WO1994004680A1 - Human interleukin-13 - Google Patents
Human interleukin-13 Download PDFInfo
- Publication number
- WO1994004680A1 WO1994004680A1 PCT/US1993/007645 US9307645W WO9404680A1 WO 1994004680 A1 WO1994004680 A1 WO 1994004680A1 US 9307645 W US9307645 W US 9307645W WO 9404680 A1 WO9404680 A1 WO 9404680A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- human
- cell
- expression
- hil
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/5437—IL-13
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/23—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a GST-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
- C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
Definitions
- the present invention relates to compositions and methods for affecting the human immune system.
- it provides nucleic acids, proteins, and antibodies which regulate immune system response and development. Diagnostic and therapeutic uses of these materials are also disclosed.
- lymphokines cytokines
- monokines soluble proteins
- this invention fills this need by providing one such new lymphokine. More particularly, this invention provides human interleukin-13 (IL-13), and methods for its use. This invention also provides nucleic acids coding for polypeptides themselves and methods for their production and use. The nucleic acids of the invention are characterized by their homology to cloned complementary DNA (cDNA) sequences enclosed herein, and/or by functional assays for IL-13 activity applied to the polypeptides, which are typically encoded by these nucleic acids. Methods for modulating or intervening in the control of an immune response are provided.
- cDNA cloned complementary DNA
- the invention is based, in part, on the discovery and cloning of human cDNAs which are capable of expressing proteins having IL-13 activity.
- cDNA clones include human cDNA inserts of plasmid vectors pB21.2Bf and pA10.66, which contain partial and full length sequences, respectively. Equivalent vectors may be constructed by using polymerase chain reaction (PCR) techniques and the sequences of the inserts.
- the present invention provides an isolated nucleic acid comprising a segment homologous to a sequence of human IL-13 disclosed in Table 1. Typically, the segment is at least about 50 nucleotides, and will often encode a protein exhibiting a biological activity characteristic of a human IL-13, e.g., an amino acid sequence of Table 1.
- the segment is at least 80% homologous to the coding sequence disclosed in Table 1.
- the nucleic acid will further encode a second protein.
- the invention also encompasses a vector or a cell containing the nucleic acid.
- the nucleic acid can be a recombinant nucleic acid with a segment homologous to a sequence of human IL-13 disclosed in Table 1. Usually, this will encode a human IL-13 or may encode a fusion protein.
- the invention also embraces vectors, e.g., expression vectors, and cells containing the nucleic acid.
- the invention provides an isolated human IL-13 protein or peptide.
- the protein has a full length sequence disclosed in Table 1, or will be a mutein thereof, and may include an altered post-translational modification pattern, e.g., glycosylation variants.
- Other embodiments include a fusion protein comprising a peptide of human IL-13, and cells containing such.
- the invention provides a method of refolding a guanidine denatured mouse P600 or human IL-13 protein comprising solubilizing said protein in 6M guanidine at a concentration of about 2.5 mg/ml; diluting the guanidine to about 60 mM over a period of hours in the presence of both reduced and oxidized glutathione; and incubating the diluted guanidine solution for at least about 12 hrs.
- the invention also provides an antibody which specifically binds to human IL-13, e.g., a mouse, a monoclonal, or a chimeric antibody. It also provides a method of supporting monocyte or B cell proliferation in a sample, or sustaining viability of said cell, by contacting the sample with an effective amount of human IL-13, alone or in combination with another cytokine, e.g., IL-4 or IL-10. In some embodiments, methods are provided for detecting human IL-13 in a sample by contacting the sample with a binding composition which recognizes human IL-13 or a nucleic acid which hybridizes to a nucleic acid encoding a human IL-13.
- a binding composition which recognizes human IL-13 or a nucleic acid which hybridizes to a nucleic acid encoding a human IL-13.
- the binding composition can be a monoclonal antibody, and the sample can be a blood sample.
- the invention provides methods of modulating the growth of a hemopoietic B cell or T cell by contacting the cell with an effective amount of an IL-13 and Bb-4 combination or antagonists thereto, including an IL-4 antagonist.
- the hemopoietic cell growth can be accompanied by cell differentiation to antibody producing cells.
- the invention further provides methods of modulating proliferation of a myeloid precursor cell by contacting the cell with an effective amount of a human IL-13, mouse P600, or agonists or antagonists thereof. Often the modulating proliferation is accompanied by cell differentiation.
- Methods of modulating the immune response to an infection or allergen are provided, e.g., by administering an effective amount of a human IL-13, mouse P600, or agonists or antagonists thereof, including an IL-4 antagonist.
- the invention provides methods of sustaining cell viability of a myeloid precursor cell by contacting the cell with an effective amount of a human IL-13, a mouse P600, or an agonist or antagonist thereof, including an IL-4 antagonist, and combinations with additional cytokines, including IL-4 and IL-10.
- the present invention provides the amino acid sequence and
- the library from which an intermediate clone of less than full length was isolated failed to provide the correct clone when screened with oligonucleotide or genomic DNA probes.
- clones isolated using the genomic mouse sequence as a probe turned out to be false positives, i.e., they did not encode the human equivalent as evaluated by sequencing.
- At least one other research group also failed to isolate the gene using a similar approach.
- a different approach was devised which successfully led to isolating a human homolog to the mouse P600 gene. Instead of using oligonucleotide probes of relatively short length, a probe corresponding to nearly the full length coding region of the mouse gene was used.
- the cell type used to make the cDNA library was quite important.
- the initially isolated clone designated pB21.Bf2
- pB21.Bf2 was less than full length. Isolating a full length clone required use of yet another cDNA library. Thus, the isolation of the full length human clone, designated pA 10.66 required investment of significant time and resources. After knowing the regions of high homology between the mouse and human genes, isolation using oligonucleotide probes of relatively short length would now be relatively straightforward.
- a cDNA library constructed in a pCD vector, was prepared from RNA isolated from human B21 cells. These cells are human T cells which, it is now understood, exhibit many of the same markers as the cells providing the mouse clone.
- Several modifications and unusual techniques were utilized to overcome problems associated with isolating a cDNA clone when probing the library with oligonucleotides.
- the initial human isolate showed homology to the mouse gene, but lacked part of the amino terminal coding portion. Thus, this intermediate isolate was less than a full length clone. Attempts to isolate a full length clone from the B21 derived library failed. However, upon selection of another cDNA library, the near full length human probe allowed isolation of the full length human clone.
- Table 1 A complete nucleotide and deduced amino acid sequence of the pA 10.66 clone is shown in Table 1. This nucleotide sequence corresponds to the sequence defined by SEQ ID NO: 1.
- Table 2 compares the gene sequence of Table 1 to a published gene sequence of the mouse P600 protein.
- Table 3 compares the deduced amino acid sequence of the human IL-13 and the published mouse P600 amino acid sequence.
- Table 1 Nucleotide and Amino Acid Sequence of .huIL-13.
- Table 3 Comparison of Human IL-13 and Mouse P600 Amino Acid Sequences (human above; mouse below). Another form of human IL-13 has a GLN between amino acids numbered 97 and 98 (position indicated by I), caused by alternative mRNA splicing.
- IL-13 describes a protein comprising a protein or peptide segment having the amino acid sequence shown in Table 1, or a fragment thereof. It also refers to a polypeptide which functionally affects cells or subcellular components in a manner similar to the IL-13 allele whose sequence is provided. It also encompasses allelic and other variants, e.g., metabolic, of the protein described. Typically, it will bind to its corresponding biological receptor with high affinity, e.g., at least about 100 nM, usually better than about 30 nM, preferably better than about 10 nM, and more preferably at better than about 3 nM. The term shall also be used herein to refer to related naturally occurring forms, e.g., allelic and metabolic variants of the human protein.
- This invention also encompasses proteins or peptides having substantial amino acid sequence homology with the amino acid sequence in Table 1, but excluding any protein or peptide which exhibits substantially the same or lesser amino acid sequence homology than does the corresponding P600 protein found in the mouse.
- a polypeptide "fragment”, or “segment” is a stretch of amino acid residues of at least about 8 amino acids, generally at least 10 amino acids, more generally at least 12 amino acids, often at least 14 amino acids, more often at least 16 amino acids, typically at least 18 amino acids, more typically at least 20 amino acids, usually at least 22 amino acids, more usually at least 24 amino acids, preferably at least 26 amino acids, more preferably at least 28 amino acids, and, in particularly preferred embodiments, at least about 30 or more amino acids. Sequences of segments of different proteins can be compared to one another over appropriate length stretches.
- Amino acid sequence homology, or sequence identity is determined by optimizing residue matches, if necessary, by introducing gaps as required. See, e.g., Needleham et al., J. Mol. Biol. 48:443 (1970); Sankoff et al., chapter one in Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparsion, 1983, Addison-Wesley, Reading, MA; and software packages from IntelliGenetics, Mountain View, CA; and the University of Wisconsin Genetics Computer Group, Madison, WI. This changes when considering conservative substitutions as matches.
- Conservative substitutions typically include substitutions within the following groups: gly cine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
- Homologous amino acid sequences are intended to include natural allelic variations in the provided sequence. Typical homologous proteins or peptides will have from 50-100% homology (if gaps can be introduced), to 60-100% homology (if conservative substitutions are included) with an amino acid sequence segment of Table 1.
- Homology will be at least about 50%, generally at least 58%, more generally at least 63%, often at least 69%, more often at least 75%, typically at least 81%, more typically at least 86%, usually at least 90%, more usually at least 93%, preferably at least 95%, and more preferably at least 97%, and in particularly preferred embodiments, at least 98% or more.
- the degree of homology will vary with the length of the compared segments.
- Homologous proteins or peptides, such as the allelic variants, will share most biological activities with the embodiment described in Table 1.
- biological activity is used to describe, without limitation, inducing characteristic cell stimulation, Ig production, cellular differentiation, or cell viability functions, or more structural properties as receptor binding and cross-reactivity with antibodies raised against the same or an allelic variant of the described human IL-13.
- ligand, agonist, antagonist, and analog include molecules that modulate the characteristic cellular responses to IL-13 or IL-13-like proteins, as well as molecules possessing the more standard structural binding competition features of ligand- receptor interactions, e.g., where the receptor is a natural receptor or an antibody. The cellular responses likely are mediated through binding of IL-13 to cellular receptors.
- a ligand is a molecule which serves either as a natural ligand to which said receptor, or an analogue thereof, binds, or a molecule which is a functional analogue of the natural ligand.
- the functional analogue may be a ligand with structural modifications, or may be a wholly unrelated molecule which has a molecular shape which interacts with the appropriate ligand binding determinants.
- the ligands may serve as agonists or antagonists, see, e.g., Goodman et al., Eds., The Pharmacological Bases of Therapeutics, 1990, Pergamon Press, New York.
- the human IL-13 protein has a number of different biological activities.
- the human IL-13 is homologous to the mouse P600 protein, but has structural differences.
- the human IL-13 gene coding sequence has only about 50% homology with the nucleotide coding sequence of mouse P600. At the amino acid level, there is about 66% identity.
- the mouse P600 molecule had rather minimally defined biological activities. In particular, it has the ability to stimulate undifferentiated mouse bone marrow cells to undergo early stages of differentiation. The mouse P600 protein appears to activate both mouse cells and human cells in this assay.
- the present disclosure also describes new activities which have been discovered using the mouse P600 molecule.
- the difference in structure between the human IL-13 and the homologous mouse P600 protein introduce some uncertainty about whether the two proteins will have identical functional properties.
- the handful of identified activities appear to be shared between the homologues. It is likely that many of the activities of mouse P600 on mouse cells or human cells will also apply to the human IL-13.
- the cross species activities indicate that many structural features are not critical in the function of the molocules.
- human IL-13 exhibits a number of identified activities when provided to human cells.
- the Examples section below describes procedures used to study the effects of human IL-13 on cell viability, morphology, proliferation, and differentiation.
- human IL-13 affects B cells, PBMC, and macrophages.
- the cytokine affects proliferation, alone or in combination with other cytokines; sustains cell viability; affects survival; causes modification of Ig surface markers; has effects specifically on CD40; and affects IgE switching.
- IL-4 On PBMC or macrophages, it induces morphological changes, causes changes of cell surface markers, affects nitric oxide production, affects IL-l ⁇ and IL-6 expression, and affects antibody dependent cell-mediated cytotoxicity (ADCC).
- ADCC antibody dependent cell-mediated cytotoxicity
- the similarity between IL-4 and IL-13 leads to antagonists of IL-13 whose structures are based upon similar antagonists of IL-4. These activities can be useful in treating immunological conditions characterized by corresponding disfunctions. See, e.g., Merck Manual, or Paul, Fundamental Immunology.
- Mouse P600 made from E. coli has the ability to stimulate or costimulate proliferation of large in vivo activated mouse B cells.
- IL-4 soluble anti-CD40
- mouse P600 stimulates proliferation of these cells.
- the large in vivo activated mouse B cells may contain some monocytes and other cells, other cells may be induced to secrete various growth factors which support the proliferation observed.
- the mouse P600 stimulates the B cells, either directly or indirectly, alone or in combination with other factors.
- Human IL-13 should exhibit similar biological activity.
- IL-13 enhanced the DNA synthesis of B cells activated through their antigen receptor. This induction was dose dependent, and was comparable in effect to IL-10, but less than IL-2 or IL-4. The time course of the effect was also different from IL-2 and IL-4. Similarly, B cells activated through their CD40 receptor were also affected, again in a dose dependent manner, and comparable to IL-4 and IL-10 effects. The kinetics of the effects exhibited a different time course from IL-4 or IL-10 responses. The combination of
- IL-10 and IL-13 exhibited additive effects, but IL-13 did not appear to increase any IL-4 effects. This suggested, with other data, that these two cytokines may share some components in signal transduction, though other data show some independence of effects. More specifically, IL-13 induced expression of various Ig's, particularly IgE. The target cell population for IL-13 also appears more restricted than for IL-4. Thus, although IL-4 and IL-13 share many biological properties, their signal transduction pathways are physiologially and mechanistically distinguishable.
- B cells activated by B21 T cell clone, their membranes, or anti- CD40 appear to exhibit modified Ig production patterns after exposure to mouse P600 or human IL-13.
- the levels of production of various Ig molecule subtypes when human IL-13 is co- administered to B cells with an inducing agent, e.g., activated B21 T cells, membranes from activated B21 T cells, or anti-CD40 antibodies were increased, particularly IgE.
- the changes in Ig production are suggestive of accelerated differentiation including IgG4 and/or IgE class switching. Both possibilities are consistent with a differentiation effect caused by mouse P600 or human IL-13.
- the effects of anti-CD40 antibody or CD40 ligand on B cell proliferation were enhanced in the presence of either IL-4 or IL-13. Both cytokines had comparable effects in spite of their significant sequence divergence.
- the B cell proliferation was accompanied by induction of IgM, IgG4, total IgG, and IgE levels.
- IgA was not stimulated.
- the two cytokines appeared to act through different structural mechanisms as anti-IL-4 antibodies blocked IL-4 effects, but not IL-13 effects.
- the effects on IgE suggest that IL-13 contributes to IgE production and is an important factor in controlling IgE mediated allergic reactions.
- IL-13 induced IgG4 and IgE synthesis by unfractionated peripheral blood mononuclear cells (PBMNC) and highly purified B cells cultured in the presence of activated CD4+ T cells or their membranes.
- IL-13-induced IgG4 and IgE synthesis was IL-4- independent, since it was not affected by neutralizing anti-IL-4 monoclonal antibody (mAb).
- Highly purified sIgD + B cells could also be induced to produce IgG4 and IgE by IL-13, indicating that the production of these isotypes reflected IgG4 and IgE switching and not a selective outgrowth of committed B cells.
- IL-4 and IL-13 were added together at optimal concentrations, had no additive or synergistic effect, suggesting that common signaling pathways may be involved.
- This notion is supported by the observation that IL-13, like IL-4, induced CD23 expression on B cells and enhanced CD72, surface IgM (slgM), and class II MHC antigen expression.
- slgM surface IgM
- class II MHC antigen expression IL-13 induced germline ⁇ transcription in highly purified B cells.
- IL-13 is another T cell-derived cytokine that, in addition to IL-4, efficiently directs naive human B cells to switch to IgG4 and IgE production.
- the mouse P600 also induced morphological changes in adherent human peripheral blood mononuclear cells.
- the treated cells exhibited significantly different morphology and clusters of small cells.
- the generic cells rounded up, and there was evidence of clonal proliferation, observations which were consistent with induction of cell proliferation.
- IL-13 (P600) was assayed by its LPS stimulated inhibitiory effect on the production of nitric oxide (NO) by GM-CSF-derived bone marrow macrophages. IFN- ⁇ induced NO production, while IL-4 or IL-13 inhibited NO production.
- IL-4 and IL-13 inhibited the production of IL-l ⁇ , IL-6, IL-10, and TNF- ⁇ by LPS-activated human monocytes.
- the inhibitory effects of IL-4 and IL-13 on cytokine production by LPS activated human monocytes were independent of IL-10, since IL-4 and IL-13 inhibited the production of IL-l ⁇ , IL-6, and TNF- ⁇ in the presence of neutralizing anti-IL-10 mAb 19F1.
- IL-13 induced significant changes in the phenotype of monocytes. Like IL-4, it enhanced the expression of CDl lb, CDl lc, CD18, CD29, CD49e (VLA-5), class II MHC, CD13, and CD23 whereas it decreased the expression of CD64, CD32, CD 16, and CD 14 in a dose dependent manner. IL-13 induced upregulation of class II MHC antigens and its downregulatory effects on CD64, CD32, and CD16 expression were prevented by IL-10.
- IFN- ⁇ could also partially prevent the IL-13 induced downregulation of CD64, but not that of CD32 and CD16.
- IL-13 strongly inhibited spontaneous and IL-10 or IFN- ⁇ induced antibody dependent cell-mediated cytotoxicity (ADCC) activity of human monocytes toward anti-IgD coated Rh + erythrocytes, indicating that the cytotoxic activity of monocytes was inhibited.
- ADCC antibody dependent cell-mediated cytotoxicity
- the mouse P600 protein can sustain or promote the proliferation of large in vivo activated B cells.
- the factor appears to be either a stimulatory or costimulatory factor useful in promoting activated B cell growth.
- Human IL-13 is therefore expected to be a useful factor in circumstances where activated B cell growth is desired.
- mouse P600 induces changes in morphology of the monocyte cells.
- the monocyte cells consist primarily of macrophage precursors, and similar results should apply to monocyte equivalents found in organs or tissues other than the peripheral blood, e.g., the aveolar, intraperitoneal, or spleen/lymph macrophage precursors.
- the IL-13 or antagonist, e.g., antibody or IL-4 antagonist, would be indicated for conditions where regulation of localized or systemic immune responses is desired and appropriate.
- the effects on class II MHC are especially relevant in these contexts.
- human IL-13 also affects differentiation of various cells of the immune system. For instance, in activated B cells, it accelerates or promotes the differentiation of Ig producing cells. It induces the B cells to produce Ig molecules characteristic of later or faster differentiation. As such, the human IL-13 and mouse P600 appear to be a differentiation factor for B cells.
- Ig production should be regulatable by IL-13, alone or in combination with other factors.
- Agonists and antagonists when provided in appropriate amounts and schedules, will be useful in treating or controlling abnormal B cell conditions, or to accelerate or decelerate B cell differentiation when appropriate.
- Peripheral blood monocytes are also sensitive to the presence of both human IL-13 and mouse P600. These cells, consisting primarily of macrophage precursors and more differentiated cell types, exhibit both a proliferative response and a differentiation response.
- IL-4 is appropriate in antitumor situations, e.g., to stimulate an endogenous response to counter the tumor; IL-13 should also be a useful therapeutic.
- IL-13 would be useful to restore function by promoting recovery and differentiation of the remaining immune function. See, e.g., Moller (ed), "Fc Receptors" in Immunological Reviews 125 :1 (1992). Similar problems exist in transplantation contexts, as well as in other genetic or developmental immunodeficiencies, e.g., in newborn infants. See, e.g., Baker et al., N. Eng. J. Med. 327:213 (1992).
- IL-13 In fact, the role of IL-13 in promoting restoration of immune function under these circumstances is supported by the cell marker changes observed. With respect to cell marker differentiation, the general trend is that the class II MHC markers are affected. Also, CD23 is affected. The effects on class II MHC markers indicate that systemic responsiveness to infections can be modulated with IL-13 or mouse P600, or agonists or antagonists thereof.
- IL-13 mediates changes in CD11 marker expression, which are associated with cell adhesion, e.g., cell-cell contacts, Thus, increasing CD 11 should facilitate cellular interaction and the functional results therefrom. See also Springer et al., Leukocyte Adhesion Molecules, 1988, Springer-Verlag, New York.
- IgG4 and IgE switching and IgG4 and IgE synthesis IgG4 and IgE switching and IgG4 and IgE synthesis.
- IgE antibodies are major mediators of allergic reactions. Allergen-specific antibodies of the IgE isotype have the specific ability to bind to high affinity Fc receptors for IgE (Fc ⁇ RI) on mast cells and basophils. Binding of the relevant allergen to these receptor-bound IgE antibodies results in cross-linking of the receptor and activation of the mast cells and basophils.
- IL-13 like IL-4 induces the expression of the low affinity receptor for IgE (Fc ⁇ RII, or CD23) on B cells and monocytes, and the subsequent release of a soluble form of CD23.
- Soluble CD23 enhances the production of IgE [see, e.g., Pene et ah, Eur. J. Immunol. 75:929 (1988); Aubry et al., Nature 358:505 (1992)]. Therefore, downregulation of IgE synthesis and soluble CD23 production reduce or inhibit IgE-mediated allergic diseases.
- IL-4 and/or IL-13 antagonists such as antibodies, or IL-4 mutant proteins like Y124D or similar mutant IL-13 proteins that compete for IL-4/IL-13 receptor binding, would be useful for blocking IgE production.
- This invention contemplates use of isolated nucleic acid or fragments which encode this or a closely related protein, or fragments thereof, to encode a biologically active corresponding polypeptide.
- this invention covers isolated or recombinant DNA which encodes a biologically active protein or polypeptide having characteristic IL-13 activity.
- the nucleic acid is capable of hybridizing, under appropriate conditions, with a nucleic acid sequence segment shown in Table 1.
- Said biologically active protein or polypeptide can be a full length protein, or fragment, and will typically have a segment of amino acid sequence highly homologous to one shown in Table 1. Further, this invention covers the use of isolated or recombinant nucleic acid, or fragments thereof, which encode proteins having fragments which are homologous to the disclosed IL-13 protein.
- the isolated nucleic acids can have the respective regulatory sequences in the 5' and 3' flanks, e.g., promoters, enhancers, poly-A addition signals, and others from the natural gene.
- an "isolated" nucleic acid is a nucleic acid, e.g., an RNA, DNA, or a mixed polymer, which is substantially pure, e.g., separated from other components which naturally accompany a native sequence, such as ribosomes, polymerases, and flanking genomic sequences from the originating species.
- the term embraces a nucleic acid sequence which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates, which are thereby distinguishable from naturally occurring compositions, and chemically synthesized analogues or analogues biologically synthesized by heterologous systems.
- a substantially pure molecule includes isolated forms of the molecule, either completely or substantially pure.
- An isolated nucleic acid will generally be a homogeneous composition of molecules, but will, in some embodiments, contain heterogeneity, preferably minor. This heterogeneity is typically found at the polymer ends or portions not critical to a desired biological function or activity.
- a "recombinant" nucleic acid is defined either by its method of production or its structure.
- the process is use of recombinant nucleic acid techniques, e.g., involving human intervention in the nucleotide sequence.
- this intervention involves in vitro manipulation, although under certain circumstances it may involve more classical animal breeding techniques.
- it can be a nucleic acid made by generating a sequence comprising fusion of two fragments which are not naturally contiguous to each other, but is meant to-exclude products of nature, e.g., naturally occurring mutants as found in their natural state.
- products made by transforming cells with any unnaturally occurring vector is encompassed, as are nucleic acids comprising sequence derived using any synthetic oligonucleotide process.
- Such a process is often done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a restriction enzyme sequence recognition site.
- the process is performed to join together nucleic acid segments of desired functions to generate a single genetic entity comprising a desired combination of functions not found in the commonly available natural forms, e.g., encoding a fusion protein.
- Restriction enzyme recognition sites are often the target of such artificial manipulations, but other site specific targets, e.g., promoters, DNA replication sites, regulation sequences, control sequences, or other useful features may be incorporated by design.
- site specific targets e.g., promoters, DNA replication sites, regulation sequences, control sequences, or other useful features may be incorporated by design.
- a similar concept is intended for a recombinant, e.g., fusion, polypeptide.
- synthetic nucleic acids which, by genetic code redundancy, encode similar polypeptides to fragments of the interleukins, and fusions of sequences from various different interleukin or related molecules, e.g., growth factors.
- a "fragment" in a nucleic acid context is a contiguous segment of at least about 17 nucleotides, generally at least 20 nucleotides, more generally at least 23 nucleotides, ordinarily at least 26 nucleotides, more ordinarily at least 29 nucleotides, often at least 32 nucleotides, more often at least 35 nucleotides, typically at least 38 nucleotides, more typically at least 41 nucleotides, usually at least 44 nucleotides, more usually at least 47 nucleotides, preferably at least 50 nucleotides, more preferably at least 53 nucleotides, and in particularly preferred embodiments will be at least 56 or more nucleotides.
- fragments of different genetic sequences can be compared to one another over appropriate length stretches.
- a nucleic acid which codes for an IL-13 will be particularly useful to identify genes, mRNA, and cDNA species which code for the IL-13 or closely related proteins, as well as DNAs which code for allelic or other genetic variants, e.g., from different individuals.
- Preferred probes for such screens are those regions of the interleukin which are conserved between different allelic variants, and will preferably be full length or nearly so. In other situations, allele specific sequences will be more useful.
- This invention further covers recombinant nucleic acid molecules and fragments having a nucleic acid sequence identical to or highly homologous to the isolated DNA set forth herein.
- sequences will often be operably linked to DNA segments which control transcription, translation, and DNA replication. These additional segments typically assist in expression of the desired nucleic acid segment.
- Homologous nucleic acid sequences when compared to one another or Table 1 sequences, exhibit significant similarity.
- the standards for homology in nucleic acids are either measures for homology generally used in the art by sequence comparison or based upon hybridization conditions. Comparative hybridization conditions are described in greater detail below.
- “Substantial homology” in the nucleic acid sequence comparison context means either that the segments, or their complementary strands, when compared, are identical when optimally aligned, with appropriate nucleotide insertions or deletions, in at least about 60% of the nucleotides, generally at least 66%, ordinarily at least 71%, often at least 76%, more often at least 80%, usually at least 84%, more usually at least 88%, typically at least 91%, more typically at least about 93%, preferably at least about 95%, more preferably at least about 96 to 98% or more, and in particular embodiments, as high at about 99% or more of the nucleotides.
- substantial homology exists when the segments will hybridize under selective hybridization conditions, to a strand or its complement, typically using a sequence derived from Table 1.
- selective hybridization will occur when there is at least about 55% homology over a stretch of at least about 14 nucleotides, more typically at least about 65%, preferably at least about 75%, and more preferably at least about 90%. See, Kanehisa, Nucleic Acids Res. 72:203 (1984).
- the length of homology comparison may be over longer stretches, and in certain embodiments will be over a stretch of at least about 17 nucleotides, generally at least about 20 nucleotides, ordinarily at least about 24 nucleotides, usually at least about 28 nucleotides, typically at least about 32 nucleotides, more typically at least about 40 nucleotides, preferably at least about 50 nucleotides, and more preferably at least about 75 to 100 or more nucleotides.
- Stringent conditions in referring to homology in the hybridization context, will be stringent combined conditions of salt, temperature, organic solvents, and other parameters typically controlled in hybridization reactions.
- Stringent temperature conditions will usually include temperatures in excess of about 30°C, more usually in excess of about 37°C, typically in excess of about 45°C, more typically in excess of about 55°C, preferably in excess of about 65°C, and more preferably in excess of about 70°C.
- Stringent salt conditions will ordinarily be less than about 1000 mM, usually less than about 500 mM, more usually less than about 400 mM, typically less than about 300 mM, preferably less than about 200 mM, and more preferably less than about 150 mM.
- the isolated DNA can be readily modified by nucleotide substitutions, nucleotide deletions, nucleotide insertions, and inversions of nucleotide stretches. These modifications result in novel DNA sequences which encode this protein, its derivatives, or proteins having IL-13 activity. These modified sequences can be used to produce mutant proteins (muteins) or to enhance the expression of variant species. Enhanced expression may involve gene amplification, increased transcription, increased translation, and other mechanisms. Such mutant IL-13 derivatives include predetermined or site-specific mutations of the protein or its fragments.
- “Mutant IL-13” as used herein encompasses a polypeptide otherwise falling within the homology definition of the human IL-13 as set forth above, but having an amino acid sequence which differs from that of human IL-13 as found in nature, whether by way of deletion, substitution, or insertion.
- site specific mutant IL-13 encompasses a protein having substantial homology with a protein of Table 1, and typically shares most of the biological activities of the form disclosed herein.
- IL-13 mutagenesis can be achieved by making amino acid insertions or deletions in the gene, coupled with expression. Substitutions, deletions, insertions, or any combinations may be generated to arrive at a final construct. Insertions include amino- or carboxy- terminal fusions. Random mutagenesis can be conducted at a target codon and the expressed human IL-13 mutants can then be screened for the desired activity. Methods for making substitution mutations at predetermined sites in DNA having a known sequence are well known in the art, e.g., by M13 primer mutagenesis. See also Sambrook et al. (1989) and Ausubel et al. (1987 and periodic Supplements).
- the mutations in the DNA normally should not place coding sequences out of reading frames and preferably will not create complementary regions that could hybridize to produce secondary mRNA structure such as loops or hairpins.
- a double stranded fragment will often be obtained either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
- PCR Polymerase chain reaction
- the present invention encompasses the human IL-13 whose sequence is disclosed in Table I and described above. Allelic and other variants are also contemplated. "Substantially pure", in the polypeptide context, typically means that the protein is free from other contaminating proteins, nucleic acids, and other biologicals derived from the original source organism.
- Purity may be assayed by standard methods, and will ordinarily be at least about 40% pure, more ordinarily at least about 50% pure, generally at least about 60% pure, more generally at least about 70% pure, often at least about 75% pure, more often at least about 80% pure, typically at least about 85% pure, more typically at least about 90% pure, preferably at least about 95% pure, more preferably at least about 98% pure, and in most preferred embodiments, at least 99% pure.
- the analysis may be weight or molar percentages, evaluated, e.g., by gel staining, spectrophotometry, or terminus labelling.
- the present invention also provides recombinant proteins, e.g., heterologous fusion proteins using segments from this human protein.
- a heterologous fusion protein is a fusion of proteins or segments which are naturally not normally fused in the same manner.
- the fusion product of a growth factor with an interleukin is a continuous protein molecule having sequences fused in a typical peptide linkage, typically made as a single translation product and exhibiting properties derived from each source peptide.
- a similar concept applies to heterologous nucleic acid sequences.
- new constructs may be made from combining similar functional or structural domains from other related proteins, e.g., growth factors or other cytokines.
- receptor- binding or other segments may be "swapped" between different new fusion polypeptides or fragments. See, e.g., Cunningham et al., Science 243:1330 (1989); and O'Dowd et al, J. Biol. Chem. 265: 15985 ( 1988).
- new chimeric polypeptides exhibiting new combinations of specificities will result from the functional linkage of receptor- binding specificities.
- the receptor binding domains from other related ligand molecules may be added or substituted for other domains of this or related proteins. The resulting protein will often have hybrid function and properties.
- a fusion protein may include a targetting domain which may serve to provide sequestering of the fusion protein to a particular organ, e.g., a ligand portions which is specifically bound by spleen cells and would serve to accumulate in the spleen.
- a targetting domain which may serve to provide sequestering of the fusion protein to a particular organ, e.g., a ligand portions which is specifically bound by spleen cells and would serve to accumulate in the spleen.
- Candidate fusion partners and sequences can be selected from various sequence data bases, e.g., GenBank, c/o IntelliGenetics, Mountain View, CA; and BCG, University of Wisconsin Biotechnology Computing Group, Madison, WI.
- “Derivatives” of the human IL-13 include amino acid sequence mutants, glycosylation variants, metabolic derivatives and covalent or aggregative conjugates with other chemical moieties.
- Covalent derivatives can be prepared by linkage of functionalities to groups which are found in the IL-13 amino acid side chains or at the N- or C- termini, e.g., by means which are well known in the art. These derivatives can include, without limitation, aliphatic esters or amides of the carboxyl terminus, or Of residues containing carboxyl side chains, O-acyl derivatives of hydroxyl group-containing residues, and N-acyl derivatives of the amino terminal amino acid or amino-group containing residues, e.g., lysine or arginine.
- Acyl groups are selected from the group of alkyl-moieties including C3 to C18 normal alkyl, thereby forming alkanoyl aroyl species.
- glycosylation alterations are included, e.g., made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing, or in further processing steps. Particularly preferred means for accomplishing this are by exposing the polypeptide to glycosylating enzymes derived from cells which normally provide such processing, e.g., mammalian glycosylation enzymes. Deglycosylation enzymes are also contemplated. Also embraced are versions of the same primary amino acid sequence which have other minor modifications, including phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.
- a major group of derivatives are covalent conjugates of the interleukin or fragments thereof with other proteins of polypeptides. These derivatives can be synthesized in recombinant culture such as N- or C-terminal fusions or by the use of agents known in the art for their usefulness in cross-linking proteins through reactive side groups. Preferred derivatization sites with cross-linking agents are at free amino groups, carbohydrate moieties, and cysteine residues. Fusion polypeptides between the interleukin and other homologous or heterologous proteins are also provided.
- Homologous polypeptides may be fusions between different growth factors, resulting in, for instance, a hybrid protein exhibiting ligand specificity for multiple different receptors, or a ligand which may have broadened or weakened specificity of binding to its receptor.
- heterologous fusions may be constructed which would exhibit a combination of properties or activities of the derivative proteins.
- Typical examples are fusions of a reporter polypeptide, e.g., luciferase, with a segment or domain of a receptor, e.g., a ligand- binding segment, so that the presence or location of a desired ligand may be easily determined.
- a reporter polypeptide e.g., luciferase
- a receptor e.g., a ligand- binding segment
- Other gene fusion partners include glutathione-S- transferase (GST), bacterial ⁇ -galactosidase, trpE, Protein A, ⁇ - lactamase, alpha amylase, alcohol dehydrogenase, and yeast alpha mating factor.
- polypeptides may also have amino acid residues which have been chemically modified by phosphorylation, sulfonation, biotinylation, or the addition or removal of other moieties, particularly those which have molecular shapes similar to phosphate groups.
- the modifications will be useful labelling reagents, or serve as purification targets, e.g., affinity ligands.
- Fusion proteins will typically be made by either recombinant nucleic acid methods or by synthetic polypeptide methods. Techniques for nucleic acid manipulation and expression are described generally, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed.), 1989, Vols. 1-3, Cold Spring Harbor Laboratory; and Ausubel et al.
- This invention also contemplates the use of derivatives of the human IL-13 other than variations in amino acid sequence or glycosylation.
- Such derivatives may involve covalent or aggregative association with chemical moieties. These derivatives generally fall into three classes: (1) salts, (2) side chain and terminal residue covalent modifications, and (3) adsorption complexes, for example with cell membranes.
- covalent or aggregative derivatives are useful as immunogens, as reagents in immunoassays, or in purification methods such as for affinity purification of a receptor or other binding molecule, e.g., an antibody.
- the human IL-13 ligand can be immobilized by covalent bonding to a solid support such as cyanogen bromide- activated Sepharose, by methods which are well known in the art, or adsorbed onto polyolefin surfaces, with or without glutaraldehyde cross-linking, for use in the assay or purification of IL-13 receptor, antibodies, or other similar molecules.
- the IL-13 can also be labelled with a detectable group, for example radioiodinated by the chloramine T procedure, covalently bound to rare earth chelates, or conjugated to another fluorescent moiety for use in diagnostic assays.
- the human IL-13 of this invention can be used as an immunogen for the production of antisera or antibodies specific for the interleukin or any fragments thereof.
- the purified interleukin can be used to screen monoclonal antibodies or antigen-binding fragments prepared by immunization with various forms of impure preparations containing the protein.
- antibodies also encompasses antigen binding fragments of natural antibodies.
- the purified interleukin can also be used as a reagent to detect any antibodies generated in response to the presence of elevated levels of expression, or immunological disorders which lead to antibody production to the endogenous cytokine.
- IL-13 fragments may also serve as immunogens to produce the antibodies of the present invention, as described immediately below.
- this invention contemplates antibodies having binding affinity to or being raised against the amino acid sequence shown in Table 1, fragments thereof, or homologus peptides.
- this invention contemplates antibodies having binding affinity to, or having been raised against, specific fragments which are predicted to be, or actually are, exposed at the exterior protein surface of the native cytokine. The blocking of physiological response to these interleukins may result from the inhibition of binding of the ligand to the receptor, likely through competitive inhibition.
- in vitro assays of the present invention will often use antibodies or ligand binding segments of these antibodies, or fragments attached to solid phase substrates. These assays will also allow for the diagnostic determination of the effects of either binding region mutations and modifications, or ligand mutations and modifications, e.g., ligand analogues.
- This invention also contemplates the use of competitive drug screening assays, e.g., where neutralizing antibodies to the interleukin or fragments compete with a test compound for binding to a receptor or antibody.
- the neutralizing antibodies or fragments can be used to detect the presence of any polypeptide which shares one or more binding sites to a receptor and can also be used to occupy binding sites on a receptor that might otherwise bind an interleukin.
- DNA which encodes the protein or fragments thereof can be obtained by chemical synthesis, screening cDNA libraries, or by screening genomic libraries prepared from a wide variety of cell lines or tissue samples. Natural sequences can be isolated using standard methods and the sequences provided herein, e.g., in Table 1.
- This DNA can be expressed in a wide variety of host cells for the synthesis of a full-length human interleukin or fragments which can in turn, for example, be used to generate polyclonal or monoclonal antibodies; for binding studies; for construction and expression of modified agonist/antagonist molecules; and for structure/function studies.
- Each variant or its fragments can be expressed in host cells that are transformed or transfected with appropriate expression vectors.
- These molecules can be substantially free of protein or cellular contaminants, other than those derived from the recombinant host, and therefore are particularly useful in pharmaceutical compositions when combined with a pharmaceutically acceptable carrier and/or diluent.
- the human protein, or portions thereof, may be expressed as fusions with other proteins.
- Expression vectors are typically self-replicating DNA or RNA constructs containing the desired receptor gene or its fragments, usually operably linked to suitable genetic control elements that are recognized in a suitable host cell. These control elements are capable of effecting expression within a suitable host. The specific type of control elements necessary to effect expression will depend upon the eventual host cell used.
- the genetic control elements can include a prokaryotic promoter system or a eukaryotic promoter expression control system, and typically include a transcriptional promoter, an optional operator to control the onset of transcription, transcription enhancers to elevate the level of mRNA expression, a sequence that encodes a suitable ribosome binding site, and sequences that terminate transcription and translation.
- Expression vectors also usually contain an origin of replication that allows the vector to replicate independently of the host cell.
- the vectors of this invention include those which contain DNA which encodes a protein, as described, or a fragment thereof encoding a biologically active equivalent polypeptide.
- the DNA can be under the control of a viral promoter and can encode a selection marker.
- This invention further contemplates use of such expression vectors which are capable of expressing eukaryotic cDNA coding for such a protein in a prokaryotic or eukaryotic host, where the vector is compatible with the host and where the eukaryotic cDNA coding for the receptor is inserted into the vector such that growth of the host containing the vector expresses the cDNA in question.
- expression vectors are designed for stable replication in their host cells or for amplification to greatly increase the total number of copies of the desirable gene per cell. It is not always necessary to require that an expression vector replicate in a host cell, e.g., it is possible to effect transient expression of the interleukin protein or its fragments in various hosts using vectors that do not contain a replication origin that is recognized by the host cell. It is also possible to use vectors that cause integration of the human protein or its fragments into the host DNA by recombination.
- Vectors as used herein, comprise plasmids, viruses, bacteriophage, integratable DNA fragments, and other vehicles which enable the integration of DNA fragments into the genome of the host.
- Expression vectors are specialized vectors which contain genetic control elements that effect expression of operably linked genes. Plasmids are the most commonly used form of vector but all other forms of vectors which serve an equivalent function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985 and Supplements, Elsevier, N.Y.; and Rodriquez et al.
- Transformed cells are cells, preferably mammalian, that have been transformed or transfected with receptor vectors constructed using recombinant DNA techniques. Transformed host cells usually express the desired protein or its fragments, but for purposes of cloning, amplifying, and manipulating its DNA, do not need to express the subject protein. This invention further contemplates culturing transformed cells in a nutrient medium, thus permitting the interleukin to accumulate in the culture. The protein can be . recovered, either from the culture or from the culture medium.
- nucleic sequences are operably linked when they are functionally related to each other.
- DNA for a presequence or secretory leader is operably linked to a polypeptide if it is expressed as a preprotein or participates in directing the polypeptide to the cell membrane or in secretion of the polypeptide.
- a promoter is operably linked to a coding sequence if it controls the transcription of the polypeptide;
- a ribosome binding site is operably linked to a coding sequence if it is positioned to permit translation.
- operably linked means contiguous and in reading frame, however, certain genetic elements such as repressor genes are not contiguously linked but still bind to operator sequences that in turn control expression.
- Suitable host cells include prokaryotes, lower eukaryotes, and higher eukaryotes.
- Prokaryotes include both gram negative and gram positive organisms, e.g., E. coli and B. subtilis.
- Lower eukaryotes include yeasts, e.g., S. cerevisiae and Pichia, and species of the genus Dictyostelium.
- Higher eukaryotes include established tissue culture cell lines from animal cells, both of non -mammalian origin, e.g., insect cells, and birds, and of mammalian origin, e.g., human, primates, and rodents.
- Prokaryotic host-vector systems include a wide variety of vectors for many different species. As used herein, E. coli and its vectors will be used generically to include equivalent vectors used in other prokaryotes.
- a representative vector for amplifying DNA is pBR322 or many of its derivatives.
- Vectors that can be used to express the receptor or its fragments include, but are not limited to, such vectors as those containing the lac promoter (pUC-series); trp promoter (pBR322-trp); Ipp promoter (the pIN-series); lambda-pP or pR promoters (pOTS); or hybrid promoters such as ptac (pDR540).
- Lower eukaryotes e.g., yeasts and Dictyostelium, may be transformed with IL-13 sequence containing vectors.
- the most common lower eukaryotic host is the baker's yeast, Saccharomyces cerevisiae. It will be used to generically represent lower eukaryotes although a number of other strains and species are also available.
- Yeast vectors typically consist of a replication origin (unless of the integrating type), a selection gene, a promoter, DNA encoding the receptor or its fragments, and sequences for translation termination, polyadenylation, and transcription termination.
- Suitable expression vectors for yeast include such constitutive promoters as 3-phosphoglycerate kinase and various other glycolytic enzyme gene promoters or such inducible promoters as the alcohol dehydrogenase 2 promoter or metallothionine promoter.
- Suitable vectors include derivatives of the following types: self- replicating low copy number (such as the YRp-series), self- replicating high copy number (such as the YEp-series); integrating types (such as the Yip-series), or mini-chromosomes (such as the YCp-series).
- Higher eukaryotic tissue culture cells are normally the preferred host cells for expression of the functionally active interleukin protein.
- any higher eukaryotic tissue culture cell line is workable, e.g., insect baculovirus expression systems, whether from an invertebrate or vertebrate source.
- mammalian cells are preferred. Transformation or transfection and propagation of such cells has become a routine procedure.
- useful cell lines include HeLa cells, Chinese hamster ovary (CHO) cell lines, baby rat kidney (BRK) cell lines, insect cell lines, bird cell lines, and monkey (COS) cell lines.
- Expression vectors for such cell lines usually include an origin of replication, a promoter, a translation initiation site, RNA splice sites (if genomic DNA is used), a polyadenylation site, and a transcription termination site.
- Suitable expression vectors may be plasmids, viruses, or retroviruses carrying promoters derived, e.g., from such sources as from adenovirus, SV40, parvoviruses, vaccinia virus, or cytomegalovirus.
- suitable expression vectors include pCDNAl; pCD, see Okayama et al, Mol. Cell Biol 5:1136 (1985); pMClneo PolyA, see Thomas et al, Cell 51:503 (1987); and a baculovirus vector such as pAC 373 or pAC 610.
- an open reading frame usually encodes a polypeptide that consists of a mature or secreted product covalently linked at ist N-terminus to a signal peptide.
- the signal peptide is cleaved prior to secretion of the mature, or active, polypeptide.
- the cleavage site can be predicted with a high degree of accuracy from empirical rules, e.g., von Heijne, Nucleic Acids Research 74:4683 (1986), and the precise amino acid composition of the signal peptide does not appear to be critical to its function, e.g., Randall et al, Science 243:1156 (1989); Kaiser et al, Science 235:312 (1987).
- polypeptides it will often be desired to express these polypeptides in a system which provides a specific or defined glycosylation pattern.
- the usual pattern will be that provided naturally by the expression system.
- the pattern will be modifiable by exposing the polypeptide, e.g., an unglycosylated form, to appropriate glycosylating proteins introduced into a heterologous expression system.
- the interleukin gene may be co- transformed with one or more genes encoding mammalian or other glycosylating enzymes. Using this approach, certain mammalian glycosylation patterns will be achievable in prokaryote or other cells.
- the source of human IL-13 can be a eukaryotic or prokaryotic host expressing recombinant huIL-13 DNA, such as is described above.
- the source can also be a cell line such as mouse Swiss 3T3 fibroblasts, but other mammalian cell lines are also contemplated by this invention, with the preferred cell line being from the human species.
- human IL-13, fragments, or derivatives thereof can be prepared by conventional processes for synthesizing peptides. These include processes such as are described in Stewart et al, Solid Phase Peptide Synthesis, 1984, Pierce Chemical Co., Rockford, IL; Bodanszky et al, The Practice of Peptide Synthesis, 1984, Springer- Verlag, New York; and Bodanszky, The Principles of Peptide Synthesis, 1984, Springer- Verlag, New York.
- an azide process for example, an acid chloride process, an acid anhydride process, a mixed anhydride process, an active ester process (for example, p-nitrophenyl ester, N-hydroxysuccinimide ester, or cyanomethyl ester), a carbodiimidazole process, an oxidative-reductive process, or a dicyclohexylcarbodiimide (DCCD)/additive process can be used.
- Solid phase and solution phase syntheses are both applicable to the foregoing processes.
- the IL-13 protein, fragments, or derivatives are suitably prepared in accordance with the above processes as typically employed in peptide synthesis, generally either by a so-called stepwise process which comprises condensing an amino acid to the terminal amino acid, one by one in sequence, or by coupling peptide fragments to the terminal amino acid.
- Amino groups that are not being used in the coupling reaction typically must be protected to prevent coupling at an incorrect location.
- the C-terminal amino acid is bound to an insoluble carrier or support through its carboxyl group.
- the insoluble carrier is not particularly limited as long as it has a binding capability to a reactive carboxyl group.
- examples of such insoluble carriers include halomethyl resins, such as chloromethyl resin or bromomethyl resin, hydroxymethyl resins, phenol resins, tert-alkyloxycarbonylhydrazidated resins, and the like.
- An amino group-protected amino acid is bound in sequence through condensation of its activated carboxyl group and the reactive amino group of the previously formed peptide or chain, to synthesize the peptide step by step. After synthesizing the complete sequence, the peptide is split off from the insoluble carrier to produce the peptide.
- This solid-phase approach is generally described by Merrifield et al, in J. Am. Chem. Soc. 55:2149 (1963).
- the prepared protein and fragments thereof can be isolated and purified from the reaction mixture by means of peptide separation, for example, by extraction, precipitation, electrophoresis, various forms of chromatography, and the like.
- the interleukin of this invention can be obtained in varying degrees of purity depending upon its desired use.
- Purification can be accomplished by use of the protein purification techniques disclosed herein or by the use of the antibodies herein described in methods of immunoabsorbant affinity chromatography.
- This immunoabsorbant affinity chromatography is carried out by first linking the antibodies to a solid support and then contacting the linked antibodies with solubilized ly sates of appropriate cells, lysates of other cells expressing the interleukin, or lysates or supernatants of cells producing the protein as a result of DNA techniques, see below.
- the purified protein will be at least about 40% pure, ordinarily at least about 50% pure, usually at least about 60% pure, typically at least about 70% pure, more typically at least about 80% pure, preferable at least about 90% pure and more preferably at least about 95% pure, and in particular embodiments, 97%-99% or more. Purity will usually be on a weight basis, but can also be on a molar basis. Different assays will be applied as appropriate.
- Antibodies can be raised to the various human IL-13 proteins and fragments thereof, both in naturally occurring native forms and in their recombinant forms, the difference being that antibodies to the active ligand are more likely to recognize epitopes which are only present in the native conformations. Anti-idiotypic antibodies are also contemplated, which would be useful as agonists or antagonists of a natural receptor or an antibody.
- Antibodies, including binding fragments and single chain versions, against predetermined fragments of the protein can be raised by immunization of animals with conjugates of the fragments with immunogenic proteins.
- Monoclonal antibodies are prepared from cells secreting the desired antibody. These antibodies can be screened for binding to normal or defective protein, or screened for agonistic or antagonistic activity. These monoclonal antibodies will _ usually bind with at least a Kj) of about 1 mM, more usually at least about 300 ⁇ M, typically at least about 100 ⁇ M, more typically at least about 30 ⁇ M, preferably at least about 10 ⁇ M, and more preferably at least about 3 ⁇ M or better.
- the antibodies, including antigen binding fragments, of this invention can have significant diagnostic or therapeutic value. They can be potent antagonists that bind to the interleukin and inhibit binding to the receptor or inhibit the ability of huamn IL-13 to elicit a biological response. They also can be useful as non -neutralizing antibodies and can be coupled to toxins or radionuclides to bind producing cells, or cells localized to the source of the interleukin. Further, these antibodies can be conjugated to drugs or other therapeutic agents, either directly or indirectly by means of a linker.
- the antibodies of this invention can also be useful in diagnostic applications. As capture or non-neutralizing antibodies, they can bind to the interleukin without inhibiting receptor binding. As neutralizing antibodies, they can be useful in competitive binding assays. They will also be useful in detecting or quantifying IL-13.
- Protein fragments may be joined to other materials, particularly polypeptides, as fused or covalently joined polypeptides to be used as immunogens.
- the human IL-13 and its fragments may be fused or covalently linked to a variety of immunogens, such as keyhole limpet hemocyanin, bovine serum albumin, tetanus toxoid, etc. See Microbiology, Hoeber Medical Division, Harper and Row, 1969; Landsteiner, Specificity of Serological Reactions, 1962, Dover Publications, New York; and Williams et al, Methods in
- a typical method involves hyperimmunization of an animal with an antigen. The blood of the animal is then collected shortly after the repeated immunizations and the gamma globulin is isolated.
- monoclonal antibodies from various mammalian hosts, such as mice, rodents, primates, humans, etc.
- Description of techniques for preparing such monoclonal antibodies may be found in, e.g., Stites et al. (eds), Basic and Clinical Immunology (4th ed.), Lange Medical Publications, Los Altos, CA, and references cited therein; Harlow et al, Antibodies: A Laboratory Manual, 1988, CSH Press; Goding, Monoclonal Antibodies: Principles and Practice (2d ed), 1986, Academic Press, New York; and particularly in Kohler and Milstein, Nature 256:495 (1975), which discusses one method of generating monoclonal antibodies.
- this method involves injecting an animal with an immunogen.
- the animal is then sacrificed and cells taken from its spleen, which are then fused with myeloma cells.
- the result is a hybrid cell or "hybridoma" that is capable of reproducing in vitro.
- the population of hybridomas is then screened to isolate individual clones, each of which secrete a single antibody species to the immunogen.
- the individual antibody species obtained are the products of immortalized and cloned single B cells from the immune animal generated in response to a specific site recognized on the immunogenic substance.
- Other suitable techniques involve in vitro exposure of lymphocytes to the antigenic polypeptides or alternatively to selection of libraries of antibodies in phage or similar vectors. See, Huse et al, Science 246:1215 (1989); and Ward et al, Nature 341 :544 (1989).
- the polypeptides and antibodies of the present invention may be used with or without modification, including chimeric or humanized antibodies.
- the polypeptides and antibodies will be labelled by joining, either covalently or non-covalently, a substance which provides for a detectable signal.
- labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like. Patents teaching the use of such labels include U.S. Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. Also, recombinant or chimeric immunoglobulins may be produced, see Cabilly, U.S. Patent No. 4,816,567.
- the antibodies of this invention can also be used for affinity chromatography in isolating the IL-13.
- Columns can be prepared where the antibodies are linked to a solid support, e.g., particles, such as agarose, Sephadex, or the like, where a cell lysate may be passed through the column, the column washed, followed by increasing concentrations of a mild denaturant, whereby the purified protein will be released.
- the antibodies may also be used to screen expression libraries for particular expression products. Usually the antibodies used in such a procedure will be labelled with a moiety allowing easy detection of presence of antigen by antibody binding. Antibodies raised against each human IL-13 will also be used to raise anti-idiotypic antibodies. These will be useful in detecting or diagnosing various immunological conditions related to expression of the protein or cells which express receptors for the protein. They also will be useful as agonists or antagonists of the interleukin, which may be competitive inhibitors or substitutes for naturally occurring ligands. VII. Uses of IL-13 Compositions. Nucleic acids
- Rational drug design may also be based upon structural studies of the molecular shapes of a receptor or antibody and other effectors or ligands. Effectors may be other proteins which mediate other functions in response to ligand binding, or other proteins which normally interact with the receptor.
- One means for determining which sites interact with specific other proteins is a physical structure determination, e.g., x-ray crystallography or 2 dimensional NMR techniques. These will provide guidance as to which amino acid residues form the molecular contact regions.
- protein structural determination see, e.g., x-ray crystallography or 2 dimensional NMR techniques.
- Purified interleukin- 13 can be coated directly onto plates for use in the aforementioned receptor screening techniques. However, non-neutralizing antibodies to these proteins can be used as capture antibodies to immobilize the respective interleukin on the solid phase, useful, e.g., in diagnostic uses.
- kits and methods for detecting the presence of the protein or its receptor.
- antibodies against the molecules may be incorporated into the kits and methods.
- the kit will have a compartment containing either a defined IL-13 peptide or gene segment or a reagent which recognizes one or the other.
- recognition reagents in the case of peptide, would be a receptor or antibody, or in the case of a gene segment, would be a probe.
- a preferred kit for determining the concentration of, for example, IL-13, a sample would typically comprise a labelled compound, e.g., receptor or antibody, having known binding affinity for IL-13, a source of IL-13 (naturally occurring or recombinant) as a positive control, and a means for separating the bound from free labelled compound, for example a solid phase for immobilizing the IL-13 in the test sample. Compartments containing reagents, and instructions, will normally be provided.
- Antibodies including antigen binding fragments, specific for IL-13 or a peptide fragment, or receptor fragments— are useful in diagnostic applications to detect the presence of elevated levels of IL-13 and/or its fragments. Diagnostic assays may be homogeneous (without a separation step between free reagent and antibody- antigen complex) or heterogeneous (with a separation step).
- Various commercial assays exist, such as radioimmunoassay (RIA), enzyme- linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), enzyme-multiplied immunoassay technique (EMIT), substrate- labelled fluorescent immunoassay (SLFIA) and the like.
- unlabelled antibodies can be employed by using a second antibody which is labelled and which recognizes the antibody to IL-13 or to a particular fragment thereof.
- a second antibody which is labelled and which recognizes the antibody to IL-13 or to a particular fragment thereof.
- assays have also been extensively discussed in the literature. See, e.g., Harlow et al, Antibodies: A Laboratory Manual, 1988, CSH; and Coligan (Ed.), Current Protocols In Immunology, 1991 and periodic supplements, Greene/Wiley, New York.
- Anti-idiotypic antibodies may have similar use to serve as agonists or antagonists of IL-13. These should be useful as therapeutic reagents under appropriate circumstances.
- the reagents for diagnostic assays are supplied in kits, so as to optimize the sensitivity of the assay.
- the protocol, and the label either labelled or unlabelled antibody, or labelled receptor is provided. This is usually in conjunction with other additives, such as buffers, stabilizers, materials necessary for signal production such as substrates for enzymes, and the like.
- the kit will also contain instructions for proper use and disposal of the contents after use.
- the kit has compartments for each useful reagent.
- the reagents are provided as a dry lyophilized powder, where the reagents may be reconstituted in an aqueous medium having appropriate concentrations for performing the assay.
- labelling may be achieved by covalently or non-covalently joining a moiety which directly or indirectly provides a detectable signal.
- a test compound, IL-13, or antibodies thereto can be labelled either directly or indirectly.
- Possibilities for direct labelling include label groups: radiolabels such as 125l, enzymes (U.S. Pat. No. 3,645,090) such as peroxidase and alkaline phosphatase, and fluorescent labels (U.S. Pat. No. 3,940,475) capable of monitoring the change in fluorescence intensity, wavelength shift, or fluorescence polarization.
- Possibilities for indirect labelling include biotinylation of one constituent followed by binding to avidin coupled to one of the above label groups.
- the IL-13 can be immobilized on various matrixes followed by washing.
- Suitable matrices include plastic such as an ELISA plate, filters, and beads.
- Methods of immobilizing the receptor to a matrix include, without limitation, direct adhesion to plastic, use of a capture antibody, chemical coupling, and biotin-avidin.
- the last step in this approach involves the precipitation of antibody/antigen complex by any of several methods including those utilizing, e.g., an organic solvent such as polyethylene glycol or a salt such as ammonium sulfate.
- suitable separation techniques include, without limitation, the fluorescein antibody magnetizable particle method described in Rattle et al, Clin. Chem. 30:1451 (1984), and the double antibody magnetic particle separation as described in U.S. Pat. No. 4,659,678.
- sequences can be used as probes for detecting levels of the IL-13 in patients suspected of having a proliferative cell conditions, e.g., cancer.
- a proliferative cell conditions e.g., cancer.
- the preparation of both RNA and DNA nucleotide sequences, the labelling of the sequences, and the preferred size of the sequences has received ample description and discussion in the literature.
- an oligonucleotide probe should have at least about. 14 nucleotides, usually at least about 18 nucleotides, and the polynucleotide probes may be up to several kilobases.
- Various labels may be employed, most commonly radionuclides, particularly 32p. However, other techniques may also be employed, such as using biotin modified nucleotides for introduction into a polynucleotide. The biotin then serves as the site for binding to avidin or antibodies, which may be labelled with a wide variety of labels, such as radionuclides, fluorescers, enzymes, or the like.
- antibodies may be employed which can recognize specific duplexes, including DNA duplexes, RNA duplexes, DNA-RNA hybrid duplexes, or DNA-protein duplexes.
- the antibodies in turn may be labelled and the assay carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
- probes to the novel anti-sense RNA may be carried out in any conventional techniques such as nucleic acid hybridization, plus and minus screening, recombinational probing, hybrid released translation (HRT), and hybrid arrested translation (HART). This also includes amplification techniques such as polymerase chain reaction (PCR).
- kits which also test for the qualitative or quantitative presence of other markers are also contemplated. Diagnosis or prognosis may depend on the combination of multiple indications used as markers. Thus, kits may test for combinations of markers. See, e.g., Viallet et al, Progress in Growth Factor Res. 7 :89 ( 1989).
- This invention provides reagents with significant therapeutic value.
- the IL-13 naturally occurring or recombinant
- Recombinant IL-13 or IL-13 antibodies can be purified and then administered to a patient.
- These reagents can be combined for therapeutic use with additional active ingredients, e.g., in conventional pharmaceutically acceptable carriers or diluents, along with physiologically innocuous stabilizers and excipients. These combinations can be sterile filtered and placed into dosage forms as by lyophilization in dosage vials or storage in stabilized aqueous preparations.
- This invention also contemplates use of antibodies or binding fragments thereof which are not complement binding.
- Receptor screening using IL-13 or fragments thereof can be performed to identify molecules having binding affinity to the interleukin. Subsequent biological assays can then be utilized to determine if a receptor can provide competitive binding, which can block intrinsic stimulating activity. Receptor fragments can be used as a blocker or antagonist in that it blocks the activity of IL-13. Likewise, a compound having intrinsic stimulating activity can activate the receptor and is thus an agonist in that it simulates the activity of IL-13. This invention further contemplates the therapeutic use of antibodies to IL-13 as antagonists.
- reagents necessary for effective therapy will depend upon many different factors, including means of administration, target site, physiological state of the patient, and other medicants administered. Thus, treatment dosages should be titrated to optimize safety and efficacy. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of these reagents. Animal testing of effective doses for treatment of particular disorders will provide further predictive indication of human dosage. Various considerations- are described, e.g., in Gilman et al. (eds), The Pharmacological Bases of Therapeutics, 8th Ed., 1990, Pergamon Press; and Remington's Pharmaceutical Sciences, 17th ed., 1990, Mack Publishing Co., Easton, Penn.
- compositions for administration are discussed therein and below, e.g., for oral, intravenous, intraperitoneal, or intramuscular administration, transdermal diffusion, and others.
- Pharmaceutically acceptable carriers will include water, saline, buffers, and other compounds described, e.g., in the Merck Index, Merck & Co., Rahway, New Jersey.
- dosage ranges would ordinarily be expected to be in amounts lower than 1 mM concentrations, typically less than about 10 ⁇ M concentrations, usually less than about 100 nM, preferably less than about 10 pM (picomolar), and most preferably less than about 1 fM (femtomolar), with an appropriate carrier.
- Slow release formulations, or slow release apparatus will often be utilized for continuous administration.
- IL-13 or fragments thereof, antibodies or fragments thereof, antagonists, and agonists may be administered directly to the host to be treated or, depending on the size of the compounds, it may be desirable to conjugate them to carrier proteins such as ovalbumin or serum albumin prior to their administration.
- Therapeutic formulations may be administered in any conventional dosage formulation.
- Formulations comprise at least one active ingredient, as defined above, together with one or more acceptable carriers thereof.
- Each carrier must be both pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the patient.
- Formulations include those suitable for oral, rectal, nasal, or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration.
- the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy.
- the therapy of this invention may be combined with or used in association with other immunotherapeutic or immunopreventive agents.
- Pst/PvuII restriction digest of the mouse P600 cDNA clone was isolated by polyacrylamide gel electrophoresis and subsequent elution and ethanol precipitation. This fragment, which encompasses most of the coding region of the mouse P600 cDNA, was radioactively labelled by random priming in the presence of [32p]dCTP.
- Filter lifts were prepared following standard procedures from ten agar plates each with approximately 5000 colonies of a B21 cDNA library. This library was made from cloned human T cells, designated B21, which had been stimulated with anti-CD3 for 7 hours prior to the isolation of the RNA. The construction of this library is described in U.S. application Serial No. 07/453,951.
- the filters were hybridized overnight at 42°C with the labelled mouse P600 fragment in 20% formamide, 6X SSPE, 0.1% SDS, 5X Denhardt's solution, and 100 ⁇ g/ml tRNA.
- the filters were washed 3 times with 2X SSPE, 0.1% SDS at room temperature for 20 minutes each, twice with IX SSPE, 0.1% SDS at 55°C for 1 hour, then exposed to film overnight. Eight positives were identified and picked for further purification. Seven of these were positive upon rescreening. Six clones had BamHl inserts of 1.35 kb and one an insert of only 0.6 kb.
- the huIL-13 cDNA isolated from the B21 library was not full length as compared to the mouse P600 cDNA. Repeated attempts to isolate a full-length cDNA from the B21 library were unsuccessful. Thus, a different library was screened with the pB21.2Bf insert for a full length clone.
- a PCR probe was derived from the human cDNA beginning 50 bp from the 5' end and ending at the stop codon.
- a cDNA library was made from a clone of an A10 T cell line. The same hybridization conditions as described above were used. The filters were washed once in IX SSPE, 0.05% SDS at room temperature for 15 minutes and then twice at 55°C for 30 min to one hour. They were exposed to film overnight. Several positives colonies were detected and rescreened. Double stranded sequence obtained from the 5' end of several of the cDNA inserts from these positives indicated that they were full-length.
- the pB21.2Bf clone containing a 1.16kb cDNA encoding human EL-13, lacked the first 23 N-terminal amino acids.
- the insert was prepared for ligation into an expression vector pGEX-2T by using PCR to provide unique restriction sites at the 5' BamKl and 3' EcoR l ends.
- the pGEX-2T vector is designed to produce a fusion protein, where the distinct protein segments are separated by a readily cleaveable protease site.
- the gel purified DNA was ligated into the expression vector pGEX-2T so that when the plasmid is expressed in E.
- Transformed E. coli cells were grown in media at 37 °C and induced with IPTG at 0.5 OD. The induced cells were grown until maximal OD was reached either by shake flask or fermentation. Cells were harvested by centrifugation at 4000 x g at 4°C for 30 min and were frozen at -10°C.
- TE buffer 50 mM Tis-HCl, 10 mM EDTA pH 8 with 1 mM Peflobloc, a protease inhibitor.
- Cells were passed through a microfluidizer at 18,000 psi, collected, and centrifuged at 10,000 x g at 4°C for 30 min. Cell pellets were repeatedly washed in TE buffer and centrifuged until supernatant was clear. The pellet was solubilized with 6 M guanidine-HCl, 10 mM DTT, 50 mM Tris-HCl pH 9, and 1 mM Peflobloc and mixed at 4°C for 2 hours. The protein concentration was measured by the Bradford
- Protein method and typically was approximately 2.5_ mg/ml total protein concentration.
- the mixture was diluted over a period of hours to 100 fold of its unfolding volume into 50 mM Tris-HCl, 150 mM NaCl, 2 mM reduced glutathione, 1 mM oxidized glutathione, 0.5 ⁇ M guanidine-HCl, and 10 mM EDTA at pH 9.0.
- the solution was mixed at 4 C for 24 hours, allowing refolding of disulfide linkages of the molecule.
- Precipitates were removed by centrifugation at 4000 x g for 30 min at 4 C or by filtration with a 0.45 ⁇ m filter. The supernatant was concentrated using a Pellicon and diafilter against 50 mM TRIS- HCL, 150 mM NaCl, 2.5 mM CaCl 2 , pH 7.5 buffer at 4°C.
- the glutathione-S-transferase fusion partner was cleaved by adding human thrombin at 10 ng per 50 ⁇ g of fusion protein. The solution was mixed at 4°C for 18 to 48 h to allow the fusion protein to be cleaved by thrombin. SDS-PAGE gels and TF-1 bioassay was used to characterize P600 conformation and activity.
- Ammonium sulfate was aded to the refolded material at a 25% saturation range after complete thrombin cleavage was observed.
- the refolded material was adjusted to pH 8.5 with 6N NaOH and loaded onto a butyl Toyo Pearl column, equilibrated at pH 8.5 with 25% ammonium sulfate, 50 mM TRIS-HCL, 0.05 M NaCl buffer.
- the column was washed with equilibration buffer until the A280 approached baseline.
- the colmn was eluted with 50 mM TRIS pH 8.5 buffer for 5 bed volumes.
- An A280 pool was collected and concentrated in a 5000 molecular weight cutoff Amicon stir cell to a volume less than 3% of the bed volume of the S200 gel filtration column.
- the S-200 column was equilibrated with depyrogenated buffer 50 mM NaPi, 150 mM NaCl, and 0.01% Tween-20 pH 6.0.
- the concentrated S pool was loaded onto the gel filtration column and fractions were collected and verified for P600 protein content by SDS-PAGE gels. Fractions were pooled based on SDS-PAGE, concentrated, filtered through 0.22 ⁇ m filters and tested by the TF-1 bioassay for biological activity. Protein concentration was determined by silver staining and scan using the Molecular Dynamic gel scanner.
- Endotoxin was measured using the Whittaker colorimetric Limulus assay and typically was ⁇ 10 eu/ml typical preparations resulted in > 95% purity by staining, with a bioactivity of about 1 x 10 6 units/ml. Variations on the refolding procedure will be effective, e.g., protein concentrations may vary over some range, typically a 5-fold difference will also work. The glutathione concentrations may be varied, and the periods of time for slow dilution and overnight incubations may be titrated. Each of the refolding parameters described should be titrated where appropriate.
- Mouse P600 functions as a stimulator/costimulator of cell viability, e.g., mouse P600 made from E. coli can stimulate or costimulate proliferation of large in vivo activated mouse B cells. Decreasing amounts of P600 administered to the cells resulted in lessened cell growth as determined by ⁇ H-thymidine incorporation.
- soluble CD40 the following PCR primers containing an Xhol site were synthesized on an Applied Biosystems 380A DNA synthesizer:
- PCR fragments encoding 191 amino acids from the start codon of mouse CD40.
- PCR fragments were digested with Xhol and then ligated into Xhol cleaved mammalian/bacterial expression vector (pME18S). The inserted fragment was sequenced by the dideoxy sequenceing method to confirm the sequence. Plasmids carrying the soluble CD40 cDNA were transfected into
- COS-7 cells by electroporation by standard procedures, See Ausubel et al. (1987 and periodic supplements). Briefly, 0.75 ml of COS-7 cell suspension in serum free Dulbecco's Minimal Essential (DME) medium at 10 ⁇ cells per ml were incubated with 50 ⁇ l of 20 ⁇ g plasmid at room temperature for 10 min, and subjected to electroporation using a Bio-Rad gene pulser (960 F, 220 V). Ten minutes after electroporation, COS-7 cells were cultured in four 10 cm dishes for 3 days.
- DME Dulbecco's Minimal Essential
- soluble CD40 medium was changed to phenol red-free RPMI 1640 supplemented with HBlOl (HANA Biologies, Alameda, CA) one day after electroporation.
- Soluble CD40 was purified by ion exchange chromatography on anion exchange columns using standard procedures. The protein was eluted from the column using a linear NaCl gradients and analyzed by Western Blotting using a rabbit antiserum against a CD40 peptide made by standard methods.
- Spleens were teased into complete RPMI (cRPMI) containing 5% fetal calf serum (FCS; J.R. Scientific, Woodland, CA), 5 x 10" 5 M 2-mercaptoethanol (Polysciences, Inc., Warrington, PA), 2 mM glutamine (J.R. Scientific), and 25 mM HEPES buffer (Irvine Scientific, Santa Ana, CA), 100 U/ml penicillin, and 100 ⁇ g/ml streptomycin (Irvine). Red blood cells were lysed using 0.83% ammonium chloride, pH 7.4.
- T cells were removed using two successive treatments with anti-mouse Thy 1.2 mAb (New England Nuclear, Boston, MA) and anti-L3T4 antibody (RL172.4 hybridoma, a gift from Dr. H.R. MacDonald, Ludwig Institute, Epalinges, Switzerland) for 20 min on ice followed by complement (1 :10 dilution of rabbit low-tox complement, Cedarlane Laboratory, Ontario, Canada) for 30 min at 37 C. Small dense B cells were then isolated by density gradient centrifugation using a discontinuous gradient composed of 75%, 65%, and 50% percoll (Pharmacia Fine Chemicals, Uppsala, Sweden) at 2500 x g for 25 min at 4°C .
- B cells collected from the interface between 65% and 75% percoll were used in subsequent experiments. Large in vivo activated B cells were collected from the 65% and 50% interface. B cells were cultured in flat bottomed 96 well tissue culture plates (3072, Falcon Labware) at various cell densities in cRPMI, plus additional stimulants, as indicated. Proliferation was evaluated via a 4 hr pulse of ⁇ H-thymidine (Amersham) added at 48 hr after culture initiation. B. Sustained Survival of B Cells: Selectivity Reagents
- the anti-CD40 mAb89 and anti-CD23 mAb25 were produced by standard procedures against the respective antigens, see Valle et al., Eur. J. Immunol. 19:1463 (1989); Bonnefoy et al, J. Immunol 735:2970 (1987).
- the extracellular domain of the 130 kDa IL-4 receptor was derived from COS-7 cells transfected with a plasmid containing a truncated IL-4 cDNA described by Garrone et al, Eur. J Immunol 27 :1365 (1991). The recombinant protein was purified from transfected cell culture supernatant by purification on an IL-4-Affi- gel 10 column. The anti-130 kDa IL-4 receptor antibody was generated after immunization of mice with the extracellular domain of the IL-4 receptor. Cultures were carried out in modified Iscove's medium.
- B cells were isolated from tonsils as described by Defrance et al, J. Immunol. 139:1135 (1987). Briefly, after a rosetting step with sheep red blood cells, non-rosetting cells were further incubated with anti-CD2, anti-CD3, and anti-CD 14 mAbs prior to negative selection performed with magnetic beads coated with anti-mouse IgG (Dynabeads, Dynal, Oslo, Norway). The isolated population expressed > 98% CD 19 or CD20 (B cells) and ⁇ 1% CD2 (T cells) or CD 14 (monocytes).
- B lymphocytes adjusted at 5 x 10 ⁇ cells/ml, were stimulated for 72 hours with insolubilized anti-IgM (5 ⁇ g/ml).
- a 16 hour pulse with 1 ⁇ Ci (3H)TdR was usually performed at day 3 and 6. [3H] -TdR uptake was measured by standard liquid scintillation counting techniques.
- 2.5 x 10 ⁇ purified B cells were cultured in the presence of 2.5 x l ⁇ 3 irradiated (7000 rad) CDw32 L cells and 0.5 ⁇ g/ml of anti-CD40 mAb89 in a final volume of 200 ⁇ l.
- B cells were tested at 2.5 x 10 ⁇ cells/ml. Supernatants were harvested after 10 days and Ig levels were determined by ELISA.
- Purified B lymphocytes were separated using a preparative magnetic cell separation system (MACS, Becton-Dickinson), according to the experimental procedure described in detail by Miltenyi et al, Cytometry 77 :231 (1990). The separation based on slgD expression has been described earlier by Defrance et al, J. Exptl Med. 175:611 (1992). Purity of the sorted cell populations were > 99% for the sIgD + B cell subpopulation, while ⁇ 1% of slgD" B cell subpopulation expressed dlgD, as assessed by fluorescence analysis using a FACScan.
- MCS preparative magnetic cell separation system
- IL-13 was expressed as a fusion protein with glutathione-S-transferase using the pGEX-2T vector (Pharmacia, Uppsala, Swede).
- a DNA fragment encoding hIL-13 residues 24-109 was prepared by polymerase chain reaction (PCR) and cloned into the BamUl/Eco l site of the vector.
- a DNA fragment encoding mIL-13 residues 19-109 was also prepared and cloned.
- the human and mouse IL-13 fusion proteins were expressed as insoluble aggregates in Escherichia coli, extracted by centrifugation, solubilized, and subjected to a renaturation step, see van Kimmenade et al, Eur. J. Biochem. 173:109 (1988).
- the refolded IL-13 was cleaved from the fusion partner by thrombin, purified by cation exchange (S-Sepharose FPLC, Pharmacia) and gel filtration (Sephacryl s-200 FPLC, Pharmacia) chromatography.
- the gel filtration column was calibrated with protein standards (Bio-Rad). Proteins were quantitated by SDS- PAGE, silver staining (ISS), and scanning densitometry (Molecular Dynamics) with normalization to chicken egg lysozyme (Sigma, St. Louis, MO). Endotoxin (determined by the Limulus ameobocyte lysate assay (Whittaker Bioproducts, Inc.) was typically ⁇ 1 eu/ml.
- IL-13 Enhances the DNA Synthesis of B Cells Activated Through Their Antigen Receptor
- the DNA synthesis of highly purified human B lymphocytes activated through their antigen receptor with anti-IgM antibody is enhanced by recombinant cytokines, such as IL-2, IL-4, and IL-10.
- Recombinant murine IL-13 also enhanced, in a dose dependent fashion, the day 3 DNA synthesis of human tonsillar B lymphocytes cultured in the presence of insolubilized anti-IgM antibody. The maximum stimulation was obtained for a concentration of 10-25 ng/ml of murine (or human) IL-13.
- the stimulatory effect was lower than that of either IL-2 or IL-4 but comparable to that of IL-10.
- IL-4 but unlike IL-2, the co-stimulatory effect of IL-13 on anti-IgM activated B cells could be observed after 3 days of culture, and decreased to be virtually undetectable after 6 days.
- IL-13 Acts As Growth Factor for B Cells Stimulated Through Their CD40 Antigen
- IL-13 was also assayed for its ability to enhance the proliferation of anti-CD40 activated B cells in comparison with IL-4 and IL-10.
- 2.5 x 10 ⁇ purified tonsillar B lymphocytes were cultured over CDw32 expressing L cells together with 0.5 ⁇ g/ml of an anti-CD40 antibody Mab 89 with or without increasing concentrations of IL-13.
- [3H]-TdR incorporation was measured at day 6. Both murine and human IL-13 strongly enhanced anti-CD40 induced DNA synthesis. Maximum stimulation was reached between 3 and 30 ng/ml IL-13 and plateaued thereafter without demonstrating any inhibitory effect (even at 1000 ng/ml).
- IL-13 activity was comparable to that of IL-4 and IL-10 when assayed early in the culture at day 6.
- the IL-13 stimulatory activity was particularly striking at day 9, where it surpassed that of IL-10 and more notably that of IL-4.
- IL-13 also showed stimulatory effects at day 12 and again was more efficient than either IL-4 or IL-10.
- Cultures grown in the presence of IL-13 formed extremely tight clumps. Clumps were very difficult to dissociate and thus rendered extremely inaccurate the enumeration of viable lymphocytes during cell cultures. Nevertheless, cell cultures were split every fifth day for up to 25 days, at which time the number of viable B lymphocytes had increased about 12 fold (estimated conservatively).
- IL-13 could act in concert with IL-4 or IL-10 for maximal B cell proliferation was studied. Combination of an optimal concentration of IL-4 and with increasing concentration of IL-13 resulted in a DNA synthesis which was comparable to that obtained with IL-4, thus indicating the lack of synergy and even additivity between these two cytokines. In contrast, combination of IL-13 and IL-10 resulted in an additivity of their stimulatory effects. The additive effects of IL-13 and IL-10 on B cell proliferation were observed at all times tested. Taken together, these results indicated that IL-13 is a growth factor for human B lymphocytes. IL-13 Induces Anti-CD40 Activated B Cells to Secrete IgE
- IL-13 did not stimulate the production of IgM, IgG, and IgA in day 8 cultures of anti-CD40 activated B cells.
- IL-13 was able to induce B cells to secrete IgE in a dose dependent fashion (Table 4).
- IL-13 was comparable to IL-4 in its capacity to induce IgE.
- the combination of IL-4 and IL-13 resulted in a production of IgE which was either comparable or slightly enhanced when compared to that obtained with IL-4 alone.
- IL-13 unable to induce either resting B cells or anti- ⁇ activated B cells to secrete IgE.
- Table 4 IL-13 Induces Anti-CD40 Activated B Cells to Secrete IgE.
- cytokine IgG ( ⁇ g/ml) IgA ( ⁇ g/ml) IgM ( ⁇ g/ml) igE (ng/ml )
- the IL-13 Target B G ll Subpopulation is More Restricted Than the IL-4 Qie
- IL-13 is able to induce CD23 expression on cultured B cells with an intensity comparable to that obtained with IL-4.
- IL-4 induced > 90% of the cultured B cells to express CD23
- IL-13 induced CD23 only on 40% of the B cell population.
- IL-4 was able to readily induce CD23 on both resting and anti-M activated B cells
- IL-13 was much less efficient under these conditions.
- the transferrin receptor expression was also analyzed on B cells cultured for six days in the CD40 system with or without IL-4 or IL-13.
- TfR transferrin receptors
- sIgD + B cells consist of naive B cells
- slgD" B cells consist of a mixture of germinal center B cells and memory B cells
- the reactivity to IL-4, IL-10, and IL-13 of slgD ⁇ and slgD" B cells was tested in the CD40 system.
- Both sIgD+ and slgD- B cells proliferated strongly in response to IL-4 and IL-40, as measured by (3H)TdR incorporation after six days of culture.
- IL-13 preferentially enhanced the anti-CD40 induced DNA synthesis of sIgD + cells.
- IL-13 and IL-4 were able to induce both sIgD + and slgD" B cells to secrete IgE.
- IL-13 displays many of the biological effects of IL-4, it was suspected that it might act either through an induction of IL-4 secretion or through binding to the IL-4 receptor.
- IL- 13 -induced B cell proliferation was tested in the presence of three different IL-4 antagonists: (1) a neutralizing anti- IL-4 monoclonal antibody; (2) a soluble extracellular domain of the 130 kDa IL-4R [see Garrone et al, Eur. J. Immunol. 27:1365 (1991)]; and (3) a blocking ami- 130 kDa IL-4R monoclonal antibody.
- IL-13 costimulated with anti- IgM antibody to induce DNA synthesis but its effects were less conspicuous than those of IL-2 or IL-4.
- IL-13 as other cytokines, failed to greatly induce the multiplication of B cells activated through their antigen receptor.
- IL-13 displayed striking growth promoting effects on B cells which were cultured in the CD40 system, which is composed of a fibroblastic cell line expressing the human Fc receptor CDw32 and monoclonal antibody to CD40. Under these conditions, IL-13 was at least as active as IL-4 and its effects on B cells were long lasting, thus allowing the multiplication of viable B cells.
- IL-13 altered the phenotype of activated B cells, as it induced B cells to express CD23.
- the IL-13 dependent induction of CD23 on CD40 activated B cells is not mediated by an anti-CD40 activation, since resting and anti-IgM activated B cells can also be induced to express CD23 in response to IL-13.
- the proportion of cells expressing CD23 was lower with IL-13 than with IL-4.
- IL-4 induced virtually all CD40 activated B cells to express high levels of transferrin receptors.
- IL-13 induced only half the cells to express transferrin receptors at high density. This indicated that IL-13 was acting on a subpopulation of B cells which was more restricted than that affected by IL-4.
- IL-13 when cells were separated according to surface IgD (slgD), which distinguishes naive B cells from germinal center and memory B cells, IL-13 was found to be more effective than IL-4 on sIgD + B cells. IL-4 was able to enhance better than IL-13 the proliferation of slgD" B cells. The different population target for IL-13 and IL-4 could be explained by differential IL-13 and IL-4 receptors expression, the demonstration of which will await the production of labelled IL-13 or of IL-13 receptor specific antibodies. The lower response of slgD- B cells is particularly interesting and warrants further analysis. IL-13, as IL-4, poorly enhanced the synthesis of IgG and IgM by B cells cultured in the CD40 system. Surprisingly, however, IL-13 induced anti-CD40 activated B cells to produce IgE.
- slgD surface IgD
- the levels of IgE produced in response to IL-13 were comparable to those produced in response to IL-4.
- IL-4, as well as IL-13 was able to induce IgE synthesis by anti-CD40 activated B cells.
- IL-13 like IL-4, was . able to induce sIgD + to secrete IgE.
- IL-13 could not induce resting B cells to secrete IgE.
- this IL-13 induced IgE production contrasts with other studies indicating IL-4 as being the sole inducer of IgE synthesis.
- recent studies have described assay systems resulting in the secretion of IgE, while IL-4 was totally blocked by neutralizing antibody.
- IL-2 has been reported to induce secretion by Staphylococcus aureus activated B cells, whereas IL-4 was ineffective. It may be possible that in these studies, IL-13 was responsible for these effects.
- IL-13 causes many functions similar to IL-4 on B cells
- the present study demonstrates that these effects are independent of possible induction of IL-4 secretion or the use of the 130 kDa IL-4 receptor, e.g., neutralizing anti-IL-4 antibody, blocking soluble IL-4 receptor, and blocking anti-IL-4 receptor antibody were unable to affect the action of IL-13 on B cell proliferation and IgE secretion.
- the 130 kDa IL-4 receptor e.g., neutralizing anti-IL-4 antibody, blocking soluble IL-4 receptor, and blocking anti-IL-4 receptor antibody were unable to affect the action of IL-13 on B cell proliferation and IgE secretion.
- IL-13 may share with IL-4 some common transducer.
- IL-13 may be involved in abnormal B cell proliferation, as occurs in leukemic and autoimmune diseases.
- agonists or antagonists of IL-13 may be useful in therapeutic treatment of such conditions.
- Highly purified B cells were isolated from normal human spleens obtained from cadaver transplant donors. Splenocytes were obtained by aseptically squashing spleens though a sterile metal mesh and frozen in aliquots for subsequent use. Highly purified B cells (> 98% CD20+) were obtained by negative FACStar Plus Becton Dickinson sorting after staining the splenocytes with the following PE-conjugated mAb: anti-CD3, anti-CD4, anti-CD8, anti-CD14, anti- CD 16, and anti-CD56. (Becton Dickinson).
- Human IL-13 was used at 30 ng/ml final concentration.
- Recombinant IL-4 (used at 400 U/ml) was provided by Schering Research (Bloomfield, NJ). Five thousand highly purified B cells were co-cultured with an equal number of T cells from clones B21 or spA3, harvested five days after stimulation with feeder cells and PHA, in a final volume of 0.2 ml of Yssel's medium supplemented with 10% FCS, 10 ⁇ g/ml ultra pure transferrin (Pierce), and 400 U/ml recombinant IL-4.
- T cell clones were replaced by 5 ⁇ g of plasma membranes derived from the T cell clones, or by 50 ⁇ g/ml anti-CD40 mAb 89.
- Ig content of the supernatants was determined by ELISA as described by Gascan et al, Eur. J. Immunol 22:1133 (1992). Plasma membranes were prepared from the CD4 + T cell clone B21, also as described therein. The amounts of production of the respective Ig isotypes were typically highest when B cells were stimulated with membranes in the presence of IL-4, but IL-13 typically had similar effects. The amount of IgG4 production was particularly high, though IL-13 seemed to enhance the IL-4 effect on IgE production after stimulation with T cell clones.
- sIgD + splenic B cells 5000 cells/well were co- cultured with pJFE14 vector transfected or sorted COS-7 cells (250 cells/well) transfected with and expressing the human (h) or mouse (m) CD40-L.
- IL-13 (30 ng/ml) and IL-4 (400 U/ml) were added.
- the sensitivities of the ELISAs 0.2 ng/ml for IgE and IgM, 0.4 ng/ml for IgG4 and total IgG were determined with calibrated Ig standards (Behring, Marburg, Germany). Both IgG and IgE levels were increased by IL-13.
- the human CD40 ligand (hCD40-L) was cloned from a cDNA library constructed from an activated CD8 + T-cell clone and two cDNA's were detected representing a 2.1 kb and a 1.2 kb clone. Both cDNA clones had identical open reading frames of 261 amino acids and differed only in the length of their 3' untranslated ends, and probably represent the 2.1 kb and 1.2 kb transiently expressed mRNA species detected by Northern analysis in an activated CD4+ T- cell clone.
- hCD40-L transcripts could also be detected in CD4 + and CD8+ T cell receptor (TCR) ⁇ T cells, TCR ⁇ T cells, natural killer cells, monocytes, small intestine, and fetal thymocytes, but not in purified B cells, fetal liver, fetal bone marrow, brain, kidney, or heart.
- TCR T cell receptor
- COS-7 cells transfected with hCD40-L COS-7/hCD40-L
- COS-7/hCD40-L induced human B cell activation as judged by the induction of homotypic aggregates of Epstein-Barr Virus (EBV) transformed, and normal B cells.
- EBV Epstein-Barr Virus
- COS-7/hCD40-L induced B cell proliferation, which was further enhanced by IL-4, or IL-13.
- IL-13 like IL-4, synergized with the mouse and hCD40-L to induce IgM, total IgG, IgG4, and IgE, but not IgA production by highly purified B cells.
- Anti-IL-4 antibodies inhibited IL-4 and COS-7/hCD40-L induced Ig production by B cells, but had no effect on IL-13 and COS-7/hCD40-L induced B cell differentiation, indicating that IL-13 and hCD40-L induced Ig production, including isotype switching to IgE, independently of IL-4.
- hCD40-L induced B cell differentiation was blocked by soluble CD40, confirming the requirement for specific engagement of CD40-L.
- T cell help Induction of B cell proliferation and differentiation into Ig producing cells requires T cell help. Antigen-specific T cell and B cell interactions involving binding of the TCR to peptide class II MHC complexes in the B cells result in T cell activation. Activated T cells deliver both contact and cytokine mediated signals, inducing B cell proliferation and differentiation. Once T cells are activated, they can interact with any B cell in an antigen independent class II MHC non- restricted fashion. Lymphokines produced by the activated T helper cells do not only determine the amounts of Ig produced, but they also direct isotype switching.
- IL-4 is a B cell growth factor which induces human B cells to switch to IgG4 and IgE production, whereas TGF- ⁇ directs IgA switching.
- the human cDNA homologue of P600 a protein produced by mouse Th2 clones following activation, has been recently cloned and expressed, as described herein.
- the human IL-13 protein induced human monocyte and B cell growth and differentiation and was designated IL-13.
- Human IL-13 is a non-glycosylated protein of 132 amino acids with a molecular mass (Mr) of 10,000 and is produced by T cells.
- Mr molecular mass
- IL-13 has no significant homology with other cytokines except IL-4, which is -30% homologous.
- IL-13 like IL-4, can specifically induce IgG4 and IgE switching in human B cells, independently of IL-4.
- the contact mediated signals delivered by activate T helper cells can be replaced by anti-CD40 mAbs.
- One of the contact T helper signals is delivered by the CD40 ligand (CD40-L), a 33 kDa molecule expressed on activated CD4+ T cells.
- CD40-L transfectants induced proliferation of B cells and induced IgE production in the presence of IL-4.
- CD40-L transfectants induced proliferation of B cells and induced IgE production in the presence of IL-4.
- CD40-L transfectants induced proliferation of B cells and induced IgE production in the presence of IL-4.
- the distribution of the human CD40-L, its ability to activate B cells, and its role as a co-activation molecule with IL-13 compared with IL-4 to differentiate B cells were assessed.
- Cells transfected with the human CD40-L exhibited induced B cell aggregation, proliferation, and considerable Ig production, including IgE synthesis, in the presence of IL-13
- Human rIL-4 was provided by Schering-Plough Research (Bloomfield, NJ) and human rIL-13 was provided by W. Dang (DNAX Research Institute, Palo Alto, CA).
- the CD40-Ig fusion protein was obtained by fusion of the cDNA segments encoding the extracellular domain of CD40 to cDNA fragments encoding the human IgGl.
- the mAb89 was kindly provided by Dr. J. Banchereau (Schering-Plough, Dardilly, France). Streptavidin-PE and all antibodies, unless stated otherwise, were from Becton-Dickinson (Mountain View, CA).
- B lymphocytes (>98% CD20+) were purified from spleen using density gradient centrifugation over Ficoll-Hypaque (Pharmacia Fine Chemicals, Piscataway, NJ), followed by negative cell sorting using a FACStar Plus (Becton Dickinson). Surface IgD + positive cells were sorted directly from the negatively sorted B cell population.
- the CD4+ T-cell clone B21 and the CD8+ T-cell clone A10 have been described by Roncarolo et al, J. Exp. Med. 167:1523 (1988).
- various numbers of purified B cells were cultured with different concentrations of COS-7 cells in U-bottom 96- well trays in 0.2 ml.
- COS-7 cells were transiently transfected.
- COS-7 or B21 cells were incubated on ice with 1.4 ⁇ g/ml biotinylated
- Cells specifically expressing CD40-L were sorted using a FACStar Plus (Becton Dickinson) before use.
- Mouse CD40-L DNA provided as a PCR product by Dr. N. Harada and Dr. R. Chang (DNAX Research Institute) was subcloned into the mammalian expression vector pJFE14.
- the human CD40-L was cloned by using the mouse CD40-L cDNA as a probe to screen colony blots of a cDNA library derived from the CD8+ T-cell clone A 10.
- 10 ⁇ A10 cells were activated for 8 hours with 10 ⁇ g/ml con A, harvested, and extracted for RNA.
- mRNA was purified using a Pharmacia (Uppsala, Sweden) mRNA Purification Kit.
- cDNA was synthesized and cloned essentially according to the manufacturers instructions using the Superscript Plasmid System (BRL, Grand Island, NY) the only modification being the use of pJFE14 as the vector for cloning.
- the library contained 10 ⁇ independent clones with an average insert size of 1.4 kb.
- RNA was isolated using RNAzol B (CNNA: Biotech, Friendswood, TX) according to manufacturer's instructions. RNA from brain, heart, kidney, and small intestine were from Clontech (Palo Alto, CA). cDNA was synthesized using Superscript (BRL) and PCR reactions performed in a GeneAmp PCR System (Perkin-Elmer Cetus, Emeryville, CA) with 30 cycles of 94°C, 55°C, and 72°C for 0.5 min, 0.5 min, and 1 min respectively.
- CNNA Biotech, Friendswood, TX
- Primers for detection of CD40-L transcripts were 5'-ACA GCA TGA TCG AAA CAT ACA-3', 5'- TGG CTC ACT TGG CTT GGA TCA GTC-3' and for hypoxanthine phosphoribosyltransferase (HPRT) transcripts 5-TATGG CAGGAC TG AGGTG ⁇ TGC-3',5' - GAGACA AACATGATTCAA
- CD40-L 2p C DNA probes for Northern and Southern blots were made using as a template a 1.3 kb EcoRl-Xhol fragment of pJFE14-CD40-L containing the CD40-L coding region.
- a cDNA library derived from the CD8 + T-cell clone AlO was screened using the mouse Q O-L cDNA as a probe, see Armitage et al, Nature 57:80 (1992).
- the CD40-L Induces Homotypic Aggregation of B Cells and B Cell Proliferation
- B cell activation with antibodies to CD40 results in homotypic aggregation.
- COS-7 cells expressing the CD40-L were purified by FACS and co- cultured with purified B cells or JY cells, an EBV transformed B cell line. Indeed, aggregation of JY cells following incubation with the COS-7 cells expressing human or mouse CD40-L was observed, whereas mock-transfected COS-7 cells were ineffective.
- purified B cells co-cultured with cells expressing human or mouse CD40-L displayed marked homotypic aggregations, whereas B cells cultured with untransfected COS -7 cells remained disperse.
- COS-7 cells expressing human or mouse CD40-L also induced Ig production by highly purified naive surface IgD + human B cells in the presence of IL-4 or IL-13 (Table 6).
- IgM, IgG4, total IgG and IgE but no IgA were produced.
- Ig levels induced by IL-13 were in the same range as those induced by IL-4.
- No Ig production was obtained in the presence of mock- transfected COS-7 cells (Table 6).
- Ig production including IgG4 and IgE production, induced by IL-13 in the presence of COS-7/CD40-L cells was not blocked by anti-IL-4 mAbs (10 ⁇ g/ml), whereas these mAbs strongly blocked IL-4-induced Ig production in the presence of COS-7/CD40-L (Table 6).
- IL-13 induces Ig production independently from IL-4.
- IL-13 is another cytokine that directs naive surface IgD + human B cells to switch to IgG4 and IgE producing cells in the presence of a contact-mediated costimulatory signal delivered by COS-7 cells expressing the mouse or human CD40-L.
- Table 6 Induction of Ig Synthesis by IL-13 or IL-4 and COS Cells Expressing CD40-L
- sIgD + splenic B cells were co- cultured with pJFE14 vector transfected or sorted COS-7 cells (250 Cells/well) transfected with and expressing the human (h) or mouse (m) CD40-L.
- IL-13 (30 ng/ml) and IL-4 (400 U/ml) were added as indicated.
- the sensitivities of the ELISAs (0.2 ng/ml for IgE and IgM, 0.4 ng/ml for IgG4 and total IgG) were determined with calibrated Ig standards (Behring, Marburg, Germany).
- CD40-L as judged by binding of PE-labelled streptavidin to biotinylated CD40-Ig bound to the T cells.
- significant expression of the CD40-L was observed on the CD4 + T cell clone B21 4 h after activation with PHA. Consistent with its presence on the surface of B21 cells, hCD40-L mRNA was detected by Northern analysis and by PCR. Low levels of hCD40-L mRNA were expressed in resting B21 cells. Kinetic studies indicated that the 2.1 kb and 1.2 kb mRNA species were already maximally expressed within 2 hours following activation, irrespective of the mode of activation of the T cells.
- CD40-L transcripts were not present in B cells, brain, kidney, heart, fetal liver, or fetal bone marrow, but could be readily detected in CD4+ T cell clones, CD8+ T cell clones, a TCR ⁇ T-cell clone, purified NK cells, monocytes, fetal thymocytes, and small intestine. Expression of CD40-L in the small intestine may reflect IL-13 production by infiltrating MNC.
- the human CD40-L cDNA which was cloned and expressed . in COS -7 cells is very effective in inducing human B cell activation. COS-7/hCD40-L induced homotypic aggregation of EBV-transformed and normal B cells and B cell proliferation, similarly as observed with anti-CD40 mAbs. In addition, differentiation of B cells into Ig secreting plasma cells was observed in the presence of IL-4 or IL-13.
- the 2.1 kb hCD40-L cDNA was isolated from a CD8+ T cell cDNA library and appeared to be a full-length clone, which was by sequence comparison, identical to the 1.8 kb cDNA's described earlier. An additional 1.2 kb cDNA clone probably represents a second mRNA species of that size which was detected in activated T cells and which apparently encodes the same protein.
- the hCD40-L has 80% homology with the corresponding mouse gene. Interestingly, the hCD40-L has also some degree of homology with TNF- ⁇ and TNF- ⁇ . The positioning of the four cysteine residues and the potential extracellular N-linked glycosylation site in the mouse CD40-L are conserved in the human CD40-L, however the human protein has an additional cysteine substituted at position 194.
- the CD40-L is reported to be a type II membrane anchored protein and there is a hydrophobic region of the human protein (amino acids 22-45) representing a potential signal/anchor domain near the amino terminus. B cell proliferation induced by COS- 7/CD40-L was enhanced by IL-4 or IL-13.
- IL-4 and IL-13 seemed to be equally effective, indicating that IL-13, like IL-4, has B cell growth promoting activity.
- IgM, IgG4, total IgG, and IgE were produced under these culture conditions.
- the profile of Ig production induced by IL-4 and IL-13 with hCD40-L is similar to that obtained in the presence of DL-4 and anti-CD40 mAbs.
- IL-13 and IL-4 appear equally potent in inducing both proliferation and Ig synthesis in B cells.
- the hCD40-L provides a co-stimulatory signal for IL-4 or IL-13 induced B cell differentiation, confirming the important role for CD40 in B cell activation and differentiation.
- CD40-L and the cell surface form of TNF- ⁇ are homologous and share some structural similarities, as do CD40 and the TNF receptor.
- the substantial help given to human B cells by the cloned human and mouse CD40-L's is consistent with previous studies, demonstrating that signaling through CD40 is of significant consequence for B cell survival, activation, and differentiation.
- the mouse CD40-L appears as effective as the human CD40-L in activating human B cells, which is consistent with the ability of murine CD40-L to bind human CD40.
- the similarity of the protein sequences and the ability of both mouse and human -CD40-L to bind CD40 cross-species indicates this is an important interaction in vivo to be so well conserved.
- Human IL-13 cDNA was isolated form the same CD8 + T-cell clone library as CD40-L. However, although IL-13 is expressed in the CD8+ T cells, far more IL-13 is expressed in CD4+ T cells.
- the potency of the combination of these two novel molecules for induction of IgE synthesis, and their abundant co-expression by CD4 + T cells, together with the prolonged expression of IL-13 mRNA following T cell activation may be a mechanism contributing to IgE production in vivo and IgE mediated allergic reactions.
- CD40-L expression on cells other than CD4+ T cells suggests a broader function for the molecule than in T-B cell interaction. It is likely that CD40-L is expressed on other cell types, and even CD4+ T cells, which will have important consequences for their function, rather than just providing a one way stimulus to CD40 positive cells such as B cells.
- CD40-L and CD40 expression, in thymocytes and thymic epithelium may be indicative of interactions involved in T cell development.
- IL-13 induced IgG4 and IgE synthesis by human B cells.
- IL-13 induced IgG4 and IgE synthesis by unfractionated peripheral blood mononuclear cells (PBMNC) and highly purified B cells cultured in the presence of activated CD4 + T cells or their membranes.
- IL-13- induced IgG4 and IgE synthesis was IL-4-independent, since it was not affected by neutralizing anti-IL-4 monoclonal antibody (mAb).
- IL-13 like IL-4, induced CD23 expression on B cells and enhanced CD72, surface IgM (slgM), and class II MHC antigen expression.
- slgM surface IgM
- class II MHC antigen expression like IL-4, IL-13 induced germline ⁇ transcription in highly purified B cells.
- IL-13 is another T cell- derived cytokine that, in addition to IL-4, efficiently directs naive human B cells to switch to IgG4 and IgE production.
- B cells undergo Ig isotype switching and differentiation into Ig-secreting cells in response to slgM mediated signals in the presence of costimulatory factors provided by CD4 + T cells.
- Antigen-specific T-B cell interactions require binding of the T cell receptor to peptide-class II major histocompatibility complexes (MHC) on B cells, which results in T-cell activation and cytokine synthesis. Once the T cells are activated they can activate B cells in an antigen- independent fashion.
- MHC major histocompatibility complexes
- Cytokines are essential for B-cell proliferation and differentiation; they not only determine Ig secretion quantitatively, but they also direct Ig isotype switching.
- IL-4 induces IgG4 and IgE switching, whereas transforming growth factor- ⁇ (TGF- ⁇ ) directs IgA switching.
- TGF- ⁇ transforming growth factor- ⁇
- contact-mediated signals delivered by CD4+ T cells are required for B cell proliferation and Ig production.
- the ligand for CD40 which is expressed on activated CD4+ T cells, was shown to be one such membrane associated molecule that acts as a costimulatory signal for IL-4-dependent IgE production by both murine and human B cells. See, e.g., Armitage et al, Nature 557:80 (1992).
- cytokines such as IL-2, IL-5, IL-6, IL-8, IL-10, IL-12, interferon- ⁇ (IFN- ⁇ ), IFN- ⁇ , tumor necrosis factor- ⁇ (TNF- ⁇ ), and TGF- ⁇ modulate IL-4-induced IgG4 and IgE synthesis.
- IL-4 has been thought to be the only cytokine capable of inducing IgE synthesis. Out of 16 cytokines tested, IL-4 was the only one inducing germline or productive ⁇ transcripts or IgE synthesis. In addition, anti-IL-4 mAbs preferentially inhibit IgE synthesis induced by IL-4 producing T cell clones without significantly affecting IgM, IgG, or IgA synthesis. Also in murine models, anti-IL-4 antibodies strongly inhibit IgE synthesis in vivo without affecting the other Ig isotypes. Most importantly, IL-4 deficient mice lack IgE in their sera following nematode infection.
- a non-IL-4-producing T cell clone induces germline ⁇ transcription in purified B cells indicating that an IL-4-independent pathway of induction of germline ⁇ transcription is operational.
- IL-13 induces CD23 expression and germline ⁇ mRNA synthesis and IgG4 and IgE switching in human B cells.
- IL-13 Human recombinant IL-13 was purified as described herein.
- Recombinant IL-4, IFN- ⁇ , and IFN- ⁇ were provided by Schering- Plough Research (Bloomfield, NJ).
- Fluorescein isothiocyanate (FITC)- conjugated anti-CD72 mAb and neutralizing anti-TGF- ⁇ mAb were purchased from R&D Systems, Inc. (Minneapolis, MN).
- FITC- and phycoerythrin (PE)-conjugated mAbs specific for CD3, CD4, CD8, CD14, CD16, CD19, CD20, CD23, CD25, CD56, HLA-DR, and control antibodies with irrelevant specificities were obtained from Becton- Dickinson (Mountain View, CA).
- FITC- or PE-conjugated mAbs specific for LFA-1 (LI 30), LFA-3, ICAM-1 (LB2), B7 (L307), and class I MHC antigen were kindly provided by Dr. J. Phillips (DNAX).
- FITC -conjugated anti-IgD and anti-IgM mAbs were obtained from Nordic Immunological Laboratories (Tilburg, The Netherlands).
- the neutralizing anti-IL-4 mAb 25D2.11 was kindly provided by Dr. J. Abrams (DNAX).
- Plasma samples and spleens were obtained from healthy volunteers or from patients undergoing splenectomy due to trauma, respectively.
- Mononuclear cells were isolated by centrifugation over Histopaque-1077 (Sigma, St. Louis, MO).
- Purified B cells were obtained by negative sorting using a fluorescence-activated cell sorter FACStar Plus (Becton-Dickinson) or magnetic beads (Dakopatts, Norway). Briefly, splenic MNC were washed twice and PE-conjugated mAbs against CD3, CD4, CD8, CD 14, CD 16, and CD56 were added at saturating concentrations and incubated at 4°C for 30 min. The cells were washed twice with PBS. Cells with the light scatter characteristics of lymphocytes were gated, and PE" cells were sorted. Alternatively, cells stained with mAbs against CD3, CD4, CD8, CD14, CD16, and CD56 were incubated for 30 min at 4°C with magnetic beads coated with anti-mouse Ig mAbs.
- FACStar Plus Fluorescence-activated cell sorter
- the cells bearing murine Ig were removed using a magnetic field. The remaining cells were washed, counted, and used in further experiments.
- positive sorting by FACStar Plus was used for isolation of sIgD + B cells.
- Splenic MNC were stained with PE- conjugated mAbs against CD3, CD4, CD8, CD14, CD16, and CD56 and FITC-conjugated anti-IgD mAb, and FITC" 1 ", PE- cells were sorted. On reanalysis, purities of the sorted cell populations were >98%, and that of cells isolated using magnetic beads >95%.
- the CD4+ T cell clone B21 and the CD4+ non-IL-4 producing T cell clone SP-A3 were cultured according to Roncarolo et al, J. Exp. Med. 167:1523 (1988). The cells were obtained 4-6 days after they had been activated by the feeder cell mixture and PHA. In addition, IL-2 (100 U/ml) was added to maintain the activation state of the T cell clones.
- the membranes of a CD4+ T cell clone were prepared according to Gascan et al, Eur. J. Immunol. 22:1133 (1992). Briefly, the CD4+ T cell clone B21 was harvested 12 days after activation with feeder cell mixture and phytohemagglutinin (PHA), the cells were washed and restimulated with 10 ⁇ g/ml of Concanavalin A (Con A) for 7-8 h at 37° C. During the last 30 min of the Con A stimulation, 100 ⁇ g/ml of ⁇ -methyl-D-mannoside (Sigma, St. Louis, MO) was added. From these cells, membranes were prepared using the method described by Brian, Proc. Natl. Acad. Sci.
- Purified B cells were cultured at 5000 cells/well in quadruplicate, in round-bottomed 96-well plates (Linbro, McLean, VA) at 37°C in a humidified atmosphere containing 5% C ⁇ 2 in 0.2ml Yssel's medium supplemented with 10% fetal calf serum (FCS). Unfractionated PBMNC were cultured at 10 ⁇ cells/well in 12 replicates. In coculture experiments, the CD4+ T cell clone SP-A3 was cultured at 5000 cells/well (T:B cell ratio 1:1). After a culture period of 12 days, Ig levels in the culture supernatants were measured by ELISA. Measurement of Ig Production
- IgM, total IgG, IgA, and IgE secretion were determined by ELISA as described in Pene et al, Proc. Natl. Acad. Sci. USA 55:6880 (1988).
- IgG4 secretion was determined by ELISA as described in Punnonen et al, J. Immunol. 745:3398 (1992).
- the sensitivities of IgM, total IgG, and IgA ELISAs were 0.5-1 ng/ml, and the sensitivities of IgG4 and IgE ELISAs were 0.2 ng/ml.
- FITC- and PE-conjugated mAbs were added at saturating concentrations and incubated at 4°C for 30 min.
- FITC- and PE-conjugated mAbs with irrelevant specificities were used as negative controls.
- the cells were washed twice with PBS and cells with the light scatter characteristics of lymphocytes were analyzed using a FACScan flow cytometer (Becton-Dickinson).
- RNA was isolated using RNAzol B (CNNA: Biotech, Friends wood, TX) according to manufacturer's instructions. RNA was electrophoresed through 0.85% agarose and transferred to BA-S nitrocellulose (Schleicher and Schuell, Keone, NH). 2p cDNA probes were made by random priming using as templates, an Tsc ⁇ RI/Hi/idlll fragment of pBSIgEl-4 for germline e, and DNA complementary to the Bgll/Smal fragment of pHFgA-1 for actin. See Gauchat et al, J. Exp. Med. 772:463 (1990); and Erba et al, Nucleic Acids Res. 14:5215 ( 1986).
- IL-13 The effect of IL-13 on the expression of a variety of B cell surface antigens was investigated by FACS analysis. Incubation of purified B cells with IL-13 (200 U/ml) resulted in strong induction of CD23 expression on a proportion (about 20%) of the B cells. IL-13 also upregulated class II MHC antigen, slgM, and CD72 expression on B cells. These effects of IL-13 were similar to those observed by IL-4. CD23 expression was already detectable after a culture period of 24 h, but maximal responses were observed after 72 h of culture. The expression of CD19, CD20, CD25, CD40, class I MHC antigen, B7, ICAM-1, LFA-1, and LFA-3 were not significantly modified by B -13.
- IL-13 was tested for induction of IgE synthesis by human PBMNC. As shown in Table 7, IL-13 induced IgE synthesis by unfractionated PBMNC in a dose-dependent manner in the absence of exogenous IL-4. In addition, strong IgG4 production in response to IL-13 was observed.
- IgE ng/ml
- IgG4 ng/mD
- IL-4 500 U/ml
- IL-13 500U/ml
- IL-13 The ability of IL-13 to induce IgG4 and IgE synthesis by purified B cells was also tested. It was thereby found that IL-13 induced IgG4 and IgE synthesis by highly purified B cells cultured in the presence of membranes of an activated CD4+ T cell clone. Also in this culture system the levels of IL- 13 -induced IgG4 and IgE production were generally lower than those induced by IL-4. The difference was in the same range as observed in the cultures of unfractionated PBMNC. IL-13 also induced significant levels of IgM and total IgG production, but no IgA synthesis was observed. In this aspect IL-13 has properties similar to IL-4, which generally inhibits IgA synthesis.
- IL-4 has been the only cytokine known to induce germline ⁇ transcription in B cells. Since switching to ⁇ by IL-4 is preceded by the induction of germline ⁇ RNA synthesis, it was hypothesized that IL-13 would induce germline ⁇ transcription as well. Indeed, when highly purified B cells were cultured in the presence of IL-13 and anti-CD40 mAbs, germline ⁇ mRNA synthesis, at levels comparable to that in the presence of IL-4 and anti-CD40 mAbs, was detected after a culture period of five days (see Tables 9 and 10).
- Sorted CD19+, sIgM+ fetal B cells IgM IgG IgG4 IgE
- IL-12 decreased the IL-13 effect, while increasing the IL-4 effect.
- IL-4 has been considered the only cytokine to induce IgE switching in human or murine B cells. This was based on studies showing that anti-IL-4 mAbs preferentially block IgE synthesis both in vitro and in vivo, and on the observation that no circulatory IgE could be detected in mice, in which the IL-4 gene had been disrupted. It was found, however, that IL- 13 -induced IgE synthesis is independent of IL-4, since IL-13 induced IgG4 and IgE synthesis in cultures of highly purified B cells in the absence of exogenous IL-4.
- anti-IL-4 mAbs which efficiently " blocked IL-4- induced IgE synthesis, failed to affect IL-13-induced IgE production.
- IL- 13 -induced IgG4 and IgE synthesis like that induced by IL-4, reflects Ig isotype switching and is not due to a selective outgrowth of a few B cells committed to IgG4 or IgE synthesis, since IL-13 also induced IgG4 and IgE synthesis by naive, sorted sIgD+ B cells.
- IL-4 has been considered to be the only cytokine to induce germline ⁇ transcription in B cells
- an IL-4- independent pathway of induction of germline ⁇ transcription is operational, since a non-IL-4 producing T cell clone was also capable of inducing strong germline ⁇ RNA synthesis.
- IL-13 produced by the non-IL-4 producing T cell clones is responsible for the IL-4-independent induction of germline ⁇ mRNA in B cells.
- the present findings may also explain why induction of IgE synthesis by IL-4 producing T-cell clones was never completely inhibited by anti-IL-4 mAbs.
- a combination of IL-4 and IL-13 antagonists may be quite effective in blocking the switching process, each present at lower levels, e.g., below threshold levels for adverse side effects.
- IL-13 also upregulated expression of class II MHC antigen, slgM, and CD72, which is the ligand for CD5.
- CD23 the exact role of CD23 in the regulation of IgE synthesis remains to be determined, a strong correlation between CD23 expression and induction of IgE synthesis was observed and soluble forms of CD23 were found to enhance IgE synthesis. Since IL-13 induced significant expression of CD23 within 24 h, these data also indicated that CD23 expression preceded IL- 13 -induced ⁇ switching, thereby confirming the correlation between induction of CD23 expression and subsequent IgE synthesis.
- IL-4 and IL-13 are not identical.
- the levels of IgG4 and IgE produced in response to IL-13 were generally lower than those induced by IL-4.
- IL-13 has no obvious T cell growth promoting activity and appears not to induce CD8a expression on CD4+ T-cell clones, which may be due to lack of functional IL-13 receptors on T cells.
- the activation state of T cells was essential for their ability to deliver co-stimulatory signals required for B cell proliferation and differentiation. Therefore, the lack of T cell activation inducing effect of IL-13 may partially explain why maximal IgG4 and IgE synthesis by PBMNC in response to IL-13 was lower than that induced by IL-4.
- PBMNC Peripheral blood mononuclear cells
- FACS fluorescence activated cell sorting
- CDl lc [pl50; NGH 93, see Visser et al, Blood 74:320 (1989)]; CD54 [ICAM; LB2, see Azuma et al, J. Expt'l Med. 775:353 (1992)], Class I MHC [W6/32, from Sera Labs, see also Barnstable et al, Cell 14:9 (1978)]; Class II MHC [Q5/13, see Quaranta et al, J. Immunol. 125:1421 (1980)]; Class II MHC [PdV5.2, see Koning et al, Human Immunol.
- CD 16 [granulocyte-1, see Huizinga et al, Nature 333:661 (1988)]; or Leu 11a, Becton Dickinson, Mountain View, CA); CD23 (gp25, from DNAX, Palo Alto, CA), IL-2Ra [7G7; or BB10, see Herve et al, Blood 75:1017 (1990)], CD44 [Nkl-Pl; see Vennegoor et al, J. Immunol. 148:1093 (1992)], CD14 (LeuM3,
- IL-13 (P600) was assayed by its inhibitiory effect on the production of nitric oxide (NO) by GM-CSF-derived bone marrow macrophages.
- the macrophages were derived by 9-12 days culture in RPMI containing GM-CSF and purified by retention of adherent, GM-CSF-responsive fraction. Cells were 99+% pure, as determined by FACS analysis using two color staining.
- Macrophages were activated to produce NO by stimulation with LPS at 3 ⁇ g/ml in the appropriate experiments, either with or without prior stimulation with cytokines, as indicated.
- the macrophages were incubated for 16 h with the cytokines (if used) 16 h prior to treatment with LPS.
- Supernatants were taken at the indicated times relative to LPS addition, i.e., 0 h is the time of addition of LPS. Supernatants were assayed for NO production by the standard
- part A shows NO production from GM-CSF-treated bone marrow derived macrophages after treatment for 16 h with designated cytokines. Note that IFN- ⁇ induced NO production, while JX-4 or IL-13 inhibited NO production. L-NMMA is -a specific inhibitor of NO production. Parts B and C are similar experiments titrated over different ranges of P600 amounts. In each case, the IL-13 decreased the production of NO.
- IL-6 IL-13 inhibits the production of IL-l ⁇ .
- Peripheral blood mononuclear cells were isolated from normal healthy donors by centrifugation over Ficoll-Hypaque.
- Total PBMNC 100 x 10 ⁇ cells/100 mm tissue culture dish
- PBS PBS-binding protein
- Adherent cells were incubated in Yssels medium with 1% human AB serum in the absence or presence LPS (E. coli 0127:B8, Difco, Detroit, MI) in combination with IL-4 (50 ng/ml), IL-13 (50 ng/ml), or IL-10 (100 U/ml).
- Table 12 Effect of IL-13 on the Production of IL-l ⁇ , IL-6, IL-10, and TNF- ⁇ by LPS Activated Human Monocytes.
- IL-l ⁇ IL-6 IL- 10 TNF- ⁇ (ng/ l) (ng/ml) (ng/ml) (n g/ml)
- IL-4 and IL-13 inhibited the production of IL-l ⁇ , IL-6, IL-10, and TNF- ⁇ by LPS activated human monocytes.
- IL-10 also inhibited the production of IL-l ⁇ , IL-6, and TNF- ⁇ by LPS activated human monocytes.
- IL-10 was produced by human monocytes and inhibited IL-l ⁇ , IL-6, and TNF- ⁇ in an autoregulatory fashion.
- Addition of IL-10 neutralizing mAb 19F1 showed that endogenously produced IL-10 also inhibited the production of IL-l ⁇ , IL-6, and TNF- ⁇ .
- IL-4 and IL-13 inhibited the production of IL-l ⁇ , IL-6, and TNF- ⁇ in the presence of neutralizing anti-IL-10 mAb 19F1.
- ADCC Antibody Dependent Cell-mediated Cytotoxicity
- IL-13 induced significant changes in the phenotype of monocytes. Like IL-4, it enhanced the expression of CDl lb, CDl lc, CD18, CD29, CD49e (VLA-5), class II MHC, CD13, and CD23 whereas it decreased the expression of CD64, CD32, CD 16, and CD 14 in a dose-dependent manner. IL-13 induced upregulation of class II MHC antigens and its downregulatory effects on CD64, CD32, and CD16 expression were prevented by IL-10.
- IFN- ⁇ could also partially prevent the IL-13 induced downregulation of CD64, but not that of CD32 and CD 16.
- IL-13 strongly inhibited spontaneous and IL-10 or IFN- ⁇ induced antibody dependent cell-mediated cytotoxicity (ADCC) activity of human monocytes toward anti-IgD coated Rh+ erythrocytes, indicating that the cytotoxic activity of monocytes was inhibited.
- ADCC antibody dependent cell-mediated cytotoxicity
- IL-13 inhibited production of IL-l ⁇ , IL-l ⁇ , IL-6, IL-8, IL-10, IL-12 P35, IL-12 P40, GM-CSF, G-CSF, IFN- ⁇ and TNF- ⁇ by monocytes activated with LPS.
- IL-13 enhanced the production of IL-1RA by these cells.
- Similar results on cytokine production were observed or have been obtained for IL-4.
- IL-13 shares most of its activities on human monocytes with IL-4, but no additive or synergistic effects of IL-4 and IL--13 on human monocytes were observed suggesting that these cytokines may share common receptor components. Taken together, these results indicate that IL-13 has anti -inflammatory and immunoregulatory activities.
- T cells secrete a number of biologically active polypeptides, which regulate the proliferation, differentiation and function of cells participating in immune responses against antigens.
- T cells producing IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IFN- ⁇ , GM-CSF, and TNF/LT simultaneously following antigenic or polyclonal stimulation have been described in both mouse and man.
- T helper cells were designated ThO cells in order to distinguish them from the more specialized Thl and Th2 subsets.
- Murine Thl cells produce IL-2, IFN- ⁇ , TNF/LT, IL-3, and GM-CSF which supports their function as regulatory and effector cells in cellular immune responses such as delayed type hypersensitivity (DTH) whereas Th2 cells produce IL-4, IL-5, IL-6, IL-10, IL-3, and GM-CSF which makes them suitable for providing help to B cells in the production of immunoglobulins of different isotypes.
- DTH delayed type hypersensitivity
- Th2 cells produce IL-4, IL-5, IL-6, IL-10, IL-3, and GM-CSF which makes them suitable for providing help to B cells in the production of immunoglobulins of different isotypes.
- T cell clones with restricted cytokine production profiles have also been isolated from patients with inflammatory or allergic diseases. Although these types of clones resembled murine Thl and Th2 clones, there were some differences.
- Thl clones Depending on their mode of activation, Thl clones generally could still produce low quantities of IL-4 whereas Th2 clones were able to produce low to normal quantities of IFN- ⁇ .
- Th2 clones were able to produce low to normal quantities of IFN- ⁇ .
- a clear imbalance in the production ratios of IL-4 and IFN- ⁇ by Th2 clones was observed following antigenic stimulation. Therefore human T cell clones were defined which produce high levels of IFN- ⁇ and no, or low levels of IL-4 Thl "like” cells and T cell clones which produce no, or low levels of IFN- ⁇ and high levels of IL-4 Th2 "like” cells.
- IL-10 which is exclusively produced by ThO and Th2 T cell subsets in the mouse, is produced by ThO, Thl "like", and Th2 "like” subsets in man.
- the present invention makes available a new cytokine, human IL-13, which is related to the mouse P600 protein. Both human IL-13 and mouse P600 proteins were biologically active and affected human monocyte and B cell functions. The biological activities of mouse and human IL-13 on human monocytes were further characterized and compared to those of EL-4, IL-10, and IFN- ⁇ , other cytokines with stimulatory of inhibitory actions on human monocytes.
- IL-13 induced dramatic changes in the phenotype of human monocytes and inhibited the production of IL-l ⁇ , IL-l ⁇ , IL-6, IL-8, IL-10, GM-CSF, G-CSF, and TNF- ⁇ following activation by LPS, whereas it induced the production of IL-1RA.
- IL-13 has anti- inflammatory activities and may play an important regulatory role in immune responses.
- Human monocytes were isolated from peripheral blood of healthy donors by centrifugation over Ficolll-Hypaque and adherence to plastic. Briefly, 100 x 10 ⁇ PBMNC were plated on a 100 mm tissue culture dish in Yssel's medium supplemented with human serum albumin (HSA) and 1% pooled human AB+ serum and incubated at 37° C for 30 min. This culture medium was endotoxin free as determined by the Limulus amoebocyte lysate assay ( ⁇ 0.2 ng/ml of endotoxin). Subsequently, nonadherent cells were removed by extensive washing and cultured in Yssel's medium with HSA and 1% pooled human AB serum as indicated. Alternatively, highly purified human peripheral blood monocytes were obtained from 500 ml blood of normal donors by centrifugal elutriation.
- HSA human serum albumin
- Mononuclear cells were isolated by density centrifugation in a blood component separator, followed by fractionation into lymphocytes and monocytes.
- the monocyte preparation was > 95% pure, as judged by nonspecific esterase staining and contained more than 98% viable cells.
- These monocytes were cultured in Yssel's medium with HSA and 1% pooled human AB+ serum at a concentration of 4 x 10 ⁇ cells/ml in teflon bags (Jansen MNL, St Niklaas, Belgium), which prevented adhesion of these cells. After culture for the times indicated, monocytes were collected and analyzed for cell surface expression by indirect immunofluorescence or analyzed for lymphokine gene expression by Northern and PCR analysis.
- monocyte culture supernatants were collected for determination of IL-l ⁇ , IL-l ⁇ , IL-6, IL-8, IL-10, TNF- ⁇ , GM-CSF, G-CSF, and IL-1RA production following activation of these cells by LPS (E. coli 0127:B8) (Difco, Detroit, MI) at 1 ⁇ g/ml.
- LPS E. coli 0127:B8
- the viability of the cells after culture always exceeded 95% as determined by trypan blue exclusion.
- Recombinant human and mouse IL-13 were expressed in E . coli as insoluble aggregates of glutathione-S-transferase fusion proteins, extracted by centrifugation, solubilized, and subjected to renaturation prior to digestion with thrombin to remove the N- terminal fusion part. Subsequently, proteins were purified by cation exchange and gel filtration chromatography, which resulted in active human and mouse IL-13. Purified human r-IL-10, r-IL-4, and r- IFN- ⁇ were provided by Schering-Plough Research Institute (Bloomfield, NJ).
- the following mAbs were used for immunofluorescence studies on the expression of cell surface markers: SPV-L7 [CDl la; Spits et al, Hybridoma 2:423 (1983)], Bear-1 [CDl lb; Keizer et al, Eur. J. Immunol 75:1142 (1985)], CLB FcR gran-1 [CD16; Klaassen et al, J. Immunol. 144:599 (1990)], gp25 [CD23; Bonnefoy et al, J.
- CD29 Ts2/16; a kind gift of C. Figdor, Amsterdam
- L307 B7; Azuma et al, J. Immunol. 149:1115 (1992)]
- IOM13 CD 13; purchased from AMAC, Inc., Westbrook, ME
- Leu-M3 CD14
- Leul5 CDl lc
- L130 CD18
- Oligonucleotides used for Southern analysis of IL-l ⁇ , IL-l ⁇ , IL-6, IL-8, IL-10, TNF- ⁇ , GM-CSF, G-CSF, and ⁇ -actin PCR products have been described by de Waal Malefyt et al, J. Exp. Med. 774 : 1209 (1991).
- IFN- ⁇ 5'-TTCTGGCTGTGAGGAAATACT-3' (nt 360-378),
- IL-1RA 5'-GTCAATTTAGAAGAAAAGATAGATGTGG-3' (nt 207-234),
- IL-12 P35 5'-AATGGGAGTTGCCTGGCCTC-3' (nt 488-507),
- IL-12 P40 5'-TAAGACCTTTCTAAGATGCGAGGCC-3' (nt 417-441), and TGF- ⁇ l : 5 , -CGAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACC-CGC-3 , (nt 1131-1170).
- Conditions for PCR were as follows: in a 50 ⁇ l reaction volume, 25 nmol of each primer, 125 ⁇ M each of dGTP, dATP, dCTP, and dTTP (Pharmacia, Uppsala, Sweden), 50 mM KC1, 10 mM Tris- HCl, pH 8.3, 1.5 mM MgCl2, 1 mg/ml gelatin, 100 ⁇ g/ml non- acetylated BSA, and 1 unit Vent DNA polymerase (New England Biolabs, Beverly, MA).
- IFN- ⁇ sense primer 5'- GCTGAAACCATCCCTGTC-3' (nt 161-178)
- IFN- ⁇ antisense primer 5'-CTGCTCTGACAACCTCCCAG-3 * (nt 450-430)
- IL-IRA sense primer S'-GCAAGCCTTCAGAATCTGGGATG-S' (nt 118-141)
- IL-IRA antisense primer 5'-GATGTTAACTGCCTCCAGCTGGAGTC-3' (nt 344-319)
- IL-12 P35 sense primer 5'-CTTCACCACTCCCAAAACCTG-3' (nt 281-302)
- IL-12 P35 antisense primer 5'-AGCTCGTCACTCTGTCAATAG-3' (nt 813-792)
- IL-12 P40 sense primer 5'-CATTCGCTCCTGCTGCTTCAC-3' (nt 337-358)
- IL-12 P40 antisense primer 5'- TACTCCTTGTTGTCCCCTCTG-3
- Thermal cycler 9600 for 25 cycles (denaturation 30 s at 94°C, annealing 30 s at 55°C, extension 60 s at 72°C). Forty microliter of each reaction was loaded on 1% agarose gels in TAE buffer and PCR products were visualized by ethidium bromide staining. Subsequently, gels were denatured in 0.5 M NaOH, 1.5 M NaCl, neutralized in 1 M ammonium acetate, and transferred to Nytran nylon membranes.
- Membranes were pre-hybridized in 6 x SSC, 1% SDS, 10 x Denhardt's solution (0.2% Ficoll, 0.2% polyvinylpyrrolidone, 0.2% BSA, pentax fraction V), and 200 ⁇ g/ml E. coli tRNA (Boehringer, Mannheim, FRG) for 4 h at 55°C.
- Oligonucleotide probes (200 ng), specific for a sequence internal to the primers used in the amplification, were labelled at the 5' end by T4 polynucleotide kinase (New England Biolabs) and ⁇ -32p-ATP (Amersham, Arlington Heights, IL). Probes were separated from non-incorporated nucleotides by passage over a Nick column (Pharmacia, Uppsala, Sweden) and added to the hybridization mix.
- cytokine specific ELISA's The production of cytokines by monocytes was determined in culture supernatants by cytokine specific ELISA's.
- the cytokine specific ELISA's and their sensitivities were the following: IL-l ⁇ , Endogen (Boston, MA) (50 pg/ml); TNF- ⁇ , Endogen (Boston, MA) (10 pg/ml); IL-l ⁇ , Cistron (Pine Brook, NJ) (20 pg/ml); IL-6, Genzyme (Boston, MA) (0.313 ng/ml); IL-8, R&D Systems (Minneapolis, MN) (4.7 pg/ml); G-CSF, R&D Systems (Minneapolis, MN) (7.2 pg/ml); IL-IRA, R&D Systems (Minneapolis, MN) (12.5 pg/ml); GM-CSF, Bacchetta et al., J.
- ADCC Antibody Dependent Cell-mediated Cytotoxicity
- ADCC activity of cultured human monocytes against antibody coated rhesus positive human erythrocytes was performed as previously described by de Velde et al, J. Immunol 749:4048 ( 1992).
- IL-13 and IL-4 Induce Identical Changes in the Expression of Cell Surface Antigens by Human Monocytes
- IL-13 Both mouse and human IL-13 induced expression of CD23 (Fc ⁇ RII) and upregulated the expression of class II MHC antigens on human monocytes.
- IL-13 affected the expression of multiple cell surface molecules belonging to different supergene families.
- IL-13 enhanced the expression of several members of the integrin superfamily of adhesion molecules.
- the expression of ⁇ subunits CDl lb (C3bi receptor, Mac-1), CDl lc (gpl50,95), and VLA-5 (FNR), as well as their respective ⁇ subunits CD18 ( ⁇ 2) and CD29 ( ⁇ l, VLA-b) were upregulated by IL-13.
- CDl la (LFA-1), VLA-2 (CD49b), VLA-3, VLA-4 (CD49d), VLA-6 (CD49f), ⁇ 3 (CD61), and ⁇ 4 was not significantly affected by JL-13.
- IL-13 enhanced the expression of class II MHC antigens.
- the expression of HLA-DR, HLA-DP and HLA-DQ was upregulated by IL-13.
- Expression of other members of the Immunoglobulin superfamily including class I MHC, CDl la (LFA-1), CD54 (ICAM-1), ICAM-2, and CD58 (LFA-3) was not dramatically affected by IL-13.
- IL-13 modulated the expression of the various Fc receptors on monocytes.
- the expression of CD64 (Fc ⁇ RI), CD32 (Fc ⁇ RII), and CD 16 (Fc ⁇ RIII) on human monocytes was strongly downregulated by
- IL-13 induced the expression of CD23 (Fc ⁇ RII).
- IL-13 upregulated the expression of CD 13 (Aminopeptidase N) and downregulated the expression of CD 14. No major effect of IL-13 was detected on the expression of CD25, CD33, and CD44.
- IL-4 induced upregulation of CDl lb, CDllc, CD18, VLA-5, CD29, class II MHC, CD13, and CD23, and inhibited the expression of CD 16, CD32, CD64, and CD 14 on human monocytes to the same extent as did IL-13.
- these results indicated that the IL-13 induced changes in the expression of cell surface molecules were similar to those induced by IL-4. Incubation of monocytes with saturating concentrations of both IL-4 and IL-13 did not result in . changes in the phenotype as compared to those induced by either cytokine alone. No additive or synergistic activities of IL-13 and IL-4 on the expression of the various cell surface molecules were detected under these conditions.
- monocytes are able to produce IL-4.
- monocytes were incubated in the presence of IL-13 and a neutralizing anti-IL-4 mAb.
- Monocytes were incubated with medium, IL-13 (50 ng/ml) or IL-4 (400 U/ml) in the absence or presence of neutralizing anti-IL-4 mAb 25D2 (10 ⁇ g/ml) at 37° C for 120 h and expression of HLA- DR/DP (Q5/13), CD23 (gp25), and CD 14 (Leu-M3) was determined by indirect immunofluorescence.
- IL-13 induced changes in expression of cell surface markers were dose-dependent as shown for the modulation of CDllb, CD 18, CD16, CD32, CD64, CD23, class II MHC, CD13, and CD14 expression (Table 14).
- incubation of human monocytes with 5 pg/ml IL-13 was insufficient to induce changes in the expression of these cell surface markers, whereas 0.5 ng/ml IL-13 resulted in significant changes in phenotype, comparable to those induced by 0.5 ng/ml IL-4.
- Maximal responses were induced by 50 ng/ml IL-13, which were again in the same range as those induced by 50 ng/ml of IL-4, indicating that IL-4 and IL-13 were equally effective.
- Table 14 IL-13 Induces Changes in Cell Surface Phenotype of Monocytes in a Dose Dependent Manner.
- Monocytes were incubated with medium, IL-13 (5 pg/ml, 500 pg/ml, or 50,000 pg/ml) or IL-4 (4 U/ml, or 400 U/ml) at 37°C for 120 h and the expression of cell surface antigens was determined by indirect immunofluorescence.
- IL-10 Downregulates IL-13 Induced Class II MHC Expression on Human Monocytes
- IL-13 IL-13 induced increase in expression of these markers.
- IL-10 or IFN- ⁇ had also no observed effect on the expression of CD 14 and the IL-13 induced inhibition of CD 14 expression.
- IL-10 downregulated not only the constitutive class II expression on monocytes, but also inhibited strongly the IL-13 induced class II MHC expression. Similar data were obtained when highly purified monocytes isolated by elutriation and cultured in teflon bags were used (Table 15) Increased expression of class II MHC antigens was observed following incubation of monocytes in medium alone, which was completely prevented by IL-10. m-IL-13, h-IL-13, IL-4, and IFN- ⁇ all induced high levels of class II MHC expression which were blocked by IL-10 (Table 15). Class II MHC expression induced by IFN- ⁇ was further enhanced by IL-13. IFN- ⁇ slightly upregulated expression of B7. Taken together, these results indicate that IL-13, IL-10, and IFN- ⁇ independently modulate the expression of cell monocyte surface antigens.
- Table 15 IL-10 Inhibits Constitutive and IL-13, IL-4, and IFN- ⁇ Induced MHC Class II Expression on Human Monocytes.
- Elutriated monocytes were incubated in medium at 4°C or 37°C, mIL-13 (50 ng/ml), hIL-13 (50 ng/ml), IL-4 (400 U/ml) or IFN- ⁇ (100 U/ml) in the absence or presence of IL-10 (200 U/ml) in teflon bags for 48 h and expression of HLA-DR/DP was determined by indirect immunoflourescence.
- IFN- ⁇ , IL-4, and IL-10 are able to modulate the expression of Fc ⁇ RI (CD64), Fc ⁇ RII (CD32), and Fc ⁇ RIII (CD 16) on human monocytes.
- IFN- ⁇ and IL-10 enhanced the expression of CD64 whereas IL-4 downregulates the expression of CD64, CD32, and CD16.
- IL-10 was able to prevent the IL-4 induced downregulation in cell surface expression of all three Fc ⁇ R and that IFN- ⁇ partially restored the downregulatory effects of IL-4 on CD64 expression.
- IL-10 prevented IL-13 induced downregulation of CD64, CD32, and CD 16.
- IFN- ⁇ could partially rescue IL-13 induced downregulation of CD64, but did not affect the IL-13 induced downregulation of CD32 and CD 16.
- the level of ADCC activity of human monocytes has been shown to correlate with the expression of Fc ⁇ RI.
- the effects of IL-13 on the functional activity of Fc ⁇ RI on monocytes was determined by their ability to lyse anti-D opsonized human Rh+ erythrocytes. Both human and mouse IL-13 were able to inhibit ADCC activity of monocytes cultured in medium alone. On the other hand, ADCC activity was enhanced when monocytes were cultured in the presence of IFN- ⁇ or IL-10.
- IL-13 significantly inhibited these effects of IFN- ⁇ and IL-10 despite the fact that IFN- ⁇ and IL-10 partially or completely reversed the inhibition of Fc ⁇ RI expression, indicating that IL-13 affected the Fc ⁇ R mediated cytotoxicity also by other mechanisms.
- IL-13 Inhibits Production of Pro-inflammatory Cytokines and Hemopoietic Growth Factors But Induces IL-IRA.
- monocytes were activated by LPS and cytokine production was determined in the culture supernatants after 6 and 24 hours by cytokine specific ELISA's. Activation of monocytes by LPS resulted in the production of IL-l ⁇ , IL-l ⁇ , IL-6, IL-8, IL-10, GM-CSF, G-CSF, TNF- ⁇ , and IL-IRA.
- IL-l ⁇ , IL-l ⁇ , IL-6, IL-8, TNF- ⁇ , and IL-IRA were present at 6 h after activation, whereas the production of IL-10, G-CSF, and GM-CSF was detected at 24 h.
- IL-13, IL-4, and IL-10 inhibited the production of IL-l ⁇ , IL-l ⁇ , IL-6, IL-8, IL-10, TNF- ⁇ , G-CSF, and GM-CSF, but enhanced the production of IL-IRA.
- IL-13 affected the morphology, phenotype, function, and cytokine production of monocytes. Incubation of monocytes with IL-13 induced strong adherence of these cells to plastic substrates and their morphology changed to a dendritic appearance. In addition, homotypic aggregates of cells were observed.
- CDl lb, CDl lc, CD18, VLA- 5, and CD29 which are members of the integrin superfamiliy, is compatible with the observed aggregation and changes in morphology, since CD l ib/CD 18 and CDl lc/CD18 heterodimers are involved in cell-cell interactions, homotypic aggregation, adhesion to artificial substrates, and bind fibrinogen.
- the ⁇ 5 ⁇ l integrin VLA-5/CD29 is the receptor for fibronectin, which is an abundant extracellular matrix protein involved in adhesion processes.
- IL-13 did not induce changes in the expression of other molecules involved in adhesion or cell-cell interaction, e.g., CDl la, VLA-2, VLA3, VLA-4, VLA-6, ⁇ 3, ⁇ 4, ICAM- 1, ICAM-2, LFA-3, MEL-14, and CD44 but it remains possible that other cell surface structures are involved in the IL-13 induced changes in morphology and adherence.
- IL-13 upregulated the expression of class II MHC antigens on human monocytes.
- the expression of HLA-DR, HLA-DP, and HLA-DQ was significantly increased by IL-13.
- IL-10 inhibited constitutive and IL-4 and IFN- ⁇ induced class II MHC expression on human monocytes. IL-10 thus inhibits IL-13 induced class II MHC expression, which further supports the general immunosuppressive activities of IL-10.
- CD64 Fc ⁇ RI
- IFN- ⁇ and IL-10 IFN- ⁇ and IL-10
- IFN- ⁇ and IL-10 were able to prevent the downregulation of CD64 induced by IL-4.
- IL-13 inhibited the constitutive expression of CD64 and that this inhibition could also be prevented by IL-10 and IFN- ⁇ .
- the expression of CD64 has been shown to correlate with ADCC activity of monocytes.
- IL-13 also affected the expression of Fc ⁇ RII and Fc ⁇ RIII.
- IL-13 downregulated the expression of CD32 and CD 16 in a dose dependent manner.
- IL-10 but not IFN- ⁇ , could block the IL-13 induced downregulation of CD32 and CD16 on monocytes.
- cytokines The only cytokine known to induce the low affinity Fc receptor for IgE (CD23) on monocytes was IL-4.
- IL-13 also induced the expression of CD23 on monocytes. It was demonstrated that the IL-13 induced expression of CD23 could be partially suppressed by IFN- ⁇ . It was also shown that IL-13 could induce production of IgE by PBMC.
- IL-13 could initiate germline ⁇ transcription in purified sIgM+ B cells and switching to IgE production when a second signal provided by T cell clones, T cell membranes, or CD40 ligand was present.
- the production of IgE is regulated by number of cytokines, including soluble CD23, which have either enhancing or inhibitory effects.
- the effects of IL-13 and IFN- ⁇ on the expression of CD23 by human monocytes fit well within this concept.
- IL-4 and IL-13 are two cytokines secreted by activated T cells which have similar effects on monocytes and B cells.
- a mutant form of human interleukin-4 (hIL-4) competitively antagonizes both hlL- 4 and human interleukin- 13 (hIL-13).
- the amino acid sequences of IL-4 and IL-13 are about 30% homologous and circular dichroism spectroscopy (CD) shows that both proteins have a highly ⁇ -helical structure.
- IL-13 competitively inhibits hIL-4-binding to functional human IL-4 receptors (called hIL-4R) expressed on a hIL-4- responsive cell line, but not to the cloned IL-4R ligand-binding protein expressed on heterologous cells.
- hIL-4 has about a 50-fold lower affinity for the IL-4R ligand-binding protein than for the functional IL-4R, while the mutant hIL-4 antagonist protein binds to both receptor types with the lower affinity.
- the above results demonstrate that IL-4 and IL-13 share a receptor component that is important for signal transduction.
- IL-4R is a complex of at least two components one of which is a novel affinity-converting subunit that is critical for cellular signal transduction.
- IL-13 is one of a number of protein hormones called cytokines that are secreted by activated T cells.
- Human IL-13 elicits morphological and cell-surface phenotype changes on human monocytes and also facilitates growth and immunoglobulin (Ig) production by human B cells. All these biological effects are also elicited by hIL-4, another protein hormone secreted by activated T cells.
- IL-4 The biological actions of IL-4 are mediated by a cell surface receptor that binds IL-4 with high specificity and affinity.
- Kd Binding constant
- Human and mouse IL-4R have been characterized by cDNA cloning which defined a 130 kDa glycoprotein (herein referred to as IL-4R ligand-binding protein) with a single transmembrane span.
- IL-4R ligand-binding protein The extracellular domain sequence of IL-4R ligand-binding protein is structurally homologous to the extracellular domains of other cytokine receptor proteins.
- IL-4 interleukin-2
- M-CSF Macrophage Colony-Simulating Factor
- GM-CSF Granulocyte Macrophage Colony-Stimulating Factor
- hIL-4 residues El 14, K117, and Y124 were selected as those most likely to be specifically involved in receptor activation. Substitution mutagenesis at these positions used a synthetically reconstructed hIL-4 coding region inserted in the pTacRBS Escherichia coli expression plasmid [Zurawski et al, J. Immunol. 137:3354 (1986)].
- Double-stranded synthetic oligonucleotides (synthesizer and reagents, Applied Biosystems) corresponding to the sequence between Sail and Hindlll ⁇ ecognition sites in the C-terminal coding region and containing equimolar amounts of each deoxynucleotide at the codon selected for randomized substitution were ligated to Sail and Hi ndlll digested pTac-hIL-4 plasmid.
- Recombinant plasmids were recovered by transformation and the DNA sequence (Sequenase 2.0 kit, US Biochemical Corp.) of their S ⁇ /1-H ⁇ ndIII intervals were determined.
- Partially pure mutant ML-4 proteins were prepared as described for mIL-2 proteins [Zurawski et al, EMBO J. 5:2583 (1989)], except that the refolding buffer contained reduced and oxidized glutathione, and assayed using TF-1 cells. It was found that substitutions at Y124 resulted in proteins that were partial agonists and that the Y124D substitution had the most drastic defect in cellular activation. During the course of this work similar observations were made by Kruse et al, supra, who also showed that hIL-4.Y124D and hIL-4 have similar affinities for hIL-4R.
- the pTrpCl l-hIL-4 E. coli expression plasmid was subjected to PCR (Geneamp kit, Perkin Elmer Cetus) using the oligonucleotides: CTCCAAGAACACAACTGAGAAGGAAACCTT (proximal to the single Pstl restriction site in the coding region) and TTGATTAAGCTTTCAGCTCGAACACTTTGAATCTTTCTC (a HmdIII recognition site precedes the underlined part which corresponds to the C-terminal coding region containing a GAT codon for residue 124).
- PCR product and pTrpCl l-hIL-4 plasmid were cleaved with Pstl and HmdIII, ligated, and pTrpCl l-hIL-4Y124D plasmid was recovered and validated by transformation and sequence analysis using previously described methods [Zurawski et al, EMBO J. 5:2583 (1989)]. Corresponding changes in hIL-13 at those positions should also have IL-13 antagonistic effects.
- E. c ⁇ /i ' -derived hIL-4 [van Kimmenade et al, Eur. J. Biochem. 775:109 (1988)], human interleukin- l ⁇ (hIL-l ⁇ ; Kronheim et al, BiolTechnology 4:1078 (1986), and mIL-13 were purified as described above.
- WL-4Y124D was prepared from E. coli K12 cells (strain CQ21) harboring the pTrpCl l-hIL-4.Y142D plasmid grown overnight at 37°C in 12 liters of L-Broth containing 50 ⁇ g/ml ampicillin in a G 53 rotatory shaker (New Brunswick Scientific) at 200 rpm.
- the cells were harvested by centrifugation in a RC-3 centrifuge (all rotors Sorvall) at 4,500 rpm, 10 min, 4°C. The pellets were resuspended in 450 ml of TE buffer (50 mM Tris- ⁇ Cl p ⁇ 8, 1 mM EDTA) by shaking at 200 rpm for 15 min. Cells were ruptured by 4 passes through an ice-cooled Microfluidizer model 110 cell disrupter (Microfluidics).
- Inclusion bodies were collected by centrifugation in a GS-3 rotor at 9,000 rpm, 40 min, 4°C. The pellet was then washed by resuspension in 450 ml of TE and Triton X-100 was added to a final concentration of 0.5%. Samples were kept at room temperature for 30 min and were then pelleted in a GSA rotor at 8,500 rpm, 10 min, 4° C.
- the inclusion bodies were resuspended in 60 ml 5 M guanidine- ⁇ Cl in PBS (120 mM NaCl, 2.7 mM KC1, 10 mM NaPi p ⁇ 7.4), 2 mM reduced glutathione, 0.2 mM oxidized glutathione and any remaining insoluble material was removed by centrifugation in a SS-34 rotor at 20,000 rpm, 30 min, 4°C.
- the supernatant was diluted 10-fold into the same buffer without guanidine hydrochloride and stirred gently overnight at 4°C to permit refolding and oxidization.
- Concentration and exchange into 100 ml 50 mM Na Acetate pH 5.0 was then performed using a Millipore Pellicon apparatus (Millipore) equipped with a tangential flow ultrafiltration cassette with a size exclusion of 10 kDa.
- the sample was subjected to anion exchange chromatography (CM sepharose 16/100 column, Pharmacia) in the same buffer with elution via a 0-0.7 M NaCl gradient.
- Fractions containing hIL-4 protein were pooled and subjected to reverse phase chromatography (Poros R 10/100 column, Perseptive Biosystems) with elution via a gradient of 0-50% acetonitrile in 0.1% trifluoroacetic acid/water.
- Fractions containing hIL-4 were lyophilized, dissolved in 50 mM Na Acetate pH 5.0, and quantified by densitometry (Molecular Dynamics) of stained SDS-PAGE with chicken egg lysozyme (Sigma) as a standard.
- Colorimetric cell proliferation assays used the human TF-1 cell line at 30,000 cells per well for 3 days and were performed as described by Mosmann, /. Immunol. Methods 65:55 (1983). Cells were assayed in RPMI medium with L-glutamine and 10% fetal bovine serum (JRH Biosciences), 0.5 mM ⁇ -mercaptoethanol (Sigma). Cells were maintained in the above medium containing 1 nM hGM- CSF (Schering-Plough).
- PHA blasts were prepared by incubation of 10" peripheral blood mononuclear cells per ml with 0.1 mg/ml phytohaemagglutinin (Wellcome Diagnostics) in Yssel's medium [see Yssel et al, J. Immunol. Methods 72:219 (1984)], supplemented with 1% human AB+ serum in 24-well Linbro plates (Flow Laboratories) and were used in the proliferative assay after six days of incubation.
- SP-B21 is a CD4+ cloned T cell line with unknown antigen specificity and was cultured as previously described [Spits et al, J. Immunol 725:95 (1982)]. Proliferative responses of both PHA blasts and SP-B21 cells were determined at 5 x 10 4 cells per well and were performed and developed colorimetrically after three days as described for TF-1 cells.
- hIL-4, hIL-l ⁇ , and mIL-13 proteins were examined on a J720 spectrophotometer with the 450 W xenon lamp and J700 data analysis software (Jasco).
- the samples were dialyzed against 20 mM NaPi, pH 7. Protein concentrations of the samples were re-determined by UV absorption scanning on a Lambda 6 spectrophotometer (Perkin-Elmer). The absorption maximum at 280 nm was used to calculate the amount of protein using theoretical extinction coefficients based on known molecular weights and expected residue absorption contributions. Samples were diluted to 0.2 mg/ml in a 0.2 mm path length cell.
- Typical scan parameters for the near UV range were a continuous wavelength scan at 10 mdeg sensitivity, 0.1 nm step resolution at a scan speed of 50 nm/min with a time constant of 2 s. Four accumulations/scan were averaged for an increased signal to noise ratio. Phosphate buffer blanks were run and subtracted out from subsequent protein scans and the spectra were noise-reduced using J700 data analysis software.
- hIL-4.Y124D was a competitive antagonist of the action of native hIL-4 on TF-1 cells.
- TF-1 is a human pre-myeloid erythroleukemic cell line that shows a growth response to various human protein hormones, such as GM-CSF, interleukin-3 (IL-3), interleukin-6 (IL-6), IL-4, and both human and mouse IL-13.
- GM-CSF interleukin-3
- IL-6 interleukin-6
- IL-4 interleukin-4
- IL-13 both human and mouse IL-13.
- the maximal responses of TF-1 cells to these factors varies widely, but the maximal biological responses of IL-4 and IL-13 are similar.
- WL-4.Y124D had no effect on the TF-1 responses to GM-CSF, IL-3, or IL-6.
- ML-4.Y124D was a potent antagonist of both mIL-13 and hIL-13 action on TF ⁇ t cells.
- WL-4.Y124D was equipotent against hIL-4, mIL-13, and hIL-13 activities on TF-1 cells and inhibited in a dose-dependent manner.
- WL-4.Y124D antagonizes hIL-4 via competitive inhibition of hIL-4 binding to IL-4R, a similar mechanism was hypothesized for its action against IL-13. Such a mode of WL-4.Y124D action against IL-13 would imply commonalty between IL-4R and IL-13R. This was tested by comparing the abilities of hIL-4 and mIL-13 to competitively displace 125i-hIL-4 binding to TF-1 cells. hIL-4 fully competed 12 5l-hIL-4 binding to TF-1 cells with the concentration required for 50% inhibition (or IC50) ⁇ 2 x 10"1 M. mIL-13 also competed 125i-hIL-4 binding.
- IL-4R and IL-13R A possible basis for the commonalty between IL-4R and IL-13R is that they are the same. This was tested by comparing the abilities of hIL-4 and mIL-13 to competitively displace l!25 -hIL-4 binding to a derivative of the cloned hIL-4R ligand-binding protein expressed on mouse pro-B Ba/F3 cells. Ba/F3 hIL-4R-S cells were used, which have a large number of binding sites/cell ( ⁇ 2000) in the form of a hIL-4R ligand-binding protein deleted for most of the cytoplasmic domain. See Harada et al, J. Biol. Chem. 267:22752 (1992). Although hIL-4 fully competed 125 I-hIL-4 binding to
- IL-13 The earliest characterizations of the biological activities of IL-13 have shown concordance between cellular responses to IL-4 and IL-13, as described herein.
- Human peripheral blood mononuclear cells PBMNC activated with phytohaemagglutinin (PHA) and certain human T cell cloned cell lines such as SP-B21 proliferate in response to hIL-4. Both these hIL-4-responsive cell types did not proliferate in response to hIL-13.
- WL-4.Y124D bound equally to both TF-1 and Ba/F3 hIL-4R-S cells.
- hIL-4.Y124D was used as the labelled ligand and the results were analogous
- IL-4 and IL-13 are Structural Homologues
- IL-4 and IL-13 Extensive insertion/deletion differences between IL-4 and IL-13 were, with one exception, confined to loops that connect the four ⁇ -helices or two short ⁇ -strands. The exception was a shortened ⁇ -helix C, although all the ⁇ -helix C residues that contribute to the structural core were retained in IL-13.
- Mouse IL-13 unlike the ⁇ -stranded hIL-l ⁇ , had a CD absorption spectrum characteristic of a highly ⁇ -helical protein such as hIL-4 [see Johnson, Ann. Rev. Biophys. Chem. 17:146 (1988)].
- IL-13 and IL-4 Receptors are Functionally Related
- IL-4R and IL-13R are different entities. This does not exclude the possibility that IL-13 is a weak partial agonist of IL-4 and that only a subset of IL-4R-bearing cells can efficiently amplify signals generated by IL-13 binding to IL-4R. Three lines of evidence helped in resolving the conundrum involving IL-4R and IL-13R.
- IL-13 failed to compete for ll25_hiL_4 binding to cells bearing only the hIL-4R ligand-binding protein. This result demonstrated that the hIL-4R ligand-binding protein is, itself, not the IL-13R.
- two T cell types responded to hIL-4, but not to hIL-13. If hIL-13 is a partial agonist acting via hIL-4R, then hIL-13 should competitively antagonize the action of hIL-4 on these cells. This is not the case in one hIL-4-responsive T-cell system that has been tested.
- hIL-13 is a partial agonist acting via hIL-4R
- hIL-13 should be capable of fully competing hIL-4 binding to all cell types bearing hIL-4R.
- IL-13 only partially competed for binding of 1 5 ⁇ _ iL-4 to TF-1 cells.
- IL-4R Contains an Additional Subunit(s) that Enhances Affinity. Helps Transduce the Signal, and is Shared ⁇ with IL-13R
- IL-4R on TF-1 cells are a complex between the IL-4R ligand-binding protein and an additional component (or components) that enhances the affinity of the IL-4R ligand-binding protein for IL-4.
- This additional component(s) also associates with an IL-13 ligand-binding protein present only on a subset of IL-4- responsive cells to form IL-13R.
- interaction of hIL-4 Tyrl24 residue with this component is essential for productive signal transduction.
- hIL-4.Y124D which fails to elicit this productive signal transduction, maintains an association between the IL-4 ligand-binding protein and this additional component(s).
- ML-4.Y124D antagonizes hIL-4 action by competing for IL-4 binding sites, but antagonizes IL-13 action by sequestering the additional component(s) from the IL-13R complex by forming a non ⁇ productive hIL-4R/hIL-4.Y124D complex.
- hIL-4.Y124D labelled with the Bolton-Hunter reagent bound about 3-fold less efficiently than hIL-4. It is possible that hIL-4.Y124iodoTyr has a reduced affinity for functional IL-4R and that affinity constants derived using this reagent in direct-binding experiments have underestimated the actual affinity of IL-4R for IL-4. This was not an issue in the experiments which used hIL-4.Y124iodoTyr as the labelled-ligand and native hIL-4 as a 'cold' competitor. A second factor that may have hindered the discovery of two affinity states for IL-4R is that the difference between the two affinities is only -50-fold.
- hIL-4R subunit-specific defect of hIL-4.Y124D is a powerful new reagent for dissection of hIL-4R complexity.
- IL-4-responsive cell types vary in IL-4R composition
- Other direct tests of this model will require molecular characterization of the IL-13R ligand binding protein by binding analyses, cross-linking studies, and cloning.
- the reagents to permit direct characterization of IL-13R have not yet been developed.
- the very low affinity (Kd - 3 x l0 "8 M) IL-4-binding sites that have been detected on human lymphocytes may be a property of an additional IL-4R component.
- This shared ⁇ c receptor subunit accounts for the observed cross-competition of IL-3, IL-5, and GM-CSF binding to certain cell types.
- hIL-4.Y124D did not antagonize the biological activities of hIL-6, mouse leukemia inhibitory factor, hIL-3, or hGM-CSF, and neither hIL-6 or hGM-CSF competed for hIL-4 binding. Therefore, gpl30 or the ⁇ c protein are not likely candidates for the additional IL-4R component, nor the component shared between IL-4R and IL-13R.
- IL-4, IL-3, IL-5, and GM-CSF form a protein family. See Boulay et al, J. Biol Chem. 267:20525 (1992).
- the biological data regarding commonalty between IL-4 and IL-13 show that IL-13 also belongs to this family.
- the available data support a clear functional separation between the receptors for IL-4/IL-13 and IL-3/IL-5/GM-CSF. For example, no effects of HL-4.Y124D on IL-3 or GM-CSF responses on TF-1 were noted.
- TF-1 cells the pattern of intracellular tyrosine-phosphorylation that is elicited by IL-3/GM-CSF is different from that elicited by IL-4.
- hIL-4.Y124D is not a specific antagonist of hIL-4 action.
- Inhibitory IL-4 variants have been suggested as potentially useful drugs in the treatment of IgE-mediated diseases. The possibility exists for antagonizing both hIL-4 and hIL-13 responses by hIL-4.Y124D treatment for various disease states.
- IL-13 variants that are antagonists. These results also predict that such IL-13 antagonists will be effective antagonists against IL-4- responses on cell types that also respond to IL-13.
- IL-4 antagonists like Y124 also effectively inhibited the proliferation of purified human B cells stimulated by anti ⁇ CD40 mAbs in the presence of either IL-4 or IL-13.
- IL-13 antagonists may have similar effects.
- administration of IL-4 and IL-13 antagonists may provide the preferred mehtod not only to inhibit IgE synthesis, but also to prevent the expansion of IgE producing cells.
- Rat polyclonal antiserum was raised against E. c ⁇ /i ' -derived human IL-13 by standard procedures. See, e.g., Harlow & Lane (1989) or Coligan (1991 and supplements). Serum from these rats was useful in immunoprecipitating 35 s-methionine labelled supernatants of C0S7 cells expressing IL-13.
- Monoclonal antibodies against hIL-13 were produced using standard methods. Rats were immunized with E. c ⁇ /i ' -produced hIL-13. The neutralizing capability of four different monoclonal antibodies were tested on TF-1 cells stimulated with COS -produced hIL-13 or E. c ⁇ /i ' -produced hIL-13. The TF-1 cells (5,000 cells/well) were incubated for 72 hours with 1:100 dilution of COS-produced hIL-13 or 5 ng/ml E. co //-produced hIL-13, with dilutions for supernatants containing rat anti-hIL-13 Monoclonal antibody. After 72 hours, cell viability was determined by alamar blue staining.
- GCTACCTCAC TGTAGCCTCC AGGTCTCACC CCAGGCAGGA GATGGGAGGG GAGGCCAGAG 972
- Human IL-13 having an amino acid sequence defined by SEQ ID NO: 2.
- a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an effective amount of human IL-13 having an amino acid sequence defined by SBQIDNQ2.
- a method for making a pharmaceutical composition comprising admixing a pharmaceutically acceptable carrier and an effective amount of human IL-13 having an amino acid sequence defined by SEQ ID NO: 2.
- An antibody preferably a monoclonal antibody, against human DL-13 having an amino acid sequence defined by SEQ ID NO:
- a pharmaceutical composition for inhibiting antibody isotype switching to IgE or IgG4 comprising a pharmaceutically acceptable carrier and an effective amount of an antagonist of IL-13.
- a method for making a pharmaceutical composition for inhibiting antibody isotype switching to IgE or IgG4 comprising admixing a pharmaceutically acceptable carrier and an effective amount of an antagonist of IL-13.
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP6506436A JPH07508179A (en) | 1992-08-21 | 1993-08-18 | human interleukin-13 |
EP93920049A EP0656947A1 (en) | 1992-08-21 | 1993-08-18 | Human interleukin-13 |
AU50107/93A AU5010793A (en) | 1992-08-21 | 1993-08-18 | Human interleukin-13 |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US93341692A | 1992-08-21 | 1992-08-21 | |
US07/933,416 | 1992-08-21 | ||
US1097793A | 1993-01-29 | 1993-01-29 | |
US08/010,977 | 1993-01-29 | ||
US08/012,543 | 1993-02-01 | ||
US08/012,543 US5596072A (en) | 1992-08-21 | 1993-02-01 | Method of refolding human IL-13 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1994004680A1 true WO1994004680A1 (en) | 1994-03-03 |
WO1994004680A9 WO1994004680A9 (en) | 1994-05-11 |
Family
ID=27359336
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1993/007645 WO1994004680A1 (en) | 1992-08-21 | 1993-08-18 | Human interleukin-13 |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP0656947A1 (en) |
JP (1) | JPH07508179A (en) |
AU (1) | AU5010793A (en) |
CA (1) | CA2142860A1 (en) |
IL (1) | IL106732A0 (en) |
WO (1) | WO1994004680A1 (en) |
Cited By (37)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996029417A1 (en) * | 1995-03-15 | 1996-09-26 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Il-13 receptor specific chimeric proteins and uses thereof |
US5710023A (en) * | 1996-03-01 | 1998-01-20 | Genetics Institute, Inc. | IL-13 cytokine receptor chain |
WO1998010638A1 (en) * | 1996-09-10 | 1998-03-19 | Amrad Operations Pty. Ltd. | Therapeutic molecules |
EP0831889A1 (en) * | 1995-05-19 | 1998-04-01 | Emory University | Use of il-13 to induce 15-lipoxygenase |
WO1998026061A3 (en) * | 1996-12-09 | 1998-11-19 | Univ California | Expression vectors containing accessory molecule ligand genes and their use for immunomodulation and treatment of malignancies and autoimmune disease |
WO1999006059A2 (en) * | 1997-07-30 | 1999-02-11 | Board Of Regents, The University Of Texas System | Methods and compositions relating to no-mediated cytotoxicity |
US6171856B1 (en) | 1997-07-30 | 2001-01-09 | Board Of Regents, The University Of Texas System | Methods and compositions relating to no-mediated cytotoxicity |
WO2001062933A2 (en) * | 2000-02-22 | 2001-08-30 | Royal Brompton And Harefield Nhs Trust | Muteins of interleukin-13 (il-13) |
WO2002055100A2 (en) * | 2000-10-20 | 2002-07-18 | Genetics Institute, Llc | Method and composition for inhibition of tumor growth and enhancing an immune response |
US6428788B1 (en) | 1995-03-15 | 2002-08-06 | Penn State University | Compositions and methods for specifically targeting tumors |
US6518061B1 (en) | 1995-03-15 | 2003-02-11 | The United States Of America As Represented By The Department Of Health And Human Services | IL-13 receptor specific chimeric proteins and uses thereof |
WO2004064860A1 (en) * | 2003-01-17 | 2004-08-05 | Children's Hospital Medical Center | Use of tff2, or agents inducing tff2, in the therapy of allergies |
GB2403952A (en) * | 2003-07-15 | 2005-01-19 | Cambridge Antibody Tech | IL-13 binding molecules |
US7026139B2 (en) * | 1998-05-29 | 2006-04-11 | Heska Corporation | Canine IL-13 nucleic acid molecules and fragments thereof |
US7078494B1 (en) | 1996-03-01 | 2006-07-18 | Genetics Institute, Llc | Antibodies to human IL-13bc and methods of their use in inhibiting IL-13 binding |
WO2006055638A3 (en) * | 2004-11-17 | 2006-08-24 | Abgenix Inc | Fully human monoclonal antibodies to il-13 |
USRE39614E1 (en) | 1998-05-29 | 2007-05-08 | Heska Corporation | Canine IL-4 immunoregulatory proteins and uses thereof |
EP1881075A1 (en) | 1994-05-09 | 2008-01-23 | Oxford Biomedica (UK) Limited | Retroviral vectors having a reduced recombination rate |
USRE40374E1 (en) | 1998-05-29 | 2008-06-10 | Heska Corporation | Canine IL-13 immunoregulatory proteins and uses thereof |
US7501121B2 (en) | 2004-06-17 | 2009-03-10 | Wyeth | IL-13 binding agents |
US7507706B1 (en) | 1998-12-14 | 2009-03-24 | Genetics Institute, Llc | Cytokine receptor chain |
US7553487B2 (en) | 1998-12-14 | 2009-06-30 | Genetics Institute, Llc | Method and compositions for treating asthma |
US7615213B2 (en) | 2004-06-09 | 2009-11-10 | Wyeth | Antibodies against human interleukin-13 and pharmaceutical compositions thereof |
EP2123674A1 (en) | 1999-04-28 | 2009-11-25 | Genetics Institute, LLC | Treatment of fibrosis by antagonism of IL-13 and/or IL-13 receptor |
US7674459B2 (en) | 2003-12-23 | 2010-03-09 | Genentech, Inc. | Treatment of cancer with a novel anti-IL13 monoclonal antibody |
US7910708B2 (en) | 2005-10-21 | 2011-03-22 | Novartis Ag | Anti-IL13 human antibodies |
US7928213B2 (en) | 2002-05-23 | 2011-04-19 | The Regents Of The University Of California | Nucleic acids encoding chimeric CD154 polypeptides |
US7964712B2 (en) | 2001-12-06 | 2011-06-21 | The Regents Of The University Of California | Chimeric nucleic acids encoding polypeptides comprising TNF alpha, CD70 and FAS ligand domains |
US8486693B2 (en) | 2006-05-23 | 2013-07-16 | Bellicum Pharmaceuticals, Inc. | Modified dendritic cells having enhanced survival and immunogenicity and related compositions and methods |
NO20160707A1 (en) * | 2003-07-15 | 2016-04-27 | Cambridge Antibody Tech Ltd | Human antibody molecules from IL-13 |
US9512194B2 (en) | 2012-01-27 | 2016-12-06 | The Board Of Trustees Of The Leland Stanford Junior University | Modified IL-13 polypeptides |
US9592293B2 (en) | 2006-09-08 | 2017-03-14 | Abbvie Inc. | Interleukin-13 binding proteins |
US9684000B2 (en) | 2010-12-16 | 2017-06-20 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
US9920120B2 (en) | 2013-09-13 | 2018-03-20 | Genentech, Inc. | Methods and compositions comprising purified recombinant polypeptides |
US9945858B2 (en) | 2013-09-13 | 2018-04-17 | Genentech, Inc. | Compositions and methods for detecting and quantifying host cells protein in cell lines and recombinant polypeptide products |
US11312757B2 (en) | 2019-04-19 | 2022-04-26 | Synerkine Pharma B.V. | Fusion protein comprising IL13 |
US11352402B2 (en) | 2013-09-24 | 2022-06-07 | Medicenna Therapeutics, Inc. | Interleukin-4 receptor-binding fusion proteins and uses thereof |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000039580A1 (en) * | 1998-12-23 | 2000-07-06 | University Of Sydney | An assay to detect a binding partner |
US20030013851A1 (en) * | 2001-06-07 | 2003-01-16 | Robert Powers | Solution structure of IL-13 and uses thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0506574A1 (en) * | 1991-03-29 | 1992-09-30 | Sanofi | Protein having cytokin type activity, recombinant DNA coding for this protein, transformed cells and microorganisms |
-
1993
- 1993-08-18 CA CA002142860A patent/CA2142860A1/en not_active Abandoned
- 1993-08-18 WO PCT/US1993/007645 patent/WO1994004680A1/en not_active Application Discontinuation
- 1993-08-18 AU AU50107/93A patent/AU5010793A/en not_active Abandoned
- 1993-08-18 EP EP93920049A patent/EP0656947A1/en not_active Withdrawn
- 1993-08-18 JP JP6506436A patent/JPH07508179A/en active Pending
- 1993-08-19 IL IL106732A patent/IL106732A0/en unknown
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0506574A1 (en) * | 1991-03-29 | 1992-09-30 | Sanofi | Protein having cytokin type activity, recombinant DNA coding for this protein, transformed cells and microorganisms |
Non-Patent Citations (4)
Title |
---|
A.N.J. MCKENZIE ET AL: "Interleukin 13 , a T-cell-derived cytokine that regulates human monocyte and B-cell function", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 90, April 1993 (1993-04-01), WASHINGTON US, pages 3735 - 3739, XP002948382, DOI: doi:10.1073/pnas.90.8.3735 * |
J. PUNNONEN ET AL: "Interleukin 13 induces Interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 90, April 1993 (1993-04-01), WASHINGTON US, pages 3730 - 3734 * |
K. D. BROWN ET AL: "a family of small inducible proteins secreted by leukocytes are members of a new super family that includes leukocyte and fibroblast-derived inflammatory agents, growth factors and indicators of various activation processes", JOURNAL OF IMMUNOLOGY, vol. 142, no. 2, 15 January 1989 (1989-01-15), BALTIMORE US, pages 679 - 687 * |
S. M. ZURAWSKI ET AL: "Receptors for Interleukin-13 and Interleukin-4 are complex and share a novel component that functions in signal transduction", EMBO JOURNAL, vol. 12, no. 7, July 1993 (1993-07-01), EYNSHAM, OXFORD GB, pages 2663 - 2670, XP002011860 * |
Cited By (97)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1881075A1 (en) | 1994-05-09 | 2008-01-23 | Oxford Biomedica (UK) Limited | Retroviral vectors having a reduced recombination rate |
WO1996029417A1 (en) * | 1995-03-15 | 1996-09-26 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Il-13 receptor specific chimeric proteins and uses thereof |
US5614191A (en) * | 1995-03-15 | 1997-03-25 | The United States Of America As Represented By The Department Of Health And Human Services | IL-13 receptor specific chimeric proteins and uses thereof |
US6518061B1 (en) | 1995-03-15 | 2003-02-11 | The United States Of America As Represented By The Department Of Health And Human Services | IL-13 receptor specific chimeric proteins and uses thereof |
US6428788B1 (en) | 1995-03-15 | 2002-08-06 | Penn State University | Compositions and methods for specifically targeting tumors |
US5919456A (en) * | 1995-03-15 | 1999-07-06 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | IL-13 receptor specific chimeric proteins |
EP0831889A4 (en) * | 1995-05-19 | 2000-09-27 | Univ Emory | Use of il-13 to induce 15-lipoxygenase |
EP0831889A1 (en) * | 1995-05-19 | 1998-04-01 | Emory University | Use of il-13 to induce 15-lipoxygenase |
US5830453A (en) * | 1995-05-19 | 1998-11-03 | Emory University | Use of IL-13 to induce 15-lipoxygenase |
US7674591B2 (en) | 1996-03-01 | 2010-03-09 | Genetics Institute, Llc | Methods of using antibodies to human IL-13bc for inhibiting IL-13 binding |
US7078494B1 (en) | 1996-03-01 | 2006-07-18 | Genetics Institute, Llc | Antibodies to human IL-13bc and methods of their use in inhibiting IL-13 binding |
US6248714B1 (en) | 1996-03-01 | 2001-06-19 | Genetics Institute, Inc. | Methods of inhibiting binding and treating Ig-mediated responses with IL-13 receptor |
US6268480B1 (en) | 1996-03-01 | 2001-07-31 | Genetics Institute, Inc. | IL-13 Receptor chain |
US5710023A (en) * | 1996-03-01 | 1998-01-20 | Genetics Institute, Inc. | IL-13 cytokine receptor chain |
WO1998010638A1 (en) * | 1996-09-10 | 1998-03-19 | Amrad Operations Pty. Ltd. | Therapeutic molecules |
EP1806360A3 (en) * | 1996-12-09 | 2007-12-12 | University Of California | Novel expression vectors containing accessory molecule ligand genes and their use for immunomodulation and treatment of malignancies and autoimmune disease |
US7070771B1 (en) | 1996-12-09 | 2006-07-04 | Regents Of The University Of California | Methods of expressing chimeric mouse and human CD40 ligand in human CD40+ cells |
US7906638B2 (en) | 1996-12-09 | 2011-03-15 | Regents Of The University Of California | Chimeric nucleic acids encoding polypeptides comprising CD70 and Fas ligand domains |
US7524944B2 (en) | 1996-12-09 | 2009-04-28 | Regents Of The University Of California | Chimeric nucleic acids encoding polypeptides comprising CD154 and TNF-α |
WO1998026061A3 (en) * | 1996-12-09 | 1998-11-19 | Univ California | Expression vectors containing accessory molecule ligand genes and their use for immunomodulation and treatment of malignancies and autoimmune disease |
EP2145958A1 (en) * | 1996-12-09 | 2010-01-20 | The Regents Of The University Of California | Novel expression vectors containing accessory molecule ligand genes and their use for immunomodulation and treatment of malignancies and autoimmune disease |
EP1806360A2 (en) * | 1996-12-09 | 2007-07-11 | University Of California | Novel expression vectors containing accessory molecule ligand genes and their use for immunomodulation and treatment of malignancies and autoimmune disease |
WO1999006059A2 (en) * | 1997-07-30 | 1999-02-11 | Board Of Regents, The University Of Texas System | Methods and compositions relating to no-mediated cytotoxicity |
US6171856B1 (en) | 1997-07-30 | 2001-01-09 | Board Of Regents, The University Of Texas System | Methods and compositions relating to no-mediated cytotoxicity |
WO1999006059A3 (en) * | 1997-07-30 | 1999-08-05 | Univ Texas | Methods and compositions relating to no-mediated cytotoxicity |
US7629441B2 (en) | 1998-05-29 | 2009-12-08 | Heska Corporation | Feline interferon-alpha proteins |
US7026139B2 (en) * | 1998-05-29 | 2006-04-11 | Heska Corporation | Canine IL-13 nucleic acid molecules and fragments thereof |
USRE40374E1 (en) | 1998-05-29 | 2008-06-10 | Heska Corporation | Canine IL-13 immunoregulatory proteins and uses thereof |
USRE39614E1 (en) | 1998-05-29 | 2007-05-08 | Heska Corporation | Canine IL-4 immunoregulatory proteins and uses thereof |
US8263559B2 (en) | 1998-05-29 | 2012-09-11 | Heska Corporation | Feline granulocyte macrophage colony stimulating factor proteins |
US7507706B1 (en) | 1998-12-14 | 2009-03-24 | Genetics Institute, Llc | Cytokine receptor chain |
US7553487B2 (en) | 1998-12-14 | 2009-06-30 | Genetics Institute, Llc | Method and compositions for treating asthma |
EP2123674A1 (en) | 1999-04-28 | 2009-11-25 | Genetics Institute, LLC | Treatment of fibrosis by antagonism of IL-13 and/or IL-13 receptor |
WO2001062933A2 (en) * | 2000-02-22 | 2001-08-30 | Royal Brompton And Harefield Nhs Trust | Muteins of interleukin-13 (il-13) |
WO2001062933A3 (en) * | 2000-02-22 | 2001-12-20 | Royal Brompton And Harefield N | Muteins of interleukin-13 (il-13) |
WO2002055100A3 (en) * | 2000-10-20 | 2003-03-27 | Inst Genetics Llc | Method and composition for inhibition of tumor growth and enhancing an immune response |
WO2002055100A2 (en) * | 2000-10-20 | 2002-07-18 | Genetics Institute, Llc | Method and composition for inhibition of tumor growth and enhancing an immune response |
EP2027867A1 (en) * | 2000-10-20 | 2009-02-25 | Genetics Institute, LLC | Method and composition for inhibition of tumor growth and enhancing an immune response |
US7964712B2 (en) | 2001-12-06 | 2011-06-21 | The Regents Of The University Of California | Chimeric nucleic acids encoding polypeptides comprising TNF alpha, CD70 and FAS ligand domains |
US8138310B2 (en) | 2002-05-23 | 2012-03-20 | The Regents Of The University Of California | Chimeric CD154 polypeptides |
US7928213B2 (en) | 2002-05-23 | 2011-04-19 | The Regents Of The University Of California | Nucleic acids encoding chimeric CD154 polypeptides |
WO2004064860A1 (en) * | 2003-01-17 | 2004-08-05 | Children's Hospital Medical Center | Use of tff2, or agents inducing tff2, in the therapy of allergies |
US7935343B2 (en) | 2003-07-15 | 2011-05-03 | Medimmune Limited | Human antibody molecules for IL-13 |
WO2005007699A3 (en) * | 2003-07-15 | 2005-05-12 | Cambridge Antibody Tech | Human antibody molecules for il-13 |
NO342727B1 (en) * | 2003-07-15 | 2018-07-30 | Cambridge Antibody Tech Ltd | Isolated specific antibody molecule against human IL-13, composition containing them, methods of preparation and use, as well as isolated nucleic acid and host cell. |
US7829090B2 (en) | 2003-07-15 | 2010-11-09 | Medimmune Limited | Human antibody molecules for IL-13 |
US9856317B2 (en) | 2003-07-15 | 2018-01-02 | Medimmune Limited | Human antibody molecules for IL-13 |
NO338853B1 (en) * | 2003-07-15 | 2016-10-24 | Cambridge Antibody Tech Ltd | Isolated specific binding member for human IL-13, isolated antibody VH and VL domain, composition containing them and methods for their preparation and use, and isolated nucleic acid and host cell. |
EP3064510A1 (en) * | 2003-07-15 | 2016-09-07 | Medimmune Limited | Neutralizing human antibody molecules for il-13 |
NO20160707A1 (en) * | 2003-07-15 | 2016-04-27 | Cambridge Antibody Tech Ltd | Human antibody molecules from IL-13 |
US9315575B2 (en) | 2003-07-15 | 2016-04-19 | Medimmune Limited | Methods of treatment using human antibody molecules for IL-13 |
US7947273B2 (en) | 2003-07-15 | 2011-05-24 | Medimmune Limited | Human antibody molecules for IL-13 |
GB2403952B (en) * | 2003-07-15 | 2005-09-21 | Cambridge Antibody Tech | Human antibody molecules for IL-13 |
EP2314624A3 (en) * | 2003-07-15 | 2011-06-29 | MedImmune Limited | Human antibody molecules for IL-13 |
GB2403952A (en) * | 2003-07-15 | 2005-01-19 | Cambridge Antibody Tech | IL-13 binding molecules |
US8067199B2 (en) | 2003-12-23 | 2011-11-29 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
US11434287B2 (en) | 2003-12-23 | 2022-09-06 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
US8318160B2 (en) | 2003-12-23 | 2012-11-27 | Genentech, Inc. | Treatment of cancer with novel anti-IL13 monoclonal antibodies |
US7674459B2 (en) | 2003-12-23 | 2010-03-09 | Genentech, Inc. | Treatment of cancer with a novel anti-IL13 monoclonal antibody |
US9605065B2 (en) | 2003-12-23 | 2017-03-28 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
US8734797B2 (en) | 2003-12-23 | 2014-05-27 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
US8734801B2 (en) | 2003-12-23 | 2014-05-27 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
US8088618B2 (en) | 2003-12-23 | 2012-01-03 | Genentech, Inc. | Anti-IL 13 antibodies and uses thereof |
US9067994B2 (en) | 2003-12-23 | 2015-06-30 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
US7615213B2 (en) | 2004-06-09 | 2009-11-10 | Wyeth | Antibodies against human interleukin-13 and pharmaceutical compositions thereof |
US8221752B2 (en) | 2004-06-09 | 2012-07-17 | Wyeth Llc | Antibodies against human interleukin-13 and uses therefor |
US7501121B2 (en) | 2004-06-17 | 2009-03-10 | Wyeth | IL-13 binding agents |
US7943342B2 (en) | 2004-06-17 | 2011-05-17 | Wyeth Llc | Nucleic acids encoding IL-13 binding agents |
US7994302B2 (en) | 2004-11-17 | 2011-08-09 | Amgen Inc. | Fully human monoclonal antibodies to IL-13 |
WO2006055638A3 (en) * | 2004-11-17 | 2006-08-24 | Abgenix Inc | Fully human monoclonal antibodies to il-13 |
US7585500B2 (en) | 2004-11-17 | 2009-09-08 | Amgen Inc. | Fully human monoclonal antibodies to IL-13 |
US8580260B2 (en) | 2005-10-21 | 2013-11-12 | Novartis Ag | Method of using anti-IL-13 antibodies |
US7910708B2 (en) | 2005-10-21 | 2011-03-22 | Novartis Ag | Anti-IL13 human antibodies |
US9650438B2 (en) | 2005-10-21 | 2017-05-16 | Novartis Ag | Nucleic acid encoding anti-IL13 human antibodies |
US8992916B2 (en) | 2005-10-21 | 2015-03-31 | Novartis Ag | Methods of using anti-IL13 human antibodies |
US8486693B2 (en) | 2006-05-23 | 2013-07-16 | Bellicum Pharmaceuticals, Inc. | Modified dendritic cells having enhanced survival and immunogenicity and related compositions and methods |
US9592293B2 (en) | 2006-09-08 | 2017-03-14 | Abbvie Inc. | Interleukin-13 binding proteins |
US10086076B2 (en) | 2006-09-08 | 2018-10-02 | Abbvie Inc. | Interleukin-13 binding proteins |
US11344621B2 (en) | 2006-09-08 | 2022-05-31 | Abbvie, Inc. | Interleukin-13 binding proteins |
US9684000B2 (en) | 2010-12-16 | 2017-06-20 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
US11226341B2 (en) | 2010-12-16 | 2022-01-18 | Genentech, Inc. | Method of treating asthma using an IL-13 antibody |
US9995755B2 (en) | 2010-12-16 | 2018-06-12 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
US9732133B2 (en) | 2012-01-27 | 2017-08-15 | The Board Of Trustees Of The Leland Stanford Junior University | Therapeutic IL-13 polypeptides |
US10227389B2 (en) | 2012-01-27 | 2019-03-12 | The Board Of Trustees Of The Leland Stanford Junior University | Therapeutic IL-13 polypeptides |
US9512194B2 (en) | 2012-01-27 | 2016-12-06 | The Board Of Trustees Of The Leland Stanford Junior University | Modified IL-13 polypeptides |
US11084858B2 (en) | 2012-01-27 | 2021-08-10 | The Board of Trustees of the Leland Stanford Junior University Stanford, CA | Therapeutic IL-13 polypeptides |
US10597446B2 (en) | 2013-09-13 | 2020-03-24 | Genentech, Inc. | Method of treatment comprising purified recombinant IL-13 antibody |
US10788494B2 (en) | 2013-09-13 | 2020-09-29 | Genentech, Inc. | Compositions and methods for detecting and quantifying host cell protein in cell lines and recombinant polypeptide products |
US10822404B2 (en) | 2013-09-13 | 2020-11-03 | Genentech, Inc. | Methods and compositions comprising purified recombinant polypeptides |
US10597447B2 (en) | 2013-09-13 | 2020-03-24 | Genentech, Inc. | Compositions comprising purified recombinant IL-13 antibody |
US9945858B2 (en) | 2013-09-13 | 2018-04-17 | Genentech, Inc. | Compositions and methods for detecting and quantifying host cells protein in cell lines and recombinant polypeptide products |
US9920120B2 (en) | 2013-09-13 | 2018-03-20 | Genentech, Inc. | Methods and compositions comprising purified recombinant polypeptides |
US10494429B2 (en) | 2013-09-13 | 2019-12-03 | Genentech, Inc. | Compositions comprising purified anti-abeta monoclonal antibodies |
US11519912B2 (en) | 2013-09-13 | 2022-12-06 | Genentech, Inc. | Compositions and methods for detecting and quantifying host cell protein in cell lines and recombinant polypeptide products |
US11667706B2 (en) | 2013-09-13 | 2023-06-06 | Genentech, Inc. | Methods of purifying recombinant anti-abeta antibodies |
US11352402B2 (en) | 2013-09-24 | 2022-06-07 | Medicenna Therapeutics, Inc. | Interleukin-4 receptor-binding fusion proteins and uses thereof |
US11312757B2 (en) | 2019-04-19 | 2022-04-26 | Synerkine Pharma B.V. | Fusion protein comprising IL13 |
Also Published As
Publication number | Publication date |
---|---|
JPH07508179A (en) | 1995-09-14 |
AU5010793A (en) | 1994-03-15 |
CA2142860A1 (en) | 1994-03-03 |
EP0656947A1 (en) | 1995-06-14 |
IL106732A0 (en) | 1993-12-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5596072A (en) | Method of refolding human IL-13 | |
EP0656947A1 (en) | Human interleukin-13 | |
WO1994004680A9 (en) | Human interleukin-13 | |
US6423500B1 (en) | Mammalian receptors for interleukin-10 | |
EP1349873B1 (en) | Modulation of il-2- and il-15-mediated t cell responses | |
Kishimoto et al. | Molecular regulation of B lymphocyte response | |
Oppmann et al. | Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12 | |
EP1899364B1 (en) | Compositions and methods for immunomodulation in an organism | |
US6001973A (en) | Antagonists of interleukin-15 | |
US7347995B2 (en) | Compositions and methods for achieving immune suppression | |
AU2001261585A1 (en) | Compositions and methods for achieving immune suppression | |
CA2594502A1 (en) | Homogeneous preparations of il-31 | |
HU208710B (en) | Method for preparation of mammalian human il-4, dna encoding il-4, host cell and pharmaceutical composition comprising human il-4 | |
HU216310B (en) | Process for producing cytokine synthesis inhibitory factor (csif) polypeptides with csif activity, csif antagonists and pharmaceutical preparations containing them | |
NZ269663A (en) | Agonists and antagonists of il-10 | |
WO2003087320A2 (en) | Antagonists of il-21 and modulation of il-21-mediated t cell responses | |
McKenzie et al. | Interleukin-13: characterization and biologic properties | |
AU2006246489A1 (en) | Compositions and methods for achieving immune suppression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU BB BG BR BY CA CZ FI HU JP KR KZ LK MG MN MW NO NZ PL RO RU SD SK UA VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
CFP | Corrected version of a pamphlet front page | ||
COP | Corrected version of pamphlet |
Free format text: PAGE 131,DESCRIPTION,ADDED;PAGES 131 AND 132,CLAIMS,REPLACED BY NEW PAGES 132 AND 133;DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |
|
CR1 | Correction of entry in section i | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
EX32 | Extension under rule 32 effected after completion of technical preparation for international publication |
Ref country code: UZ |
|
LE32 | Later election for international application filed prior to expiration of 19th month from priority date or according to rule 32.2 (b) |
Ref country code: UZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1993920049 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2142860 Country of ref document: CA |
|
WWP | Wipo information: published in national office |
Ref document number: 1993920049 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1993920049 Country of ref document: EP |