WO1993008305A1 - Method of sequencing double stranded dna - Google Patents

Method of sequencing double stranded dna Download PDF

Info

Publication number
WO1993008305A1
WO1993008305A1 PCT/EP1992/002421 EP9202421W WO9308305A1 WO 1993008305 A1 WO1993008305 A1 WO 1993008305A1 EP 9202421 W EP9202421 W EP 9202421W WO 9308305 A1 WO9308305 A1 WO 9308305A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequencing
primers
strands
solid support
support
Prior art date
Application number
PCT/EP1992/002421
Other languages
French (fr)
Inventor
Erik Hornes
Original Assignee
Dynal As
Holmes, Michael, John
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dynal As, Holmes, Michael, John filed Critical Dynal As
Publication of WO1993008305A1 publication Critical patent/WO1993008305A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing

Definitions

  • This invention relates to a method of sequencing both strands of double stranded DNA.
  • Solid phase methods have proven to be very useful in molecular biology, in areas such as peptide synthesis, peptide sequencing and DNA synthesis. A large number of instruments are commercially available utilizing this technique. The advantage with a solid phase approach is usually a combination of good yields, reproducable reactions and easy automation.
  • WO 89/09282 describes a method of sequencing one strand of double stranded DNA whereby the latter is immobilised via one terminus of one of the two strands and subjected to strand separation prior to sequencing the immobilised strand.
  • the immobilized single stranded DNA for sequencing may also be produced by the polymerase chain reaction (PCR) technique whereby relatively small amounts of the DNA to be sequenced can be greatly amplified enzymically and according to a modification, also immobilized on a solid support.
  • PCR polymerase chain reaction
  • two oligonucleotide primers are selected which hybridise to respective sequences at or near the 5'-ends of the coding and non-coding strands of the DNA to be amplified; after annealing to hybridise the primers to the target DNA, polymerisation is then effected using a suitable polymerase to produce a copy of each of the coding and non-coding strands incorporating the primers whereupon strand separation is effected, e.g. by conventional melting for example at 90°C.
  • the separated new strands together with the original strands can serve as templates for a further cycle of annealing, polymerisation and strand separation. It will be seen that if this procedure is continued through a number of repeated cycles, the target DNA will be amplified exponentially while other DNA present will largely be unaffected. Recently, a thermophilic polymerase has become available, Taq 1, which can withstand the melting temperature needed for strand separation, thus avoiding the need to add polymerase at each repeat of the cycle as when using the Klenow polymerase used originally in PCR.
  • the amplified DNA will be produced with means for immobilisation.
  • the PCR technique can produce directly immobilized single stranded DNA ready for sequencing and may produce this directly from a bacterial colony by a method which is easy to automate and does not involve restriction cleavages and plasmid purification.
  • a particular advantage of the use of a solid support in any of the reactions here concerned is the ease of separation from the reaction medium.
  • the reaction medium can be readily removed by washing and a different polymerase introduced in an optimal buffer to begin the sequencing stage, e.g.
  • the optimal concentrations of nucleotides and dideoxynucleotides can be maintained for sequencing by the Sanger method, independently of the concentrations used in the PCR step.
  • the possibility of rigorous washing of the immobilized DNA provides more reproducible results in the sequencing stage.
  • the so-called 'walking primer 1 technique is facilitated in Sanger sequencing whereby a primer can be used to sequence the first 500 base pairs of a long DNA molecule and after washing-, the unchanged immobilized DNA is annealed to a primer initiating sequencing of the next 500 base pairs (using sequence information from the first stage) , this procedure being continued until the whole DNA molecule has been sequenced.
  • a method of sequencing both strands of double stranded DNA wherein target DNA is subjected to at least one cycle of PCR using a pair of primers one of which is provided with a functional group for subsequent attachment to a first solid support or is already attached to said support and the other primer is provided with a different functional grouping permitting attachment to a second solid support, reacting the double stranded PCR products with said support or supports and separating the immobilised strands from each other and from the reaction solution, followed by sequencing of each of the said strands.
  • both primers preferably carry functional groups.
  • the target DNA may be' from, for example, genomic or plasmid DNA or cDNA prepared in situ from target mRNA.
  • the target DNA may be double stranded or single stranded since the PCR reaction will produce double stranded DNA from any single stranded target DNA. It will be appreciated that where the target DNA is single stranded, sequencing of a complementary strand will provide a check on the sequence information from the primary strand.
  • Nested primers may also be used advantageously, that is, a first primer pair may be used to amplify the target DNA initially and a second primer pair may then be introduced for the final PCR cycles in order to provide additional selectivity in amplifying the correct target DNA.
  • the PCR primers used in accordance with the invention may, in that case, only be used in the final PCR stage. Nested primer PCR techniques are described in the literature (see for example Wahlberg et al. , P.N.A.S. 1990, 82: 6569-73) .
  • the target DNA may vary considerably in length, from a few base pairs to up to for example 30 to 40 thousand base pairs depending on the application.
  • the functional groups could be any groupings which 'can be incorporated into deoxynucleotides and which have a strong interaction to a substance which can be immobilized on a solid-support. Examples of such groups include biotin - avidin, biotin - streptavidin, and cy ⁇ teine - thiol groups, or any suitable hapten-anti- hapten binding pair.
  • a suitable functional group is thus biotin.
  • Suitable haptens in this regard include digoxigenin, dinitrophenol (DNP) , 3- nitro-4-hydroxy-5-iodophenylacetic acid (NIP) , 3-nitro- 4-hydroxy phenylacetic acid (NP) or modified nucleotides.
  • the anti-hapten may be a complete antibody, or an antibody fragment retaining binding activity e.g. F(ab) 2 ,Fab or Fv fragments.
  • the first of a pair of primers according to the invention may carry a biotin functional group, and the second a hapten such as digoxigenin, e.g.
  • first and second solid supports carrying avidin or streptavidin, and the anti- hapten (e.g. anti-digoxigenin) respectively.
  • first and second solid supports carrying avidin or streptavidin, and the anti- hapten (e.g. anti-digoxigenin) respectively.
  • Any conventional solid support material such as Sepharose (Pharmacia, Sweden) , magnetic beads, filters or capillaries, to which the substance can be sufficiently coupled for the present purposes, may be used. Magnetic beads are particularly preferred since they permit ready and simple separation of the immobilised DNA strands from solution.
  • the methods for coupling or immobilizing a functional group to such carrier material are well-known and need not be described in any detail herein. It is also possible to use surfaces of microtiter wells as a means for coating. Strand separation may be effected by conventional methods, such as by the use of alkali (e.g. 0.15M NaoH) or by heat treatment.
  • Sequencing may be effected by the Maxam Gilbert or, more preferably, primer extension methods such as the Sanger dideoxy method. Any of the conventional variations of these methods may be used but it is preferred to use the Sanger method with separate tubes for the A C G and T reactions with labelled primers or labelled nucleotides (e.g. with means enabling chemiluminescent or radioactive detection) . Alternatively the A C G and T reactions may be performed in a single tube, each dideoxy equivalent being differently labelled.
  • Solid-phase sequencing on an immobilised template is generally preferred according to the invention, although other methods may of course be used.
  • the DNA chains to be sequenced may be liberated from the inert support by, for example, treatment with formamide.
  • the mixture is contacted with said first solid support carrying a substance with affinity for the functional group carried by the first primer leading to directed immobilisation of DNA fragments carrying the functional group.
  • Single stranded DNA is obtained by melting the strands, either by alkali or heat treatment and the non-immobilised strand is eluted.
  • the first solid support carrying the immobilised strand is separated from the reaction mixture and the eluted strand is subsequently contacted, following if necessary appropriate washing and neutralisation steps, with the second solid support which carries a substance with affinity for the functional group provided on the second primer.
  • oligonucleotides For Sanger-type sequencing, eg. standard sequencing or cycle sequencing, general forward or reverse sequencing primers may then be annealed to the two resulting immobilised single stranded templates and sequencing reactions performed under standard conditions.
  • the extended oligonucleotides can be labelled using different strategies, eg. radio-isotope ⁇ , chemiluminesence or fluoresence which may be incorporated either during the extension or as a labelled primer.
  • the newly synthesized labelled oligonucleotides are eluted by another melting step leaving the template available for the next sequencing reaction.
  • the annealing and extension is repeated to obtain specific fragments for all four nucleotides and the four samples are loaded onto sequencing gels.
  • kits form a further aspect of the invention.
  • the invention provides a kit for the sequencing of both strands of double stranded DNA comprising
  • a pair of PCR primers the first of which is provided with a functional group for subsequent attachment to a first solid support, preferably magnetic particles, or is already attached to said support; and the second of which is provided with a different functional grouping permitting attachment to a second solid support;
  • first and second solid supports preferably magnetic particles, carrying groups binding with the functional groups provided on said first and second primers; or said second support only;
  • the primers may be specific for the target DNA or may be standard PCR primers.
  • the solid phase approach of the present invention is suitable for both manual and automated sequencing and may be applied to plasmid DNA obtained directly from bacterial colonies through the PCR. It thus provides an integrated method for template purification, strand separation and sequencing of both strands of the DNA template; amplified double-stranded DNA, "labelled" on each strand through the functional groups carried on the primers may, without purification, be selectively captured and immobilised on a suitable support, preferably magnetic beads (e.g. Dynabeads of Dynal AS) , followed by strand separation, immobilisation of the second strand and simultaneous sequencing of the two separated immobilised strands.
  • the solid-phase approach ensures that the amplification and sequencing reactions can be performed under optimal conditions.
  • the primers are identical to regions within the lac Z gene which common cloning vectors such as pGEM 7Z f (+) contain.
  • Coating buffer is PBS pH 7.4 (0.0075M)
  • the sheep anti-mouse beads were washed once in PBS buffer.
  • the coated beads were washed twice with PBS-buffer and stored in PBS-buffer containing 0.1 % BSA, 0.02% disodium azide.
  • step 1 40 ⁇ l of the amplified PCR product was added to the 40 ⁇ l of prewashed beads (step 1) and incubated at room temperature for 15 minutes keeping the beads suspended.
  • the beads carrying the immobilized PCR product were washed once with 40 ⁇ l 2 x B & W.
  • the supernatant containing the eluted strand was transferred to a new Eppendorf tube and a new treatment of 8 ⁇ l O.I M NaOH was performed.
  • the Dynabeads with the immobilized biotinylated strand were washed once with 50 ⁇ l O.IM NaOH, once with 40 ⁇ l B & W, and once with 50 ⁇ l TE buffer. The supernatant was removed and the volume was adjusted with distilled water according to the template volume in the sequencing protocol. 7. Immobilizing the digoxigenin labelled strand
  • step 6 The saved supernatant 2 x 8 ⁇ l (step 6) was neutralized with an equal volume of O.IM HC1 and 2 ⁇ l of 1M tris-HCl pH7.4. The volume was adjusted to 50 ⁇ l using PBS pH7.4.
  • Dynabeads anti-digoxigenin (step 2) were washed once in PBS and resuspended in 50 ⁇ l PBS and added to the neutralized digoxigenin labelled strand solution. The' mixture was incubated at room temperature for 30 minutes with occasional mixing after washing once with lOO ⁇ l PBS and 50 ⁇ l 1 x TE buffer the beads were resuspended in water according to the template in the sequencing reaction.
  • Annealing was by heating for 2 minutes at 65°C then cooling slowly to ⁇ 35°C. The rest of the protocol followed the manufacturer's instructions.
  • Example 1 The procedure of Example 1 is illustrated schematically in Figure 1.

Abstract

The present invention provides a method of sequencing both strands of double stranded DNA wherein target DNA is subjected to at least one cycle of PCR using a pair of primers one of which is provided with a functional group for subsequent attachment to a first solid support or is already attached to said support and the other primer is provided with a different functional grouping permitting attachment to a second solid support, reacting the double stranded PCR products with said support or supports and separating the immobilised strands from each other and from the reaction solution, followed by sequencing of each of the said strands. Also provided is a kit for use in such a method.

Description

Method of sequencing double stranded DNA
This invention relates to a method of sequencing both strands of double stranded DNA.
There is an increasing demand for reliable sequencing of DNA, particularly in relation to the human genome project and the identification of DNA associated with pathological conditions. It is particularly desirable that such sequencing methods lend themselves to automation.
Recently, many technical improvements have been reported, although the major contributions concern the data evaluation, i.e. computer software. A filter method to prepare single stranded phage DNA has been described (Kristnesen et al (1987)), which may be developed into an automated procedure. Attempts to develop automated sequencing reactions by a centrifugal reagent handling device have also been described (Martin et al (1985) ) as well as image processing programs for the detection of the bands on the radiograms (Elder et al (1985) ) . However, the most common approach has been to automate techniques with the aid of robots. Using such a strategy, systems for high-speed sequencing ( ada et al 1983)) and DNA template preparations (De Bonville et al 1987)) have been introduced.
A novel approach to automize the electrophoresis step has been described by several groups (Smith et al (1986), Ansorge et al (1987) and Prober et al (1987)) taking advantage of fluorescence instead of isotopes for labelling the DNA fragments. With these systems on-line detection can be achieved, which makes it possible to combine the three operations electrophoresis, detection and data handling into a single automated station. Such systems are therefore likely to be included in megabase sequencing strategies. To obtain a completely automated sequencing protocol, it is therefore essential to also develop suitable automated methods for the first two operations (template preparation and sequencing reactions) . For the latter operation a strategy involving solid phase techniques would facilitate automated handling of liquids in microliter quantities, which would be suitable for automated protocols.
Solid phase methods have proven to be very useful in molecular biology, in areas such as peptide synthesis, peptide sequencing and DNA synthesis. A large number of instruments are commercially available utilizing this technique. The advantage with a solid phase approach is usually a combination of good yields, reproducable reactions and easy automation.
At present there are, however, few reports on solid phase approaches to handling manipulatations of cloned DNA sequences for applications such as DNA sequencing reactions, site-directed manipulations or cDNA synthesis. DNA sequencing of oligonucleotides on anion-exchange supports (Rosenthal et al, 1985) has been described, but most attempts to automate DNA sequencing have been focused on the use of laboratory robots (Martin et al, 1985, and Wada et al, 1987).
WO 89/09282 describes a method of sequencing one strand of double stranded DNA whereby the latter is immobilised via one terminus of one of the two strands and subjected to strand separation prior to sequencing the immobilised strand.
The immobilized single stranded DNA for sequencing may also be produced by the polymerase chain reaction (PCR) technique whereby relatively small amounts of the DNA to be sequenced can be greatly amplified enzymically and according to a modification, also immobilized on a solid support. In the PCR technique, two oligonucleotide primers are selected which hybridise to respective sequences at or near the 5'-ends of the coding and non-coding strands of the DNA to be amplified; after annealing to hybridise the primers to the target DNA, polymerisation is then effected using a suitable polymerase to produce a copy of each of the coding and non-coding strands incorporating the primers whereupon strand separation is effected, e.g. by conventional melting for example at 90°C. If an excess of the primer oligonucleotides is included in the medium as well as the four nucleotides required for synthesis, the separated new strands together with the original strands can serve as templates for a further cycle of annealing, polymerisation and strand separation. It will be seen that if this procedure is continued through a number of repeated cycles, the target DNA will be amplified exponentially while other DNA present will largely be unaffected. Recently, a thermophilic polymerase has become available, Taq 1, which can withstand the melting temperature needed for strand separation, thus avoiding the need to add polymerase at each repeat of the cycle as when using the Klenow polymerase used originally in PCR.
If one of the oligonucleotide primers is attached to a solid support such as a particle or, more preferably, carries means permitting attachment to a solid support such as biotin, the amplified DNA will be produced with means for immobilisation. Thus, the PCR technique can produce directly immobilized single stranded DNA ready for sequencing and may produce this directly from a bacterial colony by a method which is easy to automate and does not involve restriction cleavages and plasmid purification. A particular advantage of the use of a solid support in any of the reactions here concerned is the ease of separation from the reaction medium. Thus, in the PCR stage, the reaction medium can be readily removed by washing and a different polymerase introduced in an optimal buffer to begin the sequencing stage, e.g. a conventional sequencing polymerase such as T7. Furthermore, the optimal concentrations of nucleotides and dideoxynucleotides can be maintained for sequencing by the Sanger method, independently of the concentrations used in the PCR step. The possibility of rigorous washing of the immobilized DNA provides more reproducible results in the sequencing stage. Furthermore, the so-called 'walking primer1 technique is facilitated in Sanger sequencing whereby a primer can be used to sequence the first 500 base pairs of a long DNA molecule and after washing-, the unchanged immobilized DNA is annealed to a primer initiating sequencing of the next 500 base pairs (using sequence information from the first stage) , this procedure being continued until the whole DNA molecule has been sequenced.
In order to improve the reliability of the sequence information so obtained, it is possible to sequence the non-immobilised strand in the solution from which the immobilised strand has been removed. However, such a solution is normally at a high pH, due to the conventional use of sodium hydroxide in the strand separation stage, and has to be neutralised. Additionally, it is difficult to avoid diluting the solution containing the non-separated strand to a concentration optimal for sequencing.
We have found that it is possible to improve the sequencing of both strands of double stranded DNA by subjecting the target DNA to at least one cycle of a ' polymerase chain reaction (PCR) using a pair or primers each of which carries a different means of immobilisation so that the strands can be isolated separately for sequencing.
According to the present invention therefore there is provided a method of sequencing both strands of double stranded DNA wherein target DNA is subjected to at least one cycle of PCR using a pair of primers one of which is provided with a functional group for subsequent attachment to a first solid support or is already attached to said support and the other primer is provided with a different functional grouping permitting attachment to a second solid support, reacting the double stranded PCR products with said support or supports and separating the immobilised strands from each other and from the reaction solution, followed by sequencing of each of the said strands.
In the preferred method of the invention, both primers preferably carry functional groups.
The target DNA may be' from, for example, genomic or plasmid DNA or cDNA prepared in situ from target mRNA. The target DNA may be double stranded or single stranded since the PCR reaction will produce double stranded DNA from any single stranded target DNA. It will be appreciated that where the target DNA is single stranded, sequencing of a complementary strand will provide a check on the sequence information from the primary strand.
If the target DNA is present in very small quantities, it may be advantageous to subject the target DNA to several cycles of PCR before the immobilisation/separation procedure. Nested primers may also be used advantageously, that is, a first primer pair may be used to amplify the target DNA initially and a second primer pair may then be introduced for the final PCR cycles in order to provide additional selectivity in amplifying the correct target DNA. The PCR primers used in accordance with the invention may, in that case, only be used in the final PCR stage. Nested primer PCR techniques are described in the literature (see for example Wahlberg et al. , P.N.A.S. 1990, 82: 6569-73) .
The target DNA may vary considerably in length, from a few base pairs to up to for example 30 to 40 thousand base pairs depending on the application. The functional groups could be any groupings which 'can be incorporated into deoxynucleotides and which have a strong interaction to a substance which can be immobilized on a solid-support. Examples of such groups include biotin - avidin, biotin - streptavidin, and cyεteine - thiol groups, or any suitable hapten-anti- hapten binding pair. One example of a suitable functional group is thus biotin. Suitable haptens in this regard include digoxigenin, dinitrophenol (DNP) , 3- nitro-4-hydroxy-5-iodophenylacetic acid (NIP) , 3-nitro- 4-hydroxy phenylacetic acid (NP) or modified nucleotides. The anti-hapten may be a complete antibody, or an antibody fragment retaining binding activity e.g. F(ab)2,Fab or Fv fragments. Thus for example the first of a pair of primers according to the invention may carry a biotin functional group, and the second a hapten such as digoxigenin, e.g. at the 5' end, and may be immobilised on first and second solid supports carrying avidin or streptavidin, and the anti- hapten (e.g. anti-digoxigenin) respectively. Methods for attaching such functional groups to the primers, and their corresponding binding partner to the solid supports are well known in the art.
Any conventional solid support material, such as Sepharose (Pharmacia, Sweden) , magnetic beads, filters or capillaries, to which the substance can be sufficiently coupled for the present purposes, may be used. Magnetic beads are particularly preferred since they permit ready and simple separation of the immobilised DNA strands from solution. The methods for coupling or immobilizing a functional group to such carrier material are well-known and need not be described in any detail herein. It is also possible to use surfaces of microtiter wells as a means for coating. Strand separation may be effected by conventional methods, such as by the use of alkali (e.g. 0.15M NaoH) or by heat treatment. Sequencing may be effected by the Maxam Gilbert or, more preferably, primer extension methods such as the Sanger dideoxy method. Any of the conventional variations of these methods may be used but it is preferred to use the Sanger method with separate tubes for the A C G and T reactions with labelled primers or labelled nucleotides (e.g. with means enabling chemiluminescent or radioactive detection) . Alternatively the A C G and T reactions may be performed in a single tube, each dideoxy equivalent being differently labelled.
Solid-phase sequencing on an immobilised template is generally preferred according to the invention, although other methods may of course be used. In this case the DNA chains to be sequenced may be liberated from the inert support by, for example, treatment with formamide.
According to one preferred method of the invention, following the PCR step using two differentially- functionalised primers, the mixture is contacted with said first solid support carrying a substance with affinity for the functional group carried by the first primer leading to directed immobilisation of DNA fragments carrying the functional group. Single stranded DNA is obtained by melting the strands, either by alkali or heat treatment and the non-immobilised strand is eluted. The first solid support carrying the immobilised strand is separated from the reaction mixture and the eluted strand is subsequently contacted, following if necessary appropriate washing and neutralisation steps, with the second solid support which carries a substance with affinity for the functional group provided on the second primer.
For Sanger-type sequencing, eg. standard sequencing or cycle sequencing, general forward or reverse sequencing primers may then be annealed to the two resulting immobilised single stranded templates and sequencing reactions performed under standard conditions. The extended oligonucleotides can be labelled using different strategies, eg. radio-isotopeε, chemiluminesence or fluoresence which may be incorporated either during the extension or as a labelled primer. The newly synthesized labelled oligonucleotides are eluted by another melting step leaving the template available for the next sequencing reaction. The annealing and extension is repeated to obtain specific fragments for all four nucleotides and the four samples are loaded onto sequencing gels.
The various reactants in the method of the invention may conveniently be supplied in kit form. Such kits form a further aspect of the invention.
Thus in a further aspect the invention provides a kit for the sequencing of both strands of double stranded DNA comprising
(a) a pair of PCR primers, the first of which is provided with a functional group for subsequent attachment to a first solid support, preferably magnetic particles, or is already attached to said support; and the second of which is provided with a different functional grouping permitting attachment to a second solid support;
(b) either first and second solid supports, preferably magnetic particles, carrying groups binding with the functional groups provided on said first and second primers; or said second support only;
(c) one or more polymerases; and one or more of:
(d) appropriate buffers;
(e) dideoxynucleotides ddT, ddA, ddC and ddG; (f) dideoxynucleotides or an oligonucleotide, each carrying, or adapted to carry a label.
The primers may be specific for the target DNA or may be standard PCR primers.
By permitting sequencing of both strands of the double stranded DNA under identical conditions, it is possible to obtain improved accuracy in sequencing which is of value in the identification of unknown DNA molecules, for example in diagnosis or basic research.
The solid phase approach of the present invention is suitable for both manual and automated sequencing and may be applied to plasmid DNA obtained directly from bacterial colonies through the PCR. It thus provides an integrated method for template purification, strand separation and sequencing of both strands of the DNA template; amplified double-stranded DNA, "labelled" on each strand through the functional groups carried on the primers may, without purification, be selectively captured and immobilised on a suitable support, preferably magnetic beads (e.g. Dynabeads of Dynal AS) , followed by strand separation, immobilisation of the second strand and simultaneous sequencing of the two separated immobilised strands. The solid-phase approach ensures that the amplification and sequencing reactions can be performed under optimal conditions.
The invention will now be described by means of the following non-limiting Example.
Example 1
Solid phase sequencing of both strands of an abrin gene clone using Dynabeads M280-streptavidin and Dynabeads coated with anti-digoxigenin as solid supports.
Materials:
(a) Plasmid clone : pGA7.3
(G Evensen et al, Journal of Biological Chemistry 266 6048-6052,1991) comprising an abrin A gene inserted in vector pGEM 7Z f (+) (Promega)
(b) Solid supports
(1) Dynabeads M280-Streptavidin (Dynal A.S. Oslo, Norway)
(2) Dynabeads coated with anti-digoxigenin.
(c) Anti-digoxigenin (Catalogue No. 1333062 Boeringer Mannheim)
(d) Primers used in the PCR amplification
5'digoxigenin - GCTTCCGGCTCGTATGTTGTGTG 3 ' 5'biotin - AAAGGGGGATGTGCTGCAAGGCG 3'
The primers are identical to regions within the lac Z gene which common cloning vectors such as pGEM 7Z f (+) contain.
(e) Buffers
2 x B & W = lO M Tris HCl (pH 7.5) lmM EDTA 2.0M NaCl
20 X PBS = NaH2P04.H20 3.12g
NaHP04.2H20 19.6g NaCl 0.15M 162g dH20 to 11 adjust pH with NaOH to 7.4 1 x stock is working solution
(f) DNA Sequencincr Kit
Sequenase version 2.0 DNA sequencing kit from USB (United States Biochemical Corporation) Methods
1. Preparation of Dynabeads M-280 Streptavdin
20μl (200μg) of the Dynabeads were washed once in 20μl of 2 x B & W buffer using a Magnet (Dynal MPC- E) and an Eppendorf tube. After washing, the beads were resuspended in 40μl 2 x B & W buffer.
2. Preparation of anti-digoxigenin coated Sheep-anti- Mouse IgG Dynabeads M-280
Concentration of antibodies is 3.4 μg per mg beads. Coating buffer is PBS pH 7.4 (0.0075M)
Protocol:
1. The sheep anti-mouse beads were washed once in PBS buffer.
2. 3.4 μg antibodies/mg beads were used at a concentration of 100 mg beads/ml PBS buffer. The solution was allowed to rotate at a 4°C.
3. The coated beads were washed twice with PBS-buffer and stored in PBS-buffer containing 0.1 % BSA, 0.02% disodium azide.
3. PCR Conditions
(i) 5 p ol of each labelled primer (carrying either biotin or digoxigenin)
(ii) vector pGA7.3
(iii) The Perkin Elmer Cetus Ampli taq kit was used
(iv) PCR cycles 96°C 0.5 minute
65°C 1.0 minute 72*C 2.0 minute (at a volume of 50μl)
(v) A Hybaid thermo cycler was used.
4. Immobilization of the PCR product
40μl of the amplified PCR product was added to the 40μl of prewashed beads (step 1) and incubated at room temperature for 15 minutes keeping the beads suspended.
5. Melting the DNA duplex
The beads carrying the immobilized PCR product were washed once with 40μl 2 x B & W.
After the supernatant was removed, 8μl of O.IM NaOH was added and incubated at room temperature for 10 minutes.
6. Separating the DNA strand
Using the MPC-E the supernatant containing the eluted strand was transferred to a new Eppendorf tube and a new treatment of 8μl O.I M NaOH was performed.
The Dynabeads with the immobilized biotinylated strand were washed once with 50μl O.IM NaOH, once with 40μl B & W, and once with 50μl TE buffer. The supernatant was removed and the volume was adjusted with distilled water according to the template volume in the sequencing protocol. 7. Immobilizing the digoxigenin labelled strand
The saved supernatant 2 x 8μl (step 6) was neutralized with an equal volume of O.IM HC1 and 2μl of 1M tris-HCl pH7.4. The volume was adjusted to 50μl using PBS pH7.4.
500μg Dynabeads anti-digoxigenin (step 2) were washed once in PBS and resuspended in 50μl PBS and added to the neutralized digoxigenin labelled strand solution. The' mixture was incubated at room temperature for 30 minutes with occasional mixing after washing once with lOOμl PBS and 50μl 1 x TE buffer the beads were resuspended in water according to the template in the sequencing reaction.
8. Sequencing reaction
The manufacturer's recommended protocol was followed (USB) .
(a) annealing mixture:
I) 7μl of the biotin labelled strand immobilised on Dynabeads M280 Streptavidin (200μg) was added to lul reverse sequencing primer and 2μl sequencing buffer. Annealing was carried out by heating for 2 minute at 65°C then cooling slowly to ( 35"C.
II) 7μl of Dynabeads anti-digoxigenin carrying immobilized digoxigenin labelled primer was added to lμl forward sequencing primer and 2μl sequencing buffer.
Annealing was by heating for 2 minutes at 65°C then cooling slowly to <35°C. The rest of the protocol followed the manufacturer's instructions.
After completing the reaction the samples were heated to 75°C for 2 minutes immediately before loading. After magnetic separation 4μl of each reaction was loaded on to a sequencing gel.
The procedure of Example 1 is illustrated schematically in Figure 1.

Claims

1. A method of sequencing both strands of double stranded DNA wherein target DNA is subjected to at least one cycle of PCR using a pair of primers one of which is provided with a functional group for subsequent attachment to a first solid support or is already attached to said support and the other primer is provided with a different functional grouping permitting attachment to a second solid support, reacting the double stranded PCR products with said support or supports and separating the immobilised strands from each other and from the reaction solution, followed by sequencing of each of the said strands.
2. A method as claimed in claim 1 wherein each of said pair of primers is provided with a functional group for attachment to a solid support, said functional groups being different from each other.
3. A method as claimed in claim 1 or claim 2 wherein the PCR step is performed using nested primers.
4. A method as claimed in claim 3 wherein only the inner pair of nested primers are provided with said functional groups.
5. A method as claimed in any one of claims 1 to 4 wherein the functional group is a biotin or thiol group or a hapten, and said solid supports carry groupings binding thereto.
6. A method as claimed in claim 5 wherein one of said pair of primers carries a biotin functional group and the other carries digoxigenin.
7. A method as claimed in claim 5 wherein the solid support is in particulate form or is a microtitre well.
8. A method as claimed in claim 5 wherein the solid support is in the form of magnetic beads.
9. A method as claimed in any one of claims 1 to 8 wherein sequencing is effected by a primer extension method.
10. A method as claimed in any one of claims 1 to 9 wherein sequencing is effected by the Sanger method.
11. A kit for the sequencing of both strands of double stranded DNA comprising
(a) a pair of PCR primers, the first of which is provided with a functional group for subsequent attachment to a first solid support, or is already attached to said support; and the second of which is provided with a different functional grouping permitting attachment to a second solid support;
(b) either first and second solid supports carrying groups binding with the functional groups provided on said first and second primers; or said second support only;
(c) one or more poly erases; and one or more of:
(d) appropriate buffers;
(e) dideoxynucleotides ddT, ddA, ddC and ddG;
(f) dideoxynucleotides or an oligonucleotide, each carrying, or adapted to carry a label.
PCT/EP1992/002421 1991-10-17 1992-10-16 Method of sequencing double stranded dna WO1993008305A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB919122060A GB9122060D0 (en) 1991-10-17 1991-10-17 Method of sequencing double stranded dna
GB9122060.8 1991-10-17

Publications (1)

Publication Number Publication Date
WO1993008305A1 true WO1993008305A1 (en) 1993-04-29

Family

ID=10703095

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1992/002421 WO1993008305A1 (en) 1991-10-17 1992-10-16 Method of sequencing double stranded dna

Country Status (3)

Country Link
AU (1) AU2787692A (en)
GB (1) GB9122060D0 (en)
WO (1) WO1993008305A1 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993020232A1 (en) * 1992-04-03 1993-10-14 Dynal As Method of sequencing
WO1993023562A1 (en) * 1992-05-12 1993-11-25 Cemu Bioteknik Ab Chemical method for the analysis of dna sequences
WO1994029443A1 (en) * 1993-06-11 1994-12-22 Mueller Manfred W Analysis of rna sequences by pcr
WO1997018328A1 (en) * 1995-11-16 1997-05-22 Pharmacia Biotech Ab A method of sequencing
WO1997041257A1 (en) * 1995-12-22 1997-11-06 Visible Genetics Inc. Method, compositions and kit for detection and identification of microorganisms
WO1997041258A1 (en) * 1996-05-01 1997-11-06 Visible Genetics Inc. Method for determination of nucleic acid sequences and diagnostic applications thereof
WO1997041259A1 (en) * 1996-05-01 1997-11-06 Visible Genetics Inc. Method for sequencing of nucleic acid polymers
WO1998012355A1 (en) * 1996-09-19 1998-03-26 Genetrace Systems Methods of preparing nucleic acids for mass spectrometric analysis
WO1998031833A1 (en) * 1997-01-15 1998-07-23 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
US5789168A (en) * 1996-05-01 1998-08-04 Visible Genetics Inc. Method for amplification and sequencing of nucleic acid polymers
US5965363A (en) * 1996-09-19 1999-10-12 Genetrace Systems Inc. Methods of preparing nucleic acids for mass spectrometric analysis
US6051378A (en) * 1996-03-04 2000-04-18 Genetrace Systems Inc. Methods of screening nucleic acids using mass spectrometry
US6083699A (en) * 1996-05-01 2000-07-04 Visible Genetics Inc. Method for bi-directional sequencing of nucleic acid polymers
US6104028A (en) * 1998-05-29 2000-08-15 Genetrace Systems Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
US6214555B1 (en) 1996-05-01 2001-04-10 Visible Genetics Inc. Method compositions and kit for detection
US6413718B1 (en) 1996-05-01 2002-07-02 Visible Genetics Inc. Method for sequencing of nucleic acid polymers
WO2002072879A2 (en) * 2001-02-09 2002-09-19 Axaron Bioscience Ag Production and use of random arrangements of clonal nuclear acid islands on a surface
US6787349B1 (en) 1999-11-19 2004-09-07 Hitachi Software Engineering Co., Ltd. Biochip reader and labeling reagent
US7222059B2 (en) 2001-11-15 2007-05-22 Siemens Medical Solutions Diagnostics Electrophoretic trace simulator
WO2023032192A1 (en) * 2021-09-06 2023-03-09 株式会社日立ハイテク Nucleotide sequence identification method

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3816934A1 (en) * 1988-05-18 1989-11-23 Ramalho Ortigao Jose Flavio NEW SEQUENCING METHOD FOR SINGLE OR DOUBLE-STROKEN NUCLEINE ACIDS AT FIXED PHASE
EP0371437A2 (en) * 1988-11-29 1990-06-06 Orion-Yhtymà„ Oy Method and reagent combination for determining nucleotide sequences
EP0437774A1 (en) * 1990-01-17 1991-07-24 Roche Diagnostics GmbH Process for the preparation of modified nucleic acids

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3816934A1 (en) * 1988-05-18 1989-11-23 Ramalho Ortigao Jose Flavio NEW SEQUENCING METHOD FOR SINGLE OR DOUBLE-STROKEN NUCLEINE ACIDS AT FIXED PHASE
EP0371437A2 (en) * 1988-11-29 1990-06-06 Orion-Yhtymà„ Oy Method and reagent combination for determining nucleotide sequences
EP0437774A1 (en) * 1990-01-17 1991-07-24 Roche Diagnostics GmbH Process for the preparation of modified nucleic acids

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA. vol. 86, April 1989, WASHINGTON US pages 2423 - 2427 D.J. KEMP ET AL. *

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993020232A1 (en) * 1992-04-03 1993-10-14 Dynal As Method of sequencing
WO1993023562A1 (en) * 1992-05-12 1993-11-25 Cemu Bioteknik Ab Chemical method for the analysis of dna sequences
US5534424A (en) * 1992-05-12 1996-07-09 Cemu Bioteknik Ab Chemical method for the analysis of DNA sequences
WO1994029443A1 (en) * 1993-06-11 1994-12-22 Mueller Manfred W Analysis of rna sequences by pcr
WO1997018328A1 (en) * 1995-11-16 1997-05-22 Pharmacia Biotech Ab A method of sequencing
US6337185B1 (en) 1995-11-16 2002-01-08 Amersham Pharmacia Biotech Ab Method of sequencing
US5888736A (en) * 1995-12-22 1999-03-30 Visible Genetics, Inc. Method, compositions and kit for detection and identification of microorganisms
WO1997041257A1 (en) * 1995-12-22 1997-11-06 Visible Genetics Inc. Method, compositions and kit for detection and identification of microorganisms
US6051378A (en) * 1996-03-04 2000-04-18 Genetrace Systems Inc. Methods of screening nucleic acids using mass spectrometry
WO1997041258A1 (en) * 1996-05-01 1997-11-06 Visible Genetics Inc. Method for determination of nucleic acid sequences and diagnostic applications thereof
WO1997041259A1 (en) * 1996-05-01 1997-11-06 Visible Genetics Inc. Method for sequencing of nucleic acid polymers
US5830657A (en) * 1996-05-01 1998-11-03 Visible Genetics Inc. Method for single-tube sequencing of nucleic acid polymers
US6083699A (en) * 1996-05-01 2000-07-04 Visible Genetics Inc. Method for bi-directional sequencing of nucleic acid polymers
US6413718B1 (en) 1996-05-01 2002-07-02 Visible Genetics Inc. Method for sequencing of nucleic acid polymers
US6214555B1 (en) 1996-05-01 2001-04-10 Visible Genetics Inc. Method compositions and kit for detection
US5789168A (en) * 1996-05-01 1998-08-04 Visible Genetics Inc. Method for amplification and sequencing of nucleic acid polymers
US5965363A (en) * 1996-09-19 1999-10-12 Genetrace Systems Inc. Methods of preparing nucleic acids for mass spectrometric analysis
WO1998012355A1 (en) * 1996-09-19 1998-03-26 Genetrace Systems Methods of preparing nucleic acids for mass spectrometric analysis
WO1998031833A1 (en) * 1997-01-15 1998-07-23 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
US6265716B1 (en) 1998-05-29 2001-07-24 Genetrace Systems, Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
US6104028A (en) * 1998-05-29 2000-08-15 Genetrace Systems Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
US6787349B1 (en) 1999-11-19 2004-09-07 Hitachi Software Engineering Co., Ltd. Biochip reader and labeling reagent
WO2002072879A2 (en) * 2001-02-09 2002-09-19 Axaron Bioscience Ag Production and use of random arrangements of clonal nuclear acid islands on a surface
WO2002072879A3 (en) * 2001-02-09 2003-10-02 Axaron Bioscience Ag Production and use of random arrangements of clonal nuclear acid islands on a surface
US7222059B2 (en) 2001-11-15 2007-05-22 Siemens Medical Solutions Diagnostics Electrophoretic trace simulator
WO2023032192A1 (en) * 2021-09-06 2023-03-09 株式会社日立ハイテク Nucleotide sequence identification method

Also Published As

Publication number Publication date
AU2787692A (en) 1993-05-21
GB9122060D0 (en) 1991-11-27

Similar Documents

Publication Publication Date Title
WO1993008305A1 (en) Method of sequencing double stranded dna
AU648330B2 (en) Competitive PCR for quantitation of DNA
US5712125A (en) Competitive PCR for quantitation of DNA
US5484701A (en) Method for sequencing DNA using biotin-strepavidin conjugates to facilitate the purification of primer extension products
JP3021036B2 (en) Detection of nucleic acid sequences or changes therein
US5989813A (en) Detection of amplified nucleic acid sequences using bifunctional haptenization and dyed microparticles
AU702125B2 (en) Immunoassay and kit with two reagents that are cross-linked if they adhere to an analyte
CA1340160C (en) Method and reagents for detecting nucleic acid sequences
CA2140877C (en) Amplification and detection process
WO1989006285A1 (en) Method for detecting target nucleic acid in specimen
EP1162278B1 (en) Method for quantification of a specific nucleic acid by isometric primer extension
TW201802244A (en) Methods of constructing circular template and detecting DNA molecules
AU662626B2 (en) Method of sequencing
EP0406280A1 (en) Method for amplifying and detecting nucleic acid in a test liquid
JP2792757B2 (en) Nucleic acid detection method
JP2905192B2 (en) Gene expression quantification method
EP0421469A2 (en) Method for separating nucleic acid
WO1995030025A1 (en) Detection or assay of target nucleic acids
JP2972685B2 (en) Nucleic acid detection method
Lundeberg et al. Direct DNA sequencing of PCR products using magnetic beads
EP1679381A1 (en) Isometric primers extension method and kit for detection and quantification of specific nucleic acid
Lundeberg et al. Direct DNA sequencing of polymerase chain reaction products using magnetic beads

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase