WO1995014707A1 - N-2 substituted purines - Google Patents
N-2 substituted purines Download PDFInfo
- Publication number
- WO1995014707A1 WO1995014707A1 PCT/US1994/013622 US9413622W WO9514707A1 WO 1995014707 A1 WO1995014707 A1 WO 1995014707A1 US 9413622 W US9413622 W US 9413622W WO 9514707 A1 WO9514707 A1 WO 9514707A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- deoxyribose
- ribose
- rna
- oligonucleotide
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/16—Purine radicals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/06—Pyrimidine radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/06—Pyrimidine radicals
- C07H19/10—Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/16—Purine radicals
- C07H19/20—Purine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H23/00—Compounds containing boron, silicon, or a metal, e.g. chelates, vitamin B12
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07J—STEROIDS
- C07J43/00—Normal steroids having a nitrogen-containing hetero ring spiro-condensed or not condensed with the cyclopenta(a)hydrophenanthrene skeleton
- C07J43/003—Normal steroids having a nitrogen-containing hetero ring spiro-condensed or not condensed with the cyclopenta(a)hydrophenanthrene skeleton not condensed
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1133—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against herpetoviridae, e.g. HSV
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
- C12Y113/11—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
- C12Y113/11012—Linoleate 13S-lipoxygenase (1.13.11.12)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/312—Phosphonates
- C12N2310/3125—Methylphosphonates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/333—Modified A
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/336—Modified G
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3521—Methyl
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3523—Allyl
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3527—Other alkyl chain
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
- C12N2310/3531—Hydrogen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
- C12N2310/3533—Halogen
Definitions
- Oligonucleotides are used for a variety of therapeutic and diagnostic purposes, such as treating diseases, regulating gene expression in experimental systems, assaying for RNA and for RNA products through the employment of antisense
- the compounds of the invention include novel heterocyclic bases, nucleosides, and nucleotides. When incorporated into oligonucleotides, the compounds of the invention are useful for modulating the activity of RNA.
- oligonucleotides and oligonucleotide analogs as "antisense” agents.
- the oligonucleotides or oligonucleotide analogs complimentary to a specific, target, messenger RNA (mRNA) sequence are used.
- Antisense methodology is often directed to the complementary hybridization of relatively short oligonucleotides and oligonucleotide analogs to single-stranded mRNA or single-stranded DNA such that the normal, essential functions of these intracellular nucleic acids are disrupted.
- Hybridization is the sequence specific hydrogen bonding of oligonucleotides or oligonucleotide analogs to Watson-Crick base pairs of RNA or single-stranded DNA. Such base pairs are said to be complementary to one another.
- the oligonucleotides and oligonucleotide analogs are intended to inhibit the activity of the selected mRNA- - to interfere with translation reactions by which proteins coded by the mRNA are produced- - by any of a number of mechanisms .
- the inhibition of the formation of the specific proteins that are coded for by the mRNA sequences interfered with have been hoped to lead to therapeutic benefits.
- Oligonucleotides and oligonucleotide analogs are now accepted as therapeutic agents holding great promise for therapeutics and diagnostics methods. But applications of oligonucleotides and oligonucleotide analogs as antisence agents for therapeutic purposes, diagnostic purposes, and research reagents often require that the oligonucleotides or oligonucleotide analogs be synthesized in large quantities, be transported across cell membranes or taken up by cells, appropriately hybridize to targeted RNA or DNA, and sub-sequently terminate or disrupt nucleic acid function. These critical functions depend on the initial stability of oligonucleotides and oligonucleotide analogs toward nuclease degradation. A serious deficiency of unmodified
- oligonucleotides for these purposes is the enzymatic degradation of the
- oligonucleotides by a variety of intracellular and extracellular ubiquitous nucleolytic enzymes
- nucleases hereinafter referred to as "nucleases.”
- Hybridization arrest denotes the terminating event in which the oligonucleotide inhibitor binds to the target nucleic acid and thus prevents, by simple steric hindrance, the binding of essential proteins, most often ribosomes, to the nucleic acid.
- Methyl phosphonate oligonucleotides Miller, et al . , Anti -Cancer Drug Design, 1987, 2, 117-128, and ⁇ -anomer oligonucleotides are two extensively studied antisense agents that are thought to disrupt nucleic acid function by hybridization arrest.
- the second "natural" type of terminating event is the activation of RNase H by the heteroduplex formed between the DNA type oligonucleotides or oligonucleotide analogs and the targeted RNA with subsequent cleavage of target RNA by the enzyme.
- the oligonucleotides or oligonucleotide analogs which must be of the deoxyribose type, hybridize with the targeted RNA and this duplex activates the RNase H enzyme to cleave the RNA strand, thus destroying the normal function of the RNA.
- Phosphorothioate modified oligonucleotides are the most prominent example of antisense agents that are thought to operate by this type of antisense terminating event.
- antisense agents ⁇ oligonucleotides and oligonucleotide analogs ⁇ have been introduced into antisense agents ⁇ oligonucleotides and oligonucleotide analogs ⁇ to increase their therapeutic activity. Such modifications are designed to increase cell penetration of the antisense agents, to stabilize the
- antisense agents from nucleases and other enzymes that degrade or interfere with their structure or activity in the body, to enhance the antisense agents' binding to targeted RNA, to provide a mode of disruption (terminating event) once the antisense agents are sequence-specifically bound to targeted RNA, and to improve the antisense agents'
- oligonucleotides pharmacokinetic and pharmacodynamic properties. It is unlikely that unmodified, "wild type,” oligonucleotides will be useful therapeutic agents because they are rapidly
- a primary focus of antisense research has been to modify oligonucleotides to render them resistant to such nucleases. These modifications are designed to enhance the uptake of antisense agents ⁇ oligonucleotides and oligonucleotide analogs ⁇ and thus provide effective therapeutic, research reagent, or diagnostic uses.
- oligonucleotide modification is modification at the sugar-phosphate backbone, particularly on the phosphorus atom.
- Phosphorothioates, methyl phosphonates, phosphoramidites, and phosphorotriesters have been reported to have various levels of resistance to nucleases.
- Backbone modifications are disclosed as set forth in U.S. patent applications assigned to a common assignee hereof, entitled “Backbone Modified Oligonucleotide Analogs," Serial Number 703,619 and "Heteroatomic Oligonucleotide
- phosphate modifications include methyl phosphonate oligonucleotides, where the phosphoryl oxygen of the phosphorodiester linking moiety is replaced with methylene groups or the nucleotide elements together are replaced, either in total or in part, by methyl groups.
- phosphorothioate oligonucleotides The phosphorothioate modified oligodeoxynucleotides are capable of terminating RNA by activation of RNase H upon hybridization to RNA although hybridization arrest of RNA function may play some part in their activity. Phosphoramidites have been disclosed as set forth in U.S. patent application assigned to a common
- Another approach is directed to the development of sequence-specific chemical RNA cleavers. This concept requires attaching pendent groups with acid/base properties to oligonucleotides. The pendent group is not involved with the specific Watson-Crick hybridization of the
- oligonucleotides or oligonucleotide analogs with mRNA but is carried along by the oligonucleotide or oligonucleotide analog to serve as a reactive functionality.
- the pendent group is intended to interact with mRNA in some manner more effectively to inhibit translation of mRNA into protein.
- Such pendent groups have also been attached to molecules targeted to either single or double stranded DNA.
- Such pendent groups include, intercalating agents, cross-linkers, alkylating agents, or coordination complexes containing a metal ion with associated ligands.
- the sites of attachment of the pendent groups to oligonucleotides and oligonucleotide analogs play an important, yet imperfectly known, part in the effectiveness of oligonucleotides and oligonucleotide analogs for therapeutics and diagnostics.
- RNA-oligonucleotide or oligonucleotide analog duplex may be greatly affected by the positioning of the tethered functional group containing the reactive functionality. Inappropriate positioning of
- attachment sites may potentially allow sequence-specific binding but may be of such low stability that the reactive functionality will not have sufficient time to initiate RNA disruption.
- RNA-oligonucleotide or oligonucleotide analog heteroduplex is believed to be important, because without a sufficient half life the reactive or non-reactive functionalities of this invention may not have enough time to initiate the cleavage or otherwise disrupt RNA function.
- Targeted RNA is inactivated by formation of covalent links between a modified oligonucleotide and the RNA 2'-hydroxyl group.
- a variety of structural studies such as X-ray diffraction, chemical reaction, and molecular modeling studies suggests that the 2'-hydroxyl group of RNA in a duplex or heteroduplex resides in the minor groove.
- the minor side or minor groove of the duplexes formed between such oligonucleotides or modified oligonucleotides and the targeted RNA has been found to be the greatly preferred site for functional group activity.
- the functionalities not interfere with Watson-Crick base pair hydrogen bonding rules, as this is the sequence-specific recognition/ binding factor essential for selection of the desired RNA to be disrupted. Further, the functionalities preferably should improve the oligonucleotides compositions' pharmacokinetic and/or pharmacodynamic properties, as well as the oligonucleotide compositions' transport properties across cellular membranes. It is also important that the pendent groups designed to support either enzymatic or chemical cleavage of RNA must be compatible with the requisite hybridization step. When hybridized to RNA, the pendent groups would be accessible, via the minor groove, to the 2'-hydroxyl and phosphorodiester linkages of the targeted RNA.
- oligonucleotide compositions with molecules other then the target RNA, for example with other molecules that may be alkylated or which may react with radical species, as well as self-destruction, not only diminishes the diagnostic or therapeutic effect of the antisense treatment but also leads to undesired toxic
- oligonucleotide compositions that are capable of improved specificity and effectiveness both in binding and modulating mRNA modulation or inactivating mRNA without imposing undesirable side effects.
- the present invention addresses these, as well as other, needs by presenting novel compounds, based on the purine ring system, that may be used as oligonucleotide intermediates. It has now been found that certain positions on the nucleosides of double stranded nucleic acids are exposed in the minor groove and may be substituted without affecting Watson-Crick base-pairing or duplex stability. Reactive or non-reactive functionalities placed in these positions can best initiate cleavage and destruction of targeted RNA or interfere with its activity.
- This invention presents novel compounds based on the purine ring system that have utility as intermediates for the synthesis of oligonucleotides and oligonucleotide
- This invention presents novel, substituted purines comprising a tether portion and at least one reactive or non-reactive functionality.
- this invention provides nucleosides, nucleoside analogs, nucleotides, nucleotide analogs, heterocyclic bases, heterocyclic base analogs based on the purine ring system, and oligonucleotide compositions incorporating the same.
- the heterocyclic compounds of the invention are adapted for placement of the reactive, RNA cleaving moiety or other reactive moiety into the minor groove site of the hybrid structure formed from the RNA and the compositions of the invention through careful selection of the attachment of the RNA cleaving moieties.
- the 2 position of the purine ring has now been found to be a site for attachment of potential RNA cleaving moieties as well as other moieties that may enhance
- the compounds have the formula:
- G is C or N
- X is NH 2 or OH
- Y is RQ or NHRQ, wherein R is a hydrocarbyl group having from 2 to about 20 carbon atoms; and Q is at least one reactive or nonreactive functionality; and
- Z is H, a nitrogen protecting group, or a sugar moiety.
- the invention further provides compounds comprising a sugar and base moiety as discussed above, with the 3' position of the sugar moiety derivatized with a phosphate group.
- compositions may be ribose, deoxyribose, or a sugar analog.
- sugar is ribose or deoxyribose.
- heterocyclic bases or modified bases together may be the usual sugar phosphate nucleic acid backbone found in nature, but may also be modified as a phosphorothioate, methylphosphonate, or phosphate alkylated moiety to further enhance the modified oligonucleotides' properties.
- Other backbone modifications may also be employed such as the removal of 5'-methylene group, and the use of alkyl, or heteroatomic sugar.
- mixed sequence oligonucleotides incorporating at least one of the compounds as set forth herein are presented.
- This invention presents novel heterocyclic compounds based on the purine ring system that may be used as intermediates for oligonucleotide compositions.
- nucleosides nucleoside analogs
- nucleotides nucleotides, nucleotide analogs, heterocyclic bases,
- heterocyclic base analogs and oligonucleotide compositions incorporating the same.
- novel compounds of the invention are based on the purine ring system, comprising a heterocyclic purine-base portion, at least one reactive or non-reactive functionality, and a tether portion for attaching the functionalities to the balance of the compound.
- the 2 position of the purine ring has been found to be a unique point of attachment for
- oligonuceltides analogs' ability to modulate RNA activity without interfering with stability of an RNA-oligonucleotide heteroduplex, and also improves the oligonucleotides' transport properties.
- the non-reactive functionalities' utility lies, in part, in their ability to improve the pharmacodynamic or pharmacokinetic properties of the
- the functional sites on the base units are important in the design of compositions for sequence-specific destruction or modulation of targeted RNA.
- the half-life of the formed duplex is believed to be greatly effected by the positioning of the tethered group that connects the reactive function-ality to the base unit. Innapropriate positioning of func-tional groups, such as placement on the Watson-Crick base pair sites, would preclude duplex formation. It is important that the tether functionality not interfere with Watson-Crick base pair hydrogen bonding rules as this is the seq ⁇ ence-specific recognition/binding factor for selection of the desired RNA to be disrupted.
- Attachment sites may allow sequence-specific binding but may be of such low stability that the reactive functionality will not have sufficient time to initiate RNA disruption. It has now been found that certain positions on the nucleosides of double stranded nucleic acids are exposed in the minor groove and may be substituted without affecting Watson-Crick basepairing or duplex stability. Reactive or non-reactive functionalities placed in these positions in accordance with this invention can best initiate cleavage and destruction of targeted RNA or interfere with its activity.
- the sites of functionality in the heterocyclic compounds of the invention are novel ⁇ the 2 position of the purine ring system ⁇ and have been preferably designed such that the functionalities will preferably reside in or on the minor groove formed by the heteroduplex between modified oligonucleotides and targeted RNA.
- the compounds of the invention may have at least one reactive functionality or other moiety appended thereto capable of interacting with, preferably cleaving, an RNA. These moieties are preferably adapted for placement of the reactive or other moiety into the minor groove site of the hybrid structure formed from the RNA and oligonucleotides and oligonucleotide analogs including the compositions of the invention.
- RNA cleaving moiety will preferably be tethered to a relatively small proportion of the subunits, generally only one or two of the oligonucleotide compositions of the invention. In other embodiments of the invention, however, substantially all of the nucleotides in an oligonucleotide can be modified to include one or more functionalities such as RNA cleaving moieties.
- the compounds of the invention may be used to prepare desired oligonucleotides and oligonucleotide analogs; these oligonucleotides and oligonucleotide analogs are also within the ambit of this invention.
- incorporación of the novel compounds of the invention into oligonucleotide compositions improves those compositions' pharmacokinetic and pharmacodynamic properties, the compositions' resistance to nucleases, facilitates antisense and non-antisense therapeutic uses, diagnostic uses, and research reagent uses, improves the compositions' binding capabilities without any concomitant interference with the Watson-Crick binding, and enhances the compositions' penetration into cells.
- Some of these enhanced properties are illustrated in Table 1 below.
- nucleoside is a nitrogenous heterocyclic base linked to a pentose sugar, either a ribose, deoxyribose, or derivatives or analogs thereof.
- nucleotide means a phosphoric acid ester of a nucleoside comprising a nitrogenous heterocyclic base, a pentose sugar, and one or more phosphate or other backbone forming groups; it is the monomeric unit of an
- oligonucleotide refers to a plurality of joined nucleotide units formed in a specific sequence from naturally occurring heterocyclic bases and pentofuranosyl equivalent groups joined through
- Nucleotide units may include the common bases such as
- pentose sugar may be deoxyribose, ribose, or groups that substitute therefore.
- antisense agents and
- oligonucleotide compositions as used in the content of this invention encompass oligonucleotides and oligonucleotide analogs and are interchangeable.
- phosphate derivatives include phosphorothioates, methyl phosphonates, phosphoramidites, phosphorotriesters, and any other groups known to those skilled in the art.
- Modified base in the context of this invention refer to moieties that function similarly to their naturally occurring counterparts but have been functionalized to change their properties.
- oligonucleotides refer to compositions that function similarly to natural oligonucleotides but have non-naturally occurring portions. Oligonucleotide analogs or modified oligonucleotides may have altered sugar moieties, altered bases, both altered sugars and bases or altered inter-sugar linkages, for example phosphorothioates and other sulfur containing species which are known for use in the art. In the context of the invention, "improved
- pharmacodynamic property means improved oligonucleotide uptake, enhanced oligonucleotide resistance to degradation, and/or strengthened sequence-specific hybridization with RNA. "Improved pharmacokinetic property” means improved
- hydrocarbyl groups are the linkers or tethers that attach reactive or non-reactive functionalities to the purine based compounds of the invention.
- "Hydrocarbyl compounds,” as used herein, means straight, branched, or cyclic carbon and hydrogen containing compounds.
- a straight chain compound means an open chain compound, such as an aliphatic compound, including alkyl, alkenyl, or alkynyl compounds.
- a branched compound, as used herein, comprises a straight chain compound, such as an alkyl, alkenyl, alkynyl, which has further straight chains attached to the carbon atoms of the straight chain.
- lower alkynl means compounds, straight or branched, having between about 1 to about 10 carbon atoms.
- compound refers to closed chain compounds ⁇ is, a ring of carbon atoms, such as a cyclic aliphatic or aromatic compound.
- internally interrupted means that the carbon chains may be interrupted with heteroatoms such as O, N, or S. If desired, the carbon chain may have no heteroatoms present.
- the hydrocarbyl compounds noted above may be substituted or unsubstituted. In the context of this
- substituted or “unsubstituted,” means that the hydrocarbyl compounds may have any one of a variety of substituents, in replacement, for example, of one or more hydrogen atoms in the compound, or may have no substituents. Suitable substituents will be readily apparent to one skilled in the art once armed with the present disclosure. Pendent groups as used herein refers to both
- functionality means a moiety that interacts with mRNA in some manner to more effectively inhibit
- non-reactive functionality means a functional group that may not possess a reactive portion or may not initiate chemical reactions, but rather enhances the oligonucleotide compositions' pharmacodynamic and pharmacokinetic properties, whether or not it plays any role in RNA cleavage.
- terminal end is used in reference to the reactive or non-reactive functionality, this term means the end not attached to the purine core.
- the compound has the following formula:
- G is C or N
- X is NH 2 or OH
- Y is RQ or NHRQ, wherein said R is H or a
- hydrocarbyl group having from 2 to about 20 carbon atoms; and Q comprises at least one reactive or non-reactive
- Z is H, a nitrogen protecting group, or a sugar moiety.
- Q is a nitrogen-containing heterocycle.
- Q is a substituted or unsubstituted imidazole.
- Y is RQ and said Q is an imidazole.
- Y is NHRQ and Q is an imidazole.
- G is N; X is NH 2 ; Y is NHRQ, said R is a lower alkane and Q is an imidazole.
- R is an alkane having between about 2 to about 4 carbon atoms, preferably propyl .
- G is N; X is OH; Y is NHRQ, said R is a lower alkane; and Q is an imidazole.
- R is an alkane having between about 2 to about 4 carbon atoms, preferably ethyl or
- R is isobutyryl, more preferably propyl.
- Q is a methyl-imidazole.
- Y is NHRQ, said R is H and Q is an alkane having from about 5 up to about 20 carbon atoms, preferably between about 5 to about 10 carbon atoms.
- G is N; X is OH 2 ; Y is NHRQ, said R is H and Q is an alkane having from about 5 up to about 20 carbon atoms, preferably between about 5 to about 10 carbon atoms.
- Y is NHRQ
- said R is a lower alkane
- Q is an amine
- G is N; X is OH; Y is NHRQ, said R is hexane and Q is NH 2 .
- Y is NHRQ
- the reactive functionality, Q is a thiol group
- Y is RQ and the reactive functionality Q is a thiol group, aldehyde, ketone, alcohol, or an alkoxy group.
- the hydrocarbyl groups (R) may serve as tethers or lxnkers for attaching reactive or non-reactive functionalities to the purine ring system of the compounds of the invention.
- the hydrocarbyl groups, R suitable for
- Alkyl groups of the invention include, but are not limited to, straight and branched chained alkyls such as methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, isopropyl, 2-butyl, isobutyl, 2-methylbutyl, isopentyl, 2-methyl-pentyl,
- alkenyl groups useful in the invention include, but are not limited to, unsaturated moieties derived from the above alkyl groups including but not limited to vinyl, allyl, crotyl, propargyl.
- Useful aryl groups include, but are not limited to, phenyl, tolyl, benzyl, naphthyl, anthracyl, phenanthryl, and xylyl.
- hydrocarbyl groups that is, the straight, branched, or cyclic alkyl, alkenyl, or alkynyl groups pointed out above may be internally interrupted with heteroatoms, such as O, N, or S; however, this is not
- hydrocarbyl groups may be further substituted.
- Substituent groups for the above include, but are not limited to, other alkyl, haloalkyl, alkenyl, alkoxy, thioalkoxy, haloalkoxy and aryl groups as well as halogen, hydroxyl, amino, azido, carboxy, cyano, nitro, mercapto, sulfides, sulfones, sulfoxides, and heterocycles.
- Other suitable substituent groups will be apparent to those skilled in the art and may be used without departing from the spirit of the invention.
- Reactive functionalities suitable for use as Q in the practice of this invention include, but are not limited to, halogens; substituted or unsubstituted heterocyclic compounds, such as substituted or unsubstituted
- heterocycloalkyls such as
- heterocycloalkylaminos polyalkylaminos, imidazoles,
- ketones substituted or unsubstituted ethers; substituted or unsubstituted esters; substituted or unsubstituted aryl compounds having from about 6 to about 20 carbon atoms, such as aralkylamino having from about 6 to about 20 carbon atoms, aminoaralkylamino having from about 6 to about 20 carbon atoms, alkyloxyaryl compounds, or allyloxyaryl compounds.
- Amines of this invention are also meant to include polyalkylamino compounds and aminoalkylamines such as aminopropylamines and further heterocycloalkylamines, such as imidazol-1, 2, or 4-yl-propylamine.
- Polyamides, polyesters, and polyethylene glycols according to the invention have structures analogous to the above-described polyamines, except that an amide, ester or alcohol functionality is substituted for the nitrogenous species of the polyamine.
- Polyether groups have also
- phthalimide N-(8-bromooctyl)phthalimide; N-(9-bromononyl)phthalimide; N-(10-bromododecyl)phthalimide; N-(11-bromoundecyl)phthalimide; N-(12-bromodocecyl)phthalimide; N-(13-bromotridecyl) phthal-imide; N-(14-bromotetradecyl)
- phthalimide N-(18-bromooctadecyl) phthalimide; N-(19-bromononadecyl)phthalimide; N-(3-bromo-2-methylpropyl)phthalimide; N-(4-bromo-2-methyl-3-ethylbutyl) phthalimide; N-(3-bromo-2,2-diethylpropyl)phthalimide; N-(4-bromo-3- propylbutyl)phthalimide; N-(10-bromo-2,8-dibutyl-decyl)phthalimide; N-(8-bromo-6,6-dimethyloctyl)phthalimide; N-(8-bromo-6-propyl-6-butyloctyl)phthalimide; N-(4-bromo-2-methylbutyl)phthalimide; N-(5-bromo-2-methylpentyl) phthalimide; N- (5
- phthalimide N-(12-bromo-4-isopropoxydodecyl) phthalimide; N- (10-bromo-4-azido-2-nitrodecyl)phthalimide; N-(9-bromo-5-mercaptononyDphthal- imide; N-(5-bromo-4-amino-pentenyl)phthalimide; N-(5-bromo-penten-2-yl)phthalimide; N-(3-bromoallyl)phthalimide; N-(4-bromocrotyl)phthalimide; N-(3-bromopropargyl)phthalimide; N-(1-bromonaphth-4-yl)
- Suitable heterocyclic groups include, but are not limited to, imidazole, tetrazole, triazole, pyrrolidine, piperidine, piperazine and morpholine.
- Amines include amines of all of the above alkyl, alkenyl and aryl groups including primary and secondary amines and "masked amines" such as phthalimide.
- Other reactive functionalities suitable for practicing the invention include, without limitation,
- the reactive functionalities may either be basic, acidic, or amphoteric. Heteroatomic species can be formulated to be either basic or acidic or, indeed, to be amphoteric for such purposes. Alkylating and free radical forming functionalities may also be used for these purposes.
- Non-reactive functionalities for Q include, but are not limited to, alkyl chains, polyamines, ethylene glycols, polyamides, aminoalkyl chains, amphipathic moieties, points for reporter group attachment, and intercalators attached to any of the preferred sites for attachment.
- the reactive and non-reactive functionalities may be further substituted.
- Suitable substituents include, but are not limited to, other hydrocarbyl compounds,
- halohydrocarbyl compounds alkoxy, thioalkoxy, haloalkoxy, or aryl groups, as well as halogen, hydroxyl, amino, azido, carboxy, cyano, nitro, mercapto, sulfides, sulfones and sulfoxides. Any of the straight, branched, or cyclic
- hydrocarbyl substituents may be further internally
- Substituent groups can be present on the above-described alkyl, alkenyl, alkyne, polyamine, polyamide, polyester, polyethylene glycol,
- Substituent groups include but are not limited to halogen, hydroxyl, keto, carboxy, nitrates, nitrites, nitro, nitroso, nitrile, trifluoromethyl, O-alkyl, S-alkyl, NH-alkyl, amino, azido, sulfoxide, sulfone, sulfide, silyl, intercalators, conjugates, polyamines, polyamides,
- polyethylene glycols polyethers, groups that enhance the pharmacodynamic properties of oligonucleotides and groups that enhance the pharmacokinetic properties of
- oligonucleotides oligonucleotides.
- Typical intercalators and conjugates include cholesterols, phospholipids, biotin, phenanthroline, phenazine, phenanthridine, anthraquinone, acridine,
- fluoresceins fluoresceins, rhodamines, coumarins, and dyes.
- Halogens include fluorine, chlorine, bromine, and iodine.
- Other suitable substituent groups will be apparent to those skilled in the art and may be used without departing from the spirit of the invention.
- the invention further provides compounds comprising a sugar combined with a base moiety as discussed above.
- Suitable sugar moieties include, but are not limited to, ribose, deoxyribose, and sugar analogs.
- Z is ribose or deoxyribose. In a more preferred embodiment, Z is
- Z is a sugar analog, preferably similar to the deoxyribose type.
- G is N; X is OH; Y is NHRQ, said R is a lower alkane; and Q is an imidazole; and Z is ribose or deoxyribose, preferably deoxyribose.
- R is an alkane having between about 2 to about 4 carbon atoms, preferably ethyl or isobutyryl, more preferably propyl; and Z is ribose or deoxyribose, preferably deoxyribose.
- R is isobutyryl and Q is a methyl-imidazole; and Z is ribose or deoxyribose, preferably deoxyribose.
- G is N; X is NH 2 ; Y is NHRQ, said R is H and Q is an alkane having from about 5 up to about 20 carbon atoms, preferably between about 5 to about 10 carbon atoms; and Z is ribose or deoxyribose, preferably deoxyribose.
- Y is NHRQ
- said R is a lower alkane
- Q is an amine
- G is N;
- X is NH 2 ;
- Y is NHRQ, said R is a lower alkane; and
- G is N; X is OH; Y is NHRQ, said R is hexane and Q is NH 2 ; and Z is ribose or deoxyribose,
- Y is NHRQ
- the reactive functionality, Q is a thiol group
- Y is RQ and the reactive functionality Q is a thiol group, aldehyde, ketone, alcohol, or an alkoxy group; and Z is ribose or deoxyribose, preferably deoxyribose.
- Y is RQ and the reactive functionality Q is a thiol group, aldehyde, ketone, alcohol, or an alkoxy group; and Z is ribose or deoxyribose, preferably
- sugar moieties may be attached to the novel purine based compounds of the invention using methods known in the art. See Revankar, supra .
- Substituted sugars may be synthesized according to the methods disclosed in PCT Patent Application Number
- PCT ⁇ US91 ⁇ 00243 assigned to a common assignee hereof, entitled “Compositions and Methods for Detecting and Modulating RNA Activity and Gene Expression,” the disclosures of which are incorporated herein by reference to disclose more fully such modifications.
- a substiituted sugar as, methyl 3-O-(t-butyldiphenylsilyl)-2,5-dideoxy-5-C-formyl- ⁇ /ß-D-erythropentofuranoside, can be prepared by modifying 2-deoxy-D-ribose to methyl 2-deoxy-a/ ⁇ -D-erythro-pentofuranoside
- compositions may be made without deviating from the spirit of the invention.
- Suitable substituents on the sugar moiety include, but are not limited to, OH, lower alkyl, substituted lower alkyl, aralkyl, heteroalkyl, heterocycloalkyl,
- compositions of the invention exhibit an effective ability to penetrate into the intracellular spaces of cells of the organism in question or otherwise to contact the target RNA and to specifically bind therewith to form a hybrid capable of detecting and modulating RNA activity.
- target RNA RNA
- compositions of the invention exhibit an effective ability to penetrate into the intracellular spaces of cells of the organism in question or otherwise to contact the target RNA and to specifically bind therewith to form a hybrid capable of detecting and modulating RNA activity.
- native phosphorodiester structure may also be used for those purposes.
- Z will be a nitrogen protecting group.
- protecting groups are known per se as chemical functional groups that can be selectively appended to and removed from functionalities, such as amine groups. These groups are present in a chemical compound to render such functionality inert to chemical reaction conditions to which the compound is exposed. See, e . g. , Greene, et al . , Protective Groups in Organic Synthesis, (John Wiley & Sons, New York, 2d ed. 1991).
- amine protecting groups are known in the art, including, but not limited to, the allyloxycarbonyl (Alloc), benzyloxycarbonyl (CBz), chlorobenzyloxycarbonyl, t-butyloxycarbonyl (Boc), fluorenylmethoxycarbonyl (Fmoc), isonicotinyloxycarbonyl (i-Noc) groups, (see, e . g. , Veber Hirschmann, et al . , J. Org. Chem. 1977, 42, 3286 and Atherton, et al . , (Academic Press, New York, Gross & Meinhofer, eds, 1983).
- Boc group can protect an amine group from base and from reducing conditions but that it can be removed with acid.
- Other nitrogen protecting groups will be apparent to those skilled in the art and may be used without detracting from the spirit of the invention. Any este protecting groups known to those skilled in the art may be used;
- tetrahydropyranyl is an example of such a group. See Greene, supra .
- compositions comprising a sugar and base moiety as discussed above, with the 3' position of the sugar moiety derivatized with a phosphate group.
- nucleotides of the invention may be prepared by protecting the 5' position of the sugar moiety of the imidazole ring and derivatizing the 3' position with an appropriate phosphoramidite or other phosphate suitable for use on a DNA synthesizer, including without limitation, alkyl phosphonates, phosphorothioates, or phosphorotriesters.
- the compounds of the invention may be synthesized under the following reaction conditions.
- the following reaction describes attachment of the 3-(1H-imidazol-1-yl) propyl moiety to the 2-amino group of
- NPE (Nitrophenyl)ethanol
- oligonucleotides or oligonucleotide analogs incorporating the novel compounds of the invention are provided.
- the oligonucleotides or oligonucleotide analogs may comprise a sugar modified or native oligonucleotide containing a target sequence that is specifically hybridizable with a preselected nucleotide sequence, a sequence of DNA or RNA that is
- oligonucleotides of the invention comprise: a first oligonucleotide region and a second
- said first region including at least one nucleotide having a base unit as defined above in connection with the heterocyclic compounds of the invention; and said second region including a plurality of consecutive phosphorothiocite linked nucleotides having a 2'-deoxy-erythro-pentofuranosyl sugar moiety.
- the sugar moiety is ribose or deoxyribose and said phosphate is a methylphosphonate, phosphorothioate, phosphoramidite, phosphorotriester.
- the oligonucleotides of the invention further comprise a third region that includes at least one nucleotide having a base unit as defined above in connection with the heterocyclic compounds of the invention; wherein said second region is positioned in said oligonucleotide between said first and third regions.
- oligonucleotides or oligonucleotide analogs incorporating the novel compounds of the invention may be synthesized, conveniently through solid state
- synthesizers are commercially available and their use is generally understood by persons of ordinary skill in the art as being effective in generating nearly any oligonucleotide or oligonucleotide analog of reasonable length which may be desired.
- oligonucleotide analogs are synthesized by the standard solid phase, automated nucleic acid synthesizer such as the Applied Biosystems, Incorporated 380B or MilliGen/Biosearch 7500 or 8800. Triester, phosphoramidite, or hydrogen phosphonate coupling chemistries, Oligonucleotides Antisense Inhibi tors, supra, pp. 7-24, are used in with these synthesizers to provide the desired oligonucleotides or oligonucleotide analogs.
- the Beaucage reagent J. Am. Chem. Society, 1990, 112, 1253-1255 or elemental sulfur, Beaucage et al . ,
- oligonucleotide compositions comprise a targeting portion specifically hybridizable with a preselected nucleotide sequence of RNA, some of the phosphodiester bonds may be substituted with a structure that functions to enhance the compositions' ability to penetrate into cells' intracellular region where the RNA, whose activity is to be modulated, is located.
- Standard backbone modifications include, but are not limited to, phosphorothioates, methyl phosphonates, phosphoramidites, and phosphorotriesters.
- Backbone modifications may be used without departing from the spirit of the invention. It is not necessary, however, that the compounds of the invention have modified phosphate backbones. Modifications that may provide oligonucleotides or oligonucleotide analogs that are substantially less ionic than native forms and facilitate penetration of modified or unmodified oligonucleotides into the intracellular spaces are also contemplated by this invention. Any of the existing or yet to be discovered methods for accomplishing this goal may be employed in accordance with the practice of the present invention. As will be appreciated by those skilled in the art, modifications of the phosphate bond find utility in this regard. Variations in the phosphate backbone useful in the preparation of the subject compositions may be made without deviating from the spirit of the invention. Modifications at the phosphorous atom are set forth in an United States Patent Application No. 5,138,048, entitled "Polyamine Oligonucleotides to Enhance Cellular Uptake,” and assigned to a common assignee hereof.
- RNA cleaving moieties are generally to be employed.
- artisans in the field will have great latitude in selecting means for attaching the RNA cleaving moieties, the pharmacodynamic improving groups, or the pharmacokinetic improving groups in accordance with this invention.
- Examples 1-45 are depicted in synthetic Scheme 1, which immeadiately follows Example 45.
- Examples 46-53 are depicted in synthetic Scheme 2, which immeadiately follows Example 53.
- Examples 54-56 are depicted in synthetic Scheme 3, which immeadiately follows Example 56.
- the numbers in parantheses following the Example s title compound correspond to the compound numbers on the respective schemes.
- reaction mixture was evaporated to dryness and the residue dissolved in a mixture of CH 2 Cl 2 /H 2 O (250:100mL) and extracted in dichloromethane (2 ⁇ 250mL). The organic extract was washed with brine (100mL), dried, and evaporated to dryness. The residue was dissolved in
- di.-hloromethane 300mL
- silica gel 60-100 mesh, 250g
- the dry silica gel was placed on top of a silica gel column (250-400 mesh, 12 ⁇ 60cm) packed in hexane.
- the column was eluted with hexanes (1000mL), toluene (2000mL), and toluene:ethyl acetate (9:1, 3000mL).
- the fractions having the required product were pooled together and evaporated to give 52g (72%) of 3 as white solid.
- a small amount of solid was crystallized from ethanol for analytical purposes.
- the substrate 7 (5.94g, 10mmol), was dissolved in dry pyridine (75mL) and evaporated to dryness. This was repeated three times to remove traces of moisture. To this well dried solution of the substrate in dry pyridine (100mL) was added dry triethylamine (4.04g, 40mmol), 4- (dimethylamino)pyridine (1.2g, 30mmol) at room temperature. The reaction mixture was stirred at room temperature for 12 hours under argon atmosphere. Methanol (50mL) was added and the stirring was continued for 15 minutes and evaporated to dryness. The residue was purified by flash chromatography over silica gel using dichloromethane-acetone containing 1% triethylamine as the eluent.
- the substrate of 8 (2.5g, 2.7mmol), was dissolved in dry pyridine (30mL) and evaporated to dryness. This was repeated three times to remove last traces of water and dried over solid sodium hydroxide overnight.
- the dried 8. was dissolved in dry dichloromethane (30mL) and cooled to 0°C under argon atmosphere. To this cold stirred solution was added N,N-diisopropylethylamine (0.72g, 5.6mmol) followed by ( ⁇ -cyanoethoxy) chloro (N,N-diisopropylamino) phosphate (1.32g, 5.6mmol) dropwise over a period of 15 minutes. The reaction mixture was stirred at 0°C for 1 hour and at room temperature for 2 hours. The reaction mixture was diluted with
- the crude product 11 (14.03g) was dissolved in dry DMF (100mL) dry pyridine (50mL), and evaporated to dryness. This was repeated three times to remove all the water.
- the dried substrate was dissolved in dry DMF (75mL) and allowed to stir at room temperature under argon atmosphere. To this stirred solution was added dry triethylamine (10. lg, 100mmol) and 1,3-dichloro-1,1, 3,3-tetraisopropyldisiloxane (TipSiCl, 15.75g, 50.00mmol) during a 15 minute period. After the addition of TipSiCl, the reaction mixture was allowed to stir at room temperature overnight. The reaction mixture was evaporated to dryness.
- the crude product 11 (9.2g, 24.59mmol) was coevaporated three times with dry DMF/pyridine (100:50mL). The above dried residue was dissolved in dry DMF (100mL) and dry pyridine (100mL) and cooled to 0°C. To this cold stirred solution was added triethylamine (20.2g, 200mmol) followed by isobutyryl chloride (15.9g, 150mmol). After the addition of IbCl, the reaction mixture was allowed to stir at room temperature for 12 hours. The reaction mixture was
- the substrate 16 (4.2g, 5.6mmol) was coevaporated with dry pyridine (50 mL) three times. The resulting residue was dissolved in dry dichloromethane (50mL) and cooled to 0°C in a ice bath. To this cold stirred solution was added N,N-diisopropylethylamine (1.44 g, 11.2 mmol) followed by ⁇ -cyanoethoxy)chloro (N,N-diisopropylamino)phosphane (1.32g, 5.6mmol) over a period of 15 minutes. After the addition, the reaction mixture was stirred at 0°C for 1 hour and room temperature for 2 hours. The reaction was diluted with dichloromethane (150mL) and washed with 5% NaHC0 3 solution (25mL) and brine (25mL). The organic extract was dried over MgSO 4 and the solvent was removed under reduced pressure.
- Anal. Calcd for C 31 H 49 N 5 O 7 C, 61.67; H, 8.18; N, 11.60. Found: C, 61.59; H, 8.23; N, 11.34.
- Method 1 The substrate of 25, (5.00g, 6.6mmol) was dissolved in methanol (100mL) and treated with concentrated NH 4 OH (100mL). The reaction mixture was stirred for 4 hours at room temperature and evaporated to dryness. The residue was purified by flash chromatography over silica gel using CH 2 Cl 2 /MeOH (95:5) as eluent. The required fractions were collected together and evaporated to dryness and the residue on crystallization from CH 2 Cl 2 /acetone gave a colorless crystalline solid, yield 2g (66%) : mp 113-115°C.
- Method 2 A stirred solution of 22 (4.29g, 4.99mmol) in dry tetrahydrofuran (60mL) was treated with 1M solution of tetrabutylammonium fluoride (20mL, 20.00mmol). The reaction mixture was stirred at room temperature for 4 hours and evaporated to dryness.
- Compound 31 was prepared from compound 10 by following the procedure used for the preparation of 12.
- the compound was prepared from 33 by following the procedure used for the preparation of 8. Starting materials used: 33 (2.5g. 6.43mmol), 4,4'-dimethoxytrityl chloride (2.37g, 7.0mmol), dry TEA (0.71g, 7.0mmol) and dry pyridine (100mL). The crude product was purified by flash chromatography using CH 2 Cl 2 /EtOAc (7:3) containing 1%
- the intermediate of 38 (0.25g, 0.51mmol) was stirred in methanolic/ammonia (saturated at 0°C) in a steel bomb at room temperature for 40 hours.
- the vessel was cooled to 0°C, opened carefully, and the solvent evaporated to dryness.
- the solid obtained was crystallized from methanol to give a white powder (0.95g, 63%): mp 234-238°C.
- the DMT derivative of 40 was dried well overnight at vacuum and dissolved in dry methylene chloride (25mL). The solution was cooled to 0°C under argon atmosphere. To this cold stirring solution N,N-diisopropylamine tetrazolide salt (0.24g, 1.41mmol) followed by phosphorylating reagent (1.71mL, 5.66mmol) were added. The mixture was stirred at room temperature for 12hours under argon. The solution was diluted with additional methylene chloride (100mL) and washed with saturated NaHCO 3 solution (50mL), water (50mL), and brine (50mL). The organic extract was dried and evaporated to dryness.
- the crude product was purified by flash column over silica gel using methylene chloride/ethyl acetate containing 1% triethylamine as eluent. The pure fractions were pooled and evaporated to give 2.5g (91%) of 41.
- Deoxyguanosine (26.10g, 96.77mmol) was coevaporated with dry pyridine/DMF (50mL each) three times. The residue was suspended in dry DMF (50mL) and dry pyridine (50mL) at room temperature. To this stirring mixture was added N,N-dimethylaminopyridine (1.18g, 9.67mmol) followed by acetic anhydride (109.6mL, 116mmol) slowly keeping the temperature below 35°C. After the addition of Ac 2 O, the reaction was placed at 80°C for 4 hours under argon. It was cooled to room temperature and neutralized with 1N NaCO 3 solution. The mixture was extracted in CH 2 Cl 2 (2 ⁇ 250mL).
- N 2 ,3',5'-Tri-O-acetyldeoxyguanosine 42 (1.18g, 3mmol) was suspended in dry dioxane (50mL) under argon atmosphere. To this stirred suspension was added dry benzyl alcohol (0.81g, 7.5mmol) followed by triphenyl phosphine (1.96g, 7.5mmol). After stirring for 15 minutes,
- diethylazodicarboxylate (1.30g, 7.5mmol) was added dropwise over a 15 minute period at room temperature. The reaction mixture was stirred under argon overnight at room temperature
- reaction mixture was poured onto a vigorously stirred ice cold alkaline solution (70g of K 2 CO 3 in 150mL of water). The gummy suspension was extracted with methylene chloride (2 ⁇ 200mL). The organic extract was washed with brine (100mL), dried and evaporated to dryness. The residue was purified by flash chromatography over silica gel using CH 2 Cl 2 MeOH as eluent. The pure fractions were combined and evaporated to give 4.0g (79%) of 44 as foam. A small quantity was crystallized from methanol as orange crystals, mp: 165-167°C.
- the title compound was prepared from 45 by following the procedure used for the preparation of 9.
- the ether extract was washed with 5% sodium hydroxide solution (4 ⁇ 100mL), dried over anhydrous sodium sulfate, and concentrated to dryness.
- the residue was purified by flash column using a chromatograpay over a silica dichloromethane ⁇ methanol gradient.
- BocNHCH 2 3.52 (s, 2H, ArCH 2 ), 3.72 (s, 2H, ArCH 2 ), 5.55 (br s, 1H, BocNH), 7.28 (m, 10H, ArH).
- the title compound was prepared from compound 50 by following a two step procedure used in Example 48.
- Materials used in the first step The substrate 50 (25g, 57.34mmoles); Ra/Ni (5g); sodium hydroxide in ethanol (200mL, 7g of sodium hydroxide was dissolved in 20mL of water and mixed with ethanol) and ethanol used to dissolve the substrate (100mL).
- the crude product was extracted in dichloromethane which on evaporation gave 22 g (87%) of an oily product; 1 H nmr
- BocNHCH 2 3.38 (s, 2H, CNCH 2 ), 3.48 (s, 2H, ArCH 2 ), 3.54 (s, 2H, ArCH 2 ), 3.60 (s, 2H, ArCH 2 ), 5.42 (br s, 1H, BocNH), 7.26 (m, 15H, ArH).
- the title compound was prepared from compound 52 by following a two step procedure used for the preparation of the Example 48 compound 49 .
- Materials used in the first step The substrate (compound 52, 7g, 12.30mmoles); Ra/Ni (2g); sodium hydroxide in ethanol (160mL, 3.5g of sodium hydroxide was dissolved in 10mL of water and mixed with ethanol) and ethanol used to dissolve the substrate (100 ml).
- the crude product was extracted in dichloromethane which on evaporation gave 5.6 g (79%) as oil; 1 H nmr
- Example 54 The compound of Example 54 (2.00g, 1.89mmoles) was coevaporated with dry pyridine (30mL) two times.
- the compound of Example 54 (2.00g, 1.89mmoles) was coevaporated with dry pyridine (30mL) two times.
- isobutyryl CH 3.08 (m, 1H, C 2 ,H), 3.36 (m, 2H, CH 2 ), 3.52 (m, 8H, 4 ArCH 2 ), 3.84 (m, 1H, C 4 ,H), 4.00 (m, 2H, C 5 ,CH 2 ), 4.72 (m, 1H, C 3 ,H), 5.50 (s, 2H, ArCH 2 ), 6.18 (m, 1H, C 1 ,H), 7.04 (m, 1H, N 2 H), 7.26 (m, 25H, ArH), 7.76 (s, 1H, C 8 H).
- Embodiments are incorporated into oligonucleotide sequences via automated DNA synthesis protocol.
- Standard protocol using an ABI 380B DNA synthesizer was modified by increasing the wait step after the pulse delivery of tetrazole to 900 seconds. Deprotection conditions are discussed in
- a 21-mer oligonucleotide [5'd-(GCCGAGGTCCATGTCGTACGC) was modified with one, three or seven N 2 -[3-(lH-imidazol-1-yl)propyl) dGs or one or three N 2 -[3-(lH-imidazol-1-yl)propyl]-2-NH 2 dAs and hybridized to complementary DNA or RNA. See
- the average enhancement of binding affinity of several different N 2 -imidazolpropyl dG and N 2 -imidazolpropyl-2-amino-dA modified oligonucleotides hybridized to DNA is 2.7 degrees Celsius/mod (3 different sequences, 16 incorporations) and 2.5 degrees Celsius/mod (3 different sequences, 12 incorporations), respectively.
- mismatches of an RNA or DNA complement shows that N 2 -modified dG is more specific to its complement cytidine than the
- N 2 -imidazolpropyl-2-NH 2 dA is as specific as dA against RNA or DNA.
- T 1/2 9 and 16h
- the capped N 2 -modified dG sequence was stabilized by 2.8 degrees Celsius/mod against DNA and 0.9 degrees Celsius against RNA, and the 2-NH 2 -dA sequence was stabilized by 2.6 degrees Celsius/mod against DNA and 1.5 degrees/Celsius against RNA.
- a 17-mer phosphorothioate containing a modified dG at the primary cleavage site of HeLa cell extract RNase H did not prevent cleavage by the enzyme.
- Monia, et al . , Biol . Chem. submitted 1992.
- Silica gel used for flash chromatography was ICN 60 (Costa Mesa, CA), 32-63 mesh. Materials not soluble in the solvent system used for flash chromatography (FC) were coevaporated onto E. Merck silica gel 100 (Darmstadt, Republic of Germany), 70-230 mesh, using a suitable solvent. The dry materials were then applied to the top of a FC column. TLC was performed on prescored E. Merck Kieselgel 60 F 254 plates. Compounds were visualized by illuminating TLC plates under UV light (254 nm) and/or by spraying with 10 methanolic H 2 SO 4 followed by heating. Evaporations were carried out at
- modified nucleosides that will reside in the terminal 3'-position of certain antisense oligonucleotides are protected as their 5'-DMT (the cytosine and adenine exocyclic amino groups are benzoylated and the guanine amino is isobutyrlated) and treated with trifluoroacetic
- pyrimidine nucleoside and one mL of pyridine/ dimethylaminopyridine (1:1) is syringed slowly (60 to 90 sec) through a one micromole column of CPG thymidine (Applied Biosystems, Inc.) that had previously been treated with acid according to standard conditions to afford the free 5'-hydroxyl group.
- CPG thymidine Applied Biosystems, Inc.
- Other nucleosides bound to CPG columns could be employed.
- the eluent is collected and syringed again through the column. This process is repeated three times.
- the CPG column with 10 mL of acetonitrile and then attached to an ABI 38OB nucleic acid synthesizer. Oligonucleotide synthesis is now initiated.
- heterocycle and/or sugar can be attached at the 3' end of an oligonucleotide sequence.
- Substituted 5'-DMT nucleoside 3'-phosphoroamidites prepared as described in tne above Examples are inserted into sequence specific oligonucleotide phosphorothioates as described by Sproat, supra, at 3373-3386 and Beaucage, et al . , J . Am. Chem. Soc'y, 1989, 112, 1253-1255.
Abstract
This invention presents novel purine-based compounds for inclusion into oligonucleotides. The compounds of the invention, when incorporated into oligonucleotides are especially useful as 'antisense' agents -- agents that are capable of specific hybridization with a nucleotide sequence of an RNA. Oligonucleotides are used for a variety of therapeutic and diagnostic purposes, such as treating diseases, regulating gene expression in experimental systems, assaying for RNA and for RNA products through the employment of antisense interactions with such RNA, diagnosing diseases, modulating the production of proteins, and cleaving RNA in site specific fashions. The compounds of the invention include novel heterocyclic bases, nucleosides, and nucleotides. When incorporated into oligonucleotides, the compounds of the invention can be useful for modulating the activity of RNA.
Description
N-2 SUBSTITUTED PURINES
RELATED APPLICATIONS
This application is a continuation-in-part of PCT International Patent Application No. PCT\US91\00243, filed January 11, 1991, which is a continuation-in-part of U.S. Patent Application Serial Number 463,358, filed January 11, 1990; U.S. Patent Application Serial Number 566,977, filed August 13, 1990; and U.S. Patent Application Serial Number 854,634, filed July 1, 1992. FIELD OF THE INVENTION
This invention relates to novel purine-based compounds that may be incorporated into oligonucleotides. Oligonucleotides are used for a variety of therapeutic and diagnostic purposes, such as treating diseases, regulating gene expression in experimental systems, assaying for RNA and for RNA products through the employment of antisense
interactions with such RNA, diagnosing diseases, modulating the production of proteins, and cleaving RNA in site specific fashions. The compounds of the invention include novel heterocyclic bases, nucleosides, and nucleotides. When incorporated into oligonucleotides, the compounds of the invention are useful for modulating the activity of RNA.
BACKGROUND OF THE INVENTION
It is well known that most of the bodily states in mammals including most disease states, are affected by proteins. Such proteins, either acting directly or through their enzymatic functions, contribute in major proportion to many diseases in animals and man. Classical therapeutics has generally focused on interactions with such proteins in efforts to moderate their disease causing or disease
potentiating functions. Recently, however, attempts have been made to moderate the actual production of such proteins by interactions with molecules that direct their synthesis, such as intracellular RNA. By interfering with the
production of proteins, it has been hoped to affect
therapeutic results with maximum effect and minimal side effects. It is the general object of such therapeutic approaches to interfere with or otherwise modulate gene expression leading to undesired protein formation.
One method for inhibiting specific gene expression is the use of oligonucleotides and oligonucleotide analogs as "antisense" agents. The oligonucleotides or oligonucleotide analogs complimentary to a specific, target, messenger RNA (mRNA) sequence are used. Antisense methodology is often directed to the complementary hybridization of relatively short oligonucleotides and oligonucleotide analogs to single-stranded mRNA or single-stranded DNA such that the normal, essential functions of these intracellular nucleic acids are disrupted. Hybridization is the sequence specific hydrogen bonding of oligonucleotides or oligonucleotide analogs to Watson-Crick base pairs of RNA or single-stranded DNA. Such base pairs are said to be complementary to one another. The oligonucleotides and oligonucleotide analogs are intended to inhibit the activity of the selected mRNA- - to interfere with translation reactions by which proteins coded by the mRNA are produced- - by any of a number of mechanisms . The inhibition of the formation of the specific proteins that are coded for by the mRNA sequences interfered with have been hoped to lead to therapeutic benefits. Cook, P.D. Anti -Cancer Drug Design
1991, 6,585; Cook, P.D. Medicinal Chemistry Strategies for Antisense Research, in Antisense Research & Applications, Crooke, et al., CRC Press, Inc.; Boca Raton, FL, 1993;
Uhlmann, et al., A. Chem. Rev. 1990, 90,543.
Oligonucleotides and oligonucleotide analogs are now accepted as therapeutic agents holding great promise for therapeutics and diagnostics methods. But applications of oligonucleotides and oligonucleotide analogs as antisence agents for therapeutic purposes, diagnostic purposes, and research reagents often require that the oligonucleotides or oligonucleotide analogs be synthesized in large quantities, be transported across cell membranes or taken up by cells, appropriately hybridize to targeted RNA or DNA, and sub-sequently terminate or disrupt nucleic acid function. These critical functions depend on the initial stability of oligonucleotides and oligonucleotide analogs toward nuclease degradation. A serious deficiency of unmodified
oligonucleotides for these purposes, particularly antisense therapeutics, is the enzymatic degradation of the
administered oligonucleotides by a variety of intracellular and extracellular ubiquitous nucleolytic enzymes,
hereinafter referred to as "nucleases."
Initially, only two mechanisms or terminating events have been thought to be operating in the antisense approach to therapeutics. These are the hybridization arrest mechanism and the cleavage of hybridized RNA by the cellular enzyme, ribonuclease H (RNase H). Cook, 1991, supra; Cook, 1993, supra; Uhlmann, supra; Walder, et al . , Proc. Natl .
Acad. Sci . , USA, 1988, 85, 5011; Dagle, et al., Antisense Research & Development, 1991, 1, 11. It is likely, however, that additional "natural" events may be involved in the disruption of targeted RNA. Many of these naturally
occurring events are discussed in Oligonucleotides : Antisense Inhibi tors of Gene Expression, CRC Press, Inc., Boca Raton, FL (Cohen ed., 1989).
Hybridization arrest denotes the terminating event in which the oligonucleotide inhibitor binds to the target
nucleic acid and thus prevents, by simple steric hindrance, the binding of essential proteins, most often ribosomes, to the nucleic acid. Methyl phosphonate oligonucleotides, Miller, et al . , Anti -Cancer Drug Design, 1987, 2, 117-128, and α-anomer oligonucleotides are two extensively studied antisense agents that are thought to disrupt nucleic acid function by hybridization arrest.
The second "natural" type of terminating event is the activation of RNase H by the heteroduplex formed between the DNA type oligonucleotides or oligonucleotide analogs and the targeted RNA with subsequent cleavage of target RNA by the enzyme. The oligonucleotides or oligonucleotide analogs, which must be of the deoxyribose type, hybridize with the targeted RNA and this duplex activates the RNase H enzyme to cleave the RNA strand, thus destroying the normal function of the RNA. Phosphorothioate modified oligonucleotides are the most prominent example of antisense agents that are thought to operate by this type of antisense terminating event.
Walder, supra and Stein, et al . , Nucleic Acids Research, 1988, 16, 3209-3221 describe the role that RNase H plays in the antisense approach.
A number of chemical modifications have been introduced into antisense agents ╌ oligonucleotides and oligonucleotide analogs ╌ to increase their therapeutic activity. Such modifications are designed to increase cell penetration of the antisense agents, to stabilize the
antisense agents from nucleases and other enzymes that degrade or interfere with their structure or activity in the body, to enhance the antisense agents' binding to targeted RNA, to provide a mode of disruption (terminating event) once the antisense agents are sequence-specifically bound to targeted RNA, and to improve the antisense agents'
pharmacokinetic and pharmacodynamic properties. It is unlikely that unmodified, "wild type," oligonucleotides will be useful therapeutic agents because they are rapidly
degraded by nucleases. A primary focus of antisense research has been to modify oligonucleotides to render them resistant
to such nucleases. These modifications are designed to enhance the uptake of antisense agents ╌ oligonucleotides and oligonucleotide analogs ╌ and thus provide effective therapeutic, research reagent, or diagnostic uses.
To increase the potency via the "natural" termination events, the most often used oligonucleotide modification is modification at the sugar-phosphate backbone, particularly on the phosphorus atom. Phosphorothioates, methyl phosphonates, phosphoramidites, and phosphorotriesters have been reported to have various levels of resistance to nucleases. Backbone modifications are disclosed as set forth in U.S. patent applications assigned to a common assignee hereof, entitled "Backbone Modified Oligonucleotide Analogs," Serial Number 703,619 and "Heteroatomic Oligonucleotide
Linkages," Serial Number 903,160, the disclosures of which are incorporated herein by reference to disclose more fully such modifications.
An example of phosphate modifications include methyl phosphonate oligonucleotides, where the phosphoryl oxygen of the phosphorodiester linking moiety is replaced with methylene groups or the nucleotide elements together are replaced, either in total or in part, by methyl groups.
Other types of modifications to the phosphorus atom of the phosphate backbone of oligonucleotides include
phosphorothioate oligonucleotides. The phosphorothioate modified oligodeoxynucleotides are capable of terminating RNA by activation of RNase H upon hybridization to RNA although hybridization arrest of RNA function may play some part in their activity. Phosphoramidites have been disclosed as set forth in U.S. patent application assigned to a common
assignee hereof, entitled "Improved Process for Preparation of 2'-O-Alkylguanosines and Related Compounds," Serial Number 918,362, the disclosures of which are incorporated herein by reference to disclose more fully such modifications.
However, all reported modifications of the sugar-phosphate backbone, with the exception of phosphorothioates and
phosphorodithioates, obliterate the RNase H terminating
event. Cook, 1991, supra ; Cook, 1993, supra; Uhlmann, supra . Heteroduplexes formed between RNA and oligodeoxynucleotides bearing 2'-sugar modifications, RNA mimics such as fluoro and alkoxys, do not support RNase H-mediated cleavage. These modified heteroduplexes assume an A form helical geometry as does RNA-RNA heteroduplexes which also do not support RNase H cleavage. Kawasaki, et al . , J. Med. Chem. , in press 1993; Lesnik, et al . , Biochemistry, submitted 1993; Inoue, et al ., Nucleic Acids Res . , 1987, 15, 6131.
Other modifications to "wild type" oligonucleotides made to enhance resistance to nucleases, activate the RNase terminating event, or enhance the RNA-oligonucleotide duplex's hybridization properties include functionalizing the nucleoside's naturally occurring sugar. Sugar modifications are disclosed as set forth in PCT
Application assigned to a common assignee hereof, entitled "Compositions and Methods for Detecting and Modulating RNA Activity and Gene Expression, " PCT Patent Application Number PCT\US91\00243, International Publication Number WO 91/10671, the disclosures of which are incorporated herein by reference to disclose more fully such modifications.
Other synthetic terminating events, as compared to hybridization arrest and RNase H cleavage, have been studied in an attempt to increase the potency of oligonucleotides and oligonucleotide analogs for use in antisense diagnostics and therapeutics. One area of research is based on the concept that antisense oligonucleotides with modified heterocyclic portions, rather than sugar-phosphate modifications, can be resistant to nucleolytic degradation, yet on hybridization to target RNA provide a heteroduplex that supports RNase H-mediated cleavage. Modifications in the heterocycle portion of oligonucleotides may not affect the heteroduplex helical geometry of sugar that is necessary for RNase H cleavage.
Another approach is directed to the development of sequence-specific chemical RNA cleavers. This concept requires attaching pendent groups with acid/base properties
to oligonucleotides. The pendent group is not involved with the specific Watson-Crick hybridization of the
oligonucleotides or oligonucleotide analogs with mRNA but is carried along by the oligonucleotide or oligonucleotide analog to serve as a reactive functionality. The pendent group is intended to interact with mRNA in some manner more effectively to inhibit translation of mRNA into protein.
Such pendent groups have also been attached to molecules targeted to either single or double stranded DNA. Such pendent groups include, intercalating agents, cross-linkers, alkylating agents, or coordination complexes containing a metal ion with associated ligands.
The sites of attachment of the pendent groups to oligonucleotides and oligonucleotide analogs play an important, yet imperfectly known, part in the effectiveness of oligonucleotides and oligonucleotide analogs for therapeutics and diagnostics.
The half life of the formed RNA-oligonucleotide or oligonucleotide analog duplex may be greatly affected by the positioning of the tethered functional group containing the reactive functionality. Inappropriate positioning of
reactive functional groups, such as placement on the Watson-Crick base pair sites, would likely preclude duplex
formation. Other attachment sites may potentially allow sequence-specific binding but may be of such low stability that the reactive functionality will not have sufficient time to initiate RNA disruption.
A stable RNA-oligonucleotide or oligonucleotide analog heteroduplex is believed to be important, because without a sufficient half life the reactive or non-reactive functionalities of this invention may not have enough time to initiate the cleavage or otherwise disrupt RNA function.
Improved complementation between modified oligonucleotides or oligonucleotides and targeted RNA will likely result in the most stable heteroduplexes.
Targeted RNA is inactivated by formation of covalent links between a modified oligonucleotide and the RNA
2'-hydroxyl group. A variety of structural studies such as X-ray diffraction, chemical reaction, and molecular modeling studies suggests that the 2'-hydroxyl group of RNA in a duplex or heteroduplex resides in the minor groove. The minor side or minor groove of the duplexes formed between such oligonucleotides or modified oligonucleotides and the targeted RNA has been found to be the greatly preferred site for functional group activity.
Prior approaches using cross-linking agents, alkylating agents, and radical generating species as pendent groups on oligonucleotides for antisense diagnostics and therapeutics have had several significant shortcomings.
Prior workers have described most pendent groups as being attached to a phosphorus atom which affords oligonucleotides and oligonucleotide analogs with inferior hybridization properties. A phosphorus atom attachment site can allow a reactive group access to both the major and minor grooves. However, internal phosphorus modification results in greatly reduced heteroduplex stability. Attachments at the 3' and/or 5' ends are limiting in that only one or two functional groups can be accommodated in the oligonucleotide
compositions.
Other approaches have included attaching reactive functionalities or pendent groups to the 5-position of thymine, and the 7-position of purines. Functionalities placed in the 5-position or 7-position of bases, pyrimidine and purine, respectively, will typically reside in the major groove of the duplex and will not be in proximity to the RNA 2'-hydroxyl substrate. The 2'-hydroxyl is a "trigger" point for RNA inactivation, and thus, any reactive functionalities should be in appropriate proximity to the receptive substrate located in the targeted RNA, especially the most sensitive point, the 2'-hydroxyl group.
Some workers have looked at substitutions at the N- 2 position of certain purines, such as hypoxanthine, guanine or adenine. See, e . g. , Harris et al . , J. Am. Chem. Soc'y, 1991, 113 , 4328-4329; Johnson et al . , J. Am. Chem. Soc 'y,
1992, 114 , 4923-4924; Lee et al . , Tetrahedron Letters, 1990, 31 , 6773-6776; Casale et al . . J. Am . Chem . Soc 'y, 1990, 112 , 5264-5271.
The functionalities' point of attachment to the base units, which in turn may be converted to modified oligonucleotides, might be considered important in the design of compositions for sequence-specific destruction or
modulation of targeted RNA. It is important that the
functionalities not interfere with Watson-Crick base pair hydrogen bonding rules, as this is the sequence-specific recognition/ binding factor essential for selection of the desired RNA to be disrupted. Further, the functionalities preferably should improve the oligonucleotides compositions' pharmacokinetic and/or pharmacodynamic properties, as well as the oligonucleotide compositions' transport properties across cellular membranes. It is also important that the pendent groups designed to support either enzymatic or chemical cleavage of RNA must be compatible with the requisite hybridization step. When hybridized to RNA, the pendent groups would be accessible, via the minor groove, to the 2'-hydroxyl and phosphorodiester linkages of the targeted RNA.
These aforementioned prior attempts have been relatively insensitive, that is the reactive pendent groups have not been effectively delivered to sites on mRNA
molecules for alkylation or cleavage in an effective
proportion. Moreover, even if the reactivity of such
materials were perfect, (i.e., if each reactive functionality were to actually react with a mRNA molecule), the effect would be no better than stoichiometric. That is, only one mRNA molecule would be inactivated for each oligonucleotide or oligonucleotide analog molecule. It is also likely that the non-specific interactions of oligonucleotide compositions with molecules other then the target RNA, for example with other molecules that may be alkylated or which may react with radical species, as well as self-destruction, not only diminishes the diagnostic or therapeutic effect of the
antisense treatment but also leads to undesired toxic
reactions in the cell or in vitro. This is especially acute with the radical species that are believed to be able to diffuse beyond the locus of the specific hybridization to cause undesired damage to non-target materials, other
cellular molecules, and cellular metabolites. This perceived lack of specificity and stoichiometric limit to the efficacy of such prior alkylating agents and radical generating-types of antisense oligonucleotide compositions is a significant drawback to their employment.
Accordingly, there remains a great need for antisense oligonucleotide compositions that are capable of improved specificity and effectiveness both in binding and modulating mRNA modulation or inactivating mRNA without imposing undesirable side effects. The present invention addresses these, as well as other, needs by presenting novel compounds, based on the purine ring system, that may be used as oligonucleotide intermediates. It has now been found that certain positions on the nucleosides of double stranded nucleic acids are exposed in the minor groove and may be substituted without affecting Watson-Crick base-pairing or duplex stability. Reactive or non-reactive functionalities placed in these positions can best initiate cleavage and destruction of targeted RNA or interfere with its activity. SUMMARY OF THE INVENTION
This invention presents novel compounds based on the purine ring system that have utility as intermediates for the synthesis of oligonucleotides and oligonucleotide
analogs. This invention presents novel, substituted purines comprising a tether portion and at least one reactive or non-reactive functionality. In particular, this invention provides nucleosides, nucleoside analogs, nucleotides, nucleotide analogs, heterocyclic bases, heterocyclic base analogs based on the purine ring system, and oligonucleotide compositions incorporating the same.
The heterocyclic compounds of the invention are adapted for placement of the reactive, RNA cleaving moiety or other reactive moiety into the minor groove site of the hybrid structure formed from the RNA and the compositions of the invention through careful selection of the attachment of the RNA cleaving moieties.
The 2 position of the purine ring has now been found to be a site for attachment of potential RNA cleaving moieties as well as other moieties that may enhance
pharmacokinetic properties of antisense without affecting
RNase H degradation of target RNA. In addition, a remarkable enhancement of heteroduplex binding affinity is observed when certain pendent groups are attached to the 2 position of the novel purine based compounds of the invention. These pendent groups protrude into the minor groove of a DNA-RNA heteroduplex and do not affect binding affinities.
In one aspect of the invention, the compounds have the formula:
X is NH2 or OH;
Y is RQ or NHRQ, wherein R is a hydrocarbyl group having from 2 to about 20 carbon atoms; and Q is at least one reactive or nonreactive functionality; and
Z is H, a nitrogen protecting group, or a sugar moiety.
The invention further provides compounds comprising a sugar and base moiety as discussed above, with the 3' position of the sugar moiety derivatized with a phosphate group. The sugar moiety of the nucleosidic units for
incorporation into oligonucleotides compositions may be ribose, deoxyribose, or a sugar analog. Preferably the sugar is ribose or deoxyribose. The groups linking the
heterocyclic bases or modified bases together may be the usual sugar phosphate nucleic acid backbone found in nature, but may also be modified as a phosphorothioate, methylphosphonate, or phosphate alkylated moiety to further enhance the modified oligonucleotides' properties. Other backbone modifications may also be employed such as the removal of 5'-methylene group, and the use of alkyl, or heteroatomic sugar.
In another aspect of this invention, mixed sequence oligonucleotides incorporating at least one of the compounds as set forth herein are presented.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
This invention presents novel heterocyclic compounds based on the purine ring system that may be used as intermediates for oligonucleotide compositions. This
invention provides nucleosides, nucleoside analogs,
nucleotides, nucleotide analogs, heterocyclic bases,
heterocyclic base analogs, and oligonucleotide compositions incorporating the same.
The novel compounds of the invention are based on the purine ring system, comprising a heterocyclic purine-base portion, at least one reactive or non-reactive functionality, and a tether portion for attaching the functionalities to the balance of the compound. The 2 position of the purine ring has been found to be a unique point of attachment for
reactive and non-reactive functionalities. Attachment at this position enhances the oligonucleotides and
oligonuceltides analogs' ability to modulate RNA activity without interfering with stability of an RNA-oligonucleotide heteroduplex, and also improves the oligonucleotides'
transport properties. The non-reactive functionalities' utility lies, in part, in their ability to improve the pharmacodynamic or pharmacokinetic properties of the
oligonucleotide compositions, whether or not these
functionalities may also play a role in initiating cleaving reactions. These attributes and others make these compounds useful intermediates for incorporation into oligonucleotide compositions .
The functional sites on the base units are important in the design of compositions for sequence-specific destruction or modulation of targeted RNA. The half-life of the formed duplex is believed to be greatly effected by the positioning of the tethered group that connects the reactive function-ality to the base unit. Innapropriate positioning of func-tional groups, such as placement on the Watson-Crick base pair sites, would preclude duplex formation. It is important that the tether functionality not interfere with Watson-Crick base pair hydrogen bonding rules as this is the seqαence-specific recognition/binding factor for selection of the desired RNA to be disrupted.
Attachment sites, other than the 2 position of the purine ring, may allow sequence-specific binding but may be of such low stability that the reactive functionality will not have sufficient time to initiate RNA disruption. It has now been found that certain positions on the nucleosides of double stranded nucleic acids are exposed in the minor groove and may be substituted without affecting Watson-Crick basepairing or duplex stability. Reactive or non-reactive functionalities placed in these positions in accordance with this invention can best initiate cleavage and destruction of targeted RNA or interfere with its activity. The sites of functionality in the heterocyclic compounds of the invention are novel ╌ the 2 position of the purine ring system ╌ and have been preferably designed such that the functionalities will preferably reside in or on the minor groove formed by the heteroduplex between modified oligonucleotides and targeted RNA.
The compounds of the invention may have at least one reactive functionality or other moiety appended thereto capable of interacting with, preferably cleaving, an RNA. These moieties are preferably adapted for placement of the reactive or other moiety into the minor groove site of the hybrid structure formed from the RNA and oligonucleotides and oligonucleotide analogs including the compositions of the invention.
It is not necessary to tether more than one, two, or a relatively small number of RNA cleaving functionalities to oligonucleotide compositions in accordance with this invention to provide the benefits of the invention. An RNA cleaving moiety will preferably be tethered to a relatively small proportion of the subunits, generally only one or two of the oligonucleotide compositions of the invention. In other embodiments of the invention, however, substantially all of the nucleotides in an oligonucleotide can be modified to include one or more functionalities such as RNA cleaving moieties.
The compounds of the invention may be used to prepare desired oligonucleotides and oligonucleotide analogs; these oligonucleotides and oligonucleotide analogs are also within the ambit of this invention.
Incorporation of the novel compounds of the invention into oligonucleotide compositions improves those compositions' pharmacokinetic and pharmacodynamic properties, the compositions' resistance to nucleases, facilitates antisense and non-antisense therapeutic uses, diagnostic uses, and research reagent uses, improves the compositions' binding capabilities without any concomitant interference with the Watson-Crick binding, and enhances the compositions' penetration into cells. Some of these enhanced properties are illustrated in Table 1 below.
In the context of this invention, a "nucleoside" is a nitrogenous heterocyclic base linked to a pentose sugar, either a ribose, deoxyribose, or derivatives or analogs thereof. The term "nucleotide" means a phosphoric acid ester
of a nucleoside comprising a nitrogenous heterocyclic base, a pentose sugar, and one or more phosphate or other backbone forming groups; it is the monomeric unit of an
oligonucleotide. The term "oligonucleotide" refers to a plurality of joined nucleotide units formed in a specific sequence from naturally occurring heterocyclic bases and pentofuranosyl equivalent groups joined through
phosphorodiester or other backbone forming groups.
Nucleotide units may include the common bases such as
guanine, adenine, cytosine, thymine, or derivatives thereof. The pentose sugar may be deoxyribose, ribose, or groups that substitute therefore. The terms "antisense agents" and
"oligonucleotide compositions" as used in the content of this invention encompass oligonucleotides and oligonucleotide analogs and are interchangeable. In the context of this invention, phosphate derivatives include phosphorothioates, methyl phosphonates, phosphoramidites, phosphorotriesters, and any other groups known to those skilled in the art.
"Modified base," "base analog," "modified nucleoside," "nucleotide analog," or "modified nucleotide," in the context of this invention refer to moieties that function similarly to their naturally occurring counterparts but have been functionalized to change their properties.
"Sugar moiety, " as used in the context of this invention, refers to naturally occurring sugars, such as ribose or deoxyribose, and sugars and non-sugar analogs that have been functionalized to change certain properties.
"Oligonucleotide analogs" or "modified
oligonucleotides," as used in connection with this invention, refer to compositions that function similarly to natural oligonucleotides but have non-naturally occurring portions. Oligonucleotide analogs or modified oligonucleotides may have altered sugar moieties, altered bases, both altered sugars and bases or altered inter-sugar linkages, for example phosphorothioates and other sulfur containing species which are known for use in the art.
In the context of the invention, "improved
pharmacodynamic property" means improved oligonucleotide uptake, enhanced oligonucleotide resistance to degradation, and/or strengthened sequence-specific hybridization with RNA. "Improved pharmacokinetic property" means improved
oligonucleotide uptake, distribution, metabolism, or
excretion.
The "hydrocarbyl" groups disclosed and claimed herein are the linkers or tethers that attach reactive or non-reactive functionalities to the purine based compounds of the invention. "Hydrocarbyl compounds," as used herein, means straight, branched, or cyclic carbon and hydrogen containing compounds. In the context of this invention, a straight chain compound means an open chain compound, such as an aliphatic compound, including alkyl, alkenyl, or alkynyl compounds. A branched compound, as used herein, comprises a straight chain compound, such as an alkyl, alkenyl, alkynyl, which has further straight chains attached to the carbon atoms of the straight chain. In the context of this
invention, the terms "lower alkyl," "lower alkenyl," or
"lower alkynl" means compounds, straight or branched, having between about 1 to about 10 carbon atoms. A "cyclic
compound," as used herein, refers to closed chain compounds╌ is, a ring of carbon atoms, such as a cyclic aliphatic or aromatic compound. The straight, branched, or cyclic
compounds may be internally interrupted. In the context of this invention, internally interrupted means that the carbon chains may be interrupted with heteroatoms such as O, N, or S. If desired, the carbon chain may have no heteroatoms present. The hydrocarbyl compounds noted above may be substituted or unsubstituted. In the context of this
invention, "substituted" or "unsubstituted," means that the hydrocarbyl compounds may have any one of a variety of substituents, in replacement, for example, of one or more hydrogen atoms in the compound, or may have no substituents. Suitable substituents will be readily apparent to one skilled in the art once armed with the present disclosure.
Pendent groups as used herein refers to both
reactive and non-reactive functionalities. "Reactive
functionality," as used herein, means a moiety that interacts with mRNA in some manner to more effectively inhibit
translation of the mRNA into protein. For example, such a moiety may act as an RNA cleaving agent. A "non-reactive functionality," as used herein, means a functional group that may not possess a reactive portion or may not initiate chemical reactions, but rather enhances the oligonucleotide compositions' pharmacodynamic and pharmacokinetic properties, whether or not it plays any role in RNA cleavage. When terminal end is used in reference to the reactive or non-reactive functionality, this term means the end not attached to the purine core.
In one preferred aspect of the invention, the compound has the following formula:
wherein G is C or N;
X is NH2 or OH;
Y is RQ or NHRQ, wherein said R is H or a
hydrocarbyl group having from 2 to about 20 carbon atoms; and Q comprises at least one reactive or non-reactive
functionality; and
Z is H, a nitrogen protecting group, or a sugar moiety.
In certain preferred embodiments, Q is a nitrogen-containing heterocycle. In other preferred embodiments, Q is a substituted or unsubstituted imidazole. In other more
preferred embodiments, Y is RQ and said Q is an imidazole. In still other preferred embodiments, Y is NHRQ and Q is an imidazole.
In certain other preferred embodiments, G is N; X is NH2; Y is NHRQ, said R is a lower alkane and Q is an imidazole. In a more preferred embodiment, R is an alkane having between about 2 to about 4 carbon atoms, preferably propyl .
In other preferred embodiments, G is N; X is OH; Y is NHRQ, said R is a lower alkane; and Q is an imidazole. In more preferred embodiments, R is an alkane having between about 2 to about 4 carbon atoms, preferably ethyl or
isobutyryl, more preferably propyl. In other preferred embodiments, R is isobutyryl and Q is a methyl-imidazole.
In still other preferred embodiments, G is N; X is
NH2; Y is NHRQ, said R is H and Q is an alkane having from about 5 up to about 20 carbon atoms, preferably between about 5 to about 10 carbon atoms.
In still other preferred embodiments, G is N; X is OH2; Y is NHRQ, said R is H and Q is an alkane having from about 5 up to about 20 carbon atoms, preferably between about 5 to about 10 carbon atoms.
In other certain preferred embodiments, Y is RQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamines, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazones (-N=NH), or hydrazides (-C(O)-NHNH2); and Z is ribose or deoxyribose, preferably deoxyribose.
In other preferred embodiments, Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamines, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazones (-N=NH), or hydrazides (-C(O)-NHNH2); and Z is ribose or deoxyribose.
In a more preferred embodiment, G is N; X is NH2; Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamines, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazones (-N=NH), or hydrazides (-C(O)-NHNH2), especially NH2.
In another preferred embodiment, G is N; X is OH; Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamines, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazones (-N=NH), or hydrazides (-C(O)-NHNH2), especially NH2. In a more preferred embodiment, G is N; X is OH; Y is NHRQ, said R is hexane and Q is NH2.
In certain other preferred embodiments, Y is NHRQ, and the reactive functionality, Q, is a thiol group,
aldehyde, ketone, alcohol, or an alkoxy group. In other preferred embodiments, Y is RQ and the reactive functionality Q is a thiol group, aldehyde, ketone, alcohol, or an alkoxy group.
The hydrocarbyl groups (R) may serve as tethers or lxnkers for attaching reactive or non-reactive functionalities to the purine ring system of the compounds of the invention. The hydrocarbyl groups, R, suitable for
practicing this invention may be alkyl, alkenyl, aryl, or cyclic groups. Alkyl groups of the invention include, but are not limited to, straight and branched chained alkyls such as methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, isopropyl, 2-butyl, isobutyl, 2-methylbutyl, isopentyl, 2-methyl-pentyl,
3-methylpentyl, 2-ethylhexyl, 2-propylpentyl. While propyl groups have been found to be highly useful R groups, other alkyl groups, including methyl, ethyl, butyl, and others up to about octyl, can find utility; preferred are C2 to C4 alkyl with propyl being most preferred. Ethylene, propylene, and other glycols and polyamines are also useful.
Alkenyl groups useful in the invention include, but are not limited to, unsaturated moieties derived from the above alkyl groups including but not limited to vinyl, allyl, crotyl, propargyl.
Useful aryl groups include, but are not limited to, phenyl, tolyl, benzyl, naphthyl, anthracyl, phenanthryl, and xylyl.
Any of the hydrocarbyl groups, that is, the straight, branched, or cyclic alkyl, alkenyl, or alkynyl groups pointed out above may be internally interrupted with heteroatoms, such as O, N, or S; however, this is not
required. For example, polyoxyhydrocarbyl or polyaminohydrocarbyl compounds are fully contemplated within the ambit of the invention. Some further examples include those where R may comprise a polyhydric alcohol, such as -CH2-(CHOH)n-CH2OH, wherein n=1 to 5. Alternatively, by way of example, R may comprise an ether, such as -CH2(CHOH)nCH2O(CH2)m, where n=l to 10 and m= 1 to 10.
The hydrocarbyl groups may be further substituted. Substituent groups for the above include, but are not limited to, other alkyl, haloalkyl, alkenyl, alkoxy, thioalkoxy, haloalkoxy and aryl groups as well as halogen, hydroxyl, amino, azido, carboxy, cyano, nitro, mercapto, sulfides, sulfones, sulfoxides, and heterocycles. Other suitable substituent groups will be apparent to those skilled in the art and may be used without departing from the spirit of the invention.
Reactive functionalities suitable for use as Q in the practice of this invention include, but are not limited to, halogens; substituted or unsubstituted heterocyclic compounds, such as substituted or unsubstituted
heterocycloalkyls; amino containing groups, such as
heterocycloalkylaminos, polyalkylaminos, imidazoles,
imadiazole amides, alkylimidazoles; substituted or
unsubstituted aldehydes; substituted or unsubstituted
ketones; substituted or unsubstituted ethers; substituted or unsubstituted esters; substituted or unsubstituted aryl
compounds having from about 6 to about 20 carbon atoms, such as aralkylamino having from about 6 to about 20 carbon atoms, aminoaralkylamino having from about 6 to about 20 carbon atoms, alkyloxyaryl compounds, or allyloxyaryl compounds.
The amine functionalities can be primary amines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazones (-N=NH), or hydrazides (-C(O)-NHNH2), or similar nitrogenous species. Amines of this invention are also meant to include polyalkylamino compounds and aminoalkylamines such as aminopropylamines and further heterocycloalkylamines, such as imidazol-1, 2, or 4-yl-propylamine.
Polyamides, polyesters, and polyethylene glycols according to the invention have structures analogous to the above-described polyamines, except that an amide, ester or alcohol functionality is substituted for the nitrogenous species of the polyamine. Polyether groups have also
analogous structures, except that one or more ether oxygen atoms are interspersed in the carbon chains.
The following compounds for forming compounds with amine-functionalized linker or tether groups are commercially available from Aldrich Chemical Co., Inc., Milwaukee, WI : N- (2-bromoethyl)phthalimide, N-(3-bromopropyl)phthalimide and N-(4-bromobutyl)phthalimide. Other phthalimide-protected amine compounds can be conveniently synthesized from
appropriate alkyl, aralkyl or aryl halides and phthalimide. Representative compounds include N-(7-bromoheptyl)
phthalimide; N-(8-bromooctyl)phthalimide; N-(9-bromononyl)phthalimide; N-(10-bromododecyl)phthalimide; N-(11-bromoundecyl)phthalimide; N-(12-bromodocecyl)phthalimide; N-(13-bromotridecyl) phthal-imide; N-(14-bromotetradecyl)
phthalimide; N-(15-bromopentadecyl) phthalimide; N-(16-bromohexadecyl)-phthalimide; N-(17-bromoheptadecyl)
phthalimide; N-(18-bromooctadecyl) phthalimide; N-(19-bromononadecyl)phthalimide; N-(3-bromo-2-methylpropyl)phthalimide; N-(4-bromo-2-methyl-3-ethylbutyl) phthalimide; N-(3-bromo-2,2-diethylpropyl)phthalimide; N-(4-bromo-3-
propylbutyl)phthalimide; N-(10-bromo-2,8-dibutyl-decyl)phthalimide; N-(8-bromo-6,6-dimethyloctyl)phthalimide; N-(8-bromo-6-propyl-6-butyloctyl)phthalimide; N-(4-bromo-2-methylbutyl)phthalimide; N-(5-bromo-2-methylpentyl) phthalimide; N- (5-bromo-3-methylpentyl)phthalimide; N-(6-bromo-2-ethylhexyl)phthalimide; N-(5-bromo-3-penten-2-one) phthalimide; N- (4-bromo-3-methyl-2-butanol)phthalimide; N-(8-bromo-3-amino-4-chloro-2-cyano- octyl)phthalimide; N-(7-bromo-3-methoxy-4-heptanal)phthalimide; N-(4-bromo-2-iodo-3-nitrobutyl)
phthalimide; N-(12-bromo-4-isopropoxydodecyl) phthalimide; N- (10-bromo-4-azido-2-nitrodecyl)phthalimide; N-(9-bromo-5-mercaptononyDphthal- imide; N-(5-bromo-4-amino-pentenyl)phthalimide; N-(5-bromo-penten-2-yl)phthalimide; N-(3-bromoallyl)phthalimide; N-(4-bromocrotyl)phthalimide; N-(3-bromopropargyl)phthalimide; N-(1-bromonaphth-4-yl)
phthalimide; N-(2-bromoanthrac-7-yl)- phthalimide; and N-(2-bromophenanthr-6-yl)phthalimide. Such halide compounds are then reacted with an appropriate 2 amino or other 2-substituted purine.
Suitable heterocyclic groups include, but are not limited to, imidazole, tetrazole, triazole, pyrrolidine, piperidine, piperazine and morpholine. Amines include amines of all of the above alkyl, alkenyl and aryl groups including primary and secondary amines and "masked amines" such as phthalimide. Other reactive functionalities suitable for practicing the invention include, without limitation,
compounds having thiol (SH), aldehyde (C=O), or alcohol (OH) functionalities.
These reactive functionalities are capable of catalyzing, alkylating, or otherwise effecting the cleavage, destruction or disablement of RNA, especially of its
phosphorodiester bonds. The reactive functionalities may either be basic, acidic, or amphoteric. Heteroatomic species can be formulated to be either basic or acidic or, indeed, to be amphoteric for such purposes. Alkylating and free radical forming functionalities may also be used for these purposes.
Non-reactive functionalities for Q, include, but are not limited to, alkyl chains, polyamines, ethylene glycols, polyamides, aminoalkyl chains, amphipathic moieties, points for reporter group attachment, and intercalators attached to any of the preferred sites for attachment.
The reactive and non-reactive functionalities may be further substituted. Suitable substituents include, but are not limited to, other hydrocarbyl compounds,
halohydrocarbyl compounds, alkoxy, thioalkoxy, haloalkoxy, or aryl groups, as well as halogen, hydroxyl, amino, azido, carboxy, cyano, nitro, mercapto, sulfides, sulfones and sulfoxides. Any of the straight, branched, or cyclic
hydrocarbyl substituents may be further internally
interrupted with O, N, or S. Substituent groups can be present on the above-described alkyl, alkenyl, alkyne, polyamine, polyamide, polyester, polyethylene glycol,
polyether, aryl, aralkyl and heterocyclic space-spanning groups. Substituent groups include but are not limited to halogen, hydroxyl, keto, carboxy, nitrates, nitrites, nitro, nitroso, nitrile, trifluoromethyl, O-alkyl, S-alkyl, NH-alkyl, amino, azido, sulfoxide, sulfone, sulfide, silyl, intercalators, conjugates, polyamines, polyamides,
polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligonucleotides and groups that enhance the pharmacokinetic properties of
oligonucleotides. Typical intercalators and conjugates include cholesterols, phospholipids, biotin, phenanthroline, phenazine, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Halogens include fluorine, chlorine, bromine, and iodine. Other suitable substituent groups will be apparent to those skilled in the art and may be used without departing from the spirit of the invention.
The invention further provides compounds comprising a sugar combined with a base moiety as discussed above.
Suitable sugar moieties include, but are not limited to, ribose, deoxyribose, and sugar analogs.
In certain preferred embodiments, Z is ribose or deoxyribose. In a more preferred embodiment, Z is
deoxyribose. In another preferred embodiment, Z is a sugar analog, preferably similar to the deoxyribose type.
In other preferred embodiments, G is N; X is OH; Y is NHRQ, said R is a lower alkane; and Q is an imidazole; and Z is ribose or deoxyribose, preferably deoxyribose. In more preferred embodiments, R is an alkane having between about 2 to about 4 carbon atoms, preferably ethyl or isobutyryl, more preferably propyl; and Z is ribose or deoxyribose, preferably deoxyribose. In other preferred embodiments, R is isobutyryl and Q is a methyl-imidazole; and Z is ribose or deoxyribose, preferably deoxyribose.
In still other preferred embodiments, G is N; X is NH2; Y is NHRQ, said R is H and Q is an alkane having from about 5 up to about 20 carbon atoms, preferably between about 5 to about 10 carbon atoms; and Z is ribose or deoxyribose, preferably deoxyribose.
In other certain preferred embodiments, Y is RQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamines, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazones (-N=NH), or hydrazides (-C(O)-NH-NH2); and Z is ribose or deoxyribose, preferably deoxyribose.
In other preferred embodiments, Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamines, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazones (-N=NH), or hydrazides (-C(O)-NH-NH2); and Z is ribose or deoxyribose.
In a more preferred embodiment, G is N; X is NH2; Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamines, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2),
hydrazones (-N=NH), or hydrazides (-C(O)-NH-NH2), especially NH2; and Z is ribose or deoxyribose, preferably deoxyribose.
In another preferred embodiemtn, G is N; X is OH; Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylaminos, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazones (-N=NH), or hydrazides, especially NH2; and Z is ribose or deoxyribose, preferably deoxyribose. In a more preferred embodiemtn, G is N; X is OH; Y is NHRQ, said R is hexane and Q is NH2; and Z is ribose or deoxyribose,
preferably deoxyribose.
In certain other preferred embodiments, Y is NHRQ, and the reactive functionality, Q, is a thiol group,
aldehyde, ketone, alcohol, or an alkoxy group; and Z is ribose or deoxyribose, preferably deoxyribose. In other preferred embodiments, Y is RQ and the reactive functionality Q is a thiol group, aldehyde, ketone, alcohol, or an alkoxy group; and Z is ribose or deoxyribose, preferably
deoxyribose.
Generally, sugar moieties may be attached to the novel purine based compounds of the invention using methods known in the art. See Revankar, supra .
Substituted sugars may be synthesized according to the methods disclosed in PCT Patent Application Number
PCT\US91\00243 assigned to a common assignee hereof, entitled "Compositions and Methods for Detecting and Modulating RNA Activity and Gene Expression," the disclosures of which are incorporated herein by reference to disclose more fully such modifications.
For example, a substiituted sugar as, methyl 3-O-(t-butyldiphenylsilyl)-2,5-dideoxy-5-C-formyl-α/ß-D-erythropentofuranoside, can be prepared by modifying 2-deoxy-D-ribose to methyl 2-deoxy-a/β-D-erythro-pentofuranoside
(prepared according to the method of Motawai et al . , Liebigs Ann . Chem. , 1990, 599-602), which on selective tosylation
followed by 3-O-silylation gave methyl 3-O-(t-butyldi¬methylsilyl)-2-deoxy-5-O-tosyl-α/ß-D-erythro-pentofuranoside.
As will be appreciated by persons of ordinary skill in the art, variations in the structures of the sugar
moieties useful in the preparation of the subject
compositions may be made without deviating from the spirit of the invention. Suitable substituents on the sugar moiety include, but are not limited to, OH, lower alkyl, substituted lower alkyl, aralkyl, heteroalkyl, heterocycloalkyl,
aminoalkylamino, heterocycloalkyl, polyalkylamino,
substituted silyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, SOMe, SO2Me, ONO2, NO2, N3, NH2, NH-alkyl, OCH2CH=CH2, OCH2CCH, OCCHO, or an RNA cleaving moiety. It is not
necessary that every sugar linking function be in a modified form because a substantial number and even a predominance of the linking groups may exist in the native, phosphorodiester form as long as the overall targeting portion of the
compositions of the invention exhibit an effective ability to penetrate into the intracellular spaces of cells of the organism in question or otherwise to contact the target RNA and to specifically bind therewith to form a hybrid capable of detecting and modulating RNA activity. Of course, fully unmodified, native phosphorodiester structure may also be used for those purposes.
In other preferred embodiments, Z will be a nitrogen protecting group. Generally, protecting groups are known per se as chemical functional groups that can be selectively appended to and removed from functionalities, such as amine groups. These groups are present in a chemical compound to render such functionality inert to chemical reaction conditions to which the compound is exposed. See, e . g. , Greene, et al . , Protective Groups in Organic Synthesis, (John Wiley & Sons, New York, 2d ed. 1991). Numerous amine protecting groups are known in the art, including, but not limited to, the allyloxycarbonyl (Alloc), benzyloxycarbonyl (CBz), chlorobenzyloxycarbonyl, t-butyloxycarbonyl (Boc), fluorenylmethoxycarbonyl (Fmoc), isonicotinyloxycarbonyl
(i-Noc) groups, (see, e . g. , Veber Hirschmann, et al . , J. Org. Chem. 1977, 42, 3286 and Atherton, et al . , (Academic Press, New York, Gross & Meinhofer, eds, 1983). For example, it is known that the Boc group can protect an amine group from base and from reducing conditions but that it can be removed with acid. Other nitrogen protecting groups will be apparent to those skilled in the art and may be used without detracting from the spirit of the invention. Any este protecting groups known to those skilled in the art may be used;
tetrahydropyranyl is an example of such a group. See Greene, supra .
The invention further provides compositions comprising a sugar and base moiety as discussed above, with the 3' position of the sugar moiety derivatized with a phosphate group. Generally, nucleotides of the invention may be prepared by protecting the 5' position of the sugar moiety of the imidazole ring and derivatizing the 3' position with an appropriate phosphoramidite or other phosphate suitable for use on a DNA synthesizer, including without limitation, alkyl phosphonates, phosphorothioates, or phosphorotriesters.
Generally, the compounds of the invention may be synthesized under the following reaction conditions. The following reaction describes attachment of the 3-(1H-imidazol-1-yl) propyl moiety to the 2-amino group of
deoxyguanosine and 2-aminodeoxyadenosine, and subsequent incorporation of these novel nucleosides into oligonucleotides. The numbers enclosed in the parentheses refer to the compounds on the reaction scheme depicted below in the Examples section.
2-Chloro-9-(2-deoxy-β-D-erythropentofuranosyl)inosine (3), a versatile, key intermediate, was obtained by heating 2,6-dichloro-9-(2-deoxy-b-D-erythro-pentofuranosyl) purine (1) , Kazimierczuk et al . , J. Am. Chem. Soc. 1984, 106, 6379, with sodium hydride (NaH) in allyl alcohol, followed by hydrogenation of the intermediate (2) with Pd/C at atmospheric pressure. For similar procedure see Kern et al . , Heterocyclic Chem. , 1980, 17, 461. Displacement
of the 2-chloro atom of (3) with 1-(3-aminopropyl)imidazole gave (4). The isobutyryl derivative of (4), Lesnik, supra, was subjected to the Mitsunobu reaction condition,
Himmelsbach et al . , Tetrahedron, 1984, 40, 59, in the
presence of 2-(p-nitrophenyl) ethanol to provide fully protected nucleoside (6). Selective removal of the isobutyryl groups in (6), followed by dimethoxy-tritylation, Schaller et al . , Am. Chem. Soc , 1963, 85, 3821 and phosphitylation, Karpyshev et al . , Russ . Chem. Rev. , 1988, 57, 886 afforded the deoxyguanosine amidite synthon (8) in 73% yield.
2-Chloro-deoxyadenosine (9) Christensen, et al., J. Med. Chem. 1972, 15, 735 was treated with 1-(3-aminopropyl)imidazole to provide N2-substituted 2-aminodeoxyadenosine (10) which was protected by sequential treatment with
TipSiCl, Markiewicz, et al . , Nucleic. Acid Res . , Symp. Ser. 1980, 7, 115 and isobutyrylchloride ( IbCl ) to afford (12 ) . Removal of the TipSi protecting group of (12) with Bu4NF, Huss et al., Org. Chem. Soc , 1988, 53 , 499 and subsequent dimethoxytritylation and phosphitylation provided the
deoxyadenosine amidite synthon (14).
1. 2,6-Dichloro-9-(2'-deoxy-β-D-erythro-pentofuranosyl) purine.
2. R1 and R2 = H; X= Allyloxy; Y = Cl.
3. R1 and R2 = H; X= OH; Y = Cl.
4. R1 and R2 = H; X= OH; Y = NH(CH2)3Im.
5. R1 and R2 = Ib; X= OH; Y = IbN(CH2)3Im.
6. R1 and R2 = Isobutyryl; X= ONPE; Y = IbN(CH2)3Im.
7. R1 and R2 = H; X= ONPE; Y = IbN(CH2)3Im.
8. Deoxyguanosine amidite synthon.
9. 2-Chloro-deoxyadenosine.
10. R1 and R2 = H; X= NH2; Y = NH(CH2)3-Im.
11. R1 and R2 = TipSi; X= NH2; Y = NH(CH2)3-Im.
12. R1 and R2 = H; X= NHIb; Y = NH(CH2)3-Im.
13. R1 and R2 = OH; X= NHIb; Y = NH(CH2)3-Im.
Ib = Isobutyryl
Im = Imidazole
NPE = (Nitrophenyl)ethanol
Reaction Conditions:
(a) NaH/Allyl alcohol; (b) Pd/C/H/EtOH; (c) 1-(3-Aminopropyl)imidazole/2-ethoxyethanol (90°C); (d) IbCl/TEA/PY; (e) 2-(p-nitrophenyl)ethanol/Ph3P/DEAD/Dioxane; (f) NH4OH/CH3OH; (g) DMTCl/TEA/PY; (h) 2-Cyanoethyl N,N-diisopropylchlorophosphoramidite/N,N-diisopropylethylamine/CH2Cl2; (i) 1-(3-Aminopropyl)imidazole/2-Methoxyethanol (125°C); (j) TipSiCl/ TEA/PY; and (k) Bu4NF/THF.
In another aspect of the invention, oligonucleotides or oligonucleotide analogs incorporating the novel compounds of the invention are provided. Generally, the oligonucleotides or oligonucleotide analogs may comprise a sugar modified or native oligonucleotide containing a target sequence that is specifically hybridizable with a preselected nucleotide sequence, a sequence of DNA or RNA that is
involved in the production of proteins whose synthesis is ultimately to be modulated or inhibited in its entirety.
In certain preferred embodiments, the
oligonucleotides of the invention comprise:
a first oligonucleotide region and a second
nucleotide region;
together said first and said second region of a nucleotide sequence essentially complementary to at least a portion of said RNA;
said first region including at least one nucleotide having a base unit as defined above in connection with the heterocyclic compounds of the invention; and said second region including a plurality of consecutive phosphorothiocite linked nucleotides having a 2'-deoxy-erythro-pentofuranosyl sugar moiety. In certain preferred embodiments, the sugar moiety is ribose or deoxyribose and said phosphate is a methylphosphonate, phosphorothioate, phosphoramidite, phosphorotriester. In other preferred embodiments, the oligonucleotides of the invention further comprise a third region that includes at least one nucleotide having a base unit as defined above in connection with the heterocyclic compounds of the invention; wherein said second region is positioned in said oligonucleotide between said first and third regions.
Incorporation of amidites (i.e., 8. and 14. in the reaction scheme outlines depicted below in connection with the synthesis of the heterocycles of the invention) into oligonucleotide sequences can be accomplished via automated DNA synthesis protocol. (Standard protocol using an ABI 380B DNA synthesizer was modified by increasing the wait step after the pulse delivery of tetrazole to 900 seconds.
Deprotection conditions are discussed in Himmelsbach, et al . , Tetrahedron, 1984, 40, 59).
Generally, oligonucleotides or oligonucleotide analogs incorporating the novel compounds of the invention may be synthesized, conveniently through solid state
synthesis of known methodology, to be complementary to or at least to be specifically hybridizable with the preselected nucleotide sequence of the RNA or DNA. Nucleic acid
synthesizers are commercially available and their use is generally understood by persons of ordinary skill in the art
as being effective in generating nearly any oligonucleotide or oligonucleotide analog of reasonable length which may be desired.
The resulting novel oligonucleotides or
oligonucleotide analogs are synthesized by the standard solid phase, automated nucleic acid synthesizer such as the Applied Biosystems, Incorporated 380B or MilliGen/Biosearch 7500 or 8800. Triester, phosphoramidite, or hydrogen phosphonate coupling chemistries, Oligonucleotides Antisense Inhibi tors, supra, pp. 7-24, are used in with these synthesizers to provide the desired oligonucleotides or oligonucleotide analogs. The Beaucage reagent, J. Am. Chem. Society, 1990, 112, 1253-1255 or elemental sulfur, Beaucage et al . ,
Tetrahedron Letters, 1981, 22, 1859-1862, is used with phosphoramidite or hydrogen phosphonate chemistries to provide substituted phosphorothioate oligonucleotides. These oligonucleotide compositions comprise a targeting portion specifically hybridizable with a preselected nucleotide sequence of RNA, some of the phosphodiester bonds may be substituted with a structure that functions to enhance the compositions' ability to penetrate into cells' intracellular region where the RNA, whose activity is to be modulated, is located. Standard backbone modifications include, but are not limited to, phosphorothioates, methyl phosphonates, phosphoramidites, and phosphorotriesters. These
substitutions are thought in some cases to enhance the sugar modified oligonucleotides' properties. These phosphate bond modifications are disclosed as set forth in U.S. Patent
Applications assigned to a common assignee hereof, entitled "Backbone Modified Oligonucleotide Analogs," Serial Number 703,169 and "Heteroatomic Oligonucleotide Linkages," Serial Number 903,160, the disclosures of which are incorporated herein by reference to disclose more fully such
modifications. Backbone modifications may be used without departing from the spirit of the invention. It is not necessary, however, that the compounds of the invention have modified phosphate backbones.
Modifications that may provide oligonucleotides or oligonucleotide analogs that are substantially less ionic than native forms and facilitate penetration of modified or unmodified oligonucleotides into the intracellular spaces are also contemplated by this invention. Any of the existing or yet to be discovered methods for accomplishing this goal may be employed in accordance with the practice of the present invention. As will be appreciated by those skilled in the art, modifications of the phosphate bond find utility in this regard. Variations in the phosphate backbone useful in the preparation of the subject compositions may be made without deviating from the spirit of the invention. Modifications at the phosphorous atom are set forth in an United States Patent Application No. 5,138,048, entitled "Polyamine Oligonucleotides to Enhance Cellular Uptake," and assigned to a common assignee hereof.
Although the invention is primarily directed to substitutions at the N-2 position of a purine base or
heterocycle, other positions for attachment of reactive and non-reactive functionalities having a similar effect may be found, especially when further modifications of the purine structure are undertaken as may be done by persons of
ordinary skill in the art without deviating from the spirit of the present invention. Once again, it is to be understood that preferably one, or at most a few RNA cleaving moieties are generally to be employed. Thus, artisans in the field will have great latitude in selecting means for attaching the RNA cleaving moieties, the pharmacodynamic improving groups, or the pharmacokinetic improving groups in accordance with this invention.
The present invention is further described in the following examples. These examples are for illustrative purposes only, and are not to be construed as limiting the appended claims.
EXAMPLES
Examples 1-45 are depicted in synthetic Scheme 1, which immeadiately follows Example 45. Examples 46-53 are depicted in synthetic Scheme 2, which immeadiately follows Example 53. Examples 54-56 are depicted in synthetic Scheme 3, which immeadiately follows Example 56. The numbers in parantheses following the Example s title compound correspond to the compound numbers on the respective schemes.
EXAMPLE 1
2,6-Dichloro-9-(2-deoxy-3,5-di-O-p-toluoyl-β-D-erythro-pentofuranosyl)purine. (1)
To a stirred solution of 2, 6-dichloropurine (25.0g, 132.27mmol) in dry acetonitrile (1000mL) was added sodium hydride (60% in oil, 5.40g, 135mmol) in small portions over a period of 30 minutes under argon atmosphere. After the addition of NaH, the reaction mixture was allowed to stir at room temperature for 30 minutes. Predried and powdered 1-chloro-2'-deoxy-3,5,di-O-p-toluoyl-δ-D-erythro-pentofuranose (53.0g, 136mmol) was added during a 15 minute period and the stirring continued for 10 hours at room temperature over argon atmosphere. The reaction mixture was evaporated to dryness and the residue dissolved in a mixture of CH2Cl2/H2O (250:100mL) and extracted in dichloromethane (2 × 250mL). The organic extract was washed with brine (100mL), dried, and evaporated to dryness. The residue was dissolved in
di.-hloromethane (300mL), mixed with silica gel (60-100 mesh, 250g) and evaporated to dryness. The dry silica gel was placed on top of a silica gel column (250-400 mesh, 12 × 60cm) packed in hexane. The column was eluted with hexanes (1000mL), toluene (2000mL), and toluene:ethyl acetate (9:1, 3000mL). The fractions having the required product were pooled together and evaporated to give 52g (72%) of 3 as white solid. A small amount of solid was crystallized from ethanol for analytical purposes. mp 160-162°C; 1H NMR (DMSO-d6); δ 2.36 (s, 3 H, CH3), 2.38 (s, 3 H, CH3), 2.85 (m, 1 H, C2'H), 3.25 (m, 1 H, C2'H), 4.52 (m, 1 H, C4H), 4.62 (m, 2 H,
C5,CH2) , 5.80 (m, 1 H, C3'H) , 6.55 (t, 1 H, J1,,2, = 6.20 Hz, C1,H) , 7.22 (dd, 2 H, ArH) , 7.35 (dd, 2 H, ArH) , 7.72 (dd, 2 H, ArH) , 7.92 (dd, 2 H, ArH) , and 8.92 (s, 1 H, C8H) .
EXAMPLE 2
2-Chloro-6-allyloxy-9-(2'-deoxy-β-D-erythro-pentofuranosyl)purine. (2)
To a stirred suspension of 2,6-dichloro-9-(2'-deoxy-3',5'-di-O-p-toluoyl-β-D-erythro-pentofuranosyl) -purine (1, 10.3g, 19.04 mmol) in allyl alcohol (150mL) was added sodium hydride (60%, 0.8g, 20.00mmol) in small portions over a 10 minute period at room temperature. After the addition of NaH, the reaction mixture was placed in a preheated oil bath at 55°C. The reaction mixture was stirred at 55°C for 20 minutes with exclusion of moisture. The reaction mixture was cooled, filtered, and washed with allyl alcohol (50 mL). To the filtrate IRC-50 (weakly acidic) H+ resin was added until the pH of the solution reached 4-5. The resin was filtered, washed with methanol (100mL), and the filtrate was evaporated to dryness. The residue was absorbed on silica gel (10g, 60-100 mesh) and evaporated to dryness. The dried silica gel was placed on top of silica column (5×25 cm, 100-250 mesh) packed in dichloromethane. The column was then eluted with CH2Cl2/acetone (1:1). The fractions having the product were pooled together and evaporated to dryness to give 6g (96%) of the title compound as foam. 1H NMR (Me2SO-d6) δ 2.34 (m, 1 H, C2,H), 2.68 (m, 1 H, C2,H), 3.52 (m, 2 H, C5,H), 3.86 (m, 1 H, C4,H), 4.40 (m, 1 H, C3,H), 4.95 (t, 1 H, C5,OH), 5.08 (d, 2 H, CH2), 5.35 (m, 3 H, CH2 and C3,OH), 6.10 (m, 1 H, CH), 6.35 (t, 1 H, J1,,2. = 6.20 Hz, C1,H), 8.64 (s, 1 H, C8H). Anal. Calcd for C13H15ClN4O4 : C, 47.78; H, 4.63; N, 17.15; Cl, 10.86. Found: C, 47.58; H, 4.53; N, 17.21; Cl, 10.91.
EXAMPLE 3
2-Chloro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)inosine. (3)
A mixture of 2 (6g, 18.4mmol), Pd/C (10%, 1g) and triethylamine (1.92g, 19.00mmol) in ethyl alcohol (200mL) was hydrogenated at atmospheric pressure during 30 minute periods at room temperature. The reaction mixture was followed by the absorption of volume of hydrogen. The reaction mixture was filtered, washed with methanol (50mL), and the filtrate evaporated to dryness. The product 5.26g (100%) was found to be moisture sensitive and remained as a viscous oil. The oil was used as such for further reaction without purification. A small portion of the solid was dissolved in water and lyophilized to give an amorphous solid: 1H NMR (Me2SO-d6) δ 2.35 (m, 1 H, C2,H) , 2.52 (m, 1 H, C2,H), 3.54 (m, 2 H, C5,H), 3.82 (m, 1 H, C4,H), 4.35 (m, 1 H, C3,H), 4.92 (b s, 1 H, C5,OH), 5.35 (s, 1 H, C3,OH), 6.23 (t, 1 H, J1,,2, = 6.20 Hz, C1,H), 8.32 (s, 1 H, C8H) , 13.36 (b s, 1 H, NH).
EXAMPLE 4
N2-[Imidazol-1-yl(propyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (4)
A solution of the nucleoside of 3 (10.3g, 36.00mmol) and 1-(3-aminopropyl)imidazole (9.0g, 72.00mmol) in 2-methoxyethanol (60 mL) was heated in a. steel bomb at 100°C (oil bath) for 24 hours. The bomb was cooled to 0°C, opened carefully and the precipitated solid was filtered.
The solid was washed with methanol (50mL), acetone (50mL), and dried over sodium hydroxide to give 9g (67%) of pure 4. A small amount was recrystallized from DMF for analytical purposes: mp 245-47°C: 1H NMR (Me2SO-d6) δ 1.94 (m, 2 H, CH2), 2.20 (m, 1 H, C2,H), 2.54 (m, 1 H, C2,H), 3.22 (m, 2 H, CH2), 3.51 (m, 2 H, C5,H), 3.80 (m, 1 H, C4,H), 3.98 (m, 2 H, CH2), 4.34 (m, 1 H, C3,H), 4.90 (b s, 1 H, C5,OH), 5.51 (s, 1 H, C3,OH), 6.12 (t, 1 H, J1, , 2, = 6.20 Hz, C1,H), 6.46 (b s, 1 H, NH), 6.91 (s, 1 H, ImH), 7.18 (s, 1 H, ImH), 7.66 (s, 1 H, ImH), 7.91 (s, 1 H, C8H), 10.60 (b s, 1 H, NH). Anal. Calcd
for C16H21N7O4 : C, 51 . 19 ; H, 5 . 64 ; N, 26 . 12 . Found : C, 50 . 93 ; H, 5 . 47 ; N, 26 . 13 .
EXAMPLE 5
N2-3',5'-Tri-O-isobutyryl-N2-[imidazol-1-yl(propyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (5)
To a well dried solution of the substrate of 4
(1.5g, 4.00mmol) and triethylamine (1.62g, 16.00mmol) in dry pyridine (30mL) and dry DMF (30mL) was added isobutyryl chloride (1.69g, 16.00mmol) at room temperature. The reaction mixture was allowed to stir at room temperature for 12 hours and evaporated to dryness. The residue was
partitioned between dichloromethane (100mL) and water (50mL) and extracted with CH2Cl2 (2×200mL). The organic extract was washed with brine (100mL) and dried over anhydrous MgSO4. The dried organic extract was evaporated to dryness and the residue was purified over flash chromatography using
CH2Cl2/MeOH as eluent. The pure fractions were pooled, evaporated to dryness which on crystallization from
CH2Cl2/MeOH gave 1.8g (77%) of 5 as a colorless crystalline solid: mp 210-212°C; 1H NMR (Me2SO-d6) δ 1.04 (m, 18 H, 3
Isobutyryl CH3), 1.94 (m, 2 H, CH2), 2.56 (m, 4 H, C2'H and 3 Isobutyryl CH) 2.98 (m, 1 H, C2'H), 3.68 (m, 2 H, CH2), 3.98 (m, 2 H, CH2), 4.21 (2 m, 3 H, C5,H and C4,H), 5.39 (m, 1 H, C3,H), 6.30 (t, 1 H, J1,,2, = 6.20 Hz, C1,H), 6.84 (s, 1 H, ImH), 7.18 (s, 1 H, ImH), 7.34 (s, 1 H, ImH), 8.34 (s, 1 H, C8H), 10.60 (b s, 1 H, NH). Anal. Calcd for C2βH39N7O7 : C, 57.42; H, 6.71; N, 16.74. Found: C, 57.29; H, 6.58; N, 16.56.
EXAMPLE 6
6-0-[2-(4-Nitrophfenyl)ethyl]-N2-3',5'-tri-O-isobutyryl-N2- [imidazol-1-yl(propyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (6)
To a stirred solution of 5 (2.0g, 3.42mmol), triphenylphosphine (2.68g, 10.26mmol) and p-nitrophenyl ethanol (1.72g, 10.26mmol) in dry dioxane was added
diethylazodicarboxylate (1.78g, 10.26mmol) at room
temperature. The reaction mixture was stirred at room temperature for 12 hours and evaporated to dryness. The residue was purified by flash chromatography over silica gel using CH2Cl2/acetone as the eluent. The pure fractions were pooled together and evaporated to dryness to give 2.4g (96%) of the title compound as an amorphous solid. 1H NMR (Me2SO-d6) δ 1.04 (m, 18 H, 3 Isobutyryl CH3) , 1.94 (m, 2 H, CH2), 2.50 (m, 3 H, C2,H and 2 Isobutyryl CH), 3.00 (m, 1 H, C2,H) , 3.12 (m, 1 H, Isobutyryl CH), 3.24 (m, 2 H, CH2), 3.82 (m, 2 H, CH2), 3.98 (m, 2 H, CH2), 4.21 (2 m, 3 H, C5,CH2 and C4,H), 4.74 (m, 2 H, CH2), 5.39 (m, 1 H, C3,H), 6.34 (t, 1 H, J1,, 2, = 6.20 Hz, C1,H), 6.82 (s, 1 H, ImH), 7.08 (s, 1 H, ImH), 7.56 (s, 1 H, ImH), 7.62 (d, 2 H, ArH), 8.1 (d, 2 H, ArH), 8.52 (s, 1 H, C8H) . Anal. Calcd for C36H46N8O9-1/2 H20 O C, 58.13; H, 6.37; N, 15.01. Found: C, 58.33; H, 6.39; N, 14.75.
EXAMPLE 7
6-0-[2-(4-Nitrophenyl)-ethyl]-N2-isobutyryl-N2-[imidazol-1-yl-(propyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (7)
To a stirred solution of 6 (9.00g, 12.26 mmol) in methanol (250ml) was treated with ammonium hydroxide (30%, 150ml) at room temperature. The reaction mixture was stirred at room temperature for 4 hours and evaporated to dryness under reduced pressure. The residue was purified by flash chromatography over silica gel using CH2Cl2/MeOH as the eluent. The pure fractions were pooled together and
evaporated to dryness to give 5.92g (81%) of the title compound: 1H NMR (Me2SO-d6) δ 1.04 (m, 6H, Isobutyryl CH3), 1.96 (m, 2 H, CH2), 2.32 (m, 1 H, C2,H), 2.62 (m, 1 H, C2,H), 3.14 (m, 1 H, Isobutyryl CH), 3.26 (m, 2 H, CH2), 3.52 (m, 2 H, C5,CH2), 3.82 (m, 3 H, CH2 and C4,H), 3.96 (m, 2 H, CH2), 4.36 (m, 1 H, C3,H), 4.70 (m, 2 H, CH2), 4.96 (b s, 1 H,
C5.OH), 5.42 (b S, 1 H, C3,OH), 6.34 (t, 1 H, J1,, 2,= 6.20 Hz, C1,H) , 6.82 (s, 1 H, ImH), 7.12 (s, 1 H, ImH), 7.54 (s, 1 H, ImH), 7.62 (d, 2 H, ArH), 8.16 (d, 2 H, ArH), 8.56 (s, 1 H,
C8H) . Anal . Calcd for C28H34N8O7- 1/2 H2O : C , 55 . 71 ; H, 5 . 84 ; N, 18 . 56 . Found : C, 55 . 74 ; H, 5 . 67 ; N, 18 . 43 .
EXAMPLE 8
5'-0-(4.4'-Dimethoxytrityl)-6-0-[2-(4-nitrophenyl)ethyl]-N2-isobutyryl-N2-[imidazol-1-yl(propyl)]-2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (8)
The substrate 7 (5.94g, 10mmol), was dissolved in dry pyridine (75mL) and evaporated to dryness. This was repeated three times to remove traces of moisture. To this well dried solution of the substrate in dry pyridine (100mL) was added dry triethylamine (4.04g, 40mmol), 4- (dimethylamino)pyridine (1.2g, 30mmol) at room temperature. The reaction mixture was stirred at room temperature for 12 hours under argon atmosphere. Methanol (50mL) was added and the stirring was continued for 15 minutes and evaporated to dryness. The residue was purified by flash chromatography over silica gel using dichloromethane-acetone containing 1% triethylamine as the eluent. The pure fractions were pooled together and evaporated to dryness to give 7.2g (80%) of the title compound as a colorless foam: 1H NMR (Me2SO-d6) δ 1.04 (m, 6 H, Isobutyryl CH3), 1.94 (m, 2 H, CH2), 2.34 (m, 1 H, C2,H), 2.80 (m, 1 H, C2,H), 3.04 (m, 1 H, Isobutyryl CH), 3.18 (m, 2 H, CH2), 3.28 (m, 2 H, CH2), 3.62 (s, .3 H, OCH3), 3.66 (s, 3 H, OCH3), 3.74 (2 m, 2 H, C5,CH2), 3.98 (m, 3 H, CH2 and C4,H), 4.36 (m, 1 H, C3,H), 4.70 (m, 2 H, CH2), 5.44 (b s, 1 H, C3,OH), 6.32 (t, 1 H, J1,, 2, = 6.20 Hz C1,H), 6.64 - 7.32 (m, 15 H, ImH and ArH), 7.52 (s, 1 H, ImH), 7.62 (d, 2 H, ArH), 8.16 (d, 2 H, ArH), 8.42 (s, 1 H, C8H). Anal. Calcd for C49H52N8O9-H2O: C, 64.32; H, 5.95; N, 12.25. Found: C, 64.23; H, 5.82; N, 12.60.
EXAMPLE 9
3'-0-(N,N-Diisopropylamino) (β-cyanoethoxy)phosphanyl]-5'-0- (4,4'-dimethoxytrityl)-6-0-[2-(4-nitrophenyl)ethyl]-N2-isobutyryl-N2-[imidazol-1-yl(propyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (9)
The substrate of 8 (2.5g, 2.7mmol), was dissolved in dry pyridine (30mL) and evaporated to dryness. This was repeated three times to remove last traces of water and dried over solid sodium hydroxide overnight. The dried 8. was dissolved in dry dichloromethane (30mL) and cooled to 0°C under argon atmosphere. To this cold stirred solution was added N,N-diisopropylethylamine (0.72g, 5.6mmol) followed by (β-cyanoethoxy) chloro (N,N-diisopropylamino) phosphate (1.32g, 5.6mmol) dropwise over a period of 15 minutes. The reaction mixture was stirred at 0°C for 1 hour and at room temperature for 2 hours. The reaction mixture was diluted with
dichloromethane (100mL) and washed with brine (50mL). The organic extract was dried over anhydrous MgSO4 and the solvent was removed under reduced pressure. The residue was purified by flash chromatography over silica gel using hexane/acetone containing 1% triethylamine as the eluent. The main fractions were collected and evaporated to dryness. The residue was dissolved in dry dichloromethane (10mL) and added dropwise, into a stirred solution of hexane (1500mL), during 30 minutes. After the addition, the stirring was continued for an additional 1 hour at room temperature under argon. The precipitated solid was filtered, washed with hexane and dried over solid NaOH under vacuum overnight to give 2.0g (65%) of the title compound as a colorless powder: 1H NMR (Me2SO-d6) δ 1.04 (2 m, 18 H, 3 Isobutyryl CH3), 1.94 (m, 2 H, CH2), 2.44 (m 3 H, C2.H and 2 Isobutyryl CH), 2.80 (m, 1 H, C2,H), 3.2 (m, 5 H, 2 CH2 and Isobutyryl CH), 3.44 - 3.98 (m, 12 H, CH2, 2 OCH3 and C5,CH2), 4.16 (m, 1 H, C4H), 4.64 (m, 3 H, C3,H and CH2), 6.32 (t, 1 H, J1, ,2, = 6.20 Hz, C1,H) , 6.64 - 7.32 (m, 16 H, 3 ImH and ArH), 7.44 (d, 2 H, ArH), 8.16 (d, 3 H, ArH and C8H) .
EXAMPLE 10
N2-[Imidazol-1-yl(propyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)adenosine. (11)
A suspension of 2-chloro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)adenosine (10, 10.68g, 37.47mmol) and 1-(3aminopropyl) imidazole (12.5g, 100mmol) in 2-methoxyethanol (80mL) was heated at 125°C for 45 hours in a steel bomb. The bomb was cooled to 0°C, opened carefully, and evaporated to dryness. The residue was coevaporated several times with a mixture of ethanol and toluene. The residue was dissolved in ethanol which on cooling gave a precipitate. The precipitate was filtered and dried. The filtrate was evaporated to dryness and the residue carried over to the next reaction without further purification. 1H NMR (Me2SO-d6) δ 1.94 (m, 2 H, CH2), 2.18 (m, 1 H, C2,H), 2.36 (m, 1 H, C2,H), 3.18 (m, 2 H, CH2), 3.52 (2 m, 2 H, C5,CH2), 3.80 (m, 1 H, C4,H), 4.02 (m, 2 H, CH2), 4.36 (m, 1 H, C3,H), 5.24 (b s, 2 H, C3,OH and
C5,OH), 6.18 (t, 1 H, J1,,2, = 6.20 Hz, C1,H), 6.42 (t, 1 H, NH), 6.70 (b s, 2 H NH2), 6.96 (s, 1 H, ImH), 7.24 (s, 1 H, ImH) , 7 . 78 (s , 1 H, ImH) , 7 . 90 (s , 1 H, C8H) . Anal . Calcd for C16H22N8O3 : C, 51 . 33 ; H, 5 . 92 ; N, 29 . 93 . Found : C ,
51 . 30 ; H , 5 . 92 ; N, 29 . 91 .
EXAMPLE 11
3",5'-O-[(Tetraisopropyldisiloxane-1,3-diyl)-N2-(imidazol-1-yl)(propyl)]-9-(2"-deoxy-β-D-erythro-pentofuranosyl)
aminoadenosine. (12)
The crude product 11 (14.03g) was dissolved in dry DMF (100mL) dry pyridine (50mL), and evaporated to dryness. This was repeated three times to remove all the water. The dried substrate was dissolved in dry DMF (75mL) and allowed to stir at room temperature under argon atmosphere. To this stirred solution was added dry triethylamine (10. lg, 100mmol) and 1,3-dichloro-1,1, 3,3-tetraisopropyldisiloxane (TipSiCl, 15.75g, 50.00mmol) during a 15 minute period. After the addition of TipSiCl, the reaction mixture was allowed to stir at room temperature overnight. The reaction mixture was
evaporated to dryness. The residue was mixed with toluene (100mL) and evaporated again. The residue was purified by flash chromatography over silica gel using CH2Cl2/MeOH as eluent. The pure fractions were pooled and evaporated to dryness to give 12.5 g (54%) of 12 as an amorphous powder:
1H NMR (Me2SO-d6) δ 1.00 (m, 28 H), 1.92 (m, 2 H, CH2), 2.42 (m, 1 H, C2,H), 2.80 (m, 1 H, C2,H), 3.18 (m, 2 H, CH2) , 3.84 (2 m, 3 H, C5,CH2 and C4,H), 4.00 (t, 2 H, CH2), 4.72 (m, 1 H,
C3,H), 6.10 (m, 1 H, C1,H), 6.48 (t, 1 H, NH), 6.74 (b s, 2 H, NH2), 6.88 (S, 1 H, ImH), 7.18 (s, 1 H, ImH), 7.64 (s, 1 H,
ImH) , 7 . 82 ( s , 1 H, C8H) . Anal . Calcd for C28H50N8O4Si2 : C ,
54 . 33 ; H, 8 . 14 ; N, 18 . 11 . Found : C, 54 . 29 ; H, 8 . 09 ; N,
18 . 23 .
EXAMPLE 12
3",5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-N6-isobutyryl-N2-[(imidazol-1-yl)propyl]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)adenosine. (13)
A solution of 12 (12.0g, 19.42mmol) in pyridine (100mL) was allowed to stir at room temperature with
trieth} amine (10. lg, 100mmol) under argon atmosphere. To this stirred solution was added isobutyryl chloride (6.26g, 60mmol) dropwise during a 25 minute period. The reaction mixture was stirred under argon for 10 hours and evaporated to dryness. The residue was partitioned between
dichloromethane/water and extracted with dichloromethane (2 X 150mL). The organic extract was washed with brine (30mL) and dried over anhydrous MgSO4. The solvent was removed under reduced pressure and the residue was purified by flash chromatography over silica gel using CH2Cl2/acetone as the eluent to give the 12 as a foam: 1H NMR (Me2SO-d6) δ 1.00 (m, 34 H), 1.92 (m, 2 H, CH2), 2.42 (m, 1 H, C2,H) , 2.92 (m, 2 H, C2,H and Isobutyryl CH), 3.24 (m, 2 H, CH2), 3.86 (m, 3 H, C5,CH2 and C4,H), 4.40 (m, 2 H, CH2), 4.74 (m, 1 H, C3,H), 6.22 (m, 1 H, J1. , 2. = 6.20 Hz, C1,H), 6.82 (t, 1 H, NH), 6.92 (s, 1 H, ImH), 7.18 (s, 1 H, ImH), 7.60 (s, 1 H, ImH), 8.12 (s, 1 H, C8H), 10.04 (b s, 1 H, NH). Anal. Calcd for C32H54N8O5Si2 :
C, 55.94; H, 7.92; N, 16.31. Found: C, 55.89; H, 7.82; N, 16.23.
EXAMPLE 13
N6-3',5'-Tri-O-isobutyryl-N2-[imidazol-1-yl(propyl)]-9- (2'deoxy-β-D-erythro-pentofuranosyl)adenosine. (14)
The crude product 11 (9.2g, 24.59mmol) was coevaporated three times with dry DMF/pyridine (100:50mL). The above dried residue was dissolved in dry DMF (100mL) and dry pyridine (100mL) and cooled to 0°C. To this cold stirred solution was added triethylamine (20.2g, 200mmol) followed by isobutyryl chloride (15.9g, 150mmol). After the addition of IbCl, the reaction mixture was allowed to stir at room temperature for 12 hours. The reaction mixture was
evaporated to dryness. The residue was extracted with dichloromethane (2 × 200mL), washed with 5% NaHCO3 (50mL) solution, water (50mL), and brine (50mL). The organic extract was dried over dry MgSO4 and the solvent was removed under reduced pressure. The residue was purified by flash column using CH2Cl2/acetone (7:3) as the eluent. The pure fractions were collected together and evaporated to give 7.0g (44%) of 14 as a foam: 1H NMR (Me2SO-d6) δ 1.00 (m, 18 H, 3 Isobutyryl CH3), 1.98 (m, 2 H, CH2), 2.42 (m, 3 H, C2,H and 2 Isobutyryl CH), 2.92 (m, 2 H, C2,H and Isobutyryl CH), 3.24 (m, 2 H, CH2), 4.04 (m, 2 H, CH2), 4.22 (m, 3 H, C5,CH2 and C4,H), 5.42 (m, 1 H C3,H), 6.24 (t, 1 H, J1, , 2. = 6.20 Hz, C1,H), 7.04 (s, 1 H, ImH), 7.12 (t, 1 H, NH), 7.32 (s, 1 H, ImH), 8.00 (s, 1 H, ImH), 8.12 (s, 1 H, C8H), 10.14 (b s, 1 H, NH). Anal. Calcd for C28H40N8O6: C, 57.52; H, 6.89; N, 19.17.
Found: C, 57.49; H, 6.81: N, 19.09. EXAMPLE 14
N2-Isobutyryl-N2-[imidazol-1-yl(propyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)adenosine. (15)
Method 1: To a stirred solution of 13 (2.6g,
3.43mmol) in dry tetrahydrofuran (60mL) was added
tetrabutylammonium flouride (1M solution in THF, 17.15mL,
17.15mmol) at room temperature. The reaction mixture was stirred at room temperature for 1 hour and quenched with H+ resin. The resin was filtered, and washed with pyridine (20mL) and methanol (50mL). The filtrate was evaporated to dryness and the residue on purification over silica column using CH2Cl2/MeOH (95:5) gave the title compound in 59% (lg) yield: 1H NMR (Me2SO-d6) δ 1.04 (m, 6 H, Isobutyryl CH3), 1.98 (m, 2 H, CH2), 2.22 (m, 1 H, Isobutyryl CH), 2.70 (m, 1H, C2,H), 2.98 (m, 1H, C2,H), 3.22 (m, 2 H CH2), 3.52 (2 m, 2 H, C5,CH2), 3.82 (m, 1 H, C4. , 4.04 (m, 2 H, CH2), 4.38 (m, 1 H, C3,H), 4.92 (b s, 1 H, OH), 5.42 (b s, 1 H, OH) 6.22 (t, 1 H, J1,, 2, = 6.20 Hz, C1,H) , 6.92 (s, 1 H, ImH), 7.06 (t, 1 H, NH), 7.24 (s, 1 H, ImH), 7.74 (s, 1 H, ImH), 8.12 (s, 1 H, C8H), 10.08 (b s, 1 H, NH). Anal. Calcd for C20H28N8O4. H2O; C, 54.04; H, 6.35; N, 25.21. Found: C, 54.14; H, 6.53; N, 25.06.
Method 2: To an ice cold (0 to -5°C) solution of 14 (7.4g. 12.65mmol) in pyridine:EtOH:H2O (70:50:10mL) was added 1 N KOH solution (0°C, 25mL, 25mmol) at once. After 10 minutes of stirring, the reaction was quenched with H+ resin (pyridinium form) to pH 7. The resin was filtered, and washed with pyridine (25mL) and methanol (100mL). The filtrate was evaporated to dryness and the residue was purified by flash chromatography over silica gel using
CH2Cl2/MeOH (9:1) as eluent. The pure fractions were pooled together and evaporated to give 1.8g (37%) of 15.
EXAMPLE 15
5'-O-(4,4'-Dimethoxytrityl)-N6-isobutyryl-N2-[imidazol-1-yl(propyl)]-9-(2'deoxy-β-D-erythro-pentofuranosyl)adenosine. (16)
To a well dried (coevaporated three times with dry pyridine before use) solution of 15 (3.6g, 8.11mmol) in dry pyridine (100mL) was added triethylamine (1.01g, 10.00mmol) followed by 4,4'-dimethoxytrityl chloride (3.38g, 10.00mmol) at room temperature. The reaction mixture was stirred under argon for 10 hours and quenched with methanol (20mL). After
stirring for 10 minutes, the solvent was removed under reduced pressure. The residue was dissolved in
dichloromethane (250mL), washed with water (50mL), and brine (50mL), and dried over MgSO4. The dried organic extract was evaporated to dryness to an orange foam. The foam was purified by flash chromatography over silica gel using
CH2Cl2/MeOH (95:5) as eluent. The required fractions were collected together and evaporated to give 4.6 g (76%) of 16. as amorphous solid: 1H NMR (Me2SO-d6) δ 1.04 (m, 6 H,
Isobutyryl CH3), 1.90 (m, 2 H, CH2), 2.30 (m, 1 H, C2,H), 2.82 (m, 1 H, C2,H), 2.94 (m, 1 H, Isobutyryl CH), 3.14 (m, 4 H, CH2 and C5,CH2), 3.72 (m, 6 H, OCH3), 3.92 (m, 3 H, CH2 and C4,H), 4.44 (m, 1 H, C3,H), 5.44 (b s, 1 H, C5,OH), 6.28 (t, 1 H, J1, , 2, = 6.20 Hz, C1,H), 6.72 - 7.32 (m, 18 H, ImH, NH and ArH), 7.64 (s, 1 H ImH), 8.02 (s, 1 H, C8H), 10.10 (b s, 1 H, NH). Anal. Calcd for C41H46N8O6: C, 65.93; H, 6.21; N, 15.00. Found: C, 65.81; H, 6.26; N, 14.71.
EXAMPLE 16
3'-O-[(N,N-diisopropylamino)(β-cyanoethoxy)phosphanyl]-5"-O-(4,4'-dimethoxytrityl-N6-isobutyryl-N2-[imidazol-1-yl(propyl)]-9-(2'deoxy-β-D-erythro-pentofuranosyl) adenosine. (17)
The substrate 16 (4.2g, 5.6mmol) was coevaporated with dry pyridine (50 mL) three times. The resulting residue was dissolved in dry dichloromethane (50mL) and cooled to 0°C in a ice bath. To this cold stirred solution was added N,N-diisopropylethylamine (1.44 g, 11.2 mmol) followed by {β-cyanoethoxy)chloro (N,N-diisopropylamino)phosphane (1.32g, 5.6mmol) over a period of 15 minutes. After the addition, the reaction mixture was stirred at 0°C for 1 hour and room temperature for 2 hours. The reaction was diluted with dichloromethane (150mL) and washed with 5% NaHC03 solution (25mL) and brine (25mL). The organic extract was dried over MgSO4 and the solvent was removed under reduced pressure.
The residue was purified by flash chromatography over silica gel using CH2Cl2/MeOH (98:2) containing 1% triethylamine as
eluent. The pure fractions were collected together and evaporated to dryness to give 3.9g (73%) of 17.
EXAMPLE 17
N2-[Imidazol-4-yl(ethyl)]-9-(2 ' -deoxy-β-D-erythro-pentofuranosyl)guanosine. (18)
A mixture of 3 and histamine (4.4g, 40.00mmol) in 2-methoxyethanol (60mL) was heated at 110°C in a steel bomb for 12 hours. The steel bomb was cooled to 0°C, opened carefully, and the precipitated solid was filtered, washed with acetone and dried. The dried material was
recrystallized from DMF/H2O for analytical purposes. Yield 6g (79%): mp 220-22°C: 1H NMR (Me2SO-d6) δ 2.22 (m, 1 H, C2,H), 2.64 (m, 1 H, C2,H), 2.80 (m, 1 H, CH2), 3.52 (m, 4 H, CH2 and C5,CH2), 3.80 (m, 1 H, C4,H) , 4.42 (m, 1 H, C3,H), 4.98 (b s, 1 H, C5,OH), 5.44 (b S, 1 H, C3,OH), 6.16 (t, 1 H, J1,,2, = 6.20 Hz, C1,H), 6.44 (b s, 1 H, NH), 6.84 (s, 1 H, ImH), 7.56 (s, 1 H, ImH), 7.92 (s, 1 H, C8H), 10.60 (b s, 1 H, NH), 11.90 (b S, 1 H, NH). Anal. Calcd for C15H19N7O4 : C, 49.85; H, 5.30; N, 27.13. Found: C, 49.61; H, 5.21; N, 26.84. EXAMPLE 18
3',5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-N2-(imidazol-4-yl(ethyl)-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (19)
To a stirred suspension of 18 (2.4g, 6.65mmol) in dry DMF (50mL) and dry pyridine (20mL) was added
triethylamine (4.04g, 40.00mmol) followed by 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (4.18g, 13.3mmol) at room temperature. After the addition of TipSiCl, the reaction mixture was stirred overnight and evaporated to dryness. The residue was purified by flash chromatography over silica gel using CH2Cl2/MeOH (9:1) as eluent. The pure fractions were pooled together and evaporated to dryness to give 3.2g (80%) of 19. The pure product was crystallized from
acetone/dichloromethane as colorless solid, mp 245-247°C: 1H NMR (Me2SO-d6) δ 1.00 (m, 28 H), 2.46 (m, 1 H, C2,H), 2.72 (m,
1 H, C2,H), 2.84 (m, 1 H, CH2) , 3.54 (m, 2 H, CH2) , 3.90 (m, 3 H, C4,H and C5,CH2), 4.70 (m, 1 H, C3,H), 6.12 (t, 1 H, J1,,2, = 6.20 Hz, C1,H), 6.68 (b s, 1 H, NH) , 7.20 (s, 1 H, ImH) , 7.80 (s, 1 H, ImH) , 8.40 (s, 1 H, C8H) , 10.72 (b s, 1 H, NH) .
Anal. Calcd for C27H45N7O5Si2 : C, 53.70; H, 7.51; N, 16.24.
Found: C, 53.38; H, 7.63; N, 15.86.
EXAMPLE 19
3'5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-6-O-diphenyl¬carbamoyl-N2-[(N1-diphenylcarbamoyl)imidazol-4-yl(ethyl)]-9- (2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (20)
To a well stirred solution of the substrate 19
(6.03g, 10.00mmol) in dry DMF (50mL) and dry pyridine (50mL) was added N,N-diisopropylethylamine (5.16g, 40.00mmol) followed by diphenylcarbamoyl chloride (6.93g, 30.00mmol) at room temperature. The reaction mixture was allowed to stir at room temperature for 5 hours and evaporated to dryness. The residue was dissolved in CH2Cl2 (400mL), washed with water (100mL) and brine (50mL), dried over MgSO4, and
evaporated to dryness. The residue was purified by flash chromatography using hexane/acetone (8:2) to give the title compound in 78.5% (7.8g) yield: 1H NMR (Me2SO-d6) δ 1.04 (m,28 H), 2.54 (m, 1 H, C2,H), 2.65 (m, 1 H, C2,H), 2.72 (m, 2 H, CH2), 3.64 (m, 2 H, CH2), 3.86 (m, 1 H, C4,H), 4.00 (m, 2 H, C5,CH2), 4.74 (m, 1 H, C3,H), 5.30 (b s, 1 H, NH), 6.22 (m, 1 H, C1,H), 6.72 (s, 1 H, ImH), 7.12 - 7.50 (m, 20 H, ArH), 7.70 (s, 1 H, ImH), 7.86 (s, 1 H, C8H). Anal. Calcd for
C53H63N9O7Si2 : C, 64.02; H, 6.39; N, 12.68. Found: C, 64.13; H, 6.43; N, 12.79.
EXAMPLE 20
6-0-Diphenylcarbamoyl-N2-[(N1-diphenylcarbamoyl)imidazol-4-yl(ethyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (21)
To a stirred solution of the protected derivative of 20 (1.8g, 1.81mmol) in pyridine/THF (30:20mL) was added a 0.5M tetrabutyl-ammonium flouride [prepared in a mixture of
tetrahydrofuran-pyridine-water (8:1:1;v/v/v; 20mL)] at room temperature. The reaction mixture was stirred for 15 minutes and quenched with H+ resin (pydinium form) to pH 6-7. The resin was filtered off, and washed with pyridine (25mL) and methanol (30mL). The filtrate was evaporated to dryness and the residue was purified by flash chromatography using
CH2Cl2/MeOH (95:5) to give 1.2 g (88%) of 21 as a colorless amorphous solid: 1H NMR (Me2SO-d6) δ 2.32 (m, 1 H, C2,H), 2.72 (m, 2 H, CH2), 2.94 (m, 1 H, C2,H), 3.46 (m, 1 H, C4,H), 3.54 - 3.88 (m, 4 H, CH2 and C5,CH2), 4.00 (b s, 1 H, C3,H), 5.20 (b s, 2 H, OH), 5.42 (t, 1 H, NH), 6.10 (t, 1 H, J1, , 2, = 6.20 Hz C1,H), 6.80 (s, 1 H, ImH), 7.14 - 7.48 (m, 20 H, ArH), 7.64 (s, 1 H, ImH), 7.74 (s, 1 H, C8H) . Anal. Calcd for C41H37N9O6: C, 65.50; H, 4.96; N, 16.77. Found: C, 65.31; H, 5.10; N, 16.40.
EXAMPLE 21
5'-O-(4,4'-Dimethoxytrityl)-6-diphenylcarbamoyl-N2-[(N1-diphenylcarbamoyl)imidazol-4-yl(ethyl)]-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (22)
To a well dried solution of the substrate 21 (1.4g,
1.87mmol) in dry pyridine (70mL) was added triethylamine
(0.30g, 3.0mmol) followed by 4,4'-dimethoxytrityl chloride (0.85g, 2.5mmol) at room temperature. The stirring was
continued overnight under argon atmosphere. Methanol (10mL) was added, stirred for 10 minutes and evaporated to dryness. The residue was dissolved in CH2Cl2 (150mL), washed with
water (20mL) and brine (20mL), dried over MgSO4, and the solvent removed under reduced pressure. The crude product was purified by flash chromatography over silica gel using CH2Cl2/acetone (7:3) containing 1% triethylamine as eluent.
Yield 1.4 g (71%): 1H NMR (Me2SO-d6) δ 2.44 (m, 1 H, C2,H),
2.62 (m, 2 H, CH2), 2.98 (m, 1 H, C2,H), 3.26 (m, 4 H, CH2 and C5.CH2), 3.40 (m, 1 H, C4,H), 3.68 (2 s, 6 H, 2H OCH3), 4.00 (m, 1 H, C3,H), 5.34 (t, 1 H, NH), 5.44 (b s, 1 H, C3,OH),
6.12 (m, 1 H, C1,H), 6.66 - 7.48 (m, 34 H, ImH and ArH), 7.62 (s, 1 H, ImH), 7.78 (s, 1 H, C8H). Anal. Calcd for C62H55N9O84: :
C, 70.64; H, 5.26; N, 11.96. Found: C, 70.24; H, 5.39; N, 11.66.
EXAMPLE 22
3'-O-[(N,N-Diisopropylamino)(β-cyanoethoxy)phosphanyl]-5'-O- (4,4'-dimethoxytrityl)-6-0-diphenylcarbamoyl-N2-[(N1-diphenylcarbamoyl)imidazol-4-yl(ethyl)]-9-(2"-deoxy-β-D-erythro-pentofuranosyl)guanosine. (23)
Well dried 22 was dissolved in dry dichloromethane (30mL) and cooled to 0°C under argon atmosphere. To this cold stirred solution was added N,N-diisopropylethylamine (0.39g, 3.00mmol) followed by (β-cyanoethoxy) chloro (N,N-diisopropylamino)phosphane (0.71g, 3.0mmol) over a period of 10 minutes. The reaction mixture was allowed to stir at room temperature for 2 hours and diluted with CH2Cl2 (120mL). The organic layer was washed with 5% NaHCO3 (25mL), water (25mL), and brine (25mL). The extract was dried over anhydrous MgSO4 and evaporated to dryness. The residue was purified by flash using hexane/ethyl acetate (3:7) containing 1% triethylamine as eluent. The pure fractions were pooled together and concentrated to dryness to give l.Og (70%) of 23 as a foam: 1H NMR (Me2SO-d6) δ 1.12 (m, 12 H, 2 Isobutyryl CH3), 2.52 (m, 5 H, C2,H, CH2 and Isobutyryl CH), 2.62 (m, 2 H), 3.06 (m, 1 H, C2,H), 3.24 (m, 2 H, CH2) 3.40 (m, 2 H, CH2), 3.50 - 3.80 (m, 10 H, 2 OCH3, CH2 and C5,CH2), 4.08 (m, 1 H, C4,H), 4.82 (m, 1 H, C3,H), 5.74 (b s, 1 H, NH), 6.24 (m, 1 H, C1,H), 6.64 - 7.52 (m, 34 H, ImH and ArH), 7.62 (s, 1 H, ImH), 7.94 (s, 1 H, C8H).
EXAMPLE 23
N2-Nonyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (24)
A mixture of 2-chloro-2'-deoxyinosine and compound 3 (9.5g, 33.22mmol) and nonylamine (9.58g, 67.00mmol) in 2-methoxyethanol (60mL) was heated at 120°C for 12 hours in a steel bomb. The steel bomb was cooled to 0°C, opened
carefully and the solvent removed under reduced pressure.
The residue was coevaporated with a mixture of dry
pyridine/dry toluene (50mL each). The above process was repeated for three times and the resultant residue was carried over to the next reaction without further
purification. A small amount of material was precipitated from the solution which was filtered and dried: mp 164-167°C: 1H NMR (Me2SO-d6) δ 0.82 (t, 3 H, CH3), 1.24 (m, 12 H, 6 CH2), 1.48 (m, 2 H, CH2), 2.18 (m, 1 H, C2,H), 2.62 (m, 1 H, C2,H), 3.22 (m, 2 H, CH2), 3.50 (m, 2 H, C5,CH2), 3.78 (m, 1 H, C4,H), 4.32 (m, 1 H, C3.H), 4.84 (t, 1 H, C5.OH), 5.24 (m, 1 H, C3,OH), 6.12 (m, 1 H, C1,H) , 6.44 (b s, 1 H, NH), 7.86 (s, 1 H, C8H), 10.52 (b s, 1 H, NH). Anal. Calcd for C19H31N5O4.
H2O: C, 55.45; H, 8.08; N, 17.00. Found: C, 55.96; H, 7.87; N, 16.59. EXAMPLE 24
N2,3',5'-Tri-O-isobutyryl-N2-nonyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (25)
The crude product of 24. (18g, 32.91mmol) was coevaporated three times with a mixture of dry DMF/pyridine (50mL each). The residue was dissolved in dry pyridine
(150mL) and cooled to 0°C. To this cold stirred solution was added triethylamine (30.3g, 300mmol) followed by isobutyryl chloride (21.2g, 200mmol) over a 30 minute period. After the addition of IbCl, the reaction mixture was allowed to stir at room temperature for 10 hours and was then evaporated to dryness. The residue was partitioned between CH2Cl2/water (300:150mL) and extracted in CH2Cl2. The organic extract was washed with 5% NaHCO3 (50mL), water (50mL) and brine (50mL), dried over anhydrous MgSO4, and evaporated to dryness. The residue was purified by flash chromatography over silica gel using CH2Cl2/EtOAc (6:4) as eluent. The pure fractions were pooled and evaporated to give 10g (40%) of 25 as foam: 1H NMR (Me2SO-d6) δ 0.82 (t, 3 H, CH3), 1.12 (m, 30 H, 3
Isobutyryl CH3 and 6 CH2), 1.44 (m, 2 H, CH2), 2.54 (m, 4 H, C2,H and 3 Isobutyryl CH), 3.00 (m, 1 H, C2,H), 3.62 (m, 2 H, CH2), 4.20 (m, 3 H, C5,CH2 and C4,H), 5.32 (m, 1 H, C3,H), 6.24
(t, 1 H, J1, , 2, = 6.20 Hz, C1,H), 8.28 (s, 1 H, C8H), 12.82 (b s, 1 H, NH). Anal. Calcd for C31H49N5O7: C, 61.67; H, 8.18; N, 11.60. Found: C, 61.59; H, 8.23; N, 11.34.
EXAMPLE 25
3',5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-N2-nonyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (26)
To a well dried solution of the crude product of 24 (16.4g, 30.00mmol) in dry DMF (100mL) and dry pyridine
(100mL) was added triethylamine (10. lg, 100mmol) and 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (15.75g, 50mmol) during 30 min period. The reaction mixture was allowed to stir at room temperature overnight and was then evaporated to dryness. The crude product was dissolved in CH2Cl2 (300mL), washed with water (100mL), and brine (50mL). The extract was dried over MgSO4 and the solvent was removed under reduced pressure. The residue was purified over silica column using CH2Cl2/acetone (7:3) to give 14g (59%) of 26 as colorless foam. This on crystallization with the same solvent provided crystalline solid, mp 210-212°C: 1H NMR (Me2SO-d6) δ 0.82 (m, 3 H, CH3), 1.02 (m, 28 H), 1.24 (m, 12 H, 6 CH2), 1.50 (m, 2 H, CH2), 2.42 (m, 1 H, C2,H), 2.84 (m, 1 H, C2,H), 3.24 (m, 2 H, CH2), 3.82 (m, 2 H, C5,CH2), 3.92 (m, 1 H, C4,H), 4.72 (m, 1 H, C3,H), 6.12 (t, 1 H, J1,,2, = 6.20 Hz, C1,H), 6.36 (b s, 1 H, NH), 7.78 (s, 1 H, C8H), 10.38 (b s, 1 H, NH). Anal. Calcd for C31H57N5O5Si2: C, 58.54; H, 9.03; N, 11.01. Found: C, 58.64; H, 9.09; N, 10.89.
EXAMPLE 26
N2-Isobutyryl-3',5'-O-(tetraisopropyldisiloxane-1,3-diyl)-N2-nonyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (27)
To a solution of 26 (14.0g, 17.72mmol) in dry DMF
(50mL) and dry pyridine (150mL) was added triethylamine
(3.54g, 35.00mmol) and isobutyryl chloride (3.71g, 3.5mmol). The reaction mixture was stirred at room temperature
overnight and evaporated to dryness. The residue was
dissolved in CH2Cl2 (250mL), washed with 5% NaHCO3 (50mL),
water (50mL) and brine (50rnL), dried over MgSO4, and the solvent removed under reduced pressure. The residue was purified by flash chromatography over silica gel using
CH2Cl2/acetone (9:1) as eluent. The pure fractions were pooled together and evaporated to dryness to give 12.0g (77%) of the title compound as foam: 1H NMR (Me2SO-d6) δ 0.80 (m, 3 H, CH3), 0.98 (m, 34 H), 1.20 (m, 12 H, 6 CH2), 1.42 (m, 2 H, CH2), 2.52 (m, 2 H, C2,H and Isobutyryl CH), 2.82 (m, 1 H, C2,H), 3.62 (m, 2 H, CH2), 3.84 (m, 3 H, C5,CH2 and C4,H), 4.72 (m, 1 H, C3,H), 6.22 (t, 1 H, J1' , 2 ' = 6.20 Hz, C1,H), 8.18 (s, 1 H, C8H), 12.80 (b S, 1 H, NH).
EXAMPLE 27
N2-Isobutyryl-N2-nonyl-9-(2'-deoxy-β-D-erythropentofuranosyl)guanosine. (28)
Method 1: The substrate of 25, (5.00g, 6.6mmol) was dissolved in methanol (100mL) and treated with concentrated NH4OH (100mL). The reaction mixture was stirred for 4 hours at room temperature and evaporated to dryness. The residue was purified by flash chromatography over silica gel using CH2Cl2/MeOH (95:5) as eluent. The required fractions were collected together and evaporated to dryness and the residue on crystallization from CH2Cl2/acetone gave a colorless crystalline solid, yield 2g (66%) : mp 113-115°C.
Method 2: A stirred solution of 22 (4.29g, 4.99mmol) in dry tetrahydrofuran (60mL) was treated with 1M solution of tetrabutylammonium fluoride (20mL, 20.00mmol). The reaction mixture was stirred at room temperature for 4 hours and evaporated to dryness. The residue was purified by flash chromatography using CH2Cl2/MeOH (95:5) to give 1.59g (69%) of 28: 1H NMR (Me2SO-d6) δ 0.80 (m, 3 H, CH3), 0.98 (m, 6 H, Isobutyryl CH3), 1.16 (m, 12 H, 6 CH2) , 1.42 (m, 2 H, CH2) , 2.24 (m, 1 H, C2,H), 2.52 (m, 2 H, C2,H and Isobutyryl CH), 3.50 (m, 2 H, C5,CH2), 3.62 (m, 2 H, CH2) , 3.82 (m, 1 H, C4,H), 4.36 (m, 1 H, C3,H), 4.94 (t, 1 H, C5.OH), 5.34 (m, 1 H, C3,OH), 6.22 (t, 1 H, J1' ,2' = 6.20 Hz, C1,H), 8.28 (s, 1 , C8H), 12.78 (b s, 1 H, NH). Anal. Calcd for C23H37N5O5: C,
59.59; H, 8.05; N, 15.11. Found: C, 59.50; H, 8.08; N, 15.06.
EXAMPLE 28
5'-0-(4,4'-Dimethoxytrityl)-N2-isobutyryl-N2-nonyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (29)
To a stirred solution of 28 (2.00g, 4.32mmol) in dry pyridine (75mL) was added triethylamine (0.61g, 6.00mmol) and 4,4'-dimethoxytrityl chloride (2.03g, 6.00mmol) at room temperature. The reaction was stirred under argon atmosphere for 6 hours and quenched with methanol (10mL). The solvent was removed under reduced pressure and the residue dissolved in CH2Cl2 (150mL). The organic extract was washed with water (25mL) and brine (25mL), dried over MgSO4, and evaporated to dryness. The residue was purified by flash chromatography over silica gel using CH2Cl2/acetone (7:3) as eluent. The pure fractions were pooled together and evaporated to give 2g (60%) of 21 as foam: 1H NMR (Me2SO-d6) δ 0.80 (m, 3 H, CH3), 0.96 (m, 6 H, Isobutyryl CH3), 1.16 (m, 12 H, 6 CH2), 1.36 (m, 2 H, CH2), 2.32 (m, 1 H, C2,H), 2.60 (m, 1 H, Isobutyryl CH), 2.72 (m, 1 H, C2,H), 3.12 (m, 2 H, CH2), 3.52 (m, 2 H,
C5,CH2) , 3.70 (2 d, 6 H, 2 OCH3), 3.90 (m, 1 H, C4,H), 4.34 (m, 1 H, C3,H), 5.36 (m, 1 H, C3,OH) , 6.26 (t, 1 H, J1,,2, = 6.20 Hz, C1,H), 6.70 - 7.36 (m, 13 H, ArH) , 8.18 (s, 1 H, C8H) .
Anal. Calcd for C44H56N5O7: C, 68.90; H, 7.36; N, 9.31.
Found: C, 68.76; H, 7.47; N, 9.09.
EXAMPLE 29
3'-O-[(N,N-Diisopropylamino)(β-cyanoethoxy)phosphanyl]-5'-O-(4,4'-dimethoxytrityl)-N2-isobutyryl-N2-nonyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (30)
A well dried solution of 22 91.7g, 2.22mmol) in dry dichloromethane (30mL) was cooled to 0°C. To this cold solution was added N,N-diisopropyethylamine (0.57g, 4.4mmol) and (β-cyanoethoxy) chloro (N,N-diisopropylamino) phosphane (0.94g, 4.0mmol) under argon atmosphere. The reaction mixture was stirred at room temperature for 2 hours and
diluted with CH2Cl2 (170mL). The organic extract was washed with 5% NaHCO3 (25mL), water (25mL) and brine (25mL), dried over Na2SO4, and evaporated to dryness. The residue was purified on a silica column using CH2Cl2/acetone (9:1) containing 1% triethylamine as eluent. The pure fractions were pooled together and evaporated to dryness to give 1.5g (53%) of 30.
EXAMPLE 30
3',5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-2-chloro-9-(2'-deoxy-β-D-ezythro-pentofuranosyl)adenosine. (31)
Compound 31 was prepared from compound 10 by following the procedure used for the preparation of 12.
Starting materials used: 10 (4.30g, 15.09mmol), 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (4.74g, 15.1mmol), dry TEA (3.05g, 30.2mmol), and dry pyridine (100mL). The crude product was purified by flash chromatography using
CH2Cl2/acetone {7:3) as eluent to give 7.3g (92%) of 31. The pure product was crystallized from ethylacetate/hexane as a colorless solid, mp 183-185°C: 1H NMR (Me2SO-d6) δ 1.00 (m, 28 H), 2.54 (m, 1 H, C2,H), 2.82 (m, 1 H, C2,H), 3.76 (m, 1 H, C4,H), 3.86 (m, 2 H, C5,CH2), 5.08 (m, 1 H, C3,H), 6.22 (t, 1 H, J1,, 2, = 6.20 Hz, C1,H), 7.82 (b s, 2 H, NH2), 8.22 (s, 1 H, C8H. Anal. Calcd for C22H38ClN5O4Si2: C, 50.02; H, 7.25; N, 13.26, Cl, 6.72. Found: C, 50.24; H, 7.28; N, 13.07, Cl, 6.63.
EXAMPLE 31
3',5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-2-chloro-N6-benzoyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl) adenosine. (32)
A well dried solution of 31 (8g, 15.00mmol) in dry pyridine (150mL) was allowed to react with triethylamine (4.55g, 45.00mmol) and benzoyl chloride (6.3g, 45.00mmol) at room temperature for 12 hours under argon atmosphere. The reaction mixture was evaporated to dryness. The residue was partitioned between CH2Cl2/water and extracted in CH2Cl2 (2 ×
150mL). The organic extract was washed with brine (60mL), dried over MgSO4 and evaporated to dryness. The residue was purified and silica column using CH2Cl2/acetone as eluent and crystallization from the same solvent gave 8.2g (86%) of 32. mp 167-170°C: 1H NMR (Me2SO-d6) δ 1.00 (m, 28 H), 2.60 (m, 1 H, C2,H), 3.02 (m, 1 H, C2,H), 3.84 (m, 3 H, C5,CH2 and C4,H), 5.04 (m, 1 H, C3,H), 6.34 (d, 1 H, C1,H) , 7.42 -7.84 (m, 5 H, ArH), 8.70 (s, 1 H, C8H). Anal. Calcd for C29H42ClN5O5Si2 : C, 55.08; H, 6.69; N, 11.08, Cl, 5.61. Found: C, 55.21; H, 6.79; N, 11.19, Cl, 5.70.
EXAMPLE 32
N6-Benzoyl-2-chloro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)adenosine. (33)
To a stirred solution of 32 (7.9g, 12.5mmol) in dry THF (100mL) was added 1M solution of tetrabutylammonium fluoride (50mL, 50.00mmol) slowly over a 15 minute period at room temperature. The reaction mixture was stirred for 6 hours and evaporated to dryness. The residue was purified by flash chromatography using CH2Cl2/acetone (7:3) as eluent to give 3.88 g (80%) of 33. mp >275°C dec: 1H NMR (Me2SO-d6) δ 2.34 (m, 1 H, C2,H), 2.72 (m, 1 H, C2,H), 3.58 (m, 2 H,
C5,CH2), 3.88 (m, 1 H, C4,H) , 4.42 (m, 1 H, C3,H), 4.96 (t, 1H, C5,OH), 5.38 (d, 1 H, C3,OH), 6.40 (t, 1 H, J1,, 2, = 6.20 Hz, C1,H) , 7.52 (m, 2 H, ArH), 7.64 (m, 1 H, ArH), 8.04 (d, 2 H, ArH), 8.70 (s, 1 H, C8H), 11.52 (b s, 1 H, NH). Anal. Calcd for C17H16ClN5O4 : C, 52.37; H, 4.14; N, 17.97; Cl , 9.11.
Found: C, 52.31; H, 4.07; N, 17.94; Cl, 9.03.
EXAMPLE 33
5'-O-(4,4'-Dimethoxytrityl)-N6-benzoyl-2-chloro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)adenosine. (34)
The compound was prepared from 33 by following the procedure used for the preparation of 8. Starting materials used: 33 (2.5g. 6.43mmol), 4,4'-dimethoxytrityl chloride (2.37g, 7.0mmol), dry TEA (0.71g, 7.0mmol) and dry pyridine (100mL). The crude product was purified by flash
chromatography using CH2Cl2/EtOAc (7:3) containing 1%
triethylamine as the eluent to give 3g (68%) of 2i as foam: 1H NMR (Me2SO-d6) δ 2.34 (m, 1 H, C2,H), 2.82 (m, 1 H, C2,H) 3.18 (m, 2 H, C5,CH2) , 3.64 (2d, 6 H, OCH3) , 3.98 (m, 1 H, C4,H) , 4.44 (m, 1 H, C3,H), 5.40 (d, 1 H, OH) , 6.42 (t, 1 H, J1,,2, = 6.20 Hz, C1,H) , 6.74 (m, 4 H, ArH) , 7.16 (m, 7 H, ArH) , 7.32 (m, 2 H, ArH) , 7.52 (m, 7 H, ArH) , 7.64 (m, 1 H, ArH) , 8.04 (m, 2 H, ArH) , 8.58 (s, 1 H, C8H) , 11.50 (b s, 1 H, ArH) . Anal. Calcd for C38H34ClN5O6 : C, 65.93; H, 4.95; N, 10.12; Cl, 5.13. Found: C, 65.55; H, 5.16; N, 9.73; Cl, 5.10.
EXAMPLE 34
3'-O-[(N,N-Diisopropylamino)(β-cyanoethoxy)phosphanyl]-5'-O- (4,4'-dimethoxytrityl)-N6-benzoyl-2-chloro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)adenosine. (35)
The title compound was prepared from 34 by following the procedure used for the preparation of 9.
Starting materials used: Compound 34 (2.4g, 3.47mmol), N, N-diisopropylethylamine (1.22mL, 7.00mmol), (β-cyanoethoxy) chloro (N,N-diisopropylamino)phosphene (1.65g, 7.00mmol) and dry CH2Cl2 (30mL). The crude product was purified by flash chromatography using hexane-ethyl acetate (1:1) containing 1% triethylamine as eluent. The pure fractions were pooled together and evaporated to dryness to give 1.8g (58%) of 35. The foam was dissolved in dry dichloromethane (10mL) and added dropwise into a well stirred hexane (1500mL) under argon atmosphere. After the addition, stirring was continued for additional 1 hour and the precipitated solid was
filtered, washed with hexane and dried over solid NaOH for 3 hours. The dried powder showed no traces of impurity in 31P spectrum: 1H NMR (Me2SO-d6) δ 1.18 (m, 12 H, Isobutyryl CH3), 2.58 (m, 3 H, C2,H and Isobutyryl CH), 2.98 (m, 1 H, C2,H), 3.34 (d, 2 H, CH2), 3.64 (m, 2 H, C5,CH2), 3.72 (m, 8 H, 2 OCH3 and CH2), 4.24 (m, 1 H, C4,H), 4.82 (m, 1 H, C3,H), 6.36 (t, 1 H, J1,,2, = 6.20 Hz, Ci,H), 6.76 (m, 4 H, ArH), 7.22 (m, 7 H, ArH), 7.38 (m, 2 H, ArH), 7.52 (m, 2 H, ArH), 7.64 (m, 1 H,
ArH) , 7 . 98 (m, 2 H, ArH) , 8 . 24 ( s , 1 H , C8H) , 9 . 34 (b s , 1 H, NH) .
EXAMPLE 35
3',5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-N2-ethyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (36)
A solution of 3',5'-0-(tetraisopropyldisiloxane-1,3-diyl)-2-chloro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)-inosine (5.0g, 9.45mmol) in 2-methoxyethanol (30mL) was placed in a steel bomb and cooled to 0°C. Freshly condensed ethylamine (7.0mL) was quickly added. The steel bomb was sealed and the reaction mixture was stirred at 90°C for 16 hours. The vessel was cooled and opened carefully. The precipitated white solid was filtered and crystallized from methanol. The filtrate on evaporation gave solid which was also crystallized from methanol. Total yield 3. g (65%). mp >250°C dec: 1H NMR (Me2SO-d6) δ 1.06 (m, 31 H), 2.32 (m, 1 H, C2,H), 2.84 (m, 1 H, C2,H), 3.26 (m, 2 H, CH2), 4.12 (m, 2 H, C5,CH2), 4.22 (m, 1 H, C4,H), 4.70 (m, 1 H, C3,H), 6.23 (t, 1 H, J1,, 2, = 6.20 Hz, C1,H), 6.42 (m, 1 H, NH), 7.87 (s, 1 H, C8H), 10.58 (b s, 1 H, NH). Anal. Calcd for C24H43N5O5Si2. C, 53.59; H, 8.06; N, 13.02. Found: C, 53.44; H, 8.24; N, 12.91.
EXAMPLE 36
3',5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-6-O-diphenyl¬carbamoyl-N2-ethyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (37)
Compound 36 (2.40g, 4.46mmol) was dissolved in anhydrous pyridine (30mL) at room temperature. To this solution was added N,N-diisoproylethylamine (1.60mL,
8.93mmol) followed by diphenylcarbamoyl chloride (2.07g,
8.93mmol). The mixture was stirred at room temperature under argon atmosphere for 10 hours. A dark red solution was obtained, which was evaporated to dryness. The residue was purified by flash chromatography on a silica column using CH2Cl2/EtoAc as eluent. The pure fractions were collected
together and evaporated to give a brownish foam (3.25g, 99%) . 1H NMR (Me2SO-d6) δ 1.14 (t, 31 H), 2.52 (m, 1 H, C2,H), 3.04 (m, 1 H, C2,H), 3.34 (m, 2 H, CH2), 3.87 (m, 3 H, C5,CH2 & C4,H), 4.83 (m, 1 H, C3,H), 6.23 (m, 1 H, C1,H), 7.36 (m, 11 H, ArH & NH), 8.17 (s, 1 H, C8H). Anal. Calcd for C37H52N6O6Si2. C, 60.71; H, 7.16; N, 11.48. Found: C, 60.33; H, 7.18; N, 11.21.
EXAMPLE 37
6-0-Diphenylcarbamoyl-N2-ethyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (38)
To a stirred solution of 37 (3.25g, 4.47mmol) in pyridine (25mL) was added 0.5 M solution of
tetrabutylammonium fluoride (prepared in p ridine/THF/water, 4/1/1, 36mL, 17.88mmol) at once. The react on was allowed to stir for 10 minutes and quenched with H+ resin (amberlite IRC 50) to pH 7. The resin was filtered and washed with pyridine (20mL) and MeOH (20mL). The filtrate was evaporated to dryness. The residue was purified using flash chromotography over a silica column using methylene chloride-acetone as eluent to give 1.84g (84%) of the pure product as foam. XH NMR (Me2SO-d6) δ 1.14 (t, 3 H, CH2CH3), 2.22 (m, 1 H, C2,H), 2.76 (m, 1 H, C2,H), 3.34 (m, 2 H, CH2) , 3.57 (m, 2 H, C5,CH2), 3.84 (m, 1 H, C4,H), 4.42 (m, 1 H, C3,H), 4.91 (t, 1 H, C5,OH), 5.32 (d, 1 H, C3,OH), 6.27 (t, 1 H, J1,, 2, = 6.20 Hz C1,H), 7.29 (m, 1 H, NH), 7.46 (m, 10 H, ArH), 8.27 (s, 1 H, C8H). Anal. Calcd for C25H2SN6O5·3/4H2O. C, 59.61; H, 5.35; N, 16.68.
Found: C, 59.83; H, 5.48; N, 16.21.
EXAMPLE 38
N2-Ethyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (39)
The intermediate of 38 (0.25g, 0.51mmol) was stirred in methanolic/ammonia (saturated at 0°C) in a steel bomb at room temperature for 40 hours. The vessel was cooled to 0°C, opened carefully, and the solvent evaporated to dryness. The solid obtained was crystallized from methanol
to give a white powder (0.95g, 63%): mp 234-238°C. 1H NMR (Me2SO-d6) δ 1.14 (t, 3 H, CH2CH3), 2.18 (m, 1 H, C2,H), 2.67 (m, 1 H, C2,H), 3.34 (m, 2 H, CH2), 3.52 (m, 2 H, C5,CH2), 3.82 (m, 1 H, C4,H), 4.36 (m, 1 H, C3,H), 4.89 (t, 1 H, C5.OH), 5.30 (d, 1 H, C3,OH), 6.16 (t, 1 H, J1,,2, = 6.20 Hz C1,H), 6.44 (m,
1 H, NH), 7.91 (S, 1 H, C8H), 10.58 (b S, 1 H, NH).
EXAMPLE 39
5'-O-(4,4'-Dimethoxytrityl)-6-O-diphenylcarbamoyl-N2-ethyl-9- (2'-deoxy-β-D-exythro-pentofuranosyl)guanosine. (40)
Compound 38 (1.6g, 3.26mmol) was dried well by coevaporation with dry pyridine (3 × 50mL). The dried material was dissolved in anhydrous pyridine (25mL) and allowed to stir under argon atmosphere. To this stirred solution was added triethylamine (0.59mL, 4.24mmol) followed by DMTCl (1.44g, 4.24mmol). The reaction mixture was stirred at room temperature for 14 hours and quenched with methanol (10mL). After stirring for 15 minutes, the solvent was removed and the residue was dissolved in methylene chloride (150mL). The organic extract was washed with saturated
NaHCO3 solution (30mL), water (30mL), and brine (30mL). The methylene chloride extract was dried and evaporated to dryness. The residue was purified by flash chromatography over silica gel using methylene chloride/acetone as eluent. The pure fractions were collected together and evaporated to give a foam (2.24g, 87%). 1H NMR (Me2SO-d6) δ 1.10 (t, 3 H, CH2CH3), 2.32 (m, 1 H, C2,H), 2.82 (m, 1 H, C2,H), 3.15 (m, 2 H, CH2), 3.34 (s, 6 H, 2 OCH3), 3.67 (m, 2 H, C5,CH2), 3.96 (m, 1 H, C4,H), 4.42 (m, 1 H, C3,H), 5.36 (d, 1 H, C3,OH), 6.30 (t, 1 H, J1,, 2, = 6.20 Hz, C1,H), 6.83 (m, 4 H, ArH), 7.23 (m, 10 H, ArH & NH), 8.17 (s, 1 H, C8H). Anal Calcd for C45H44N6O7. 1/4 CH3OH. 1/4 H2O. C, 68.50; H, 5.78; N, 10.60. Found: C, 68.72; H, 5.42; N, 10.40.
EXAMPLE 40
3'-O-[(N,N-Diisopropylamino)(β-cyanoethoxy)phosphanyl]-5'-O- (4,4'-dimethoxytrityl)-6-O-diphenylcarbamoyl-N2-ethyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (41)
The DMT derivative of 40 was dried well overnight at vacuum and dissolved in dry methylene chloride (25mL). The solution was cooled to 0°C under argon atmosphere. To this cold stirring solution N,N-diisopropylamine tetrazolide salt (0.24g, 1.41mmol) followed by phosphorylating reagent (1.71mL, 5.66mmol) were added. The mixture was stirred at room temperature for 12hours under argon. The solution was diluted with additional methylene chloride (100mL) and washed with saturated NaHCO3 solution (50mL), water (50mL), and brine (50mL). The organic extract was dried and evaporated to dryness. The crude product was purified by flash column over silica gel using methylene chloride/ethyl acetate containing 1% triethylamine as eluent. The pure fractions were pooled and evaporated to give 2.5g (91%) of 41.
EXAMPLE 41
N2-3',5'-Tri-O-acetyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (42)
Deoxyguanosine (26.10g, 96.77mmol) was coevaporated with dry pyridine/DMF (50mL each) three times. The residue was suspended in dry DMF (50mL) and dry pyridine (50mL) at room temperature. To this stirring mixture was added N,N-dimethylaminopyridine (1.18g, 9.67mmol) followed by acetic anhydride (109.6mL, 116mmol) slowly keeping the temperature below 35°C. After the addition of Ac2O, the reaction was placed at 80°C for 4 hours under argon. It was cooled to room temperature and neutralized with 1N NaCO3 solution. The mixture was extracted in CH2Cl2 (2 × 250mL). The organic extract was washed with water (50mL) and brine (50mL), dried, and evaporated to dryness. The residue was crystallized from MeOH to give 29. lg (76%): mp 217-219°C. 1H NMR (Me2SO-d6) δ 2.04 (s, 3 H, COCH3), 2.09 (s, 3 H, COCH3), 2.19 (s, 3 H,
COCH3), 2.60 (m, 1 H, C2,H), 3.02 (m, 1 H, C2,H), 4.19 (m, 3 H,
C4,H & C5, CH2) , 5 . 31 (m, 1 H, C3,H) , 6 . 21 (t , 1 H, J1, , 2, = 6 . 00 Hz , C1,H) , 8 . 27 ( s , 1 H, C8H) , 11 . 72 (b s , 1 H, NH) , 12 . 02 (b s , 1 H, NH) .
EXAMPLE 42
6-O-Benzyl-9-(2'-deoxy-β-D-erythro-pentofuranosyl)guanosine. (43)
N2,3',5'-Tri-O-acetyldeoxyguanosine 42 (1.18g, 3mmol) was suspended in dry dioxane (50mL) under argon atmosphere. To this stirred suspension was added dry benzyl alcohol (0.81g, 7.5mmol) followed by triphenyl phosphine (1.96g, 7.5mmol). After stirring for 15 minutes,
diethylazodicarboxylate (1.30g, 7.5mmol) was added dropwise over a 15 minute period at room temperature. The reaction mixture was stirred under argon overnight at room
temperature. The solvent was removed and the residue treated with 0.1M sodium methoxide (75mL) and stirred at room
temperature overnight. Glacial acetic acid (0.45mL) was added, the solvents were evaporated and the residue was partitioned between water and ethyl acetate. The ethyl acetate extracts were dried, evaporated and the residue was chromatographed over silica gel using CH2Cl2-MeOH mixture. The product (0.5g, 75%) was obtained as an amorphous white solid after trituration with ether. 1H NMR (Me2SO-d6) δ 2.22 (m, 1 H, C2,H), 2.60 (m, 1 H, C2,H), 3.56 (m, 2 H,C5,CH2), 3.80 (m, 1 H, C4,H), 4.37 (m, 1 H, C3,H), 5.01 (t, 1 H, C5,OH), 5.29 (b s, 1 H, C3,OH), 5.52 (s, 2 H, ArCH2), 6.23 (t, 1 H, J1,,2, = 6.66 Hz, C1,H), 6.52 (b s, 2 H, NH2), 7.40 (m, 2 H, ArH), 7.50 (m, 2 H, ArH), 8.11 (s, 1 H, C8H). Anal. Calcd for C17H19N5O4. C, 57.13; H, 5.36; N, 19.59. Found: C, 57.09; H, 5.42; N, 19.61.
EXAMPLE 43
6-O-Benzyl-2-flouro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)purine. (44)
To a stirred suspension of the substrate 43 (5.0g, 14mmol) in dry pyridine (20ml) at -40°C was added HF/pyridine
(Aldrich 18,422-5 70%) in two portions (2 × 10mL) under argon atmosphere. After the addition of HF/pyridine, the mixture was warmed up to -10°C, during that time all the solid had gone into solution. Tert-butyl nitrite (4.0mL) was added slowly during the course of 10 minutes maintaining the temperature between -20°C and -10°C. At intervals the reaction mixture was removed from the cooling bath and swirled vigorously to ensure thorough mixing. After complete conversion of the starting material (checked by TLC at 15 minute intervals), the reaction mixture was poured onto a vigorously stirred ice cold alkaline solution (70g of K2CO3 in 150mL of water). The gummy suspension was extracted with methylene chloride (2 × 200mL). The organic extract was washed with brine (100mL), dried and evaporated to dryness. The residue was purified by flash chromatography over silica gel using CH2Cl2 MeOH as eluent. The pure fractions were combined and evaporated to give 4.0g (79%) of 44 as foam. A small quantity was crystallized from methanol as orange crystals, mp: 165-167°C. 1H NMR (Me2SO-d6) δ 2.36 (m, 1 H, C2,H), 2.66 (m, 1 H, C2,H), 3.60 (m, 2 H, C5,CH2), 3.87 (m, 1
H, C4,H), 4.42 (m, 1 H, C3,H), 4.95 (t, 1 H, C5,OH) , 5.36 (d, 1 H, C3,OH) , 5.62 (s, 2 H, ArCH2) , 6.34 it, 1 H, J1,,2, = 6.67 Hz, C1,H) , 6.46 (m, 4 H, ArH) , 8.61 (s, 1 H, C8H) . Anal. Calcd for C17H17FN4O4. C, 56.66; H, 4.76; N, 15.55.. Found: C,
56.62; H, 4.69; N, 15.50.
EXAMPLE 44
5'-O-(4,4'-Dimethoxytrityl)-2-flouro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)inosine. (45)
Compound 44. (5.00g, 13.89mmol) was dissolved in methanol (100mL) and placed in a parr bottle. To this solution Pd/C (5%, 1.00g) was added and hydrogenated at 45 psi for 2 hours. The suspension was filtered, washed with methanol (50mL) and the combined filtrate evaporated to dryness. The residue was dissolved in dry pyridine (50mL) and evaporated to dryness. This was repeated three times and the resulting residue (weighed 4.00g) was dissolved in dry
pyridine (100mL) under argon atmosphere. To this stirred solution was added triethylamine (1.52g, 15.0mmol) and 4,4'-dimethoxytrityl chloride (5.07g, 15.0mmol) at room
temperature. The reaction mixture was allowed to stir at room temperature under argon atmosphere overnight. It was quenched with methanol (20mL) and evaporated to dryness. The residue was dissolved in methylene chloride (200ml) and washed with 5% NaHCO3 solution (50mL), water (50mL), and brine (50mL). The organic extract was dried, and evaporated to dryness. The residue was suspended in dichlormethane and the insoluble solid filtered. The filtrate was purified by flash chromatography over silica gel using CH2Cl2 MeOH as the eluent. The pure fractions were collected and evaporated to give 7.0g (88%) of the title compound. The insoluble solid was found to be the DMT derivative. mp> 220°C dec: 1H NMR
(Me2SO-d6) δ 2.22 (m, 1 H, C2,H), 2.70 (m, 1 H, C2,H), 3.16 (m, 2 H, C5,CH2), 3.90 (m, 1 H, C4,H), 4.38 (m, 1 H, C3,H), 5.32 (d, 1 H, C3,OH), 6.16 (t, 1 H, J1,,2, = 6.20 Hz, C1,H), 6.82 (m, 4 H, ArH), 7.25 (m, 9 H, ArH), 7.79 (s, 1 H, C8H). EXAMPLE 45
3'-O-[(N,N-Diisopropylamino)(β-cyanoethoxy)phosphanyl]-5'-O- (4,4'-dimethoxytrityl)-2-flouro-9-(2'-deoxy-β-D-erythro-pentofuranosyl)inosine. (46)
The title compound was prepared from 45 by following the procedure used for the preparation of 9.
Starting materials used: 45. (7.0g, 12.24mmol), N,N-diisopropylethylamine (5.2mL, 30.00mmol), (β-cyanoethoxy) chloro (N,N-diisopropylamino)phosphane (5.9g, 25.00mmol) and dry CH2Cl2 (100mL). The crude product was purified by flash chromatography using dichloromethane/methanol (95:5)
containing 1% triethylamine as eluent. The pure fractions were pooled together and evaporated to dryness to give 7.00g (75.5%) of 46.. The foam was dissolved in dry dichloromethane (30mL) and added dropwise into a well stirred hexane (2500ml) under argon atmosphere. After the addition, stirring was continued for additional 1 hour and the precipitated solid
was filtered, washed with hexane and dried over solid NaOH for 3 hours. The dried powder showed no traces of impurity in 31P spectrum.
N-[N-(tert-Butyloxycarbonyl)-3-aminopropyl]benzylamine (47).
A solution of N-(3-aminopropyl)benzylamine (38 g, 231.71mmoles) in dry tetrahydrofuran (300mL) was cooled to 5°C in an ice-alcohol bath. To this cold stirred solution 2- [[(tert-butyoxycarbonyl)oxy]imino]-2-phenylacetonitrile (BOC-ON) (56.58g, 230mmoles) in dry tetrahydrofuran (300mL) was added slowly during a 6 hour period. After the addition of BOC-ON, the reaction mixture was stirred at room temperature under argon for an additional 6 hours. The reaction mixture was evaporated to dryness and the residue was dissolved in ether (750mL). The ether extract was washed with 5% sodium hydroxide solution (4 × 100mL), dried over anhydrous sodium sulfate, and concentrated to dryness. The residue was purified by flash column using a chromatograpay over a silica dichloromethane→ methanol gradient. The pure fractions were pooled together and evaporated to give 49.5 g (81%) of product as oil: 1H nmr (deuteriochloroform): δ 1.42 (s, 9H, t-Boc), 1.65 (m, 2H, CH2CH2CH2), 2.70 (t, 2H, CH2NHCH2), 3.20 (m, 2H, BocNHCH2), 3.78 (s, 2H, ArCH2), 5.32 (br s, 1H,
BocNH), 7.30 (m, 5H, ArH).
EXAMPLE 47
10-Cyano-9-(phenylmethyl)-2,2-dimethyl-3-oxa-4-oxo-5,9-diazadecane (48).
To a stirred solution of the compound 47 (24g,
91mmoles) in dry acetonitrile (500 ml) was added
potassium/celite (50g) and chloroacetonitrile (27.3g,
364mmoles) at room temperature. The reaction mixture was placed in a preheated oil bath at 85°C and allowed to stir at that temperature under argon for 12 hours. The reaction mixture was cooled, filtered and washed with dichloromethane (100mL). The combined filtrate was evaporated to dryness. The residue was dissolved in dichloromethane (100mL) and washed with 5% sodium bicarbonate solution (100mL), water (100mL) and brine (100mL). The organic extract was dried over anhydrous sodium sulfate and concentrated to give a
solid. The solid was crystallized from
dichloromethane/hexane to give 24g ((87%) as colorless needles, mp 70-73°C; 1H nmr (deuteriochloroform): δ 1.44 (s, 9H, t-Boc), 1.71 (m, 2H, CH2CH2CH2), 2.67 (t, 2H, J=6.4Hz, CH2NHCH2), 3.23 (m, 2H,BocNHCH2), 3.46 (s, 2H, CH2CN), 3.65 (s, 2H, ArCH2), 4.85 (br s, 1H, BocNH), 7.33 (s, 5H, ArH).
Anal. Calcd. for C17H25N3O2: C, 67.29; H, 8.31; N, 13.85, Found: C, 67.34; H, 8.45; N, 13.85.
EXAMPLE 48
9,12-Di(phenylmethyl)-2,2-dimethyl-3-oxa-4-oxo-5,9,12-triazadodecane (49).
The nitrile compound of Example 47 (34g,
112.21mmoles) was dissolved in ethanol (100mL) and placed in a parr hydrogenation bottle. Sodium hydroxide (7g) was dissolved in water (20mL), mixed with ethanol (180mL) and added into the parr bottle. Ra/Ni (5g, wet) was added and shaked in a parr apparatus over hydrogen (45 psi) for 12 hours. The catalyst was filtered, washed with 95% ethanol (100mL). The combined filtrate was concentrated to 100mL and cooled to 5°C in an ice bath mixture. The cold solution was extracted with dichloromethane (3 × 200mL). The combined extract dried over anhydrous sodium sulfate and evaporated to give 32 g (92%) of an oil product. The product was used as such for the next reaction. 1H nmr (deuteriochloroform): δ 1.32 (br s, 2H, NH2), 1.42 (s, 9H, t-Boc), 1.67 (m, 2H,
CH2CH2CH2), 2.48 (m, 4H, CH2CH2NH2), 2.75 (t, 2H, J=6.4Hz, CH2NHCH2), 3.15 (m, 2H, BocNHCH2), 3.55 (s, 2H, ArCH2), 5.48 (br s, 1H, BocNH), 7.31 (m, 5H, ArH).
The above amine (33g, 107.5mmoles) in dry methanol (100mL) was mixed with anhydrous magnesium sulfate (30g) and allowed to stir at room temperature under argon atmosphere. To this stirred solution benzaldehyde (13.2g, 125mmoles) was added and the stirring was continued for 4 hours under argon. The reaction mixture was diluted with methanol (150mL) and cooled to -5°C in an ice salt bath. Solid sodium borohydride (30g) was added in 1 g lots at a time during 2 hour periods,
keeping the reaction temperature below 0°C. After the addition of sodium borohydride, the reaction mixture was allowed to stir at room temperature overnight and filtered over celite. The filtrate was evaporated to dryness. The residue was partitioned between water (350mL) /ether (500mL) and extracted in ether. The ether extract was dried over anhydrous sodium sulfate and evaporated to dryness. The residue was purified on a silica gel column using
dichloromethane → methanol as eluent. The pure fractions were pooled together and evaporated to give 35 g (82%) as oil; 1H nmr (deuteriochloroform): δ 1.42 (s, 9H, t-Boc), 1.65 (m, 2H, CH2CH2CH2), 1.75 (br s, 1H, ArCH2NH), 2.55 (m,
4H,CH2CH2, 2.70 (t, 2H, J=6.4Hz, CH2NHCH2), 3.15 (m, 2H,
BocNHCH2), 3.52 (s, 2H, ArCH2), 3.72 (s, 2H, ArCH2), 5.55 (br s, 1H, BocNH), 7.28 (m, 10H, ArH).
Anal . Calcd . for C24H35N3O2 : C , 72 . 51 ; H , 8 . 87 ; N, 10 . 57 . Found : C , 72 . 39 ; H, 8 . 77 ; H , 10 . 72 .
EXAMPLE 49
13-cyano-9,12-di(phenylmethyl)-2,2-dimethyl-3-oxa-4-oxo-5,9,12-triazatridecane (50).
The title compound was prepared from compound 49 by following the procedure used for the preparation of the compound of Example 47. Materials used: Substrate 49
(4.55g, 11.46mmoles); chloro acetonitrile (2.6g,
34.38mmoles); potassium fluoride/celite (9.0g) and dry acetonitrile (100mL). The crude product was purified by flash chromatography over silica gel using dichloromethane → acetone as the eluent to give 4.8g (96%); 1H nmr
(deuteriochloroform): δ 1.42 (s, 9H, t-Boc), 1.68 (m, 2H, CH2CH2CH2), 2.52 (m, 4H, CH2CH2), 2.68 (t, 2H, J=6.2Hz,
CH2NHCH2), 3.22 (m, 2H, BocNHCH2), 3.36 (s, 2H, CNCH2), 3.50 (s, 2H, ArCH2), 3.62 (s, 2H, ArCH2), 5.72 (br s, 1H, BocNH), 7.32 (m, 10H, ArH).
Anal. Calcd. for C26H36H4O2: C, 71.52; H, 8.31; H, 12.83. Found: C, 71.17; H, 8.14; N, 12.82.
EXAMPL. 50
9,12,15-Tri(phenylmethyl)2,2-dimethyl-3-oxa-4-oxo-5,9,12,15-tetraazapentadecane (51).
The title compound was prepared from compound 50 by following a two step procedure used in Example 48. Materials used in the first step: The substrate 50 (25g, 57.34mmoles); Ra/Ni (5g); sodium hydroxide in ethanol (200mL, 7g of sodium hydroxide was dissolved in 20mL of water and mixed with ethanol) and ethanol used to dissolve the substrate (100mL). The crude product was extracted in dichloromethane which on evaporation gave 22 g (87%) of an oily product; 1H nmr
(deuteriochloroform): δ 1.40 (s, 9H, t-Boc), 1.50 (m, 4H, CH2CH2CH2 & NH2), 2.48 (m, 8H, 2 CH2CH2), 2.66 (t, 2H, J=6.2Hz, CH2NHCH2), 3.24 (m, 2H, BocNHCH2), 3.50 (s, 2H, ArCH2), 3.56 (s, 2H, ArCH2), 5.48 (br s, 1H, BocNH), 7.28 (m, 10H, ArH).
Materials used in the second step: Above amine
(24.4g, 55.33mmoles); benzaldehyde (6.36g, 60.00mmoles);
magnesium sulfate (20.0 g) and dry methanol (200mL) . The crude product was purified by flash chromatography over silica gel using dichloromethane → methanol as the eluent to give 20.0g (68%) of compound 51 as oil; 1H nmr
(deuteriochloroform): δ 1.40 (s, 9H, t-Boc), 1.52 (m, 2H, CH2CH2CH2), 1.84 (br s, 1H, ArCH2NH), 2.38 (t, 2H, J=6.2Hz, CH2NHCH2), 2.54 (m, 8H 2 CH2CH2), 3.08 (m, 2H, BocNHCH2), 3.42 (s, 2H, ArCH2), 3.50 (s, 2H, ArCH2), 3.65 (s, 2H, ArCH2), 3.65 (s, 2H, ArCH2), 5.45 (br s, 1H, BocNH), 7.28 (m, 15H, ArH).
Anal. Calcd. for C33H46N4O2: C, 74.67; H, 8.74; N, 10.56. Found: C, 74.92; H, 8.39; N, 10.71.
EXAMPLE 51
16-Cyano-9,12,15-tri(phenylmethyl)-2,2-dimethyl-3-oxa-oxo-5,9,12,15-tetraazahexadecane (52).
The title compound was prepared from compound 51 by following the procedure used in Example 47. Materials used: Substrate (Example 50 compound 51, 8.30g, 15.66mmoles);
chloro acetonitrile (3.52g, 46.98mmoles); potassium
fluoride/celite (10.0g and dry acetonitrile (150mL). The
crude product was purified by flash chromatography over silica gel using dichloromethane → ethyl acetate as the eluent to give 7.6 g (85%); 1H nmr (deuteriochloroform): δ 1.42 (s, 9H, t-Boc), 1.60 (m,2H, CH2CH2CH2), 2.42 (t, 2H, J=6.2Hz, CH2NHCH2), 2.60 (m, 8H, 2CH2CH2), 3.14 (m, 2H,
BocNHCH2), 3.38 (s, 2H, CNCH2), 3.48 (s, 2H, ArCH2), 3.54 (s, 2H, ArCH2), 3.60 (s, 2H, ArCH2), 5.42 (br s, 1H, BocNH), 7.26 (m, 15H, ArH).
Anal. Calcd. for C35H47N5O2: C, 73,77; H, 8.32; N, 12.29. Found: C, 73.69; H, 8.19; N, 12.31.
EXAMPLE 52
9,12,15,18-Tetra(phenylmethyl)-2,2-dimethyl-3-oxa-4-oxo- 5,9,12,15,18-petaazaoctadecane (53).
The title compound was prepared from compound 52 by following a two step procedure used for the preparation of the Example 48 compound 49 . Materials used in the first step: The substrate (compound 52, 7g, 12.30mmoles); Ra/Ni (2g); sodium hydroxide in ethanol (160mL, 3.5g of sodium hydroxide was dissolved in 10mL of water and mixed with ethanol) and ethanol used to dissolve the substrate (100 ml). The crude product was extracted in dichloromethane which on evaporation gave 5.6 g (79%) as oil; 1H nmr
(deuteriochloroform): δ 1.40 (s, 9H, t-Boc), 1.50 (m, 4H, CH2CH2CH2 & NH2), 2.48 (m, 12H, 3 CH2CH2), 2.66 (m,
2H,CH2NHCH2), 3.24 (m, 2H, BocNHCH2), 3.50 (s, 2H, ArCH2), 3.56 (s, 4H, 2 ArCH2), 3.62 (s, 2H, ArCH2), 5.48 (br s, 1H, BocNH), 7.28 (m, 15H, ArH).
Material used in the second step: above amine
(21.2g, 36.74mmoles); benzaldehyde (4.24g, 40.00mmoles);
magnesium sulfate (10.0g), dry methanol (200mL) and sodium borohydride (4.85g, 128.45mmoles). The crude product was purified by flash chromatography over silica gel using dichloromethane → methanol as the eluent to give 18 . 67 g (77%) of compound 53 as oil; 1H nmr (deuteriochloroform): δ 1.40 (s, 9H, t-Boc), 1.52 (m, 2H, CH2CH2CH2), 2.05 (br s, 1H, ArCH2NH), 2.38 (t, 2H, J=6.0Hz, CH2NHCH2), 2.54 (m, 12H, 2
CH2CH2) , 3.0: (TP, 2H, BocNHCH2) , 3.40 (s, 2H, ArCH2) , 3.50 (s, 4H, 2 ArCH2) , 3.64 (s, 2H, ArCH2), 5.55 (br s, 1H, 3ocNH) , 7.28 (m, 20H, ArH) .
Anal. Calcd. for C42H57N5O2: C, 75.98; H, 8.65; N, 10.55. Found: C, 75.72; H, 8.67; N, 10.39.
EXAMPLE 53
13-amino-1,4,7,10-tetra(phenylmethyl)-1,4,7,10-tetraazatridecane (54).
To a stirred solution of compound 53 (2.65g,
4mmoles) in dichloromethane (10mL) was added trifluoroacetic acid (10mL) at room temperature. The reaction mixture was allowed to stir at room temperature for 30 minutes and evaporated to dryness. The residue was dissolved in
dichloromethane (100mL) and washed with 5% sodium bicarbonate solution (150mL) to pH 8, and brine (50mL). The organic extract was dried over anhydrouε sodium sulfate and
concentrated to dryness. The oily residue that obtained was used as such for the next reaction. 1H nmr
(deuteriochloroform): δ 1.50 (m, 5H, CH2CH2CH2, NH2, &
ArCH2NH), 2.38 (t, 2H, J=6.4Hz, CH2NHCH2), 2.54 (m, 14H, 7
CH2), 3.52 (s, 2H, ArCl 3.56 (s, 4H, 2 ArCH2). 3.62 (s, 2H, ArCH2), 7.28 (m, 20H, ArH).
3',5'-O-(Tetraisopropyldisiloxane-1 3-diyl)-N-[4,7,10,13-tetrakis-(phenylmethyl)-4,7,10,13-tetraazatridec-1-yl]-2 ' -deoxyquanosine (56).
A mixture of 2-chloroinosine (55 in reaction scheme
3, 2.12g, 4mmoles) and compound 54 (2.5g, 4.4mmoles) in 2-methoxyethanol (50mL) was heated at 80°C for 12 hours. The reaction mixture was evaporated to dryness and the residue on flash chromatography over silica gel using dichloromethane and methanol (9:1) gave 2.55 g (60%) of the title compound as foam. 1H nmr (deuteriochloroform): δ 1.00 (m, 24H, 4
Isobutyl-H), 1.62 (m, 1H, C2,H), 1.80 (m, 4H, CH2CH2CH2, C2,H, & ArCH2NH), 2.52 (m, 14H, 7 CH2), 3.20 (s, 2H, ArCH2), 3.32 (s, 2H, ArCH2), 3.42 (s, 2H, ArCH2), 3.48 (s, 4H, ArCH2 & CH2), 3.78 (m, 1H, C4,H), 4.05 (m, 2H, C5.CH2), 4.72 (m, 1H, C3,H), 6.22 (m, 1H, C1,H), 6.94 (m. 1H, N2H), 7.26 (m, 20H, ArH), 7.72 (s, 1H, C8H), 10.52 (br s, 1H, NH).
Anal . Calcd . for C59H85N9OsSi2 : C, 67 . 07 ; H, 8 . 11 ; N, 11 . 93 . Found : C, 67 . 22 ; H, 8 . 24 ; N, 11 . 81 . EXAMPLE 55
3',5'-O-(Tetraisopropyldisiloxane-1,3-diyl)-6-O-(phenylmethyl)-N-[15-methyl-14-oxo-4,7,10,13-tetrakis
(phenylmethyl)-4,7,10,13-tetraazahexadec-1-yl]-2'-deoxyguanosine (57).
The compound of Example 54 (2.00g, 1.89mmoles) was coevaporated with dry pyridine (30mL) two times. The
resulting residue was dissolved in dry pyridine (50mL) and cooled to 0°C in an ice bath mixture. To this cold stirred solution was added triethylamine (0.61g, 6mmoles) followed by isobutyryl chloride (0.64g, 6mmoles) slowly under argon atmosphere. After the addition of isobutyryl chloride, the reaction mixture was stirred at room temperature for 12 hours and evaporated to dryness. The residue was dissolved in dichloromethane (150mL), washed with 5% sodium bicarbonate (50mL), water (50mL) and brine (50mL). The organic extract was dried over anhydrous sodium sulfate and evaporated to
dryness. The residue on purification over silica gel using dichloromethane/methanol (95:5) gave 1.88g (88%) of the title compound as a foam.
The above foam (1.8g, 1.61mmoles) was dried over phosphorous pentaoxide under vacuum for 12 hours. The dried residue was dissolved in dry dioxane (50mL) and treated with triphenyl phosphine (0.83g, 3.2mmoles), benzyl alcohol
(0.35g, 3.2mmoles), and diethylazodicarboxylate (0.54g, 3.2mmoles) at room temperature under argon atmosphere. The reaction mixture after stirring for 10 hours evaporated to dryness. The residue was dissolved in dichloromethane
(150mL) and washed with 5% sodium bicarbonate (50mL), water (50mL) and brine (50mL). The organic extract was dried over anhydrous sodium sulfate and evaporated to dryness. The residue was flash chromatographed over silica gel using dichloromethane/acetone (7:3) as the eluent. The pure fractions were collected together and evaporated to give 1.7 g (74%) of foam: 1H nmr (deuteriochloroform): δ 1.04 (m, 30H, 5 Isobutyl-CH3), 1.68 (m, 2H, CH2CH2CH2), 2.55 (m,, 16H, 7 CH2, C2,H, & isobutyl-CH), 3.08 (m, 1H, C2,H), 3.36 (m, 2H,
CH2), 3.52 (m, 8H, 4 ArCH2), 3.84 (m, 1H, C4,H), 4.00 (m, 2H, C5.CH2), 4.72 (m, 1H, C3,H), 5.50 (s, 2H, ArCH2), 6.18 (m, 1H, C1,H), 7.04 (m, 1H, N2H), 7.26 (m, 25H, ArH), 7.76 (s, 1H, C8H).
Anal . Calcd . for C70H97N9O6Si2 : C , 69 . 09 ; H , 8 . 04 ; N,
10 . 36 . Found : C, 69 . 12 ; H, 8 .23 ; N, 10 . 19 .
EXAMPLE 56
6-O-(Phenylmethyl)-N-[15-methyl-14-oxo-4,7,10,13-tetrakis(phenylmethyl)-4,7,10,13-tetraazahexadec-1-yl]-2 ' -deoxyguanosine (58).
To a stirred solution of compound 57 (5.0g, 4.11mmoles) in pyridine (50mL) was added freshly prepared 1N solution of tetrabutylammonium fluoride (20mL, 20mmoles;
prepared in a mixture of pyridine:tetrahydrofuran:water in the ratio of 5:4:1) at room temperature. The reaction mixture was allowed to stir for 30 minutes and quenched with
H+ resin (pyridinium form) to pH 6-7. T -e resin was
filtered, washed with methanol (50mL), and the combined filtrate evaporated to dryness. The residue was dissolved in dichloromethane (200mL), washed with water (50mL), and brine (50mL). The organic extract was dried over sodium sulfate and concentrated to dryness. The foam that obtained was purified by flash chromatography over silica gel column using dichloromethane/methanol (95:5) as the eluent. The required fractions were collected together and evaporated to give 3.5g (87%) of the titled compound as foam. 1H nmr
(deuteriochloroform): δ 1.04 (m, 30H, 5 isobutyryl CH3), 1.68 (m, 2H, CH2CH2CH2), 2.55 (m, 16H, 7 CH2, C2,H, &
isobutyryl CH), 3.08 (m, 1H, C2,H), 3.36 (m, 2H, CH2), 3.52 (m, 8H, 4 ArCH2), 3.84 (m, 1H, C4,H), 4.00 (m, 2H, C5,CH2), 4.72 (m, 1H, C3,H), 5.50 (s, 2H, ArCH2), 6.18 (m, 1H, C1,H), 7.04 (m, 1H, N2H), 7.26 (m, 25H, ArH), 7.76 (s, 1H, C8H).
Anal. Calcd. for C70H97N9O6Si2: C, 69.09; H, 8.04; N, 10.36. Found: C, 69.12; H, 8.23; N, 10.19.
58
EXAMPLE 57
The amidites 9, 17, 23, 30, 35, 41 and 46, as discussed in the Detailed Description of the Preferred
Embodiments, are incorporated into oligonucleotide sequences via automated DNA synthesis protocol. (Standard protocol using an ABI 380B DNA synthesizer was modified by increasing the wait step after the pulse delivery of tetrazole to 900 seconds. Deprotection conditions are discussed in
Himmelsbach, et al . , Tetrahedron, 1984, 40, 59). Enzymatic degradation and subsequent HPLC analysis indicated the
expected ratios of the nucleoside components.
(Oligonucleotides were digested with a mixture of spleen phosphodiesterase, snake venom phosphodiesterase, and
bacterial alkaline phosphatase to provide individual
nucleosides which were analyzed by HPLC).
A 21-mer oligonucleotide [5'd-(GCCGAGGTCCATGTCGTACGC) was modified with one, three or seven N2-[3-(lH-imidazol-1-yl)propyl) dGs or one or three N2-[3-(lH-imidazol-1-yl)propyl]-2-NH2 dAs and hybridized to complementary DNA or RNA. See
Freier et al . , Gene Regulation : Biology of Antisense RNA and DNA, (Erickson, et al . Raven Press, New York, 1992), pp. 95-107; Breslauer, et al . , Proc. Nat 'l Acad. Sci . USA, 1991, 8, 3746. Compared to unmodified DNA, the average change Tm/mod was +2.0 and +0.3 for dG modified oligonucleotides hybridized with DNA and RNA, respectively; the average change Tm/mod was +2.7 and +0.6 for dA modified oligonucleotides hybridized with DNA and RNA, respectively. The average enhancement of binding affinity of several different N2-imidazolpropyl dG and N2-imidazolpropyl-2-amino-dA modified oligonucleotides hybridized to DNA is 2.7 degrees Celsius/mod (3 different sequences, 16 incorporations) and 2.5 degrees Celsius/mod (3 different sequences, 12 incorporations), respectively. The relative specificity of hybridization of dG or N2-imidazolpropyl dG to cytidine versus A, G, and U(T)
mismatches of an RNA or DNA complement shows that N2-modified dG is more specific to its complement cytidine than the
corresponding unmodified dG; N2-imidazolpropyl-2-NH2 dA is as
specific as dA against RNA or DNA. Incorporation of three N2-imidazolpropyl-2-NH2 dGs or 2-NH2-dAs at the n-1, n-2, and n-3 positions at the 3' end of a 15-mer provided an increase in stability (T1/2 = 9 and 16h, respectively) to nucleolytic degradation in fetal calf serum compared to the unmodified oligomer (T1/2 = 1h) . See Hoke et al . , Nucleic Acids Res . , 1991, 8, 3746. The capped N2-modified dG sequence was stabilized by 2.8 degrees Celsius/mod against DNA and 0.9 degrees Celsius against RNA, and the 2-NH2-dA sequence was stabilized by 2.6 degrees Celsius/mod against DNA and 1.5 degrees/Celsius against RNA.
Molecular modeling simulations of oligomers containing the N2-imidazolpropyl functionality suggest that the imidazole binds in the minor groove proximate to the phosphate backbone, stabilizing the DNA-DNA duplex.
(Molecular minimization and dynamics studies were conducted using the Amber forcefield with the Insight and Discover programs (Biosys Inc., San Diego, CA). Four thousand steps of conjugate gradient minimization were used, followed by 1000 cycles of equilibration at 300 degrees Celsius, and 4000 steps of dynamics at 10 psec intervals). In the case of the RNA-DNA duplex, the imidazolpropyl group does not bind specifically since the minor groove is broad and the
phosphates are turned away. However, other hydrogen bond donors and acceptors are accessible in the minor groove, which may account for the increased stability of the modified duplex.
A 21-mer having imidazolpropyl modified dG in 7 positions (1,4,6,7,13,16, and 20) and another 21-mer having imidazolpropyl modified 2-NH2-dA in 5 positions (1,5,8,11, and 18) support HeLa cell extract RNase H dependent cleavage. Agrawal, et al . , Proc. Nat 'l Acad. Sci . USA, 1989, 87, 1401. Furthermore, a 17-mer phosphorothioate containing a modified dG at the primary cleavage site of HeLa cell extract RNase H did not prevent cleavage by the enzyme. Monia, et al . , Biol . Chem. , submitted 1992. These data suggest the heteroduplexes formed between N2-imidazolpropyl dG or 2-NH2-dA modified
EXAMPLE 58
Chromatography and Purification.
Silica gel used for flash chromatography was ICN 60 (Costa Mesa, CA), 32-63 mesh. Materials not soluble in the solvent system used for flash chromatography (FC) were coevaporated onto E. Merck silica gel 100 (Darmstadt, Republic of Germany), 70-230 mesh, using a suitable solvent. The dry materials were then applied to the top of a FC column. TLC was performed on prescored E. Merck Kieselgel 60 F254 plates. Compounds were visualized by illuminating TLC plates under UV light (254 nm) and/or by spraying with 10 methanolic H2SO4 followed by heating. Evaporations were carried out at
40-50°C using a rotary evaporator and a vacuum pump coupled to a vacuum controller. 1H-NMR spectra were obtained at 400 mHz in dmso-d6 unless otherwise noted. Where relevant, treatment of samples with D2O recorded exchangeable protons. Infrared spectra were recorded on a Perkin-Elmer 16PC FT-IR spectrophotometer. Solvent system A = ethyl acetate-hexanes, 3:2; B = ethyl acetate-methanol, 9:1, v/v. EXAMPLE 59
Procedure for attaching modified 5'-dimethoxytriphenylmethyl ribonucleosides to the 5'-hydroxyl of nucleosides bound to CPG support.
The modified nucleosides that will reside in the terminal 3'-position of certain antisense oligonucleotides are protected as their 5'-DMT (the cytosine and adenine exocyclic amino groups are benzoylated and the guanine amino is isobutyrlated) and treated with trifluoroacetic
acid/bromoacetic acid mixed anhydride in pyridine and
dimethylaminopyridine at 50°C for five hours. The solution is evaporated under reduced pressure to a thin syrup which is dissolved in ethyl acetate and passed through a column of silica gel. The homogenous fractions were collected and evaporated to dryness. A solution of 10 mL of acetonitrile, 10 micromoles of the 3'-O-bromomethyl-ester modified
pyrimidine nucleoside, and one mL of pyridine/
dimethylaminopyridine (1:1) is syringed slowly (60 to 90 sec) through a one micromole column of CPG thymidine (Applied Biosystems, Inc.) that had previously been treated with acid according to standard conditions to afford the free 5'-hydroxyl group. Other nucleosides bound to CPG columns could be employed. The eluent is collected and syringed again through the column. This process is repeated three times. The CPG column with 10 mL of acetonitrile and then attached to an ABI 38OB nucleic acid synthesizer. Oligonucleotide synthesis is now initiated. The standard conditions of concentrated ammonium hydroxide deprotection that cleaves the thymidine ester linkage from the CPG support also cleaves the 3',5' ester linkage connecting the pyrimidine modified nucleoside to the thymidine that was initially bound to the CPG nucleoside. In this manner, any modified nucleoside or generally any nucleoside with modifications in the
heterocycle and/or sugar can be attached at the 3' end of an oligonucleotide sequence.
EXAMPLE 60
Procedure for the conversion of modified nucleoside-5'-DMT-3'-phosphoramidites into oligonucleotides.
The polyribonucleotide solid phase synthesis procedure of Sproat, et al . , 1989, Nucleic Acids Res . , 17, 3373-3386 is used to prepare the modified oligonucleotides. EXAMPLE 61
Preparation of Modified Phosphorothioate Oligonucleotides.
Substituted 5'-DMT nucleoside 3'-phosphoroamidites prepared as described in tne above Examples are inserted into sequence specific oligonucleotide phosphorothioates as described by Sproat, supra, at 3373-3386 and Beaucage, et al . , J . Am. Chem. Soc'y, 1989, 112, 1253-1255.
Claims
What is claimed is:
A compound having the formula:
wherein G is C or N;
X is NH2 or OH;
Y is RQ or NHRQ, wherein said R is H or a hydrocarbyl group having from 2 to about 20 carbon atoms; and Q comprises at least one reactive or non-reactive
functionality; and
Z is H, a nitrogen protecting group, or a sugar moiety.
2. The compound of claim 1 wherein Q is a nitrogen-containing heterocycle.
3. The compound of claim 1 wherein Q is a substituted or unsubstituted imidazole.
4. The compound of claim 1 wherein Y is RQ, said Q is an imidazole.
5. The compound of claim 1 wherein Y is NHRQ, said Q is an imidazole.
6. The compound of claim 1 wherein G is N; X is NH2; Y is NHRQ, said R is a lower alkane; and Q is an imidazole.
7. The compound of claim 6 wherein said R is an alkane having between about 2 to about 4 carbon atoms.
8. The compound of claim 7 wherein Z is ribose or deoxyribose.
9. The compound of claim 6 wherein R is propyl.
10. The compound of claim 9 wherein Z is ribose or deoxyribose.
11. The compound of claim 1 wherein G is N; X is OH; Y is NHRQ, said R is a lower alkane; and Q is an imidazole.
12. The compound of claim 11 wherein R is an alkane having between about 2 to about 4 carbon atoms.
13. The compound of claim 11 wherein Z is ribose or deoxyribose.
14. The compound of claim 12 wherein Z is ribose or deoxyribose.
15. The compound of claim 11 wherein R is propyl.
16. The compound of claim 15 wherein Z is ribose or deoxyribose.
17. The compound of claim 11 wherein R is ethyl.
18. The compound of claim 17 wherein Z is ribose or deoxyribose.
19. The compound of claim 11 wherein R is isobutyryl and Q is a methyl-imidazole.
20. The compound of claim 19 wherein Z is ribose or deoxyribose.
21. The compound of claim 1 wherein G is N; X is NH2; Y is NHRQ, said R is H and Q is an alkane having from about 5 up to about 20 carbon atoms.
22. The compound of claim 21 wherein Z is ribose or deoxyribose.
23. The compound of claim 1 wherein G is N; X is OH; Y is NHRQ, said R is H and Q is an alkane having from about 5 up to about 20 carbon atoms.
24. The compound of claim 23 wherein Q is nonyl.
25. The compound of claim 24 wherein Z is ribose or deoxyribose.
26. The compound of claim 23 wherein Q is isobutyryl-nonane.
27. The compound of claim 26 wherein Z is ribose or deoxyribose.
28. The compound of claim 1 wherein Y is RQ, said R is a lower alkane; and Q is an amine, wherein said amine
comprises NH2, polyalkylamine, aminoalkylamine, hydrazine
(-NH-NH-), hydroxylamine(-NH-OH), semicarbazide (-NH-C(O)-NH-NH2), thiosemicarbazide (-NH-C(S)-NH-NH2), hydrazone (-N=NH), or hydrazide (-C(O)-NH-NH2).
29. The compound of claim 1 wherein Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamine, aminoalkylamine, hydrazine (-NH-NH-), hydroxylamine (-NH-OH), semicarbazide (-NH-C(O)-NH-NH2), thiosemicarbazide (-NH-C(S)-NH-NH2), hydrazone (-N=NH), or hydrazide (-C(O)-NH-NH2); and Z is ribose or deoxyribose.
30. The compound of claim 1 wherein G is N; X is NH2; Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamine, aminoalkylamine, hydrazine (-NH-NH-), hydroxylamine (-NH-OH), semicarbazides (-NH-C(O)-NH-NH2), thiosemicarbazide (-NH-C(S)-NH-NH2), hydrazone (-N=NH), or hydrazide (-C(O)-NH-NH2).
31. The compound of claim 30 wherein said amine is NH2.
32. The compound of claim 31 wherein Z is ribose or deoxyribose.
33. The compound of claim 1 wherein G is N; X is OH; Y is NHRQ, said R is a lower alkane; and Q is an amine, wherein said amine comprises NH2, polyalkylamine, aminoalkylamines, hydrazines (-NH-NH-), hydroxylamines (-NH-OH), semicarbazide (-NH-C(O)-NH-NH2), thiosemicarbazides (-NH-C(S)-NH-NH2), hydrazone (-N=NH), or hydrazide (-C(O)-NH-NH2).
34. The compound of claim 33 wherein Z is ribose or deoxyribose.
35. The compound of claim 33 wherein said amine is NH2.
36. The compound of claim 35 wherein Z is ribose or deoxyribose.
37. The compound of claim 33 wherein R is hexane and Q is NH2.
38. The compound of claim 37 wherein Z is ribose or deoxyribose.
39. The compound of claim 1 wherein Y is NHRQ, said Q is a thiol group, an aldehyde, a ketone, an alcohol, an alkoxy group, or a halogen.
40. The compund of claim 39 wherein Z is ribose or deoxyribose.
41. The compound of claim 1 wherein Y is RQ, said Q is a thiol group, an aldehyde, a ketone, an alcohol, an alkoxy group, or a halogen.
42. The compund of claim 41 wherein Z is ribose or deoxyribose.
43. The compound of claim 1 wherein Y is NHRQ, said Q is a thiol group, an aldehyde, a ketone, an alcohol, an alkoxy group, or a halogen.
44. The compund of claim 43 wherein Z is ribose or deoxyribose.
45. The compound of claim 1 further having a phosphate group at the 3' position of the sugar moiety, wherein said phosphate group may be a native phosphate or a modified phosphate.
46. The compound of claim 45 wherein said sugar moiety is a ribose or deoxyribose.
47. The compound of claim 45 wherein said sugar moiety is ribose or deoxyribose and said modified phosphate is a methylphosphonate, phosphorothioate, phosphoramidite, phosphorotriester.
48. A mixed sequence oligonucleotide having at least one compound in accordance with claim 1.
49. An oligonucleotide for affecting RNase H cleavage of RNA comprising:
a first oligonucleotide region and a second nucleotide region;
together said first and said second region of a nucleotide sequence essentially complementary to at least a portion of said RNA;
said first region including at least one nucleotide in accordance with claim 1;
said second region including a plurality of consecutive phosphorothioate linked nucleotides having a 2'-deoxy-erythro-pentofuranosyl sugar moiety.
50. An oligonucleotide of claim 49 further comprising a third region of said oligonucleotide, said third region including at least one nucleotide in accordance with claim 1;
wherein said second region is positioned in said oligonucleotide between said first and third regions.
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP95902698A EP0731807B1 (en) | 1993-11-29 | 1994-11-29 | N-2 substituted purines |
JP51525895A JP3535519B2 (en) | 1993-11-29 | 1994-11-29 | N-2-substituted purines |
DE69433626T DE69433626T2 (en) | 1993-11-29 | 1994-11-29 | N-2 SUBSTITUTED PURINE |
AT95902698T ATE261984T1 (en) | 1993-11-29 | 1994-11-29 | N-2 SUBSTITUTED PURINES |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/159,088 US5459255A (en) | 1990-01-11 | 1993-11-29 | N-2 substituted purines |
US08/159,088 | 1993-11-29 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1995014707A1 true WO1995014707A1 (en) | 1995-06-01 |
Family
ID=22571037
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1994/013622 WO1995014707A1 (en) | 1993-11-29 | 1994-11-29 | N-2 substituted purines |
Country Status (6)
Country | Link |
---|---|
US (4) | US5459255A (en) |
EP (1) | EP0731807B1 (en) |
JP (1) | JP3535519B2 (en) |
AT (1) | ATE261984T1 (en) |
DE (1) | DE69433626T2 (en) |
WO (1) | WO1995014707A1 (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997012896A1 (en) * | 1995-10-04 | 1997-04-10 | Epoch Pharmaceuticals, Inc. | Selective binding complementary oligonucleotides |
US5744460A (en) * | 1996-03-07 | 1998-04-28 | Novartis Corporation | Combination for treatment of proliferative diseases |
DE19945503A1 (en) * | 1999-09-23 | 2001-04-05 | Henkel Kgaa | Multi-phase cleaning agent with an antimicrobial effect |
EP1109825A1 (en) * | 1998-09-01 | 2001-06-27 | Isis Pharmaceuticals, Inc. | Improved process for the synthesis of oligonucleotides incorporating 2-aminoadenosine |
EP3296306A1 (en) * | 2012-02-17 | 2018-03-21 | Ajinomoto Co., Inc. | Base-protected oligonucleotide |
Families Citing this family (925)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6753423B1 (en) | 1990-01-11 | 2004-06-22 | Isis Pharmaceuticals, Inc. | Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals |
US20040142899A1 (en) * | 1990-01-11 | 2004-07-22 | Isis Pharmaceuticals, Inc. | Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals |
US6339066B1 (en) | 1990-01-11 | 2002-01-15 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides which have phosphorothioate linkages of high chiral purity and which modulate βI, βII, γ, δ, Ε, ζ and η isoforms of human protein kinase C |
US5459255A (en) * | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
US5681941A (en) * | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
US6001988A (en) * | 1990-06-11 | 1999-12-14 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands to lectins |
US6153595A (en) * | 1990-08-16 | 2000-11-28 | Isis Pharmaceuticals Inc. | Composition and method for treatment of CMV infections |
US6335434B1 (en) | 1998-06-16 | 2002-01-01 | Isis Pharmaceuticals, Inc., | Nucleosidic and non-nucleosidic folate conjugates |
US8153602B1 (en) | 1991-11-19 | 2012-04-10 | Isis Pharmaceuticals, Inc. | Composition and methods for the pulmonary delivery of nucleic acids |
US20070032446A1 (en) * | 1991-12-24 | 2007-02-08 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
EP1695979B1 (en) * | 1991-12-24 | 2011-07-06 | Isis Pharmaceuticals, Inc. | Gapped modified oligonucleotides |
US6537973B1 (en) | 1992-03-16 | 2003-03-25 | Isis Pharmaceuticals, Inc. | Oligonucleotide inhibition of protein kinase C |
US6117847A (en) * | 1992-03-16 | 2000-09-12 | Isis Pharmaceuticals, Inc. | Oligonucleotides for enhanced modulation of protein kinase C expression |
US6174868B1 (en) | 1992-09-10 | 2001-01-16 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of hepatitis C virus-associated diseases |
US20030013670A1 (en) * | 1992-10-05 | 2003-01-16 | Monia Brett P. | Antisense oligonucleotide inhibition of ras |
US5985558A (en) | 1997-04-14 | 1999-11-16 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide compositions and methods for the inibition of c-Jun and c-Fos |
CA2146320C (en) * | 1992-10-05 | 2004-12-14 | Brett P. Monia | Antisense oligonucleotide inhibition of the ras gene |
US5872242A (en) * | 1992-10-05 | 1999-02-16 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide inhibition of ras |
US6784290B1 (en) | 1992-10-05 | 2004-08-31 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide inhibition of ras |
GB9301000D0 (en) * | 1993-01-20 | 1993-03-10 | Glaxo Group Ltd | Chemical compounds |
ATE247128T1 (en) | 1993-09-03 | 2003-08-15 | Isis Pharmaceuticals Inc | AMINODERIVATIZED NUCLEOSIDES AND OLIGONUCLEOSIDES |
US5801154A (en) * | 1993-10-18 | 1998-09-01 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of multidrug resistance-associated protein |
US6391636B1 (en) | 1994-05-31 | 2002-05-21 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of raf gene expression |
US5981731A (en) * | 1994-05-31 | 1999-11-09 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of B-raf gene expression |
US6420549B1 (en) | 1995-06-06 | 2002-07-16 | Isis Pharmaceuticals, Inc. | Oligonucleotide analogs having modified dimers |
US5854033A (en) | 1995-11-21 | 1998-12-29 | Yale University | Rolling circle replication reporter systems |
US6555692B1 (en) | 1996-02-26 | 2003-04-29 | California Institute Of Technology | Preparation and use of bifunctional molecules having DNA sequence binding specificity |
US6635417B1 (en) * | 1996-07-31 | 2003-10-21 | California Institute Of Technology | Complex formation between DSDNA and oligomer of cyclic heterocycles |
US5898031A (en) * | 1996-06-06 | 1999-04-27 | Isis Pharmaceuticals, Inc. | Oligoribonucleotides for cleaving RNA |
US9096636B2 (en) * | 1996-06-06 | 2015-08-04 | Isis Pharmaceuticals, Inc. | Chimeric oligomeric compounds and their use in gene modulation |
US7812149B2 (en) | 1996-06-06 | 2010-10-12 | Isis Pharmaceuticals, Inc. | 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations |
US20030044941A1 (en) | 1996-06-06 | 2003-03-06 | Crooke Stanley T. | Human RNase III and compositions and uses thereof |
US20040266706A1 (en) * | 2002-11-05 | 2004-12-30 | Muthiah Manoharan | Cross-linked oligomeric compounds and their use in gene modulation |
US20040161777A1 (en) * | 1996-06-06 | 2004-08-19 | Baker Brenda F. | Modified oligonucleotides for use in RNA interference |
US6111085A (en) * | 1996-09-13 | 2000-08-29 | Isis Pharmaceuticals, Inc. | Carbamate-derivatized nucleosides and oligonucleosides |
US6001991A (en) * | 1996-10-04 | 1999-12-14 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide modulation of MDR P-glycoprotein gene expression |
US7235653B2 (en) * | 1996-12-31 | 2007-06-26 | Isis Pharmaceuticals, Inc. | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
US6319906B1 (en) | 1996-12-31 | 2001-11-20 | Isis Pharmaceuticals | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
US6077833A (en) * | 1996-12-31 | 2000-06-20 | Isis Pharmaceuticals, Inc. | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
US20040023917A1 (en) * | 1996-12-31 | 2004-02-05 | Bennett C. Frank | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
US6172209B1 (en) | 1997-02-14 | 2001-01-09 | Isis Pharmaceuticals Inc. | Aminooxy-modified oligonucleotides and methods for making same |
US6127533A (en) * | 1997-02-14 | 2000-10-03 | Isis Pharmaceuticals, Inc. | 2'-O-aminooxy-modified oligonucleotides |
US6576752B1 (en) | 1997-02-14 | 2003-06-10 | Isis Pharmaceuticals, Inc. | Aminooxy functionalized oligomers |
US6251591B1 (en) | 1997-02-27 | 2001-06-26 | Lorne Park Research, Inc. | Quantitative method for detecting nucleotide concentration |
US6046004A (en) * | 1997-02-27 | 2000-04-04 | Lorne Park Research, Inc. | Solution hybridization of nucleic acids with antisense probes having modified backbones |
EP0866071B1 (en) * | 1997-03-20 | 2004-10-20 | F. Hoffmann-La Roche Ag | Modified primers |
WO1999001579A1 (en) | 1997-07-01 | 1999-01-14 | Isis Pharmaceuticals, Inc. | Compositions and methods for the delivery of oligonucleotides via the alimentary canal |
US6809193B2 (en) | 1997-08-13 | 2004-10-26 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide compositions and methods for the modulation of JNK proteins |
US20070149472A1 (en) * | 1997-08-13 | 2007-06-28 | Mckay Robert | Antisense oligonucleotide compositions and methods for the modulation of jnk proteins |
US5877309A (en) * | 1997-08-13 | 1999-03-02 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotides against JNK |
US6133246A (en) * | 1997-08-13 | 2000-10-17 | Isis Pharmaceuticals Inc. | Antisense oligonucleotide compositions and methods for the modulation of JNK proteins |
US6232463B1 (en) | 1997-10-09 | 2001-05-15 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
JPH11199597A (en) * | 1997-10-27 | 1999-07-27 | Sankyo Co Ltd | Oligodeoxyribonucleotide containing modified nucleoside or the like |
US20040171564A1 (en) * | 1997-11-20 | 2004-09-02 | Honkanen Richard E. | Antisense oligonucleotide modulation of human serine/threonine protein phosphatase gene expression |
US5948902A (en) * | 1997-11-20 | 1999-09-07 | South Alabama Medical Science Foundation | Antisense oligonucleotides to human serine/threonine protein phosphatase genes |
US5968748A (en) * | 1998-03-26 | 1999-10-19 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of human HER-2 expression |
US7321828B2 (en) | 1998-04-13 | 2008-01-22 | Isis Pharmaceuticals, Inc. | System of components for preparing oligonucleotides |
US20040186071A1 (en) | 1998-04-13 | 2004-09-23 | Bennett C. Frank | Antisense modulation of CD40 expression |
US6841539B1 (en) * | 1998-05-21 | 2005-01-11 | Isis Pharmaceuticals, Inc. | Compositions and methods for topical delivery of oligonucleotides |
EP1080103A4 (en) * | 1998-05-21 | 2003-07-02 | Isis Pharmaceuticals Inc | Compositions and methods for non-parenteral delivery of oligonucleotides |
US6255050B1 (en) | 1998-05-22 | 2001-07-03 | Lorne Park Research, Inc. | Dynamic hybridization system |
US6300319B1 (en) | 1998-06-16 | 2001-10-09 | Isis Pharmaceuticals, Inc. | Targeted oligonucleotide conjugates |
US6867294B1 (en) | 1998-07-14 | 2005-03-15 | Isis Pharmaceuticals, Inc. | Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages |
US6043352A (en) | 1998-08-07 | 2000-03-28 | Isis Pharmaceuticals, Inc. | 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides |
US20040009938A1 (en) * | 1998-08-07 | 2004-01-15 | Muthiah Manoharan | Methods of enhancing renal uptake of oligonucleotides |
US6673912B1 (en) | 1998-08-07 | 2004-01-06 | Isis Pharmaceuticals, Inc. | 2′-O-aminoethyloxyethyl-modified oligonucleotides |
US6225293B1 (en) | 1998-09-02 | 2001-05-01 | Isis Pharmaceuticals, Inc. | Methods and compounds for tracking the biodistribution of macromolecule-carrier combinations |
US6077709A (en) | 1998-09-29 | 2000-06-20 | Isis Pharmaceuticals Inc. | Antisense modulation of Survivin expression |
US6069243A (en) * | 1998-10-06 | 2000-05-30 | Isis Pharmaceuticals, Inc. | Process for oligonucleotide synthesis |
US6492111B1 (en) | 1998-11-25 | 2002-12-10 | Isis Pharmaceuticals, Inc. | In situ binary synthesis of biologically effective molecules |
US6300320B1 (en) | 1999-01-05 | 2001-10-09 | Isis Pharmaceuticals, Inc. | Modulation of c-jun using inhibitors of protein kinase C |
US6403779B1 (en) | 1999-01-08 | 2002-06-11 | Isis Pharmaceuticals, Inc. | Regioselective synthesis of 2′-O-modified nucleosides |
US6127124A (en) * | 1999-01-20 | 2000-10-03 | Isis Pharmaceuticals, Inc. | Fluorescence based nuclease assay |
US6399765B1 (en) * | 1999-03-17 | 2002-06-04 | Isis Pharmaceuticals, Inc. | Methods for removing dimethoxytrityl groups from oligonucleotides |
US6235891B1 (en) | 1999-03-31 | 2001-05-22 | South Alabama Medical Science Foundation | Glucocorticoid receptor agonist and decreased PP5 |
US7098192B2 (en) | 1999-04-08 | 2006-08-29 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of STAT3 expression |
US6656730B1 (en) | 1999-06-15 | 2003-12-02 | Isis Pharmaceuticals, Inc. | Oligonucleotides conjugated to protein-binding drugs |
US6147200A (en) * | 1999-08-19 | 2000-11-14 | Isis Pharmaceuticals, Inc. | 2'-O-acetamido modified monomers and oligomers |
US6277982B1 (en) | 1999-08-20 | 2001-08-21 | Isis Pharmaceuticals, Inc. | Alkylation of alcohols, amines, thiols and their derivatives by cyclic sulfate intermediates |
US6261840B1 (en) | 2000-01-18 | 2001-07-17 | Isis Pharmaceuticals, Inc. | Antisense modulation of PTP1B expression |
US20020055479A1 (en) | 2000-01-18 | 2002-05-09 | Cowsert Lex M. | Antisense modulation of PTP1B expression |
US6680172B1 (en) | 2000-05-16 | 2004-01-20 | Regents Of The University Of Michigan | Treatments and markers for cancers of the central nervous system |
CN1274072C (en) * | 2000-08-03 | 2006-09-06 | 松下电器产业株式会社 | Brushless motor and method of Manufacturing the brushless motor |
US8568766B2 (en) | 2000-08-24 | 2013-10-29 | Gattadahalli M. Anantharamaiah | Peptides and peptide mimetics to treat pathologies associated with eye disease |
AU2001296846B2 (en) | 2000-10-12 | 2007-07-05 | University Of Rochester | Compositions that inhibit proliferation of cancer cells |
US7767802B2 (en) | 2001-01-09 | 2010-08-03 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of anti-apoptotic genes |
US6573051B2 (en) * | 2001-03-09 | 2003-06-03 | Molecular Staging, Inc. | Open circle probes with intramolecular stem structures |
CA2441071C (en) | 2001-03-14 | 2010-06-22 | Myriad Genetics, Inc. | Tsg101-gag interaction and use thereof |
MXPA03011985A (en) | 2001-06-20 | 2004-03-26 | Genentech Inc | Compositions and methods for the diagnosis and treatment of tumor. |
US7803915B2 (en) | 2001-06-20 | 2010-09-28 | Genentech, Inc. | Antibody compositions for the diagnosis and treatment of tumor |
CA2451643C (en) | 2001-06-21 | 2012-11-13 | Isis Pharmaceuticals, Inc. | Antisense modulation of superoxide dismutase 1, soluble expression |
US6964950B2 (en) | 2001-07-25 | 2005-11-15 | Isis Pharmaceuticals, Inc. | Antisense modulation of C-reactive protein expression |
US7425545B2 (en) | 2001-07-25 | 2008-09-16 | Isis Pharmaceuticals, Inc. | Modulation of C-reactive protein expression |
US20030096772A1 (en) | 2001-07-30 | 2003-05-22 | Crooke Rosanne M. | Antisense modulation of acyl CoA cholesterol acyltransferase-2 expression |
US7407943B2 (en) | 2001-08-01 | 2008-08-05 | Isis Pharmaceuticals, Inc. | Antisense modulation of apolipoprotein B expression |
US7227014B2 (en) | 2001-08-07 | 2007-06-05 | Isis Pharmaceuticals, Inc. | Antisense modulation of apolipoprotein (a) expression |
ES2390531T3 (en) | 2001-09-18 | 2012-11-13 | Genentech, Inc. | Compositions and procedures for the diagnosis and treatment of tumor |
US6750019B2 (en) | 2001-10-09 | 2004-06-15 | Isis Pharmaceuticals, Inc. | Antisense modulation of insulin-like growth factor binding protein 5 expression |
NZ585001A (en) | 2001-10-09 | 2011-08-26 | Isis Pharmaceuticals Inc | Antisense modulation of insulin-like growth factor binding protein 5 expression |
US6965025B2 (en) | 2001-12-10 | 2005-11-15 | Isis Pharmaceuticals, Inc. | Antisense modulation of connective tissue growth factor expression |
EP2067472A1 (en) | 2002-01-02 | 2009-06-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
US7553619B2 (en) | 2002-02-08 | 2009-06-30 | Qiagen Gmbh | Detection method using dissociated rolling circle amplification |
US20030191075A1 (en) * | 2002-02-22 | 2003-10-09 | Cook Phillip Dan | Method of using modified oligonucleotides for hepatic delivery |
US20030180712A1 (en) | 2002-03-20 | 2003-09-25 | Biostratum Ab | Inhibition of the beta3 subunit of L-type Ca2+ channels |
US7169916B2 (en) * | 2002-04-01 | 2007-01-30 | Isis Pharmaceuticals, Inc. | Chloral-free DCA in oligonucleotide synthesis |
ITBO20020198A1 (en) * | 2002-04-12 | 2003-10-13 | Univ Bologna | DERIVATIVES 2, 5 BIS DIAMMINO 1, 4 BENZOCHENIONIC USEFUL FOR THE TREATMENT OF ALZHEIMER DISEASE, METHOD FOR THEIR PREPARATION AND |
NZ535925A (en) | 2002-04-16 | 2008-06-30 | Genentech Inc | An isolated antibody that binds to a particular polypeptide |
US7199107B2 (en) | 2002-05-23 | 2007-04-03 | Isis Pharmaceuticals, Inc. | Antisense modulation of kinesin-like 1 expression |
DE60333365D1 (en) | 2002-05-30 | 2010-08-26 | Sloan Kettering Inst Cancer | KINASESUPPRESSOR OF RAS INACTIVATION FOR THE THERAPY OF RAS-ASSOCIATED TUMORGENESIS |
CA2495478A1 (en) | 2002-08-05 | 2004-02-12 | University Of Rochester | Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof |
US6884880B2 (en) | 2002-08-21 | 2005-04-26 | Ash Stevens, Inc. | Process for the preparation of 9-β-anomeric nucleoside analogs |
JP2006500030A (en) | 2002-09-20 | 2006-01-05 | イェール ユニバーシティ | Riboswitch, method of using the same, and composition for use with riboswitch |
EP1549767A4 (en) | 2002-09-26 | 2006-06-07 | Amgen Inc | Modulation of forkhead box o1a expression |
US9150606B2 (en) | 2002-11-05 | 2015-10-06 | Isis Pharmaceuticals, Inc. | Compositions comprising alternating 2'-modified nucleosides for use in gene modulation |
US9150605B2 (en) | 2002-11-05 | 2015-10-06 | Isis Pharmaceuticals, Inc. | Compositions comprising alternating 2′-modified nucleosides for use in gene modulation |
EP1578765A4 (en) | 2002-11-05 | 2008-04-23 | Isis Pharmaceuticals Inc | Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
EP1560839A4 (en) | 2002-11-05 | 2008-04-23 | Isis Pharmaceuticals Inc | Chimeric oligomeric compounds and their use in gene modulation |
EP1569695B1 (en) | 2002-11-13 | 2013-05-15 | Genzyme Corporation | Antisense modulation of apolipoprotein b expression |
DK2336318T3 (en) | 2002-11-13 | 2013-07-15 | Genzyme Corp | ANTISENSE MODULATION OF APOLIPOPROTEIN B EXPRESSION |
WO2004046330A2 (en) | 2002-11-15 | 2004-06-03 | Morphotek, Inc. | Methods of generating high-production of antibodies from hybridomas created by in vitro immunization |
JP4915980B2 (en) | 2002-11-15 | 2012-04-11 | エムユーエスシー ファウンデーション フォー リサーチ デベロップメント | Complement receptor 2 targeted complement regulator |
US7557092B2 (en) | 2002-11-21 | 2009-07-07 | University Of Utah Research Foundation | Purinergic modulation of smell |
US7144999B2 (en) | 2002-11-23 | 2006-12-05 | Isis Pharmaceuticals, Inc. | Modulation of hypoxia-inducible factor 1 alpha expression |
CA2510587A1 (en) | 2002-12-20 | 2004-07-15 | Qiagen Gmbh | Nucleic acid amplification |
US9487823B2 (en) | 2002-12-20 | 2016-11-08 | Qiagen Gmbh | Nucleic acid amplification |
US6977153B2 (en) * | 2002-12-31 | 2005-12-20 | Qiagen Gmbh | Rolling circle amplification of RNA |
CA2515484C (en) | 2003-02-11 | 2011-09-20 | Antisense Therapeutics Ltd | Modulation of insulin like growth factor i receptor expression |
US7002006B2 (en) * | 2003-02-12 | 2006-02-21 | Isis Pharmaceuticals, Inc. | Protection of nucleosides |
US7803781B2 (en) | 2003-02-28 | 2010-09-28 | Isis Pharmaceuticals, Inc. | Modulation of growth hormone receptor expression and insulin-like growth factor expression |
AU2004220556B2 (en) | 2003-03-07 | 2009-05-07 | Alnylam Pharmaceuticals, Inc. | Therapeutic compositions |
US20040185559A1 (en) | 2003-03-21 | 2004-09-23 | Isis Pharmaceuticals Inc. | Modulation of diacylglycerol acyltransferase 1 expression |
US8043834B2 (en) | 2003-03-31 | 2011-10-25 | Qiagen Gmbh | Universal reagents for rolling circle amplification and methods of use |
US7598227B2 (en) | 2003-04-16 | 2009-10-06 | Isis Pharmaceuticals Inc. | Modulation of apolipoprotein C-III expression |
EP2664672A1 (en) | 2003-04-17 | 2013-11-20 | Alnylam Pharmaceuticals Inc. | Modified iRNA agents |
US7399853B2 (en) | 2003-04-28 | 2008-07-15 | Isis Pharmaceuticals | Modulation of glucagon receptor expression |
US7960355B2 (en) * | 2003-05-23 | 2011-06-14 | Isis Pharmaceuticals, Inc. | Compositions and methods for the modulation of the expression of B7 protein |
US7897582B2 (en) * | 2003-05-23 | 2011-03-01 | Isis Pharmaceuticals, Inc. | Oligonucleotide compositions and methods for the modulation of the expression of B7 protein |
WO2004108081A2 (en) | 2003-06-02 | 2004-12-16 | Isis Pharmaceuticals, Inc. | Oligonucleotide synthesis with alternative solvents |
WO2005002507A2 (en) | 2003-06-03 | 2005-01-13 | Isis Pharmaceuticals, Inc. | Modulation of survivin expression |
DK3604537T3 (en) | 2003-06-13 | 2022-02-28 | Alnylam Europe Ag | Double-stranded ribonucleic acid with increased efficiency in an organism |
CA2533701A1 (en) | 2003-07-31 | 2005-02-17 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and compositions for use in modulation of small non-coding rnas |
US7825235B2 (en) | 2003-08-18 | 2010-11-02 | Isis Pharmaceuticals, Inc. | Modulation of diacylglycerol acyltransferase 2 expression |
CN102813923B (en) | 2003-08-27 | 2015-04-01 | 奥普索特克公司 | Combination therapy for the treatment of ocular neovascular disorders |
US20050053981A1 (en) | 2003-09-09 | 2005-03-10 | Swayze Eric E. | Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini |
EP2182063A3 (en) | 2003-09-18 | 2012-07-18 | Isis Pharmaceuticals, Inc. | Modulation of EIF4E expression |
AU2004274021B2 (en) | 2003-09-18 | 2009-08-13 | Isis Pharmaceuticals, Inc. | 4'-thionucleosides and oligomeric compounds |
US7125945B2 (en) * | 2003-09-19 | 2006-10-24 | Varian, Inc. | Functionalized polymer for oligonucleotide purification |
EP1678194B1 (en) | 2003-10-10 | 2013-06-26 | Alchemia Oncology Pty Limited | The modulation of hyaluronan synthesis and degradation in the treatment of disease |
US20050191653A1 (en) | 2003-11-03 | 2005-09-01 | Freier Susan M. | Modulation of SGLT2 expression |
JP4901478B2 (en) | 2003-11-17 | 2012-03-21 | ジェネンテック, インコーポレイテッド | Compositions and methods for the treatment of tumors of hematopoietic origin |
EP1711606A2 (en) | 2004-01-20 | 2006-10-18 | Isis Pharmaceuticals, Inc. | Modulation of glucocorticoid receptor expression |
US8778900B2 (en) | 2004-01-22 | 2014-07-15 | Isis Pharmaceuticals, Inc. | Modulation of eIF4E-BP1 expression |
US7468431B2 (en) | 2004-01-22 | 2008-12-23 | Isis Pharmaceuticals, Inc. | Modulation of eIF4E-BP2 expression |
US8569474B2 (en) | 2004-03-09 | 2013-10-29 | Isis Pharmaceuticals, Inc. | Double stranded constructs comprising one or more short strands hybridized to a longer strand |
EP2700720A3 (en) | 2004-03-15 | 2015-01-28 | Isis Pharmaceuticals, Inc. | Compositions and methods for optimizing cleavage of RNA by RNASE H |
KR101147147B1 (en) * | 2004-04-01 | 2012-05-25 | 머크 샤프 앤드 돔 코포레이션 | Modified polynucleotides for reducing off-target effects in rna interference |
WO2005097817A2 (en) | 2004-04-05 | 2005-10-20 | Alnylam Pharmaceuticals, Inc. | Process and reagents for oligonucleotide synthesis and purification |
US20050244869A1 (en) | 2004-04-05 | 2005-11-03 | Brown-Driver Vickie L | Modulation of transthyretin expression |
US7674778B2 (en) | 2004-04-30 | 2010-03-09 | Alnylam Pharmaceuticals | Oligonucleotides comprising a conjugate group linked through a C5-modified pyrimidine |
DK1773872T3 (en) | 2004-05-21 | 2017-05-08 | Uab Res Found | VARIABLE Lymphocyte Receptors, Associated Polypeptides and Nucleic Acids, and Uses thereof |
US8394947B2 (en) | 2004-06-03 | 2013-03-12 | Isis Pharmaceuticals, Inc. | Positionally modified siRNA constructs |
EP2990410A1 (en) | 2004-08-10 | 2016-03-02 | Alnylam Pharmaceuticals Inc. | Chemically modified oligonucleotides |
WO2006023880A2 (en) | 2004-08-23 | 2006-03-02 | Isis Pharmaceuticals, Inc. | Compounds and methods for the characterization of oligonucleotides |
US7884086B2 (en) | 2004-09-08 | 2011-02-08 | Isis Pharmaceuticals, Inc. | Conjugates for use in hepatocyte free uptake assays |
ES2729826T3 (en) | 2004-09-23 | 2019-11-06 | Arc Medical Devices Inc | Pharmaceutical compositions and related methods to inhibit fibrous adhesions or inflammatory disease using low sulfate fucans |
US7935811B2 (en) | 2004-11-22 | 2011-05-03 | Dharmacon, Inc. | Apparatus and system having dry gene silencing compositions |
US7923207B2 (en) | 2004-11-22 | 2011-04-12 | Dharmacon, Inc. | Apparatus and system having dry gene silencing pools |
US7923206B2 (en) | 2004-11-22 | 2011-04-12 | Dharmacon, Inc. | Method of determining a cellular response to a biological agent |
US9944713B2 (en) | 2004-11-24 | 2018-04-17 | Medicinal Bioconvergence Research Center | Antibody specific to the AIMP2-DX2 |
AU2005319925B2 (en) | 2004-12-20 | 2011-10-27 | Isu Abxis Co., Ltd. | Molecules inhibition intercellular adhesion |
ES2586410T3 (en) | 2005-02-11 | 2016-10-14 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for detecting a drug resistant EGFR mutant |
CN101175769A (en) | 2005-03-10 | 2008-05-07 | 健泰科生物技术公司 | Methods and compositions for modulating vascular integrity |
US7476733B2 (en) | 2005-03-25 | 2009-01-13 | The United States Of America As Represented By The Department Of Health And Human Services | Development of a real-time PCR assay for detection of pneumococcal DNA and diagnosis of pneumococccal disease |
US8309303B2 (en) | 2005-04-01 | 2012-11-13 | Qiagen Gmbh | Reverse transcription and amplification of RNA with simultaneous degradation of DNA |
WO2007008300A2 (en) | 2005-05-31 | 2007-01-18 | ECOLE POLYTECHNIQUE FéDéRALE DE LAUSANNE | Triblock copolymers for cytoplasmic delivery of gene-based drugs |
WO2006138145A1 (en) | 2005-06-14 | 2006-12-28 | Northwestern University | Nucleic acid functionalized nanoparticles for therapeutic applications |
JP4966969B2 (en) * | 2005-06-14 | 2012-07-04 | ブリガム ヤング ユニバーシティ | Method for selective N-9 glycosylation of purines |
US8067571B2 (en) | 2005-07-13 | 2011-11-29 | Avi Biopharma, Inc. | Antibacterial antisense oligonucleotide and method |
GB0514809D0 (en) * | 2005-07-19 | 2005-08-24 | Glaxo Group Ltd | Compounds |
ATE483802T1 (en) | 2005-08-11 | 2010-10-15 | Synthetic Genomics Inc | METHOD FOR IN VITRO RECOMBINATION |
EP1915461B1 (en) | 2005-08-17 | 2018-08-01 | Dx4U GmbH | Composition and method for determination of ck19 expression |
AU2006284855B2 (en) | 2005-08-29 | 2011-10-13 | Regulus Therapeutics Inc. | Methods for use in modulating miR-122a |
EP1762627A1 (en) | 2005-09-09 | 2007-03-14 | Qiagen GmbH | Method for the activation of a nucleic acid for performing a polymerase reaction |
EP1937813A2 (en) | 2005-09-19 | 2008-07-02 | Isis Pharmaceuticals, Inc. | Modulation of glucagon receptor expression |
US20070066557A1 (en) | 2005-09-19 | 2007-03-22 | Monia Brett P | Modulation of glucocorticoid receptor expression |
US8080534B2 (en) | 2005-10-14 | 2011-12-20 | Phigenix, Inc | Targeting PAX2 for the treatment of breast cancer |
EP1934331A4 (en) | 2005-10-14 | 2009-01-21 | Musc Found For Res Dev | Targeting pax2 for the induction of defb1-mediated tumor immunity and cancer therapy |
AU2006305886C1 (en) * | 2005-10-28 | 2011-03-17 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of huntingtin gene |
US20100069461A1 (en) | 2005-11-09 | 2010-03-18 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of factor v leiden mutant gene |
JP2009516710A (en) | 2005-11-21 | 2009-04-23 | アイシス ファーマシューティカルズ, インコーポレーテッド | Modulating the expression of eIF4E-BP2 |
WO2007100412A2 (en) * | 2005-12-21 | 2007-09-07 | Yale University | Methods and compositions related to the modulation of riboswitches |
WO2007123579A2 (en) | 2005-12-28 | 2007-11-01 | Translational Therapeutics | Translational dysfunction based therapeutics |
CN101437933B (en) | 2005-12-28 | 2013-11-06 | 斯克里普斯研究所 | Natural antisense and non-coding RNA transcripts as drug targets |
EP2314594B1 (en) | 2006-01-27 | 2014-07-23 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
US7569686B1 (en) | 2006-01-27 | 2009-08-04 | Isis Pharmaceuticals, Inc. | Compounds and methods for synthesis of bicyclic nucleic acid analogs |
US8129515B2 (en) | 2006-01-27 | 2012-03-06 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and compositions for the use in modulation of microRNAs |
US7820883B2 (en) | 2006-03-15 | 2010-10-26 | Dow Agrosciences Llc | Resistance to auxinic herbicides |
KR101547579B1 (en) | 2006-03-31 | 2015-08-27 | 알닐람 파마슈티칼스 인코포레이티드 | DsRNA for inhibiting expression of Eg5 gene |
CA2651031A1 (en) | 2006-05-03 | 2007-11-08 | Baltic Technology Development, Ltd. | Antisense agents combining strongly bound base - modified oligonucleotide and artificial nuclease |
US20090326041A1 (en) | 2006-05-05 | 2009-12-31 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of sglt2 |
US7666854B2 (en) | 2006-05-11 | 2010-02-23 | Isis Pharmaceuticals, Inc. | Bis-modified bicyclic nucleic acid analogs |
WO2007134161A2 (en) | 2006-05-11 | 2007-11-22 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the pcsk9 gene |
DK2066684T3 (en) | 2006-05-11 | 2012-10-22 | Isis Pharmaceuticals Inc | 5'-Modified Bicyclic Nucleic Acid Analogs |
CN101489566B (en) | 2006-05-19 | 2012-04-18 | 阿尔尼拉姆医药品有限公司 | Rnai modulation of aha and therapeutic uses thereof |
CA2653451C (en) | 2006-05-22 | 2015-12-29 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of ikk-b gene |
US9506056B2 (en) | 2006-06-08 | 2016-11-29 | Northwestern University | Nucleic acid functionalized nanoparticles for therapeutic applications |
US20090280188A1 (en) * | 2006-06-23 | 2009-11-12 | Northwestern University | Asymmetric functionalizated nanoparticles and methods of use |
US8198253B2 (en) | 2006-07-19 | 2012-06-12 | Isis Pharmaceuticals, Inc. | Compositions and their uses directed to HBXIP |
EP2057284A4 (en) * | 2006-08-04 | 2011-06-29 | Isis Pharmaceuticals Inc | Compositions and methods for the modulation of jnk proteins |
EP2061799A4 (en) * | 2006-09-11 | 2010-12-22 | Univ Yale | Methods and compositions for the use of lysine riboswitches |
CA2663581C (en) | 2006-09-21 | 2016-03-01 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the hamp gene |
CA2663601C (en) | 2006-09-22 | 2014-11-25 | Dharmacon, Inc. | Duplex oligonucleotide complexes and methods for gene silencing by rna interference |
US20100099858A1 (en) * | 2006-09-28 | 2010-04-22 | Mirkin Chad A | Maximizing Oligonucleotide Loading on Gold Nanoparticle |
ES2611924T3 (en) | 2006-10-03 | 2017-05-11 | Arbutus Biopharma Corporation | Formulations containing lipids |
JP5560039B2 (en) | 2006-10-05 | 2014-07-23 | マサチューセッツ インスティテュート オブ テクノロジー | Multi-functional coded particles for high-throughput analysis |
WO2008136852A2 (en) | 2006-11-01 | 2008-11-13 | University Of Rochester | Methods and compositions related to the structure and function of apobec3g |
CA2672297A1 (en) | 2006-12-11 | 2008-06-19 | University Of Utah Research Foundation | Compositions and methods for treating pathologic angiogenesis and vascular permeability |
US20100129358A1 (en) | 2006-12-22 | 2010-05-27 | University Of Utah Research Foundation | Method of detecting ocular diseases and pathologic conditions and treatment of same |
EP2121987B1 (en) | 2007-02-09 | 2012-06-13 | Northwestern University | Particles for detecting intracellular targets |
US20090060889A1 (en) * | 2007-03-12 | 2009-03-05 | Von Hofe Eric | Ii-RNAi involved Ii suppression in cancer immunotherapy |
JP5750209B2 (en) * | 2007-03-16 | 2015-07-15 | アプタ バイオサイエンス リミテッド | Functional molecule, amidite for functional molecule synthesis, and target substance analysis method |
KR20100015757A (en) | 2007-03-22 | 2010-02-12 | 예일 유니버시티 | Methods and compositions related to riboswitches that control alternative splicing |
PE20090064A1 (en) | 2007-03-26 | 2009-03-02 | Novartis Ag | DOUBLE-CHAIN RIBONUCLEIC ACID TO INHIBIT THE EXPRESSION OF THE HUMAN E6AP GENE AND THE PHARMACEUTICAL COMPOSITION THAT INCLUDES IT |
JP5350360B2 (en) | 2007-03-29 | 2013-11-27 | アルナイラム ファーマシューティカルズ, インコーポレイテッド | Compositions and methods for inhibiting the expression of genes from Ebola |
US8808747B2 (en) * | 2007-04-17 | 2014-08-19 | Baxter International Inc. | Nucleic acid microparticles for pulmonary delivery |
MX2009012773A (en) * | 2007-05-29 | 2009-12-16 | Univ Yale | Riboswitches and methods and compositions for use of and with riboswitches. |
CA2687684A1 (en) * | 2007-05-29 | 2008-12-11 | Yale University | Methods and compositions related to riboswitches that control alternative splicing and rna processing |
AU2008260277C1 (en) | 2007-05-30 | 2014-04-17 | Isis Pharmaceuticals, Inc. | N-substituted-aminomethylene bridged bicyclic nucleic acid analogs |
US7807372B2 (en) * | 2007-06-04 | 2010-10-05 | Northwestern University | Screening sequence selectivity of oligonucleotide-binding molecules using nanoparticle based colorimetric assay |
DK2173760T4 (en) | 2007-06-08 | 2016-02-08 | Isis Pharmaceuticals Inc | Carbocyclic bicyclic nukleinsyreanaloge |
BRPI0814189A2 (en) | 2007-07-05 | 2015-03-03 | Novartis Ag | DOUBLE FILM RIBONUCLEIC ACID, PHARMACEUTICAL COMPOSITION AND ITS USES, METHOD FOR INHIBITING PHOSPHYDYLINOSITOL 4-KINASE EXPRESSION, VECTOR AND USE OF A COMPOUND THAT SELECTIVELY INHIBITS PHOSPHTIDYLINOSITOL-4 PHASE. |
ES2376507T5 (en) | 2007-07-05 | 2015-08-31 | Isis Pharmaceuticals, Inc. | 6-disubstituted bicyclic nucleic acid analogs |
EP2188298B1 (en) | 2007-08-15 | 2013-09-18 | Isis Pharmaceuticals, Inc. | Tetrahydropyran nucleic acid analogs |
JP2010537638A (en) | 2007-08-28 | 2010-12-09 | ユーエービー リサーチ ファウンデーション | Synthetic apolipoprotein E mimetic polypeptides and methods of use |
DK2682400T5 (en) | 2007-08-28 | 2017-11-27 | Uab Research Foundation | Synthetic apolipoprotein E mimic polypeptides and methods of use |
US8796241B2 (en) | 2007-08-29 | 2014-08-05 | Adam Lubin | Therapy of tumors and infectious agents deficient in methylthioadenosine phosphorylase |
EP2190995A2 (en) * | 2007-09-18 | 2010-06-02 | Intradigm Corporation | Compositions comprising k-ras sirna and methods of use |
US20100280097A1 (en) * | 2007-09-18 | 2010-11-04 | Intradigm Corporation | Compositions comprising hif-1 alpha sirna and methods of use thereof |
WO2009039466A1 (en) | 2007-09-20 | 2009-03-26 | Vanderbilt University | Free solution measurement of molecular interactions by backscattering interferometry |
WO2009039442A1 (en) | 2007-09-21 | 2009-03-26 | California Institute Of Technology | Nfia in glial fate determination, glioma therapy and astrocytoma treatment |
EP2222851B1 (en) | 2007-11-20 | 2017-06-28 | Ionis Pharmaceuticals, Inc. | Modulation of cd40 expression |
CA2910760C (en) | 2007-12-04 | 2019-07-09 | Muthiah Manoharan | Targeting lipids |
JP5530933B2 (en) | 2007-12-10 | 2014-06-25 | アルナイラム ファーマシューティカルズ, インコーポレイテッド | Compositions and methods for inhibiting factor VII gene expression |
EP2224912B1 (en) | 2008-01-02 | 2016-05-11 | TEKMIRA Pharmaceuticals Corporation | Improved compositions and methods for the delivery of nucleic acids |
WO2009100320A2 (en) | 2008-02-07 | 2009-08-13 | Isis Pharmaceuticals, Inc. | Bicyclic cyclohexitol nucleic acid analogs |
US8188060B2 (en) | 2008-02-11 | 2012-05-29 | Dharmacon, Inc. | Duplex oligonucleotides with enhanced functionality in gene regulation |
US10131904B2 (en) | 2008-02-11 | 2018-11-20 | Rxi Pharmaceuticals Corporation | Modified RNAi polynucleotides and uses thereof |
JP2011518117A (en) | 2008-03-05 | 2011-06-23 | アルナイラム ファーマシューティカルズ, インコーポレイテッド | Compositions and methods for inhibiting expression of Eg5 and VEGF genes |
CA2717496A1 (en) * | 2008-03-12 | 2009-09-17 | Intradigm Corporation | Compositions comprising notch1 sirna and methods of use thereof |
US8426378B2 (en) * | 2008-03-21 | 2013-04-23 | Isis Pharmaceuticals, Inc. | Oligomeric compounds comprising tricyclic nucelosides and methods for their use |
DK2285819T3 (en) | 2008-04-04 | 2013-12-02 | Isis Pharmaceuticals Inc | OLIGOMER COMPOUNDS INCLUDING NEUTRAL BONDED, TERMINAL BICYCLIC NUCLEOSIDES |
EP2274423A2 (en) | 2008-04-04 | 2011-01-19 | Isis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleosides and having reduced toxicity |
CA2721183C (en) | 2008-04-11 | 2019-07-16 | Alnylam Pharmaceuticals, Inc. | Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components |
EP2982753B1 (en) | 2008-04-18 | 2018-06-06 | Baxter International Inc. | Microsphere-based composition for preventing and/or reversing new-onset autoimmune diabetes |
EP2280995A2 (en) * | 2008-04-29 | 2011-02-09 | Wyeth LLC | Methods for treating inflammation |
BRPI0916440A2 (en) * | 2008-07-15 | 2018-06-05 | Hoffmann La Roche | compositions and methods for inhibiting tgf-beta receptor gene expression |
WO2010008582A2 (en) | 2008-07-18 | 2010-01-21 | Rxi Pharmaceuticals Corporation | Phagocytic cell drug delivery system |
WO2010017248A2 (en) | 2008-08-04 | 2010-02-11 | University Of Miami | Sting (stimulator of interferon genes), a regulator of innate immune responses |
EP3081648A1 (en) | 2008-08-25 | 2016-10-19 | Excaliard Pharmaceuticals, Inc. | Antisense oligonucleotides directed against connective tissue growth factor and uses thereof |
WO2010028054A1 (en) | 2008-09-02 | 2010-03-11 | Alnylam Europe Ag. | Compositions and methods for inhibiting expression of mutant egfr gene |
JP2012502991A (en) | 2008-09-22 | 2012-02-02 | アールエックスアイ ファーマシューティカルズ コーポレーション | RNA interference in dermal applications |
JP2012513953A (en) | 2008-09-23 | 2012-06-21 | アルニラム ファーマスーティカルズ インコーポレイテッド | Chemical modification of monomers and oligonucleotides using cycloaddition |
US8501805B2 (en) | 2008-09-24 | 2013-08-06 | Isis Pharmaceuticals, Inc. | Substituted alpha-L-bicyclic nucleosides |
EP2361256B1 (en) * | 2008-09-24 | 2013-04-10 | Isis Pharmaceuticals, Inc. | Cyclohexenyl nucleic acid analogs |
EP2334793B1 (en) | 2008-09-25 | 2016-04-06 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of serum amyloid a gene |
JP6128732B2 (en) | 2008-10-03 | 2017-05-17 | クルナ・インコーポレーテッド | Treatment of apolipoprotein-A1 related diseases by suppression of natural antisense transcripts against apolipoprotein-A1 |
WO2010042877A1 (en) | 2008-10-09 | 2010-04-15 | Tekmira Pharmaceuticals Corporation | Improved amino lipids and methods for the delivery of nucleic acids |
AU2009305636A1 (en) | 2008-10-15 | 2010-04-22 | Ionis Pharmaceuticals, Inc. | Modulation of Factor 11 expression |
EA029762B1 (en) | 2008-10-20 | 2018-05-31 | Элнилэм Фармасьютикалз, Инк. | Compositions and methods for inhibiting expression of transthyretin |
EP2447274B1 (en) | 2008-10-24 | 2017-10-04 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds and methods |
AU2009308217B2 (en) | 2008-10-24 | 2016-01-21 | Ionis Pharmaceuticals, Inc. | 5' and 2' bis-substituted nucleosides and oligomeric compounds prepared therefrom |
KR20220150995A (en) | 2008-11-10 | 2022-11-11 | 알닐람 파마슈티칼스 인코포레이티드 | Novel lipids and compositions for the delivery of therapeutics |
CA2743249A1 (en) * | 2008-11-17 | 2010-05-20 | F. Hoffmann-La Roche Ag | Compositions and methods for inhibiting expression of factor vii genes |
WO2010059226A2 (en) | 2008-11-19 | 2010-05-27 | Rxi Pharmaceuticals Corporation | Inhibition of map4k4 through rnai |
DK2365803T3 (en) | 2008-11-24 | 2018-01-22 | Univ Northwestern | POLYVALENT RNA NANOPARTICLE COMPOSITIONS |
KR101881596B1 (en) | 2008-12-02 | 2018-07-24 | 웨이브 라이프 사이언시스 재팬 인코포레이티드 | Method for the synthesis of phosphorous atom modified nucleic acids |
WO2010065792A2 (en) | 2008-12-04 | 2010-06-10 | Curna, Inc. | Treatment of erythropoietin (epo) related diseases by inhibition of natural antisense transcript to epo |
JP5971948B2 (en) | 2008-12-04 | 2016-08-17 | クルナ・インコーポレーテッド | Treatment of vascular endothelial growth factor (VEGF) -related diseases by suppression of natural antisense transcripts against VEGF |
MX366774B (en) | 2008-12-04 | 2019-07-24 | Curna Inc | Treatment of sirtuin 1 (sirt1) related diseases by inhibition of natural antisense transcript to sirtuin 1. |
ES2637063T3 (en) | 2008-12-04 | 2017-10-10 | Curna, Inc. | Treatment of diseases related to tumor suppressor genes by inhibiting the natural antisense transcript to the gene |
WO2010068816A1 (en) | 2008-12-10 | 2010-06-17 | Alnylam Pharmaceuticals, Inc. | Gnaq targeted dsrna compositions and methods for inhibiting expression |
US9493774B2 (en) | 2009-01-05 | 2016-11-15 | Rxi Pharmaceuticals Corporation | Inhibition of PCSK9 through RNAi |
US20100233270A1 (en) | 2009-01-08 | 2010-09-16 | Northwestern University | Delivery of Oligonucleotide-Functionalized Nanoparticles |
AU2010208386B2 (en) | 2009-01-27 | 2016-08-11 | Qiagen Gaithersburg | Thermophilic helicase dependent amplification technology with endpoint homogenous fluorescent detection |
CA2751342C (en) | 2009-01-29 | 2019-05-07 | Alnylam Pharmaceuticals, Inc. | Lipid formulations comprising cationic lipid and a targeting lipid comprising n-acetyl galactosamine for delivery of nucleic acid |
MX2011007776A (en) * | 2009-02-03 | 2011-08-12 | Hoffmann La Roche | Compositions and methods for inhibiting expression of ptp1b genes. |
WO2010090762A1 (en) | 2009-02-04 | 2010-08-12 | Rxi Pharmaceuticals Corporation | Rna duplexes with single stranded phosphorothioate nucleotide regions for additional functionality |
WO2010090969A1 (en) | 2009-02-06 | 2010-08-12 | Isis Pharmaceuticals, Inc. | Tetrahydropyran nucleic acid analogs |
EP2393825A2 (en) | 2009-02-06 | 2011-12-14 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and methods |
PL2396038T3 (en) | 2009-02-12 | 2016-05-31 | Curna Inc | Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf |
US20110319476A1 (en) | 2009-02-12 | 2011-12-29 | Opko Curna, Llc | Treatment of glial cell derived neurotrophic factor (gdnf) related diseases by inhibition of natural antisense transcript to gdnf |
WO2010099341A1 (en) | 2009-02-26 | 2010-09-02 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of mig-12 gene |
US8975389B2 (en) | 2009-03-02 | 2015-03-10 | Alnylam Pharmaceuticals, Inc. | Nucleic acid chemical modifications |
EP2403946A4 (en) | 2009-03-04 | 2012-11-14 | Treatment of sirtuin 1 (sirt1) related diseases by inhibition of natural antisense transcript to sirt 1 | |
JP6032724B2 (en) | 2009-03-12 | 2016-11-30 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Lipid preparation composition and method for inhibiting expression of Eg5 gene and VEGF gene |
US9464287B2 (en) | 2009-03-16 | 2016-10-11 | Curna, Inc. | Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2) related diseases by inhibition of natural antisense transcript to NRF2 |
CA2755404C (en) | 2009-03-17 | 2020-03-24 | Joseph Collard | Treatment of delta-like 1 homolog (dlk1) related diseases by inhibition of natural antisense transcript to dlk1 |
JP6145270B2 (en) | 2009-04-15 | 2017-06-07 | ノースウェスタン ユニバーシティ | Delivery of oligonucleotide functionalized nanoparticles |
EP3248618A1 (en) | 2009-04-22 | 2017-11-29 | Massachusetts Institute Of Technology | Innate immune suppression enables repeated delivery of long rna molecules |
US8318690B2 (en) | 2009-05-01 | 2012-11-27 | Curna, Inc. | Treatment of hemoglobin (HBF/HBG) related diseases by inhibition of natural antisense transcript to HBF/HBG |
SG10201402054UA (en) | 2009-05-05 | 2014-09-26 | Muthiah Manoharan | Lipid compositions |
AU2010245933B2 (en) | 2009-05-05 | 2016-06-16 | Arbutus Biopharma Corporation | Methods of delivering oligonucleotides to immune cells |
CN106237345A (en) | 2009-05-06 | 2016-12-21 | 库尔纳公司 | By suppression therapy lipid transfer and the metabolic gene relevant disease of the natural antisense transcript for lipid transfer and metabolic gene |
ES2609655T3 (en) | 2009-05-06 | 2017-04-21 | Curna, Inc. | Treatment of diseases related to tristetraproline (TTP) by inhibition of natural antisense transcript for TTP |
ES2618572T3 (en) | 2009-05-08 | 2017-06-21 | Curna, Inc. | Treatment of diseases related to the dystrophin family by inhibiting a natural antisense transcript for the dmd family |
WO2010130771A2 (en) * | 2009-05-15 | 2010-11-18 | F. Hoffmann-La Roche Ag | Compositions and methods for inhibiting expression of glucocorticoid receptor (gcr) genes |
US20120107331A1 (en) | 2009-05-15 | 2012-05-03 | Yale University | Gemm riboswitches, structure-based compound design with gemm riboswitches, and methods and compositions for use of and with gemm riboswitches |
JP5922017B2 (en) | 2009-05-18 | 2016-05-24 | クルナ・インコーポレーテッド | Treatment of reprogramming factor-related diseases by suppression of natural antisense transcripts against the reprogramming factor |
WO2010135695A2 (en) | 2009-05-22 | 2010-11-25 | Curna, Inc. | TREATMENT OF TRANSCRIPTION FACTOR E3 (TFE3) and INSULIN RECEPTOR SUBSTRATE 2 (IRS2) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO TFE3 |
EP2435571B1 (en) | 2009-05-28 | 2016-12-14 | CuRNA, Inc. | Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene |
CN104873464B (en) | 2009-06-10 | 2018-06-22 | 阿布特斯生物制药公司 | Improved lipid formulations |
KR101801404B1 (en) | 2009-06-16 | 2017-12-20 | 큐알엔에이, 인크. | Treatment of collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene |
ES2629339T3 (en) | 2009-06-16 | 2017-08-08 | Curna, Inc. | Treatment of diseases related to paraoxonase 1 (pon1) by inhibition of natural antisense transcript to pon1 |
CA2765889A1 (en) | 2009-06-24 | 2010-12-29 | Opko Curna, Llc | Treatment of tumor necrosis factor receptor 2 (tnfr2) related diseases by inhibition of natural antisense transcript to tnfr2 |
KR101807324B1 (en) | 2009-06-26 | 2017-12-08 | 큐알엔에이, 인크. | Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene |
IN2012DN00720A (en) | 2009-07-06 | 2015-06-19 | Ontorii Inc | |
US9512164B2 (en) | 2009-07-07 | 2016-12-06 | Alnylam Pharmaceuticals, Inc. | Oligonucleotide end caps |
US8927513B2 (en) | 2009-07-07 | 2015-01-06 | Alnylam Pharmaceuticals, Inc. | 5′ phosphate mimics |
CN102712925B (en) | 2009-07-24 | 2017-10-27 | 库尔纳公司 | It is diseases related that SIRTUIN (SIRT) is treated by suppressing SIRTUIN (SIRT) natural antisense transcript |
CA2769665A1 (en) | 2009-08-05 | 2011-02-10 | Opko Curna, Llc | Treatment of insulin gene (ins) related diseases by inhibition of natural antisense transcript to an insulin gene (ins) |
EP2462153B1 (en) | 2009-08-06 | 2015-07-29 | Isis Pharmaceuticals, Inc. | Bicyclic cyclohexose nucleic acid analogs |
EP2464731B1 (en) | 2009-08-11 | 2016-10-05 | CuRNA, Inc. | Treatment of adiponectin (adipoq) related diseases by inhibition of natural antisense transcript to an adiponectin (adipoq) |
AP2015008874A0 (en) | 2009-08-14 | 2015-11-30 | Alnylam Pharmaceuticals Inc | Lipid formulated compositions and methods for inhibiting expression of a gene from the ebola virus |
WO2011022420A1 (en) | 2009-08-17 | 2011-02-24 | Yale University | Methylation biomarkers and methods of use |
WO2011022606A2 (en) | 2009-08-21 | 2011-02-24 | Curna, Inc. | Treatment of 'c terminus of hsp70-interacting protein' (chip) related diseases by inhibition of natural antisense transcript to chip |
KR101892760B1 (en) | 2009-08-25 | 2018-08-28 | 큐알엔에이, 인크. | Treatment of 'iq motif containing gtpase activating protein' (iqgap) related diseases by inhibition of natural antisense transcript to iqgap |
DK2473522T3 (en) | 2009-09-02 | 2016-11-28 | Genentech Inc | Smoothened MUTANT AND METHODS OF USING THE SAME |
CN102791861B (en) | 2009-09-25 | 2018-08-07 | 库尔纳公司 | FLG relevant diseases are treated by adjusting expression and the activity of Filaggrin (FLG) |
RU2539772C2 (en) | 2009-10-22 | 2015-01-27 | Дженентек, Инк. | Methods and compositions for hepsin modulation of macrophage-stimulating protein |
EP2494066B1 (en) | 2009-10-27 | 2017-04-05 | Swift Biosciences, Inc. | Bimolecular primers |
AU2010313154B2 (en) | 2009-10-30 | 2016-05-12 | Northwestern University | Templated nanoconjugates |
KR20120102674A (en) | 2009-11-03 | 2012-09-18 | 유니버시티 오브 버지니아 페이턴트 파운데이션 | Versatile, visible method for detecting polymeric analytes |
WO2011054939A2 (en) | 2009-11-09 | 2011-05-12 | F. Hoffmann-La Roche Ag | Compositions and methods for inhibiting expression of kif10 genes |
EP2504450B1 (en) | 2009-11-23 | 2016-07-06 | Swift Biosciences, Inc. | Devices to extend single stranded target molecules |
PE20121584A1 (en) | 2009-11-30 | 2012-11-29 | Genentech Inc | COMPOSITIONS AND METHODS FOR THE DIAGNOSIS AND TREATMENT OF TUMORS |
CA3044884A1 (en) | 2009-12-07 | 2011-06-16 | Arbutus Biopharma Corporation | Compositions for nucleic acid delivery |
ES2661813T3 (en) | 2009-12-16 | 2018-04-04 | Curna, Inc. | Treatment of diseases related to membrane transcription factor peptidase, site 1 (mbtps1) by inhibition of the natural antisense transcript to the mbtps1 gene |
US20110152349A1 (en) * | 2009-12-18 | 2011-06-23 | Anke Geick | Compositions and methods for inhibiting expression of il-18 genes |
US20130017223A1 (en) | 2009-12-18 | 2013-01-17 | The University Of British Columbia | Methods and compositions for delivery of nucleic acids |
WO2011079261A2 (en) | 2009-12-23 | 2011-06-30 | Curna, Inc. | Treatment of hepatocyte growth factor (hgf) related diseases by inhibition of natural antisense transcript to hgf |
EP2515947B1 (en) | 2009-12-23 | 2021-10-06 | CuRNA, Inc. | Treatment of uncoupling protein 2 (ucp2) related diseases by inhibition of natural antisense transcript to ucp2 |
RU2615450C2 (en) | 2009-12-29 | 2017-04-04 | Курна, Инк. | Treating diseases associated with nuclear respiratory factor 1 (nrf1) by inhibition of natural antisense transcript to nrf1 |
JP5982288B2 (en) | 2009-12-29 | 2016-08-31 | カッパーアールエヌエー,インコーポレイテッド | Treatment of tumor protein 63-related diseases by inhibition of natural antisense transcripts against tumor protein 63 (p63) |
EP2519632B1 (en) | 2009-12-31 | 2018-04-11 | CuRNA, Inc. | Treatment of insulin receptor substrate 2 (irs2) related diseases by inhibition of natural antisense transcript to irs2 and transcription factor e3 (tfe3) |
DK2521784T3 (en) | 2010-01-04 | 2018-03-12 | Curna Inc | TREATMENT OF INTERFERON REGULATORY FACTOR 8- (IRF8) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENCE TRANSCRIPT TO IRF8 |
JP5963680B2 (en) | 2010-01-06 | 2016-08-03 | カッパーアールエヌエー,インコーポレイテッド | Treatment of pancreatic developmental gene diseases by inhibition of natural antisense transcripts against pancreatic developmental genes |
WO2011085347A2 (en) | 2010-01-11 | 2011-07-14 | Opko Curna, Llc | Treatment of sex hormone binding globulin (shbg) related diseases by inhibition of natural antisense transcript to shbg |
US8779118B2 (en) | 2010-01-11 | 2014-07-15 | Isis Pharmaceuticals, Inc. | Base modified bicyclic nucleosides and oligomeric compounds prepared therefrom |
EP2524042A2 (en) | 2010-01-12 | 2012-11-21 | Yale University | Structured rna motifs and compounds and methods for their use |
ES2671877T3 (en) | 2010-01-25 | 2018-06-11 | Curna, Inc. | Treatment of diseases related to RNASA (H1) by inhibition of the natural antisense transcript to RNASA H1 |
US9198972B2 (en) | 2010-01-28 | 2015-12-01 | Alnylam Pharmaceuticals, Inc. | Monomers and oligonucleotides comprising cycloaddition adduct(s) |
WO2011094580A2 (en) | 2010-01-28 | 2011-08-04 | Alnylam Pharmaceuticals, Inc. | Chelated copper for use in the preparation of conjugated oligonucleotides |
CA2824843A1 (en) | 2010-02-04 | 2011-08-11 | Ico Therapeutics Inc. | Dosing regimens for treating and preventing ocular disorders using c-raf antisense |
TW201129365A (en) | 2010-02-05 | 2011-09-01 | Hoffmann La Roche | Compositions and methods for inhibiting expression of IKK2 genes |
CN102844435B (en) | 2010-02-22 | 2017-05-10 | 库尔纳公司 | Treatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1 |
KR20130004579A (en) | 2010-02-23 | 2013-01-11 | 제넨테크, 인크. | Compositions and methods for the diagnosis and treatment of tumor |
WO2011105901A2 (en) | 2010-02-23 | 2011-09-01 | Academisch Ziekenhuis Bij De Universiteit Van Amsterdam | Antagonists of complement component 9 (c9) and uses thereof |
WO2011105902A2 (en) | 2010-02-23 | 2011-09-01 | Academisch Ziekenhuis Bij De Universiteit Van Amsterdam | Antagonists of complement component 8-beta (c8-beta) and uses thereof |
WO2011105900A2 (en) | 2010-02-23 | 2011-09-01 | Academisch Ziekenhuis Bij De Universiteit Van Amsterdam | Antagonists of complement component 8-alpha (c8-alpha) and uses thereof |
EP2539357B1 (en) | 2010-02-26 | 2017-06-14 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for the detection and treatment of cancer involving mirnas and mirna inhibitors and targets |
WO2011109427A2 (en) | 2010-03-01 | 2011-09-09 | Alnylam Pharmaceuticals, Inc. | Improving the biological activity of sirna through modulation of its thermodynamic profile |
WO2011112516A1 (en) | 2010-03-08 | 2011-09-15 | Ico Therapeutics Inc. | Treating and preventing hepatitis c virus infection using c-raf kinase antisense oligonucleotides |
EP2544703A4 (en) | 2010-03-12 | 2013-09-18 | Brigham & Womens Hospital | Methods of treating vascular inflammatory disorders |
US20130101512A1 (en) | 2010-03-12 | 2013-04-25 | Chad A. Mirkin | Crosslinked polynucleotide structure |
WO2011115817A1 (en) | 2010-03-16 | 2011-09-22 | Isis Pharmaceuticals, Inc. | Methods of preparing 2'-o-substituted purine nucleosides |
US9193752B2 (en) | 2010-03-17 | 2015-11-24 | Isis Pharmaceuticals, Inc. | 5′-substituted bicyclic nucleosides and oligomeric compounds prepared therefrom |
WO2011119852A1 (en) | 2010-03-24 | 2011-09-29 | Rxi Pharmaceuticals Corporation | Reduced size self-delivering rnai compounds |
WO2011119871A1 (en) | 2010-03-24 | 2011-09-29 | Rxi Phrmaceuticals Corporation | Rna interference in ocular indications |
BR112012024049A2 (en) | 2010-03-24 | 2017-03-01 | Rxi Pharmaceuticals Corp | rna interference on dermal and fibrotic indications |
US8889350B2 (en) | 2010-03-26 | 2014-11-18 | Swift Biosciences, Inc. | Methods and compositions for isolating polynucleotides |
AU2011235276B2 (en) | 2010-03-29 | 2015-09-03 | Alnylam Pharmaceuticals, Inc. | SiRNA therapy for transthyretin (TTR) related ocular amyloidosis |
WO2011123621A2 (en) | 2010-04-01 | 2011-10-06 | Alnylam Pharmaceuticals Inc. | 2' and 5' modified monomers and oligonucleotides |
RU2612884C2 (en) | 2010-04-02 | 2017-03-13 | Курна, Инк. | Treatment of diseases associated with colonystimulating factor 3 (csf3) by inhibition of natural antisense transcript to csf3 |
EP2556160A4 (en) | 2010-04-09 | 2013-08-21 | Curna Inc | Treatment of fibroblast growth factor 21 (fgf21) related diseases by inhibition of natural antisense transcript to fgf21 |
WO2011133695A2 (en) | 2010-04-20 | 2011-10-27 | Swift Biosciences, Inc. | Materials and methods for nucleic acid fractionation by solid phase entrapment and enzyme-mediated detachment |
US9725479B2 (en) | 2010-04-22 | 2017-08-08 | Ionis Pharmaceuticals, Inc. | 5′-end derivatives |
WO2011133868A2 (en) | 2010-04-22 | 2011-10-27 | Alnylam Pharmaceuticals, Inc. | Conformationally restricted dinucleotide monomers and oligonucleotides |
US10913767B2 (en) | 2010-04-22 | 2021-02-09 | Alnylam Pharmaceuticals, Inc. | Oligonucleotides comprising acyclic and abasic nucleosides and analogs |
US9156873B2 (en) | 2010-04-28 | 2015-10-13 | Isis Pharmaceuticals, Inc. | Modified 5′ diphosphate nucleosides and oligomeric compounds prepared therefrom |
EP2625186B1 (en) | 2010-04-28 | 2016-07-27 | Ionis Pharmaceuticals, Inc. | 5' modified nucleosides and oligomeric compounds prepared therefrom |
CN103154014B (en) | 2010-04-28 | 2015-03-25 | Isis制药公司 | Modified nucleosides, modified nucleosides-like and oligomeric compounds prepared therefrom |
ES2625689T3 (en) | 2010-04-29 | 2017-07-20 | Ionis Pharmaceuticals, Inc. | Modulation of transthyretin expression |
WO2011139911A2 (en) | 2010-04-29 | 2011-11-10 | Isis Pharmaceuticals, Inc. | Lipid formulated single stranded rna |
CN107090045A (en) | 2010-05-03 | 2017-08-25 | 霍夫曼-拉罗奇有限公司 | Composition and method for tumor diagnosis and therapy |
WO2011139387A1 (en) | 2010-05-03 | 2011-11-10 | Opko Curna, Llc | Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt) |
TWI586356B (en) | 2010-05-14 | 2017-06-11 | 可娜公司 | Treatment of par4 related diseases by inhibition of natural antisense transcript to par4 |
WO2011150226A1 (en) | 2010-05-26 | 2011-12-01 | Landers James P | Method for detecting nucleic acids based on aggregate formation |
KR20180053419A (en) | 2010-05-26 | 2018-05-21 | 큐알엔에이, 인크. | Treatment of atonal homolog 1 (atoh1) related diseases by inhibition of natural antisense transcript to atoh1 |
EP2576784B1 (en) | 2010-05-26 | 2017-11-15 | CuRNA, Inc. | Treatment of methionine sulfoxide reductase a (msra) related diseases by inhibition of natural antisense transcript to msra |
US8628914B2 (en) | 2010-05-26 | 2014-01-14 | Qiagen Gaithersburg, Inc. | Quantitative helicase assay |
KR102095478B1 (en) | 2010-05-28 | 2020-04-01 | 사렙타 쎄러퓨틱스, 인코퍼레이티드 | Oligonucleotide analogues having modified intersubunit linkages and/or terminal groups |
EP2576579B1 (en) | 2010-06-02 | 2018-08-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods directed to treating liver fibrosis |
US8957200B2 (en) | 2010-06-07 | 2015-02-17 | Isis Pharmaceuticals, Inc. | Bicyclic nucleosides and oligomeric compounds prepared therefrom |
US9476101B2 (en) | 2010-06-07 | 2016-10-25 | Firefly Bioworks, Inc. | Scanning multifunctional particles |
US8846637B2 (en) | 2010-06-08 | 2014-09-30 | Isis Pharmaceuticals, Inc. | Substituted 2′-amino and 2′-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom |
US9638632B2 (en) | 2010-06-11 | 2017-05-02 | Vanderbilt University | Multiplexed interferometric detection system and method |
WO2011159836A2 (en) | 2010-06-15 | 2011-12-22 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating interaction between proteins and target nucleic acids |
US9168297B2 (en) | 2010-06-23 | 2015-10-27 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Regulation of skin pigmentation by neuregulin-1 (NRG-1) |
WO2011163499A2 (en) | 2010-06-23 | 2011-12-29 | Opko Curna, Llc | Treatment of sodium channel, voltage-gated, alpha subunit (scna) related diseases by inhibition of natural antisense transcript to scna |
WO2012009402A2 (en) | 2010-07-14 | 2012-01-19 | Opko Curna Llc | Treatment of discs large homolog (dlg) related diseases by inhibition of natural antisense transcript to dlg |
DK3031920T3 (en) | 2010-07-19 | 2019-10-14 | Ionis Pharmaceuticals Inc | MODULATION OF DYSTROPHY MYOTONICA-PROTEIN KINASE (DMPK) EXPRESSION |
WO2012016188A2 (en) | 2010-07-30 | 2012-02-02 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for delivery of active agents |
WO2012016184A2 (en) | 2010-07-30 | 2012-02-02 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for delivery of active agents |
WO2012021554A1 (en) | 2010-08-09 | 2012-02-16 | Yale University | Cyclic di-gmp-ii riboswitches, motifs, and compounds, and methods for their use |
US10017763B2 (en) | 2010-09-03 | 2018-07-10 | Sarepta Therapeutics, Inc. | dsRNA molecules comprising oligonucleotide analogs having modified intersubunit linkages and/or terminal groups |
US10428019B2 (en) | 2010-09-24 | 2019-10-01 | Wave Life Sciences Ltd. | Chiral auxiliaries |
AU2011312205B2 (en) | 2010-10-05 | 2015-08-13 | Curis, Inc. | Mutant smoothened and methods of using the same |
CA2813901C (en) | 2010-10-06 | 2019-11-12 | Curna, Inc. | Treatment of sialidase 4 (neu4) related diseases by inhibition of natural antisense transcript to neu4 |
US20140031250A1 (en) | 2010-10-07 | 2014-01-30 | David Tsai Ting | Biomarkers of Cancer |
EP2630240A1 (en) | 2010-10-18 | 2013-08-28 | Arrowhead Research Corporation | Compositions and methods for inhibiting expression of rrm2 genes |
US8648053B2 (en) | 2010-10-20 | 2014-02-11 | Rosalind Franklin University Of Medicine And Science | Antisense oligonucleotides that target a cryptic splice site in Ush1c as a therapeutic for Usher syndrome |
EP2630241B1 (en) | 2010-10-22 | 2018-10-17 | CuRNA, Inc. | Treatment of alpha-l-iduronidase (idua) related diseases by inhibition of natural antisense transcript to idua |
ES2677070T3 (en) | 2010-10-27 | 2018-07-27 | Curna, Inc. | Treatment of diseases related to the developmental regulator 1 associated with interferon (ifrd1) by inhibition of the natural antisense transcript to the ifrd1 gene |
CN110123830A (en) | 2010-11-09 | 2019-08-16 | 阿尔尼拉姆医药品有限公司 | Composition and method for inhibiting the lipid of the expression of Eg5 and VEGF gene to prepare |
EP2638163B1 (en) | 2010-11-12 | 2017-05-17 | The General Hospital Corporation | Polycomb-associated non-coding rnas |
EP2640853B1 (en) | 2010-11-17 | 2018-12-26 | Ionis Pharmaceuticals, Inc. | Modulation of alpha synuclein expression |
US10000752B2 (en) | 2010-11-18 | 2018-06-19 | Curna, Inc. | Antagonat compositions and methods of use |
ES2657590T3 (en) | 2010-11-23 | 2018-03-06 | Curna, Inc. | Treatment of nanog related diseases by inhibiting the natural antisense transcript to nanog |
US9150926B2 (en) | 2010-12-06 | 2015-10-06 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Diagnosis and treatment of adrenocortical tumors using human microRNA-483 |
WO2012078967A2 (en) | 2010-12-10 | 2012-06-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for increasing erythropoietin (epo) production |
EP2648763A4 (en) | 2010-12-10 | 2014-05-14 | Alnylam Pharmaceuticals Inc | Compositions and methods for inhibiting expression of klf-1 and bcl11a genes |
WO2012099755A1 (en) | 2011-01-11 | 2012-07-26 | Alnylam Pharmaceuticals, Inc. | Pegylated lipids and their use for drug delivery |
US9045749B2 (en) | 2011-01-14 | 2015-06-02 | The General Hospital Corporation | Methods targeting miR-128 for regulating cholesterol/lipid metabolism |
TWI593416B (en) | 2011-02-02 | 2017-08-01 | 艾克厘德製藥公司 | Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (ctgf) |
US20130338178A1 (en) | 2011-02-02 | 2013-12-19 | The Trustees Of Princeton University | Sirtuin modulators as inhibitors of cytomegalovirus |
EP2673381A4 (en) | 2011-02-07 | 2014-10-15 | Univ Toronto | Bioprobes and methods of use thereof |
US10017764B2 (en) | 2011-02-08 | 2018-07-10 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleotides and uses thereof |
US9562853B2 (en) | 2011-02-22 | 2017-02-07 | Vanderbilt University | Nonaqueous backscattering interferometric methods |
JP6108628B2 (en) | 2011-03-29 | 2017-04-05 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Composition and method for inhibiting expression of TMPRSS6 gene |
EP2694660B1 (en) | 2011-04-03 | 2018-08-08 | The General Hospital Corporation | Efficient protein expression in vivo using modified rna (mod-rna) |
US20140186844A1 (en) | 2011-04-26 | 2014-07-03 | Swift Biosciences, Inc. | Polynucleotide primers and probes |
US9353371B2 (en) | 2011-05-02 | 2016-05-31 | Ionis Pharmaceuticals, Inc. | Antisense compounds targeting genes associated with usher syndrome |
WO2012151268A1 (en) | 2011-05-02 | 2012-11-08 | University Of Virginia Patent Foundation | Method and system for high throughput optical and label free detection of analytes |
WO2012151289A2 (en) | 2011-05-02 | 2012-11-08 | University Of Virginia Patent Foundation | Method and system to detect aggregate formation on a substrate |
RU2620980C2 (en) | 2011-06-09 | 2017-05-30 | Курна, Инк. | Treatment of diseases associated with frataxin (fxn), by inhibiting natural antisense fxn transcript |
WO2012170347A1 (en) | 2011-06-09 | 2012-12-13 | Isis Pharmaceuticals, Inc. | Bicyclic nucleosides and oligomeric compounds prepared therefrom |
RU2631805C2 (en) | 2011-06-21 | 2017-09-26 | Элнилэм Фармасьютикалз, Инк. | Compositions and methods for apolipoprotein c-iii (apoc3) gene expression inhibition |
EP3388068A1 (en) | 2011-06-21 | 2018-10-17 | Alnylam Pharmaceuticals, Inc. | Composition and methods for inhibition of expression of protein c (proc) genes |
CN103890000B (en) | 2011-06-21 | 2017-09-01 | 阿尔尼拉姆医药品有限公司 | (ANGPTL3) the iRNA compositions of angiopoietin-like 3 and its application method |
EP3366312A1 (en) | 2011-06-23 | 2018-08-29 | Alnylam Pharmaceuticals, Inc. | Serpina 1 sirnas: compositions of matter and methods of treatment |
US20140227293A1 (en) | 2011-06-30 | 2014-08-14 | Trustees Of Boston University | Method for controlling tumor growth, angiogenesis and metastasis using immunoglobulin containing and proline rich receptor-1 (igpr-1) |
US9222093B2 (en) | 2011-06-30 | 2015-12-29 | The University Of Hong Kong | Two-way, portable riboswitch mediated gene expression control device |
TW202244278A (en) | 2011-06-30 | 2022-11-16 | 美商艾羅海德製藥公司 | Compositions and methods for inhibiting gene expression of hepatitis b virus |
BR112014001244A2 (en) | 2011-07-19 | 2017-02-21 | Wave Life Sciences Pte Ltd | methods for the synthesis of functionalized nucleic acids |
US20140328811A1 (en) | 2011-08-01 | 2014-11-06 | Alnylam Pharmaceuticals, Inc. | Method for improving the success rate of hematopoietic stem cell transplants |
US10202599B2 (en) | 2011-08-11 | 2019-02-12 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
EP3640332A1 (en) | 2011-08-29 | 2020-04-22 | Ionis Pharmaceuticals, Inc. | Oligomer-conjugate complexes and their use |
US9976138B2 (en) | 2011-08-29 | 2018-05-22 | Ionis Pharmaceuticals, Inc. | Methods and compounds useful in conditions related to repeat expansion |
US10583128B2 (en) | 2011-09-06 | 2020-03-10 | Curna, Inc. | Treatment of diseases related to alpha subunits of sodium channels, voltage-gated (SCNxA) with small molecules |
JP6129844B2 (en) | 2011-09-14 | 2017-05-17 | ラナ セラピューティクス インコーポレイテッド | Multimeric oligonucleotide compounds |
CA2847698C (en) | 2011-09-14 | 2020-09-01 | Northwestern University | Nanoconjugates able to cross the blood-brain barrier |
WO2013040548A2 (en) | 2011-09-17 | 2013-03-21 | Yale University | Fluoride-responsive riboswitchs, fluoride transporters, and methods of use |
WO2013049328A1 (en) | 2011-09-27 | 2013-04-04 | Alnylam Pharmaceuticals, Inc. | Di-aliphatic substituted pegylated lipids |
BR112014008925A2 (en) | 2011-10-11 | 2020-10-27 | The Brigham And Women's Hospital, Inc. | micro rnas in neurodegenerative disorders |
US9738727B2 (en) | 2011-10-14 | 2017-08-22 | Genentech, Inc. | Anti-HtrA1 antibodies and methods of use |
EP2780299A4 (en) | 2011-11-18 | 2015-04-22 | Sarepta Therapeutics Inc | Functionally-modified oligonucleotides and subunits thereof |
US9243291B1 (en) | 2011-12-01 | 2016-01-26 | Isis Pharmaceuticals, Inc. | Methods of predicting toxicity |
DK2790736T3 (en) | 2011-12-12 | 2018-05-07 | Oncoimmunin Inc | In vivo delivery of oligonucleotides |
WO2013106770A1 (en) | 2012-01-11 | 2013-07-18 | Isis Pharmaceuticals, Inc. | Compositions and methods for modulation of ikbkap splicing |
US8846885B2 (en) | 2012-02-17 | 2014-09-30 | Ajinomoto Co., Inc. | Oligonucleotide with protected base |
SG11201405669XA (en) | 2012-03-13 | 2014-10-30 | Swift Biosciences Inc | Methods and compositions for size-controlled homopolymer tailing of substrate polynucleotides by a nucleic acid polymerase |
US20150031750A1 (en) | 2012-03-15 | 2015-01-29 | The Scripps Research Institute | Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf |
US9610362B2 (en) | 2012-03-16 | 2017-04-04 | Valerion Therapeutics, Llc | Antisense conjugates for decreasing expression of DMPK |
US20150086584A1 (en) | 2012-03-22 | 2015-03-26 | University Of Miami | Multi-specific binding agents |
EP2831231A1 (en) | 2012-03-30 | 2015-02-04 | Isis Pharmaceuticals, Inc. | Compositions and methods for modulating tau expression for reducing seizure and modifying a neurodegenerative syndrome |
WO2013154799A1 (en) | 2012-04-09 | 2013-10-17 | Isis Pharmaceuticals, Inc. | Tricyclic nucleosides and oligomeric compounds prepared therefrom |
EP2850092B1 (en) | 2012-04-09 | 2017-03-01 | Ionis Pharmaceuticals, Inc. | Tricyclic nucleic acid analogs |
US9133461B2 (en) | 2012-04-10 | 2015-09-15 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the ALAS1 gene |
CN104704122A (en) | 2012-04-20 | 2015-06-10 | 艾珀特玛治疗公司 | miRNA modulators of thermogenesis |
WO2013159108A2 (en) | 2012-04-20 | 2013-10-24 | Isis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleotides and uses thereof |
US9127274B2 (en) | 2012-04-26 | 2015-09-08 | Alnylam Pharmaceuticals, Inc. | Serpinc1 iRNA compositions and methods of use thereof |
US9273949B2 (en) | 2012-05-11 | 2016-03-01 | Vanderbilt University | Backscattering interferometric methods |
US10059941B2 (en) | 2012-05-16 | 2018-08-28 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
CA2873809A1 (en) | 2012-05-16 | 2013-11-21 | Rana Therapeutics, Inc. | Compositions and methods for modulating gene expression |
US9574193B2 (en) | 2012-05-17 | 2017-02-21 | Ionis Pharmaceuticals, Inc. | Methods and compositions for modulating apolipoprotein (a) expression |
WO2013173789A2 (en) | 2012-05-17 | 2013-11-21 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide compositions |
US9828602B2 (en) | 2012-06-01 | 2017-11-28 | Ionis Pharmaceuticals, Inc. | Antisense compounds targeting genes associated with fibronectin |
WO2013181666A2 (en) | 2012-06-01 | 2013-12-05 | Isis Pharmaceuticals, Inc. | Antisense compounds targeting genes associated with fibronectin |
WO2013184209A1 (en) | 2012-06-04 | 2013-12-12 | Ludwig Institute For Cancer Research Ltd. | Mif for use in methods of treating subjects with a neurodegenerative disorder |
WO2013185097A1 (en) | 2012-06-08 | 2013-12-12 | The Regents Of The University Of Michigan | Ultrasound-triggerable agents for tissue engineering |
EP2872147B1 (en) | 2012-07-13 | 2022-12-21 | Wave Life Sciences Ltd. | Method for making chiral oligonucleotides |
EP2873674B1 (en) | 2012-07-13 | 2020-05-06 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant |
BR112015000784A8 (en) | 2012-07-13 | 2018-04-03 | Wave Life Sciences Japan | ASYMMETRICAL AUXILIARY GROUP |
US20140038182A1 (en) | 2012-07-17 | 2014-02-06 | Dna Logix, Inc. | Cooperative primers, probes, and applications thereof |
US20150216892A1 (en) | 2012-08-03 | 2015-08-06 | Aptamir Therapeutics, Inc. | Cell-specific delivery of mirna modulators for the treatment of obesity and related disorders |
EP2885312A4 (en) | 2012-08-15 | 2016-01-20 | Isis Pharmaceuticals Inc | Method of preparing oligomeric compounds using modified capping protocols |
LT3421602T (en) | 2012-09-06 | 2021-05-25 | The University Of Chicago | Antisense polynucleotides to induce exon skipping and methods of treating dystrophies |
EP2906699A4 (en) | 2012-10-11 | 2016-06-08 | Ionis Pharmaceuticals Inc | Oligomeric compounds comprising bicyclic nucleosides and uses thereof |
WO2014059356A2 (en) | 2012-10-12 | 2014-04-17 | Isis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
EP4144845B1 (en) | 2012-10-12 | 2024-04-24 | Ionis Pharmaceuticals, Inc. | Antisense compounds and uses thereof |
US9029335B2 (en) | 2012-10-16 | 2015-05-12 | Isis Pharmaceuticals, Inc. | Substituted 2′-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom |
US10548962B2 (en) | 2012-10-22 | 2020-02-04 | The Board Of Regents For Oklahoma State University | Use of the salmonella SPP type III secretion proteins as a protective vaccination |
US9950053B2 (en) | 2012-10-22 | 2018-04-24 | The Board Of Regents For Oklahoma State University | Use of the Salmonella SPP type III secretion proteins as a protective vaccination |
EP2912179A4 (en) | 2012-10-26 | 2016-10-12 | Geron Corp | C-myc antisense oligonucleotides and methods for using the same to treat cell-proliferative disorders |
EP2914621B1 (en) | 2012-11-05 | 2023-06-07 | Foundation Medicine, Inc. | Novel ntrk1 fusion molecules and uses thereof |
WO2014093537A1 (en) | 2012-12-11 | 2014-06-19 | Isis Pharmaceuticals, Inc. | Competitive modulation of micrornas |
CA2898326C (en) | 2013-01-18 | 2022-05-17 | Foundation Medicine, Inc. | Methods of treating cholangiocarcinoma |
US10260069B2 (en) | 2013-02-04 | 2019-04-16 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
US20150366890A1 (en) | 2013-02-25 | 2015-12-24 | Trustees Of Boston University | Compositions and methods for treating fungal infections |
JP2016519083A (en) | 2013-03-14 | 2016-06-30 | アンデス バイオテクノロジーズ ソシエダード アノニマAndes Biotechnologies S.A. | Methods for detecting and treating multiple myeloma |
EP2971142B1 (en) | 2013-03-14 | 2020-06-24 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating tau expression |
PL2970970T3 (en) | 2013-03-14 | 2019-06-28 | Andes Biotechnologies Global, Inc. | Antisense oligonucleotides for treatment of cancer stem cells |
HUE034987T2 (en) | 2013-03-14 | 2018-05-02 | Alnylam Pharmaceuticals Inc | Complement component c5 irna compositions and methods of use thereof |
EP2971160B1 (en) | 2013-03-15 | 2018-05-30 | Bio-Rad Laboratories, Inc. | Digital assays for mutation detection |
CA2918194C (en) | 2013-03-27 | 2022-12-06 | The General Hospital Corporation | Methods and agents for treating alzheimer's disease |
EP2981617B1 (en) | 2013-04-04 | 2023-07-05 | President and Fellows of Harvard College | Therapeutic uses of genome editing with crispr/cas systems |
WO2015012916A2 (en) | 2013-04-23 | 2015-01-29 | Northwestern University | Metal-ligand coordination polymer nanoparticles and methods for making |
EA031393B1 (en) | 2013-05-01 | 2018-12-28 | Ионис Фармасьютикалз, Инк. | Compositions and methods for modulating hbv and ttr expression |
BR112015029276B1 (en) | 2013-05-22 | 2022-07-12 | Alnylam Pharmaceuticals, Inc | DUAL STRIP IRNA AGENT CAPABLE OF INHIBITING THE EXPRESSION OF TMPRSS6, PHARMACEUTICAL COMPOSITION AND USE THEREOF |
PT2999785T (en) | 2013-05-22 | 2018-07-09 | Alnylam Pharmaceuticals Inc | Serpina1 irna compositions and methods of use thereof |
EP3004396B1 (en) | 2013-06-06 | 2019-10-16 | The General Hospital Corporation | Compositions for the treatment of cancer |
US20160129089A1 (en) | 2013-06-13 | 2016-05-12 | Antisense Therapeutics Ltd | Combination therapy |
US20160122761A1 (en) | 2013-06-21 | 2016-05-05 | Isis Pharmaceuticals, Inc. | Compositions and methods for modulation of target nucleic acids |
US10077236B2 (en) | 2013-07-15 | 2018-09-18 | The Regents Of The University Of California | Azacyclic constrained analogs of FTY720 |
TWI657819B (en) | 2013-07-19 | 2019-05-01 | 美商Ionis製藥公司 | Compositions for modulating tau expression |
US10435430B2 (en) | 2013-07-31 | 2019-10-08 | Ionis Pharmaceuticals, Inc. | Methods and compounds useful in conditions related to repeat expansion |
AU2014306271A1 (en) | 2013-08-08 | 2016-03-24 | The Scripps Research Institute | A method for the site-specific enzymatic labelling of nucleic acids in vitro by incorporation of unnatural nucleotides |
TW201536329A (en) | 2013-08-09 | 2015-10-01 | Isis Pharmaceuticals Inc | Compounds and methods for modulation of dystrophia myotonica-protein kinase (DMPK) expression |
US9943604B2 (en) | 2013-09-20 | 2018-04-17 | Ionis Pharmaceuticals, Inc. | Targeted therapeutic nucleosides and their use |
EP3052626A1 (en) | 2013-10-02 | 2016-08-10 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
EP3052107B1 (en) | 2013-10-04 | 2018-05-02 | Novartis AG | Organic compounds to treat hepatitis b virus |
AU2014329560B2 (en) | 2013-10-04 | 2017-03-02 | Novartis Ag | 3'end caps for RNAi agents for use in RNA interference |
WO2015051366A2 (en) | 2013-10-04 | 2015-04-09 | Novartis Ag | Novel formats for organic compounds for use in rna interference |
UA124961C2 (en) | 2013-10-04 | 2021-12-22 | Елнілем Фармасьютикалз, Інк. | Compositions and methods for inhibiting expression of the alas1 gene |
WO2015054451A1 (en) | 2013-10-09 | 2015-04-16 | The United States Of America As Represented By The Secretary Department Of Health And Human Services | Detection of hepatitis delta virus (hdv) for the diagnosis and treatment of sjögren's syndrome and lymphoma |
US11162096B2 (en) | 2013-10-14 | 2021-11-02 | Ionis Pharmaceuticals, Inc | Methods for modulating expression of C9ORF72 antisense transcript |
WO2015061091A1 (en) | 2013-10-21 | 2015-04-30 | The General Hospital Corporation | Methods relating to circulating tumor cell clusters and the treatment of cancer |
US10301622B2 (en) | 2013-11-04 | 2019-05-28 | Northwestern University | Quantification and spatio-temporal tracking of a target using a spherical nucleic acid (SNA) |
EP3066219B1 (en) | 2013-11-08 | 2018-12-26 | Ionis Pharmaceuticals, Inc. | Methods for detecting oligonucleotides |
RU2744194C2 (en) | 2013-12-02 | 2021-03-03 | Фио Фармасьютикалс Корп | Cancer immunotherapy |
CA2931829A1 (en) | 2013-12-02 | 2015-06-11 | Ionis Pharmaceuticals, Inc. | Antisense compounds and uses thereof |
CA2932122C (en) | 2013-12-03 | 2022-04-19 | Northwestern University | Liposomal particles, methods of making same and uses thereof |
KR20160110370A (en) | 2013-12-04 | 2016-09-21 | 알엑스아이 파마슈티칼스 코포레이션 | Methods for treatment of wound healing utilizing chemically modified oligonucleotides |
WO2015085183A2 (en) | 2013-12-06 | 2015-06-11 | Swift Biosciences, Inc. | Cleavable competitor polynucleotides |
CA2844640A1 (en) | 2013-12-06 | 2015-06-06 | The University Of British Columbia | Method for treatment of castration-resistant prostate cancer |
IL282401B (en) | 2013-12-12 | 2022-08-01 | Alnylam Pharmaceuticals Inc | Complement component irna compositions and methods of use thereof |
US10900083B2 (en) | 2013-12-20 | 2021-01-26 | The General Hospital Corporation | Methods and assays relating to circulating tumor cells |
US9274117B2 (en) | 2013-12-21 | 2016-03-01 | Catholic University Industry Academic | Use of SIRT7 as novel cancer therapy target and method for treating cancer using the same |
WO2015108047A1 (en) | 2014-01-15 | 2015-07-23 | 株式会社新日本科学 | Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator |
JPWO2015108048A1 (en) | 2014-01-15 | 2017-03-23 | 株式会社新日本科学 | Chiral nucleic acid adjuvant and antitumor agent having antitumor activity |
JPWO2015108046A1 (en) | 2014-01-15 | 2017-03-23 | 株式会社新日本科学 | Chiral nucleic acid adjuvant and antiallergic agent having antiallergic action |
KR20230152178A (en) | 2014-01-16 | 2023-11-02 | 웨이브 라이프 사이언시스 리미티드 | Chiral design |
PT3099333T (en) | 2014-01-31 | 2020-12-24 | Univ Temple | Bag3 as a target for therapy of heart failure |
CA2937539A1 (en) | 2014-02-04 | 2015-08-13 | Genentech, Inc. | Mutant smoothened and methods of using the same |
EP3960860A3 (en) | 2014-02-11 | 2022-06-08 | Alnylam Pharmaceuticals, Inc. | Ketohexokinase (khk) irna compositions and methods of use thereof |
WO2015142910A1 (en) | 2014-03-17 | 2015-09-24 | Isis Pharmaceuticals, Inc. | Bicyclic carbocyclic nucleosides and oligomeric compounds prepared therefrom |
US10006027B2 (en) | 2014-03-19 | 2018-06-26 | Ionis Pharmaceuticals, Inc. | Methods for modulating Ataxin 2 expression |
AU2015231130C1 (en) | 2014-03-19 | 2021-12-23 | Ionis Pharmaceuticals, Inc. | Compositions for modulating Ataxin 2 expression |
AU2015240761B2 (en) | 2014-04-01 | 2019-09-12 | Biogen Ma Inc. | Compositions for modulating SOD-1 expression |
TWI638047B (en) | 2014-04-09 | 2018-10-11 | 史基普研究協會 | Import of unnatural or modified nucleoside triphosphates into cells via nucleic acid triphosphate transporters |
US10221416B2 (en) | 2014-04-24 | 2019-03-05 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds comprising alpha-beta-constrained nucleic acid |
CA2947270A1 (en) | 2014-04-28 | 2015-11-05 | Rxi Pharmaceuticals Corporation | Methods for treating cancer using nucleic acids targeting mdm2 or mycn |
EP3647318B1 (en) | 2014-04-28 | 2021-06-30 | Ionis Pharmaceuticals, Inc. | Linkage modified oligomeric compounds |
CA2946003A1 (en) | 2014-05-01 | 2015-11-05 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating angiopoietin-like 3 expression |
BR112016022593B1 (en) | 2014-05-01 | 2022-04-26 | Ionis Pharmaceuticals, Inc | Oligomeric compounds, compositions comprising them, and uses thereof |
ES2812099T3 (en) | 2014-05-01 | 2021-03-16 | Ionis Pharmaceuticals Inc | Compositions and methods for modulating growth hormone receptor expression |
JP2017514908A (en) | 2014-05-01 | 2017-06-08 | アールエックスアイ ファーマシューティカルズ コーポレーション | Methods for the treatment of disorders in the front of the eye utilizing nucleic acid molecules |
WO2015171918A2 (en) | 2014-05-07 | 2015-11-12 | Louisiana State University And Agricultural And Mechanical College | Compositions and uses for treatment thereof |
TW201607559A (en) | 2014-05-12 | 2016-03-01 | 阿尼拉製藥公司 | Methods and compositions for treating a SERPINC1-associated disorder |
AU2015264038B2 (en) | 2014-05-22 | 2021-02-11 | Alnylam Pharmaceuticals, Inc. | Angiotensinogen (AGT) iRNA compositions and methods of use thereof |
WO2015179693A1 (en) | 2014-05-22 | 2015-11-26 | Isis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
WO2015187541A1 (en) | 2014-06-02 | 2015-12-10 | Children's Medical Center Corporation | Methods and compositions for immunomodulation |
AU2015269412B2 (en) | 2014-06-04 | 2020-03-12 | Exicure Operating Company | Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications |
HRP20220379T1 (en) | 2014-06-10 | 2022-05-27 | Erasmus University Medical Center Rotterdam | Antisense oligonucleotides useful in treatment of pompe disease |
TW201620526A (en) | 2014-06-17 | 2016-06-16 | 愛羅海德研究公司 | Compositions and methods for inhibiting gene expression of alpha-1 antitrypsin |
EP3161159B1 (en) | 2014-06-25 | 2020-08-05 | The General Hospital Corporation | Targeting human satellite ii (hsatii) |
US9951327B1 (en) | 2014-07-17 | 2018-04-24 | Integrated Dna Technologies, Inc. | Efficient and rapid method for assembling and cloning double-stranded DNA fragments |
BR112017001860A2 (en) | 2014-07-31 | 2018-02-27 | Uab Research Foundation | synthetic peptide, pharmaceutical composition, methods, dosage regimen, and monoclonal antibody |
CN106794256B (en) | 2014-08-19 | 2021-04-30 | 西北大学 | Protein/oligonucleotide core-shell nanoparticle therapeutics |
JP6607925B2 (en) | 2014-08-20 | 2019-11-20 | ノースウェスタン ユニバーシティ | Biocompatible infinitely coordinated polymer nanoparticles-nucleic acid conjugates for antisense gene regulation |
US10385343B2 (en) | 2014-08-29 | 2019-08-20 | Children's Medical Center Corporation | Methods and compositions for the treatment of cancer |
WO2016033424A1 (en) | 2014-08-29 | 2016-03-03 | Genzyme Corporation | Methods for the prevention and treatment of major adverse cardiovascular events using compounds that modulate apolipoprotein b |
CN113599539A (en) | 2014-08-29 | 2021-11-05 | 阿尔尼拉姆医药品有限公司 | Methods of Treating Transthyretin (TTR) -mediated amyloidosis |
US10900039B2 (en) | 2014-09-05 | 2021-01-26 | Phio Pharmaceuticals Corp. | Methods for treating aging and skin disorders using nucleic acids targeting Tyr or MMP1 |
WO2016040589A1 (en) | 2014-09-12 | 2016-03-17 | Alnylam Pharmaceuticals, Inc. | Polynucleotide agents targeting complement component c5 and methods of use thereof |
WO2016044271A2 (en) | 2014-09-15 | 2016-03-24 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation |
EP3198012B1 (en) | 2014-09-26 | 2019-09-04 | University of Massachusetts | Rna-modulating agents |
JOP20200115A1 (en) | 2014-10-10 | 2017-06-16 | Alnylam Pharmaceuticals Inc | Compositions And Methods For Inhibition Of HAO1 (Hydroxyacid Oxidase 1 (Glycolate Oxidase)) Gene Expression |
US20170304459A1 (en) | 2014-10-10 | 2017-10-26 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for inhalation delivery of conjugated oligonucleotide |
WO2016061487A1 (en) | 2014-10-17 | 2016-04-21 | Alnylam Pharmaceuticals, Inc. | Polynucleotide agents targeting aminolevulinic acid synthase-1 (alas1) and uses thereof |
US10258697B2 (en) | 2014-10-29 | 2019-04-16 | Massachusetts Eye And Ear Infirmary | Efficient delivery of therapeutic molecules in vitro and in vivo |
WO2016069906A1 (en) | 2014-10-29 | 2016-05-06 | Massachusetts Eye And Ear Infirmary | Efficient delivery of therapeutic molecules to cells of the inner ear |
EP3904519A1 (en) | 2014-10-30 | 2021-11-03 | Genzyme Corporation | Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof |
JOP20200092A1 (en) | 2014-11-10 | 2017-06-16 | Alnylam Pharmaceuticals Inc | HEPATITIS B VIRUS (HBV) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
WO2016077540A1 (en) | 2014-11-12 | 2016-05-19 | Ionis Pharmaceuticals, Inc. | Compounds and methods for the modulation of comp |
AU2015350120B2 (en) | 2014-11-17 | 2021-05-27 | Alnylam Pharmaceuticals, Inc. | Apolipoprotein C3 (APOC3) iRNA compositions and methods of use thereof |
WO2016081911A2 (en) | 2014-11-21 | 2016-05-26 | Northwestern University | The sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates |
WO2016094342A1 (en) | 2014-12-08 | 2016-06-16 | The Board Of Regents Of The University Of Texas System | Lipocationic polymers and uses thereof |
WO2016094845A2 (en) | 2014-12-12 | 2016-06-16 | Woolf Tod M | Compositions and methods for editing nucleic acids in cells utilizing oligonucleotides |
WO2016100716A1 (en) | 2014-12-18 | 2016-06-23 | Vasant Jadhav | Reversirtm compounds |
US9688707B2 (en) | 2014-12-30 | 2017-06-27 | Ionis Pharmaceuticals, Inc. | Bicyclic morpholino compounds and oligomeric compounds prepared therefrom |
US10793855B2 (en) | 2015-01-06 | 2020-10-06 | Ionis Pharmaceuticals, Inc. | Compositions for modulating expression of C9ORF72 antisense transcript |
US10538763B2 (en) | 2015-01-16 | 2020-01-21 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulation of DUX4 |
EP3247988A4 (en) | 2015-01-23 | 2018-12-19 | Vanderbilt University | A robust interferometer and methods of using same |
EP3256487A4 (en) | 2015-02-09 | 2018-07-18 | Duke University | Compositions and methods for epigenome editing |
CA2976445A1 (en) | 2015-02-13 | 2016-08-18 | Alnylam Pharmaceuticals, Inc. | Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof |
US20180200387A1 (en) | 2015-02-23 | 2018-07-19 | Crispr Therapeutics Ag | Materials and methods for treatment of human genetic diseases including hemoglobinopathies |
US11129844B2 (en) | 2015-03-03 | 2021-09-28 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating MECP2 expression |
US20160348073A1 (en) | 2015-03-27 | 2016-12-01 | President And Fellows Of Harvard College | Modified t cells and methods of making and using the same |
US10961532B2 (en) | 2015-04-07 | 2021-03-30 | The General Hospital Corporation | Methods for reactivating genes on the inactive X chromosome |
WO2016164746A1 (en) | 2015-04-08 | 2016-10-13 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
DK3283500T3 (en) | 2015-04-08 | 2020-11-16 | Univ Chicago | Compositions and methods for correcting limb girdle muscular dystrophy type 2C using exon skipping |
WO2016167780A1 (en) | 2015-04-16 | 2016-10-20 | Ionis Pharmaceuticals, Inc. | Compositions for modulating expression of c9orf72 antisense transcript |
EP3302489A4 (en) | 2015-06-04 | 2019-02-06 | Sarepta Therapeutics, Inc. | Methods and compounds for treatment of lymphocyte-related diseases and conditions |
WO2016201301A1 (en) | 2015-06-12 | 2016-12-15 | Alnylam Pharmaceuticals, Inc. | Complement component c5 irna compositions and methods of use thereof |
WO2016205323A1 (en) | 2015-06-18 | 2016-12-22 | Alnylam Pharmaceuticals, Inc. | Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof |
WO2016209862A1 (en) | 2015-06-23 | 2016-12-29 | Alnylam Pharmaceuticals, Inc. | Glucokinase (gck) irna compositions and methods of use thereof |
WO2016210241A1 (en) | 2015-06-26 | 2016-12-29 | Beth Israel Deaconess Medical Center, Inc. | Cancer therapy targeting tetraspanin 33 (tspan33) in myeloid derived suppressor cells |
US10590425B2 (en) | 2015-06-29 | 2020-03-17 | Caris Science, Inc. | Therapeutic oligonucleotides |
EP3313989A4 (en) | 2015-06-29 | 2018-12-05 | Ionis Pharmaceuticals, Inc. | Modified crispr rna and modified single crispr rna and uses thereof |
CN108135923B (en) | 2015-07-06 | 2021-03-02 | 菲奥医药公司 | Nucleic acid molecules targeting superoxide dismutase 1(SOD1) |
WO2017007825A1 (en) | 2015-07-06 | 2017-01-12 | Rxi Pharmaceuticals Corporation | Methods for treating neurological disorders using a synergistic small molecule and nucleic acids therapeutic approach |
ES2917181T3 (en) | 2015-07-10 | 2022-07-07 | Ionis Pharmaceuticals Inc | Diacylglycerol acyltransferase 2 (DGAT2) modulators |
US10494632B2 (en) | 2015-07-10 | 2019-12-03 | Alnylam Pharmaceuticals, Inc. | Insulin-like growth factor binding protein, acid labile subunit (IGFALS) compositions and methods of use thereof |
AU2016295168B2 (en) | 2015-07-17 | 2021-08-19 | Alnylam Pharmaceuticals, Inc. | Multi-targeted single entity conjugates |
MA43072A (en) | 2015-07-22 | 2018-05-30 | Wave Life Sciences Ltd | COMPOSITIONS OF OLIGONUCLEOTIDES AND RELATED PROCESSES |
AU2016298317B2 (en) | 2015-07-28 | 2021-02-18 | Caris Science, Inc. | Targeted oligonucleotides |
EP3332009A1 (en) | 2015-08-04 | 2018-06-13 | Yeda Research and Development Co., Ltd. | Methods of screening for riboswitches and attenuators |
KR20180038465A (en) | 2015-08-07 | 2018-04-16 | 애로우헤드 파마슈티컬스 인코포레이티드 | RNAi therapy for hepatitis B virus infection |
CN114525280A (en) | 2015-09-02 | 2022-05-24 | 阿尔尼拉姆医药品有限公司 | iRNA compositions of programmed cell death 1 ligand 1(PD-L1) and methods of use thereof |
JP7041616B2 (en) | 2015-09-14 | 2022-03-24 | ザ ボード オブ リージェンツ オブ ザ ユニバーシティー オブ テキサス システム | Lipocationic dendrimer and its use |
EP3353297A1 (en) | 2015-09-24 | 2018-08-01 | Crispr Therapeutics AG | Novel family of rna-programmable endonucleases and their uses in genome editing and other applications |
MX2018003685A (en) | 2015-09-24 | 2018-08-15 | Univ California | Synthetic sphingolipid-like molecules, drugs, methods of their synthesis and methods of treatment. |
RU2018113709A (en) | 2015-09-24 | 2019-10-30 | Айонис Фармасьютикалз, Инк. | KRAS EXPRESSION MODULATORS |
US10533175B2 (en) | 2015-09-25 | 2020-01-14 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating Ataxin 3 expression |
US10709812B2 (en) | 2015-09-29 | 2020-07-14 | The Regents Of The University Of Michigan | Biodegradable hydrogel for tissue expansion |
JP2018531037A (en) | 2015-10-19 | 2018-10-25 | アールエックスアイ ファーマシューティカルズ コーポレーション | Reduced size self-delivering nucleic acid compounds targeting long non-coding RNAs |
JP2019507579A (en) | 2015-10-28 | 2019-03-22 | クリスパー セラピューティクス アーゲー | Materials and methods for the treatment of Duchenne muscular dystrophy |
KR102440160B1 (en) | 2015-10-30 | 2022-09-02 | 제넨테크, 인크. | Anti-HtrA1 antibodies and methods of use thereof |
ES2938883T3 (en) | 2015-11-05 | 2023-04-17 | Los Angeles Childrens Hospital | Oligo antisense for use in the treatment of acute myeloid leukemia |
WO2017079739A1 (en) | 2015-11-06 | 2017-05-11 | Ionis Pharmaceuticals, Inc. | MODULATING APOLIPOPROTEIN (a) EXPRESSION |
US20190046555A1 (en) | 2015-11-06 | 2019-02-14 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds for use in therapy |
WO2017077386A1 (en) | 2015-11-06 | 2017-05-11 | Crispr Therapeutics Ag | Materials and methods for treatment of glycogen storage disease type 1a |
CA3005878A1 (en) | 2015-11-19 | 2017-05-26 | The Brigham And Women's Hospital, Inc. | Lymphocyte antigen cd5-like (cd5l)-interleukin 12b (p40) heterodimers in immunity |
WO2017093804A2 (en) | 2015-12-01 | 2017-06-08 | Crispr Therapeutics Ag | Materials and methods for treatment of alpha-1 antitrypsin deficiency |
US11058709B1 (en) | 2015-12-04 | 2021-07-13 | Ionis Pharmaceuticals, Inc. | Methods of treating breast cancer |
AU2015416656B2 (en) | 2015-12-07 | 2023-02-23 | Erasmus University Medical Center Rotterdam | Enzymatic replacement therapy and antisense therapy for Pompe disease |
US11761007B2 (en) | 2015-12-18 | 2023-09-19 | The Scripps Research Institute | Production of unnatural nucleotides using a CRISPR/Cas9 system |
US20210260219A1 (en) | 2015-12-23 | 2021-08-26 | Crispr Therapeutics Ag | Materials and methods for treatment of amyotrophic lateral sclerosis and/or frontal temporal lobular degeneration |
AU2017205462A1 (en) | 2016-01-05 | 2018-06-07 | Ionis Pharmaceuticals, Inc. | Methods for reducing LRRK2 expression |
US10627396B2 (en) | 2016-01-29 | 2020-04-21 | Vanderbilt University | Free-solution response function interferometry |
EP3411078A1 (en) | 2016-02-02 | 2018-12-12 | Crispr Therapeutics AG | Materials and methods for treatment of severe combined immunodeficiency (scid) or omenn syndrome |
CN109071625A (en) | 2016-02-04 | 2018-12-21 | 柯瑞斯公司 | Smooth mutant and its application method |
WO2017141109A1 (en) | 2016-02-18 | 2017-08-24 | Crispr Therapeutics Ag | Materials and methods for treatment of severe combined immunodeficiency (scid) or omenn syndrome |
EP3419665A4 (en) | 2016-02-25 | 2019-10-16 | The Brigham and Women's Hospital, Inc. | Treatment methods for fibrosis targeting smoc2 |
US11364258B2 (en) | 2016-03-04 | 2022-06-21 | Rhode Island Hospital | Methods for treating chondrosarcoma using microrna(miR) |
US11136577B2 (en) | 2016-03-09 | 2021-10-05 | Ionis Pharmaceuticals, Inc. | Methods and compositions for inhibiting PMP22 expression |
CA3013799A1 (en) | 2016-03-16 | 2017-09-21 | Ionis Pharmaceuticals, Inc. | Methods of modulating keap1 |
US10577607B2 (en) | 2016-03-16 | 2020-03-03 | Ionis Pharmaceuticals, Inc. | Modulation of DYRK1B expression |
US11083799B2 (en) | 2016-03-16 | 2021-08-10 | Crispr Therapeutics Ag | Materials and methods for treatment of hereditary haemochromatosis |
JP2019516393A (en) | 2016-03-18 | 2019-06-20 | カリス サイエンス インコーポレイテッド | Oligonucleotide probes and uses thereof |
ES2933435T3 (en) | 2016-04-13 | 2023-02-08 | Ionis Pharmaceuticals Inc | Methods to reduce the expression of C9ORF72 |
BR112018071321A2 (en) | 2016-04-18 | 2019-02-26 | Crispr Therapeutics Ag | Materials and methods for treatment of hemoglobinopathies |
MA45295A (en) | 2016-04-19 | 2019-02-27 | Alnylam Pharmaceuticals Inc | HIGH DENSITY LIPOPROTEIN BINDING PROTEIN (HDLBP / VIGILINE) RNA COMPOSITION AND METHODS FOR USING THEM |
WO2017191503A1 (en) | 2016-05-05 | 2017-11-09 | Crispr Therapeutics Ag | Materials and methods for treatment of hemoglobinopathies |
CN109414408B (en) | 2016-05-16 | 2022-03-29 | 得克萨斯州大学系统董事会 | Cationic sulfonamide amino lipids and amphiphilic zwitterionic amino lipids |
AU2017271579B2 (en) | 2016-05-25 | 2023-10-19 | Caris Science, Inc. | Oligonucleotide probes and uses thereof |
JP2019518028A (en) | 2016-06-10 | 2019-06-27 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Complement component C5i RNA composition and its use for treating paroxysmal nocturnal hemoglobinuria (PNH) |
US11708614B2 (en) | 2016-06-15 | 2023-07-25 | Streck Llc | Assays and methods for determining microbial resistance |
US11236339B2 (en) | 2016-06-17 | 2022-02-01 | Ionis Pharmaceuticals, Inc. | Modulation of GYS1 expression |
EP3475295B1 (en) | 2016-06-24 | 2022-08-10 | The Scripps Research Institute | Novel nucleoside triphosphate transporter and uses thereof |
US11174469B2 (en) | 2016-06-29 | 2021-11-16 | Crispr Therapeutics Ag | Materials and methods for treatment of Amyotrophic Lateral Sclerosis (ALS) and other related disorders |
EP3478828A1 (en) | 2016-06-29 | 2019-05-08 | Crispr Therapeutics AG | Materials and methods for treatment of friedreich ataxia and other related disorders |
WO2018002812A1 (en) | 2016-06-29 | 2018-01-04 | Crispr Therapeutics Ag | Materials and methods for treatment of myotonic dystrophy type 1 (dm1) and other related disorders |
US11459587B2 (en) | 2016-07-06 | 2022-10-04 | Vertex Pharmaceuticals Incorporated | Materials and methods for treatment of pain related disorders |
EP3481856A1 (en) | 2016-07-06 | 2019-05-15 | Crispr Therapeutics AG | Materials and methods for treatment of pain related disorders |
WO2018007871A1 (en) | 2016-07-08 | 2018-01-11 | Crispr Therapeutics Ag | Materials and methods for treatment of transthyretin amyloidosis |
AU2017296195A1 (en) | 2016-07-11 | 2019-01-24 | Translate Bio Ma, Inc. | Nucleic acid conjugates and uses thereof |
PL3484524T3 (en) | 2016-07-15 | 2023-03-20 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulation of smn2 |
WO2018020323A2 (en) | 2016-07-25 | 2018-02-01 | Crispr Therapeutics Ag | Materials and methods for treatment of fatty acid disorders |
JOP20170161A1 (en) | 2016-08-04 | 2019-01-30 | Arrowhead Pharmaceuticals Inc | RNAi Agents for Hepatitis B Virus Infection |
NL2017295B1 (en) | 2016-08-05 | 2018-02-14 | Univ Erasmus Med Ct Rotterdam | Antisense oligomeric compound for Pompe disease |
NL2017294B1 (en) | 2016-08-05 | 2018-02-14 | Univ Erasmus Med Ct Rotterdam | Natural cryptic exon removal by pairs of antisense oligonucleotides. |
WO2018039629A2 (en) | 2016-08-25 | 2018-03-01 | Northwestern University | Micellar spherical nucleic acids from thermoresponsive, traceless templates |
SG10201607303YA (en) | 2016-09-01 | 2018-04-27 | Agency Science Tech & Res | Antisense oligonucleotides to induce exon skipping |
WO2018055577A1 (en) | 2016-09-23 | 2018-03-29 | Synthena Ag | Mixed tricyclo-dna, 2'-modified rna oligonucleotide compositions and uses thereof |
JOP20190065A1 (en) | 2016-09-29 | 2019-03-28 | Ionis Pharmaceuticals Inc | Compounds and methods for reducing tau expression |
KR20190065341A (en) | 2016-10-06 | 2019-06-11 | 아이오니스 파마수티컬즈, 인코포레이티드 | Method of joining oligomeric compounds |
SG10201609048RA (en) | 2016-10-28 | 2018-05-30 | Agency Science Tech & Res | Antisense oligonucleotides |
CA3037046A1 (en) | 2016-10-31 | 2018-05-03 | University Of Massachusetts | Targeting microrna-101-3p in cancer therapy |
JOP20190104A1 (en) | 2016-11-10 | 2019-05-07 | Ionis Pharmaceuticals Inc | Compounds and methods for reducing atxn3 expression |
TW202313978A (en) | 2016-11-23 | 2023-04-01 | 美商阿尼拉製藥公司 | Serpina1 irna compositions and methods of use thereof |
EP3548620A4 (en) | 2016-12-02 | 2020-07-22 | Cold Spring Harbor Laboratory | Modulation of lnc05 expression |
WO2018111834A1 (en) | 2016-12-13 | 2018-06-21 | Seattle Children's Hospital (dba Seattle Children's Research Institute) | Methods of exogenous drug activation of chemical-induced signaling complexes expressed in engineered cells in vitro and in vivo |
KR20230166146A (en) | 2016-12-16 | 2023-12-06 | 알닐람 파마슈티칼스 인코포레이티드 | Methods for treating or preventing ttr-associated diseases using transthyretin(ttr) irna compositions |
KR20190098748A (en) | 2017-01-10 | 2019-08-22 | 애로우헤드 파마슈티컬스 인코포레이티드 | Alpha-1 antitrypsin (AAT) RNAi agent, compositions comprising AAT RNAi agent, and methods of use |
US11197928B2 (en) | 2017-01-13 | 2021-12-14 | Board Of Regents, The University Of Texas System | Sustained production of high affinity antigen specific antibody by high dose BAFF receptor-targeting mAb-siRNA conjugate |
BR112019014841A2 (en) | 2017-01-23 | 2020-04-28 | Regeneron Pharma | guide rna, use of guide rna, antisense rna, sirna or shrna, use of antisense rna, sirna or shrna, isolated nucleic acid, vector, composition, cell, and, methods to modify an hsd17b13 gene in a cell, to decrease the expression of an hsd17b13 gene in a cell, to modify a cell and to treat an individual who does not carry the hsd17b13 variant |
WO2018154459A1 (en) | 2017-02-22 | 2018-08-30 | Crispr Therapeutics Ag | Materials and methods for treatment of primary hyperoxaluria type 1 (ph1) and other alanine-glyoxylate aminotransferase (agxt) gene related conditions or disorders |
EP3585900B1 (en) | 2017-02-22 | 2022-12-21 | CRISPR Therapeutics AG | Materials and methods for treatment of spinocerebellar ataxia type 2 (sca2) and other spinocerebellar ataxia type 2 protein (atxn2) gene related conditions or disorders |
AU2018224387A1 (en) | 2017-02-22 | 2019-09-05 | Crispr Therapeutics Ag | Compositions and methods for gene editing |
WO2018154439A1 (en) | 2017-02-22 | 2018-08-30 | Crispr Therapeutics Ag | Materials and methods for treatment of spinocerebellar ataxia type 1 (sca1) and other spinocerebellar ataxia type 1 protein (atxn1) gene related conditions or disorders |
EP3585807A1 (en) | 2017-02-22 | 2020-01-01 | CRISPR Therapeutics AG | Materials and methods for treatment of early onset parkinson's disease (park1) and other synuclein, alpha (snca) gene related conditions or disorders |
WO2018165564A1 (en) | 2017-03-09 | 2018-09-13 | Ionis Pharmaceuticals, Inc. | Morpholino modified oligomeric compounds |
JOP20190215A1 (en) | 2017-03-24 | 2019-09-19 | Ionis Pharmaceuticals Inc | Modulators of pcsk9 expression |
WO2018183969A1 (en) | 2017-03-30 | 2018-10-04 | California Institute Of Technology | Barcoded rapid assay platform for efficient analysis of candidate molecules and methods of making and using the platform |
KR20200006972A (en) | 2017-04-14 | 2020-01-21 | 톨나인, 인크. | Immunomodulatory polynucleotides, antibody conjugates thereof, and methods of use thereof |
KR20200015895A (en) | 2017-04-18 | 2020-02-13 | 알닐람 파마슈티칼스 인코포레이티드 | How to treat a subject infected with hepatitis B virus (HBV) |
JP2020517613A (en) | 2017-04-20 | 2020-06-18 | シンセナ アーゲー | Modified oligomeric compounds containing tricyclo DNA nucleosides and uses thereof |
WO2018193428A1 (en) | 2017-04-20 | 2018-10-25 | Synthena Ag | Modified oligomeric compounds comprising tricyclo-dna nucleosides and uses thereof |
US20200384115A1 (en) | 2017-04-21 | 2020-12-10 | The Broad Institute , Inc. | Targeted delivery to beta cells |
US11433131B2 (en) | 2017-05-11 | 2022-09-06 | Northwestern University | Adoptive cell therapy using spherical nucleic acids (SNAs) |
AU2018367896B2 (en) | 2017-05-12 | 2023-06-01 | Crispr Therapeutics Ag | Materials and methods for engineering cells and uses thereof in immuno-oncology |
WO2019006455A1 (en) | 2017-06-30 | 2019-01-03 | Solstice Biologics, Ltd. | Chiral phosphoramidite auxiliaries and methods of their use |
AU2018300069A1 (en) | 2017-07-11 | 2020-02-27 | Synthorx, Inc. | Incorporation of unnatural nucleotides and methods thereof |
WO2019014530A1 (en) | 2017-07-13 | 2019-01-17 | Alnylam Pharmaceuticals Inc. | Lactate dehydrogenase a (ldha) irna compositions and methods of use thereof |
EP3652186A4 (en) | 2017-07-13 | 2021-03-31 | Northwestern University | General and direct method for preparing oligonucleotide-functionalized metal-organic framework nanoparticles |
TWI757528B (en) | 2017-08-03 | 2022-03-11 | 美商欣爍克斯公司 | Cytokine conjugates for the treatment of proliferative and infectious diseases |
US11197884B2 (en) | 2017-08-18 | 2021-12-14 | Ionis Pharmaceuticals, Inc. | Modulation of the notch signaling pathway for treatment of respiratory disorders |
WO2019051173A1 (en) | 2017-09-08 | 2019-03-14 | Ionis Pharmaceuticals, Inc. | Modulators of smad7 expression |
US11806360B2 (en) | 2017-09-19 | 2023-11-07 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for treating transthyretin (TTR) mediated amyloidosis |
SG11202003464VA (en) | 2017-10-17 | 2020-05-28 | Crispr Therapeutics Ag | Compositions and methods for gene editing for hemophilia a |
EP3701029A1 (en) | 2017-10-26 | 2020-09-02 | Vertex Pharmaceuticals Incorporated | Materials and methods for treatment of hemoglobinopathies |
WO2019089922A1 (en) | 2017-11-01 | 2019-05-09 | Alnylam Pharmaceuticals, Inc. | Complement component c3 irna compositions and methods of use thereof |
TWI809004B (en) | 2017-11-09 | 2023-07-21 | 美商Ionis製藥公司 | Compounds and methods for reducing snca expression |
EP3707155A2 (en) | 2017-11-09 | 2020-09-16 | Vertex Pharmaceuticals Incorporated | Crispr/cas systems for treatment of dmd |
US20200385719A1 (en) | 2017-11-16 | 2020-12-10 | Alnylam Pharmaceuticals, Inc. | Kisspeptin 1 (kiss1) irna compositions and methods of use thereof |
WO2019100039A1 (en) | 2017-11-20 | 2019-05-23 | Alnylam Pharmaceuticals, Inc. | Serum amyloid p component (apcs) irna compositions and methods of use thereof |
WO2019102381A1 (en) | 2017-11-21 | 2019-05-31 | Casebia Therapeutics Llp | Materials and methods for treatment of autosomal dominant retinitis pigmentosa |
CN111629747A (en) | 2017-12-05 | 2020-09-04 | 沃泰克斯药物股份有限公司 | CRISPR-CAS9 modified CD34+ human pigment stem cells and progenitor cells and application thereof |
MA51138A (en) | 2017-12-14 | 2020-10-21 | Bayer Healthcare Llc | NEW RNA-PROGRAMMABLE ENDONUCLEASE SYSTEMS AND THEIR USES IN GENOME EDITING AND OTHER APPLICATIONS |
EP3724206B1 (en) | 2017-12-14 | 2023-06-28 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
JP2021508491A (en) | 2017-12-18 | 2021-03-11 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | High Mobility Group Box-1 (HMGB1) iRNA Composition and How to Use It |
WO2019123430A1 (en) | 2017-12-21 | 2019-06-27 | Casebia Therapeutics Llp | Materials and methods for treatment of usher syndrome type 2a and/or non-syndromic autosomal recessive retinitis pigmentosa (arrp) |
AU2018393050A1 (en) | 2017-12-21 | 2020-06-18 | Bayer Healthcare Llc | Materials and methods for treatment of Usher Syndrome Type 2A |
WO2019126641A2 (en) | 2017-12-21 | 2019-06-27 | Ionis Pharmaceuticals, Inc. | Modulation of frataxin expression |
US11597932B2 (en) | 2017-12-21 | 2023-03-07 | Alnylam Pharmaceuticals, Inc. | Chirally-enriched double-stranded RNA agents |
JP7455746B2 (en) | 2018-01-12 | 2024-03-26 | ブリストル-マイヤーズ スクイブ カンパニー | Antisense oligonucleotides targeting alpha-synuclein and their uses |
US20210254057A1 (en) | 2018-01-12 | 2021-08-19 | Crispr Therapeutics Ag | Compositions and methods for gene editing by targeting transferrin |
CN111902537A (en) | 2018-01-15 | 2020-11-06 | Ionis制药公司 | Modulators of DNM2 expression |
WO2019142135A1 (en) | 2018-01-19 | 2019-07-25 | Synthena Ag | Tricyclo-dna nucleoside precursors and processes for preparing the same |
US20190233816A1 (en) | 2018-01-26 | 2019-08-01 | Massachusetts Institute Of Technology | Structure-guided chemical modification of guide rna and its applications |
EP3749767A1 (en) | 2018-02-05 | 2020-12-16 | Vertex Pharmaceuticals Incorporated | Materials and methods for treatment of hemoglobinopathies |
WO2019150203A1 (en) | 2018-02-05 | 2019-08-08 | Crispr Therapeutics Ag | Materials and methods for treatment of hemoglobinopathies |
US11332733B2 (en) | 2018-02-12 | 2022-05-17 | lonis Pharmaceuticals, Inc. | Modified compounds and uses thereof |
EP3752616A1 (en) | 2018-02-16 | 2020-12-23 | CRISPR Therapeutics AG | Compositions and methods for gene editing by targeting fibrinogen-alpha |
KR20200127207A (en) | 2018-02-26 | 2020-11-10 | 신톡스, 인크. | IL-15 conjugate and uses thereof |
BR112020016001A2 (en) | 2018-03-02 | 2020-12-15 | Ionis Pharmaceuticals, Inc. | IRF4 EXPRESSION MODULATORS |
WO2019169243A1 (en) | 2018-03-02 | 2019-09-06 | Ionis Pharmaceuticals, Inc. | Compounds and methods for the modulation of amyloid-beta precursor protein |
EP3768834A1 (en) | 2018-03-19 | 2021-01-27 | CRISPR Therapeutics AG | Novel rna-programmable endonuclease systems and uses thereof |
WO2019183440A1 (en) | 2018-03-22 | 2019-09-26 | Ionis Pharmaceuticals, Inc. | Methods for modulating fmr1 expression |
CA3095545A1 (en) | 2018-03-30 | 2019-10-03 | Rheinische Friedrich-Wilhelms-Universitat Bonn | Aptamers for targeted activaton of t cell-mediated immunity |
CA3096274A1 (en) | 2018-04-06 | 2019-10-10 | Children's Medical Center Corporation | Compositions and methods for somatic cell reprogramming and modulating imprinting |
CN112041440A (en) | 2018-04-11 | 2020-12-04 | Ionis制药公司 | Modulators of EZH2 expression |
WO2019204668A1 (en) | 2018-04-18 | 2019-10-24 | Casebia Therapeutics Limited Liability Partnership | Compositions and methods for knockdown of apo(a) by gene editing for treatment of cardiovascular disease |
CN112105733A (en) | 2018-04-19 | 2020-12-18 | 查美特制药公司 | Synthetic RIG-I like receptor agonists |
US20210172928A1 (en) | 2018-05-03 | 2021-06-10 | The Trustees Of Wheaton College | Improved membranes for nanopore sensing applications |
CU20200082A7 (en) | 2018-05-09 | 2021-06-08 | Ionis Pharmaceuticals Inc | COMPOUNDS AND METHODS FOR REDUCING THE EXPRESSION OF FXI |
SG11202010215TA (en) | 2018-05-09 | 2020-11-27 | Ionis Pharmaceuticals Inc | Compounds and methods for reducing atxn3 expression |
TW202016304A (en) | 2018-05-14 | 2020-05-01 | 美商阿尼拉製藥公司 | Angiotensinogen (agt) irna compositions and methods of use thereof |
CA3103429A1 (en) | 2018-06-14 | 2019-12-19 | Don W. Cleveland | Compounds and methods for increasing stmn2 expression |
WO2020006267A1 (en) | 2018-06-27 | 2020-01-02 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing lrrk2 expression |
AR115847A1 (en) | 2018-07-25 | 2021-03-03 | Ionis Pharmaceuticals Inc | COMPOUNDS AND METHODS TO REDUCE THE EXPRESSION OF ATXN2 |
SG11202100715WA (en) | 2018-08-13 | 2021-02-25 | Alnylam Pharmaceuticals Inc | HEPATITIS B VIRUS (HBV) dsRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF |
TW202020157A (en) | 2018-08-16 | 2020-06-01 | 美商艾爾妮蘭製藥公司 | Compositions and methods for inhibiting expression of the lect2 gene |
CA3110211A1 (en) | 2018-08-20 | 2020-02-27 | Rogcon, Inc. | Antisense oligonucleotides targeting scn2a for the treatment of scn1a encephalopathies |
EP3843845A4 (en) | 2018-08-29 | 2022-05-11 | University Of Massachusetts | Inhibition of protein kinases to treat friedreich ataxia |
EP3620520A1 (en) | 2018-09-10 | 2020-03-11 | Universidad del Pais Vasco | Novel target to treat a metabolic disease in an individual |
CA3112793A1 (en) | 2018-09-14 | 2020-03-19 | Northwestern University | Programming protein polymerization with dna |
JP2022500003A (en) | 2018-09-18 | 2022-01-04 | アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. | Ketohexokinase (KHK) iRNA composition and its usage |
TW202023573A (en) | 2018-09-19 | 2020-07-01 | 美商Ionis製藥公司 | Modulators of pnpla3 expression |
CN113366106A (en) | 2018-10-17 | 2021-09-07 | 克里斯珀医疗股份公司 | Compositions and methods for delivery of transgenes |
US10913951B2 (en) | 2018-10-31 | 2021-02-09 | University of Pittsburgh—of the Commonwealth System of Higher Education | Silencing of HNF4A-P2 isoforms with siRNA to improve hepatocyte function in liver failure |
TW202028222A (en) | 2018-11-14 | 2020-08-01 | 美商Ionis製藥公司 | Modulators of foxp3 expression |
AU2019380940A1 (en) | 2018-11-15 | 2021-06-03 | Ionis Pharmaceuticals, Inc. | Modulators of IRF5 expression |
CA3117694A1 (en) | 2018-11-21 | 2020-05-28 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing prion expression |
WO2020118259A1 (en) | 2018-12-06 | 2020-06-11 | Northwestern University | Protein crystal engineering through dna hybridization interactions |
TW202039000A (en) | 2018-12-20 | 2020-11-01 | 瑞士商休曼斯生物醫藥公司 | Combination hbv therapy |
AU2019406186A1 (en) | 2018-12-20 | 2021-07-15 | Praxis Precision Medicines, Inc. | Compositions and methods for the treatment of KCNT1 related disorders |
CA3124415A1 (en) | 2018-12-21 | 2020-06-25 | Northwestern University | Use of annexins in preventing and treating muscle membrane injury |
US20220062299A1 (en) | 2018-12-26 | 2022-03-03 | Northwestern University | Use of glucocorticoid steroids in preventing and treating conditions of muscle wasting, aging and metabolic disorder |
WO2020142693A1 (en) | 2019-01-04 | 2020-07-09 | Empirico Inc. | Treatment of thymic stromal lymphopoietin (tslp) related diseases by inhibition of long-form tslp transcripts |
CN113557023A (en) | 2019-01-16 | 2021-10-26 | 建新公司 | Serpinc1 iRNA compositions and methods of use thereof |
KR20210122809A (en) | 2019-01-31 | 2021-10-12 | 아이오니스 파마수티컬즈, 인코포레이티드 | Regulators of YAP1 expression |
AU2020218203A1 (en) | 2019-02-06 | 2021-08-26 | Synthorx, Inc. | IL-2 conjugates and methods of use thereof |
CA3129532A1 (en) | 2019-02-15 | 2020-08-20 | Crispr Therapeutics Ag | Gene editing for hemophilia a with improved factor viii expression |
BR112021015323A2 (en) | 2019-02-27 | 2021-10-05 | Ionis Pharmaceuticals, Inc. | MALAT1 EXPRESSION MODULATORS |
WO2020181144A1 (en) | 2019-03-06 | 2020-09-10 | Northwestern University | Hairpin-like oligonucleotide-conjugated spherical nucleic acid |
CN113924127A (en) | 2019-03-11 | 2022-01-11 | 奥克斯纳健康系统公司 | micro-RNA regulatory network as biomarker for epileptic seizures in patients with spontaneous intracerebral hemorrhage |
MA55297A (en) | 2019-03-12 | 2022-01-19 | Bayer Healthcare Llc | NOVEL HIGH-FIDELITY PROGRAMMABLE RNA ENDONUCLEASE SYSTEMS AND THEIR USES |
WO2020205463A1 (en) | 2019-03-29 | 2020-10-08 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulating ube3a-ats |
CN114126628A (en) | 2019-05-13 | 2022-03-01 | 维尔生物科技有限公司 | Compositions and methods for treating Hepatitis B Virus (HBV) infection |
WO2020243292A1 (en) | 2019-05-28 | 2020-12-03 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing fus expression |
WO2020243644A1 (en) | 2019-05-31 | 2020-12-03 | Streck, Inc. | Detection of antibiotic resistance genes |
TW202113078A (en) | 2019-06-14 | 2021-04-01 | 美商史基普研究協會 | Reagents and methods for replication, transcription, and translation in semi-synthetic organisms |
US20220305117A1 (en) | 2019-06-18 | 2022-09-29 | Janssen Sciences Ireland Unlimited Company | Combination of hepatitis b virus (hbv) vaccines and hbv-targeting rnai |
CN114340663A (en) | 2019-06-18 | 2022-04-12 | 爱尔兰詹森科学公司 | Combination of Hepatitis B Virus (HBV) vaccine and HBV-targeted RNAi |
EP3956450A4 (en) | 2019-07-26 | 2022-11-16 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulating gfap |
EP4007812A1 (en) | 2019-08-01 | 2022-06-08 | Alnylam Pharmaceuticals, Inc. | Serpin family f member 2 (serpinf2) irna compositions and methods of use thereof |
WO2021022108A2 (en) | 2019-08-01 | 2021-02-04 | Alnylam Pharmaceuticals, Inc. | CARBOXYPEPTIDASE B2 (CPB2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
WO2021030522A1 (en) | 2019-08-13 | 2021-02-18 | Alnylam Pharmaceuticals, Inc. | SMALL RIBOSOMAL PROTEIN SUBUNIT 25 (RPS25) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF |
EP4013767A4 (en) | 2019-08-15 | 2023-10-25 | Ionis Pharmaceuticals, Inc. | Linkage modified oligomeric compounds and uses thereof |
CN114555128A (en) | 2019-08-15 | 2022-05-27 | 新索思股份有限公司 | Combination immunooncology therapy with IL-2 conjugates |
MX2022002053A (en) | 2019-08-23 | 2022-03-17 | Synthorx Inc | Il-15 conjugates and uses thereof. |
US20220290152A1 (en) | 2019-09-03 | 2022-09-15 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the lect2 gene |
KR20220061158A (en) | 2019-09-10 | 2022-05-12 | 신톡스, 인크. | IL-2 conjugates and methods of use for treating autoimmune diseases |
US20220389429A1 (en) | 2019-10-04 | 2022-12-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing ugt1a1 gene expression |
CN114728017A (en) | 2019-10-14 | 2022-07-08 | 阿斯利康(瑞典)有限公司 | Modulators of PNPLA3 expression |
EP4045652A1 (en) | 2019-10-18 | 2022-08-24 | Alnylam Pharmaceuticals, Inc. | Solute carrier family member irna compositions and methods of use thereof |
TW202134435A (en) | 2019-10-22 | 2021-09-16 | 美商阿尼拉製藥公司 | Complement component c3 irna compositions and methods of use thereof |
WO2021081353A1 (en) | 2019-10-23 | 2021-04-29 | Checkmate Pharmaceuticals, Inc. | Synthetic rig-i-like receptor agonists |
WO2021086623A1 (en) | 2019-10-31 | 2021-05-06 | The Trustees Of Wheaton College | Design and characterization of multilayered structures for support of lipid bilayers |
EP4051796A1 (en) | 2019-11-01 | 2022-09-07 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing dnajb1-prkaca fusion gene expression |
TW202132567A (en) | 2019-11-01 | 2021-09-01 | 美商阿尼拉製藥公司 | Huntingtin (htt) irna agent compositions and methods of use thereof |
TW202131952A (en) | 2019-11-04 | 2021-09-01 | 美商欣爍克斯公司 | Interleukin 10 conjugates and uses thereof |
WO2021092464A2 (en) | 2019-11-08 | 2021-05-14 | Phio Pharmaceuticals Corp. | Chemically modified oligonucleotides targeting bromodomain containing protein 4 (brd4) for immunotherapy |
MX2022005692A (en) | 2019-11-13 | 2022-06-08 | Alnylam Pharmaceuticals Inc | Methods and compositions for treating an angiotensinogen- (agt-) associated disorder. |
EP4061945A1 (en) | 2019-11-22 | 2022-09-28 | Alnylam Pharmaceuticals, Inc. | Ataxin3 (atxn3) rnai agent compositions and methods of use thereof |
JP2023503635A (en) | 2019-11-27 | 2023-01-31 | クリスパー・セラピューティクス・アクチェンゲゼルシャフト | Methods of synthesizing RNA molecules |
KR20220115995A (en) | 2019-12-13 | 2022-08-19 | 알닐람 파마슈티칼스 인코포레이티드 | Human chromosome 9 open reading frame 72 (C9orf72) iRNA preparation compositions and methods of using the same |
WO2021126734A1 (en) | 2019-12-16 | 2021-06-24 | Alnylam Pharmaceuticals, Inc. | Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof |
WO2021122944A1 (en) | 2019-12-18 | 2021-06-24 | Alia Therapeutics Srl | Compositions and methods for treating retinitis pigmentosa |
US20230089478A1 (en) | 2019-12-31 | 2023-03-23 | Phio Pharmaceuticals Corp. | Chemically modified oligonucleotides with improved systemic delivery |
WO2021142245A1 (en) | 2020-01-10 | 2021-07-15 | Translate Bio, Inc. | Compounds, pharmaceutical compositions and methods for modulating expression of muc5b in lung cells and tissues |
US20230057461A1 (en) | 2020-01-27 | 2023-02-23 | The U.S.A., As Represented By The Secretary, Department Of Health And Human Services | Rab13 and net1 antisense oligonucleotides to treat metastatic cancer |
WO2021154941A1 (en) | 2020-01-31 | 2021-08-05 | Alnylam Pharmaceuticals, Inc. | Complement component c5 irna compositions for use in the treatment of amyotrophic lateral sclerosis (als) |
IL295445A (en) | 2020-02-10 | 2022-10-01 | Alnylam Pharmaceuticals Inc | Compositions and methods for silencing vegf-a expression |
MX2022010052A (en) | 2020-02-18 | 2022-09-05 | Alnylam Pharmaceuticals Inc | Apolipoprotein c3 (apoc3) irna compositions and methods of use thereof. |
JP2023515566A (en) | 2020-02-28 | 2023-04-13 | タラック セラピューティクス,インク. | Transglutaminase-mediated conjugation |
CR20220485A (en) | 2020-02-28 | 2022-11-10 | Ionis Pharmaceuticals Inc | Compounds and methods for modulating smn2 |
EP4114947A1 (en) | 2020-03-05 | 2023-01-11 | Alnylam Pharmaceuticals, Inc. | Complement component c3 irna compositions and methods of use thereof for treating or preventing complement component c3-associated diseases |
WO2021178736A1 (en) | 2020-03-06 | 2021-09-10 | Alnylam Pharmaceuticals, Inc. | KETOHEXOKINASE (KHK) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
EP4121534A1 (en) | 2020-03-18 | 2023-01-25 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant |
WO2021195307A1 (en) | 2020-03-26 | 2021-09-30 | Alnylam Pharmaceuticals, Inc. | Coronavirus irna compositions and methods of use thereof |
EP4127171A2 (en) | 2020-03-30 | 2023-02-08 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing dnajc15 gene expression |
CA3179411A1 (en) | 2020-04-06 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for silencing myoc expression |
WO2021206922A1 (en) | 2020-04-07 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | Transmembrane serine protease 2 (tmprss2) irna compositions and methods of use thereof |
CN116134135A (en) | 2020-04-07 | 2023-05-16 | 阿尔尼拉姆医药品有限公司 | Compositions and methods for silencing SCN9A expression |
WO2021206917A1 (en) | 2020-04-07 | 2021-10-14 | Alnylam Pharmaceuticals, Inc. | ANGIOTENSIN-CONVERTING ENZYME 2 (ACE2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
CA3181400A1 (en) | 2020-04-27 | 2021-11-04 | Alnylam Pharmaceuticals, Inc. | Apolipoprotein e (apoe) irna agent compositions and methods of use thereof |
WO2021222549A1 (en) | 2020-04-30 | 2021-11-04 | Alnylam Pharmaceuticals, Inc. | Complement factor b (cfb) irna compositions and methods of use thereof |
TW202206596A (en) | 2020-05-01 | 2022-02-16 | 美商Ionis製藥公司 | Compounds and methods for modulating atxn1 |
WO2021231680A1 (en) | 2020-05-15 | 2021-11-18 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of methyl-cpg binding protein 2 (mecp2) |
WO2021231692A1 (en) | 2020-05-15 | 2021-11-18 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of otoferlin (otof) |
EP4150087A1 (en) | 2020-05-15 | 2023-03-22 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of gap junction protein beta 2 (gjb2) |
EP4150077A1 (en) | 2020-05-15 | 2023-03-22 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of transmembrane channel-like protein 1 (tmc1) |
EP4150089A1 (en) | 2020-05-15 | 2023-03-22 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of retinoschisin 1 (rs1) |
WO2021231675A1 (en) | 2020-05-15 | 2021-11-18 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of argininosuccinate synthetase (ass1) |
EP4150078A1 (en) | 2020-05-15 | 2023-03-22 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of argininosuccinate lyase (asl) |
WO2021231673A1 (en) | 2020-05-15 | 2021-11-18 | Korro Bio, Inc. | Methods and compositions for the adar-mediated editing of leucine rich repeat kinase 2 (lrrk2) |
EP4153746A1 (en) | 2020-05-21 | 2023-03-29 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting marc1 gene expression |
AR122534A1 (en) | 2020-06-03 | 2022-09-21 | Triplet Therapeutics Inc | METHODS FOR THE TREATMENT OF NUCLEOTIDE REPEAT EXPANSION DISORDERS ASSOCIATED WITH MSH3 ACTIVITY |
WO2021252557A1 (en) | 2020-06-09 | 2021-12-16 | Alnylam Pharmaceuticals, Inc. | Rnai compositions and methods of use thereof for delivery by inhalation |
BR112022024420A2 (en) | 2020-06-18 | 2023-01-17 | Alnylam Pharmaceuticals Inc | XANTHINE DEHYDROGENASE (XDH) IRNA COMPOSITIONS AND METHODS OF USE THEREOF |
AU2021296848A1 (en) | 2020-06-24 | 2023-02-09 | Humabs Biomed Sa | Engineered hepatitis B virus neutralizing antibodies and uses thereof |
IL299074A (en) | 2020-06-25 | 2023-02-01 | Synthorx Inc | Immuno oncology combination therapy with il-2 conjugates and anti-egfr antibodies |
BR112022024206A2 (en) | 2020-06-29 | 2023-01-03 | Ionis Pharmaceuticals Inc | COMPOUNDS AND METHODS TO MODULATE PLP1 |
TW202227102A (en) | 2020-09-22 | 2022-07-16 | 瑞典商阿斯特捷利康公司 | Method of treating fatty liver disease |
WO2022066847A1 (en) | 2020-09-24 | 2022-03-31 | Alnylam Pharmaceuticals, Inc. | Dipeptidyl peptidase 4 (dpp4) irna compositions and methods of use thereof |
US20230392134A1 (en) | 2020-09-30 | 2023-12-07 | Crispr Therapeutics Ag | Materials and methods for treatment of amyotrophic lateral sclerosis |
EP3978608A1 (en) | 2020-10-05 | 2022-04-06 | SQY Therapeutics | Oligomeric compound for dystrophin rescue in dmd patients throughout skipping of exon-51 |
EP4225917A1 (en) | 2020-10-05 | 2023-08-16 | Alnylam Pharmaceuticals, Inc. | G protein-coupled receptor 75 (gpr75) irna compositions and methods of use thereof |
KR20230084204A (en) | 2020-10-09 | 2023-06-12 | 신톡스, 인크. | Immuno-oncology therapy using IL-2 conjugates |
CA3194859A1 (en) | 2020-10-09 | 2022-04-14 | Carolina E. CAFFARO | Immuno oncology combination therapy with il-2 conjugates and pembrolizumab |
AU2021365822A1 (en) | 2020-10-21 | 2023-06-08 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for treating primary hyperoxaluria |
WO2022087329A1 (en) | 2020-10-23 | 2022-04-28 | Alnylam Pharmaceuticals, Inc. | Mucin 5b (muc5b) irna compositions and methods of use thereof |
IL302709A (en) | 2020-11-13 | 2023-07-01 | Alnylam Pharmaceuticals Inc | COAGULATION FACTOR V (F5) iRNA COMPOSITIONS AND METHODS OF USE THEREOF |
US11447521B2 (en) | 2020-11-18 | 2022-09-20 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulating angiotensinogen expression |
WO2022106695A1 (en) | 2020-11-23 | 2022-05-27 | Alpha Anomeric Sas | Nucleic acid duplexes |
EP4256053A1 (en) | 2020-12-01 | 2023-10-11 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression |
WO2022125490A1 (en) | 2020-12-08 | 2022-06-16 | Alnylam Pharmaceuticals, Inc. | Coagulation factor x (f10) irna compositions and methods of use thereof |
GB2603454A (en) | 2020-12-09 | 2022-08-10 | Ucl Business Ltd | Novel therapeutics for the treatment of neurodegenerative disorders |
WO2022140702A1 (en) | 2020-12-23 | 2022-06-30 | Flagship Pioneering, Inc. | Compositions of modified trems and uses thereof |
EP4274896A1 (en) | 2021-01-05 | 2023-11-15 | Alnylam Pharmaceuticals, Inc. | Complement component 9 (c9) irna compositions and methods of use thereof |
JP2024508714A (en) | 2021-02-12 | 2024-02-28 | アルナイラム ファーマシューティカルズ, インコーポレイテッド | Superoxide dismutase 1 (SOD1) iRNA composition and method for using the same for treating or preventing superoxide dismutase 1- (SOD1-) related neurodegenerative diseases |
WO2022174101A1 (en) | 2021-02-12 | 2022-08-18 | Synthorx, Inc. | Skin cancer combination therapy with il-2 conjugates and cemiplimab |
TW202302148A (en) | 2021-02-12 | 2023-01-16 | 美商欣爍克斯公司 | Lung cancer combination therapy with il-2 conjugates and an anti-pd-1 antibody or antigen-binding fragment thereof |
JP2024509783A (en) | 2021-02-25 | 2024-03-05 | アルナイラム ファーマシューティカルズ, インコーポレイテッド | Prion protein (PRNP) IRNA compositions and methods of use thereof |
KR20230150844A (en) | 2021-02-26 | 2023-10-31 | 알닐람 파마슈티칼스 인코포레이티드 | Ketohexokinase (KHK) iRNA compositions and methods of using the same |
CA3212128A1 (en) | 2021-03-04 | 2022-09-09 | Alnylam Pharmaceuticals, Inc. | Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof |
EP4304640A1 (en) | 2021-03-12 | 2024-01-17 | Northwestern University | Antiviral vaccines using spherical nucleic acids |
WO2022192519A1 (en) | 2021-03-12 | 2022-09-15 | Alnylam Pharmaceuticals, Inc. | Glycogen synthase kinase 3 alpha (gsk3a) irna compositions and methods of use thereof |
WO2022212231A2 (en) | 2021-03-29 | 2022-10-06 | Alnylam Pharmaceuticals, Inc. | Huntingtin (htt) irna agent compositions and methods of use thereof |
WO2022212153A1 (en) | 2021-04-01 | 2022-10-06 | Alnylam Pharmaceuticals, Inc. | Proline dehydrogenase 2 (prodh2) irna compositions and methods of use thereof |
TW202309291A (en) | 2021-04-07 | 2023-03-01 | 法商新植物Sas公司 | Compositions and methods for indoor air remediation |
JP2024516168A (en) | 2021-04-22 | 2024-04-12 | デイナ ファーバー キャンサー インスティチュート,インコーポレイテッド | Compositions and methods for treating cancer |
IL307926A (en) | 2021-04-26 | 2023-12-01 | Alnylam Pharmaceuticals Inc | Transmembrane protease, serine 6 (tmprss6) irna compositions and methods of use thereof |
EP4330396A1 (en) | 2021-04-29 | 2024-03-06 | Alnylam Pharmaceuticals, Inc. | Signal transducer and activator of transcription factor 6 (stat6) irna compositions and methods of use thereof |
WO2022235537A1 (en) | 2021-05-03 | 2022-11-10 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for treating transthyretin (ttr) mediated amyloidosis |
WO2022245583A1 (en) | 2021-05-18 | 2022-11-24 | Alnylam Pharmaceuticals, Inc. | Sodium-glucose cotransporter-2 (sglt2) irna compositions and methods of use thereof |
EP4341405A1 (en) | 2021-05-20 | 2024-03-27 | Korro Bio, Inc. | Methods and compositions for adar-mediated editing |
WO2022256283A2 (en) | 2021-06-01 | 2022-12-08 | Korro Bio, Inc. | Methods for restoring protein function using adar |
EP4347823A1 (en) | 2021-06-02 | 2024-04-10 | Alnylam Pharmaceuticals, Inc. | Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof |
TW202313679A (en) | 2021-06-03 | 2023-04-01 | 美商欣爍克斯公司 | Head and neck cancer combination therapy comprising an il-2 conjugate and a pd-1 antagonist |
CN117561334A (en) | 2021-06-04 | 2024-02-13 | 阿尔尼拉姆医药品有限公司 | Human chromosome 9 open reading frame 72 (C9 ORF 72) iRNA pharmaceutical compositions and methods of use thereof |
WO2022260939A2 (en) | 2021-06-08 | 2022-12-15 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for treating or preventing stargardt's disease and/or retinal binding protein 4 (rbp4)-associated disorders |
IL308896A (en) | 2021-06-11 | 2024-01-01 | Bayer Ag | Type v rna programmable endonuclease systems |
EP4101928A1 (en) | 2021-06-11 | 2022-12-14 | Bayer AG | Type v rna programmable endonuclease systems |
CN117500815A (en) | 2021-06-18 | 2024-02-02 | Ionis制药公司 | Compounds and methods for reducing IFNAR1 expression |
US20230194709A9 (en) | 2021-06-29 | 2023-06-22 | Seagate Technology Llc | Range information detection using coherent pulse sets with selected waveform characteristics |
WO2023278410A1 (en) | 2021-06-29 | 2023-01-05 | Korro Bio, Inc. | Methods and compositions for adar-mediated editing |
KR20240026203A (en) | 2021-06-30 | 2024-02-27 | 알닐람 파마슈티칼스 인코포레이티드 | Methods and compositions for treating angiotensinogen (AGT)-related disorders |
WO2023285431A1 (en) | 2021-07-12 | 2023-01-19 | Alia Therapeutics Srl | Compositions and methods for allele specific treatment of retinitis pigmentosa |
WO2023003995A1 (en) | 2021-07-23 | 2023-01-26 | Alnylam Pharmaceuticals, Inc. | Beta-catenin (ctnnb1) irna compositions and methods of use thereof |
WO2023009687A1 (en) | 2021-07-29 | 2023-02-02 | Alnylam Pharmaceuticals, Inc. | 3-hydroxy-3-methylglutaryl-coa reductase (hmgcr) irna compositions and methods of use thereof |
WO2023014677A1 (en) | 2021-08-03 | 2023-02-09 | Alnylam Pharmaceuticals, Inc. | Transthyretin (ttr) irna compositions and methods of use thereof |
KR20240041973A (en) | 2021-08-04 | 2024-04-01 | 피오 파마슈티칼스 코프. | Chemically modified oligonucleotides |
KR20240042016A (en) | 2021-08-04 | 2024-04-01 | 알닐람 파마슈티칼스 인코포레이티드 | iRNA compositions and methods for silencing angiotensinogen (AGT) |
WO2023015264A1 (en) | 2021-08-04 | 2023-02-09 | Phio Pharmaceuticals Corp. | Immunotherapy of cancer utilizing natural killer cells treated with chemically modified oligonucleotides |
IL310407A (en) | 2021-08-13 | 2024-03-01 | Alnylam Pharmaceuticals Inc | Factor xii (f12) irna compositions and methods of use thereof |
US11833221B2 (en) | 2021-09-01 | 2023-12-05 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds for reducing DMPK expression |
EP4144841A1 (en) | 2021-09-07 | 2023-03-08 | Bayer AG | Novel small rna programmable endonuclease systems with impoved pam specificity and uses thereof |
WO2023044370A2 (en) | 2021-09-17 | 2023-03-23 | Alnylam Pharmaceuticals, Inc. | Irna compositions and methods for silencing complement component 3 (c3) |
CA3232420A1 (en) | 2021-09-20 | 2023-03-23 | Alnylam Pharmaceuticals, Inc. | Inhibin subunit beta e (inhbe) modulator compositions and methods of use thereof |
WO2023056329A1 (en) | 2021-09-30 | 2023-04-06 | Akouos, Inc. | Compositions and methods for treating kcnq4-associated hearing loss |
CA3234835A1 (en) | 2021-10-22 | 2023-04-27 | Korro Bio, Inc. | Methods and compositions for disrupting nrf2-keap1 protein interaction by adar mediated rna editing |
CA3234636A1 (en) | 2021-10-29 | 2023-05-04 | Alnylam Pharmaceuticals, Inc. | Complement factor b (cfb) irna compositions and methods of use thereof |
TW202334418A (en) | 2021-10-29 | 2023-09-01 | 美商艾拉倫製藥股份有限公司 | Huntingtin (htt) irna agent compositions and methods of use thereof |
WO2023086295A2 (en) | 2021-11-10 | 2023-05-19 | University Of Rochester | Antisense oligonucleotides for modifying protein expression |
WO2023086292A2 (en) | 2021-11-10 | 2023-05-19 | University Of Rochester | Gata4-targeted therapeutics for treatment of cardiac hypertrophy |
GB202117758D0 (en) | 2021-12-09 | 2022-01-26 | Ucl Business Ltd | Therapeutics for the treatment of neurodegenerative disorders |
WO2023122573A1 (en) | 2021-12-20 | 2023-06-29 | Synthorx, Inc. | Head and neck cancer combination therapy comprising an il-2 conjugate and pembrolizumab |
WO2023118349A1 (en) | 2021-12-21 | 2023-06-29 | Alia Therapeutics Srl | Type ii cas proteins and applications thereof |
WO2023122750A1 (en) | 2021-12-23 | 2023-06-29 | Synthorx, Inc. | Cancer combination therapy with il-2 conjugates and cetuximab |
WO2023118068A1 (en) | 2021-12-23 | 2023-06-29 | Bayer Aktiengesellschaft | Novel small type v rna programmable endonuclease systems |
WO2023141314A2 (en) | 2022-01-24 | 2023-07-27 | Alnylam Pharmaceuticals, Inc. | Heparin sulfate biosynthesis pathway enzyme irna agent compositions and methods of use thereof |
WO2023194359A1 (en) | 2022-04-04 | 2023-10-12 | Alia Therapeutics Srl | Compositions and methods for treatment of usher syndrome type 2a |
WO2023233290A1 (en) | 2022-05-31 | 2023-12-07 | Janssen Sciences Ireland Unlimited Company | Rnai agents targeting pd-l1 |
WO2023237587A1 (en) | 2022-06-10 | 2023-12-14 | Bayer Aktiengesellschaft | Novel small type v rna programmable endonuclease systems |
EP4311579A1 (en) | 2022-07-29 | 2024-01-31 | Association Française contre les Myopathies | B cell-specific mab-sirna conjugates improve myasthenia |
WO2024039776A2 (en) | 2022-08-18 | 2024-02-22 | Alnylam Pharmaceuticals, Inc. | Universal non-targeting sirna compositions and methods of use thereof |
WO2024044352A1 (en) | 2022-08-26 | 2024-02-29 | The General Hospital Corporation | Methods and compositions for prognosis and treatment of dilated cardiomyopathy and heart failure |
WO2024050261A1 (en) | 2022-08-29 | 2024-03-07 | University Of Rochester | Antisense oligonucleotide-based anti-fibrotic therapeutics |
WO2024059165A1 (en) | 2022-09-15 | 2024-03-21 | Alnylam Pharmaceuticals, Inc. | 17b-hydroxysteroid dehydrogenase type 13 (hsd17b13) irna compositions and methods of use thereof |
WO2024056880A2 (en) | 2022-09-16 | 2024-03-21 | Alia Therapeutics Srl | Enqp type ii cas proteins and applications thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3654262A (en) * | 1969-08-21 | 1972-04-04 | Merck & Co Inc | 3-deoxy-3-c-lower alkyl glycosides and nucleosides |
US4804748A (en) * | 1985-08-16 | 1989-02-14 | Boehringer Mannheim Gmbh | 7-deaza-2'-deoxyguanosine nucleotides |
US5216141A (en) * | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
Family Cites Families (22)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPS4826038B1 (en) * | 1970-09-25 | 1973-08-03 | ||
JPS55139399A (en) * | 1979-04-12 | 1980-10-31 | Asahi Chem Ind Co Ltd | Novel adenosine derivative substituted in the 2-position |
DE3010399A1 (en) * | 1980-03-18 | 1981-09-24 | Kailash Kumar Dr. 2359 Lentföhrden Gauri | Cytostatic and antiviral pyrimidine nucleoside derivs. - which are 5-haloalkyl-pyrimidine nucleoside 5'-ester derivs. |
US4381344A (en) * | 1980-04-25 | 1983-04-26 | Burroughs Wellcome Co. | Process for producing deoxyribosides using bacterial phosphorylase |
SE421182B (en) * | 1980-04-25 | 1981-12-07 | Atlas Copco Ab | VIBRATION DUMP DEVICE TOOL |
US4511713A (en) * | 1980-11-12 | 1985-04-16 | The Johns Hopkins University | Process for selectively controlling unwanted expression or function of foreign nucleic acids in animal or mammalian cells |
US4352795A (en) * | 1981-01-29 | 1982-10-05 | Warner-Lambert Company | 7-β-D-Arabinofuranosyl-7H-pyrrolo[2,3-d]pyrimidine compounds and methods for their production |
NZ209840A (en) * | 1983-10-17 | 1988-11-29 | Kaji Akira | A method of inhibiting viral propagation by hybridising dna with the viral rna thus blocking its action |
WO1987001373A1 (en) * | 1985-09-09 | 1987-03-12 | Teijin Limited | Pyridopyrimidine nucleotide derivatives |
US4760017A (en) * | 1985-12-23 | 1988-07-26 | E. I. Du Pont De Nemours And Company | Arabinonucleic acid probes for DNA/RNA assays |
US4719295A (en) * | 1985-12-31 | 1988-01-12 | Warner-Lambert Company | Compound 2-iodo-2'-deoxyadenosine |
JPS638396A (en) * | 1986-06-30 | 1988-01-14 | Wakunaga Pharmaceut Co Ltd | Poly-labeled oligonucleotide derivative |
DE3788914T2 (en) * | 1986-09-08 | 1994-08-25 | Ajinomoto Kk | Compounds for cleaving RNA at a specific position, oligomers used in the preparation of these compounds and starting materials for the synthesis of these oligomers. |
DE3739366A1 (en) * | 1987-04-10 | 1988-10-27 | Boehringer Mannheim Gmbh | DESAZA-PURIN-NUCLEOSIDE DERIVATIVES, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE IN NUCLEIC ACID SEQUENCING AND AS AN ANTIVIRAL AGENT |
IL89258A0 (en) * | 1988-02-16 | 1989-09-10 | Lilly Co Eli | 2',3'-dideoxy-2',2'-difluoro-nucleosides |
IE980216A1 (en) * | 1989-04-17 | 2000-02-23 | Scotia Holdings Plc | Anti-virals |
US5359051A (en) * | 1990-01-11 | 1994-10-25 | Isis Pharmaceuticals | Compounds useful in the synthesis of nucleic acids capable of cleaning RNA |
ATE271064T1 (en) * | 1990-01-11 | 2004-07-15 | Isis Pharmaceuticals Inc | OLIGONUCLEOTIDE DERIVATIVES FOR DETECTING AND MODULATING RNA ACTIVITY AND GENE EXPRESSION |
US5212295A (en) * | 1990-01-11 | 1993-05-18 | Isis Pharmaceuticals | Monomers for preparation of oligonucleotides having chiral phosphorus linkages |
US5459255A (en) * | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
DE4110085A1 (en) * | 1991-03-27 | 1992-10-01 | Boehringer Ingelheim Int | New 2'O-alkyl-oligo-ribonucleotide(s) with 8-35 nucleotide units - useful as anti-sense oligo-nucleotide(s), primers and probes |
US5214135A (en) * | 1991-08-30 | 1993-05-25 | Chemgenes Corporation | N-protected-2'-O-methyl-ribonucleosides and N-protected 2'-O-methyl-3'-cyanoethyl-N-,N-diisopropyl phosphoramidite ribonucleosides |
-
1993
- 1993-11-29 US US08/159,088 patent/US5459255A/en not_active Expired - Lifetime
-
1994
- 1994-11-29 WO PCT/US1994/013622 patent/WO1995014707A1/en active IP Right Grant
- 1994-11-29 DE DE69433626T patent/DE69433626T2/en not_active Expired - Lifetime
- 1994-11-29 JP JP51525895A patent/JP3535519B2/en not_active Expired - Fee Related
- 1994-11-29 AT AT95902698T patent/ATE261984T1/en not_active IP Right Cessation
- 1994-11-29 EP EP95902698A patent/EP0731807B1/en not_active Expired - Lifetime
-
1995
- 1995-08-30 US US08/473,450 patent/US5587469A/en not_active Expired - Lifetime
-
1996
- 1996-12-10 US US08/762,587 patent/US5808027A/en not_active Expired - Fee Related
-
1998
- 1998-08-04 US US09/128,834 patent/US6166199A/en not_active Expired - Fee Related
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3654262A (en) * | 1969-08-21 | 1972-04-04 | Merck & Co Inc | 3-deoxy-3-c-lower alkyl glycosides and nucleosides |
US4804748A (en) * | 1985-08-16 | 1989-02-14 | Boehringer Mannheim Gmbh | 7-deaza-2'-deoxyguanosine nucleotides |
US5216141A (en) * | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997012896A1 (en) * | 1995-10-04 | 1997-04-10 | Epoch Pharmaceuticals, Inc. | Selective binding complementary oligonucleotides |
US5912340A (en) * | 1995-10-04 | 1999-06-15 | Epoch Pharmaceuticals, Inc. | Selective binding complementary oligonucleotides |
US5744460A (en) * | 1996-03-07 | 1998-04-28 | Novartis Corporation | Combination for treatment of proliferative diseases |
EP1109825A1 (en) * | 1998-09-01 | 2001-06-27 | Isis Pharmaceuticals, Inc. | Improved process for the synthesis of oligonucleotides incorporating 2-aminoadenosine |
EP1109825A4 (en) * | 1998-09-01 | 2001-09-05 | Isis Pharmaceuticals Inc | Improved process for the synthesis of oligonucleotides incorporating 2-aminoadenosine |
DE19945503A1 (en) * | 1999-09-23 | 2001-04-05 | Henkel Kgaa | Multi-phase cleaning agent with an antimicrobial effect |
EP3296306A1 (en) * | 2012-02-17 | 2018-03-21 | Ajinomoto Co., Inc. | Base-protected oligonucleotide |
Also Published As
Publication number | Publication date |
---|---|
JPH09500398A (en) | 1997-01-14 |
EP0731807A1 (en) | 1996-09-18 |
DE69433626T2 (en) | 2005-02-10 |
US5459255A (en) | 1995-10-17 |
EP0731807B1 (en) | 2004-03-17 |
US5808027A (en) | 1998-09-15 |
JP3535519B2 (en) | 2004-06-07 |
ATE261984T1 (en) | 2004-04-15 |
DE69433626D1 (en) | 2004-04-22 |
US6166199A (en) | 2000-12-26 |
EP0731807A4 (en) | 1997-11-19 |
US5587469A (en) | 1996-12-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0731807B1 (en) | N-2 substituted purines | |
US5457191A (en) | 3-deazapurines | |
US5948903A (en) | Synthesis of 3-deazapurines | |
US5587470A (en) | 3-deazapurines | |
US5811534A (en) | Substituted purines and oligonucleotide cross-linking | |
AU651569B2 (en) | Compositions and methods for detecting and modulating RNA activity and gene expression | |
US5514786A (en) | Compositions for inhibiting RNA activity | |
US6262241B1 (en) | Compound for detecting and modulating RNA activity and gene expression | |
US6307040B1 (en) | Sugar modified oligonucleotides that detect and modulate gene expression | |
CA2089376C (en) | Sugar modified oligonucleotides that detect and modulate gene expression | |
US5670633A (en) | Sugar modified oligonucleotides that detect and modulate gene expression | |
US5914396A (en) | 2'-O-modified nucleosides and phosphoramidites | |
US5359051A (en) | Compounds useful in the synthesis of nucleic acids capable of cleaning RNA | |
US6232463B1 (en) | Substituted purines and oligonucleotide cross-linking | |
EP0635023A1 (en) | Covalently cross-linked oligonucleotides | |
KR100257972B1 (en) | Oligonucleotides having phosphorothioate linkages of high chiral purity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1995902698 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1995902698 Country of ref document: EP |
|
WWG | Wipo information: grant in national office |
Ref document number: 1995902698 Country of ref document: EP |