WO1993015200A1 - Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium - Google Patents

Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium Download PDF

Info

Publication number
WO1993015200A1
WO1993015200A1 PCT/FR1993/000087 FR9300087W WO9315200A1 WO 1993015200 A1 WO1993015200 A1 WO 1993015200A1 FR 9300087 W FR9300087 W FR 9300087W WO 9315200 A1 WO9315200 A1 WO 9315200A1
Authority
WO
WIPO (PCT)
Prior art keywords
vwf
polypeptide
residues
plasmid
sequence
Prior art date
Application number
PCT/FR1993/000087
Other languages
French (fr)
Inventor
Reinhard Fleer
Alain Fournier
Jean-Dominique Guitton
Gérard Jung
Patrice Yeh
Original Assignee
Rhone-Poulenc Rorer S.A.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rhone-Poulenc Rorer S.A. filed Critical Rhone-Poulenc Rorer S.A.
Priority to JP5512988A priority Critical patent/JPH07503369A/en
Priority to EP93904131A priority patent/EP0625199A1/en
Publication of WO1993015200A1 publication Critical patent/WO1993015200A1/en
Priority to FI943565A priority patent/FI943565A/en
Priority to NO942840A priority patent/NO942840L/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76—Albumins
    • C07K14/765—Serum albumin, e.g. HSA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/745—Blood coagulation or fibrinolysis factors
    • C07K14/755—Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

Abstract

Recombinant polypeptides consisting of an adhesive portion derived from the structure of the vWF which is at least partially antagonistic to the bond between said vWF and the platelets and/or the subendothelium, as well as a portion for stabilising and presenting it $i(in vivo); preparation thereof; and pharmaceutical compositions containing said polypeptides.

Description

POLYPEPTIDES ANTITHROMBOTIQUES , ANTAGONISTES DE LA LIAISON DU VWF AUX PLAQUETTES ET/OU AU SOUS-ENDOTHELIUM.ANTITHROMBOTIC POLYPEPTIDES, ANTAGONISTS OF THE VWF BINDING TO PLATELETS AND / OR THE SUBENDOTHELIUM.
La présente invention concerne de nouveaux polypeptides antithrombotiques, leur préparation et des compositions pharmaceutiques les contenant. Plus particulièrement, la présente invention concerne de nouveaux polypeptides comportant une partie dérivée de la structure du facteur de von Willebrand (vWF) et intrinsèquement capable de se fixer aux plaquettes sanguines et/ou au sous-endothélium.The present invention relates to new antithrombotic polypeptides, their preparation and pharmaceutical compositions containing them. More particularly, the present invention relates to new polypeptides comprising a part derived from the structure of von Willebrand factor (vWF) and intrinsically capable of binding to blood platelets and / or to the subendothelium.
Le vWF est une protéine glycosylée de 2813 acides aminés comprenant une séquence signal de 22 résidus, un région "pro" de 741 résidus et une protéine mature de 2050 acides aminés organisée en plusieurs structures répétées [Titani K. et al., Biochemistry 25 (1986) 3171-3184; Verweij CL. et al., EMBO J. 5 (1986) 1839- 1847]. Cette glycoprotéine complexe est présente in vivo, soit stockée dans des vésicules spécialisées des cellules endotheliales ou des plaquettes, soit sous forme circulante dans le plasma sanguin après sécrétion et maturation protéolytique lors du processus de sécrétion. Les formes circulantes du vWF sont présentes sous la forme de multimères de haut poids moléculaire (jusqu'à 20 000 kDa) et dont le protomère est un dimère d'environ 450 kDa. Le gène du vWF a été clone et séquence par plusieurs équipes et mappé sur le bras court du chromosome 12 [Sadler J.E. et al., Proc. Natl. Acad. Sci. £2 (1985) 6394-6398; Verweij CL. et al., EMBO J. 5_ (1986) 1839-1847; Shelton-Inloes B.B. et al., Biochemistry 2£ (1986) 3164-3171; Bonthron D. et al., Nucleic Acids Res. XZ (1986) 7125-7127; Ginsburg D. et al., Science 22£ (1985) 1401-1406].VWF is a glycosylated protein of 2813 amino acids comprising a signal sequence of 22 residues, a "pro" region of 741 residues and a mature protein of 2050 amino acids organized in several repeated structures [Titani K. et al., Biochemistry 25 ( 1986) 3171-3184; Verweij CL. et al., EMBO J. 5 (1986) 1839-1847]. This complex glycoprotein is present in vivo, either stored in specialized vesicles of endothelial cells or platelets, or in circulating form in the blood plasma after secretion and proteolytic maturation during the secretion process. The circulating forms of vWF are present in the form of multimers of high molecular weight (up to 20,000 kDa) and the protomer of which is a dimer of approximately 450 kDa. The vWF gene has been cloned and sequenced by several teams and mapped to the short arm of chromosome 12 [Sadler J.E. et al., Proc. Natl. Acad. Sci. £ 2 (1985) 6394-6398; Verweij CL. et al., EMBO J. 50 (1986) 1839-1847; Shelton-Inloes B.B. et al., Biochemistry 2 £ (1986) 3164-3171; Bonthron D. et al., Nucleic Acids Res. XZ (1986) 7125-7127; Ginsburg D. et al., Science 22 £ (1985) 1401-1406].
Le vWF est impliqué dans la genèse des thrombus artériels par une interaction complexe et mal comprise entre certains composants du sous- endothélium d'une part et les plaquettes sanguines d'autre part (et notamment les récepteurs GPlb plaquettaires). Un point important est que le vWF plasmatique circulant ne lie pas spontanément les récepteurs GPlb des plaquettes, et il est vraisemblable que son interaction avec le sous-endothélium soit nécessaire pour démasquer son (ses) site(s) d'interaction avec les plaquettes, par exemple à la suite d'un changement conformationnel du vWF. L'interaction entre le vWF ainsi activé et les GPlb plaquettaires conduit à l'activation des plaquettes sanguines qui acquièrent alors la capacité de s'aggréger et de générer un thrombus fibrino-cellulaire en présence de certaines protéines adhésives (fibrinogène, thrombospondine, vWF etc.).VWF is involved in the genesis of arterial thrombi by a complex and poorly understood interaction between certain components of the subendothelium on the one hand and blood platelets on the other (and in particular platelet GP1b receptors). An important point is that the circulating plasma vWF does not spontaneously bind the GPlb receptors of platelets, and it is likely that its interaction with the subendothelium is necessary to unmask its site (s) of interaction with platelets, for example following a conformational change in the vWF. The interaction between the vWF thus activated and platelet GPlb leads to the activation of blood platelets which then acquire the ability to aggregate and generate a fibrino-cellular thrombus in the presence of certain adhesive proteins (fibrinogen, thrombospondin, vWF etc.).
Compte tenu de son rôle précoce dans l'activation plaquettaire, le vWF constitue une cible pharmacologique de choix pour la réalisation d'agents antithrombotiques. Toutefois, de nombreuses difficultés doivent être surmontées pour pouvoir exploiter cette molécule sur le plan pharmacologique : l'incapacité du vWF circulant à lier les plaquettes, la méconnaissance de la contribution respective des différentes fonctions adhésives du vWF (sous-endothélium et plaquettes) dans son activité thrombogénique, la difficulté de produire à des niveaux suffisamment élevés des produits suffisamment purs et homogènes pour pouvoir être utilisés comme agents thérapeutiques, la taille importante du vWF et sa complexité, la dynamique de sa structure tertiaire, etc.. Certains fragments du vWF ont été obtenus par digestion protéolytique et étudiés sur le plan pharmacologique. Des fragments recombinants ont également été produits [EP 255 206 ; Sugimoto M. et al., Biochemistry 2Q (1991) 5202-5209 ; Azuma H. et al., J. Biol. Chem. 2£é (1991) 12342-12347]. Il ressort de ces études que les molécules obtenues ne sont pas totalement satisfaisantes, et en particulier, ne se comportent pas comme des antagonistes optimaux de l'interaction vWF-plaquettes en l'absence de certains ligands non physiologiques (tels que la ristocétine ou la botrocétine par exemple), ou encore doivent être modifiés chimiquement (réduction et alkylation par exemple), probablement pour démasquer les sites cryptiques de liaison du vWF à la GPlb plaquettaire.Given its early role in platelet activation, vWF constitutes a pharmacological target of choice for the production of antithrombotic agents. However, many difficulties must be overcome to be able to exploit this molecule on the pharmacological level: the inability of circulating vWF to bind platelets, the ignorance of the respective contribution of the different adhesive functions of vWF (subendothelium and platelets) in its thrombogenic activity, the difficulty of producing at sufficiently high levels sufficiently pure and homogeneous products to be able to be used as therapeutic agents, the large size of the vWF and its complexity, the dynamics of its tertiary structure, etc. Some fragments of the vWF have were obtained by proteolytic digestion and studied pharmacologically. Recombinant fragments have also been produced [EP 255,206; Sugimoto M. et al., Biochemistry 2Q (1991) 5202-5209; Azuma H. et al., J. Biol. Chem. 2 £ (1991) 12342-12347]. It emerges from these studies that the molecules obtained are not completely satisfactory, and in particular, do not behave as optimal antagonists of the vWF-platelet interaction in the absence of certain non-physiological ligands (such as ristocetin or botrocetin for example), or else must be chemically modified (reduction and alkylation for example), probably to unmask the cryptic binding sites of vWF to platelet GPlb.
La présente invention fournit de nouvelles molécules intrinsèquement capables d'antagoniser au moins partiellement l'activation plaquettaire. Les molécules de l'invention comportent une partie adhesive dérivée de la structure du vWF et une partie permettant sa présentation fonctionnelle et assurant la stabilité et la distribution in vivo de la molécule. La demanderesse a en effet montré qu'il est possible de coupler génétiquement le vWF à une structure de nature protéique, et de produire de telles molécules à des niveaux satisfaisants. Les molécules de l'invention permettent de plus de générer et d'utiliser de petites structures dérivées du vWF et donc très spécifiques d'un effet recherché (par exemple antagonistes de la seule interaction vWF-GPlb). La demanderesse a par ailleurs montré qu'un tel couplage favorisait la présentation de cette structure à son/ses sites de liaison. Les polypeptides de l'invention permettent donc d'exposer, au sein d'une structure stable, des structures dérivées du vWF capables d'antagoniser au moins partiellement la liaison du vWF aux plaquettes, et de ce fait d'inhiber l'activation plaquettaire. Les polypeptides de l'invention permettent également d'exposer, au sein d'une structure stable, des structures dérivées du vWF capables d'antagoniser au moins partiellement la liaison du vWF au sous-endothélium.The present invention provides new molecules intrinsically capable of at least partially antagonizing platelet activation. The molecules of the invention comprise an adhesive part derived from the structure of vWF and a part allowing its functional presentation and ensuring the stability and in vivo distribution of the molecule. The Applicant has indeed shown that it is possible to genetically couple vWF to a structure of protein nature, and to produce such molecules at satisfactory levels. The molecules of the invention also make it possible to generate and use small structures derived from vWF and therefore very specific for a desired effect (for example antagonists of the sole vWF-GPlb interaction). The Applicant has also shown that such coupling promotes the presentation of this structure at its link site (s). The polypeptides of the invention therefore make it possible to exhibit, within a stable structure, structures derived from vWF capable of at least partially antagonizing the binding of vWF to platelets, and therefore of inhibiting platelet activation . The polypeptides of the invention also make it possible to expose, within a stable structure, structures derived from vWF capable of at least partially antagonizing the binding of vWF to the subendothelium.
Un objet de la présente invention concerne donc des molécules comportant une partie adhesive dérivée de la structure du vWF capable d'antagoniser au moins partiellement la liaison du vWF aux plaquettes et/ou au sous-endothélium, et une partie de nature protéique permettant sa stabilisation et sa présentation in vivo.An object of the present invention therefore relates to molecules comprising an adhesive part derived from the structure of vWF capable of at least partially antagonizing the binding of vWF to platelets and / or to the subendothelium, and a part of a protein nature allowing its stabilization. and its presentation in vivo.
Plus particulièrement, dans les molécules de l'invention, la partie adhesive est constituée par tout ou partie de la séquence peptidique comprise entre les résidus 445-733 du vWF ou d'un variant de celle-ci. La séquence peptidique du vWF ayant été publiée, la numérotation des résidus de la partie adhesive des molécules de l'invention se réfère à la numérotation de la séquence du vWF publiée par Titani et al. [Biochemistry 2£ (1986) 3171-3184]. Il est entendu que cette fonction peut être redondante au sein des molécules de la présente invention. Une partie de cette séquence du vWF (résidus Thr470 à Val713) est indiquée à la Figure 1, dans laquelle elle est couplée en C-terminal de la sérum-albumine humaine.More particularly, in the molecules of the invention, the adhesive part consists of all or part of the peptide sequence comprised between residues 445-733 of vWF or a variant thereof. The peptide sequence of vWF having been published, the numbering of the residues of the adhesive part of the molecules of the invention refers to the numbering of the sequence of vWF published by Titani et al. [Biochemistry 2 £ (1986) 3171-3184]. It is understood that this function can be redundant within the molecules of the present invention. Part of this sequence of vWF (residues Thr470 to Val713) is indicated in Figure 1, in which it is coupled at the C-terminal of human serum albumin.
Au sens de la présente invention, le terme variant désigne toute molécule obtenue par modification de la séquence capable d'antagoniser au moins partiellement la liaison du vWF aux plaquettes et/ou au sous-endothélium. Par modification, on doit entendre toute mutation, substitution, délétion, addition ou modification obtenue, par exemple, au moyens des techniques du génie génétique. De tels variants peuvent être générés dans des buts différents, tels que notamment celui d'augmenter l'affinité de la molécule pour son (ses) site(s) de fixation, celui d'améliorer ses niveaux de production, celui de réduire sa susceptibilité à des proteases, celui d'augmenter son efficacité thérapeutique ou encore de réduire ses effets secondaires, ou celui de lui conférer de nouvelles propriétés pharmacocinétiques ou biologiques telles que notamment des fonctions adhésives exprimée de façon intrinsèquement non cryptique.Within the meaning of the present invention, the term variant designates any molecule obtained by modification of the sequence capable of at least partially antagonizing the binding of vWF to platelets and / or to the subendothelium. By modification, one must understand any mutation, substitution, deletion, addition or modification obtained, for example, by means of genetic engineering techniques. Such variants can be generated for different purposes, such as in particular that of increasing the affinity of the molecule for its site (s) of fixation, that of improving its production levels, that of reducing its susceptibility to proteases, that of increasing its therapeutic effectiveness or of reducing its side effects, or that of imparting new properties to it pharmacokinetics or biology such as in particular adhesive functions expressed in an intrinsically non-cryptic manner.
Des polypeptides de l'invention particulièrement avantageux sont ceux dans lesquels la partie adhesive présente: (a) la séquence peptidique comprise entre les résidus 445-733 du vWF, ou,Particularly advantageous polypeptides of the invention are those in which the adhesive part has: (a) the peptide sequence comprised between residues 445-733 of vWF, or,
(b) une partie de la séquence peptidique (a) capable d'antagoniser au moins partiellement la liaison du vWF au GPlb et/ou au sous-endothélium, ou,(b) part of the peptide sequence (a) capable of at least partially antagonizing the binding of vWF to GPlb and / or to the subendothelium, or,
(c) une structure dérivée des structures (a) ou (b) par modifications structurales (mutation, substitution addition et/ou délétion d'un ou plusieurs résidus) et capable d'antagoniser au moins partiellement la liaison du vWF au GPlb et ou au sous-endothélium, ou,(c) a structure derived from structures (a) or (b) by structural modifications (mutation, substitution addition and / or deletion of one or more residues) and capable of at least partially antagonizing the binding of vWF to GPlb and or at the subendothelium, or,
(d) une séquence peptidique non naturelle, par exemple isolée à partir de banques peptidiques et capable d'antagoniser au moins partiellement la liaison du vWF au GPlb et/ou au sous-endothélium. Parmi les structures du type (b), on peut citer plus particulièrement celles ayant conservé la capacité d'antagoniser l'interaction entre le vWF et la GPlb plaquettaire, telles que par exemple les peptides G10 ou D5 décrits par Mori et al. [J. Biol. Chem. 2£3_ (1988) 17901-17904], ou les peptides ayant conservé la capacité de lier le collagène [Pareti F.I. et al., J. Biol. Chem. 26_1 (1986) 15310-15315 ; Roth GJ. et al. Biochemistry 2£ (1986) 8357-8361], et ou l'héparine [Fujimura Y. et al. J. Biol. Chem. 26 (1987) 1734-1739] et/ou la botrocétine [Sugimoto M. et al., J. Biol. Chem. 26i> (1991) 18172-18178], et/ou les sulfatides [Christophe O. et al. Blood 7£ (1991) 2310-2317] et ou la ristocétine etc., ou toute combinaison entre ces différentes fonctions adhésives. Les structures du type (c) comprennent par exemple les molécules dans lesquelles certains sites de N- ou O-glycosylation ont été modifiés ou supprimés, ainsi que les molécules dans lesquelles un, plusieurs, voire tous les résidus cystéine ont été substitués, ou encore des mutants ponctuels et/ou multiples concernant au moins un résidu impliqué dans des pathologies de type HB associées au vWF comme les résidus Arg543, Arg545, Trp550, Val553 ou Arg578 par exemple. Elles comprennent également des molécules obtenues à partir de (a) ou (b) par délétion de régions n'intervenant pas ou peu dans l'interaction avec les sites de liaison considérés, et des molécules comportant par rapport à (a) ou (b) des résidus supplémentaires, tels que par exemple une méthionine N-terminale et/ou une séquence signal de sécrétion et ou un adaptateur polypeptidique permettant la jonction à la structure stabilisatrice.(d) an unnatural peptide sequence, for example isolated from peptide libraries and capable of at least partially antagonizing the binding of vWF to GPlb and / or to the subendothelium. Among the structures of type (b), mention may be made more particularly of those which have retained the capacity to antagonize the interaction between vWF and platelet GPlb, such as for example the peptides G10 or D5 described by Mori et al. [J. Biol. Chem. 2 £ 3_ (1988) 17901-17904], or the peptides which have retained the capacity to bind collagen [Pareti FI et al., J. Biol. Chem. 26_1 (1986) 15310-15315; Roth GJ. et al. Biochemistry 2 £ (1986) 8357-8361], and or heparin [Fujimura Y. et al. J. Biol. Chem. 26 (1987) 1734-1739] and / or botrocetin [Sugimoto M. et al., J. Biol. Chem. 26i> (1991) 18172-18178], and / or the sulfatides [Christophe O. et al. Blood 7 £ (1991) 2310-2317] and or ristocetin etc., or any combination of these different adhesive functions. Structures of type (c) include, for example, molecules in which certain N- or O-glycosylation sites have been modified or deleted, as well as molecules in which one, more, or even all of the cysteine residues have been substituted, or alternatively point and / or multiple mutants relating to at least one residue involved in HB-type pathologies associated with vWF such as residues Arg543, Arg545, Trp550, Val553 or Arg578 for example. They also include molecules obtained from (a) or (b) by deletion of regions having little or no involvement in the interaction with the binding sites considered, and molecules comprising, with respect to (a) or (b ) additional residues, such as for example an N-terminal methionine and / or a signal secretion sequence and or a polypeptide adapter allowing junction to the stabilizing structure.
A titre d'exemple on peut citer des polypeptides de l'invention comportant la structure stabilisatrice couplée: - à un peptide de type PI dont la version minimale correspond au peptideBy way of example, mention may be made of polypeptides of the invention comprising the stabilizing structure coupled: - to a peptide of PI type, the minimum version of which corresponds to the peptide
G10 compris entre les résidus Cys474 et Pro488 du vWF, ou,G10 between residues Cys474 and Pro488 of vWF, or,
- à un peptide de type P2 dont la version minimale correspond au peptide D5 compris entre les résidus Leu694 et Pro708 du vWF ou,- a P2 type peptide whose minimum version corresponds to the D5 peptide between the residues Leu694 and Pro708 of the vWF or,
- à un peptide de type X ou XD qui correspondent respectivement au fragment du vWF compris entre les résidus Pro488 et Leu694, et ses variants obtenus par délétion, ou,- a peptide of type X or XD which respectively correspond to the fragment of vWF comprised between the residues Pro488 and Leu694, and its variants obtained by deletion, or,
- à un peptide de type X* défini comme tout variant moléculaire des peptides de type X et XD , ou, à toute combinaison de ces peptides, et entre autres : - les peptides de type P1-P2 ;- a peptide of type X * defined as any molecular variant of peptides of type X and XD, or, to any combination of these peptides, and among others: - peptides of type P1-P2;
- les peptides de type Pl-X, Pl-XD, Pl-X* ;- peptides of the Pl-X, Pl-XD, Pl-X * type;
- les peptides de type X-P2, XD-P2, X*-P2 ;- peptides of type X-P2, XD-P2, X * -P2;
- les peptides de type P1-X-P2 ;- P1-X-P2 type peptides;
- les peptides de type P1-XD-P2 ; - les peptides de type Pl-X*-P2 ;- P1-XD-P2 type peptides; - Pl-X * -P2 type peptides;
- tout peptide adhésif tel que défini plus avant et représenté plus d'une fois au sein de la molécule de l'invention.- Any adhesive peptide as defined further and represented more than once within the molecule of the invention.
La partie adhesive des molécules' de l'invention peut être couplée, soit directement, soit par l'intermédiaire d'un peptide de jonction à la structure stabilisatrice protéique. De plus, elle peut constituer l'extrémité N-terminale comme l'extrémité C-terminale de la molécule. Préférentiellement, dans les molécules de l'invention, la partie adhesive constitue la partie C-terminale de la chimère.The adhesive portion of the molecules' of the invention can be coupled, either directly or via a linking peptide to the protein stabilizing structure. In addition, it can constitute the N-terminal end as the C-terminal end of the molecule. Preferably, in the molecules of the invention, the adhesive part constitutes the C-terminal part of the chimera.
Préférentiellement, la structure stabilisatrice des polypeptides de l'invention est un polypeptide possédant une demie- vie plasmatique élevée. A titre d'exemple, il peut s'agir d'une protéine telle qu'une albumine, une apolipoprotéine, une immunoglobuline ou encore une transferine, etc.. Il peut également s'agir de peptides dérivés de telles protéines par modifications structurales, ou de peptides synthétisés artificiellement ou semi-artificiellement, et possédant une demie-vie plasmatique élevée. Par ailleurs, la structure stabilisatrice utilisée est plus préférentiellement un polypeptide faiblement ou non-immunogénique pour l'organisme dans lequel le polypeptide de l'invention est utilisé.Preferably, the stabilizing structure of the polypeptides of the invention is a polypeptide having a high plasma half-life. By way of example, it may be a protein such as albumin, an apolipoprotein, an immunoglobulin or a transferin, etc. It may also be peptides derived from such proteins by structural modifications, or peptides artificially or semi-artificially synthesized, and having a high plasma half-life. Furthermore, the stabilizing structure used is more preferably a weakly or non-immunogenic polypeptide for the organism in which the polypeptide of the invention is used.
Dans un mode de réalisation particulièrement avantageux de l'invention, la structure stabilisatrice est une albumine ou un variant de l'albumine et par exemple la sérum-albumine humaine (S AH). Il est entendu que les variants de l'albumine désignent toute protéine à haute demie-vie plasmatique obtenue par modification (mutation, délétion et/ou addition) par les techniques du génie génétique d'un gène codant pour un isomorphe donné de la sérum-albumine humaine, ainsi que toute macromolécule à haute demie- vie plasmatique obtenue par modification in vitro de la protéine codée par de tels gènes. L'albumine étant très polymorphe, de nombreux variants naturels ont été identifiés et répertoriés [Weitkamp L.R. et al., Ann. Hum. Genêt. 27 (1973) 219]. A titre d'exemple, les chimères entre la (les) dite(s) fonction(s) adhésive(s) et la SAH mature possèdent des propriétés pharmacocinétiques et des activités antithrombotiques particulièrement utiles en thérapeutique.In a particularly advantageous embodiment of the invention, the stabilizing structure is an albumin or a variant of albumin and for example human serum albumin (S AH). It is understood that the albumin variants designate any protein with a high plasma half-life obtained by modification (mutation, deletion and / or addition) by genetic engineering techniques of a gene coding for a given isomorph of serum- human albumin, as well as any macromolecule with a high plasma half-life obtained by in vitro modification of the protein encoded by such genes. Since albumin is very polymorphic, many natural variants have been identified and listed [Weitkamp L.R. et al., Ann. Hmm. Broom. 27 (1973) 219]. For example, the chimeras between the said adhesive function (s) and mature SAH have pharmacokinetic properties and antithrombotic activities which are particularly useful in therapy.
Un autre objet de l'invention concerne un procédé de préparation des molécules chimères décrites ci-avant. Plus précisément, ce procédé consiste à faire exprimer par un hôte cellulaire eucaryote ou procaryote une séquence nucléotidique codant pour le polypeptide désiré, puis à récolter le polypeptide produit.Another subject of the invention relates to a process for the preparation of the chimeric molecules described above. More specifically, this method consists in causing a eukaryotic or prokaryotic cellular host to express a nucleotide sequence coding for the desired polypeptide, then in collecting the polypeptide produced.
Parmi les hôtes eucaryotes utilisables dans le cadre de la présente invention, on peut citer les cellules animales, les levures, ou les champignons. En particulier, s'agissant de levures, on peut citer les levures du genre Saccharomyces. Klυyveromyces. Pichia. Schwanniomyces . ou Hansenula. S'agissant de cellules animales, on peut citer les cellules COS, CHO, C127, etc.. Parmi les champignons susceptibles d'être utilisés dans la présente invention, on peut citer plus particulièrement Aspergillus ssp. ou Trichoderma ssp. Comme hôtes procaryotes, on préfère utiliser les bactéries telles que Escherichia coli. ou appartenant aux genres Corynebacterium . Bacillus. ou Streptomyces.Among the eukaryotic hosts which can be used in the context of the present invention, mention may be made of animal cells, yeasts, or fungi. In particular, as regards yeasts, mention may be made of yeasts of the genus Saccharomyces. Klυyveromyces. Pichia. Schwanniomyces. or Hansenula. As regards animal cells, mention may be made of COS, CHO, C127 cells, etc. Among the fungi capable of being used in the present invention, there may be mentioned more particularly Aspergillus ssp. or Trichoderma ssp. As prokaryotic hosts, it is preferred to use bacteria such as Escherichia coli. or belonging to the genera Corynebacterium. Bacillus. or Streptomyces.
Les séquences nucléotidiques utilisables dans le cadre de la présente invention peuvent être préparées de différentes manières. Généralement, elles sont obtenues en assemblant en phase de lecture les séquences codant pour chacune des parties fonctionnelles du polypeptide. Celles-ci peuvent être isolées par les techniques de l'homme de l'art, et par exemple directement à partir des ARN messsagers (ARNm) cellulaires, ou par reclonage à partir d'une banque d'ADN complémentaire (ADNc) effectuée à partir de cellules productrices, ou encore il peut s'agir de séquences nucléotidiques totalement synthétiques. Il est entendu de plus que les séquences nucléotidiques peuvent également être ultérieurement modifiées, par exemple par les techniques du génie génétique, pour obtenir des dérivés ou des variants desdites séquences. Plus préférentiellement, dans le procédé de l'invention, la séquence nucléotidique fait partie d'une cassette d'expression comprenant une région d'initiation de la transcription (région promoteur) permettant, dans les cellules hôtes, l'expression de la séquence nucléotidique placée sous son contrôle et codant pour les polypeptides de l'invention. Cette région peut provenir de régions promoteurs de gènes fortement exprimés dans la cellule hôte utilisée, l'expression étant constitutive ou régulable. S'agissant de levures, il peut s'agir du promoteur du gène de la phosphoglycérate kinase (PGK). de la glycéraldéhyde-3-phosphate déshydrogénase (GPD). de la lactase (LAC4). des énolases (ENO). des alcools deshydrogénases (ADH), etc.. S'agissant de bactéries, il peut s'agir du promoteur des gènes droit ou gauche du bactériophage lambda (PL, PR), ou encore des promoteurs des gènes des opérons tryptophane (Ptrp) ou lactose (Plac)- En outre, cette région de contrôle peut être modifiée, par exemple par mutagénèse in vitro, par introduction d'éléments additionnels de contrôle ou de séquences synthétiques, ou par des délétions ou des substitutions des éléments originels de contrôle. La cassette d'expression peut également comprendre une région de terminaison de la transcription fonctionnelle dans l'hôte envisagé, positionnée immédiatement en aval de la séquence nucléotidique codant pour un polypeptide de l'invention.The nucleotide sequences which can be used in the context of the present invention can be prepared in different ways. Generally, they are obtained by assembling in reading phase the sequences coding for each of the functional parts of the polypeptide. These can be isolated by the techniques of a person skilled in the art, and for example directly from cellular messenger RNAs (mRNA), or by recloning from a complementary DNA library (cDNA) carried out at from producer cells, or it can be completely synthetic nucleotide sequences. It is further understood that the nucleotide sequences can also be subsequently modified, for example by genetic engineering techniques, to obtain derivatives or variants of said sequences. More preferably, in the process of the invention, the nucleotide sequence is part of an expression cassette comprising a region for initiating transcription (promoter region) allowing, in host cells, the expression of the nucleotide sequence placed under its control and coding for the polypeptides of the invention. This region can come from promoter regions of genes strongly expressed in the host cell used, the expression being constitutive or regulable. In the case of yeasts, it may be the promoter of the phosphoglycerate kinase (PGK) gene. glyceraldehyde-3-phosphate dehydrogenase (GPD). lactase (LAC4). enolases (ENO). alcohol dehydrogenases (ADH), etc. As regards bacteria, it can be the promoter of the right or left genes of bacteriophage lambda (PL, PR), or promoters of the genes of the tryptophan operons (Ptrp) or lactose (Plac) - In addition, this control region can be modified, for example by in vitro mutagenesis, by the introduction of additional control elements or synthetic sequences, or by deletions or substitutions of the original control elements. The expression cassette can also comprise a transcription termination region functional in the envisaged host, positioned immediately downstream of the nucleotide sequence coding for a polypeptide of the invention.
Dans un mode préféré, les polypeptides de l'invention résultent de l'expression dans un hôte eucaryote ou procaryote d'une séquence nucléotidique et de la sécrétion du produit d'expression de ladite séquence dans le milieu de culture. Il est en effet particulièrement avantageux de pouvoir obtenir par voie recombinante des molécules directement dans le milieu de culture. Dans ce cas, la séquence nucléotidique codant pour un polypeptide de l'invention est précédée d'une séquence "leader" (ou séquence signal) dirigeant le polypeptide naissant dans les voies de sécrétion de l'hôte utilisé. Cette séquence "leader" peut être la séquence signal naturelle du vWF ou de la structure stabilisatrice dans le cas où celle-ci est une protéine naturellement sécrétée, mais il peut également s'agir de toute autre séquence "leader" fonctionnelle, ou d'une séquence "leader" artificielle. Le choix de l'une ou l'autre de ces séquences est notamment guidé par l'hôte utilisé. Des exemples de séquences signal fonctionnelles incluent celles des gènes des phéromones sexuelles ou des toxines "killer" de levures.In a preferred embodiment, the polypeptides of the invention result from the expression in a eukaryotic or prokaryotic host of a nucleotide sequence and from the secretion of the expression product of said sequence in the culture medium. It is in fact particularly advantageous to be able to obtain molecules by recombinant route directly in the culture medium. In this case, the nucleotide sequence coding for a polypeptide of the invention is preceded by a "leader" sequence (or signal sequence) directing the nascent polypeptide in the pathways secretion from the host used. This “leader” sequence can be the natural signal sequence of the vWF or of the stabilizing structure in the case where this is a naturally secreted protein, but it can also be any other functional “leader” sequence, or an artificial "leader" sequence. The choice of one or the other of these sequences is in particular guided by the host used. Examples of functional signal sequences include those of genes for sex pheromones or yeast "killer" toxins.
En plus de la cassette d'expression, un ou plusieurs marqueurs permettant de sélectionner l'hôte recombiné peuvent être additionnés, tels que par exemple le gène URA3 de la levure S. cerevisiae. ou des gènes conférant la résistance à des antibiotiques comme la généticine (G418) ou à tout autre composé toxique comme certains ions métalliques.In addition to the expression cassette, one or more markers making it possible to select the recombinant host can be added, such as for example the URA3 gene from the yeast S. cerevisiae. or genes conferring resistance to antibiotics such as geneticin (G418) or to any other toxic compound such as certain metal ions.
L'ensemble constitué par la cassette d'expression et par le marqueur de sélection peut être introduit, soit directement dans les cellules hôtes considérées, soit inséré préalablement dans un vecteur autoréplicatif fonctionnel. Dans le premier cas, des séquences homologues à des régions présentes dans le génome des cellules hôtes sont préférentiellement additionnées à cet ensemble; lesdites séquences étant alors positionnées de chaque côté de la cassette d'expression et du gène de sélection de façon à augmenter la fréquence d'intégration de l'ensemble dans le génome de l'hôte en ciblant l'intégration des séquences par recombinaison homologue. Dans le cas où la cassette d'expression est insérée dans un système réplicatif, un système de réplication préféré pour les levures du genre Kluyveromyces est dérivé du plasmide pKDl initialement isolé de K. drosophilarum: un système préféré de réplication pour les levures du genre Saccharomyces est dérivé du plasmide 2μ de S. cerevisiae. De plus, ce plasmide d'expression peut contenir tout ou partie desdits systèmes de réplication, ou peut combiner des éléments dérivés du plasmide pKDl aussi bien que du plasmide 2μ.The assembly constituted by the expression cassette and by the selection marker can be introduced, either directly into the host cells considered, or inserted beforehand into a functional self-replicating vector. In the first case, sequences homologous to regions present in the genome of the host cells are preferably added to this set; said sequences then being positioned on each side of the expression cassette and of the selection gene so as to increase the frequency of integration of the assembly into the host genome by targeting the integration of the sequences by homologous recombination. In the case where the expression cassette is inserted into a replicative system, a preferred replication system for yeasts of the genus Kluyveromyces is derived from the plasmid pKD1 initially isolated from K. drosophilarum: a preferred replication system for yeasts of the genus Saccharomyces is derived from the plasmid 2μ of S. cerevisiae. In addition, this expression plasmid may contain all or part of said replication systems, or may combine elements derived from the plasmid pKDl as well as from the plasmid 2μ.
En outre, les plasmides d'expression peuvent être des vecteurs navettes entre un hôte bactérien tel que Escherichia coli et la cellule hôte choisie. Dans ce cas, une origine de réplication et un marqueur de sélection fonctionnant dans l'hôte bactérien sont requises. Il est également possible de positionner des sites de restriction entourant les séquences bactériennes et uniques sur le vecteur d'expression : ceci permet de supprimer ces séquences par coupure et religature in vitro du vecteur tronqué avant transformation des cellules hôtes, ce qui peut résulter en une augmentation du nombre de copies et en une stabilité accrue des plasmides d'expression dans lesdits hôtes. Par exemple, de tels sites de restriction peuvent correspondre aux séquences telles que 5'-GGCCNNNNNGGCC-3' (SfiD ou 5'- GCGGCCGC-3' (Notl) dans la mesure où ces sites sont extrêmement rares et généralement absents d'un vecteur d'expression.In addition, the expression plasmids can be shuttle vectors between a bacterial host such as Escherichia coli and the chosen host cell. In this case, an origin of replication and a selection marker functioning in the bacterial host are required. It is also possible to position restriction sites surrounding the bacterial and unique sequences on the expression vector: this makes it possible to remove these sequences by cleavage and in vitro religation of the truncated vector before transformation of the host cells, which may result in an increase in the number of copies and in an increased stability of the expression plasmids in said hosts. For example, such restriction sites can correspond to sequences such as 5'-GGCCNNNNNGGCC-3 '(SfiD or 5'- GCGGCCGC-3' (Notl) since these sites are extremely rare and generally absent from a vector of expression.
Après construction de tels vecteurs ou cassette d'expression, ceux-ci sont introduits dans les cellules hôtes retenues selon les techniques classiques décrites dans la littérature. A cet égard, toute méthode permettant d'introduire un ADN étranger dans une cellule peut être utilisée. Il peut s'agir notamment de transformation, électroporation, conjugaison, ou toute autre technique connue de l'homme de l'art. A titre d'exemple pour les hôtes de type levure, les différentes souches de Kluyveromyces utilisées ont été transformées en traitant les cellules entières en présence d'acétate de lithium et de polyéthylène glycol, selon la technique décrite par Ito et al. [J. Bacteriol. 153 (1983) 163]. La technique de transformation décrite par Durrens et al. [Curr. Genêt. JLβ (1990) 7] utilisant l'éthylène glycol et le diméthylsulfoxyde a également été utilisée. Il est aussi possible de transformer les levures par électroporation, selon la méthode décrite par Karube et al. [FEBS Letters 1£2 (1985) 901. Un protocole alternatif est également décrit en détail dans les exemples qui suivent.After construction of such vectors or expression cassette, these are introduced into the host cells selected according to the conventional techniques described in the literature. In this regard, any method allowing the introduction of foreign DNA into a cell can be used. It may especially be transformation, electroporation, conjugation, or any other technique known to those skilled in the art. As an example for yeast-type hosts, the different Kluyveromyces strains used were transformed by treating whole cells in the presence of lithium acetate and polyethylene glycol, according to the technique described by Ito et al. [J. Bacteriol. 153 (1983) 163]. The transformation technique described by Durrens et al. [Curr. Broom. JLβ (1990) 7] using ethylene glycol and dimethyl sulfoxide was also used. It is also possible to transform yeasts by electroporation, according to the method described by Karube et al. [FEBS Letters 1 £ 2 (1985) 901. An alternative protocol is also described in detail in the examples which follow.
Après sélection des cellules transformées, les cellules exprimant lesdits polypeptides sont inoculées et la récupération desdits polypeptides peut être faite, soit au cours de la croissance cellulaire pour les procédés "en continu", soit en fin de croissance pour les cultures "en lots" ("batch"). Les polypeptides qui font l'objet de la présente invention sont ensuite purifiés à partir du surnageant de culture en vue de leur caractérisation moléculaire, pharmacocinétique et antithrombotique.After selection of the transformed cells, the cells expressing said polypeptides are inoculated and the recovery of said polypeptides can be made, either during cell growth for the "continuous" methods, or at the end of growth for the "batch" cultures ( "batch"). The polypeptides which are the subject of the present invention are then purified from the culture supernatant for their molecular, pharmacokinetic and antithrombotic characterization.
Un système d'expression préféré des polypeptides de l'invention consiste en l'utilisation des levures du genre Kluyveromyces comme cellule hôte, transformées par certains vecteurs dérivés du réplicon extrachromosomique pKDl initialement isolé chez K. marxianus var. drosophilarum. Ces levures, et en particulier K. lactis et K. fragilis sont généralement capables de répliquer lesdits vecteurs de façon stable et possèdent en outre l'avantage d'être incluses dans la liste des organismes G.R.A.S. ("G_enerally Recognized As S_afe"). Des levures privilégiées sont préférentiellement des souches industrielles du genre Kluyveromyces capables de répliquer de façon stable lesdits plasmides dérivés du plasmide pKDl et dans lesquels a été inséré un marqueur de sélection ainsi qu'une cassette d'expression permettant la sécrétion à des niveaux élevés des polypeptides de l'invention.A preferred expression system for the polypeptides of the invention consists in the use of yeasts of the genus Kluyveromyces as host cell, transformed by certain vectors derived from the extrachromosomal replicon pKD1 initially isolated from K. marxianus var. drosophilarum. These yeasts, and in particular K. lactis and K. fragilis are generally capable of replicating said vectors stably and also have the advantage of being included in the list of GRAS organisms ("G_enerally Recognized As S_afe"). Preferred yeasts are preferentially industrial strains of the genus Kluyveromyces capable of stably replicating said plasmids derived from the plasmid pKDl and into which a selection marker has been inserted as well as an expression cassette allowing the secretion at high levels of the polypeptides of the invention.
La présente invention concerne également les séquences nucléotidiques codant pour les polypeptides chimères décrits ci-avant, ainsi que les cellules recombinantes, eucaryotes ou procaryotes, comprenant de telles séquences.The present invention also relates to the nucleotide sequences coding for the chimeric polypeptides described above, as well as the recombinant, eukaryotic or prokaryotic cells, comprising such sequences.
La présente invention concerne aussi l'application à titre de médicament des polypeptides selon la présente invention. Plus particulièrement, l'invention a pour objet toute composition pharmaceutique comprenant un ou plusieurs polypeptides tel que décrit ci-avant. Plus particulièrement, ces compositions peuvent être utilisées pour la prévention ou le traitement des thromboses.The present invention also relates to the application as a medicament of the polypeptides according to the present invention. More particularly, the subject of the invention is any pharmaceutical composition comprising one or more polypeptides as described above. More particularly, these compositions can be used for the prevention or treatment of thromboses.
La présente invention sera plus complètement décrite à l'aide des exemples qui suivent, qui doivent être considérés comme illustratifs et non limitatifs.The present invention will be more fully described with the aid of the following examples, which should be considered as illustrative and not limiting.
ï-fSTF. DES FIGURESï-fSTF. FIGURES
Les représentations des plasmides indiquées dans les Figures suivantes ne sont pas tracées à l'échelle et seuls les sites de restriction importants pour la compréhension des clonages réalisés ont été indiqués.The representations of the plasmids indicated in the following Figures are not drawn to scale and only the restriction sites important for understanding the cloning carried out have been indicated.
Figure 1 : Séquence nucléotidique d'un fragment de restriction Hindiπ codant pour une protéine chimère du type S AH-vWF. Les flèches noires indiquent la fin des régions "pré" et "pro" de la SAH. Les sites de restriction Mstll et Pstl sont soulignés. La numérotation des acides aminés (colonne de droite) correspond à la protéine chimère SAH-vWF470->713 mature (829 résidus) ; le fragment Thr470- Val713 du vWF de cette chimère particulière est numéroté des résidus Thr586 à Val829. Les résidus Thr470, Leu494, Asp498, Pro502, Tyr508, Leu694, Pro704, et Pro708 du vWF mature sont soulignés.Figure 1: Nucleotide sequence of a Hindiπ restriction fragment coding for a chimeric protein of the S type AH-vWF. The black arrows indicate the end of the "pre" and "pro" regions of HSA. The Mstll and Pstl restriction sites are underlined. The amino acid numbering (right column) corresponds to the mature chimeric protein SAH-vWF470-> 713 (829 residues); the Thr470-Val713 fragment of the vWF of this particular chimera is numbered from residues Thr586 to Val829. The Thr470, Leu494, Asp498, Pro502, Tyr508, Leu694, Pro704, and Pro708 residues of mature vWF are underlined.
Figure 2 : Schématisation des chimères du type S AH-vWF (A), du type vWF-SAH (B) ou vWF-S AH-vWF (C). Abréviations utilisées : M/LP, résidu méthionine initiateur de la traduction, éventuellement suivi d'une séquence signal de sécrétion ; SAH, sérum-albumine humaine mature ou un de ses variants ; vWF, fragment(s) du vWF possédant une propriété de fixation aux plaquettes et/ou au sous-endothélium, ou un (des) variants obtenus par les techniques du génie génétique. La flèche noire indique l'extrémité N-terminale de la protéine mature.Figure 2: Diagram of chimeras of type S AH-vWF (A), of type vWF-SAH (B) or vWF-S AH-vWF (C). Abbreviations used: M / LP, methionine residue initiating translation, possibly followed by a signal secretion sequence; SAH, mature human serum albumin or a variant thereof; vWF, fragment (s) of vWF having a property of binding to platelets and / or to the subendothelium, or one (or more) variants obtained by genetic engineering techniques. The black arrow indicates the N-terminus of the mature protein.
Figure 3 : A, carte de restriction du plasmide pYG105 et stratégie de construction des plasmides d'expression des protéines chimères de la présente invention. Abréviations utilisées : P, promoteur transcriptionnel ; T, terminateur transcriptionnel ; IR, séquences répétées inversées du plasmide pKDl ; LPsAH» région "prépro" de la SAH; Apr et Kmr désignent respectivement les gènes de résistance à l'ampicilline (E. coli) et au G418 (levures). B, caractéristiques et filiation génétiques des principaux plasmides d'expression des hybrides entre SAH et vWF exemplifiés dans la présente invention. Les plasmides de la première colonne sont des plasmides de type pUC comportant un fragment de restriction HindIII correspondant à des fusions traductionnelles entre la totalité de la SAH et un fragment ou un variant moléculaire du vWF. Les plasmides d'expression correspondent au clonage dans l'orientation productive de ces fragments HindIII dans le site HindIII du plasmide pYG105 (LAC4).FIG. 3: A, restriction map of the plasmid pYG105 and strategy for the construction of the expression plasmids of the chimeric proteins of the present invention. Abbreviations used: P, transcriptional promoter; T, transcriptional terminator; IR, inverted repeat sequences of the plasmid pKD1; LPsAH "SAH" prepro "region; Ap r and Km r respectively designate the genes for resistance to ampicillin (E. coli) and to G418 (yeasts). B, genetic characteristics and parentage of the main expression plasmids of the hybrids between SAH and vWF exemplified in the present invention. The plasmids of the first column are pUC type plasmids comprising a HindIII restriction fragment corresponding to translational fusions between all of the SAH and a fragment or a molecular variant of vWF. The expression plasmids correspond to the cloning in the productive orientation of these HindIII fragments into the HindIII site of the plasmid pYG105 ( LAC4).
Figure 4 : Caractérisation du matériel sécrété après 4 jours de cultureFigure 4: Characterization of the secreted material after 4 days of culture
(erlenmeyers) de la souche CBS 293.91 transformée par les plasmides pYG1248 (plasmide d'expression d'une chimère du type SAH-P1-X-P2) et pKan707 (plasmide contrôle). Dans cette expérience les résultats des panneaux A, B, et C ont été migres sur le même gel (SDS-PAGE 8,5%) puis traités séparemment.(Erlenmeyer flasks) of the strain CBS 293.91 transformed by the plasmids pYG1248 (expression plasmid of a chimera of the SAH-P1-X-P2 type) and pKan707 (control plasmid). In this experiment the results of panels A, B, and C were migrated on the same gel (SDS-PAGE 8.5%) and then treated separately.
A, coloration au bleu de coomassie; standard de poids moléculaire (piste 2) ; surnageant équivalent à 50 μl de la culture transformée par les plasmides pKan.707 en milieu YPL (piste 1) , ou pYG1248 en milieu YPD (piste 3) ou YPL (piste 4) .A, coomassie blue staining; molecular weight standard (lane 2); supernatant equivalent to 50 μl of the culture transformed by the plasmids pKan.707 in YPL medium (lane 1), or pYG1248 in YPD medium (lane 3) or YPL (lane 4).
B, caractérisation immunologique du matériel sécrété après utilisation d'anticorps de souris dirigés contre le vWF humain : même légende qu'en A à l'exception que des standards biotinilés de poids moléculaire ont été utilisés.B, immunological characterization of the secreted material after use of mouse antibodies directed against human vWF: same legend as in A except that biotinilized molecular weight standards were used.
C, caractérisation immunologique du matériel sécrété après utilisation d'anticorps de lapin dirigés contre l'albumine humaine: surnageant équivalent à 50 μl de la culture transformée par les plasmides pKan707 en milieu YPL (piste 1), ou pYG1248 en milieu YPD (piste 2) ou YPL (piste 3). Figure 5 : Cinétique de sécrétion d'une chimère du type SAH-P2 par la souche CBS 293.91 transformée par le plasmide pYG1206.C, immunological characterization of the secreted material after use of rabbit antibodies directed against human albumin: supernatant equivalent to 50 μl of the culture transformed by the plasmids pKan707 in YPL medium (lane 1), or pYG1248 in YPD medium (lane 2 ) or YPL (track 3). Figure 5: Kinetics of secretion of a SAH-P2 type chimera by the strain CBS 293.91 transformed by the plasmid pYG1206.
A, coloration au bleu de coomassie ; standard de poids moléculaire (piste 1) ; surnageant équivalent à 2,5 μl d'une culture "Fed Batch" en milieu YPD après 24h. (piste 2), 40h. (piste 3) ou 46h. (piste 4) de croissance.A, coomassie blue staining; molecular weight standard (lane 1); supernatant equivalent to 2.5 μl of a "Fed Batch" culture in YPD medium after 24 h. (track 2), 40h. (track 3) or 46h. (track 4) of growth.
B, caractérisation immunologique du matériel sécrété après utilisation d'anticorps de souris dirigés contre le vWF humain : même légende qu'en A à l'exception que des standards biotinilés de poids moléculaire ont été utilisés.B, immunological characterization of the secreted material after use of mouse antibodies directed against human vWF: same legend as in A except that biotinilized molecular weight standards were used.
Figure 6 : Caractérisation du matériel sécrété par K. lactis' transformé par les plasmides pKan707 (plasmide contrôle, piste 2), pYG1206 (plasmide d'expression d'une chimère du type SAH-P2, piste 3), pYG1214 (plasmide d'expression d'une chimère du type SAH-P1, piste 4) et pYG1223 (plasmide d'expression d'une chimère du type SAH-P1-XD-P2, piste 5) ; standard de poids moléculaire (piste 1). Les dépôts correspondent à 50 μl de surnageant d'une culture stationnaire après croissance en milieu YPD, migration dans un gel à 8.5 % d'acrylamide et coloration au bleu de coomassie.Figure 6: Characterization of the material secreted by K. lactis ' transformed by the plasmids pKan707 (control plasmid, lane 2), pYG1206 (expression plasmid of a chimera of the SAH-P2 type, lane 3), pYG1214 (plasmid expression of a chimera of the SAH-P1 type, lane 4) and pYG1223 (plasmid of expression of a chimera of the SAH-P1-XD-P2 type, lane 5); molecular weight standard (lane 1). The deposits correspond to 50 μl of supernatant from a stationary culture after growth in YPD medium, migration into a gel containing 8.5% acrylamide and staining with coomassie blue.
Figure 7 : Caractérisation du matériel sécrété après 4 jours de cultureFigure 7: Characterization of the secreted material after 4 days of culture
(erlenmeyers) de la souche CBS 293.91 transformée par les plasmides pYG1311 (SAH-vWF508->704) et pYG1313 (SAH-vWF470->704, C471G, C474G), après migration sur gel SDS-PAGE à 8,5 %.(Erlenmeyer flasks) of the CBS 293.91 strain transformed with the plasmids pYG1311 (SAH-vWF508-> 704) and pYG1313 (SAH-vWF470-> 704, C471G, C474G), after migration on 8.5% SDS-PAGE gel.
A, coloration au bleu de coomassie; surnageant équivalent à 100 μl de la culture transformée par les plasmides pYG1311 (piste 1) ou pYG1313 (piste 2) en milieu YPL ; standard de poids moléculaire (piste 3).A, coomassie blue staining; supernatant equivalent to 100 μl of the culture transformed with the plasmids pYG1311 (lane 1) or pYG1313 (lane 2) in YPL medium; molecular weight standard (lane 3).
B, caractérisation immunologique du matériel sécrété après utilisation d'anticorps de souris dirigés contre le vWF humain : même légende qu'en A.B, immunological characterization of the secreted material after use of mouse antibodies directed against human vWF: same legend as in A.
C, caractérisation immunologique du matériel sécrété après utilisation d'anticorps de lapin dirigés contre la SAH : même légende qu'en A.C, immunological characterization of the secreted material after use of rabbit antibodies directed against HSA: same legend as in A.
Figure 8 : Caractérisation du matériel sécrété après 4 jours de cultureFigure 8: Characterization of the secreted material after 4 days of culture
(erlenmeyers) de la souche CBS 293.91 transformée par les plasmides pYG1361 (SAH-vWF470->704, C471G, C474G, R543W) et pYG1365 (SAH-vWF470->704,(Erlenmeyer flasks) of the CBS 293.91 strain transformed by the plasmids pYG1361 (SAH-vWF470-> 704, C471G, C474G, R543W) and pYG1365 (SAH-vWF470-> 704,
C471G, C474G, P574L), après migration sur gel SDS-PAGE à 8,5 %. Dans cette expérience les résultats des panneaux A, B, et C ont été migres sur le même gel puis traités séparemment.C471G, C474G, P574L), after migration on 8.5% SDS-PAGE gel. In this experience the results of panels A, B, and C were migrated on the same gel and then treated separately.
A, coloration au bleu de coomassie; surnageant équivalent à 100 μl de la culture transformée par les plasmides pYG1361 (piste 1) ou pYG1365 (piste 2) en milieu YPL; standard de poids moléculaire (piste 3).A, coomassie blue staining; supernatant equivalent to 100 μl of the culture transformed with the plasmids pYG1361 (lane 1) or pYG1365 (lane 2) in YPL medium; molecular weight standard (lane 3).
B, caractérisation immunologique du matériel sécrété après utilisation d'anticorps de souris dirigés contre le vWF humain : même légende qu'en A.B, immunological characterization of the secreted material after use of mouse antibodies directed against human vWF: same legend as in A.
C, caractérisation immunologique du matériel sécrété après utilisation d'anticorps de lapin dirigés contre la SAH : même légende qu'en A.C, immunological characterization of the secreted material after use of rabbit antibodies directed against HSA: same legend as in A.
Figure 9 : Dosage de l'activité antagoniste in vitro de l'agglutination des plaquettes humaines fixées au paraformaldéhyde : CI50 des hybrides SAH-vWF694- 708, [SAH-vWF470-713 C471G, C474G] et [SAH-vWF470-704 C471G, C474G] relativement à l'étalon RG12986. La détermination de l'inhibition dose-dépendante de l'agglutination plaquettaire est réalisée sous agitation à 37°C, en utilisant un agrégamètre PAP-4, en présence de vWF humain, de botrocétine (8,2 mg ml) et du produit à tester à différentes dilutions. La concentration du produit permettant d'inhiber de moitié l'agglutination contrôle (absence de produit) est alors déterminée (CI50).Figure 9: Assay of the antagonistic activity in vitro of the agglutination of human platelets attached to paraformaldehyde: IC50 of the hybrids SAH-vWF694- 708, [SAH-vWF470-713 C471G, C474G] and [SAH-vWF470-704 C471G, C474G] relative to the standard RG12986. The determination of the dose-dependent inhibition of platelet agglutination is carried out with stirring at 37 ° C., using a PAP-4 aggregameter, in the presence of human vWF, botrocetin (8.2 mg ml) and the product to be test at different dilutions. The concentration of the product making it possible to inhibit control agglutination by half (absence of product) is then determined (IC50).
EXEMPLESEXAMPLES
TECHNIQUESGENERALESDECLONAGEGENERAL LOCKING TECHNIQUES
Les méthodes classiquement utilisées en biologie moléculaire telles que les extractions préparatives d'ADN plasmidique, la centrifugation d'ADN plasmidique en gradient de chlorure de césium, l'électrophorèse sur gels d'agarose ou d'acrylamide, la purification de fragments d'ADN par électroélution, les extraction de protéines au phénol ou au phénol-chloroforme, la précipitation d'ADN en milieu salin par de l'éthanol ou de l'isopropanol, la transformation dans Escherichia coli etc.. sont bien connues de l'homme de métier et sont abondament décrites dans la littérature [Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982 ; Ausubel F.M. et al. (eds), "Current Protocols in Molecular Biology", John Wiley & Sons, New York, 1987]. Les enzymes de restriction ont été fournies par New England Biolabs (Biolabs), Bethesda Research Laboratories (BRL) ou Amersham et sont utilisées selon les recommandations des fournisseurs.Methods conventionally used in molecular biology such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in cesium chloride gradient, electrophoresis on agarose or acrylamide gels, purification of DNA fragments by electroelution, the extraction of proteins with phenol or phenol-chloroform, the precipitation of DNA in a saline medium with ethanol or isopropanol, the transformation in Escherichia coli, etc. are well known to humans. trade and are abundantly described in the literature [Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982; Ausubel FM et al. (eds), "Current Protocols in Molecular Biology", John Wiley & Sons, New York, 1987]. Restriction enzymes have been supplied by New England Biolabs (Biolabs), Bethesda Research Laboratories (BRL) or Amersham and are used as recommended by suppliers.
Les plasmides de type pBR322, pUC et les phages de la série M13 sont d'origine commerciale (Bethesda Research Laboratories).The pBR322, pUC and phage plasmids of the M13 series are of commercial origin (Bethesda Research Laboratories).
Pour les ligatures, les fragments d'ADN sont séparés selon leur taille par électrophorèse en gels d'agarose ou d'acrylamide, extraits au phénol ou par un mélange phénol chloroforme, précipités à l'éthanol puis incubés en présence de l' ADN ligase du phage T4 (Biolabs) selon les recommandations du fournisseur. Le remplissage des extrémités 5' proéminentes est effectué par le fragment deFor the ligations, the DNA fragments are separated according to their size by electrophoresis in agarose or acrylamide gels, extracted with phenol or with a phenol chloroform mixture, precipitated with ethanol and then incubated in the presence of DNA ligase. phage T4 (Biolabs) according to the supplier's recommendations. The filling of the protruding 5 ′ ends is carried out by the fragment of
Klenow de l'ADN Polymérase I d'E. coli (Biolabs) selon les spécifications du fournisseur. La destruction des extrémités 3' proéminentes est effectuée en présence de l'ADN Polymérase du phage T4 (Biolabs) utilisée selon les recommandations du fabricant. La destruction des extrémités 5' proéminentes est effectuée par un traitement ménagé par la nucléase SI.Klenow of E. DNA Polymerase I. coli (Biolabs) according to the supplier's specifications. The destruction of the protruding 3 ′ ends is carried out in the presence of the DNA polymerase of phage T4 (Biolabs) used according to the manufacturer's recommendations. The destruction of the protruding 5 ′ ends is carried out by gentle treatment with nuclease SI.
La mutagénèse dirigée in vitro par oligodéoxynucléotides synthétiques est effectuée selon la méthode développée par Taylor et al. [Nucleic Acids Res. 13. (1985) 8749-8764] en utilisant le kit distribué par Amersham.Mutagenesis directed in vitro by synthetic oligodeoxynucleotides is carried out according to the method developed by Taylor et al. [Nucleic Acids Res. 13. (1985) 8749-8764] using the kit distributed by Amersham.
L'amplification enzymatique de fragments d'ADN par la technique dite de PCR [Polymérase-catalyzed £hain Reaction, Saiki R.K. et al., Science 22Q (1985)The enzymatic amplification of DNA fragments by the technique called PCR [Polymerase-catalyzed £ hain Reaction, Saiki R.K. et al., Science 22Q (1985)
1350-1354 ; Mullis K.B. et Faloona F.A., Meth. Enzym. 15_5_ (1987) 335-350] est effectuée en utilisant un "DNA thermal cycler" (Perkin Elmer Cetus) selon les spécifications du fabricant.1350-1354; Mullis K.B. and Faloona F.A., Meth. Enzym. 15_5_ (1987) 335-350] is carried out using a "DNA thermal cycler" (Perkin Elmer Cetus) according to the manufacturer's specifications.
La vérification des séquences nucléotidiques est effectuée par la méthode développée par Sanger et al. [Proc. Natl. Âcad. Sci. USA, 74 (1977) 5463-5467] en utilisant le kit distribué par Amersham.Verification of the nucleotide sequences is carried out by the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467] using the kit distributed by Amersham.
La numérotation des acides aminés du vWF est celle de Titani et al. [Biochemistry 25 (1986) 3171-3184].The amino acid numbering of the vWF is that of Titani et al. [Biochemistry 25 (1986) 3171-3184].
Les transformations de K. lactis avec l'ADN des plasmides d'expression des protéines de la présente invention sont effectuées par toute technique connue de l'homme de l'art, et dont un exemple est donné dans le texte.Transformations of K. lactis with the DNA of the protein expression plasmids of the present invention are carried out by any technique known to those skilled in the art, an example of which is given in the text.
Sauf indication contraire, les souches bactériennes utilisées sont E. coli MC1060 (lâe-POZYA, X74, galU, galK, 3_rAr), ou E. coli TG1 Qâ≤, proA.B. supE. tM, h§dD5 / PîraD36, proA+B+. iaçW, laçZ, M15). Les souches de levures utilisées appartiennent aux levures bourgeonnantes et plus particulièrement aux levures du genre Kluyveromyces. Les souche K. lactis MW98-8C (a, JSHΔ, aεg, IgS. +, pKDl°) et K. lactis CBS 293.91 ont été particulièrement utilisées; un échantillon de la souche MW98-8C a été déposé le 16 Septembre 1988 au Centraalbureau voor Schimmelkulturen (CBS) à Baam (Pays Bas) où il a été enregistré sous le numéro CBS 579.88.Unless otherwise specified, the bacterial strains used are E. coli MC1060 (lâe-POZYA, X74, galU, galK, 3_rA r ), or E. coli TG1 Qâ≤, proA.B. supE. tM, h§dD5 / PîraD36, proA + B + . iaçW, laçZ, M15). The yeast strains used belong to budding yeasts and more particularly to yeasts of the genus Kluyveromyces. The strains K. lactis MW98-8C (a, JSHΔ, aεg, IgS. + , PKDl °) and K. lactis CBS 293.91 were particularly used; a sample of the strain MW98-8C was deposited on September 16, 1988 at the Centraalbureau voor Schimmelkulturen (CBS) in Baam (Netherlands) where it was registered under the number CBS 579.88.
Une souche bactérienne (E. coli) transformée avec le plasmide pET-8c52K a été déposée le 17 Avril 1990 auprès de l' American Type Culture Collection sous le numéro ATCC 68306. Les souches de levures transformées par les plasmides d'expression codant pour les protéines de la présente invention sont cultivées en erlenmeyers ou en fermenteurs pilotes de 21 (SETRIC, France) à 28°C en milieu riche (YPD: 1 % yeast extract, 2 % Bactopeptone, 2 % glucose ; ou YPL : 1 % yeast extract, 2 % Bactopeptone, 2 % lactose) sous agitation constante.A bacterial strain (E. coli) transformed with the plasmid pET-8c52K was deposited on April 17, 1990 with the American Type Culture Collection under the number ATCC 68306. The yeast strains transformed by the expression plasmids coding for the proteins of the present invention are cultured in Erlenmeyer flasks or in pilot fermenters of 21 (SETRIC, France) at 28 ° C in rich medium (YPD: 1% yeast extract, 2% Bactopeptone, 2% glucose; or YPL: 1% yeast extract , 2% Bactopeptone, 2% lactose) with constant stirring.
EXEMPLE 1: CONSTRUCTION DU PLASMIDE pET-8c52K ET DEEXAMPLE 1: CONSTRUCTION OF THE PLASMID pET-8c52K AND OF
SES VARI NTS MOLECULAIRESITS MOLECULAR VARI NTS
Le fragment du cDNA du vWF codant pour les résidus 445 à 733 du vWF humain possède plusieurs déterminants cruciaux de l'interaction entre le vWF et les plaquettes d'une part, et certains éléments de la membrane basale et du tissu sous- endothelial d'autre part. L'amplification de ces déterminants génétiques peut être réalisée, par exemple à partir d'une lignée cellulaire humaine exprimant le vWF, et par exemple d'une lignée de cellules endotheliales de veines de cordon ombilical humain [Verweij CL. et al., Nucleic Acids Res. 1_3_ (1985) 4699-4717], ou encore à partir d' ARN de plaquettes humaines, par exemple selon le protocole décrit par Ware et al. [Proc Natl. Acad. Sci. fig (1991) 2946-2950]. Les ARN cellulaires sont purifiés en utilisant la technique d'extraction au thiocyanate de guanidium initialement décrite par Cathala et al. [DNA 4 (1983) 329-335] et utilisés comme matrice à la synthèse d'ADN complémentaires (ADNc) incluant la partie du vWF à amplifier. Dans un premier temps, la synthèse du brin non codant se fait en utilisant le kit distribué par Amersham et un oligodeoxynucléotide complémentaire de la séquence nucléotidique de l'ARNm codant pour des résidus contigus localisés en C- terminal de la partie à amplifier. La solution résultante est ensuite soumise à 30 cycles d'amplification enzymatique par la technique PCR, en utilisant comme amorce l'oligodéoxynucléotide précédent et un oligodeoxynucléotide identique à la séquence nucléotidique codant pour des résidus contigus localisés en N-terminal de la partie du vWF à amplifier. Les fragments amplifiés sont ensuite clones dans des vecteurs du type M13 en vue de leur vérification par séquençage en utilisant soit les amorces universelles situées de part et d'autre du multisite de clonage, soit des oligodéoxynucléotides spécifiques de la région amplifiée du gène du vWF dont la séquence de plusieurs isomorphes est connue [Sadler J.E. et al., Proc Natl. Acad. Sci. S2 (1985) 6394-6398 ; Verweij CL. et al., EMBO J. 5 (1986) 1839-1847 ; Shelton-Inloes B.B. et al., Biochemistry 25. (1986) 3164-3171 ; Bonthron D. et al., Nucleic Acids Res. 17 (1986) 7125-7127]. Le plasmide pET-8c52K est particulièrement utile car il comporte un fragment du cDNA du vWF codant pour les résidus 445 à 733 du vWF humain et inclus notamment les peptides G10 et D5 antagonistes de l'interaction entre vWF et GPlb [Mori H. et al., J. Biol. Chem. 263 (1988) 17901-17904]. Le fragment du vWF présent dans le plasmide p5E est identique au fragment du vWF du plasmide pET-8c52K à l'exception que les résidus cystéine aux positions 459, 462, 464, 471 et 474 ont été mutés en résidus glycine par mutagénèse dirigée. Le plasmide p7E est identique au plasmide p5E à l'exception que les résidus cystéine aux positions 509 et 695 ont également été mutés en résidus glycine par mutagénèse dirigée.The vWF cDNA fragment encoding residues 445 to 733 of human vWF has several crucial determinants of the interaction between vWF and platelets on the one hand, and certain elements of the basement membrane and the subendothelial tissue of somewhere else. Amplification of these genetic determinants can be carried out, for example from a human cell line expressing vWF, and for example from a line of endothelial cells of human umbilical cord veins [Verweij CL. et al., Nucleic Acids Res. 1_3_ (1985) 4699-4717], or also from human platelet RNA, for example according to the protocol described by Ware et al. [Proc Natl. Acad. Sci. fig (1991) 2946-2950]. The cellular RNAs are purified using the guanidium thiocyanate extraction technique initially described by Cathala et al. [DNA 4 (1983) 329-335] and used as a template for the synthesis of complementary DNA (cDNA) including the part of the vWF to be amplified. First, the synthesis of the non-coding strand is carried out using the kit distributed by Amersham and an oligodeoxynucleotide complementary to the nucleotide sequence of the mRNA coding for contiguous residues located at the C-terminal of the part to be amplified. The resulting solution is then subjected to 30 cycles of enzymatic amplification by the PCR technique, using as initiates the preceding oligodeoxynucleotide and an oligodeoxynucleotide identical to the nucleotide sequence coding for contiguous residues located at the N-terminal of the part of the vWF to be amplified. The amplified fragments are then cloned into vectors of the M13 type with a view to their verification by sequencing using either the universal primers located on either side of the cloning multisite, or oligodeoxynucleotides specific for the amplified region of the vWF gene, of which the sequence of several isomorphs is known [Sadler JE et al., Proc Natl. Acad. Sci. S2 (1985) 6394-6398; Verweij CL. et al., EMBO J. 5 (1986) 1839-1847; Shelton-Inloes BB et al., Biochemistry 25. (1986) 3164-3171; Bonthron D. et al., Nucleic Acids Res. 17 (1986) 7125-7127]. The plasmid pET-8c52K is particularly useful because it contains a fragment of the cDNA of vWF coding for residues 445 to 733 of human vWF and includes in particular the peptides G10 and D5 antagonists of the interaction between vWF and GPlb [Mori H. et al ., J. Biol. Chem. 263 (1988) 17901-17904]. The fragment of vWF present in the plasmid p5E is identical to the fragment of the vWF of the plasmid pET-8c52K with the exception that the cysteine residues at positions 459, 462, 464, 471 and 474 were mutated into glycine residues by site-directed mutagenesis. The plasmid p7E is identical to the plasmid p5E except that the cysteine residues at positions 509 and 695 have also been mutated into glycine residues by site-directed mutagenesis.
EXEMPLE 2: CONSTRUCTION D'UN FRAGMENT DE RESTRICTION MSTII-HINDIII INCLUANT UN SITE DE LIAISON DU vWF AUX PLAQUETTES SANGUINESEXAMPLE 2: CONSTRUCTION OF A MSTII-HINDIII RESTRICTION FRAGMENT INCLUDING A VWF BINDING SITE TO BLOOD PLATES
E.2.I. Peptide du type P1-X-P2.E.2.I. Peptide of the P1-X-P2 type.
E.2.1.1. Résidus Thr470-Val713 du vWF. L'amplification PCR du plasmide pET-8c52K avec les oligodéoxynucléotidesE.2.1.1. Residues Thr470-Val713 from vWF. PCR amplification of plasmid pET-8c52K with oligodeoxynucleotides
5'-CCCGGGATCCCTTAGGCTTAACCTGTGAAGCCTGC-3' (Sql969, les sites Ba HI et Mstll sont soulignés) et 5'-CCCGGGATCCAAGC- TTAGACTTGTGCCATGTCG-3' (Sq2029, les sites BamHI et HjndIII sont soulignés), génère un fragment incluant les résidus Thr470 à Val713 du vWF (cf. Figure 1, résidus Thr586 à Val829). Les fragments amplifiés sont d'abord coupés par BamHI. clones dans le site BamHI d'un vecteur de type pUC et la séquence d'un clone est vérifiée par séquençage. La séquence peptidique ainsi amplifiée comporte un fragment de restriction MstlI-HindHI incluant les résidus Thr470 à Val713 du vWF et dont la séquence peptidique est identique à la séquence correspondante décrite par Titani et al. [Biochemistry 25_ (1986) 3171-3184]. Le plasmide pYG1220 comporte ce fragment de restriction MstlI-HindlII précédé du fragment HindlII- Mstll du plasmide pYG404 (cf. Exemple 4 et Figure 3B). E.2.1.2. Résidus Thr470-Prp704 du vWF.5'-CCCGGGATCCCTTAGGCTTAACCTGTGAAGCCTGC-3 '(Sql969, Ba HI and Mstll sites are underlined) and 5'-CCCGGGATCCAAGC- TTAGACTTGTGCCATGTCG-3' (Sq2029, BamHI and HjndIII sites are underlined7) Thr generates a fragment704 Thr vWF (cf. Figure 1, residues Thr586 to Val829). The amplified fragments are first cut with BamHI. clones in the BamHI site of a pUC type vector and the sequence of a clone is verified by sequencing. The peptide sequence thus amplified comprises a restriction fragment MstlI-HindHI including the residues Thr470 to Val713 of vWF and whose peptide sequence is identical to the corresponding sequence described by Titani et al. [Biochemistry 25_ (1986) 3171-3184]. The plasmid pYG1220 comprises this restriction fragment MstlI-HindlII preceded by the HindlII-Mstll fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B). E.2.1.2. Residues Thr470-Prp704 from vWF.
Le résidue 705 du vWF naturel est O-glycosylé et se situe à l'intérieur du peptide D5 défini par les résidus Leu694 à Pro708 du vWF [Mon H. et al., J. Biol. Chem. 26_2 (1988) 17901-17904], De plus il est connu qu'un traitement du vWF naturel par une neuraminidase, dont la fonction est de libérer les acides sialiques terminaux des glycosylations des cellules de mammifères, permet d'exposer les sites de liaisons du vWF à la GPlb plaquettaire en l'absence de cofacteurs de l'agglutination plaquettaire tel que la botrocétine par exemple. Il est donc possible que la suppression de tout ou partie des sites de O-glycosylation du vWF recombinant, et notamment sécrété par une levure dont il est admis que la O- glycosylation est dépourvue d'acides sialiques, génère un produit intrinsèquement capable de reconnaitre la GPlb plaquettaire en l'abscence de tels cofacteurs. Un fragment MstlI-HindlII incluant les résidus Thr470 à Pro704 du vWF est donc généré de façon similaire à l'exemple précédent: les fragments résultant de l'amplification PCR du plasmide p5E avec les oligodéoxynucléotides 5'-CCCGG- GATCCCTTAGGCTTAACCGGTGAAGCCGGC-3' (Sq2149, les sites BamHI et Mstll sont soulignés) et 5'-CCATGGATCCAAGCTTAAGGAGGAGGGGCTTCA- GGGGCAAGGTC-3' (Sq2622, les sites BamHI et HindIII sont soulignés) sont d'abord clones dans un vecteur de type pUC sous la forme d'un fragment de restriction BamHI. et la séquence d'un clone est vérifiée par séquençage. La séquence du fragment MstlI-HindlII ainsi généré corresponds à la séquence correspondante donnée à la Figure 1 à l'exception que le codon TAA spécifiant l'arrêt traductionnel est localisé immédiatement en aval du résidu Pro704 du vWF et que les résidus 471 et 474 sont des résidus glycine et non des résidus cystéine. Le plasmide pYG1310 comporte ce fragment de restriction MstlI-HindlII précédé du fragment HindIII-MstlI du plasmide p YG404 (cf. Exemple 4 et Figure 3B) . E.2.1.3. Résidus Leu494-Pro704 du vWF. La séquence peptidique présente dans le plasmide pYG1310 possède encore les résidus thréonine ou serine aux positions 485, 492, 493 et 500 qui sont naturellement O-glycosylés dans la molécule native du vWF humain, localisés à proximité immédiate du peptide G10 défini par Mori et al. [J. Biol. Chem. 263 (1988) 17901-17904]. L'amplification par la technique PCR du plasmide pET8C- 52K par les oligodéoxynucléotides 5'-CCCGGGTACCTTAGG- CTTACTGTATGTGGAGGACATC-3' (Sq3037, les sites Kpnl et Mstll sont soulignés) et 5'-CCATGGATCCAAGCTTAAGGAGGAGGGGCTTCAGGGGC- AAGGTC-3' (Sq2622, les sites BamHI et HindIII sont soulignés) génère un fragment incluant les résidus Leu494 à Pro704 du vWF. Les fragments amplifiés sont d'abord coupés par les enzymes Kpnl et BamHI pour être clones dans un vecteur de type pUC coupé par les mêmes enzymes. Un clone particulier est isolé qui corresponds à la séquence attendue vérifiée par séquençage. Ce fragment Kpnl- BamHI comporte donc un fragment MstlI-HindlII incluant les résidus Leu494 à Pro704 du vWF humain. Le plasmide pYG1373 comporte ce fragment de restriction MstlI-HindlH précédé du fragment HindIII-MstlI du plasmide pYG404 (cf. Exemple 4 et Figure 3B). E.2.1.4. Résidus Tyr508-Pro704 du vWF.Residue 705 of natural vWF is O-glycosylated and is located inside the peptide D5 defined by residues Leu694 to Pro708 of vWF [Mon H. et al., J. Biol. Chem. 26_2 (1988) 17901-17904], Furthermore, it is known that treatment of natural vWF with a neuraminidase, the function of which is to release terminal sialic acids from glycosylations of mammalian cells, makes it possible to expose the binding sites from vWF to platelet GPlb in the absence of platelet agglutination cofactors such as botrocetin for example. It is therefore possible that the suppression of all or part of the O-glycosylation sites of the recombinant vWF, and in particular secreted by a yeast of which it is recognized that the O-glycosylation is devoid of sialic acids, generates a product intrinsically capable of recognizing the platelet GPlb in the absence of such cofactors. A fragment MstlI-HindlII including the residues Thr470 to Pro704 of vWF is therefore generated in a similar manner to the previous example: the fragments resulting from the PCR amplification of the plasmid p5E with the oligodeoxynucleotides 5'-CCCGG- GATCCCTTAGGCTTAACCGGTGAAGCCGGC-3 '(Sq2149 , the BamHI and Mstll sites are underlined) and 5'-CCATGGATCCAAGCTTAAGGAGGAGGGGCTTCA- GGGGCAAGGTC-3 '(Sq2622, the BamHI and HindIII sites are underlined) are first cloned into a vector of type pUC in the form of a restriction fragment BamHI. and the sequence of a clone is verified by sequencing. The sequence of the MstlI-HindlII fragment thus generated corresponds to the corresponding sequence given in FIG. 1 except that the TAA codon specifying the translational stop is located immediately downstream of the Pro704 residue of the vWF and that the residues 471 and 474 are glycine residues and not cysteine residues. The plasmid pYG1310 comprises this restriction fragment MstlI-HindlII preceded by the HindIII-MstlI fragment of the plasmid p YG404 (cf. Example 4 and Figure 3B). E.2.1.3. Residues Leu494-Pro704 from vWF. The peptide sequence present in the plasmid pYG1310 still has the threonine or serine residues at positions 485, 492, 493 and 500 which are naturally O-glycosylated in the native molecule of human vWF, located at immediate proximity to the G10 peptide defined by Mori et al. [J. Biol. Chem. 263 (1988) 17901-17904]. Amplification by the PCR technique of plasmid pET8C- 52K by the oligodeoxynucleotides 5'-CCCGGGTACCTTAGG- CTTACTGTATGTGGAGGACATC-3 '(Sq3037, the KpnI and MstII sites are underlined) and 5'-CCATGGATCCAAGCTTAAGGAGGAGGGGCTTCAGGGGC- AAGGTC-3' (Sq2622, sites BamHI and HindIII are underlined) generates a fragment including residues Leu494 to Pro704 of vWF. The amplified fragments are first cut by the enzymes Kpn1 and BamHI to be cloned in a vector of pUC type cut by the same enzymes. A particular clone is isolated which corresponds to the expected sequence verified by sequencing. This Kpnl-BamHI fragment therefore comprises an MstlI-HindIII fragment including the residues Leu494 to Pro704 of human vWF. The plasmid pYG1373 comprises this restriction fragment MstlI-HindlH preceded by the HindIII-MstlI fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B). E.2.1.4. Residues Tyr508-Pro704 from vWF.
La séquence peptidique présente après amplification PCR dans le plasmide pYG1373 possède encore le résidu thréonine à la position 500 qui est naturellement O-glycosylé dans la molécule native du vWF humain. L'amplification par la technique PCR du plasmide pET8C-52K par les oligodéoxynucléotides 5'-CCCGG- GTACCTTAGGCTTATACTGCAGCAGGCTACTGGACCTG-3' (Sq2621, les sites Kpnl et Mstll sont soulignés) et 5'-CCATGGATC-The peptide sequence present after PCR amplification in the plasmid pYG1373 still has the threonine residue at position 500 which is naturally O-glycosylated in the native molecule of human vWF. Amplification by the PCR technique of the plasmid pET8C-52K by the oligodeoxynucleotides 5'-CCCGG- GTACCTTAGGCTTATACTGCAGCAGGCTACTGGACCTG-3 '(Sq2621, the Kpnl and Mstll sites are underlined) and 5'-CCATGGATC-
CAAGCTTAAGGAGGAGGGGCTTCAGGGGCAAGGTC-3' (Sq2622, les sites BamHI et HindIII sont soulignés) génère un fragment incluant les résidus Tyr508 à Pro704 du vWF. Les fragments amplifiés sont d'abord coupés par les enzymes Kpnl et BamHI pour être clones dans un vecteur de type pUC coupé par les mêmes enzymes. Un clone particulier est isolé qui corresponds à la séquence attendue vérifiée par séquençage. Ce fragment Kpnl-BamHI comporte donc un fragment MstlI-HindlII incluant les résidus Tyr508 à Pro704 du vWF humain. Le plasmide pYG1309 comporte ce fragment de restriction MstlI-HindlII précédé du fragment Hindiπ-Mstll du plasmide pYG404 (cf. Exemple 4 et Figure 3B) . E.2.1.5. Résidus Pro502-Pro704 du vWF. La séquence peptidique correspondant aux résidus Pro502 à Pro704 du vWF humain est générée à partir du plasmide précédent par insertion des oligcxiéoxynucléotides 5'-TTAGGGT ACCACCTTTGCATGACTTCTACTGCA-3' (Sq2751) et 5'-GTAGAAGTCATGCAAAGGTGGTAACCC-3' (Sq2752) qui en s'appariant peuvent être clones entre les sites Mstll et PstI du plasmide obtenu après amplification PCR selon l'exemple E.2.I.4., ce qui permet de générer un fragment de restriction MstlI-HindlII incluant les résidus Pro502 à Pro704 du vWF humain. Le plasmide pYG1350 comporte ce fragment de restriction MstlI-HindlII précédé du fragment HindIII-MstlI du plasmide pYG404 (cf. Exemple 4 et Figure 3B).CAAGCTTAAGGAGGAGGGGCTTCAGGGGCAAGGTC-3 '(Sq2622, BamHI and HindIII sites are underlined) generates a fragment including residues Tyr508 to Pro704 of vWF. The amplified fragments are first cut by the enzymes Kpn1 and BamHI to be cloned in a vector of the pUC type cut by the same enzymes. A particular clone is isolated which corresponds to the expected sequence verified by sequencing. This Kpnl-BamHI fragment therefore comprises an MstlI-HindIII fragment including the residues Tyr508 to Pro704 of human vWF. The plasmid pYG1309 comprises this restriction fragment MstlI-HindlII preceded by the Hindiπ-Mstll fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B). E.2.1.5. Residues Pro502-Pro704 from vWF. The peptide sequence corresponding to residues Pro502 to Pro704 of human vWF is generated from the preceding plasmid by insertion of the oligcxieoxynucleotides 5'-TTAGGGT ACCACCTTTGCATGACTTCTACTGCA-3 ' (Sq2751) and 5'-GTAGAAGTCATGCAAAGGTGGTAACCC-3 '(Sq2752) which by pairing can be cloned between the Mstll and PstI sites of the plasmid obtained after PCR amplification according to Example E.2.I.4., Which allows generate a MstlI-HindlII restriction fragment including residues Pro502 to Pro704 of human vWF. The plasmid pYG1350 comprises this restriction fragment MstlI-HindlII preceded by the HindIII-MstlI fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B).
E.2.2. Résidus Thr470-Asp498 du vWF: peptide du type Pl.E.2.2. Residues Thr470-Asp498 of vWF: peptide of the Pl type.
Dans un mode de réalisation particulier, le site de liaison du vWF est un peptide incluant les résidus Thr470 à Asp498 du vWF mature. Cette séquence inclus le peptide G10 (Cys474-Pro488) décrit par Mori et al. [J. Biol. Chem. 2£2 (1988) 17901-17904] et capable d'antagoniser l'interaction du vWF humain à la GPlb des plaquettes humaines. La séquence incluant le peptide G10 est d'abord générée sous la forme d'un fragment de restriction MstlI-HindlII. par exemple au moyen de la technique d'amplification PCR, ou encore directement à l'aide d'oligodéoxynucléotides synthétiques. Par exemple, les produits de l'amplification PCR du plasmide ρET-8c52K avec les oligodéoxynucléotides Sql969 et 5'-CCCG- GGATCCAAGCTTAGTCCTCCACATACAG-3' (Sql970, les sites BamHI et HindIII sont soulignés) sont d'abord coupés par l'enzyme BamHI puis clones dans le site BamHI d'un vecteur de type pUC Un clone particulier est isolé qui corresponds à la séquence attendue vérifiée par séquençage. Ce fragment BamHI comporte donc un fragment MstlI-HindlII incluant les résidus Thr470 à Asp498 du vWF humain. Le plasmide pYG1210 comporte ce fragment de restriction MstlI-HindlII précédé du fragment HindIII-MstlI du plasmide pYG404 (cf. Exemple 4 et Figure 3B).In a particular embodiment, the vWF binding site is a peptide including residues Thr470 to Asp498 of mature vWF. This sequence includes the peptide G10 (Cys474-Pro488) described by Mori et al. [J. Biol. Chem. 2 £ 2 (1988) 17901-17904] and capable of antagonizing the interaction of human vWF with the GPlb of human platelets. The sequence including the peptide G10 is first generated in the form of a restriction fragment MstlI-HindlII. for example by means of the PCR amplification technique, or even directly using synthetic oligodeoxynucleotides. For example, the PCR amplification products of the plasmid ρET-8c52K with the oligodeoxynucleotides Sql969 and 5'-CCCG- GGATCCAAGCTTAGTCCTCCACATACAG-3 '(Sql970, the BamHI and HindIII sites are underlined) are first cut by the enzyme BamHI then clones in the BamHI site of a vector of the pUC type. A particular clone is isolated which corresponds to the expected sequence verified by sequencing. This BamHI fragment therefore comprises an MstlI-HindlII fragment including the residues Thr470 to Asp498 of human vWF. The plasmid pYG1210 comprises this restriction fragment MstlI-HindlII preceded by the HindIII-MstlI fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B).
E.2.3. Résidus Leu694-Pro708 du vWF: peptide du type P2. Dans un second mode de réalisation, le site de liaison du vWF à la GPlb est directement conçu à l'aide d'oligodéoxynucléotides synthétiques, et par exemple les oligodéoxynucléotides 5'-TTAGGCCTCTGTGACCTTGCCCCTG-E.2.3. Residues Leu694-Pro708 from vWF: peptide of type P2. In a second embodiment, the binding site of vWF to GPlb is directly designed using synthetic oligodeoxynucleotides, for example the oligodeoxynucleotides 5'-TTAGGCCTCTGTGACCTTGCCCCTG-
AAGCCCCTCCTCCTACTCTGCCCCCCTAAGCTTA-3' et 5'-GATC-AAGCCCCTCCTCCTACTCTGCCCCCCTAAGCTTA-3 'and 5'-GATC-
TAAGCTTAGGGGGGCAGAGTAGGAGGAGGGGCTTCAGGGGCAAGGTC- ACAGAGGCC-3'. Ces oligodéoxynucléotides forment en s'appariant un fragment de restriction MstlI-BglII incluant le fragment MstlI-HindlII correspondant au peptide D5 défini par les résidus Leu694 à Pro708 du vWF [Mori H. et al., J. Biol. Chem. 263 (1988) 17901-17904]. Le plasmide pYG1204 comporte ce fragment de restriction MstlI-HindlII précédé du fragment HindIII-MstlI du plasmide pYG404 (cf. Exemple 4 et Figure 3B).TAAGCTTAGGGGGGCAGAGTAGGAGGAGGGGCTTCAGGGGCAAGGTC- ACAGAGGCC-3 '. These oligodeoxynucleotides form by pairing a MstlI-BglII restriction fragment including the MstlI-HindlII fragment corresponding to the D5 peptide defined by residues Leu694 to Pro708 of the vWF [Mori H. et al., J. Biol. Chem. 263 (1988) 17901-17904]. Plasmid pYG1204 contains this fragment of MstlI-HindlII restriction preceded by the HindIII-MstlI fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B).
E.2.4. Peptide du type P1-XD-P2.E.2.4. Peptide of the P1-XD-P2 type.
Des variants utiles du plasmide pET-8c52K sont délétés par mutagénèse dirigée entre les peptides G10 et D5, par exemple des sites de fixation au collagène, et/ou à l'héparine, et/ou à la botrocétine, et/ou aux sulfatides et ou à la ristocétine. Un exemple est le plasmide pMMB9 délété par mutagénèse dirigée entre les résidus Cys509 et Ile662. L'amplification PCR de ce plasmide avec les oligodéoxynucléotides Sql969 et Sq2029 génère un fragment de restriction Mstll- HindIII incluant les résidus Thr470 à Tyr508 et Arg663 à Val713 et en particulier les peptides G10 et D5 du vWF et délété en particulier de son site de fixation au collagène localisé entre les résidus Glu542 et Met622 [Roth GJ. et al. Biochemistry 2g (1986) 8357-8361]. Le plasmide pYG1217 comporte ce fragment de restriction Mstπ-HindHI précédé du fragment HindIII-MstlI du plasmide pYG404 (cf. Exemple 4 et Figure 3B). Dans d'autres modes de réalisation, l'utilisation des techniques combinées de mutagénèse dirigée et d'amplification PCR permet de générer à volonté des variants du fragment de restriction MstlI-HindlII de la Figure 1 mais délétés d'un ou plusieurs sites de fixation aux sulfatides et/ou à la botrocétine et ou à l'héparine et/ou au collagène.Useful variants of the plasmid pET-8c52K are deleted by site-directed mutagenesis between the peptides G10 and D5, for example binding sites to collagen, and / or to heparin, and / or to botrocetin, and / or to sulfatides and or ristocetin. An example is the plasmid pMMB9 deleted by site-directed mutagenesis between residues Cys509 and Ile662. PCR amplification of this plasmid with the oligodeoxynucleotides Sql969 and Sq2029 generates a restriction fragment Mstll-HindIII including residues Thr470 to Tyr508 and Arg663 to Val713 and in particular the peptides G10 and D5 of vWF and deleted in particular from its binding site to collagen located between residues Glu542 and Met622 [Roth GJ. et al. Biochemistry 2g (1986) 8357-8361]. The plasmid pYG1217 comprises this restriction fragment Mstπ-HindHI preceded by the HindIII-MstlI fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B). In other embodiments, the use of the combined techniques of site-directed mutagenesis and PCR amplification makes it possible to generate at will variants of the restriction fragment MstlI-HindlII of FIG. 1 but deleted from one or more binding sites. sulfatides and / or botrocetin and or heparin and / or collagen.
E.2.5. Peptide du type Pl-X*-P2.E.2.5. Peptide of the Pl-X * -P2 type.
E.2.5.1. Altération conformationnelle par substitution des résidus cystéine.E.2.5.1. Conformational alteration by substitution of cysteine residues.
Les produits de l'amplification PCR des plasmides p5E et p7E avec les oligodéoxynucléotides Sq2149 (5'-CCCGGGATCCCTTAGGCTTAACCGGTG- AAGCCGGC-3', les sites BamHI et Mstll sont soulignés) et Sq2029 sont d'abord clones dans un vecteur de type pUC sous la forme d'un fragment de restrictionThe PCR amplification products of plasmids p5E and p7E with the oligodeoxynucleotides Sq2149 (5'-CCCGGGATCCCTTAGGCTTAACCGGTG- AAGCCGGC-3 ', the BamHI and Mstll sites are underlined) and Sq2029 are first cloned into a vector of type pUC under the shape of a restriction fragment
BamHI. et la séquence d'un clone est vérifiée par séquençage. La séquence du fragment MstlI-HindlII ainsi généré corresponds à la séquence correspondante donnée à la Figure 1 à l'exception que les résidus 471 et 474 du vWF sont des résidus glycine et non des résidus cystéine. Le plasmide pYG1271 comporte ce fragment de restriction Mstϋ-HindlII précédé du fragment HindIII-MstlI du plasmide pYG404 (cf. Exemple 4 et Figure 3B). Le plasmide pYG1269 est généré de façon similaire à l'exception que le plasmide p7E est utilisé comme matrice lors de l'amplification PCR par les oligodéoxynucléotides Sq2149 et Sq2029. E.2.5.2. Altération conformationnelle par introduction de mutations du type IIB D'autres mutations particulièrement utiles concernent au moins un résidu impliqué dans des pathologies de type IIB associées au vWF (augmentation de l'affinité intrinsèque du vWF pour la GPlb), comme les résidus Arg543, Arg545, Trp550, Val551, Val553, Pro574 ou Arg578 par exemple. Les techniques de recombinaison génétique in vitro permettent également d'introduire à volonté un ou des résidus supplémentaires dans la séquence du vWF et par exemple une méthionine surnuméraire entre les positions Asp539 et Glu542. Dans une exemplification particulière, les mutations Arg543->Trp543 (R543W) et Pro574- >Leu574 (P574L) sont introduites par mutagénèse dirigée à l'aide des oligodéoxynucléotides 5'-GTGCTGAAGGCCTTTGTGGTCGACATGATGGA- GTQfiCTGCGGATATCCCAGAAGTGGGTAGCGGTGGCCGTGGTGGA-BamHI. and the sequence of a clone is verified by sequencing. The sequence of the MstlI-HindIII fragment thus generated corresponds to the corresponding sequence given in FIG. 1 with the exception that residues 471 and 474 of vWF are glycine residues and not cysteine residues. The plasmid pYG1271 comprises this restriction fragment Mstϋ-HindlII preceded by the HindIII-MstlI fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B). Plasmid pYG1269 is generated similarly except that the plasmid p7E is used as a template during the PCR amplification by the oligodeoxynucleotides Sq2149 and Sq2029. E.2.5.2. Conformational alteration by introduction of type IIB mutations Other particularly useful mutations relate to at least one residue involved in type IIB pathologies associated with vWF (increase in the intrinsic affinity of vWF for GPlb), such as the residues Arg543, Arg545 , Trp550, Val551, Val553, Pro574 or Arg578 for example. In vitro genetic recombination techniques also make it possible to introduce, at will, one or more additional residues into the sequence of vWF and for example a supernumerary methionine between the positions Asp539 and Glu542. In a particular exemplification, the mutations Arg543-> Trp543 (R543W) and Pro574-> Leu574 (P574L) are introduced by site-directed mutagenesis using the oligodeoxynucleotides 5'-GTGCTGAAGGCCTTTGTGGTCGACATGATGGAGGGGGGGGGTGTGTGTTGAGTGTGAGTGAGTTAG
GTACC-3' (Sq2851; le codon spécifiant le résidu Arg543 est souligné) et 5'- GGGCTCAAGGACCGGAAGCGCTTAAGCGAGCTGCGGCGCATTGCC- AGCCAG-3' (Sq2855; le codon spécifiant le résidu Leu574 est souligné), respectivement. Après vérification de la séquence nucléotidique, on génère ainsi des fragments de restriction MstlI-HindlII incluant les mutants de type IIB du vWF humain R543W et P574L. Les plasmides pYG1359 (R543W) et pYG1360 (P574L) comportent ces fragments de restriction MstlI-HindlII précédés du fragment HindIII-MstlI du plasmide pYG404 (cf. Exemple 4 et Figure 3B). La mutagénèse à l'aide de l'oligodéoxynucléotide Sq2851 introduit également les sites Sali. EcoRV et MluI aux positions Val538, Ile546 et Val551, respectivement. Ces sites de restriction ne sont pas présents dans la séquence correspondante naturelle du vWF humain et sont donc particulièrement utiles pour introduire facilement toute mutation désirable entre les résidus Val538 et Val551. A titre d'exemple, les oligodéoxynucléotides 5'-ATCCCAGAAGTGCGTA-3' (Sq3017, le codon spécifiant le mutant de type IIB Cys550 est souligné) et 5'-CGCGTACGCACTTCTGGGAT-3' (Sq3018) forment en s'appariant un fragment de restriction EcoRV-MluI qui peut être clone dans le plasmide pYG1359 coupé par les enzymes EcoRV et MluI. ce qui génère le plasmide pYG1374 comportant les mutations R543W et W550C (Figure 3B). De la même façon, les oligodéoxynucléotides 5'- TCGACATGATGGAGCHfiCTGCGGAT-3' (Sq3019, le codon spécifiant le résidu Arg543 provenant de la séquence naturelle est souligné) et 5'- ATCCGCAGCCGCTCCATCATG-3' (Sq3020) forment en s'appariant un fragment de restriction SalI-EcoRV qui peut être clone dans le plasmide pYG1374 coupé par les enzymes Sali et EcoRV. ce qui génère le plasmide pYG1386 qui ne comporte que la mutation W550C (Figure 3B).GTACC-3 '(Sq2851; the codon specifying the Arg543 residue is underlined) and 5'- GGGCTCAAGGACCGGAAGCGCTTAAGCGAGCTGCGGCGCATTGCC- AGCCAG-3'(Sq2855; the codon specifying the Leu574 residue is underlined), respectively. After verification of the nucleotide sequence, MstlI-HindlII restriction fragments are thus generated including the type IIB mutants of human vWF R543W and P574L. The plasmids pYG1359 (R543W) and pYG1360 (P574L) comprise these restriction fragments MstlI-HindlII preceded by the HindIII-MstlI fragment of the plasmid pYG404 (cf. Example 4 and Figure 3B). Mutagenesis using the oligodeoxynucleotide Sq2851 also introduces the SalI sites. EcoRV and MluI at positions Val538, Ile546 and Val551, respectively. These restriction sites are not present in the corresponding natural sequence of human vWF and are therefore particularly useful for easily introducing any desirable mutation between residues Val538 and Val551. For example, the oligodeoxynucleotides 5'-ATCCCAGAAGTGCGTA-3 '(Sq3017, the codon specifying the type IIB mutant Cys550 is underlined) and 5'-CGCGTACGCACTTCTGGGAT-3' (Sq3018) form by matching a restriction fragment EcoRV-MluI which can be cloned into the plasmid pYG1359 cut by the enzymes EcoRV and MluI. which generates the plasmid pYG1374 comprising the mutations R543W and W550C (Figure 3B). Similarly, the 5'- oligodeoxynucleotides TCGACATGATGGAGCHfiCTGCGGAT-3 '(Sq3019, the codon specifying the Arg543 residue from the natural sequence is underlined) and 5'- ATCCGCAGCCGCTCCATCATG-3' (Sq3020) form by matching a restriction fragment SalI-EcoRV which can be cloned into the plasmid pYG1374 cut by the enzymes Sali and EcoRV. which generates the plasmid pYG1386 which contains only the W550C mutation (Figure 3B).
EXEMPLE 3: CONSTRUCTION D'UN FRAGMENT DE RESTRICTION MSTII/HINDIII INCLUANT UN SITE DE LIAISON DU vWF AU SOUS- ENDOTHELIUMEXAMPLE 3: CONSTRUCTION OF AN MSTII / HINDIII RESTRICTION FRAGMENT INCLUDING A VWF LINK SITE TO THE SUBENDOTHELIUM
Dans un mode de réalisation particulier, les sites de liaison du vWF aux composants du tissu sous-endothélial et du collagène en particulier, sont générés par amplication PCR du plasmide pET-8c52K. Par exemple l'utilisation des oligodéoxynucléotides Sq2258 (5'-GGATCCTTAGGGCTG-In a particular embodiment, the binding sites of vWF to the components of the subendothelial tissue and of collagen in particular, are generated by PCR amplification of the plasmid pET-8c52K. For example, the use of the oligodeoxynucleotides Sq2258 (5'-GGATCCTTAGGGCTG-
TGCAGCAGGCTACTGGACCTGGTC-3', le siteMstlI est souligné) et Sq2259 (5'- GAATTCAAG^TTAACAGAGGTAGCTAACGATCTCGTCCC-3,, le site Hjndiπ est souligné) permet de générer le plasmide pYG1254 dont le fragment de restriction MstlI-HindlII inclus les résidus Cys509 à Cys695 du vWF naturel (peptide de' type X). La ligature de ce fragment de restriction avec le fragment de restriction HindlII- Mstπ du plasmide pYG404 (cf. Exemple 4) génère le fragment de restriction Hindm du plasmide pYG1276 (Figure 3B) .TGCAGCAGGCTACTGGACCTGGTC-3 ', the siteMstlI is underlined) and Sq2259 (5'-TTAACAGAGGTAGCTAACGATCTCGTCCC GAATTCAAG ^ 3, Hjndiπ site underlined) used to generate the plasmid pYG1254 whose MstII-HindIII restriction fragment includes residues Cys509 to Cys695 of natural vWF (peptide 'type X). Ligation of this restriction fragment with the HindIII-Mstπ restriction fragment of the plasmid pYG404 (cf. Example 4) generates the Hindm restriction fragment of the plasmid pYG1276 (FIG. 3B).
Des variants moléculaires des types XD (cf. E.2.4.) ou X* (cf. E.2.5.) peuvent également être générés selon la même stratégie et qui comportent toute combinaison souhaitable entre les sites de fixation du vWF aux sulfatides et/ou à la botrocétine et/ou à l'héparine et/ou au collagène et/ou tout résidu responsable d'une modification de l'affinité du vWF pour la GPlb (pathologies de type II associée au vWF). Dans un autre mode de réalisation, le domaine capable de se fixer au collagène peut également provenir du fragment du vWF compris entre les résidus 911 et 1114 et décritparPareti et al. [J. Biol. Chem. (1987) 2£2: 13835-13841].Molecular variants of types XD (cf. E.2.4.) Or X * (cf. E.2.5.) Can also be generated according to the same strategy and which comprise any desirable combination between the sites for binding of vWF to sulfatides and / or botrocetin and / or heparin and / or collagen and / or any residue responsible for a modification of the affinity of vWF for GPlb (type II pathologies associated with vWF). In another embodiment, the domain capable of binding to collagen can also come from the vWF fragment comprised between residues 911 and 1114 and described by Pareti et al. [J. Biol. Chem. (1987) 2 £ 2: 13835-13841].
EXEMPLE 4: COUPLAGE EN C-TERMINAL DE LA SAHEXAMPLE 4: COUPLING IN C-TERMINAL OF THE SAH
Le plasmide pYG404 est décrit dans la demande de brevet EP 361 991. Ce plasmide comporte un fragment de restriction HindIII codant pour le gène de la prépro-SAH précédé des 21 nucléotides naturellement présents immédiatement en amont de l'ATG initiateur de traduction du gène PGK de S. cerevisiae. Ce fragment comporte un fragment de restriction HindIII-MstlI correspondant à la totalité du gène codant pour la SAH à l'exception des trois acides aminés les plus C-terminaux (résidus leucine-glycine-leucine). La ligature de ce fragment avec l'un quelconque des fragments MstlI-HindlII décrits dans les exemples 2 ou 3 permet de générer des fragments de restriction HindIII incluant des gènes composites codant pour des protéines chimères dans lesquelles un fragment du vWF doué de propriétés particulières est positionné en phase traductionnelle de lecture en C-terminal de la molécule de SAH. De tels gènes composites sont exemplifiés dans le Tableau de la Figure 3B.The plasmid pYG404 is described in patent application EP 361 991. This plasmid comprises a HindIII restriction fragment coding for the prepro-SAH gene preceded by the 21 nucleotides naturally present immediately in upstream of the translation initiating ATG of the PGK gene of S. cerevisiae. This fragment comprises a HindIII-MstlI restriction fragment corresponding to the entire gene coding for SAH with the exception of the three most C-terminal amino acids (leucine-glycine-leucine residues). Ligation of this fragment with any of the MstlI-HindlII fragments described in Examples 2 or 3 makes it possible to generate HindIII restriction fragments including composite genes coding for chimeric proteins in which a fragment of vWF endowed with particular properties is positioned in the translational phase of C-terminal reading of the SAH molecule. Such composite genes are exemplified in the Table of Figure 3B.
EXEMPLE 5: COUPLAGE EN N-TERMINAL DE LA SAHEXAMPLE 5: COUPLING IN N-TERMINAL OF THE SAH
Dans un mode réalisation particulier, les techniques combinées de mutagénèse dirigée et d'amplification PCR permettent de construire des gènes hybrides codant pour une protéine chimère résultant du couplage traductionnel entre un peptide signal (et par exemple la région prépro de la SAH), une séquence incluant un fragment du vWF doué de propriétés d'adhésivité et la forme mature de la SAH ou -un de ses variants moléculaires. Ces gènes hybrides sont préférentiellement bordés en 5' de l'ATG initiateur de traduction et en 3' du codon de fin de traduction par des sites de restriction HindIII ce qui permet de générer des plasmides d'expression de ces protéines chimères, par exemple selon la stratégie détaillée dans l'exemple suivant.In a particular embodiment, the combined techniques of site-directed mutagenesis and PCR amplification make it possible to construct hybrid genes coding for a chimeric protein resulting from the translational coupling between a signal peptide (and for example the prepro region of HSA), a sequence including a fragment of vWF endowed with adhesiveness properties and the mature form of SAH or one of its molecular variants. These hybrid genes are preferably bordered 5 'to the translation initiating ATG and 3' to the translation end codon by HindIII restriction sites, which makes it possible to generate expression plasmids for these chimeric proteins, for example according to the strategy detailed in the following example.
EXEMPLE 6: PLASMIDES D'EXPRESSIONEXAMPLE 6: EXPRESSION PLASMIDS
Les protéines chimères des exemples précédents peuvent être exprimées dans les levures à partir de promoteurs fonctionnels, régulables ou constitutifs, tels que, par exemple, ceux présents dans les plasmides pYG105 (promoteur LAC4 de Kluyveromyces lactis). pYG106 (promoteur PGK de Saccharomyces cerevisiae) . pYG536 (promoteur PHO5 de S. cerevisiae). ou des promoteur hybrides tels que ceux décrits dans la demande de brevet EP 361 991. Les plasmides pYG105 et pYG106 sont ici particulièrement utiles car ils permettent l'expression des gènes codés par les fragments de restriction HindIII des exemples E.4. et E.5. à partir de promoteurs fonctionnels chez K. lactis. régulables (pYG105) ou constitutifs (pYG106). Le plasmide pYG105 corresponds au plasmide pKan707 décrit dans la demande de brevet EP 361 991 dans lequel le site de restriction HindIII unique et localisé dans le gène de résistance à la généticine (G418) a été détruit par mutagénèse dirigée tout en conservant une protéine inchangée (oligodeoxynucléotide 5'-GAAATGCATAAGCTCTTGCCATTCTCACCG-3'). Le fragment Sall-Sacl codant pour le gène URA3 du plasmide muté a été ensuite remplacé par un fragment de restriction Sall-Sacl comportant une cassette d'expression constituée du promoteur LAC4 de K. lactis (sous la forme d'un fragment SalI-HindHI) et du terminateur du gène PGK de S. cerevisiae (sous la forme d'un fragment HindJJI- Sacl). Le plasmide pYG105 est mitotiquement très stable chez les levures Kluyveromyces et une carte de restriction en est donnée à la Figure 3. Les plasmides pYG105 et pYG106 ne diffèrent entre eux que par la nature du promoteur de transcription encodé par le fragment SalI-HindIII. A titre d'exemple, le clonage, "dans l'orientation productive" (définie comme l'orientation qui place la région "prépro" de l'albumine de façon proximale par rapport au promoteur de transcription), des fragments de restriction HindIII des plasmides pYG1220, pYG1310, pYG1373, pYG1309, pYG1350, pYG1210, pYG1204, pYG1217, pYG1269, pYG1271, pYG1359, pYG1360, pYG1374, pYG1386 et pYG1276, dans le site HindIII du plasmide pYG105 génère respectivement les plasmides d'expression pYG1248, pYG1313, pYG1375, pYG1311, pYG1355, pYG1214, pYG1206, pYG1223, pYG1279, pYG1283, pYG1361, pYG1365, pYG1377, pYG1389 etpYG1277.The chimeric proteins of the preceding examples can be expressed in yeasts from functional, regulatable or constitutive promoters, such as, for example, those present in the plasmids pYG105 (LAC4 promoter from Kluyveromyces lactis). pYG106 (PGK promoter of Saccharomyces cerevisiae). pYG536 (PHO5 promoter of S. cerevisiae). or hybrid promoters such as those described in patent application EP 361 991. The plasmids pYG105 and pYG106 are particularly useful here because they allow the expression of the genes encoded by the HindIII restriction fragments of Examples E.4. and E.5. from functional promoters in K. lactis. controllable (pYG105) or constitutive (pYG106). The plasmid pYG105 corresponds to the plasmid pKan707 described in the Patent application EP 361 991 in which the unique HindIII restriction site located in the geneticin resistance gene (G418) was destroyed by site-directed mutagenesis while retaining an unchanged protein (oligodeoxynucleotide 5'-GAAATGCATAAGCTCTTGCCATTCTCACCG-3 '). The Sall-Sacl fragment coding for the URA3 gene of the mutated plasmid was then replaced by a Sall-Sacl restriction fragment comprising an expression cassette consisting of the LAC4 promoter from K. lactis (in the form of a SalI-HindHI fragment ) and the terminator of the PGK gene of S. cerevisiae (in the form of a HindJJI-Sacl fragment). The plasmid pYG105 is mitotically very stable in Kluyveromyces yeasts and a restriction map is given in FIG. 3. The plasmids pYG105 and pYG106 differ from each other only in the nature of the transcription promoter encoded by the SalI-HindIII fragment. For example, cloning, "in productive orientation" (defined as the orientation that places the "prepro" region of albumin proximal to the transcription promoter), HindIII restriction fragments of plasmids pYG1220, pYG1310, pYG1373, pYG1309, pYG1350, pYG1210, pYG1204, pYG1217, pYG1269, pYG1271, pYG1359, pYG1360, pYG1374, pYG1386 and pYG125, plasmid p13, pYG1386 and pYG1276, in expression site p13, pYG1386 , pYG1311, pYG1355, pYG1214, pYG1206, pYG1223, pYG1279, pYG1283, pYG1361, pYG1365, pYG1377, pYG1389 and pYG1277.
EXEMPLE 7: TRANSFORMATION DES LEVURESEXAMPLE 7: YEAST PROCESSING
La transformation des levures appartenant au genre Kluyveromyces. et en particulier les souches MW98-8C et CBS 293.91 de K. lactis. s'effectue par exemple par la technique de traitement des cellules entières par de l'acétate de lithium [Ito H. et al., J. Bacteriol. 153 (1983) 163-168], adaptée comme suit. La croissance des cellules se fait à 28°C dans 50 ml de milieu YPD, avec agitation et jusqu'à une densité optique à 600 nm (DOOOO) comprise entre 0,6 et 0,8 ; les cellules sont récoltées par centrifugation à faible vitesse, lavées dans une solution stérile de TE (10 mM Tris HCl pH 7,4; 1 mM EDTA), resuspendues dans 3-4 ml d'acétate lithium (0,1 M dans du TE) pour obtenir une densité cellulaire d'environ 2 x 10° cellules/ml, puis incubées à 30°C pendant 1 heure sous agitation modérée. Des aliquotes de 0,1 ml de la suspension résultante de cellules compétentes sont incubés à 30°C pendant 1 heure en présence d'ADN et à une concentration finale de 35 % de polyéthylène glycol (PEG400O' Sigma). Après un choc thermique de 5 minutes àThe transformation of yeasts belonging to the genus Kluyveromyces. and in particular the MW98-8C and CBS 293.91 strains of K. lactis. is carried out for example by the technique of treating whole cells with lithium acetate [Ito H. et al., J. Bacteriol. 153 (1983) 163-168], adapted as follows. The cells are grown at 28 ° C. in 50 ml of YPD medium, with stirring and up to an optical density at 600 nm (DOOOO) of between 0.6 and 0.8; the cells are harvested by centrifugation at low speed, washed in a sterile TE solution (10 mM Tris HCl pH 7.4; 1 mM EDTA), resuspended in 3-4 ml of lithium acetate (0.1 M in TE ) to obtain a cell density of approximately 2 x 10 ° cells / ml, then incubated at 30 ° C for 1 hour with moderate shaking. 0.1 ml aliquots of the resulting suspension of competent cells are incubated at 30 ° C for 1 hour in the presence of DNA and at a final concentration of 35% polyethylene glycol (PEG400O 'Sigma). After a thermal shock of 5 minutes at
42°C, les cellules sont lavées 2 fois, resuspendues dans 0,2 ml d'eau stérile et incubées 16 heures à 28°C dans 2 ml de milieu YPD pour permettre l'expression phénotypique du gène de résistance au G418 exprimé sous contrôle du promoteur P^l (cf. EP 361 991) ; 200 μl de la suspension cellulaire sont ensuite étalés sur boites YPD sélectives (G418, 200 μg/ml). Les boites sont mises à incuber à 28°C et les transformants apparaissent après 2 à 3 jours de croissance cellulaire.42 ° C, the cells are washed twice, resuspended in 0.2 ml of sterile water and incubated for 16 hours at 28 ° C in 2 ml of YPD medium to allow the phenotypic expression of the G418 resistance gene expressed under control the promoter P ^ 1 (cf. EP 361 991); 200 μl of the cell suspension are then spread on selective YPD dishes (G418, 200 μg / ml). The dishes are incubated at 28 ° C and the transformants appear after 2 to 3 days of cell growth.
EXEMPLE 8: SECRETION DES CHIMERESEXAMPLE 8: SECRETION OF CHIMERAS
Après sélection sur milieu riche supplémenté en G418 les clones recombinants sont testés pour leur capacité à sécréter les protéines chimères entre SAH et vWF. Quelques clones correspondant à la souche CBS 293.91 transformée, par exemple, avec les plasmides pYG1214 (SAH-P1), ρYG1206 (SAH-P2), pYG1223 (SAH-P1-XD-P2) et pYG1248 (SAH-P1-X-P2) ou pKan707 (vecteur témoin) sont mis à incuber en milieu YPD ou YPL à 28°C Les surnageants cellulaires sont récupérés par centrifugation quand les cellules atteignent la phase stationnaire de croissance, éventuellement concentrés 10 fois par précipitation pendant 30 minutes à -20°C dans une concentration finale de 60 % d'éthanol, puis testés après électrophorèse en gel SDS-PAGE à 8.5 %, soit directement par coloration du gel par du bleu de coomassie, soit après immunoblot en utilisant comme anticorps primaires des anticorps de souris dirigés contre le vWF ou un sérum polyclonal de lapin dirigé contre la SAH. Lors des expériences de détection immunologique, le filtre de nitrocellulosë est d'abord incubé en présence des anticorps primaires spécifiques, lavé plusieurs fois, incubé en présence d'anticorps de chèvre anti-souris (immunoblot anti-vWF) ou anti-lapin (immunoblot anti-SAH), puis incubé en présence d'un complexe avidine-péroxydase en utilisant le "kit ABC" distribué par Vectastain (Biosys S.A., Compiègne, France). La réaction immunologique est ensuite révélée par addition de diamino-3,3' benzidine tetrachlorydrate (Prolabo) en présence d'eau oxygénée, selon les recommandations du fabricant. Les résultats des Figures 4 à 8 démontrent que la levure K. lactis est capable de sécréter des protéines chimères entre la SAH et un fragment du vWF, et que ces chimères sont reconnues par des anticorps spécifiques de la SAH ou du vWF. EXEMPLE 9: PURIFICATION ET CARACTERISATION MOLECULAIRE DES PRODUITS SECRETESAfter selection on rich medium supplemented with G418, the recombinant clones are tested for their capacity to secrete chimeric proteins between SAH and vWF. A few clones corresponding to the CBS 293.91 strain transformed, for example, with the plasmids pYG1214 (SAH-P1), ρYG1206 (SAH-P2), pYG1223 (SAH-P1-XD-P2) and pYG1248 (SAH-P1-X-P2 ) or pKan707 (control vector) are incubated in YPD or YPL medium at 28 ° C. The cell supernatants are recovered by centrifugation when the cells reach the stationary growth phase, possibly concentrated 10 times by precipitation for 30 minutes at -20 °. C in a final concentration of 60% ethanol, then tested after electrophoresis in SDS-PAGE gel at 8.5%, either directly by staining the gel with coomassie blue, or after immunoblotting using, as primary antibodies, antibodies to mice directed against vWF or a polyclonal rabbit serum directed against HSA. During immunological detection experiments, the nitrocellulose filter is first incubated in the presence of specific primary antibodies, washed several times, incubated in the presence of goat anti-mouse antibodies (immunoblot anti-vWF) or anti-rabbit (immunoblot anti-HSA), then incubated in the presence of an avidin-peroxidase complex using the "ABC kit" distributed by Vectastain (Biosys SA, Compiègne, France). The immunological reaction is then revealed by the addition of 3,3-diamino benzidine tetrachlorydrate (Prolabo) in the presence of hydrogen peroxide, according to the manufacturer's recommendations. The results of FIGS. 4 to 8 demonstrate that the yeast K. lactis is capable of secreting chimeric proteins between SAH and a fragment of vWF, and that these chimeras are recognized by antibodies specific for SAH or vWF. EXAMPLE 9 PURIFICATION AND MOLECULAR CHARACTERIZATION OF THE SECRET PRODUCTS
Les chimères présentes dans les surnageants de culture correspondant à la souche CBS 293.91 transformée, par exemple par les plasmides d'expression selon l'exemple 6, sont caractérisées dans un premier temps à l'aide d'anticorps spécifiques de la partie SAH et de la partie vWF. Les résultats des Figures 4 à 8 démontrent que la levure K. lactis est capable de sécréter des protéines chimères entre la SAH et un fragment du vWF, et que ces chimères sont immunologiquement réactives. Il peut être également souhaitable de purifier certaines de ces chimères. La culture est alors centrifugée (10000 g, 30 min), le surnageant est passé à travers un filtre de 0,22 mm (Millipore), puis concentré par ultrafiltration (Amicon) en utilisant une membrane dont le seuil de discrimination se situe à 30 kDa. Le concentrât obtenu est alors dialyse contre une solution de Tris HCl (50 mM pH 8) puis purifié sur colonne. Par exemple, le concentrât correspondant au surnageant de culture de la souche CBS 293.91 transformée par le plasmide pYG1206 est purifiée par chromatographie d'affinité sur Bleu-Trisacryl (IBF). Une purification par chromatographie d'échange d'ions peut également être utilisée. Par exemple dans le cas de la chimère SAH- vWF470-713, le concentrât obtenu après ultrafiltration est dialyse contre une solution de Tris HCl (50 mM pH 8), puis déposé par fractions de 20 ml sur une colonne (5 ml) échangeuse de cations (S Fast Flow, Pharmacia) équilibrée dans le même tampon. La colonne est alors lavée plusieurs fois par la solution de Tris HCl (50 mM pH 8) et la protéine chimère est alors éluée de la colonne par un gradient (0 à 1 M) de NaCl. Les fractions contenant la protéine chimère sont alors réunies et dialysées contre une solution de Tris HCl 50 mM (pH 8) puis redéposées sur colonne S Fast Flow. Après élution de la colonne, les fractions contenant la protéine sont réunies, dialysées contre de l'eau et lyophilisées avant caractérisation: par exemple, le séquençage (Applied Biosystem) de la protéine [SAH-vWF470-704 C471G, C474G] sécrétée par la levure CBS 293.91 donne la séquence N-terminale attendue de la SAH (Asp-Ala-His...), démontrant une maturation correcte de la chimère immédiatement en C-terminal du doublet de résidus Arg-Arg de la région "pro" de la SAH (Figure 1). Le caractère essentiellement monomérique des protéines chimères entre SAH et vWF est également confirmé par leur profil d'élution sur colonne TSK 3000 [Toyo Soda Company, équilibrée par une solution de cacodylate (pH 7) contenant 0,2 M de Na2Sθ4] : par exemple la chimère [SAH-vWF 470-704 C471G, C474G] se comporte dans ces conditions comme une protéine de poids moléculaire apparent de 95 kDa démontrant son caractère monomérique.The chimeras present in the culture supernatants corresponding to the strain CBS 293.91 transformed, for example by the expression plasmids according to example 6, are first characterized using antibodies specific for the HSA part and the vWF part. The results of FIGS. 4 to 8 demonstrate that the yeast K. lactis is capable of secreting chimeric proteins between SAH and a fragment of vWF, and that these chimeras are immunologically reactive. It may also be desirable to purify some of these chimeras. The culture is then centrifuged (10,000 g, 30 min), the supernatant is passed through a 0.22 mm filter (Millipore), then concentrated by ultrafiltration (Amicon) using a membrane with a discrimination threshold of 30 kDa. The concentrate obtained is then dialyzed against a solution of Tris HCl (50 mM pH 8) and then purified on a column. For example, the concentrate corresponding to the culture supernatant of the CBS 293.91 strain transformed with the plasmid pYG1206 is purified by affinity chromatography on Blue-Trisacryl (IBF). Purification by ion exchange chromatography can also be used. For example, in the case of the SAH-vWF470-713 chimera, the concentrate obtained after ultrafiltration is dialyzed against a solution of Tris HCl (50 mM pH 8), then deposited in 20 ml fractions on a column (5 ml) exchanging cations (S Fast Flow, Pharmacia) balanced in the same buffer. The column is then washed several times with the Tris HCl solution (50 mM pH 8) and the chimeric protein is then eluted from the column by a gradient (0 to 1 M) of NaCl. The fractions containing the chimeric protein are then combined and dialyzed against a 50 mM Tris HCl solution (pH 8) and then redeposited on a S Fast Flow column. After elution from the column, the fractions containing the protein are combined, dialyzed against water and lyophilized before characterization: for example, sequencing (Applied Biosystem) of the protein [SAH-vWF470-704 C471G, C474G] secreted by the yeast CBS 293.91 gives the expected N-terminal sequence of SAH (Asp-Ala-His ...), demonstrating a correct maturation of the chimera immediately at the C-terminal of the doublet of Arg-Arg residues from the "pro" region of SAH (Figure 1). The essentially monomeric nature of the chimeric proteins between SAH and vWF is also confirmed by their elution profile on a TSK 3000 column [Toyo Soda Company, balanced by a cacodylate solution (pH 7) containing 0.2 M Na2Sθ4]: for example the chimera [SAH-vWF 470-704 C471G, C474G] behaves under these conditions as a protein of apparent molecular weight of 95 kDa demonstrating its monomeric character.
EXEMPLE 10: ACTIVITE ANTAGONISTE DES HYBRIDES GENETIQUES ENTRE SAH ET VWF POUR L'AGGLUTINATION PLAQUETTAIREEXAMPLE 10: ANTAGONIST ACTIVITY OF GENETIC HYBRIDS BETWEEN SAH AND VWF FOR PLATELET AGGLUTINATION
L'activité antagoniste des produits est déterminée par mesure de l'inhibition dose-dépendante de l'agglutination des plaquettes humaines fixées au paraformaldéhyde selon la méthode décrite par Prior et al. [Bio/Technology (1992) 10: 66]. Les mesures se font dans un agrégamètre (PAP-4, Bio Data, Horsham, PA, USA) qui enregistre les variations au cours du temps de la transmission optique sous agitation à 37°C en présence de vWF, de botrocétine (8,2 mg/ml) et du produit à tester à différentes dilutions (concentrations). Pour chaque mesure, 400 ml (8x10? plaquettes) d'une suspension de plaquettes humaines stabilisées au paraformaldéhyde (0,5 %, puis resuspendues en [NaCl (137 mM) ; MgCl2 (1 mM) ; NaH2P04 (0,36 mM) ; NaHCθ3 (10 mM) ; KC1 (2,7 mM) ; glucose (5,6 mM) ; SAH (3,5 mg/ml) ; tampon HEPES (10 mM, pH 7,35)] sont préincubés à 37°C dans la cuve cylindrique (8,75 x 50 mm, Wellcome Distriwell, 159 rue Nationale, Paris) de l'agrégamètre pendant 4 min puis sont additionnés de 30 ml de la solution du produit à tester à différentes dilutions dans du véhicule de formulation apyrogène [mannitol (50 g/1) ; acide citrique (192 mg/1) ; L-lysine monochlorhydratée (182,6 mg/1) ; NaCl (88 mg/1) ; pH ajusté à 3,5 par addition de NaOH (IM)], ou de véhicule de formulation uniquement (essai contrôle). La suspension résultante est alors incubée pendant 1 min à 37°C et on ajoute 12,5 ml de vWF humain [American Bioproducts, Parsippany, NJ, USA ; 11 % d'activité von Willebrand mesurée selon les recommandations d'utilisation du PAP-4 (Platelet Aggregation Profiler^) à l'aide de plaquettes fixées au formaldéhyde (2x10^ plaquettes/ml), de plasma humain contenant de 0 à 100 % de vWF et de ristocétine (10 mg/ml, cf. p. 36-45: vW ProgramTM] que i'on incube à 37°C pendant 1 min avant d'ajouter 12,5 ml de la solution de botrocétine [purifiée à partir de venin lyophilisé de Bothrops jararaca (Sigma), selon le protocole décrit par Sugimoto et al., Biochemistry (1991) 266: 18172]. L'enregistrement de la lecture de la transmission en fonction du temps est alors réalisée pendant 2 min sous agitation à l'aide d'un barreau aimanté (Wellcome Distriwell) placé dans la cuve et sous une agitation magnétique de 1100 tr/min assurée par l'agrégamètre. La variation moyenne de la transmission optique (n35 pour chaque dilution) au cours du temps est donc une mesure de l'agglutination plaquettaire due à la présence de vWF et de botrocétine, en l'absence ou en présence de concentrations variables du produit à tester. A partir de tels enregistrements, on détermine alors le % d'inhibition de l'agglutination plaquettaire due à chaque concentration de produit et on trace la droite donnant le % d'inhibition en fonction de l'inverse de la dilution de produit en échelle log-log. La CI50 (ou concentration de produit provoquant 50 % d'inhibition de l'agglutination) est alors déterminée sur cette droite. Le Tableau de la Figure 9 compare les CI50 de quelques unes des chimères SAH-vWF de la présente invention et démontre que certaines d'entre elles sont de meilleurs antagonistes de l'agglutination plaquettaire que le produit RG12986 décrit par Prior et al. [Bio/Technology (1992) lu: 66] et inclus dans les essais à titre de valeur étalon. Des tests identiques de l'inhibition de l'agglutination de plaquettes humaines en présence de vWF de plasma de porc (Sigma) permet en plus de démontrer que certains des hybrides de la présente invention, et notamment certains variants de type IIB, sont de très bons antagonistes de l'agglutination plaquettaire en l'absence de co-facteurs de type botrocétine. L'antagonisme botrocétine-indépendant de ces chimères particulières peut également être démontré selon le protocole initialement décrit par Ware et al. [Proc. Natl. Acad. Sci. (1991) 88: 2946] par déplacement de l'anticorps monoclonal ^^Ï-U-IB1 (10 mg/ml), un inhibiteur compétitif de la fixation du vWF sur la GPlb plaquettaire [Handa M. et al., (1986) J. Biol. Chem. 26J.: 12579] après 30 min d'incubation à 22°C en présence de plaquettes fraiches (10^ plaquettes/ml). The antagonistic activity of the products is determined by measuring the dose-dependent inhibition of the agglutination of human platelets attached to paraformaldehyde according to the method described by Prior et al. [Bio / Technology (1992) 10: 66]. The measurements are made in an aggregameter (PAP-4, Bio Data, Horsham, PA, USA) which records the variations over time of the optical transmission with stirring at 37 ° C in the presence of vWF, botrocetin (8.2 mg / ml) and of the product to be tested at different dilutions (concentrations). For each measurement, 400 ml (8x10? Platelets) of a suspension of human platelets stabilized with paraformaldehyde (0.5%, then resuspended in [NaCl (137 mM); MgCl2 (1 mM); NaH2PO4 (0.36 mM) ; NaHCθ3 (10 mM); KC1 (2.7 mM); glucose (5.6 mM); SAH (3.5 mg / ml); HEPES buffer (10 mM, pH 7.35)] are preincubated at 37 ° C in the cylindrical tank (8.75 x 50 mm, Wellcome Distriwell, 159 rue Nationale, Paris) of the aggregameter for 4 min, then 30 ml of the solution of the product to be tested are added at different dilutions in the formulation vehicle nonpyrogenic [mannitol (50 g / 1); citric acid (192 mg / 1); L-lysine monochlorhydrate (182.6 mg / 1); NaCl (88 mg / 1); pH adjusted to 3.5 by addition of NaOH (IM)], or formulation vehicle only (control test) The resulting suspension is then incubated for 1 min at 37 ° C. and 12.5 ml of human vWF are added [American Bioproducts, Parsippany, NJ, USA; 11 % of von Willebrand activity measured according to s recommendations for the use of PAP-4 (Platelet Aggregation Profiler ^) using formaldehyde-fixed platelets (2x10 ^ platelets / ml), human plasma containing 0 to 100% vWF and ristocetin (10 mg / ml, cf. p. 36-45: vW ProgramTM] q ue i is incubated at 37 ° C for 1 min before adding 12.5 ml of botrocetin solution [purified from lyophilized venom of Bothrops jararaca (Sigma) according to the protocol described by Sugimoto et al., Biochemistry (1991) 266: 18172]. The recording of the transmission reading as a function of time is then carried out for 2 min with stirring using a magnetic bar (Wellcome Distriwell) placed in the tank and under a magnetic stirring of 1100 rpm provided by the aggregameter. The average variation in optical transmission (n 3 5 for each dilution) over time is therefore a measure of the platelet agglutination due to the presence of vWF and botrocetin, in the absence or in the presence of variable concentrations of the product to be tested. From such recordings, the% inhibition of platelet agglutination due to each concentration of product is then determined and the line is given giving the% inhibition as a function of the inverse of the dilution of product on a log scale. -log. The IC50 (or concentration of product causing 50% inhibition of agglutination) is then determined on this line. The Table in Figure 9 compares the IC50s of some of the SAH-vWF chimeras of the present invention and demonstrates that some of them are better antagonists of platelet agglutination than the product RG12986 described by Prior et al. [Bio / Technology (1992) read: 66] and included in the tests as a standard value. Identical tests for the inhibition of the agglutination of human platelets in the presence of pig plasma vWF (Sigma) also make it possible to demonstrate that some of the hybrids of the present invention, and in particular certain variants of type IIB, are very good antagonists of platelet agglutination in the absence of botrocetin-type co-factors. The botrocetin-independent antagonism of these particular chimeras can also be demonstrated according to the protocol initially described by Ware et al. [Proc. Natl. Acad. Sci. (1991) 88: 2946] by displacement of the monoclonal antibody ^^ Ï-U-IB1 (10 mg / ml), a competitive inhibitor of vWF binding on platelet GPlb [Handa M. et al., (1986 ) J. Biol. Chem. 26J .: 12579] after 30 min of incubation at 22 ° C in the presence of fresh platelets (10 ^ platelets / ml).
LISTE DE SEQUENCESLIST OF SEQUENCES
(2) INFORMATION POUR LA SEQ ID NO: 1 :(2) INFORMATION FOR SEQ ID NO: 1:
(i) CARACTERISTIQUES DE LA SEQUENCE:(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LONGUEUR: 2591 paires de bases(A) LENGTH: 2,591 base pairs
(B) TYPE: acide nucléique(B) TYPE: nucleic acid
(C) NOMBRE DE BRINS: double(C) NUMBER OF STRANDS: double
(D) CONFIGURATION: linéaire(D) CONFIGURATION: linear
(ii) TYPE DE MOLECULE: ADNc (iii) HYPOTHETIQUE: NON (iii) ANTI-SENS: NON(ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETIC: NO (iii) ANTI-SENSE: NO
(ix) CARACTERISTIQUE ADDITIONELLE:(ix) ADDITIONAL FEATURE:
(A) NOM/CLE: CDS(A) NAME / KEY: CDS
(B) EMPLACEMENT: 26..2587(B) LOCATION: 26..2587
FEUILLE DE REMPLACEMENT REPLACEMENT SHEET

Claims

REVENDICATIONS
1. Polypeptide recombinant composé d'une partie adhesive dérivée de la structure du vWF capable d'antagoniser au moins partiellement la liaison du vWF aux plaquettes et ou au sous-endothélium, et d'une partie permettant sa stabilisation et sa présentation in vivo.1. Recombinant polypeptide composed of an adhesive part derived from the structure of vWF capable of at least partially antagonizing the binding of vWF to platelets and or to the subendothelium, and of a part allowing its stabilization and its presentation in vivo.
2. Polypeptide selon la revendication 1 caractérisée en ce que la partie adhesive est constituée par tout ou partie de la séquence peptidique comprise entre les résidus 445 et 733 du vWF ou d'un variant de celle-ci.2. Polypeptide according to claim 1 characterized in that the adhesive part consists of all or part of the peptide sequence between residues 445 and 733 of vWF or a variant thereof.
3. Polypeptide selon la revendication 2 caractérisé en ce que la partie adhesive présente une structure choisie parmi :3. Polypeptide according to claim 2 characterized in that the adhesive part has a structure chosen from:
(a) la séquence peptidique comprise entre les résidus 445-733 du vWF, ou,(a) the peptide sequence between residues 445-733 of vWF, or,
(b) une partie de la séquence peptidique (a) capable d'antagoniser au moins partiellement la liaison du vWF au GPlb et/ou au sous-endothélium, ou,(b) part of the peptide sequence (a) capable of at least partially antagonizing the binding of vWF to GPlb and / or to the subendothelium, or,
(c) une structure dérivée des structures (a) ou (b) par modifications structurales (mutation, substitution addition et/ou délétion d'un ou plusieurs résidus) et capable d'antagoniser au moins partiellement la liaison du vWF au GPlb et/ou au sous-endothélium, ou,(c) a structure derived from structures (a) or (b) by structural modifications (mutation, substitution addition and / or deletion of one or more residues) and capable of at least partially antagonizing the binding of vWF to GPlb and / or the subendothelium, or,
(d) une séquence peptidique non naturelle, par exemple isolée à partir de banques peptidiques aléatoires, et capable d'antagoniser au moins partiellement la liaison du vWF au GPlb et/ou au sous-endothélium.(d) an unnatural peptide sequence, for example isolated from random peptide libraries, and capable of at least partially antagonizing the binding of vWF to GPlb and / or to the subendothelium.
4. Polypeptide selon la revendication 3 caractérisé en ce que la partie adhesive est constituée par une séquence choisie parmi les peptides de type Pl, P2, X, XD et X* ou par toute combinaison de ces peptides entre-eux.4. Polypeptide according to claim 3 characterized in that the adhesive part consists of a sequence chosen from peptides of type P1, P2, X, XD and X * or by any combination of these peptides with one another.
5. Polypeptide selon la revendication 4 caractérisé en ce que la combinaison des peptides est choisie parmi les peptides de type P1-P2, Pl-X, Pl-5. Polypeptide according to claim 4 characterized in that the combination of the peptides is chosen from peptides of type P1-P2, Pl-X, Pl-
XD, Pl-X*, X-P2, XD-P2, X*-P2, P1-X-P2, P1-XD-P2 et Pl-X*-P2.XD, Pl-X *, X-P2, XD-P2, X * -P2, P1-X-P2, P1-XD-P2 and Pl-X * -P2.
6. Polypeptide selon la revendication 4 caractérisé en ce que la partie adhesive est constituée par tout peptide d'un type défini dans les revendications 4 et 5 représenté plus d'une fois. 6. Polypeptide according to claim 4 characterized in that the adhesive part consists of any peptide of a type defined in claims 4 and 5 shown more than once.
7. Polypeptide selon l'une des revendications 1 à 6 caractérisé en ce que la partie adhesive est couplée à l'extrémité N-terminale de la structure stabilisatrice.7. Polypeptide according to one of claims 1 to 6 characterized in that the adhesive part is coupled to the N-terminal end of the stabilizing structure.
8. Polypeptide selon l'une des revendications 1 à 6 caractérisé en ce que la partie adhesive est couplée à l'extrémité C-terminale de la structure stabilisatrice.8. Polypeptide according to one of claims 1 to 6 characterized in that the adhesive part is coupled to the C-terminal end of the stabilizing structure.
9. Polypeptide selon l'une des revendications 1 à 8 caractérisé en ce que la structure stabilisatrice est un polypeptide possédant une demie-vie plasmatique élevée.9. Polypeptide according to one of claims 1 to 8 characterized in that the stabilizing structure is a polypeptide having a high plasma half-life.
10. Polypeptide selon la revendication 9 caractérisé en ce que le polypeptide possédant une demie-vie plasmatique élevée est une protéine telle qu'une albumine, une apolipoprotéine, une immunoglobuline ou encore une transferine.10. A polypeptide according to claim 9 characterized in that the polypeptide having a high plasma half-life is a protein such as an albumin, an apolipoprotein, an immunoglobulin or a transferin.
11. Polypeptide selon la revendication 9 caractérisé en ce que le polypeptide possédant une demie-vie plasmatique élevée est dérivé par modification(s) structurale (s) (mutation, substitution addition et/ou délétion d'un ou plusieurs résidus, modification chimique) d'une protéine selon la revendication 10 .11. Polypeptide according to claim 9 characterized in that the polypeptide having a high plasma half-life is derived by structural modification (s) (mutation, substitution addition and / or deletion of one or more residues, chemical modification) of a protein according to claim 10.
12. Polypeptide selon l'une des revendications 9 à 11 caractérisé en ce que la structure stabilisatrice est un polypeptide faiblement ou non-immunogénique pour l'organisme dans lequel il est utilisé.12. Polypeptide according to one of claims 9 to 11 characterized in that the stabilizing structure is a weakly or non-immunogenic polypeptide for the organism in which it is used.
13. Polypeptide selon la revendication 9 caractérisé en ce que la structure stabilisatrice est une albumine ou un variant.de l'albumine.13. Polypeptide according to claim 9 characterized in that the stabilizing structure is an albumin or a variant . albumin.
14. Séquence nucléotidique codant pour un polypeptide selon l'une quelconque des revendications 1 à 13.14. Nucleotide sequence coding for a polypeptide according to any one of claims 1 to 13.
15. Séquence nucléotidique selon la revendication 14 caractérisée en ce qu'elle comprend une séquence "leader" permettant la sécrétion du polypeptide exprimé.15. Nucleotide sequence according to claim 14 characterized in that it comprises a "leader" sequence allowing the secretion of the expressed polypeptide.
16. Cassette d'expression comprenant une séquence nucléotidique selon l'une des revendications 14 ou 15 sous le contrôle d'une région d'initiation de la transcription et éventuellement d'une région de terminaison de la transcription. 16. Expression cassette comprising a nucleotide sequence according to one of claims 14 or 15 under the control of a transcription initiation region and optionally a transcription termination region.
17. Plasmide autoréplicatif comportant une cassette d'expression selon la revendication 16.17. Self-replicating plasmid comprising an expression cassette according to claim 16.
18. Cellule recombinante eucaryote ou procaryote dans laquelle a été inséré une séquence nucléotidique selon l'une des revendications 14 ou 15 ou une cassette d'expression selon la revendication 16 ou un plasmide selon la revendication 17.18. A recombinant eukaryotic or prokaryotic cell into which has been inserted a nucleotide sequence according to one of claims 14 or 15 or an expression cassette according to claim 16 or a plasmid according to claim 17.
19. Cellule recombinante selon la revendication 18 caractérisée en ce qu'il s'agit d'une levure, d'une cellule animale, d'un champignon ou d'une bactérie.19. Recombinant cell according to claim 18 characterized in that it is a yeast, an animal cell, a fungus or a bacterium.
20. Cellule recombinante selon la revendication 19 caractérisée en ce qu'il s'agit d'une levure.20. Recombinant cell according to claim 19 characterized in that it is a yeast.
21. Cellule recombinante selon la revendication 20 caractérisée en ce qu'il s'agit d'une levure du genre Saccharomyces ou Kluyveromyces.21. Recombinant cell according to claim 20, characterized in that it is a yeast of the genus Saccharomyces or Kluyveromyces.
22. Procédé de préparation d'un polypeptide tel que défini dans l'une des revendications 1 à 13 caractérisé en ce que l'on cultive une cellule recombinante selon l'une des revendications 18 à 21 dans des conditions d'expression, et on récupère le polypeptide produit.22. Method for preparing a polypeptide as defined in one of claims 1 to 13 characterized in that a recombinant cell according to one of claims 18 to 21 is cultured under expression conditions, and recover the polypeptide produced.
23. Composition pharmaceutique comprenant un ou plusieurs polypeptides selon l'une quelconque des revendications 1 à 13. 23. Pharmaceutical composition comprising one or more polypeptides according to any one of claims 1 to 13.
PCT/FR1993/000087 1992-01-31 1993-01-28 Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium WO1993015200A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP5512988A JPH07503369A (en) 1992-01-31 1993-01-28 Antithrombotic polypeptides that are antagonists of vWF binding to platelets and/or subendothelium
EP93904131A EP0625199A1 (en) 1992-01-31 1993-01-28 Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium
FI943565A FI943565A (en) 1992-01-31 1994-07-29 Novel anticoagulant polypeptides, their preparation and pharmaceutical composition containing them
NO942840A NO942840L (en) 1992-01-31 1994-07-29 Antithrombotic polypeptides as antagonists for binding of VWF to platelets or to subendothelium

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR9201066A FR2686901A1 (en) 1992-01-31 1992-01-31 NOVEL ANTITHROMBOTIC POLYPEPTIDES, THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM.
FR92/01066 1992-01-31

Publications (1)

Publication Number Publication Date
WO1993015200A1 true WO1993015200A1 (en) 1993-08-05

Family

ID=9426193

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR1993/000087 WO1993015200A1 (en) 1992-01-31 1993-01-28 Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium

Country Status (7)

Country Link
EP (1) EP0625199A1 (en)
JP (1) JPH07503369A (en)
CA (1) CA2126092A1 (en)
FI (1) FI943565A (en)
FR (1) FR2686901A1 (en)
NO (1) NO942840L (en)
WO (1) WO1993015200A1 (en)

Cited By (130)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0627923A1 (en) * 1992-02-26 1994-12-14 The Scripps Research Institute Therapeutic domains of von willebrand factor
FR2719593A1 (en) * 1994-05-06 1995-11-10 Rhone Poulenc Rorer Sa New biologically active polypeptides, their preparation and pharmaceutical composition containing them
WO2005047334A1 (en) 2003-11-13 2005-05-26 Hanmi Pharmaceutical. Co., Ltd. Igg fc fragment for a drug carrier and method for the preparation thereof
EP1681304A2 (en) 1995-12-30 2006-07-19 Delta Biotechnology Limited Recombinant fusion proteins of growth hormone and serum albumin
WO2006089133A2 (en) 2005-02-15 2006-08-24 Duke University Anti-cd19 antibodies and uses in oncology
WO2006107124A1 (en) 2005-04-08 2006-10-12 Hanmi Pharmaceutical Co., Ltd. Immunoglobulin fc fragment modified by non-peptide polymer and pharmaceutical composition comprising the same
US7132100B2 (en) 2002-06-14 2006-11-07 Medimmune, Inc. Stabilized liquid anti-RSV antibody formulations
US7371381B2 (en) 2003-12-12 2008-05-13 Amgen Inc. Anti-galanin antibodies and uses thereof
US7393534B2 (en) 2003-07-15 2008-07-01 Barros Research Institute Compositions and methods for immunotherapy of cancer and infectious diseases
US7425618B2 (en) 2002-06-14 2008-09-16 Medimmune, Inc. Stabilized anti-respiratory syncytial virus (RSV) antibody formulations
EP2080771A2 (en) 2001-02-27 2009-07-22 Maxygen Aps New interferon beta-like molecules
WO2009133208A1 (en) 2008-05-02 2009-11-05 Novartis Ag Improved fibronectin-based binding molecules and uses thereof
WO2010015608A1 (en) 2008-08-05 2010-02-11 Novartis Ag Compositions and methods for antibodies targeting complement protein c5
WO2010027364A1 (en) 2008-09-07 2010-03-11 Glyconex Inc. Anti-extended type i glycosphingolipid antibody, derivatives thereof and use
US7704505B2 (en) 1994-08-15 2010-04-27 Medimmune, Llc Human-murine chimeric antibodies against respiratory syncytial virus
WO2010056804A1 (en) 2008-11-12 2010-05-20 Medimmune, Llc Antibody formulation
WO2010070346A2 (en) 2008-12-18 2010-06-24 Medimmune Limited BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Ra) - 836
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
EP2221316A1 (en) 2005-05-05 2010-08-25 Duke University Anti-CD19 antibody therapy for autoimmune disease
WO2010123290A2 (en) 2009-04-22 2010-10-28 (주)알테오젠 In vivo half life increased fusion protein or peptide maintained by sustained in vivo release, and method for increasing in vivo half-life using same
WO2011020024A2 (en) 2009-08-13 2011-02-17 The Johns Hopkins University Methods of modulating immune function
WO2011044368A1 (en) 2009-10-07 2011-04-14 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
EP2316487A1 (en) 2003-04-11 2011-05-04 MedImmune, LLC Recombinant IL-9 antibodies & uses thereof
WO2011051466A1 (en) 2009-11-02 2011-05-05 Novartis Ag Anti-idiotypic fibronectin-based binding molecules and uses thereof
WO2011092233A1 (en) 2010-01-29 2011-08-04 Novartis Ag Yeast mating to produce high-affinity combinations of fibronectin-based binders
WO2011138392A1 (en) 2010-05-06 2011-11-10 Novartis Ag Compositions and methods of use for therapeutic low density lipoprotein -related protein 6 (lrp6) antibodies
WO2011138391A1 (en) 2010-05-06 2011-11-10 Novartis Ag Compositions and methods of use for therapeutic low density lipoprotein - related protein 6 (lrp6) multivalent antibodies
WO2012019061A2 (en) 2010-08-05 2012-02-09 Stem Centrx, Inc. Novel effectors and methods of use
WO2012022814A1 (en) 2010-08-20 2012-02-23 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3)
WO2012027723A1 (en) 2010-08-27 2012-03-01 Stem Centrx, Inc Notum protein modulators and methods of use
WO2012031273A2 (en) 2010-09-03 2012-03-08 Stem Centrx, Inc. Novel modulators and methods of use
WO2012058768A1 (en) 2010-11-05 2012-05-10 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the fc domain
WO2012069466A1 (en) 2010-11-24 2012-05-31 Novartis Ag Multispecific molecules
WO2012078813A2 (en) 2010-12-08 2012-06-14 Stem Centrx, Inc. Novel modulators and methods of use
WO2012094252A1 (en) 2011-01-03 2012-07-12 The Terasaki Family Foundation Anti-hla-e antibodies, therapeutic immunomodulatory antibodies to human hla-e heavy chain, useful as ivig mimetics and methods of their use
WO2012112943A1 (en) 2011-02-18 2012-08-23 Stem Centrx, Inc. Novel modulators and methods of use
WO2012172495A1 (en) 2011-06-14 2012-12-20 Novartis Ag Compositions and methods for antibodies targeting tem8
EP2540741A1 (en) 2006-03-06 2013-01-02 Aeres Biomedical Limited Humanized anti-CD22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease
WO2013004607A1 (en) 2011-07-01 2013-01-10 Bayer Intellectual Property Gmbh Relaxin fusion polypeptides and uses thereof
WO2013007563A1 (en) 2011-07-08 2013-01-17 Bayer Intellectual Property Gmbh Fusion proteins releasing relaxin and uses thereof
US8388965B2 (en) 2007-10-15 2013-03-05 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573114A1 (en) 2005-08-10 2013-03-27 MacroGenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
WO2013063702A1 (en) 2011-11-04 2013-05-10 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the fc domain
WO2013067055A1 (en) 2011-11-01 2013-05-10 Bionomics, Inc. Methods of blocking cancer stem cell growth
WO2013067054A1 (en) 2011-11-01 2013-05-10 Bionomics, Inc. Antibodies and methods of treating cancer
WO2013067355A1 (en) 2011-11-04 2013-05-10 Novartis Ag Low density lipoprotein-related protein 6 (lrp6) - half life extender constructs
WO2013067060A1 (en) 2011-11-01 2013-05-10 Bionomics, Inc. Anti-gpr49 antibodies
WO2013067057A1 (en) 2011-11-01 2013-05-10 Bionomics, Inc. Anti-gpr49 antibodies
WO2013084147A2 (en) 2011-12-05 2013-06-13 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3)
WO2013084148A2 (en) 2011-12-05 2013-06-13 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3
EP2604628A2 (en) 2007-12-21 2013-06-19 Medimmune Limited Binding members for interleukin-4 receptor alpha (IL-4R) - 173
WO2013093762A1 (en) 2011-12-21 2013-06-27 Novartis Ag Compositions and methods for antibodies targeting factor p
WO2013106586A2 (en) 2012-01-11 2013-07-18 The Terasaki Family Foundation Anti-hla class-ib antibodies mimic immunoreactivity and immunomodulatory functions of intravenous immunoglobulin (ivig) useful as therapeutic ivig mimetics and methods of their use
WO2013119960A2 (en) 2012-02-08 2013-08-15 Stem Centrx, Inc. Novel modulators and methods of use
WO2013166594A1 (en) 2012-05-10 2013-11-14 Zymeworks Inc. Heteromultimer constructs of immunoglobulin heavy chains with mutations in the fc domain
EP2676691A2 (en) 2005-11-17 2013-12-25 Zogenix, Inc. Delivery of viscous formulations by needle-free injection
US8647622B2 (en) 2007-08-29 2014-02-11 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
EP2703011A2 (en) 2007-05-07 2014-03-05 MedImmune, LLC Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease
WO2014084859A1 (en) 2012-11-30 2014-06-05 Novartis Ag Molecules and methods for modulating tmem16a activities
WO2014089111A1 (en) 2012-12-05 2014-06-12 Novartis Ag Compositions and methods for antibodies targeting epo
US8765915B2 (en) 2006-02-06 2014-07-01 Csl Behring Gmbh Modified coagulation factor VIIa with extended half-life
EP2756756A1 (en) 2008-04-28 2014-07-23 Zogenix, Inc. Novel formulations for treatment of migraine
EP2759292A1 (en) 2006-10-24 2014-07-30 Aradigm Corporation Dual action, inhaled formulations providing both an immediate and sustained release profile
WO2014159239A2 (en) 2013-03-14 2014-10-02 Novartis Ag Antibodies against notch 3
WO2014160958A1 (en) 2013-03-29 2014-10-02 Alexion Pharmaceuticals, Inc. Compositions and methods for increasing the serum half-life of a therapeutic agent targeting complement c5
US8852608B2 (en) 2009-02-02 2014-10-07 Medimmune, Llc Antibodies against and methods for producing vaccines for respiratory syncytial virus
WO2014205302A2 (en) 2013-06-21 2014-12-24 Novartis Ag Lectin-like oxidized ldl receptor1 antibodies and methods of use
WO2014205300A2 (en) 2013-06-21 2014-12-24 Novartis Ag Lectin-like oxidized ldl receptor1 antibodies and methods of use
US8980273B1 (en) 2014-07-15 2015-03-17 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
US8986691B1 (en) 2014-07-15 2015-03-24 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
US8993517B2 (en) 2001-12-21 2015-03-31 Human Genome Sciences, Inc. Albumin fusion proteins
US9244074B2 (en) 2011-06-07 2016-01-26 University Of Hawaii Biomarker of asbestos exposure and mesothelioma
WO2016020882A2 (en) 2014-08-07 2016-02-11 Novartis Ag Angiopoetin-like 4 (angptl4) antibodies and methods of use
WO2016020880A2 (en) 2014-08-07 2016-02-11 Novartis Ag Angiopoietin-like 4 antibodies and methods of use
US9283274B2 (en) 2009-10-06 2016-03-15 Medimmune Limited RSV specific binding molecule
US9308257B2 (en) 2007-11-28 2016-04-12 Medimmune, Llc Protein formulation
WO2016057846A1 (en) 2014-10-08 2016-04-14 Novartis Ag Compositions and methods of use for augmented immune response and cancer therapy
US9321831B2 (en) 2007-06-01 2016-04-26 Medimmune Limited RSV-specific binding molecules and means for producing them
WO2016098079A2 (en) 2014-12-19 2016-06-23 Novartis Ag Compositions and methods for antibodies targeting bmp6
EP3037544A1 (en) 2005-10-13 2016-06-29 Human Genome Sciences, Inc. Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases
EP3072525A1 (en) 2007-05-14 2016-09-28 MedImmune, LLC Methods of reducing basophil levels
EP3073267A1 (en) 2004-09-21 2016-09-28 Medimmune, Inc. Antibodies against and methods for producing vaccines for respiratory syncytial virus
EP3095797A1 (en) 2012-02-24 2016-11-23 Stemcentrx, Inc. Anti dll3 antibodies and methods of use thereof
WO2016187408A1 (en) 2015-05-19 2016-11-24 Yale University Compositions for treating pathological calcification conditions, and methods using same
WO2016193872A2 (en) 2015-06-05 2016-12-08 Novartis Ag Antibodies targeting bone morphogenetic protein 9 (bmp9) and methods therefor
WO2016207858A1 (en) 2015-06-26 2016-12-29 Novartis Ag Factor xi antibodies and methods of use
US9546214B2 (en) 2014-04-04 2017-01-17 Bionomics, Inc. Humanized antibodies that bind LGR5
US9561274B2 (en) 2011-06-07 2017-02-07 University Of Hawaii Treatment and prevention of cancer with HMGB1 antagonists
WO2017021893A1 (en) 2015-08-03 2017-02-09 Novartis Ag Methods of treating fgf21-associated disorders
US9592289B2 (en) 2012-03-26 2017-03-14 Sanofi Stable IgG4 based binding agent formulations
WO2017042701A1 (en) 2015-09-09 2017-03-16 Novartis Ag Thymic stromal lymphopoietin (tslp)-binding antibodies and methods of using the antibodies
WO2017103895A1 (en) 2015-12-18 2017-06-22 Novartis Ag Antibodies targeting cd32b and methods of use thereof
WO2017122130A1 (en) 2016-01-11 2017-07-20 Novartis Ag Immune-stimulating humanized monoclonal antibodies against human interleukin-2, and fusion proteins thereof
WO2017125897A1 (en) 2016-01-21 2017-07-27 Novartis Ag Multispecific molecules targeting cll-1
WO2017189724A1 (en) 2016-04-27 2017-11-02 Novartis Ag Antibodies against growth differentiation factor 15 and uses thereof
WO2017198435A1 (en) * 2016-05-20 2017-11-23 Octapharma Ag Glycosylated vwf fusion proteins with improved pharmacokinetics
WO2017216724A1 (en) 2016-06-15 2017-12-21 Novartis Ag Methods for treating disease using inhibitors of bone morphogenetic protein 6 (bmp6)
US9867777B2 (en) 2010-01-19 2018-01-16 Hanmi Science Co., Ltd. Liquid formulations for long-acting G-CSF conjugate
EP3338793A1 (en) 2013-08-28 2018-06-27 AbbVie Stemcentrx LLC Novel sez6 modulators and methods of use
WO2018116267A2 (en) 2016-12-23 2018-06-28 Novartis Ag Methods of treatment with anti-factor xi/xia antibodies
WO2018116255A1 (en) 2016-12-23 2018-06-28 Novartis Ag Factor xi antibodies and methods of use
WO2018146594A1 (en) 2017-02-08 2018-08-16 Novartis Ag Fgf21 mimetic antibodies and uses thereof
US10064951B2 (en) 2012-03-30 2018-09-04 Hanmi Science Co., Ltd. Liquid formulation of highly concentrated long-acting human growth hormone conjugate
WO2018229715A1 (en) 2017-06-16 2018-12-20 Novartis Ag Compositions comprising anti-cd32b antibodies and methods of use thereof
WO2019081983A1 (en) 2017-10-25 2019-05-02 Novartis Ag Antibodies targeting cd32b and methods of use thereof
WO2019229701A2 (en) 2018-06-01 2019-12-05 Novartis Ag Binding molecules against bcma and uses thereof
WO2019229658A1 (en) 2018-05-30 2019-12-05 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
WO2020079580A1 (en) 2018-10-15 2020-04-23 Novartis Ag Trem2 stabilizing antibodies
US10656156B2 (en) 2012-07-05 2020-05-19 Mepur Ravindranath Diagnostic and therapeutic potential of HLA-E monospecific monoclonal IgG antibodies directed against tumor cell surface and soluble HLA-E
WO2020109978A1 (en) 2018-11-26 2020-06-04 Novartis Ag Lpl-gpihbp1 fusion polypeptides
US10745487B2 (en) 2016-03-22 2020-08-18 Bionomics Limited Method of treating cancer by administering an anti-LGR5 monoclonal antibody
WO2020198731A2 (en) 2019-03-28 2020-10-01 Danisco Us Inc Engineered antibodies
US10800847B2 (en) 2012-01-11 2020-10-13 Dr. Mepur Ravindranath Anti-HLA class-IB antibodies mimic immunoreactivity and immunomodulatory functions of intravenous immunoglobulin (IVIG) useful as therapeutic IVIG mimetics and methods of their use
WO2020236792A1 (en) 2019-05-21 2020-11-26 Novartis Ag Cd19 binding molecules and uses thereof
WO2020236797A1 (en) 2019-05-21 2020-11-26 Novartis Ag Variant cd58 domains and uses thereof
WO2020242989A1 (en) 2019-05-24 2020-12-03 Sanofi Methods for treating systemic sclerosis
WO2021053559A1 (en) 2019-09-18 2021-03-25 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
WO2021053560A1 (en) 2019-09-18 2021-03-25 Novartis Ag Combination therapy with entpd2 and cd73 antibodies
US10987424B2 (en) 2012-07-25 2021-04-27 Hanmi Pharm. Co., Ltd. Liquid formulation of long-acting insulin conjugate
US11008389B2 (en) 2011-03-16 2021-05-18 Sanofi Uses of a dual V region antibody-like protein
EP3842457A1 (en) 2015-09-09 2021-06-30 Novartis AG Thymic stromal lymphopoietin (tslp)-binding molecules and methods of using the molecules
WO2021202473A2 (en) 2020-03-30 2021-10-07 Danisco Us Inc Engineered antibodies
EP3892294A1 (en) 2013-08-28 2021-10-13 AbbVie Stemcentrx LLC Site-specific antibody conjugation methods and compositions
WO2022097060A1 (en) 2020-11-06 2022-05-12 Novartis Ag Cd19 binding molecules and uses thereof
RU2782212C2 (en) * 2016-05-20 2022-10-24 Октафарма Аг Glycosylated fused proteins vwf with improved pharmacokinetics
US11512326B2 (en) 2009-05-26 2022-11-29 University Of Florida Research Foundation, Incorporated Small angiotensin peptide expression system in mammalian cells
US11739130B2 (en) 2013-03-11 2023-08-29 University Of Florida Research Foundation, Incorporated Delivery of card protein as therapy for ocular inflammation
US11773160B1 (en) 2022-08-05 2023-10-03 Anaveon AG Immune-stimulating IL-2 fusion proteins
WO2023209568A1 (en) 2022-04-26 2023-11-02 Novartis Ag Multispecific antibodies targeting il-13 and il-18
WO2024015953A1 (en) 2022-07-15 2024-01-18 Danisco Us Inc. Methods for producing monoclonal antibodies

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0255206A2 (en) * 1986-05-30 1988-02-03 The Scripps Research Institute Peptides that inhibit von Willebrand factor binding
EP0413622A1 (en) * 1989-08-03 1991-02-20 Rhone-Poulenc Sante Albumin derivatives with therapeutic functions
WO1991013093A1 (en) * 1990-03-02 1991-09-05 Bio-Technology General Corp. CLONING AND PRODUCTION OF HUMAN VON WILLEBRAND FACTOR GPIb BINDING DOMAIN POLYPEPTIDES AND METHODS OF USING SAME
WO1992006999A1 (en) * 1990-10-17 1992-04-30 The Scripps Research Institute Therapeutic fragments of von willebrand factor
WO1992017192A1 (en) * 1991-03-27 1992-10-15 The Scripps Research Institute Therapeutic fragments of von willebrand factor
WO1993000357A1 (en) * 1991-06-28 1993-01-07 Rhone-Poulenc Rorer International (Holdings) Inc. Therapeutic polypeptides based on von willebrand factor

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0255206A2 (en) * 1986-05-30 1988-02-03 The Scripps Research Institute Peptides that inhibit von Willebrand factor binding
EP0413622A1 (en) * 1989-08-03 1991-02-20 Rhone-Poulenc Sante Albumin derivatives with therapeutic functions
WO1991013093A1 (en) * 1990-03-02 1991-09-05 Bio-Technology General Corp. CLONING AND PRODUCTION OF HUMAN VON WILLEBRAND FACTOR GPIb BINDING DOMAIN POLYPEPTIDES AND METHODS OF USING SAME
WO1992006999A1 (en) * 1990-10-17 1992-04-30 The Scripps Research Institute Therapeutic fragments of von willebrand factor
WO1992017192A1 (en) * 1991-03-27 1992-10-15 The Scripps Research Institute Therapeutic fragments of von willebrand factor
WO1993000357A1 (en) * 1991-06-28 1993-01-07 Rhone-Poulenc Rorer International (Holdings) Inc. Therapeutic polypeptides based on von willebrand factor

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS. vol. 164, no. 3, 15 Novembre 1989, DULUTH, MINNESOTA US pages 1339 - 1347 PIETU, G. ET AL. 'Production in Escherichia coli of a biologically active subfragment of von Willebrand Factor corresponding to the platelet glycoprotein Ib, collagen and heparin binding domains' *
JOURNAL OF BIOLOGICAL CHEMISTRY. (MICROFILMS) vol. 263, no. 34, 5 Décembre 1988, BALTIMORE, MD US pages 17901 - 17904 MOHRI, H. ET AL. 'Structure of the von Willebrand Factor domain interacting with glycoprotein Ib' cité dans la demande *

Cited By (220)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0627923A4 (en) * 1992-02-26 1996-01-17 Scripps Research Inst Therapeutic domains of von willebrand factor.
EP0627923A1 (en) * 1992-02-26 1994-12-14 The Scripps Research Institute Therapeutic domains of von willebrand factor
FR2719593A1 (en) * 1994-05-06 1995-11-10 Rhone Poulenc Rorer Sa New biologically active polypeptides, their preparation and pharmaceutical composition containing them
WO1995030759A1 (en) * 1994-05-06 1995-11-16 Rhone-Poulenc Rorer S.A. Biologically active polypeptides inserted into an albumin
US7704505B2 (en) 1994-08-15 2010-04-27 Medimmune, Llc Human-murine chimeric antibodies against respiratory syncytial virus
US8562994B2 (en) 1994-08-15 2013-10-22 Medimmune, Llc Human-murine chimeric antibodies against respiratory syncytial virus
EP1681304A2 (en) 1995-12-30 2006-07-19 Delta Biotechnology Limited Recombinant fusion proteins of growth hormone and serum albumin
EP2275557A1 (en) 2000-04-12 2011-01-19 Human Genome Sciences, Inc. Albumin fusion proteins
EP2295456A1 (en) 2000-04-12 2011-03-16 Human Genome Sciences, Inc. Albumin fusion proteins
EP2267026A1 (en) 2000-04-12 2010-12-29 Human Genome Sciences, Inc. Albumin fusion proteins
EP2236152A1 (en) 2000-04-12 2010-10-06 Human Genome Sciences, Inc. Albumin fusion proteins
EP2357008A1 (en) 2000-04-12 2011-08-17 Human Genome Sciences, Inc. Albumin fusion proteins
EP2216409A1 (en) 2000-04-12 2010-08-11 Human Genome Sciences, Inc. Albumin fusion proteins
EP2213743A1 (en) 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
EP2311872A1 (en) 2000-04-12 2011-04-20 Human Genome Sciences, Inc. Albumin fusion proteins
EP2298355A2 (en) 2000-04-12 2011-03-23 Human Genome Sciences, Inc. Albumin fusion proteins
EP2080771A2 (en) 2001-02-27 2009-07-22 Maxygen Aps New interferon beta-like molecules
US9221896B2 (en) 2001-12-21 2015-12-29 Human Genome Sciences, Inc. Albumin fusion proteins
US8993517B2 (en) 2001-12-21 2015-03-31 Human Genome Sciences, Inc. Albumin fusion proteins
US9296809B2 (en) 2001-12-21 2016-03-29 Human Genome Sciences, Inc. Albumin fusion proteins
EP2570432A1 (en) 2002-06-14 2013-03-20 Medimmune, Inc. Stabilized anti-respiratory syncytial virus (RSV) antibody formulations
EP2327421A1 (en) 2002-06-14 2011-06-01 MedImmune, LLC Stabilized liquid anti-RSV antibody formulations
US7425618B2 (en) 2002-06-14 2008-09-16 Medimmune, Inc. Stabilized anti-respiratory syncytial virus (RSV) antibody formulations
US9879067B2 (en) 2002-06-14 2018-01-30 Medimmune, Llc Stabilized liquid anti-RSV antibody formulations
EP2206516A1 (en) 2002-06-14 2010-07-14 Medimmune, LLC Stabilized liquid anti-RSV antibody formulations
US7294336B2 (en) 2002-06-14 2007-11-13 Medimmune, Inc. Stabilized liquid anti-RSV antibody formulations
US10604560B2 (en) 2002-06-14 2020-03-31 Arexis Ab Stabilized liquid anti-RSV antibody formulations
US8986686B2 (en) 2002-06-14 2015-03-24 Medimmune, Llc Stabilized liquid anti-RSV antibody formulations
US11180542B2 (en) 2002-06-14 2021-11-23 Arexis Ab Stabilized liquid anti-RSV antibody formulations
US7132100B2 (en) 2002-06-14 2006-11-07 Medimmune, Inc. Stabilized liquid anti-RSV antibody formulations
US9272032B2 (en) 2002-06-14 2016-03-01 Medimmune, Llc Stabilized liquid anti-RSV antibody formulations
EP2316487A1 (en) 2003-04-11 2011-05-04 MedImmune, LLC Recombinant IL-9 antibodies & uses thereof
US8257714B2 (en) 2003-07-15 2012-09-04 Michigan State University Compositions and methods for immunotherapy of cancer and infectious diseases
US7393534B2 (en) 2003-07-15 2008-07-01 Barros Research Institute Compositions and methods for immunotherapy of cancer and infectious diseases
EP2239273A1 (en) 2003-11-13 2010-10-13 Hanmi Pharmaceutical. Co., Ltd. A pharmaceutical composition comprosing an immunoglobulin fc as a carrier
EP2256134A1 (en) 2003-11-13 2010-12-01 Hanmi Pharmaceutical Co., Ltd. IgG Fc fragment for a drug carrier and method for the preparation thereof
WO2005047334A1 (en) 2003-11-13 2005-05-26 Hanmi Pharmaceutical. Co., Ltd. Igg fc fragment for a drug carrier and method for the preparation thereof
WO2005047337A1 (en) 2003-11-13 2005-05-26 Hanmi Pharmaceutical Co., Ltd. A pharmaceutical composition comprising an immunoglobulin fc region as a carrier
US7371381B2 (en) 2003-12-12 2008-05-13 Amgen Inc. Anti-galanin antibodies and uses thereof
EP3073267A1 (en) 2004-09-21 2016-09-28 Medimmune, Inc. Antibodies against and methods for producing vaccines for respiratory syncytial virus
WO2006089133A2 (en) 2005-02-15 2006-08-24 Duke University Anti-cd19 antibodies and uses in oncology
EP2548575A1 (en) 2005-02-15 2013-01-23 Duke University Anti-CD19 antibodies that mediate ADCC for use in treating autoimmune diseases
WO2006107124A1 (en) 2005-04-08 2006-10-12 Hanmi Pharmaceutical Co., Ltd. Immunoglobulin fc fragment modified by non-peptide polymer and pharmaceutical composition comprising the same
EP2221316A1 (en) 2005-05-05 2010-08-25 Duke University Anti-CD19 antibody therapy for autoimmune disease
EP2573114A1 (en) 2005-08-10 2013-03-27 MacroGenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
EP3037544A1 (en) 2005-10-13 2016-06-29 Human Genome Sciences, Inc. Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases
EP2676691A2 (en) 2005-11-17 2013-12-25 Zogenix, Inc. Delivery of viscous formulations by needle-free injection
EP3058972A1 (en) 2005-11-17 2016-08-24 Zogenix, Inc. Delivery of viscous formulations by needle-free injection
US8765915B2 (en) 2006-02-06 2014-07-01 Csl Behring Gmbh Modified coagulation factor VIIa with extended half-life
EP2540741A1 (en) 2006-03-06 2013-01-02 Aeres Biomedical Limited Humanized anti-CD22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease
EP2789330A1 (en) 2006-10-24 2014-10-15 Aradigm Corporation Dual action, inhaled formulations providing both an immediate and sustained release profile
EP2759292A1 (en) 2006-10-24 2014-07-30 Aradigm Corporation Dual action, inhaled formulations providing both an immediate and sustained release profile
EP2737907A2 (en) 2007-05-07 2014-06-04 MedImmune, LLC Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease
EP2703011A2 (en) 2007-05-07 2014-03-05 MedImmune, LLC Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease
EP3072525A1 (en) 2007-05-14 2016-09-28 MedImmune, LLC Methods of reducing basophil levels
US10059757B2 (en) 2007-06-01 2018-08-28 Medimmune Limited RSV-specific binding molecules and means for producing them
US10730931B2 (en) 2007-06-01 2020-08-04 Medimmune Limited RSV-specific binding molecules and means for producing them
US9321831B2 (en) 2007-06-01 2016-04-26 Medimmune Limited RSV-specific binding molecules and means for producing them
US8647622B2 (en) 2007-08-29 2014-02-11 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8980262B2 (en) 2007-08-29 2015-03-17 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9175087B2 (en) 2007-08-29 2015-11-03 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9815902B2 (en) 2007-08-29 2017-11-14 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their uses
US9228019B2 (en) 2007-08-29 2016-01-05 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US9243067B2 (en) 2007-08-29 2016-01-26 Sanofi Humanized anti-CXCR5 antibodies, derivatives thereof and their use
US8388965B2 (en) 2007-10-15 2013-03-05 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2574626A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573115A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573117A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP3686220A1 (en) 2007-10-15 2020-07-29 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2573116A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2574630A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2573121A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2574629A1 (en) 2007-10-15 2013-04-03 Sanofi Antibodies that bind il-4 and/or il-13 and their uses
EP2573118A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US9738728B2 (en) 2007-10-15 2017-08-22 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US9732162B2 (en) 2007-10-15 2017-08-15 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US10759871B2 (en) 2007-10-15 2020-09-01 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
EP2573119A1 (en) 2007-10-15 2013-03-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US11453727B2 (en) 2007-10-15 2022-09-27 Sanofi Antibodies that bind IL-4 and/or IL-13 and their uses
US9308257B2 (en) 2007-11-28 2016-04-12 Medimmune, Llc Protein formulation
EP2604628A2 (en) 2007-12-21 2013-06-19 Medimmune Limited Binding members for interleukin-4 receptor alpha (IL-4R) - 173
EP3211010A1 (en) 2007-12-21 2017-08-30 Medimmune Limited Binding members for interleukin-4 receptor alpha (il-4r) - 173
EP2756756A1 (en) 2008-04-28 2014-07-23 Zogenix, Inc. Novel formulations for treatment of migraine
EP2829265A2 (en) 2008-04-28 2015-01-28 Zogenix, Inc. Novel formulations for treatment of migraine
EP3000462A1 (en) 2008-04-28 2016-03-30 Zogenix, Inc. Novel formulations for treatment of migraine
WO2009133208A1 (en) 2008-05-02 2009-11-05 Novartis Ag Improved fibronectin-based binding molecules and uses thereof
EP3173424A1 (en) 2008-05-02 2017-05-31 Novartis Ag Improved fibronectin-based binding molecules and uses thereof
EP2383292A1 (en) 2008-05-02 2011-11-02 Novartis AG Improved fibronectin-based binding molecules and uses thereof
EP2439212A1 (en) 2008-05-02 2012-04-11 Novartis AG Improved fibronectin-based binding molecules and uses thereof
EP2815766A1 (en) 2008-08-05 2014-12-24 Novartis AG Compositions and methods for antibodies targeting complement protein C5
WO2010015608A1 (en) 2008-08-05 2010-02-11 Novartis Ag Compositions and methods for antibodies targeting complement protein c5
EP2837388A1 (en) 2008-08-05 2015-02-18 Novartis AG Compositions and methods for antibodies targeting complement protein C5
WO2010027364A1 (en) 2008-09-07 2010-03-11 Glyconex Inc. Anti-extended type i glycosphingolipid antibody, derivatives thereof and use
WO2010056804A1 (en) 2008-11-12 2010-05-20 Medimmune, Llc Antibody formulation
WO2010070346A2 (en) 2008-12-18 2010-06-24 Medimmune Limited BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Ra) - 836
US8852608B2 (en) 2009-02-02 2014-10-07 Medimmune, Llc Antibodies against and methods for producing vaccines for respiratory syncytial virus
US9499590B2 (en) 2009-02-02 2016-11-22 Medimmune, Llc Antibodies against and methods for producing vaccines for respiratory syncytial virus
WO2010123290A2 (en) 2009-04-22 2010-10-28 (주)알테오젠 In vivo half life increased fusion protein or peptide maintained by sustained in vivo release, and method for increasing in vivo half-life using same
US11512326B2 (en) 2009-05-26 2022-11-29 University Of Florida Research Foundation, Incorporated Small angiotensin peptide expression system in mammalian cells
WO2011020024A2 (en) 2009-08-13 2011-02-17 The Johns Hopkins University Methods of modulating immune function
EP3381937A2 (en) 2009-08-13 2018-10-03 The Johns Hopkins University Methods of modulating immune function
US10035843B2 (en) 2009-10-06 2018-07-31 Medimmune Limited RSV-specific binding molecule
US10723786B2 (en) 2009-10-06 2020-07-28 Medimmune, Limited RSV-specific binding molecule
US9283274B2 (en) 2009-10-06 2016-03-15 Medimmune Limited RSV specific binding molecule
WO2011044368A1 (en) 2009-10-07 2011-04-14 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
US9096877B2 (en) 2009-10-07 2015-08-04 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
WO2011051466A1 (en) 2009-11-02 2011-05-05 Novartis Ag Anti-idiotypic fibronectin-based binding molecules and uses thereof
US9867777B2 (en) 2010-01-19 2018-01-16 Hanmi Science Co., Ltd. Liquid formulations for long-acting G-CSF conjugate
WO2011092233A1 (en) 2010-01-29 2011-08-04 Novartis Ag Yeast mating to produce high-affinity combinations of fibronectin-based binders
EP3345926A1 (en) 2010-05-06 2018-07-11 Novartis AG Compositions and methods of use for therapeutic low density lipoprotein-related protein 6 (lrp6) antibodies
EP4234698A2 (en) 2010-05-06 2023-08-30 Novartis AG Compositions and methods of use for therapeutic low density lipoprotein-related protein 6 (lrp6) antibodies
WO2011138392A1 (en) 2010-05-06 2011-11-10 Novartis Ag Compositions and methods of use for therapeutic low density lipoprotein -related protein 6 (lrp6) antibodies
WO2011138391A1 (en) 2010-05-06 2011-11-10 Novartis Ag Compositions and methods of use for therapeutic low density lipoprotein - related protein 6 (lrp6) multivalent antibodies
WO2012019061A2 (en) 2010-08-05 2012-02-09 Stem Centrx, Inc. Novel effectors and methods of use
WO2012022814A1 (en) 2010-08-20 2012-02-23 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3)
WO2012027723A1 (en) 2010-08-27 2012-03-01 Stem Centrx, Inc Notum protein modulators and methods of use
WO2012031273A2 (en) 2010-09-03 2012-03-08 Stem Centrx, Inc. Novel modulators and methods of use
WO2012058768A1 (en) 2010-11-05 2012-05-10 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the fc domain
WO2012069466A1 (en) 2010-11-24 2012-05-31 Novartis Ag Multispecific molecules
WO2012078813A2 (en) 2010-12-08 2012-06-14 Stem Centrx, Inc. Novel modulators and methods of use
WO2012118547A1 (en) 2010-12-08 2012-09-07 Stem Centrx, Inc. Novel modulators and methods of use
WO2012094252A1 (en) 2011-01-03 2012-07-12 The Terasaki Family Foundation Anti-hla-e antibodies, therapeutic immunomodulatory antibodies to human hla-e heavy chain, useful as ivig mimetics and methods of their use
EP3763388A1 (en) 2011-02-18 2021-01-13 AbbVie Stemcentrx LLC Novel modulators and methods of use
WO2012112943A1 (en) 2011-02-18 2012-08-23 Stem Centrx, Inc. Novel modulators and methods of use
US11008389B2 (en) 2011-03-16 2021-05-18 Sanofi Uses of a dual V region antibody-like protein
US9244074B2 (en) 2011-06-07 2016-01-26 University Of Hawaii Biomarker of asbestos exposure and mesothelioma
US9561274B2 (en) 2011-06-07 2017-02-07 University Of Hawaii Treatment and prevention of cancer with HMGB1 antagonists
WO2012172495A1 (en) 2011-06-14 2012-12-20 Novartis Ag Compositions and methods for antibodies targeting tem8
WO2013004607A1 (en) 2011-07-01 2013-01-10 Bayer Intellectual Property Gmbh Relaxin fusion polypeptides and uses thereof
US9382305B2 (en) 2011-07-01 2016-07-05 Bayer Intellectual Property Gmbh Relaxin fusion polypeptides and uses thereof
WO2013007563A1 (en) 2011-07-08 2013-01-17 Bayer Intellectual Property Gmbh Fusion proteins releasing relaxin and uses thereof
US10598653B2 (en) 2011-11-01 2020-03-24 Bionomics Inc. Methods of blocking cancer stem cell growth
WO2013067055A1 (en) 2011-11-01 2013-05-10 Bionomics, Inc. Methods of blocking cancer stem cell growth
US10196442B2 (en) 2011-11-01 2019-02-05 Bionomics Inc. Methods of inhibiting growth of a colon cancer tumor in a subject by administering monoclonal antibodies to G protein-coupled receptor 49 (GPR49)
WO2013067057A1 (en) 2011-11-01 2013-05-10 Bionomics, Inc. Anti-gpr49 antibodies
WO2013067060A1 (en) 2011-11-01 2013-05-10 Bionomics, Inc. Anti-gpr49 antibodies
US9220774B2 (en) 2011-11-01 2015-12-29 Bionomics Inc. Methods of treating cancer by administering anti-GPR49 antibodies
US9221907B2 (en) 2011-11-01 2015-12-29 Bionomics Inc. Anti-GPR49 monoclonal antibodies
US9221906B2 (en) 2011-11-01 2015-12-29 Bionomics Inc. Methods of inhibiting solid tumor growth by administering GPR49 antibodies
WO2013067054A1 (en) 2011-11-01 2013-05-10 Bionomics, Inc. Antibodies and methods of treating cancer
EP3252075A1 (en) 2011-11-04 2017-12-06 Novartis AG Low density lipoprotein-related protein 6 (lrp6) - half life extender constructs
EP3290442A1 (en) 2011-11-04 2018-03-07 Novartis AG Low density lipoprotein-related protein 6 (lrp6) half-life extender constructs
WO2013067355A1 (en) 2011-11-04 2013-05-10 Novartis Ag Low density lipoprotein-related protein 6 (lrp6) - half life extender constructs
WO2013063702A1 (en) 2011-11-04 2013-05-10 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the fc domain
EP3590538A1 (en) 2011-12-05 2020-01-08 Novartis AG Antibodies for epidermal growth factor receptor 3 (her3)
WO2013084147A2 (en) 2011-12-05 2013-06-13 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3)
WO2013084148A2 (en) 2011-12-05 2013-06-13 Novartis Ag Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3
EP3330288A1 (en) 2011-12-21 2018-06-06 Novartis AG Compositions and methods for antibodies targeting factor p
WO2013093762A1 (en) 2011-12-21 2013-06-27 Novartis Ag Compositions and methods for antibodies targeting factor p
US10800847B2 (en) 2012-01-11 2020-10-13 Dr. Mepur Ravindranath Anti-HLA class-IB antibodies mimic immunoreactivity and immunomodulatory functions of intravenous immunoglobulin (IVIG) useful as therapeutic IVIG mimetics and methods of their use
WO2013106586A2 (en) 2012-01-11 2013-07-18 The Terasaki Family Foundation Anti-hla class-ib antibodies mimic immunoreactivity and immunomodulatory functions of intravenous immunoglobulin (ivig) useful as therapeutic ivig mimetics and methods of their use
WO2013119960A2 (en) 2012-02-08 2013-08-15 Stem Centrx, Inc. Novel modulators and methods of use
EP3095797A1 (en) 2012-02-24 2016-11-23 Stemcentrx, Inc. Anti dll3 antibodies and methods of use thereof
US10525130B2 (en) 2012-03-26 2020-01-07 Sanofi Stable IGG4 based binding agent formulations
US9592289B2 (en) 2012-03-26 2017-03-14 Sanofi Stable IgG4 based binding agent formulations
US10064951B2 (en) 2012-03-30 2018-09-04 Hanmi Science Co., Ltd. Liquid formulation of highly concentrated long-acting human growth hormone conjugate
WO2013166594A1 (en) 2012-05-10 2013-11-14 Zymeworks Inc. Heteromultimer constructs of immunoglobulin heavy chains with mutations in the fc domain
US10656156B2 (en) 2012-07-05 2020-05-19 Mepur Ravindranath Diagnostic and therapeutic potential of HLA-E monospecific monoclonal IgG antibodies directed against tumor cell surface and soluble HLA-E
US10987424B2 (en) 2012-07-25 2021-04-27 Hanmi Pharm. Co., Ltd. Liquid formulation of long-acting insulin conjugate
WO2014084859A1 (en) 2012-11-30 2014-06-05 Novartis Ag Molecules and methods for modulating tmem16a activities
EP3851454A1 (en) 2012-12-05 2021-07-21 Novartis AG Compositions and methods for antibodies targeting epo
WO2014089111A1 (en) 2012-12-05 2014-06-12 Novartis Ag Compositions and methods for antibodies targeting epo
US11739130B2 (en) 2013-03-11 2023-08-29 University Of Florida Research Foundation, Incorporated Delivery of card protein as therapy for ocular inflammation
EP3611189A1 (en) 2013-03-14 2020-02-19 Novartis AG Antibodies against notch 3
WO2014159239A2 (en) 2013-03-14 2014-10-02 Novartis Ag Antibodies against notch 3
EP3473272A1 (en) 2013-03-29 2019-04-24 Alexion Pharmaceuticals, Inc. Compositions and methods for increasing the serum half-life of a therapeutic agent targeting complement c5
WO2014160958A1 (en) 2013-03-29 2014-10-02 Alexion Pharmaceuticals, Inc. Compositions and methods for increasing the serum half-life of a therapeutic agent targeting complement c5
WO2014205302A2 (en) 2013-06-21 2014-12-24 Novartis Ag Lectin-like oxidized ldl receptor1 antibodies and methods of use
WO2014205300A2 (en) 2013-06-21 2014-12-24 Novartis Ag Lectin-like oxidized ldl receptor1 antibodies and methods of use
EP3892294A1 (en) 2013-08-28 2021-10-13 AbbVie Stemcentrx LLC Site-specific antibody conjugation methods and compositions
EP3338793A1 (en) 2013-08-28 2018-06-27 AbbVie Stemcentrx LLC Novel sez6 modulators and methods of use
US9546214B2 (en) 2014-04-04 2017-01-17 Bionomics, Inc. Humanized antibodies that bind LGR5
US10358500B2 (en) 2014-04-04 2019-07-23 Bionomics Inc. Humanized antibodies that bind LGR5
US8986691B1 (en) 2014-07-15 2015-03-24 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
US8980273B1 (en) 2014-07-15 2015-03-17 Kymab Limited Method of treating atopic dermatitis or asthma using antibody to IL4RA
WO2016020882A2 (en) 2014-08-07 2016-02-11 Novartis Ag Angiopoetin-like 4 (angptl4) antibodies and methods of use
EP4122957A1 (en) 2014-08-07 2023-01-25 Novartis AG Angiopoietin-like 4 antibodies and methods of use
WO2016020880A2 (en) 2014-08-07 2016-02-11 Novartis Ag Angiopoietin-like 4 antibodies and methods of use
WO2016057841A1 (en) 2014-10-08 2016-04-14 Novartis Ag Compositions and methods of use for augmented immune response and cancer therapy
WO2016057846A1 (en) 2014-10-08 2016-04-14 Novartis Ag Compositions and methods of use for augmented immune response and cancer therapy
WO2016098079A2 (en) 2014-12-19 2016-06-23 Novartis Ag Compositions and methods for antibodies targeting bmp6
WO2016187408A1 (en) 2015-05-19 2016-11-24 Yale University Compositions for treating pathological calcification conditions, and methods using same
WO2016193872A2 (en) 2015-06-05 2016-12-08 Novartis Ag Antibodies targeting bone morphogenetic protein 9 (bmp9) and methods therefor
WO2016207858A1 (en) 2015-06-26 2016-12-29 Novartis Ag Factor xi antibodies and methods of use
WO2017021893A1 (en) 2015-08-03 2017-02-09 Novartis Ag Methods of treating fgf21-associated disorders
WO2017042701A1 (en) 2015-09-09 2017-03-16 Novartis Ag Thymic stromal lymphopoietin (tslp)-binding antibodies and methods of using the antibodies
EP3842457A1 (en) 2015-09-09 2021-06-30 Novartis AG Thymic stromal lymphopoietin (tslp)-binding molecules and methods of using the molecules
WO2017103895A1 (en) 2015-12-18 2017-06-22 Novartis Ag Antibodies targeting cd32b and methods of use thereof
WO2017122130A1 (en) 2016-01-11 2017-07-20 Novartis Ag Immune-stimulating humanized monoclonal antibodies against human interleukin-2, and fusion proteins thereof
WO2017125897A1 (en) 2016-01-21 2017-07-27 Novartis Ag Multispecific molecules targeting cll-1
EP3851457A1 (en) 2016-01-21 2021-07-21 Novartis AG Multispecific molecules targeting cll-1
US10745487B2 (en) 2016-03-22 2020-08-18 Bionomics Limited Method of treating cancer by administering an anti-LGR5 monoclonal antibody
WO2017189724A1 (en) 2016-04-27 2017-11-02 Novartis Ag Antibodies against growth differentiation factor 15 and uses thereof
RU2782212C2 (en) * 2016-05-20 2022-10-24 Октафарма Аг Glycosylated fused proteins vwf with improved pharmacokinetics
WO2017198435A1 (en) * 2016-05-20 2017-11-23 Octapharma Ag Glycosylated vwf fusion proteins with improved pharmacokinetics
CN109152817A (en) * 2016-05-20 2019-01-04 瑞士奥克特珐玛公司 Glycosylation VWF fusion protein with improved pharmacokinetics
IL262967B1 (en) * 2016-05-20 2023-04-01 Octapharma Ag Glycosylated vwf fusion proteins with improved pharmacokinetics
WO2017216724A1 (en) 2016-06-15 2017-12-21 Novartis Ag Methods for treating disease using inhibitors of bone morphogenetic protein 6 (bmp6)
WO2018116267A2 (en) 2016-12-23 2018-06-28 Novartis Ag Methods of treatment with anti-factor xi/xia antibodies
WO2018116255A1 (en) 2016-12-23 2018-06-28 Novartis Ag Factor xi antibodies and methods of use
WO2018146594A1 (en) 2017-02-08 2018-08-16 Novartis Ag Fgf21 mimetic antibodies and uses thereof
WO2018229715A1 (en) 2017-06-16 2018-12-20 Novartis Ag Compositions comprising anti-cd32b antibodies and methods of use thereof
WO2019081983A1 (en) 2017-10-25 2019-05-02 Novartis Ag Antibodies targeting cd32b and methods of use thereof
WO2019229658A1 (en) 2018-05-30 2019-12-05 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
WO2019229701A2 (en) 2018-06-01 2019-12-05 Novartis Ag Binding molecules against bcma and uses thereof
WO2020079580A1 (en) 2018-10-15 2020-04-23 Novartis Ag Trem2 stabilizing antibodies
WO2020109978A1 (en) 2018-11-26 2020-06-04 Novartis Ag Lpl-gpihbp1 fusion polypeptides
WO2020198731A2 (en) 2019-03-28 2020-10-01 Danisco Us Inc Engineered antibodies
WO2020236797A1 (en) 2019-05-21 2020-11-26 Novartis Ag Variant cd58 domains and uses thereof
WO2020236792A1 (en) 2019-05-21 2020-11-26 Novartis Ag Cd19 binding molecules and uses thereof
US11827671B2 (en) 2019-05-24 2023-11-28 Sanofi Methods for treating systemic sclerosis
WO2020242989A1 (en) 2019-05-24 2020-12-03 Sanofi Methods for treating systemic sclerosis
WO2021053559A1 (en) 2019-09-18 2021-03-25 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
WO2021053560A1 (en) 2019-09-18 2021-03-25 Novartis Ag Combination therapy with entpd2 and cd73 antibodies
WO2021202473A2 (en) 2020-03-30 2021-10-07 Danisco Us Inc Engineered antibodies
WO2022097060A1 (en) 2020-11-06 2022-05-12 Novartis Ag Cd19 binding molecules and uses thereof
WO2023209568A1 (en) 2022-04-26 2023-11-02 Novartis Ag Multispecific antibodies targeting il-13 and il-18
WO2024015953A1 (en) 2022-07-15 2024-01-18 Danisco Us Inc. Methods for producing monoclonal antibodies
US11773160B1 (en) 2022-08-05 2023-10-03 Anaveon AG Immune-stimulating IL-2 fusion proteins

Also Published As

Publication number Publication date
CA2126092A1 (en) 1993-08-05
EP0625199A1 (en) 1994-11-23
FI943565A0 (en) 1994-07-29
FI943565A (en) 1994-07-29
FR2686901A1 (en) 1993-08-06
NO942840L (en) 1994-09-29
JPH07503369A (en) 1995-04-13
NO942840D0 (en) 1994-07-29

Similar Documents

Publication Publication Date Title
WO1993015200A1 (en) Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium
EP0624195B1 (en) Novel biologically active polypeptides, preparation thereof and pharmaceutical composition containing said polypeptides
WO1993015211A1 (en) New polypeptides having granulocyte colony stimulating activity, preparation thereof and pharmaceutical compositions containing said polypeptides
US5837488A (en) Cloning and production of human von Willebrand Factor GP1b binding domain polypeptides and methods of using same
CA2077446A1 (en) Cloning and production of human von willebrand factor gpib binding domain polypeptides and methods of using same
WO1995030759A1 (en) Biologically active polypeptides inserted into an albumin
FR2686605A1 (en) NOVEL POLYPEPTIDES, THEIR PREPARATION AND THEIR USE.
AU645077C (en) Cloning and production of human von willebrand factor GPIb binding domain polypeptides and methods of using same

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA FI JP NO US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2126092

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1993904131

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 1994 256831

Country of ref document: US

Date of ref document: 19940728

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 943565

Country of ref document: FI

WWP Wipo information: published in national office

Ref document number: 1993904131

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1993904131

Country of ref document: EP