WO1994005784A1

WO1994005784A1 - Portable intron as an insertion vector for gene insertion

Info

Publication number: WO1994005784A1
Application number: PCT/US1993/008067
Authority: WO
Inventors: John D. Reilly; Robert F. Silva
Original assignee: THE UNITED STATES OF AMERICA as represented by THE SECRETARY, U.S. DEPARTMENT OF AGRICULTURE
Priority date: 1992-08-27
Filing date: 1993-08-27
Publication date: 1994-03-17
Also published as: MX9305183A; AU4839493A

Abstract

The portable intron of this invention is an isolated DNA molecule which contains, in the order from 5' to 3', a splice donor sequence, a multiple cloning sequence, a lariat branch acceptor sequence, a pyrimidine-rich sequence and a splice acceptor sequence. When a foreign gene is inserted into the multiple cloning site of the portable intron, and the portable intron is inserted into a host gene in the appropriate orientation, both the foreign gene and the host gene can be simultaneously transcribed and expressed. Alternatively, the portable intron can be inserted into the host gene in a manner which permits expression of the foreign gene without expression of the host gene. The portable intron is useful for expressing in an animal a gene that is not normally expressed in the animal or for correcting a defect in the animal's expression of the gene. The portable intron is also useful for inhibiting a single function of a multifunctional protein expressed by a host gene.

Description

PORTABLE INTRON AS AN INSERTION VECTOR FOR GENE INSERTION

Background of the Invention

The poultry industry in the United States spends an estimated 1.7 billion dollars a year on poultry health products. Much of this cost goes towards utilizing and developing means to prevent poultry diseases. Other areas of agriculture spend similar amounts for the prevention of disease. Medical research continues to spend more than all other areas combined towards the prevention of disease.

Vaccine research holds the best promise for developing means to effectively control disease at the least cost, in both agriculture and medicine. One area of vaccine research involves the use of recombinant viruses. Construction of recombinant viruses currently requires that foreign genes be inserted into "non-essential" sites in the viral DNA. Non-essential sites are DNA sequences which do not appear necessary for viral replication in tissue culture. However, many of these sites have subsequently been found to be essential for viral replication in vivo. In addition, "non-essential" sites for gene insertion may not exist for many viral vectors, thereby compromising the ability to construct more efficacious vaccines by recombinant DNA technology. The present invention is able to preserve the coding integrity of genes and also negates the time consuming search for nonessential sites.

The present invention will be of equal value in the introduction of foreign genes into eucaryotic cells. Stable transformation of eukaryotic cells currently requires the screening of large numbers of transfectants for expression of the foreign gene without any other apparent affect to the host. The present invention allows the introduction of desirous genes into plants and animals without the risk of deleting or mutagenizing any host gene. The large screening programs for benign insertions would be unnecessary, saving considerable time, money and resources.

The splicing consensus sequences incorporated in this invention are common knowledge (Shapiro and Senapathy, 1987; Reilly et al., 1990). Use of portable introns as a means of turning off the expression of a gene in a bacterium was described by Vancanneyt et al. (1990). Mayeda and Oshima (1990) used an intron cassette as a method of studying the role of flanking exon sequences in RNA splicing. Yoshimatsu and Nagawa (1989) constructed a temperature-sensitive portable intron to study gene expression. However, the concept of using an intron to introduce a foreign gene into another gene has not been proposed by these authors or others knowledgeable in the fields of RNA splicing or recombinant DNA. This invention allows for the simultaneous transcription of a recipient gene and a foreign gene inserted into the recipient gene, in the opposite orientation with respect to the transcription of the first gene. Simultaneous expression of both the recipient gene and the foreign gene inserted in the opposite orientation has not before been considered possible. Even though it is known that some naturally occuring genes partially overlap and are transcribed in opposite directions, it has been assumed that transcription of the genes was not simultaneous, but occured at different times in the life cycle of the organism. It was assumed that interference in transcription would occur if both transcripts were synthesized at the same time. Experimental tests of the present invention have demonstrated that both of the overlapping genes can be transcribed and that the isolated DNA molecule of this invention inserted into the recipient gene was accurately spliced out.

Summary of the Invention

This invention provides an isolated DNA molecule which comprises in the direction from 5' to 3' a splice donor sequence, a multiple cloning site, a lariat branch acceptor sequence, a pyrimidine-rich sequence and a splice acceptor sequence. Also provided is an isolated DNA molecule of this invention wherein a DNA sequence has been inserted into the multiple cloning site.

This invention further provides a recombinant viral genomic DNA molecule comprising the isolated DNA molecule of this invention. This invention provides a modified live virus comprising the recombinant viral genomic DNA molecule and a vaccine comprising an effective immunizing amount of the modified live virus and a suitable carrier. This invention also provides a method of immunizing an animal against a viral disease which comprises administering to the animal an effective dose of the vaccine of this invention.

This invention provides a recombinant DNA cloning vector comprising the isolated DNA molecule, and a recombinant cloning vector further comprising a gene into which the isolated DNA molecule has been inserted. This invention also provides a stably transformed eucaryotic cell comprising the isolated DNA molecule integrated into the cellular genome. This invention further provides a method of producing an RNA molecule which comprises culturing the stably transformed eucaryotic cell under conditions permitting transcription of DNA into RNA and recovering the RNA molecule so produced. This invention still further provides a method of producing a protein which comprises culturing the stably transformed eucaryotic cell of this invention under conditions which permit transcription of DNA into mRNA and translation of the resultant mRNA into protein, followed by recovering the protein so produced. This invention provides a method of expressing a gene in an animal that is not normally expressed in the animal or of correcting a defect in the animal's expression of the gene which comprises the steps of isolating suitable cells from the animal, stably transforming the cells with the isolated DNA molecule of this invention and readministering the stably transformed cells to the animal from which the cells were isolated. This invention also provides a method of mutating a first gene on one DNA strand without mutating an overlapping gene on the complementary DNA strand which comprises inserting the isolated DNA molecule of this invention into the first gene, wherein the isolated DNA molecule is placed in the negative orientation with respect to the first gene and in the positive orientation with respect to the overlapping gene on the complementary DNA strand. This invention further provides a method of inhibiting a function of a multifunctional protein without inhibiting the other functions of the protein, which comprises inserting the isolated DNA molecule of this invention into a gene encoding the protein in a region of the gene which encodes the function of the protein to be inhibited.

Brief Description of the Figures

Figure 1. Portable intron operation. A: Clone portable intron with foreign gene into the middle of any viral or eukaryotic gene; B: transcription and processing; and C: splicing.

Figure 2. A. pIn(E/K): sequence of the type A portable intron in pUC18. The intron multiple cloning site was derived from pBS (pBluescript, Stratagene). The adenovirus intron sequences are underlined.

adenovirus 2 exon sequences are in bold type within the boxes. (S/H) is the junction formed from the ligation of the SmaI end of pBSD (pBluescript, splice Donor) and the Hindi end of pBSD. B: Sequence of type B portable intron in pIn(P/P). The type B portable intron was constructed from the type A portable intron by site-directed mutagenesis.

Figure 3. Construction of the type A portable intron.

A. pBSD contains the 3' end of adenovirus exon 1 (see Fig. 10) and the 5' end of intron 1 inserted between the SacI/SacII sites of pBS. B. pBSA (pBluescript, splice Acceptor) contains the 3' end of intron 1 and the 5' end of the exon 2 inserted between the ApaI/KpnI sites of pBS. C. The EcoRI/SmaI fragment from pBSD was inserted between the EcoRI/HincII sites of pBSA to create pAdIn(E/K). D. pIn(E/K) contains the EcoRI/KpnI fragment from pAdIn(E/K) inserted between the EcoRI and Kpnl sites of pUC18.

Figure 4. Insertion of the type A portable intron into pRSVCAT. The type A portable intron was excised from pIn(E/K) with PvuII and HincII and inserted into the PvuII site in the chloramphenicol acetyl transferase (CAT) gene. A. The portable intron inserted in the (+) orientation. B. The portable intron inserted in the (-) orientation. The arrow head on the CAT gene indicates the direction of transcription. All components of the plasmids which are depicted in the diagrams are drawn to scale.

Figure 5. A. pRSVCAT(+)InCMVZ(-) contains the lacZ gene regulated by the CMV immediate early promoter inserted into pRSVCAT(+) In in the (-) orientation. B. pRSVCAT(+)Inα4Z(-) contains the lacZ gene regulated by the HSVαr4 promoter inserted into pRSVCAT in the (-) orientation. C. pRSVCAT(+)InCMVZ(+) contains the lacZ gene regulated by the CMV immediate early promoter inserted into pRSVCAT(+) In in the (+) orientation. D. pRSVCAT(+)Inα4Z(+) contains the lacZ gene regulated by the HSVα4 promoter inserted into pRSVCAT(+)In in the (+) orientation.

Figure 6. Construction of pWEΔgB(+)In. The type A portable intron was inserted into the EcoRV site of pWEagB in the (+) orientation.

Figure 7. Insertion of lacZ into pWEΔgB(+)In. A.

pWEΔgB(+) InCMVZ(-) contains the lacZ gene regulated by the CMV immediate early promoter inserted into pWEΔgB(+)ln in the (-) orientation. B. pWEΔgB(+)Inα4Z(-) contains the lacZ gene regulated by the HSVα4 promoter inserted into pWEΔgB(+) In in the (-) orientation.

Figure 8. Construction of gA(+)In. A. Restriction endonuclease map of the HVT gA antigen gene and surrounding regions. B. BamHI/XhoI fragment of gA inserted between the BamHI/SalI sites of pUClβ. C. gA(+)In contains the type A portable intron inserted into the EcoRV site of gA in pUC18.

Figure 9. Insertion of lacZ into gA(+)In. A.

gA(+)InCMVZ(-) contains the lacZ gene regulated by the CMV immediate early promoter inserted into gA(+)In in the (-) orientation. B. gA(+)Inα4Z(-) contains the lacZ gene regulated by the HSVα4 promoter inserted into gA(+)In in the (-) orientation. Figure 10. Modification of adenovirus 2 late leader region. A. Restriction endonuclease map of the adenovirus 2 BalI E fragment containing the late leader exons 1 and 2 and introns 1 and 2. B. The BalI E fragment was cloned into the BalI site of pBR322 and the central portion of intron l was deleted to construct Ad2Δ-intron. C. Ad2Δ-intronT7.

Figure 11. Plasmids containing the reporter genes lacZ and Ecogpt. A. pNOTα4Z contains the HSVα4- driven lacZ gene inserted into pNOT. B. pCMVZ(B/P) contains the CMVlacZ gene removed from pON249 with BamHI and PstI, inserted between the BamHI/PstI sites of pBS. C. pON249 contains the lacZ gene regulated by the CMV immediate early promoter in the plasmid pBR322 (pON249 was supplied by Dr. E. Mocarski, Stanford University). D. pCMVΔgpt contains the E. coli xanthineguanine phosphoribosyl transferase (Ecogpt) gene regulated by the CMV immediate early promoter in pBS. E. pRSVΔgpt contains the Ecogpt gene regulated by the RSV promoter in pBS. F. pSV2gpt contains the Ecogpt gene regulated by the SV40 promoter in pBR322, and was the source for the Ecogpt gene in Figures 11D and E.

Figure 12. Coding sequence surrounding the insertion site of the type A portable intron in the gB and gA genes. A: Coding sequence surrounding the EcoRV site in gB. B: Coding sequence after the inserted type A portable intron is spliced out of gB. C: Coding sequence surrounding the EcoRV site in gA. D: Coding sequence after the type A portable intron is spliced out of gA. The underlined amino acids are encoded by gB or gA, the boxed DNA sequences encode the amino acids contributed by the type A portable intron exon sequences that remain in gA and gB after RNA splicing.

Figure 13. Coding sequence surrounding the insertion site of the type A portable intron in the chloramphenicol acteyl transferase gene. A:

Coding sequence surrounding the PvuII site of the CAT gene. B: Coding sequence after the type A portable intron inserted into the CAT PvuII site is spliced out of CAT. The amino acids encoded by the portable intron are within the boxed region.

Figure 14. Chloramphenicol acetyl transferase activity in extracts from chicken embryo fibroblast (CEF) cells transfected with pRSVCAT and pRSVCAT containing the type A portable intron in both the positive and negative orientations, pRSVCAT(+)In and pRSVCAT(-) In, respectively. Extracts from CEF transfected with pRSVCAT(+)In and pRSVCAT

(-)In were assayed for chloramphenicol acetyl transferase activity. Activity was measured as ¹⁴C incorporated into chloramphenicol per μg of DNA transfected. A and B are two separate transfection experiments.

Figure 15. Chloramphenicol acteyl transferase activity and ß-galactosidase activity in transfected CEF cells. A. Extracts from chicken embryo fibroblasts (CEF) transfected with pRSVCAT and pRSVCAT(+) InCMVZ (-) were assayed for chloramphenicol acteyl transferase and ß- galactosidase activity. Chloramphenicol acteyl transferase activity was measured as cpm of ¹⁴C incorporated into chloramphenicol. ß-galactosidase activity was measured as A420 units (x10³) from ONPG assays. B.

Extracts from CEF transfected with: 1, pRSVCAT(+) InCMVZ(-); 2, pRSVCAT(+) Inα4Z(-); 3, pRSVCAT(+) InCMVZ (+) ; 4, pRSVCAT; 5: pCMVZ(B/P); 6: pNotα4Z. Assays for chloramphenicol acteyl transferase and ß- galactosidase activity were done as in part A.

Figure 16. Insertion of CMVΔgpt into gA(+)In. To construct gA(+) InCMVΔgpt(-), the NotI/XhoI

CMVΔgpt fragment from pBluescript, containing the CMVΔgpt gene inserted between the SalI/BamHI (Fig. 11D), sites was inserted between the NotI/XhoI sites of gA(+)In in the (-) orientation.

Figure 17. Insertion of RSVΔgpt into pWEΔgB(+)In. To construct pWEΔgB(+) InRSVΔgpt(-), the NotI/XhoI RSVΔgpt fragment from pBluescript, containing the RSVΔgpt gene inserted between the HindIII/BamHI (Fig. HE) sites, was inserted between the NotI/XhoI sites of pWEΔgB(+)In in the (-) orientation. Figure 18. Schematic diagrams of HVT and gA recombinant genomes with the NotI sites indicated. The upper diagram represents the BamHI restriction endonuclease maps of the HVT wild type genome. On the diagram, the NotI sites are indicated, and below the diagram the fragments produced by a NotI digest are shown. The lower diagram represents a BamHI restriction map of the HVT gA recombinant gene. On the diagram the NotI sites are indicated and below the diagram the fragments produced by a NotI digest are shown.

Detailed Description of the Invention

This invention provides an isolated DNA molecule which comprises, in the direction from 5' to 3,' a splice donor sequence, a multiple cloning sequence, a lariat branch acceptor sequence, a pyrimidine-rich sequence and a splice acceptor sequence. For the purposes of this invention, an "isolated DNA molecule" is a non-naturally occurring DNA molecule, that is, a molecule in a form which does not occur in nature.

The term "splice donor sequence" as used herein means the 5' splice sequence, i.e., the sequence at the 5' end of the intron at which the first cleavage of the precursor mRNA molecule is made during RNA processing. Typically, the splice donor sequence comprises the consensus nucleotide sequence GTPAGT. The nucleotide symbol "P" as used herein indicates that either of the purine nucleotides, i.e., adenosine or guanine, may occupy the position in the nucleotide sequence indicated by the "P". In the presently preferred embodiment of this invention, the GTPAGT splice donor sequence comprises the nucleotide sequence GTGAGT.

The term "multiple cloning site" as used herein means aDNA sequence comprising at least two distinct nucleotide sequences specifically recognized by restriction endonuclease enzymes. These are sites at which the restriction endonucleases cleave double-stranded DNA. In the presently preferred embodiment of this invention, the multiple cloning sequence comprises cleavage sites for the restriction endonucleases NotI, XbaI, SpeI, BamHI, XhoI, ApaI, HindIII and BstEII. The term "lariat branch acceptor sequence" as used herein means the DNA intron sequence corresponding to a sequence in a messenger RNA transcript necessary for the binding of the cleaved 5' end of the intron during RNA processing. The cleaved 5' end of the intron specifically binds to a conserved adenosine nucleotide within the lariat branch acceptor sequence. Typically, the lariat branch acceptor sequence comprises the nucleotide sequence YNCTNAY. For the purposes of this invention, the nucleotide symbol "Y" is intended to mean that either pyrimidine nucleotide, i.e., cytosine or thymidine, may occupy the position in the nucleotide sequence indicated by the "Y". Preferably, the YNCTNAY lariat branch acceptor sequence comprises the nucleotide sequence TACTTAT.

The term "pyrimidine-rich sequence" as used herein refers to nucleotide sequences wherein at least 70% of the nucleotides are pyrimidine, i.e., cytosine or thymidine, nucleotides. Typically, the pyrimidine-rich sequence comprises a nucleotide sequence which is at least twenty nucleotides in length. Preferably, the pyrimidine-rich sequence comprises the nucleotide sequence TCCTGTCCCTTTTTTTTCCAG.

For the purposes of this invention, a "splice acceptor sequence" is the 3' splice sequence, i.e., the sequence at the 3' end of the intron at which the second cleavage of the precursor mRNA molecule is made and where the 3' end of the first exon is joined to the 5' end of the next exon downstream, i.e., in the 3' direction. Typically, the splice acceptor sequence comprises the nucleotide sequence AG.

In one embodiment of this invention, the isolated DN molecule contains the last 25 nucleotides of the adenovirus late leader exon 1 adjacent to the 5' end of the splice donor site and the first 41 nucleotides of the adenovirus late leader exon 2 at the 3' end of the splice donor site. An EcoRI restriction endonuclease site is at the 3' end of exon 1 and SmaI, XmaI, SalI, PstI, SphI, HindIII and KpnI sites are at the 3' end of exon 2. Within exon 2 is a PvuII site. The restriction endonuclease sites at the 5' and 3' ends enable the isolated DNA molecule of this invention to be recovered with different ends. The isolated DNA molecule containing exon sequences adjacent to the 5' end of the splice donor site and the 3' end of the splice acceptor site is referred to herein as the type A portable intron. The isolated DNA molecule not containing exon sequences adjacent to the 5' splice donor and 3' splice acceptor sites is referred to herein as the type B portable intron. The type B portable intron was constructed from the isolated DNA molecule by changing the splice donor region to a PmlI restriction endonuclease site and the splice acceptor region to a PvuII site, using site-directed mutagenesis. The type B portable intron was inserted into the EcoRI site of the plasmid of pUC18 modified to contain only an EcoRI site. An EcoRI site is at the 5' end of adenovirus exon 1 and the 3' end of exon 2. The rest of the features of the type B portable intron are the same as those of the type A portable intron. The type B portable intron may be isolated from pIn(P/P) with the restriction endonucleases PmlI and PvuII. This invention also provides an isolated DNA molecule further comprising a DNA sequence inserted into the multiple cloning site. The DNA sequence may be operably linked to its own RNA polymerase promoter and transcription termination signals and inserted into the multiple cloning site in the 3' to 5' or 5' to 3' direction. The isolated DNA molecule provided by this invention may be inserted into a eucaryotic gene. When this eucaryotic gene containing the DNA molecule is transcribed into an RNA molecule, the portion of the transcript corresponding to the DNA molecule is excised from the RNA molecule by RNA processing enzymes. This invention makes use of the RNA excision and ligation reactions that are natural functions which occur in the nucleus of all eucaryotic cells.

In one embodiment of this invention, the DNA sequence inserted into the multiple cloning site of the isolated DNA molecule encodes an antisense RNA molecule. In another embodiment of this invention, the DNA sequence encodes a messenger RNA molecule. Preferably, the messenger RNA molecule encodes a protein. The protein may be a detectable marker, e.g., ß- galactosidase or fluorescein. The protein may also be a selectable marker, e.g., thymidine kinase or guanine phosphoribosyl transferase. The protein may further be a viral protein, e.g., a Marek's Disease Virus protein or an Infectious Bursal Disease Virus protein. The protein may still further be a modulator of immunity, e.g., an interferon or a modulator of growth, e.g., a growth hormone.

In one embodiment of this invention, the RNA polymerase promoter operably linked to the DNA sequence is a latency associated transcript (LAT) promoter. LAT promoters maybe obtained from herpesviruses, e.g., Marek's Disease Virus. Herpesviruses induce life long latent infections in their natural hosts. During latency, certain regions of the viral genome are continuously being transcribed. By using LAT promoters from genes which are normally expressed after the virus has become latent, and operably linking the promoters to foreign genes, this invention provides a means for continuously expressing the foreign genes in an animal into which the genes have been introduced. Examples of such genes include, but are not limited to, growth hormone, interferon and MHC genes.

The isolated DNA molecule of this invention containing a foreign DNA sequence inserted into the multiple cloning site may be inserted into any recipient eucaryotic or viral gene. The recipient gene is transcribed into a pre-mRNA molecule which contains RNA sequences corresponding to the isolated DNA molecule. The portion of the pre-mRNA molecule corresponding to the isolated DNA molecule is excised from the pre-mRNA as a lariat structure, and the flanking RNA sequences corresponding to the recipient are ligated together, generating an mRNA molecule that can be translated into a functional protein. As discussed hereinabove, the foreign DNA sequence may be transcribed and the resultant mRNA translated into a functional protein. This invention thus provides a method of inserting a foreign gene into a recipient gene, with the result that both the recipient and foreign genes are transcribed into mRNAs which are translated into functional protein products. A schematic diagram illustrating the operation of this method is provided in Figure 1.

As indicated hereinabove, in one embodiment of this invention, the isolated DNA molecule, i.e., the type A portable intron, comprises exon sequences flanking the 5' and 3' splice sites. In this embodiment of the invention, the exon sequences will remain when the isolated DNA molecule is spliced out of the pre-mRNA. The size of these exon sequences must therefore be adjusted so as not to disrupt the translational reading frame downstream, i.e., in the 3' direction, of a gene into which the isolated DNA molecule has been inserted.

Also provided by this invention is an isolated DNA molecule further comprising a transcriptional regulatory element, e.g., an enhancer, or a replication control element, e.g., a viral origin of replication.

This invention provides an isolated DNA molecule further comprising a second DNA sequence inserted into the multiple cloning site. This invention provides a recombinant viral genomic DNA molecule comprising the isolated DNA molecule of this invention. The virus may, but is not required to, be a double-stranded DNA virus. Examples of such viruses suitable for use in accordance with the practice of this invention include, but are not limited to, adenoviruses or herpesviruses. The virus may also be an RNA virus, i.e., the recombinant viral genomic DNA molecule may comprise a cDNA copy of a retroviral genome into which the isolated DNA molecule has been inserted. Examples of such RNA viruses include, but are not limited to, Avian Leukosis Virus, Infectious Bursal Disease Virus, Murine or Feline Leukemia Virus or Human Immunodeficiency Virus.

The isolated DNA molecule may comprise a gene encoding one or more viral antigens. The antigens may be from one or more viruses.

The isolated DNA molecule of this invention may be inserted into a coding region of the viral genome without disrupting processing of the viral transcript and its translation into functional protein. This invention provides a modified live virus comprising the recombinant viral genomic DNA molecule. For the purposes of this invention, a "modified live virus" is any avirulent or attenuated virus capable of inducing an immune response in an animal vaccinated with the virus. In one embodiment of this invention, the modified live virus is a modified live avian virus, e.g., a modified live Marek's Disease Virus. In another embodiment of this invention, the modified live virus is a modified live swine virus, e.g. a modified live pseudorabies virus. In still another embodiment of this invention, the modified live virus is a modified live human virus, e.g., a modified live Herpes simplex virus.

This invention provides a vaccine comprising per dose an effective immunizing amount of the modified live virus and a suitable carrier. For the purposes of this invention, an "effective immunizing amount" of a modified live virus is any amount of the virus effective to confer immunity upon an animal vaccinated with the virus. Methods of determining an effective immunizing amount of a modified live virus are well known to those skilled in the art or are readily determinable by routine experimentation. Typically, the effective immunizing amount of a modified live virus is an amount greater than about 1,000 plaque forming units. Suitable carriers for a vaccine in accordance with the practice of this invention are any of a number of aqueous buffers well known to those skilled in the art. Presently preferred aqueous buffers are phosphate buffers. The vaccine of this invention may comprise a modified live virus which comprises an isolated DNA molecule having genes encoding more than one viral antigen.

This invention provides a method of immunizing an animal against a viral disease which comprises administering to the animal a dose of the modified live virus vaccine of this invention. In one embodiment of this invention, the animal is a fowl, e.g., a chicken, turkey, duck or quail. In another embodiment of this invention, the animal is a mammal, e.g., a porcine or a human. As indicated hereinabove, the vaccine of this invention may comprise more than one viral antigen. The vaccine of this invention may therefore be useful in a method of immunizing an animal against more than one viral disease. Methods of administering a modified live virus vaccine to an animal, and of determining the appropriate age at which to administer the vaccine, are well known to those skilled in the art or are readily determinable by routine experimentation. Presently preferred methods of administration comprise subcutaneous, intramuscular, intravenous or in ovo injection, or oral administration.

This invention provides a recombinant cloning vector comprising the isolated DNA molecule of this invention. The recombinant cloning vector may be a plasmid, retrovirus, cosmid or phage.

The recombinant cloning vector may further comprise a gene, i.e., a DNA sequence encoding an mRNA molecule. The isolated DNA molecule of this invention may be inserted into a coding region of the gene without disrupting translation of the mRNA encoded by the gene into a functional protein product. The term "coding region" as used herein means a region of the gene comprising triplet nucleotide "codons" corresponding to specific amino acids. Such recombinant cloning vectors include, but are not limited to, pRSVCAT(+)In (see Fig. 4A), pRSVCAT(-)In (Fig. 4B), pRSVCAT(+) InCMVZ (-) (Fig.5A), pRSVCAT(+) Inα4Z(-) (Fig.5B), pRSVCAT(+) InCMVZ (+) (Fig.5C), pRSVCAT(+) Inα4Z(+) (Fig.5D), pWEΔgB(+)In (Fig. 6), pWEΔgB(+)In CMVZ(-) (Fig. 7A), pWEΔgB(+)Inα4Z(-) (Fig. 7B), gA(+)In (Fig. 8C), gA(+) InCMVZ (-) (Fig. 9A), gA(+) Inα4Z(-) (Fig. 9B) gA(+)InCMVΔgpt(-) (Fig. 16) or gB(+) InRSVΔgpt(-) (Fig. 17). Recombinant cloning vectors useful in accordance with the practice of this invention also include viral vectors comprising LAT promoters operably linked to foreign genes. This invention also provides a stably transformed eukaryotic cell comprising the recombinant cloning vector. For the purposes of this invention, a "stably transformed eukaryotic cell" is a eukaryotic cell in which foreign DNA has stably integrated into chromosomal DNA of the cell. Methods of stably transforming eucaryotic cells with recombinant cloning vectors, such as electroporation, calcium phosphate transfection and microinjection, are well known to those skilled in the art. The recombinant cloning vector of this invention may integrate into a region of cellular DNA homologous to the gene of the recombinant cloning vector. Homology between this gene and its cellular homologue allows insertion of the isolated DNA molecule to be directed into the cellular gene. This insertion will occur without disrupting transcription of the cellular gene if the isolated DNA molecule is inserted in the positive orientation with respect to the direction of transcription of the cellular gene. For the purposes of this invention, "positive orientation" means that the 5' to 3' direction of the isolated DNA molecule is aligned with the direction of transcription, i.e., from 5' to 3', of the cellular gene. The isolated DNA molecule will be transcribed as part of the precursor mRNA molecule transcribed from the cellular gene, but the portion of the precursor corresponding to the isolated DNA molecule will be spliced out during RNA processing. In one embodiment of this invention, the stably transformed eucaryotic cell is a yeast. In another embodiment of this invention, the stably transformed eucaryotic cell is an animal cell. The stably transformed animal cell may be an avian cell, e.g., a chicken, turkey, duck or quail cell. The stably transformed animal cell may also be a mammalian cell, e.g., a porcine, bovine, monkey, cat, dog or human cell.

This invention provides a method of producing an RNA molecule which comprises culturing the stably transformed eucaryotic cell of this invention under conditions which permit transcription of DNA into RNA, followed by recovering the RNA molecule so produced. The RNA molecule may be an antisense RNA molecule or a messenger RNA molecule. This invention also provides a method of producing a protein which comprises culturing the stably transformed eucaryotic cell of this invention under conditions permitting transcription of DNA into mRNA, and translation of the resultant mRNA molecule into protein, followed by recovering the protein so produced.

This invention further provides a transgenic animal comprising the stably transformed animal cell of this invention. The transgenic animal may be a transgenic fowl, e.g., a transgenic chicken, turkey, duck or quail. The transgenic animal may also be a transgenic non-human mammal, e.g., a transgenic mouse, rat, bovine, equine, caprine, ovine or porcine.

This invention still further provides an animal into which a viral vector comprising a LAT promoter operably linked to a foreign gene has been introduced at an early developmental stage. Preferably, the viral vector is introduced into a fertilized egg or an early embryo of the animal. The LAT promoter used is one which is capable of serving as an RNA polymerase promoter for an operably linked gene in the animal. LAT promoters suitable for use in a specific animal are well known to those skilled in the art or can be readily determined without undue experimentation. The foreign gene linked to the LAT promoter will be continuously expressed throughout the life of the animal. This invention provides a method of expressing a gene in an animal that is not normally expressed in the animal or of correcting a defect in the animal's expression of the gene which comprises transforming cells of the animal with the isolated DNA molecule of this invention. In the presently preferred embodiment of this invention, cells suitable for transformation are isolated from the animal, transformed with the isolated DNA molecule of this invention under conditions permitting stable integration of the isolated DNA molecule into the genome of the animal's cells, and readministering the stably transformed cells to the animal from which the cells were isolated.

The animal may be a fowl, e.g., a chicken, turkey, duck or quail. The animal may also be a mammal, e.g., a mouse, rat or human. Cells suitable for isolation, transformation and readministration are well known to those skilled in the art and include, but are not limited to, bone marrow cells. Methods of isolating and readministering suitable cells contemplated by this invention include generally accepted methods of withdrawing and readministering cells which do not interfere with the viability and integrity of the cells. Methods of stably transforming cells are well known to those skilled in the art and include, but are not limited to, transfection, e.g., using calcium phosphate or by retrovirus, electroporation and microinjection.

In one embodiment of this invention, the isolated DNA molecule comprises a DNA sequence encoding antisense RNA. The antisense RNA may bind to messenger RNA in the cell. Such binding will inhibit translation of the mRNA into functional protein and thereby decrease the amount of protein produced by the cell. This invention thus provides a method of inhibiting the production of a protein in an animal's cells and a method of treating a subject afflicted with a disease, e.g., diabetes, characterized overproduction of a protein. In another embodiment of this invention, the isolated DNA molecule comprises a DNA sequence encoding messenger RNA. The messenger RNA will encode a protein that the animal synthesizes in insufficient quantities to meet its physiological needs. This invention thus provides a method of enhancing the synthesis of a protein by an animal's cells and a method of treating a subject afflicted with a disorder, e.g., anemia, characterized by the synthesis of an insufficient amount of a protein. This invention provides a method of mutating a first geneon a DNA strand without mutating an overlapping gene on a complementary DNA strand which comprises inserting the isolated DNA molecule of this invention into the first gene in the negative orientation with respect to the first gene and in the positive orientation with respect to the overlapping gene on the complementary DNA strand. For the purposes of this invention, the "negative orientation" means that the isolated DNA molecule runs 3' to 5' within the 5' to 3' direction of the gene into which it has been inserted and the "positive orientation" means that the isolated DNA molecule runs 5' to 3' within the 5' to 3' direction of the gene into which it has been inserted. The first gene is transcribed into an mRNA molecule which contains RNA sequences corresponding to the first gene and RNA sequences corresponding to the isolated DNA molecule. The RNA sequences corresponding to the isolated DNA molecule are not spliced from this mRNA molecule because the 5' and 3' splice sites of the isolated DNA molecule are in the negative orientation with respect to the first gene. Translation of the mRNA to produce a functional protein is prevented by the RNA sequences in the mRNA corresponding to the isolated DNA molecule. The overlapping gene on the complementary DNA strand is transcribed into an mRNA molecule containing RNA sequences corresponding to the isolated DNA molecule and RNA sequences corresponding to the overlapping gene. The RNA sequences corresponding to the isolated DNA molecule are spliced from this mRNA because the 5' and 3' splice sites of the isolated DNA molecule are in the positive orientation with respect to the overlapping gene. The mRNA corresponding to the overlapping gene is then translated into functional protein. The method provided by this invention is valuable as a new and useful method of mutating overlapping, antiparallel genes, i.e., genes which have at least a portion of their sequences in the same location on the complementary strands of a double-stranded DNA.

The method provided by this invention is valuable over methods for mutating overlapping antiparallel genes generally known to those skilled in the art because it allows mutation of a gene on one of the DNA strands without resulting in a mutation of the gene in the corresponding location on the complementary DNA strand. Presently available methods of mutating overlapping anti-parallel genes result in the mutation of both genes. The method provided by this invention can be used to mutate overlapping, antiparallel viral genes, e.g., herpesvirus and adenovirus genes. An example of such a viral gene is the thymidine kinase gene of Herpes simplex virus. This invention provides a method of inhibiting one function of a multifunctional protein without inhibiting the other functions of the protein, which comprises inserting the isolated DNA molecule of this invention into a gene encoding the protein in a region of the gene that encodes the function of the protein to be inhibited. For genes encoding proteins with multiple functions, the type A portable intron may be inserted into one or several regions of a gene that encode specific functions. The isolated DNA molecule of this invention can be modified to leave a portion of its DNA sequences in the mRNA molecule transcribed from the mutated gene after RNA processing. The modified DNA molecule will inhibit the protein function encoded at the insertion site of the isolated DNA molecule, while the other protein functions are not inhibited. The type A portable intron exon sequences that remain in the mRNA may be modified to include, but are not limited to, protein cleavage sites, structural destabilizing sequences, glycosylation sites or phosphorylation sites.

The method provided by this invention is valuable over presently available methods for mutating specific regions of genes, as the invention provides both a method for introducing a variety of mutations into a region without disrupting the coding frame of the gene downstream of the mutation, and a method for isolating viruses or cells containing the mutations. A reporter gene, such as lacZ or Ecogpt, inserted into the multiple cloning site of the invention would provide a method for isolating the virus or cell containing the mutated gene.

An example of a gene with multiple functions is the glycoprotein B (gB) gene of herpes simplex virus. Thus, this invention provides a method of mutating the region of gB responsible for cell penetration or the region responsible for cell fusion, while not mutating the regions of the protein necessary to elicit immunity to the virus. A live herpes simplex vaccine comprising a gB gene mutated in the manner described herein would not be able to spread through the vaccinated host, but would possess the immunogenic portions of gB, thereby rendering the host resistant to herpes simplex virus infection. This invention will be better understood from the Examples which follow. However, one skilled in the art will readily appreciate that the specific examples and results discussed are only illustrative of the invention as described more fully in the claims which follow thereafter.

Examples

Example l Adenovirus 2 late leader intron

The late leader intron flanked by exons l and 2 was obtained from a Ball digest of adenovirus 2. The Ball E adenovirus fragment (Fig. 10A) was recovered and cloned into the BalI site of pBR322. The central region of the intron was deleted to create Ad2Δ-intron (Fig. 10B). The 5' end of the Ball E fragment was removed with Bal 31, trimmed with Klenow, and EcoRI linkers were then added to the end. The fragment was released from pBR322 with Ball and EcoRI, and cloned between the EcoRI/HincII sites of pBS to create Ad2Δ-intronT7 (Fig. 10C).

Example 2 lacZ and Ecogpt reporter genes

Fig. 11 show the sources of the lacZ and Ecogpt reporter genes inserted into the various constructs described herein. Example 3

Construction of the Type A Portable Intron

The type A portable intron (pIn(E/K)) contains a truncated version of the adenovirus 2 late leader intron 1 flankedby 25 bp of exon 1 and 41 bp of exon 2 (Reilly et al., 1990). The type A portable intron contains the splice donor site followed by 91 bp of the 5' end of the intron, a 60 bp multiple cloning site, and 86 bp of the 3' end of the intron followed by the splice acceptor site (Fig. 2a, SEQ ID NO. 1). Table 1 (see below) shows a comparison of the splicing consensus sequences to the splicing sequences used to construct the isolated DNA molecule of this invention. TABLE 1

COMPARISON OF SPLICING CONSENSUS SEQUENCES TO PORTABLE INTRON SEQUENCES

Exon 1: intron Branch accptr seq. Intron:Exon 2

1. NNN - GTPAGT .. . . .. . YNCTGAC Pyr. rich . . .. . .CAG: NNN

2. GGG :GTGAGT.. MCS .. TACTTATCCTGTCCCTTTTTTTTCCACAG:CTC

3. CAC:GTGAGT.. MCS ..TACTTATCCTGTCCCTTTTTTTTCCACAG:CTG

The consensus sequences required for splicing are the sequenes commonly found at the splice donor, splice acceptor and branch acceptor sites. The only invariant components of the consensus sequences are the GT at the splice donor site, the A at the branch acceptor (branch accptr) site and the AG at the splice acceptor site. The other nucleotides in the consensus sequences are variable. Introns with sequences deviating from the consensus sequences appear to splice as efficiently as introns that have sequences that conform exactly to the consensus sequences. 1: Splicing consensus sequences; 2: type A portable intron; 3: type B portable intron. The branch acceptor nucleotide (A) is underlined. N: A, T, G or C. Pyr. rich: pyrimidine rich. MCS: multiple cloning site. Branch accptr seq.: lariat branch acceptor sequence.

The type A portable intron in pIn(E/K) was constructed from pBSD and pBSA (Fig. 3A and B; see Reilly et al., 1990 for construction of pBSD and pBSA). pBSD contains the last 25 bp of exon 1 and 91 bp of the 5' end of intron 1 cloned between the SacI/SacII sites of pBluescript. pBSA contains the 3' end of intron 1 and the first 41 bp of exon 2 cloned between ApaI/KpnI sites of pBS. The SacI/SmaI fragment from pBSD, containing the 5' exon/intron sequences, was inserted between the SacI/HincII sites of pBSA, creating pAdIn(E/K) (Fig. 3C). The EcoRI/KpnI fragment from pAdIn(E/K), containing the portable intron, was inserted between the EcoRI/KpnI sites of pUC18, creating pIn(E/K) (Fig. 3D).

The pUC18 multiple cloning site downstream from the portable intron provides a number of restriction endonuclease sites. Since the type A portable intron will leave its exon sequences behind when the intron is spliced out of the pre-mRNA, it is necessary to adjust the size of the exon sequences flanking the intron. The exon sequences must be adjusted so as not to disrupt the translational reading frame downstream from the insertion site (see Table 2, below). The series of restriction endonuclease sites downstream from the portable intron in pIn(E/K) allow the portable intron to be inserted into any recipient gene restriction endonuclease site made blunt, either by filling in the missing nucleotides with Klenow large fragment polymerase or removing the excess nucleotides with T4 DNA polymerase, regardless of how the restriction endonuclease site cleaves the translational reading frame. Since the exon sequences will contribute additional amino acids to the final protein product, it will be important to determine whether the recipient gene will be able to tolerate the additional amino acids at the insertion site. Table 2

Portable Intron insertion Sites That Do Not Disrupt Downstream Coding Frames

A. Spliced Exon Information

Portable Spliced Exon Sizes ^{Codon Triplet} Intron of the Within the Insert¹ Portable Intron Spliced Exons²

1. EcoRI .. ..KpnI 66 22

2. EcoRI....SmaI 72 24

3. EcoRI....XbaI 74 24 + 2 nt

4. EcoRI....SalI 91 30 + 1 nt

5. EcoRI....PstI 92 31

6. EcoRI....SphI 99 33

7. EcoRI....HindIII 109 36 + 1 nt

8. EcoRI....HincII 89 29 + 2 nt

9. PvuII....XbaI 57 19

10. PvuII....SmaI 55 18 + 1 nt

11. PvuII....HincII 72 24

12. PvuII....KpnI 49 16 + 1 nt

13. PvuII....SalI 74 24 + 2 nt

14. PvuII....PstI 76 25 + 1 nt

15. PvuII....SphI 82 27 + 1 nt

16. PvuII....HindIII 92 30 + 2 nt

B. Allowed Codon Insertion Sites

Portable Intron

Insert Allowed Codon Insertion Sites

1. EcoRI . . .KpnI NN N or N NN or NN- - - N or N - - -N

2. EcoRI . . . SmaI NN N or N NN or NN- - - N or N- - -N

3. EcoRI.. .XbaI NN- -NN or N - - NNN

4 . EcoRI . . . SalI N- - - -N

5. EcoRI . . . PstI N NN or N - - - N

6. EcoRI.. .SphI N NN or N- - -N

7. EcoRI.. .HindIII N-- --N

8. EcoRI.. .HincII NN- -NN

9. PvuII.. .XbaI NNN NNN or N-- -N

10. PvuII.. .SmaI NNN -NN or N-- --N

11. PvuII.. .HincII NNN NNN

12. PvuII.. .KpnI NNN -NN or N-- --N

13. PvuII.. .SalI NNN --N

14. PvuII.. .PstI NNN -NN

15. PvuII.. .SphI NNN -NN

16. PvuII.. .HindIII NNN --N

1. The restriction endonuclease sites that generate 5' overhangs (EcoRI, XbaI, HindIII, and SalI) are filled in with Klenow large fragment. The restriction endonucleases PstI, SphI and KpnI generate 3' overhangs that are removed with T4 DNA polymerase.

2. Spliced exons that contribute whole number codon triplets to the recipient gene may be inserted into any blunt end restriction endonuclease site. Spliced exons generating either 1 or 2 extra nucleotides (nt) enable the portable intron to be inserted into most non-blunt restriction endonuclease sites that have been either filled in with Klenow or trimmed with T4 DNA polymerase.

3. The portable intron can only be inserted into the sites listed to prevent disruption of the downstream coding frame. For example, 1, 2, 5, or 6 bases inserted between codons (NNN NNN) result in the translation termination codon UGA contained within the second exon to be in-frame. Restriction sites HincII, SalI, PstI, SphI and HindIII are downstream from a UAG translation termination codon in the pUC18 multiple cloning site that must be considered. Dashes represent nucleotides that must be filled by the portable intron's exon sequences in order to maintain the downstream coding frame. The type A portable intron was modified to enable it to be inserted into genes that have not been sequenced (Fig. 2b, SEQ ID No. 2). The type A portable intron nucleotides 8 through 18 were deleted, nucleotide 21 was converted from a T to an A, and nucleotides 25-26 were changed from GGG to CAC, generating a PmlI site at the splice acceptor site. The type A portable intron nucleotides 275-299 were replaced by nucleotides TTCC, generating an EcoRI site, and nucleotide 62 was changed from a C to a G, generating a PvuII site at the splice acceptor site. The modified portable intron (now denoted the type B portable intron), flanked by EcoRI sites, was inserted into the EcoRI site of pUC18-E, generating pIn(P/P). pUC18-E was derived from a pUC18 that had its HindIII site deleted and replaced by an EcoRI site. PmlI and PvuII cleave at the center of their respective recognition sequences. Digesting the type B portable intron with PmlI and PvuII therefore results in the generation of a blunt-ended portable DNA molecule that has the splice donor nucleotides GT at the 5' end and the splice acceptor nucleotides AG at the 3' end. The consensus sequences required for RNA splicing are highly degenerate, only the splice donor GT and the splice acceptor AG being invariant. The consensus sequences for the splice donor and acceptor sites are presented in Table 2.

Converting the splice donor and splice acceptor sites to PmlI and PvuII sites, respectively, enables the type B portable intron to be excised from the plasmid vector as a blunt-ended DNA fragment. The portable intron can now be inserted into any blunt-ended restriction endonuclease site in the host gene. During splicing the type B portable intron is. cleaved at the 5' end between the host pre-mRNA sequences and the GU and the 3' end between the AG and the host sequences. The cleaved type B portable intron is excised and the host mRNA sequences are ligated together. The result is a host mRNA indistinguishable from the same mRNA that did not contain a portable intron. The type B portable intron is limited to host genes containing a blunt- end restriction endonuclease site, but is not encumbered by the need to know the sequence of the host gene. The type A portable intron can be tailored to be inserted into any restriction endonuclease site, but it is limited to those host genes whose final product can tolerate the addition of several amino acids to the protein product.

Example 4 Insertion of Type A Portable Intron into the Chloramphenicol Acetyl Transferase (CAT. Gene

The type A portable intron was excised from pIn(E/K) with PvuII/HincII and inserted into the PvuII site of the chloramphenicol acetyl transferase (CAT) gene, containedin the vector pRSVCAT. The intron was cloned in the direction of transcription, creating pRSVCAT(+)In (Fig. 4A) and in the opposite direction, creating pRSVCAT(-)In (Fig. 4B). In Fig. 5A the lacZ gene regulated by the CMV promoter was excised from pCMVZ(B/P) (Fig. 11B) with NotI/XhoI and inserted into the intron between the NotI/XhoI sites of pRSVCAT(+)In in the direction opposite to CAT transcription. In Fig. 5B the lacZ gene regulated by the HSVα4 promoter was excised from pNotα4Z (Fig. 11A) with NotI/XhoI and inserted into the intron between the NotI/XhoI sites of pRSVCAT(+)In in the direction opposite to CAT transcription. In Fig. and 5D, the CMV-regulated lacZ and HSVα4-regulated lacZ were excised from pON249 (Fig. 11C) and pNotα4Z, respectively, with BamHI. The BamHI ends were made blunt with Klenow large fragment and inserted into the NotI site of pRSV AT (+)In, made blunt with Klenow large fragment, in the same direction as CAT transcription. The CMV promoter is a very strong promoter whereas the HSVα4 promoter is a much weaker promoter (Silva and Finkelstein, 1990; Tieber et al., 1990). The tpye A portable intron sequences remaining in the CAT mRNA after RNA splicing do not disrupt the translation reading frame downstream from the insertion site (see Fig. 13B, SEQ ID No. 13 and SEQ ID No. 14).

Example 5

Insertion of Type A Portable Intron into B Antigen Gene

The B antigen gene (gB) was isolated from serotype-1 MDV (strain GA) as an EcoRI/SalI fragment and cloned betweenthe EcoRI/SalI sites of the cosmid pWE15. The type A portable intron was excised from pIn(E/K) with PvuII/XbaI and the XbaI end was made blunt by filling in with Klenow. Then the intron was inserted into the EcoRV site of the gB gene in the same direction as gB transcription (Fig. 6). The PvuII/XbaI portable intron allowed the portable intron tobe inserted into the EcoRV site so that the exon sequences left behind after splicing did not disrupt the translational reading frame downstream from the insertion site (see Fig. 12A, SEQ ID No. 3 and SEQ ID No. 4).

The lacZ gene, regulated by the CMV immediate early promoter, was excised from pCMV(B/P) with NotI/XhoI and inserted into the intron in pWEΔgB(+)In between the NotI/Xho I sites (Fig. 7A). The direction of lacZ transcription was in the direction opposite to gB transcription. The vector may be linearized with SmaI (cleaves only in pWEi5) for transfection experiments. The lacZ gene regulated by HSVα4 was excised from pNotA5 with NotI/SalI and inserted into the intron in gB between the NotI/XhoI sites (Fig. 7B). The direction of lacZ transcription was opposite to gB transcription. The vector may be linearized with SphI for transfection experiments.

Example 6

Insertion of Type A Portable Intron into A Antigen Gene

The A antigen gene (gA) (Fig. 8A) was isolated from serotype-3 MDV (HVT strain FC126) as a BamHI/XhoI fragment and cloned between the BamHI/SalI sites of pUC18 (Fig. 8B). The PvuII/XbaI (blunt) intron fragment was inserted into the EcoRV site of gA in the same orientation as gA transcription (Fig. 8C). The exon sequences left behind when the intron is spliced from the gA transcript do not disrupt the downstream translation reading frame (see Fig. 12B, SEQ ID No. 5 and SEQ ID No. 6).

The CMVlacZ NotI/XhoI fragment was inserted between the NotI/XhoI sites of gA(+)In in the direction opposite to gA transcription (Fig. 9A). The vector may be linearized with SmaI for transfection experiments. The NotI/SalI HSVα4 fragment was inserted between the NotI/XhoI sites of gA(+)In in the direction opposite to gA transcription (Fig. 9B). The vector may be linearized with SphI for transfection experiments.

The CMVΔgpt NotI/XhoI fragment from pCMVΔgpt (Fig. 11D) was inserted between the NotI/XhoI sites of gA(+)In in the direction opposite to gA transcription (Fig. 16). The vector may be linearized with SphI for transfection experiments. The RSVΔgpt NotI/SalI fragment from pRSVΔgpt (Fig. HE) was inserted between the NotI/XhoI sites of pWEΔgB(+)In in the direction opposite to gB transcription (Fig. 17). The vector may be linearized with SmaI for transfection experiments.

Example 7

Assay For RNA Splicing

Chicken embryo fibroblast cells (CEF) were transfected with each of the CAT constructs by calcium phosphate precipitation. Forty-two hours later extracts from the transfected cells were assayed for chloramphenicol acteyl transferase activity (see Figures 14 and 15) according to the procedure described in Molecular Cloning: A Laboratory Manual, second edition, at pages 16.59-16.67.

Example 8 pRSVCAT(+)In Inserting the type A portable intron into the CAT gene in the (+) orientation (Fig. 4A) results in the splice donor and acceptor sites being aligned in the direction of transcription, as found for any gene containing an intron. In the (+) orientation, the CAT mRNA is spliced and the spliced mRNA encodes a functional CAT enzyme.

Extracts from CEF transfected with the construct containing the portable intron in the (+) orientation had enzyme activity similar to the activity found in extracts from CEF transfected with pRSVCAT (Fig. 14).

Example 9 pRSVCAT(-) In

Insertion of the portable intron into the CAT gene in the (-) orientation results in the intron (Fig. 4B) being inverted with respect to the direction of transcription. Consequently, the nonfunctional antisense forms of the splice donor and splice acceptor sequences are included in the RNA transcript. In the (-) orientation, the intron will not be spliced out.

The unspliced RNA transcript can still serve as a template for protein synthesis, but translation will terminate within the intron because of the numerous translational stop codons contained within the intron. The resulting protein product will be truncated and will not exhibit chloramphenicol acetyl transferase activity.

There was no activity found in extracts from CEF transfected with the construct containing the portable intron in the (-) orientation (Fig. 14).

Example 10 pRSVCAT (+) In Containing lacZ In The ( +) Orientation Insertion of the lacZ gene in the (+) orientation with respect to the CAT gene (Figure 5C and 5D) results in the transcription termination site of the lacZ gene being aligned with the direction of transcription of the CAT gene. The construct containing lacZ in the (+) orientation exhibited β-galactosidase activity, but not chloramphenicol acetyl transferase activity, upon transfection into CEF (Fig. 15). That was expected since the lacZ gene contained a transcription termination site. Thus, transcripts starting from the CAT gene RSV promoter in the (+) constructs terminated at the lacZ termination site and did not continue on to terminate at the CAT termination site. The truncated transcript did not encode a complete CAT protein, explaining the lack of chloramphenicol acteyl transferase activity.

Example 11 pRSVCAT (+) In Containing lacZ In The (-) Orientation

Insertion of the lacZ gene in the (-) orientation with respect to the CAT gene (Figure 5A and 5B) results in the lacZ gene being inverted with respect to the CAT gene. The lacZ termination signals are in the antisense orientation with respect to the CAT gene and are no longer recognizable by RNA polymerases initiating transcription at the CAT promoter. The construct containing lacZ in the (-) orientation exhibited both β-galactosidase and chloramphenicol acteyl transferase activity upon transfection into CEF (Fig. 15). When lacZ was inserted in the (-) orientation, the lacZ termination site was inverted and not recognized by RNA polymerases initiating at the CAT gene's RSV promoter. The complete CAT transcript synthesized was spliced, and a functional gene product was made. Example 12 pWEΔgB(+) In Containing lacZ In The (-) Orientation

The lacZ gene driven by the HSVα.4 promoter was inserted into pWEΔgB(+) In in the (-) orientation (Fig. 7) and transfected into CEF.

Extracts from these transfected cells had ß-galactosidase activity.

The gB homologue is a viral structural protein, not an enzyme. An assay for gB will therefore require transfection of CEF cells with pWEΔgB(+) InlacZ(-), labelling of the transfected cells with ³⁵S-methiσnine, isolation of the gB protein with gB-specific polyclonal antibodies and resolution of the isolated protein on SDS polyacrylamide gels. Example 13 gA Gene With Type A Portable Intron And Ecogpt gA(+)InCMVΔgpt (Fig. 16) was cotransfected with HVT DNA into chicken embryo fibroblast (CEF) cells by calcium phosphate precipitation. The transfected cells were cultivated in medium containing mycophenolic acid, xanthine, hypoxanthine, aminopterin and thymidine (MXHAT). Cell free virus was isolated from MXHAT-resistant virus plaques by sonication. CEF in MXHAT medium were infected with the cell free virus.

DNA was isolated from the recombinant virus, digested with NotI and electrophoresed on an agarose gel with control virus DNA digested with NotI. The gel was Southern transferred to a nylon membrane. The NotI digests were used to readily distinguish recombinant from nonrecombinant virus. NotI cleaves outside the gA gene, generating a 77-kb DNA fragment. In the recombinant virus, a NotI site is introduced at the insertion site, resulting in cleavage into 41 and 39-kb fragments (Fig. 18).

The Southern transfer was hybridized to a gA probe. In the control virus lane the expected 77-kb NotI fragment hybridized to the gA probe. In the recombinant virus DNA lane, a new 39-kb fragment hybridized to the gA probe. However, the population of virus in the recombinant virus lane still contained nonrecombinant virus, as evidenced by the 77-kb fragment. The membrane was stripped and reprobed with CMVΔgpt. Only the 39-kb fragment in the recombinant virus lane hybridized to the gA probe. The data indicates that the recombinant virus was a mixture of recombinant virus and non-recombinant virus. Proper expression of the gA gene will be assayed when a pure population of virus is isolated.

Example 14

The data indicated that insertion of the type A portable intron in the positive orientation with respect to the chloramphenicol acetyl transferase (CAT) gene resulted in correct splicing of the portable intron from the CAT mRNA precursor and production of a functional CAT protein.

The data also indicated that the lacZ gene, inserted into the CAT gene containing the type A portable intron in the (+) orientation, resulted in correct splicing of the portable intron containing lacZ from the CAT mRNA. Both the chloramphenicol acteyl transferase and ß-galactosidase protein products were functional.

References

1. A. Mayeda and Y. Ohshima, Nucleic Acids Res. 18(16):

4671-4676 (1990). 2. Molecular Cloning: A Laboratory Manual, second edition (J. Sambrook, E. F. Fristch and T. Maniatis, eds., Cold Spring Harbor Press, Cold Sping Harbor, NY, pp. 16.59- 16.67 (1989)). 3. J. D. Reilly et al., DNA and Cell Biology 9(7): 535-542 (1990).

4. M. B. Shapiro and P. Senapathy, Nucleic Acids Res.

15(17): 7155-7174 (1987).

5. R. F. Silva and A. Finkelstein, A. Recombinant viruses as poultry vaccines. In: Genetic Engineering of Animals (W. Hansel and B. J. Weir, eds.), The Journals of Reproduction and Fertility, Colchester, Essex. pp. 153-162 (1990).

6. V. L. Tieber et al., Virology 179: 719-727 (1990).

7. T. Yoshimatsu and F. Nagawa, Science 244: 1346-1348 (1989).

8. C. Vancanneyt et al., Mol. Gen. Genet. 220: 245-250 (1990). SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Silva, Robert F

Reilly, John D

(ii) TITLE OF INVENTION: PORTABLE INTRON AS AN INSERTION VECTOR FOR

GENE INSERTION

(iii) NUMBER OF SEQUENCES: 14

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSES: Curtis P. Ribando, Esq.

(B) STREET: 1815 N. University Street

(C) CITY: Peoria

(D) STATE: Illinois

(E) COUNTRY: USA

(F) ZIP: 61604

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.24

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Ribando, Curtis P

(C) REFERENCE/DOCKET NUMBER: ARS P.O. 2090.91

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 309-685-4011 ex. 513

(B) TELEFAX: 309-685-4128

(2) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 344 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(iv) ANTI-SENSE: N

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 1..2

(D) OTHER INFORMATION: /standard name= "plasmid sequence" (ix) FEATURE:

(A) NAME/KEY: exon (B) LOCATION: 3..27

(D) OTHER INFORMATION: /standard_name= "adenovirus late leader exon 1"

(ix) FEATURE:

(A) NAME/KEY: intron

(B) LOCATION: 28..259

(D) OTHER INFORMATION:

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 28..29

(D) OTHER INFORMATION: /standard_name= "splice donor sequence" (ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 120.7173

(D) OTHER INFORMATION: /standard_name= "multiple cloning site" (ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 231.7237

(D) OTHER INFORMATION: /standard_name= "lariat branch acceptor sequence"

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 236

(D) OTHER INFORMATION: /standard_name= "lariat branch acceptor nucleotide"

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 237..259

(D) OTHER INFORMATION: /standard_name= "pyrimidine-rich

sequence"

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 258.7259

(D) OTHER INFORMATION: /standard_name= "splice acceptor

sequence"

(ix) FEATURE:

(A) NAME/KEY: exon

(B) LOCATION: 260..299

(D) OTHER INFORMATION: /standard_name= "adenovirus late leader exon 2"

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 300..343

(D) OTHER INFORMATION: /standard_name= "plasmid sequence"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

GGAATTCCGC GAGGOCCAGC TGTTGGGGTG AGTACTCCCT CTCAAAAGCG GGCATGACTT 60

CTGCGCTAAG ATTOTCAGTT TCCAAAAACG AGGAGGATTT TTGATATTCA CCTGGCCCGC 120

GGTGGCGGCC GCTCTAGAAC TAGTGGATCC CCCGACCTCG AGGGGGGGCC CCAAGCTTGG 180

TGACCTGCAC GTCTAGGGCG CAGTAGTCCA GGGTTTCCTT GATGATGTCA TACTTATCCT 240

GTCCCTTTTT TTTCCACAGC TCCCGGTTGA GGAACAAACT CTTCGCGGTC TTTCCAGTGG 300

GTACCCGGGG ATCCTCTAGA GTCGACCTGC AGGCATGCAA GCTT 344 (2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 266 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(iv) ANTI-SENSE: N

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 1..6

(D) OTHER INFORMATION: /standard name= "plasmid sequence" (ix) FEATURE:

(A) NAME/KEY: exon

(B) LOCATION: 7..15

(D) OTHER INFORMATION: /standard_name= "adenovirus late leader exon 1"

(ix) FEATURE:

(A) NAME/KEY: intron

(B) LOCATION: 16..247

(D) OTHER INFORMATION:

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 16..17

(D) OTHER INFORMATION: /standard name* "splice donor site" (ix) FEATURE:

(A) NAME/KEY: misc feature

(B) LOCATION: 108.7.62

(D) OTHER INFORMATION: /standard name- "multiple cloning site" (ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 219..225

(D) OTHER INFORMATION: /standard_name= "lariat branch acceptor sequence"

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 224

(D) OTHER INFORMATION: /standard_name= "lariat branch acceptor sequence"

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 246.7247

(D) OTHER INFORMATION: /standard_name= "splice acceptor

sequence"

(ix) FEATURES

(A) NAME/KEY: misc_feature

(B) LOCATION: 248..262

(D) OTHER INFORMATION: /standard_name= "adenovirus late leader exon 2"

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 263..266

(D) OTHER INFORMATION: /standard name= "plasmid sequence" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

GAATTCGCAG TTCACGTGAG TACTCCCTCT CAAAAGCGGG CATGACTTCT GCGCTAAGAT 60

TGTCAGTTTC CAAAAACGAG GAGGATTTTT GATATTCACC TGGCCCGCGG TGGCGGCCGC 120

TCTAGAACTA GTGGATCCCC CGACCTCCAG GGGGGGCCCC AAGCTTGGTG ACCTGCACGT 180

CTAGGGCGCA GTAGTCCAGG GTTTCCTTGA TGATGTCATA CTTATCCTGT CCCTTTTTTT 240

TCCACAGCTG GCGGTTGAGG AATTCC 266 (2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 10..15

(D) OTHER INFORMATION: /standard_name= "EcoRV cleavage site" (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 2..31

(D) OTHER INFORMATION:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

A CCC ATG GGA TAT CCC CAG GAT AAT TTC AAA 31

Pro Met Gly Tyr Pro Gln Asp Asn Phe Lys

1 5 10

(2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 10 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Pro Met Gly Tyr Pro Gln Asp Asn Phe Lys

1 5 10

(2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 85 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(iv) ANTI-SENSE: N

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 2..85

(D) OTHER INFORMATION:

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 1..11

(D) OTHER INFORMATION: /standard_name= "gB sequence" (ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 12..65

(D) OTHER INFORMATION: /standard_name= "adenovirus late leader exon 1 and exon 2"

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 66..85

(D) OTHER INFORMATION: /standard_name- "gB sequence"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

A CCC ATG GGA TCT GTT GGG CTC GCG GTT GAG GAA CAA ACT CTT CGC 46

Pro Met Gly Ser Val Gly Leu Ala Val Glu Glu Gln Thr Leu Arg

1 5 10 15

GGT CTT TCC ACT GGG TAC CAT CCC CAG GAT AAT TTC AAA 85

Gly Leu Ser Ser Gly Tyr His Pro Gln Asp Asn Phe Lys

20 25

(2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

Pro Met Gly Ser Val Gly Leu Ala Val Glu Glu Gln Thr Leu Arg Gly

1 5 10 15

Leu Ser Ser Gly Tyr His Pro Gln Asp Asn Phe Lys

20 25

(2) INFORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 34 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 2..34

(D) OTHER INFORMATION:

(ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 8..13

(D) OTHER INFORMATION: /standard_name= "EcoRV cleavage site"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

A CTA ATT GGA TAT CCG TTC GAC GTG GAT AGA TTT 34

Leu Ile Gly Tyr Pro Phe Asp Val Asp Arg Phe

1 5 10

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 11 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

Leu Ile Gly Tyr Pro Phe Asp Val Asp Arg Phe

1 5 10

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 88 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(iv) ANTI-SENSE: N

(ix) FEATURE:

(A) NAME/XEY: CDS

(B) LOCATION: 2..88

(D) OTHER INFORMATION:

(ix) FEATURES

(A) NAME/KEY: exon

(B) LOCATION: 1..11 (D) OTHER INFORMATION: /standard_name= "Marek's Disease Virus glycoprotein A coding sequence"

(ix) FEATURE:

(A) NAME/KEY: exon

(B) LOCATION: 12..65

(D) OTHER INFORMATION: /standard_name= "adenovirus late leader exon 1 and exon 2 sequence"

(ix) FEATURE:

(A) NAME/KEY: exon

(B) LOCATION: 66..88

(D) OTHER INFORMATION: /standard_name= "Marek's Disease Virus glycoprotein A coding sequence"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

A CTA ATT GGA TCT GTT GGG CTC GCG GTT GAG GAA CAA ACT CTT CGC 46

Leu Ile Gly Ser Val Gly Leu Ala Val Glu Glu Gln Thr Leu Arg

1 5 10 15

GGT CTT TCC AGT GGG TAC CAT CCG TTC GAC GTG GAT AGA TTT 88

Gly Leu Ser Ser Gly Tyr His Pro Phe Asp Val Asp Arg Phe

20 25

(2) INFORMATION FOR SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

Leu Ile Gly Ser Val Gly Leu Ala Val Glu Glu Gln Thr Leu Arg Gly

1 5 10 15

Leu Ser Ser Gly Tyr His Pro Phe Asp Val Asp Arg Phe

20 25

(2) INFORMATION FOR SEQ ID NO: 11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 37 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESSs double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(iv) ANTI-SENSE: N

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 2..37

(D) OTHER INFORMATION: (ix) FEATURE:

(A) NAME/KEY: misc_feature

(B) LOCATION: 11..16

(D) OTHER INFORMATION: /standard_name= "PvuII restriction

endonuclease cleavage site"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

C CAG ACC GTT CAG CTG GAT ATT ACG GCC TTT TTA AAG 37

Gln Thr Val Gln Leu Asp Ile Thr Ala Phe Leu Lys

1 5 10

(2) INFORMATION FOR SEQ ID NO: 12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTHS 12 amino acids

(B) TYPEs amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

Gln Thr Val Gln Leu Asp Ile Thr Ala Phe Leu Lys

1 5 10

(2) INFORMATION FOR SEQ ID NO: 13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 109 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPEs DNA (genomic)

(iii) HYPOTHETICAL: N

(ix) FEATURES

(A) NAME/KEY: CDS

(B) LOCATION: 2..109

(D) OTHER INFORMATION:

(ix) FEATURES

(A) NAME/KEY: exon

(B) LOCATIONS 1..13

(D) OTHER INFORMATION: /standard_name- "chloramphenicol acetyl transferaϊe gene sequences"

(ix) FEATURE:

(A) NAME/KEYs exon

(B) LOCATION: 14..88

(D) OTHER INFORMATION: /standard_name= "adenovirus late leader exon 1 and exon 2 sequences"

(ix) FEATURES

(A) NAME/KEY: exon

(B) LOCATION: 89..109

(D) OTHER INFORMATION: /standard_name= "chloramphenicol acetyl transferase gene sequences" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

C CAG ACC GTT CAG CTG TTG GGC TCG CCG TTG AGG AAC AAA CTC TTC 46

Gln Thr Val Gln Leu Leu Gly Ser Arg Leu Arg Asn Lys Leu Phe

1 5 10 15

GCG GTC TTT CCA GTG GGT ACC CGG GGA TCC TCT AGA GTC CTG GAT ATT 94 Ala Val Phe Pro Val Gly Thr Arg Gly Ser Ser Arg Val Leu Asp Ile

20 25 30

ACG GCC TTT TTA AAG 109

Thr Ala Phe Leu Lys

35

(2) INFORMATION FOR SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 amino acids

(B) TYPEs amino acid

(D) TOPOLOGYs linear

(ii) MOLECULE TYPEs protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

Gln Thr Val Gln Leu Leu Gly Ser Arg Leu Arg Asn Lys Leu Phe Ala

1 5 10 15

Val Phe Pro Val Gly Thr Arg Gly Ser Ser Arg Val Leu Asp Ile Thr

20 25 30

Ala Phe Leu Lye

35

Claims

What is claimed is:

1. An isolated DNA molecule which comprises in the direction from 5' to 3' a splice donor sequence, a multiple cloning site, a lariat branch acceptor sequence, a pyrimidine-rich sequence; and a splice acceptor sequence.

2. The isolated DNA molecule of claim 1, wherein a DNA sequence has been inserted into the multiple cloning site.

3. The isolated DNA molecule of claim 2, wherein the DNA sequence encodes an antisense RNA molecule.

4. The isolated DNA molecule of claim 2, wherein the DNA sequence encodes a messenger RNA molecule.

5. The isolated DNA molecule of claim 4, wherein the messenger RNA molecule encodes a protein.

6. The isolated DNA molecule of claim 5, wherein the protein is a detectable marker, selectable marker, viral protein, modulator of growth or modulator of immunity.

7. The isolated DNA molecule of claim 2, wherein the DNA sequence comprises a transcriptional regulatory element.

8. The isolated DNA molecule of claim 7 , wherein the transcriptional regulatory element comprises an enhancer.

9. The isolated DNA molecule of claim 2, wherein the DNA sequence comprises a replication control element.

10. The isolated DNA molecule of claim 9, wherein the replication control element comprises a viral origin of replication.

11. The isolated DNA molecule of claim 2 further comprising a second DNA sequence inserted into the multiple cloning site.

12. A recombinant viral genomic DNA molecule comprising the isolated DNA molecule of claim 1.

13. The recombinant viral genomic DNA molecule of claim 12, wherein the DNA molecule is a cDNA molecule.

14. A modified live virus comprising the recombinant viral genomic DNA molecule of claim 12.

15. A vaccine comprising per dose an effective immunizing amount of the modified live virus of claim 14 and a suitable carrier.

16. A method of immunizing an animal against a viral disease which comprises administering to the animal a dose of the vaccine of claim 15.

17. The method of claim 16, wherein the animal is a fowl.

18. The method of claim 16, wherein the animal is a mammal.

19. A recombinant cloning vector comprising the isolated DNA molecule of claim 1.

20. The recombinant cloning vector of claim 19, further comprising a gene into which the isolated DNA molecule has been inserted.

21. A stably transformed eukaryotic cell comprising the recombinant cloning vector of claim 19.

22. A method of producing a messenger RNA molecule which comprises culturing the stably transformed eukaryotic cell of claim 21 under conditions permitting transcription of DNA sequence into an RNA molecule and recovering the RNA molecule so produced.

23. A method of producing a protein which comprises culturing the stably transformed eukaryotic cell of claim 21 under conditions permitting transcription of a DNA into an mRNA molecule and translation of the resultant mRNA molecule into a protein, followed by recovering the protein so produced.

24. A method of expressing a gene in an animal that is not normally expressed in the animal or of correcting a defect in the animal's expression of the gene which comprises transformation of cells of the animals with the isolated DNA molecule of claim 2.

25. A method of mutating a first gene on one DNA strand without mutating an overlapping gene on the complementary DNA strand which comprises inserting the isolated DNA molecule of this invention into the first gene in the negative orientation with respect to the first gene and in the positive orientation with respect to the overlapping gene on the complementary DNA strand.

26. A method of inhibiting a function of a multifunctional protein without inhibiting the other functions of the protein, which comprises inserting the isolated DNA molecule of this invention into a gene encoding the protein in a region of the gene which encodes the function of the protein to be inhibited.