WO1994000562A1

WO1994000562A1 - A novel human immunodeficiency virus

Info

Publication number: WO1994000562A1
Application number: PCT/US1993/006162
Authority: WO
Inventors: Irwin H. Gelman; Jeffrey C. Laurence
Original assignee: The Mt. Sinai School Of Medicine Of The City University Of New York; Cornell Research Foundation, Inc.
Priority date: 1992-06-24
Filing date: 1993-06-23
Publication date: 1994-01-06

Abstract

The present invention relates to a new variety of retroviruses distinct from HIV-1 and HIV-2, designated HIV-LP. The isolation, characterization and cloning of a prototype HIV-LP is described. The invention also relates to nucleotide sequences derived from the HIV-LP family, viral proteins and antigens and antibodies specific for HIV-LP which can be used for diagnostic and/or therapeutic purposes.

Description

A NOVEL HUMAN IMMUNODEFICIENCY VIRUS

1. INTRODUCTION The present invention relates to a new variety of retroviruses distinct from HIV-1 and HIV-2, designated HIV-LP. The isolation, characterization and cloning of a prototype HIV-LP is described. The invention also relates to nucleotide sequences derived from the HIV-LP family, viral proteins and antigens and antibodies specific for HIV-LP which can be used for diagnostic and/or therapeutic purposes.

2. BACKGROUND OF THE INVENTION Acquired immune deficiency syndrome (AIDS) is etiologically linked to two subtypes of human immunodeficiency virus, HIV-1,-2. However, in certain acquired cellular immune defects among patients with risk factors for HIV neither HIV-1 or -2 can be detected. These encompass homosexual men with aggressive Kaposi's sarcoma and varying degrees of cellular immune deficiency who are negative for HIV-1,- 2 by serology, viral cultures and DNA amplification by polymerase chain reaction (PCR) (A.E. Friedman-Kien, et al., 1990, Lancet 335: 168; V. Soriano et al., VII Intl. Conf. AIDS, Florence, Italy, June 16-21, 1991, Abst. TuB82) , as well as a recent case report of a young homosexual male with profound CD4+ T-cell depletion, Kaposi*s sarcoma, Pneumocystis carinii pneumonia, and similar lack of evidence for HIV-1,-2 infection (B. Safai, et al., VII Intl. Conf. AIDS, Florence, Italy, June 16-21, 1991, Abst. TuB83) . It would be highly desirable to identify the agent or agents responsible for the clinical symptoms in such patients, and to devise diagnostic assays that can be used to test blood supplies for the presence of the infectious agent. However, heretofore, this agent had not been identified.

3. SUMMARY OF THE INVENTION

A new variant of the human immunodeficiency virus, distinct from HIV-1 or HIV-2 is described. This new member of the human lentivirus family, referred to herein as HIV-LP, can be used to construct clones, engineer nucleotide sequences, polypeptides, and antigens useful for diagnosis and/or therapy. The invention is based, in part, on the discovery of the prototype of this new member of the human lentivirus family, in individuals having clinical symptoms associated with ARC (AIDS related complex) or AIDS, but who are negative for HIV-1,-2 as determined by standard immunoasεay, PCR analysis and cell culture/p24 HIV-1,-2 Gag antigen assays. In particular, three individuals with profound CD4+ T lymphocyte depletion and opportunistic infections were identified, two of whom had known AIDS risk factors. There was no evidence for HIV-l,-2 infection by serology, DNA amplification by high stringency polymerase chain reaction (PCR) , and co-culture with assay for p24 Gag. However, particulate RNA directed DNA polymerase activity was observed in cultures from two available individuals, and low-stringency PCR amplification of HIV-l tat, pol, and/or HIV-l,-2 gag sequences gave signals of the predicted sizes with all patient samples. One isolate, selected for further study, could infect mitogen- activated peripheral blood lymphocytes in a CD4- restricted manner. Immunoprecipitation of [³⁵S]-labeled proteins from infected cells using patient antisera yielded bands of molecular weight 140, 41 and 27 kD, representing the putative envelope, transmembrane and core molecules of HIV-LP, respectively. cDNA was synthesized from purified virions, and recombinant plasmids were constructed, cloned and sequenced providing partial sequences of env, LTR/nef, and pol with significant homology to HIV. This agent, termed "HIV-LP," is apparently a new variant of the HIV family, and may be of significant public health concern.

This invention relates to the family of HIV- ^LP viruses, nucleotide sequences derived from HIV-LP viruses, viral proteins and viral antigens, and antibodies specific for HIV-LP which can be used for a variety of ends including diagnostics and therapeutics.

4. DESCRIPTION OF THE FIGURES

FIG. 1. Reverse transcriptase (RT) activity and HIV Gag antigen in supernatants of Pt. 1 and Pt. 2 PBMC cultures. 2 x 10⁶/ml PBMC from Pt. 1 (A) or an HIV-l seropositive control (B) were incubated for 3 days with 5 μg/ l PHA-P (Sigma) in RPMI 1640 plus 10% fetal bovine serum, then resuspended at 0.5 x 10⁶/ml in culture medium with 32 U/ml IL-2 (Electro-Nucleonics, Fairfield, NJ) in a total volume of 2 ml in polyvinyl flat-bottom macrowells (Falcon B-D Labware, Lincoln Pk, NJ) . Co-cultures were performed by incubating 0.5 x 10⁶ Pt. 1 (C) or Pt. 2 (D) PBMCs with 0.5 x 10⁶ normal donor PBMCs, pre-activated for 48-72 hours with PHA, in 2 ml of culture medium plus IL-2. Cell-free transmission of RT activity was demonstrated by exposure of PHA-activated PBMC cultures from two different donors (E, F) to 2 x 10³ counts/minute of RT activity from Pt. 1, together with 2 μg/ml of the anionic resin polybrene (Sigma) . The medium was completely changed 18 hours later. For each culture, one-half of the supernatant was removed every 3-4 days, evaluated for RT activity and p24 Ag, and replenished with fresh medium plus IL-2. RT assays were performed as previously described (Laurence et al., 1987, Science 235: 1501). p24 Ag was detected by ELISA (Abbott Labs, Chicago, IL) using rabbit Ig directed against HIV-l epitopes and contained in polystyrene beads, as per the manufacturer's directions. It has a sensitivity of > 30 pg/ l.

FIG. 2. Multi-nucleated giant cells induced by Pt. 1 RT+ supernatants in PHA-activated normal donor PBMCs (upper photo) and a clone of CD4+ HUT-78 T-cells (lower photo) .

FIG. 3. A: Immunoblots of HIV-l antigens with various sera. Nitrocellulose strips containing HIV-l antigens were incubated with 1:40 dilutions of sera, then developed with alkaline phosphatase- conjugated anti-human IgG and colorimetric reagents, as per the manufacturer's directions (DuPont, Wilmington, DE) . Lane 1, HIV-l seropositive donor. Lane 2, HIV- 1_/-2 seronegative donor without AIDS risk factors. Lane 3, Pt. 1. Lane 4, PT. 2.

B: Radioimmunoprecipitation of [³⁵S]cysteine- labeled lysates of an isolate from Pt. 1. PHA- activated donor PBMC exposed to Pt. 1 RT activity were harvested at the peak of RT production, labeled for 16 hours, and cellular lysates precipitated with 5 μl aliquots of various sera, as previously detailed (Laurence et al., 1987, Science 235: 1501; Laurence et al., 1990, Cell. Immunol. 128: 337). Lane 1, molecular weight markers. Lane 2, HIV-l,-2 seronegative donor without AIDS risk factors. Lane 3, HIV-l seropositive donor (pre-selected, based on ELISA reactivity with Pt. 1 PBMC lysates, from six others showing no such reactivity) . Lane 4, HIV-2 seropositive donor. Lane 5, Pt. 1. Arrows indicate areas of specific reactivity with Pt. 1 serum. FIG. 4. Thin-section electron photomicrographs of PHA-activated normal donor PBMC inoculated with RT+ Pt. 1 supernatant. Cells were fixed in Karnofsky solution (2.5% glutaraldehyde, 0.5% paraformaldehyde, 0.1M phosphate buffer, pH 7.2) for 2 days at 4°C, post-fixed in 1% Os0₄, plastic embedded, sectioned, and treated with 0.5% lead acetate. Lymphoblasts are magnified 31,000 X. The insert shows 0 a particle with an electron-dense internal core (100,000 X) .

FIG. 5. PCR analysis for HIV-l tat and HIV- 1,-2 gag. DNA was extracted from PBMC co-cultures (Pt. 1) using an anionic chromatography column (A.S.A.P., 5 Boehringer-Mannheim, Indianapolis, IN), as per manufacturer's instructions, or from paraffin sections of an intestinal lamina propria biopsy (Pt. 3) , using published procedures (Wright & Manos, In PCR Protocols: A Guide to Methods and Applications (Academic Press, o NY, 1990), p. 153). High stringency involved 2.5 U Tag polymerase (Perkin-Elmer-Cetus, Norwalk, CT) , 0.75 mM MgCl₂, 200 μM of oligonucleotide primers, and 0.2 μg of DNA in a total volume of 50 μl. Samples were overlaid with 50 μl mineral oil, preheated to 80°C for 8 5 minutes, then 90°C for 45 seconds, followed by injection of deoxynucleoside triphosphateε (dNTP; 200 μM final concentration) . DNA was amplified for 40 cycles at 94°C for 1 minute, 55°C for 2 minutes, and 72°C for 2 minutes. Low stringency conditions were 0 similar except that greater amounts of MgCl₂ (1.5 mM) and Tag (3.75 U) were included, and the annealing temperature was lowered to 42°C. Controls included Ul.l, a human promonocytic cell line that contains two integrated copies of HIV-l per cell (Folks, et al., 5 1988, J. Immunol. 140: 1117), reaction mixture without added sample ("no DNA") , and DNA extracted from PHA- activated PBMCs derived from a healthy, HIV-l seronegative donor ("control") . The integrity of all DNAs was evaluated by amplification for 0-globin. 20 μl of each sample was electrophoresed through a 1.5% agarose minigel containing 0.5 mg/ml ethidium bromide, then photographed under UV illumination. Primers: HIV-l tat, designed to amplify a 171 bp segment from position 5359 to 5529, ACAGAGGAGAGCAAGAAATGG (sense) and GCTTCTTCCTGCCATAGG (anti-sense); HIV-l,-2 gag (Perkin-Elmer-Cetus) , designed to amplify a 142 bp segment from position 1366 to 1507 of HIV-l, AGTGGGGGGACATCAAGCAGCCATGCAAAT (sense) and TGCTATGTCAGTTCCCCTTGGTTCTCT (anti-sense) ; jδ-globin (Perkin-Elmer-Cetus) , designed to amplify a 268 bp fragment, CAACTTCATCCACGTTCACC (sense) and GAAGAGCCAAGGACAGGTAC (anti-sense) .

FIG. 6. Molecular hybridizations with Pt. 1 isolate. Virions were purified from 90 ml of supernatant from a co-culture of Pt. 1 and normal donor PHA-activated PBMCs, ultra-centrifuged, and aliquots used for hybridization and cloning. A,B: Pellets resuspended in TNE buffer (10 mM Tris-HCl, pH 7.4, 0.1 M NaCl, 1 mM EDTA) with 0.1% SDS were spotted onto nitrocellulose strips presoaked in 2X SSC (standard saline citrate; 0.3 M NaCl, 0.03 M sodium citrate), baked, and hybridized for 16 hours under conditions of high (45% formamide, 6X SSC, 68°C) or low (30% formamide, 5X SSC, 42°C) stringency, then washed in 2X SSC with 0.1% SSD at 68°C or 42°C, respectively. Probes represent HIV-l env, tat. LTR (A) and tat- nef/LTR (B) sequences in linearized pBR322 plasmids, illustrated elsewhere (Laurence et al., 1987, J. Clin. Invest. 80: 1631) . Procedures for probe labeling with digoxigenin-11-dUTP by the random primer method, and DNA detection using a polyclonal sheep anti- digoxigenin-Fab' of IgG conjugated with alkaline phosphatase have been previously published (Laurence et al., 1990, Blood 75: 696). FIG. 7. Nucleotide sequences of Pt. 1 isolate. A cDNA first strand using oligo(dT) (Dynabeads dT₂₅, Dynal, Great Neck, NY) was synthesized from Pt. 1 pellet using MLV RT as described (Clavel et al., 1986, Nature 324: 691). Product was tailed with dCTP by terminal deoxynucleotide transferase, then converted into dsDNA by the DNA polymerase I/RNase H method (GIBCO-BRL, Bethesda, MD) . This cDNA was amplified by PCR for 30 cycles (94°C, 1 minute; 55°C, 2 minutes, 72°C, 3 minutes) using the following primers: GCGAAAGCTTG₁₅ and CGAGGAATTCT₃₀• Following removal of excess primers by filtration through Sephadex G-50 spin columns, the products were cut with EcoRl and Hindlll and ligated to pBluescript KS (Stratagene, La Jolla, CA) . Nucleotide sequencing was performed on (double- stranded) plasmid DNA using a Sequenase 2.0 kit (U.S. Biochemical, Cleveland, OH) .

A: Nucleotide sequence from HIV-LP, cDNA clones JS-3 and JS-5 (SEQ. ID NO:l). A stretch of residues identical to a region of HIV-l strain SF-2 env (nucleotides 6612-6827; Myers et al., eds. Human

Retroviruses and AIDS 1991: a compilation and analysis of nucleic acid and amino acid sequences, Los Alamos National Lab., Los Alamos, NM, 1991) are underlined. B: Nucleotide sequence from HIV-LP cDNA clone JS-8 (SEQ. ID NO:2) . Residues identical to a region of HIV-l HXB2 clone LTR/nef (nucleotides 718- 579; Myers et al., eds. Human Retroviruses and AIDS 1991: a compilation and analysis of nucleic acid and amino acid sequences, Los Alamos National Lab., Los Alamos, NM, 1991) are underlined. C: Nucleotide sequence from HIV-LP, cDNA clone JS-2 (SEQ. ID NO:3). Residues identical to a region of HIV-2 (strain ST) pol (nucleotides 3347-3524) are underlined. The similarity between HIV-LP and HIV- 2_ST in this region is 56%, as compared to a 58% similarity between HIV-2_ST and HIV-I_H^.

5. DETAILED DESCRIPTION OF THE INVENTION ₀ The invention relates to a new variant of the

HIV family, referred to herein as HIV-LP. Clones and nucleotide sequences which can be used in diagnostic hybridization assays or for the cloning and expression of viral antigens are also encompassed by the ₅ invention. The invention also relates to the production of viral proteins and antigens by recombinant DNA or synthetic chemical techniques. Such antigens may be used in immunoassays for the diagnosis of HIV-LP infection, or in the development of vaccine o formulations.

The invention is described in the subsections below and by the examples detailed in Sections 6 and 7, infra, which document the existence, in three individuals residing in New York City, of an acquired ₅ cellular immune deficiency associated with opportunistic infections and malignancies pathognomonic of AIDS or AIDS-related complex, occurring in the absence of evidence for HIV-l,-2 infection by serology, viral culture and PCR. Such persistent and progressive ₀ CD4+ T-cell depletion is distinctly unusual outside of HIV infection (Bofill, et al., 1992, Clin. Exp. Immunol. 88: 243). For example, it was not seen in a group of elderly HIV-l,-2 seronegative, retroviral culture (p24 Gag and RT) negative individuals with ₅ Pneumocystis carinii pneumonia and no HIV risk factors (Jacobs, et al., 1991, N. Engl. J. Med. 324: 246). A retroviral isolate was partially characterized from Patient no. 1 (Pt. 1) . Its CD4 cell tropism, pattern of cytopathic and cytolytic effects, biochemistry of its polymerase, A/C codon usage, and partial sequences of its env. LTR/nef. and pol genes clearly place it in the lentivirus family, with similarities to HIV-l,-2, as well as distinct differences. All HIV-l and -2 isolates described thus ₀ far share common serologic properties, and though there may be substantial variation in nucleic acid and protein composition, many antigenic components immunologically cross-react (Clavel, 1987, AIDS 1: 135) . This is clearly not the case for our examples. ₅ Pending further sequence and molecular taxonomy data, we suggest calling this subtype and members of its family, HIV-LP.

Given the cross-reactive serologies of Patients 1 and 2, described infra, and similarities in o PCR patterns among all three patients, and subject to sequencing the full length provirus, it appears that these patients are infected with the same agent. The public health implications of these findings are clear. Based on the information from these cases and from in ₅ vitro studies described infra, HIV-LP is probably transmissible by the same routes as HIV-l,-2, and as reported for HIV-2 (O'Brien, et al., 1992, Amer. Med. Assoc. 267: 2775) may co-infect HIV-1+ individuals, and will certainly escape detection by current serological ₀ surveillance mechanisms.

5.1. THE HIV-LP VIRUS The prototype HIV-LP virus was originally isolated from a patient with clinical AIDS who is ₅ negative for both HIV-l and HIV-2 as determined by immunoassay, PCR (polymerase chain reaction) analysis, and cell culture/p24 antigen assays. The patient was also negative for human T-cell lymphotropic viruses type I and II (HTLV-I, II). Samples of cells infected with the HIV-LP isolated from this patient have been deposited with the American Type Culture Collection (ATCC) and assigned accession no. VR 2374. The isolation and characterization of this HIV-LP virus isolate is described in Section 6, infra. However, the invention includes HIV-LP strain variants and viruses which are functionally equivalent as described in the subsections below.

5.1.1. ISOLATION AND CHARACTERIZATION OF THE HIV-LP VIRUS

In accordance with the invention, the samples deposited with the ATCC can be used as a source of virus for propagation, cloning, etc. Alternatively, the HIV-LP can be isolated from other patients with clinical ARC or AIDS who are negative for HIV-l,-2 and HTLV-I,II. To this end, the virus can be propagated and expanded by co-culturing PBMCs (peripheral blood ononuclear cells) obtained from the patient with normal PBMCs activated with PHA (phytohemagglutinin) or other appropriate T-cell itogenε. Alternatively, the virus (obtained from patients or the ATCC deposit) may be propagated in continuous CD4+ cell lines including but not limited to HUT-78, for example. The virus can be isolated from the culture supernatants by centrifugation (e.g. , at 1000 x g) , layered over a discontinuous sucrose gradient and purified by ultra- centrifugation (e.g.. 33,000 rpm in a SW41 rotor for 12 hours at 4°C) . The HIV-LP sediments at a density between 1.12 to 1.16 g/ml; a density which is characteristic of mammalian retroviruses.

The HIV-LP virus displays a tropism for CD4 positive cells. Im unoprecipitation of viral antigens from infected cell cultures using patient antisera identifies three viral antigens of molecular weight 130-140, 41 and 27 kD, corresponding to the envelope, transmembrane and core viral proteins.

Preliminary sequence information, obtained by cloning the cDNA synthesized from viral RNA of the deposited HIV-LP is described herein (see Section 6.4.3 and FIG. 7) . The cDNA sequences corresponding to HIV- LP env (JS-3, JS-5; FIG. 7A; SEQ. ID NO:l), the LTR including the nef region (JS-8; FIG. 7B; SEQ. ID NO:2), and the pol region (JS-2; FIG. 7C; SEQ. ID NO: 3) are described. Corresponding cDNA clones JS-3, JS-5, JS-2, and JS-8 have also been deposited with the ATCC and assigned accession nos. 69011, 69012, and 69013, respectively.

The viruses of the invention include the HIV- LP virus as deposited with the ATCC, including any related virus strains of HIV-LP and functional equivalents, i.e.. retroviruses having equivalent antigenic and immunologic properties. Even though HIV- LP strains may vary genetically rather substantially, the diverse strains should have certain common antigenic sites on the structural proteins, e.g.. core, envelope and the transmembrane protein. Therefore, the prototype strain deposited with the ATCC may be used as a source of antigen to detect strain variants and functional equivalents i.e.. non-HIV-1,-2 viruses that immunologically cross react with HIV-LP at any level. Strain variants of HIV-LP are defined herein as retroviruses which can be identified as HIV-LP based on at least one of the following criteria: immunoassay or hybridization analysis, including nucleotide amplification techniques (e.g.. PCR, LCR) , using antibodies, antigens or oligonucleotide probes or primers designed on the basis of the prototype HIV-LP as deposited with the ATCC and described herein.

5.1.2. CLONING AND SEQUENCING THE VIRAL GENOME

The HIV-LP prototype has been isolated, cultivated in PHA-stimulated co-cultures, and regions of the virus (e.g. , env, LTR/nef, and p_p_l) have been subcloned and sequenced as described in Section 5.1.1 and in the working examples described in Section 6, et seq. This material, which has been deposited by the ATCC, can be used to complete the cloning and sequencing of the viral genome using any of a number of techniques which are well known to those skilled in the art, including but not limited to the construction of cDNA libraries corresponding to the HIV-LP genome which can be used to "walk-out" the remaining sequence; RACE (Rapid Amplification of cDNA Ends) which involves the use of full length viral RNA and oligonucleotide primers to amplify cDNA ends to generate a full length cDNA clone(s); individual HIV-LP genes can be cloned from infected cells using oligonucleotide primers in a polymerase amplification assay (e.g. PCR, LCR) designed for the desired gene located within the proviral sequence, e.g.. p_o_l, gag, env, etc. For a review of such techniques, see Maniatis et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y.

Alternatively, the protocol described in Section 6, et seq., infra, could be used to clone and sequence HIV-LP isolated from other AIDS/ARC patients who are HIV-l,-2 negative, as determined by both immunoassay and hybridization/amplification assays. In another embodiment of the invention, an expression cloning approach could be taken (see Maniatis, and Ausubel, supra) . In this regard, cDNA copies of the HIV-LP genome could be cloned into an expression library such as λgt 11 and screened using antisera or antibodies derived from AIDS/ARC patients who are HIV-l,-2 negative as determined by both immunoassay and hybridization/amplification assays. Since serum antibodies specific for authentic viral antigens responsible for the immune response generated in an infected individual are used to screen the library, this approach has an added advantage of identifying clones which express viral antigens that may be most relevant to diagnostics and therapeutics. The sequences of such clones can be used to re-screen the library and "walk-out" the remaining sequences in the library; to express the encoded viral antigens by recombinant DNA techniques; or to design and synthesize peptide antigens. The antigens so produced can be used for diagnostics and/or therapeutics as described in more detail, infra.

5.2. PRODUCTION OF VIRAL

PROTEINS AND ANTIGENS

In order to express HIV-LP proteins, or polypeptides or peptides derived from the viral proteins, the appropriate nucleotide sequence coding for such HIV-LP gene products, e.g. either the entire open reading frame (ORF) of an HIV-LP gene or a desired portion thereof, or a functional equivalent

(hereinafter referred to as the "HIV-LP coding sequence") is inserted into an appropriate expression vector, i.e.. a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Due to the degeneracy of the genetic code, other DNA sequences which encode the same or functionally equivalent HIV-LP gene product(s) , or portion(s) thereof, may be used for cloning and expression of viral proteins and antigens. Such sequences include those which are capable of hybridizing to the HIV-LP sequence under stringent conditions, or which would be capable of hybridizing under stringent conditions but for the degeneracy of the genetic code. Such altered DNA sequences may include deletions, additions or substitutions of different nucleotide residues resulting in a sequence that encodes the same or a functionally equivalent HIV- LP gene product. Functionally equivalent gene products are those which contain deletions, additions or substitutions of amino acid residues within the HIV-LP sequence which result in a silent change.

The HIV-LP expression products as well as host cells or cell lines transfected or transformed with such recombinant expression vectors can be used for a variety of purposes. These include but are not limited to producing viral polypeptides useful in diagnostic immunoassays, vaccines, etc.

5.2.1. EXPRESSION SYSTEMS Methods which are well known to those skilled in the art can be used to construct expression vectors containing HIV-LP coding sequences and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, synthetic techniques and jLn vivo recombination/genetic recombination. See, for example, the techniques described in Maniatis et al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y. A variety of host-expression vector systems may be utilized to express the HIV-LP coding sequences. These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the HIV-LP coding sequence; yeast transformed with recombinant yeast expression vectors containing the HIV-LP coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g.. baculovirus) containing the HIV-LP coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g. , cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g. , Ti plasmid) containing the HIV-LP coding sequence; or animal cell systems infected with recombinant virus expression vectors (e.g.. adenovirus, vaccinia virus) including cell lines engineered to contain multiple copies of the HIV-LP coding sequences either stably amplified (e.g.. CHO/dhfr) or unstably amplified in double-minute chromosomes (e.g.. murine cell lines) .

The expression elements of these systems vary in their strength and specificities. Depending on the host/vector system utilized, any of a number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used in the expression vector. For example, when cloning in bacterial systems, inducible promoters such as pL of bacteriophage λ, plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used; when cloning in insect cell systems, promoters such as the baculovirus polyhedrin promoter may be used; when cloning in plant cell systems, promoters derived from the genome of plant cells (e.g.. heat shock promoters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein) or from plant viruses (e.g.. the 35S RNA promoter of CaMV; the coat protein promoter of TMV) may be used; when cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g.. metallothionein promoter) or from mammalian viruses (e.g.. the adenovirus late promoter; the vaccinia virus 7.5K promoter) may be used; when generating cell lines that contain multiple copies of the HIV-LP coding sequence, SV40-, BPV- and EBV-based vectors may be used with an appropriate selectable marker.

In bacterial systems a number of expression vectors may be advantageously selected depending upon the use intended for the HIV-LP coding sequences expressed. For example, when large quantities of HIV- LP polypeptides are to be produced for the generation of antibodies, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include but are not limited to the E_j_ coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2:1791), in which the HIV-LP coding sequence may be ligated into the vector in frame with the lac Z coding region so that a hybrid AS-lac Z protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 264:5503-5509) ; and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST) . In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety.

In yeast, a number of vectors containing constitutive or inducible promoters may be used. For a review see, Current Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, in 0 Methods in Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y., Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL Press, Wash., D.C., Ch. 3; and Bitter, 1987, Heterologous Gene Expression in Yeast, Methods in Enzymology, Eds. Berger & Kimmel, Acad. 5 Press, N.Y., Vol. 152, pp. 673-684; and The Molecular Biology of the Yeast Saccharomyces, 1982, Eds. Strathern et al.. Cold Spring Harbor Press, Vols. I and II.

In cases where plant expression vectors are o used, the expression of the HIV-LP coding sequence may be driven by any of a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brisson et al., 1984, Nature 310:511-514), or the coat protein promoter of TMV 5 (Takamatsu et al., 1987, EMBO J. 6:307-311) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO J. 3:1671-1680; Broglie et al., 1984, Science 224:838- 843); or heat shock promoters, e.g. , soybean hspl7.5-E 0 or hspl7.3-B (Gurley et al., 1986, Mol. Cell. Biol. 6:559-565) may be used. These constructs can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, etc. 5 For reviews of such techniques see, for example, Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp. 421-463; and Grierson & Corey, 1988, Plant Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9. An alternative expression system which could be used to express HIV-LP coding sequences is an insect system. In one such system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The HIV-LP coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter) . Successful insertion of the HIV- LP coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e.. virus lacking the proteinaceous coat coded for by the polyhedrin gene) . These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. (E.g.. see Smith et al., 1983, J. Viol. 46:584; Smith, U.S. Patent No. 4,215,051).

In mammalian host cells, a number of viral based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the HIV-LP coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g.. the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or .in vivo recombination. Insertion in a non-essential region of the viral genome (e.g. , region E4 or E3) will result in a recombinant virus that is viable and capable of expressing the HIV- LP coding sequence in infected hosts. (E.g.. See Logan & Shenk, 1984, Proc. Natl. Acad. Sci. (USA) 81:3655- 3659). Alternatively, the vaccinia 7.5K promoter may be operatively linked to the HIV-LP coding sequence which is inserted within a nonessential gene of vaccinia virus, e.g. thymidine kinase. The chimeric gene may be inserted into the vaccinia virus genome by in vivo recombination. (E.g.. see Mackett et al., 1982, Proc. Natl. Acad. Sci. (USA) 79:7415-7419; Mackett et al., 1984, J. Virol. 49:857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. 79:4927-4931). Specific initiation signals may also be required for efficient translation of inserted HIV-LP coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire HIV-LP gene sequence, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of an HIV-LP gene sequence is inserted, exogenous translational control signals, including the ATG initiation codon, may be provided. Furthermore, the initiation codon must be in phase with the reading frame of the HIV-LP coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and sythetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bitter et al., 1987, Methods in Enzymol. 153:516-544).

In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g. , glycosylation) and processing (e.g.. cleavage) of protein products may be important for the function of certain proteins of HIV-LP e.g.. structural proteins or enzymes. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cells lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, WI38, etc. For long-term, high-yield production of recombinant proteins, stable expression may be preferred. For example, cell lines which stably express an HIV-LP coding sequence may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with the HIV-LP coding sequence controlled by appropriate expression control elements (e.g.. promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Strong eukaryotic promoters are preferred, including but not limited to the cytomegalovirus immediate early promoter. Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase

(Lowy, et al., 1980, Cell 22:817) genes can be employed in tk^", hgprt^" or aprt^" cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981) , Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150:1); and hygro, which confers resistance to hygro ycin (Santerre, et al., 1984, Gene 30:147) genes. Recently, additional selectable genes have been described, namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, 1988, Proc. Natl. Acad. Sci. USA 85:8047) ; and ODC (ornithine decarboxylase) which confers resistance to the ornithine decarboxylase inhibitor, 2-(difluoromethyl)-DL-ornithine, DFMO

(McConlogue L. , 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.).

The host cells which contain the coding sequence and which express the HIV-LP gene product may be identified by at least four general approaches;

(a) DNA-DNA or DNA-RNA hybridization; (b) the presence or absence of "marker" gene functions; (c) assessing the level of transcription as measured by the expression of HIV-LP mRNA transcripts in the host cell; and (d) detection of the gene product as measured by immunoassay or by its biological activity. In the first approach, the presence of the HIV-LP coding sequence inserted in the expression vector can be detected by DNA-DNA or DNA-RNA hybridization using probes comprising nucleotide sequences that are complementary to the HIV-LP coding sequence, respectively, or portions or derivatives thereof.

In the second approach, the recombinant expression vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g. , thy idine kinase activity, resistance to antibiotics, resistance to methotrexate, transformation phenotype, occlusion body formation in baculovirus, etc.) . For example, if the HIV-LP coding sequence is inserted within a marker gene sequence of the vector, e.g. β-galactosidase, recombinants containing the HIV-LP coding sequence can be identified by the absence of the marker gene function. Alternatively, a marker gene can be placed in tandem with the HIV-LP sequence under the control of the same or different promoter used to control the expression of the HIV-LP coding sequence. Expression of the marker in response to induction or selection indicates expression of the HIV-LP coding sequence. In the third approach, transcriptional activity for the HIV-LP coding sequence can be assessed by hybridization assays. For example, RNA can be isolated and analyzed by Northern blot using a probe complementary to the HIV-LP coding sequence or particular portions thereof.

In the fourth approach, the expression of the HIV-LP polypeptide product can be assessed immunologically, for example by Western blots, immunoassays such as radioimmuno-precipitation, enzyme- linked immunoassays and the like. Once a clone that produces high levels of the HIV-LP polypeptide product is identified, the clone may be expanded and used to produce large amounts of the product which may be purified using techniques well- known in the art including, but not limited to immunoaffinity purification, chro atographic methods including high performance liquid chromatography, affinity chromatography. 0 Where the HIV-LP coding sequence is engineered to encode a cleavable fusion protein, purification may be readily accomplished using affinity purification techniques. For example, a collagenase cleavage recognition consensus sequence may be 5 engineered between the carboxy terminus of the HIV-LP amino acid sequence and protein A. The resulting fusion protein may be readily purified using an IgG column that binds the protein A moiety. The HIV-LP product may be readily released from the column by o treatment with collagenase. Another example would be the use of pGEX vectors that express foreign polypeptides as fusion proteins with glutathionine S- transferase (GST) . The fusion protein may be engineered with either thrombin or factor Xa cleavage 5 sites between the cloned gene and the GST moiety. The fusion protein may be easily purified from cell extracts by adsorption to glutathione agarose beads followed by elution in the presence of glutathione. In this aspect of the invention, any cleavage site or 0 enzyme cleavage substrate may be engineered between the GnRH-R sequence and a second peptide or protein that has a binding partner which could be used for purification, e.g. , any antigen for which an immunoaffinity column can be prepared. 5

5.2.2. SYNTHETIC PEPTIDES In an alternative embodiment of the invention, the HIV-LP protein, polypeptide or peptide itself could be produced using chemical methods to synthesize the desired HIV-LP amino acid sequence in whole or in part. For example, peptides can be synthesized by solid phase techniques, cleaved from the solid phase resin, and purified by preparative high performance liquid chromatography. (E.g. , see Creighton, 1983, Proteins Structures and Molecular Principles, W.H. Freeman and Co., N.Y., pp. 50-60) . The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g. , the Ed an degradation procedure; see Creighton, 1983, Proteins, Structures and Molecular Principles, W.H. Freeman and Co., N.Y., pp. 34-49).

3. GENERATION OF ANTIBODIES TO HIV-LP

Various procedures known in the art may be used for the production of antibodies to epitopes of HIV-LP using whole virus, disrupted virus, isolated viral antigens, the reco binantly or synthetically produced HIV-LP proteins, polypeptides or peptides as the immunogen. Neutralizing antibodies, i.e.. those which would neutralize infectivity of native HIV-LP or production of progeny virus, are especially preferred for therapeutics. Neutralizing antibodies, or antibodies which define HIV-LP serological markers would be preferred for diagnostic uses. Such antibodies may be generated using appropriate viral antigens, (e.g. , identified by screening expression clones with AIDS or ARC patient antisera) , as immunogens. For example, clones which express antigens that immunoreact with patient antisera generated against authentic HIV-LP may be identified in this fashion. Polypeptides or peptides produced by these clones, or synthetic derivatives, could be used to generate appropriate antibodies that define serological markers. Antibodies which may be used in accordance with the invention include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by an Fab expression library.

For the production of antibodies, various host animals may be immunized by injection with the HIV-LP protein, polypeptide, or peptide (either as a fusion protein or unfused) including but not limited to rabbits, mice, rats, etc. Various adjuvants may be used to increase the im unological response, depending on the host species, including but not limited to

Freund's (complete and incomplete) , mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corvnebacteriu parvu .

Monoclonal antibodies to HIV-LP proteins, polypeptides, or peptides may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein, (Nature, 1975, 256:495-497) , the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today, 4:72; Cote et al., 1983, Proc. Natl. Acad. Sci., 80:2026- 2030) and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) . In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci., 81:6851-6855; Neuberger et al., 1984, Nature, 312:604- 608; Takeda et al., 1985, Nature, 314:452-454) by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. Alternatively, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce HIV-LP-specific single chain antibodies.

Antibody fragments which contain the antigen- binding sites for HIV-LP may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab'), fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')₂ fragments. Alternatively, Fab expression libraries may be constructed (Huse et al., 1989, Science, 246:1275- 1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to HIV-LP.

5.4. DIAGNOSTIC ASSAYS FOR HIV-LP The HIV-LP, and proteins, polypeptides or peptides that correspond to viral antigens, and/or antibodies to such HIV-LP antigens may be used in diagnostic immunoassays to detect HIV-LP infection. Alternatively, the HIV-LP nucleotide sequence can be used to design oligonucleotide probes/primers for use in hybridization/amplification assays for HIV-LP. The invention encompasses both the methods and kits which can be used for the detection of any strain or non-HIV- 1,-2 functional equivalent of HIV-LP.

It should be understood that a certain amount of cross reactivity of HIV-LP with HIV-l or -2 is to be expected when conducting these assays. By way of background, although HIV-2 is related to HIV-l based on its morphology, tropism for CD4+ cells and cytopathic effects, the two viruses are distinct. Nonetheless, a certain amount of sequence similarity and serological cross-reactivity is observed between HIV-l and -2.

Generally, the cross-reactivity is restricted mostly to the major core protein, and to some extent, the envelope protein. Although HIV-LP is distinct from HIV-l and -2, it is still a member of the HIV group of viruses, and as such, a certain similar level of cross- reactivity is to be expected between HIV-LP and HIV-l, - 2.

5.4.1. IMMUNOASSAYS FOR DETECTION OF HIV-LP INFECTION

Immunoassays can be designed using HIV-LP antigens to detect patient antibodies to HIV-LP.

Alternatively, the HIV-LP antigens can be used to generate antibodies (polyclonal, monoclonal, chimeric,

Fab fragments, etc.) that, in turn, can be used to detect HIV-LP in infected patients. The immunoassay kits can be designed using any label in any of a number of formats, including but not limited to, enzyme-linked immunoassays (ELISA) , radioimmunoassays, and fluorescence immunoassays, which can be configured in heterogeneous or homogeneous systems, a sandwich, competitive, or displacement format, including the use of immunoprecipitation, Western blot analysis and immunoblot assays to name but a few. The immunoassay kits can be conveniently designed to test a patient's body fluids, such as serum or saliva in vitro; e.g. , using a icrotiter well format or an immobilized antigen-bead format. Alternatively, the immunoassay can be designed to test biopsied tissue samples, such as liver, kidney, lung, etc.

Disrupted HIV-LP may be used as a mixture of viral antigens for detecting serum antibodies, or for generating antibodies that can be used to detect HIV- LP. Alternatively, isolated viral antigens, or combinations of individual antigens, may be used. These can be produced by recombinant DNA techniques, by chemical synthetic methods, or can be isolated from disrupted HIV-LP. Viral antigens for use in the immunoassays and kits may be identified and selected by screening an expression library with AIDS/ARC HIV-l, -2 negative patient sera, as described in Section 5.1.2, supra. In this way the coding regions for viral serological markers may be readily identified. Alternatively, the viral antigens may be identified, selected and designed by aligning the HIV-LP genome with those of HIV-l and HIV-2; e.g. , the genomes should be aligned with respect to the various HIV genes such as pol, ga , env etc. , and the sequences should be configured so as to maximize homology (e.g. , by introducing gaps, etc.) . Stretches of amino acids within the HIV-LP sequence corresponding to the location of antigenic regions or amino acid stretches of HIV-l or HIV-2 which are currently used in immunoassays for HIV (e.g. , in commercially available kits) may be produced by recombinant DNA or chemical synthetic techniques and used in immunoassay kits for the detection of HIV-LP.

In general, the antigenic regions of the HIV- LP polypeptides utilized can be very small, typically 7 to 10 amino acids in length. Fragments as few as 3 to 5 amino acids may characterize an antigenic region. Segments of HIV-LP polypeptides can be expressed recombinantly either as fusion proteins or as isolated polypeptides. Alternatively, short peptides can be synthetically produced. However, larger peptides, polypeptides or the entire viral protein may be utilized.

5.4.2. OLIGONUCLEOTIDE PROBES/PRIMERS FOR

HYBRIDIZATION OR AMPLIFICATION ASSAYS

Oligonucleotide probes/primers can be designed on the basis of the HIV-LP sequence obtained as described herein, for use in hybridization/ amplification (e.g. PCR, LCR) assays for HIV-LP. Such assay systems can be designed for detecting HIV-LP nucleic acids (i.e. , virus or proviral sequences) in any of a variety of patient samples, including but not limited to PBLs (peripheral blood lymphocytes) , PBMCs, tissue biopsy samples, etc.

While virtually any oligonucleotide sequence corresponding to any region of the HIV-LP genome may be utilized, in order to minimize potential cross reactivities with other HIV viruses, such as HIV-l,-2, it may be preferred to design the oligonucleotide probes/primers on the basis of sequences found in nonconserved regions of the HIV genome; i.e. , regions of the HIV-LP which are most divergent from the corresponding sequence of HIV-l,-2. Since genes such as gag and pol are relatively conserved within an HIV family, oligonucleotides corresponding to non-conserved regions of such gene sequences would be useful for distinguishing HIV-LP from other HIVs such as HIV-l and -2. However, oligonucleotides corresponding to non- conserved regions of env. which is highly variable from strain to strain, may be preferred for identifying and distinguishing different strains of virus within the HIV-LP family.

The degree of cross-reactivity can also be controlled by the stringency of the hybridization conditions used. For example, the temperature, formamide or salt concentrations at which the annealing reactions are carried out may be increased to minimize the chances of cross-reactivity. The conditions will vary depending upon the primer used. For an example of high and low stringency conditions that can be used in PCR reaction with certain primers described herein refer to the description for FIG. 5 supra. For hybridization assays, the stringency of the washes may be controlled, as for example, explained in the description of FIG. 6, supra.

For a review of methods and conditions which can be utilized in such hybridization/amplification assay systems, see Maniatis, supra and Ausubel, supra.

5.4.3. REVERSE TRANSCRIPTASE ASSAYS

HIV-LP infection can also be diagnosed by assaying for reverse transcriptase activity in primary cultures of virus obtained from a patient using procedures well known to those skilled in the art; e.g.. see Kacian, 1977, Methods In Virol. 6: 143; Prasad & Goff, 1990, Ann. N.Y. Acad. Sci. 616: 11-21. A reverse transcriptase assay will be less specific, in that other non-HIV-LP viruses, including HIV-l or -2 will be detected. However, the reaction conditions may be adjusted to increase the specificity of the reaction conditions for HIV-LP. For example, it is well known that the majority of retroviral polymerases preferentially use Mg⁺⁺, including HIV-l, which utilizes Mg⁺⁺ much more effectively than Mn⁺⁺ with most template primers (Hoffman et al., 1985, Virology 147: 326) . However, using poly(rA) *oligo(dT) as a template, HIV-l appears to be distinct in that it prefers Mn⁺⁺ over Mg⁺⁺ (Hoffman et al., supra) . By contrast to HIV- 1, when using the poly(rA) »oligo(dT) template, the reverse transcriptase of HIV-LP exhibits a five-fold preference for Mg⁺⁺ over Mn⁺⁺ as the divalent cation used in the reaction. In this regard, we have found that HIV-LP appears to prefer Mg⁺⁺ with all artificial templates tested to date. Accordingly, in designing a reverse transcriptase assay specific for HIV-LP reaction conditions could be adjusted to include Mg⁺⁺ or to use Mg⁺⁺ exclusively as the cation in the reaction, e.g. , using oligo(rA) *oligo(dT) template. Alternatively, the reverse transcriptase assay can be performed on a sample in parallel, with and without neutralizing antibody specific for HIV-LP reverse transcriptase, i.e. , an antibody which binds to and neutralizes the activity of the reverse transcriptase of HIV-LP but not that of HIV-l or -2. Inhibition of the enzyme in the presence of such antibody would indicate that the reverse transcriptase activity detected is HIV-LP in origin. Likewise, antibodies that specifically neutralize HIV-l, or -2 reverse transcriptase could be used. Such antibodies should fail to inhibit HIV-LP enzyme activity in the assay.

5.5. DEVELOPMENT OF VACCINES

A number of approaches, described in the subsections below, are possible for formulating vaccines for HIV-LP. A number of methods may be used to introduce the vaccine formulations described below, including but not limited to intravenous, oral, intradermal, intramuscular, intraperitoneal, subcutaneous, and intranasal routes. The choice, dosage, and frequency of inoculation will depend on the formulation used; e.g.. live virus formulations are preferably administered via the natural route of infection; inactivated virus formulations generally require higher doses and more frequent boosts.

Since, in general, the object of immunization is to protect against disease, vaccine formulations may be designed to generate an immune response that "neutralizes" the activity of any viral antigen involved at any stage of viral replication, and is not restricted to those involved in viral binding to target cells and infection. For example, vaccines designed to generate an immune response against the HIV-LP reverse transcriptase may be as effective, if not more effective than one designed to generate an immune response against HIV-LP envelope antigens. Multivalent vaccines which incorporate two or more viral antigens may be preferred.

5.5.1. INACTIVATED VACCINES Inactivated ("killed") vaccines may be made from the HIV-LP virus by destroying its infectivity while retaining its immunogenicity. Being non- infectious, such vaccines should be safe, but generally need to be injected in large amounts to elicit an antibody response commensurate with that attainable by a much smaller dose of live attenuated virus. Normally, even the primary course comprises two or three injections, and further ("booster") doses may be required at intervals over succeeding years to revive waning immunity.

Purified virus is the most preferred starting material for such vaccines. Stocks of virus purified by end-dilution or cloning can be prepared as a source for vaccine formulations. For example, a single HIV-LP can be selected by serial-dilution cloning using any characteristic feature of viral infection, e.g.. syncytia formation, RT activity, etc. , to assay the serially diluted cultures. Alternatively, molecular biological techniques could be used to transfect T-cell lines, e.g. , HUT-78, so that virus is generated from molecular clones of the integrated provirus. The virus propagated by the engineered cell can be cloned, and isolates used to prepare the viral stocks which can be used to formulate vaccines.

To prepare the large number of virions required for inactivated vaccine formulation, the purified HIV-LP virus may be propagated in cultures of mitogen-stimulated PBLs, or in cell lines that are infectable with HIV-LP and can sustain HIV-LP replication; e.g. , HUT-78. The infected cells or cell lines may be grown in large volumes in suspension, in monolayers, or on microcarrier beads in fermentors.

Virus may be purified and concentrated from the culture by any of a number of standard techniques including zonal ultracentrifugation, gel filtration, ion exchange chromatography, and affinity chromatography using monoclonal antibodies or a combination of such procedures. It is important to remove aggregated virus prior to chemical inactivation to avoid contamination by residual live virus.

The most commonly used inactivating agents are formaldehyde, β-propiolactone and the ethylenimines.

5.5.2. ATTENUATED VACCINES Live vaccine formulations may be prepared using variants of HIV-LPs that demonstrate attenuation i.e. , viruses which are capable of multiplying in the host and eliciting a natural type of immune response, but which do not cause disease. Such attenuated strains may be derived from host range mutants generated by repeated passages in one or more types of cell lines which have been screened for the absence of endogenous retrovirus (e.g. , host cell lines genetically engineered to express the CD4 receptor may be useful to this end) ; temperature-sensitive and cold- adapted mutants (although such mutants may demonstrate an unacceptable rate of reversion to wild type) ; or deletion mutants. In this regard, an attenuated strain may be engineered by mutagenizing HIV-LP (e.g. , radiation, chemically, etc.) or site-directed mutagenesiε (e.g. , by deleting, adding or substituting nucleotides in viral genes which are not eεεential for replication, but responsible for pathogenicity) . Target gene sequences of the HIV-LP which could be engineered to obtain an attenuated strain include but are not limited to nef, pol, and the transmembrane region. For example, in εimian immunodeficiency viruε, an amber mutation in nef reεulted in reduced mortality; εuch mutationε in HIV-LP nef may produce a similar result. Mutations in the HIV-LP polymerase which reduce its efficiency (e.g. , binding affinity, enzyme activity) may reduce viral replication. Mutations in the transmembrane region may be engineered to inhibit the cytopathic effects induced by syncytia formation. Mutations in env may alter the target cells infected and thus, result in attenuation. Care must be taken to test the non-pathogenicity of any of these engineered strains and to minimize or prevent the posεibility of recombination in vivo and reverεion to wild type.

5.5.3. SUBUNIT VACCINES

One or more protein(ε) , polypeptide(s) or peptide(s) of HIV-LP may be formulated as an immunogen in subunit vaccine for ulationε, which may be multivalent. Subunit vaccineε co priεe εolely the relevant immunogenic material necessary to immunize a host. Accordingly, the relevant viral antigenε of HIV- LP may be purified from virions, prepared by recombinant DNA techniques, or by chemical synthetic methods and purified described in Section 5.2 supra. With respect to recombinant DNA methods, eukaryotic host cell expresεion εyεtems may be preferred for proper processing and glycosylation of HIV-LP gene products where such modification may be important; e.g. envelope. While any of the HIV-LP genes could be utilized to engineer suitable i munogens, all or portions of the polymerase (reverse tranεcriptaεe) , envelope, or gag genes may be preferred.

Whether purified from virions, made by recombinant DNA technology or chemically εyntheεized, when iεolated viral proteins, polypeptides or peptides are to be employed as vaccines, their immunogenicity can be enhanced by several orders of magnitude by coupling the protein to a εuitable carrier, incorporation into a lipoεome, or emulsification with an adjuvant. The most widely used adjuvants in man are aluminum salts (alum) , such as aluminum phosphate and aluminum hydroxide gel. However, the resulting immune response is not particularly prolonged, therefore, booster injections are required. Other adjuvants may include, but are not limited to surface active subεtances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions and potentially useful human adjuvantε εuch as BCG (bacille Calmette- Guerin) and Corvnebacterium parvuro.

5.5.4. RECOMBINANT LIVE VIRUS VACCINES

In an alternative approach, one or more HIV- LP gene sequences, or a desired portion(s) thereof, may be engineered into the genome of an avirulent virus that can be administered as a live recombinant vaccine. Cells in which the recombinant virus multiplies in vivo will produce the HIV-LP protein, polypeptide or peptide, against which the body will mount an immune reεponεe. For example, a recombinant live vaccinia viruε which expreεεeε one or more HIV-LP εtructural geneε (e.g.. env, gag) or viral enzymeε (e.g. , pol) , or portions thereof, can be engineered. To this end the HIV-LP coding sequence, controlled by a strong vaccinia virus promoter (e.g. , 7.5K promoter) can be inεerted within a noneεεential vaccinia viral gene (e.g. , TK, thymidine kinase) in a plasmid. When cultured mammalian cells are infected with wild-type vaccinia and the recombinant plasmid, recombination in vivo will occur between the vaccinia DNA and the plasmid DNA resulting in the production of recombinant virions which can be purified, and expanded by propagation in cell culture. (See, e.g. Mackett et al., 1982, Proc. Natl. Acad. Sci. USA 79: 7415-7419; Mackett et al., 1984, J. Virol. 49: 857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. USA 79: 4927-4931) . 6. EXAMPLE: THE ISOLATION OF A RETROVIRUS RELATED TO HIV-l AND HIV-2 FROM PATIENTS WITH CLINICAL AIDS

The εubεections below describe the isolation and characterization of a new retrovirus, related to but significantly different from HIV-l and HIV-2, isolated from a patient with clinical AIDS. Three HIV-

1,-2 seronegative individuals from New York City, two with known risk factors for acquiεition of HIV, with CD4+ T-cell depletion and clinical evidence of immune deficiency conεiεtent with Centerε for Diεeaεe Control definitionε of AIDS or AIDS-related complex were εtudied (CDC, 1987, Morbid. Mortal. Weekly Rep. 36:1S) . A brief clinical deεcription of theεe patientε, along with three related caεeε iε described in Section 7, infra.

6.1. CASE HISTORIES Patient 1 (Pt. 1) , the proband, is a 38 year- old white, sexually active homosexual male who presented in early 1990 with a six month hiεtory of malaiεe, oral candidiaεiε, and a cutaneous abscesε. CD4+ T-cell countε ranged from 552/mm³ to 230/mm³ (normal 880-1677/mm³) , with CD4:CD8 ratioε of 0.80 to 0.52 (normal 0.90-2.94) . DNA proliferative reεponεeε of peripheral blood mononuclear cells (PBMC) to mitogen (pokeweek and phytohe agglutinin (PHA) ) and antigen (tetanus toxoid) were <20% of normal controls. Serologies for HIV-l, -2 were negative by enzyme-linked immunoεorbent aεεay (ELISA) and immunoblotting, and for human T-cell lymphotropic viruε types I, II (HTLV-I, II) by immunoblotting, repeated in several labs over four years.

Patient 2 (Pt. 2) was a 73 year old Puerto Rican female whose only known risk factor for HIV was blood transfusionε in 1978. She preεented in late 1989 with weight loεε, diarrhea, left lower extremity edema and fever, and was found to have intestinal strongyloids, Pneu ocystiε carinii pneumonia, Kapoεi'ε εarcoma, and diεεeminated Mycobacterium tuberculoεiε. PBMC proliferative reεponses to mitogen were depressed. Serologies for HIV-l, -2 and HTLV-1/II were negative by ELISA and/or immunoblotting. The patient expired with a cerebral aneuryεm. Patient 3 (Pt. 3) waε a 47 year old white heteroεexual male, originally from εouthern Italy, who presented in mid-1990 with a clinical picture consiεtent with inflammatory bowel disease. He was treated with a one month course of oral glucocorticoids, which were discontinued after a diagnoεiε of cytomegaloviruε (CMV) colitiε waε made by biopεy, pre-εteroid therapy, of terminal ileum and cecum. Over the next three monthε he developed oral candidiasiε, Pneumocyεtis carinii pneumonia, multiple Herpes simplex cutaneous infections, and a profound waεting εyndrome. CD4+ T-cell countε were 76/mm³, with concomitant depreεεion of CD8 countε and T-cell lymphopenia. In vitro mitogen reεponεeε and εerum antibody response to pneu ococcal vaccination were markedly depresεed. Serologies for HIV-l,-2 and HTLV- I, II were negative by ELISA and/or immunoblotting. The patient expired in mid-1991.

6.2. ISOLATION AND PRELIMINARY CHARACTERIZATION OF HIV-LP

6.2.1. PRIMARY VIRAL ISOLATES For virus iεolation, PBMCε from Pt. 1 and Pt. 2 were cultivated in the preεence of PHA, or co- cultivated with equal numberε of normal donor PBMC pre- activated with PHA. One-half of the culture medium, containing interleukin-2 (IL-2) , was replaced with fresh medium every 3-4 days, and monitored for reverse tranεcriptaεe (RT) activity (Laurence et al., 1987, Science 235: 150) and HIV-l, -2 p24 Gag production. Primary cultureε from Pt. 1 gave no detectable RT or p24 antigen (Ag) over a 32-day culture period (FIG. IA) , aε contraεted with a representative primary culture from a known HIV-l seropositive individual, exhibiting maximal activity, by both methods, by day 14 (FIG. IB) . PBMCs from Pts. 1 and 2 were subsequently co-cultured with PHA-activated PBMCs from two different HIV-l seronegative healthy donors. A peak of RT activity was noted by day 28 for Pt. 1 (FIG. 1C) and day 10 for Pt. 2 (FIG. ID) . In contrast to the HIV-1+ control (FIG. IB) , and all reported retroviral isolations performed with HIV-l or -2 seropoεitive individualε (Laurence et al., 1990, Cell. Immunol. 128: 337) , where RT valueε parallel p24 Ag concentration, p24 Gag waε not identified in either patient co-culture (FIG. 1C and ID) .

6.2.2. VIRAL TRANSMISSION AND CYTOPATHICITY

Both cell-free and cell-associated transmission of this RT activity was observed. In two repreεentative experiments, 50 μl of filtered (0.2μ) εupernatant from cultureε at the height of RT activity were added to donor PHA-activated PBMC. RT activity waε observed by day 13-17 of culture (FIG. IE and IF) , again in the absence of Gag Ag. Similar results were obtained with Pt. 2 supernatantε. Cytopathic effectε typical of HIV-l were detected in many cultureε, with multinucleated giant cellε (FIG. 2) and extenεive cytolyεiε. For example, in the experiments of FIG. IE and IF there were 39.1 ± 5% viable cells (trypan blue vital dye exclusion method; Laurence, et al., 1990, Cell. Immunol. 128:337) in Pt. 1 supernatant-exposed cultures on day 15, compared to 87.0 ± 3% viability in control co-cultures.

6.2.3. PURIFICATION AND MORPHOLOGIC IDENTIFICATION OF VIRUS

A simultaneouε detection aεεay waε uεed to εegregate particulate RT activity from contaminating cellular DNA polymeraεeε. Supernatantε of Pt. 1 co- cultures were cleared by centrifugation at 1000 x g, layered over a diεcontinuous gradient of sucrose in TNE buffer (10 mM Tris-HCl, pH 7.4, 0.1 M NaCl, 1 mM EDTA) , and centrifuged at 33,000 rp in a SW41 rotor for 12h at 4°C, as deεcribed (Kacian, 1977, Methods Virol. 6: 143) . The RNA-directed DNA polymerase activity using a poly(rA) .oligo(dT) _12.1!( template (P-L Biochem. , Milwaukee, WI) peaked in fractions with a density between 1.12-1.16 g/ml. This iε characteristic of mammalian retroviruseε (Kacian, 1977, Methodε Virol. 6: 143) , and paralleled fractionation of an HIV-l control εupernatant.

6.2.4. CELLULAR TROPISM OF VIRUS ISOLATE

The tropiε of Pt. 1 iεolate waε determined by itε capacity to replicate in donor PBMC in the preεence or abεence of an anti-CD4 monoclonal antibody, Leu-3a, known to block CD4-dependent cell entry of HIV and SIV. Complete abrogation of RT activity waε obεerved in antibody-treated cultures.

6.2.5. ELECTRON MICROSCOPY Preliminary examination of ultra-thin sectionε of fixed pelletε from Pt. 1 cell co-cultures by electron microscopy revealed only occasional particleε of diameter 100-llOnm with morphologic εimilarities to HIV and SIV (FIG. 4) . No definitive membrane budding, intracellularly or extracellularly, waε noted, perhapε related to the low RT countε of theεe εampleε, aε compared with typical co-cultures of HIV-l.

6.3. ANALYSIS OF VIRAL ANTIGENS

6.3.1. IMMUNOPRECIPITATION OF VIRAL ANTIGENS

As noted above, serum samples from all three patients failed to react by ELISA and immunoblotting ₀ with Ags from HIV-l,-2 and HTLV- I, II; thiε is illustrated for HIV-l and Pts. 1 and 2 in FIG. 3A. Metabolic labeling of Pt. 1 iεolated-infected PBMC with [ ⁵S]cyεteine, immunoprecipitation of εoluble extracts from these cultureε, and εodium dodecyl εulfate- 5 polyacrylamide gel electrophoreεiε (SDS-PAGE) waε then performed. Serum from Pt. 1 precipitated four bandε, including molecules of molecular weight 130-140, 41 and 27 kD (FIG. 3B) . By analogy to HIV-l,-2, these may represent envelope, transmembrane, and group antigen o (core) structureε. Serum from εix of εeven HIV-l εeropositive donors and one HIV-2 seropoεitive donor failed to recognize any unique epitopes in Pt. 1 extracts; one of the HIV-1+ subjectε gave a radioimmunoprecipitation pattern similar to that of Pt. 5 1 serum (FIG. 3B) . Pt. 2 serum εimilarly recognized Agε. of Pt. 1 extracts.

6.3.2. SEROLOGIC REACTIVITIES Indirect immunofluorescence was performed ₀ with either mouse anti-human monoclonal antibodies counterεtained with fluoreεcein-conjugated F(ab')₂ fragmentε of goat anti-mouse IgG (Tago Inc. , Burlingame, CA) , or with a 1:20 dilution of human sera, then counterstained with fluoreεcein-conjugated F(ab')₂ 5 fragmentε of goat anti-human IgG, IgA and IgM (Cappel Laboratories, Cochranville, PA) . Details of these procedures have been previously described (Laurence et al., 1987, J. Clin. Invest. 80: 1631-9). Cells were analyzed by flow cytometry using an EPICS-V cytofluorograph.

Sera from other HIV-l seropositive individuals, selected for varying clinical manifestations of HIV-l diseaεe aε well aε differing dateε of initial diagnoεis, were also examined for the ability to recognize Pt. 1-εpecific membrane antigenε by indirect immunofluorescence aεεay. Sera from normal controlε, an HIV-l,-2 εeronegative and retroviruε culture negative individual with Pneumocyεtiε carinii pneumonia (Patient N, Table 1) , and an HIV-2 εeropoεitive reagent (L657, Table I) failed to recognize Pt. 1 infected PBMC (Table I) . However, one of 7 HIV-l positive sera εcreened did react with Pt. 1 infected PBMC (Table I) . An eεtimate of the percent infected cellε, determined by cytofluorimetry with Pt. 1 serum, was approximately 9%. This is in good agreement with the frequency of infected cells typically found in HIV-l infected PBMC cultures (Sarngardharan et al., 1984, Science 224: 506-8) . The reaction noted between Pt. 1 and HIV-l sera may be due either to cross reaction between Pt. 1 and HIV-l sera as observed for HIV-l and -2, or to co-infection of HIV-LP in patients infected with HIV-l. For example, in one large survey, croεε-reactionε againεt HIV-2 env glycoproteinε were observed by immunoblot in 10% and by RIPA in 40% of the HIV-l antibody positive sera

(Bottiger et al., 1990, J. Virol. 64: 3492-9) . Pt. 2 serum also recognized a significant proportion of Pt. 1 infected cells (Table I) . TABLE I

INDIRECT IMMUNOFLUORESCENCE ANALYSIS OF PBMC INFECTED WITH RT+ Pt. 1 SUPERNATANT

Serum εampleε were uεed at a 1:20 dilution. Indicator cell targets were from 3 week cultures of PHA-activated normal donor PBMC (PHA-PBMC) or PBMC infected with RT+ Pt. 1 supernatantε and

30 maintained for the same culture interval, representing the peak or RT activity.

35 6.4. MOLECULAR CHARACTERIZATION OF THE VIRUS

6.4.1. PCR ASSAYS

To further εtudy relationεhipε among HIV-l,- 2, Pt. 1 iεolate and material from Pts. 2 and 3, DNA was extracted from fresh PBMCs (Pts. 1 and 2) , paraffin-embedded lymphoid tissue (Pt. 3) , and viral co-cultures (Pts. 1 and 2) , then aεεayed for HIV-l,-2 gag and HIV-l tat by PCR. Thiε was first performed under conditions of εtringency (temperature, [Mg++]) appropriate for each primer pair, and a "hot εtart" protocol capable of detecting one molecule of HIV DNA in the presence of lμg of human DNA on an ethidiu - εtained gel (Mulliε, 1991, PCR Methods Applicationε 1: 1) . The gag primers amplify sequences conserved among all known HIV-l, -2 isolateε, permitting up to 2 miεmatches at the 3'-terminus (Kwok, et al., 1990, Nuc. Acidε Reε. 18:999; Ou, et al., 1988 Science 239: 295) . The tat primerε were of particular utility, capable of detecting HIV-l sequences in DNA extracted from multiple PBMC and paraffin-embedded tisεue εpecimenε from HIV-l εeropositive individuals.

In addition, DNA from Pt. 1 PBMC waε independently aεεeεεed by PCR for HIV-l gag and env (Dept. of Diagnoεticε Research, Cetus Corp., Emmeryville, CA) , and from Pt. 3 for HIV-l, -2 gag and pol (Dr. B. Poieεz, SUNY Health Science Center, Syracuεe, NY) . No HIV-l,-2 εequenceε were detected by theεe methodε (FIG. 5) . Upon lowering the εtringency for primer annealing, HIV-l,-2 related gag εignalε were detected in all samples tested, while only Pt. 3 gave a tat amplicon of expected εize (FIG. 5) .

A set of degenerate primer oligonucleotides capable of detecting pol gene εequenceε from HIV-l,-2 and SIV, as well as other mammalian lentiviruses with no croεε-reactivity with HTLV-I/II or human endogenouε retroviral εequenceε, was also used to probe DNA from Pts. 1 and 3. The two setε of degenerate primerε utilized were: LV1, 5 ^■-CCGGATCCDCAPyCCNGSAGGAPyTAMAA, and LV2, 5 '-GGTCTAGAPyPuPyAPuTTCATAACCCAKCCA, where D=G, T or A; Py=C or T, Pu=A or G, S=C or G; M=C or A; and LV3, 5 '-CCGGATCCGApyPuTPuGGKGAPyGCMTA, where K=G or T, and DDMY, 5 '-CCGGATCCPuTCPuTCCTPuTA. No product of expected εize (450bp) was noted on a first round of ₀ amplification under high stringency using primer pair LV1 and LV2, while second round amplification under high stringency with the nested primers LV3 and DDMY gave PCR products of anticipated size (254 bp) , as recognized by ethidiu bromide agarose electrophoreεiε. 5

6.4.2. DOT BLOT HYBRIDIZATION ASSAYS Dot-blot hybridizationε of HIV-l εtrain TIIIB RNA and RNA from ultracentrifuged εupernatantε from Pt. o co-cultures were then performed utilizing subgenomic DNA probes under conditions of varying stringency. Strong hybridization was εeen with one probe representing the entire 3 ' half of HIV-l under low stringency, with a weaker εignal detected using a more 5 restricted sequence (FIG. 6A and 6B) .

6.4.3. CLONING AND SEQUENCING OF VIRAL cDNA

Preliminary sequence information waε obtained by cloning of complementary DNA (cDNA) from the viral 0 RNA of Pt. 1 co-cultureε (FIG. 7A, 7B and 7C) , uεing eεtabliεhed procedureε (Clavel et al., 1986, Nature 324: 691) . In one region, a 215 baεe stretch of env- like sequenceε gave a 71% match with HIV-l isolate SF-2 (nucleotides 6612-6827, FIG. 7A) corresponding, at the 5 nucleotide level, to a relatively conεerved region, the gpl20 VI loop. In a εecond 274bp fragment there waε a 40.1% match with a region of the HIV-l long terminal repeat, including nef (FIG. 7B) . In a third fragment there waε a 56% match with the pol region (nucleotideε 3347-3524) of HIV-l (FIG. 7C) .

To identify the putative tat amplicon from Pt. 3 PCR product, a pre-εcreen, utilizing the TA Cloning Syεtem (Invitrogen, San Diego, CA) waε uεed prior to εequencing of the 142 bp product. A εequence ₀ identical to an HIV-l tat conεenεuε (Myerε et al., eds. Human Retroviruseε and AIDS 1991: a compilation and analyεiε of nucleic acid and amino acid sequences, Los Alamos National Lab., Los Alamos, NM, 1991) , except for

5 nucleotide changes (T for A at position 56, A for G 5 at 62, A for C at 88, C for G at 147 and G for C at position 149) , resulting in five amino acid alterationε, waε obtained. Finally, aε an additional assessment of this isolate'ε poεition among lentiviruses, codon uεage waε obtained for all o sequences derived to date. High A, low C content iε reεtricted to mammalian lenti- and εpumaviruses (Myers

6 Pavlakiε, In J. Levy, ed. HIV, Plenum, NY, 1992, p. 72) . For Pt. 1 iεolate env εequence (FIG. 7A) , A waε 31.5% and C 18.1%, which parallelε to that for HIV 5 (35.4% A, 17.8% C for SF-2) and spumaviruseε (mean 32.5% A, 19.1% C) (Myers & Pavlakis, In J. Levy, ed. HIV, Plenum, NY, 1992, p.72) .

6.5. ELISAs FOR HIV-LP 0 Based on these PCR and sequence data, a εearch for HIV Pol reactive antibodieε in Pt. 1 and 2 εera waε conducted uεing an epitope εcanning kit (Cambridge Research Biochemicals, Wilmington, DE) containing decapeptides spanning amino acid residues 5 144-536 of HIV-l clone HXB2 (Myers et al., eds. Human Retroviruseε and AIDS 1991: a compilation and analyεiε of nucleic acid and amino acid sequences, Los Alamos National Lab., Loε Alamoε, NM, 1991) , and an ELISA detection system previously described (Laurence, et al., 1984, N. Engl. J. Med. 311: 1269) . Strong reactivity was found with εeven decapeptideε (positivity defined as >3 SD above reactivity with normal εera) , including residues 294-303 (PLTEEAELEL) , which define a region recognized by several sera from HIV-l seropositive individuals (Laurence et al., 1987, Science 235: 1501) as well as monoclonal antibodies prepared from HIV-l Pol-immunized mice capable of specifically inhibiting the catalytic activity of HIV-l Pol (Orvell, et al., 1991, J.Gen. Virol. 72: 1913) . Similar techniques were applied to a preliminary ELISA screen of various sera with SDS lysateε of ultracentrifugeε pelletε from supernatants of Pt. 1 infected cultures. Strong reactivity was obtained with sera from Pts. 1 and 2, as well aε one of ten HIV-l εeropoεitive individualε at various clinical stageε of infection (optical denεity > 1.5 at serum dilutions of 1:100, with backgrounds from donor serum <0.2) . This latter reεult may reflect co-infection of the individual with both HIV-l and our novel HIV iεolate. Such aεεayε will be facilitated by uεe of Pt. 1 iεolate propagated in continuous cell lines and, indeed, low- level RT activity has been identified in HUT-78 CD4+ T- cells inoculated with this virus.

7. EXAMPLE: CLINICAL DESCRIPTION OF

AIDS PATIENTS INFECTED WITH HIV-LP

Five individuals from the New York City area, four with known risk factors for human immunodeficiency virus (HIV) infection, with profound CD4+ T-cell depletion and clinical syndromes consistent with definitions of AIDS-related complex or AIDS (CDC, 1987,

MMWR, 1987; 36: 1S-14S) are described. All lacked evidence of HIV-l,-2 infection, aε aεεeεεed by multiple εerologies over several years, εtandard viral co- cultures for HIV p24 Gag antigen, and proviral DNA amplification by polymerase chain reaction. Standard serologieε were performed for HIV-l by ELISA and immunoblotting, for HIV-2 by immunoblotting or competition peptide ELISA, and for human T-cell lymphotropic viruε types, I, II (HTLV-I, II) by immunoblotting. Viral iεolationε were attempted uεing peripheral blood mononuclear cellε (PBMC) co-cultured with phytohemagglutinin-activated normal donor PBMC in the preεence of interleukin-2 , with evidence for HIV activity sought by ELISA-based asεay for HIV-l, -2 p24 Gag in culture supernatantε. Further evidence for HIV waε εought by PCR-directed DNA amplification, uεing primers as outlined in each caεe.

Patientε 1, 2 and 3 are deεcribed in Section 6, εupra. Patient 4 iε a 37 year-old white male health care worker with a history of multiple heterosexual partners. Over the past two years he haε εuffered intractable cutaneouε papillomaviruε infections, Molluscum contagioεum, and Herpeε zoster. CD4+ T-cell countε have fluctuated from 120-200/mm³, with poor in vitro responseε to T and B cell mitogenε, and anergy to εeveral antigenε. Serologies for HIV-l, -2 and PCR for HIV-l,-2 gag have been negative.

Patient 5 is a 35 year-old Hispanic, sexually active homoεexual male who preεented with a three month history of chronic cough and dyspnea. Conversion of PPD skin test positivity was documented, and Mycobacterium tuberculosiε identified on thoracentesis of an extensive pleural effusion. A CD4+ T-cell count was 289/mm\ Repetitive HIV-l ELISAs, and PCR for HIV- 1,-2 gag sequenceε have been negative. These five cases, as well as two in the literature (Safai et al., Kaposi's sarcoma among HIV εeronegative high-riεk populationε. VII Intl. Conf. AIDS, florence, Italy, June 16-21, 1991, Abst. TuB83; Caεtro, et al., 1992, Lancet, 339: 868) , illuεtrate individualε with acquired cellular immune deficiencieε and clinical caεe hiεtorieε conεiεtent with AIDS or ARC, in the abεence of evidence for known retroviral ₀ infection by εerology, PCR-directed DNA amplification, and εtandard viral cultures. Given riεk factors for spread of HIV in many of theεe individualε, theεe caεeε raise the question of the existence of other agents lined to transmissible immune deficiencies which can 5 evade current laboratory detection techniques.

8. DEPOSIT OF MICROORGANISMS The following microorganiεmε have been deposited with the American Type Culture Collection, o (ATCC) , Rockville, Maryland and have been asεigned the following acceεεion numberε:

Microorganiεm Date of Deposit Accesεion No.

HIV-LP June 12, 1992 VR 2374

JS-2 June 12, 1992 69012 5 JS-8 June 12, 1992 69013

JS-5 June 12, 1992 69011

JS-3 June 18, 1992 69018

The preεent invention iε not to be limited in scope by the microorganisms deposited since the 0 depoεited embodiments are intended as illustrationε of εingle aεpectε of the invention and any microorganisms which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those shown and described 5 herein will become apparent to thoεe εkilled in the art from the foregoing deεcription and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

It is also to be understood that all base pair εizes given for nucleotides are approximate and are used for purpoεeε of deεcription.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Gelman, Ir in H.

Laurence, Jeffrey C.

(ii) TITLE OF INVENTION: A Novel Human Immunodeficiency Virus

(iii) NUMBER OF SEQUENCES: 3

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Pennie & Edmonds

(B) STREET: 1155 Avenue of the Americas

(C) CITY: New York

(D) STATE: New York

(E) COUNTRY: U.S.A.

(F) ZIP: 10036-2711

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk.

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Misrock, S. Leslie

(B) REGISTRATION NUMBER: 18,872

(C) REFERENCE/DOCKET NUMBER: 6923-023

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 212 790-9090

(B) TELEFAX: 212 869-8864/9741

(C) TELEX: 66141 PENNIE

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 215 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

AAGCTTAGAG TCTTGGATCT AGTGACATTC TTATATTTGC TTTCCTTTAT ATTGTGGTAT 60

ATTTTTGAGC TTAATTATTA AACATAAATA CTCATCAAGG TCAAGGATCT GAAATCCCAT 120

TCAGAAAGAA AATGCAACAA TTGGAACCCT GTGCAACCTA GAAGACATTG GGCACTGAAT 180

AAAGTGGATT TCCAGGAGCT CTCCGTTTGC AACTC 215 (2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 274 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

TGGTTGCGTG GCTCATGCCT GTAATCTAAG CACTTTGGGA GGCCAAGGTG GGAAGATTGC 60

TTGAGCCCAG TAGTTGGAGA CCAGGCTAGG CAACGTGGAG AGACCCAATC TCTACAAAAA 120

TTTTAAAAAT GAGCTGAGTG TGGTAGATCA CGACTGTGGC CCTGCTACTC TGGAGGCCGA 180

GGCAAGAGGA TTCCCTGAGC TCAGGAGGTT GAGGCTCGAC TGAGCCATGA TCACACCACT 240

GCACTCCAGC CTGGCAACAG GTAGAGCCAT GTTT 274 (2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 169 base pairs _,

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

GGTAGGACAG GCAACAGACT ACAAAGGAAA CATAAAGTAA GGAATCCCCC AGGGACTAGA 60

CAAAGGGAAA TTACCAAAAG AAAATAAATA GGATAAGGAA AATAAGAAAA GAAATCAACC 120

TTTTGATTCA TCGGAAAAAA GTACAAAAAA AAACCAAAAT CCAGGATTC 169

International Application No: PCT/

International Application No: PCT/ /

Form PCT/R0/134 (cont.)

American Type Culture Collection 2301 Parklawn Drive Rockville. MD 10582 US

Accession No. Date of Deposit 6901 1 June 12, 1992 69012 June 12, 1992 69013 June 12, 1992 VR 2374 June 12, 1992

Claims

WHAT IS CLAIMED IS:

1. A purified HIV-LP virus.

2. A non HIV-l, -2 human retrovirus that immunologically cross-reacts with an antibody to the HIV-LP isolate as deposited with the ATCC and assigned accession no. VR 2374.

A cultured cell infected with HIV-LP.

A continuous cell line infected with

HIV-LP.

5. An isolated HIV-LP polynucleotide, the sequence of which corresponds to the HIV-LP genome or provirus.

6. The isolated polynucleotide of Claim 5 which comprises RNA.

7. The isolated polynucleotide of Claim 5 which comprises DNA.

8. An oligonucleotide having a sequence complementary to a portion of the HIV-LP genome or provirus.

9. An oligonucleotide which is capable of hybridizing under stringent conditions to a portion of the HIV-LP genome or provirus.

10. A recombinant DNA vector containing a nucleotide sequence that encodes an HIV-LP gene product or an epitope thereof. 11. A recombinant DNA vector containing a nucleotide sequence that encodes a fusion protein comprising an HIV-LP gene product or an epitope thereof fused to a heterologous polypeptide.

12. The recombinant DNA vector of Claim 10 in which the nucleotide sequence that encodes the HIV- LP gene product or epitope thereof is operatively associated with a regulatory sequence that controls gene expression in a host.

13. The recombinant DNA vector of Claim 11 in which the nucleotide sequence that encodes the fusion protein is operatively associated with a regulatory sequence that controls gene expression in a host.

14. The recombinant DNA vector of Claim 10, 11, 12 or 13 in which the HIV-LP gene product is the envelope protein.

15. The recombinant DNA vector of Claim 10, 11, 12 or 13 in which the HIV-LP gene product is the transmembrane protein.

16. The recombinant DNA vector of Claim 10, 11, 12 or 13 in which the HIV-LP gene product is the core protein.

17. The recombinant DNA vector of Claim 10,

11, 12 or 13 in which the HIV-LP gene product is the reverse transcriptase.

18. The recombinant DNA vector of Claim 10,

11, 12 or 13 which is capable of hybridizing under stringent conditions, or which would be capable of hybridizing under stringent conditions but for the degeneracy of the genetic code to the HIV-LP env gene.

19. The recombinant DNA vector of Claim 10,

11, 12 or 13 which is capable of hybridizing under stringent conditions, or which would be capable of hybridizing under stringent conditions but for the degeneracy of the genetic code to the HIV-LP gag gene.

20. The recombinant DNA vector of Claim 10, 11, 12 or 13 which is capable of hybridizing under stringent conditions, or which would be capable of hybridizing under stringent conditions but for the degeneracy of the genetic code to the HIV-LP pol gene.

21. A host cell transformed with the recombinant DNA vector of Claim 10, 11, 12, or 13.

22. A method for producing an HIV-LP gene product or epitope thereof, comprising:

(a) culturing a host cell transformed with the recombinant DNA expression vector of Claim 12 and which expresses the HIV-LP gene product or epitope thereof; and

(b) recovering the expressed product from the cell culture.

23. A method for producing fusion protein comprising an HIV-LP gene product, or epitope thereof, fused to a heterologous peptide, comprising: (a) culturing a host cell transformed with the recombinant DNA expression vector of Claim 13 , and which expresses the fusion protein; and (b) recovering the fusion protein from the cell culture.

24. The method of Claim 22 or 23 in which the HIV-LP gene product is the envelope protein.

25. The method of Claim 22 or 23 in which the HIV-LP gene product is the transmembrane protein.

26. The method of Claim 22 or 23 in which the HIV-LP gene product is the core protein.

27. The method of Claim 22 or 23 in which the HIV-LP gene product is the reverse transcriptase.

28. The method of Claim 22 or 23 in which the recombinant DNA vector is capable of hybridizing under stringent conditions, or would be capable of hybridizing under stringent conditions but for the degeneracy of the genetic code, to the HIV-LP env gene.

29. The method of Claim 22 or 23 in which the recombinant DNA vector is capable of hybridizing under stringent conditions, or would be capable of hybridizing under stringent conditions but for the degeneracy of the genetic code, to the HIV-LP gag gene.

30. The method of Claim 22 or 23 in which the recombinant DNA vector is capable of hybridizing under stringent conditions, or would be capable of hybridizing under stringent conditions but for the degeneracy of the genetic code, to the HIV-LP pol gene. 31. A peptide, polypeptide or protein encoded by the genome of HIV-LP.

32. The peptide, polypeptide or protein of

Claim 31 which contains an epitope of HIV-LP.

33. The peptide, polypeptide or protein of Claim 31 that immunologically cross reacts with an antibody to the HIV-LP isolate as deposited with the ATCC and assigned accession no. VR 2374.

34. The peptide, polypeptide or protein of Claim 31, 32 or 33 having an amino acid sequence homologous to the envelope protein of HIV-LP.

35. The peptide, polypeptide or protein of Claim 31, 32 or 33 having an amino acid sequence homologous to the transmembrane protein of HIV-LP.

36. The peptide, polypeptide or protein of

Claim 31, 32 or 33 having an amino acid sequence homologous to the core protein of HIV-LP.

37. The peptide, polypeptide or protein of

Claim 31, 32 or 33 having an amino acid sequence homologous to the reverse transcriptase of HIV-LP.

38. A fusion protein comprising an HIV-LP gene product, or an epitope thereof, fused to a heterologous polypeptide.

39. The fusion protein of Claim 38 that immunologically cross reacts with an antibody to the HIV-LP isolate as deposited with the ATCC and assigned accession no. VR 2374. 40. The fusion protein of Claim 38 in which the HIV-LP gene product has an amino acid sequence homologous to the envelope protein of HIV-LP.

41. The fusion protein of Claim 38 in which the HIV-LP gene product has an amino acid sequence homologous to the transmembrane protein of HIV-LP.

10 42. The fusion protein of Claim 38 in which the HIV-LP gene product has an amino acid sequence homologous to the core protein of HIV-LP.

43. The fusion protein of Claim 38 in which ■_j_5 the HIV-LP gene product has an amino acid sequence homologous to the reverse transcriptase protein of HIV- LP.

44. An isolated antibody that

2o immunospecifically binds to an epitope of HIV-LP.

45. An isolated antibody that immunospecifically binds to a serological marker of HIV-LP.

25

46. The antibody of Claim 44 or 45 which is polyclonal.

47. The antibody of Claim 44 or 45 which is 3₀ monoclonal.

48. A method for detecting HIV-LP nucleic acids in a sample, comprising

(a) reacting nucleic acids of the 35 sample with an oligonucleotide probe for HIV-LP under conditions which allow the formation of a polynucleotide duplex between the probe and HIV-LP nucleic acid in the sample; and

(b) detecting a polynucleotide duplex which contains the probe as an indication of the presence of HIV- LP nucleic acids in the sample.

49. The method according to Claim 48 in which the HIV-LP nucleic acid in the sample is amplified.

50. A kit for analyzing sample for the presence of nucleic acids derived from HIV-LP comprising an oligonucleotide probe of Claim 8 or 9 in a suitable container.

51- The kit of Claim 50 which additionally contains a polymerase to amplify the HIV-LP nucleic acids.

52. An immunoassay for HIV-LP antigen, in a sample, comprising

(a) contacting the sample with an antibody that immunospecifically binds to an epitope of HIV-LP under conditions which allow formation of antibody-antigen complex; and

(b) detecting antibody-antigen complex in the sample as an indication of the presence of HIV-LP antigen in the sample. 53. An immunoassay for antibodies to HIV-LP in a sample, comprising

(a) contacting the sample with a 5 peptide, polypeptide, protein or fusion protein containing an HIV-LP epitope under conditions which allow formation of antibody-antigen complex; and •_jLo (b) detecting antibody-antigen complex in the sample as an indication of the presence of antibody to HIV-LP in the sample.

!5 54. The immunoassay of Claim 52 or 53 in which the HIV-LP epitope is an envelope epitope.

55. The immunoassay of Claim 52 or 53 in which the HIV-LP epitope is a transmembrane epitope.

20

56. The immunoassay of Claim 52 or 53 in which the HIV-LP epitope is a core protein epitope.

57. The immunoassay of Claim 52 or 53 in 25 which the HIV-LP epitope is a reverse transcriptase epitope.

58. An immunoassay kit for analyzing samples for the presence of HIV-LP antigen comprising an

₃₀ antibody that immunospecifically binds to an epitope of HIV-LP, in a suitable container.

59. An immunoassay kit for analyzing samples for the presence of antibodies to HIV-LP, comprising a

35 peptide, polypeptide, protein or fusion protein containing an epitope of HIV-LP, in a suitable container.

60. An HIV-LP, vaccine formulation, comprising an immunogenically effective dose of inactivated HIV-LP in a pharmaceutically acceptable carrier.

61. An HIV-LP vaccine formulation, comprising an immunologically effective dose of attenuated HIV-LP in a pharmaceutically acceptable carrier.

62. An HIV-LP vaccine formulation, comprising an immunogenically effective dose of a peptide, polypeptide, protein or fusion protein containing an HIV-LP antigen in a pharmaceutically acceptable carrier.

63. An HIV-LP vaccine formulation comprising an immunologically effective dose of a recombinant virus which directs the expression of an HIV-LP epitope, in a pharmaceutically acceptable carrier.