WO1993009222A2 - Transfection of vertebrate cells e.g. by homologous recombination - Google Patents
Transfection of vertebrate cells e.g. by homologous recombination Download PDFInfo
- Publication number
- WO1993009222A2 WO1993009222A2 PCT/US1992/009627 US9209627W WO9309222A2 WO 1993009222 A2 WO1993009222 A2 WO 1993009222A2 US 9209627 W US9209627 W US 9209627W WO 9309222 A2 WO9309222 A2 WO 9309222A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dna
- cells
- primary
- transfected
- cell
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
- A61K47/6901—Conjugates being cells, cell fragments, viruses, ghosts, red blood cells or viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
- A61P39/06—Free radical scavengers or antioxidants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/06—Drugs for disorders of the endocrine system of the anterior pituitary hormones, e.g. TSH, ACTH, FSH, LH, PRL, GH
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/18—Drugs for disorders of the endocrine system of the parathyroid hormones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/505—Erythropoietin [EPO]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/605—Glucagons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/61—Growth hormones [GH] (Somatotropin)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/02—Cells for production
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/108—Plasmid DNA episomal vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
- C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor
Definitions
- Gene therapy can therefore be thought of as an in vivo protein production and delivery system, and almost all diseases that are currently treated by the administration of proteins are candidates for treatment using gene therapy.
- Germ cell gene therapy can be divided into two areas: germ cell and somatic cell gene therapy.
- Germ cell gene therapy refers to the modification of sperm cells, egg cells, zygotes, or early stage embryos. On the basis of both ethical and practical criteria, germ cell gene therapy is inappropriate for human use.
- somatic cell gene therapy would affect only the person under treatment (somatic cells are cells that are not capable of developing into whole individuals and include all of the body's cells with the exception of the germ cells) . As such, somatic cell gene therapy is a reasonable approach to the treatment and cure of certain disorders in human beings.
- somatic cells e.g., fibroblasts, hepatocytes, or endothelial cells
- somatic cells e.g., fibroblasts, hepatocytes, or endothelial cells
- the present invention relates to transfected primary and secondary somatic cells of vertebrate origin, particularly of mammalian origin, transfected with exogenous DNA which encodes a therapeutic product, exogenous DNA which is itself a therapeutic product and/or exogenous DNA which causes the transfected cells to express a gene at a higher level than occurs in the corresponding nontransfected cell.
- the present invention relates to transfected primary and secondary somatic cells of vertebrate origin, particularly mammalian origin, transfected with exogenous genetic material (DNA) which encodes a desired (e.g., a therapeutic) product or is itself a desired (e.g., therapeutic) product, methods by which primary and secondary cells are transfected to include exogenous genetic material, methods of producing clonal cell strains or heterogenous cell strains, methods of gene therapy in which the transfected primary or secondary cells are used, methods of producing a therapeutic protein through the use of transfected primary or secondary cells made by the present method and methods of producing antibodies using the transfected primary or secondary cells.
- DNA exogenous genetic material
- the present invention relates to transfected primary and secondary somatic cells of vertebrate origin, particularly mammalian origin, transfected with exogenous genetic material (DNA or RNA) which encodes a clinically useful product, such as human growth hormone (hGH) , erythropoietin (EPO) or insulinotropin, methods by which primary and secondary cells are transfected to include exogenous genetic material encoding hGH, EPO or insulinotropin, methods of producing clonal cell strains or heterogenous cell strains which express exogenous genetic material encoding hGH, EPO or insulinotropin, a method of providing hGH, EPO or insulinotropin in physiologically useful quantities to an individual in need thereof, through the use of transfected cells of the present invention or by direct injection of DNA encoding hGH, EPO insulinotropin into an individual; and methods of producing antibodies against the encoded product using the transfected primary or secondary cells.
- exogenous genetic material DNA or RNA
- a clinically useful product such as
- the present invention relates to a method of gene or DNA targeting in cells of vertebrate, particularly mammalian, origin. That is, it relates to a method of introducing DNA into primary or secondary cells of vertebrate origin through homologous recombination or targeting of the DNA, which is introduced into genomic DNA of the primary or secondary cells at a preselected site. The preselected site determines the targeting sequences used.
- the present invention further relates to homologously recombinant primary or secondary cells, referred to as homologously recombinant (HR) primary or secondary cells, produced by the present method and to uses of the HR primary or secondary cells.
- HR homologously recombinant
- the present invention also relates to a method of turning on or activating a gene present in primary cells, secondary cells or immortalized cells of vertebrate origin, which is normally not expressed in the cells or is not expressed at significant levels in the cells. Homologous recombination or targeting is used to replace or disable the regulatory region normally associated with the gene with a regulatory sequence which causes the gene to be expressed at levels higher than evident in the corresponding nontransfected cell.
- the present invention therefore, relates to a method of making proteins by turning on or activating an endogenous gene which encodes the desired product in transfected primary, secondary or immortalized cells.
- the term primary cell includes cells present in a suspension of cells isolated from a verte ⁇ brate tissue source (prior to their being plated i.e., attached to a tissue culture substrate such as a dish or flask) , cells present in an explant derived from tissue, both of the previous types of cells plated for the first time, and cell suspensions derived from these plated cells.
- the term secondary cell or cell strain refers to cells at all subsequent steps in culturing. That is, the first time a plated primary cell is removed from the culture substrate and replated (passaged) , it is referred to herein as a secondary cell, as are all cells in subsequent passages. Secondary cells are cell strains which consist of secondary cells which have been passaged one or more times.
- a cell strain consists of secondary cells that: 1) have been passaged one or more times; 2) exhibit a finite number of mean population doublings in culture; 3) exhibit the properties of contact-inhibited, anchorage dependent growth (anchorage-dependence does not apply to cells that are propagated in suspension culture) ; and 4) are not immortalized.
- a "clonal cell strain” is defined as a cell strain that is derived from a single founder cell.
- a “heterogenous cell strain” is defined as a cell strain that is derived from two or more founder cells.
- the present invention includes primary and secondary somatic cells, such as fibroblasts, keratinocytes, epithelial cells, endothelial cells, glial cells, neural cells, formed elements of the blood, muscle cells, other somatic cells which can be cultured and somatic cell precursors, which have been transfected with exogenous DNA which is stably integrated into their genomes or is expressed in the cells episomally.
- the resulting cells are referred to, respectively, as transfected primary cells and transfected secondary cells.
- the exogenous DNA 1) encodes a product, such as a translational product (e.g., a protein) or a transcriptional product (e.g., a ribozyme or an anti-sense nucleic acid sequence) which is a therapeutic product; 2) is itself a therapeutic product (e.g., DNA which binds to a cellular regulatory protein or alters gene expression) or 3) is DNA which undergoes homologous recombination with genomic DNA of recipient cells and results in alteration of (increase or decrease in) expression of an endogenous gene.
- a translational product e.g., a protein
- a transcriptional product e.g., a ribozyme or an anti-sense nucleic acid sequence
- 3) is DNA which undergoes homologous recombination with genomic DNA of recipient cells and results in alteration of (increase or decrease in) expression of an endogenous gene.
- the exogenous DNA encodes a translational or transcriptional product to be expressed by the recipient cells
- the resulting product is retained within the cell, incorporated into the cell membrane or secreted from the cell.
- the exogenous DNA encoding the therapeutic product is introduced into cells along with additional DNA sequences sufficient for expression of the exogenous DNA in transfected cells and is operatively linked to those sequences.
- exogenous DNA is, for example, DNA sequences which bind to a cellular regulatory protein, DNA sequences sufficient for sequestration of a protein or nucleic acid present in the transfected primary or secondary cell, DNA sequences which alter secondary or tertiary chromosomal structure or DNA sequences which are transcriptional regulatory elements.
- transfected primary cells Such primary cells modified to express or render available exogenous DNA are referred to herein as transfected primary cells, which include cells removed from tissue and placed on culture medium for the first time.
- Secondary cells modified to express or render available exogenous DNA are referred to herein as transfected secondary cells.
- exogenous DNA undergoes homologous recombination with genomic DNA of transfected (recipient) cells
- introduction of the exogenous DNA results in disablement of the endogenous sequences which control expression of the endogenous gene, either by replacing all or a portion of the endogenous (genomic) sequence or disrupting the endogenous sequence.
- Primary and secondary cells transfected by the subject method fall into three types or categories: 1) cells which do not, as obtained, make or contain the therapeutic product, 2) cells which make or contain the therapeutic product but in lower quantities than normal (in quantities less than the physiologically normal lower level) or in defective form, and 3) cells which make the therapeutic product at physiologically normal levels, but are to be augmented or enhanced in their content or production.
- Exogenous DNA is introduced into primary or secondary cells by a variety of techniques.
- a construct which includes exogenous DNA encoding a thera-plastic protein and additional DNA sequences necessary for expression in recipient cells is introduced into primary or secondary cells by electroporation, microinjection, or other means (e.g., calcium phosphate precipitation, modified calcium phosphate precipitation, polybrene precipitation, liposome fusion, receptor-mediated DNA delivery) .
- a vector such as a retroviral vector, which includes exogenous DNA can be used and cells can be genetically modified as a result of infection with the vector.
- transfected primary and secondary cells may optionally contain DNA encoding a selectable marker, which is expressed and confers upon recipients a selectable phenotype, such as antibiotic resistance, resistance to a cytotoxic agent, nutritional prototrophy or expression of a surface protein. Its presence makes it possible to identify and select cells containing the exogenous DNA.
- selectable marker genes can be used, such as neo, gpt, dhfr, ada, pac, hyg, dr and hisD.
- Transfected cells of the present invention are useful, as populations of transfected primary cells, transfected clonal cell strains, transfected heterogenous cell strains, and as cell mixtures in which at least one representative cell of one of the three preceding categories of transfected cells is present, as a delivery system for treating an individual with an abnormal or undesirable condition which responds to delivery of a therapeutic product, which is either: 1) a therapeutic protein (e.g., a protein which is absent, underproduced relative to the individual's physiologic needs, defective or inefficiently or inappropriately utilized in the individual; a protein with novel functions, such as enzymatic or transport functions) or 2) a therapeutic nucleic acid (e.g.
- a therapeutic protein e.g., a protein which is absent, underproduced relative to the individual's physiologic needs, defective or inefficiently or inappropriately utilized in the individual
- a protein with novel functions such as enzymatic or transport functions
- a therapeutic nucleic acid e.g.
- DNA which binds to or sequesters a regulatory protein, RNA which inhibits gene expression or has intrinsic enzymatic activity DNA which binds to or sequesters a regulatory protein, RNA which inhibits gene expression or has intrinsic enzymatic activity.
- transfected primary cells, clonal cell strains or heterogenous cell strains are administered to an individual in whom the abnormal or undesirable condi ⁇ tion is to be treated or prevented, in sufficient quantity and by an appropriate route, to express or make available the exogenous DNA at physiologically relevant levels.
- a physiologically relevant level is one which either approximates the level at which the product is produced in the body or results in improvement of the abnormal or undesirable condition.
- Cells administered in the present method are cells transfected with exogenous DNA which encodes a therapeutic product, exogenous DNA which is itself a therapeutic product or exogenous DNA, such as a regulatory sequence, which is introduced into a preselected site in genomic DNA through homologous recombination and functions to cause recipient cells to produce a product which is normally not expressed in the cells or to produce the product of a higher level than occurs in the corresponding nontransfected cell.
- a regulatory sequence e.g., a promoter
- it replaces or disables a regulatory sequence normally associated with a gene, and results in expression of the gene at a higher level than occurs in the corresponding nontransfected cell.
- Figure 1 is a schematic representation of plasmid pXGH5, which includes the human growth hormone (hGH) gene under the control of the mouse metallothionein promoter.
- Figure 2 is a schematic representation of plasmid pcDNEO, which includes the neo coding region (BamHI-Bglll fragment) from plasmid pSV2neo inserted into the BamHI site of plasmid pcD; the Amp-R and pBR3220ri sequences from pBR322; and the polyA, 16S splice junctions and early promoter regions from SV40.
- Figure 3 is a schematic representation of plasmid pXGH301 which includes the human growth hormone gene and the neo gene.
- Figure 4 is a flow chart of the method of the present invention.
- FIG. 5 is a schematic representation of plasmid pXEPOl.
- the solid black arc represents the pUC12 backbone and the arrow denotes the direction of transcription of the ampicillin resistance gene.
- the stippled arc represents the mouse metallothionein promoter (pmMTl) .
- the unfilled arc interrupted by black boxes represents the human erythropoietin EPO gene (the black boxes denote exons and the arrow indicates the direction hEPO transcription) .
- the relative positions of restriction endonuclease recognition sites are indicated.
- FIG. 6 is a schematic representation of plasmid pE3neoEPO.
- the positions of the human erythropoietin gene and the neo and amp resistance genes are indicated. Arrows indicate the directions of transcription of the various genes.
- pmMTl denotes the mouse metallothionein promoter (driving hEPO expression)
- pTK denotes the Herpes Simplex Virus thymidine kinase promoter (driving neo expression) .
- the dotted regions of the map mark the positions of human HGPRT sequences. The relative positions of restriction endonuclease recognition sites are indicated.
- Figure 7 is a schematic diagram of a strategy for transcriptionally activating the hEPO gene.
- Figure 8 is a schematic diagram of a strategy for transcriptionally activating the hEPO gene.
- Figure 9 shows the results of an assessment of long- term in vitro hGH production by transfected primary human skin fibroblasts (two strains, HF96-11 and HF96-23) .
- Figure 10 is a graphic representation of human growth hormone (hGH) expression by transfected primary rabbit skin fibroblasts in vitro.
- Figure 11 shows the results of an assay to detect serum levels of hGH over time in mice implanted with transfected rabbit fibroblasts expressing hGH.
- Figure 12 is a graphic representation of human growth hormone (hGH) expression in cells recovered from subrenal capsule implants.
- Figure 13a shows hematocrit (HCT) levels in control mice and mice implanted with transfected rabbit fibroblasts expressing hEPO.
- Figure 13b shows results of an assay to detect hEPO in the serum of mice implanted with transfected rabbit fibroblasts expressing hEPO.
- the present invention relates to transfected primary and secondary somatic cells of vertebrate origin, particularly of mammalian origin, transfected with exogenous DNA which encodes a therapeutic product, exogenous DNA which is itself a therapeutic product and/or exogenous DNA which causes the transfected cells to express a gene at a higher level than occurs in the corresponding nontransfected cell.
- primary or secondary cells of vertebrate, particularly mammalian, origin have been transfected with exogenous DNA encoding a therapeutic product and shown to produce the encoded therapeutic protein stably and reproducibly, both .in vitro and in vivo, over extended periods of time.
- transfected primary and secondary cells have been shown to express the encoded product in vivo at physiologically relevant levels, to be recoverable after implantation and, upon reculturing, to grow and display their preimplanta- tion properties.
- This demonstration is in sharp contrast to what one of skill in the art would predict, because, for example, even experts in the field see the finite life span of normal somatic cells and the inability to isolate or grow the relevant transplantable cells as precluding their use for gene therapy unless the cells are genetically modified using retroviruses. Miller, A.D., Blood, 76,:271-278 (1990).
- transfected primary and secondary cells which include exogenous DNA encoding a desired product, (i.e., a translation product which is a therapeutic protein or an antigen against which antibodies are produced) and stably express the exogenous DNA. It is also possible, using the method described herein, to produce transfected primary and secondary cells which include exogenous DNA encoding other translation products (novel proteins not made in nature) or transcription products (e.g., anti-sense RNA or ribozymes) or exogenous DNA which itself is a therapeutic product (e.g., exogenous DNA which binds a regulatory protein present in the transfected cell) .
- a desired product i.e., a translation product which is a therapeutic protein or an antigen against which antibodies are produced
- transfected primary and secondary cells which include exogenous DNA encoding other translation products (novel proteins not made in nature) or transcription products (e.g., anti-sense RNA or ribozymes) or exogenous DNA which itself
- the method of the present invention includes the steps of: 1) providing a population of primary cells, obtained from the individual to whom the transfected primary cells will be administered or from another source; 2) introducing into the primary cells or into secondary cells derived from primary cells a DNA construct which includes exogenous DNA as described above and the necessary additional DNA sequences described above, producing transfected primary or secondary cells; 3) maintaining transfected primary or secondary cells under conditions appropriate for their propagation; 4) identify- ing a transfected primary or secondary cell; and
- exogenous DNA is introduced into genomic DNA by homologous recombination between DNA sequences present in the DNA construct and genomic DNA.
- a cell suspension containing primary or secondary cells is combined with exogenous DNA encoding a therapeutic product and DNA encoding a selectable marker, such as the neo gene.
- the two DNA sequences are present on the same DNA construct or on two separate DNA constructs.
- the resulting combination is subjected to electroporation, generally at 250-300 volts with a capacitance of 960 ⁇ Farads and an appropriate time constant (e.g., 14 to 20 m sec) for cells to take up the DNA construct.
- electroporation generally at 250-300 volts with a capacitance of 960 ⁇ Farads and an appropriate time constant (e.g., 14 to 20 m sec) for cells to take up the DNA construct.
- icroinjection is used to intro ⁇ quiz the DNA construct into primary or secondary cells.
- introduction of the exogenous DNA results in production of transfected primary or secondary cells.
- heterogenous cell strains of the present invention the same steps are carried out as described for production of a clonal cell strain, except that a single transfected primary or secondary cell is not isolated and used as the founder cell. Instead, two or more transfected primary or secondary cells are cultured to produce a heterogenous cell strain.
- the subject invention also relates to a method of producing antibodies specific for the protein encoded by the exogenous DNA.
- transfected primary or secondary cells expressing an antigen against which antibodies are desired are introduced into an animal recipient (e.g., rabbit, mouse, pig, dog, cat, goat, guinea pig, sheep, non-human primate) .
- the animal recipient produces antibodies against the antigen expressed, which may be an entire protein antigen or a peptide encoded by a fragment of the intact gene which encodes the entire antigen.
- Polyclonal sera is obtained from the animals.
- Splenocytes are removed from an animal recipient of transfected primary or secondary cells expressing the antigen against which monoclonal antibodies are desired.
- the splenocytes are fused with myeloma cells, using known methods, such as that of
- the present invention has wide applicability in treating abnormal or undesired conditions and can be used to provide a variety of products to an individual.
- it can be used to provide secreted proteins (with either predominantly systemic or predominantly local effects), membrane proteins (e.g., for imparting new or enhanced cellular responsiveness, facilitating removal of a toxic product or marking or targeting a cell) or intracellular proteins (e.g. , for affecting gene expression or producing autolytic effects) .
- secreted proteins with either predominantly systemic or predominantly local effects
- membrane proteins e.g., for imparting new or enhanced cellular responsiveness, facilitating removal of a toxic product or marking or targeting a cell
- intracellular proteins e.g. , for affecting gene expression or producing autolytic effects
- engineered DNA which binds or sequesters a cellular protein
- engineered RNA useful in an anti-sense approach to altering gene expression or to provide antigens against which immune response occurs in an individual (to prevent disease as by vaccination or to suppress an existing condition) .
- the present invention is particularly advantageous in treating abnormal or undesired conditions in that it: 1) is curative (one gene therapy treatment has the potential to last a patient's lifetime) ; 2) allows precise dosing (the patient's cells continuously determine and deliver the optimal dose of the required protein based on physiologic demands, and the stably transfected cell strains can be characterized extensively in vitro prior to implantation, leading to accurate predictions of long term function in vivo); 3) is simple to apply in treating patients; 4) eliminates issues concerning patient compliance (following a one-time gene therapy treatment, daily protein injections are no longer necessary) ; 5) reduces treatment costs (since the therapeutic protein is synthesized by the patient's own cells, investment in costly protein production and purification is unnecessary) ; and 6) is safe (the invention does not use infectious agents such as retroviruses to genetically engineer the patient's cells, thereby overcoming the safety and efficacy issues that have hampered other gene therapy systems) .
- primary or secondary cells of vertebrate, particularly mammalian, origin have been transfected with exogenous DNA encoding EPO and shown to produce the encoded EPO reproducibly, both n vitro and n vivo, over extended periods of time.
- the transfected primary and secondary cells have been shown to express EPO in vivo at physiologically relevant levels.
- the EPO expressed has been shown to have the glycosylation pattern typical of EPO purified from human urine or recombinant human EPO.
- primary or secondary cells of vertebrate, particularly mammalian, origin have been transfected with exogenous DNA encoding hGH and shown to produce the encoded hGH reproducibly, both in vitro and in vivo, over extended periods of time.
- the transfected primary and secondary cells have been shown to express hGH in vivo at physiologically relevant levels.
- Applicants have also developed methods for producing transfected primary or secondary cells which stably express exogenous DNA encoding EPO, clonal cell strains and heterogenous cell strains of such transfected cells, methods of producing the clonal and heterogenous cell strains, and methods of using transfected cells expressing EPO to deliver the encoded product to an individual mammal at physiologically relevant levels.
- the constructs and methods herein described are useful, for example, for treating an individual (human) whose EPO production and/or function is in need of being increased or enhanced [e.g., is compromised or less than normal, or normal but the individual would benefit from enhancement, at least temporarily, of red blood cell production (e.g., during predialysis or dialysis therapy, during treatment of AIDS with AZT, after surgery, or during chemotherapy) ] .
- insulinotropin includes, e.g.
- GLP-1 glucagon-like peptide 1
- GLP-1 such as GLP(7-37), GLP(7-36) , GLP-1(7- 35) and GLP-l(7-34) as well as their carboxy-terminal amidated derivatives produced by in vivo amidating enzymes and derivatives which have amino acid alterations or other alterations which result in substantially the same biological activity or stability in the blood as that of a truncated GLP-1 or enhanced biological activity or stability.
- DNA can be introduced into primary or secondary vertebrate cells in a DNA construct or plasmid and integrated into the genome of the transfected primary or secondary cells by homologous recombination. That is, they have demonstrated gene targeting in primary and secondary mammalian cells. They have further demonstrated that the exogenous DNA has the desired function in the homologously recombinant (HR) cells and that correctly targeted cells can be identified on the basis of a detectable phenotype conferred by a selectable marker gene.
- HR homologously recombinant
- the present invention relates to a method of protein production using transfected primary. secondary or immortalized cells.
- the method involves transfecting primary cells, secondary cells or immortalized cells with exogenous DNA which encodes a therapeutic product or with DNA which is sufficient to target to and activate an endogenous gene which encodes a therapeutic product.
- Examples 18 f , 19 and 21 describe protein production by targeting and activation of a selected endogenous gene.
- plasmid pcDNEO a selectable marker gene
- plasmid pXGH5 a gene encoding a therapeutic product
- pXGH30l a therapeutic product
- pE3Neo a plasmid useful for targeting to a particular locus in the human genome and selection based upon a drug resistant phenotype
- This plasmid is designated pE3Neo and its integration into the cellular genomes at the HPRT locus produces cells which have an hprt " , 6-TG resistant phenotype and are also G418 resistant.
- pE3Neo functions properly in gene targeting in an established human fibroblast cell line (Example 18b) , by demonstrating localization of the DNA introduced into established cells within exon 3 of the HPRT gene.
- Applicants demonstrate gene targeting in primary and secondary human skin fibroblasts using pE3Neo (Example 18c) and describe construction of a plasmid for targeted insertion of a gene encoding a therapeutic product (human growth hormone [hGH]) into the human genome (Example 18d) .
- the subject application further demonstrates that modification of DNA termini enhances targeting of DNA into genomic DNA (Examples 18c and 18e) and construction of a variety of targeting plasmids.
- Applicants describe targeting plasmids for placing a human gene under the control of a murine promoter known to function in human cells (Examples 18f and 18i) ; for targeting to sequences flanking a gene and isolation of targeted secondary fibroblasts using a variety of screening and selection approaches (Examples 18g, 18h, 18j and 18k) ; for placing a human gene not normally expressed in the primary or secondary cells under the control of a promoter of nonhuman or human origin, to produce homologously recombinant primary or secondary cells which express the encoded product (Examples 18f-18k) .
- the normal regulatory sequences upstream of a gene e.g. the human EPO gene
- the product of the targeting events is a chimeric transcription unit, in which a regulatory element and an operatively linked exon are positioned upstream of the desired endogenous gene to be activated.
- the product of transcription, splicing, and translation produces a chimeric protein in which amino acids encoded by exon 1 of the exogenous gene are fused to amino acids encoded by exons 2 and downstream exons in the endogenous gene.
- the product of the targeting event replaces the regulatory and exon 1 sequences of the endogenous gene with corresponding exogenous sequences.
- the product of transcription, splicing, and translation produces a chimeric protein similar to that described above.
- secretion of such proteins involves membrane translocation and removal of the signal peptide, in this case producing a normal protein lacking the chimeric signal peptide. In both cases the chimeric protein is now under the control of a desired regulatory element.
- Examples 18f-18h and 19 illustrate embodiments in which the normal regulatory sequences upstream of the human EPO gene are altered to allow expression of hEPO in primary or secondary fibroblast strains which do not express EPO in detectable quantities in their untransfected state.
- the product of targeting leaves the normal EPO protein intact, but under the control of the mouse metallothionein promoter.
- Examples 18i and 18j demonstrate the use of similar targeting constructs to activate the endogenous growth hormone gene in primary or secondary human fibroblasts.
- the products of targeting events are chimeric transcription units, in which the first exon of the human growth hormone gene is positioned upstream of EPO exons 2-5.
- the product of transcription (controlled by the mouse metallothionein promoter) , splicing, and translation is a protein in which amino acids 1-4 of the hEPO signal peptide are replaced with amino acid residues 1-3 of hGH.
- the chimeric portion of this protein, the signal peptide is removed prior to secretion from cells.
- the Examples provide methods for activating endogenous genes by gene targeting which do not require manipulation or other uses of the hEPO and hGH protein coding regions. By these methods, normally inactive genes may be activated in cells that have properties desirable for in vivo protein delivery methods (e.g. gene therapy) and in vitro protein production (e.g., pharmaceutics).
- Figures 7 and 8 illustrate two strategies for transcriptionally activating the hEPO gene.
- the thin lines represent hEPO sequences; thick lines, mouse metallothionein I promoter; stippled box, 5' untranslated region of hGH; solid box, hGH exon 1; striped box, 10 bp linker from hEPO intron 1; cross-hatched box, 5' untranslated region of hEPO; and open boxes, hEPO coding sequences; HIII, Hindlll site.
- exogenous DNA which encodes a therapeutic product (e.g., protein, ribozyme, nucleic acid) can be inserted at preselected sites in the genome of vertebrate (e.g., mammalian, both human and nonhuman) primary or secondary cells.
- a therapeutic product e.g., protein, ribozyme, nucleic acid
- the methods and DNA constructs described can be used for a wide variety of purposes.
- the method can be used to alter primary or secondary cells of vertebrate origin in order to repair, alter, delete or replace DNA already present in the recipient primary or secondary cell; to introduce into primary or secondary cells a gene or DNA sequence (at a preselected site) which encodes a therapeutic product or other desired product or is itself a therapeutic or other product; to add to or replace regulatory sequences present in the primary or secondary cell recipients; to knock out or remove an entire gene or gene portion present in primary or secondary cells; and to produce universal donor cells.
- the transfected primary or secondary cells may also include DNA encoding a selectable marker which confers a selectable phenotype upon them, facilitating their identification and isolation.
- Applicants have also developed methods for producing transfected primary or secondary cells which stably express exogenous DNA, clonal cell strains and heterogenous cell strains of such transfected cells, methods of producing the clonal and heterogenous cell strains, and methods of treating or preventing an abnormal or undesirable condition through the use of populations of transfected primary or secondary cells of the present invention.
- Primary and secondary cells to be transfected by the present method can be obtained from a variety of tissues and include all cell types which can be maintained in culture.
- primary and secondary cells which can be transfected by the present method include fibroblasts, keratinocytes, epithelial cells (e.g., mammary epithelial cells, intestinal epithelial cells), endothelial cells, glial cells, neural cells, formed elements of the blood (e.g., lymphocytes, bone marrow cells) , muscle cells and precursors of these somatic cell types.
- Primary cells are preferably obtained from the individual to whom the transfected primary or secondary cells are administered. However, primary cells may be obtained from a donor (other than the recipient) of the same species or another species (e.g., mouse, rat, rabbit, cat, dog, pig, cow, bird, sheep, goat, horse) .
- Transfected primary and secondary cells have been produced, with or without phenotypic selection, as described in Examples 5-7, and shown to express exogenous DNA encoding a therapeutic product including, e.g., EPO and insulinotropin.
- a therapeutic product including, e.g., EPO and insulinotropin.
- Immortalized cells can also be transfected by the present method and used for either gene therapy or protein production.
- Examples of immortalized human cell lines useful for protein production by the present method include, but are not limited to, HT1080, HeLa, MCF-7 breast cancer cells, K-562 leukemia cells, KB carcinoma cells and 2780AD ovarian carcinoma cells. Exo ⁇ enous DNA
- Exogenous DNA incorporated into primary or secondary cells by the present method is: 1) DNA which encodes a translation or transcription product whose expression in primary or secondary cells is desired, such as a transla ⁇ tion or transcription product useful to treat an existing condition or prevent it from occurring (eg. , EPO or insulinotropin) and 2) DNA which does not encode a gene product but is itself useful, such as DNA useful to treat an existing condition or prevent it from occurring or 3) DNA which undergoes homologous recombination with genomic DNA of recipient cells and results in alteration of (increase or decrease in) expression of an endogenous gene.
- DNA transfected into primary or secondary cells can encode an entire desired product, or can encode, for example, the active or functional portion(s) of the product.
- the product can be, for example, a hormone, a cytokine, an antigen, an antibody, an enzyme, a clotting factor, a transport protein, a receptor, a regulatory protein, a structural protein, an anti-sense RNA, a ribozyme or a protein or a nucleic acid which does not occur in nature (i.e., a novel protein or novel nucleic acid) .
- the DNA can be obtained from a source in which it occurs in nature or can be produced, using genetic engineering techniques or synthetic processes.
- the DNA transfected into primary or secondary cells can encode one or more therapeutic products.
- the exogenous DNA After transfection into primary or secondary cells, the exogenous DNA is stably incorporated into the recipient cell's genome (along with the additional sequences present in the DNA construct used), from which it is expressed or otherwise functions. Alternatively, the exogenous DNA may exist episomally within the transfected primary or secondary cells.
- DNA encoding the desired product can be introduced into cells under the control of an inducible promoter, with the result that cells produced or as introduced into an individual do not express the product but can be induced to do so (i.e., production is induced after the transfected cells are produced but before implantation or after implantation) .
- DNA encoding the desired product can, of course, be introduced into cells in such a manner that it is expressed upon introduction (i.e., without induction) .
- selectable markers can be incorporated into primary or secondary cells.
- a select ⁇ able marker which confers a selectable phenotype such as drug resistance, nutritional auxotrophy, resistance to a cytotoxic agent or expression of a surface protein, can be used.
- Selectable marker genes which can be used include neo, gpt, dhfr, ada, pac, hyg and hisd. The selectable phenotype conferred makes it possible to identify and isolate recipient primary or secondary cells.
- Selectable markers can be divided into two categories: positive selectable and negative selectable.
- positive selection cells expressing the positive selectable marker are capable of surviving treatment with a selective agent (such as neo, gpt, dhfr, ada, pac, hyg, mdrl and hisD) .
- negative selection cells expressing the negative selectable marker are destroyed in the presence of the selective agent (e.g., tk, gpt).
- DNA constructs which include exogenous DNA and, optionally, DNA encoding a selectable marker, along with additional sequences necessary for expression of the exogenous DNA in recipient primary or secondary cells, are used to transfect primary or secondary cells in which the encoded product is to be produced.
- the DNA construct can also include targeting sequences for homologous recombination with host cell DNA.
- DNA constructs which include exogenous DNA sequences which do not encode a gene product (and are the therapeutic product) and, optionally, include DNA encoding a selectable marker can be used to transfect primary and secondary cells.
- infectious vectors such as retroviral, herpes, adenovirus, adenovirus-associated, mumps and poliovirus vectors, can be used for this purpose.
- a DNA construct which includes the exogenous DNA and additional sequences, such as sequences necessary for expression of the exogenous DNA can be used (e.g., plasmid pXGH5 or plasmid pXEPOl) .
- a DNA construct can include an inducible promoter which controls expression of the exogenous DNA, making inducible expression possible.
- the DNA construct may include a bacterial origin of replication and bacterial antibiotic resistance markers, which allow for large-scale plasmid propagation in bacteria.
- a DNA construct which includes DNA encoding a selectable marker, along with additional sequences, such as a promoter, poly- adenylation site and splice junctions, can be used to confer a selectable phenotype upon transfected primary or secondary cells (e.g., plasmid pcDNEO) .
- the two DNA constructs are co-transfected into primary or secondary cells, using methods described herein.
- one DNA construct which includes exogenous DNA, a selectable marker gene and additional sequences e.g., those necessary for expression of the exogenous DNA and for expression of the selectable marker gene
- additional sequences e.g., those necessary for expression of the exogenous DNA and for expression of the selectable marker gene
- Such a DNA construct e.g., plasmid PXGH301, which includes the hGH gene and the neo gene, or plasmid pE3neoEPO which includes the EPO gene and the neo gene; these plasmids are described in Figures 3 and 6, respectively.
- Similar constructs which include exogenous DNA encoding insulinotropin and additional sequences (e.g. , sequences necessary for insulinotropin expression) can be produced (e.g., plasmid pXGLPl; see Example 11) .
- These constructs can also include DNA encoding a selectable marker, as well as other sequences, such as a promoter, a polyadenylation site, and splice junctions.
- the DNA construct includes the exogenous DNA and regulatory sequences necessary and sufficient for expression of the encoded product (e.g., EPO) upon entry of the DNA construct into recipient cells.
- EPO encoded product
- DNA constructs which include exogenous DNA encoding a desired product, targeting sequences for homologous recombination and, optionally, DNA encoding one or more selectable markers are used to transfect primary or secondary cells in which homologous recombination is to occur.
- DNA sequences necessary for expression of the exogenous DNA will generally be present as well.
- DNA constructs which include exogenous DNA sequences which do not encode a gene product (and are the desired product) and, optionally, include DNA encoding a selectable marker can also be used to transfect primary and secondary cells.
- the exogenous DNA, targeting sequences and selectable marker can be introduced into cells on a single DNA construct or on separate constructs.
- the total length of the DNA construct will vary according to the number of components (exogenous DNA, targeting sequences, selectable marker gene) and the length of each.
- the entire construct length will generally be at least 20 nucleotides.
- the construct will include a single component, the exogenous DNA.
- the exogenous DNA because of its homology, serves also to target integration into genomic DNA and additional targeting sequences are unnecessary.
- Such a construct is useful to knock out, replace or repair a resident DNA sequence, such as an entire gene, a gene portion, a regulatory element or portion thereof or regions of DNA which, when removed, place regulatory and structural sequences in functional proximity. It is also useful when the exogenous DNA is a selectable marker.
- ne DNA construct includes exogenous DNA and one or more separate targeting se ⁇ quences, generally located at both ends of the exogenous DNA sequence.
- Targeting sequences are DNA sequences normally present in the primary or secondary cell genome in the genome of the cells as obtained [e.g., an essential gene, a nonessential gene or noncoding DNA, or present in the genome through a previous modification] .
- exogenous DNA encoding a therapeutic product, such as a hormone, a cytokine, an antigen, an antibody, an enzyme, a clotting factor, a transport protein, a receptor, a regulatory protein, a structural protein, an anti-sense RNA, a ribozyme or a protein or a nucleic acid which does not occur in nature.
- exogenous DNA can encode one of the following: Factor VIII, Factor IX, erythropoietin, alpha-1 antitrypsin, calcitonin, glucocerebrosidase, growth hormone, low density lipoprotein (LDL) receptor, apolipoprotein E, IL-2 receptor and its antagonists.
- LDL low density lipoprotein
- Such a construct is also useful to integrate exogenous DNA which is a therapeutic product, such as DNA sequences sufficient for sequestration of a protein or nucleic acid in the transfected primary or secondary cell, DNA sequences which bind to a cellular regulatory protein, DNA sequences which alter the secondary or tertiary chromosomal structure and DNA sequences which are transcriptional regulatory elements into genomic DNA of primary or secondary cells.
- exogenous DNA which is a therapeutic product, such as DNA sequences sufficient for sequestration of a protein or nucleic acid in the transfected primary or secondary cell, DNA sequences which bind to a cellular regulatory protein, DNA sequences which alter the secondary or tertiary chromosomal structure and DNA sequences which are transcriptional regulatory elements into genomic DNA of primary or secondary cells.
- the DNA construct includes exogenous DNA, targeting DNA sequences and DNA encoding at least one selectable marker.
- the order of construct components can be: targeting sequences-exogenous DNA-DNA encoding a selectable marker(s)-targeting sequences.
- one or more selectable markers are included in the construct, which makes selection based on a selectable phenotype possible. Cells that stably integrate the construct will survive treatment with the selective agent; a subset of the stably transfected cells will be HR cells, which can be identified by a variety of techniques, including PCR, Southern hybridization and phenotypic screening.
- the order of components in the DNA construct can be: targeting sequence-selectable marker 1 - targeting sequence - selectable marker 2.
- selectable marker 2 displays the property negative selection. That is, the gene product of selectable marker 2 can be selected against by growth in an appropriate media formulation containing an agent (typically a drug or metabolite analog) which kills cells expressing selectable marker 2. Recombination between the targeting sequences flanking selectable marker 1 with homologous sequences in the host cell genome results in the targeted integration of selectable marker 1, while selectable marker 2 is not integrated.
- Such recombination events generate cells which are stably transfected with selectable marker 1 but not stably transfected with selectable marker 2, and such cells can be selected for by growth in the media containing the selective agent which selects for selectable marker 1 and the selective agent which selects against selectable marker 2.
- exogenous DNA can encode one or more products, can be one or more therapeutic products or one or more of each, thus making it possible to deliver multiple products.
- vertebrate tissue is first obtained; this is carried out using known procedures, such as punch biopsy or other surgical methods of obtaining a tissue source of the primary cell type of interest.
- punch biopsy is used to obtain skin as a source of fibroblasts or keratinocytes.
- a mixture of primary cells is obtained from the tissue, using known methods, such as enzymatic digestion or explanting. If enzymatic digestion is used, enzymes such as collagena ⁇ e, hyaluronidase, dispase, pronase, trypsin, elastase and chymotrypsin can be used.
- the resulting primary cell mixture can be transfected directly or it can be cultured first, removed from the culture plate and resuspended before transfection is carried out.
- Primary cells or secondary cells are combined with exogenous DNA to be stably integrated into their genomes and, optionally, DNA encoding a selectable marker, and treated in order to accomplish transfection.
- the exogenous DNA and selectable marker-encoding DNA are each on a separate construct (e.g., pXGH5 and pcDNEO, see Figures 1 and 2) or on a single construct (e.g., pXGH301 and pE3neoEPO, see Figure 3 and Figure 6) .
- An appropriate quantity of DNA is used to ensure that at least one stably transfected cell containing and appropriately expressing exogenous DNA is produced. In general, 0.1 to 500 ⁇ g DNA is used.
- Example 5 Using the present methods to introduce only a selectable marker gene, between 170 (1 in 588 starting cells treated by electroporation, Example 6) and 2000 (1 in 49 starting cells treated by microinjection. Example 5) stably transfected cells are generated per 100,000 starting cells. Using the present methods to introduce a therapeutic gene as well as a selectable marker gene, between 7 (1 in 14,705 starting cells treated by electroporation. Example 6) and 950 (1 in 105 starting cells treated by microinjection. Example 5) stably transfected cells are generated per 100,000 starting cells. Of these stable transfeetants, from 43 to 90% express the gene of therapeutic interest. Since only a single appropriately expressing cell is required, it is clearly possible to use substantially fewer starting cells. Conversely, using transfection techniques which are substantially less efficient than the present methods, it would not be possible to obtain even a single such cell unless large amount of the individual's tissue is used as the source of starting cells.
- transfection is effected by electroporation, as described in the Examples. Electroporation is carried out at appropriate voltage and capacitance (and corresponding time constant) to result in entry of the DNA construct(s) into the primary or secondary cells. Electroporation can be carried out over a wide range of voltages (e.g., 50 to 2000 volts) and corresponding capacitance. As described herein, electroporation is very efficient if carried out at an electroporation voltage in the range of 250-300 volts and a capacitance of 960 ⁇ Farads. Total DNA of approximately 0.1 to 500 ⁇ g is generally used.
- primary or secondary cells are transfected using microinjection. See, for example, Example 5.
- known methods such as calcium phosphate precipitation, modified calcium phosphate precipitation and polybrene precipitation, liposome fusion and receptor-mediated gene delivery can be used to transfect cells.
- a stably transfected cell is isolated and cultured and subcultivated, under culturing conditions and for sufficient time, to propagate the stably transfected secondary cells and produce a clonal cell strain of transfected secondary cells.
- more than one transfected cell is cultured and subcultured, resulting in production of a heterogenous cell strain.
- Transfected primary or secondary cells undergo a sufficient number of doublings to produce either a clonal cell strain or a heterogenous cell strain of sufficient size to provide the therapeutic product (e.g. , EPO) to an individual in effective amounts.
- a clonal cell strain or a heterogenous cell strain of sufficient size to provide the therapeutic product (e.g. , EPO) to an individual in effective amounts.
- EPO therapeutic product
- 0.1 cm 2 of skin is biopsied and assumed to contain 100,000 cells; one cell is used to produce a clonal cell strain and undergoes approximately 27 doublings to produce 100 million transfected secondary cells. If a heterogenous cell strain is to be produced from an original transfected population of approximately 100,000 cells, only 10 doublings are needed to produce 100 million transfected cells.
- the number of required cells in a transfected clonal or heterogenous cell strain is variable and depends on a variety of factors, which include but are not limited to, the use of the transfected cells, the functional level of the exogenous DNA in the transfected cells, the site of implantation of the transfected cells (for example, the number of cells that can be used is limited by the anatomical site of implantation) , and the age, surface area, and clinical condition of the patient.
- the site of implantation of the transfected cells for example, the number of cells that can be used is limited by the anatomical site of implantation
- the age, surface area, and clinical condition of the patient To put these factors in perspective, to deliver therapeutic levels of human growth hormone in an otherwise healthy 60 kg patient with isolated growth hormone deficiency, approximately one to five hundred million transfected fibroblasts would be necessary. This represents approximately the volume of cells prosent on the very tip of the patient's thumb.
- episomes DNA sequences that are present within the cell yet do not integrate into the genome are referred to as episomes.
- Recombinant episomes may be useful in at least three settings: 1) if a given cell type is incapable of stably integrating the exogenous DNA; 2) if a given cell type is adversely affected by the integration of DNA; and 3) if a given cell type is capable of improved therapeutic function with an episomal rather than integrated DNA.
- exogenous DNA in the form of episomes can be introduced into vertebrate primary and secondary cells.
- Plasmid pXGH301 can be converted into such an episome by the addition DNA sequences for the Epstein-Barr virus origin of replication and nuclear antigen [Yates, J.L. Nature 319:780-7883 (1985)].
- vertebrate autonomously replicating sequences can be introduced into the construct (Weidle, U.H. Gene 73 (2) :427-437 (1988).
- These and other episomally derived sequences can also be included in DNA constructs without selectable markers, such as pXGH5.
- the episomal exogenous DNA is then introduced into primary or secondary vertebrate cells as described in this application (if a selective marker is included in the episome a selective agent is used to treat the transfected cells) .
- the transfected cells produced by the methods described above and in the Examples that follow, are introduced into an individual to whom the therapeutic product is to be delivered, using known methods.
- the clonal cell strain or heterogenous cell strain is then introduced into an individual, using known methods, using various routes of administration and at various sites (e.g., renal subcapsular, subcutaneous, central nervous system (including intrathecal) , intravascular, intrahepatic, intrasplanchnic, intraperitoneal (including intraomental) , or intramuscular implantation) .
- the transfected cells produce the therapeutic product encoded by the exogenous DNA or are affected by the exogenous DNA itself.
- an individual who has been diagnosed with Hemophilia B a bleeding disorder that is caused by a deficiency in Factor IX, a protein normally found in the blood, is a candidate for a gene therapy cure.
- the patient has a small skin biopsy performed; this is a simple procedure which can be performed on an out-patient basis.
- the piece of skin approximately the size of a matchhead, is taken, for example, from under the arm and requires about one minute to remove.
- the sample is processed, resulting in isolation of the patient's cells (in this case, fibroblasts) and genetically engineered to produce the missing Factor IX. Based on the age, weight, and clinical condition of the patient, the required number of cells are grown in large-scale culture.
- the entire process usually requires 4-6 weeks and, at the end of that time, the appropriate number of genetically-engineered cells are introduced into the individual, once again as an out-patient (e.g., by injecting them back under the patient's skin) .
- the patient is now capable of producing his or her own Factor IX and is-no longer a hemophiliac.
- a similar approach can be used to treat other conditions or diseases.
- short stature can be treated by administering human growth hormone to an individual by implanting primary or secondary cells which express human growth hormone, or anemia can be treated by implanting primary or secondary cells which express EPO.
- transfected cells produced as described above, which contain insulinotropin-encoding DNA are delivered into an individual in whom insulin production, secretion, function and/or sensitivity is compromised. They are introduced into the individual by known methods and at various sites of administration (e.g., renal, subcapsular, subcutaneous, central nervous system (including intrathecal) , intra- vascular, intrahepatic, intrasplanchnic, intraperitoneal (including intraomental) or intramuscular implantation) . Once implanted in the individual, the transfectedcells produce insulinotropin encoded by the exogenous DNA.
- sites of administration e.g., renal, subcapsular, subcutaneous, central nervous system (including intrathecal) , intra- vascular, intrahepatic, intrasplanchnic, intraperitoneal (including intraomental) or intramuscular implantation
- an individual in whom insulin production, secretion or sensitivity is impaired can receive therapy or preventive treatment through the implantation of transfected cells expressing exogenous DNA encoding insulinotropin produced as described herein.
- the cells to be genetically engineered are obtained as described above, processed in a similar manner to produce sufficient numbers of cells, and introduced back into the individual.
- the cells used will generally be patient-specific genetically-engineered cells. It is possible, however, to obtain cells from another individual of the same species or from a different species. Use of such cells might require administration of an immunosuppressant, alteration of histocompatibility antigens, or use of a barrier device to prevent rejection of the implanted cells.
- a barrier device is used to prevent rejection of implanted cells obtained from a source other than the recipient (e.g., from another human or from a non-human mammal such as a cow, dog, pig, goat, sheep or rodent) .
- transfected cells of the present invention are placed within the barrier device, which is made of a material (e.g., a membrane such as Amicon XM-50) which permits the product encoded by the exogenous DNA to pass into the recipient's circulation or tissues but prevents contact between the cells and the recipient's immune system and thus prevents an immune resonse to (and possible rejection of) the cells by the recipient.
- a material e.g., a membrane such as Amicon XM-50
- DNA encoding hGH, EPO or insulinotropin can be introduced into an individual by direct injection, such as into muscle or other appropriate site.
- the DNA construct includes exogenous DNA encoding the therapeutic product (e.g., EPO, insulinotropin) and sufficient regulatory sequences for expression of the exogenous DNA in recipient cells. After injection into the individual, the DNA construct is taken up by some of the recipient cells.
- the DNA can be injected alone or in a formulation which includes a physiologially compatible carrier (e.g., a physiological buffer) and, optionally, other components, such as agents which allow more efficient entry of the DNA construct into cells, stabilize the DNA or protect the DNA from degradation.
- a physiologially compatible carrier e.g., a physiological buffer
- other components such as agents which allow more efficient entry of the DNA construct into cells, stabilize the DNA or protect the DNA from degradation.
- Transfected primary or secondary cells or cell strains as described herein have wide applicability as a vehicle or delivery system for therapeutic products, such as enzymes, hormones, cytokines, antigens, antibodies, clotting factors, anti-sense RNA, regulatory proteins, transcription proteins, receptors, structural proteins, ribozymes, novel (non-naturally occurring) proteins and nucleic acid products, and engineered DNA.
- therapeutic products such as enzymes, hormones, cytokines, antigens, antibodies, clotting factors, anti-sense RNA, regulatory proteins, transcription proteins, receptors, structural proteins, ribozymes, novel (non-naturally occurring) proteins and nucleic acid products, and engineered DNA.
- transfected primary or secondary cells can be used to supply a therapeutic protein, including, but not limited to, Factor VIII, Factor IX, erythropoietin, alpha-1 antitrypsin, calcitonin, glucocerebrosidase, growth hormone, low density lipoprotein (LDL) , apolipoprotein E, receptor IL-2 receptor and its antagonists, insulin, globin, immunoglobulins, catalytic antibodies, the interleukins, insulin-like growth factors, superoxide dismutase, immune responder modifiers, parathyroid hormone and interferon, nerve growth factors, tissue plasminogen activators, and colony stimulating factors.
- a therapeutic protein including, but not limited to, Factor VIII, Factor IX, erythropoietin, alpha-1 antitrypsin, calcitonin, glucocerebrosidase, growth hormone, low density lipoprotein (LDL) , apolipoprotein E, receptor
- transfected primary and secondary cells can be used to immunize an individual (i.e., as a vaccine).
- a vaccine i.e., as a vaccine.
- the wide variety of uses of cell strains of the present invention can perhaps most conveniently be summarized as shown below.
- the cell strains can be used to deliver the following therapeutic products.
- transfected primary or secondary cells of the present invention can be used to administer therapeutic proteins (e.g., hormones, enzymes, clotting factors) which are presently administered intravenously, intra-muscularly or subcutaneou ⁇ ly, which require patient cooperation and, often, medical staff participation.
- therapeutic proteins e.g., hormones, enzymes, clotting factors
- transfected primary or secondary cells there is no need for extensive purification of the polypeptide before it is administered to an individual, as is generally necessary with an isolated polypeptide.
- transfected primary or secondary cells of the present invention produce the therapeutic product as it would normally be produced.
- transfected primary or secondary cells of the present invention is that by controlling the number of cells introduced into an individual, one can control the amount of the product delivered to the body. In addition, in some cases, it is possible to remove the transfected cells if there is no longer a need for the product.
- a further advantage of treatment by use of transfected primary or secondary cells of the present invention is that production of the therapeutic product can be regulated, such as through the administration of zinc, steroids or an agent which affects translation or transcription of a protein, product or nucleic acid product or affects the stability of a nucleic acid product.
- GLP-1 derivatives include truncated derivatives GLP-l(7-37), GLP-l(7-36), GLP-1(7- 35) GLP-l(7-34) and other truncated carboxy-terminal amidated derivatives and derivatives of GLP-1 which have amino acid substitutions, deletions, additions or other alterations (e.g., addition of a non-amino acid component) which result in biological activity or stability in the blood which is substantially the same as that of a truncated GLP-1 derivative or enhanced biological activity or stability in the blood (greater than that of a truncated GLP-1 derivative) .
- GLP-1 derivative includes all of the above-described molecules.
- GLP-1 related peptide includes GLP-1 and GLP-1 derivatives.
- GLP-1 derivatives also known as insulinotropins or incretins, are normally secreted into the circulation by cells in the gastrointestinal tract. £n vivo studies have demonstrated that these peptides function to stimulate insulin secretion and inhibit glucagon secretion from the endocrine pancreas, as well as increase insulin sensitivity in peripheral tissues [Goke, R. et a_l. (1991) Eur. J. Clin. Inv. 2_1:135-144; Gutnia M. et a_l. (1992) New Engl. J.
- NIDDM non- insulin dependent diabetes mellitus
- gene targeting can be used to replace a gene's existing regulatory region with a regulatory sequence isolated from a different gene or a novel regulatory sequence synthesized by genetic engineering methods.
- regulatory sequences may be comprised of promoters, enhancers, Scaffold-attachment regions, negative regulatory elements, transcriptional initiation sites, regulatory protein binding sites or combinations of said sequences.
- sequences which affect the structure or stability of the RNA or protein produced may be replaced, removed, added, or otherwise modified by targeting, including polyadenylation signals, mRNA stability elements, splice sites, leader sequences for enhancing or modifying transport or secretion properties of the protein, or other sequences which alter or improve the function or stability of protein or RNA molecules.
- the targeting event may be a simple insertion of the regulatory sequence, placing the gene under the control of the new regulatory sequence (for example, inserting a new promoter or enhancer or both upstream of a gene) .
- the targeting event may be a simple deletion of a regulatory element, such as the deletion of a tissue-specific negative regulatory element.
- the targeting event may replace an existing element; for example, a tissue-specific enhancer can be replaced by an enhancer that has broader or different cell-type specificity than the naturally-occurring elements. In this embodiment the naturally occurring sequences are deleted and new sequences are added.
- the identification of the targeting event may be facilitated by the use of one or more selectable marker genes that are contiguous with the targeting DNA, allowing for the selection of cells in which the exogenous DNA has integrated into the host cell genome.
- the identification of the targeting event may also be facilitated by the use of one or more marker genes exhibiting the property of negative selection, such that the negatively selectable marker is linked to the exogenous DNA, but configured such that the negatively selectable marker flanks the targeting sequence, and such that a correct homologous recombination event with sequences in the host cell genome does not result in the stable integration of the negatively selectable marker.
- Markers useful for this purpose include the Herpes Simplex Virus thymidine kinase (TK) gene or the bacterial xanthine-guanine phosphoribosyl- transferase (gpt) gene.
- EXAMPLE 1 ISOLATION OF FIBROBLASTS a. Source of Fibroblasts
- Human fibroblasts can be obtained from a variety of tissues, including biopsy specimens derived from liver, kidney, lung and skin. The procedures presented here are optimized for the isolation of skin fibroblasts, which are readily obtained from individuals of any age with minimal discomfort and risk (embryonic and fetal fibroblasts may be isolated using this protocol as well) . Minor modifica- tions to the protocol can be made if the isolation of fibroblasts from other tissues is desired.
- Human skin is obtained following circumcision or punch biopsy.
- the specimen consists of three major components: the epidermal and dermal layers of the skin itself, and a fascial layer that adheres to the dermal layer.
- Fibroblasts can be isolated from either the dermal or fascial layers.
- tissue Approximately 3 cm 2 tissue is placed into approximately 10 ml of wash solution (Hank's Balanced Salt Solution containing 100 units/ml penicillin G, 1O0 ⁇ g/ml streptomycin sulfate, and 0.5 ⁇ g/ml Fungisone) and subjected to gentle agitation for a total of three 10-minute washes at room temperature. The tissue is then transferred to a 100 mm tissue culture dish containing 10 ml digestion solution (wash solution containing 0.1 units/ml collagenase A, 2.4 units/ml grade II Dispase) .
- wash solution Hank's Balanced Salt Solution containing 100 units/ml penicillin G, 1O0 ⁇ g/ml streptomycin sulfate, and 0.5 ⁇ g/ml Fungisone
- the skin is adjusted such that the epidermis is facing down.
- the fascial tissue is separated from the dermal and epidermal tissue by blunt dissection.
- the fascial tissue is then cut into small fragments (less than 1 mm) and incubated on a rotating platform for 30 min at 37°C.
- the enzyme/cell suspension is removed and saved, an additional 10 cc of digestion solution is added to the remaining fragments of tissue, and the tissue is reincubated for 30 min at 37°C.
- the enzyme/cell suspensions are pooled, passed through a 15-gauge needle several times, and passed through a Cellector Sieve (Sigma) fitted with a 150-mesh screen.
- the cell suspension is centrifuged at 1100 rpm for 15 min at room temperature.
- the supernatant is aspirated and the disaggregated cells resuspended in 10 ml of nutrient medium (see below) .
- Fibroblast cultures are initiated on tissue culture treated flasks (Corning) at a density of approximately 40,000 cells/cm 2 .
- Fascia is removed from skin biopsy or circumcision specimen as described above and the skin is cut into small fragments less than 0.5 cm 2 .
- the tissue is incubated with 0.25% trypsin for 60 min at 37°C (alternatively, the tissue can be incubated in trypsin for 18 hrs at 4°C). Under the dissecting microscope, the dermis and epidermis are separated. Dermal fibroblasts are then isolated as described above for fascial fibroblasts.
- the procedure is essentially as described above. Skin should be removed from areas that have been shaved and washed with a germicidal solution surgically prepared using accepted procedures.
- EXAMPLE 2 CULTURING OF FIBROBLASTS a. Culturing of Human Fibroblasts When confluent, the primary culture is trypsinized using standard methods and seeded at approximately 10,000 cells/cm 2 . The cells are cultured at 37°C in humidified air containing 5% C0 2 . Human fibrobla ⁇ t nutrient medium (containing DMEM, high glucose with sodium pyruvate, 10-15% calf serum, 20 mM HEPES, 20 mM L-glutamine, 50 units/ml penicillin G, and 10 ⁇ g/ml streptomycin sulfate) is changed twice weekly.
- DMEM high glucose with sodium pyruvate
- 10-15% calf serum 20 mM HEPES
- 20 mM L-glutamine 50 units/ml penicillin G
- 10 ⁇ g/ml streptomycin sulfate is changed twice weekly.
- Rabbit fibroblast nutrient medium consists of a 1:1 solution of MCDB-110 (Sigma) with 20% calf serum and conditioned medium.
- Conditioned medium is essentially human fibroblast nutrient medium (with 15% calf serum) removed from rabbit fibroblasts grown in mass culture for 2-3 days.
- EXAMPLE 3 CONSTRUCTION OF A PLASMID (PXGH301 CONTAIN ⁇ ING BOTH THE HUMAN GROWTH HORMONE AND NEOMYCIN RESISTANCE GENES pXGH301 was constructed by a two-step procedure.
- the Sall-Clal fragment from pBR322 (positions 23-651 in pBR322) was isolated and inserted into Sall-Clal digested pcD NEO, introducing a BamHI site upstream of the SV40 early promoter region of pcDNEO.
- This plasmid, pBNEO was digested with BamHI, and the 2.1 kb fragment containing the neo gene under the control of the SV40 early promoter, was isolated and inserted into BamHI digested pXGH5.
- a plasmid with a single insertion of the 2.1 kb BamHI fragment was isolated in which neo and hGH are transcribed in the same direction relative to each other.
- This plasmid was designated pXGH301 ( Figure 3) .
- EXAMPLE 4 CONSTRUCTION OF A PLASMID r EPOl ⁇ CONTAINING THE HUMAN ERYTHROPOIETIN GENE UNDER THE CONTROL OF THE MOUSE METALLOTHIONEIN PROMOTER
- the expression plasmid pXEPOl has the hEPO gene under the transcriptional control of the mouse metallothionein (mMT) promoter.
- pXEPOl is constructed as follows: Plasmid pUC19 (ATCC #37254) is digested with Kpnl and BamHI and ligated to a 0.7 kb Kpnl-Bglll fragment containing the mouse metallothionein promoter [Hamer, D.H. and Walling, M. , J. Mol.
- This fragment can also be isolated by known methods from mouse genomic DNA using PCR primers designed from analysis of mMT sequences available from Genbank; i.e. MUSMTI, MUSMTIP, MUSMTIPRM] .
- the resulting clone is designated pXQM2.
- the hEPO gene was isolated by from a bacteriophage lambda clone containing the entire hEPO gene. This bacteriophage was isolated by screening a human Sau3A— partial genomic DNA library (Stratagene) constructed in the lambda vector LAMBDA DASH with 0.77 kb fragment of the human gene. This 0.77 kb fragment was amplified from human genomic DNA using the primers shown below in the polymerase chain reaction (PCR) .
- PCR polymerase chain reaction
- Oligo hEPO-1 5'GTTTGCTCAGCTTGGTGCTTG (SEQ ID NO 1)
- Oligo hEPO-2 5'TCAAGTTGGCCCTGTGACAT (SEQ ID NO 2) (positions 2986-2967 in the Genbank HUMERPA sequence)
- the amplified fragment encompassing exons 4 and 5 of the human EPO gene, was radiolabelled and used to screen the human genomic DNA library. Phage with a 5.4 kb Hindlll-BamHI fragment containing the entire human EPO gene were assumed to contain the entire gene, based on published DNA sequence and restriction enzyme mapping data [Lin, F-K. , et al., Proc. Natl. Acad. Sci. USA. 82:7580-7584 (1985)].
- BstEII site is at position 580 in Genbank HUMERPA sequence; the BamHI site is 4.8 kb 3' of this site, outside of the sequenced region
- the purified fragment is made blunt-ended by treatment with the Klenow fragment of E_j_ coli DNA polymerase and ligated to Hindi digested pXQM2, which cuts in the pUC19-derived polylinker adjacent to the 3' side of the subcloned mMT promoter.
- FIBROBLASTS BY MICROINJECTION Direct injection of DNA into cell nuclei is another method for stably transfecting cells.
- the ability of primary and secondary human foreskin fibroblasts to be stably transfected by this method has not been previously reported.
- the 8 kb Hindlll fragment from plasmid RV6.9h (Zheng, H. et al. , Proc. Natl. Acad. Sci. USA 88:18 8067- 8071 (1991)) was purified by gel electrophoresis and passage through an anion exchange column (QIAGEN Inc.). DNA at (10 ⁇ g/ml) was injected into primary or secondary human foreskin fibroblasts using 0.1 ⁇ m outer diameter glass needles.
- G418 r clones were isolated after injection of 2,000 cells (1 in 49 starting cells). hGH expressing clones were also generated by micro ⁇ injection. Plasmid pXGH301 was linearized by Seal digestion (which cuts once within the amp r gene in the P UC12 backbone) , purified by passage through an anion exchange column (QIAGEN Inc.), and injected into secondary human foreskin fibroblasts using 0.1 ⁇ m outer diameter glass needles. Several DNA concentrations were used, ranging from 2.5-20 ⁇ g pXGH301/ml. Twenty G418 resistant clones were isolated after microinjection into 2,100 cells (1 in 105 starting cells) . The fraction of G418 cells, is approximately 1% of all cells treated.
- Exponentially growing or early stationary phase fibroblasts are trypsinized and rinsed from the plastic surface with nutrient medium. An aliquot of the cell suspension is removed for counting, and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is resuspended in 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KC1, 0.7 mM Na2HP04, 6 mM dextrose). The cells are recentrifuged, the supernatant aspirated, and the cells resuspended in electroporation buffer containing 1 mg/ml acetylated bovine serum albumin. The final cell suspension contains approximately 3 x 10 6 cells/ml. Electroporation should be performed immediately following resuspension.
- Supercoiled plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap (Bio-Rad) .
- the final DNA concentration is generally at least 120 ⁇ g/ml.
- 0.5 ml of the cell suspension (containing approximately 1.5 x 10 6 cells) is then added to the cuvette, and the cell suspension and DNA solutions are gently mixed.
- Electro ⁇ poration is performed with a Gene-Pulser apparatus (Bio-Rad) . Capacitance and voltage are set at 960 ⁇ F and 250-300 V, respectively. As voltage increases, cell survival decreases, but the percentage of surviving cells that stably incorporate the introduced DNA into their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 msec should be observed.
- Electroporated cells are maintained at room temper ⁇ ature for approximately 5 min, and the contents of the cuvette are then gently removed with a sterile transfer pipette.
- the cells are added directly to 10 ml of prewarmed nutrient media (as above with 15% calf serum) in a 10 cm dish and incubated as described above. The following day, the media is aspirated and replaced with 10 ml of fresh media and incubated for a further 16-24 hrs. Subculture of cells to determine cloning efficiency and to select for G418-resistant colonies is performed the following day.
- fibroblasts are trypsinized, counted and plated; typically, fibroblasts are plated at 10 3 cells/10 cm dish for the determination of cloning efficiency and at 1-2 x 10 4 cells/10 cm dish for G418 selection.
- Human fibroblasts are selected for G418 resistance in medium consisting of 300-400 ⁇ g/ml G418 (Geneticin, disulfate salt with a potency of approximately 50%; Gibco) in fibroblasts nutrient media (with 15% calf serum) . Cloning efficiency is determined in the absence of G 18.
- the plated cells are incubated for 12-14 days, at which time colonies are fixed with formalin, stained with crystal violet and counted (for cloning efficiency plates) or isolated using cloning cylinders (for G418 plates) . Electroporation and selection of rabbit fibroblasts is performed essentially as described for human fibroblasts, with the exception of the selection conditions used. Rabbit fibroblasts are selected for G418 resistance in medium containing 1 g /ml G418.
- Fibroblasts were isolated from freshly excised human foreskins. Cultures were seeded at 50,000 cells/cm in DMEM + 10% calf serum. When cultures became confluent fibroblasts were harvested by trypsinization and trans ⁇ fected by electroporation. Electroporation conditions were evaluated by transfection with the plasmid pcDNEO. A representative electroporation experiment using near optimal conditions (60 ⁇ g of plasmid pcDNEO at an electroporation voltage of 250 volts and a capacitance setting of 960 ⁇ Farads) resulted in one G418 coloney per 588 treated cells (0.17% of all cells treated), or one G418 colony per 71 clonable cells (1.4%).
- Stable transfectants also have been generated by electroporation of primary or secondary human fibroblasts with pXGH30l, a DNA construct in which the neo and hGH genes are present on the same plasmid molecule (Example 3).
- pXGH30l a DNA construct in which the neo and hGH genes are present on the same plasmid molecule
- 1.5 x 10 6 cells were electroporated with 60 ⁇ g pXGH301 at 300 volts and 960 ⁇ Farads.
- G418 resistant colonies were isolated from transfected secondary fibroblasts at a frequency of 652 G418 resistant colonies per 1.5 x 10 treated cells (1 per 2299 treated cells) . Approximately 59% of these colonies express hGH.
- EXAMPLE 7 ISOLATION OF TRANSFECTANTS IN THE ABSENCE OF SELECTION Stable transfection of primary fibroblasts with the plasmid pXGH5 renders recipient fibroblasts capable of secreting human growth hormone (hGH) into the surrounding medium. Therefore, a radioimmunoassay for hGH (or for any expressed protein) can be used as a simple and rapid screen for transfectants as an alternative to the use of selective markers and selective agents. In addition, it should be possible to determine the true frequency of stable integration of exogenous DNA using a screening method such as PCR which does not necessarily rely on gene expression.
- a screening method such as PCR which does not necessarily rely on gene expression.
- Human Foreskin Tissue Approximately 2.0 x 10 6 human cells that were freshly dissociated from tissue were electroporated with 60 ⁇ g of pXGH5 at 300 volts, 960 ⁇ Farads. The cells were plated immediately in a 100 mm tissue culture dish containing 10 ml of prewarmed medium and incubated at 37°C in a humidified 5% C0 2 atmosphere. Two days following transfection, 5 x 10 3 cells were subcultured into a 24 well cloning plate (Bellco Glass Co.). Each well of the 24 well plate contained 16 smaller wells (384 wells/ plate) . Eight days later 10 of 24 large wells were screened for hGH expression via radioimmune assay.
- the above experiment was repeated using another primary human foreskin fibroblast culture. From this experiment a second clone expressing hGH was isolated. After 24 mpd in culture these cells, HF24-GH1, were producing 60 ng hGH/10 cells/24 hr. hGH production continued until the cells reached 45 mpd, at which point the cells were frozen away. The lower limit transfection frequency was similar to the first experiment (6-7% of clonable cells) .
- SKIN FIBROBLASTS Fibroblasts were isolated from freshly excised human skin fibroblasts and cultured in DMEM + 10% calf serum. Electroporation (250 volts, 960 ⁇ Farads) with 60 ⁇ g of an equimolar mixture of pcDNEO and pXGH5 was performed and treated cells were selected in G418-containing medium (300 ⁇ g/ml G418) . Colonies were isolated and expanded using standard methods, and the resulting primary cell strains were subcultured repeatedly in order to monitor the stability of hGH expression as a function of time in culture. Data derived from two such strains, HF96-11 and HF96-23, are shown in Figure 9.
- hGH levels (expressed as ⁇ g hGH/10 6 cells/24 hr) were plotted for various culture passage numbers from 9 to 28 passages.
- results of these assays show that hGH expression remains remarkably constant throughout this extended in vitro culture interval (for example, data derived from two different strains show that HF96-11 at passage 28 reached 69 mpd, while HF96-23 at passage 27 reached 76 mpd) .
- RF40/1-3 Data derived from one such strain, RF40/1-3 are shown in Figure 10.
- RF40/1-3 cells were maintained in the absence of selection in rabbit fibroblast nutrient medium and subcultured at a seeding density of 10,000 cells/cm 2 .
- Culture medium was changed 24 hr prior to harvesting the cells for passaging.
- an aliquot of the culture medium was removed for hGH assay and the cells were then harvested, counted, and reseeded.
- hGH concentration in the medium was determined using a commercially available immunoassay.
- hGH levels (expressed as ⁇ g hGH/10 6 cells/24 hr) are plotted for culture passage numbers, 4, 8, 10, 13, 16, 19, and 22, corresponding to culture mean population doubling (mpd) levels of approximately 28 through 84.
- the results of these assays demonstrate that hGH expression remains remarkably constant throughout this extended in vitro culture interval and virtually identical to the levels observed at approximately 20 mpd in culture (47 ⁇ g hGH/10 6 cells/24 hr) .
- EXAMPLE 10 LONG-TERM EXPRESSION OF HUMAN GROWTH HORMONE IN MICE
- the nude mouse provides a valuable system to study implants of genetically engineered cells for their ability to deliver therapeutically useful proteins to an animal's general circulation. The relative immune-incompetence of these animals may allow certain primary and secondary rabbit fibroblasts to survive in vivo for extended periods.
- mice are given intraperitoneal injection of Avertin (a solution of 2% w/v 2.2.2 tribromoethanol and 2% v/v 2-methyl, 2-butanol.) at a dose of 0.017 ml/g body weight.
- Avertin a solution of 2% w/v 2.2.2 tribromoethanol and 2% v/v 2-methyl, 2-butanol.
- the kidney generally the left kidney
- the skin, abdominal musculature, perito ⁇ neum, and perirenal fascia are retracted to expose the kidney.
- a small forcep is used to pull the kidney out of the abdominal cavity.
- a 27-gauge hypodermic needle is used to make a small opening in the renal capsule. Using a 20-gauge I.V.
- cells to be implanted typically 3 million cells in a volume of 5-10 ⁇ l
- cells to be implanted typically 3 million cells in a volume of 5-10 ⁇ l
- Care is taken to ensure that the cells are released distal to the opening in the renal capsule.
- the incision is closed with one staple through the musculature and the skin.
- Blood is collected after placing the mouse in a large beaker containing methoxyflurane until light anesthesia is achieved.
- the tip of a Pasteur pipette is placed between the eye and the periorbital space to collect blood from the orbital sinus.
- Serum hGH levels are determined using a commercially available kit (Nichol's Institute) .
- a nude mouse was implanted with 5 million transfected rabbit fibroblast cells (strain RF20-11) . This mouse has displayed detectable hGH in its serum for one year. The time course of expression is shown below.
- Serum hGH (ng/ml): 0.7 0.7 0.8 0.6 0.7 0.6
- EXAMPLE 11 RECULTURING hGH PRODUCING CELLS FROM SUBRENAL CAPSULE IMPLANTS
- RF40/1-3 cells (3 x 10 6 cells per mouse) expressing 24.5 ⁇ g hGH/10 6 cells/24 hr were implanted under the subrenal capsule of nude mice. These cells had undergone 49 mpd in culture prior to implantation. After either 5 or 10 weeks in vivo, the animals were sacrificed, kidneys were harvested, and cells in the vicinity of the implant (clearly visible on the surface of the kidney) were microdissected out.
- the resulting tissue was subjected to a scaled-down version of a standard enzymatic cell dispersion protocol (Example 6) , and the single cell suspension was placed in G418-containing medium.
- Cell culture data was obtained from 5 recultured implants from mice having 5-week-old implants, and 4 recultured implants from mice having 10-week-old implants.
- the recovered cells were propagated for 19 mpd in culture and the hGH levels were analyzed at various times after placing in culture, ranging from about 10 to about 50 days in culture. Results from these experiments are shown in Figure 12. Each point in Figure 12 represents the average (with standard deviation) of at least four separate recovery experiments.
- G418 r cells expressing high levels of hGH were recovered, with hGH expression being relatively stable over the 19 in vitro population doublings post-recovery.
- the rabbit is anesthetized with an intramuscular injection of Ketamine- HC1 (50 mg/kg body weight) and Xylazine-HCl (5 mg/kg body weight) until sedation is achieved.
- the animal is shaved in the area, for example, above the right pelvic joint and prepped for surgery using accepted procedures.
- Two arc-shaped incisions are made approximately 3 cm apart which are joined at the dorsal and ventral areas to form an oval-shaped patch.
- a serrated forcep is used to remove the epidermis and a small scissor is used to remove the underlying fascia.
- the dermis and fascia are placed in culture medium and the incision is closed with a 3-0 nylon suture. Rabbits are placed on a heating pad for recovery. Fascial fibroblasts are cultured, transfected, and selected as described in Example 1, 2, and 4.
- the rabbits are anesthetized as described above.
- the animal is placed in a right side lateral recumbent position exposing the area below the left rib cage.
- the animal is shaved and prepped according to accepted procedures.
- the left kidney is approached through a 6 cm dorso-ventral incision approximately 2 cm below the twelfth rib.
- the incision is carried through the abdominal musculature, peritoneum, and peri-renal fat and fascia.
- a Balfour retractor is used to maintain the abdominal opening while dissection of peri-renal fat and fascia is performed.
- Using an 11-gauge surgical blade a 2-3 mm incision is made at the surface of the renal capsule.
- cells to be implanted typically 100-200 million cells in a volume of 165-660 ⁇ l
- cells to be implanted typically 100-200 million cells in a volume of 165-660 ⁇ l
- Care is taken to ensure that the cells are released distal to the opening in the renal capsule.
- the peritoneal cavity is closed by suturing the peritoneum and abdominal muscle with 3-0 adsorbable chromic gut
- the skin is closed with a 3-0 nylon suture and a sterile gauze bandage and antibiotic ointment (Bactrin) is applied to the wound. Rabbits are placed on a heating pad for recovery.
- Systemic antibiotics Tribrissin
- Fibroblasts were isolated from freshly excised human skin fibroblasts and cultured in DMEM + 15% calf serum. Electroporation (250 volts, 960 ⁇ Farads) with 60 ⁇ g of an equimolar mixture of pcDNEO and pXEPOl was performed on passage 1 cells and treated cells were selected in G418- containing medium (300 ⁇ g/ml G418) . Colonies were isolated and expanded using standard methods. Data derived from an analysis of fifty-six individual clones is shown in Table 2. Cells were maintained in G418 (300 ⁇ g/ml G418) in DMEM + 15% calf serum and subcultured at a seeding density of 10,000 cells/cm 2 .
- hEPO concentration in the medium was determined using a commercially available ELISA (R & D Systems) .
- hEPO levels are expressed as mU/10 6 cells/24 hr., and expression levels ranged from 69 to 55,591 mU/10 6 cells/24 hr. 19% of all G418-resistant colonies expressed detectable levels of hEPO.
- Clonally derived human fibroblasts isolated by co-transfection with pcDneo and pXEPOl were analyzed for the glycosylation state of secreted hEPO.
- Media was collected from hEPO producing cells and immunoprecipitated with a mouse monoclonal antibody (Genzyme Corporation) specific for human erythropoietin.
- the immunoprecipitated material was subject to electrophoresis on a 12.5% poly- acrylamide gel and transferred to a PVDF membrane
- Fibroblasts were isolated from freshly excised rabbit skin and cultured in DMEM 10% calf serum. Electroporation (250 volts, 960 ⁇ Farads) with 60 ⁇ g of an equimolar mixture of pcDNEO and pXEPOl was performed and treated cells were selected in G418-containing rabbit fibroblast growth medium (1 mg/ml G418; Example 2). Colonies were isolated and expanded using standard methods, and the resulting secondary cell strains were analyzed for hEPO expression. Data derived from forty-nine independent rabbit fibroblast clones is shown in Table 3. Expression levels in these clones ranged from 43 to 2,900,000 mU/10 6 cells/24 hr. , and 72% of all G418-resistant clones expressed detectable levels of hEPO.
- pE3Neo One orientation, with the direction of neo transcription opposite that of HPRT transcription was chosen and designated pE3Neo.
- pE3neo has a unique Xhol site at the junction of HPRT sequences and the 5' side of the neo gene.
- pE3neo is cut with Xhol and made blunt-ended by treatment with the Klenow fragment of Ej. coli DNA polymerase.
- a 5.1 kb EcoRI-Hindlll fragment was isolated from plasmid pXEPOl (Example 3; Figure 5).
- the EcoRI site is located adjacent to the 5' side of the mMT promoter, and the Hindlll site is located 5.1 kb away, 3' to the hEPO coding region.
- the purified Fragment is made blunt-ended by treatment with Klenow fragment of E_j_ coli DNA polymerase and ligated to the Xhol digested and blunt-ended pE3neo fragment described above. After transformation into E ⁇ . coli.
- a plasmid with one copy of the MT-hEPO fragment inserted into pE3neo was identified by restriction enzyme analysis in which the hEPO gene is transcribed in the same orientation as the adjacent neo gene. This plasmid was designated pE3neoEP0.
- this fragment may also be used in gene targeting to direct the integration of the hEPO gene to the human HPRT locus.
- MARKER fPE3neoEPO Fibroblasts were isolated from freshly excised human skin fibroblasts and cultured in DMEM + 15% calf serum. Electroporation (250 volts, 960 ⁇ Farads) with 60 ⁇ g of supercoiled pE3neoEP0 was performed on passage 1 cells and treated cells were selected in G418-containing medium (300 ⁇ g/ml G418) . Colonies were isolated and expanded using standard methods. Data derived from an analysis of twenty-six individual clones is shown in Table 4. Cells were maintained in G418 (300 ⁇ g/ml G418) in DMEM + 15% calf serum and subcultured at a seeding density of 10,000 cells/cm 2 .
- hEPO concentration in the medium was determined using a commercially available ELISA (R and D Systems) .
- hEPO levels are expressed as mU hEPO/10 6 cells/24 hr, and expression levels ranged from 240 to 961,620 mU/10 6 cells/24 hr. 89% of all G418-re ⁇ i ⁇ tant clone ⁇ expressed detectable levels of hEPO.
- hEPO expres ⁇ ing human fibroblast clones are also isolated by electroporation with 60 ⁇ g of Hindlll digested pE3neoEP0.
- hEPO expressing rabbit fibroblast clones are isolated using pla ⁇ mid pE3neoEPO under identical transfection conditions, with the exception that rabbit fibroblast clones are selected in rabbit fibroblast growth medium (Example 2) containing 1 mg/ml G418.
- EXAMPLE 16 EXPRESSION OF BIOLOGICALLY ACTIVE HUMAN ERYTHROPOIETIN IN MICE The mouse provides a valuable system to study implants of genetically engineered cells for their ability to deliver therapeutically useful proteins to an animal's general circulation. The relative immuneincompetence of nude mice allow xenogeneic implants to retain biologic function and may allow certain primary and secondary rabbit fibroblasts to survive in vivo for extended period .
- mice are given intraperitoneal injection of Avertin at a dose of 0.0175 ml/g body weight.
- the kidney generally the left kidney
- the skin, abdominal musculature, peritoneum, and peri-renal fascia are retracted to expose the kidney.
- a small forcep is used to pull the kidney out of the abdominal cavity.
- a 27-gauge hypodermic needle is used to make a small opening in the renal capsule. Using a 20-gauge I.V.
- cells to be implanted typically 3 million cells in a volume of 5-10 ⁇ l
- cells to be implanted typically 3 million cells in a volume of 5-10 ⁇ l
- Care is taken to ensure that the cells are released distal to the opening in the renal capsule.
- the incision is closed with one staple through the musculature and the skin.
- Blood is collected after placing the mouse in a large beaker containing methoxyflurane until light anesthesia is achieved.
- the tip of a Pasteur pipette is placed between the eye and the periorbital ⁇ pace to collect blood from the orbital sinus.
- Serum hEPO levels are determined using a commercially available kit (R and D Systems) .
- An aliquot of blood is also drawn into EDTA coated capillary tubes (Statspin, Norwood, MA) for determination of he atocrit levels.
- a clonal strain of rabbit skin fibroblasts was isolated by the methods described in Example 13.
- One clone, designated RF115-D4 was determined to be stably transfected with the human EPO gene and expressed approx ⁇ imately 786,000 mU hEPO/10 6 cells/24 hr.
- Three million cells were implanted into the subrenal capsule in each of 15 six nude mice. Approximately 400 ⁇ l of blood was drawn on days 1 and 7 after implantation and on every other day thereafter until day 21. During this time an equal volume of saline solution was injected after bleeding to prevent hypotonic shock. Blood was drawn weekly thereafter until day 63. An identical bleeding schedule was used on ten mice that had no cells implanted.
- Figure 13a shows the effect of these treatments on blood hematocrit (HCT) , a commonly u ⁇ ed indicator of red blood cell number, wa ⁇ measured in implanted and control animals.
- HCT blood hematocrit
- animals receiving implants of the hEPO expre ⁇ ing cells showed elevated HCT levels by day 7.
- hEPO immuno ⁇ reactive hEPO was readily detectable in the blood of implanted animals (the sensitivity of the hEPO ELISA has been determined to be 2 mU/ml by the kit's manufacturer (R and D Systems) and endogenous mouse EPO shows no cros ⁇ - reactivity with the antibodies u ⁇ ed in the ELISA kit) .
- hEPO levels in the implanted animals dropped gradually, from 29 to 9 mU/ml, from days 7 to 63 po ⁇ timplantation.
- GLP-lf7-37 EXPRESSION PLASMID
- the portion of GLP-1 from amino acid residues 7 to 37 [GLP-l(7-37) ; encoded by base pairs 7214 to 7306 in Genbank sequence HUMGLUCG2] has been demonstrated to .have insulinotropin activity in vivo.
- Plasmid pXGLPl is constructed such that the GLP-l(7-37) moiety is fused at its N-terminus to a 26-amino acid signal peptide derived from human growth hormone for efficient transport through the endoplasmic reticulum.
- Plasmid pXGLPl is constructed as follows: Plasmid PXGH5 [Selden, R.F. et al., Mol. Cell. Biol. 6:3173-3179 (1986)] is digested with Smal and ligated to a double- stranded oligonucleotide containing a Bglll site (Bglll linkers; New England Biolabs) .
- the ligated product is digested with Bglll and EcoRI and the 0.32 kb fragment corresponding to the 3'-untranslated region of the human growth hormone gene is isolated (with a Bglll linker attached to the Smal site lying at position 6698 in Genbank entry HUMGHCSA) .
- the hGH fragment can also be isolated by known methods from human genomic DNA using PCR primers designed to amplify the sequence between positions 6698 to 7321 in Genbank entry HUMGHCSA.
- the mouse metallothionein promoter may be isolated by known methods from mouse genomic DNA using PCR primers designed from analysis of mMT sequences available from Genbank (i.e. Genbank entries MUSMTI, MUSMTIP, and MUSMTIPRM) .
- Plasmid pUC19 (ATCC #37254) is dige ⁇ ted with EcoRI and treated with bacterial alkaline pho ⁇ phatase. The treated plasmid is ligated with the hGH and mMT fragments described above. The resulting plasmid has a single copy of each the mouse metallothionein promoter and the 3'untran ⁇ lated region of hGH joined at a Bglll site.
- This plasmid designated pXl is digested with Bglll and the full-length linear product is purified by gel electrophoresis.
- Oligonucleotides 11.1 and 11.2 are used to amplify a DNA sequence encoding amino acids 7-37 of GLP-1 from human genomic DNA by PCR.
- the amplified product (104 bp) is purified and mixed with pXGH5 and oligonucleo ⁇ tides 11.2, 11.3, 11.4, and 11.5 and ⁇ ubject to PCR.
- Oligonucleotide ⁇ 11.3 and 11.4 are complementary and correspond to the desired junction between the hGH signal peptide and GLP-1 amino acid residue 7.
- the 500 base pair amplification product contain ⁇ 5'-untran ⁇ lated, exon 1, intron 1, and part of exon 2 ⁇ equences from hGH (nucleotides 5168 to 5562 in Genbank entry HUMGHCSA) 15 fused to a sequence encoding GLP-1 residue ⁇ 7-37 followed by a stop codon.
- the fragment by design, is flanked on both ends by BamHI sites. The fragment is cleaved with BamHI and ligated to the Bglll digest of pXl described above.
- Ligation products are analysed to identify those with one copy of the hGH-GLP-l(7-37) fusion product inserted at the Bglll site separating the mMT promoter and the 3'-untranslated hGH sequence in pXl, such that GLP-1 residue 37 is distal to the mMT promoter.
- DNA encoding the signal peptides of the LDL receptor (amino acid residues 1-21) , preproglucagon (amino acid residues 1-20) , or human growth hormone (amino acid residues 1-26) may be synthesized by known methods and ligated in vitro to similarly synthesized DNA encoding amino acids 7-37 or 7-36 of GLP-1 (followed immediately by a stop codon) .
- HUMLDLR01 human LDL receptor
- HUMGLUCG2 human GLP-1 and glucagon sequences
- HUMGHCSA human growth hormone
- the ligated product may be synthesized with an appropriate 5'-untranslated sequence and inserted into plasmid pXl described above.
- a second insulinotropic GLP-l derivative, GLP-l(7- 36), can be expressed by sub ⁇ tituting oligonucleotide 11.6 for oligonucleotide 11.2 de ⁇ cribed above. All subsequent cloning operations described above for construction of pXGLPl are followed, such that the final product is lacking the C-terminal glycine residue characteri ⁇ tic of GLP-l(7-37).
- thi ⁇ terminal glycine residue may be removed in vivo by the activity of a peptidyl- glycine alpha-amidating enzyme to produce the insulino ⁇ tropin GLP-l(7-36) amide.
- Pla ⁇ mid pXGLPl i ⁇ co-tran ⁇ fected into primary human skin fibroblasts with plasmid pcDNEO exactly as described for pXEPOl and pcDNEO in Example 13. Clones are ⁇ elected in G418 containing medium, tran ⁇ ferred to 96-well plate ⁇ , and assayed for GLP-l(7-37) activity or immunoreactivity in cell supernatants.
- GLP-l(7-37) activity is determined by incubation of cell supernatants with rat insulinoma RINm5F cells and measuring the ability of the supernatants to induce insulin secretion from these cells using a commercially available insulin radioimmuno-as ⁇ ay (Coat-a- Count Insulin, DPC, Los Angeles, CA) .
- GLP-l(7-37) antigen is determined using a commercially available anti ⁇ era against GLP-l (Peninsula Laboratories, Belmont, CA) .
- GLP-l(7-37) positive clones are expanded for implantation into nude mice as described in Example 16 and blood samples are taken to monitor serum human GLP-l(7-37) levels.
- In vivo activity is monitored in fasting animals by determining the insulinogenic index after intraperitoneal injection of glucose (1 mg glucose per gram of body weight) .
- glucose 1 mg glucose per gram of body weight
- implanted and non-implanted groups of 32 mice are fasted overnight, and 28 are injected with glucose. After injection, the 28 mice are arbitrarily assigned to seven groups of four, and blood sampling (for serum glucose and insulin) i ⁇ performed on each group at 5, 10, 20, 30, 45, 60, or 90 minute ⁇ post-injection, with the non-glucose injected group serving as a fasting control.
- EXAMPLE 18 PRODUCTION OF TRANSFECTED CELL STRAINS BY GENE TARGETING Gene targeting occur ⁇ when transfecting DNA either integrates into or partially replaces chromosomal DNA sequences through a homologous recombinant event. While such events may occur in the course of any given transfec ⁇ tion experiment, they are usually masked by a vast excess of events in which plasmid DNA integrates by non- homologous, or illegitimate, recombination. a.
- the human HPRT locus encodes the enzyme hypoxanthine-phosphoribosyl transferase, hprt " cells can be selected for by growth in medium containing the nucleoside analog 6-thioguanine (6-TG) : cells with the wild-type (HPRT+) allele are killed by 6-TG, while cells with mutant (hprt " ) alleles can survive. Cells harboring targeted events which disrupt HPRT gene function are therefore selectable in 6-TG medium.
- the 6.9 kb Hindlll fragment extending from positions 11,960-18,869 in the HPRT sequence (Genebank name HUMHPRTB; Edwards, A. et a.. , Genomics .6:593-608 (1990)) and including exon ⁇ 2 and 3 of the HPRT gene, is subcloned into the Hindlll site of pUC12.
- the human fibrosarcoma cell line HT1080 (ATCC CCL 121) was transfected with pE3Neo by electroporation.
- HT1080 cells were maintained in HAT (hypoxanthine/ aminopteri ⁇ /xanthine) supplemented DMEM with 15% calf serum (Hyclone) prior to electroporation. Two days before electroporation, the cells are switched to the same medium without aminopterin. Exponentially growing cells were trypsinized and diluted in DMEM/15% calf serum, centrifuged, and resuspended in PBS (phosphate buffered saline) at a final cell volume of 13.3 million cells per ml.
- HAT hypoxanthine/ aminopteri ⁇ /xanthine
- DMEM 15% calf serum
- PBS phosphate buffered saline
- pE3Neo is digested with Hindlll, separating the 8 kb HPRT-neo fragment from the pUC12 backbone, purified by phenol extraction and ethanol precipitation, and resuspended at a concentration of 600 ⁇ g/ml. 50 ⁇ l (30 ⁇ g) was added to the electroporation cuvette (0.4 cm electrode gap; Bio-Rad Laboratories) , along with 750 ⁇ l of the cell suspension (10 million cells) . Electroporation was at 450 volts, 250 ⁇ Farads (Bio-Rad Gene Pulser; Bio-Rad Laboratories) .
- the contents of the cuvette were immediately added to DMEM with 15% calf serum to yield a cell suspension of 1 million cells per 25 ml media.
- 25 ml of the treated cell suspension was plated onto 150 mm diameter tissue culture dishe ⁇ and incubated at 37°C, 5% C0 2 .
- 24 hrs later a G418 solution was added directly to the plate ⁇ to yield a final concentration of 800 ⁇ g/ml G418.
- Five days later the media was replaced with DMEM/15% calf serum/800 ⁇ g/ml G418.
- the media was replaced with DMEM/15% calf serum/800 ⁇ g/ml G418 and 10 ⁇ M 6-thioguanine. Colonies resistant to G418 and 6-TG were picked using cloning cylinders 14-16 day ⁇ after the dual ⁇ election was initiated.
- FIBROBLASTS pE3Neo is digested with Hindlll, separating the 8 kb HPRT-neo fragment from the pUCl2 backbone, and purified by phenol extraction and ethanol precipitation. DNA was resuspended at 2 mg/ml. Three million secondary human foreskin fibroblasts cells in a volume of 0.5 ml were electroporated at 250 volts and 960 ⁇ Farads, with 100 ⁇ g of Hindlll pE3Neo (50 ⁇ l) . Three separate transfections were performed, for a total of 9 million treated cells.
- Cells are processed and selected for G418 resistance as described in Example 6, except that 500,000 cells per 150 mm culture dish are plated for G418 selection. After 10 days under selection, the culture medium is replaced with human fibroblast nutrient medium containing 400 ⁇ g/ml G418 and 10 ⁇ M 6-TG. Selection with the two drug combination is continued for 10 additional days. Plates are scanned microscopically to localize human fibroblast colonies resistant to both drugs. The fraction of G418 r t-TG r colonies is 4 per 9 million treated cells. These colonies constitute 0.0001% (or 1 in a million) of all cells capable of forming colonies.
- Control plates de ⁇ igned to determine the overall yield of G418 r colonie ⁇ indicated that 2,850 G418 r colonie ⁇ could be generated from the initial 9 x 10 6 treated cell ⁇ .
- the ratio of targeted to non-targeted events is 4/2,850, or 1 to 712.
- Restriction enzyme and Southern hybridization experiments using probes derived from the neo and HPRT genes were u ⁇ ed to localize the neo gene to the HPRT locu ⁇ at the predicted site within HPRT exon 3 and demonstrate that targeting had occurred in these four clonal cell strains. Colonies resi ⁇ tant to both drug ⁇ have also been isolated by transfecting primary cell ⁇ (1/3.0 x 10 7 ) .
- Targeting was maximally stimulated (approximately 10-fold stimulation) when overhangs of 175 bp were used, with 1/80 G418 r colonies displaying restriction fragments that are diagnostic for targeting at HPRT (a total of 9 targeted clones were isolated).
- targeting is readily observed in normal human fibroblast ⁇ and the overall targeting frequency (the number of targeted clone ⁇ divided by the total number of clones stably transfected to G418-resistance) can be stimulated by transfection with targeting constructs containing single-stranded overhanging tails, by the method a ⁇ de ⁇ cribed in Example 18e.
- a variant of pE3Neo in which a gene of therapeutic interest is inserted within the HPRT coding region, adjacent to or near the neo gene, can be used to target a gene of therapeutic interest to a specific position in a recipient primary or secondary cell genome.
- Such a variant of pE3Neo can be constructed for targeting the hGH gene to the HPRT locus.
- pXGH5 is digested with EcoRI and the 4.1 kb fragment containing the hGH gene and linked mouse metallothionein (mMT) promoter is isolated. The EcoRI overhangs are filled in with the Klenow fragment from E. coli DNA polymerase.
- pE3Neo is digested with Xhol, which cuts at the junction of the neo fragment and HPRT exon 3 (the 3' junction of the insertion into exon 3).
- the Xhol overhanging ends of the linearized plasmid are filled in with the Klenow fragment from E. coli DNA polymerase, and the resulting fragment is ligated to the 4.1 kb blunt-ended hGH-mMT fragment.
- Bacterial colonies derived from the.ligation mixture are screened by re ⁇ triction enzyme analysis for a single copy insertion of the hGH-mMT fragment and one orientation, the hGH gene transcribed in the same direction as the neo gene, is chosen and designated pE3Neo/hGH.
- pE3Neo/hGH is digested with Hindlll, releasing the 12.1 kb fragment containing HPRT, neo and mMT-hGH sequences.
- Digested DNA i ⁇ treated and tran ⁇ fected into primary or ⁇ econdary human fibroblasts as described in Example 18c G418 r TG r colonies are selected and analyzed for targeted insertion of the mMT-hGH and neo sequences into the HPRT gene as described in Example 18c.
- Individual colonie ⁇ are a ⁇ sayed for hGH expression using a commercially available immunoassay (Nichols Institute) .
- Xenopu ⁇ laevi ⁇ In Xenopu ⁇ laevi ⁇ oocyte ⁇ , molecule ⁇ with 3'-overhanging end ⁇ of several hundred base pairs in length underwent recombination with similarly treated molecules much more rapidly after microinjection than molecule ⁇ with very ⁇ hort overhang ⁇ (4 bp) generated by re ⁇ triction enzyme dige ⁇ tion. In yea ⁇ t, the generation of 3'-overhanging end ⁇ ⁇ everal hundred ba ⁇ e pair ⁇ in length appears to be a rate limiting step in meiotic recombina ⁇ tion.
- plasmid pE3Neo (Example 18a) is digested with Hindlll.
- This DNA can be used directly after phenol extraction and ethanol precipitation, or the 8 kb Hindlll fragment containing only HPRT and the neo gene can be separated away from the pUC12 vector sequences by gel electrophoresis.
- ExoIII digestion of the Hindlll digested DNA results in extensive exonucleolytic digestion at each end, initiating at each free 3' end, and leaving 5'- overhanging ends. The extent of exonucleolytic action and, hence, the length of the re ⁇ ulting 5'-overhangings, can be controlled by varying the time of ExoIII digestion.
- ExoIII digestion of 100 ⁇ g of Hindlll digested pE3Neo is carried out according to the supplier's recommended conditions, for times of 30 sec, 1 min, 1.5 min, 2 min, 2.5 min, 3 min, 3.5 min, 4 min, 4.5 min, and 5 min.
- an aliquot from each time point containing 1 ⁇ g of ExoIII treated DNA, i ⁇ treated with mung bean nuclea ⁇ e (Promega) , under condition ⁇ recommended by the supplier, and the samples fractionated by gel electrophoresis.
- the difference in size between non-treated, Hindlll digested pE3Neo and the same molecules treated with ExoIII and mung bean nuclease i ⁇ measured. This size difference divided by two gives the average length of the 5'-overhang at each end of the molecule. Using the time points described above and digestion at 30°, the 5'-overhangs produced should range from 100 to 1,000 bases.
- ExoIII treated DNA total Hindlll digest of pE3NEO
- the degree to which targeting is enhanced by each ExoIII treated preparation is quantified by counting the number of G418 r 6-TG r colonies and comparing these numbers to targeting with Hindlll digested pE3Neo that wa ⁇ not treated with ExoIII.
- a region lying exclusively upstream of the human EPO coding region can be amplified by PCR.
- Three sets of primers useful for this purpo ⁇ e were designed after analysis of the published human EPO [Genbank designation HUMERPA; Lin, F-K. , et al . , Proc. Natl. Acad. Sci.. USA .82.:7580-7584 (1985)]. These primer pairs can amplify fragments of 609, 603, or 590 bp.
- the three fragment ⁇ overlap ⁇ ub ⁇ tantially and are interchangeable for the present purposes.
- the 609 bp fragment extending from -623 to -14 relative to the translation ⁇ tart site (HUMERPA nucleotide position ⁇ 2 to 610), is ligated at both ends with Clal linkers.
- the resulting Clal-linked fragment is digested with Clal and inserted into the Clal site of pBlue ⁇ criptIISK/+ (Stratagene) , with the orientation ⁇ uch that HUMERPA nucleotide position 610 is adjacent to the Sail site in the plasmid polylinker) .
- This pla ⁇ mid, p5'EP0 can be cleaved, separately, at the unique Fspl or Sfil sites in the EPO upstream fragment (HUMERPA nucleotide position ⁇ 150 and 405, re ⁇ pectively) and ligated to the mou ⁇ e metallotheionein promoter.
- the 1.8 kb EcoRI-Bglll from the mMT-I gene [containing no mMT coding sequences; Hamer, D.H. and Walling M. , J. Mol. APPI. Gen.
- this fragment can also be isolated by known methods from mouse genomic DNA using PCR primers designed from analysis of mMT sequences available from Genbank; i.e., MUSMTI, MUSMTIP, MUSMTIPRM] is made blunt- ended by known methods and ligated with Sfil digested (also made blunt-ended) or Fspl digested pS'EPO.
- Sfil digested also made blunt-ended
- Fspl digested pS'EPO Fspl digested pS'EPO.
- the orientations of resulting clones are analyzed and those in which the former mMT Bglll site is proximal to the Sail site in the plasmid polylinker are used for targeting primary and secondary human fibroblasts. This orientation directs mMT transcription towards HUMERPA nucleotide position 610 in the final construct.
- the resulting plasmids are designated p5'EPO-mMTF and p5'EPO-mMTS
- Additional upstream sequences are useful in cases where it is desirable to modify, delete and/or replace negative regulatory elements or enhancers that lie upstream of the initial target sequence.
- EPO a negative regulatory element that inhibits EPO expression in extrahepatic and extrarenal tissues [Semenza, G.L. et al. , Mol. Cell. Biol. 10:930-938 (1990)] can be deleted. A series of deletions within the 6 kb fragment are prepared. The deleted regions may be replaced with an enhancer with broad host-cell activity [e.g. an enhancer from the Cytomegalovirus (CMV) ] .
- CMV Cytomegalovirus
- the orientation of the 609 bp 5'EPO fragment in the pBluescriptIISK/+ vector was chosen since the HUMERPA sequences are preceded on their 5' end by a BamHI (distal) and Hindlll site (proximal) .
- a 6 kb BamHI-Hindlll fragment normally lying upstream of the 609 bp fragment [Semenza, G. L. et al.. Mol. Cell. Biol. 10:930-938 (1990)3 can be isolated from genomic DNA by known methods. For example, a bacteriophage, cosmid, or yeast artificial chromosome library could be screened with the 609 bp PCR amplified fragment as a probe.
- the desired clone will have a 6 kb BamHI-Hindlll fragment and its identity can be confirmed by comparing its restriction map from a restriction map around the human EPO gene determined by known methods.
- constructing a restriction map of the human genome upstream of the EPO gene using the 609 bp fragment as a probe can identify enzymes which generate a fragment originating between HUMERPA coordinate ⁇ 2 and 609 and extending pa ⁇ t the up ⁇ tream BamHI site; this fragment can be isolated by gel electrophoresis from the appropriate digest of human genomic DNA and ligated into a bacterial or yeast cloning vector.
- the correct clone will hybridize to the 609 bp 5'EPO probe and contain a 6 kb BamHI-HindiII fragment.
- the isolated 6 kb fragment is inserted in the proper orientation into p5'EPO, p5'EPO-mMTF, or p5'EPO-mMTS ( ⁇ uch that the Hindlll ⁇ ite i ⁇ adjacent to HUMERPA nucleotide po ⁇ ition 2) .
- Additional upstream sequence ⁇ can be isolated by known methods, using chromosome walking techniques or by isolation of yeast artificial chromosomes hybridizing to the 609 bp 5'EPO probe.
- the cloning strategies described above allow sequences upstream of EPO to be modified in vitro for subsequent targeted transfection of primary and secondary human fibroblast ⁇ .
- the strategies describe simple insertions of the mMT promoter, as well as deletion of the negative regulatory region, and deletion of the negative regulatory region and replacement with an enhancer with broad host-cell activity. g. TARGETING TO SEQUENCES FLANKING THE HUMAN EPO GENE AND ISOLATION OF TARGETED PRIMARY. SECONDARY AND IMMORTALIZED HUMAN FIBROBLASTS BY SCREENING
- the plasmids are cut with restriction enzymes that free the insert away from the plasmid backbone.
- p5'EPO-mMTS Hindlll and Sail digestion releases a targeting fragment of 2.4 kb, comprised of the 1.8 kb mMT promoter flanked on the 5' and 3 ' sides by 405 bp and 204 base pairs, respectively, of DNA for targeting this construct to the regulatory region of the EPO gene.
- This DNA or the 2.4 kb targeting fragment alone is purified by phenol extraction and ethanol precipitation and transfected into primary or secondary human fibroblasts under the conditions described in Example 18c. Transfected cells are plated onto 150 mm dishes in human fibroblast nutrient medium.
- the cells are plated into 24 well dishes at a density of 10,000 cells/cm 2 [approximately 20,000 cells per well; if targeting occurs at a rate of 1 event per 10 6 clonable cells (Example 18c, then about 50 wells would need to be assayed to isolate a single expressing colony] .
- Cells in which the transfecting DNA ha ⁇ targeted to the homologou ⁇ region upstream of EPO will express EPO under the control of the mMT promoter. After 10 days, whole well supernatants are as ⁇ ayed for EPO expre ⁇ sion using a commercially available immunoassay kit (Amgen) .
- Clones from wells displaying EPO synthesis are isolated using known methods, typically by assaying fractions of the heterogenous populations of cell ⁇ separated into individual wells or plates, assaying fractions of these positive wells, and repeating as needed, ultimately isolating the targeted colony by screening 96-well microtiter plates seeded at one cell per well.
- DNA from entire plate lysates can also be analyzed by PCR for amplification of a fragment u ⁇ ing a mMT specific primer in conjunction with a primer lying upstream of HUMERPA nucleotide position 1. This primer pair should amplify a DNA fragment of a size precisely predicted based on the DNA sequence. Positive plates are tryp ⁇ inized and replated at successively lower dilutions, and the DNA preparation and PCR steps repeated as needed to isolate targeted cells.
- the targeting schemes herein described may also be used to activate hGH expres ⁇ ion in immortalized human cells (for example, HT1080 fibroblast ⁇ , HeLa, MCF-7 brea ⁇ t cancer cell ⁇ , K-562 leukemia cell ⁇ , KB carcinoma cell ⁇ or 2780AD ovarian carcinoma cell ⁇ ) for the purpo ⁇ e ⁇ of producing hGH for conventional pharmacologic delivery.
- immortalized human cells for example, HT1080 fibroblast ⁇ , HeLa, MCF-7 brea ⁇ t cancer cell ⁇ , K-562 leukemia cell ⁇ , KB carcinoma cell ⁇ or 2780AD ovarian carcinoma cell ⁇
- the ⁇ trategy for con ⁇ tructing p5'EPO-mMTF, p5'EPO-mMTS, and derivatives of such with the additional upstream 6 kb BamHI-Hindlll fragment can be followed with the additional step of in ⁇ erting the neo gene adjacent to the mMT promoter.
- a negative selection marker for example, gpt [from pMSG (Pharmacia) or another suitable source]
- gpt can be inserted adjacent to the HUMERPA sequences in the pBluescriptIISK/+ polylinker.
- G418 r colonie ⁇ are i ⁇ olated and ⁇ creened by PCR amplification or re ⁇ triction enzyme and Southern hybridization analy ⁇ i ⁇ o£ DNA prepared from pools of colonies to identify targeted colonies.
- G418 r colonies are placed in medium containing 6-thioxanthine to select against the integration of the gpt gene [Besnard, C. et a_l. , Mol. Cell. Biol.
- the HSV-TK gene can be placed on the opposite side of the insert as gpt, allowing selection for neo and against both gpt and TK by growing cells in human fibroblast nutrient medium containing 400 ⁇ g/ml G418, 100 ⁇ M 6-thioxanthine, and 25 ⁇ g/ml gancyclovir.
- the double negative selection should provide a nearly absolute selection for true targeted events and Southern blot analysis provides an ultimate confirmation.
- the targeting schemes herein described may also be used to activate hEPO expression in immortalized human cells (for example,. HT1080 fibroblasts, HeLa, MCF-7 breast cancer cells, K-562 leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma cells) for the purposes of producing hEPO for conventional pharmacologic delivery.
- immortalized human cells for example,. HT1080 fibroblasts, HeLa, MCF-7 breast cancer cells, K-562 leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma cells
- the following example serve ⁇ to illu ⁇ trate one embodiment of the pre ⁇ ent invention, in which the normal regulatory sequences upstream of the human growth hormone gene are altered to allow expres ⁇ ion of human growth hormone in primary or secondary human fibroblast strains.
- Targeting molecules similar to those described in Example 18f for targeting to the EPO gene regulatory region are generated using cloned DNA fragments derived from the 5' end of the human growth hormone N gene.
- HUMGHCSA Genebank Entry
- HUMGHCSA Genebank Entry
- PCR primers designed by analysis of the HUMGHCSA sequence in thi ⁇ region. This region extends from the middle of hGH gene N intron 1 to an upstream position approximately 1.4 kb 5' to the translational start site.
- pUC12 is digested with EcoRI and BamHI, treated with Klenow to generate blunt ends, and recircularized under dilute conditions, resulting in plasmids which have lost the EcoRI and BamHI sites.
- This plasmid is designated pUC12XEB.
- Hindlll linkers are ligated onto the amplified hGH fragment and the resulting fragment is digested with Hindlll and ligated to Hindlll digested pUC12XEB.
- the resulting plasmid, pUC12XEB-5'hGH is dige ⁇ ted with EcoRI and BamHI, to remove a 0.5 kb fragment lying immediately up ⁇ tream of the hGH tran ⁇ criptional initiation ⁇ ite.
- the fragment can also be isolated by known methods from mouse genomic DNA using PCR primers designed from analysi ⁇ of mMT sequences available from Genbank; i.e., MUSMTI, MUSMTIP, MUSMTIPRM] .
- This plasmid p5'hGH-mMT has the mMT promoter flanked on both sides by upstream hGH sequence ⁇ .
- the plasmids are cut with restriction enzymes that free the insert away from the plasmid backbone.
- Hindlll digestion releases a targeting fragment of 2.9 kb, comprised of the 1.8 kb mMT promoter flanked on the 5' end 3' sides by DNA for targeting this construct to the regulatory region of the hGH gene.
- This DNA or the 2.9 kb targeting fragment alone is purified by phenol extraction and ethanol precipitation and transfected into primary or secondary human fibroblasts under the condition ⁇ described in Example 6.
- Transfected cells are plated onto 150 mm dishes in human fibroblast nutrient medium. 48 hours later the cells are plated into 24 well dishes at a density of 10,000 cell ⁇ /cm 2 [approximately 20,000 cells per well; if targeting occurs at a rate of 1 event per 10 6 clonable cells (Example 18c) , then about 50 wells would need to be assayed to isolate a single expressing colony] .
- Cells in which the transfecting DNA has targeted to the homologous region upstream of hGH will expres ⁇ hGH under the control of the mMT promoter. After 10 days, whole well supernatants are assayed for hGH expression using a commercially available immunoassay kit (Nichols) .
- Clones from wells displaying hGH synthesis are isolated using known methods, typically by as ⁇ aying fractions of the heterogenous populations of cell ⁇ ⁇ eparated into individual wells or plates, assaying fractions of these positive wells, and repeating as needed, ultimately isolated the targeted colony by screening 96-well microtiter plates seeded at one cell per well.
- DNA from entire plate lysates can also be analyzed by PCR for amplification of a fragment using a mMT specific primer in conjunction with a primer lying down ⁇ tream of HUMGHCSA nucleotide position 5,432. This primer pair should amplify a DNA fragment of a size precisely predicted ba ⁇ ed on the DNA sequence.
- Positive plates are trypsinized and replated at successive ⁇ ively lower dilutions, and the DNA preparation and PCR steps repeated as needed to isolate targeted cells.
- the targeting schemes herein described may also be used to activate hHGH expression in immortalized human cells (for example, HT1080 fibroblasts, HeLa, MCF-7 breast cancer cells, K-562 leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma cell ⁇ ) for the purpo ⁇ e ⁇ of producing hGH for conventional pharmacologic delivery.
- immortalized human cells for example, HT1080 fibroblasts, HeLa, MCF-7 breast cancer cells, K-562 leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma cell ⁇
- a negative selection marker for example, gpt [from pMSG (Pharmacia) or another suitable source]
- gpt [from pMSG (Pharmacia) or another suitable source]
- gpt can be inserted adjacent to the HUMGHCSA ⁇ equence ⁇ in the pUC12 poly- linker.
- G418 r colonie ⁇ are i ⁇ olated and screened by PCR amplification or restriction enzyme and Southern hybridization analysi ⁇ of DNA prepared from pool ⁇ of colonie ⁇ to identify targeted colonie ⁇ .
- G418 r colonie ⁇ are placed in medium containing thioxanthine to ⁇ elect again ⁇ t the integration of the gpt gene (Be ⁇ nard, C. et al.. Mol. Cell. Biol.
- the HSV-TK gene can be placed on the oppo ⁇ ite side of the insert as gpt, allowing selection for neo and against both gpt and TK by growing cells in human fibroblast nutrient medium containing 400 ⁇ g/ml G418, 100 ⁇ M 6-thioxanthine, and 25 ⁇ g/ml gancyclovir.
- the double negative selection should provide a nearly absolute selection for true targeted events. Southern hybridization analysis is confirmatory.
- the targeting schemes herein described may also be used to activate hGH expression in immortalized human cells (for example, HT1080 fibroblasts, HeLa, MCF-7 breast cancer cells, K-562 leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma cells) for the purposes of producing hGH for conventional pharmacologic delivery.
- immortalized human cells for example, HT1080 fibroblasts, HeLa, MCF-7 breast cancer cells, K-562 leukemia cells, KB carcinoma cells or 2780AD ovarian carcinoma cells
- EXAMPLE 19 CONSTRUCTION OF TARGETING PLASMIDS WHICH RESULT IN CHIMERIC TRANSCRIPTION UNITS IN WHICH HUMAN GROWTH HORMONE AND ERYTHROPOIETIN SEQUENCES ARE FUSED
- the product ⁇ of the targeting event ⁇ are chimeric tran ⁇ cription unit ⁇ in which the first exon of the human growth hormone gene is positioned upstream of EPO exons 2-5.
- the product of transcription, splicing and translation is a protein in which amino acids 1-4 of the hEPO signal peptide are replaced with amino acid residues 1-3 of hGH.
- Plasmid pXEPO-10 is designed to replace exon 1 of hEPO with exon 1 of hGH by gene targeting to the endogenou ⁇ hEPO gene on human chromo ⁇ ome 7. Pla ⁇ mid pXEPO-10 is constructed as follows.
- the intermediate plasmid pT163 is constructed by inserting the 6 kb Hindlll-BamHI fragment (see Example 18f) lying upstream of the hEPO coding region into Hindlll-BamHI digested pBluescriptll SK+ (Stratagene, LaJolla, CA) .
- the product of this ligation is digested with Xhol and Hindlll and ligated to the 1.1 kb Hindlll-Xhol fragment from pMClneoPolyA [Thomas, K. R. and Capecchi, M. R. Cell 51: 503-512 (1987) available from Strategene, LaJolla, CA] to create pT163.
- Oligonucleotide ⁇ 13.1 - 13.4 are utilized in polymera ⁇ e chain reactions to generate a fusion fragment in which the mouse metallothionein 1 (mMT-I) promoter - hGH exon 1 sequences are additionally fused to hEPO intron 1 sequence ⁇ .
- oligonucleotides 13.1 and 13.2 are used to amplify the approximately 0.73 kb mMT-I promoter - hGH exon 1 fragment from pXGH5 ( Figure 1) .
- oligonucleotides 13.3 and 13.4 are used to amplify the approximately 0.57 kb fragment comprised predominantly of hEPO intron 1 from human genomic DNA.
- the two amplified fragments are mixed and further amplified with oligonucleotides 13.1 and 13.4 to generate the final fusion fragment (fusion fragment 3) flanked by a Sail site at the 5' side of the mMT-I moiety and an Xhol ⁇ ite at the 3' side of the hEPO intron 1 sequence.
- Fusion fragment 3 is digested with Xhol and Sail and ligated to Xhol digested pT163. The ligation mixture is transformed into E.
- the boldface type denotes a Sail site tail to convert the 5' boundary to a Sail site.
- the boldface region of oligos 13.2 and 13.3 denote hGH sequences, while the non-boldface regions are intron 1 sequence ⁇ from the hEPO gene.
- the boldface region include ⁇ an Xhol ⁇ ite tail to convert the 3' boundary of the amplified fragment to an Xhol site.
- Plasmid pXEPO-11 is designed to place, by gene targeting, the mMT-I promoter and exon 1 of hGH upstream of the hEPO structural gene and promoter region at the endogenous hEPO locu ⁇ on human chromo ⁇ ome 7.
- Pla ⁇ mid pXEPO-11 i ⁇ constructed as follows. Oligonucleotide ⁇ 13.1 and 13.5 - 13.7 are utilized in poly era ⁇ e chain reaction ⁇ to generate a fu ⁇ ion fragment in which the mouse metallothionein I (mMT-I) promoter - hGH exon 1 sequences are additionally fused to hEPO ⁇ equence ⁇ from -1 to -630 relative to the hEPO coding region.
- mMT-I mouse metallothionein I
- oligonucleo ⁇ tides 13.1 and 13.5 are used to amplify the approximately 0.73 kb mMT-I promoter - hGH exon 1 fragment from pXGH5 ( Figure 1).
- oligonucleotides 13.6 and 13.7 are used to amplify, from human genomic DNA, the approximately 0.62 kb fragment comprised predominantly of hEPO sequences from -1 to -620 relative to the hEPO coding region.
- Both oligos 13.5 and 13.6 contain a 10 bp linker sequence located at the hGH intron 1 - hEPO promoter region, which corresponds to the natural hEPO intron 1 splice donor site.
- the two amplified fragments are mixed and further amplified with oligonucleotides 13.1 and 13.7 to generate the final fusion fragment (fu ⁇ ion fragment 6) flanked by a Sail site at the 5' side of the mMT-I moiety and an Xhol site at the 3' ⁇ ide of the hEPO promoter region.
- the ligation mixture is transformed into E. coli and a clone containing a single insert of fusion fragment 6 in which the Xhol site is regenerated at the 3' side of hEPO promoter sequence ⁇ is identified and designated pXEPO-li.
- oligos 13.5 and 13.6 denote hGH sequences.
- the italicized regions correspond to the first 10 base pairs of hEPO intron 1.
- the remainder of the oligos correspond to hEPO sequences from -620 to -597 relative to the hEPO coding region.
- the non- boldface region of oligo 13.7 is identical to bases -1 to -24 relative to the hEPO coding region.
- the boldface region includes an Xhol site tail to convert the 3' boundary of the amplified fragment to an Xhol site.
- Plasmid pXEPO-10 can be used for gene targeting by digestion with BamHI and Xhol to release the 7.3 kb fragment containing the mMT-I/hGH fusion flanked on both sides by hEPO sequences.
- This fragment contains no hEPO coding sequences, having only sequences lying between -620 and approximately -6620 upstream of the hEPO coding region and hEPO intron 1 sequences to direct targeting to the human EPO locus.
- Targeting fragment 1 is transfected into primary or secondary human skin fibroblast ⁇ u ⁇ ing conditions similar to those described in Example 18c.
- G418-resistant colonies are picked into individual wells of 96-well plates and screened for EPO expres ⁇ ion by an ELISA assay (R&D Systems, Minneapolis MN) .
- Cell ⁇ in which the transfecting DNA integrates randomly into the human genome cannot produce EPO.
- Cell ⁇ in which the tran ⁇ fecting DNA ha ⁇ undergone homologou ⁇ recombination with the endogenou ⁇ hEPO intron 1 and hEPO upstream sequences contain a chimeric gene in which the mMT-I promoter and non- transcribed ⁇ equence ⁇ and the hGH 5' untran ⁇ lated sequences and hGH exon 1 replace the normal hEPO promoter and hEPO exon 1 (see Figure 7).
- Non-hEPO sequences in targeting fragment 1 are joined to hEPO sequences down ⁇ stream of hEPO intron 1.
- the replacement of the normal hEPO regulatory region with the mMT-I promoter will activate the EPO gene in fibroblasts, which do not normally expres ⁇ EPO.
- the replacement of hEPO exon 1 with hGH exon 1 results in a protein in which the first 4 amino acids of the hEPO signal peptide are replaced with amino acids 1-3 of hGH, creating a functional, chimeric signal peptide which is removed by post-tran ⁇ lation processing from the mature protein and is secreted from the expressing cells.
- Plasmid pXEPO-11 can be used for gene targeting by digestion with BamHI and Xhol to release the 7.4 kb fragment containing the mMT-I/hGH fusion flanked on both sides by hEPO sequence ⁇ .
- Thi ⁇ fragment (targeting fragment 2) contain ⁇ no hEPO coding ⁇ equence ⁇ , having only sequences lying between -1 and approximately -6620 upstream of the hEPO coding region to direct targeting to the human EPO locus.
- Targeting fragment 2 is transfected into primary or secondary human skin fibroblast ⁇ u ⁇ ing condition ⁇ similar to those de ⁇ cribed in Example 18g.
- G418-resistant colonie ⁇ are picked into individual well ⁇ of 96-well plate ⁇ and screened for EPO expres ⁇ ion by an ELISA assay (R&D System ⁇ , Minneapoli ⁇ , MN) .
- Cell ⁇ in which the tran ⁇ fecting DNA integrate ⁇ randomly into the human genome cannot produce EPO.
- Cell ⁇ in which the tran ⁇ fecting DNA ha ⁇ undergone homologous recombination with the endogenous hEPO promoter and up ⁇ tream ⁇ equence ⁇ contain a chimeric gene in which the mMT-I promoter and non-tran ⁇ cribed ⁇ equences, hGH 5' untranslated sequence ⁇ and hGh exon 1, and a 10 ba ⁇ e pair linker compri ⁇ ed of the first 10 base ⁇ of hEPO intron 1 are in ⁇ erted at the Hindlll ⁇ ite lying at po ⁇ ition -620 relative to the hEPO coding region (see Figure 8) .
- the localization of the mMT-I promoter upstream of the normally silent hEPO promoter will direct the synthesis, in primary or secondary skin fibroblasts, of a message reading (5' to 3') non-translated metallothionein and hGH sequences, hGH exon 1, 10 bases of DNA identical to the first 10 base pairs of hEPO intron 1, and the normal hEPO promoter and hEPO exon 1 (-620 to +13 relative to the EPO coding sequence) .
- the 10 base pair linker sequence from hEPO intron 1 acts as a splice donor site to fuse hGH exon 1 to the next downstream splice acceptor site, that lying immediately upstream of hEPO exon 2.
- the relative positions of the mMT-I promoter and hGH sequences, as well as the position at which the mMT-I/hGH sequence ⁇ are inserted into hEPO upstream sequences, are varied to create alternative chimeric transcription units that facilitate gene targeting, result in more efficient expression of the fusion transcripts, or have other desirable properties.
- Such constructs will give similar results, such that an hGH-hEPO fusion gene is placed under the control of an exogenous promoter by gene targeting to the normal hEPO locus.
- the 6 kb Hindlll-BamHI fragment upstream of the hEPO gene ha ⁇ numerou ⁇ re ⁇ triction enzyme recognition ⁇ equence ⁇ that can be utilized a ⁇ ⁇ ite ⁇ for in ⁇ ertion of the neo gene and the mMT-I promoter/hGH fusion fragment.
- One such site a Bglll site lying approximately 1.3 kb upstream of the Hindlll site, is unique in this region and can be used for insertion of one or more selectable markers and a regulatory region derived from another gene that will serve to activate EPO expres ⁇ ion in primary, secondary, or immortalized human cells.
- the intermediate plasmid pT164 is constructed by inserting the 6 kb Hindlll-BamHI fragment (Example 18f) lying upstream of the hEPO coding region into Hindlll- BamHI digested pBluescriptll SK+ (Stratagene, LaJolla, CA) .
- Plasmid pMClneoPolyA [Thomas, K.R. and Capecchi, M.R. Cell 51:503-512 (1987); available from Stratagene, LaJolla, CA] is digested with BamHI and Xhol, made blunt- ended by treatment with the Klenow fragment of E.
- pT164 is digested with Bglll and made blunt-ended by treatment with the Klenow fragment of E. coli DNA polymerase. The two preceding blunt-ended fragments are ligated together and transformed into competent E. coli .
- Clones with a single insert of the 1.1 kb neo fragment are isolated and analyzed by restriction enzyme analysi ⁇ to identify tho ⁇ e in which the Bglll ⁇ ite recreated by the fu ⁇ ion of the blunt Xhol and Bglll ⁇ ite ⁇ i ⁇ localized 1.3 kb away from the unique Hindlll ⁇ ite pre ⁇ ent in plasmid pT164.
- the resulting plasmid, pT165 can now be cleaved at the unique Bglll site flanking the 5' side of the neo tran ⁇ cription unit.
- Oligonucleotide ⁇ 13.8 and 13.9 are utilized in polymerase chain reactions to generate a fragment in which the mouse metallothionein I (mMT-I) promoter - hGH exon 1 sequences are additionally fused to a 10 ba ⁇ e pair fragment comprising a splice donor ⁇ ite.
- the ⁇ plice donor site chosen corresponds to the natural hEPO intron l splice donor site, although a larger number of splice donor sites or consensus splice donor sites may be used.
- the oligonucleotides (13.8 and 13.9) are used to amplify the approximately 0.73 kb mMT-I promoter - hGH exon 1 fragment from pXGH5 ( Figure 1) .
- the amplified fragment (fragment 7) is digested with Bglll and ligated to Bglll digested pT165.
- the ligation mixture is transformed into E. coli and a clone, containing a single insert of fragment 7 in which the Kpnl site in the mMT-I promoter is adjacent to the 5' end of the neo gene and the mMT-I promoter is oriented such that transcription is directed towards the unique Hindlll site, is identified and designated pXEPO-12.
- the non-boldface region of oligo 13.8 is identical to the mMT-I promoter, with the natural Kpnl ⁇ ite as its 5' boundary.
- the boldface type denotes a Bglll site tail to convert the 5' boundary to a Bglll site.
- hGH sequences The boldface region of oligos 13.9 denote hGH sequences.
- the italicized region corresponds to the first 10 ba ⁇ e pair ⁇ of hEPO intron 1.
- the underlined Bglll site is added for pla ⁇ mid con ⁇ truction purpose ⁇ .
- Plasmid pXEPO-12 can be used for gene targeting by digestion with BamHI and Hindlll to relea ⁇ e the 7.9 kb fragment containing the neo gene and the mMT-I/hGH fu ⁇ ion flanked on both sided by hEPO sequences.
- This fragment contains no hEPO coding sequences, having only sequences lying between approximately -620 and approximately -6620 upstream of the hEPO coding region to direct targeting upstream of the human EPO locus.
- Targeting fragment 3 is transfected into primary, secondary, or immortalized human skin fibroblasts using conditions similar to those described in Examples 18b and 18c.
- G418-resi ⁇ tant colonie ⁇ are picked into individual wells of 96-well plates and screened for EPO expres ⁇ ion by an ELISA assay (R&D System ⁇ , Minneapoli ⁇ MN) . Cell ⁇ in which the tran ⁇ fecting DNA integrate ⁇ randomly into the human genome cannot produce EPO.
- Cell ⁇ in which the transfecting DNA has undergone homologous recombination with the endogenou ⁇ hEPO promoter and up ⁇ tream ⁇ equence ⁇ contain a chimeric gene in which the mMT-I promoter and non-tran ⁇ cribed ⁇ equence ⁇ , hGH 5' untran ⁇ lated ⁇ equence ⁇ , and hGH exon 1, and a 10 ba ⁇ e pair linker compri ⁇ ed of the first 10 base ⁇ of hEPO intron 1 are in ⁇ erted at the Bglll site lying at position approximately -1920 relative to the hEPO coding region.
- the localization of the mMT-I promoter upstream of the normally silent hEPO promoter will direct the synthe ⁇ i ⁇ , in primary, ⁇ econdary, or immortalized human fibrobla ⁇ t ⁇ (or other human cell ⁇ ) , of a message reading: (5' to 3') nontranslated metallothionein and hGH ⁇ equence ⁇ , hGH exon 1, 10 ba ⁇ e ⁇ of DNA identical to the fir ⁇ t 10 ba ⁇ e pairs of hEPO intron 1, and hEPO upstream region and hEPO exon 1 (from approximately -1920 to +13 relative to the EPO coding sequence) .
- the 10 base pair linker sequence from hEPO intron 1 acts as a splice donor site to fuse hGH exon 1 to a downstream splice acceptor site, that lying immediately upstream of hEPO exon 2. Processing of the resulting transcript will therefore splice out the hEPO upstream sequences, promoter region, exon 1, and intron 1 sequences.
- post- transcriptional processing of the message may be improved by using in vitro mutagenesis to eliminate splice acceptor sites lying in hEPO upstream sequences between the mMT-I promoter and hEPO exon 1, which reduce level of productive splicing events needed create the desired message.
- hEPO exon 1 The replacement of hEPO exon 1 with hGH exon 1 results in a protein in which the first 4 amino acids of the hEPO signal peptide are replaced with amino acids 1-3 of hGH, creating a functional, chimeric signal peptide which is removed by post-translation processing from the mature protein and is secreted from the expressing cells.
- HMEC Human mammary epithelial cells
- Breast tissue is trimmed of fat and minced into 2 - 4 mm 3 pieces.
- Minced tissue is wa ⁇ hed with Hank ⁇ Basic Salt Solution (HBSS) and then placed in enzyme solution in trypsinizing flasks (Bellco, Vineland, NJ) at approximately 50 ml enzyme solution per 10 g tissue.
- Enzyme solution consist ⁇ of Collagena ⁇ e A (Boehringer Mannheim, Indianapolis, IN) at l mg/ml and hyaluronidase (Sigma, St.
- the pellet is either resuspended in freezing media (MEBM + 20% calf serum + 10% DMSO) and frozen under liquid nitrogen or further digested to obtain single cells.
- trypsin 0.05% trypsin-EDTA, Gibco
- trypsinization is stopped with the addition of 2 ml calf serum and cell ⁇ are ⁇ pun down at 1200 rpm for 10 minute ⁇ .
- the cell pellet is resu ⁇ pended in growth media, counted and ⁇ eeded into uncoated culture vessels at 10,000 cells/cm 2 .
- HMEC are routinely cultured in serum-free growth media, MEGM, composed of MEBM supplemented with bovine insulin (10 ⁇ g/ml, Sigma), epidermal growth factor (10 ng/ml, Collaborative Research, Waltham, MA), bovine transferrin (5 ⁇ g/ml, Sigma), hydrocorti ⁇ one (0.14 ⁇ M, Sigma), and bovine pituitary extract (35 ⁇ g/ml, Sigma) .
- HMEC at early pas ⁇ age are tryp ⁇ inized, re ⁇ uspended in HBSS + 15% calf serum, and counted. Cells are then pelleted, resu ⁇ pended in 10 ml of electroporation buffer (EPB) and pelleted once again. Cell ⁇ are resuspended at 3 x 10 6 cells/ml EPB + bovine serum albumin (BSA, Sigma) . Supercoiled plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap (Bio Rad, Melville, NY).
- 0.5 ml of the cell su ⁇ pen ⁇ ion i ⁇ added to the cuvette and mixed with the DNA u ⁇ ing a ⁇ terile tran ⁇ fer pipette (Co ⁇ tar, Cambridge, MA) .
- a Gene Pul ⁇ er apparatus Bio Rad, Melville, NY
- i ⁇ set at a capacitance of 960 ⁇ F and 150 - 400 V.
- cells are removed with a transfer pipette and added to 15 ml polypropylene conical centrifuge tubes containing MEGM. The cell suspension is added to tissue culture dishes at 1.5 x 10 6 cells per 100 mm dish for selection.
- Cells are re-fed after 48 hours with MEGM containing 50 ⁇ g/ml G418 (Geneticin, Gibco) . Selection dishes are incubated for 14 - 28 days until distinct colonies of 2 mm 2 or larger are observed. During the selection period cultures are re-fed twice weekly with MEGM + 50 ⁇ g/ml G418 after one week without refeeding. Colonies are isolated with cloning cylinders and transferred into 96 or 24 well plates.
- MEGM containing 50 ⁇ g/ml G418 (Geneticin, Gibco) . Selection dishes are incubated for 14 - 28 days until distinct colonies of 2 mm 2 or larger are observed. During the selection period cultures are re-fed twice weekly with MEGM + 50 ⁇ g/ml G418 after one week without refeeding. Colonies are isolated with cloning cylinders and transferred into 96 or 24 well plates.
- HMEC were transfected with pXGH301 (120 ⁇ g) , pcDNEO (5 - 60 ⁇ g) , or cotransfected with pXGH5 and pcDNEO (100 ⁇ g each) at voltages ranging from 150 - 400 V.
- Table 9 summarize ⁇ the number of population doublings achieved for a sample of transfected and non-transfected clones. A ⁇ the data indicate, stably transfected human mammary epithelial cell clones can be propagated for more than 20 population doubling ⁇ and may be used further as cellular implants for m vivo protein delivery and gene therapy.
- plasmid pT22.1 was constructed, containing 63 bp of genomic hEPO sequence upstream of the first codon of the hEPO gene fused to the mouse metallothionein-1 promoter (mMT-I) . Oligonucleotides 22.1 to 22.4 were used in PCR to fuse mMT-I and hEPO sequence ⁇ .
- the propertie ⁇ of these primers are as follows: 22.1 i ⁇ a 21 ba ⁇ e oligonucleotide homologou ⁇ to a ⁇ egment of the mMT-I promoter beginning 28 bp upstream of the mMT-I Kpnl site; 22.2 and 22.3 are 58 nucleotide complementary primers which define the fusion of hEPO and mMT-I ssq ence ⁇ ⁇ uch that the fu ⁇ ion contains 28 bp of hEPO sequence beginning 35 base ⁇ up ⁇ tream of the first codon of the hEPO gene, and mMT-I sequences beginning at base 29 of oligonucleotide 22.2, comprising the natural Bglll site of mMT-I and extending 30 base ⁇ into mMT-I sequence; 22.4 is 21 nucleotide ⁇ in length and i ⁇ homologou ⁇ to hEPO sequence beginning 725 bp downstream of the first codon of the hEPO gene.
- the re ⁇ ulting fragment wa ⁇ dige ⁇ ted with Kpnl (the PCR fragment contained two Kpnl ⁇ ite ⁇ : a ⁇ ingle natural Kpnl ⁇ ite in the mMT-I promoter region and a ⁇ ingle natural Kpnl site in the hEPO sequence) , and purified.
- the plasmid pXEPOl ( Figure 5) was also digested with Kpnl, releasing a 1.4 kb fragment and a 6.4 kb fragment.
- the 6.4 kb fragment was purified and ligated to the 1.4 kb Kpnl PCR fusion fragment.
- the re ⁇ ulting construct was called pT22.1.
- a second intermediate, pT22.2, was con ⁇ tructed by ligating the approximately 6 kb Hindlll- BamHI fragment lying upstream of the hEPO structural gene (see Example 18f) to BamHI and Hindlll digested pBSIISK+ (Stratagene, LaJolla, CA) .
- a third intermediate, pT22.3 was constructed by first excising a 1.1 kb XhoI/BamHI fragment from pMCINEOpolyA (Stratagene,, LaJolla, CA) containing the neomycin phosphotransferase gene. The fragment was then made blunt-ended with the Klenow fragment of DNA polymerase I (New England Biolabs) . This fragment was then ligated to the Hindi site of pBSIISK+ (similarly made blunt with DNA polymerase I) to produce pT22.3.
- a fourth intermediate, pT22.4 was made by purifying a 1.1 kb Xhol/Hindlll fragment comprising the neo gene from pT22.3 and ligating this fragment to Xhol and Hindlll digested pT22.2.
- pT22.4 thus contains the neo gene adjacent to the Hindlll side of the BamHI-Hindlll upstream hEPO fragment.
- pXEPO-13 was generated by first excising a 2.8 kb EcoRI/AccI fragment from pT22.1. The EcoRI site of this fragment defines the 5' boundary of the mMT-I promoter, while the AccI site of this fragment lies within hEPO exon 5.
- the AccI/EcoRI fragment contain ⁇ a nearly complete hEPO expression unit, missing only a part of exon 5 and the natural polyadenylation site.
- This 2.8 kb EcoRI/AccI fragment wa ⁇ purified, made blunt-ended by treatment with the Klenow fragment of DNA polymera ⁇ e I, and ligated to Xhol digested, blunt-ended, pT22.4.
- HT1080 cells were transfected with Pvul-BamHI digested pXEPO-13.
- pXEPO-13 digested in this way generates three fragments; a 1 kb vector fragment including a portion of the amp gene, a 1.7 kb fragment of remaining vector sequence ⁇ and an 8.9 kb fragment containing hEPO, neo and mMT-I ⁇ equence ⁇ .
- the 8.9 kb BamHI/PvuI fragment contained the following sequences in order from the BamHI site: 6.0 kb of upstream hEPO genomic sequence, the l.l kb neo transcription unit, the 0.7 kb mMT-I promoter and the 2.8 kb hEPO coding sequence truncated within exon 5.
- 45 ⁇ g of pEXPO-13 digested in this way was used in an electroporation of 12 million cells (electroporation conditions were de ⁇ cribed in
- Example 18b This electroporation was repeated a total of eight times, re ⁇ ulting in electroporation of a total of 96 million cells.
- Cells were mixed with media to provide a cell density of 1 million cells per ml and 1 ml aliquot ⁇ were dispensed into a total of 96, 150mm tis ⁇ ue culture plate ⁇ (Falcon) each containing a minimum of 35 ml of DMEM/15% calf ⁇ erum.
- each plate was sampled for hEPO by ELISA analysi ⁇ (R & D Systems) .
- Six of the 96 plates contained at least 10 mU/ml hEPO.
- each of the 96, 150 mm plate ⁇ contained approximately 600 G418 re ⁇ i ⁇ tant colonie ⁇ (an e ⁇ timated total of 57,600 G418 re ⁇ i ⁇ tant colonie ⁇ on all 96 plate ⁇ ) .
- the approximately 600 colonie ⁇ on plate number 18 were tryp ⁇ inized and replated at 50 cell ⁇ /ml into 364 well plate ⁇ (Sterilin) .
- a 0.2 kb DNA probe extending from the AccI site in hEPO exon 5 to the Bglll site in the 3' untran ⁇ lated region was used to probe genomic DNA from HT165-18A2-10 cells.
- the targeting construct, pXEPO-13, truncated at the AccI site in exon 5 does not contain these AccI/Bglll sequences and, therefore, is diagnostic for targeting at the hEPO locus. Only cell strains that have recorabined in a homologous manner with natural hEPO sequences would produce an hEPO mRNA containing sequence homologous to the Accl/Bglll sequences.
- HT16518A2-10 was found to express an mRNA of the predicted ⁇ ize hybridizing with the 32-P labeled AccI/Bglll hEPO probe on Northern blot ⁇ . Restriction enzyme and Southern blot analysis confirmed that the neo gene and mMT-I promoter were targeted to one of the two hEPO alleles in HT165-18A2-10 cell ⁇ . These results demon ⁇ trate that homologou ⁇ recombination may be u ⁇ ed to target a regulatory region to a gene that is normally silent in human fibroblasts, resulting in the functional activation of that gene.
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP50876793A JP3564126B2 (en) | 1991-11-05 | 1992-11-05 | Transfection of vertebrate cells by homologous recombination |
CA002122991A CA2122991A1 (en) | 1991-11-05 | 1992-11-05 | Transfection of vertebrate cells by homologous recombination |
EP92924367A EP0649464B1 (en) | 1991-11-05 | 1992-11-05 | Transfection of vertebrate cells e.g. by homologous recombination |
DE69221168T DE69221168T2 (en) | 1991-11-05 | 1992-11-05 | TRANSFECTION OF VERTEBRATE CELLS FOR EXAMPLE BY HOMOLOGOUS RECOMBINATION |
AU30698/92A AU669499B2 (en) | 1991-11-05 | 1992-11-05 | Transfection of vertebrate cells e.g. by homologous recombination |
GR970402700T GR3025054T3 (en) | 1991-11-05 | 1997-10-15 | Transfection of vertebrate cells e.g. by homologous recombination. |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US78918891A | 1991-11-05 | 1991-11-05 | |
US78784091A | 1991-11-05 | 1991-11-05 | |
US789,188 | 1991-11-05 | ||
US787,840 | 1991-11-05 | ||
US91153392A | 1992-07-10 | 1992-07-10 | |
US911,533 | 1992-07-10 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1993009222A2 true WO1993009222A2 (en) | 1993-05-13 |
WO1993009222A3 WO1993009222A3 (en) | 1993-10-28 |
Family
ID=27419842
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1992/009627 WO1993009222A2 (en) | 1991-11-05 | 1992-11-05 | Transfection of vertebrate cells e.g. by homologous recombination |
Country Status (19)
Country | Link |
---|---|
US (7) | US5994127A (en) |
EP (3) | EP1221477A3 (en) |
JP (3) | JP3564126B2 (en) |
KR (1) | KR100339316B1 (en) |
AT (2) | ATE155810T1 (en) |
AU (1) | AU669499B2 (en) |
CA (1) | CA2122991A1 (en) |
DE (2) | DE69221168T2 (en) |
DK (2) | DK0649464T3 (en) |
ES (2) | ES2181841T3 (en) |
GR (1) | GR3025054T3 (en) |
HK (1) | HK1014033A1 (en) |
IL (1) | IL103649A0 (en) |
MX (1) | MX9206376A (en) |
MY (1) | MY119132A (en) |
NZ (1) | NZ245015A (en) |
PT (1) | PT101031B (en) |
SG (1) | SG44652A1 (en) |
WO (1) | WO1993009222A2 (en) |
Cited By (92)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994012650A2 (en) | 1992-12-03 | 1994-06-09 | Transkaryotic Therapies, Inc. | Activating expression of an amplifying endogenous gene by homologous recombination |
EP0667791A1 (en) * | 1991-08-22 | 1995-08-23 | The Board Of Trustees Of The Leland Stanford Junior University | Isolation, growth, differentiation and genetic engineering of human muscle cells |
WO1996004397A1 (en) * | 1994-08-05 | 1996-02-15 | Maria Anvret | Gene therapy using homologous recombination |
WO1997015195A1 (en) * | 1995-10-25 | 1997-05-01 | Transkaryotic Therapies, Inc. | Hybrid matrix implants and explants |
EP0779362A1 (en) | 1989-12-22 | 1997-06-18 | Applied Research Systems ARS Holdings N.V. | DNA constructs for endogenous gene activation and expression modification |
WO1998014593A2 (en) | 1996-10-01 | 1998-04-09 | Geron Corporation | Human telomerase catalytic subunit |
EP0879279A1 (en) * | 1996-02-06 | 1998-11-25 | Eli Lilly And Company | Diabetes therapy |
WO1999005267A1 (en) * | 1997-07-23 | 1999-02-04 | Roche Diagnostics Gmbh | Identification of human cell lines for the production of human proteins by endogenous gene activation |
WO1999005268A1 (en) * | 1997-07-23 | 1999-02-04 | Roche Diagnostics Gmbh | Production of erythropoietin by endogenous gene activation |
US5869041A (en) * | 1996-01-12 | 1999-02-09 | The Miriam Hospital | Delivery of bioactive compounds to an organism |
US5952226A (en) * | 1996-11-05 | 1999-09-14 | Modex Therapeutiques | Hypoxia responsive EPO producing cells |
WO1999055866A1 (en) * | 1998-04-24 | 1999-11-04 | Transkaryotic Therapies, Inc. | Delivery of therapeutic proteins via implantation of genetically modified cells in the omentum |
US5981214A (en) * | 1989-11-06 | 1999-11-09 | Cell Genesys, Inc. | Production of proteins using homologous recombination |
US6083725A (en) * | 1996-09-13 | 2000-07-04 | Transkaryotic Therapies, Inc. | Tranfected human cells expressing human α-galactosidase A protein |
EP1054018A1 (en) | 1999-05-18 | 2000-11-22 | Target Quest B.V. | Fab fragment libraries and methods for their use |
US6172211B1 (en) | 1997-07-11 | 2001-01-09 | Boehringer Ingelheim International Gmbh | Nucleic acid encoding tag7 polypeptide |
WO2001036643A1 (en) * | 1999-11-19 | 2001-05-25 | Transkaryotic Therapies, Inc. | Nucleic acid construct for optimized production of products |
US6241701B1 (en) | 1997-08-01 | 2001-06-05 | Genetronics, Inc. | Apparatus for electroporation mediated delivery of drugs and genes |
US6270989B1 (en) | 1991-11-05 | 2001-08-07 | Transkaryotic Therapies, Inc. | Protein production and delivery |
US6294655B1 (en) | 1998-04-03 | 2001-09-25 | Hyseq, Inc. | Anti-interleukin-1 receptor antagonist antibodies and uses thereof |
US6337072B1 (en) | 1998-04-03 | 2002-01-08 | Hyseq, Inc. | Interleukin-1 receptor antagonist and recombinant production thereof |
US6361972B1 (en) | 1997-09-26 | 2002-03-26 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US6391633B1 (en) | 1997-07-23 | 2002-05-21 | Roche Diagnostics Gmbh | Production of erythropoietin by endogenous gene activation |
WO2002049673A2 (en) | 2000-12-20 | 2002-06-27 | F. Hoffmann-La Roche Ag | Conjugates of erythropoietin (pep) with polyethylene glycol (peg) |
US6419920B1 (en) | 1995-10-25 | 2002-07-16 | Trans Karyotic Therapies, Inc. | Hybrid matrix implants and explants |
US6426191B1 (en) | 1998-04-03 | 2002-07-30 | Hyseq, Inc. | Assays involving an IL-1 receptor antagonist |
WO2003006482A2 (en) | 2001-07-10 | 2003-01-23 | Senomyx, Inc. | Use of specific t2r taste receptors to identify compounds that block bitter taste |
US6541623B1 (en) | 1998-04-03 | 2003-04-01 | Hyseq, Inc. | Interleukin—1 receptor antagonist and uses thereof |
US6555373B1 (en) | 1997-07-23 | 2003-04-29 | Roche Diagnostics Gmbh | Methods for identifying human cell lines useful for endogenous gene activation isolated human cell lines identified thereby, and uses thereof |
US6565844B1 (en) | 1991-11-05 | 2003-05-20 | Transkaryotic Therapies, Inc. | Protein production and protein delivery |
US6576443B2 (en) | 1999-12-10 | 2003-06-10 | Cytos Biotechnology Ag | Replicon based activation of endogenous genes |
WO2003054172A2 (en) | 2002-01-17 | 2003-07-03 | Lonza Biologics Plc. | Glutamine-auxothrophic human cells capable of producing proteins and capable of growing in a glutamine-free medium |
WO2003062394A2 (en) | 2002-01-22 | 2003-07-31 | Cold Spring Harbor Laboratory | Methods and compositions for rna interference |
US6740503B1 (en) | 1997-09-26 | 2004-05-25 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US6846673B2 (en) | 1997-07-23 | 2005-01-25 | Roche Diagnostics Gmbh | Identification of human cell lines for the production of human proteins by endogenous gene activation |
US6951839B1 (en) | 1999-11-30 | 2005-10-04 | Curis, Inc. | Methods and compositions for regulating lymphocyte activity |
US7005299B1 (en) | 1993-04-21 | 2006-02-28 | The University Of Edinburgh | Expression of heterologous genes according to a targeted expression profile |
WO2006028967A2 (en) | 2004-09-02 | 2006-03-16 | Yale University | Regulation of oncogenes by micrornas |
EP1728862A1 (en) | 2000-03-16 | 2006-12-06 | Genetica, Inc. | Methods and compositions for RNA interference |
WO2007047988A2 (en) | 2005-10-20 | 2007-04-26 | Senomyx, Inc. | Chimeric human sweet-umami and umami-sweet taste receptors |
EP1538202A3 (en) * | 1996-09-13 | 2007-05-30 | Transkaryotic Therapies, Inc. | Production of human alpha-galactosidase A |
US7235360B2 (en) | 1997-03-14 | 2007-06-26 | Biogen Idec Inc. | Method for integrating genes at specific sites in mammalian cells via homologous recombination and vectors for accomplishing the same |
WO2008057470A2 (en) | 2006-11-01 | 2008-05-15 | Senomyx, Inc. | Identification of bitter ligands that specifically activate human t2r receptors and related assays for identifying human bitter taste modulators |
EP1985630A2 (en) | 2001-01-03 | 2008-10-29 | Senomyx, Inc. | T1R taste receptors and genes encoding same |
WO2008140449A1 (en) | 2007-05-11 | 2008-11-20 | Thomas Jefferson University | Methods of treatment and prevention of neurodegenerative diseases and disorders |
US7459436B2 (en) | 2002-11-22 | 2008-12-02 | Hoffmann-La Roche Inc. | Treatment of disturbances of iron distribution |
US7459435B2 (en) | 2002-08-29 | 2008-12-02 | Hoffmann-La Roche Inc. | Treatment of disturbances of iron distribution |
EP2003451A2 (en) | 2001-06-26 | 2008-12-17 | Senomyx, Inc. | T1R hetero-oligomeric taste receptors and cell lines that express said receptors and use thereof for identification of taste compounds |
EP2030986A1 (en) | 1999-09-29 | 2009-03-04 | The General Hospital Corporation | Polypeptide derivative of parathyroid hormone (PTH) |
US7514072B1 (en) | 1998-12-14 | 2009-04-07 | Hannelore Ehrenreich | Method for the treatment of cerebral ischaemia and use of erythropoietin or erythropoietin derivatives for the treatment of cerebral ischaemia |
EP1025253B2 (en) † | 1997-10-20 | 2009-07-29 | Roche Diagnostics GmbH | Positive-negative selection for homologous recombination |
US7659373B2 (en) | 1997-12-03 | 2010-02-09 | Roche Diagnostics Gmbh | Erythropoietin with high specific activity |
US7674594B2 (en) | 2006-07-27 | 2010-03-09 | Redpoint Bio Corporation | Screening assay for inhibitors of TRPA1 activation by a lower alkyl phenol |
US7749730B2 (en) | 2005-11-03 | 2010-07-06 | Redpoint Bio Corporation | High throughput screening assay for the TRPM5 ion channel |
US7772459B2 (en) | 2002-02-20 | 2010-08-10 | Bellweather Farms | Transgenic production in saliva |
US7833742B2 (en) | 2002-04-25 | 2010-11-16 | Shire Human Genetic Therapies, Inc. | Treatment of α-galactosidase A deficiency |
EP2281828A2 (en) | 2000-12-29 | 2011-02-09 | The Kenneth S. Warren Institute, Inc. | Compositions comprising modified erythropoietin |
US7888470B2 (en) | 2003-08-06 | 2011-02-15 | Senomyx, Inc. | Chimeric T1R taste receptor polypeptides and nucleic acid sequences encoding and cell lines that express said chimeric T1R polypeptides |
EP2287319A1 (en) | 1999-03-11 | 2011-02-23 | Shire Human Genetic Therapies, Inc. | Medical preparations for the treatment of alpha-galactosidase a deficiency |
EP2298802A1 (en) | 2000-03-07 | 2011-03-23 | Senomyx, Inc. | T1R3 taste receptors and genes encoding same |
WO2011035914A1 (en) | 2009-09-23 | 2011-03-31 | Biogenerix Ag | Process for the purification of recombinant human erythropoietin (epo), epo thus purified and pharmaceutical compositions comprising same |
EP2319530A1 (en) | 2006-01-27 | 2011-05-11 | Hannelore Ehrenreich | Method for treating and/or preventing multiple sclerosis, and use of erythropoietin in the production of a drug for intermittent treatment and/or intermittent prevention of multiple sclerosis |
EP2329714A1 (en) | 2004-08-03 | 2011-06-08 | Biogen Idec MA Inc. | Influence of TAJ in the neuronal functions |
US8110185B2 (en) | 2008-10-03 | 2012-02-07 | St. Michael's Hospital | Method for preventing and treating cardiovascular diseases with BRCA1 |
US8138317B2 (en) | 2007-07-17 | 2012-03-20 | Hoffmann-La Roche Inc. | Purification of pegylated polypeptides |
WO2012035037A1 (en) | 2010-09-14 | 2012-03-22 | F. Hoffmann-La Roche Ag | Method for purifying pegylated erythropoietin |
US8168178B2 (en) | 1999-11-30 | 2012-05-01 | Curis, Inc. | Methods and compositions for regulating lymphocyte activity |
WO2012075337A2 (en) | 2010-12-01 | 2012-06-07 | Spinal Modulation, Inc. | Directed delivery of agents to neural anatomy |
US8211655B2 (en) | 2009-02-12 | 2012-07-03 | Discoverx Corporation | Wild-type receptor assays |
EP2487169A1 (en) | 2007-08-21 | 2012-08-15 | Senomyx Inc. | Compounds that inhibit (block) bitter taste in compositions and use thereof |
WO2013003697A1 (en) | 2011-06-30 | 2013-01-03 | Trustees Of Boston University | Method for controlling tumor growth, angiogenesis and metastasis using immunoglobulin containing and proline rich receptor-1 (igpr-1) |
US8354384B2 (en) | 2005-06-23 | 2013-01-15 | Yale University | Anti-aging micrornas |
WO2013020044A1 (en) | 2011-08-03 | 2013-02-07 | The Charlotte-Mecklenburg Hospital Authority D/B/A Carolinas Medical Center | Treatment of fibrosis using microrna-19b |
EP2561887A2 (en) | 2003-01-14 | 2013-02-27 | Dana Farber Cancer Institute, Inc. | Cancer therapy sensitizer |
US8795533B2 (en) | 2007-07-17 | 2014-08-05 | Hoffmann-La Roche Inc. | Chromatographic methods |
US9029383B2 (en) | 2007-05-11 | 2015-05-12 | The Trustees Of The University Of Pennsylvania | Methods of treatment of skin ulcers |
US9057727B2 (en) | 2007-08-01 | 2015-06-16 | The General Hospital Corporation | Screening methods using G-protein coupled receptors and related compositions |
US9072313B2 (en) | 2006-04-21 | 2015-07-07 | Senomyx, Inc. | Comestible compositions comprising high potency savory flavorants, and processes for producing them |
EP2932982A1 (en) | 2005-05-17 | 2015-10-21 | Amicus Therapeutics, Inc. | A method for the treatment of pompe disease using 1-deoxynojirimycin and derivatives |
US9180165B2 (en) | 2007-07-19 | 2015-11-10 | Hannelore Ehrenreich | Use of EPO receptor activation or stimulation for the improvement of the EDSS score in patients with multiple sclerosis |
WO2016044271A2 (en) | 2014-09-15 | 2016-03-24 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation |
EP3031470A2 (en) | 2005-09-09 | 2016-06-15 | The Johns Hopkins University | Manipulation of regulatory t cell and dc function by targeting neuritin gene using antibodies, agonists and antagonists |
US9492508B2 (en) | 2010-05-13 | 2016-11-15 | The General Hospital Corporation | Parathyroid hormone analogs and uses thereof |
EP3176263A1 (en) * | 2007-08-10 | 2017-06-07 | Toto Ltd. | Method of producing recombinant mammalian cells |
EP3216800A1 (en) | 2008-09-26 | 2017-09-13 | Ambrx, Inc. | Modified animal erythropoietin polypeptides and their uses |
WO2018011381A1 (en) | 2016-07-15 | 2018-01-18 | F. Hoffmann-La Roche Ag | Method for purifying pegylated erythropoietin |
US10066001B2 (en) | 2013-03-15 | 2018-09-04 | Apotex Inc. | Enhanced liquid formulation stability of erythropoietin alpha through purification processing |
US10196601B2 (en) | 2013-08-20 | 2019-02-05 | Lek Pharmaceuticals D.D. | Cell culture medium and process for controlling α-amidation and/or C-terminal amino acid cleavage of polypeptides |
WO2019129876A1 (en) | 2017-12-29 | 2019-07-04 | F. Hoffmann-La Roche Ag | Process for providing pegylated protein composition |
WO2019129877A1 (en) | 2017-12-29 | 2019-07-04 | F. Hoffmann-La Roche Ag | Process for providing pegylated protein composition |
WO2019129878A1 (en) | 2017-12-29 | 2019-07-04 | F. Hoffmann-La Roche Ag | Process for providing pegylated protein composition |
WO2022159414A1 (en) | 2021-01-22 | 2022-07-28 | University Of Rochester | Erythropoietin for gastroinfestinal dysfunction |
Families Citing this family (71)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6048729A (en) * | 1987-05-01 | 2000-04-11 | Transkaryotic Therapies, Inc. | In vivo protein production and delivery system for gene therapy |
US7094400B1 (en) * | 1987-05-01 | 2006-08-22 | Shire Human Genetic Therapies, Inc. | Transkaryotic implantation |
US6063630A (en) | 1991-11-05 | 2000-05-16 | Transkaryotic Therapies, Inc. | Targeted introduction of DNA into primary or secondary cells and their use for gene therapy |
US6692737B1 (en) | 1991-11-05 | 2004-02-17 | Transkaryotic Therapies, Inc. | In vivo protein production and delivery system for gene therapy |
NZ245015A (en) * | 1991-11-05 | 1995-12-21 | Transkaryotic Therapies Inc | Delivery of human growth hormone through the administration of transfected cell lines encoding human growth hormone, which are physically protected from host immune response; the transfected cells and their production |
FR2686899B1 (en) * | 1992-01-31 | 1995-09-01 | Rhone Poulenc Rorer Sa | NOVEL BIOLOGICALLY ACTIVE POLYPEPTIDES, THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM. |
US6531124B1 (en) | 1992-07-10 | 2003-03-11 | Transkaryotic Therapies, Inc. | In vivo production and delivery of insulinotropin for gene therapy |
US6670178B1 (en) | 1992-07-10 | 2003-12-30 | Transkaryotic Therapies, Inc. | In Vivo production and delivery of insulinotropin for gene therapy |
US6055453A (en) | 1997-08-01 | 2000-04-25 | Genetronics, Inc. | Apparatus for addressing needle array electrodes for electroporation therapy |
US6216034B1 (en) | 1997-08-01 | 2001-04-10 | Genetronics, Inc. | Method of programming an array of needle electrodes for electroporation therapy of tissue |
US6893838B1 (en) | 1998-04-07 | 2005-05-17 | Genetics Institute Llc | DADD, death activator death domain protein |
US6537806B1 (en) * | 1998-06-02 | 2003-03-25 | University Of Washington | Compositions and methods for treating diabetes |
DE69936866T2 (en) * | 1998-06-26 | 2008-04-30 | Genetronics, Inc., San Diego | SYNERGISM OF PHOTODYNAMIC AND ELECTROPERMEATION EFFECTS ON CELL VITALITY AS A NEW CYTOTOXIC AGENT |
US6678556B1 (en) | 1998-07-13 | 2004-01-13 | Genetronics, Inc. | Electrical field therapy with reduced histopathological change in muscle |
US7922709B2 (en) | 1998-07-13 | 2011-04-12 | Genetronics, Inc. | Enhanced delivery of naked DNA to skin by non-invasive in vivo electroporation |
CA2337652C (en) | 1998-07-13 | 2013-03-26 | Genetronics, Inc. | Skin and muscle-targeted gene therapy by pulsed electrical field |
US6302874B1 (en) | 1998-07-13 | 2001-10-16 | Genetronics, Inc. | Method and apparatus for electrically assisted topical delivery of agents for cosmetic applications |
EP1144594A1 (en) * | 1998-11-24 | 2001-10-17 | Regents Of The University Of Minnesota | Transgenic circulating endothelial cells |
NZ515678A (en) | 1999-04-28 | 2004-01-30 | Genetics Inst | Human GIL-19/AE289 proteins and polynucleotides encoding same |
US20050100991A1 (en) * | 2001-04-12 | 2005-05-12 | Human Genome Sciences, Inc. | Albumin fusion proteins |
EP1274720A4 (en) * | 2000-04-12 | 2004-08-18 | Human Genome Sciences Inc | Albumin fusion proteins |
US6656700B2 (en) | 2000-05-26 | 2003-12-02 | Amersham Plc | Isoforms of human pregnancy-associated protein-E |
US6686188B2 (en) * | 2000-05-26 | 2004-02-03 | Amersham Plc | Polynucleotide encoding a human myosin-like polypeptide expressed predominantly in heart and muscle |
US20040204379A1 (en) * | 2000-06-19 | 2004-10-14 | Cheng Seng H. | Combination enzyme replacement, gene therapy and small molecule therapy for lysosomal storage diseases |
KR100407792B1 (en) * | 2000-08-02 | 2003-12-01 | 한국생명공학연구원 | Preparation method of recombinant protein by use of human glucagon-derived peptide analogue as a fusion expression partner |
JP5161412B2 (en) | 2000-09-18 | 2013-03-13 | サノス・バイオサイエンス・アクティーゼルスカブ | Methods of using GLP-1 and GLP-2 peptides |
US20070135345A1 (en) * | 2000-09-18 | 2007-06-14 | Henriksen Dennis B | Use of GLP-2 for the treatment or prevention, of bone-related disorders |
US20080249016A1 (en) * | 2000-09-18 | 2008-10-09 | Sanos Bioscience A/S | Use of GLP-2 in a combination treatment for bone-related disorders |
US7371721B2 (en) * | 2000-09-18 | 2008-05-13 | Sanos Bioscience A/S | Use of GLP-2 and related compounds for the treatment, prevention, diagnosis, and prognosis of bone-related disorders and calcium homeostasis related syndromes |
US20020123474A1 (en) * | 2000-10-04 | 2002-09-05 | Shannon Mark E. | Human GTP-Rho binding protein2 |
ES2328796T3 (en) | 2001-03-14 | 2009-11-18 | Myriad Genetics, Inc. | TSG101-GAG INTERACTION AND USE OF THE SAME. |
WO2002097038A2 (en) * | 2001-05-25 | 2002-12-05 | Human Genome Sciences, Inc. | Chemokine beta-1 fusion proteins |
US20040204669A1 (en) * | 2001-07-05 | 2004-10-14 | Hofmann Gunter A. | Apparatus for electroporation mediated delivery for drugs and genes |
CN1363654A (en) * | 2001-07-19 | 2002-08-14 | 上海华谊生物技术有限公司 | Genetically engineered bacteria and process for preparing insulinotropic hormone secretion peptide GLP-1 (7-36) |
DE60234057D1 (en) * | 2001-07-25 | 2009-11-26 | Raptor Pharmaceutical Inc | COMPOSITIONS AND METHODS FOR MODULATING TRANSPORT BY THE BLOOD-BRAIN BARRIER |
US6867189B2 (en) * | 2001-07-26 | 2005-03-15 | Genset S.A. | Use of adipsin/complement factor D in the treatment of metabolic related disorders |
US6642003B2 (en) | 2001-08-02 | 2003-11-04 | Cedars-Sinai Medical Center | Human glucose-dependent insulin-secreting cell line |
US20040078837A1 (en) * | 2001-08-02 | 2004-04-22 | Shannon Mark E. | Four human zinc-finger-containing proteins: MDZ3, MDZ4, MDZ7 and MDZ12 |
US20040143104A1 (en) * | 2001-08-08 | 2004-07-22 | Wadsworth Samuel C. | Methods of treating diabetes and other blood sugar disorders |
BR0214217A (en) * | 2001-11-16 | 2004-09-21 | Childrens Medical Center | Increased Organ Function |
EP2277888A3 (en) * | 2001-12-21 | 2011-04-27 | Human Genome Sciences, Inc. | Fusion proteins of albumin and erythropoietin |
EP1463752A4 (en) * | 2001-12-21 | 2005-07-13 | Human Genome Sciences Inc | Albumin fusion proteins |
US7141240B2 (en) * | 2002-03-12 | 2006-11-28 | Cedars-Sinai Medical Center | Glucose-dependent insulin-secreting cells transfected with a nucleotide sequence encoding GLP-1 |
US7374930B2 (en) * | 2002-05-21 | 2008-05-20 | Expression Genetics, Inc. | GLP-1 gene delivery for the treatment of type 2 diabetes |
ES2343518T3 (en) * | 2002-09-09 | 2010-08-03 | Hanall Biopharma Co., Ltd. | ALFA INTERFERATED POLYPEPTIDES MODIFIED PROTEASAS RESISTANT. |
WO2004063356A2 (en) * | 2003-01-13 | 2004-07-29 | Rao Mahendra S | Persistent expression of candidate molecule in proliferating stem and progenitor cells for delivery of therapeutic products |
US20050048041A1 (en) * | 2003-01-13 | 2005-03-03 | Rao Mahendra S. | Persistent expression of candidate molecule in proliferating stem and progenitor cells for delivery of therapeutic products |
US7595306B2 (en) * | 2003-06-09 | 2009-09-29 | Alnylam Pharmaceuticals Inc | Method of treating neurodegenerative disease |
WO2005058347A1 (en) * | 2003-12-19 | 2005-06-30 | F. Hoffmann-La Roche Ag | Use of erythropoietin in the treatment of disturbances of iron distribution in chronic inflammatory intestinal diseases |
US8129334B2 (en) | 2006-03-31 | 2012-03-06 | The Regents Of The University Of California | Methods and compositions for treating neurodegenerative disorders and Alzheimer'S disease and improving normal memory |
JP2007325571A (en) * | 2006-06-09 | 2007-12-20 | Toto Ltd | Method for producing protein using recombinant mammalian cell |
US20100159450A1 (en) | 2006-06-23 | 2010-06-24 | Susanne Wagner | Dpyd gene variants and use thereof |
JP2010510794A (en) | 2006-11-28 | 2010-04-08 | ハナル ファーマシューティカル カンパニー リミテッド | Modified erythropoietin polypeptide and therapeutic use thereof |
CN101827933B (en) * | 2007-06-08 | 2014-01-29 | 韦克福里斯特大学健康科学院 | Selective cell therapy for the treatment of renal failure |
EP2006388A1 (en) * | 2007-06-19 | 2008-12-24 | Helmholtz-Zentrum für Infektionsforschung GmbH | Nucleic acid constructs for deactivation and conditional mutagenesis of genes |
US20090176729A1 (en) * | 2007-12-14 | 2009-07-09 | Alnylam Pharmaceuticals, Inc. | Method of treating neurodegenerative disease |
SI2245145T1 (en) | 2008-01-18 | 2017-05-31 | Biomarin Pharmaceutical Inc. | Manufacture of active highly phosphorylated human lysosomal sulfatase enzymes and uses thereof |
US20090291073A1 (en) * | 2008-05-20 | 2009-11-26 | Ward Keith W | Compositions Comprising PKC-theta and Methods for Treating or Controlling Ophthalmic Disorders Using Same |
EP3388509A1 (en) | 2008-11-12 | 2018-10-17 | inRegen | Isolated renal cells and uses thereof |
WO2010057013A1 (en) * | 2008-11-14 | 2010-05-20 | Wake Forest University Health Sciences | Selective cell therapy for the treatment of renal failure |
WO2010057015A1 (en) * | 2008-11-14 | 2010-05-20 | Wake Forest University Health Sciences | Kidney structures and methods of forming the same |
US20100178641A1 (en) * | 2009-01-12 | 2010-07-15 | Franklin David Damon | Apparel fastening learning apparatus |
EP2451475A2 (en) | 2009-07-06 | 2012-05-16 | Novartis AG | Self replicating rna molecules and uses thereof |
AR082319A1 (en) | 2010-07-22 | 2012-11-28 | Biomarin Pharm Inc | PRODUCTION OF A HIGHLY ACTIVE PHOSPHORILED HUMAN N-ACETILGALACTOSAMINE-6-SULPHATASE AND ITS USES |
CA2817206C (en) | 2010-11-10 | 2020-03-10 | Tengion, Inc. | Injectable formulations for organ augmentation |
EP3332802A1 (en) | 2011-07-06 | 2018-06-13 | GlaxoSmithKline Biologicals SA | Immunogenic combination compositions and uses thereof |
EP3508219A1 (en) | 2011-07-06 | 2019-07-10 | GlaxoSmithKline Biologicals S.A. | Self-replicating rna prime - protein boost vaccines |
CN104853770A (en) | 2012-07-06 | 2015-08-19 | 诺华股份有限公司 | Immunogenic compositions and uses thereof |
MA40871A (en) | 2014-10-29 | 2017-09-05 | Novartis Ag | DIRECT EXPRESSION OF ANTIBODIES |
US11123372B2 (en) | 2016-07-29 | 2021-09-21 | Prokidney | Bioactive renal cells for the treatment of chronic kidney disease |
AU2021230209A1 (en) * | 2020-03-04 | 2022-09-29 | Metcela Inc. | Fibroblast having enhanced erythropoietin production ability |
Citations (17)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2159172A (en) * | 1984-05-24 | 1985-11-27 | Damon Biotech Inc | Production of antibodies |
WO1987000201A1 (en) * | 1985-07-05 | 1987-01-15 | Whitehead Institute For Biomedical Research | Epithelial cells expressing foreign genetic material |
EP0236059A2 (en) * | 1986-02-27 | 1987-09-09 | Snow Brand Milk Products Co. Ltd. | Preparation of erythropoietin-producing cells and production process of erythropoietin using same |
WO1988000239A1 (en) * | 1986-06-30 | 1988-01-14 | Pharmaceutical Proteins Ltd | Peptide production |
EP0255231A1 (en) * | 1986-06-27 | 1988-02-03 | The Board Of Regents Of The University Of Washington | Human erythropoietin gene: high level expression in stably transfected mammalian cells |
WO1988008306A1 (en) * | 1987-05-01 | 1988-11-03 | The General Hospital Corporation | Transkaryotic implantation |
WO1989001517A1 (en) * | 1987-08-07 | 1989-02-23 | Medical Res Council | Vector for integration site independent gene expression in mammalian host cells |
WO1990011354A1 (en) * | 1989-03-20 | 1990-10-04 | Institut Pasteur | Process for the specific replacement of a copy of a gene present in the receiver genome via the integration of a gene |
WO1991009955A1 (en) * | 1989-12-22 | 1991-07-11 | Applied Research Systems Ars Holding N.V. | Endogenous gene expression modification with regulatory element |
WO1991013151A1 (en) * | 1990-02-22 | 1991-09-05 | Biogen, Inc. | Improved expression of polypeptides |
EP0452894A2 (en) * | 1990-04-19 | 1991-10-23 | Consiglio Nazionale Delle Ricerche | Human cells for the high expression of genes inserted in episomal recombinant DNA, their preparation and their use |
WO1991019796A1 (en) * | 1990-06-12 | 1991-12-26 | Baylor College Of Medicine | Method for homologous recombination in animal and plant cells |
WO1992003917A1 (en) * | 1990-08-29 | 1992-03-19 | Genpharm International | Homologous recombination in mammalian cells |
WO1992008796A1 (en) * | 1990-11-13 | 1992-05-29 | Immunex Corporation | Bifunctional selectable fusion genes |
WO1992019255A1 (en) * | 1991-05-06 | 1992-11-12 | Cell Genesys, Inc. | Gene manipulation and expression using genomic elements |
WO1992020808A1 (en) * | 1991-05-15 | 1992-11-26 | Cell Genesys, Inc. | Genomic modifications with homologous dna targeting |
WO1993004169A1 (en) * | 1991-08-20 | 1993-03-04 | Genpharm International, Inc. | Gene targeting in animal cells using isogenic dna constructs |
Family Cites Families (38)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4497796A (en) * | 1980-03-26 | 1985-02-05 | The Regents Of The University Of California | Gene transfer in intact mammals |
US4396601A (en) * | 1980-03-26 | 1983-08-02 | The Regents Of The University Of Calif. | Gene transfer in intact mammals |
DE3176404D1 (en) * | 1980-04-22 | 1987-10-08 | Pasteur Institut | Vaccine against viral hepatitis b, method and transformed eucaryotic cells for the preparation of this vaccine |
NZ210501A (en) * | 1983-12-13 | 1991-08-27 | Kirin Amgen Inc | Erythropoietin produced by procaryotic or eucaryotic expression of an exogenous dna sequence |
CA1215922A (en) * | 1984-05-25 | 1986-12-30 | Connaught Laboratories Limited | Microencapsulation of living tissue and cells |
ATE89314T1 (en) * | 1985-02-13 | 1993-05-15 | Scios Nova Inc | HUMAN METALLOTHIONEIN II PROMOTOR IN MAMMALIAN EXPRESSION SYSTEMS. |
US4980286A (en) * | 1985-07-05 | 1990-12-25 | Whitehead Institute For Biomedical Research | In vivo introduction and expression of foreign genetic material in epithelial cells |
US5118666A (en) * | 1986-05-05 | 1992-06-02 | The General Hospital Corporation | Insulinotropic hormone |
US5219740A (en) * | 1987-02-13 | 1993-06-15 | Fred Hutchinson Cancer Research Center | Retroviral gene transfer into diploid fibroblasts for gene therapy |
US5175255A (en) * | 1987-03-23 | 1992-12-29 | Amgen Inc. | Methods for purification of platelet-derived growth factor |
US6048729A (en) * | 1987-05-01 | 2000-04-11 | Transkaryotic Therapies, Inc. | In vivo protein production and delivery system for gene therapy |
US5166059A (en) * | 1987-06-16 | 1992-11-24 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy using gene fusions for genetic or acquired disorders |
WO1989000239A1 (en) * | 1987-07-06 | 1989-01-12 | Komatsu Zenoah Kabushiki Kaisha | Choke for engines |
EP0378576B1 (en) * | 1987-09-11 | 1995-01-18 | Whitehead Institute For Biomedical Research | Transduced fibroblasts and uses therefor |
US4892538A (en) * | 1987-11-17 | 1990-01-09 | Brown University Research Foundation | In vivo delivery of neurotransmitters by implanted, encapsulated cells |
EP0391960B1 (en) * | 1987-12-11 | 1994-08-17 | Whitehead Institute For Biomedical Research | Genetic modification of endothelial cells |
US4890286A (en) * | 1987-12-11 | 1989-12-26 | Sanyo Electric Co., Ltd. | Method and apparatus for decoding error correcting code |
DE3802640A1 (en) * | 1988-01-29 | 1989-08-03 | Roehm Gmbh | HAIR-RESERVED AASIS PROCEDURE |
ATE152169T1 (en) * | 1988-02-05 | 1997-05-15 | Whitehead Biomedical Inst | MODIFIED HEPATOCYTES AND THEIR APPLICATION |
EP0456640A1 (en) * | 1988-12-13 | 1991-11-21 | UNITED STATES GOVERNMENT as represented by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES | Genetically engineered endothelial cells and use thereof |
US5082670A (en) * | 1988-12-15 | 1992-01-21 | The Regents Of The University Of California | Method of grafting genetically modified cells to treat defects, disease or damage or the central nervous system |
GB8907700D0 (en) * | 1989-04-05 | 1989-05-17 | Fine Organics Ltd | Preparation of substituted ethenes |
GB8909218D0 (en) * | 1989-04-22 | 1989-06-07 | Medical Res Council | Improvements in or relating to enhancers |
CA2058955A1 (en) * | 1989-06-13 | 1990-12-14 | Helen Blau | Isolation growth and differentiation of human muscle cells |
US5399346A (en) * | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
US5194596A (en) * | 1989-07-27 | 1993-03-16 | California Biotechnology Inc. | Production of vascular endothelial cell growth factor |
US5464764A (en) * | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
ES2127458T3 (en) | 1989-11-06 | 1999-04-16 | Cell Genesys Inc | PROTEIN PRODUCTION USING HOMOLOGICAL RECOMBINATION. |
US5272071A (en) * | 1989-12-22 | 1993-12-21 | Applied Research Systems Ars Holding N.V. | Method for the modification of the expression characteristics of an endogenous gene of a given cell line |
AU659824B2 (en) * | 1990-10-31 | 1995-06-01 | Cell Genesys, Inc. | Retroviral vectors useful for gene therapy |
JPH05505944A (en) * | 1990-12-26 | 1993-09-02 | ホワイトヘッド・インスティテュート・フォー・バイオメディカル・リサーチ | Modified hepatocytes and their uses |
WO1992015676A1 (en) * | 1991-03-08 | 1992-09-17 | The Salk Institute For Biological Studies | Somatic cell gene therapy |
NZ245015A (en) * | 1991-11-05 | 1995-12-21 | Transkaryotic Therapies Inc | Delivery of human growth hormone through the administration of transfected cell lines encoding human growth hormone, which are physically protected from host immune response; the transfected cells and their production |
US6054288A (en) * | 1991-11-05 | 2000-04-25 | Transkaryotic Therapies, Inc. | In vivo protein production and delivery system for gene therapy |
US6063630A (en) * | 1991-11-05 | 2000-05-16 | Transkaryotic Therapies, Inc. | Targeted introduction of DNA into primary or secondary cells and their use for gene therapy |
US6670178B1 (en) * | 1992-07-10 | 2003-12-30 | Transkaryotic Therapies, Inc. | In Vivo production and delivery of insulinotropin for gene therapy |
US6531124B1 (en) * | 1992-07-10 | 2003-03-11 | Transkaryotic Therapies, Inc. | In vivo production and delivery of insulinotropin for gene therapy |
KR960037062A (en) * | 1996-08-02 | 1996-11-19 | 오동덕 | Manufacturing method of therapeutic agent for purulent skin disease |
-
1992
- 1992-11-04 NZ NZ245015A patent/NZ245015A/en not_active IP Right Cessation
- 1992-11-04 PT PT101031A patent/PT101031B/en not_active IP Right Cessation
- 1992-11-05 DE DE69221168T patent/DE69221168T2/en not_active Revoked
- 1992-11-05 AT AT92924367T patent/ATE155810T1/en not_active IP Right Cessation
- 1992-11-05 ES ES96202037T patent/ES2181841T3/en not_active Expired - Lifetime
- 1992-11-05 EP EP01204619A patent/EP1221477A3/en not_active Withdrawn
- 1992-11-05 ES ES92924367T patent/ES2106891T3/en not_active Expired - Lifetime
- 1992-11-05 DK DK92924367.3T patent/DK0649464T3/en active
- 1992-11-05 EP EP96202037A patent/EP0750044B1/en not_active Expired - Lifetime
- 1992-11-05 AU AU30698/92A patent/AU669499B2/en not_active Ceased
- 1992-11-05 JP JP50876793A patent/JP3564126B2/en not_active Expired - Fee Related
- 1992-11-05 SG SG1996005101A patent/SG44652A1/en unknown
- 1992-11-05 EP EP92924367A patent/EP0649464B1/en not_active Revoked
- 1992-11-05 IL IL103649A patent/IL103649A0/en not_active IP Right Cessation
- 1992-11-05 AT AT96202037T patent/ATE221917T1/en not_active IP Right Cessation
- 1992-11-05 DE DE69232728T patent/DE69232728T2/en not_active Expired - Fee Related
- 1992-11-05 CA CA002122991A patent/CA2122991A1/en not_active Abandoned
- 1992-11-05 MY MYPI92002007A patent/MY119132A/en unknown
- 1992-11-05 WO PCT/US1992/009627 patent/WO1993009222A2/en not_active Application Discontinuation
- 1992-11-05 MX MX9206376A patent/MX9206376A/en active IP Right Grant
- 1992-11-05 DK DK96202037T patent/DK0750044T3/en active
-
1994
- 1994-05-04 KR KR10-1994-0701527A patent/KR100339316B1/ko not_active IP Right Cessation
- 1994-11-04 US US08/334,455 patent/US5994127A/en not_active Expired - Lifetime
-
1995
- 1995-05-22 US US08/446,909 patent/US6048524A/en not_active Expired - Lifetime
- 1995-05-22 US US08/446,911 patent/US6048724A/en not_active Expired - Lifetime
-
1997
- 1997-10-15 GR GR970402700T patent/GR3025054T3/en unknown
-
1998
- 1998-12-24 HK HK98115412A patent/HK1014033A1/en not_active IP Right Cessation
-
1999
- 1999-06-08 US US09/328,130 patent/US6846676B2/en not_active Expired - Fee Related
- 1999-10-19 US US09/420,861 patent/US6355241B1/en not_active Expired - Lifetime
-
2002
- 2002-12-11 JP JP2002359926A patent/JP3733110B2/en not_active Expired - Fee Related
-
2004
- 2004-07-07 US US10/885,899 patent/US7410799B2/en not_active Expired - Lifetime
- 2004-07-22 JP JP2004214021A patent/JP2005046147A/en active Pending
-
2008
- 2008-06-24 US US12/145,324 patent/US20100143314A1/en not_active Abandoned
Patent Citations (17)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2159172A (en) * | 1984-05-24 | 1985-11-27 | Damon Biotech Inc | Production of antibodies |
WO1987000201A1 (en) * | 1985-07-05 | 1987-01-15 | Whitehead Institute For Biomedical Research | Epithelial cells expressing foreign genetic material |
EP0236059A2 (en) * | 1986-02-27 | 1987-09-09 | Snow Brand Milk Products Co. Ltd. | Preparation of erythropoietin-producing cells and production process of erythropoietin using same |
EP0255231A1 (en) * | 1986-06-27 | 1988-02-03 | The Board Of Regents Of The University Of Washington | Human erythropoietin gene: high level expression in stably transfected mammalian cells |
WO1988000239A1 (en) * | 1986-06-30 | 1988-01-14 | Pharmaceutical Proteins Ltd | Peptide production |
WO1988008306A1 (en) * | 1987-05-01 | 1988-11-03 | The General Hospital Corporation | Transkaryotic implantation |
WO1989001517A1 (en) * | 1987-08-07 | 1989-02-23 | Medical Res Council | Vector for integration site independent gene expression in mammalian host cells |
WO1990011354A1 (en) * | 1989-03-20 | 1990-10-04 | Institut Pasteur | Process for the specific replacement of a copy of a gene present in the receiver genome via the integration of a gene |
WO1991009955A1 (en) * | 1989-12-22 | 1991-07-11 | Applied Research Systems Ars Holding N.V. | Endogenous gene expression modification with regulatory element |
WO1991013151A1 (en) * | 1990-02-22 | 1991-09-05 | Biogen, Inc. | Improved expression of polypeptides |
EP0452894A2 (en) * | 1990-04-19 | 1991-10-23 | Consiglio Nazionale Delle Ricerche | Human cells for the high expression of genes inserted in episomal recombinant DNA, their preparation and their use |
WO1991019796A1 (en) * | 1990-06-12 | 1991-12-26 | Baylor College Of Medicine | Method for homologous recombination in animal and plant cells |
WO1992003917A1 (en) * | 1990-08-29 | 1992-03-19 | Genpharm International | Homologous recombination in mammalian cells |
WO1992008796A1 (en) * | 1990-11-13 | 1992-05-29 | Immunex Corporation | Bifunctional selectable fusion genes |
WO1992019255A1 (en) * | 1991-05-06 | 1992-11-12 | Cell Genesys, Inc. | Gene manipulation and expression using genomic elements |
WO1992020808A1 (en) * | 1991-05-15 | 1992-11-26 | Cell Genesys, Inc. | Genomic modifications with homologous dna targeting |
WO1993004169A1 (en) * | 1991-08-20 | 1993-03-04 | Genpharm International, Inc. | Gene targeting in animal cells using isogenic dna constructs |
Non-Patent Citations (28)
Cited By (155)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5981214A (en) * | 1989-11-06 | 1999-11-09 | Cell Genesys, Inc. | Production of proteins using homologous recombination |
EP0779362A1 (en) | 1989-12-22 | 1997-06-18 | Applied Research Systems ARS Holdings N.V. | DNA constructs for endogenous gene activation and expression modification |
EP0667791A1 (en) * | 1991-08-22 | 1995-08-23 | The Board Of Trustees Of The Leland Stanford Junior University | Isolation, growth, differentiation and genetic engineering of human muscle cells |
EP0667791A4 (en) * | 1991-08-22 | 1996-05-08 | Univ Leland Stanford Junior | Isolation, growth, differentiation and genetic engineering of human muscle cells. |
US6565844B1 (en) | 1991-11-05 | 2003-05-20 | Transkaryotic Therapies, Inc. | Protein production and protein delivery |
US6270989B1 (en) | 1991-11-05 | 2001-08-07 | Transkaryotic Therapies, Inc. | Protein production and delivery |
WO1994012650A2 (en) | 1992-12-03 | 1994-06-09 | Transkaryotic Therapies, Inc. | Activating expression of an amplifying endogenous gene by homologous recombination |
US7005299B1 (en) | 1993-04-21 | 2006-02-28 | The University Of Edinburgh | Expression of heterologous genes according to a targeted expression profile |
EP1403376A3 (en) * | 1993-04-21 | 2007-08-29 | The University Court Of The University Of Edinburgh | Expression of heterologous genes according to a targeted expression profile |
WO1996004397A1 (en) * | 1994-08-05 | 1996-02-15 | Maria Anvret | Gene therapy using homologous recombination |
WO1997015195A1 (en) * | 1995-10-25 | 1997-05-01 | Transkaryotic Therapies, Inc. | Hybrid matrix implants and explants |
US5965125A (en) * | 1995-10-25 | 1999-10-12 | Transkaryotic Therapies, Inc. | Hybrid matrix implants and explants |
US6582391B2 (en) | 1995-10-25 | 2003-06-24 | Transkaryotic Therapies, Inc. | Hybrid matrix implants and explants |
US6472181B1 (en) | 1995-10-25 | 2002-10-29 | Transkaryotic Therapies, Inc. | Hybrid matrix implants and explants |
US6419920B1 (en) | 1995-10-25 | 2002-07-16 | Trans Karyotic Therapies, Inc. | Hybrid matrix implants and explants |
US5869041A (en) * | 1996-01-12 | 1999-02-09 | The Miriam Hospital | Delivery of bioactive compounds to an organism |
EP0879279A1 (en) * | 1996-02-06 | 1998-11-25 | Eli Lilly And Company | Diabetes therapy |
EP0879279A4 (en) * | 1996-02-06 | 2000-07-12 | Lilly Co Eli | Diabetes therapy |
EP2374876A3 (en) * | 1996-09-13 | 2012-10-24 | Shire Human Genetic Therapies, Inc. | Therapy for alpha-galactosidase A deficiency |
US6395884B1 (en) | 1996-09-13 | 2002-05-28 | Transkaryotic Therapies, Inc. | Therapy for α-galactosidase a deficiency |
US6566099B1 (en) | 1996-09-13 | 2003-05-20 | Transkaryotic Therapies, Inc. | Nucleic acid encoding a chimeric polypeptide |
EP2374876A2 (en) | 1996-09-13 | 2011-10-12 | Shire Human Genetic Therapies, Inc. | Therapy for alpha-galactosidase a deficiency |
EP2327775A2 (en) | 1996-09-13 | 2011-06-01 | Shire Human Genetic Therapies, Inc. | Therapy for alpha-galactosidase a deficiency |
US7122354B2 (en) | 1996-09-13 | 2006-10-17 | Transkaryotic Therapies, Inc. | Nucleic acid encoding a chimeric polypeptide |
US6083725A (en) * | 1996-09-13 | 2000-07-04 | Transkaryotic Therapies, Inc. | Tranfected human cells expressing human α-galactosidase A protein |
EP2327775A3 (en) * | 1996-09-13 | 2012-10-24 | Shire Human Genetic Therapies, Inc. | Therapy for alpha-galactosidase a deficiency |
EP1538202A3 (en) * | 1996-09-13 | 2007-05-30 | Transkaryotic Therapies, Inc. | Production of human alpha-galactosidase A |
WO1998014593A2 (en) | 1996-10-01 | 1998-04-09 | Geron Corporation | Human telomerase catalytic subunit |
EP1333094A2 (en) | 1996-10-01 | 2003-08-06 | Geron Corporation | Human telomerase catalytic subunit |
EP2213740A1 (en) | 1996-10-01 | 2010-08-04 | The Regents of the University of Colorado | Human telomerase catalytic subunit |
US5952226A (en) * | 1996-11-05 | 1999-09-14 | Modex Therapeutiques | Hypoxia responsive EPO producing cells |
US7235360B2 (en) | 1997-03-14 | 2007-06-26 | Biogen Idec Inc. | Method for integrating genes at specific sites in mammalian cells via homologous recombination and vectors for accomplishing the same |
US6172211B1 (en) | 1997-07-11 | 2001-01-09 | Boehringer Ingelheim International Gmbh | Nucleic acid encoding tag7 polypeptide |
US6759211B1 (en) | 1997-07-11 | 2004-07-06 | Boehringer Ingelheim International Gmbh | Tumor growth inhibition- and apoptosis-associated genes and polypeptides and methods of use thereof |
US7186529B2 (en) | 1997-07-23 | 2007-03-06 | Roche Diagnostics Gmbh | Preparation of erythropoietin by endogenous gene activation |
WO1999005268A1 (en) * | 1997-07-23 | 1999-02-04 | Roche Diagnostics Gmbh | Production of erythropoietin by endogenous gene activation |
US6391633B1 (en) | 1997-07-23 | 2002-05-21 | Roche Diagnostics Gmbh | Production of erythropoietin by endogenous gene activation |
US6395484B1 (en) | 1997-07-23 | 2002-05-28 | Roche Diagnostics Gmbh | Identification of human cell lines for the production of human proteins by endogenous gene activation |
WO1999005267A1 (en) * | 1997-07-23 | 1999-02-04 | Roche Diagnostics Gmbh | Identification of human cell lines for the production of human proteins by endogenous gene activation |
US6555373B1 (en) | 1997-07-23 | 2003-04-29 | Roche Diagnostics Gmbh | Methods for identifying human cell lines useful for endogenous gene activation isolated human cell lines identified thereby, and uses thereof |
US6846673B2 (en) | 1997-07-23 | 2005-01-25 | Roche Diagnostics Gmbh | Identification of human cell lines for the production of human proteins by endogenous gene activation |
US6241701B1 (en) | 1997-08-01 | 2001-06-05 | Genetronics, Inc. | Apparatus for electroporation mediated delivery of drugs and genes |
US6541221B1 (en) | 1997-09-26 | 2003-04-01 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US7316923B1 (en) | 1997-09-26 | 2008-01-08 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US7419828B2 (en) | 1997-09-26 | 2008-09-02 | Abt Holding Company | Compositions and methods for non-targeted activation of endogenous genes |
US6524818B1 (en) | 1997-09-26 | 2003-02-25 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US6602686B1 (en) | 1997-09-26 | 2003-08-05 | Athersys, Inc. | Compositions and method for non-targeted activation of endogenous genes |
US6524824B1 (en) | 1997-09-26 | 2003-02-25 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US6623958B1 (en) | 1997-09-26 | 2003-09-23 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US6740503B1 (en) | 1997-09-26 | 2004-05-25 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US7569220B2 (en) | 1997-09-26 | 2009-08-04 | Abt Holding Company | Compositions and methods for non-targeted activation of endogenous genes |
US7785831B2 (en) | 1997-09-26 | 2010-08-31 | Abt Holding Company | Compositions and methods for non-targeted activation of endogenous genes |
US6410266B1 (en) | 1997-09-26 | 2002-06-25 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US6361972B1 (en) | 1997-09-26 | 2002-03-26 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
US7842792B2 (en) | 1997-09-26 | 2010-11-30 | Abt Holding Company | Compositions and methods for non-targeted activation of endogenous genes |
US7033782B2 (en) | 1997-09-26 | 2006-04-25 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
EP1025253B2 (en) † | 1997-10-20 | 2009-07-29 | Roche Diagnostics GmbH | Positive-negative selection for homologous recombination |
US7659373B2 (en) | 1997-12-03 | 2010-02-09 | Roche Diagnostics Gmbh | Erythropoietin with high specific activity |
US6541623B1 (en) | 1998-04-03 | 2003-04-01 | Hyseq, Inc. | Interleukin—1 receptor antagonist and uses thereof |
US6337072B1 (en) | 1998-04-03 | 2002-01-08 | Hyseq, Inc. | Interleukin-1 receptor antagonist and recombinant production thereof |
US6426191B1 (en) | 1998-04-03 | 2002-07-30 | Hyseq, Inc. | Assays involving an IL-1 receptor antagonist |
US6294655B1 (en) | 1998-04-03 | 2001-09-25 | Hyseq, Inc. | Anti-interleukin-1 receptor antagonist antibodies and uses thereof |
WO1999055866A1 (en) * | 1998-04-24 | 1999-11-04 | Transkaryotic Therapies, Inc. | Delivery of therapeutic proteins via implantation of genetically modified cells in the omentum |
AU755723B2 (en) * | 1998-04-24 | 2002-12-19 | Transkaryotic Therapies, Inc. | Delivery of therapeutic proteins via implantation of genetically modified cells in the omentum |
US7514072B1 (en) | 1998-12-14 | 2009-04-07 | Hannelore Ehrenreich | Method for the treatment of cerebral ischaemia and use of erythropoietin or erythropoietin derivatives for the treatment of cerebral ischaemia |
EP2287319A1 (en) | 1999-03-11 | 2011-02-23 | Shire Human Genetic Therapies, Inc. | Medical preparations for the treatment of alpha-galactosidase a deficiency |
EP3231871A1 (en) | 1999-03-11 | 2017-10-18 | Shire Human Genetic Therapies, Inc. | Medical preparations for the treatment of alpha-galactosidase a deficiency |
EP2314699A1 (en) | 1999-03-11 | 2011-04-27 | Shire Human Genetic Therapies, Inc. | Medical preparations for the treatment of alpha-galactosidase A deficiency |
EP1054018A1 (en) | 1999-05-18 | 2000-11-22 | Target Quest B.V. | Fab fragment libraries and methods for their use |
EP2067788A2 (en) | 1999-05-18 | 2009-06-10 | Dyax Corp. | Fab fragment libraries and methods for their use |
EP2030986A1 (en) | 1999-09-29 | 2009-03-04 | The General Hospital Corporation | Polypeptide derivative of parathyroid hormone (PTH) |
US7229793B1 (en) | 1999-11-19 | 2007-06-12 | Shire Human Genetic Therapies, Inc. | Constructs and cells for production of small peptides |
WO2001036643A1 (en) * | 1999-11-19 | 2001-05-25 | Transkaryotic Therapies, Inc. | Nucleic acid construct for optimized production of products |
US6951839B1 (en) | 1999-11-30 | 2005-10-04 | Curis, Inc. | Methods and compositions for regulating lymphocyte activity |
US8168178B2 (en) | 1999-11-30 | 2012-05-01 | Curis, Inc. | Methods and compositions for regulating lymphocyte activity |
US6576443B2 (en) | 1999-12-10 | 2003-06-10 | Cytos Biotechnology Ag | Replicon based activation of endogenous genes |
EP2298802A1 (en) | 2000-03-07 | 2011-03-23 | Senomyx, Inc. | T1R3 taste receptors and genes encoding same |
EP1728862A1 (en) | 2000-03-16 | 2006-12-06 | Genetica, Inc. | Methods and compositions for RNA interference |
WO2002049673A2 (en) | 2000-12-20 | 2002-06-27 | F. Hoffmann-La Roche Ag | Conjugates of erythropoietin (pep) with polyethylene glycol (peg) |
EP2281828A2 (en) | 2000-12-29 | 2011-02-09 | The Kenneth S. Warren Institute, Inc. | Compositions comprising modified erythropoietin |
EP1985630A2 (en) | 2001-01-03 | 2008-10-29 | Senomyx, Inc. | T1R taste receptors and genes encoding same |
EP2003451A2 (en) | 2001-06-26 | 2008-12-17 | Senomyx, Inc. | T1R hetero-oligomeric taste receptors and cell lines that express said receptors and use thereof for identification of taste compounds |
EP2327985A2 (en) | 2001-06-26 | 2011-06-01 | Senomyx, Inc. | T1R Hetero-oligomeric taste receptors and cell lines that express said receptors and use thereof for identification of taste compounds |
EP2293067A2 (en) | 2001-06-26 | 2011-03-09 | Senomyx, Inc. | T1R hetero-oligomeric taste receptors and cell lines that express said receptors and use thereof for identification of taste compounds |
WO2003006482A2 (en) | 2001-07-10 | 2003-01-23 | Senomyx, Inc. | Use of specific t2r taste receptors to identify compounds that block bitter taste |
WO2003054172A2 (en) | 2002-01-17 | 2003-07-03 | Lonza Biologics Plc. | Glutamine-auxothrophic human cells capable of producing proteins and capable of growing in a glutamine-free medium |
WO2003062394A2 (en) | 2002-01-22 | 2003-07-31 | Cold Spring Harbor Laboratory | Methods and compositions for rna interference |
US8329980B2 (en) | 2002-02-20 | 2012-12-11 | Erickson Jeffrey P | Transgenic production in bovine saliva |
US7772459B2 (en) | 2002-02-20 | 2010-08-10 | Bellweather Farms | Transgenic production in saliva |
US9267166B2 (en) | 2002-04-25 | 2016-02-23 | Shire Human Genetic Therapies, Inc. | Treatment of α-galactosidase A deficiency |
US7833742B2 (en) | 2002-04-25 | 2010-11-16 | Shire Human Genetic Therapies, Inc. | Treatment of α-galactosidase A deficiency |
US9523113B2 (en) | 2002-04-25 | 2016-12-20 | Shire Human Genetic Therapies, Inc. | Treatment of α-galactosidase A deficiency |
US11116823B2 (en) | 2002-04-25 | 2021-09-14 | Takeda Pharmaceutical Company Limited | Treatment of α-galactosidase a deficiency |
EP2361631A1 (en) | 2002-04-25 | 2011-08-31 | Shire Human Genetic Therapies, Inc. | Treatment of alpha-galactosidase a deficiency |
US7459435B2 (en) | 2002-08-29 | 2008-12-02 | Hoffmann-La Roche Inc. | Treatment of disturbances of iron distribution |
US7459436B2 (en) | 2002-11-22 | 2008-12-02 | Hoffmann-La Roche Inc. | Treatment of disturbances of iron distribution |
EP2561887A2 (en) | 2003-01-14 | 2013-02-27 | Dana Farber Cancer Institute, Inc. | Cancer therapy sensitizer |
US8404455B2 (en) | 2003-08-06 | 2013-03-26 | Senomyx, Inc. | Chimeric T1R taste receptor polypeptides and nucleic acid sequences encoding and cell lines that express said chimeric T1R polypeptides |
US7888470B2 (en) | 2003-08-06 | 2011-02-15 | Senomyx, Inc. | Chimeric T1R taste receptor polypeptides and nucleic acid sequences encoding and cell lines that express said chimeric T1R polypeptides |
US10352929B2 (en) | 2003-08-06 | 2019-07-16 | Senomyx, Inc. | T1R hetero-oligomeric taste receptors, cell lines that express said receptors, and taste compounds |
US10557845B2 (en) | 2003-08-06 | 2020-02-11 | Firmenich Incorporated | Flavors, flavor modifiers, tastants, taste enhancers, umami or sweet tastants, and/or enhancers and use thereof |
US9091686B2 (en) | 2003-08-06 | 2015-07-28 | Senomyx, Inc. | Chimeric T1R taste receptor polypeptides and nucleic acid sequences encoding and cell lines that express said chimeric T1R polypeptides |
US10060909B2 (en) | 2003-08-06 | 2018-08-28 | Senomyx, Inc. | Flavors, flavor modifiers, tastants, taste enhancers, umami or sweet tastants, and/or enhancers and use thereof |
US11268952B2 (en) | 2003-08-06 | 2022-03-08 | Firmenich Incorporated | Flavors, flavor modifiers, tastants, taste enhancers, umami or sweet tastants, and/or enhancers and use thereof |
US9459250B2 (en) | 2003-08-06 | 2016-10-04 | Senomyx, Inc. | Use of T1R3 venus flytrap region polypeptide to screen for taste modulators |
EP2329714A1 (en) | 2004-08-03 | 2011-06-08 | Biogen Idec MA Inc. | Influence of TAJ in the neuronal functions |
EP2298897A1 (en) | 2004-09-02 | 2011-03-23 | Yale University | Regulation of oncogenes by microRNAs |
US7741306B2 (en) | 2004-09-02 | 2010-06-22 | Yale University | Regulation of oncogenes by microRNAs |
US7893034B2 (en) | 2004-09-02 | 2011-02-22 | Yale University | Regulation of oncogenes by microRNAs |
WO2006028967A2 (en) | 2004-09-02 | 2006-03-16 | Yale University | Regulation of oncogenes by micrornas |
EP2338994A1 (en) | 2004-09-02 | 2011-06-29 | Yale University | Regulation of oncogenes by microRNAs |
EP2338993A1 (en) | 2004-09-02 | 2011-06-29 | Yale University | Regulation of oncogenes by microRNAs |
EP2932982A1 (en) | 2005-05-17 | 2015-10-21 | Amicus Therapeutics, Inc. | A method for the treatment of pompe disease using 1-deoxynojirimycin and derivatives |
EP3441090A1 (en) | 2005-05-17 | 2019-02-13 | Amicus Therapeutics, Inc. | A method for the treatment of pompe disease using 1-deoxynojirimycin and derivatives |
EP3782655A1 (en) | 2005-05-17 | 2021-02-24 | Amicus Therapeutics, Inc. | A method for the treatment of pompe disease using 1-deoxynojirimycin and derivatives |
US8354384B2 (en) | 2005-06-23 | 2013-01-15 | Yale University | Anti-aging micrornas |
EP3031470A2 (en) | 2005-09-09 | 2016-06-15 | The Johns Hopkins University | Manipulation of regulatory t cell and dc function by targeting neuritin gene using antibodies, agonists and antagonists |
EP3312194A1 (en) | 2005-10-20 | 2018-04-25 | Senomyx, Inc. | Cell lines expressing chimeric human sweet-umami and umami-sweet taste receptors |
WO2007047988A2 (en) | 2005-10-20 | 2007-04-26 | Senomyx, Inc. | Chimeric human sweet-umami and umami-sweet taste receptors |
US7749730B2 (en) | 2005-11-03 | 2010-07-06 | Redpoint Bio Corporation | High throughput screening assay for the TRPM5 ion channel |
US9254312B2 (en) | 2006-01-27 | 2016-02-09 | Hannelore Ehrenreich | Method for the treatment and/or prophylaxis of multiple sclerosis, and use of erythropoietin for the manufacture of a medicament for the intermittent treatment and/or intermittent prophylaxis of multiple sclerosis |
EP2319530A1 (en) | 2006-01-27 | 2011-05-11 | Hannelore Ehrenreich | Method for treating and/or preventing multiple sclerosis, and use of erythropoietin in the production of a drug for intermittent treatment and/or intermittent prevention of multiple sclerosis |
US9072313B2 (en) | 2006-04-21 | 2015-07-07 | Senomyx, Inc. | Comestible compositions comprising high potency savory flavorants, and processes for producing them |
US7674594B2 (en) | 2006-07-27 | 2010-03-09 | Redpoint Bio Corporation | Screening assay for inhibitors of TRPA1 activation by a lower alkyl phenol |
WO2008057470A2 (en) | 2006-11-01 | 2008-05-15 | Senomyx, Inc. | Identification of bitter ligands that specifically activate human t2r receptors and related assays for identifying human bitter taste modulators |
US9029383B2 (en) | 2007-05-11 | 2015-05-12 | The Trustees Of The University Of Pennsylvania | Methods of treatment of skin ulcers |
EP2977452A2 (en) | 2007-05-11 | 2016-01-27 | Thomas Jefferson University | Methods of treatment and prevention of neurodegenerative diseases and disorders |
WO2008140449A1 (en) | 2007-05-11 | 2008-11-20 | Thomas Jefferson University | Methods of treatment and prevention of neurodegenerative diseases and disorders |
US8138317B2 (en) | 2007-07-17 | 2012-03-20 | Hoffmann-La Roche Inc. | Purification of pegylated polypeptides |
US8889837B2 (en) | 2007-07-17 | 2014-11-18 | Hoffman-La Roche Inc. | Purification of pegylated polypeptides |
US8795533B2 (en) | 2007-07-17 | 2014-08-05 | Hoffmann-La Roche Inc. | Chromatographic methods |
US9180165B2 (en) | 2007-07-19 | 2015-11-10 | Hannelore Ehrenreich | Use of EPO receptor activation or stimulation for the improvement of the EDSS score in patients with multiple sclerosis |
US9057727B2 (en) | 2007-08-01 | 2015-06-16 | The General Hospital Corporation | Screening methods using G-protein coupled receptors and related compositions |
EP3176263A1 (en) * | 2007-08-10 | 2017-06-07 | Toto Ltd. | Method of producing recombinant mammalian cells |
EP2487169A1 (en) | 2007-08-21 | 2012-08-15 | Senomyx Inc. | Compounds that inhibit (block) bitter taste in compositions and use thereof |
EP3216800A1 (en) | 2008-09-26 | 2017-09-13 | Ambrx, Inc. | Modified animal erythropoietin polypeptides and their uses |
US8110185B2 (en) | 2008-10-03 | 2012-02-07 | St. Michael's Hospital | Method for preventing and treating cardiovascular diseases with BRCA1 |
US8211655B2 (en) | 2009-02-12 | 2012-07-03 | Discoverx Corporation | Wild-type receptor assays |
WO2011035914A1 (en) | 2009-09-23 | 2011-03-31 | Biogenerix Ag | Process for the purification of recombinant human erythropoietin (epo), epo thus purified and pharmaceutical compositions comprising same |
US9492508B2 (en) | 2010-05-13 | 2016-11-15 | The General Hospital Corporation | Parathyroid hormone analogs and uses thereof |
WO2012035037A1 (en) | 2010-09-14 | 2012-03-22 | F. Hoffmann-La Roche Ag | Method for purifying pegylated erythropoietin |
US10273277B2 (en) | 2010-09-14 | 2019-04-30 | Hoffmann-La Roche Inc. | Method for purifying PEGylated erythropoietin |
WO2012075337A2 (en) | 2010-12-01 | 2012-06-07 | Spinal Modulation, Inc. | Directed delivery of agents to neural anatomy |
WO2013003697A1 (en) | 2011-06-30 | 2013-01-03 | Trustees Of Boston University | Method for controlling tumor growth, angiogenesis and metastasis using immunoglobulin containing and proline rich receptor-1 (igpr-1) |
WO2013020044A1 (en) | 2011-08-03 | 2013-02-07 | The Charlotte-Mecklenburg Hospital Authority D/B/A Carolinas Medical Center | Treatment of fibrosis using microrna-19b |
US10066001B2 (en) | 2013-03-15 | 2018-09-04 | Apotex Inc. | Enhanced liquid formulation stability of erythropoietin alpha through purification processing |
US10196601B2 (en) | 2013-08-20 | 2019-02-05 | Lek Pharmaceuticals D.D. | Cell culture medium and process for controlling α-amidation and/or C-terminal amino acid cleavage of polypeptides |
WO2016044271A2 (en) | 2014-09-15 | 2016-03-24 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation |
US11390885B2 (en) | 2014-09-15 | 2022-07-19 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (SCNT) efficiency by removing histone H3-lysine trimethylation |
WO2018011381A1 (en) | 2016-07-15 | 2018-01-18 | F. Hoffmann-La Roche Ag | Method for purifying pegylated erythropoietin |
WO2019129878A1 (en) | 2017-12-29 | 2019-07-04 | F. Hoffmann-La Roche Ag | Process for providing pegylated protein composition |
WO2019129877A1 (en) | 2017-12-29 | 2019-07-04 | F. Hoffmann-La Roche Ag | Process for providing pegylated protein composition |
WO2019129876A1 (en) | 2017-12-29 | 2019-07-04 | F. Hoffmann-La Roche Ag | Process for providing pegylated protein composition |
US11518781B2 (en) | 2017-12-29 | 2022-12-06 | Hoffmann-La Roche Inc. | Process for providing PEGylated protein composition |
WO2022159414A1 (en) | 2021-01-22 | 2022-07-28 | University Of Rochester | Erythropoietin for gastroinfestinal dysfunction |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0750044B1 (en) | DNA constructs and transfection of cells therewith for homologous recombination | |
US6537542B1 (en) | Targeted introduction of DNA into primary or secondary cells and their use for gene therapy and protein production | |
US6670178B1 (en) | In Vivo production and delivery of insulinotropin for gene therapy | |
US6048729A (en) | In vivo protein production and delivery system for gene therapy | |
AU689455B2 (en) | Activating expression of an amplifying endogenous gene by homologous recombination | |
US6565844B1 (en) | Protein production and protein delivery | |
US6054288A (en) | In vivo protein production and delivery system for gene therapy | |
US6692737B1 (en) | In vivo protein production and delivery system for gene therapy | |
AU710255B2 (en) | Transfection of vertebrate cells e.g. by homologous recombination | |
AU753372B2 (en) | Transfection of vertebrate cells e.g. by homologous recombination | |
US6531124B1 (en) | In vivo production and delivery of insulinotropin for gene therapy | |
NZ270805A (en) | Transfected primary and secondary cells of vertebrate origin and their use in gene therapy |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AU CA JP KR |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AU CA JP KR |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2122991 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1992924367 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1992924367 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 1996 737264 Country of ref document: US Date of ref document: 19961126 Kind code of ref document: A |
|
WWG | Wipo information: grant in national office |
Ref document number: 1992924367 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1992924367 Country of ref document: EP |