WO1992022667A1 - Analogs of glycoprotein hormone receptors which bind choriogonadotrophins, leutrophins, and follitrophins and methods for preparing and using same - Google Patents

Abstract

In one embodiment, the present invention pertains to a protein having binding affinity to human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH), comprising an amino acid sequence of 341 amino acids, wherein the protein is a chimera having an amino acid sequence homologous to the amino acid sequence of residues 1-92 of FSHR, an amino acid sequence homologous to the amino acid sequence of residues 93-170 of LHR, and an amino acid sequence homologous to the amino acid sequence of residues 171-341 of FSHR, wherein the protein is a chain of amino acids that is not naturally occurring as a binding protein. (LH numbering system). In another embodiment, the present invention pertains to a glycoprotein hormone receptor having binding affinity to human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH), wherein the receptor comprises a transmembrane region and an extracellular N-terminus region, wherein the N-terminus region is a chimera containing an amino acid sequence of 341 amino acids comprising an amino acid sequence homologous to the amino acid sequence of residues 1-92 of FSHR, an amino acid sequence homologous to the amino acid sequence of residues 93-170 of LHR, and an amino acid sequence homologous to the amino acid sequence of residues 171-341 of FSHR, wherein the receptor is a chain of amino acids that is not naturally occurring as a receptor. (LH nmbering system).

Description

ANALOGS OF GLYCOPROTEIN HORMONE RECEPTORS WHICH BIND CHORIOGONADOTROPINS, LEUTROPINS, AND FOLLITROPINS

AND METHODS FOR PREPARING AND USING SAME

Field of the Invention This invention relates to glycoprotein hormone receptor chimeras and other analogs and methods for preparing and using the analogs. The molecules of the invention are derivatives of naturally occurring receptors found in the ovary and testes. These proteins are usually found associated with the cell surface and combine specifically with the hormones. Protein engineering techniques permit construction of novel forms of the receptors which have the ability to bind both hCG and hFSH with high affinity. These analogs are useful in assays designed to measure biologically active hCG or hLH and hFSH at the same time.

The Reproductive Glycoprotein Hormones and Their Biological Actions.

The glycoprotein hormone family (1) consists of three alpha, beta heterodimeric glycoproteins found in the anterior pituitary gland where they are made and includes luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH). In some species, a glycoprotein hormone structurally similar to LH is found in the placenta wherein it is synthesized. In humans, this glycoprotein hormone is called human chorionic gonadotropin (hCG). In primates, significant quantities of all the hormones are also found as excretion products in urine. Urine from pregnant women serves as a convenient source of hCG. After menopause, when the secretion of LH and FSH from the anterior pituitary is greatly increased, significant quantities of LH and FSH are found in the urine and are termed human menopausal gonadotropins (hMG). Urine from menopausal women serves as an important source of LH and FSH activities. Both urinary hCG and hMG have important commercial uses. Unlike hCG, which interacts with LH receptors and only weakly with FSH receptors, hMG interacts with both LH and FSH receptors. The activity of hMG is due to the presence of multiple hormone species in the urinary extract. Gonadotropins such as CG, LH, and FSH play a major role in the reproductive process (1, 2) while the structurally related hormone, TSH, is important for thyroid function (1). Both LH and FSH are essential for puberty and normal reproductive function. Lack of sufficient FSH, LH, or hCG at appropriate times results in infertility or termination of pregnancy (2). Excessive amounts of these hormones can result in premature puberty or hyperstimulation of the gonads. In the female, FSH is essential for follicular development leading to oocyte maturation and ovulation. In polycystic ovarian disease, a condition which is characterized by incomplete follicular development, fertility can usually be restored by administration of FSH or treatments which increase FSH secretion. LH is essential for ovulation and formation of the corpus luteum. In humans, hCG is important for maintenance of progesterone secretion from the corpus luteum during early pregnancy. In males, LH is required for puberty and, in its absence, there is a failure to acquire the sexual attributes and fertility of an adult. FSH is needed for the onset of spermatogenesis. The clinical activities of these hormones are reviewed extensively in several standard textbooks including that by Yen and Jaffe (2).

The biological actions of the glycoprotein hormones start with binding to specific LH receptors (LHR) or FSH receptors (FSHR) located in gonadal tissues (3). Both hCG and LH have high affinity for LHR and low affinity for FSHR. In the testis, LHR are found primarily in the Leydig cells. In the ovary, LHR are found primarily in thecal, FSH-stimulated granulosa, and luteal cells. FSH has high affinity for FSHR and low affinity for LHR. FSHR are located primarily in the Sertoli cells of the testis and the granulosa cells of the ovaries. Hormonal specificity appears to be controlled entirely by the interactions of the hormones with their receptors. Once the hormone receptor interaction has occurred, the subsequent cellular events appear to occur via similar pathways.

At the cellular level, the major role of LH is to stimulate the formation of cyclic AMP leading to increased steroid hormone synthesis. The steroids made depend on the cell type and include the androgens testosterone and androstenedione (Leydig and thecal cells) and progesterone (FSH-stimulated granulosa, thecal, and luteal cells). LH also alters the activity of other enzymes which leads to the ovulation of mature follicles. hCG is normally produced only by the placenta during pregnancy and acts on LHR to stimulate luteal progesterone synthesis. Due to its high affinity for LH receptors, the ease which it can be purified from urine, and its long biological half-life, hCG has been widely used as a substitute for LH. The primary roles of FSH are to stimulate the formation of cyclic AMP which, in granulosa cells, enhances the conversion of androgens (i.e., the steroids produced in response to LH stimulation of testicular Leydig cells and ovarian thecal cells) to estrogens. FSH also promotes the synthesis of inhibin and activin, the development of Sertoli and granulosa cells, gamete maturation.

The differences in the effects of FSH and LH and the complex endocrine interactions between the two hormones cause them to have synergistic effects (4, 5). For example, normal estrogen production is due to the effect of LH on androgen formation and the influence of FSH on the conversion of androgens to estradiol. This process is regulated by negative and positive feedback mechanisms wherein estradiol can inhibit FSH secretion and increase LH secretion from the pituitary gland. For this reason, the ratio of LH/FSH activity as well as the absolute hormone levels in blood are important for reproductive functions such as sperm production and ovulation of the proper number of oocytes during the menstrual and estrus cycles.

Structures of the Receptors for Glycoprotein Hormones

The cDNA for several glycoprotein hormone receptors have been cloned (6-10) and enabled the primary amino acid sequences of the receptors to be determined (c.f., Figure 1 for the sequences of the rat LH, FSH, and TSH receptors). Those for FSH and LH encode proteins of approximately 700 amino acids. The N-terminal halves of these proteins (i.e., those residues shown in the upper panel of Figure 1) appear to be located outside the cell. The C-terminal half (i.e., those residues shown in the lower panel of Figure 1) contains seven hydrophobic regions which presumably span the plasma membrane and anchor the protein on the cell surface. The LHR appears to have two ligand binding domains. A high affinity domain is found in the extracellular N-terminus (11-13) and a low affinity domain is located in the transmembrane region (11). The specificity of ligand binding appears to be a property of the extracellular N-terminus since 1) analogs containing only the N-terminus or portions of the N-terminus of the LHR bind hCG (12, 13).

Measurements of Gonadotropins

There are several methods for measuring hCG, hLH, and hFSH. These include radioimmunoassay (RIA), sandwich immunoassay, radioligand receptor binding assay (RLA), bioassay, and bioimmunoassay. The first two depend on the use of antisera and/or monoclonal antibodies. The RLA and bioassays depend on the ability of the hormones to interact with their receptors. The bioimmunoassay depends on the ability of the hormones to interact with their receptor and with an antibody (14). Since the regions of the hormones which interact with most antibodies and with the LHR and FSHR are not identical, these assays give different values when they are used to measure the hormones (15, 16). The immunological assays often give lower values for the amount of LH and FSH in serum and this observation has led to the concept of a biological/immunological assay ratio (B/I). There is some evidence that this ratio changes as a function of hormone secretion. Diagnosis and treatment of infertility often depend on accurate measurements of circulating levels of LH and FSH as well as on the ratio of the two hormones. Given the variability between the hormone assays and the importance of obtaining accurate measurements of biologically active hormone, assays which could monitor the biological activity of LH and FSH as well as the ratio of LH:FSH activities in an unbiased fashion would be valuable. Pathological changes in the ratios of FSH:LH are often associated with infertility (e.g., polycystic ovarian disease). Indeed, diagnosis may depend on the ratio of LH:FSH in serum (2). Currently, different reagents and procedures are required to monitor the amounts of biologically active LH and FSH in serum. This leads to the possibility of increased measurement errors and problems in assay standardization. Assays based on the use of common reagents should reduce the variability in measurements of biologically active hormone. Since only one "receptor" need be produced, it should also be more cost effective than assays dependent on two or more receptors.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows a comparison of the extracellular N-termini and the transmembrane domain of the rat LHR (1), FSHR (4), TSHR (24). Numbers correspond to those of the rat LHR and exclude the signal sequences. Amino acids identical to rat LHR are indicated by a dot (.) Absent amino acids are indicated by a dash (-).

Figure 2 shows the affinity of ¹²⁵I-hCG for the LHR, LHR-B, and LHR-E forms. COS-7 cells were transfected with pSVL-LHR, pSVL-LHR-B, or pSVL-LHR-E. Four days latter, the cells were scraped from the dishes into 0.9% NaCl solution, sedimented at 600 × G (10 min), homogenized in buffer containing ice cold 1% Triton X- 100, and binding of ¹²⁵I-hCG was measured as described in the Examples. The average value of Ka for the LHR expressed in COS-7 cells was (3.4+/-1.7)×10⁹M^-1. The binding constants obtained in this experiment were: LHR,

4.4×10⁹M^-1; LHR-B, 4.6×10⁹M^-1; and LHR-E, 2.8×10⁹M^-1.

Figure 3 shows the binding of ¹²⁵I-hCG to LLLLL-LLL-LA and LLLLL-AAA-A. ¹²⁵I-hCG was added to Triton-X100 extracts of COS-7 cells in duplicate. Bound and free radiolabel was separated by immunoprecipitation using an antiserum prepared against the C-terminal 11 amino acids of the β₂AR as described in the Examples. Binding constants were estimated to be (2.2+/-0.1)×10⁹M^-1 and (3.6+/-0.4)×10⁹M^-1 for LLLLL-LLL-LA (LLLA) and LLLLL-AAA-A (LAA), respectively. Figure 4 shows the binding of ¹²⁵I-hCG to LLLLL-LLL-L and LLLLLHH╌. ¹²⁵I-hCG binding to Triton X100 solubilized COS-7 cells which had been transfected with LLL or LHH was performed in duplicate as described in the Examples. Bound and free radiolabel was separated using PEI coated filters and the results are illustrated here. The binding constants were estimated to be (3.5+/-0.2)×10⁹M^-1 and (4.0+/-0.6)×10⁹M^-1 for LLLLL-LLL-L (LLL) and LLLLLHH╌ (LHH), respectively.

Figure 5 depicts the competition of hCG and hFSH for various receptor chimeras. Triton X-100 solubilized receptors from transfected COS-7 cells were incubated with ¹²⁵I-hCG or ¹²⁵I-hFSH and varying amounts of hCG or hFSH in duplicate as shown. In the experiments shown, the maximal amounts of I-hCG bound over the blank were 20,260; 3227; and 4253 cpm for LLLLL-LLL-L, FLLFF-FFF-F, F(F/L) (L/F) FF-FFF-F. The maximal amounts of ¹²⁵l-hFSH bound over the blank were 19,850; 12,790; and 12220 cpm for FFFFF-LLL-L, FFFFF-FFF-F, and F(F/L) (L/F) FF-FFF-F. Binding of ¹²⁵I-hCG to LLLFF-LLL-L and LLLFF-FFF-F was not inhibited by a 10, 000-fold excess of hFSH.

Figure 6: Upper panel shows the affinity of ¹²⁵I-hCG for LHR/FSHR chimeras. The binding constants obtained were: LLLFF-LLL-L, 8.0×10⁹M^-1; FLLLL-LLL-L, 9.7×10⁹M^-1; FLLFF-FFF-F, (2.2+/-1.0)×10⁹M^-1; F(F/L) (L/F) FF-FFF-F, (1.8+/-0.6)×10⁹M^-1; LLLFF-FFF-F, 3.2×10⁹M^-1 (curve not illustrated). Figure 6: Lower panel shows the affinity of ¹²⁵I-hFSH for the FSHR and F(F/L) (L/F) FF-FFF-F. The binding constants obtained were: FSHR, (3.5+/-2.7)×10⁹M^-1; F(F/L) (L/F) FF-FFF- F, (4.1+/-2.2)×10⁹M^-1. Data illustrated in these panels were obtained in different experiments.

Figure 7 is a representation of a model of receptor binding determinants of the LHR and FSHR. A schematic diagram of the LHR and FSHR is illustrated showing the extracellular N-terminus, the seven transmembrane domains, and the intracellular C-terminus. The regions of the extracellular domains that convey the ability of the LHR and FSHR to distinguish hCG and hFSH are indicated. Note that this model does not exclude a lower affinity interaction of the hormones with other portions of their receptors. The numbering system employed herein corresponds to that for LHR. The corresponding numbering system for FSHR may be determined by reference to Figure l.

Figure 8 illustrates a strategy for preparing the LHR/FSHR chimeras used in these studies. The upper portion describes the PCR strategy for obtaining cDNA fragments which encode various forms of the FSHR. Primer combinations 1 & 2, 3 & 4, and 5 & 6 were used to obtain coding sequences for residues -26/201, 202/341, and 342/675, respectively. During PCR, restriction sites were incorporated into the cDNA fragments which permitted subcloning directly into the indicated sites of the LHR (i.e., LLLLL-LLL-L) as illustrated. The lower portion illustrates the remaining LHR/FSHR chimeras used in these studies. Some of these were prepared by rearranging fragments of the original chimeras (c.f., upper portion) by restriction endonuclease digestion and religation. Preparation of the BglII fragments by PCR was described in the text. Preparation of F(F/L) (L/F) FF-FFF-F by multiple PCR reactions was also described in the text. Chimera nomenclature: the first hyphen denotes the junction of the N-terminus and transmembrane domain and the second hyphen denotes the junction of the transmembrane domain and the C-terminus; the first block (five letters) refers to the location of DNA sequences between selected restriction endonuclease sites in the N-terminus including XbaI-BglII (-26 to 58), BglII-BglII (59-123), BglII-Apal (124-202), Apal-Fspl (203-259), and FspI-Bsu36I (260-341), respectively; the second block (three letters) refers to location of DNA sequences between selected restriction endonuclease sites in the transmembrane domain including Bsu36I-SphI, Sphl-Ball, and Ball-Espl; and the third block (one letter) refers to the C-terminus. L, residues derived from LHR; F, residues derived from FSHR.

Figure 9 illustrates methods for the preparation of analogs LLLLL-LLL-L (LLL), LLLLL-LLL-LA (LLLA), LLLLL-AAA-A (LAA), A-LLL-L (ALL), A-LLL-LA (ALLA), LLLLL╌ (L╌), LLLLLHH╌ (LLLHH), and LLLLL-V-V (LVV) are described in the Examples. AAA refers to the hamster ß₂-adrenergic receptor (24). The open bars refer to residues derived from the rat LHR and the solid bars refer to residues derived from the hamster ß₂AR. Residues in the bars denoted by ascending hatchmarks (////) refer to the 27 C-terminal residues of the ß₂AR which include the 11 amino acid sequence recognized by the rabbit anti-ß₂AR serum used to immunoprecipitate the receptor (c.f., LLLA, below). Residues in bars denoted by descending hatchmarks (\\\\) are derived from the VSV-G transmembrane and C-terminus. Amino acid sequences in the region of the junctions are: LLLA, -VHCQQPIPPRAFFV- NCQGTVPSLSLDSQGRNCSTNDSPL*; LAA, -DIMGYAFLRDEAWVVGMAILM- ; ALL, -TTNGSHVPDHDVTDLVLIWLINILAIFGNLTVLFVLLTS-; L╌, - DIMGYAFLR*; LVV, -DIMGYAFLRSSIASFFFFIIGLIIGLFLVLR-; LHH, -DIMGYAFLRHH* where the residues derived from the LHR are underlined. Note that the corresponding junctions in related analogs (i.e., ALLA and LLLA or ALL and ALLA) are identical.

Figure 10 shows the binding of ¹²⁵I-hCG to LHR expressed in ldl-d cells. pMB13 was expressed stably in ldl-d cells as set out in Example 27. The cells were cultured in the presence or absence of galactose (Gal) and N-acetylgalactosamine (GalNac) for 4 days (26). In the absence of these sugars, the ldl-d cells cannot make Ser-linked oligosaccharides. Other oligosaccharides lack galactose and sialic acid. Whole ldl-d cells were incubated with ¹²⁵I-hCG and varying amounts of unlabeled ¹²⁵I-hCG as shown on the abscissa. Bound and free ¹²⁵ι- hCG were separated by sedimentation. Detergent solubilized receptors from these cells were also incubated with ¹²⁵I-hCG and unlabeled hCG as shown on the abscissa. Bound and free ¹²⁵I-hCG were separated by PEI filtration (21). As illustrated in this Figure, ¹²⁵I-hCG had a lower affinity to LHR in the membrane of ldl-d cells which had been grown in the presence of galactose and N-acetylgalactosamine than those which had been grown in the absence of these sugars. This difference was less apparent for the solubilized receptors from these cells.

Figure 11 shows the competition of hCG and hFSH for binding of ¹²⁵I-hCG to pMB133. COS-7 cells transfected with pMB133 were solubilized with buffer containing Triton X-100 and incubated with ¹²⁵I-hCG and hormones as described in Example 1. Bound and free ¹²⁵ι- hCG were separated by filtration on PEI coated filters (21). Results illustrated here show that hCG and hFSH bind to pMB133. This shows that only a very small region of the receptor is responsible for ligand binding specificity and that this pMB133 analog would be useful for measurement of hormones which bind to LH and FSH receptors.

Figure 12 shows a comparison of the extracellular N-termini of several LHR/FSHR chimeras discussed in the Examples. Numbers correspond to those of the rat LHR and exclude the signal sequences.

SUMMARY OF THE INVENTION

In one embodiment, the present invention pertains to a protein having binding affinity to human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH), comprising an amino acid sequence of 341 amino acids, wherein the protein is a chimera having an amino acid sequence homologous to the amino acid sequence of residues 1-92 of FSHR, an amino acid sequence homologous to the amino acid sequence of residues 93-170 of LHR, and an amino acid sequence homologous to the amino acid sequence of residues 171-341 of FSHR, wherein the protein is a chain of amino acids that is not naturally occurring as a binding protein. (LH numbering system). In another embodiment, the present invention pertains to a glycoprotein hormone receptor having binding affinity to human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH), wherein the receptor comprises a transmembrane region and an extracellular N-terminus region, wherein the N-terminus region is a chimera containing an amino acid sequence of 341 amino acids comprising an amino acid sequence homologous to the amino acid sequence of residues 1-92 of FSHR, an amino acid sequence homologous to the amino acid sequence of residues 93-170 of LHR, and an amino acid sequence homologous to the amino acid sequence of residues 171-341 of FSHR, wherein the receptor is a chain of amino acids that is not naturally occurring as a receptor. (LH numbering system).

DETAILED DESCRIPTION OF THE INVENTION

This invention relates to glycoprotein hormone receptor chimeras and other analogs and methods for preparing and using the analogs. The molecules of the present invention are derivatives of naturally occurring receptors found in the ovary and testes which are usually found associated with the cell surface and combine specifically with the hormones. These glycoprotein hormone receptor analogs are useful in assays designed to measure biologically active hCG or both hLH and hFSH at the same time.

As set out above, the specificity of ligand binding appears to be a property of the extracellular N- terminus because analogs containing only the N-terminus or portions of the N-terminus of the LHR bind hCG (12, 13, Figures 2, 3 and 4). Accordingly, applicants have prepared analogs of the LHR and FSHR in an effort to identify the region of the N-terminus which contains the ligand binding domain. To study the roles of these domains, vectors were prepared encoding the rat LHR N- terminal domain alone (L╌), the LHR N-terminal domain fused to the transmembrane and C-terminal domains of the vesicular stomatitis virus-G protein (LVV), the LHR N- terminal domain fused to the transmembrane and C-terminal domains of the hamster B₂AR (LAA), and the B₂AR N- terminal domain fused to the transmembrane and C-terminal domains of the rat LHR (ALL).

The following nomenclature was used to described the chimeras: the first hyphen denotes the junction of the N-terminus and transmembrane domain and the second hyphen denotes the junction of the transmembrane domain and the C-terminus; the first block (five letters) refers to the location of DNA sequences between selected restriction endonuclease sites in the N-terminus including XbaI-BglII (-26 to 58), BglII-BglII (59-123), BglII-Apal (124-202), Apal-Fspl (203-259), and FspI-Bsu36I (260-341), respectively; the second block (three letters) refers to location of DNA sequences between selected restriction endonuclease sites in the transmembrane domain including Bsu36I-SphI, Sphl-Ball, and Ball-Espl; and the third block (one letter) refers to the C-terminus. L refers to residues derived from LHR and F refers to residues derived from FSHR.

Generally, amino acid sequence variants will be substantially homologous with the relevant portion of the N-terminus of the receptor coupled to the transmembrane as set forth in Figure 1. Substantially homologous means that greater than about 70% of the primary amino acid sequence of the candidate polypeptide corresponds to the sequence of the relevant portion of the N-terminus polypeptide when aligned in order to maximize the number of amino acids residue matches between the two polypeptides. Alignment to maximize matches of residues includes shifting the amino and/or carboxyl terminus, introducing gaps as required or deleting residues present as inserts in the candidate polypeptide, or both. For example, see Figure 1 where the glycoprotein hormone receptors are aligned for maximum homology. Typically, amino acid sequence variants will be greater than about 90% homologous with the corresponding sequences shown for the proteins in Figure 1.

Variants that are not hormonally-active fall within the scope of this invention, and include polypeptides that may or may not be substantially homologous with a sequence described herein but which are 1) immunologically cross-reactive with antibodies raised against the counterpart polypeptide or 2) capable of competing with such counterpart polypeptides for cell surface receptor binding. Hormonally active variants are produced by the recombinant or organic synthetic preparation of fragments or by introduction of amino acid sequence variations so that the molecule no longer demonstrates hormonal activity as defined herein.

Immunological or receptor cross-reactivity means that the candidate polypeptide is capable of competitively inhibiting the binding of the hormonally-active analogue to polyclonal antisera raised against the hormonally-active analogue. Such antisera are prepared in a conventional manner by injecting goats or rabbits S.C. with the hormonally active analogue or derivative in complete Freunds adjuvant, followed by booster intraperitoneal or S.C. injections in incomplete Freunds. Variants that are not hormonally active but which are capable of cross-reacting with antisera to hormonally active polypeptides are useful a) as reagents in diagnostic assays for the analogues of their antibodies, b) when msolubilized in accord with known methods, as an agent for purifying anti-analogue anti- antibodies from anti-sera, and c) as an immunogen for raising antibodies to hormonally active analogues.

Applicants have discovered that analogs in which the N-terminus of the LHR is coupled to the transmembrane and cytoplasmic domains of other proteins including the FSHR bind hCG, not FSH (Figure 3, Table 1) and analogs prepared by coupling of the N-terminus of the FSHR to the transmembrane and cytoplasmic domains of the LHR bind hFSH much better than hCG (Figure 5, Table 1). Some chimeras of the LHR and FSHR bound both hCG and hFSH with high affinity (Figures 5 and 6). The regions of the LHR and FSH which determine ligand binding specificity appear to overlap one another and it is clear that hCG can inhibit the binding of hFSH and, vice versa. hFSH can inhibit the binding of hCG (Figure 5). These results suggest the model shown in the schematic diagram of Figure 7.

Binding affinity studies of the series of analogs of the LHR and FSHR described herein permit the deduction of the relative locations of the ligand binding sites. Some of these analogs have the unique characteristics of being able to recognize both hCG and FSH. Since hCG and LH bind to the same receptors, analogs that bind hCG will also recognize LH. One of these analogs F(F/L) (L/F) FF-FFF-F (pMB111) binds both ligands with high affinity, albeit not at the same time. When used in a Bio-IRMA employing antibodies specific for hLH- or hFSH- complexes, analogs similar to F(F/L) (L/F) FF-FFF-F should permit the simultaneous detection of both LH (or hCG) and FSH as well as their ratio of biological activities. The structures of the receptor analogs and methods for making them are illustrated in the Examples. It is contemplated that other analogs of the invention would also be useful in the bioimmunoassay. Only a portion of the extracellular N-terminus is needed for high affinity ligand binding (12, 13). Thus, only the N-terminus of analogs similar to F(F/L) (L/F) FF-FFF-F (i.e., the truncated portion shown as F(F/L) (L/F)FF-) are necessary. In addition, analogs of the LHR such as LLLLL-LLL-LA and LLLLL-AAA-A also bind ¹²⁵I-hCG and can be immunoprecipitated with antibodies to the C-terminal "A" region. It is likely that F(F/L) (L/F)FF-FFF-FA or F(F/L) (L/F)FF-AAA-A which contain these same amino acids in the C-terminal "A" region would also be useful in the bioimmunoassay. It has been shown that other types of "handles" can also be added to the receptors without disrupting their ability to bind ligands. Thus, LLLLL-LLL-LH₂ and LLLLL-H₂ have high affinity for ¹²⁵I-hCG and FFFFF-FFF-FH₃ has high affinity for ¹²⁵I-hFSH. These analogs can be adsorbed to an NTA resin (obtained from Qiagen, Chatsworth, CA 91311) and would enable a sandwich bioimmunoassay to function. Addition of a larger number of His residues would be expected to facilitate this interaction.

It is contemplated that other methods of expressing the receptors would also be useful to produce them. COS-7 cells were used herein to express pMB111. These cells are good at transient expression using the vector described below. However, as noted in this disclosure, other eukaryotic cells have been shown to express these types of receptors and it is expected that a large variety of expression systems will work well. Indeed, since the region of the binding domain which determines ligand binding specificity has been determined in this invention, it is possible that bacterial expression systems will be useful. We have also found that the LHR can be expressed in a CHO cell line known as ldl-D (26) which can produce receptors which lack fully glycosylated proteins. When these cells are cultured under conditions in which the terminal galactose and sialic acid residues are not added to the Asn-linked sugar residues, the cells express receptors which have approximately 4-fold higher affinity for ¹²⁵I-hCG. Thus, expression of F(F/L) (L/F) FF-FFF-F in these cells may enable the production of an analog with higher affinity in the bioimmunoassay.

Useful antibodies in the bioimmunoassays of the present invention include but are not limited to antibodies having the properties of B105 (obtained from

Dr. Robert Canfield, Columbia University) and B602

(obtained from Hybritech). These antibodies have high affinity for ligand-receptor complexes. Other antibodies could also be used including B110 (28) which binds to hCG-receptor complexes better than to free hCG and B407

(obtained from Dr. Robert Canfield, Columbia University) which only binds to dimeric forms of hCG and hLH and ligand-receptor complexes.

Throughout this application, various publications have been referenced. The disclosures in these publications are incorporated herein by reference in order to more fully describe the state of the art.

The present invention is further illustrated by the following examples which are not intended to limit the effective scope of the claims. All parts and percentages in the examples and throughout the specification and claims are by weight of the final composition unless otherwise specified. The following examples illustrate the preparation and characterization of LHR and FSHR and analogs of these two receptors. The examples also illustrate how these receptors can be expressed and how their abilities to interact with ligands can be monitored.

Example 1

Preparation and characterization of pMB11, the vector encoding the LHR (LLLLL-LLL-L).

The LHR coding sequences were obtained from an ovarian corpus luteum library in three segments using PCR conditions which have been described (17). The PCR product encoding amino acids -26 to 315 was created using primers 5'-GGCTCAACCTCTAGAGCTCACACTCA-3' and 5'-GCAGAAGCCGTAGTCGTAGTCCCA-3' digested with XbaI and subcloned between the XbaI and Smal sites of pIBI31 (obtained from IBI) to give pMB3. The sequence of the bases in the region between the XbaI and Apal sites was determined by dideoxy methods and shown to encode the same amino acids between 26 and 201 as reported for the rat LHR (6). The PCR product obtained using primers 5'-CCACGGGGCCCAGCATCCTGGATATTTC-3' and 5'- TGGGATGGCATGCCTCAGTCTTAGCT-3' and which encoded amino acids 201 to 460 was digested with Apal and SphI and subcloned between the Apal and SphI sites of pIBI31 to give pMBl. The sequences of the bases in the region between the Apal and SphI sites was determined by dideoxy methods and shown to encode the same amino acids reported for the rat LHR (6). The PCR product obtained using primers 5'-CTGAGGCATGCCATCCCAATTATGCTC-3' and 5'-ATTTTGGATCCTAGTGAGTTAACGCTCTCGGT-3' and which encoded amino acids 461 to 674 was digested with SphI and BamHI and subcloned between the SphI and BamHI sites of pIBI31 to give pMB4. The coding sequence of pMB4 was found to be the same as that of the rat LHR (6). All subcloning and dideoxy sequencing used in these studies were performed by standard methods (18, 19). To make pMB11, a vector which expressed the full length LHR, the LHR coding fragments formed upon digestion of pMB3 with XbaI/Apal (i.e., residues 26->201), digestion of pMB1 with Apal/SphI (i.e., residues 201->460), and digestion of pMB4 with Sphl/BamHI (i.e., residues 461->674) were ligated together with the large fragment released from pSVL (obtained from Pharmacia) by digestion with XbaI and BamHI. pMB11 was transfected into COS-7 cells using calcium phosphate procedures (18, 19). After 2-4 days, the abilities of hCG and hFSH to bind to Triton X-100 detergent extracts of these cells were measured using 1²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I-hFSH. The cells were solubilized using a buffer containing Triton X-100 as described (21) and incubated with the radiolabels for 1-2 hours at room temperature or at 4° C. overnight. The 1²⁵I-hCG used in these assays was prepared using an iodogen procedure which has been described (22). Preparation of ¹²⁵I-eLH and¹²⁵I-hFSH was similar to that of ¹²⁵I-hCG except that the labeling period with Iodogen was reduced from 5 minutes to 30 seconds. (Equine LH or eLH was obtained from Dr. George Bousfield, Houston, TX). A PEI-based filtration procedure used to separate bound and free radiolabeled ¹²⁵I-hCG and ¹²⁵I-hFSH to Triton X- 100 solubilized receptors obtained from COS-7 cell homogenates has been reported (21). Unlike this report (21), we found that we could readily separate the bound and free ¹²⁵I-hFSH using the PEI procedure. Non-specific binding was determined by measuring the amount of radiolabel which became bound in the presence of lug of unlabeled hCG or hFSH. These extracts had high affinity for ¹²⁵I-hCG (greater than 10⁹M^-1) and non-detectable affinity for ¹²⁵I-hFSH (Figures 2 and 5, Table 1). They also bound ¹²⁵I-eLH (Table 1).

Example 2

Preparation and characterization of pMB52, the vector encoding FSHR/LHR chimera FFFLL-LLL-L. pMB52 is an LHR/FSHR chimera containing FSHR sequences for LHR residues -25->201. The FSHR coding sequences used to make pMB52 were obtained from an ovarian corpus luteum library (17) by PCR as follows (Figure 8, upper section). During PCR, some codons of the FSHR were modified to create endonuclease restriction sites which facilitated chimera construction and enabled the PCR products to be directionally subcloned into XbaI and Apal sites of pSVL-LHR. To make pMB52 we used primers #1 [5'-TCGGTGTCTAGATAAATAAGGATGGCCTTGCTC-3'] and #2 [5'-AATTACGGGCCCAGAGGCTCCCTGGAA-3'] and the library (17) as a template. These primers incorporated XbaI and Apal restriction sites into the PCR product which was subcloned into the XbaI-Apal sites of pMB11 using standard methods to give pMB52. The base sequence of the FSHR portion of this chimera was determined using a double stranded dideoxy method (18, 19). pMB52 was expressed in COS-7 cells by methods which have been described for pMB11 in Example 1. As illustrated in Table 1, FFFLL-LLL-L did not substantially bind ¹²⁵I-hCG, ¹²⁵I-eLH, or ¹²⁵I-hFSH specifically in these conditions

(i.e., over the level of the non-specific binding).

Example 3

Preparation and characterization of pMB53, the vector encoding FSHR/LHR chimera LLLFF-LLL-L.

To make LLLFF-LLL-L, an LHR/FSHR chimera containing FSHR sequences for LHR residues 202->341, we used primers #3 [5'-GGAGCCTCTGGGCCCGTCATTTTAGAT-3'] and #4 [5'-TATCAAGACCCTAAGGATGTTGTACCC-3'] and the ovarian corpus luteum library (17) as a template (Figure 8, upper section). The resulting PCR product contained Apal and Bsu36I endonuclease restriction sites which were used to subclone the fragment into the pMB11 vector by standard methods. The base sequence of the FSHR portion of this chimera was determined using a double stranded dideoxy method (18, 19). This was expressed in COS-7 cells using procedures described for pMB11. Binding of hCG and hFSH was monitored using ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I-hFSH also as described for pMB11 in Example l. This analog bound hCG and eLH much better than hFSH (Figure 6, Table 1).

Example 4

Preparation and characterization of pMB69, the vector encoding FSHR/LHR chimera LLLLL-FFF-F.

To make LLLLL-FFF-F, the LHR/FSHR chimera which contained the transmembrane and C-terminal portions derived from the FSHR, we used primers #5 [5'- TACAACATCCTTAGGGTCTTGATATGG-3'] and #6 [5'- CTCTCTGGATCCTAATGATGATGGTTCTGGCTCGAGTGATTAAGAGGGACAAGCACG TAACT-3] and the ovarian corpus luteum library (17) as a template (Figure 8, upper section). This PCR product contained Bsu36I and BamHI sites and was cloned into the corresponding sites of pMB11 using standard methods. This chimera also contained three additional His residues at the C-terminus not found in the naturally occurring FSHR. The base sequence of the FSHR portion of this chimera was determined using a double stranded dideoxy method (18, 19). This was expressed in COS-7 cells using procedures described for pMB11. The binding of hCG and hFSH was monitored using ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I- hFSH also as described for pMB11 in Example 1. This analog bound ¹²⁵I-hCG better than ¹²⁵I-hFSH although it did not appear to be expressed well (Table 1).

Example 5

Preparation and characterization of pMB59, the vector encoding the FSHR (FFFFF-FFF-F). XbaI/Apal, ApaI/Bsu36I, and Bsu36I/BamHI fragments were cut from pMB52, pMB53, and pMB69, respectively, separated on agarose electrophoresis gels, and then ligated together with the 4.9 Kbp fragment obtained by digesting pMB11 with XbaI/BamHI to yield pSVL-FSHR. This coding sequence of this analog is similar to that of the rat FSHR (9) except for the substitution of Thr for Ile³⁵⁸ and the presence of three His residues at the C-terminus. This was expressed in COS-7 cells using procedures described for pMB11. The binding of hCG and hFSH was monitored using ¹²⁵I-hCG and 1²⁵I-hFSH also as described for pMB11 in Example 1. This analog bound ¹²⁵I-eLH and ¹²⁵I-hFSH better than ¹²⁵I-hCG (Figure 6, Table 1). Example 6

Preparation and characterization of pMB68, the vector encoding FSHR/LHR chimera LLLFF-FFF-F. This analog was prepared by ligating the small XbaI/Apal fragment from pMB11 LHR with the large Apal/BamHI fragment of pMB59. This was expressed in COS-7 cells using procedures described for pMB11. Binding of hCG and hFSH was monitored using ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I-hFSH also as described for pMB11 in Example 1. LLLFF-FFF-F was found to bind ¹²⁵I-hCG and ¹²⁵I-eLH better than ¹²⁵I-hFSH (Table 1). Example 7

Preparation and characterization of pMB55, the vector encoding FSHR/LHR chimera FFFFF-LLL-L.

This analog was prepared by ligating the small XbaI/Apal, ApaI/Bsu36I, and Bsu36I/BamHI fragments of pMB52, pMB53, and pMB11 with the large XbaI/BamHI fragment of pSVL. pMB55 was expressed in COS-7 cells using procedures described for pMB11. Binding of hCG and hFSH was monitored using ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵ι-hFSH also as described for pMB11 in Example 1. This analog was found to bind ¹²⁵I-hFSH and ¹²⁵I-eLH better than ¹²⁵I-hCG (Figure 6, Table 1). Example 8

Preparation and characterization of pMB71, the vector encoding FSHR/LHR chimera FFFLL-FFF-F.

This analog was prepared by ligating the small XbaI/Apal, ApaI/Bsu36I, and Bsu36I/BamHI fragments from pMB59, pMB11, and pMB59 with the large XbaI/BamHI fragment of pSVL. This was expressed in COS-7 cells using procedures described for pMB11. Binding of hCG and hFSH was monitored using ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I- hFSH also as described for pMB11 in Example 1. This analog was found not to substantially bind any of the ligands above the level of non-specific binding (Table 1).

Example 9

Preparation and characterization of pMB72, the vector encoding FSHR/LHR chimera FLLLL-LLL-L.

The following were ligated: 1) the XbaI/BglII fragment of the PCR product created using primers 5'- GAGAGAGGAGATCTTTGTCACAGCTGGCAAGT-3' and 5'- TCGGTGTCTAGATAAATAAGGATGGCCTTGCTC-3' with pMB59 as template, 2) the BglII/BglII and BglII/Apal fragments of the PCR product created using primers 5'-AAAATTGAGATCTCACAGAGTGATTCC-3' and 5'- GCAGAAGCCGTAGTCGTAGTCCCA-3' with pMB11 as template, and 3) the large XbaI/Apal fragment of pMB11. After the region between XbaI and Apal was sequenced using dideoxy methods, pMB72 was expressed in COS-7 cells using the procedure outlined in Example 1. Binding of ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I-hFSH was also measured as described in Example 1. This analog was found to bind ¹²⁵I-hCG with high affinity (Figure 6, Table 1). While it bound ¹²⁵l-eLH, it did not substantially bind ¹²⁵I-hFSH above the level of non-specific binding (Table 1). Example 10

Preparation and characterization of pMB73, the vector encoding FSHR/LHR chimera LFLLL-LLL-L.

The following were ligated: 1) the XbaI/BglII fragment of the PCR product created using primers '5-ACTCTGTGAGATCTCAATTTTTACGAC-3' and 5'- CTCAGTCTAGAGGGCCATGGGGCGGCGAGTCCCAG-3' with pMB11 as the template, 2) the BglII/BglII fragment of the PCR product formed using primers 5'-GAGAGAGGAGATCTTTGTCACAGCTGGCAAGT- 3' and 5'-TCGGTGTCTAGATAAATAAGGATGGCCTTGCTC-3' with pMB59 as template, 3) the BglII/Apal fragment of the PCR product formed using primers 5'-AAAATTGAGATCTCACAGAGTGATTCC-3' and 5'- GCAGAAGCCGTAGTCGTAGTCCCA-3' using pMB11 as template and 4) the large Xba/Apal fragment of pMB11. After the region between XbaI and Apal was sequenced using dideoxy methods, pMB72 was expressed in COS-7 cells using the procedure outlined in Example 1. Binding of ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I-hFSH was also measured as described in Example 1. LFLLL-LLL-L did not substantially bind any of the ligands above the level of non-specific binding (Table 1).

Example 11

Preparation and characterization of pMB74, the vector encoding FSHR/LHR chimera LLFLL-LLL-L.

The following were ligated: 1) the XbaI/BglII fragment of the PCR product created using primers '5-ACTCTGTGAGATCTCAATTTTTACGAC-3' and 5'- CTCAGTCTAGAGGGCCATGGGGCGGCGAGTCCCAG-3' with pMB11 as the template, 2) the BglII/BglII fragment of the PCR product formed using primers 5'-AAAATTGAGATCTCACAGAGTGATTCC-3' and 5'-GCAGAAGCCGTAGTCGTAGTCCCA-3' with pMB11 as template, 3) the BglII/Apal fragment of the PCR product formed using primers 5'-GTGCACAAGATCTCCTCTCTCCAAAAGGTT-3' and S'-AATTACGGGCCCAGAGGCTCCCTGGAA-S' and pMB59 as template and 4) the large Xba/Apal fragment of pMB11. After the region between XbaI and Apal was sequenced using dideoxy methods, pMB72 was expressed in COS-7 cells using the procedure outlined in Example 1. Binding of 1²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I-hFSH was also measured as described in Example 1. LLFLL-LLL-L did not substantially bind any of the ligands above the level of non-specific binding (Table 1).

Example 12

Preparation and characterization of pMB88, the vector encoding FSHR/LHR chimera FLLFF-FFF-F.

This analog was prepared by ligating the small fragment produced by digestion of pMB72 with XbaI and Apal to the large fragment produced by digestion of pMB59 with XbaI and Apal. FLLFF-FFF-F was expressed in COS-7 cells using the procedure outlined in Example 1. Binding of ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I-hFSH was also measured as described in Example 1. FLLFF-FFF-F had high, affinity for hCG. It also bound hFSH and was approximately 1% as good as the product of pMB59 in this regard. Both hCG and hFSH competed for binding to this analog (Figures 5 and 6, Table 1). FLLFF-FFF-F also bound ¹²⁵I-eLH (Table 1).

Example 13

Preparation and characterization of pMB89, the vector encoding FSHR/LHR chimera FLLLL-FFF-F.

This analog was prepared by ligating the small fragment produced by digestion of pMB72 with XbaI and Apal to the large fragment produced by digestion of pMB69 with XbaI and Apal. FLLLL-FFF-F was expressed in COS-7 cells using the procedure outlined in Example l. Binding of ¹²⁵I-hCG and ¹²⁵I-hFSH was also measured as described in Example 1. FLLLL-FFF-F had high affinity for ¹²⁵I-hCG but did not substantially bind ¹²⁵I-hFSH above the level of non-specific binding (Table 1). Example 14

Preparation and characterization of pMB90, the vector encoding FSHR/LHR chimera FLLFF-LLL-L. This analog was prepared by ligating the small fragment produced by digestion of pMB72 with XbaI and Apal to the large fragment produced by digestion of pMB53 with XbaI and Apal. FLLFF-FFF-F was expressed in COS-7 cells using the procedure outlined in Example 1. Binding of ¹²⁵I-hCG was also measured as described in Example 1. FLLFF-LLL-L bound ¹²⁵I-hCG much better than ¹²⁵I-hFSH (Table 1).

Example 15

Preparation and characterization of pMB111, the vector encoding FSHR/LHR chimera F(F/L) (L/F) FF-FFF-F.

F(F/L) (L/F) FF-FFF-F was made by in a two-step PCR reaction. In the first step, three separate PCR reactions were performed including 1) primers 5'-AGGATTGAAAAGGCCAACAACCTGCTATACATTGAACCTGGTG-3' and 5'-CATCTAGCTGCGTCCCATTGAATGCATGGCTTTGTACTTC-3' with pSVL-11 as template, 2) primers 5'-AGCTGTCCTGGAGCTAGGAATCTCTGTACGGAAGTGTTACTTCTGCTCT-3' and 5'-GTATAGCAGGTTGTTGGCCTTTTCAATCCTAATTTCATGC-3' with pSVL- 59 as template, and 3) primers 5'-GCATTCAATGGGACGCAGCTAGATGAACTGAATCTAAGCG-3' and 5'-CTAGCCTAGAAGCTCTGACTGTCTTTGGTGGAAGAAAATATCCAGGATGCT-3' with pSVL-59 as template. One ul of each PCR reaction were pooled and the mixture amplified in the second PCR reaction using primers 5'-AGCTGTCCTGGAGCTAGGAATCT-3' and 5'-CTAGCCTAGAAGCTCTGACTGTC-3'. The final PCR product was cut with XbaI and Apal endonucleases, isolated by agarose gel electrophoresis, and ligated into the XbaI/Apal sites of pSVL-FSHR. The construct was verified by a double stranded DNA sequencing procedure (16, 17) and expressed in COS-7 cells similar to pMB11. Receptor binding assays demonstrated that Triton X-100 extracts of cells transfected with F(F/L) (L/F) FF-FFF-F bound ¹²⁵I-hCG and 1²⁵I-hFSH with high affinity. Both hCG and hFSH competed with each tracer for binding to this analog (Figures 5 and 6, Table 1).

Example 16

Preparation and characterization of pMB96, the vector encoding FSHR/LHR chimera LFFLL-LLL-L.

The large fragment resulting from digestion of pMB73 with BglII and Apal was ligated with the small BglII/Apal fragment resulting from digestion of pMB59. LFFLL-LLL-L was expressed in COS-7 cells similar to pMB11. Extracts of these cells did not substantially bind ¹²⁵I-hCG, ¹²⁵I-eLH, or ¹²⁵I-hFSH better than extracts from non-transfected cells (Table 1).

Example 17

Preparation and characterization of pMB93, the vector encoding FSHR/LHR chimera LF^CLLL-LLL-L.

There is no comparable amino acid homologous to Cys¹⁰⁹ in the FSHR. As a result, analog LFLLL-LLL-L contains Cys residues which are not comparable to those in the LHR. PCR was employed to change Ser¹⁰⁹/Cys in analog LFLLL-LLL-L using primers 5'-GAGAGAGGAGATCTTGTGCACCGCGGGCAAGTGCTTAATGCCTGTGTTGCATATTAA CAG-3'and 5'-CTCAGTCTAGAGGGCCATGGGGCGGCGAGTCCCAG-3' with LFLLL-LLL-L as template. The BglII fragment from this PCR product was used to replace the BglII/BglII fragment of LFLLL-LLL-L to form LF^CLLL-LLL-L and the expected product confirmed by dideoxy DNA sequencing. This analog was expressed in COS-7 cells using methods identical to those used to express pMB11. LF^CLLL-LLL-L did not substantially bind ¹²⁵I-hCG , ¹²⁵I-eLH, or ¹²⁵I-hFSH better than the non-specific binding controls (Table 1) .

Example 18

Preparation and characterization of pMB99, the vector encoding FSHR/LHR chimera LLF^CLL-LLL-L.

Cys¹³⁴ of the LHR and Cys¹⁶⁹ of the FSHR are not located in homologous positions. As a result, analog LLFLL-LLL-L contains Cys residues which are not comparable to those in the LHR. Using LLFLL-LLL-L as template a two-step PCR reaction was performed. One percent of the products of both the first PCR reactions utilizing primer pairs 5'- GTTCACAAGATCTCCTCTCTGCAGAAGAACGTTCTACTAGACATTTGCGATAACATA AAC-3' /5'-GAGTTCCGTTGAATGCATGGTTGTGTATTT-3' and 5'-GAAGAAATACACAACCATGCATTCAACGGA-3 ' /5 '-

TGGGATGGCATGCCTCAGTCTTAGCT-3' were mixed and a second PCR performed using primers 5'- GTTCACAAGATCTCCTCTCTGCAGAAGAACGTTCTACTAGACATTTGCGATAACATA AAC-3' and 5'-TGGGATGGCATGCCTCAGTCTTAGCT-3'. The final PCR product was digested with BglII and Apal and the fragment that was produced was ligated to the large piece created by digestion of pMB11 with BglII and Apal. The resulting vector encoded an analog in which Gin¹³⁴ was converted to Cys, Cys¹⁶⁹ was converted to His, and an Asn was inserted at position 130. The DNA sequence was confirmed using a dideoxy procedure and pMB99 was expressed in COS-7 cells using the same procedure described in Example 1 for pMB11. Triton X-100 extracts of cells transfected with pMB99 did not substantially bind ¹²⁵I-hCG, ¹²⁵I-eLH, or ¹²⁵I-hFSH better than controls (Table 1). Example 19

Preparation and characterization of pMB10, the vector encoding LHR-B, the "B" form of the LHR.

The LHR coding sequences were obtained from an ovarian corpus luteum library in three segments using PCR conditions which have been described (17). The short PCR product encoding an alternately spliced form of the LHR cDNA in the region coding amino acids 201 to 460 was digested with Apal and SphI and subcloned between the Apal and SphI sites of pIBI31 to give pMB2 which had the sequence reported (17). To make pMB10, a vector which expressed the B-form of the LHR, the small fragments formed upon digestion of pMB3 with Xbal/Apal, digestion of pMB2 with Apal/SphI, and digestion of pMB4 with Sphl/BamHI were ligated together with the large fragment released from pSVL (obtained from Pharmacia) by digestion with Xbal and BamHI. pMB10 was transfected into COS-7 cells using calcium phosphate procedures which have been described (20). Triton X-100 extracts of cells transfected with pMB10 bound ¹²⁵I-hCG with high affinity (Figure 2). Example 20

Preparation and characterization of pMB35, the vector encoding LHR-E OR LLL-EE-LLL-L,

the "E" form of the LHR.

The LHR coding sequences were obtained from an ovarian corpus luteum library in three segments using PCR conditions which have been described (17). The intermediate PCR product encoding an alternately spliced form of the LHR cDNA in the region coding amino acids 201 to 460 was obtained using primers 5'-GGCTTTGGGCCCAGCATCCTGCAGAATTTTTCATTTTCCATTTTTGA-3' and 5'-TGGGATGGCATGCCTCAGTCTTAGCT-3', digested with Apal and SphI, and ligated with the coding sequence released by XbaI/Apal digestion of pMB3, the coding sequence released by Sphl/BamHI digestion of pMB4, and the large fragment released by XbaI/BamHI digestion of pIBI31 to give pMB33. This encoded the amino acid sequence reported for the E- form (17). To make pMB35, a vector which expressed the E-form of the LHR (17), the small fragments formed upon digestion of pMB3 with XbaI/Apal, digestion of pMB33 with Apal/SphI, and digestion of pMB4 with Sphl/BamHI were ligated together with the large fragment released from pSVL (obtained from Pharmacia) by digestion with XbaI and BamHI. pMB35 was transfected into COS-7 cells using calcium phosphate procedures which have been described (20). Triton X-100 extracts of cells transfected with pMB35 bound ¹²⁵I-hCG with high affinity (Figure 2).

Example 21

Preparation and characterization of pMB46, the vector encoding the LLLLL-LLL-LA form of the LHR.

This vector encodes an LHR analog in which residues Leu⁶⁷²Thr⁶⁷³His⁶⁷⁴ are replaced by the sequence

PhePheValAsnCysGlnGlyThrValProSerLeuSerLeuAspSerGlnGlyArg Asn-CysSerThrAsnAspSerProLeu (Figure 8) which is derived largely from the C-terminus of the hamster ß₂-adrenergic receptor and to which a polyclonal antisera (23) was obtained (Catherine Strader, Merck & Co.). To make this analog we started with pMB9, a vector which contained a cDNA of the LHR coding sequences in pIBI31. pMB9 was made by ligating the coding sequences from XbaI/Apal digestion of pMB3, Apal/SphI digestion of pMBl, and Sphl/BamHI digestion of pMB4 with the large fragment produced by digesting pIBI31 with XbaI and BamHI. pMB40 was made by digesting pMB9 with Hpal and BamHI and ligating the large fragment with the AluI/HamHI fragment of the product of a PCR reaction which employed primers 5'-GACGGAAAGCTTTGTGAACTGT-3' and 5'- GAAAGCGGATCCTACAGCGGTGAGTCATTTGT-3' and the hamster ß₂- adrenergic receptor cDNA (25) as template. After DNA sequencing to confirm the result, the coding sequence released from pMB40 by XbaI/BamHI digestion was ligated to the large fragment obtained by digesting pSVL with XbaI and BamHI to give pMB46. This vector was expressed in COS-7 cells using methods described in Example 1. LLLLL-LLL-LA bound ¹²⁵I-hCG with high affinity and the complex was readily immunoprecipitated using the antisera to the C-terminus of the ß₂-adrenergic receptor (Figure 3, Table 3).

Example 22

Preparation and characterization of pMB23, the vector encoding the LLLLL-AAA-A form of the LHR.

This vector encodes an LHR analog in which residues of the LHR transmembrane and C-terminal domains are replaced with those of the hamster ß₂-adrenergic receptor (Figure 8). The DNA- sequence encoding the transmembrane and C-terminal sections of the ß₂-adrenergic receptor was amplified by PCR with primers 5'-GTCACTGACCTTAGGGACGAAGCATGGGTG-3' and 5'- GAAAGCGGATCCTACAGCGGTGAGTCATTTGT-3' and the ß₂-adrenergic receptor cDNA as a template. The PCR product was digested with Bsu36I and BamHI and the two fragments which resulted were ligated with the large fragment produced by digestion of pMB11 with Bsu36I and BamHI to make pMB23. This was expressed in COS-7 cells using procedures described in Example 1 and found to bind ¹²⁵l-hCG with high affinity (Figure 3, Tables 2 and 3). An antibody to the ß₂-adrenergic receptor C-terminus was able to immunoprecipitate ¹²⁵I-hCG bound to this receptor (Figure 3). Example 23

Preparation and characterization of pMB17, the vector encoding the LLLLL-V-V form of the LHR.

This vector encodes an LHR analog in which the seven membered LHR transmembrane domain and C-terminal domain are replaced with the single transmembrane domain and the C-terminal domain of the vesicular stomatis G protein, respectively (Figure 8). LLLLL-V-V was prepared from an analog of the hCG ß-subunit which contained the VSV-G transmembrane and C-terminal domains. To prepare the hCG analog, we used oligonucleotides 5'-GGGCTCTATTGCCTCTTTTTTCTTTATCAT-3' and 5'-GGATCCGAGTTACTTTCCAAGTCGGTTCAT-3' to insert Smal and BamHI restriction sites into the region of the VSV-G cDNA encoding the transmembrane and C-terminal domains. The PCR product was digested with Mbol and cloned into the Smal-BamHI sites of hCG ß-subunit cDNA which had previously been inserted into pSVL as described (20). Preparation of LLLLL-V-V was performed by PCR of the hCG-VSV-G construct in pSVL using primers S'-GCATCCC-GCCTTAGGAGCTCTATTGCCTCT-3' and 5'-GTCCAAACTCATCAATG3' , digesting the PCR product with Mstll and BamHI, and subcloning it into the Mstll-BamHI sites of the vector encoding the LHR. When made in COS-7 cells, this analog had high affinity for ¹²⁵I-hCG (Table 2).

Example 24

Preparation and characterization of pMB16, the vector encoding the LLLLLHH— form of the LHR.

This vector encodes an LHR analog in which the transmembrane and C-terminal domains were replaced by His residues (Figure 8). LLLLLHH—, the analog truncated after amino acid residue 341 was prepared by inserting a termination codon at the Mstll site. pMB11 was digested with Mstll and BamHI and the large fragment obtained was ligated with a cassette prepared by annealing oligos 5'- TTAGGCATCATTAG-3' and 5'-GATCCTAATGATGCC-3'. When made in COS-7 cells, this analog had high affinity for ¹²⁵l- hCG (Table 2). This analog also binds to an NTA resin.

Example 25

Preparation and characterization of pMB22, the vector encoding the A-LLL-Lform of the LHR.

This vector encodes an LHR analog in which the N-terminal domain was replaced with that derived from the hamster ß₂-adrenergic receptor (Figure 8). To prepare A- LLL-L, we used PCR to insert an Mstll site into the region which encodes the junction of the N-terminus and the transmembrane domains of the ß₂AR using primers 5'- TTCGTCCCTAAGGGTCAGTGACATCGTGGTC-3' and 5'- GGCTCAACCTCTAGAGCTCACACTCA-3'. We then subcloned the fragment produced by XbaI and Mstll digestion into the corresponding sites of the construct encoding the LHR. This analog did not substantially bind ¹²⁵I-hCG (Table 2).

Example 26

Preparation and characterization of pMB25, the vector encoding the LLLLL-LLL-LHH form of the LHR.

This vector encodes an LHR analog which two additional His residues at the C-terminus. pMB9 was digested with Hpal and BamHI and the large piece which remained was ligated with the cassette prepared by annealing oligos 5'-GACTCACCACCACTAG-3' and 5'-GATCCTAGTGGTGGTGAGTC-3' to make pMB21. After the coding sequence of the resulting vector was confirmed by dideoxy DNA sequencing, the 2.1Kb fragment released on digestion with XbaI and BamHI was ligated into the XbaI/BamHI sites of pSVL. When expressed in COS-7 cells, this receptor analog had high affinity for hCG. This analog was adsorbed to an NTA resin and enables ¹²⁵I-hCG to bind to this resin (Table 4).

Example 27

Preparation of pMB13, a vector used to stably express an analog of the LHR lacking galactose and sialic acid residues. The LHR coding sequence was removed from pMB11 by XbaI/BamHI digestion and ligated into the large fragment obtained after XbaI and BamHI digestion of expression vector pLEN'-hCGß'. pLEN'-hCGß' is a vector derived from pLEN (25) which was obtained from P.J. Kushner, UCSF, San Francisco, CA 94143. pLEN contains the sequences of pUC8, the 1.12Kbp Hindu fragment of SV40 as an enhancer, bases -771->70 of the human metalothionein IIA gene as a promoter, a unique BamHI site, and approximately 0.3 Kbp of the 3' end of the human growth hormone gene. Constructs cloned into the BamHI site in the correct orientation can be expressed stably in CHO cells (25). pLEN'-hCGß' was made from pLEN as follows. pKBM-hCGß' (20) was digested with Hindlll and ligated to the cassette formed by annealing the oligonucleotide 5'-AGCTAGATCT-3' to itself. This destroyed the Hindlll site and introduced a BglII site upstream of the coding sequence for hCGß'. The resulting vector was digested with BglII and BamHI and the small fragment (approximately 600 bp) was ligated with pLEN which had been digested with BamHI. The intermediate pLEN vector which contained the insert in the correct orientation was identified by digestion with BamHI and EcoRI. Digestion of this vector with BamHI and EcoRI released a fragment of approximately 300 bp. This vector was then termed pLEN'-hCGß' and contained the hCGβ' cDNA flanked on the 5' side by Xhol and XbaI restriction endonuclease sites and on the 3' side by Sad and BamHI restriction sites in place of the original BamHI site. To make pMB13, pLEN'-hCGß' was digested with XbaI and BamHI and the large fragment ligated to the small fragment obtained from pMB11 by XbaI/BamHI digestion. pMB13 was cotransfected into ldl-d CHO cells (26) obtained from M. Krieger, MIT, Cambridge MA along with pSV2Neo (27), a vector which encodes resistance to the antibiotic G418. After one day in culture, G418 (500 ug/ml) was added and the cells which were Neo resistant were cloned and tested for their abilities to bind ¹²⁵I-hCG. Cells which have incorporated the Neo gene and the LH receptor construct will survive in G418 and express LHR on their surfaces. When ldl-d cells are grown in medium lacking galactose, they do not add galactose or sialic acid to Asn-linked oligosaccharides. We compared the affinities of ¹²⁵I-hCG to receptors expressed in ldl-d cells grown in the presence or absence of galactose for 4 days. Receptors expressed in ldl-d cells grown in the absence of galactose had approximately 4-fold higher affinity for ¹²⁵I-hCG than those grown in the presence of galactose (Figure 10). This indicates that the presence of full-length sugars inhibits the binding of hCG to receptors. Therefore expression of receptor analogs in cells that do not fully glycosylate the analogs or which do not glycosylate the analogs is expected to enable them to recognize ligands with higher affinity.

Example 28

Expression of pMB13 in Y-1 cells. pMB13 and pSV2Neo were transfected into Y-1 adrenal cells obtained from the American Type Culture Collection using a calcium phosphate procedure (18, 19). One day later, 250 ug/ml G418 was added and the cells which survived were tested for their abilities to bind ¹²⁵I-hCG. Clones of cells were obtained which were resistant to G418 and which expressed LHR. These cells became round shortly after exposure to hCG. Example 29

Preparation of pMB26, a pLEN-based vector encoding LLLLL- LLL-LHH and LHR analog expression in COS-7 and CHO cells.

The DNA region encoding the receptor construct was excised by digestion of pMB21 with XbaI and BamHI and ligated to the large fragment obtained from pLEN'-hCGß' by digestion with XbaI and BamHI to give pMB26. pMB26 and pSV40Neo were cotransfected into CHO cells and stable clones were obtained using G418 selection as described in Example 27. Triton X-100 extracts of these cells bound to the NTA resin (Table 4). Example 30

Preparation of pMB120, a vector which encodes FFFEE-FFF- F, an analog of the FSHR analogous to the LHR-E form. pMB120 was created by ligating the fragment resulting from Apal and Bsu36I digestion of the PCR product obtained using primers 5'-AGTAGCAAGTAGATGCC-3' and 5'-GCCTCTGGGCCCGTCATTTTAATCTCTGAACTTCATCCAATTTGCA-3' with pMB59 as template to the small fragment created by digesting pMB52 with XbaI and Apal, the small fragment created by digestion of pMB54 with Bsu36I and BamHI, and the large fragment created by digestion of pSVL with XbaI and BamHI. pMB120 was expressed in COS-7 cells similar to the procedure noted in Example 1. The FSHR-E form did not substantially bind ¹²⁵I-hCG or ¹²⁵I-hFSH (Table 1).

Example 31

Preparation of pMB43, a vector which encodes A-LLL-LA, a chimera of the LHR and hamster ß₂-adrenergic receptor.

This vector was prepared by ligating the small fragment resulting from XbaI and Bsu36I digestion of pMB22 with the large fragment obtained from XbaI and Bsu36I digestion of pMB40 described in Example 21. This chimera did not substantially bind ¹²⁵I-hCG.

Example 31

Preparation of pMB43, a vector which encodes A-LLL-LA, a chimera of the LHR and hamster ß₂-adrenergic receptor.

This vector was prepared by ligating the smal fragment resulting from XbaI and Bsu36I digestion of pMB22 with the large fragment obtained from XbaI and Bsu36 digestion of pMB40 described in Example 21. This chimera di not substantially bind ¹²⁵I-hCG. Example 32

Preparation of pMB132, a vector which encodes F(F/L)LFF-FFF-F, a chimera of the LHR and FSHR. pMB111 was digested with BglII and the small fragment was ligated with the large fragment which resulted from BglII digestion of pMB88. The insert with the correct orientation was confirmed by a dideoxysequencmg procedure (18, 19). When expressed in COS-7 cells, F(F/L)LFF-FFF-F was found to have low ability to bind ¹²⁵I-hCG and ¹²⁵I-hFSH (Table 1).

Example 33 Preparation of pMB136, a vector which encodes F(F/FL) (LL/F) FF- FFF-F, a chimera of the LHR and FSHR. pMB136/pMB139 were made in an effort to further localize the smallest number of amino acid residues derived from the LHR that are needed to confer ¹²⁵I-hCG binding to pMB111. These are all derivatives of pMB111 in which the region derived from the LHR (i.e., corresponding to LHR residues 93/170) was divided into four sections and each was replaced by residues from the FSHR. pMB136 was made in a two step PCR reaction. Step Ia employed primers 5'- CTAGCCTAGAAGCTCTGACTGTCTGTCCTTGAGATATCTAAAATGAC-3' and 5'-ATCTGTTAATATGTAACACAGGCATCCGAACCCTT-3' and pMB111 as templat and step lb employed primers 5'-GCCTGTGTTACATATTAACAGATATCTGAGACTGG-3' and 5'-AGCTGTCCTG GAGCTAGGAATCTCTGTACGGAAGTGTTACTTCTGCTCT-3' and pMB59 a template. Step II employed primers 5'- AGCTGTCCTGGAGCTAGGAATCT-3' and 5'-CTAGCCTAGAAGCTCTGACTGTC-3' and the products of steps Ia and lb as template. The resulting product was digested with XbaI and Apal and ligated to the large fragment resulting from XbaI and Apal digestion of pMB59. When expressed in COS-7 cells, F(F/FL) (LL/F) FF-FFF-F had low ability to bind ¹²⁵I-hCG and ¹²⁵I-hFSH (Table 1). Example 34

Preparation of pMB137, a vector which encodes F(F/LF) (LL/F) FF- FFF-F, a chimera of the LHR and FSHR. pMB137 was made in a two step PCR reaction. Step Ia employed primers and 5'- CTAGCCTAGAAGCTCTGACTGTCTGTCCTTGAGATATCTAAAATGAC-3' 5'- CACAAGATCCAGTCTCTCCCAAAAGGTTCTACTAGACATCTGTGATAACTTACACATAACCA CC-3' and pMB111 as template and step lb employed primers 5'-GGAGAGACTGGATCTTGTGAACAGCTGGCAAGTGCTTGATGCCTGTGTTACAGATGC-3' and 5'-AGCTGTCCTGGAGCTAGGAATCTCTGTACGGAAGTGTTACTTCTGCTCT-3 ' and pMB111 as template. Step II employed primers 5'-AGCTGTCCTGGAGCTAGGAATCT-3 ' and 5'-CTAGCCTAGAAGCTCTGACTGTC-3' and the products of steps Ia and lb as template. The resulting product was digested with XbaI and Apal and ligated to the large fragment resulting from XbaI and Apal digestion of pMB59. When expressed in COS-7 cells, F(F/LF) (LL/F) FF-FFF-F had low ability to bind ¹²⁵I-hCG and ¹²⁵I-hFSH (Table 1). Example 35

Preparation of pMB138, a vector which encodes F(F/LL) (FL/F)FF

FFF-F, a chimera of the LHR and FSHR. pMB138 was made in a two step PCR reaction. Step Ia employed primers 5'- CTAGCCTAGAAGCTCTGACTGTCTGTCCTTGAGATATCTAAAATGAC-3' and 5'- GCTTGCCAGGAACTCCTTCATGGGGCTGAGTTTTGAGTCTGTCACACTAAAACTG-3' an pMB111 as template and step lb employed primers 5'- GAAGGAGTTCCTGGCAACGATGTGTATGTTTATGTTATCACAGATTTCCAG-3' and 5'- AGCTGTCCTGGAGCTAGGAATCTCTGTACGGAAGTGTTACTTCTGCTCT-3' an pMB111 as template. Step II employed primers 5'- AGCTGTCCTGGAGCTAGGAATCT-3' and 5'-CTAGCCTAGAAGCTCTGACTGTC-3' and the products of steps Ia and lb as template. The resulting product was digested with XbaI and Apal and ligated to the large fragment resulting from XbaI and Apal digestion of pMB59. When expressed in COS-7 cells, F(F/LL) (FL/F)FF-FFF- F had higher ability to bind 125I-hCG than 1251-hFSH (Table 1). This binding ability shows that only a portion of the region between residues 93/170 needs to be derived from the LHR to insure that the receptor binds 125I-hCG.

Example 36

Preparation of pMB139, a vector which encodes F(F/LL) (LF/F) FF- FFF-F, a chimera of the LHR and FSHR. pMB139 was made in a two step PCR reaction. Step Ia employed primers 5'- CTAGCCTAGAAGCTCTGACTGTCTGTCCTTGAGATATCTAAAATGAC-3' and 5'-AAGAATGGGATTGAAGAAATACACAACCATGCATTCAATGGGACGC-3' and pMB111 as template and step lb employed primers 5'-GTGTATTTCTTCAATCCCATTCTTACTCAGCCATAAAATGACAGACTCGTTATTCATCCCTT

G-3' and 5'-AGCTGTCCTGGAGCTAGGAATCTCTGTACGGAAGTGTTACTTCTGCTCT-3' and pMB11 as template. Step II employed primers 5'-AGCTGTCCTGGAGCTAGGAATCT-3' and 5'-CTAGCCTAGAAGCTCTGACTGTC-3' and the products of steps Ia and lb as template. The resulting product was digested with XbaI and Apal and ligated to the large fragment resulting from XbaI and Apal digestio of pMB59. When expressed in COS-7 cells, F(F/LL) (LF/F)FF-FFF-F had low ability to bind 125I-hCG and 125I-hFSH (Table 1). Example 37

Preparation of pMB133, a vector which encodes FL(L/F) FF- FFF-F, a chimera of the LHR and FSHR. pMB111 was digested with BglII and the large fragment was ligated with the small fragment which resulted from BglII digestion of pMB88. The insert with the correct orientation was confirmed by a dideoxysequencing procedure (18, 19). When expressed in COS-7 cells, FL(L/F) FF-FFF-F was found to have high ability to bind ¹²⁵I-hCG and ¹²⁵I-hFSH (Figure 11, Table 1).

* Binding of ¹²⁵I-hCG, ¹²⁵I-eLH, and ¹²⁵I-hFSH to COS-7 cells transfected with LHR/FSHR chimeras. Binding was measured in duplicate or triplicate. Values shown are pooled from several experiments and are the average mean counts per minute over the non-specific blank, the standard error of the mean, and the number of independent experiments used to calculate the mean. When only one experiment was performed, the error values indicate the standard error of the replicates within the experiment. Non-specific binding was determined as: 1) the CPM bound in the presence of lug unlabeled ligand, 2) the CPM bound to extracts of cells that had not been transfected, and/or 3) the CPM bound to extracts of cells that had been transfected with an analog that had been prematurely truncated at residue 145.

* Binding was carried out of ¹²⁵I-hCG to Triton X-100 solubilized COS-7 cells which had been transfected with various receptor constructs. The bound and free ¹²⁵I-hCG were separated by PEG precipitation or PEI filtration as described (21).

* Immunoprecipitation of Triton X-100 solubilized ¹²⁵I- hCG-LHR/ß₂AR chimeras was carried out using an antibody prepared against the C-terminal region of the ß₂AR (23). Antiserum (2 Ìl) was included at the time ¹²⁵I-hCG was added to the solubilized receptor (total volume 0.25 ml). Following incubation overnight at 4°, we added 50 Ìl of 10% IgGsorb (obtained from The Enzyme Center, Maiden, MA), incubated the slurry 1 more hour at 4°, added 2 mis of 0.9% NaCl solution containing 1 mg/ml bovine serum albumin, sedimented the IgGsorb by centrifugation (2000 × g - 15 min), aspirated the supernate, and analyzed the bound ¹²⁵I-hCG in a gamma-counter.

* CHO cells expressing pMB26 (LLLLL-LLL-LHH) and CHO cells expressing pMB13 (LLLLL-LLL-L) were incubated with

TOR

1²⁵I-hCG in the presence and absence of 1 ug unlabeled hCG. The free ¹²⁵I-hCG was removed by replacing the medium with fresh medium lacking radiolabel, the receptors were solubilized using Triton X-100 (29), and the extracts were passed over an NTA resin (30) obtained from Qiagen (Chatsworth, CA 91311). Specifically bound hCG and receptor was eluted from the column using a pH 5.0 buffer (which disrupts the interaction between the His residues and the NTA-Ni complex, 30). In other studies, the receptors from the CHO cells expressing pMB26 or pMB13 were solubilized using Triton X-100 and the extracts were chromatographed on the NTA column. Then ¹²⁵I-hCG was added to the column and allowed to bind to the receptors for 2 hours at room temperature. Bound and free ¹²⁵I-hCG were separated by washing the column with the detergent extract. Specifically bound ¹²⁵I-hCG was eluted from the column using pH 5.0 buffer. These data show that the presence of the His residues on the receptor do not interfere with its ability to bind ¹²⁵I- hCG and enable the ¹²⁵I-hCG to become specifically bound to the receptor. In addition they demonstrate that the unoccupied receptor can adsorb to the resin and capture 1²⁵I-hCG.

APPENDIUM OF REFERENCES

1. Pierce, J.G. and Parsons, T.F. (1981) Ann. Rev. Biochem. 50, 465.

2. Yen, S.S.C. and Jaffe, R.B. (1986) "Reproductive Endocrinology: Physiology, Pathophysiology and Clinical Management," 2nd edition, W.B. Saunders Company, Philadelphia (1986).

3. Moyle, W.R. (1980) Biochemistry of Gonadotropin Receptors, In: Oxford Reviews of Reproductive Biology Volume 2, Edited by CA. Finn, Clarendon Press, Oxford, pp 123.

4. Dorrington, J.H. and Armstrong, D.T. (1979) Recent Prog. Hormone Research 35, 301.

5. Hsueh, A.J.W., Adashi, E.Y., Jones, P.B.C., and Welsh, T.H., Jr. (1984) Endocrine Rev. 4, 76.

6. McFarland, K.C., Sprengel, R., Phillips, H.S., Kohler, M., Rosemblit, N., Nikolics, K., Segaloff, D.L., and Seeburg, P.H. (1989) Science 245, 494-499.

7. Loosfelt, H., Misrahi, M., Atger, M.,

Salesse, R., Tu Vu Hai Luu Thi, M.T., Jolivet, A.,

Mantel-Guiochon, A., Sar., S., Jallal., B., Gamier. J., and Milgrom, E. (1989) Science 245, 525-528. 8. Frazier, A.L., Robbins., L.S., Stork, P.J., Sprengel, R., Segaloff, D.L., and Cone, R.D. (1990) Mol. Endocrmol. 4., 1264-1276.

9. Sprengel, R., Braun, T., Nikolics, K., Segaloff, D.L., Seeburg, P.H., (1990) Mol. Endocrmol. 4 _F 525-530. 10. Parmentier, M., Libert, F. , Maenhaut, C.,

Lefort, A., Gerard, C., Perret, J., Van Sande, J.,

Dumont, J.E., and Vassart, G. (1989) Science 246, 1620- 1622. 11. Ji, I. and Ji, T.H. (1991) Endocrinology

128, 2648.

12. Xie, Y.B., Wang, H. , and Segaloff, D.L. (1990) J. Biol. Chem. 265, 21411-21414.

13. Tsai-Morris, CH., Buczko, E., Wang, W., and Dufau, M.L. (1990) J. Biol. Chem. 265, 19385-19388.

14. Moyle, W.R., Anderson, D.M., Macdonald, G.J. and Armstrong, E.G. (1988) J. Receptor

Research 8_., 419.

15. Beitins, I.Z., Padmanabhan, V., Kasa-Vubu, J., Kletter, G.B., and Sizinenko, P.C, (1990) J. Clin. Endocrinol. Metab. 71, 1022.

16. Veldhuis, J.D., Urban, R.J., Beitins, I.Z., Buzzard, R.M., Johnson, M.L., and Dufau, M.L. (1989) J. Steroid Biochem. 33, 739.

17. Bernard, M.P., Myers, R.V., and Moyle, W.R. (1990) Mol. Cell. Endocrinol. 71 , R19-R23. 18. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A laboratory manual (second edition) Cold Spring Harbor Laboratory Press. 19. Ausubel, F.M., Brent, R., Kingston, R.E.

Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (1987) Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York. 20. Campbell, R.K., Dean-Emig, D.M., and

Moyle, W.R. (1991) Proc. Nat'l. Acad. Sci. fUSAl 88, 760.

21. Roche, P.C, Bergert, E.R., and Ryan, R. J. (1985) Endocrinology 117, 790-792.

22. Cruz, R.I., Anderson, D.M., Armstrong, E.G., and Moyle, W. R. (1987) J. Clin. Endocrinol. Metab. 64, 433-440. 23. Strader, D.D., Sigal, I.S., Blake, A.D.,

Cheung, A.H., Register, R.B., Rands, E., Zemcik, B.A., Candelore, M.R., and Dixon, R.A.F. (1987) Cell 49, 855-863. 24. Dixon, R.A.F., Kobilka, B.K., Strader,

D.J., Benovic, J.L., Dohlman, H.G., Frielle, T., Bolanowski, M.A., Bennett, CD., Rands, E., Diehl, R.E., Mumford, R.A., Slater, E.E., Sigal, I.S., Caron, M.G., Lefkowitz, R.J., and Strader, CD., (1986) Nature 321, 75-79.

25. Friedman, J.S., Cofer, C.L., Anderson, C.L., Kushner, J.A., Gray, P.P., Chapman, G.E., Stuart, M.C, Lazarus, L., Shine, J., and Kushner, P.J. (1989) Bio/Technology 7 , 359.

26. Matzuk, M.M., Krieger, M., Corless, C.L., and Boime, I. (1987) Proc. Nat'l. Acad. Sci. (USA) 84, 6354. 27. Southern P.J. and Berg, P. (1982) J. Mol. Appl. Genet. 1 , 327. 28. Moyle, W.R., Pressey, A., Dean-Emig, D.M.,

Anderson,D.M., DeMeter, M., Lustbader, J., and Ehrlich, P. (1987) J. Biol. Chem. 262, 16920.

29. Roche, P.C, and Ryan, R.J. (1989) J. Biol. Chem. 264, 4636-4641.

30. Hochuli, E., Bannwarth, W., Dobli, H., Gentz, R., and Stuber, D. (1988) Bio/Technology 6, 1321.

The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention and all such modifications are intended to be included within the scope of the following claims.

Claims

We claim:

1. A protein having binding affinity to human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH), comprising an amino acid sequence of 341 amino acids, wherein the protein is a chimera having an amino acid sequence homologous to the amino acid sequence of residues 1-92 of FSHR, an amino acid sequence homologous to the amino acid sequence of residues 93-170 of LHR, and an amino acid sequence homologous to the amino acid sequence of residues 171-341 of FSHR, wherein the protein is a chain of amino acids that is not naturally occurring as a binding protein. (LH numbering system).

2. The protein according to claim 1, wherein the protein is the FSHR/LHR chimera F(F/L) (L/F) FF-FFF-F (pMB111). 3. A bioimmunoassay for assaying human chorionic gonadotrophin (hCG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and the ratio of LH:FSH, wherein the bioimmunoassay comprises a binding agent which is the protein according to claim 1.

4. The bioimmunoassay according to claim 3, wherein human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH) are bound to antibodies.

5. The bioimmunoassay according to claim 3, wherein the assay is a radioligand assay (RLA), an enzyme linked immunosorbent assay (ELISA), or a radioimmunoassay (RIA).

6. A glycoprotein hormone receptor having binding affinity to human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH), wherein the receptor comprises a transmembrane region and an extracellular N-terminus region, wherein the N-terminus region is a chimera containing an amino acid sequence of 341 amino acids comprising an amino acid sequence homologous to the amino acid sequence of residues 1-92 of FSHR, an amino acid sequence homologous to the amino acid sequence of residues 93-170 of LHR, and an amino acid sequence homologous to the amino acid sequence of residues 171-341 of FSHR, wherein the receptor is a chain of amino acids that is not naturally occurring as a receptor. (LH numbering system).

7. The glycoprotein hormone receptor according to claim 6, wherein the transmembrane region is derived from avidin or biotin.

8. The glycoprotein hormone receptor according o claim 6, wherein the extracellular N-terminus region is the FSHR/LHR chimera F(F/L) (L/F) FF-FFF-F (pMB111).

AMENDED CLAIMS

[received by the International Bureau on 29 September 1992 (29.09.92); original claims 1-8 replaced by amended claims 1-8 (2 pages)

1. A protein having binding affinity to human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH), comprising an amino acid sequence of 341 amino acids, wherein the protein is a chimera in which the N-terminal region has an amino acid sequence homologous to the amino acid sequence of residues 1-92 of FSHR, an amino acid sequence homologous to the amino acid sequence of residues 93-170 of LHR, and an amino acid sequence homologous to the amino acid sequence of residues 171-341 of FSHR, wherein the protein is a chain of amino acids that is not naturally occurring as a binding protein. (LH numbering system).

2. The protein according to claim 1, wherein the protein is the FSHR/LHR chimera F(F/L) (L/F) FF-FFF-F (pMB111).

3. A bioimmunoassay for assaying human chorionic gonadotrophin (hCG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and the ratio of LH:FSH, which comprises the step of binding hCG, LH, or FSH with a binding agent which is the protein according to claim 1.

4. The bioimmunoassay according to claim 3, wherein human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH) are bound to antibodies at a site which remains exposed.

5. The bioimmunoassay according to claim 3, wherein the assay is a radioligand assay (RLA), an enzyme linked immunosorbent assay (ELISA), or a radioimmunoassay (RIA).

6. A glycoprotein hormone receptor having binding affinity to human chorionic gonadotrophin (hCG), luteinizing hormone (LH), and follicle stimulating hormone (FSH), wherein the receptor comprises a transmembrane region and an extracellular N-terminus region, wherein the N-terminus region is a chimera containing an amino acid sequence of 341 amino acids comprising an amino acid sequence homologous to the amino acid sequence of residues 1-92 of FSHR, an amino acid sequence homologous to the amino acid sequence of residues 93- 170 of LHR, and an amino acid sequence homologous to the amino acid sequence of residues 171-341 of FSHR, wherein the receptor is a chain of amino acids that is not naturally occurring as a rat LH receptor. (LH numbering system).

7. The glycoprotein hormone receptor according to claim 6, wherein the transmembrane region is avidin.

8. The glycoprotein hormone receptor according to claim 6, wherein the extracellular N-terminus region is the FSHR/LHR chimera F(F/L) (L/F) FF-FFF-F (pMB111).