en) | 2004-09-30 | 2011-03-23 | Novozymes A/S | Polypeptides having lipase activity and polynucleotides encoding same |
EP2295555A2 (en) | 2004-09-30 | 2011-03-16 | Novozymes, Inc. | Polypeptides having lipase activity and polynucleotides encodig same |
WO2006039541A2 (en) | 2004-09-30 | 2006-04-13 | Novozymes, Inc. | Polypeptides having lipase activity and polynucleotides encoding same |
WO2006037327A2 (en) | 2004-10-04 | 2006-04-13 | Novozymes A/S | Polypeptides having phytase activity and polynucleotides encoding same |
WO2006037328A1 (en) | 2004-10-04 | 2006-04-13 | Novozymes A/S | Polypeptides having phytase activity and polynucleotides encoding same |
EP2272964A2 (en) | 2004-10-04 | 2011-01-12 | Novozymes A/S | Polypeptides having phytase activity and polynucleotides encoding same |
WO2006053565A2 (en) | 2004-11-19 | 2006-05-26 | Novozymes A/S | Polypeptides having antimicrobial activity and polynucleotides encoding same |
WO2006069289A2 (en) | 2004-12-22 | 2006-06-29 | Novozymes North America, Inc | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2006097110A2 (en) | 2005-03-18 | 2006-09-21 | Novozymes A/S | Polypeptides having antimicrobial activity and polynucleotides encoding same |
WO2006116682A2 (en) | 2005-04-27 | 2006-11-02 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
EP2360246A1 (en) | 2005-08-16 | 2011-08-24 | Novozymes A/S | Polypeptides of strain bacillus SP. P203 |
EP1967584A1 (en) | 2005-08-16 | 2008-09-10 | Novozymes A/S | Polypeptides of strain bacillus SP. P203 |
WO2007023163A1 (en) | 2005-08-26 | 2007-03-01 | Novozymes A/S | Polypeptides having antimicrobial activity and polynucleotides encoding same |
EP2385110A2 (en) | 2005-09-30 | 2011-11-09 | Novozymes, Inc. | Methods for enhancing the degradation or conversion of cellulosic material |
WO2007109441A2 (en) | 2006-03-20 | 2007-09-27 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
EP2336309A2 (en) | 2006-03-20 | 2011-06-22 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
EP2374877A2 (en) | 2006-03-30 | 2011-10-12 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
EP2489671A2 (en) | 2006-08-23 | 2012-08-22 | febit holding GmbH | Programmable oligonucleotide synthesis |
WO2008022789A2 (en) | 2006-08-23 | 2008-02-28 | Febit Holding Gmbh | Programmable oligonucleotide synthesis |
US10202608B2 (en) | 2006-08-31 | 2019-02-12 | Gen9, Inc. | Iterative nucleic acid assembly using activation of vector-encoded traits |
WO2008037757A1 (en) | 2006-09-29 | 2008-04-03 | Novozymes A/S | Xylanases for animal feed |
WO2008067423A2 (en) | 2006-11-29 | 2008-06-05 | Novozymes, Inc. | Methods of improving the introduction of dna into bacterial cells |
EP2210898A1 (en) | 2006-11-29 | 2010-07-28 | Novozymes Inc. | Bacillus Licheniformis chromosome |
WO2008116878A1 (en) | 2007-03-26 | 2008-10-02 | Novozymes A/S | Hafnia phytase |
EP2468852A1 (en) | 2007-03-30 | 2012-06-27 | Novozymes A/S | Fungal peroxygenases and methods of application |
EP2471911A2 (en) | 2007-03-30 | 2012-07-04 | Novozymes A/S | Fungal peroxygenases and methods of application |
WO2009037253A2 (en) | 2007-09-18 | 2009-03-26 | Novozymes A/S | Polypeptides having tyrosinase activity and polynucleotides encoding same |
WO2009068565A1 (en) | 2007-11-27 | 2009-06-04 | Novozymes A/S | Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same |
WO2009068554A1 (en) | 2007-11-29 | 2009-06-04 | Novozymes A/S | Synthase inhibitor screening method |
WO2009073709A1 (en) | 2007-12-06 | 2009-06-11 | Novozymes A/S | Polypeptides having acetylxylan esterase activity and polynucleotides encoding same |
WO2009085935A2 (en) | 2007-12-19 | 2009-07-09 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP2653539A1 (en) | 2007-12-19 | 2013-10-23 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
US9115352B2 (en) | 2008-03-31 | 2015-08-25 | Sloning Biotechnology Gmbh | Method for the preparation of a nucleic acid library |
EP3404088A1 (en) | 2008-06-06 | 2018-11-21 | The Procter & Gamble Company | Detergent composition comprising a variant of a family 44 xyloglucanase |
US8202831B2 (en) | 2008-06-06 | 2012-06-19 | The Procter & Gamble Company | Detergent composition comprising a variant of a family 44 xyloglucanase |
WO2009147210A1 (en) | 2008-06-06 | 2009-12-10 | Novozymes A/S | Variants of a family 44 xyloglucanase |
EP2905333A1 (en) | 2008-06-06 | 2015-08-12 | Novozymes A/S | Variants of a family 44 xylogucanase |
EP2674488A1 (en) | 2008-06-06 | 2013-12-18 | Novozymes A/S | Variants of a family 44 xyloglucanase |
US9279010B2 (en) | 2008-07-18 | 2016-03-08 | Defensin Therapeutics Aps | Treatment of inflammatory bowel diseases with mammal beta defensins |
US8802621B2 (en) | 2008-07-18 | 2014-08-12 | Defensin Therapeutics Aps | Treatment of inflammatory bowel diseases with mammal beta defensins |
EP2399600A1 (en) | 2008-07-18 | 2011-12-28 | Novozymes Adenium Biotech A/S | Treatment of inflammatory bowel diseases with mammal beta defensins |
WO2010059413A2 (en) | 2008-11-20 | 2010-05-27 | Novozymes, Inc. | Polypeptides having amylolytic enhancing activity and polynucleotides encoding same |
EP2857515A2 (en) | 2008-11-20 | 2015-04-08 | Novozymes Inc. | Polypeptides having amylolytic enhancing activity and polynucleotides encoding same |
WO2010065830A1 (en) | 2008-12-04 | 2010-06-10 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2010068800A1 (en) | 2008-12-12 | 2010-06-17 | Novozymes, Inc. | Polypeptides having aspartic endopeptidase activity and polynucleotides encoding same |
WO2010068650A1 (en) | 2008-12-12 | 2010-06-17 | Novozymes, Inc. | Polypeptides having lipase activity and polynucleotides encoding same |
WO2010074972A1 (en) | 2008-12-15 | 2010-07-01 | Novozymes, Inc. | Polypeptides having catalase activity and polynucleotides encoding same |
WO2010074955A1 (en) | 2008-12-16 | 2010-07-01 | Novozymes, Inc. | Polypeptides having carboxypeptidase activity and polynucleotides encoding same |
WO2010077775A1 (en) | 2008-12-16 | 2010-07-08 | Novozymes, Inc. | Polypeptides having alpha-mannosidase activity and polynucleotides encoding same |
WO2010070110A2 (en) | 2008-12-19 | 2010-06-24 | Novozymes A/S | Use of enzymes having silicase activity |
WO2010084086A1 (en) | 2009-01-21 | 2010-07-29 | Novozymes A/S | Polypeptides having esterase activity and nucleic acids encoding the same |
WO2010088387A1 (en) | 2009-01-28 | 2010-08-05 | Novozymes, Inc. | Polypeptides having beta-glucosidase activity and polynucleotides encoding same |
WO2010088447A1 (en) | 2009-01-30 | 2010-08-05 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2010088463A2 (en) | 2009-01-30 | 2010-08-05 | Novozymes, Inc. | Polypeptides having expansin activity and polynucleotides encoding same |
WO2010089302A1 (en) | 2009-02-06 | 2010-08-12 | University Of Chile | Protein and dna sequence encoding a cold adapted xylanase |
US8679814B2 (en) | 2009-02-06 | 2014-03-25 | University Of Chile | Protein and DNA sequence encoding a cold adapted xylanase |
WO2010091221A1 (en) | 2009-02-06 | 2010-08-12 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
US11555061B2 (en) | 2009-02-11 | 2023-01-17 | Albumedix, Ltd | Albumin variants and conjugates |
WO2010094772A1 (en) | 2009-02-20 | 2010-08-26 | Febit Holding Gmbh | Synthesis of sequence-verified nucleic acids |
WO2010097436A1 (en) | 2009-02-27 | 2010-09-02 | Novozymes A/S | Mutant cells having reduced expression of metallopeptidase, suitable for recombinant polypeptide production |
WO2010106068A1 (en) | 2009-03-17 | 2010-09-23 | Novozymes A/S | Polypeptides having tyrosinase activity and polynucleotides encoding same |
WO2010108918A1 (en) | 2009-03-24 | 2010-09-30 | Novozymes A/S | Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same |
EP2248893A1 (en) | 2009-05-06 | 2010-11-10 | Novozymes A/S | DFPase Enzymes from Octopus Vulgaris |
WO2010138754A1 (en) | 2009-05-29 | 2010-12-02 | Novozymes, Inc. | Methods for enhancing the degradation or conversion of cellulosic material |
WO2010141325A1 (en) | 2009-06-02 | 2010-12-09 | Novozymes, Inc. | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2010151787A1 (en) | 2009-06-26 | 2010-12-29 | Novozymes North America, Inc. | Heat-stable carbonic anhydrases and their use |
WO2011005867A1 (en) | 2009-07-07 | 2011-01-13 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same |
WO2011009747A1 (en) | 2009-07-24 | 2011-01-27 | Novozymes A/S | Carbohydrate oxidases |
WO2011014458A1 (en) | 2009-07-28 | 2011-02-03 | Novozymes, Inc. | Polypeptides having phytase activity and polynucleotides encoding same |
WO2011020910A1 (en) | 2009-08-21 | 2011-02-24 | Novozymes A/S | Polypeptides having isoamylase activity and polynucleotides encoding same |
EP3103876A1 (en) | 2009-09-01 | 2016-12-14 | Novozymes Inc. | Methods for improving malic acid production in filamentous fungi |
WO2011028643A1 (en) | 2009-09-01 | 2011-03-10 | Novozymes, Inc. | Methods for improving malic acid production in filamentous fungi |
EP3269804A1 (en) | 2009-09-17 | 2018-01-17 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP3805348A2 (en) | 2009-09-17 | 2021-04-14 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011035027A2 (en) | 2009-09-17 | 2011-03-24 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011035029A1 (en) | 2009-09-18 | 2011-03-24 | Novozymes, Inc. | Polypeptides having beta-glucosidase activity and polynucleotides encoding same |
WO2011036263A1 (en) | 2009-09-25 | 2011-03-31 | Novozymes A/S | Subtilase variants |
WO2011036264A1 (en) | 2009-09-25 | 2011-03-31 | Novozymes A/S | Use of protease variants |
WO2011041397A1 (en) | 2009-09-29 | 2011-04-07 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011041405A1 (en) | 2009-09-29 | 2011-04-07 | Novozymes, Inc. | Polypeptides having xylanase activity and polynucleotides encoding same |
EP2977382A2 (en) | 2009-09-30 | 2016-01-27 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011041504A1 (en) | 2009-09-30 | 2011-04-07 | Novozymes, Inc. | Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011039319A1 (en) | 2009-09-30 | 2011-04-07 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2011050037A1 (en) | 2009-10-23 | 2011-04-28 | Novozymes, Inc. | Cellobiohydrolase variants and polynucleotides encoding same |
WO2011059740A1 (en) | 2009-10-29 | 2011-05-19 | Novozymes, Inc. | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2011051489A2 (en) | 2009-10-30 | 2011-05-05 | Novozymes Biopharma Dk A/S | Albumin variants |
US10696732B2 (en) | 2009-10-30 | 2020-06-30 | Albumedix, Ltd | Albumin variants |
EP3421491A2 (en) | 2009-10-30 | 2019-01-02 | Albumedix Ltd | Albumin variants |
WO2011057086A1 (en) | 2009-11-06 | 2011-05-12 | Novozymes, Inc. | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2011057083A1 (en) | 2009-11-06 | 2011-05-12 | Novozymes, Inc. | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2011066560A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2011066576A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2011068803A1 (en) | 2009-12-01 | 2011-06-09 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2011067335A1 (en) | 2009-12-02 | 2011-06-09 | Novozymes A/S | Use of defensins for treatment of infective endocarditis |
WO2011067349A1 (en) | 2009-12-03 | 2011-06-09 | Novozymes A/S | Variants of a polypeptide with lipolytic activity and improved stability |
WO2011070101A1 (en) | 2009-12-09 | 2011-06-16 | Novozymes A/S | Methods of producing gh8 xylanase variants |
WO2011070032A1 (en) | 2009-12-11 | 2011-06-16 | Novozymes A/S | Arenicin-3 for use in the treatment of urinary tract infections |
WO2011080267A2 (en) | 2009-12-29 | 2011-07-07 | Novozymes A/S | Polypetides having detergency enhancing effect |
EP3101127A1 (en) | 2010-01-04 | 2016-12-07 | Novozymes A/S | Alpha-amylase variants with improved stability |
WO2011080354A1 (en) | 2010-01-04 | 2011-07-07 | Novozymes A/S | Alpha-amylases |
WO2011082429A1 (en) | 2010-01-04 | 2011-07-07 | Novozymes A/S | Alpha-amylases |
WO2011082425A2 (en) | 2010-01-04 | 2011-07-07 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2011104284A1 (en) | 2010-02-25 | 2011-09-01 | Novozymes A/S | Polypeptides having antimicrobial activity |
WO2011104339A1 (en) | 2010-02-25 | 2011-09-01 | Novozymes A/S | Variants of a lysozyme and polynucleotides encoding same |
WO2011109524A2 (en) | 2010-03-03 | 2011-09-09 | Novozymes, Inc. | Xylanase variants and polynucleotides encoding same |
WO2011120938A2 (en) | 2010-03-28 | 2011-10-06 | Novozymes A/S | Enzymatic hydroxylation of aliphatic hydrocarbon |
WO2011123505A1 (en) | 2010-03-30 | 2011-10-06 | Novozymes North America, Inc. | Processes of producing a fermentation product |
WO2011126897A2 (en) | 2010-03-30 | 2011-10-13 | Novozymes A/S | Methods for enhancing by-products from fermentation processes |
EP3070171A1 (en) | 2010-03-30 | 2016-09-21 | Novozymes A/S | Processes of producing a fermentation product |
WO2011123450A1 (en) | 2010-03-31 | 2011-10-06 | Novozymes, Inc. | Cellobiohydrolase variants and polynucleotides encoding same |
US10233228B2 (en) | 2010-04-09 | 2019-03-19 | Albumedix Ltd | Albumin derivatives and variants |
WO2011127802A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2011153317A1 (en) | 2010-06-04 | 2011-12-08 | Novozymes, Inc. | C4 dicarboxylic acid production in filamentous fungi |
WO2011154525A1 (en) | 2010-06-12 | 2011-12-15 | Novozymes A/S | Antimicrobial peptide variants and polynucleotides encoding same |
WO2011163269A1 (en) | 2010-06-21 | 2011-12-29 | Novozymes, Inc. | Aspergillus aculeatus derived polypeptides having c4-dicarboxylic acid transporter activity and polynucleotides encoding same |
EP2769985A1 (en) | 2010-06-21 | 2014-08-27 | Novozymes, Inc. | Aspergillus aculeatus derived polypeptides having C4-dicarboxylic acid transporter activity and polynucleotides encoding same |
WO2011163270A1 (en) | 2010-06-21 | 2011-12-29 | Novozymes, Inc. | Methods for improved c4-dicarboxylic acid production in filamentous fungi |
WO2012003379A1 (en) | 2010-06-30 | 2012-01-05 | Novozymes A/S | Polypeptides having beta-glucosidase activity and polynucleotides encoding same |
WO2012021395A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and a sulfur-containing compound and uses thereof |
WO2012021399A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and a nitrogen-containing compound and uses thereof |
WO2012021408A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and a dioxy compound and uses thereof |
WO2012021401A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and a bicyclic compound and uses thereof |
WO2012021394A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and a quinone compound and uses thereof |
WO2012021396A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and an organic compound and uses thereof |
WO2012021400A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and a heterocyclic compound and uses thereof |
WO2012021410A1 (en) | 2010-08-12 | 2012-02-16 | Novozymes, Inc. | Compositions comprising a polypeptide having cellulolytic enhancing activity and a liquor and uses thereof |
WO2012022777A1 (en) | 2010-08-19 | 2012-02-23 | Novozymes A/S | Induced sporulation screening method |
WO2012025577A1 (en) | 2010-08-24 | 2012-03-01 | Novozymes A/S | Heat-stable persephonella carbonic anhydrases and their use |
WO2012030849A1 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2012030811A1 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012030844A1 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
EP2735611A2 (en) | 2010-08-30 | 2014-05-28 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012030845A2 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same |
EP3470514A1 (en) | 2010-08-30 | 2019-04-17 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012030858A2 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having hemicellulolytic activity and polynucleotides encoding same |
WO2012030799A1 (en) | 2010-08-30 | 2012-03-08 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012035103A1 (en) | 2010-09-16 | 2012-03-22 | Novozymes A/S | Lysozymes |
WO2012044836A1 (en) | 2010-09-30 | 2012-04-05 | Novozymes, Inc. | Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012044835A1 (en) | 2010-09-30 | 2012-04-05 | Novozymes, Inc. | Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012042037A1 (en) | 2010-10-01 | 2012-04-05 | Novozymes A/S | Polypeptides having endopeptidase activity and polynucleotides encoding same |
EP3023492A1 (en) | 2010-10-01 | 2016-05-25 | Novozymes, Inc. | Beta-glucosidase variants and polynucleotides encoding same |
WO2012044915A2 (en) | 2010-10-01 | 2012-04-05 | Novozymes, Inc. | Beta-glucosidase variants and polynucleotides encoding same |
WO2012058293A1 (en) | 2010-10-26 | 2012-05-03 | Novozymes North America, Inc. | Methods of saccharifying sugarcane trash |
WO2012058566A1 (en) | 2010-10-29 | 2012-05-03 | Novozymes A/S | Polypeptides having succinyl-coa:aceto acetate transferase activity and polynucleotides encoding same |
WO2012058603A1 (en) | 2010-10-29 | 2012-05-03 | Novozymes A/S | Recombinant n-propanol and isopropanol production |
WO2012061517A1 (en) | 2010-11-02 | 2012-05-10 | Novozymes, Inc. | Methods of pretreating cellulosic material with a gh61 polypeptide |
WO2012059053A1 (en) | 2010-11-04 | 2012-05-10 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012064351A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2012064350A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same |
US10982208B2 (en) | 2010-11-12 | 2021-04-20 | Gen9, Inc. | Protein arrays and methods of using and making the same |
WO2012062220A1 (en) | 2010-11-12 | 2012-05-18 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2012062817A1 (en) | 2010-11-12 | 2012-05-18 | Novozymes A/S | Polypeptides having phospholipase c activity and polynucleotides encoding same |
US9295965B2 (en) | 2010-11-12 | 2016-03-29 | Gen9, Inc. | Methods and devices for nucleic acid synthesis |
US11845054B2 (en) | 2010-11-12 | 2023-12-19 | Gen9, Inc. | Methods and devices for nucleic acids synthesis |
US10457935B2 (en) | 2010-11-12 | 2019-10-29 | Gen9, Inc. | Protein arrays and methods of using and making the same |
US11084014B2 (en) | 2010-11-12 | 2021-08-10 | Gen9, Inc. | Methods and devices for nucleic acids synthesis |
WO2012068509A1 (en) | 2010-11-18 | 2012-05-24 | Novozymes, Inc. | Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012078656A1 (en) | 2010-12-06 | 2012-06-14 | Novozymes North America, Inc. | Methods of hydrolyzing oligomers in hemicellulosic liquor |
EP3235903A1 (en) | 2011-01-26 | 2017-10-25 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012103288A1 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012103350A1 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012101206A2 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Novel glycoside hydrolases from thermophilic fungi |
WO2012103322A1 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2012103293A1 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012103300A2 (en) | 2011-01-26 | 2012-08-02 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2012134626A2 (en) | 2011-01-31 | 2012-10-04 | Novozymes North America, Inc. | Processes for enzymatic refining of pretreated cellulosic material for saccharification |
WO2012110563A1 (en) | 2011-02-16 | 2012-08-23 | Novozymes A/S | Detergent compositions comprising metalloproteases |
WO2012110564A1 (en) | 2011-02-16 | 2012-08-23 | Novozymes A/S | Detergent compositions comprising m7 or m35 metalloproteases |
WO2012110562A2 (en) | 2011-02-16 | 2012-08-23 | Novozymes A/S | Detergent compositions comprising metalloproteases |
WO2012113340A1 (en) | 2011-02-23 | 2012-08-30 | Novozymes Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012118848A1 (en) | 2011-02-28 | 2012-09-07 | Novozymes, Inc. | Microorganism for c4-dicarboxylic acid production |
EP3339442A1 (en) | 2011-03-09 | 2018-06-27 | Novozymes A/S | Methods of increasing the cellulolytic enhancing activity of a polypeptide |
WO2012122518A1 (en) | 2011-03-09 | 2012-09-13 | Novozymes A/S | Methods of increasing the cellulolytic enhancing activity of a polypeptide |
WO2012122477A1 (en) | 2011-03-10 | 2012-09-13 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2012127001A1 (en) | 2011-03-23 | 2012-09-27 | Novozymes A/S | Methods for producing secreted polypeptides |
WO2012127002A1 (en) | 2011-03-23 | 2012-09-27 | Novozymes A/S | Sweet-tasting polypeptide from gram-positive bacteria |
EP3333258A2 (en) | 2011-03-25 | 2018-06-13 | Novozymes A/S | Method for degrading or converting cellulosic material |
WO2012135659A2 (en) | 2011-03-31 | 2012-10-04 | Novozymes A/S | Methods for enhancing the degradation or conversion of cellulosic material |
WO2012135719A1 (en) | 2011-03-31 | 2012-10-04 | Novozymes, Inc. | Cellulose binding domain variants and polynucleotides encoding same |
WO2012149192A1 (en) | 2011-04-28 | 2012-11-01 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2012149344A1 (en) | 2011-04-29 | 2012-11-01 | Novozymes, Inc. | Methods for enhancing the degradation or conversion of cellulosic material |
WO2012150319A1 (en) | 2011-05-05 | 2012-11-08 | Novozymes Biopharma Dk A/S | Albumin variants |
WO2012159007A1 (en) | 2011-05-19 | 2012-11-22 | Novozymes, Inc. | Methods for enhancing the degradation of cellulosic material with chitin binding proteins |
WO2012159009A1 (en) | 2011-05-19 | 2012-11-22 | Novozymes, Inc. | Methods for enhancing the degradation of cellulosic material with chitin binding proteins |
WO2012160093A1 (en) | 2011-05-23 | 2012-11-29 | Novozymes A/S | Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi |
EP2527432A1 (en) | 2011-05-23 | 2012-11-28 | Novozymes A/S | Bi-directional cytosine deaminase-encoding selection marker |
EP2527448A1 (en) | 2011-05-23 | 2012-11-28 | Novozymes A/S | Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi |
WO2012160097A1 (en) | 2011-05-23 | 2012-11-29 | Novozymes A/S | Bi-directional cytosine deaminase-encoding selection marker |
WO2012175708A2 (en) | 2011-06-24 | 2012-12-27 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
EP3121270A2 (en) | 2011-06-30 | 2017-01-25 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants reference to a sequence listing |
EP2540824A1 (en) | 2011-06-30 | 2013-01-02 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants reference to a sequence listing |
EP2540825A2 (en) | 2011-06-30 | 2013-01-02 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants reference to a sequence listing |
WO2013001078A1 (en) | 2011-06-30 | 2013-01-03 | Novozymes A/S | Alpha-amylase variants |
EP4026901A2 (en) | 2011-06-30 | 2022-07-13 | Novozymes A/S | Method for screening alpha-amylases |
WO2013001087A2 (en) | 2011-06-30 | 2013-01-03 | Novozymes A/S | Method for screening alpha-amylases |
WO2013003659A1 (en) | 2011-06-30 | 2013-01-03 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants reference to a sequence listing |
EP3798303A1 (en) | 2011-06-30 | 2021-03-31 | Novozymes A/S | Alpha-amylase-variants |
EP3543333A2 (en) | 2011-06-30 | 2019-09-25 | Novozymes A/S | Method for screening alpha-amylases |
EP3421595A1 (en) | 2011-06-30 | 2019-01-02 | Novozymes A/S | Alpha-amylase-variants |
WO2013006756A2 (en) | 2011-07-06 | 2013-01-10 | Novozymes A/S | Alpha amylase variants and polynucleotides encoding same |
WO2013004639A2 (en) | 2011-07-07 | 2013-01-10 | Novozymes A/S | Enzymatic preparation of diols |
WO2013007596A2 (en) | 2011-07-08 | 2013-01-17 | Novozymes A/S | Oral treatment of inflammatory bowel disease |
US9833495B2 (en) | 2011-07-08 | 2017-12-05 | Defensin Therapeutics Aps | Oral treatment of inflammatory bowel disease |
US9217021B2 (en) | 2011-07-08 | 2015-12-22 | Defensin Therapeutics Aps | Oral treatment of inflammatory bowel disease |
WO2013010783A1 (en) | 2011-07-15 | 2013-01-24 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
US10273271B2 (en) | 2011-07-15 | 2019-04-30 | The General Hospital Corporation | Methods of transcription activator like effector assembly |
US11472849B2 (en) | 2011-07-15 | 2022-10-18 | The General Hospital Corporation | Methods of transcription activator like effector assembly |
WO2013016115A1 (en) | 2011-07-22 | 2013-01-31 | Novozymes North America, Inc. | Processes for pretreating cellulosic material and improving hydrolysis thereof |
WO2013019827A2 (en) | 2011-08-04 | 2013-02-07 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
EP3091073A2 (en) | 2011-08-04 | 2016-11-09 | Novozymes Inc. | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2013019780A2 (en) | 2011-08-04 | 2013-02-07 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
EP3382016A1 (en) | 2011-08-04 | 2018-10-03 | Novozymes, Inc. | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2013021059A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021065A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021062A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021064A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021060A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021061A1 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013021063A2 (en) | 2011-08-10 | 2013-02-14 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013024021A1 (en) | 2011-08-15 | 2013-02-21 | Novozymes A/S | Polypeptides having cellulase activity and polynucleotides encoding same |
WO2013026794A1 (en) | 2011-08-19 | 2013-02-28 | Novozymes | Novel immunomodulatory peptide |
WO2013028512A1 (en) | 2011-08-19 | 2013-02-28 | Novozymes, Inc. | Recombinant microorganisms for production c4-dicarboxylic acids |
WO2013026796A1 (en) | 2011-08-19 | 2013-02-28 | Novozymes A/S | Polypeptides having protease activity |
US11702662B2 (en) | 2011-08-26 | 2023-07-18 | Gen9, Inc. | Compositions and methods for high fidelity assembly of nucleic acids |
WO2013029496A1 (en) | 2011-08-26 | 2013-03-07 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
WO2013036526A1 (en) | 2011-09-06 | 2013-03-14 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2013034106A1 (en) | 2011-09-09 | 2013-03-14 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2013036898A2 (en) | 2011-09-09 | 2013-03-14 | Novozymes A/S | Improving properties of paper materials |
WO2013039776A1 (en) | 2011-09-13 | 2013-03-21 | Novozymes North America, Inc. | Methods of hydrolyzing and fermenting cellulosic material |
WO2013043910A1 (en) | 2011-09-20 | 2013-03-28 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2013041689A1 (en) | 2011-09-22 | 2013-03-28 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2013040991A1 (en) | 2011-09-23 | 2013-03-28 | Novozymes A/S | Color modification of textile |
WO2013044867A1 (en) | 2011-09-30 | 2013-04-04 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2013049073A1 (en) | 2011-09-30 | 2013-04-04 | Novozymes, Inc. | Dehydrogenase variants and polynucleotides encoding same |
WO2013053801A1 (en) | 2011-10-11 | 2013-04-18 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
EP4253534A2 (en) | 2011-10-17 | 2023-10-04 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
EP3495479A1 (en) | 2011-10-17 | 2019-06-12 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2013057143A2 (en) | 2011-10-17 | 2013-04-25 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2013057141A2 (en) | 2011-10-17 | 2013-04-25 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2013064075A1 (en) | 2011-10-31 | 2013-05-10 | Novozymes, Inc. | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2013064195A1 (en) | 2011-11-04 | 2013-05-10 | Enel Ingegneria E Ricerca S.P.A. | A new heat-stable carbonic anhydrase and uses thereof |
WO2013068309A1 (en) | 2011-11-08 | 2013-05-16 | Novozymes A/S | Methods for production of archeae protease in yeast |
WO2013074956A2 (en) | 2011-11-18 | 2013-05-23 | Novozymes, Inc. | Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same |
US10711050B2 (en) | 2011-11-18 | 2020-07-14 | Albumedix Ltd | Variant serum albumin with improved half-life and other properties |
EP3382017A1 (en) | 2011-11-18 | 2018-10-03 | Novozymes A/S | Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same |
EP3409769A1 (en) | 2011-11-18 | 2018-12-05 | Novozymes A/S | Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same |
WO2013119302A2 (en) | 2011-11-21 | 2013-08-15 | Novozymes, Inc. | Gh61 polypeptide variants and polynucleotides encoding same |
EP3597736A1 (en) | 2011-11-21 | 2020-01-22 | Novozymes A/S | Gh61 polypeptide variants and polynucleotides encoding same |
EP3219794A1 (en) | 2011-11-21 | 2017-09-20 | Novozymes A/S | Gh61 polypeptide variants and polynucleotides encoding same |
EP3342860A1 (en) | 2011-11-22 | 2018-07-04 | Novozymes, Inc. | Polypeptides having beta-xylosidase activity and polynucleotides encoding same |
WO2013075644A1 (en) | 2011-11-22 | 2013-05-30 | Novozymes, Inc. | Polypeptides having beta-xylosidase activity and polynucleotides encoding same |
WO2013076253A1 (en) | 2011-11-25 | 2013-05-30 | Novozymes A/S | Polypeptides having lysozyme activity and polynucleotides encoding same |
WO2013076259A2 (en) | 2011-11-25 | 2013-05-30 | Novozymes A/S | Polypeptides having lysozyme activity and polynucleotides encoding same |
WO2013076269A1 (en) | 2011-11-25 | 2013-05-30 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2013079015A1 (en) | 2011-12-01 | 2013-06-06 | Novozymes, Inc. | Polypeptides having beta-xylosidase activity and polynucleotides encoding same |
WO2013079531A2 (en) | 2011-12-02 | 2013-06-06 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
WO2013079533A1 (en) | 2011-12-02 | 2013-06-06 | Novozymes A/S | Polypeptides having peroxygenase activity and polynucleotides encoding same |
EP3272862A1 (en) | 2011-12-16 | 2018-01-24 | Novozymes, Inc. | Polypeptides having laccase activity and polynucleotides encoding same |
WO2013091547A1 (en) | 2011-12-19 | 2013-06-27 | Novozymes, Inc. | Polypeptides having catalase activity and polynucleotides encoding same |
WO2013096603A2 (en) | 2011-12-20 | 2013-06-27 | Novozymes, Inc. | Cellobiohydrolase variants and polynucleotides encoding same |
EP2607468A1 (en) | 2011-12-20 | 2013-06-26 | Henkel AG & Co. KGaA | Detergent compositions comprising subtilase variants |
EP3323875A1 (en) | 2011-12-20 | 2018-05-23 | Henkel AG & Co. KGaA | Detergent compositions comprising subtilase variants |
WO2013092635A1 (en) | 2011-12-20 | 2013-06-27 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2013098185A1 (en) | 2011-12-28 | 2013-07-04 | Novozymes A/S | Polypeptides having protease activity |
WO2013110766A1 (en) | 2012-01-26 | 2013-08-01 | Novozymes A/S | Use of polypeptides having protease activity in animal feed and detergents |
EP3211074A2 (en) | 2012-02-03 | 2017-08-30 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP2623586A2 (en) | 2012-02-03 | 2013-08-07 | The Procter & Gamble Company | Compositions and methods for surface treatment with lipases |
WO2013116261A2 (en) | 2012-02-03 | 2013-08-08 | The Procter & Gamble Company | Compositions and methods for surface treatment with lipases |
WO2013113622A1 (en) | 2012-02-03 | 2013-08-08 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP3696265A2 (en) | 2012-02-03 | 2020-08-19 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP2628785A1 (en) | 2012-02-17 | 2013-08-21 | Henkel AG & Co. KGaA | Detergent compositions comprising subtilase variants |
WO2013120948A1 (en) | 2012-02-17 | 2013-08-22 | Novozymes A/S | Subtilisin variants and polynucleotides encoding same |
WO2013120952A2 (en) | 2012-02-17 | 2013-08-22 | Henkel Ag & Co. Kgaa | Detergent compositions comprising subtilase variants |
WO2013123871A1 (en) | 2012-02-20 | 2013-08-29 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
US10329340B2 (en) | 2012-03-16 | 2019-06-25 | Albumedix Ltd | Albumin variants |
EP3330283A2 (en) | 2012-03-16 | 2018-06-06 | Albumedix A/S | Albumin variants |
WO2013135896A1 (en) | 2012-03-16 | 2013-09-19 | Novozymes Biopharma Dk A/S | Albumin variants |
US10308931B2 (en) | 2012-03-21 | 2019-06-04 | Gen9, Inc. | Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis |
WO2013144105A1 (en) | 2012-03-31 | 2013-10-03 | Novozymes A/S | Epoxidation using peroxygenase |
WO2013149858A1 (en) | 2012-04-02 | 2013-10-10 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2013160247A2 (en) | 2012-04-23 | 2013-10-31 | Novozymes A/S | Polypeptides having glucuronyl esterase activity and polynucleotides encoding same |
WO2013160248A2 (en) | 2012-04-23 | 2013-10-31 | Novozymes A/S | Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same |
US10081807B2 (en) | 2012-04-24 | 2018-09-25 | Gen9, Inc. | Methods for sorting nucleic acids and multiplexed preparative in vitro cloning |
US10927369B2 (en) | 2012-04-24 | 2021-02-23 | Gen9, Inc. | Methods for sorting nucleic acids and multiplexed preparative in vitro cloning |
WO2013160370A1 (en) | 2012-04-25 | 2013-10-31 | Novozymes A/S | Method of baking |
EP3279320A2 (en) | 2012-04-27 | 2018-02-07 | Novozymes A/S | Gh61 polypeptide variants and polynucleotides encoding same |
WO2013163590A2 (en) | 2012-04-27 | 2013-10-31 | Novozymes, Inc. | Gh61 polypeptide variants and polynucleotides encoding same |
WO2013167581A1 (en) | 2012-05-07 | 2013-11-14 | Novozymes A/S | Polypeptides having xanthan degrading activity and polynucleotides encoding same |
WO2013173711A1 (en) | 2012-05-18 | 2013-11-21 | Novozymes A/S | Bacterial mutants with improved transformation efficiency |
US10894950B2 (en) | 2012-05-29 | 2021-01-19 | The General Hospital Corporation | TAL-Tet1 fusion proteins and methods of use thereof |
US9890364B2 (en) | 2012-05-29 | 2018-02-13 | The General Hospital Corporation | TAL-Tet1 fusion proteins and methods of use thereof |
WO2013178808A2 (en) | 2012-05-31 | 2013-12-05 | Novozymes A/S | Polypeptides having organophosphorous hydrolase activity |
WO2013178699A1 (en) | 2012-05-31 | 2013-12-05 | Novozymes A/S | Isopropanol production by bacterial hosts |
WO2013189802A1 (en) | 2012-06-19 | 2013-12-27 | Novozymes A/S | Enzymatic reduction of hydroperoxides |
WO2013189972A2 (en) | 2012-06-20 | 2013-12-27 | Novozymes A/S | Use of polypeptides having protease activity in animal feed and detergents |
US11072789B2 (en) | 2012-06-25 | 2021-07-27 | Gen9, Inc. | Methods for nucleic acid assembly and high throughput sequencing |
WO2014009473A1 (en) | 2012-07-12 | 2014-01-16 | Novozymes A/S | Polypeptides having lipase activity and polynucleotides encoding same |
WO2014012506A1 (en) | 2012-07-18 | 2014-01-23 | Novozymes A/S | Method of treating polyester textile |
WO2014015256A2 (en) | 2012-07-20 | 2014-01-23 | Novozymes A/S | Enzymatic oxidation of 5-hydroxymethylfurfural and derivatives thereof |
EP3553172A1 (en) | 2012-08-16 | 2019-10-16 | Novozymes A/S | Method for treating textile with endoglucanase |
WO2014027062A1 (en) | 2012-08-17 | 2014-02-20 | Novozymes A/S | Thermostable asparaginase variants and polynucleotides encoding same |
WO2014029819A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Metalloprotease from exiguobacterium |
WO2014029821A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Metalloproteases from alicyclobacillus sp. |
WO2014029820A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Detergent compositions comprising metalloproteases |
WO2014037438A1 (en) | 2012-09-05 | 2014-03-13 | Novozymes A/S | Polypeptides having protease activity |
WO2014092832A2 (en) | 2012-09-19 | 2014-06-19 | Novozymes, Inc. | Methods for enhancing the degradation or conversion of cellulosic material |
WO2014052630A1 (en) | 2012-09-27 | 2014-04-03 | Novozymes, Inc. | Bacterial mutants with improved transformation efficiency |
WO2014053594A1 (en) | 2012-10-05 | 2014-04-10 | Novozymes A/S | Preventing adhesion of bacteria |
EP3176260A1 (en) | 2012-10-05 | 2017-06-07 | Novozymes A/S | Preventing adhesion of bacteria |
WO2014058896A1 (en) | 2012-10-08 | 2014-04-17 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
EP3586610A1 (en) | 2012-10-08 | 2020-01-01 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2014056919A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056916A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056920A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056921A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
US11891631B2 (en) | 2012-10-12 | 2024-02-06 | The General Hospital Corporation | Transcription activator-like effector (tale) - lysine-specific demethylase 1 (LSD1) fusion proteins |
WO2014056922A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056927A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014056917A2 (en) | 2012-10-12 | 2014-04-17 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2014066141A2 (en) | 2012-10-24 | 2014-05-01 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2014068010A1 (en) | 2012-10-31 | 2014-05-08 | Novozymes A/S | Isopropanol production by bacterial hosts |
US10501524B2 (en) | 2012-11-08 | 2019-12-10 | Albumedix Ltd | Albumin variants |
US10934341B2 (en) | 2012-11-08 | 2021-03-02 | Albumedix, Ltd. | Albumin variants |
WO2014076232A2 (en) | 2012-11-19 | 2014-05-22 | Novozymes A/S | Isopropanol production by recombinant hosts using an hmg-coa intermediate |
WO2014085330A1 (en) | 2012-11-30 | 2014-06-05 | Novozymes, Inc. | 3-hydroxypropionic acid production by recombinant yeasts |
EP2740840A1 (en) | 2012-12-07 | 2014-06-11 | Novozymes A/S | Improving drainage of paper pulp |
WO2014086976A1 (en) | 2012-12-07 | 2014-06-12 | Novozymes A/S | Improving drainage of paper pulp |
WO2014086706A1 (en) | 2012-12-07 | 2014-06-12 | Novozymes A/S | Method for generating site-specific mutations in filamentous fungi |
WO2014087011A1 (en) | 2012-12-07 | 2014-06-12 | Novozymes A/S | Preventing adhesion of bacteria |
EP3556836A1 (en) | 2012-12-07 | 2019-10-23 | Novozymes A/S | Preventing adhesion of bacteria |
WO2014090161A1 (en) | 2012-12-11 | 2014-06-19 | Novozymes A/S | Polypeptides having phospholipase c activity and polynucleotides encoding same |
WO2014093835A1 (en) | 2012-12-14 | 2014-06-19 | Novozymes A/S | Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same |
WO2014090940A1 (en) | 2012-12-14 | 2014-06-19 | Novozymes A/S | Removal of skin-derived body soils |
WO2014099653A1 (en) | 2012-12-17 | 2014-06-26 | Novozymes A/S | Alpha-amylases and polynucleotides encoding same |
WO2014099798A1 (en) | 2012-12-19 | 2014-06-26 | Novozymes A/S | Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same |
WO2014096259A1 (en) | 2012-12-21 | 2014-06-26 | Novozymes A/S | Polypeptides having protease activiy and polynucleotides encoding same |
WO2014101753A1 (en) | 2012-12-24 | 2014-07-03 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
EP3321360A2 (en) | 2013-01-03 | 2018-05-16 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2014122109A1 (en) | 2013-02-05 | 2014-08-14 | Novozymes A/S | Enzymatic preparation of indigo dyes and intermediates |
WO2014122161A2 (en) | 2013-02-06 | 2014-08-14 | Novozymes A/S | Polypeptides having protease activity |
US10676749B2 (en) | 2013-02-07 | 2020-06-09 | The General Hospital Corporation | Tale transcriptional activators |
US10731167B2 (en) | 2013-02-07 | 2020-08-04 | The General Hospital Corporation | Tale transcriptional activators |
WO2014138672A1 (en) | 2013-03-08 | 2014-09-12 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
EP3533866A1 (en) | 2013-03-21 | 2019-09-04 | Novozymes A/S | Polypeptides having phospholipase a activity and polynucleotides encoding same |
WO2014147127A1 (en) | 2013-03-21 | 2014-09-25 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2014147219A1 (en) | 2013-03-21 | 2014-09-25 | Novozymes A/S | Polypeptides having phospholipase a activity and polynucleotides encoding same |
WO2014170218A1 (en) | 2013-04-18 | 2014-10-23 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
EP3569611A1 (en) | 2013-04-23 | 2019-11-20 | Novozymes A/S | Liquid automatic dish washing detergent compositions with stabilised subtilisin |
EP3372680A1 (en) | 2013-04-30 | 2018-09-12 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2014177541A2 (en) | 2013-04-30 | 2014-11-06 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
EP3461881A1 (en) | 2013-05-03 | 2019-04-03 | Novozymes A/S | Microencapsulation of detergent enzymes |
WO2014182990A1 (en) | 2013-05-10 | 2014-11-13 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2014184164A1 (en) | 2013-05-14 | 2014-11-20 | Novozymes A/S | Detergent compositions |
WO2014183921A1 (en) | 2013-05-17 | 2014-11-20 | Novozymes A/S | Polypeptides having alpha amylase activity |
EP3786269A1 (en) | 2013-06-06 | 2021-03-03 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2014202793A1 (en) | 2013-06-21 | 2014-12-24 | Novozymes A/S | Production of polypeptides without secretion signal in bacillus |
WO2014207227A1 (en) | 2013-06-27 | 2014-12-31 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2014207224A1 (en) | 2013-06-27 | 2014-12-31 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2015001017A2 (en) | 2013-07-04 | 2015-01-08 | Novozymes A/S | Polypeptides having anti-redeposition effect and polynucleotides encoding same |
WO2015004102A1 (en) | 2013-07-09 | 2015-01-15 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2015007639A1 (en) | 2013-07-17 | 2015-01-22 | Novozymes A/S | Pullulanase chimeras and polynucleotides encoding same |
EP3613853A1 (en) | 2013-07-29 | 2020-02-26 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP3339436A1 (en) | 2013-07-29 | 2018-06-27 | Henkel AG & Co. KGaA | Detergent composition comprising protease variants |
EP3611260A1 (en) | 2013-07-29 | 2020-02-19 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP3309249A1 (en) | 2013-07-29 | 2018-04-18 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP2832853A1 (en) | 2013-07-29 | 2015-02-04 | Henkel AG&Co. KGAA | Detergent composition comprising protease variants |
WO2015017721A1 (en) | 2013-07-31 | 2015-02-05 | Novozymes A/S | 3-hydroxypropionic acid production by recombinant yeasts expressing an insect aspartate 1-decarboxylase |
WO2015022429A1 (en) | 2013-08-15 | 2015-02-19 | Novozymes A/S | Polypeptides having beta-1,3-galactanase activity and polynucleotides encoding same |
WO2015049370A1 (en) | 2013-10-03 | 2015-04-09 | Novozymes A/S | Detergent composition and use of detergent composition |
WO2015059133A1 (en) | 2013-10-22 | 2015-04-30 | Novozymes A/S | Cellobiose dehydrogenase variants and polynucleotides encoding same |
EP2876156A1 (en) | 2013-11-26 | 2015-05-27 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | New enzymes and method for preparing hydroxylated L-lysine or L-ornithine and analogs thereof |
WO2015079064A2 (en) | 2013-11-29 | 2015-06-04 | Novozymes A/S | Peroxygenase variants |
WO2015085920A1 (en) | 2013-12-11 | 2015-06-18 | Novozymes A/S | Cutinase variants and polynucleotides encoding same |
WO2015091755A2 (en) | 2013-12-18 | 2015-06-25 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | New enzymes and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof |
EP2886656A1 (en) | 2013-12-18 | 2015-06-24 | Commissariat A L'energie Atomique Et Aux Energies Alternatives | New enzyme and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof |
EP3453757A1 (en) | 2013-12-20 | 2019-03-13 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2015109972A1 (en) | 2014-01-22 | 2015-07-30 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
EP3415624A1 (en) | 2014-01-22 | 2018-12-19 | Novozymes A/S | Pullulanase variants and polynucleotides encoding same |
EP3521434A1 (en) | 2014-03-12 | 2019-08-07 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2015143144A1 (en) | 2014-03-19 | 2015-09-24 | Novozymes A/S | Method for enhancing activity of an x143 polypeptide |
EP4163354A2 (en) | 2014-03-19 | 2023-04-12 | Novozymes A/S | Polypeptides having phospholipase c activity and polynucleotides encoding same |
WO2015150457A1 (en) | 2014-04-01 | 2015-10-08 | Novozymes A/S | Polypeptides having alpha amylase activity |
EP3550015A1 (en) | 2014-04-10 | 2019-10-09 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
EP3722406A1 (en) | 2014-04-11 | 2020-10-14 | Novozymes A/S | Detergent composition |
WO2015158237A1 (en) | 2014-04-15 | 2015-10-22 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
EP4311857A2 (en) | 2014-04-17 | 2024-01-31 | Boehringer Ingelheim RCV GmbH & Co KG | Recombinant host cell engineered to overexpress helper proteins |
WO2015158800A1 (en) | 2014-04-17 | 2015-10-22 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Recombinant host cell for expressing proteins of interest |
WO2015158808A2 (en) | 2014-04-17 | 2015-10-22 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Recombinant host cell engineered to overexpress helper proteins |
WO2015173426A1 (en) | 2014-05-15 | 2015-11-19 | Novozymes A/S | Compositions comprising polypeptides having phospholipase c activity and use thereof |
WO2015181119A2 (en) | 2014-05-27 | 2015-12-03 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP3760713A2 (en) | 2014-05-27 | 2021-01-06 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2015183710A1 (en) | 2014-05-30 | 2015-12-03 | Novozymes A/S | Variants of gh family 11 xylanase and polynucleotides encoding same |
EP2952584A1 (en) | 2014-06-04 | 2015-12-09 | Boehringer Ingelheim RCV GmbH & Co KG | Improved protein production |
EP2952585A1 (en) | 2014-06-04 | 2015-12-09 | Boehringer Ingelheim RCV GmbH & Co KG | Improved protein production in fungi or yeasts |
WO2015189371A1 (en) | 2014-06-12 | 2015-12-17 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2015200659A1 (en) | 2014-06-25 | 2015-12-30 | Novozymes A/S | Xylanase variants and polynucleotides encoding same |
WO2016001319A1 (en) | 2014-07-03 | 2016-01-07 | Novozymes A/S | Improved stabilization of non-protease enzyme |
EP3878960A1 (en) | 2014-07-04 | 2021-09-15 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
EP3739029A1 (en) | 2014-07-04 | 2020-11-18 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2016028999A1 (en) | 2014-08-20 | 2016-02-25 | Novozymes A/S | Xyloglucan endotransglycosylase variants and polynucleotides encoding same |
EP3594335A1 (en) | 2014-09-05 | 2020-01-15 | Novozymes A/S | Carbohydrate binding module variants and polynucleotides encoding same |
WO2016037096A1 (en) | 2014-09-05 | 2016-03-10 | Novozymes A/S | Carbohydrate binding module variants and polynucleotides encoding same |
WO2016062875A2 (en) | 2014-10-23 | 2016-04-28 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2016073610A1 (en) | 2014-11-07 | 2016-05-12 | Novozymes A/S | Xylanase based bleach boosting |
WO2016079305A1 (en) | 2014-11-20 | 2016-05-26 | Novozymes A/S | Alicyclobacillus variants and polynucleotides encoding same |
WO2016087327A1 (en) | 2014-12-01 | 2016-06-09 | Novozymes A/S | Polypeptides having pullulanase activity comprising the x25, x45 and cbm41 domains |
WO2016090059A1 (en) | 2014-12-02 | 2016-06-09 | Novozymes A/S | Laccase variants and polynucleotides encoding same |
EP4339282A2 (en) | 2014-12-04 | 2024-03-20 | Novozymes A/S | Liquid cleaning compositions comprising protease variants |
EP3690037A1 (en) | 2014-12-04 | 2020-08-05 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
EP4067485A2 (en) | 2014-12-05 | 2022-10-05 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2016087401A1 (en) | 2014-12-05 | 2016-06-09 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2016096996A1 (en) | 2014-12-16 | 2016-06-23 | Novozymes A/S | Polypeptides having n-acetyl glucosamine oxidase activity |
EP3741849A2 (en) | 2014-12-19 | 2020-11-25 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP3741848A2 (en) | 2014-12-19 | 2020-11-25 | Novozymes A/S | Protease variants and polynucleotides encoding same |
WO2016095856A1 (en) | 2014-12-19 | 2016-06-23 | Novozymes A/S | Compositions comprising polypeptides having xylanase activity and polypeptides having arabinofuranosidase activity |
WO2016100910A1 (en) | 2014-12-19 | 2016-06-23 | Novozymes A/S | Recombinant host cells for the production of 3-hydroxypropionic acid |
EP4273238A2 (en) | 2014-12-19 | 2023-11-08 | Novozymes A/S | Compositions comprising polypeptides having xylanase activity and polypeptides having arabinofuranosidase activity |
WO2016138167A2 (en) | 2015-02-24 | 2016-09-01 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
EP3739045A2 (en) | 2015-02-24 | 2020-11-18 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
WO2016138315A1 (en) | 2015-02-25 | 2016-09-01 | Danisco Us Inc | Alpha-glucosidase, compositions & methods |
WO2016138303A1 (en) | 2015-02-27 | 2016-09-01 | Novozymes A/S | Mutant host cells for the production of 3-hydroxypropionic acid |
WO2016146473A1 (en) | 2015-03-19 | 2016-09-22 | Novozymes A/S | A brewing method |
WO2016162556A1 (en) | 2015-04-10 | 2016-10-13 | Novozymes A/S | Laundry method, use of dnase and detergent composition |
WO2016162558A1 (en) | 2015-04-10 | 2016-10-13 | Novozymes A/S | Detergent composition |
WO2016180748A1 (en) | 2015-05-08 | 2016-11-17 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2016180792A1 (en) | 2015-05-08 | 2016-11-17 | Novozymes A/S | Alpha-amylase variants having improved performance and stability |
WO2016180749A1 (en) | 2015-05-08 | 2016-11-17 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
EP4212609A1 (en) | 2015-05-08 | 2023-07-19 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
EP3964575A2 (en) | 2015-05-08 | 2022-03-09 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2016188459A1 (en) | 2015-05-27 | 2016-12-01 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
WO2016196202A1 (en) | 2015-05-29 | 2016-12-08 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2016193420A1 (en) | 2015-06-04 | 2016-12-08 | Novozymes A/S | Use of m4 metalloprotease in wort production |
WO2016202739A1 (en) | 2015-06-16 | 2016-12-22 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2016205127A1 (en) | 2015-06-18 | 2016-12-22 | Novozymes A/S | Polypeptides having trehalase activity and the use thereof in process of producing fermentation products |
EP3106508A1 (en) | 2015-06-18 | 2016-12-21 | Henkel AG & Co. KGaA | Detergent composition comprising subtilase variants |
EP3872175A1 (en) | 2015-06-18 | 2021-09-01 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
EP4071244A1 (en) | 2015-06-18 | 2022-10-12 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2016206621A1 (en) | 2015-06-26 | 2016-12-29 | Novozymes A/S | Biofinishing system |
WO2016207373A1 (en) | 2015-06-26 | 2016-12-29 | Novozymes A/S | Polypeptides having peroxygenase activity |
WO2016207384A1 (en) | 2015-06-26 | 2016-12-29 | Novozymes A/S | Method for producing a coffee extract |
EP3929285A2 (en) | 2015-07-01 | 2021-12-29 | Novozymes A/S | Methods of reducing odor |
WO2017000922A1 (en) | 2015-07-02 | 2017-01-05 | Novozymes A/S | Animal feed compositions and uses thereof |
EP3950939A2 (en) | 2015-07-06 | 2022-02-09 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2017019490A1 (en) | 2015-07-24 | 2017-02-02 | Novozymes Inc. | Polypeptides having arabinofuranosidase activity and polynucleotides encoding same |
WO2017019491A1 (en) | 2015-07-24 | 2017-02-02 | Novozymes Inc. | Polypeptides having beta-xylosidase activity and polynucleotides encoding same |
US10633428B2 (en) | 2015-08-20 | 2020-04-28 | Albumedix Ltd | Albumin variants and conjugates |
WO2017035270A1 (en) | 2015-08-24 | 2017-03-02 | Novozymes A/S | Beta-alanine aminotransferases for the production of 3-hydroxypropionic acid |
WO2017050242A1 (en) | 2015-09-22 | 2017-03-30 | Novozymes A/S | Polypeptides having cellobiohydrolase activity and polynucleotides encoding same |
EP3708660A2 (en) | 2015-10-07 | 2020-09-16 | Novozymes A/S | Polypeptides |
WO2017060505A1 (en) | 2015-10-07 | 2017-04-13 | Novozymes A/S | Polypeptides |
WO2017066510A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Cleaning of water filtration membranes |
EP4324919A2 (en) | 2015-10-14 | 2024-02-21 | Novozymes A/S | Polypeptide variants |
WO2017064269A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Polypeptide variants |
WO2017064253A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2017066255A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2017070219A1 (en) | 2015-10-20 | 2017-04-27 | Novozymes A/S | Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same |
EP3957711A2 (en) | 2015-10-28 | 2022-02-23 | Novozymes A/S | Detergent composition comprising amylase and protease variants |
WO2017089366A1 (en) | 2015-11-24 | 2017-06-01 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2017093318A1 (en) | 2015-12-01 | 2017-06-08 | Novozymes A/S | Methods for producing lipases |
WO2017100240A1 (en) | 2015-12-07 | 2017-06-15 | Eastman Chemical Company | Calb variants |
US10035995B2 (en) | 2015-12-07 | 2018-07-31 | Eastman Chemical Company | CALB variants |
US11441140B2 (en) | 2015-12-07 | 2022-09-13 | Henkel Ag & Co. Kgaa | Dishwashing compositions comprising polypeptides having beta-glucanase activity and uses thereof |
WO2017112847A1 (en) | 2015-12-22 | 2017-06-29 | Albumedix A/S | Improved protein expression strains |
US10023618B2 (en) | 2015-12-22 | 2018-07-17 | Albumedix A/S | Protein expression strains |
EP4219702A2 (en) | 2015-12-30 | 2023-08-02 | Novozymes A/S | Enzyme variants and polynucleotides encoding the same |
WO2017129754A1 (en) | 2016-01-29 | 2017-08-03 | Novozymes A/S | Beta-glucanase variants and polynucleotides encoding same |
WO2017140807A1 (en) | 2016-02-16 | 2017-08-24 | Monaghan Mushrooms Group | Fungal polypeptides having lysozyme activity |
US11685911B2 (en) | 2016-02-16 | 2023-06-27 | Monaghan Mushroom S Group | Fungal polypeptides having lysozyme activity |
WO2017151957A1 (en) | 2016-03-02 | 2017-09-08 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
WO2017165760A1 (en) | 2016-03-24 | 2017-09-28 | Novozymes A/S | Cellobiohydrolase variants and polynucleotides encoding same |
EP3693449A1 (en) | 2016-04-29 | 2020-08-12 | Novozymes A/S | Detergent compositions and uses thereof |
WO2017186943A1 (en) | 2016-04-29 | 2017-11-02 | Novozymes A/S | Detergent compositions and uses thereof |
WO2017186250A1 (en) | 2016-04-29 | 2017-11-02 | Defensin Therapeutics Aps | Treatment of liver, biliary tract and pancreatic disorders |
WO2017191160A1 (en) | 2016-05-03 | 2017-11-09 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding the same |
WO2017194487A1 (en) | 2016-05-09 | 2017-11-16 | Novozymes A/S | Variant polypeptides with improved performance and use of the same |
EP3246401A1 (en) | 2016-05-20 | 2017-11-22 | Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives | New fatty acid decarboxylase and its uses |
WO2017202966A1 (en) | 2016-05-24 | 2017-11-30 | Novozymes A/S | Polypeptides having alpha-galactosidase activity and polynucleotides encoding same |
WO2017202979A1 (en) | 2016-05-24 | 2017-11-30 | Novozymes A/S | Polypeptides having alpha-galactosidase activity and polynucleotides encoding same |
WO2017202997A1 (en) | 2016-05-24 | 2017-11-30 | Novozymes A/S | Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity |
WO2017202946A1 (en) | 2016-05-24 | 2017-11-30 | Novozymes A/S | Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity |
WO2017205535A1 (en) | 2016-05-27 | 2017-11-30 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2017210188A1 (en) | 2016-05-31 | 2017-12-07 | Novozymes A/S | Stabilized liquid peroxide compositions |
WO2017207762A1 (en) | 2016-06-03 | 2017-12-07 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2017211803A1 (en) | 2016-06-07 | 2017-12-14 | Novozymes A/S | Co-expression of heterologous polypeptides to increase yield |
WO2018001959A1 (en) | 2016-06-30 | 2018-01-04 | Novozymes A/S | Lipase variants and compositions comprising surfactant and lipase variant |
WO2018002379A2 (en) | 2016-07-01 | 2018-01-04 | Novozymes A/S | Enzymatic preparation of indigo dyes and in situ dyeing process |
WO2018002261A1 (en) | 2016-07-01 | 2018-01-04 | Novozymes A/S | Detergent compositions |
WO2018007435A1 (en) | 2016-07-05 | 2018-01-11 | Novozymes A/S | Pectate lyase variants and polynucleotides encoding same |
WO2018007154A1 (en) | 2016-07-08 | 2018-01-11 | Novozymes A/S | Xylanase variants and polynucleotides encoding same |
WO2018007573A1 (en) | 2016-07-08 | 2018-01-11 | Novozymes A/S | Detergent compositions with galactanase |
WO2018007153A1 (en) | 2016-07-08 | 2018-01-11 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2018011277A1 (en) | 2016-07-13 | 2018-01-18 | Novozymes A/S | Bacillus cibi dnase variants |
WO2018011276A1 (en) | 2016-07-13 | 2018-01-18 | The Procter & Gamble Company | Bacillus cibi dnase variants and uses thereof |
EP3950941A2 (en) | 2016-07-13 | 2022-02-09 | Novozymes A/S | Dnase polypeptide variants |
WO2018015295A1 (en) | 2016-07-18 | 2018-01-25 | Novozymes A/S | Lipase variants, polynucleotides encoding same and the use thereof |
EP4357453A2 (en) | 2016-07-18 | 2024-04-24 | Novozymes A/S | Lipase variants, polynucleotides encoding same and the use thereof |
WO2018017792A1 (en) | 2016-07-20 | 2018-01-25 | Novozymes A/S | Heat-stable metagenomic carbonic anhydrases and their use |
WO2018015304A1 (en) | 2016-07-21 | 2018-01-25 | Novozymes A/S | Serine protease variants and polynucleotides encoding same |
WO2018015303A1 (en) | 2016-07-21 | 2018-01-25 | Novozymes A/S | Serine protease variants and polynucleotides encoding same |
WO2018015444A1 (en) | 2016-07-22 | 2018-01-25 | Novozymes A/S | Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi |
WO2018026868A1 (en) | 2016-08-01 | 2018-02-08 | Novozymes, Inc. | Polypeptides having endoglucanase activity and polynucleotides encoding same |
WO2018037062A1 (en) | 2016-08-24 | 2018-03-01 | Novozymes A/S | Gh9 endoglucanase variants and polynucleotides encoding same |
WO2018037061A1 (en) | 2016-08-24 | 2018-03-01 | Novozymes A/S | Xanthan lyase variants and polynucleotides encoding same |
WO2018037064A1 (en) | 2016-08-24 | 2018-03-01 | Henkel Ag & Co. Kgaa | Detergent compositions comprising xanthan lyase variants i |
WO2018037065A1 (en) | 2016-08-24 | 2018-03-01 | Henkel Ag & Co. Kgaa | Detergent composition comprising gh9 endoglucanase variants i |
WO2018060475A1 (en) | 2016-09-29 | 2018-04-05 | Novozymes A/S | Spore containing granule |
WO2018077938A1 (en) | 2016-10-25 | 2018-05-03 | Novozymes A/S | Detergent compositions |
WO2018085370A1 (en) | 2016-11-02 | 2018-05-11 | Novozymes A/S | Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material |
WO2018094181A1 (en) | 2016-11-21 | 2018-05-24 | Novozymes A/S | Yeast cell extract assisted construction of dna molecules |
WO2018098124A1 (en) | 2016-11-23 | 2018-05-31 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2018102348A1 (en) | 2016-11-29 | 2018-06-07 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2018099965A1 (en) | 2016-11-30 | 2018-06-07 | Novozymes A/S | Method of baking |
WO2018106792A1 (en) | 2016-12-06 | 2018-06-14 | Novozymes A/S | Improved processes for production of ethanol from xylose-containing cellulosic substrates using engineered yeast strains |
WO2018108971A2 (en) | 2016-12-13 | 2018-06-21 | Defensin Therapeutics Aps | Methods for treating inflammatory conditions of the lungs |
EP4001416A1 (en) | 2016-12-20 | 2022-05-25 | Novozymes A/S | Recombinant yeast strains for pentose fermentation |
WO2018114973A1 (en) | 2016-12-20 | 2018-06-28 | Novozymes A/S | Recombinant yeast strains for pentose fermentation |
WO2018144399A1 (en) | 2017-02-01 | 2018-08-09 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants |
WO2018141707A2 (en) | 2017-02-01 | 2018-08-09 | Novozymes A/S | Alpha-amylase variants |
EP3357994A1 (en) | 2017-02-01 | 2018-08-08 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants |
EP4276179A2 (en) | 2017-02-01 | 2023-11-15 | Novozymes A/S | Alpha-amylase variants |
WO2018150021A1 (en) | 2017-02-20 | 2018-08-23 | Novozymes A/S | Lipolytic enzyme for use in baking |
WO2018164737A1 (en) | 2017-03-07 | 2018-09-13 | Danisco Us Inc. | Thermostable glucoamylase and methods of use, thereof |
WO2018178126A1 (en) | 2017-03-29 | 2018-10-04 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Recombinant host cell with altered membrane lipid composition |
WO2018177938A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having dnase activity |
WO2018177936A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having dnase activity |
WO2018178061A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having rnase activity |
WO2018185152A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Polypeptide compositions and uses thereof |
WO2018185181A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Glycosyl hydrolases |
WO2018185150A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Polypeptides |
WO2018191215A1 (en) | 2017-04-11 | 2018-10-18 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2018202846A1 (en) | 2017-05-05 | 2018-11-08 | Novozymes A/S | Compositions comprising lipase and sulfite |
WO2018206535A1 (en) | 2017-05-08 | 2018-11-15 | Novozymes A/S | Carbohydrate-binding domain and polynucleotides encoding the same |
WO2018206300A1 (en) | 2017-05-08 | 2018-11-15 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2018206302A1 (en) | 2017-05-08 | 2018-11-15 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2018220116A1 (en) | 2017-05-31 | 2018-12-06 | Novozymes A/S | Xylose fermenting yeast strains and processes thereof for ethanol production |
WO2018222990A1 (en) | 2017-06-02 | 2018-12-06 | Novozymes A/S | Improved yeast for ethanol production |
WO2018224544A1 (en) | 2017-06-08 | 2018-12-13 | Novozymes A/S | Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions |
US11130979B2 (en) | 2017-06-20 | 2021-09-28 | Albumedix Ltd | Protein expression strains |
WO2018234349A1 (en) | 2017-06-20 | 2018-12-27 | Albumedix Ltd | Improved protein expression strains |
EP4026908A1 (en) | 2017-06-20 | 2022-07-13 | Albumedix Ltd | Improved protein expression strains |
US11396670B2 (en) | 2017-06-20 | 2022-07-26 | Albumedix Limited | Protein expression strains |
WO2018234465A1 (en) | 2017-06-22 | 2018-12-27 | Novozymes A/S | Xylanase variants and polynucleotides encoding same |
WO2019005755A1 (en) | 2017-06-28 | 2019-01-03 | Novozymes A/S | Polypeptides having trehalase activity and polynucleotides encoding same |
EP4015524A1 (en) | 2017-06-28 | 2022-06-22 | Novozymes A/S | Polypeptides having trehalase activity and polynucleotides encoding same |
WO2019002356A1 (en) | 2017-06-30 | 2019-01-03 | Novozymes A/S | Enzyme slurry composition |
WO2019023222A1 (en) | 2017-07-24 | 2019-01-31 | Novozymes A/S | Gh5 and gh30 in wet milling |
WO2019030165A1 (en) | 2017-08-08 | 2019-02-14 | Novozymes A/S | Polypeptides having trehalase activity and the use thereof in process of producing fermentation products |
WO2019038060A1 (en) | 2017-08-24 | 2019-02-28 | Henkel Ag & Co. Kgaa | Detergent composition comprising xanthan lyase variants ii |
WO2019038059A1 (en) | 2017-08-24 | 2019-02-28 | Henkel Ag & Co. Kgaa | Detergent compositions comprising gh9 endoglucanase variants ii |
WO2019038058A1 (en) | 2017-08-24 | 2019-02-28 | Novozymes A/S | Gh9 endoglucanase variants and polynucleotides encoding same |
WO2019038057A1 (en) | 2017-08-24 | 2019-02-28 | Novozymes A/S | Xanthan lyase variants and polynucleotides encoding same |
WO2019042971A1 (en) | 2017-08-29 | 2019-03-07 | Novozymes A/S | Baker's yeast expressing anti-staling/freshness amylases |
WO2019043088A1 (en) | 2017-08-31 | 2019-03-07 | Novozymes A/S | Polypeptides having d-psicose 3-epimerase activity and polynucleotides encoding same |
WO2019043189A1 (en) | 2017-09-01 | 2019-03-07 | Novozymes A/S | Animal feed additives comprising polypeptide having protease activity and uses thereof |
WO2019043191A1 (en) | 2017-09-01 | 2019-03-07 | Novozymes A/S | Animal feed additives comprising a polypeptide having protease activity and uses thereof |
WO2019046703A1 (en) | 2017-09-01 | 2019-03-07 | Novozymes A/S | Methods for improving genome editing in fungi |
WO2019050754A1 (en) | 2017-09-11 | 2019-03-14 | Danisco Us Inc | Glucoamylase and methods of use, thereof |
WO2019063499A1 (en) | 2017-09-27 | 2019-04-04 | Novozymes A/S | Lipase variants and microcapsule compositions comprising such lipase variants |
WO2019067390A1 (en) | 2017-09-27 | 2019-04-04 | The Procter & Gamble Company | Detergent compositions comprising lipases |
WO2019068715A1 (en) | 2017-10-02 | 2019-04-11 | Novozymes A/S | Polypeptides having mannanase activity and polynucleotides encoding same |
WO2019068713A1 (en) | 2017-10-02 | 2019-04-11 | Novozymes A/S | Polypeptides having mannanase activity and polynucleotides encoding same |
WO2019070883A1 (en) | 2017-10-04 | 2019-04-11 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2019083818A1 (en) | 2017-10-23 | 2019-05-02 | Novozymes A/S | Improving expression of a protease by co-expression with propeptide |
WO2019084350A1 (en) | 2017-10-27 | 2019-05-02 | The Procter & Gamble Company | Detergent compositions comprising polypeptide variants |
WO2019081721A1 (en) | 2017-10-27 | 2019-05-02 | Novozymes A/S | Dnase variants |
WO2019081724A1 (en) | 2017-10-27 | 2019-05-02 | Novozymes A/S | Dnase variants |
WO2019084349A1 (en) | 2017-10-27 | 2019-05-02 | The Procter & Gamble Company | Detergent compositions comprising polypeptide variants |
DE102017125559A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANSING COMPOSITIONS CONTAINING DISPERSINE II |
DE102017125560A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANSING COMPOSITIONS CONTAINING DISPERSINE III |
DE102017125558A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANING COMPOSITIONS CONTAINING DISPERSINE I |
WO2019086521A1 (en) | 2017-11-01 | 2019-05-09 | Henkel Ag & Co. Kgaa | Cleaning compositions containing dispersins ii |
WO2019086520A1 (en) | 2017-11-01 | 2019-05-09 | Henkel Ag & Co. Kgaa | Cleaning compositions containing dispersins i |
WO2019086526A1 (en) | 2017-11-01 | 2019-05-09 | Henkel Ag & Co. Kgaa | Cleaning compositions containing dispersins iii |
WO2019092201A2 (en) | 2017-11-10 | 2019-05-16 | Defensin Therapeutics Aps | Maturation of mucosal defense and gut/lung function in the preterm infant |
WO2019092042A1 (en) | 2017-11-10 | 2019-05-16 | Novozymes A/S | Temperature-sensitive cas9 protein |
WO2019099235A1 (en) | 2017-11-14 | 2019-05-23 | Danisco Us Inc | Alpha-amylase, composition and method |
WO2019096903A1 (en) | 2017-11-20 | 2019-05-23 | Novozymes A/S | New galactanases (ec 3.2.1.89) for use in soy processing |
WO2019101773A2 (en) | 2017-11-24 | 2019-05-31 | Defensin Therapeutics Aps | Prevention and treatment of graft-versus-host-disease with defensins |
WO2019110462A1 (en) | 2017-12-04 | 2019-06-13 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2019113413A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2019113415A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2019125804A1 (en) | 2017-12-20 | 2019-06-27 | Basf Se | Nucleases and methods for making and using them |
WO2019122083A1 (en) | 2017-12-22 | 2019-06-27 | Novozymes A/S | Wheat milling process and gh8 xylanases |
US11667941B2 (en) | 2018-01-12 | 2023-06-06 | Camena Bioscience Limited | Compositions and methods for template-free geometric enzymatic nucleic acid synthesis |
WO2019148192A1 (en) | 2018-01-29 | 2019-08-01 | Novozymes A/S | Microorganisms with improved nitrogen utilization for ethanol production |
WO2019154951A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipases, lipase variants and compositions thereof |
WO2019154952A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipase variants and compositions thereof |
WO2019154954A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipase variants and compositions thereof |
WO2019154955A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipase variants and compositions thereof |
WO2019168650A1 (en) | 2018-02-28 | 2019-09-06 | The Procter & Gamble Company | Methods of cleaning |
US11525151B2 (en) | 2018-03-09 | 2022-12-13 | Danisco Us Inc. | Glucoamylases and methods of use, thereof |
WO2019173424A1 (en) | 2018-03-09 | 2019-09-12 | Danisco Us Inc | Glucoamylases and methods of use thereof |
WO2019175240A1 (en) | 2018-03-13 | 2019-09-19 | Novozymes A/S | Microencapsulation using amino sugar oligomers |
WO2019185726A1 (en) | 2018-03-29 | 2019-10-03 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2019197318A1 (en) | 2018-04-09 | 2019-10-17 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2019201785A1 (en) | 2018-04-19 | 2019-10-24 | Novozymes A/S | Stabilized cellulase variants |
WO2019201783A1 (en) | 2018-04-19 | 2019-10-24 | Novozymes A/S | Stabilized cellulase variants |
WO2019229228A1 (en) | 2018-05-31 | 2019-12-05 | Novozymes A/S | Method for treating dissolving pulp using lytic polysaccharide monooxygenase |
WO2020002494A1 (en) | 2018-06-27 | 2020-01-02 | Boehringer Ingelheim Rcv Gmbh & Co Kg | Means and methods for increased protein expression by use of transcription factors |
WO2020002575A1 (en) | 2018-06-28 | 2020-01-02 | Novozymes A/S | Polypeptides having pectin lyase activity and polynucleotides encoding same |
WO2020010101A2 (en) | 2018-07-04 | 2020-01-09 | Danisco Us Inc | Glucoamylases and methods of use, thereof |
WO2020023411A1 (en) | 2018-07-25 | 2020-01-30 | Novozymes A/S | Enzyme-expressing yeast for ethanol production |
WO2020043836A1 (en) | 2018-08-31 | 2020-03-05 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2020070199A1 (en) | 2018-10-03 | 2020-04-09 | Novozymes A/S | Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same |
WO2020076697A1 (en) | 2018-10-08 | 2020-04-16 | Novozymes A/S | Enzyme-expressing yeast for ethanol production |
WO2020092608A1 (en) | 2018-10-31 | 2020-05-07 | Novozymes A/S | Genome editing by guided endonuclease and single-stranded oligonucleotide |
WO2020123463A1 (en) | 2018-12-12 | 2020-06-18 | Novozymes A/S | Polypeptides having xylanase activity and polynucleotides encoding same |
WO2020127796A2 (en) | 2018-12-21 | 2020-06-25 | Novozymes A/S | Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same |
WO2020160126A1 (en) | 2019-01-31 | 2020-08-06 | Novozymes A/S | Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed |
WO2020188095A1 (en) | 2019-03-21 | 2020-09-24 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2020197400A1 (en) | 2019-03-27 | 2020-10-01 | Umc Utrecht Holding B.V. | Engineered iga antibodies and methods of use |
US11091562B2 (en) | 2019-03-27 | 2021-08-17 | Umc Utrecht Holding B.V. | Engineered IGA antibodies and methods of use |
US11059909B2 (en) | 2019-03-27 | 2021-07-13 | Umc Utrecht Holding B.V. | Engineered IgA antibodies and methods of use |
WO2020201403A1 (en) | 2019-04-03 | 2020-10-08 | Novozymes A/S | Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions |
WO2020207944A1 (en) | 2019-04-10 | 2020-10-15 | Novozymes A/S | Polypeptide variants |
WO2020208056A1 (en) | 2019-04-12 | 2020-10-15 | Novozymes A/S | Stabilized glycoside hydrolase variants |
WO2020229191A1 (en) | 2019-05-15 | 2020-11-19 | Novozymes A/S | Temperature-sensitive rna-guided endonuclease |
WO2020260223A1 (en) | 2019-06-24 | 2020-12-30 | Novozymes A/S | Alpha-amylase variants |
WO2020264552A1 (en) | 2019-06-24 | 2020-12-30 | The Procter & Gamble Company | Cleaning compositions comprising amylase variants |
WO2021001400A1 (en) | 2019-07-02 | 2021-01-07 | Novozymes A/S | Lipase variants and compositions thereof |
WO2021013464A1 (en) | 2019-07-25 | 2021-01-28 | Novozymes A/S | Filamentous fungal expression system |
WO2021021458A1 (en) | 2019-07-26 | 2021-02-04 | Novozymes A/S | Microorganisms with improved nitrogen transport for ethanol production |
WO2021018751A1 (en) | 2019-07-26 | 2021-02-04 | Novozymes A/S | Enzymatic treatment of paper pulp |
WO2021025872A1 (en) | 2019-08-06 | 2021-02-11 | Novozymes A/S | Fusion proteins for improved enzyme expression |
WO2021032881A1 (en) | 2019-08-22 | 2021-02-25 | Basf Se | Amylase variants |
WO2021055395A1 (en) | 2019-09-16 | 2021-03-25 | Novozymes A/S | Polypeptides having beta-glucanase activity and polynucleotides encoding same |
WO2021064068A1 (en) | 2019-10-03 | 2021-04-08 | Novozymes A/S | Polypeptides comprising at least two carbohydrate binding domains |
WO2021119304A1 (en) | 2019-12-10 | 2021-06-17 | Novozymes A/S | Microorganism for improved pentose fermentation |
WO2021127319A1 (en) | 2019-12-19 | 2021-06-24 | The Procter & Gamble Company | Cleaning compositions comprising polypeptides having alpha amylase activity |
WO2021122867A2 (en) | 2019-12-19 | 2021-06-24 | Novozymes A/S | Xylanase variants and polynucleotides encoding same |
WO2021123184A2 (en) | 2019-12-19 | 2021-06-24 | Novozymes A/S | Alpha-amylase variants |
WO2021123307A2 (en) | 2019-12-20 | 2021-06-24 | Novozymes A/S | Polypeptides having proteolytic activity and use thereof |
WO2021148278A1 (en) | 2020-01-24 | 2021-07-29 | Novozymes A/S | Mutants of a filamentous fungal cell having increased productivity in the production of a polypeptide |
WO2021152120A1 (en) | 2020-01-31 | 2021-08-05 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2021152123A1 (en) | 2020-01-31 | 2021-08-05 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2021163030A2 (en) | 2020-02-10 | 2021-08-19 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2021163015A1 (en) | 2020-02-10 | 2021-08-19 | Novozymes A/S | Process for producing ethanol from raw starch using alpha-amylase variants |
WO2021163011A2 (en) | 2020-02-10 | 2021-08-19 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2021170559A1 (en) | 2020-02-26 | 2021-09-02 | Novozymes A/S | Polypeptide variants |
WO2021204838A1 (en) | 2020-04-08 | 2021-10-14 | Novozymes A/S | Carbohydrate binding module variants |
WO2021212095A1 (en) | 2020-04-17 | 2021-10-21 | Danisco Us Inc. | Glucoamylase and methods of use thereof |
WO2021214059A1 (en) | 2020-04-21 | 2021-10-28 | Novozymes A/S | Cleaning compositions comprising polypeptides having fructan degrading activity |
WO2022037836A1 (en) | 2020-08-18 | 2022-02-24 | Novozymes A/S | Dispersins expressed with amylase signal peptides |
WO2022043321A2 (en) | 2020-08-25 | 2022-03-03 | Novozymes A/S | Variants of a family 44 xyloglucanase |
WO2022043547A1 (en) | 2020-08-28 | 2022-03-03 | Novozymes A/S | Protease variants with improved solubility |
WO2022043563A1 (en) | 2020-08-28 | 2022-03-03 | Novozymes A/S | Polyester degrading protease variants |
WO2022053706A1 (en) | 2020-09-14 | 2022-03-17 | Aesculus Bio Aps | Defensin fragment derived lipopeptides for treatment of drug-resistant microorganisms |
WO2022074037A2 (en) | 2020-10-07 | 2022-04-14 | Novozymes A/S | Alpha-amylase variants |
WO2022078910A1 (en) | 2020-10-13 | 2022-04-21 | Novozymes A/S | Glycosyltransferase variants for improved protein production |
WO2022090320A1 (en) | 2020-10-28 | 2022-05-05 | Novozymes A/S | Use of lipoxygenase |
WO2022090361A2 (en) | 2020-10-29 | 2022-05-05 | Novozymes A/S | Lipase variants and compositions comprising such lipase variants |
WO2022090564A1 (en) | 2020-11-02 | 2022-05-05 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
WO2022090555A1 (en) | 2020-11-02 | 2022-05-05 | Novozymes A/S | Leader peptides and polynucleotides encoding the same |
WO2022106400A1 (en) | 2020-11-18 | 2022-05-27 | Novozymes A/S | Combination of immunochemically different proteases |
WO2022106404A1 (en) | 2020-11-18 | 2022-05-27 | Novozymes A/S | Combination of proteases |
WO2022129166A1 (en) | 2020-12-15 | 2022-06-23 | Novozymes A/S | Mutated host cells with reduced cell motility |
WO2022162043A1 (en) | 2021-01-28 | 2022-08-04 | Novozymes A/S | Lipase with low malodor generation |
WO2022171780A2 (en) | 2021-02-12 | 2022-08-18 | Novozymes A/S | Alpha-amylase variants |
WO2022175440A1 (en) | 2021-02-18 | 2022-08-25 | Novozymes A/S | Inactive heme polypeptides |
EP4047088A1 (en) | 2021-02-22 | 2022-08-24 | Basf Se | Amylase variants |
WO2022175435A1 (en) | 2021-02-22 | 2022-08-25 | Basf Se | Amylase variants |
WO2022189521A1 (en) | 2021-03-12 | 2022-09-15 | Novozymes A/S | Polypeptide variants |
WO2022197512A1 (en) | 2021-03-15 | 2022-09-22 | The Procter & Gamble Company | Cleaning compositions containing polypeptide variants |
WO2022194668A1 (en) | 2021-03-15 | 2022-09-22 | Novozymes A/S | Polypeptide variants |
EP4060010A2 (en) | 2021-03-15 | 2022-09-21 | The Procter & Gamble Company | Cleaning compositions containing polypeptide variants |
EP4060036A1 (en) | 2021-03-15 | 2022-09-21 | Novozymes A/S | Polypeptide variants |
WO2022194673A1 (en) | 2021-03-15 | 2022-09-22 | Novozymes A/S | Dnase variants |
WO2022199418A1 (en) | 2021-03-26 | 2022-09-29 | Novozymes A/S | Detergent composition with reduced polymer content |
WO2022218863A1 (en) | 2021-04-12 | 2022-10-20 | Novozymes A/S | Method for producing a meat analogue product |
WO2022251056A1 (en) | 2021-05-27 | 2022-12-01 | Novozymes A/S | Transcriptional regulators and polynucleotides encoding the same |
WO2022261003A1 (en) | 2021-06-07 | 2022-12-15 | Novozymes A/S | Engineered microorganism for improved ethanol fermentation |
WO2022263553A1 (en) | 2021-06-16 | 2022-12-22 | Novozymes A/S | Method for controlling slime in a pulp or paper making process |
WO2023285348A1 (en) | 2021-07-13 | 2023-01-19 | Novozymes A/S | Recombinant cutinase expression |
WO2023288294A1 (en) | 2021-07-16 | 2023-01-19 | Novozymes A/S | Compositions and methods for improving the rainfastness of proteins on plant surfaces |
WO2023061928A1 (en) | 2021-10-12 | 2023-04-20 | Novozymes A/S | Endoglucanase with improved stability |
WO2023064905A1 (en) | 2021-10-15 | 2023-04-20 | Danisco Us Inc. | Glucoamylase variants and methods for use thereof |
WO2023104846A1 (en) | 2021-12-10 | 2023-06-15 | Novozymes A/S | Improved protein production in recombinant bacteria |
WO2023118436A1 (en) | 2021-12-22 | 2023-06-29 | Novozymes A/S | Method of producing a milk-based product |
WO2023118565A1 (en) | 2021-12-23 | 2023-06-29 | Novozymes A/S | Reduction of residual dna in microbial fermentation products |
WO2023152220A1 (en) | 2022-02-10 | 2023-08-17 | Novozymes A/S | Improved expression of recombinant proteins |
WO2023161245A1 (en) | 2022-02-22 | 2023-08-31 | Novozymes A/S | Oral care composition comprising enzymes |
WO2023165507A1 (en) | 2022-03-02 | 2023-09-07 | Novozymes A/S | Use of xyloglucanase for improvement of sustainability of detergents |
WO2023170177A1 (en) | 2022-03-08 | 2023-09-14 | Novozymes A/S | Fusion polypeptides with deamidase inhibitor and deamidase domains |
EP4242303A1 (en) | 2022-03-08 | 2023-09-13 | Novozymes A/S | Fusion polypeptides with deamidase inhibitor and deamidase domains |
WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
WO2023222648A2 (en) | 2022-05-17 | 2023-11-23 | Novozymes A/S | Process for reducing free fatty acids |
WO2023247348A1 (en) | 2022-06-21 | 2023-12-28 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2023247514A1 (en) | 2022-06-22 | 2023-12-28 | Novozymes A/S | Recombinant mannanase expression |
WO2023247664A2 (en) | 2022-06-24 | 2023-12-28 | Novozymes A/S | Lipase variants and compositions comprising such lipase variants |
WO2024003143A1 (en) | 2022-06-30 | 2024-01-04 | Novozymes A/S | Mutanases and oral care compositions comprising same |
WO2024012912A1 (en) | 2022-07-15 | 2024-01-18 | Novozymes A/S | Polypeptides having deamidase inhibitor activity |
WO2024033133A2 (en) | 2022-08-11 | 2024-02-15 | Basf Se | Enzyme compositions comprising an amylase |
WO2024033134A1 (en) | 2022-08-11 | 2024-02-15 | Basf Se | Enzyme compositions comprising protease, mannanase, and/or cellulase |
WO2024056643A1 (en) | 2022-09-15 | 2024-03-21 | Novozymes A/S | Fungal signal peptides |
EP4273249A2 (en) | 2023-07-07 | 2023-11-08 | Novozymes A/S | Improved expression of recombinant proteins |
Also Published As
Publication number | Publication date |
---|---|
DE4343591A1 (en) | 1995-06-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO1995017413A1 (en) | Process for the evolutive design and synthesis of functional polymers based on designer elements and codes | |
DE19953854C2 (en) | Process for the production of biopolymers with modified properties | |
EP2175021B1 (en) | Method for producing polymers | |
DE3687287T3 (en) | Process for the amplification of nucleic acid sequences. | |
DE19826758C1 (en) | Production of closed, double-stranded DNA molecules for use in gene therapy or genetic vaccination | |
EP1314783B1 (en) | Nucleic acid linkers and their use in gene synthesis | |
DE69432586T2 (en) | METHOD FOR GENERATING SINGLE-STRENGTH DNA MOLECULES | |
DE69830395T2 (en) | ITERATIVE RESEQUENCING | |
EP1005574A2 (en) | Method for producing nucleic acid polymers | |
EP1181395B1 (en) | Method for the synthesis of dna fragments | |
EP1685261B1 (en) | Highly parallel dna synthesiser based on matrices | |
DE102006039479A1 (en) | Programmable oligonucleotide synthesis | |
WO1989011211A2 (en) | Oligonucleotide bank and process for dna sequencing | |
CN109868268A (en) | A method of optimization DNA encoding library of compounds Start Fragment | |
DE60312507T3 (en) | A METHOD FOR THE IN VITRO MOLECULAR EVOLUTION OF THE PROTEIN FUNCTION | |
DE60300389T2 (en) | METHOD FOR THE SELECTIVE RANDOM MUTAGENESIS OF POLYNUCLEOTIDES | |
WO2005030957A1 (en) | Method for in vitro evolution of polypeptides | |
DE69730558T2 (en) | Method of forming macromolecular micro-polymers | |
WO1996005296A1 (en) | Method of preparing and amplifying nucleic acids | |
DE69827998T2 (en) | short PNA oligonucleotides in triplex complexes | |
EP1015640B1 (en) | Method for synthesising and amplifying nucleic acids | |
EP1234056B1 (en) | Dynamic determination of analytes using arrays on internal surfaces | |
EP1266027A2 (en) | Dynamic sequencing by hybridization | |
WO2003100058A2 (en) | Method for creating polynucleotide molecules | |
DE3512435A1 (en) | RESTRICTIONSENDONUKLEASE ASP 718, YOUR RECOVERY AND USE |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase |