THERAPEUTIC FRAGMENTS OF VON WILLEBRAND FACTOR
Cross-Reference to Related Applications
This is a continuation-in-part of application Serial No. 07/613,004, filed November 13, 1990, which is a continuation- in-part of Serial No. 07/600,183, filed October 17, 1990, which is a continuation-in-part of Serial No. 07/519,606, filed May 7, 1990, which is a continuation-in-part of Serial No. 07/270,488, filed November 4, 1988, now abandoned, which is a continuation of Serial No. 869,188, filed May 30, 1986, now abandoned. This is also a continuation-in-part of aforementioned Serial No. 07/600,183, filed October 17, 1990.
Field of the Invention
This invention relates to polypeptides which are useful in the treatment of vascular disorders such as thrombosis. This invention relates also to polypeptides which are useful in the treatment of hemorrhagic diseases, such as von Willebrand disease (vWD) . This invention further relates to the production by reco binant DNA-directed methods of pharmacologically useful quantities of the polypeptides of the present invention.
The term "hemostasis" refers to those processes which comprise the defense mechanisms of the body against loss of circulating blood caused by vascular injury. Processes which
are normal as a physiologic response to vascular injury may lead in pathologic circumstances, such as in a patient afflicted with atherosclerotic vascular disease or chronic congestive heart failure, to the formation of undesired thrombi (clots) with resultant vascular occlusion.
Impairment of blood flow to organs under such circumstances may lead to severe pathologic states, including myocardial infarction, a leading cause of mortality in developed countries. The restriction or termination of the flow of blood within the circulatory system in response to a wound or as a result of a vascular disease state involves a complex series of reactions which can be divided into two processes, primary and secondary hemostasis. Primary hemostasis refers to the process of platelet plug or soft clot formation. The platelets are non-nucleated discoid structures approximately 2-5 microns in diameter derived from egakaryocytic cells. Effective primary hemostasis is accomplished by platelet adhesion, the interaction of platelets with the surface of damaged vascular endothelium on which are exposed underlying collagen fibers and/or other adhesive macromolecules such as proteoglycans and glycosaminoglycans to which platelets bind.
Secondary" hemostasis involves the reinforcement or crosslinking of the soft platelet clot. This secondary process is initiated by proteins circulating in the plasma (coagulation factors) which are activated during primary hemostasis, either in response to a wound or a vascular disease state. The activation of these factors results ultimately in the production of a polymeric matrix of the protein fibrinogen (then called fibrin) which reinforces the soft clot.
Therapeutic drugs for controlling thrombosis have been classified according to the stage of hemostasis which is affected by the administration thereof. Such prior art compositions are typically classified as anticoagulants, thrombolytics and platelet inhibitors.
The anticoagulant therapeutics typically represent a class of drugs which intervene in secondary hemostasis. Anticoagulants typically have no direct effect on an
established thrombus, nor do they reverse tissue damage. Associated with the use of existing anticoagulants is the hazard of hemorrhage, which may under some conditions be greater than the clinical benefits otherwise provided by the use thereof. As a result, anticoagulant therapy must be closely monitored. Certain anticoagulants act by inhibiting the synthesis of vitamin K-dependent coagulation factors resulting in the sequential depression of, for example, factors II, VII, IX, and X. Representative anticoagulants which are used clinically include coumarin, dicoumarol, phenindione, and phenprocoumon.
Thrombolytics act by lysing thrombi after they have been formed. Thrombolytics such as streptokinase and urokinase have been indicated for the management of acute myocardial infarctions and have been used successfully to remove intravascular clots if administered soon after thrombosis occurs. However, the lysis effected thereby may be incomplete and nonspecific, i.e., useful plasma fibrinogen, in addition to fibrin polymers within clots, is affected. As a result, a common adverse reaction associated with the use of such therapeutics is hemorrhage.
A third classification, antiplatelet drugs, includes drugs which suppress primary hemostasis by altering platelets or their interaction with other circulatory system components. The present invention relates to this classification of antiplatelet drugs.
Reported Developments
Specific antiplatelet drugs operate by one or several mechanisms. A first example involves reducing the availability of ionized calcium within the platelet cytoplasm thereby impairing activation of the platelet and resultant aggregation. Pharmaceuticals representative of this strategy include prostacyclin, and also Persatine® (dipyridamole) which may affect calcium concentrations by affecting the concentration of cyclic AMP. Numerous side effects related to the administration of these compounds have been reported. An additional class of antiplatelet drugs acts by inhibiting
the synthesis of thromboxane A2 within the platelet, reducing the platelet activation response. Non-steroidal anti- inflammatory agents, such as ibuprofen, phenolbutazone and napthroxane may produce a similar effect by competitive inhibition of a particular cyclooxygenase enzyme, which catalyzes the synthesis of a precursor of thromboxane A2. A similar therapeutic effect may be derived through the administration of aspirin which has been demonstrated to irreversably acetylate a cyclooxygenase enzyme necessary to generate thromboxane A2. A third anti-platelet mechanism has involved the platelet membrane so as to interfere with surface receptor function. One such drug is dextran, a large branched polysaccharide, which is believed to impair the interaction of fibrinogen with platelet receptors that are exposed during aggregation. Dextran is contraindicated for patients with a history of renal problems or with cardiac impairment. The therapeutic ticlopidine is stated to inhibit platelet adhesion and aggregation by suppressing the binding of von Willebrand factor and/or fibrinogen to their respective receptors on the platelet surface. However, it has been found that ticlopidene possesses insufficient specificity to eliminate the necessity of administering large doses which, in turn, may be associated with clinical side effects. The aforementioned pharmaceuticals are foreign to the body and may cause numerous adverse clinical side effects, there being no way to prevent such compounds from participating in other aspects of a patient's physiology or biochemistry, particularly if high doses are required. It would be desirable to provide for pharmaceuticals having such specificity for certain of the reactions of hemostasis, that they could be administered to patients at low doses, such doses being much less likely to produce adverse effects in patients. An example of a pharmaceutical which is representative of a therapeutic that is derived from natural components of the hemostatic process is described in EPO Publication No. 317278. This publication discloses a method for inhibiting thrombosis in a patient by administering to the patient a
therapeutic polypeptide comprised of the amino-terminal region of the α chain of platelet membrane glycoprotein lb, or a subfragment thereof.
The present invention is directed to the provision of antithrombotic polypeptides derived from a von Willebrand factor, one of the proteins of the hemostatic mechanism.
Summary of the Present Invention
In accordance with the present invention, there is provided a polypeptide patterned on a fragment of wild type mature von Willebrand factor (vWF) subunit having one or more binding sites of predetermined affinity for one or more of the ligands selected from the group consisting of collagen, glycosaminoglycans, proteoglycans, platelet glycoprotein Ibα, platelet glycoprotein Ilb/IIIa, or coagulation factor VIII, said polypeptide having a modified amino acid sequence relative to that of said fragment and an increased binding affinity, relative to said predetermined affinity, for one or more of said ligands.
In one embodiment, this invention provides for host cells containing recombinant vWF DNA sequences in which are expressed biologically active and therapeutically useful polypeptides related to the 52/48 kg/mole (kg/mol) tryptic fragment or domain of mature vWF subunit.
Such polypeptides, when present in monomeric form, may be used as antithrombotic agents. In dimerized form they can be used as antihemorrhagic agents. When expressed in mammalian host cells, such polypeptides are typically also glycosylated.
In accordance with the practice of this invention, there are provided also biologically active polypeptides which are effective in preventing adhesion of platelets to surfaces, in inhibiting activation or aggregation of platelets, and in inhibiting thrombosis. More specifically there are provided polypeptides which are effective in inhibiting the binding of von Willebrand factor multimers to platelet membrane glycoprotein Ibα and which are created by expression in host cells of DNA sequences which reflect one or more mutations
determined from the vWF gene in one or more patients having Type IIB von Willebrand disease, said mutations providing in whole, or in part, the molecular basis for the disease.
Accordingly, there is provided a process for producing from DNA encoding mature von Willebrand factor subunit, or a fragment thereof, a biologically active polypeptide which process comprises the steps of (A) providing a DNA sequence encoding a mature vWF subunit, or a fragment thereof, in which one or more wild type codons are replaced by codons specifying one or more amino acid mutations found in the vWF DNA sequence of one or more Type IIB von Willebrand disease patients; (B) inserting the DNA sequence so provided into a suitable vector to create a construct comprising an expression plasmid or viral expression vector, said construct being capable of directing the expression in cells of said biologically active polypeptide; (C) transforming a host cell with said construct; and (D) culturing said transformed host cell under conditions which cause expression within said host cell of the polypeptide. Known mutations reflective of the genotype and phenotype of Type IIB von Willebrand disease and suitable for incorporation into the DNA sequences useful in the practice of the invention include Trp550 → Cys550; Arg511 → Trpsn; Arg5*3 → Trp543; Val553 → Met553; and Gly561 → Asp561. It is believed that the invention, and the mutagenesis and protein expression procedures thereof, will be widely practiced in the art to generate mutant fragments of mature von Willebrand factor subunit with improved therapeutic utility. Particularly useful examples of antithrombotic polypeptides produced according to the practice of the invention include the following:
(A) a monomeric polypeptide patterned upon a parent polypeptide which comprises the amino acid sequence of that fragment of mature von Willebrand factor subunit beginning approximately at residue 441 (arginine) and ending approximately at residue 730 (asparagine) , or a subfragment thereof, in which when compared to the parent polypeptide, one or
more amino acid residues thereof are replaced by the corresponding residues found at the equivalent sequence positions of mature vWF subunit as isolated from one or more humans with Type IIB von Willebrand disease; and
(B) a polypeptide according to (A) above in which each of cysteine residues 459, 462, 464, 471 and 474 thereof is replaced by a residue of glycine, and in which cysteine residues 509 and 695 thereof are linked by an intrachain disulfide bond.
Although the invention is described initially in terms of reproducing in recombinant DNA molecules particular mutations determined from the vWF encoding DNA of Type IIB disease patients, biologically active vWF-derived polypeptides having similar or higher affinities for the glycoprotein Ib(α) receptors of platelets and resultant therapeutic utility may be artificially created by site specific and random mutagenesis procedures.
Representative of these procedures is a process for generating a biologically active mutant amino acid sequence patterned upon wild type mature von Willebrand factor subunit or a fragment thereof, said sequence demonstrating relative to wild type subunit, or the said fragment thereof, an increased binding affinity for GPIbα, and comprising the steps of:
(A) providing a population of oligonucleotides corresponding to one or more mature vWF subunit DNA subsequences and containing random mutations within one or more of the codons within said subsequences;
(B) using the resultant population of mutant oligonucleotides in a mutagenesis procedure with a vWF or vWF fragment-encoding DNA sequence as template, thereby creating a random population of mutagenized sequences; (C) inserting the mixture of mutagenized vWF or vWF fragment-encoding DNA sequences into plasmids or vectors thereby creating a population of expression plasmids or viral expression vectors;
(D) inserting the resultant population of expression plasmids or viral expression vectors into suitable host cells;
(E) screening individual colonies or cultures of resultant host cells for expression of vWF-derived polypeptides having properties reflective of Type IIB vWF or of fragments thereof;
(F) having determined the DNA sequence of a vWF insert in a colony or culture of a host cell expressing vWF-derived polypeptide having said reflective properties;
(G) expressing the mutagenized DNA sequence, or an additional DNA sequence which is constructed to reflect the changes identified in the mutagenized sequence, in a host cell;
(H) isolating the mutant vWF-derived polypeptide produced thereby. Speaking more generally it is noted that von Willebrand factor is an unusually large, multivalent plasma protein that is involved in platelet adhesion to the subendothelium and in the formation of platelet plugs at sites of vascular injury. Due specially to its multivalent character, the protein links platelets to each other, to collagen and to glycosaminoglycans and proteoglycans, and also protects and then localizes coagulation factor VIII to the site of a forming blood clot. The bivalent or multivalent character of circulating vWF and the multiple potential functions of each mature subunit thereof provide a unique opportunity to affect in vivo binding properties through mutagenesis of or covalent alteration of the relevant binding sites.
Accordingly there is provided a process for producing a polypeptide useful for treating or inhibiting thrombosis, said polypeptide being patterned upon the wild type mature vWF subunit, or a fragment thereof, and being derived therefrom as follows:
(A) providing a mutant vWF DNA sequence, said mutant sequence being characterized as encoding a mature vWF subunit, or a fragment thereof, the encoded polypeptide having, relative to the corresponding
wild type polypeptide sequence, an increased binding affinity for one or more of collagen, glycosaminoglycans, proteoglycans, platelet glycoprotein Ibα, platelet glycoprotein Ilb/IIIa or coagulation factor VIII;
(B) further mutagenizing the DNA sequence of (A) above so that the encoded polypeptide expressed therefrom has a lesser tendency to participate in disulfide- induced dimerization or multimerization than the polypeptide encoded by the DNA sequence of (A) above; and
(C) expressing the further mutagenized DNA sequence of (B) above in a host cell from which an undimerized form of the encoded polypeptide may be extracted or secreted.
Polypeptides of the present invention possess high specificity for target binding domains on other macromolecules, including platelet receptors involved in the hemostatic mechanism. Generally speaking, polypeptides of the present invention are believed to function by preventing platelet adhesion, activation and aggregation, and are expected to be effective at concentrations which are not associated with clinically disadvantageous side effects.
Brief Description of the Drawings
Figure 1 is a table which shows the previously reported amino acid and DNA sequence for the mature von Willebrand factor subunit (human) between residue 431 and residue 750 thereof (see also SEQ ID NO: 1) .
Figure 2 is a drawing of the disulfide dependent association of two 52/48 kg/mol vWF fragments to form a 116 kg/mol homodimer.
Figure 3 is a graph which shows the effect of two Type IIB mutations on the ability of bacterially expressed vWF fragments to bind to platelets. Figure 4 is a graph which shows the effect of a single Type IIB mutation on the ability of bacterially-expressed vWF fragments to bind platelets at two different concentrations
of a monoclonal antibody which competes with vWF fragments for platelet GPIbα receptor.
Figure 5 is a map of the pCDM8 plasmid.
Figure 6 is a graph which shows the effect of the Trp550 → Cys550 mutation on the affinity of the reduced and alkylated 36 kg/mol vWF fragment for platelet GPIbα receptor.
Figure 7 is a graph which shows the effect of the Trp550 → Cys550 mutation on the affinity of the 116 kg/mol homodimeric vWF fragment for platelet GPIbα receptor.
Definitions
Unless indicated otherwise herein, the following terms have the indicated meanings.
Codon - A DNA sequence of three nucleotides (a triplet) which encodes through mRNA an amino acid, a translation start signal or a translation termination signal. For example, the DNA nucleotide triplets TTA, TTG, CTT, CTC, CTA and CTG encode the amino acid leucine ("Leu") ; TAG, TAA and TGA are translation stop signals; and ATG is a translation start signal encoding methionine. Structural Gene - A DNA sequence which encodes through its corresponding messenger RNA ("mRNA") a sequence of amino acids characteristic of a specific polypeptide. Structural genes may also have RNAs as their primary product such as transfer RNAs (tRNAs) or ribosomal RNAs (rRNAs) . Transcription - The process of producing RNA from a structural gene.
Translation - The process of producing a polypeptide from mRNA. Coding* Sequence (Encoding DNA) - DNA sequences which, in the appropriate reading frame, code for the amino acids of a protein. For the purpose of the present invention, it should be understood that the synthesis or use of a coding sequence may necessarily involve synthesis or use of the corresponding complementary strand, as shown by: 5'-CGG-GGA-GGA-3'/3'- GCC-CCT- CCT-5' which "encodes" the tripeptide NH2-arg-gly- gly-COjH. A discussion of or claim to one strand is deemed
to refer to or to claim the other strand and the double stranded counterpart thereof as is appropriate, useful or necessary in the practice of the art. cDNA - A DNA molecule or sequence which has been enzymatically synthesized from the sequence(s) present in an mRNA template.
Transcribed Strand - The DNA strand whose nucleotide sequence is read 3' → 5' by RNA polymerase to produce mRNA. This strand is also referred to as the noncoding strand. Coding Strand or Non-Transcribed Strand - This strand is the antiparallel compliment of the transcribed strand and has a base sequence identical to that of the mRNA produced from the transcribed strand except that thymine bases are present (instead of uracil bases of the mRNA) . It is referred to as "coding" because like mRNA, and when examined 5' -* 3', the codons for translation may be directly discerned. Expression - The process undergone by a structural gene to produce a product. In the case of a protein product, it is a combination of transcription and translation. Mutation - A hereditable change in the genetic information of a DNA molecule.
Recombinant DNA Molecule - A molecule consisting of segments of DNA from different genomes which have been joined end-to- end and have, or can be modified to have, the capacity to infect some host cell and be maintained therein.
Replicon - the DNA required for replication in a particular organism. It includes an origin of replication. Biological Activity - One or more functions, effects of, activities performed or caused by a molecule in a biological context (that is, in an organism or in an in vitro facsimile) . A characteristic biological activity of the 116 kg/mol homodimeric fragment of the mature von Willebrand factor subunit is the potential ability to bind to more than one platelet GPIb receptor thereby enabling the molecule to facilitate aggregation of platelets in the presence of ristocetin. Other resultant or related effects of the 116 kg/mol species include function as a thrombotic and the induction of platelet activation, and/or adhesion to surfaces. Thus such a fragment has therapeutic utility in
the treatment of von Willebrand disease, as an antihemorrhagic agent.
Similarly, a characteristic biological activity of the 52/48 kg/mol monomeric fragment of the mature von Willebrand factor subunit is the potential ability to bind to only one platelet GPIb receptor thereby enabling the molecule to inhibit botrocetin-induced binding of multimeric vWF to platelets. Other resultant or related effects of the undimerized 52/48 kg/mol species include inhibition of platelet activation, aggregation, or adhesion to surfaces. Thus, such a fragment has therapeutic utility as an antithrombotic agent.
Mutant Polypeptide - A polypeptide derived from DNA encoding a parent polypeptide, the DNA having been mutated leading to the presence of one or more altered codons which dictate the placement, during translation, into the mutant polypeptide amino acid sequence of one or more substitute amino acids. Reducing Conditions - Refers to the presence of a "reducing" agent in a solution containing von Willebrand factor, or polypeptides derived therefrom, which agent causes the disruption of disulfide bonds of the vWF. However, consistent with usage typical in the art, the "reducing" agent such as dithiothreitol (DTT) causes a vWF disulfide bond to be broken by forming a disulfide bond between a vWF cysteine and the DTT with no net change in oxidation state of the involved sulfur atoms.
Phage or Bacteriophage - Bacterial virus many of which consist of DNA sequences encapsulated in a protein envelope or coat ("capsid") . Promoter - DNA sequences upstream from a gene which promote its transcription.
Cloning Vehicle (Vector) - A plasmid, phage DNA or other DNA sequence which is able to replicate in a host cell, typically characterized by one or a small number of endonuclease recognition sites at which such DNA sequences may be cut in a determinable fashion for the insertion of heterologous DNA without attendant loss of an essential biological function of the DNA, e.g., replication, production of coat proteins or loss of expression control regions such as promoters or
binding sites, and which may contain a selectable gene marker suitable for use in the identification of host cells transformed therewith, e.g., tetracycline resistance or ampicillin resistance. Plasmid - A nonchromosomal double-stranded DNA sequence comprising an intact "replicon" such that the plasmid is replicated in a host cell. When the plasmid is placed within a procaryotic or eucaryotic host cell, the characteristics of that cell may be changed (or transformed) as a result of the DNA of the plasmid. For example, a plasmid carrying the gene for tetracycline resistance (TetR) transforms a cell previously sensitive to tetracycline into one which is resistant to it. A cell transformed by a plasmid is called a "transformant." Cloning - The process of obtaining a population of organisms, or DNA sequences or other macromolecules derived from one such organism or sequence by asexual reproduction or DNA replication. Expression Plasmid - A plasmid into which has been inserted the DNA being cloned, such as the von Willebrand factor structural gene. The DNA sequence inserted therein may also contain sequences which control the translation of mRNA resultant therefrom, and contain restriction endonuclease sites which facilitated assembly of, and may facilitate further modification of, said expression plasmid. An expression plasmid is capable of directing, in a host cell, the expression therein of the encoded polypeptide and usually contains a transcription promoter upstream from the DNA sequence of the encoded structural gene. An expression plasmid may or may not become integrated into the host chromosomal DNA. For the purpose of this invention, an integrated plasmid is nonetheless referred to as an expression plasmid. Viral Expression Vector - A viral expression vector is similar to an expression plasmid except that the DNA may be packaged into a viral particle that can transfect cells through a natural biological process.
Downstream - A nucleotide of the transcribed strand of a structural gene is said to be downstream from another section
of the gene if the nucleotide is normally read by RNA polymerase after the earlier section of the gene. The complimentary nucleotide of the nontranscribed strand, or the corresponding base pair within the double stranded form of the DNA, are also denominated downstream.
Additionally, and making reference to the direction of transcription and of translation within the structural gene, a restriction endonuclease sequence added upstream (or 5') to the gene means it is added before the sequence encoding the amino terminal end of the protein, while a modification created downstream (or 3') to the structural gene means that it is beyond the carboxy terminus-encoding region thereof. von Willebrand factor fvWF) - It is understood that all references herein to von Willebrand factor refer to vWF in humans. The term "von Willebrand factor" is intended to include within its scope any and all of the terms which are defined below.
Pre-pro-vWF - von Willebrand factor is subject to extensive posttranslational processing. "Pre-pro-vWF" contains (from the N to the C terminus) a signal peptide comprised of approximately 22 amino acid residues, a propeptide of approximately 741 amino acids, and then the approximate 2,050 residues of circulating vWF.
Pro-vWF - The signal peptide has been removed from pre-pro- vWF.
Mature vWF - Circulating vWF as found in the plasma or as bound to the subendothelium. It consists of a population of polypeptide monomers which are typically associated into numerous species of multimers thereof, each subunit of which being 2,050 residues in length. Additionally, when expressed in mammalian cells, mature vWF is usually glycosylated. Additionally, von Willebrand factor is found as a component of the subendothelial matrix, as a component of the α-granules secreted by activated platelets, and as a circulating blood plasma protein. It is possible that the three-dimensional subunit structure or multisubunit structure of vWF varies in these different contexts potentially caused, for example, by differences in glycosylation. Such differences do not prevent useful therapeutic vWF-derived
polypeptides from being produced from the vWF DNA sequences of endothelial cells or megakaryocytes according to the practice of this invention.
Furthermore, it is possible that there are minor biologically unimportant differences between the actual DNAs and polypeptides manipulated or otherwise utilized in the practice of the invention and the structural sequences of amino acids or nucleotides thereof as reported herein. It is understood that the invention encompasses any such biologically unimportant variations. It is also understood that within the genome of the human population there are alleles encoding vWF subunits which contain unimportant amino acid substitutes unrelated to Type IIB disease. It is understood that the invention also encompasses the use of any such variant sequences.
Heparin Binding Site - A domain comprised of one or more regions of amino acid primary sequences of one or more mature vWF subunits having a specific binding affinity for heparin and/or other glycosaminoglycans and/or one or more species of proteoglycans. von Willebrand factor contains binding sites having affinity for glycosaminoglycans, said sites being known to demonstrate affinity for heparin or other glycosaminoglycans patterned upon repeating units similar to those of heparin. Because of these "heparin binding sites," vWF also has affinity for proteoglycans (glycosaminoglycans anchored to a protein core) typically found in the subendothelium. Signal Peptide (Sequence) - A signal peptide is the sequence of amino acids in a newly translated polypeptide which signals translocation of the polypeptide across the membrane of the endoplasmiσ reticulum and into the secretory pathway of the cell. A signal peptide typically occurs at the beginning (amino terminus) of the protein and is 20-40 amino acids long with a stretch of approximately 5-15 hydrophobic amino acids in its center. Typically the signal sequence is proteolytically cleaved from the protein during, or soon after, the process of translocation into the endoplasmic reticulum. That portion of a gene or cDNA encoding a signal peptide may also be referred to as a .signal sequence.
Wild Type Amino Acid Sequence - refers to the amino acid sequence of mature vWF subunit, or of a fragment thereof, which is present in the large majority of humans, and refers also to any mutant amino acid sequence as isolated from vWF of a particular person if no detectable functional differences in the vWF with respect to its interaction with GPIbα result therefrom in humans.
Modified Amino Acid Sequence - reflects any change in the primary structure of a sequence of amino acids of mature vWF subunit compared to wild type sequence. Representative examples of modifications with respect to one or more amino acid residues at one or more primary sequence positions in a polypeptide include deletions, additions, substitutions and the covalent labelling of amino acids present therein or the addition of amino acids containing such labels, i.e., radicals or blocking groups which affect the properties of the amino acid residues so labelled.
Peptide - for the purposes of this invention, the terms "peptide" and "polypeptide" are interchangable. Purified or Substantially in Pure Form - when used with respect to one or more vWF-encoding DNAs or vWF-derived polypeptides, these and similar terms mean that the- composition is substantially free of most of the cellular protoplasm, non vWF-protein, or extracellular material with which the DNA or polypeptide normally occurs in the body. Monomeric - when used with respect to polypeptides, "monomeric" refers to a polypeptide which is not covalently linked to another polypeptide. "Dimeric" refers to a covalent association of two monomers. Fragment - when used with respect to vWF subunit, this term refers to any sequence composed of less than the 2,050 amino acid residues of the mature subunit which can be generated by deleting one or more residues from either the amino or the carboxy terminals of said subunit, or by deletion of one or more residues within the subunit. When used with respect to mature multimeric vWF, the term refers to any combination of subunits and/or fragments of subunits having a combined molecular weight less than about 30 times the weight of a single subunit.
vWF-Derived Polypeptide - a vWF-derived polypeptide refers to any amino acid sequence which is patterned upon the 2,050 residue mature vWF subunit sequence, or any combinations of subsets thereof, and which contains any of the above defined "modifications". Such derived polypeptides can be made through expression of an appropriate encoding DNA or by chemical modification of vWF subunit or a fragment thereof. Other terms used in connection with the description of vWF- derived polypeptides of the invention include "comparable wild type sequence" and "equivalent sequence position" which are best described by way of example.
With respect to the residue 441-730 fragment of mature vWF subunit containing a cysteine residue at position 550, the "comparable wild type sequence" is the 441-730 fragment containing tryptophan at position 550. "Equivalent sequence position" means that the substituted amino acid (for example Cys550) occupies the same position in the vWF-derived polypeptide (position 550) as in the amino acid sequence of vWF subunit from the Type IIB patient from which the mutation was identified, and thus, for example, the incorporation of a Trp550→Cys550 mutation into a vWF-derived polypeptide would not affect the positioning of Lys549 or Val551.
Table 1 shows the standard three letter designations for amino acids as used in the application.
Detailed Description of the Invention
A "Sequence Listing" pursuant to 37 CFR §1.821(c) for nucleotide and amino acid sequences disclosed or referred to herein is appended and made part of this application. As set forth above, both the antithrombotic and antihemorrhagic polypeptides of the present invention are based upon fragments of the natural occurring protein von Willebrand factor. For background purposes, there is set forth hereafter information concerning this protein and its role in hemostasis and thrombosis.
Description of the Role of vWF in Hemostasis and Thrombosis vWF performs an essential role in normal hemostasis during vascular injury and is also of central importance in the pathogenesis of acute thrombotic occlusions in diseased blood vessels. Both of these roles involve the interaction of vWF with platelets which are induced to bind at the affected site and are then crosslinked. It is believed that single platelets first adhere to a thrombogenic surface after which they become activated, a process involving major metabolic changes and significant morphological changes within the platelet. Activation is evidenced by the discharge
of platelet storage granules containing adhesive substances such as von Willebrand factor (an adhesive protein) , and the expression on the surface of the platelet of additional functional adhesive sites. Once activated, and as a part of normal hemostasis, platelet cells become aggregated, a process which involves extensive crosslinking of the platelet cells with additional types of adhesive proteins.
As stated above, these processes are normal as a physiologic response to vascular injury. However, they may lead in pathologic circumstances, such as in diseased vessels, to formation of undesired platelet thrombi with resultant vascular occlusion.
Other circumstances in which it is desirable to prevent deposition of platelets in blood vessels include the prevention and treatment of stroke, and to prevent occlusion of arterial grafts. Platelet thrombus formation during surgical procedures may also interfere with attempts to relieve preexisting vessel obstructions.
The adhesion of platelets to damaged or diseased vessels occurs through mechanisms that involve specific platelet membrane receptors which interact with specialized adhesive molecules. One such platelet receptor is the glycoprotein Ib-IX complex which consists of a noncovalent association of two integral membrane proteins, glycoprotein lb (GPIb) and glycoprotein IX (GPIX) . The adhesive ligand of the GPIb-IX complex is the protein von Willebrand factor which is found as a component of the subendothelial matrix, as a component of the α-granules secreted by activated platelets, and also as a circulating blood plasma protein. The actual binding site of the vWF to the GPIb-IX receptor has been localized on the amino terminal region of the α chain of glycoprotein lb which is represented by GPIb(α) . von Willebrand factor exists as a series of high molecular weight multimers of up to 30 glycosylated subunits per multimer in which the subunits are believed to be identical, with each having an approximate molecular weight of 270,000 (270 kg/mol). Formation of an initial monolayer of platelets covering injured endothelial surfaces is believed to involve a bridging function in which surface
bound multimeric vWF binds on the one side to components of the subendothelium, such as collagen or proteoglycans, and on the other side to the GPIb-IX receptor of a platelet membrane. Evidence that von Willebrand factor is necessary for thrombus formation has been provided by studies using anti-vWF monoclonal antibodies to induce a deficieny in circulating vWF, Bellinger, D.A. et al. , Proc. Natl. Acad. Sci.. USAf 84, 8100-8104 (1987), and by studies utilizing a monoclonal antibody specific for the platelet glycoprotein Ilb/IIIa receptor, Coller, B.S. et al.. Blood. 68, 783 (1986) . The essential role of von Willebrand factor in hemostasis and thrombosis is further evidenced in patients who are deficient in the glycoprotein Ib-IX complex. These persons exhibit a disease state characterized by severe bleeding following nominal vascular injury under otherwise nonpathologic conditions.
It is believed that the interaction of multimeric vWF with glycoprotein Ib-IX complex (at GPIb(α)) results in platelet activation and facilitates the recruitment of additional platelets to a now growing thrombus. The rapidly accumulating platelets are also crosslinked (aggregated) by the binding of fibrinogen at platelet glycoprotein Hb-IIIa receptor sites, and possibly also by vWF at these sites, and/or at additional glycoprotein Ib-IX receptor sites. In addition, the glycoprotein Ilb/IIIa receptor may also be involved in the formation of the initial monolayer of platelets. Of particular Importance in this process is the multimeric and multivalent character of circulating vWF, which enables the macromolecule to effectively carry out its binding and bridging functions.
Inactivation of the GPIbα or GPIIb/IIIa receptors on the platelets of a patient or inactivation of the binding sites for vWF located in the subendothelium of a patient's vascular system, thereby inhibiting the bridging ability of vWF, would be of great medical importance for treating or inhibiting thrombosis. Accordingly, the present invention relates to the development of polypeptides which are effective in accomplishing the foregoing.
Although preventing unwanted thrombi is of great importance, there are circumstances where promoting thrombus formation is desirable. von Willebrand disease, the most common of the bleeding disorders, is the term used to describe a heterogeneous disease state which results when von Willebrand factor is produced in inadequate quantities or when circulating vWF molecules are somehow defective. Various subtypes of the disease have been described. It is apparent that supplying the bridging function of vWF is of central importance in the treatment of patients afflicted with von Willebrand disease. The present invention is concerned with preparation of fragments of von Willebrand factor capable of performing a bridging function between the GPIb(α) receptor or GPIIb/IIIa receptor of the platelet membrane and a receptor on another platelet, or between such a receptor and components of the subendothelium, thereby performing in affected individuals the crucial physiological role of native multimeric von Willebrand factor.
Information Concerning the Structure of vWF and the Design of Therapeutics Derived Therefrom
As mentioned above, von Willebrand factor which circulates in the blood exists as a series of high molecular weight multimers containing up to 30 glycosylated subunits per multimer in which the subunits are believed to be identical, each having an approximate molecular weight of about 270 kg/mol. The circulating "mature" human subunit consists of 2050 amino acid residues. Its structure is the final result of extensive post-translational processing, von Willebrand factor is synthesized in endothelial cells and megakaryocytes. The vWF mRNA is comprised of approximately 9,000 bases and encodes for a polypeptide containing 2,813 amino acid residues. This protein is known as "pre-pro-vWF". After translation and entry into the endoplasmic reticulum, the von Willebrand factor subunit is believed to rapidly dimerize via disulfide bonds involving the carboxy and amino termini regions of respective subunits. Associated with the passages of pre-pro-vWF into the endoplasmic reticulum is the cleavage of the 22 amino acid
signal peptide resulting in the "pro-vWF" form of the polypeptide.
Other post translational events, the timing of which is not fully understood, include glycosylation of at least 22 sites, sulfation, and finally cleavage of a 741 amino acid sequence, the propeptide, from the amino terminal end of the pro-subunit. Finally, dimerized mature vWF subunits (each subunit now comprising 2050 amino acids) are assembled into multimers of larger size by formation of interchain disulfide bonds.
The mature vWF protein from endothelial cells is either secreted constitutively or stored in Weibel-Palade bodies for later release. vWF from megakaryocytes is packaged into the alpha granules of platelets and is secreted at the time of platelet activation.
The domain of the von Willebrand factor subunit which binds to the platelet membrane glycoprotein Ib-IX receptor (GPIb(α)) has been identified within a fragment of vWF. The fragment may be generated by trypsin digestion, followed by disulfide reduction, and extends from approximately residue 449 (valine) of the circulating subunit to approximately residue 728 (lysine) thereof. Current evidence indicates that this segment also contains (between residues 509 and 695 thereof) binding domains for components of the subendothelium, such as collagen and proteoglycans, although other regions of the mature vWF subunit may be more important in recognizing these substances (an additional proteoglycan or heparin binding site is located in residues 1-272 of the mature subunit and an additional collagen binding site within residues 910-1110 thereof). The tetrapeptide Arg-GlyAsp- Ser (SEQ ID NO: 2) (residues 1744 to 1747) , a sequence which vWF shares with many other adhesive proteins, is believed to represent the platelet glycoprotein Hb-IIIa binding site. The primary and tertiary structure of von Willebrand factor and the location of functional domains thereof is reviewed by Titani, K. et al., "Primary Structure of Human von Willebrand Factor" in Coagulation and Bleeding Disorders: The Role of Factor VIII and von Willebrand Factor, T. Zimmerman and Z.M. Ruggeri, eds., Marcel Dekker, New York, 1989.
Figure 1 shows the previously reported amino acid and DNA sequence for the mature von Willebrand factor subunit (human) between residue 431 and residue 750. The 52/48 kg/mol fragment produced by tryptic digestion has an amino terminus at residue 449 (valine) and extends approximately to residue 728 (lysine) . Amino acids are shown by standard three letter designations. The DNA sequence is represented by the coding strand (non-transcribed strand) . Very little polymorphism has been reported in the 52/48 human sequence with one significant exception - histidine/aspartic acid at position 709, see Mancuso, D.J. et al. J. Biol. Chem. , 264(33), 19514-19527, Table V, (1989). (See also SEQ ID NO:
1).
As described in the parent '606 application, polypeptides derived from the above mentioned region of the circulating (mature) von Willebrand factor subunit - from approximately residue 449 to approximately residue 728, or subsets thereof are considered useful as antithrombotic pharmaceuticals when added to blood in such sufficient amounts as to compete successfully with multimeric vWF for platelet GPlb(α) receptor sites, thereby preventing monolayer formation by, or crosslinking of, the platelets in circumstances where thrombus formation is undesirable, such as in the treatment of vascular disorders. The ,606 application identifies numerous publications which relate to the structure, function and molecular genetics of von Willebrand factor, such publications being incorporated herein by reference.
With respect to the mutant therapeutic antithrombotic polypeptides of the present invention, the following information concerning vWF is of particular interest.
A fragment of mature von Willebrand factor having platelet glycoprotein lb(α) binding activity and of approximately 116,000 (116 kg/mol) molecular weight is isolated by digesting vWF with trypsin. If the 116 kg/mol fragment is treated with a reducing agent capable of cleaving disulfide bonds, a pair of identical fragments is generated. Each of the identical fragments (which together comprise the 116 kg/mol polypeptide) has an apparent molecular weight of
about 52,000 (52 kg/mol). (Polypeptide molecular weight are typically measured by migration, relative to standards, in a denaturing gel electrophoresis system. Weight values which result are only approximate.) Typically, the 52,000 molecular weight fragment is referred to as a "52/48" fragment reflecting the fact that human enzyme systems glycosylate the fragment contributing to its molecular weight. The amount of glycosylation varies from molecule to molecule, with two weights, 52,000 and 48,000, being most common.
The 52/48 fragment has been demonstrated to have as its amino-terminus residue 449 (valine) of the mature subunit, and as its carboxy-terminus residue 728 (lysine) thereof. Without the additional weight contributed by glycosylation, the polypeptide has a molecular weight of approximately 38,000.
The 52/48 fragment has been demonstrated to competitively inhibit the binding of von Willebrand factor to platelets. However, manipulation of the 52/48 fragment or its unglycosylated 38 kg/mol equivalent has proved difficult. Successful manipulation of the fragment has typically required that the cysteine residues thereof be reduced and permanently alkylated. Without this treatment, undesired reaction of the cysteine residues thereof invariably occurs, leading to the formation of insoluble and biologically inactive polypeptide aggregates unsuited for effective use as therapeutics.
It is known that the residue 449-728 fragment of mature von Willebrand factor subunit, which contains the platelet glycoprotein Ib(α) binding domain, has cysteine residues at positions 459, 462, 464, 471, 474, 509 and 695. It is known also that all of the cysteine residues of the mature vWF subunit are involved in disulfide bonds. (Legaz, et al. , J. Biol. Chem.. 248, 3946-3955 (1973)). Marti, T. et al. Biochemistry, 26, 8099-8109 (1987) conclusively identified mature subunit residues 471 and 474 as being involved in an intrachain disulfide bond. Residues 509 and 695 were identified as being involved in a disulfide bond, although it was not demonstrated whether this pairing
was intrachain or interchain (that is, within the same mature vWF subunit) .
Mohri, H. et al. J. Biol. Chem.. 263(34), 17901-17904 (1988) inhibited the ristocetin-induced binding of 125I- labelled multimeric vWF to formalin-fixed platelets with peptide subfragments of the 449-728 subunit fragment. Peptide subfragments fifteen residues in length were synthesized and tested. Those peptides which represent subunit sequence contained within, or overlapping with, two distinct regions Leu469 to Asp498 and Glu689 to Val713 were found to be active. Although individual peptides were shown to interact with GPIb(α) receptor, a synergistic effect was noted when two peptides (one from each region) were used, suggesting that the two sequences are in close spatial relation in the correctly folded vWF molecule even though they are far apart in the vWF subunit primary sequence. Mohri, H. et al. tested their hypothesis by using the 15 residue peptides to map the epitopes of several murine monoclonal anti-vWF antibodies which were selected because of their ability to block the vWF-GPIb(α) interaction. The epitope of NMC-4 was found to map into the same two discrete regions of the vWF amino acid sequence previously noted as having GPIb(α) receptor binding capability (Leu^-Asp498 and Glu689-Val713) . The epitope was demonstrated to require the simultaneous presence of amino acid sequence from both primary sequence regions as demonstrated by the binding of NMC-4 to the ho odimeric 116 kg/mol vWF subunit fragment in unreduced form but not to the reduced 52/48 fragment.
Mohri concluded that the GPIb(α) binding domain of vWF was formed by residues contained in two discontinuous sequences Cys474-Pro488 and Leu694-Pro708 maintained in proper conformation in native vWF by disulfide bonding, although the authors were unable to identify the cysteine residue which formed the stabilizing bond(s) and whether the bonds were intra or interchain.
Inasmuch as the present invention is concerned with the production of certain mutant polypeptides that are cysteine- deficient relative to the parent polypeptide, there is set forth below background information concerning the sulfur-
containing amino acid cysteine and the nature of intrachain and interchain disulfide bonds which are present in that fragment of a mature vWF subunit comprising approximately residue position 449 to 728, or which link i;he subunit fragment to similar domains on other subunits.
Information Concerning Cysteine and Disulfide Bonds
Cysteine is unique among the amino acids which typically form the primary sequence of proteins in that, with rare exceptions, it is the only amino acid which forms a covalent bond to another residue of the protein other than a backbone amide linkage, and-thereby alters the three-dimensional structure of the polypeptide.
The thiol group (SH) of a cysteine residue in a polypeptide is capable of combining with the equivalent group of another cysteine to form a covalent disulfide bridge (-S- S-) . Since cysteine residues otherwise far apart in the primary sequence of the molecule can be combined in this way, disulfide bonds are a potentially important factor in determining the three dimensional structure of a protein. In fact for many proteins, their structures, catalytic activities, or other functions require that certain disulfide bonds be formed. If a disulfide bond forms between two cysteines contained within the primary sequence of one polypeptide, the bond is defined as "intrachain." If the cysteines forming a disulfide bond are found on different protein molecules, or polypeptides thereof, the bond is defined as "interchain."
The fragment of mature von Willebrand factor subunit (approximate residues 449 to 728) which contains the platelet glycoprotein lb'α) binding domain, and which is thus useful in the design of antithrombotic therapeutics, contains 7 cysteine residues, at positions 459, 462, 464, 471, 474, 509 and 695 thereof.
There is hereafter provided a first embodiment of the invention involving recombinant DNA molecules expressed in host bacterial cells and suitable for the expression of therapeutic polypeptides patterned on vWF, and a second embodiment involving recombinant DNA molecules expressed in
host eucaryotic cells and suitable for the expression of therapeutic polypeptides patterned on vWF, and a third embodiment of the invention comprising the construction and utilization of vWF-derived polypeptides reflecting enhanced affinity for GPIbα and patterned upon the polypeptides of the aforementioned first and second embodiments.
First Embodiment of the Invention (U.S. Serial No. 07/600,183)
A first embodiment of the invention provides for polypeptides derived from the residue 449-728 region of the mature von Willebrand factor subunit which are useful in the treatment of vascular disorders such as thrombosis.
Among the polypeptides so provided are
(A) a polypeptide patterned upon a parent polypeptide and comprising the amino acid sequence of that fragment of mature von Willebrand factor subunit which begins approximately at residue 441 (arginine) and ends at approximately residue 733 (valine) , or any subset thereof, in which one or more of the cysteine residues normally present in the parent polypeptide, or subset thereof, have been deleted and/or replaced by one or more other amino acids, said polypeptide having therefore less tendency than the parent polypeptide, or subset thereof, to form intra or interchain disulfide bonds in aqueous media at a physiological pH; and
(B) a polypeptide comprising the amino acid sequence from approximately residue 441 (arginine) to approximately residue 733 (valine) of mature von Willebrand factor subunit, or any subset of said sequence which contains residues 509 (cysteine) and 695 (cysteine) , wherein one or more of cysteine residues 459, 462, 464, 471, and 474 are deleted or replaced by one or more other amino acids. Such molecules can be made from DNA which encodes that fragment of mature von Willebrand factor subunit comprising essentially the amino acid sequence from approximately residue 441 (arginine) to approximately residue 733 (valine) ,
or which encodes any subset of said amino acid sequence, a mutant polypeptide fragment, or subset thereof, which contains fewer cysteine residues than that of the comparable wild-type amino acid sequence. Preparation of the molecules comprises culturing a host organism transformed with a biologically functional expression plasmid which contains a mutant DNA sequence encoding a portion of said von Willebrand factor subunit under conditions which effect expression of the mutant von Willebrand factor fragment, or a subset thereof, by the host organism and recovering said fragment therefrom.
The preferred means for effecting mutagenesis of cysteine codons in a vWF DNA to codons encoding amino acids incapable of disulfide bonding is based upon the site directed mutagenesis procedure of Kunkel, T.A. , Proc. Natl. Acad. Sci. U.S.A., 82, 488-492 (1985).
An important aspect of the embodiment is the provision of compositions of said vWF-derived polypeptides which are less prone to aggregation and denaturation caused by undesired disulfide bonding within the inclusion bodies of host expression cells (or resultant from inclusion body solubilization procedures) than previous preparations. The development employs mutagenesis to limit the number of cysteine residues present within said polypeptides. More specifically, preparation of a mutant polypeptide fragment which corresponds to that fragment of mature von Willebrand subunit having an amino terminus at residue 441 (arginine) and a carboxy terminus at residue 733 (valine) , but which differs therefrom in that each of the cysteine residues thereof is replaced by a glycine residue is disclosed. The embodiment also teaches that retention of a certain disulfide bond within polypeptides corresponding to the 449-728 vWF subunit region is particularly important for the design of therapeutic molecules derived therefrom. To accomplish this, a cDNA clone encoding the von
Willebrand factor gene (for the pre-propeptide) was utilized. The cDNA was then subjected to enzymatic amplification in a polymerase chain reaction using oligonucleotides which flanked the indicated region. The first oligonucleotide
representing coding strand DNA contained an EcoRI site 5' to the codon for residue 441 (arginine) and extended to the codon for residue 446 (glycine) . The second oligonucleotide, corresponding to non-coding strand DNA, encoded amino acids 725 to 733 and encoded 3' to codon 733 a Hindlll restriction sequence. The resultant double stranded von Willebrand factor cDNA corresponding to the amino acid sequence from residue 441 to residue 733 (of the mature subunit) was then inserted, using EcoRI and Hindlll restriction enzymes, into the double stranded replicative form of bacteriophage M13mpl8 which contains a multiple cloning site having compatible EcoRI and Hindlll sequences. Following the procedure of Kunkel, T.A. , Proc. Natl. Acad. Sci. USA. 82, 488-492 (1985), site directed mutagenesis was performed using hybridizing oligonucleotides suitable for replacing all of the cysteine codons (residue positions 459, 462, 464, 471, 474, 509 and 695) with individual glycine codons (see Example 1) or 5 of the cysteine codons (residue positions 459, 462, 464, 471 and 474) with individual glycine codons (see Example 4) . Mutant double stranded vWF cDNA fragments derived from the procedure were removed from M13mpl8 phage by treatment with EcoRI and Hindlll restriction endonucleases, after which the ends of the vWF cDNA fragments were modified with BamHI linkers.
The two types of mutant vWF cDNA, containing either 5 or 7 Cys to Gly mutations, were then separately cloned into the pET-3A expression vector (see Rosenberg, A.H. et al.. Gene. 56, 125-136 (1987)) for expression from E.coli strain BL21(DE3), Novagen Co., Madison, WI. pET-3A vehicle containing cDNA for the vWF subunit fragment with 7 cysteine to glycine mutations is referred to as "p7E", and as "p5E" when the contained vWF cDNA fragment encoded the 5 above specified cysteine to glycine mutations. Mutant von Willebrand factor polypeptides produced by bacterial cultures containing expression plasmid p5E were compared with those expressed from cultures containing p7E plasmids. The p5E molecule is capable of forming a disulfide bond between cysteine residue 509 and 695 whereas the p7E molecule cannot.
The behavior of p5E and p7E extracts was examined using immunological methods (see Example 5) . vWF-specific urine monoclonal antibodies RG-46 and NMC-4 were used as probes. RG-46 has been demonstrated to recognize as its epitope a linear sequence of amino acids, comprising residues 694 to 708 within the mature von Willebrand factor subunit. The binding of this antibody to its determinant is essentially conformation independent. Mohri, H. et al. , J. Biol. Chem.. 263(34), 17901-17904 (1988). NMC-4 however, has as its epitope the domain of the von Willebrand factor subunit which contains the glycoprotein lb binding site. Mapping of the epitope has demonstrated that it is contained within two discontinuous domains (comprising approximately mature vWF subunit residues 474 to 488 and also approximately residues 694 to 708) brought into disulfide- dependent association, Mohri, H. et al., supra, although it could not be determined whether the disulfide bond conferring this tertiary conformation in the native vWF molecule was intrachain or interchain. Id. at 17903. Accordingly, 7.5 μg samples (of protein) were first run on 10% SDS-polyacrylamide gels so that the antigenic behavior of particular bands (under reducing and nonreducing conditions) could be compared with results obtained by Coomassie blue staining. Immunoblotting ("Western Blotting") according to a standard procedure, Burnette, A. Anal.
Biochem. r 112, 195-203 (1981), was then performed to compare p5E and p7E extracts.
Briefly, it was found that, under nonreducing conditions, the single chain p5E polypeptide fragment (representing the sequence from residue 441 to residue 733) displays an approximate 120 fold increase in binding affinity for NMC-4 compared to the comparable cysteine-free species isolated from p7E. After electrophoresis under reducing conditions (utilizing 100 mM DTT) , the single chain p5E species shows a remarkably decreased affinity for NMC-4, which was then very similar to that of the cysteine-free p7E species under either reduced or nonreduced conditions. NMC-4 also failed, under reducing or non-reducing conditions, to
recognize as an epitope disulfide-linked dimers from the p5E extract.
The nitrocellulose filters used to produce autoradio- graphs based on NMC-4 were rescreened with RG-46 by subtracting the initial NMC-4 exposure response, which was kept low through a combination of low antibody titer and short exposure time. The binding of RG-46 to the 36,000 kg/mol p7E polypeptide on the filters was the same whether reducing or non-reducing conditions were chosen, consistent with the replacement of all cysteines by glycine in the expressed polypeptide.
A large molecular weight vWF antigen (reactive to RG-46) was present in the p5E polypeptide extract under nonreducing conditions. These p5E vWF aggregates (reflecting interchain disulfide bonds) migrated under reducing conditions in the same position as the p7E polypeptide indicating disruption of their disulfide contacts. However, the large p5E interchain disulfide aggregates which are readily recognized under nonreducing conditions by RG-46 were not recognized by NMC-4 under either reducing or nonreducing conditions. It was thus demonstrated that the disulfide bond between residues 509 and 695 in native multimeric vWF subunits represents an intrachain contact.
The disulfide bond between residues 471 and 474 of the mature vWF subunit has previously been shown to be an intrachain contact, thus the aforementioned embodiment is able to suggest that interchain disulfide bond(s) in multisubunit mature vWF would be formed using one or more of cysteine residues 459, 462 or 464. This discovery is expected to be particularly useful in the design of therapeutic vWF polypeptides patterned upon the 52/48 tryptic fragment (for use as antithrombotics) or patterned instead upon the 116 kg/mol homodimer thereof (for use as antihemorrhagics) .
Disulfide Engineering in the A-. Sequence Domain
The 52/48 tryptic fragment of the mature vWF subunit has been established to comprise the amino acid sequence between residues 449 and 728. Contained within that sequence is a
subfragment consisting approximately of residues 500 to 700 known as the Ax domain. This domain has substantial amino acid sequence homology to the A2 and A3 domains of the 2,050 residue subunit and which are located at approximately residue positions 710-910 (A2) and 910-1110 (A3) . See Titani, K. et al "Primary Structure of Human von Willebrand Factor" in Coagulation and Bleeding Disorders, Marcel Dekker, New York, 1989.
It has been discovered that these "A" domains also share substantial amino acid sequence homology (at minimum approximately 15-20%) with similar domains in numerous other adhesive proteins. Twenty percent sequence homology is generally recognized as being far to great to appear by chance. As recognized by Mancuso, D.J. et al J. Biol Chem, 264(33) 19514-19527 (1989), these homologies clearly suggest that the vWF subunit is the product of a mosaic gene which contains subregions shared by many other proteins. These homologies probably arose from repeated gene segment duplication and exon shuffling. • Pharmacologically active collagen binding polypeptides can be derived from the "A3" domain. The A3 domain contains also a pair of cysteine residues which are believed to form, in vivo, a loop analogous to the residue 509-695 Aj loop structure. The potential utility of this new mutant vWF fragment as an inhibitor of the binding of multimeric vWF to collagen can be demonstrated following the procedures of Pareti, F.I. et al., J. Biol. Chem.. 262(28), 13835-13841 (1987) and Mohri, H. et al., J. Biol. Chem., 264(29), 17361- 17367 (1989).
Second Embodiment of the Invention fU.S. Serial No. 07/613.004)
This second embodiment includes within its scope the recognition of certain of the roles performed by cysteine residues present in the residue 449-728 primary sequence fragment of the mature vWF subunit. In this connection, this embodiment confirms that the cysteine 509-695 disulfide bond is an intrachain bond and provides for effective therapeutics incorporating the 509-695 bond for the purpose of treating
thrombosis, or for the purpose of treating von Willebrand's disease.
Both the antithrombotic polypeptides and antihemorrhagic polypeptides of this the second embodiment of the invention are based upon that amino acid sequence domain which comprises approximately residues 449 to 728 of the mature von Willebrand factor subunit and which, if fully glycosylated, would be equivalent in weight to the 52/48 kg/mol vWF subunit fragment. In practice it is difficult to derive therapeutically useful quantities of such polypeptides from blood plasma. Difficulties include effective separation of 116 kg/mol and 52/48 kg/mol fragments from other components of tryptic digests and effective sterilization of blood- derived components from human viruses such as hepatitis and AIDS. In addition, methods reported in the literature to generate the 52/48 kg/mol monomer from the 116 kg/mol dimer have utilized complete disulfide reduction with resultant loss of tertiary structure. Certain important manipulations of the 52/48 fragment, such as replacement of selective cysteine residues to improve product utility and stability, can only be accomplished in a practical sense by recombinant DNA technology.
However, the production by recombinant DNA-directed means of therapeutic vWF polypeptides analogous to the 52/48 tryptic fragment has met with certain limitations. It is desirable that the polypeptide not only be made by the host cells but that it be correctly folded for maximum therapeutic utility. It is believed that the principal factor which has to date prevented the expression of the most therapeutically active forms of the 52/48 fragment is the incorrect folding of the molecule caused by the linking up of cysteine residues to form incorrect disulfide contacts. In addition, such polypeptides appear to exhibit hydrophobic properties or solubility problems which would not be encountered if they were to be contained within the entirety of the natural vWF subunit, or were properly glycosylated.
Of critical importance, therefore, to the synthesis of vWF-derived therapeutic polypeptides is the selection of conditions which minimize the formation of improper disulfide
contacts. Prior expression of such polypeptides from recombinant DNA in host bacterial cells has certain disadvantages. With reference to the first embodiment, newly produced vWF polypeptides are unable to escape from the host cells, causing them to be accumulated within insoluble aggregates therein (inclusion bodies) where the effective concentration of cysteine residues was extremely high. Under these circumstances, disulfide bonds not characteristic of the vWF molecule as it naturally exists in the plasma are encouraged to, and do, form either within the inclusion bodies or during attempts to solubilize the polypeptide therefrom.
This embodiment provides a solution to these difficulties by causing the vWF-derived polypeptides to be expressed in mammalian cells using a DNA sequence which encodes the polypeptide and which also encodes for a signal peptide, the presence of which causes the vWF polypeptide to be secreted from the host cells. Incorrect disulfide bond formation is minimized by limiting the accumulation of high local concentrations of the polypeptide as in inclusion bodies.
In addition, enzymes present in the host eucaryotic cells, unlike bacteria, are able to glycosylate (add carbohydrate chains to) the vWF-derived polypeptides resulting in therapeutic molecules which more closely resemble domains of vWF molecules derived from human plasma.
The recombinant 116 kg/mol polypeptide generated according to this invention is demonstrated to represent a dimer of the subunit fragment consisting of residues 441-730 and possesses an amount of glycosylation equivalent to that found in the comparable region of plasma-derived vWF.
There follows hereafter a description of the types of therapeutic vWF-derived polypeptides which have or may be generated according to the effective recombinant procedures of the second embodiment.
Recombinant vWF Polypeptides of the Second Embodiment Stated broadly, this second embodiment includes any fragment of mature von Willebrand subunit comprising that
sequence of amino acids between approximately residue 449 and approximately residue 728, or a subfragment thereof, from which at least one of cysteine residues 459, 462 and 464 thereof is removed. Such removal reduces the tendency of the fragment to form undesired interchain disulfide bonds (and resultant dimers) with the result that therapeutic utility as an antithrombotic is improved.
A further aspect of the embodiment encompasses a glycosylated form of the above defined polypeptides. In the design of antithrombotic polypeptides derived from the aforementioned region of vWF, it is preferred that cysteine residues be retained at positions 509 and 695 so that the tertiary structure of the GPIb(α) binding domain of the mature vWF subunit fragment is preserved. Also preferred in the practice of the embodiment is a glycosylated polypeptide derived from the aforementioned region of vWF in which cysteine residues are retained at positions 509 and 695 and in which each of cysteine residues 459, 462 and 464 is deleted or replaced by residues of other amino acids.
Additionally preferred in the practice of the embodiment is a glycosylated polypeptide derived from the aforementioned region of vWF in which cysteine residues are retained at positions 509 and 695 and in which any one of cysteine residues 459, 462 and 464 is deleted or replaced by a single residue of another amino acid.
Important factors involved in the design of, or further modification to, the preferred mutant polypeptides (antithro botics) of the invention are described hereafter. Potential binding sites for collagens and glycosamino¬ glycans (or proteoglycans) exist in the 449-728 tryptic fragment in the loop region between cysteine residues 509 and 695. In the event that binding at these sites by such macromolecules impairs the antithrombotic therapeutic utility of any of the recombinant polypeptides of the invention by, for example, also providing bridging to collagen, the polypeptide can be redesigned (for example, by proteolysis, covalent labelling or mutagenesis) to delete or alter the loop region, or a subdomain thereof.
It is known that both platelets and von Willebrand factor molecules contain large numbers of negative charges such as, for example, those contributed by sialic acid. Such charges can facilitate desirable mutual repulsion of the molecules under non-injury conditions. The addition of one or more positively charged residues of lysine and/or of arginine extending, for example, from the amino and/or from the carboxy terminus of the 52/48 tryptic fragment or recombinant equivalents thereof can overcome electrical repulsions with respect to the GPIb(α) receptor, thus facilitating use of the fragment as an antithrombotic therapeutic.
In addition, and with respect to polypeptides patterned upon the 449-728 vWF subunit fragment, it is within the scope of the invention to remove certain cysteine residues by site directed mutagenesis and to thereafter inactivate any remaining cysteine residues by chemical inactivation thereof, such as, for example, by S-carboxymethylation.
The second embodiment is also concerned with the preparation of polypeptides which are useful in the treatment of hemorrhagic disease. Stated broadly, there is provided a process for the production by recombinant DNA-directed methods of a dimeric polypeptide substantially equivalent to the 116 kg/mol tryptic fragment derived from circulating vWF. In accordance with the process, the monomeric fragment initially formed assumes a tertiary structure suitable for dimerization, and dimerization thereof is effected (see Example 7) . In addition, the process conditions are such that it is possible to form a properly glycosylated dimeric polypeptide.
There follows hereafter a discussion of means by which polypeptides of the second embodiment can be prepared and, in particular, by which such polypeptides can be effectively secreted from host cells in proper folded form and possessing preferably only those disulfide bonds whose presence is consistent with therapeutic utility.
Preparation of Mutant Polypeptides of the
Second Embodiment - Construction of
Suitable DNA Sequences and Expression Plasmids
Essential elements necessary for the practice of the embodiment are: (A) a DNA sequence which encodes the residue
449-728 domain of the mature vWF subunit; (B) an expression plasmid or viral expression vector capable of directing in a eucaryotic cell the expression therein of the aforementioned residue 449-728 domain; and (C) a eucaryotic host cell in which said expression may be effected.
The expression of the DNA sequence of the von Willebrand factor subunit fragment is facilitated by placing a eucaryotic consensus translation initiation sequence and a methionine initiation codon upstream (5') to the residue 449- 728 encoding DNA. The vWF DNA sequence may be a cDNA sequence, or a genomic sequence such as, for example, may be produced by enzymatic amplification from a genomic clone in a polymerase chain reation. Expression of the residue 449-728 encoding sequence is further facilitated by placing downstream therefrom a translation initiation codon such as TGA. The vWF-polypeptide so expressed typically remains within the host cells because of the lack of attachment to the nascent vWF polypeptide of a signal peptide. In such a situation, purification of proteins expressed therein and the extraction of pharmacologically useful quantities thereof are more difficult to accomplish than if the polypeptide were secreted into the culture medium of the host cells. Such expression systems are nonetheless useful for diagnostic assay purposes such as, for example, testing the proper function of platelet GPIb-IX receptor complexes in a patient. In the preferred practice of the invention in which the polypeptide is secreted from the host cell, there is provided a vWF-encoding DNA sequence for insertion into a suitable host cell in which there is also inserted upstream from the residue 449-728 encoding sequence thereof a DNA sequence encoding the vWF signal peptide (see Example 7) . Other vWF- encoding DNA sequences corresponding to different regions of the mature vWF subunit, or corresponding to the propeptide, or to combinations of any of such regions, may be similarly expressed by similarly placing them downstream from a vWF
signal peptide sequence in a suitable encoding DNA. When attached to the amino terminal end of the residue 449-728 fragment of the vWF subunit, the signal peptide causes the fragment to be recognized by cellular structures as a polypeptide of the kind to be processed for ultimate secretion from the cell, with concomitant cleavage of the signal polypeptide from the 449-728 fragment.
With respect to the construction of a eucaryotic expression system and the expression therein of the tryptic 52/48 kg/mol domain of mature subunit vWF (the residue 449- 728 fragment) , it has been found (see Example 7) to be conveneint to manipulate a slightly larger fragment represented by residues 441 (arginine) to 730 (asparagine) . Other similar fragments containing small regions of additional amino acids (besides the 449-728 residue sequence) , which additional amino acids do not significantly affect the function of said fragment, may also be expressed.
Similarly, functional fragments may be expressed from which, when compared to the 449-728 fragment, several residues adjacent to the amino and carboxy terminals have been removed as long as the GPIb(α) binding sequences are not compromised.
It has also been found to be effective, with respect to the construction of a suitable DNA sequence for encoding and expressing the residue 441-730 fragment, to cause to be inserted between the DNA encoding the carboxy terminus of the signal peptide and the codon for residue 441 codons for the first three amino acids of the vWF propeptide (alanine- glutamic acid-glycine) said codons being naturally found directly downstream (3') to the signal sequence in the human vWF gene.
A wide variety of expression plasmids or viral expression vectors are suitable for the expression of the residue 441-730 mature vWF subunit fragment or similar vWF fragments. One factor of importance in selecting an expression system is the provision in the plasmid or vector of a high efficiency transcription promoter which is directly adjacent to the cloned vWF insert.
Another factor of importance in the selection of an expression plasmid or viral expression vector is the provision in the plasmid or vector of an antibiotic resistance gene marker so that, for example, continuous selection for stable transformant eucaryotic host cells can be applied.
Examples of plasmids suitable for use in the practice of the invention include pCDM8, pCDM8neo, pcDNAl, pcDNAl"60, pMAM∞0 and Rc/CMV. Preferred plasmids include pCDMS0*50, pcDNAl"00, pMAM™*0 and Rc/CMV.
Examples of viral expression vector systems suitable for the practice of the invention include those based upon retroviruses and those based upon baculovirus Autographa californica nuclear polyhedrosis virus. Representative host cells comprising permanent cell lines suitable for use in the practice of the invention include CHO-K1 Chinese hamster ovary cells, ATCC-CCL- 61; COS- 1 cells, SV-40 transformed African Green monkey kidney, ATCC- CRL 1650; ATT 20 murine pituitary cells; RIN-5F rat pancreatic β cells; cultured insect cells, Spodoptera frugiperda: or yeast (Sarcomyces) .
Example 7 contains a detailed explanation of preferred procedures used to express and secrete the 441-730 sequence. In that Example, the fragment is secreted as a homodimer held together by one or more disulfide bonds involving cysteine residues 459, 462 and 464. Expression of monomeric fragments useful as antithrombotics necessitates control be made of the disulfide bonding abilities of the monomers which is achieved most preferably by mutagenesis procedures as described below.
Mutagenesis of vWF DNA Encoding The
Mature Subunit Residue 449-728 Region
A variety of molecular biological techniques are available which can be used to change cysteine codons for those of other amino acids. Suitable techniques include mutagenesis using a polymerase chain reaction, gapped-duplex mutagenesis, and differential hybridization of an oligonucleotide to DNA molecules differing at a single nucleotide position. For a review of suitable codon altering techniques, see Kraik, C. "Use of Oligonucleotides for Site
Specific Mutagenesis", Biotechnigues, Jan/Feb 1985 at page 12.
In the practice of this embodiment, it preferred to use the site-directed or site-specific mutagenesis procedure of Kunkel, T.A. , Proc. Natl. Acad. Sci. USA, 82, 488-492 (1985). This procedure takes advantage of a series of steps which first produces, and then selects against, a uracil-containing DNA template. Example 1 of the present invention explains in detail the mutagenesis techniques used to create mutant vWF cDNA.
Other publications which disclose site-directed mutagenesis procedures are: Giese, N.A. et al., Science, 236, 1315 (1987); U.S. Patent No. 4,518,584; and U.S. Patent No. 4,959,314. It is also preferred in the practice of this embodiment to cause to be substituted for one or more of the cysteine codons of the wild type DNA sequence codons for one or more of the following amino acids: alanine, threonine, serine, glycine, and asparagine. Replacement with alanine and glycine codons is most preferred. The selection of a replacement for any particular codon is generally independent of the selection of a suitable replacement at any other position.
The following are representative examples of the types of codon substitutions which can be made, using as an example cysteine residue 459:
(A) the codon for cysteine 459 could be replaced by a codon for glycine; or
(B) the codon for cysteine 459 could be replaced by two or more codons such as one for serine and one for glycine, such replacement resulting in a new amino acid sequence: His^-Ser^^-Gly^^-Gln60; or
(C) the codon for cysteine 459 could be deleted from the cDNA, such deletion resulting in a shortened amino acid sequence represented by - - - His458- Gln460 ; or
(D) one or more codons for residues adjacent to cysteine residue 459 could be deleted along with codon 459 as represented by - - Glu^'-Gln460- -.
It is contemplated that codons for amino acids other than alanine, threonine, serine, glycine or asparagine will also be useful in the practice of the invention depending on the particular primary, secondary, tertiary and quaternary environment of the target cysteine residue.
It is considered desirable in the practice of this embodiment to provide as a replacement for any particular cysteine residue of the 449-728 tryptic vWF subunit fragment an amino acid which can be accommodated at the cysteine position with minimal perturbation of the secondary structure (such as α-helical or β-sheet) of the wild type amino acid sequence subsegment within which the cysteine position is located. In the practice of the present invention, alanine, threonine, serine, glycine and asparagine will generally be satisfactory because they are, like cysteine, neutrally charged and have side chains which are small or relatively small in size.
Substantial research has been conducted on the subject of predicting within which types of structural domains of proteins (α-helix, /3-sheet, or random coil) one is most likely to find particular species of amino acids. Serine is a preferred amino acid for use in the practice of this invention because it most closely approximates the size and polarity of cysteine and is believed not to disrupt α-helical and /3-sheet domains.
Reference, for example, to Chou, P.Y. et al., Biochemistry. 13(2), 211-222 (1974) and Chou, P.Y. et al., "Prediction of Protein Conformation," Biochemistry. 13(2), 222-244 (1974) provides further information useful in the selection of replacement amino acids. Chou, P.Y. et al. predicted the secondary structure of specified polypeptide sequence segments based on rules for determining which species of amino acids therein are likely to be found in the center of, for example, an alpha helical region, and which residues thereof would be likely to terminate propagation of a helical zone, thus becoming a boundary residues or helix breakers. According to Chou, P.Y. et al., supra, at 223, cysteine and the group of threonine, serine, and asparagine are found to be indifferent to α-helical structure, as
opposed to being breakers or formers of such regions. Thus, threonine, serine and asparagine are likely to leave unperturbed an α-helical region in which a potential target cysteine might be located. Similarly, glycine, alanine and serine were found to be more or less indifferent to the formation of /3-regions. It is noted that serine, threonine and asparagine residues represent possible new sites of glycosylation making them potentially unsuitable replacement residues at certain positions in secretory proteins subject to glycosylation.
Generally, the primary consideration which should be taken into account in connection with selecting suitable amino acid replacements is whether the contemplated substitution will have an adverse effect on the tertiary structure of the fragment. Thus, other amino acids may be suitable as acceptable substitutes for particular cysteine residues as long as the new residues do not introduce undesired changes in the tertiary structure of the 449-728 fragment. Reactivity with NMC-4 antibody is recommended as a -test of whether a mutant polypeptide has the desired therapeutic properties.
The specific protocol used to generate the mutant vWF residue 441-730 fragment containing cysteine to glycine substitutions at each of residue positions 459, 462 and 464 is described in Example 9. The expression plasmid used therein was designated pAD4/Δ3C.
The specific protocol, adapted from that of Example 9, and which was used to generate the three mutant residue 441- 730 fragments, each of which contains a different single Cys → Gly mutation (at positions 459, 462 or 464) is described in Example 14. The respective expression plasmids used therein were designated pAD4/G459, pAD4/G462 and pAD/G464 (collectively "the pAD4/ΔlC plasmids").
Properties of the Polypeptides of the Second Embodiment Homodimeric 116 kg/mol vWF Fragments
Example 7 below discloses the use of stably transformed CHO-Kl cells to express the unmutagenized residue 441-730 vWF subunit fragment. As set forth in Example 10 below, the
unmutagenized fragment was also expressed in unstable COS-1 transformants.
SDS-polyacrylamide gel electrophoresis of secreted and immunoprecipitated proteins derived from CHO-Kl cells demonstrates that, under nonreducing conditions, the dominant vWF-derived polypeptide, detected by staining with Coomassie blue, has an apparent molecular weight of about 116,000 (Example 7) . This result was confirmed by characterizing the polypeptides secreted by pAD4/WT transformed COS-1 cells (Examples 12-14) using autoradiographs of 35S-labelled proteins. Under disulfide-reducing conditions (such as in the presence of 100 mM dithiothreitol) the 116 kg/mol fragment was no longer detected and the vWF-derived material appears as the expected 52/48 kg/mol monomer. The apparent molecular weight of the recombinant 116 kg/mol polypeptide was consistent with the presence of said polypeptide as a homodimer of the 441-730 fragment. This homodimer carries also an amount of glycosylation equivalent to that observed in the 116 kg/mol polypeptide isolated by tryptic digestion of mature plasma (circulating) vWF. It is thus demonstrated that expression of the 441-730 fragment in the mammalian cell cultures of this invention favors the formation of the disulfide-dependent 116 kg/mol dimer thereof, mimicking the structure seen in plasma. That the 116 kg/mol fragment so formed represents a correctly folded polypeptide was evidenced by its reaction (under nonreducing conditions) with conformation-dependent NMC-4 antibody. This antibody recognizes a properly assembled GPIb(α) binding site (Example 7) . Reactivity with NMC-4 disappears under reducing conditions.
The dimeric 116 kg/mol fragment which is within the scope of the present embodiment and which contains two GPIb(α) binding sites supports ristocetin-induced platelet aggregation by virtue of its bivalent character. This was evidenced in Example 8 below.
Since it was demonstrated in the first embodiment that cysteine residues 471 and 474 and also residues 509 and 695 are involved in intrachain bonds, the interchain bonds which stabilize the 116 kg/mol homodimer must be formed from one or
more of residues 459, 462 and 464. It is further noted that since residues 459, 462 and 464 are in such close proximity in any monomer, there may be variation as to which particular residue or residues contribute the interchain disulfide bond or bonds which form the interpolypeptide contact in any particular mature vWF dimer or multimer, or recombinant 116 kg/mol fragment. Therapeutically-active populations of dimeric molecules can be generated according to the practice of the invention utilizing any of the possible combinations of interchain disulfide bonds. It is noted that it is also possible that some structural folding or disulfide bond formation associated with the generation of therapeutically active conformations of the recombinant 116 kg/mol dimers of the invention, or disulfide exchange therein, occurs after the polypeptides are secreted from a host cell.
Since there are also contained within the 441-730 vWF fragment potential binding sites for collagens, proteoglycans and glycosaminoglycans, the 116 kg/mol polypeptide is capable of performing a bridging function between a platelet and the subendothelium. This enables it to be used in a method for inducing platelet adhesion to surfaces such as, for example, vascular subendothelium. There is also provided a method of inducing platelet activation and/or aggregation which comprises contacting platelets with an effective amount of the recombinant 116 kg/mol polypeptide.
It is noted that as long as at least one of the one or more potential interchain disulfide bonds stabilizing the homodimer is left intact, and the amino acid sequences comprising the two GPIb(α) binding sites are preserved, that other regions of one or more of the two monomeric fragments thereof could be deleted, if necessary, to modify the therapeutic properties of the dimer.
52/48 kg/mol monomeric vWF fragments An important aspect of the second embodiment of the invention is the provision of glycosylated 52/48 kg/mol monomeric fragments of the vWF subunit having substantial elements of normal tertiary structure. Such fragments have a
reduced tendency to form dimers which tend to be unsuitable for use as antithrombotic therapeutics.
Following the above described procedures for site directed mutagenesis, residue 441-730 vWF fragments were produced in which one or more of cysteine residues 459, 462 and 464 were replaced with glycine residues. Examples 9, 10 and 11 below explain the mutagenesis and cell culture conditions necessary to create COS-1 cell transformants expressing these mutant vWF polypeptides. Examples 6 to 8 of the invention describe the properties of the molecules so derived in comparison with the recombinant 116 kg/mol polypeptide produced from pAD4/WT transformed COS-1 cells.
The vWF-derived polypeptides expressed by pAD4/Δ3C transformed COS-1 cells (containing the vWF 441-730 DNA sequence, but with each of cysteine codons 459, 462 and 464 thereof replaced by single glycine codons) were compared with the polypeptides secreted by pAD4/WT transformed COS-1 cells. To perform the comparisons, 35S-methionine-supplemented culture medium from each culture was subjected to immunoprecipitation using equal amounts of NMC-4 and RG-46 anti-vWF antibodies (Example 6) to collect the vWF-derived secreted proteins. The immunoprecipitated vWF polypeptides were then resolved by autoradiography of 35S-lab'el on SDS polyacrylamide gels. No 116 kg/mol polypeptide could be detected in culture extracts of pAD4/Δ3C transformed cells under nonreducing conditions. Instead, under either reducing or nonreducing conditions, a band having an apparent molecular weight of 52 kg/mol was seen. In contrast, the pAD4/WT transformed COS-1 cells produce under nonreducing conditions, as expected, a polypeptide of apparent molecular weight of 116 kg/mol.
The immunoprecipitation procedure was also repeated using only conformation-dependent NMC-4 antibody (Example 13) . The major vWF-derived component isolated from the culture medium of pAD4/WT transformed cells again had an apparent molecular weight of 116 kg/mol under nonreducing conditions and 52 kg/mol under reducing conditions. A band of apparent 52 kg/mol molecular weight was detected under nonreducing conditions on gels of pAD4/Δ3C derived
polypeptide material. As described in Example 13, reactivity with NMC-4 antibody is important evidence that the 52 kg/mol fragment detected in pAD4/Δ3C transformed cells possesses the tertiary structure of the natural residue 441-730 domain.
The immunoprecipitation procedure was also used to detect NMC-4 reactive vWF polypeptide produced by pAD4/ΔlC transformed COS-1 cells cultured under conditions similar to those for pAD4/WT and Δ3C transformants in the presence of 35S methionine. Immunoprecipitated proteins were run under reducing and nonreducing conditions in SDS-polyacrylamide gels and compared with vWF polypeptides produced by pAD4/WT and pAD4/Δ3C transformants (Example 14) .
It was revealed that substitution of any one of cysteine residues 459, 462 or 464 by glycine results predominantly in a polypeptide having an apparent molecular weight of 52 kg/mol under nonreducing or reducing conditions, the formation of the 116 kg/mol species having been prevented.
The apparent molecular weight of 52 kg/mol for recombinant polypeptides derived from COS-1 cells transformed with either pAD4/Δ3C or pAD4/ΔlC plasmids is consistent with said polypeptides being monomers of the 441-730 fragment, while carrying also an amount of glycosylation equivalent to that seen in the 52 kg/mol polypeptide as isolated from tryptic digestion and reduction of mature plasma (circulating) vWF.
Unlike the dimeric polypeptides of apparent 116 kg/mol molecular weight, the monomeric 52 kg/mol polypeptides produced by pAD4/ΔlC and pAD4/Δ3C plasmids are unlikely to be capable of the bridging function associated with the dimer. Accordingly, there is provided a method of preventing platelet activation and/or aggregation which comprises contacting platelets with an effective amount of a mutant recombinant 52/48 kg/mol polypeptide which polypeptide shows at least a substantially reduced tendency to dimerize when compared with nonmutant (wild type) recombinant 52/48 kg/mol polypeptides.
There is further provided a method of preventing the adhesion of platelets to surfaces which comprises contacting
platelets with an effective amount of a mutant recombinant 52/48 kg/mol polypeptide which shows at least a substantially reduced tendency to dimerize when compared with nonmutant recombinant 52/48 kg/mol polypeptides. Contained within the 441-730 vWF fragment are potential binding sites for collagen (approximately residues 542-622) and glycosaminoglycans and proteoglycans (also within the residue 509-695 disulfide loop) , in addition to the GPIbα binding sites. It is probable because of steric considerations that a single residue 441-730 fragment could not perform effectively as a bridging, potentially thrombotic, molecule. It is noted, however, that as long as the GPIb(α) binding domain of the 52/48 kg/mol monomer (consisting of approximately the primary sequence regions 474-488 and 694-708, and a tertiary domain thereof contributed in part by the 509-695 disulfide bond) is preserved, other regions (part of the heparin and collagen binding loop) of the said 52/48 kg/mol monomeric fragment could be deleted or altered, such as by proteolysis or by mutagenesis, if necessary, to modify or preserve the antithrombotic therapeutic properties thereof.
It is also possible that some structural folding or disulfide bond formation associated with the generation of therapeutically active conformations of the recombinant 52/48 kg/mol monomers of the invention, or disulfide exchange therein, occurs after the polypeptides are secreted from a host cell.
The Present (Third) Embodiment
Description of the Embodiments of the Present Invention This embodiment of the invention provides for antithrombotic polypeptides patterned on mature von Willebrand factor and fragments thereof. Stated more precisely, this embodiment of the invention reflects the discovery that certain mutant polypeptides patterned on mature von Willebrand factor and capable of enhanced binding (relative to wild type) to specific receptors or ligands of vWF can be used to inhibit binding by native or wild type vWF to the same receptors or ligands thereby preventing or
inhibiting thrombosis. The mutant vWF polypeptides having antithrombotic activity can be expressed from recombinant bacterial or eucaryotic expression systems.
A principal goal of the invention is to modify von Willebrand factor or fragments thereof by, for example, mutation or covalent labelling so that the vWF-derived polypeptides bind to one or more receptors (ligands) with a greater affinity than the comparable sequence of amino acids present in wild type vWF, or in the equivalent fragment thereof. Provision of such polypeptides having an "increased binding affinity" allows for more effective clinical treatments including the provision of an effective dose by a lower concentration of therapeutic, with the result that adverse clinical consequences such as immune response are minimized. For the purpose of the invention, a binding affinity is considered increased if the modification enhances the therapeutic utility of the polypeptide by either (1) increasing the affinity of the vWF-derived polypeptide for a ligand by about 10% in relation to the comparable wild-type sequence and as measured in a suitable in vitro or in vivo assay, or (2) achieving an equivalent amount of binding to a ligand with about 10% less polypeptide; or (3) with respect to a particular amino acid sequence modification, achieving (1) or (2) above by use of the said modification in combination with one or more other "modifications" to the amino acid sequence as that term was above defined. More preferably, therapeutics of the invention have an increased binding affinity of about 100% or more for a ligand and most preferably an increased binding affinity for a ligand, compared to the wild type sequence, of about 5 fold or higher.
In the preferred practice of the invention, the mutant polypeptides are designed to have only one binding function, that is, they are capable of binding to only one receptor or ligand, thereby preventing a bridging function in which two or more components which participate in the hemostatic process such as, for example, platelets and damaged vascular wall tissue, are joined, potentially initiating an unwanted thrombus. Methods are described below whereby such
additional binding functions can be avoided. The preferred receptor or ligand of the mutant vWF polypeptides is platelet membrane glycoprotein Ibα.
Preferred as clinically useful antithrombotic polypeptides are those polypeptides patterned upon the mature von Willebrand factor subunit amino acid sequence between approximately residue 441 and approximately residue 733, or subfragments thereof, and having, relative to the wild type amino acid sequence of said polypeptide, or of a subfragment thereof, an enhanced affinity for platelet glycoprotein Ibα. Additionally preferred are vWF-derived polypeptides having a similarly enhanced affinity for platelet glycoprotein Ibα encompassing all or part of the mature subunit residue 441- 733 sequence and containing additional vWF polypeptide sequence.
Although vWF polypeptide fragments reflecting wild type vWF sequences can be used to effect inhibition of the binding of vWF to platelet GPIbα receptors in patients, it is desirable to identify polypeptides having enhanced affinity for GPIbα which are therefore effective at lower doses.
As will be described in detail, an important aspect of the invention is the recognition that certain amino acid substitutions, additions or deletions (compared to the wild type vWF sequence) can be made in the polypeptides to enhance their affinity for GPIbα, thereby making them more effective when administered in therapeutic compositions.
A principal discovery, of the invention is that such suitable amino acid substitutions, additions, or deletions are reflected in, or are suggested by, the amino acid sequences of mature vWF subunit as derived from patients afflicted with Type IIB of von Willebrand disease, said amino acid sequence mutations being responsible for the affliction which is manifested by a prolonged bleeding time after injury. As stated in Ruggeri, Z.M. and Zimmerman, T.S., Blood, 70(4), 895-904 (1987) at 896, "the term von Willebrand disease (vWD) defines a bleeding disorder that is heterogenous in its modalities of genetic transmission, clinical and laboratory manifestations, and underlying
pathogenic mechanisms. Common to the different forms of the disease is that they all represent a genetic disorder, transmitted in an autosomal manner, which alters the structure, functions or concentration of vWF." Numerous separate types and subtypes of vWD have been determined based on phenotypic characteristics of the respective proteins.
Of particular interest to the practice of the invention is that variant of von Willebrand disease known as Type IIB, the criteria for diagnosis thereof being provided by Ruggeri, Z.M. et al., N. Engl. J. of Med. , 302, 1047-1051 (1980).
These criteria include a lifelong bleeding tendency, absence of large vWF multimers circulating in plasma, and platelet aggregation which is hyperresponsive to ristocetin, i.e., occuring with lower ristocetin concentrations than are needed to induce aggregation in platelet-rich plasma of normal individuals. Purified Type IIB vWF has an increased affinity for platelets and, unlike vWF from normal individuals, binds in vitro to platelet GPIbα in the absence of any modulating substance. See Berkowitz, S.D. et al., in Coagulation and Bleeding Disorders, von Willebrand Disease, Chapter 12,
Marcel Dekker, Inc., New York (1989). It is characteristic of normal vWF under similar circumstances that it not bind to platelets in the absence of an added helper molecule (a modulator) such as ristocetin or botrocetin. It should be emphasized that normally circulating plasma vWF and platelets do not interact, absent some physical or chemical stimulus indicating damage to the vascular system. It is believed that modulators used in in vitro assays fulfill the function of such an in vivo stimulus. This invention recognizes the significance of the greater IIB-type affinity for platelet receptors, which can be demonstrated in the presence and/or in the absence of modulators (see Examples 18-19 and 23-24 below) , the mutations responsible therefor being used to design therapeutic vWF fragments reflective of said mutations and having enhanced antithrombotic utility.
As further evidence of the significance of these mutations, patients afflicted with Type IIB von Willebrand disease typically exhibit thrombocytopencia (a reduction in
the number of circulating functional platelets) which is thought, Holmberg, L. et al., N. Engl. J. Med.. 309, 816-821 (1983) , to result from intravascular platelet clumping initiated by the binding of Type IIB vWF molecules to the platelets. Platelets if so aggregated may be transiently removed from circulation leaving the patient with inadequate levels of functional platelets and less able to form clots in the event of vascular injury.
Accordingly, this invention provides for vWF-derived polypeptides which are designed to incorporate mutations associated with Type IIB vWD phenotype and have therefore, relative to the wild type sequence, an enhanced ability to bind to platelet GPIbα receptors. By occupying said GPIbα receptor site, the polypeptides demonstrate antithrombotic utility, that is, they prevent platelets from participating in the processes which under normal or pathological circumstances lead to thrombus formation. Representative of processes involved in thrombus formation and which can be inhibited by the polypeptides of the invention are platelet adhesion, activation and aggregation.
It is important to note that viewed from the perspective of designing new antithrombotic therapeutics, the important characteristic of the new polypeptides is an enhanced affinity for GPIbα receptor, irrespective of whether the mutation is reflected in one or more particular IIB patients. For the purposes of identifying or creating such therapeutic polypeptides the terms "IIB-like", "IIB phenotype", "reflective of Type IIB vWF", "IIB-like properties", and the like, refer to enhanced binding of GPIbα. The methods described below are useful in the identification or creation of such other, additional polypeptide sequences. In addition, and as described in Example 16 below, Type IIB mutations or lib-like mutations can be incorporated into vWF, or fragments thereof, thereby providing enhanced affinity for GPIbα even though said mutant amino acid residues are not inserted into the polypeptide at the exact equivalent sequence positions that the mutations occupy in the vWF from particular patients. It is understood that all such
resulting polypeptides having similar functional properties are within the scope of the invention.
In the preferred practice of the invention, the aforementioned antithrombotic polypeptides are made by a process of genetic engineering (recombinant DNA technology) which involves transferring into vWF-encoding DNA that coding information which causes the resultant expressed polypeptide to contain one or more amino acid substitutions reflective of vWF as isolated from one or more patients with Type IIB disease. The types of amino acid mutations useful in the design of said polypeptides and additional effective amino acid substitutions, additions or deletions are described below.
An additional aspect of the invention provides for the chemical modification or inactivation of a side chain or one or more amino acids in a vWF-derived polypeptide reflective of wild type vWF leading to a polypeptide expressing the vWD Type IIB phenotype.
As a result of the characterization of the functional properties of the polypeptides resultant from the practice of this embodiment of the invention, there is also provided an explanation, with respect to particular patients, for the molecular basis of Type IIB disease.
Example 15 of the invention provides procedures representative of those which may be used to identify the particular mutations in mature von Willebrand factor which are responsible, in particular patients, for Type IIB von Willebrand disease. One propositus was determined to have a Trp550→Cys550 mutation. A second propositus was determined to have an Arg5II→Trp5u mutation. A third propositus having certain Type IIB-like symptoms (see Example 16, method 2 thereof) was determined to have a Gly^'→Asp561 mutation. In a separate published study with respect to two other patients, the mutations believed responsible for Type IIB phenotype were identified as Arg →Trp543 and Val553→Met553. Cooney, K.A. et al.. Blood, 76(supp. 1), abstract 1661, page 418a, Nov. 15, 1990.
It is noted that although all of. the known Type IIB mutations are determined from the residue 509-695 loop region
of the 52/48 kg/mol tryptic fragment or vWF, additional patients may come to be identified for whom the responsible mutations are positioned outside the residue 509-695 loop or outside of the residue 441-730 fragment itself. Example 15 provides for methods suitable to analyze also DNA encoding mature vWF subunit sequence(s) outside of the above-indicated domains thereof. The invention also provides for therapeutic vWF-derived polypeptides that are designed to incorporate one or more of such other potential mutations. It was demonstrated in the first and second embodiments of the invention that the interaction of the vWF fragment comprising approximately residues 441-730 with platelet GPIbα involves "actual binding regions or sequences" (residues 474- 488 and 694-708 thereof) supported in the tertiary structure of the fragment by a disulfide stabilized loop which modulates the position and therefore the activity of the actual binding regions. These sequences and the loop are believed responsible for the adhesion of multisubunit vWF to platelets at GPIbα sites. It may be determined, however, that additional amino acid sequences also participate in binding to GPIbα or in the modulation of said binding.
It was noted above that soluble plasma vWF and platelets circulate in the blood without interacting with each other in normal individuals unless stimulated by one or more vascular injury-related signals. It is suggested therefore that proper exposure of the actual GPIbα binding sites in vWF, and the regulation thereof, require particular conformation(s) of adjacent structural regions of vWF including the residue 509- 695 sequence. Changes in conformation (such as in, adjacent to, or caused by the disulfide-stabilized loop) are believed necessary to facilitate the participation of vWF in hemostasis and thrombosis by inducing binding to GPIbα. These changes in conformation are further believed to be subject to regulation, in vivo, and can be mimicked, .in vitro, by inserting into the loop or other applicable regions of the mature subunit, or of a fragment of either, one or more mutant amino acid substitutions as determined from Type IIB patients. It is anticipated that certain other mutations conferring Type IIB properties may function in different ways
to achieve the Type IIB phenotype but may be nonetheless transferred into therapeutic polypeptides according to the representative procedures of the invention (see Examples 17- 18, 21-22). It is also representative of the practice of the invention to identify mutations in other types or subtypes of von Willebrand disease such as Type I (New York) , which result in enhanced affinity for GPIbα and which may be incorporated into antithrombotic therapeutic polypeptides. As elaborated below, understanding the function of these substitutions or of the amino acids replaced thereby enables the provision of further amino acid changes providing equivalent or improved IIB-like functional properties.
With respect to the invention of additional vWF-derived polypeptides having antithrombotic utility and exhibiting XR vitro or in vivo properties similar to polypeptides as derived from patients with Type IIB disease, the following is of particular significance. Methods 1 to 4 of Example 16 provide representative techniques for the identification of potential amino acid substitutions which although not identified from a particular Type IIB patient, confer nonetheless Type IIB-like properties on recombinantly produced vWF-derived polypeptides incorporating same. The above methods are also representative of techniques which can be used to identify proposed amino acid changes in the vWF polypeptide sequence which effect an increased affinity for GPIbα and which do not correspond with any known human vWF sequence.
(A) The technique of random mutagenesis, Hutchison,
CA. et al., Proc. Natl. Acad. Sci. USA, 83, 710- 714 (1986) can be used to generate a mature vWF (or mature vWF fragment) encoding DNA with random codon changes. By sequentially focusing on consecutive series of 10 to 20 codons from which mutant series are generated, individual vWF-derived polypeptides containing one or more random mutations in the loop region, or other target regions can be generated. Assay systems, suitable for screening large numbers of individual bacterial clones to identify those expressing polypeptide having enhanced binding
affinity for GPIbα are also described in Example 16.
(B) An additional method whereby IIB-like polypeptides (or other vWF-derived polypeptides having enhanced binding affinity for GPIbα) can be identified results from the observations that two of the five known IIB mutations (511, 543) involve Arg→Trp substitutions, that presently all known mutations are within the region of approximately residue 510 to approximately residue 570 and that the region contains numerous other amino acid residues bearing positive charges at physiological pH, substitution for which by one or more neutral or negatively charged residues is hereby postulated to disrupt the proper in vivo function of the loop region, including thereby the function of preventing interaction of GPIbα and vWF until some stimulus or signal related to vascular injury causes a conformational change in vWF or in GPIbα permitting their interaction.
(C) Additional broadly applicable strategies are provided in Method 4 of Example 16 (using Arg511 as a representative example) which reflect the idea that once a particular mutation is identified at a particular position in the amino acid sequence of a patient's vWF gene and it is determined by way of functional studies that the mutation confers or helps to confer the Type IIB phenotype, a significant number of further equivalent (or more effective) amino acid changes at or near that site become possible. Indentification (screening) and confirmation of the effects of such further amino acid changes in vWF-derived polypeptides are possible utilizing, for example, the representative mutagenesis strategies of Examples 16-18, 21-22 below to incorporate such mutations, and then the screening systems of Example 16 to prove or determine the utility thereof (see the section of Example 16 entitled "Screening of mutant vWF-
derived polypeptides for enhanced GPIbα binding activity") .
If, for example, it is determined that positive charge at one or more of residue positions 511, 524, 534, 543, 545, 552, 563, 571, 573, 578, or 579 is necessary for or facilitates normal function of the loop region, and that the absence thereof may confer Type IIB-like properties, then it may be determined that a significant number of other effective and related amino acid sequence permutations can be made surrounding the above- mentioned residue position(s) . Representative of such a permutation strategy is the following. Positive charge reduction and resultant IIB-like activity may be accomplished using substitution of various neutral residues or of residues possessing negative charge at physiological pH. According to the practice of the invention, and using Arg^→Trp543 as an example, since the effecting of a net change in charge of (-1) may explain the conferring of
IIB-like properties at this particular position, making additional, or different substitutions, or additions of other negatively charged or neutral residues may provide an equivalent enhanced GPIbα binding effect. Alternately, proximal and positively charged Arg545 could be deleted or substituted for. Parallel arguments apply to any negatively charged residue positions of wild type vWF determined by comparison with vWF from Type IIB patients to be necessary for proper in vivo function.
The following manipulations resulting in modified amino acid sequences are also within the practice of the invention as are also other similar or equivalent manipulations which would readily occur to practitioners of the biochemical art: (1) replacement of a residue which provides a particular hydrogen bond or provides a particular hydrophobic contact with a residue incapable of
forming such a bond or contact, and (2) chemical inactivation by covalent labelling of one or more residues of wild type vWF amino acid sequence (such as of Arg511) using a covalent label which produces the same change in functional behavior as any of the aforementioned mutations.
(D) It is also contemplated that any of the above strategies can be used in any combination thereof so that, for example, one or more mutations from the vWF gene of one Type IIB vWD patient could be incorporated into a DNA encoding a vWF-derived therapeutic polypeptide along with one or more mutations from the DNA of another such patient, or along with one or more mutations not derived from a patient but predicted or determined in a vWF- derived polypeptide to confer Type IIB-like properties. Similarly, more than one such predicted or determined mutation can be combined in an encoding DNA for expression therefrom of a therapeutic polypeptide.
(E) It should be noted that following the random mutagenesis and screening strategy of Example 16, or of such other mutation and screening strategies as are well known to practitioners of the biochemical art, other vWF-derived fragments having enhanced GPIbα binding ability, but not characteristic of all aspects of Type IIB disease- phenotype, can be generated which reflect mutations that are nonetheless in the residue 509-695 region. Other mutations conferring antithrombotic therapeutic utility may also, of course, be reflective of mutations in the "actual binding regions or sequences" for GPIbα.
Preparation and testing of the polypeptides of the invention
There follows hereafter (and in Examples 15-24) a discussion of means by which the antithrombotic polypeptides of the present invention can be prepared and their utility
confirmed. In this regard the teachings of the first and second embodiments of the invention (including Examples 1 to 14 thereof) are particularly useful and it is suggested that frequent reference thereto be made. By way of example, the following teachings of those embodiments are noted: elucidation of the roles of certain cysteine residues of mature von Willebrand factor subunit and the manipulation of said residue positions to design therapeutic polypeptides, the preparation of vWF fragments having elements of tertiary structure conferred by one or more disulfide bonds reflective of the equivalent structure as present in circulating vWF and also the preparation of vWF fragments lacking such elements, and the preparation, replication and expression of DNA sequences encoding vWF, or mutant polypeptides derived from vWF, or of fragments of either, and the structure, properties and therapeutic function of the vWF-derived polypeptides reported in the said embodiments including the potential utility of glycosylation thereof.
Examples 15-24 of the invention are representative of procedures useful in the practice of the invention, including those for the preparation of DNA sequences from which can be expressed the polypeptides of the invention, and those whereby the utility of said polypeptides as antithrombotic therapeutics can be demonstrated. Other suitable procedures known to those skilled in the art may be substituted if necessary and as the context requires.
Antihemorrhagic polypeptides derived from the polypeptides of the invention
The aforementioned second embodiment of the invention relates to the production by recombinant DNA technology of
116 kg/mol homodimers of the mature vWF subunit residue 441-
730 fragment.
Reference to Figure 2 demonstrates that dimerization of the 441-730 fragment involves one or more disulfide bonds of cysteine residues 459, 462, and 464.
An additional aspect of the invention is the recognition that certain amino acid substitutions, additions or deletions, which in the context of a monomeric fragment (such as 52/48 kg/mol fragment) have antithrombotic utility, have
instead antihemorrhagic utility when incorporated into a dimeric fragment (such as the 116 kg/mol fragment) . Accordingly, such mutations may be incorporated into a DNA sequence in a host eucaryotic cell which encodes the residue 441-730 fragment, with resultant expression therefrom
(following the procedure of Example 7) of a dimeric fragment having enhanced binding affinity for GPIbα and enhanced (relative to wild type) antihemorrhagic activity. It is important to note that, in order to have therapeutic utility, such mutations must result in a fragment which does not bind to platelet GPIbα receptors while in solution, but binds only when the vWF fragment has adhered to a surface, mimicking thereby the changes in vWF structure which result from binding, for example, to the subendothelium. Clone screening assays designed to employing surface bound vWF fragments are accordingly required.
With respect to amino acid changes suitable for producing monomeric fragments having enhanced GPIbα binding affinity, and therefore antithrombotic activity, it is noted that all such strategies (including covalent modification of particular amino acid residues) are suitable for generating antihemorrhagic dimers having enhanced GPIbα affinity. Covalent modifications may of course be applied to 116 kg/mol fragments produced by tryptic digestion. Examples 7, 8 and 16 below, and the preceding discussion thereof, contain representative methods which can be used to produce and screen amino acid changes in the context of dimeric vWF fragments having enhanced antihemorrhagic activity. Other suitable procedures are generally known in the art.
Additional Binding Functions
Although the invention is initially described in terms of constructing therapeutically active fragments of mature vWF subunit patterned upon the residue 441-730 domain thereof and having enhanced affinity for platelet GPIbα receptor, the multivalent character of circulating vWF, and the multiple potential functions of each mature subunit provide a unique
opportunity to design other fragments of vWF having additional enhanced antithrombotic properties.
A review of the particular functions of specific binding domains in mature vWF is provided in Zimmerman, T.S. and Ruggeri, Z.M. Coagulation and Bleeding Disorders, Marcel Dekker, New York, 1989. Particular functional domains of mature vWF subunit having identified binding functions are as follows: (A) residues 1744-1747 (Arg- Gly-Asp- Ser - see SEQ ID NO: 2) of the C02H terminal region of the subunit are responsible for platelet glycoprotein Ilb/IIIa binding; (B) two independent binding sites for collagen within or comprising approximately residue sequences 542-622 and 948- 998; (C) a binding domain for coagulation Factor VIIIc between or comprising mature vWF subunit residues 1 to 272; (D) binding domains for glycosaminoglycans (and proteoglycans) localized to the residue 1-272 region and also within the residue 509-695 region of the mature subunit; and (E) the above described platelet glycoprotein Ibα binding domain. • By generating a population of randomly mutagenized DNA sequences corresponding to one of the above binding domains of vWF and then screening the expressed polypeptides produced by resultant individual clones, appropriately sized inhibitor polypeptides with enhanced binding activity toward one of the above specified ligands or receptors may be derived. It is noted that this procedure is also applicable to additional binding domains of vWF for the same or different ligands or receptors that may come to be determined. The mutagenesis procedure is equally applicable to those of the above binding functions of vWF which may be shown to involve participation of two or more primary sequence regions of one or more mature vWF subunits which assemble to form a combined total binding domain.
Of particular importance as a source of new anti- thrombotics is the 52/48 kg/mol tryptic fragment which has multiple potential ligand or receptor binding functions. Reference to Figure 2 shows that the homodimeric 116 kg/mol fragment (a dimer of the residue 441-730 fragment held together by one or more disulfide bonds at positions 459,
462, 464) can be used to cause adhesion or aggregation of platelets and therefore has antihemorrhagic utility, whereas 52/48 kg/mol monomers thereof stabilized against interchain disulfide bond formation are capable of binding to a target ligand or receptor to the exclusion of multimeric vWF and therefore have utility as antithrombotics. If particular circumstances are identified, however, wherein the function of one binding site within the 52/48 kg/mol fragment can be affected adversely by engagement at another binding site thereof of an additional ligand or receptor resulting in undesireable binding properties, the fragment can be further mutated or chemically altered to inactivate the particular undesired binding activity.
It was mentioned previously that random mutagenesis procedures, for example those of Hutchison, CA. et al.,
Proc. Natl. Acad. Sci., USA. 83,710-714 (1986) could be used to generate a population of DNA sequences encoding the 52/48 vWF fragment with random amino acid substitutions therein. As further provided in Example 16 below, such individual resultant DNA sequences (each contained preferably within a bacterial clone) can be expressed and subjected to a large scale screening system designed to detect those species among the expressed vWF polypeptides which have enhanced binding activity (higher affinity) toward the platelet GPIbα receptor, said enhancement resulting either from one or more mutations in the actual GPIbα binding sequences (consisting approximately of residues 474-488 and 694-708) , or within sequences (such as in the case of known Type IIB mutations) which modulate the properties of the actual binding sequences.
Antithrombotic polypeptides which are monomeric and which are unable to perform a potentially thrombotic bridging function may also be designed to target the collagen fibers such as are exposed at the site of disease-caused circulatory system lesions, and upon which a thrombus may otherwise form. By occupying these collagen binding sites, to the exclusion of multimeric vWF, the complex sequence of events resulting in platelet aggregation and thrombus formation can be avoided.
The random mutagenesis procedure of Hutchison, CA. et al., supra, may be used to target the collagen binding domain within the loop of the 52/48 kg/mol vWF fragment. Suitable clones expressing polypeptides with enhanced binding activity toward collagen may be screened according to the procedure of Example 25. With respect to the design of such an antithrombotic 52/48 kg/mol polypeptide having a high binding affinity for collagen sites, it may be desireable to cause substitution or deletion (by mutation) or inactivation (by chemical labelling or proteolysis) of the actual GPIbα binding sequences in order to prevent a potentially thrombotic bridging activity within the monomeric 52/48 kg/mol fragment.
A particularly important benefit of the invention, and of the Second Embodiment thereof (see Examples 9 and 11) , is the provision of a 52/48 kg/mol vWF fragment which has a substantially reduced tendency to participate in disulfide- induced dimerization; it therefore lacks potentially thrombotic bridging activity. An additional collagen binding site is represented by the A3 domain of the mature vWF subunit. This domain comprises approximately residues 910-1100 of the subunit and contains also a disulfide loop formed by cysteine residues 921 and 1108. The A3 domain is believed to represent a partially autonomous structural domain containing within its primary amino acid sequence information adequate to allow assembly of a polypeptide patterned thereon into a structure mimicing in whole or part the natural tertiary structure of the A3 domain as present in multimeric vWF. The A3 domain itself lacks additional cysteines, analogous, for example, to cysteine residues 459, 462 and 464 positioned adjacent to the Aj domain, and which would tend to cause dimerization of the fragment. Thus the A3 domain is a region from which to derive effective antithrombotics. As an example of the procedure used to express mutant polypeptides which target exposed collagen fibers of the subendothelium and representative of the mutagenesis strategy used to target any other of the above-mentioned macromolecules of the hemostatic mechanism, a DNA sequence
corresponding to the A3 domain may be prepared by any of several standard methods based upon the known vWF gene sequence, the location of exon/intron boundaries therein, the nucleotide sequence of available vWF mRNA or cDNA and the known amino acid sequence of pre-pro-vWF. A vWF mRNA could be used, for example, as a template for reverse transcriptase with the resultant cDNA being subjected to a polymerase chain reaction using suitable oligonucleotide primers to flank the ends of the target A3 encoding region. A nucleotide sequence sufficiently large to facilitate efficient replication, transcription and translation (such as corresponding to amino acid positions 850-1150) can be chosen for amplification with random mutagenesis, Hutchison, CA. et al., supra, applied to emphasize permutation of the DNA region encoding amino acid residues 948-998. Screening of clones expressing the randomly mutagenized population of polypeptide sequences for particular species demonstrating enhanced collagen binding activity would follow the method of Example 27.
Binding Sites for Glycosaminoglycans and Proteoglycans Bacterial clones possessing mutagenized DNA sequences corresponding to the "heparin binding sites" of the mature vWF subunit (believed to be positioned in whole or part within the loop of the 52/48 kg/mol fragment and also in whole or part within the mature subunit region represented by residues 1-272) may be similarly generated and screened for the necessary enhanced binding affinity toward their respective target macromolecules to create antithrombotic therapeutic polypeptides. The screening procedure follows the procedure of Examples 26 and 29. The "heparin-binding domains" of vWF may prove to be instrumental in the binding of vWF to exposed subendothelium in response to vascular injury and in the pathogenesis of vascular disease. It has been shown that vWF binds to endothelial cell-produced extracellular matrices even after collagen has been enzymatically digested away. It is likely that proteoglycans are responsible for this interaction.
The platelet glycoprotein Ilb/IIIa receptor site Although the binding reaction believed primarily responsible for crosslinking (aggregation) of individual platelets that have adhered to the subendothelium at the site of vascular injury is the bridging of platelet GPIIb/IIIa receptor sites by fibrinogen, multimeric vWF can also contribute to this crosslinking activity. Suitable vWF fragments can also be used to inhibit the activity. vWF and fibrinogen contain within their respective polypeptides a domain of primary sequence consisting of Arg- Gly-Asp (residues 1744-1746 in mature vWF subunit) which is known to be at least part of the platelet GPIIb/IIIa recognition site for these adhesive proteins. Synthetic peptides patterned upon the Arg-Gly-Asp sequence have been demonstrated to inhibit binding of fibrinogen or vWF to platelet GPIIb/IIIa membrane receptors. See Ruggeri, Z.M. et al., Proc. Natl. Acad. Sci.. USA. 83, 5708-5712 (1986) and U.S. Patent No. 4,683,291.
Aggregation of platelets (the result of which is the crosslinked platelet mass or thrombus) can be inhibited in a patient by administering therapeutic compositions containing mutant polypeptides derived from the Arg-Gly-Asp region of the mature vWF subunit. Such polypeptides possessing enhanced binding affinity are effectively made by systematic random mutagenesis (see Example 16, method 1 thereof) of a suitable DNA sequence encoding the GPIIb/IIIa binding domain of vWF. Screening of mutant clones for expressed polypeptide of enhanced binding activity follows the procedure of Example 28.
The Factor VIII Binding Domain
The above mutagenesis procedures are also applicable to targeting the interaction of vWF with coagulation factor VIII, a necessary participant in secondary hemostasis and believed to be necessary to facilitate activation of coagulation factor X by factor IX,. Factor VIII has been shown to be extremely labile except when complexed to vWF. This invention provides a fragment of vWF capable of binding factor VIII, and having, relative to wild type, an enhanced
affinity therefor, but of insufficient size to substantially protect factor VIII so complexed from denaturation or proteolysis. Screening of mutant vWF polypeptides for enhanced binding affinity follows the procedure of Example 30.
Inactivation of Heparin Sites
With respect to the use of the 52/48 kg/mol vWF fragment as an antithrombotic, or of any of the therapeutic polypeptides patterned thereupon, the following considerations are of particular significance. It has been mentioned previously that it is possible for more than one of the GPIbα, glycosaminoglycan (proteoglycan) , or collagen binding domains of such a therapeutic polypeptide to be occupied by a respective target receptor or ligand at any particular time. Methods were described to prevent one or both of the undesired binding activities, said aforementioned methods involving further modifications to the therapeutic polypeptide.
It must be considered also that delivery of such therapeutic polypeptides to target platelet GPIbα receptors in a patient suffering from vascular disease or otherwise at risk to thrombosis involves the exposure of the polypeptide to all of the macromolecules present in the vascular system, a situation which is very different from a two or three component in vitro binding assay at low total protein concentration. It is noted, for example, that there are many types of glycosaminoglycans and proteoglycans present in the extracellular matrix (the subendothelium) of the vascular system. Although proteoglycans may be deemed confined to such a matrix and unavailable for binding to vWF in undamaged vessels, glycosaminoglycans are more widely distributed. In particular, glycosaminoglycans are found on the surface of many types of human cells including those that form the walls of blood vessels. In addition, heparin itself has anticoagulant activity and is commonly administered to patients presenting or suspected of presenting a vascular disease state. Consequently, there is a considerable possibility that the administration of a monomeric 52/48
kg/mol polypeptide or, for example, a modified form of the polypeptide containing also one or more Type lib mutations (see Example 22 below) as an intended antithrombotic will be ineffective, the therapeutic molecules having sufficient affinity for the widely dispersed array of glycosammoglycan macromolecules or for additionally administered heparins. Accordingly, it is preferred in the practice of the invention, with respect to the design of antithrombotic polypeptides patterned upon the 52/48 kg/mol vWF fragment, said fragments intended to have affinity for platelet GPIbα receptors, that the binding domain for glycosaminoglycans within such fragments be deleted or inactivated by, for example, one of the following methods:
(A) site directed or loop out mutagenesis in M13mpl8 (see Example 7) to express a further mutagenized polypeptide from which the glycosammoglycan binding domain is deleted; or
(B) subjecting the mature subunit 52/48 kg/mol fragment to selective proteolysis to preserve subfragments of the residue 441-730 sequence having GPIbα binding ability, and which can then be covalently reattached, but minus a deleted section of the fragment such as a subset of the intervening residue 509-695 region; or (C) covalent modification of the vWF amino acid sequence domain which confers the additional and undesired binding function to inactivate it. A similar strategy can be employed to delete or inactivate the collagen binding function of such therapeutic polypeptides. Removal of both the potential collagen and potential glycosammoglycan (proteoglycan) binding functions from such vWF-derived therapeutics is also within the scope of the invention.
Similar strategies may be used to modify different or larger fragments of vWF directed to platelet GPIbα binding sites, including those up to the size pf the entire mature subunit thereof, or larger, and demonstrated to have potential antithrombotic activity but one or more potential binding sites for other ligands or receptors, the deletion or
inactivation of which is preferable. Additionally, and with respect to those polypeptides of the invention patterned upon the mature vWF subunit, or a fragment thereof, which are directed to receptor sites or macromolecules other than GPIbα (see Example 25-30) , it is noted that any other binding function of the polypeptide can be deleted or inactivated by the above-mentioned strategies.
Additionally preferred in the treatment of hemorrhagic disease is a polypeptide patterned upon the 116 kg/mol vWF homodimer (Example 7, below), directed to the platelet GPIbα receptor, in which one or more other binding functions of the polypeptide have been deleted or inactivated.
Antibodies with Therapeutic Activity
Antibodies, and particularly conformation dependent antibodies, are powerful tools for analyzing the structure and function of macromolecules. By blocking macromolecular interactions, antibodies can also have important therapeutic utility.
Accordingly, this invention includes within its scope an antibody which is specific for the vWF subunit, or any polypeptide containing a subset thereof, and which is made by a process which involves immunizing animals with a polypeptide patterned upon the mature vWF subunit sequence between approximately residue 441 and residue 730 thereof, and containing one or more residues corresponding to a Type IIB vWF, or with any other polypeptide of the invention. Further diagnostic or therapeutically useful antibodies can be generated against polypeptides so patterned upon the above stated sequence region and in which cysteine residues 509 and 695 form a disulfide bond, thereby recreating important domains of tertiary structure. Procedures useful in immunizing animals with vWF polypeptides are well known in the art.
Therapeutic compositions One or more of the polypeptides of the present invention can be formulated into pharmaceutical preparations for therapeutic, diagnostic, or other uses. To prepare them for
intravenous administration, the compositions are dissolved in water containing physiologically compatible substances such as sodium chloride (e.g. at 0.35-2.0 M) , glycine, and the like and having a buffered pH compatible with physiological conditions, which water and physiologically compatible substances comprise a pharmaceutically acceptable carrier.
With respect to the monomeric 52/48 kg/mol polypeptides of the invention or other antithrombotic polypeptides, the amount to administer for the prevention or inhibition of thrombosis will depend on the severity with which the patient is subject to thrombosis, but can be determined readily for any particular patient.
With respect to the recombinant 116 kg/mol polypeptides of the invention, or other dimeric polypeptide subfragments thereof, the amount to administer for the treatment of von
Willebrand disease will depend on the severity with which the patient is subject to hemorrhage, but can be determined readily for any particular patient.
Examples The following Examples are representative of the practice of the invention.
I. Construction of vWF Polypeptides
Suitable to Carry lib-Type Mutations
Example 1 - Expression of a mutant cysteine-free mature von Willebrand factor subunit fragment having an amino terminus at residue 441 (arginine) and a carb'oxy terminus at residue 733 (valine)
Preparation of a cDNA Clone from pre-pro-von Willebrand Factor mRNA
A cDNA clone encoding the entire von Willebrand factor gene (for the pre-propeptide) was provided by Dr. Dennis
Lynch, Dana-Farber Cancer Institute, Boston, MA and was prepared as described in Lynch, D.C et al., Cell, 41, 49-56 (1985) . It had been deemed probable that the size of vWF mRNA would likely exceed that of human 28S type rRNA.
Accordingly, total RNA from endothelial cells (the major source of plasma vWF) was sedimented in sucrose gradients,
with RNA larger than 28S being selected for construction of a cDNA library.
This enriched fraction was further purified using two separate cycles of poly(u)-Sephadex® chromatography to select for RNA species (mRNA) having 3' polyadenylated ends. Lynch et al., supra, estimated the prevalence of vWF mRNA in this fraction at about l in 500, which fraction was used to generate a cDNA library of approximately 60,000 independent recombinants. To generate the cDNA library, standard techniques were used. The mRNA population was primed using an oligo (dT) primer, and then transcribed with a reverse transcriptase. The RNA strands were then removed by alkaline hydrolysis, leaving cDNA anticoding strands (equivalent to transcribed strands) which were primed by hairpin looping for second strand synthesis using DNA polymerase I. The hairpin loop was removed with Si nuclease and rough ends were repaired with DNA polymerase I.
GC tailing, Maniatis, T. et al., Molecular Cloning. 2nd ed., v.l, p.5.56 (1987), was then used to anneal the cDNA into plasmid vector pBR322. Oligo(dC) tails were added to the cDNA fragments with terminal transferase and were annealed to oligo(dG) tailed pBR322. The plasmids were transformed into ampicillin sensitive E.coli. strain HB101 for propagation. Suitable clones were identified after screening with 32P-labelled cDNA prepared as reverse transcriptase product of immunopurified vWF polysomes. Positive clones were subcloned into pSP64 (Promega Co., Madison, WI) .
Primer Directed Amplification of cDNA cDNA representing the full length pre-pro-vWF gene from pSP64 was subjected to enzymatic amplification in a polymerase chain reaction. Based upon the established nucleotide sequence of the pre pro-vWF gene, Bonthron, D. et al. Nucl. Acids Res. , 14(17), 7125-7127 (1986); Mancuso, D. et al., J. of Biological Chemistry, v.264(33), 19514-19527 (1989) oligonucleotides flanking the region of interest (designated (1), SEQ ID NO: 3, and (2), SEQ ID NO: 4) were
prepared. All oligonucleotides used herein were synthesized by the phosphoramidite method , Sinha, et al. , Tetrahedron Letters, 24, 5843 (1983) , using a model 380B automated system, Applied Biosystems, Foster City, CA.
Oligonucleotide (1) (SEQ ID NO: 3)
5'ACGAATTC CGG CGT TTT GCC TCA GGA3' EcoRI Argψjj Gl ^
Oligonucleotide (2) (SEQ ID NO: 4)
3'GG GAC CCC GGG TTC TCC TTG AGG TAC CAT TCGAAG5' 5'cc ctg ggg ccc aag agg aac tec atg qta agcttc3'
Leu-725 • MetrøValrøHindlll
The oligonucleotides overlap the ends1 of the coding region for that fragment of the mature vWF subunit which can be produced by digestion with trypsin and which begins with residue 449 (valine) and ends with residue 728 (lysine) . Oligonucleotide (1) corresponds to coding strand DNA (analogous with mRNA) for amino acid positions 441 to 446 and adds an EcoRI restriction site 5' to the codon for amino acid 441. Oligonucleotide (2) corresponds to the non-coding strand (transcribed strand) of mature vWF DNA for amino acids positions 725-733 and adds a Hindlll restriction site 3' to the codon for amino acid 733. The coding strand complementary to (2) is shown in lower case letters.
Using the above oligonucleotides with the full length cDNA as template, a cDNA fragment corresponding to mature vWF residues Nos. 441-733, and containing EcoRI and Hind III linkers, was then synthesized in a polymerase chain reaction following the method of Saiki, R.K. et al. Science. 239, 487- 491 (1988) . The procedure utilizes a segment of double-stranded vWF cDNA, a subsegment of which is to be amplified, and two single-stranded oligonucleotide primers (in this case oligonucleotides (1), (2)) which flank the ends of the subsegment. The primer oligonucleotides (in the presence of a DNA polymerase and deoxyribonucleotide triphosphates) were added in much higher concentrations than the DNA to be amplified.
Specifically, PCR reactions were performed with a DNA thermal cycler (Perkin Elmer Co., Norwalk, CT/Cetus Corporation, Berkeley, CA) using Taq polymerase (Thermus aguaticus) . The reactions were run in 100 μl volumes containing 1.0 μg of pre-pro-vWF cDNA, 1.0 μg of each synthetic oligonucleotide primer, and buffer consisting of 50 mM KC1, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.1% gelatin (BioRad Co., Richmond, CA) and 200 mM of each dNTP. PCR conditions were 35 cycles of 30 seconds at 94°C, 30 seconds at 52°C and 1 minute at 72°C. Amplified fragments were then purified and isolated by electrophoresis through a 2% agarose gel, Maniatis et al., Molecular Cloning. A Laboratory Manual. 164-170, Cold Spring Harbor Lab., Cold Spring Harbor, NY (1982) . The vast majority of polynucleotides which accumulate after numerous rounds of denaturation, oligonucleotide annealing, and synthesis, represent the desired double- stranded cDNA subsegment suitable for further amplification by cloning. For some experiments, cDNA corresponding to the mature vWF fragment beginning at amino acid sequence position 441 and ending at position 733 was prepared and amplified directly from platelet mRNA following the procedure of Newman, P.J. et al. J. Clin. Invest.. 82, 739-743 (1988). Primer nucleotides No. 440 and 733 were utilized as before with the resulting cDNA containing EcoRI and Hindlll linkers.
Insertion of cDNA into M13mpl8 Cloning Vehicle
The resultant double stranded von Willebrand factor cDNA corresponding to the amino acid sequence from residue 441 to 733 was then inserted, using EcoRI and Hindlll restriction enzymes, into the double stranded replicative form of bacteriophage Ml3mpl8 which contains a multiple cloning site having compatible EcoRI and Hindlll sequences.
M13 series filamentous phages infect male (F factor containing) E.coli strains. The infecting form of the virus is represented by single stranded DNA, the (+) strand, which is converted by host enzymes into a double stranded circular form, containing also the minus (") strand, which double
stranded structure is referred to as the replicative form (RF) . The ability to isolate a stable single stranded (+) form of the virus is particularly useful to verify the integrity of any cloned sequences therein. See Messing, J. , Meth. Enzvmoloqy. 101, 20-78 (1983) ; Yanish-Perron, C et al., Gene. 33, 103-109 (1985).
Accordingly, the vWF cDNA insert was completely sequenced using single-stranded dideoxy methodology (Sanger, F. et al. Proc. Natl. Acad. Sci USA. 74, 5463-5467 (1977)), utilizing the single-stranded (+) form of M13mpl8, to confirm that the vWF cDNA fragment contained the correct coding sequence for mature vWF subunit residues 441-733.
Site-Directed Mutagenesis to Replace Cysteine Residues
Cysteine residues 459, 462, 464, 471, 474, 509, and 695, within the mature vWF fragment corresponding to amino acids 441 to 733, were replaced with glycine residues by substitution of glycine codons for cysteine codons in the corresponding cDNA. In order to accomplish this, oligonucleotides (see Sequence Listing ID NOS: 5-8) encompassing the region of each cysteine codon of the vWF cDNA were prepared as non-coding strand (transcribed strand) with the corresponding base substitutions needed to substitute glycine for cysteine. The oligonucleotides used were as follows: Oligonucleotide (3) (SEQ ID NO: 5)
3'GGA CTC GTG CCG>GTC TAA CCG GTG CAA CTA CAA CAG5'
5'cct gag gac ggc cag att ggc cac ggt gat gtt gtc3'
Pro Glu His Gly Gin He Gly His Gly Asp Val Val
459 462 464 (simultaneously replacing cysteines 459, 462, 464).
Oligonucleotide (4) (SEQ ID NO: 6)
3'TTG GAG TGG CCA CTT CGG CCG GTC CTC GGC5' 5'aac etc ace qqt gaa gcc ggc cag gag ccg3' Asn Leu Thr Gly Glu Ala Gly Gin Glu Pro 471 474
(simultaneously replacing cysteines 471, 474)
Oligonucleotide (5) (SEQ ID NO: 7)
3'CTA AAG ATG CCG TCG TCC G5' 5'gat ttc tac ggc age agg c3' Asp Phe Tyr Gly Ser Arg 509
(replacing cysteine 509)
Oligonucleotide (6) (SEQ ID NO: 8)
3'TCG ATG GAG CCA CTG GAA CGG5' 5'age tac etc gqt gac ctt gcc3' Ser Tyr Leu Gly Asp Leu Ala
695 (replacing cysteine 695)
Hybridizing oligonucleotides are shown in capital letters and are equivalent to the transcribed strand (non- coding DNA) . The equivalent coding strand is shown in lower case letters with the corresponding amino acids shown by standard three letter designation, (for designations see Table 1)
As elaborated below, cysteines 459, 462 and 464 were replaced simultaneously using oligonucleotide (3) . Cysteine residues 471 and 474 were then replaced simultaneously using oligonucleotide (4) . Cysteine residues 509 and 695 were then replaced individually using oligonucleotides (5) and (6) respectively. The cysteine to glycine cDNA substitutions were accomplished following the procedure of Kunkel, T.A., Proc. Natl. Acad. Sci. USA, 82,488-492 (1985) which procedure repeats a series of steps for each oligonucleotide and takes advantage of conditions which select against a uracil containing DNA template:
(A) M13mpl8 phage, containing wild type vWF cDNA corresponding to amino acid positions 441 to 733, is grown in an E.coli CJ236 mutant dut'ung"strain in a uracil rich medium. Since this E.coli strain is deficient in deoxyuridine triphosphatase (dut") , an intracellular pool of dUTP accumulates which competes with dTTP for incorporation into DNA.
(see Shlomai, J. et al. J. Biol. Chem. , 253(9), 3305-3312 (1978). Viral DNA synthesized under these conditions includes several uracil insertions per 5 viral genome and is stable only in an
E.coli strain which is incapable of removing uracil, such as (ung~) strains which lack uracil glycosylase. Uracil- containing nucleotides are lethal in 10 single stranded (+) M13mpl8 DNA in ung+ strains due to the creation of abasic sites by uracil glycosylase.
(B) Single-stranded (+) viral DNA is isolated from culture media in which phage were
15 grown in E.coli strain CJ236 dut'ung".
The single stranded (+) form of the virus contains the specified vWF cDNA at its multiple cloning site which cDNA is equivalent to the nontranscribed vWF DNA
20 strand.
(C) Oligonucleotide (3), which contains codon alterations necessary to substitute glycines for cysteines at positions 459, 462 and 464, is then annealed in vitro to
25 single stranded (+) phage DNA.
Generally, a wide range of oligonucleotide concentrations is suitable in this procedure. Typically 40 ng of oligonucleotide was annealed to
30 0.5-1.0 μg M13mpl8 phage (+) DNA.
(D) All missing sequence of the M13mpl8(") strand is then completed in vitro using T7 DNA polymerase and T4 DNA ligase in a dTTP rich environment thereby generating
35 a transcribable vWF cDNA sequence corresponding to amino acid positions 441 to 733 of the mature vWF subunit.
(E) The double stranded M13mpl8 phage, now containing a thymine normal (") strand
and a (+) strand with several uracil substitutions, is transformed into a wild type E.coli XL-1 Blue (Stratagene, La Jolla, CA) strain which contains normal levels of uracil glycosylase and deoxyuridine triphosphatase.
(F) Uracil glycosylase and other enzymes present in the new host initiate destruction of the uracil-containing (+) strand of the double-strand phages, leading after replication in the host of remaining phage (~) strand DNA to the presence of stable thymine-normal double stranded (RF) DNA which reflects the glycine mutations induced by the oligonucleotide.
(G) Steps (A) to (F) of the above process are then repeated for each of oligonucleotides (4) , (5) and (6) until each successive cysteine codon of the vWF sequence within the M13mpl8 phage has been replaced by a glycine codon. (H) Upon completion of mutagenesis procedures the sequence of the vWF cDNA insert was reconfirmed using the single stranded DNA dideoxy method. (Sanger, F. et al., supra)
Construction of Expression Plasmids.
The double stranded vWF cDNA fragment containing 7 site- specific cysteine to glycine mutations is then removed from M13mpl8 phage by treatment with EcoRI and Hindlll restriction endonucleases, after which the ends of the fragment are modified with BamHI linkers (Roberts, R.J. et al. Nature. 265, 82-84 (1977)) for cloning into a high efficiency E.coli expression vector. The particular expression vector chosen is plasmid pET-3A, developed by Rosenberg, A.H. et al. Gene. v.56, 125-135, (1987) and which is a pBR322 derivative containing a high efficiency (φlO) T7 transcription promoter
directly adjacent to the BamHI linker site. When containing the above-specified fragment of mutant vWF cDNA, the pET-3A vehicle is refered to as "p7En or p7E expression plasmid.
A second pET-3A-derived expression plasmid (designated p7D) was constructed containing the identical vWF coding sequence cloned into the plasmid in the opposite orientation. p7D should be unable to express the vWF polypeptide fragment.
A third expression plasmid (pJDlδ) contains wild type 52/48 tryptic vWF fragment cDNA encoding the vWF amino acid sequence between residues 441 and 733, (with 7 cysteines) in the same pET-3 vector.
The p7E (or p7D and pJD18) expression plasmids were then cloned into an ampicillin sensitive E.coli strain, BL21(DE3), Novagen Co., Madison WI, according to a well established protocol Hanahan, D. , J. Mol. Biol. , 166, 557-580 (1983). Strain BL21(DE3) is engineered to contain a gene for T7 RNA polymerase so that the vWF insert can be transcribed with high efficiency.
Expression of Mutant vWF Polypeptides Three separate samples of E.coli strain BL21(DE3) containing respectively p7E, p7D or pJDlδ expression plasmids were innoculated into 5-6 ml of 2X-YT growth medium containing 200 μg/ml of ampicillin, and grown overnight at 37°C to create fully grown cultures. 2X-YT growth medium contains, per liter of water, 10 gm Bacto-tryptone, 10 gm yeast extract and 5 gm NaCl. Five ml of each overnight culture was then innoculated into 500 ml of 2X-YT medium, again containing 200 μg/ml of ampicillin and grown for 2 hours at 37°C with shaking. After the 2 hour incubation period, the cultures were induced for protein expression by addition of isopropyl-beta- d-thiogalactopyranoside to a concentration of 5 mM. The incubation was then continued for 3 hours at 37°C
A high level of expression of vWF polypeptide was obtained with p7E and pJDlδ resulting in the generation of cytoplasmic granules or "inclusion bodies" which contain high concentrations of vWF polypeptide in essentially insoluble form. Solubilization of vWF polypeptide was accomplished
according to the following procedure. As explained in Example 2, p7E and pJD18 extracts responded very differently to solubilization procedures. See Maniatis, T. et al., Molecular Cloning, 2nd ed., vol. 3, Sec. 17.37, (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, for a general discussion of the properties of, and successful manipulation strategies for, inclusion bodies.
The cells were harvested by centrifugation at 4000 g for 15 minutes in a JA-14 rotor at 4°C The pelleted cells were washed in 50 ml of ice cold buffer (0.1 M NaCl, 10 mM Tris pH 9.0, 1 mM EDTA) and repelleted by centrifugation at 4000 g at 4°C.
The cell pellets from p7E, p7D and pJD18 cultures were each redissolved in 5 ml of lysing buffer and kept ice-cold for 30 minutes. The lysing buffer comprises a solution of sucrose 25%(w/v), 1 mM phenylmethylsulfonylfluoride (PMSF) , 1 mM ethylene diaminetetraacetic acid (EDTA) , 2 mg/ml lysozyme and 50 mM Tris hydrochloride, adjusted to pH 8.0.
After the 30 minute incubation, aliquots of 1.0 Molar MgCl2 and MnCl2 were added to make the lysing solution 10 mM in each cation. Sixty μg of DNAsel (Boehringer-Mannheim) was then added and the incubation was continued at room temperature for 30 minutes.
Twenty ml of buffer No. 1 (0.2 M NaCl, 2 mM EDTA, and 1% (w/v) 3-[ (3-cholamidopropyl)-dimethylammonio]-l- propanesulfonate (CHAPS) , 1% (w/v) Non-idet 40, and 20 mM Tris hydrochloride, pH 7.5) was then added to the incubation mixture. The insoluble material was pelleted by centrifugation at 14,000 g (12,000 rpm in a JA-20 rotor) for 30 minutes at 4°C
The relatively insoluble pelleted material derived from each culture (which contains the desired polypeptides except in the case of p7D) was washed at 25°C in 10 ml of buffer No. 2 (0.5% (w/v) Triton X-100 surfactant, 2 mM EDTA, 0.02 M Tris hydrochloride, pH 7.5) and vortexed extensively. The suspension was centrifuged at 14,000 g for 30 minutes at 4°C and the supernatant was then discarded. The process of resuspension of the pelleted material in buffer No. 2, vortexing and centrifugation was repeated twice.
Each pellet was then washed in 5 ml of buffer No. 3 (0.02 M Tris hydrochloride, pH 7.5, and 2 mM EDTA) at 25°C and vortexed extensively. The suspension was then centrifuged at 4°C for 30 minutes at 14,000 g after which the 5 supernatant was discarded leaving a pellet of inclusion body derived material (the "wet pellet") with a clay-like consistency (With respect to the following final steps, and in replacement therefor, see also Example 20 which presents an additional improved procedure) . 10 The insoluble pellet was slowly redissolved in an 8 Molar urea solution held at room temperature for 2 hours, after which solubilization was continued overnight at 4°C The urea-soluble material was extensively dialyzed against a solution of 0.15 M NaCl containing 20 mM Hepes (N-[2- 15 hydroxyethyl]piperazine-N-[2-ethanesulfonic acid]) (pH 7.4) ("Hepes-buffered saline") at 4°C The solublized peptide extracts were assayed for purity (Example 2) , used in vWF binding inhibition assays (Example 3) or subject to further purification. Further purification steps should not 20 be delayed and the samples should remain cold.
The cysteine-free vWF polypeptide (comprising subunit positions 441 to 733) constitutes more than 75% of the material solubilized from the inclusion bodies according to the above procedure. Further purification of the cysteine- 25 free mutant vWF polypeptide was accomplished by redialyzing the partially purified peptide extract against 6 M guanidine-HCl, 50 mM Tris-HCl, pH 8.8 followed by dialysis against 6 M urea, 25 mM Tris-HCl, 20 mM KCl, 0.1 mM EDTA, pH 8.0. The extract was then subjected to high performance 30 liquid chromatography using Q-Sepharose® Fast Flow
(Pharmacia, Uppsala, Sweden) for anion exchange. The column was preequilibrated with 6 M urea, 25 mM Tris-HCl, 20 mM KCl, 0.1 mM EDTA pH 8.0. Elution of the vWF polypeptide utilized the same buffer except that the concentration of KCl was 35. raised to 250 mM. Polypeptide samples used for further assays were redialyzed against 0.15 M NaCl, 20 mM Hepes, pH 7.4. However, long term storage was best achieved in urea buffer (6 M urea, 25 mM Tris-HCl, 20 mM KCl, 0.1 mM EDTA pH 8.0. Final p7E-vWF polypeptide percent amino acid
compositions (by acid hydrolysis) compared closely with values predicted from published sequence information (Bonthron, D. et al. and also Mancuso, D. et al. in Example 1, supra; see also Figure 1) .
Example 2 - Characterization of the cysteine-free mutant von Willebrand factor fragment produced by expression plasmid p7E
Urea-solubilized and dialyzed polypeptides extracted from inclusion bodies of cultures containing expression plasmids p7E, p7D and pJDlδ were analyzed using polyacryla ide gel electrophoresis (PAGE) and immunoblotting.
Characterization by SDS-Polvacrylamide Gel Electrophoresis
The purity and nature of the expression plasmid extracts, which had been urea-solubilized and then extensively dialyzed, were first analyzed using the denaturing sodium dodecylsulfate-polyacrylamide gel electrophoresis procedure of Weber, K. et al. J. Biol. Chem. , 244, 4406-4412 (1969), as modified by Laemli, U.K. Nature. 227, 680-685 (1970) using an acrylamide concentration of 10%. The resultant gels were stained with Coomassie blue and compared.
The extract from expression plasmid p7E contains as the major component, the mutant von Willebrand factor polypeptide which migrates with an apparent molecular weight of approximately 36,000 gram/mole (g/mol) . The polypeptide appears as a single band under both reducing conditions (addition of between 10 and 100 mM dithiothreitol "DTT" to the sample for 5 min at 100°C prior to running the gel in a buffer also containing the same DTT concentration) and nonreducing conditions, which result is consistent with the substitution of glycine residues for all of the cysteine residues therein. No vWF polypeptide could be extracted from host cells containing p7D expression plasmids as expected from the opposite orientation of the vWF cDNA insert. The cysteine-containing vWF polypeptide expressed by host cells containing pJD18 plasmids, and which contains the wild type amino acid sequence of the 52/48 fragment, (herein
represented by a residue 441 to 733 cloned fragment) behaved differently under reducing and nonreducing conditions of electrophoresis. The wild-type sequence expressed from pJD18 forms intermolecular disulfide bridges resulting in large molecular weight aggregates which are unable to enter the 10% acrylamide gels. After reduction (incubation with 100 mM DTT for 5 min at 100°C) , the vWF peptide migrates as a single band with a molecular weight of approximately 38,000.
Characterization by Immunoblottinq Polypeptides expressed from p7E, p7D and pJD18 were further characterized by immunoblotting ("Western blotting") according to a standard procedure Burnett et al. , A. Anal. Biochem.. 112, 195-203, (1981) and as recommended by reagent suppliers. Samples containing approximately 10 μg of protein from the urea-solubilized and dialyzed inclusion body extracts of host cells (containing p7E, p7D and pJDlδ plasmids) were subjected to electrophoresis on 10% polyacrylamide gels, Laemli, U.K. Nature, 227, 6δ0-6δ5 (1970) , in the presence of 2% concentration of sodium dodecyl sulfate.
The proteins were blotted and immobilized onto a nitrocellulose sheet (Schleicher and Schuell, Keene, NH) and the pattern was then visualized using immunoreactivity.
The von Willebrand factor-specific monoclonal antibodies (from mice) used to identify the polypeptides were RG-46 (see Fugimura, Y. et al. J. Biol. Chem.. 261(1), 3δl-3δ5 (1986), Fulcher, CA. et al. Proc. Natl. Acad. Sci. USA. 79, 1648- 1652 (1982)), and NMC-4 (Shima, M. et al. J. Nara Med. Assoc. , 36, 662-669 (1985)), both of which have epitopes within the expressed vWF polypeptide of this invention. The secondary antibody (I25I-rabbit anti-mouse IgG) , labelled by the method of Fraker, P.J. et al. Biochem. Biophvs. Res. Commun.. 80, 849-657 (1978)), was incubated for 60 minutes at 25°C on the nitrocellulose sheet. After rinsing, the sheet was developed by autoradiography.
Peptide extracts from host cells containing p7E and pJDlδ expression plasmids display strong immunoreactivity for RG-46 antibody and a weaker but definite affinity for NMC-4
antibody. As expected, peptide extracts from p7D plasmids show no immunoreactivity with either RG-46 or NMC-4.
Example 3 - Inhibition of botrocetin-induced binding of vWF to platelets by the cysteine-free mutant polypeptide expressed by p7E
It has been demonstrated that botrocetin, extracted from the venom of Bothrops iararaca modulates the in vitro binding of multimeric von Willebrand factor to platelets (Read, et al. Proc. Natl. Acad. Sci.. 75, 4514-4518 (197δ)) and that botrocetin binds to vWF within the region thereof containing amino acid sequence positions 441-733 (of the mature subunit) , and thus the GPIb binding domain. (Andrews, R.K. et al., Biochemistry. 28, 8317-8326 (1989)).
The urea-solubilized and dialyzed polypeptide extracts, obtained (according to the method of Example 1) from cultures containing expression plasmids p7E, p7D and pJD18, were tested without further purification for their ability to inhibit botrocetin-induced vWF binding to formalin-fixed platelets on a dose dependent basis. Formalin-fixed platelets, prepared according to the method of MacFarlane, D. et al., Thromb. Diath. Haemorrh. 34, 306-308 (1975) , were pre-incubated at room temperature for 15 minutes with specified dilutions of peptide extracts obtained from cultures containing pJDlδ, p7D, and p7E plasmids. Botrocetin, (Sigma, St. Louis, MO) to a final concentration of 0.4 μg/ml, and 125I-labelled multimeric vWF (isolated from human plasma cryoprecipitate according to the method of Fulcher, CA. et al. Proc. Natl. Acad. Sci. USA, 79, 1648- 1652 (1982) , and labelled according to the method of Fraker, P.J. et al. Biochem. Biophvs. Res. Commun.. 80, 849-857
(1978)) were then added to the incubation mixture, and the amount of 125ι- vWF bound to the platelets was determined.
I25I-vWF binding to the platelets was referenced against 100% binding which was defined as the amount of J25I- vWF bound in the absence of added peptide extracts.
Peptide extracts from expression plasmids p7D, and also pJD18 (unreduced and unalkylated) could not compete with plasma-derived vWF for platelet GPIb receptor binding sites. The peptide extract from plasmid p7E was effective in a dose
dependent manner (using a range of 0 to 100 μg extract/ml) in inhibiting vWF binding. The concentration of urea- solubilized polypeptide extract (μg/ml) in the incubation mixture reflects the total protein concentration from the extract. Addition of peptide extracts to the reaction mixture causes certain nonspecific effects which raise apparent initial binding to 110% of the value found in the absence of the added peptide extracts. The 125-IvWF concentration used was 2μg/ml.
Example 4 - Expression of a mutant vWF fragment of reduced cysteine content containing a disulfide-dependant conformation
Utilizing the procedures of Example 1, except as modified below, a mutant vWF polypeptide fragment (corresponding to the mature vWF subunit sequence from residue 441 to residue 733) was prepared in which the cysteines at positions 459, 462, 464, 471 and 474 were each replaced by a glycine residue. Cysteine residues were retained at positions 509 and 695, and allowed to form an intrachain disulfide bond.
Site directed mutagenesis was performed only with oligonucleotides No. 459 and 471, thereby substituting glycine codons only at positions 459, 462, 464, 471 and 474.
Upon completion of mutagenesis procedures, the sequence of the mutant vWF cDNA was confirmed using the single-stranded dideoxy method.
The double-stranded*form of the vWF cDNA insert
(containing 5 cysteine to glycine mutations) was then removed from M13mpl8 phage by treatment with EcoRI and Hindlll restriction endonucleases, modified as in Example 1 with
BamHI linkers, and cloned into pET-3A. The pET-3A vehicle so formed is referred to as "p5E" or p5E expression plasmid.
The p5E expression plasmids were then cloned into ampicillin sensitive E.coli strain BL21(DE3), Novagen Co., Madison, WI, according to the procedure of Hanahan, D. , J.
Mol. Biol., 166, 557-580 (1983) . The p5E mutant polypeptide was expressed from cultures of E.coli BL21(DE3) following the procedure of Example 1 except that solubilization of inclusion body pellet material in the presence of 8 Molar
urea need not be continued beyond the initial 2 hour period at room temperature, at which point redissolved material had reached a concentration of 200 μg/ml. Oxidation of cysteine residues 509 and 695 to form a disulfide bond was accomplished by dialysis overnight against Hepes-buffered saline. Formation of intrachain rather than interchain disulfide bonds is favored by allowing thiol oxidation to proceed at a low protein concentration such as 50-100 μg/ml. As in Example 1 pertaining to the p7E extracts, final purification of urea-solubilized inclusion body preparations was accomplished by dialysis against the 6 M guanidirie and 6 M urea buffers followed by anion exchange chromatography.
Example 5 - Characterization of the mutant vWF fragment produced by expression plasmid p5E The mutant von Willebrand factor polypeptides produced by cultures containing expression plasmid p5E were characterized utilizing the procedures of Example 2, and in particular compared with the vWF fragment expressed by plasmid p7E. Urea-solubilized and dialyzed polypeptides extracted from inclusion bodies (according to the procedure of Example 4) were compared with similar extracts from p7E plasmid cultures produced as in Example 1.
Characterization by SDS-Polyacrylamide Gel Electrophoresis The denaturing sodium dodecylsulfate gel procedure of
Example 2 was used to compare the p5E vWF fragments, which can form disulfide bonds using cysteine residues 509 and 695, with the p7E fragment which has no cysteine residues.
Electrophoresis was conducted using 7.5 μg of protein extract per lane on 10% acrylamide gels under reducing (100 mM dithiothreitol) and non-reducing conditions.
Under reducing conditions, and after staining with
Coomassie blue, extracts from p7E and p5E have identical electrophoretic mobilities. Electrophoresis under nonreducing conditions, however, demonstrates the effects of disulfide bonds involving residues 509 and 695. A substantial amount of the p5E
extract appears as a high molecular weight complex (resulting from interchain disulfide bonds) which enters the gel only slightly. Densitometric scanning of the gels of initial preparations indicates that approximately 25% of the p5E polypeptide material found on nonreducing gels is represented by monomers of the 441-733 fragment having an apparent molecular weight of approximately 38,000. The percent of monomer present in p5E extracts can be improved significantly by conducting urea solubilization, dialysis, and thiol oxidation at a more dilute protein concentration, such as 50- 100 μg/ml, to favor intrachain rather than interchain disulfide bond formation.
This p5E monomeric species has a slightly higher mobility during electrophoresis under nonreducing conditions than the comparable p7E product species which has no cysteine residues. The mobilities of these p5E and p7E monomeric 3δ kg/mol species appear identical under reducing conditions. The slightly accelerated mobility of a polypeptide which retains tertiary structure in the presence of SDS under nonreducing conditions, when compared to the mobility of the homologous polypeptide which the anionic detergent converts completely into a negatively charged fully rigid rod under said conditions, is generally considered suggestive of the presence of an intrachain disulfide bond.
Characterization by Immunoblotting
The behavior of p5E and p7E extracts were also examined using immunological methods.
As in Example 2, vWF-specific murine monoclonal antibodies RG-46 and NMC-4 were used as probes. RG-46 has been demonstrated to recognize as its epitope a linear sequence of amino acids, comprising residues 694 to 70δ, within the mature von Willebrand factor subunit. The binding of this antibody to its determinant is essentially conformation independent. Mohri, H. et al., J. Biol. Chem.. 263(34), 17901-17904 (19δδ) .
NMC-4 however, has as its epitope the domain of the von Willebrand factor subunit which contains the glycoprotein lb binding site. Mapping of the epitope has demonstrated that
δ5 it is contained within two discontinuous domains (comprising approximately mature vWF subunit residues 474 to 488 and also approximately residues 694 to 708) brought into disulfide- dependent association, Mohri, H. et al., supra, although it was unknown whether the disulfide bond conferring this tertiary conformation in the native vWF molecule was intrachain or interchain. Id. at 17903.
7.5 μg samples (of protein) were first run on 10% SDS polyacrylamide gels so that the antigenic behavior of particular bands (under reducing and nonreducing conditions) could be compared with results obtained above by Coomassie blue staining. Immunoblotting was performed as in Example 2 to compare p5E and p7E extracts.
Application of antibody to the nitrocellulose sheets was usually accomplished with antibody solutions prepared as follows. Mice were injected with B-lymphocyte hybridomas producing NMC-4 or RG-46. Ascites fluid from peritoneal tumors was collected and typically contained approximately 5 mg/ml of monoclonal antibody. The ascites fluid was mixed (1 part per 1000) into blocking fluid (PBS containing 5% (w/v) non-fat dry milk, Carnation) to minimize non-specific background binding. The antibody-containing blocking fluid was then applied to the nitrocellulose.
Under nonreducing conditions, the single chain p5E polypeptide fragment (representing the sequence from residue 441 to residue 733) displayed an approximate 120 fold increase in binding affinity for NMC-4 compared to the comparable cystein-free species isolated from p7E also representing the primary sequence from residue 441 to 733. After electrophoresis under reducing conditions (utilizing
100 mM DTT) , the single chain p5E species showed a remarkably decreased affinity for NMC-4, which was then very similar to that of the cysteine-free p7E species under either reduced or nonreduced conditions. NMC-4 also fails, under reducing or non-reducing conditions, to recognize as an epitope disulfide-linked dimers from the p5E extract.
The nitrocellulose filters used to produce autoradio- graphs based on NMC-4 were rescreened with RG-46 by subtracting the initial NMC-4 exposure response, which was
kept low through a combination of low antibody titer and short exposure time. The binding of RG-46 to the p7E 36,000 kg/mol polypeptide on the filters is the same whether reducing or non-reducing conditions were chosen, consistent with the replacement of all cysteines by glycine in the expressed polypeptide.
A large molecular weight vWF antigen (reactive to RG-46) is present in the p5E polypeptide extract under nonreducing conditions. These p5E vWF aggregates (reflecting interchain disulfide bonds) migrate under reducing conditions in the same position as the p7E polypeptide indicating disruption of their disulfide contacts. However, the large p5E interchain disulfide aggregates which are readily recognized under nonreducing conditions by RG-46 are not recognized by NMC-4 under either reducing or nonreducing conditions. It is thus demonstrated that the disulfide bond between residues 509 and 695 in native multimeric vWF subunits represents an intrachain contact.
Example 6 - Inhibition of the binding of an anti-GPIb monoclonal antibody by p5E polypeptide
Monoclonal antibody LJ-Ibl is known to completely inhibit von Willebrand factor-platelet glycoprotein lb interaction. Handa, M. et al., J. Biol. Chem., 261(27), 12579-12585 (1986) . It reacts specifically with the amino terminal 45 kg/mol domain of GPIbα which contains the vWF binding site. Vicente, V. et al., J. Biol. Chem.. 265, 274- 280 (1990) .
To assess the inhibitory activity of p5E extracts on antibody binding, a concentration of LJ-Ibl was first selected which would, in the absence of p5E extracts, provide half-maximal binding.
LJ-Ibl was iodinated by the procedure of Fraker, D.J. et al., Biochem. Biophvs. Res. Commun.. 80, 849-δ57 (1978) using I125 from Amersham, Arlington Heights, IL and Iodogen (Pierce Chemical Co., Rockford, IL) . Washed platelets were prepared by the albumin density gradient technique of Walsh, et al., Br. J. Haematol. f 36, 281-298 (1977) , and used at a count of 1 x 108/ml. Half-maximal binding of antibody to platelets
was observed at 10 μg/ml LJ-Ibl concentration, which concentration was selected for p5E polypeptide inhibition studies.
The p5E polypeptide extract was purified according to the procedure of Example 4 including final purification of the urea-solubilized inclusion body preparation by dialysis against 6.0 M guanidine and urea solutions followed by Q- Sepharose® chromatography.
To evaluate binding, platelets were incubated for 30 minutes at 22-25°C with LJ-Ibl (10 μg/ml) and concentrations of purified p5E polypeptide (.002-10.0 μMolar) . At the end of the incubation platelets with bound radioactivity were separated from free antibody by centrifugation at 12000 g through a 20% sucrose layer, in 0.15 M NaCl, 20 mM Hepes, pH 7.4, hereinafter "Hepes-buffered saline" buffer in a microcentrifuge tube. Inhibition of LJ-Ibl binding was plotted in the presence of 2 μg/ml botrocetin (Sigma Chemical Co., St. Louis, MO) and in the absence of botrocetin. Less than 5 percent of the 125I label bound to the platelets was contributed by labelled substances other than LJ-Ibl as determined by binding competition experiments in the presence of a 100 fold excess of unlabelled LJ-Ibl. Background labelling was subtracted from data points. Binding of ,25I LJ-Ibl was expressed as a percentage of a control assay lacking recombinant polypeptides. Fifty percent inhibition of 1 SI LJ-Ibl binding to platelets was achieved at 10 μM of p5E polypeptide without botrocetin whereas in the presence of botrocetin (2 μg/ml) , 50% inhibition may be achieved at less than 0.1 μM. It is known that botrocetin induces in circulating multisubunit von Willebrand factor and single subunits thereof a conformational change which enhances or permits binding to the GPIbα receptor. This example demonstrates that the p5E polypeptide (containing an intrachain cysteine 509-695 bond) behaves very much like native circulating von Willebrand factor with respect to how its activity is modulated by botrocetin. Structural similarity is therefore indicated.
Example 7 - Expression of homodimeric 116 kDa von Willebrand factor fragment in stable mammalian transformants
This example is illustrative of conditions under which a DNA sequence encoding the mature vWF subunit fragment having an amino terminus at residue 441 (arginine) and a carboxy terminus at residue 730 (asparagine) may be expressed, and of the secretion from cultured mammalian host cells of a glycosylated homodimeric form of the 441-730 vWF fragment having native tertiary structure.
Expression of the 116 kg/mol homodimer is achieved using a DNA construct in which the following structural elements are assembled in a 5' to 3' direction (referring to the coding or nontranscribed strand) : (A) a eucaryotic consensus translation initiation sequence, CCACC; and
(B) the initiating vWF methionine codon followed by the remaining 21 amino acids of the vWF signal peptide; and (C) the coding sequence corresponding to the first three amino acids from the amino terminus region of the vWF propeptide; and
(D) the coding sequence for vWF amino acid residues
441-730; and (E) the "TGA" translation termination codon.
Preparation of a cDNA Clone from Pre-pro-von Willebrand Factor mRNA
The cDNA clone, pvWF, encoding the entire pre-pro-vWF gene was obtained from Dr. Dennis Lynch, Dana-Farber Cancer Institute, Boston, MA and was prepared as described in Lynch,
D.C et al.. Cell, 41, 49-56 (1985). Preparation of pvWF was described in Example 1.
Primer Directed Amplification of cDNA - Phase I
The cDNA representing the full length pre-pre-vWF gene from pSP64 was subjected to enzymatic amplification in a polymerase chain reaction according to the method of Saiki, R.K. et al. Science, 239, 487-491 (1988), as described in Example 1.
For PCR amplification, the following oligonucleotides were synthesized by the phosphoramidite method, Sinha, et al., Tetrahedron Letters, 24, 5843 (1983), using a model 380B automated system, Applied Biosystems, Foster City, CA.
Oligonucleotide (7) - see SEQ ID NO: 9
5' - GTCGACGCCACCATGATTCCTGCCAGA - 3' Sail Met
Oligonucleotide (8) - see SEQ ID NO: 10
5' - TCAGTTTCTAGATACAGCCC - 3' Xbal
In designing the oligonucleotides used herein, reference was made to the established nucleotide sequence of the pre pro-vWF gene, Bonthron, D. et al., Nucl. Acids Res., 14(17), 7125-7127 (1986); Mancuso, D. et al., J. Biol. Chem.. 264(33), 19514-19527 (1989).
Oligonucleotide (7) was used to create a Sail restriction site fused 5' to a eucaryotic consensus translation initiation sequence (CCACC) preceding the initiating methionine codon of the vWF cDNA. See Kozak, M. Cell. 44, 183-292 (1986).
Oligonucleotide (8) hybridizes with the non-transcribed strand (coding strand) of the vWF cDNA and overlaps with nucleotides which are approximately 360 base pairs from the initiating methionine in the pre-pro-vWF cDNA, thus spanning (at residues 120 and 121 within the pre-pro-vWF cDNA sequence) an Xbal restriction site.
The polymerase chain reaction therefore synthesized a cDNA fragment, containing (reading from 5' to 3' on the coding strand) a Sail site, a consensus initiation sequence, an initiating methionine codon, the codon sequence for the signal peptide, and approximately, the first 100 codons of the propeptide, followed by an Xbal site.
Insertion of cDNA into M13mplδ Cloning Vehicle
The amplified cDNA fragment was then inserted, using Sail and Xbal restriction enzymes, into the double stranded replicative form of bacteriophage Ml3mpl8 which contains a multiple cloning site having compatible Sail and Xbal
sequences. The resulting clone is known as pADl. See Arrand, J.R. et al. J. Mol. Biol.. 118, 127-135 (1978) and Zain, S.S. et al. J. Mol. Biol.. 115, 249-255 (1977) for the properties of Sail and Xbal restriction enzymes respectively. The vWF cDNA insert was completely sequenced using single- stranded dideoxy methodology (Sanger, F. et al. Proc. Natl. Acad. Sci. USA. 74, 5463-5467 (1977)) to confirm that the vWF cDNA fragment contained the correct vWF coding sequence.
Primer Directed Amplification of cDNA - Phase II cDNA corresponding to mature vWF amino acid residues 441 to 732 was then amplified in a polymerase chain reaction.
For amplification, the pvWF clone encoding the entire pre- pro-vWF gene was used. Alternatively, a cDNA corresponding to mature subunit residues 441 to 732 may be prepared and then amplified directly from platelet mRNA following the procedure of Newman, P.J. et al. J. Clin. Invest. , 82, 739-
743 (1988).
Suitable flanking oligonucleotides were synthesized as follows: Oligonucleotide (9) - see SEQ ID NO: 11
5' - AC-GAATTC-CGG- CGT-TTT-GCC-TCA-GGA - 3' EcoRI Arg44iArg442
Oligonucleotide (10) - see SEQ ID NO: 12
5' - G-AAGCTT-AC-CAT-GGA-GTT- CCT-CTT-GGG - 3' Hindlll Met Ser Asn Arg Lys Pro
732 731 730 729 728 727 -or- 3' - GGG-TTC-TCC-TTG-AGG-TAC- CA*TTCGAA-G - 5' Pro Lys Arg Asn Ser Met Hindlll 727 728 729 730 731 732
(equivalent to anticoding strand)
The ends of the double stranded vWF cDNA fragment product were then modified with BamHI linkers (Roberts, R.J. et al. Nature, 265, 82-δ4 (1977)), digested with BamHI, and inserted into the BamHI site of pADl, which site is directly downstream(3') from the Xbal site. The resultant plasmid was designated pAD2.
Loopout Mutagenesis of pAD2.
Site-directed (loopout) mutagenesis was then performed to synchronize the reading frames of the first insert with the second insert simultaneously deleting all propeptide codon sequence (except that encoding the first 3 amino terminal residues of the propeptide) , and the remaining bases between the Xbal and BamHI sites.
As a loopout primer, the following oligonucleotide was utilized which encodes the four carboxy-terminal amino acid residues of the signal peptide, the three amino-terminal residues of the propeptide, and amino acid residues 441 to 446 of the mature vWF subunit sequence. Oligonucleotide (11) - see SEQ ID NO: 13
5' - GGGACCCTTTGTGCAGAAGGACGGCGTTTTGCCTCAGGA - 3'
Arg*,, Gly.^
The loopout of undesired nucleotide sequence was accomplished following the procedure of Kunkel, T.A. , Proc. Natl. Acad. Sci. USA. 62, 488-492 (1985) . This procedure involves the performance of a series of steps to take advantage of conditions which select against a uracil containing DNA template:
(A) M13mpl8 phage (containing cDNA corresponding to the consensus translation initiation sequence, the signal peptide, approximately the first 121 amino acids of the propeptide, residual intervening M13mplδ polylinker sequence, and codons corresponding to mature subunit sequence residues 441 to 732) is grown in an E.coli CJ236 mutant dufung" strain in a uridine rich medium. Since this E.coli strain is deficient in deoxyuridine triphosphatase (dut~) , an intracellular pool of dUTP accumulates which competes with dTTP for incorporation into DNA. (see Shlo ai, J. et al. J. Biol. Chem.. 253(9) , 3305-3312 (1978) . Viral DNA synthesized under these conditions includes several uracil insertions per viral genome and is stable only in an E.coli strain which is incapable of removing uracil, such as (ung~) strains which lack uracil glycosylase. Uracil-containing nucleotides are lethal in single stranded (+) M13mpl8 DNA in
ung+ strains due to the creation of abasic sites by uracil glycosylase.
(B) Single-stranded (+) viral DNA is isolated from culture media in which phage were grown in E.coli strain CJ236 dut'ung". The single stranded (+) form of the virus contains the specified vWF cDNA at its multiple cloning site. This cDNA is equivalent to the transcribed vWF cDNA strand.
(C) Oligonucleotide (11) is then annealed in vitro to single stranded (+) phage DNA, thereby looping out the undesired sequence. Generally, a wide range of oligonucleotide concentrations is suitable in this procedure. Typically 40 ng of oligonucleotide was annealed to 0.5-1.0 μg M13mplδ phage (+) DNA. (D) All missing sequence of the M13mpl8 (~) strand is then completed in vitro using T7 DNA polymerase and T4 DNA ligase in an environment containing dTTP, dGTP, dATP and dCTP, thereby generating a chimeric vWF cDNA sequence without the undesired intermediate sequence.
(E) The double stranded M13mpl8 phage, now containing a thymine normal (") strand and a (+) strand with several uracil substitutions, is transformed into a wild type E.coli XL-1 Blue (Stratagene, La Jolla, CA) strain which contains normal levels of uracil glycosylase and deoxyuridine triphosphatase.
(F) Uracil glycosylase and other enzymes present in the new host initiate destruction of the uracil- containing (+) strand of the double stranded phages, leading after replication in the host of remaining phage (~) strand DNA to the presence of stable thymine-normal double stranded (RF) DNA which reflects the desired deletion. Upon completion of mutagenesis procedures, the sequence of the vWF cDNA insert was confirmed using the single stranded DNA dideoxy method. (Sanger, F. et al. , supra) . A second mutagenesis procedure, following steps (A) to (F) above, was performed to add to the cDNA insert a
translation termination codon (TGA) , and an Xbal restriction site (TCTAGA) . The oligonucleotide, again synthesized by the phosphoramadite method and containing also sequence homology at its 3' end with the M13mpl8 vehicle sequence, was as follows. The stop codon was added after residue 730.
Oligonucleotide (12) - see SEQ ID NO: 14
5'- GGGCCCAAG-AGG-AAC-TGA- TCTAGA-AAGCTTGGCACTGGC -3' Arg-rø.jAs røo Xbal
The final M13mpl8 recombinant containing the desired construct as a Sail - Xbal insert was designated pAD3-l. In addition to the Xbal site created 3' to the termination codon, an Xbal site exists in the polylinker region of M13mpl8 directly 5' to the Sail site. The vWF insert was again sequenced by the dideoxy method to verify organization and integrity of the components.
Cloning of the Sail - Xbal Fragment of pAD3-l Into the pBluescript II KS(") Vector
The Sall-Xbal fragment was then removed from pAD3-l (as contained within the Xbal-Xbal fragment) and inserted into pBluescript II KS(~) vector (Stratagene, La Jolla, CA) which had been previously digested with Xbal. pBluescript II KS(") contains an Xhol restriction site which is 5' to the Xbal insert and a Notl site which is directly 3' to the Xbal insert. A resultant plasmid selected as having the proper insert orientation was designated pAD3-2. Reference to the restriction map for pBluescript II KS(') shows that an EcoRI site is present in the polylinker region thereof between the Xhol restriction site and the Xbal site, and is therefore useful (see Example 21 below) for inserting vWF gene sequences containing Type IIB mutations into pCDM8 vectors so that stable mutant transformants can be generated.
Construction of Plasmids for Integration into Mammalian Cells
A selection procedure, based on aminoglycosidic antibiotic resistance, was then employed to select continuously for transformants which retained the vWF expression plasmid.
pCDM8 vector (developed by B. Seed et al. Nature, 329, 840-842 (1987) and available from Invitrogen, San Diego, CA) was modified by Dr. Timothy O'Toole, Scripps Clinic and Research Foundation, La Jolla, CA to include a neomycin resistance gene (phosphotransferase II) that was cloned into the BamHI restriction site of pCDM8 as a part of a 2000 base pair BamHI fragment. The site of the BamHI insert is indicated by an arrow in Figure 5. The protein produced by the neomycin(neo) gene also confers resistance against other aminoglycoside antibiotics such as Geneticin® G418 sulfate (Gibco/Life Technologies, Inc. , Gaithersburg, MD) . The neo gene is provided by the Tn5 transposable element and is widely distributed in procaryots. Lewin, J. , Genes, 3rd ed. , p.596, Wiley & Sons (1987). The final construct places the neo gene under the control of an SV40 early promoter.
Several other suitable expression vectors containing neomycin resistance markers are commercially available: pcDNA 1™° (Invitrogen, San Diego, CA) , Rc/CMV (Invitrogen, San Diego, CA) and pMAM0**0 (Clontech, Palo Alto, CA) . If necessary, the vWF fragment may be differently restricted or modified for expression capability in these other expression plasmids.
The Xhol-Notl fragment of pAD3-2 was therefore inserted into pCDM8neo which had been restricted with Xhol and Notl. Ampicillin sensitive E.coli strain XS-127 cells (Invitrogen, San Diego, CA) were transformed with the resultant ligated DNA mixture following the method of Hanahan, D. , J. Mol. Biol. , 166, 557-5δ0 (19δ3) .
Plasmids from resultant colonies were characterized by restriction mapping and DNA sequencing to identify colonies which contained the intended insert. One such appropriate plasmid (designated pAD5/WT) was maintained in E.coli strain XS-127, and was selected for mammalian cell transformation procedures. Prior to use in transforming mammalian cells, supercoiled plasmids (pAD5/WT) were recovered from host E.coli by an alkaline cell lysis procedure, Birnboim, H.C and Doly, J. , Nucleic Acids Research, 7,1513 (1979), followed by purification by CsCl/ethidium bromide equilibrium
centrifugation according to Maniatis, T. et al., Molecular Cloning. 2nd ed. , p. 1.42, Cold Spring Harbor Laboratory Press (19δ7) .
Transformation of Chinese Hamster Ovary Cells pAD5/WT was introduced into CHO-Kl Chinese hamster ovary cells (ATCC-CCL- 61) by a standard calcium phosphate-mediated transfection procedure. Chen, C. et al. Mol. Cell. Biol.. 7(8) , 2745-2752 (1987) .
CHO-Kl cells were grown at 37°C in Dulbecco's modified Eagle's medium (DMEM) (Gibco/Life Technologies, Inc.,
Gaithersburg, MD) supplemented with 10% heat-inactivated fetal calf serum (FCS) , 0.5 mM of each nonessential amino acid (from NEAA supplement, Whittaker, Walkersville, MD) and 2 mM L-glutamine under a 5% C02 atmosphere, and then subcultured 24 hours prior to transformation at a density of 1.5 x 105 cells per 60 mm tissue culture dish (approximately 25% of confluence) . CHO-Kl cells have a doubling time in DMEM/10%FCS of approximately 16 hours under these conditions. To accomplish transformation, pAD5/WT plasmids were recovered from cultures of E.coli strain XS-127, according to the method of Birnboim, H.C and Doly, J. , Nucleic Acids Research. 7, 1513 (1979). Ten μg of plasmids were applied to the cells of each 60 mm dish in a calcium phosphate solution according to the method of Chen et al., supra. After inoculation with plasmid, the cells were maintained in DMEM/10% FCS for 8 hours at 37°C in a 5% C02 atmosphere.
The growth medium was then replaced with a solution of phosphate-buffered saline, 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HP04-7H20/1.4 mM KH2P04, pH 7.4, hereinafter "PBS", containing also 10% (v/v) glycerol. The cultures were then maintained in glycerol-PBS for 2 minutes to increase the efficiency of transformation (see Ausukel, et al., eds. Current Protocols in Molecular Biology, p.9.1.3, Wiley & Sons (1987) . After 2 minutes the glycerol-PBS solution was replaced with DMEM/10% FCS.
After approximately 24 hours of growth at 37°C in a 5% C02 atmosphere, the cells were trypsinized as follows. Growth medium for each dish was replaced by 3 ml of 0.25%
trypsin in PBS. Trypsinization was conducted for 3 minutes. The trypsin-containing medium was removed and the dishes were then placed in the incubator for a further 15 minutes after which the cells were resuspended in DMEM containing 10% fetal calf serum. The cells from each dish were then split 20 fold, and plated at a density of 3 x 104 cells/60 mm dish (approximately 5% of confluence) .
Production of stable transformants, which have integrated the plasmid DNA, was then accomplished by adding Geneticin® G418 sulfate to the 60 mm dishes to a concentration of O.δ mg/ml. Growth was continued for 10-14 days at 37°C in a 5% C02 atmosphere. Surviving independent colonies were transferred to 12- well plates using cloning rings and then grown for another seven days in DMEM/10% FCS supplemented with 0.8 mg/ml of Geneticin®. Under these conditions, 3 to 7 surviving colonies per plate were apparent after 10-14 days. Approximately 100 stable transformants can be isolated from each original 60 mM dish originally containing approximately 5 x 105 cells at a plate density of 50-70% of confluence.
Fifty to seventy percent of G418-resistant cell lines produce the 441-730 mature vWF subunit fragment. The specific geometry of integration of each clone presumably prevents expression in all cases. Stable transformants were then cultured and maintained at all times in medium containing Geneticin® G 18 sulfate (.δ mg/ml) to apply continuous selection.
Colonies expressing the recombinant 441-730 vWF polypeptide were detected by dot-blot analysis on nitro- cellulose after lysis in disruption buffer (see Cullen,
Methods in Enzvmoloqy, 152, 684-704 (1987)) comprising 10 mM Tris-HCl, pH 7.8, 150 mM NaCl, 5 mM EDTA, 10 mM benzamidine, 1 mM PMSF, 1% (w/v) Non-idet 40 (an octylphenol-ethylene oxide condensate containing an average of 9 moles of ethylene oxide/mole phenol) , Sigma, St. Louis, MO. RG-46 (see
Fugimura, Y. et al. J. Biol. Chem. ; 261(1), 381-365 (1986) and Fulcher, CA. et al. Proc. Natl. Acad. Sci. USA, 79, 1648-1652 (1982)) was used as the primary antibody. The secondary antibody (125I-rabbit anti-mouse IgG) which had been
labelled by the method of Fraker, P.J. et al. Biochem. Biophys. Res. Commun. , 80, 849-857 (1978) was incubated for 60 minutes at 25°C on the nitrocellulose sheet. After rinsing, the nitrocellulose was developed by autoradiography to identify those colonies expressing the vWF fragment.
Secretion of the von Willebrand Factor Fragment
Secretion of the 441-730 mature vWF subunit fragment into the culture medium by CHO-Kl cells was confirmed by immunoprecipitation and immunoaffinity chromatography of culture medium.
Confluent transformed CHO-Kl cells were rinsed three times with PBS to remove bovine vWF and then incubated in DMEM without FCS for 16 hours at 37°C in a 5% C02 atmosphere. To a 5 ml volume of the culture medium was added a 1/10 volume (0.5 ml) of lOx immunoprecipitation buffer (lOxIPB) which comprises 100 mM Tris-HCl, pH 7.5, 1.5 M NaCl, 10 mM EDTA, and 10% (w/v) Non-idet 40. It has been established that bovine vWF-derived polypeptides present in fetal calf serum do not react with NMC-4. The mixture was then incubated for 16 hours at 4°C with approximately 0.05 mg of NMC-4 or 0.05 mg of RG-46 murine monoclonal anti-vWF antibody (or 0.1 mg of both) allowing formation of IgG-vWF complexes. Immune complexes were precipitated by taking advantage of the affinity of protein A (isolated from the cell wall of Staphylococcus aureus) for constant regions of heavy-chain antibody polypeptides following generally the method of Cullen, B. et al., Meth. Enzymology, 152, 684-704 (1987). See also Harlow, E. et al. eds. Antibodies, A Laboratory Manual, Chapters 14-15, Cold Spring Harbor Laboratory Press (1988) .
Protein A-Sepharose® beads were purchased from Sigma, St. Louis, MO. Immune complexes were then precipitated with the beads in the presence of 3 M NaCl/1.5 M glycine (pH 8.9), and washed twice with lx IPB and then once with lx IPB without Non-idet 40.
Immunoprecipitated proteins were then electrophoresed in polyacrylamide gels containing sodium docecyl sulfate (SDS- PAGE) following the method of Weber, K. et al., J. Biol.
Chem.. 244, 4406-4412 (1969), or as modified by Laemli, U.K., Nature. 227, 680-685 (1970), using an acrylamide concentration of 10%. Samples of immune-complexed vWF protein were dissociated prior to electrophoresis by heating at 100°C for 5 minutes in non-reducing and 2% SDS-containing acrylamide gel sample buffer to disrupt non-covalent bonds. The protein A-Sepharose®4B beads were spun down and discarded. Visualization was accomplished with Coomassie blue staining which revealed the dominant vWF-derived polypeptide species to have an apparent molecular weight, based on molecular weight markers, of about 116,000 g/mol.
Protein bands in duplicate gels were blotted and immobilized onto nitrocellulose sheets (Schleicher & Schuell Co., Keene, NH) and the pattern was then visualized using immunoreactivity according to the highly sensitive "Western blot" technique. Burnette, et al., A. Anal. Biochem. , 112, 195-203 (1981) .
The von Willebrand factor-specific monoclonal antibodies (from mice) used to identify the polypeptides were RG-46 (see - Fugimura, Y. et al. J. Biol. Chem., 261(1), 381-385 (1986), Fulcher, CA. et al., Proc. Natl. Acad. Sci. USA. 79, 1648- 1652 (1982)), and NMC-4 (Shima, M. et al. , J. Nara Med. Assoc.. 36, 662-669 (1985)), both of which have epitopes within the expressed vWF polypeptide of this invention. The secondary antibody (125I-rabbit anti-mouse IgG) , labelled by the method of Fraker, P.J. et al., Biochem. Biophys. Res. Commun. , 80, 849-857 (1978)), was incubated for 60 minutes at 25°C on the nitrocellulose sheet. After rinsing, the sheet was developed by autoradiography. Growth medium from non-transformed CHO-Kl cells shows no immunoreactivity with RG-46 and NMC-4 anti-vWF monoclonal antibodies under identical conditions.
The 116 kg/mol fragment may also be isolated from the culture medium of CHO-Kl cells using immunoaffinity chromatography. Approximately 300μg of the 116 kg/mol fragment can be recovered from 500 ml of culture medium derived from transformed CHO-Kl culture plates using NMC-4 antibodies coupled to particles of Sepharose®4B.
Example 8 - Induction of platelet aggregation by the homodimeric 116 kg/mol von Willebrand factor fragment derived from the culture medium of stable CHO-Kl transformants The tryptic 116 kg/mol fragment has been previously characterized as a dimer consisting of two identical disulfide-linked subunits each corresponding to the tryptic
52/48 kg/mol fragment of vWF and containing the mature subunit sequence from residue 449 to residue 728. Owing to its bivalent character, the dimeric 116 kg/mol fragment can support ristocetin-induced platelet aggregation whereas the constituent 52/48 kg/mol subunit cannot (see Mohri, H. et al., J. Biol. Chem.. 264(29) , 17361-17367 (1989)) .
Stable pAD5/WT CHO-Kl transformants, and untransformed CHO-Kl cells as controls, were each grown to 90% of confluence in DMEM/10% FCS, at 37°C in a 5% C02 atmosphere. The 60 mm plates were then rinsed twice with PBS and the incubation was continued in DMEM (without FCS) for 24 hours. The resultant serum-free culture medium was collected and concentrated (at 18°C) 300 fold in a centrifugation- filtration apparatus, Centricon 30, Amicon Co., Lexington, MA.
Dose-dependent platelet aggregation curves were obtained by the addition of concentrated culture medium from pAD5/WT transformed cells to platelets. No aggregation was seen in the presence of control culture medium derived from untransformed CHO-Kl cells. Platelets for the assay were prepared using albumin density gradients according to the procedure of Walsh, et al. British J. of Hematology. 36, 281- 298 (1977) . Aggregation was monitored in siliconized glass cuvettes maintained at 37°C with constant stirring (1200 rpm.) in a Lumi-aggregometer (Chrono-Log Corp. , Havertown, PA) . Aggregation experiments followed generally the procedure of Mohri, H. et al., J. Biol. Chem., 264(29), 17361-17367 (1989) . Two to ten μl quantities of 300-fold concentrated FCS-free DMEM from cultures of pAD5/WT-transformed and control untransformed CHO-Kl cells (CM) were brought up to 100 μl by dilution with "Hepes" buffered saline, comprising 20 mM Hepes, N-[2-hydroxyethyl]piperazine-Ni[2- ethanesulfonic acid], (pH 7.4), and 0.15 M NaCl. The 100 μl
samples were then mixed with 200 μl of platelet suspension (4 x 108/ml) and then incubated with stirring in the aggregometer for 5 minutes. Ristocetin was then added to a final concentration of lmg/ml at the injection timepoints (time zero) . Aggregation was monitored by recording changes in light transmittance. Platelet aggregation can be observed with as little as 100 μl of unconcentrated serum-free medium from pAD5/WT-transformed cell lines. Serum-free medium from control untransformed cultures concentrated up to 300 fold, and assayed at up to 10 μl concentrated medium/100 μl sample did not induce platelet aggregation.
Preincubation with Monoclonal Antibodies
As a further control to confirm the specificity of the ristocetin-induced 116 kg/mol vWF fragment-platelet interaction, platelets were preincubated with anti-platelet glycoprotein lb monoclonal antibody LJ-Ibl which has been specifically demonstrated to block vWF-platelet GPIb-IX receptor interaction (Handa, et al. , J. Biol. Chem. , 261, 12579-12565 (1986)). Platelets subjected to this preincubation did not exhibit an aggregation response whereas platelets similarly preincubated with monoclonal antibody LJ-CP3 (Trapani- Lombardo et al. , J. Clin. Invest.. 76, 1950-1958 (1985) gave an effective aggregation response. LJ-CP3 has been demonstrated to block platelet GPIIb/IIIa receptor sites and not vWF-specific GPIb-IX receptors. To perform the assays antibody LJ-Ibl or antibody LJ-CP3 was added, at a concentration of 100 μg/ml, to the platelet/serum mixture while the mixture was being stirred in the aggregometer, and at a timepoint one minute prior to the point when ristocetin (to 1 mg/ml) was added.
Example 9 - Construction of a mammalian transformant for the expression of the monomeric 441-730 mature von Willebrand factor subunit fragment with cysteine-to-glycine mutations at residues 459, 462 and 464
This example is illustrative of conditions under which a
DNA sequence encoding a mature vWF subunit fragment, which
has an amino terminus at residue 441 (arginine) and a carboxy terminus at residue 730 (asparagine) and which further contains glycine residues substituted for cysteine residues at positions 459, 462 and 464 thereof, can be constructed and transfected into mammalian cells.
The Sall-Xbal insert of pAD3-2 (see Example 7) was removed by restriction and then cloned into pcDNAl vector (Invitrogen, San Diego, CA) which had been previously digested with Xhol and Xbal restriction enzymes. Since Xhol and Sail restriction sites contain identical internal sequences -TCGA- / -AGCT- , a Sail restricted fragment may be annealed into an Xhol site. The fragments were ligated with T4 DNA ligase; however the integrity of the Xhol site was not restored. This plasmid construct was designated pAD4/WT.
Site-directed mutagenesis using M13mpl8 pAD4/WT was restricted with EcoRI and Smal enzymes. pcDNAl vector contains an EcoRI site within its polylinker • region which is upstream from the Xhol ("Sail") site but contains no Smal site. As shown in Figure 1 (SEQ ID NO: 1) , a unique Smal site (CCCGGG) is contained within the vWF cDNA insert, spanning mature subunit residues 716 (glycine) to residue 718 (glycine) .
Accordingly, an approximate 950 base pair EcoRI-Smal fragment of pAD4/WT was subcloned into the EcoRI-Smal site within the polylinker region of M13mpl8 phage. The vWF sequence in M13mpl8 was then mutagenized and reinserted into the previously restricted pAD4/WT construct leading to reassembly of the intact residue 441-730 vWF sequence. The mutagenesis followed the procedure of Example 1 and Kunkel, T.A., supra, and utilized the following oligonucleotide.
Oligonucleotide (13) - see SEQ ID NO: 15
3' - GGACTCGTGCCGGTCTAACCGGTGCCACTACAACAG - 5'
5' - cctqagcacggccagattggccacggtgatgttgtc - 3' Gly459 Gly462 Gl ^ The hybridizing oligonucleotide is shown (3' → 5') in capital letters and is equivalent to transcribed strand (non- coding strand DNA) . Underlined letters indicate the single base mutations for the mutant codons. The equivalent coding strand is shown in lower case letters with the corresponding glycine substitutions identified by three letter designation. The mutant 950 base pair EcoRI-Smal fragment was then re-inserted into the EcoRI-Smal site of the previously restricted pAD4/WT plasmid. The mutant construct was designated pAD4/Δ3C To facilitate long-term storage and propagation, pAD4/Δ3C was transformed into ampicillin sensitive E.coli strain XS-127 according to the method of Hanahan, D., J. Mol. Biol.. 166, 557-560 (1983).
Consistent with the procedures of Example 1, the sequence of the mutant cDNA was confirmed by the dideoxy method and the plasmid was purified by CsCl/ethidium bromide equilibrium centrifugation.
Transformation of COS-l cells pAD4/Δ3C was introduced into COS-1 cells (SV 40 transformed African Green monkey kidney cells, ATCC - CRL 1650) by a standard calcium phosphate-mediated transfection procedure. Chen, C et al., Mol. Cell. Biol.. 7(8), 2745- 2752 (1987) .
COS-1 cells were grown at 37°C in Dulbecco's modified Eagle's medium (DMEM) (Gibco/Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal calf serum (FCS) under a 5% C02 atmosphere, and then subcultured 24 hours prior to transformation at a density of 1.5 x 105 cells/60 mm tissue culture dish (approximately 25% of confluence) . COS-1 cells have a doubling time in DMEM/10% FCS of approximately 20 hours under these conditions.
To accomplish transformation, pAD4/Δ3C plasmids were recovered from cultures of E.coli strain XS-127 according to the method of Birnboim, H.C and Doly, J., Nucleic Acids
Research. 7, 1513 (1979) . Ten μg of plasmids were applied to the cells of each 60 mm dish in a calcium phosphate solution according to the method of Chen et al., supra. After inoculation with plasmid, the cells were maintained in DMEM/10% FCS for 8 hours at 37°C in a 5% C02 atmosphere.
The growth medium was then replaced with a solution of phosphate-buffered saline/10% (v/v) glycerol. The cultures were then maintained in glycerol-PBS for 2 minutes to facilitate the production of transformants (Ausukel, et al. eds, Current Protocols in Molecular Biology, p.9.1.3, Wiley & Sons (1987)). After 2 minutes, the glycerol-PBS solution was replaced with DMEM/10% FCS. Antibiotic resistance was not used to select for stable transformants. The cells were then maintained at 37°C in DMEM/10% FCS in a 5% C02 atmosphere.
Example 10 - Transformation of COS-l cells by PAD4/WT plasmids
COS-1 cells were also transformed successfully with pAD4/WT plasmids. Although antibiotic resistance was not used to select for stable transformants, transient expression of the 116 kg/mol fragment therefrom was particularly useful for the purpose of comparing the properties of the 116 kg/mol mutagenized polypeptide produced by pAD4/Δ3C plasmids to those of the pAD4/WT 116 kg/mol homodimer.
Following the procedures of Example 9, pAD4/WT plasmids were recovered from storage cultures of E.coli strain XS-127. Transformation of COS-1 cells with pAD4/WT was then accomplished using the procedures of Example 9. The cells were then maintained at 37°C in DMEM/10% FCS in a 5% C02 atmosphere.
Example 11 - Construction of mammalian transformants which express mutant 441-730 mature von Willebrand factor subunit fragments wherein each mutant contains a single cysteine-to-glvcine substitution Following the procedures of Example 9, and using suitable oligonucleotides for site-directed mutagenesis, three plasmids (pAD4/G459, pAD4/G462 and PAD4/G464, collectively referred to as "pAD4/ΔlC plasmids") were constructed. Such plasmids are identical to pAD4/WT except that each contains a
single base pair mutation which corresponds to a single cysteine to glycine substitution at mature vWF subunit residue positions 459, 462 and 464 respectively. The oligonucleotides used are identical to oligonucleotide (13) used to prepare pAD4/Δ3C except that each contains only one of the three mutant codons of that oligonucleotide, the other two codons being represented by the wild type coding sequence. To facilitate long-term storage and propagation, samples of pAD4/G459, pAD4/G462, and pAD4/G464 were each cloned into ampicillin sensitive E.coli strain XS-127 following the method of Example 9.
Consistent with the procedures of Example 9, the sequences of the mutant cDNAs were confirmed by the dideoxy method and the plasmids were purified by CsCl/ethidium bromide equilibrium centrif gation.
Transformation of COS-1 cells with either pAD4/G459, PAD4/G462 or pAD4/G464 plasmids was accomplished according to the protocol of Example 9. Antibiotic resistance was not used to select for stable transformants. The cells were then maintained at 37°C in DMEM/10% FCS in a 5% C02 atmosphere.
Example 12 - Expression and characterization of von Willebrand factor subunit fragments by COS-1 cells transformed with PAD4/WT and pAD4/Δ3C plasmids COS-1 cells which had been transformed with pAD4/Δ3C or pAD4/WT plasmids according to the procedures of Examples 9 and 10 respectively were cultured to express the encoded vWF DNA as explained below. COS-1 cells similarly transformed with pcDNAl plasmid vector (not containing a vWF cDNA insert) were used as controls.
COS-1 cells at a density of 4-5 x 105/60 mm dish were transformed by adding, at time zero, 10 μg of pAD4/WT, pAD4/Δ3C or pcDNAl plasmid. Following the procedure of Examples 9 and 10, the cells were glycerol-shocked after a period of 8 hours. The cells were then covered with DMEM/10% FCS at 37°C in a 5% C02 atmosphere for 32 hours.
The cells for each culture were then rinsed three times with PBS and the incubation was continued with DMEM (without FCS) which was supplemented with 35S-methionine (Amersham Co.,
Arlington Heights, IL) having a specific activity of 1000 Ci/mmol to a final concentration of 100 μCi/ml. The cells were returned to the incubator for 16 hours, after which time the respective culture media were harvested for purification by immunoprecipitation of secreted vWF polypeptides.
Immunoprecipitation followed generally the procedure of Example 7. Five ml volumes of culture media were incubated with 0.5 ml of 10X immunoprecipitation buffer, 0.05 mg of NMC-4 antibody and 0.05 mg of RG-46 antibody for 16 hours. Treatment with protein A-Sepharose®4B was performed according to Example 7. Samples of IgG-complexed vWF protein were dissociated prior to SDS-PAGE in SDS-containing sample buffer.
For analysis of the vWF polypeptides under reducing conditions, the sample buffer was modified to contain 100 mM dithiothreitol (DTT) .
Results
The gels run under reducing and non-reducing conditions were dried and subject to autoradiography to develop the 35S label. No 35S-labelled protein was detected as an immunoprecipitate derived from control cultures of COS-1 cells (transformed by unmodified pcDNAl vehicle) under either reducing or non-reducing conditions.
COS-l cells transformed with pAD4/WT plasmids produce, under non-reducing conditions, a prominent 35S-labelled band of an approximate apparent molecular weight of 116,000. This value is consistent with proper mammalian glycosylation of the 441-730 fragment. When run under reducing conditions, no 116 kg/mol material is apparent, consistent with the reduction of the disulfide bonds which stabilize the 116 kg/mol homodimer. Under reducing conditions, a prominent 35S- labelled band is visualized of approximately 52,000 apparent molecular weight. The apparent 52 kg/mol value is again consistent with proper glycosylation of the reduced monomeric 441-730 fragment.
The gel lanes corresponding to transformation with pAD4/Δ3C show no apparent 116 kg/mol material. Instead a
band is apparent, under reducing and non-reducing conditions, at an apparent molecular weight of approximately 52,000.
Thus, mutagenesis to replace cysteine residues 459, 462 and 464 within the 441-730 vWF fragment with glycine residues 5 results in the successful expression of a non-dimerizing polypeptide presumably having only intrachain (471 to 474 and 509 to 695) disulfide bonds. Interaction with NMC-4 (see also Example 7) is known to require an intact 509 to 695 intrachain disulfide bond, thereby demonstrating the presence
10 of native wild type tertiary structure in the polypeptide produced by pAD4/Δ3C
The presence in the gels of low molecular weight 35S- labelled material (under reducing and non-reducing conditions) probably indicates that not all vWF polypeptides
15 produced by pAD4/WT constructs successfully dimerize and that proteolysis and/or incomplete glycosylation of the polypeptide may prevent higher yields. Proteolysis and/or incomplete glycosylation also presumably affect the yield of the monomeric vWF polypeptide produced by the pAD4/Δ3C
20 transformants. Some high molecular weight aggregate material (essentially not entering the gels) is present in non-reduced samples from pAD4/WT and pAD4/Δ3C
Example 13 - Use of NMC-4 monoclonal antibody to immunoprecipitate vWF polypeptides 25 secreted by pAD4/WT and pAD4/Δ3C transformed COS-1 cells
The NMC-4 monoclonal antibody has as its epitope the domain of the von Willebrand factor subunit which contains the glycoprotein lb binding site. Mapping of the epitope has
30 demonstrated that it is contained within two discontinuous domains (comprising approximately mature vWF subunit residues 474 to 488 and also approximately residues 694 to 708) brought into disulfide-dependent association by an intrachain (residues 509 to 695) disulfide bond.
35. Thus, reactivity with NMC-4 is important evidence of whether a particular recombinant 441-730 mature vWF subunit fragment has assumed the tertiary structure of the analogous wild type residue 441-730 domain.
Accordingly, the procedure of Example 12 was followed to characterize vWF polypeptides secreted by pAD4/WT and pAD4/Δ3C transformed COS-1 cells, with the modification that immunoprecipitation of the culture media was effected solely with NMC-4 antibody (0.05 mg NMC-4 per 5 ml of culture media to which 0.5 ml of 10X immunoprecipitation buffer had been added) .
Samples were run under reducing and non-reducing conditions. Consistent with the results of Example 12, the major component isolated from pAD4/WT culture medium has an apparent molecular weight of 116 kg/mol under non-reducing conditions and 52 kg/mol under reducing conditions.
Although only a small fraction of the total pAD4/Δ3C derived vWF polypeptide material binds to NMC-4 (compared to conformation independent RG-46) , a band of apparent molecular weight of 52 kg/mol is visible under reducing and non- reducing conditions in gels of NMC-4 immunoprecipitates.
Example 14 - Expression and characterization of von Willebrand factor subunit fragments produced by COS-1 cells transformed with
PAD4/G459. PAD4/G462 or PAD4/G464 plasmids
Transformation of COS-1 cells by either pAD4/G459,
PAD4/G462 or PAD4/G464 plasmid (collectively the "pAD4/ΔlC plasmids") was accomplished according to the procedure of Example 11. Culture media were analyzed for secreted vWF polypeptide according to the procedure of Example 7, using only NMC-4 for immunoprecipitation.
35S-labelled proteins, prepared according to Example 12, were immunoprecipitated by NMC-4 and run in SDS- polyacrylamide gels under reducing and non-reducing conditions and compared with vWF antigen produced by pAD4/WT and pAD4/Δ3C transformants. Substitution of any one of the 3 cysteines (459, 462, 464) believed responsible for interchain disulfide contacts in native mature subunits prevents the formation of the homodimeric 116 kg/mol polypeptide characteristic of pAD4/WT transformed COS-1 cells. These three vWF antigens with a single glycine substitution appear predominantly as monomeric polypeptides of an apparent molecular weight of 52,000 under reducing or
non-reducing conditions. That the predominant material has an apparent molecular weight of 52 kg/mol is strongly suggestive' of correct glycosylation by the COS-1 cell transformants duplicating glycosylation seen in the human 52/48 kg/mol tryptic vWF fragment. Some proteolyzed and/or inadequately glycosylated vWF antigen (molecular weight less than 52 kg/mol) is also apparent in the gels. The relatively small fraction of pAD4/Δ3C vWF polypeptide which is successfully folded and secreted, thereby presenting an NMC-4 epitope, was shown by the low intensity of the pAD4/Δ3C transformant autoradiograph band of apparent 52,000 molecular weight.
II. Introduction of Type IIB Mutations into vWF Polypeptides
Example 15 - Genetic characterization of patients with Type IIB von Willebrand disease
This example demonstrates the procedure used to identify the mutation(s) in the mature von Willebrand factor subunit responsible for Type IIB von Willebrand disease in particular patients. Patients selected for screening were previously determined to fulfill all of the criteria for a diagnosis of Type IIB von Willebrand disease. See Ruggeri, Z.M. et al., N. Engl. J. Med.. 302, 1047-1051 (I960).
The propositus determined to have a vWF gene with a Trp550 → Cys550 mutation is identified as patient No. 7 in the study reported in Kyrle, P.A. et al., Br. J. Hemat.. 69, 55- 59 (1988) . The propositus determined to have a vWF gene with an Arg511 → Trp511 mutation is identified as patient No. 8 in the same study. Samples of blood were drawn from patients after obtaining informed consent according to the Declaration of Helsinki and institutional guidelines.
Platelets were collected from 50 ml of blood drawn into a 5 ml volume of 3.2% trisodium citrate as anticoagulant. The residual total platelet RNA was then isolated by ultracentrifugation through a cesium chloride cushion following the procedure of Newman, P.J. et al., J. Clin. Invest.. 82, 739-743 (1988).
To generate double stranded cDNA, standard techniques were used. Total platelet RNA was primed for first-strand
cDNA synthesis with a vWF-specific oligonucleotide corresponding to the non-coding strand (transcribed strand) for mature vWF subunit residues 899-908.
Oligonucleotide (14) - see SEQ ID NO: 16 3' GGA CTG GAC CAC• GAC• GTC•TCC•ACG•ACG•AGG•TTCGAA 5' Pro Ser Hindlll
899 908
The primed vWF mRNA population was then used as template for reverse transcriptase (from Moloney murine leukemia virus, Gibco/Bethesda Research Laboratories, Gaithersburg, MD) according to the procedure of Maniatis, T. et al., Molecular Cloning. 2 ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) . The RNA strands were then removed by alkaline hydrolysis and the first strand cDNA was primed for second strand synthesis using DNA polymerase I and then amplified in a polymerase chain reaction ("PCR") as described in Example 1 using oligonucleotide 14, and also oligonucleotide 15 (equivalent to coding strand, non- transcribed strand DNA, corresponding to amino acid residues 428-436) .
Oligonucleotide (15) - see SEQ ID NO: 17
5' GAATTC GTT GAC CCT GAA GAC TGT CCA GTG TGT 3' EcoRI Val Cys
428 436 The product of a vWF pseudogene (said gene having an intron-exon arrangement similar to that of the functional gene within the region thereof corresponding to the mRNA region selected for amplification) was avoided in the PCR reaction by selecting priming oligonucleotides complementary to exons 23 and 24 (Mancuso, D.J. et al., J. Biol. Chem.. 264, 19514-19527 (1989)) which are separated in the functional gene by a 2000 base pair intron. Amplified DNA of the predicted length was therefore verified to be derived from platelet cDNA and not from genomic DNA corresponding to small quantities of leukocytes or other cells which may have contaminated the platelet preparation.
The amplified 1.4 kilobase cDNA fragment corresponding to mature subunit residues 428-908 was then subjected to further rounds of PCR amplification which split the fragment
into two smaller overlapping cDNA regions (corresponding to amino acid residues 440-670 and 660-905) to facilitate sequence analysis.
Priming oligonucleotides therefor were synthesized (according to the method of Example l) to correspond approximately to the first twenty nucleotides on the 5' (upstream) and 3' (downstream) ends of each of the two overlapping fragments and contained also either an EcoRI (if 5') or Hindlll (if 3') restriction sequence so that the amplified 440-670 or 660-905 sequences so prepared could be inserted into M13mpl8 phage for sequencing. Resultant double stranded vWF cDNA corresponding to the residue 440-670 or 660-905 fragment was then inserted into the multiple cloning site of the double stranded replicative form of bacteriophage M13mpl8 using EcoRI and Hind III restriction enzymes, and then sequenced by the single-stranded dideoxy method (Example 1, Sanger, F. supra)
One patient was found to have a mutation at the codon corresponding to mature subunit residue 550 that specified a Trp to Cys mutation (5' TGG3' → 5TGC3') . The transversion mutation destroys an Avail restriction site overlapping codons for residues 550-552 of the mature subunit. Absence of the restriction site was confirmed in the patient's genomic DNA. Another patient was found to have a mutation at the codon corresponding to mature subunit residue 511 specifying an Arg to Trp mutation (5'AGG3' → 5'TGG3') . Both patients were found to be heterozygous for their particular amino acid substitutions, a finding consistent with the autosomal dominant mode of inheritance seen in most Type IIB patients. Ruggeri, Z.M. et al., N. Engl. J. Med.. 302, 1047- 1051 (1980) .
In the event the mutation or mutations responsible for the altered properties of the mature vWF subunit from other particular Type IIB patients cannot be resolved into the above region of the mRNA, corresponding to residues 428-908, other regions may be selected for study using suitable oligonucleotides with reference to the published DNA sequence for the vWF gene.
Example 16 - Mutagenesis of peptide subdomains of vWF to create additional vWF-derived polypeptides having Type IIB-like properties
It has been demonstrated that the GPIb(α) binding domain of vWF is formed primarily by residues contained in two discontinuous sequences, comprising approximately Cys474-Pro488 and approximately Leu694-Pro708 maintained in proper conformation in native vWF by disulfide bonding. Mohri, H. et al., J. Biol. Chem.. 263(34), 17901-17904 (1988). It has also been demonstrated that an intrachain disulfide bond which is necessary to provide that conformation is formed by cysteine residues 509 and 695 (U.S. Application Serial No. 07/600,183, filed. October 17, 1990 and Examples 1-6 reported herein) . The present development provides substantial evidence that the "loop" region of the mature vWF subunit (between residues 509 and 695) modulates the binding properties toward GPIbα of the above mentioned primary sequence regions of vWF. The following methods are representative of techniques which can be employed to (A) identify within the "loop" region of vWF further potentially important primary sequence subdomains or specific amino acids involved in modulating binding of vWF to GPIbα; and/or (B) create artificial vWF-derived polypeptide sequences with altered modulating or binding activity.
Method 1 Random mutagenesis of the "loop" to generate antithrombotic or antihemorrhagic therapeutic polypeptides
Using vWF DNA from plasmid p5E (which encodes the amino acid sequence comprising mature subunit residues 441 to 733 in which the cysteine residues at positions 459, 462, 464, 471 and 474 thereof are replaced by glycine residues) , and random mutant oligonucleotides which will sequentially span the entire 187 amino acid "loop", novel variant DNA sequences can be constructed which encode variant vWF-derived polypeptides. Resultant potential therapeutic polypeptides can be screened for relative binding affinity (1) in direct binding assays for affinity to GPIbα, or (2) in botrocetin or ristocetin induced binding assays, or (3) to conformation dependent vWF-specific antibodies. Random mutagenesis
experiments can also be performed using vWF DNA constructs suitable for expression in mammalian cells such as those of Example 7.
Preparation of Oligonucleotides Mutant oligonucleotides suitable for site directed mutagenesis protocols and spanning sequential 10 amino acid subdomains of the loop (for example corresponding to amino acids 510 - 519, 520 - 529, 530 - 539) can be generated using a procedure designed to yield a randomly mutagenized oligonucleotide population. Hutchison, CA. et al., Proc. Natl. Acad. Sci.. USA. 83, 710-714 (1986). The randomized vWF oligonucleotide is then hybridized, for example, to M13mpl8 to copy the mutation into a residue 441-733 encoding DNA sequence. The method of Hutchison, CA. et al. relies on automated synthesis of the oligonucleotide from the 3' end. In the Hutchison procedure, a random oligonucleotide population suitable for causing permutation of the residues between positions 504 and 524 of the mature vWF subunit would be constructed as follows. The oligonucleotide corresponds to transcribed strand DNA. As the chain is then built stepwise by the nonenzymatic 3'→5' addition of subsequent bases (comprising the part of the vWF loop region to be surveyed) , each of the four nucleoside phosphoramidite reservoirs (A,T,G,C) for oligonucleotide synthesis would be "doped" with a small amount of each of the other three bases. Incorporation of one of the "doping" nucleotides would result in a mutant oligonucleotide. The amount of doping can be adjusted to control results. The resultant randomized population of mutant oligonucleotides is then used in the standard site directed mutagenesis protocol (Example 1) to construct a pool of mutagenized VWF "loop" DNA sequences in M13mpl8 corresponding to the mature vWF subunit residue 441- 733 fragment and suitable for subcloning into a bacterial expression system. It is possible to control the number of mutations per molecule by controlling the composition of the base mixtures. For example, it is possible to select for only single base pair substitutions or to select for molecules which have 2,
3, 4, or more mutations. The procedure developed by Hutchison, supra typically employed solutions of each of the four bases in which approximately 1.5% impurity of each of the other three bases contaminates the original base solutions. Mutagenesis using this particular doped mixture resulted in roughly 41% of clones with no base substitutions, 40% with one, 15% with two, 3% with three and 0.7% with four (for target nucleotide sequences corresponding to 10 amino acids) . The resultant mutant M13mpl8 populations are then subject to restriction (Example 1) , and the mutagenized DNA sequences are inserted into vectors or plasmids such as pET- 3A for expression in host bacterial cells. Large scale screening of mammalian clones is generally much more difficult than for bacterial clones. However, promising mutations identified in bacterial constructs may later be inserted into mammalian or other eucaryotic host cells for further testing or for commercial-scale polypeptide production. The mutant clones can then be screened in GPIbα binding assays or in binding assays with vWF-specific monoclonal antibodies (as described below) . Mutant clones having cell lysates which exhibit enhanced platelet binding or antibody response can be sequenced to determine the amino acid alteration(s) responsible for the mutant phenotype. In this way a very systematic analysis of the loop region of vWF can be performed and mutations which alter the binding of vWF to GPIbα can be identified.
The mutagenesis techniques of Method 1 above is equally applicable to permuting the amino acid sequence regions of the mature subunit believed to represent the actual GPIbα binding site (Leu469-Asp498 and Glu689-Val713) for the purpose of enhancing their GPIbα affinity.
Method 2 Random mutation of targeted subdomains to develop therapeutic polypeptides
To date, five residue positions within the residue 441-
733 region of mature vWF subunit have been identified which when appropriately mutated result in potentiation of platelet
aggregation response and with Type IIB disease. These sites are at amino acid positions 511 (Arg→Trp) , 543 (Arg→Trp) , 550 (Trp→Cys) , 553 (Val→Met) , and also possibly 561 (Gly→Asp) . (The patient with a mutation at position 561 exhibits some Type IIB-like disease symptoms, namely enhanced platelet aggregation with low doses of ristocetin and was treated at the Greene Hospital of Scripps Clinic and Research Foundation, La Jolla, CA) . Since the known mutations indicate primary sequence subdomains wherein Type IIB properties can be generated, random mutagenesis of the DNA corresponding to short peptide sequences directly adjacent to these particular sites would be emphasized. Randomly mutagenized oligonucleotides, prepared and used as described above, and which span domains of approximately 10 amino acids adjacent to residues 510, 520, 530, 540, 550, 560, 570 and 580 can be utilized.
Method 3 Mutagenesis of specific target amino acids to develop therapeutic polypeptides
Two of the known mutations which correlate with Type IIB von Willebrand disease result in replacement of a wild type codon, encoding a positively charged amino acid, with a codon corresponding to a neutral residue. It is probable that the electrical charge of particular subdomains in the "loop" must be maintained for proper in vivo function (i.e. preventing interaction of GPIbα with circulating multimeric plasma vWF until vascular injury triggers a sequence of events resulting in a conformational change in the vWF molecule or its GPIbα receptor) . Positively charged amino acids that are proximal to arginine residues 511 and 543 can also be specifically mutated to code for amino acids which are neutral or possess, at physiological pH, negatively changed side chains. In addition. Type IIB disease-conferring neutral mutant codons such as Trp543, may be replaced by codons for other neutral or negatively charged amino acids. Representative further target amino acid sites predicted to yield mutant polypeptides having Type IIB properties and resultant therapeutic utility include the arginine residues at positions 524, 545, 552, 571, 573, 578 and 579, the lysine
residues at positions 534 and 549 and the histidine residues at positions 559 and 563.
Method 4 Generation of additional mutant oligonucleotide constructs having therapeutic activity
There are numerous additional mutagenesis strategies which can be used to probe the specific structural features and amino acid sequence requirements therefor which confer upon the vWF loop region the ability to modulate GPIbα binding. Such strategies are also useful in constructing vWF-derived polypeptides containing, for example, mutant loop regions which are useful as therapeutics. Representative, additional mutagenesis strategies are hereafter described. In the practice of this invention, effective substitutions need not be made at the exact residue positions corresponding to the targeted wild type residues. For example, substitution of cysteine for Lys549 or Val551 or for other nearby residues instead of for Trp550 may be performed, with the resultant polypeptides being subjected to screening for therapeutic utility.
Table 2 presents representative examples of potentially useful amino acid substitutions, deletions and additions which accomplish net reduction of positive charge at or adjacent to specific sites. Similar strategies can be employed at or adjacent to other specific residues of vWF to accomplish net reduction of negative charge or to break or form a hydrogen bond, salt bridge, or hydrophobic contact.
Table 2 with respect to the sequence: Ser-Arg-Leu -
510 512
a substitution of a neutral for Arg5n → a neutral residue or negatively charged residue: such as Gly, Ser, Asn, Ala, or Gln5n, or, for example, Asp
an insertion of a negatively Arg511-Asp-Leu5I2 charged residue:
a deletion of a positively Cys- Ser-Leu charged residue: . 510 512
Cloned vWF polypeptide constructs reflecting known Type
IIB mutations may also be subject to the above mentioned random mutagenesis procedures and then screened for restoration of normal binding function such as, for example, having a normal response in a modulator-induced GPIbα binding assay. For example, it may be demonstrated that a particular "reversion" mutation proximal to residue 511 would compensate "for, and nullify the effect of the original Arg→Trp511 Type IIB mutation. The associated DNA sequence can then be determined to identify the relevant counteracting amino acid. Such procedures can be used to give important further evidence as to which other residue positions in the mature subunit vWF amino acid sequence are important modulators of GPIbα binding.
Screening of mutant vWF-derived polypeptides for enhanced GPIbα binding activity
There is hereafter presented an effective method to screen randomly mutagenized mature vWF subunit polypeptide sequences for enhanced GPIbα binding activity, and resultant enhanced therapeutic utility.
To perform the assays, a device used for the enzyme- linked immunofiltration assay technique (ELIFA) , Pierce Chemical Co., Rockford, IL, can be adapted in combination with immobilization of the mutant vWF-derived polypeptides to be tested. It is considered most efficient to initially test the effect of mutant codons on vWF polypeptides expressed
from bacterial constructs and to then copy potentially useful mutations (using, for example, mutagenesis in M13mplδ vehicle and the procedure of Example 22) into a mammalian expression construct. High levels of mutant vWF polypeptides corresponding to mutant DNA sequences can be expressed from pET-3A type bacterial expression plasmids such as p5E. Mutant polypeptides constitute a major portion of host E.coli cell lysates and can be readily screened for GPIbα affinity. Accordingly, site directed mutagenesis can be performed following the procedure of Example 1 using as template in M13mplδ the vWF fragment corresponding to p5E expression plasmid (Example 4) which because of the use of BamHI linkers in assembly of p5E is recovered therefrom and inserted into M13mpl8 as an Xbal/Hindlll fragment (see Example 17) . For the oligonucleotide pool, oligonucleotides each having randomly mutagenized residue 505 to 524 sequences are used.
The mutagenized population of M13mpl8 constructs can be cloned into pET-3A plasmids after which the expression plasmids can be transformed into E.coli BL21 (DE3) following the procedure of Example 1. Preparation of mutant polypeptide extracts from E.coli BL21(DE3) for screening follows the procedure of Example 1 with the final step being solubilization of extracted inclusion body material with 8 M urea at room temperature for 2 hours. Resultant extracts of expressed mutant p5E-type vWF polypeptides are immobilized following the manufacturer's instructions onto a nitrocellulose membrane (0.45μ pore size) using 96-well sample application plates (Easy-Titer® ELIFA System, Pierce Co., Rockford, IL) and a vacuum chamber. Commercially available pump materials can be used. The apparatus is suitable for screening large series of clone lysates in an ELIFA or dot blot system and allows also quantitative transfer of sample fluids to underlying microtiter wells without cross contamination. Immobilization of the vWF polypeptides is accomplished by causing a suitable volume, such as 200 μl, of each resuspended inclusion body pellet material (in 8 M urea) to be vacuum-drawn through the individual wells to the nitrocellulose membrane over a 5 minute period. Several 200
μl volumes of Hepes-buffered saline are then drawn through the membrane to remove urea.
The protein binding capacity of the membrane is then saturated by passing through it three consecutive 200 μl aliquots of HEPES/BSA buffer herein comprising 20 mM Hepes, pH 7.4, 150 mM NaCl, and 1% w/v bovine serum albumin (Calbiochem, La Jolla, CA) .
After completion of the above procedure to minimize background caused by nonspecific interaction, a 50 μl volume of HEPES/BSA containing botrocetin (at approximately 0.5 μg/ml) or containing ristocetin ( at approximately 1 mg/ml) can be vacuum drawn through the nitrocellulose membrane again over a 5 minute period. The ristocetin-induced precipitation of bacterially-expressed vWF polypeptides observed under some test conditions is not expected to cause difficulty in this assay as the polypeptide is already immobilized. GPIb(α) represented by its external domain, glycocalicin, or the 45 kg/mol tryptic fragment thereof is next applied to the nitrocellulose using the vacuum system and the 96-well plate. The GPIbα fragments are purified and 125iodinated by standard procedures. Vicente, V. et al., J. Biol. Chem.. 265, 274-280 (1990). 50 μl aliquots of HEPES/BSA containing 15I-GPIbα fragments (0.25 μg/ml having a recommended specific activity of between approximately 5xl08 and approximately 5xl09 cpm/mg) can then be vacuum drawn through the nitrocellulose filter over 5 minutes.
The membrane is then allowed to dry and discs corresponding to the position of each application well are cut out and counted in a scintillation spectrometer to determine bound radioactivity. An autoradiograph of the membrane can also be obtained before cutting out the discs in order to ascertain that there was no leakage of radioactivity from one well to another. The counting process may be facilitated by scanning the developed autoradiogram in a densitometer to digitize the intensity of developed spots. As long as the autoradiogram is not excessively overdeveloped, beyond the linear region of response, useful qualitative results are obtained.
An alternate procedure to derive from individual host E.coli clones an impure extract which can be screened in immunoblot or dotblot procedures is as follows. A large set of individual E.coli colonies carrying separate randomly mutagenized vWF inserts is picked and grown overnight as separate cultures. The cultures are then diluted 1:100 and grown to an ODβα, of 1.0. vWF fragment synthesis is induced by adding isopropyl-/3-d-thiogalactopyranoside (IPTG) , U.S. Biochemicals, Cleveland, OH, to 5 mM and continuing growth for approximately 2.5 hours. The cells are harvested by centrifugation for 1 minute at 10,000 g and then washed and repelleted (at 10,000 g) 3 times with phosphate buffered saline (0.14 M NaCl, 0.1 M Na2HP04 pH 7.0). The bacterial pellet is then solubilized by boiling for 10 minutes in a buffer comprising 0.01 M NaH2P04, 10 mM Na2EDTA, 1% (w/v) sodium dodecylsulfate, pH 7.0. The incubation is continued for 2 hours at 60°C in the presence also of 10 mM dithiothreitol (DTT) . Suitable volumes (such as 200 μl) of such extracts can be used directly in ELIFA apparatus or dot • immunoblot analyses. Prior to adding 125I-GPIbα to the plate several rinses of Hepes-buffered saline are washed through the wells. This extract preparation technique is applicable to the screening requirements posed by Examples 25-30. vWF derived polypeptides from colonies representing the most intense response are selected for confirmation of enhanced binding using methods such as subjecting purified or partially purified extracts therefrom as appropriate to (A) i munoblotting according to the procedure of Example 2 with conformation-dependent NMC-4 antibody; (B) assaying for ability to inhibit botrocetin-induced vWF binding to formalin-fixed platelets on a dose dependent basis (Example 3) ; or (C) assayed for ability to inhibit the binding of anti GPIbα monoclonal antibodies to platelets (Example 6) . The procedure of Example 6 can be readily adapted as a supplementary screening system for other target receptors besides GPIbα (see Examples 25-30) .
Clones which confer enhanced positive responses in these systems are then subjected to standard DNA sequencing procedures to identify the vWF gene mutations responsible for
the mutant properties. The appropriate mutations may be copied, according to the procedure of Example 22, into a vWF DNA sequence within a plasmid (such as a pAD5/WT-pCDM8neo expression plasmid) suitable for expression in CHO-Kl cells. Further characterization, such as enhanced potential for induction of platelet aggregation by 116 kg/mol homodimers thereof can then be performed.
Example 17 - Selection of oligonucleotides for expression in E.coli of fragments of mature von Willebrand factor subunit reflecting Type IIB disease mutations
This example demonstrates the mutagenesis strategy for expression in E.coli of the vWF subunit sequence encoded by p5E or p7E plasmid, said constructs containing also Trp511 or Cys550 mutations. p7E and p5E expression plasmids (Examples 1 and 4) were recovered from cultures of E.coli strain BL21 (DE3) according to the alkaline lysis procedure of Birnboim, H.C and Doly, J., Nucleic Acids Research, 7, 1513 (1979).
The p5E and p7E constructs contain, in reference to the vWF BamHI insert, an upstream Xbal site and a downstream Hindlll site. The BamHI site at which the vWF sequence is inserted is positioned directly between an upstream initiating methionine codon of the parent plasmid and a downstream stop codon thereof. Rosenberg, A.H. et al.. Gene. 56, 125 (1987) . As a result of the structure of pET-3A and the position of the BamHI- site therein, expressed p5E or p7E vWF polypeptides contain also a 17 residue amino terminal sequence extension derived from the gene 10 capsid protein of the vector.
Accordingly the Xbal/Hindlll fragment was removed from p5E or p7E and inserted into Ml3mpl8 which had been previously restricted with Xbal and Hindlll. Site directed mutagenesis was then performed in M13mpl8, according to the procedure of Examples 1 and 4 using the following oligonucleotides (for p7E) to insert either a Trp511 or Cys550 mutation.
For Trp511: Oligonucleotide (16) - see SEQ ID NO: 18
I 3' G• TGCCG• CG•ACC• GATGACCT 5' Tyr508 τrp5π and for Cys550: Oligonucleotide (17) - see SEQ ID NO: 19
■I 3' GG- GTCTTCACGCAGGCGCACC 5'
Oligonucleotides are equivalent to non-coding strand (transcribed strand) DNA with the secreted single stranded (+) form of M13mpl8 DNA containing coding strand vWF DNA.
Similar manipulations were performed to insert either the Trp511 (using oligonucleotide 18) or Cys550 (again using oligonucleotide 17) mutation into a p5E construct. With respect to the Trp511 p5E insertion, the hybridizing oligo¬ nucleotide reflected a Cys509 codon instead of the previously inserted glycine509 mutation as shown below.
Oligonucleotide (18) - see SEQ ID NO: 20
I 3' G-ATG ACGTCGACCGATGACTT 5' TyrjogCySjrø TrpJn
Example 18 Effect of recombinant von Willebrand factor p5E fragments reflecting Type IIB mutations on the binding of anti-glycoprotein lb monoclonal antibody LJ-Ibl to platelets
Following the procedure of Example 17, the von Willebrand factor DNA sequence as contained within p5E (Example 4) was mutagenized to contain either a tryptophan codon or a cysteine codon corresponding to residue positions 511 and 550 respectively.
The mutant polypeptides were expressed in E.coli strain BL21(DE3), and then solubilized from inclusion bodies, according to the procedure of Example 4.
Final purification of the monomeric p5E, p5E-Trp511 and p5E-Cys550 polypeptides was accomplished as in Example 4 by dialysis against 6 M guanidine and urea buffers followed by anion exchange chromatography.
The ability of p5E-Trp5π, p5E-Cys550, and p5E polypeptides to compete with LJ-Ibl for binding to platelets was
demonstrated over a polypeptide concentration of between about 0.03 and about 2.5 μM. LJ-Ibl was prepared as described in Handa, M. et al., J. Biol. Chem.. 261(27), 12579-12585 (1986) , iodinated according to the procedure of Example 6 above, purified on protein-A Sepharose® (Sigma, St. Louis, MO) according to the method of Ey, P.L. et al., Immunoche istry. 15, 429-436 (1978) and then used in the competition assays at a concentration of 20 μg/ml. Washed platelets (used at 1 x 108/ml) were also prepared according to the procedure of Example 6.
The assay is based on the ability under certain circumstances of native vWF to inhibit the binding to platelets of the anti-glycoprotein lb monoclonal antibody LJ- Ibl. The antibody is also a potent inhibitor of vWF binding to platelets, indicating that the epitope of LJ-Ibl must overlap with the vWF binding site in GPIbα.
Incubations were performed by mixing the purified fragments at specified concentrations (Figure 3) with washed platelets and 125I-LJ-Ibl for 30 minutes at 22-25°C After the incubation separation of platelet-bound from free antibody was achieved by centrifugation through a layer of 20% sucrose in Hepeε-buffered saline at 12,000 g for 4 minutes. See Ruggeri, Z.M. et al. , J. Clin. Invest.. 72, 1- 12 (1983) . Residual antibody binding (Figure 3) is expressed as a percentage of binding determined from control incubation mixtures containing LJ-Ibl (20 μg/ml) in 20 mM Hepes, 150 mM NaCl, pH 7.4 without vWF fragments. The figure demonstrates that both the Trp511 and the Cys550 Type IIB mutations increase the affinity of the purified polypeptide for GPIbα.
Example 19 - Effect of the recombinant p5E vWF fragment containing a Cys55" mutation on LJ-Ibl binding to platelets at different monoclonal antibody concentrations
This example further demonstrates, at two different monoclonal antibody concentrations, the effect of the Trp550 to Cys550 mutation on the binding of the residue 441-733 vWF subunit fragment to platelet GPIbα.
Following the procedure of Example 18, vWF polypeptide (p5E or p5E-Cys550) was incubated at various concentrations (Figure 4) with washed platelets (1 x 108/ml) for 30 minutes at 22-25°C but in the presence of either 6 or 20 μg/ml of LJ- Ibl. The assay otherwise followed the procedure of Example 18. As demonstrated in Figure 4, the Cys550 polypeptide competes for platelet GPIbα receptor at both antibody concentrations with a higher affinity than the wild type p5E polypeptide. The affinity of the p5E-Cys550 molecule for platelet receptor is at least 5-fold greater than that of the "wild type" p5E molecule. An additional procedure to test the behavior of vWF polypeptides containing Type IIB mutations is dependent on direct binding of 125I-labelled polypeptides to platelets. It is noted also that most of the p5E-Cys550 molecules in the samples whose activity was demonstrated in Figures 3 and 4 are dimers.
The results of Examples 18 and 19 are consistent with the hypothesis that amino acid substitutions in the cysteine 509-695 loop region of the mature vWF subunit are responsible for the molecular basis of Type IIB von Willebrand disease.
Example 20 - An improved procedure to solubilize recombinant bacterially- expressed and disulfide-stabilized residue 441-733 vWF fragments An optimized procedure for the solubilization of "p5E- type" polypeptides with formation of disulfide bonds therein has been developed which is believed to comprise an improved method to practice this aspect of the invention. Following this new procedure, a sample of "wet pellet" (Example 1) weighing approximately 350 mg was dissolved in 10 ml of a buffer composed of 6 M guanidine-HC1, 50 mM Tris, pH 8.8. Dithiothreitol (DTT) was then added to a final concentration of 10 mM, and the mixture was allowed to set at 37°C for two hours. The protein concentration of the solution was determined by a bicinchoninic acid (BCA) titration kit
(Pierce Chemical Co., Rockford, IL) . A typical final result is 2 mg/ml.
Seven ml of the above solution was then diluted to 140 ml with 3 M guanidine- HC1, 50 mM Tris, pH 8.8 and then
subjected to dialysis for approximately 24 hours against Hepes-buffered saline using several reservoir changes. Oxidation of thiol groups occurs during dialysis as the DTT is removed. The desired oxidized p5E-type molecule can be purified by reverse phase HPLC on a 1x30 cm C8 column (Vydac Co. , Hesperia, CA) using an acetonitrile gradient. The remaining components of the eluting solvent are a constant amount of n- propanol (3%) and a constant amount of trifluoroacetic acid (0.1%), with the balance being spectrograde purity water.
The recommended acetonitrile gradient profile is 30% for 5 minutes, increasing linearly to 56% in 35 minutes, to 70% in 5 minutes, and maintained at 70% for an additional 10 minutes. The column is operated at a constant flow rate of 2.5 ml/min. The oxidized monomer of p5E itself (Example 4) corresponds to the most hydrophilic major peak, eluting at approximately 40 minutes.
Example 21 - Expression in stable mammalian transformants of the homodimeric 116 kg/mol von Willebrand factor fragment containing a Trp550 to Cys550 mutation
This example is illustrative of conditions under which a
DNA sequence encoding the mature vWF subunit fragment having an amino terminus at residue 441 (arginine) and a carboxy terminus at residue 730 (asparagine) , and containing also a Type IIB mutation may be expressed in a stable mammalian cell transformant with secretion therefrom of the polypeptide. The mutation strategy of Example 9 was adopted, with modifications, to insert the Cys550 codon mutation into a pCDMδ"0 construct.
Following the procedure of Birnboim, H.C and Doly, J., Nucleic Acids Research, 7, 1513 (1979), pAD4/WT plasmids were recovered from storage cultures of E.coli strain XS127. The approximate 950 base pair EcoRI-Smal fragment of pAD4/WT (Example 9) was subcloned into the EcoRI-Smal site within the polylinker region of M13mplδ phage; The vWF sequence in M13mplδ was then mutagenized according to the site directed mutagenesis protocol of Example 1. Oligonucleotide 17 (see Example 17) was used to insert the Trp550→Cys550 mutation.
The oligonucleotide is equivalent to non-coding strand (transcribed strand) DNA with the secreted single stranded (+) form of M13mpl8 DNA containing coding strand vWF DNA.
The mutagenized DNA sequence was recovered as the EcoRI- Smal fragment and subcloned into pAD5/WT (Example 7) which had been previously digested with EcoRI and Smal.
Review of the cloning strategy of Example 7 discloses that the Xhol-Notl fragment of pAD3-2 (containing the expression construct for wild type vWF residues 441-730) contains the following sequence of elements
5'-XhoI EcoRI Xbal-Sall-vWF expression construct-XbaI-NotI-3 ' wherein the EcoRI site is acquired by cloning the Xbal- restricted vWF insert into pBluescript II KS("). A Smal site is defined within the vWF coding sequence corresponding to amino acid residues 716-718. Reference to Figure 5 shows that the Xhol-Notl fragment can be appropriately inserted into pCDMδ-type vectors for expression. Consequently, insertion of the mutagenized EcoRI-Smal fragment as a replacement for the equivalent EcoRI-Smal fragment of pAD5/WT creates a construct from which the Type IIB-mutated 441-730 vWF sequence can be expressed.
No Smal restriction sites are contained in the parent pCDMδ plasmid. (The complete nucleotide sequence of pCMDδ is available from Invitrogen, San Diego, CA) . In addition to the Smal site at vWF residues 716-71δ, an additional Smal site is contributed to the pAD5/WT construct as part of the pBluescript II KS(") polylinker (upstream from the vWF "Xbal- Xbal" insert and downstream from the EcoRI site) . A further Smal site arises in the 2000 base pair neomycin resistance gene fragment cloned into the BamHI site of pCDMδ to create pCDMδ060.
A strategy of (1) partial digestion with Smal, and (2) agarose gel purification of the appropriately restricted vehicle fragment was used to assure reassembly of the proper expression vector. Five μg of pAD5/WT plasmid were incubated with 5 units of EcoRI for 60 minutes at 37°C resulting in complete digestion of the site and a homogenous population of linear fragments. A partial digest with Smal was then accomplished using 5 μg of linearized plasmid as substrate
for 0.1 unit of Smal (at 37°C for 15 minutes). Plasmid fragments were purified on an agarose sizing gel and a population of linearized plasmid of approximately 7.3 kb having been cleaved at the vWF residue 716-718 site was selected for insertion of the mutagenized EcoRI-Smal fragment.
The Arg511 to Trp511 mutation may be similarly expressed in a 116 kg/mol homodimer using oligonucleotide (18) in the mutagenesis protocol. Alternatively, using two or more complete cycles of mutagenesis in M13mpl8, the Trp511, Cys550 and further Type IIB mutations may be expressed in a single polypeptide.
Experimental procedures for effecting stable transformation of Chinese hamster ovary cells and for immunopurification of secreted 116 kg/mol vWF polypeptide were described in Example 7. For the purpose of purifying vWF polypeptides containing IIB mutations according to the present example, however, an immunoaffinity column procedure was used. - Twenty mg of purified NMC-4 antibody were coupled to CNBr-activated Sepharose® 4B beads (Pharmacia, Uppsala, Sweden). The column was preequilibrated with 0.5 M LiCl, 50 mM Tris-HCl, pH 7.4, containing 0.05% (w/v) NaN3.
Culture plates containing confluent CHO-Kl cells were covered with DMEM/10% FCS and incubated for 24 hours. The medium was then collected. In a typical experiment, 500 ml of resultant culture medium containing secreted polypeptides were then applied to the immunoaffinity column. The column was then extensively washed with 15 bed volumes of equilibration buffer. vWF antigens were then eluted using a solution of equilibration buffer containing also 3 M NaSCN. The eluted vWF polypeptides were concentrated by ultracentrifugation and then dialyzed against Hepes-saline buffer (150 mM NaCl, 20 mM Hepes, pH 7.4). Protein concentrations were determined using the bicinchoninic acid titration method (Pierce Chemical Co., Rockford, IL) .
An alternate strategy for the transfer of Type IIB mutation codons to pAD5/WT expression constructs is to transform pAD3-2 into E.coli CJ236 and select for bacterial
colonies resistant to ampicillin (conferred by plasmid) and chloramphenicol (conferred by host CJ236) . An individual colony is grown in 2X-YT culture medium to late log phase and diluted 1:100 in fresh medium in the presence of VCS-M13 (helper filamentous phage available from Strategene, La
Jolla, CA) see Maniatis, T. et al., eds. Molecular Cloning. 2nd ed.. Cold Spring Harbor Laboratory Press, 1989. After another overnight incubation, single-stranded uracil- containing DNA is isolated from secreted filamentous phage and the DNA is subjected to the standard extension reaction associated with mutagenesis using mutant oligonucleotides that are identical to the coding strand of vWF except for the intended mutation(s). After the extension reaction, the DNA is transformed into E.coli XL-1 Blue cells, (Stratagene, La Jolla, CA) , selected with ampicillin and tetracycline and the resultant colonies characterized for the presence of mutant plasmids. The vWF inserts within the mutant plasmids are sequenced completely to confirm the absence of any additional mutagenic errors. The vWF insert is cloned into pcDMS000 as an Xhol/Notl fragment as described above for the generation of pAD5/WT.
An additional strategy is to transform pAD5/WT into CJ236 and to select on plates containing chloramphenicol and kanamycin (Kanr is conferred by the neomycin gene) . A single resistant colony is picked and grown as described above for preparation of single-stranded DNA. An extension reaction using a coding strand oligonucleotide followed by transformation into XS-127 results in colonies with mutations, the frequencies ranging from 20-100%, depending upon the oligo and purity of the single-stranded DNA used in the mutagenesis reaction. Mutant colonies are sequenced to verify the targeted mutation, and the lack of any unexpected mutation. The mutant plasmids are ready for transformation into CHO-Kl cells for the establishment of stable cell lines.
Example 22 - Construction of a stable mammalian transformant for the expression of the monomeric 441-730 mature von Willebrand factor subunit fragment with cysteine-to- glycine mutations at residues 459, 462 and 464 and containing also one or more mutations reflective of Type IIB disease
Following the procedure of Examples 9 and 21, an EcoRI- Smal fragment may be removed from pAD4/WT plasmid and subjected to two or more successive rounds of site directed mutagenesis in M13mpl8 to (A) replace one or more of cysteine residues 459, 462 and 464 with, for example, glycine or alanine codons and (B) substitute one or more mutant codons identified from Type IIB patients or one or more codons which confer on the resulting polypeptide properties reflective of Type IIB von Willebrand disease.
Oligonucleotide 13 can be used to substitute glycine codons for each of the above specified cysteine codons thereby preventing formation of the 116 kg/mol homodimer and leading to the expression of 52/48 kg/mol monomers with wild type tertiary structure. A second round of mutagenesis using, for example, oligonucleotide 17 or 18 is used to insert Type IIB point mutations, in this case Cys550 or Trp511. Similarly, monomeric residue 441-730 fragments reflecting Type IIB codon mutations and only one or two of glycine substitutions at positions 459, 462 and 464 may be made following the above procedure and using the oligonucleotides of Example 11.
Alternate or additional strategies for the transfer of Type IIB mutant codons to pAD5 constructs according to this Example, and from which can be generated 52/48 kg/mol monomeric fragments, are provided in Example 21 above.
Example 23 - Effect of reduced and alkylated recombinant von Willebrand factor fragment reflecting the Cys550 Type IIB mutation on the binding of anti-glycoprotein lb monoclonal antibody LJ-Ibl to platelets
This example demonstrates that residue position 550 in the mature vWF subunit has no direct effect on binding to GPIbα but is important in the context of modulating the
structure of the vWF subunit and hence activity of the GPIbα binding region (residues 474-488 and 694-708) . p5E polypeptide was expressed and purified according to an improved procedure which modifies the method of Example 1. The corresponding p5E-Cys550 polypeptide was similarly expressed and purified. The inclusion body solubilization method of Example 1 was followed up to the solubilization step which utilized 6 M guanidine HC1, 50 mM Tris, pH δ.β, said solution now containing 10 mM dithiothreitol. Incubation in this solution, according to the new procedure, continued for 60 minutes at 37°C p5E and p5E-Cys550 polypeptides were then S-carboxymethylated with iodoacetamide according to the procedure of Fujimura, Y. et al., J. Biol. Chem.. 262, 1734-1739 (19δ7) . The extract was then subjected to high performance liquid chromatography first using Q-
Sepharose® Fast Flow (Pharmacia, Uppsala, Sweden) for anion exchange followed by cation exchange on a Protein-Pack SP 8HR column (Waters Co., Bedford, MA).
The resultant poly., aptides contain glycine residues at positions 459, 462, 464, 471 and 474 and chemically inactivated cysteines at positions 509 and 695, and in the case of p5E-Cys550, an additional chemically inactivated cysteine at position 550. Consistant with the lack of glycosylation arising in the bacterial expression system, the polypeptides have apparent molecular weights of approximately 36 kg/mol.
Binding inhibition assays were performed generally according to the procedure of Example 16 with 10 μg/ml of l25I-U-Ibl being used to evaluate the inhibitory effect of vWF polypeptides on antibody binding. Ten μg/ml is approximately the concentration of LJ-Ibl at which, in these assays, half-maximal binding of antibody to platelets is acheived. Various concentrations of vWF-derived polypeptide (Figure 6) were used with the constant amount of LJ-Ibl. Non-specific binding was determined in the presence of a 100 fold excess of unlabelled LJ-Ibl and has been subtracted from all data points. Binding of the antibody was again expressed as a percentage of that measured for the control mixture lacking recombinant polypeptide.
Figure 6 demonstrates comparative antibody binding inhibition results for the reduced and alkylated p5E molecule (r36/Trp550) and for the mutant reduced and alkylated p5E molecule carrying also a reduced and alkylated cysteine at position 550 (r36/Cys550) .
It can be seen (Figure 6) that, in the reduced and alkylated fragments (which have no stable tertiary structure) , substitution of Trp550 by cysteine does not effect binding to GPIbα, presumably because the GPIbα binding sequences are already exposed. It is anticipated that numerous other amino acid species could also occupy position 550 without effect under these assay conditions. It is likely that only when the polypeptide is assembled into a three dimensional structure having conformational domains mimicking those of the native subunit that the effects of mutations altering the activity of the loop region are evident. The result of this Example is in contrast to that of Example 18 (Figure 3) where the Cys550 mutation substantially enhanced the binding of bacterially-expressed polypeptide to platelets to the exclusion of LJ-Ibl in the context of a p5E construct which polypeptide possessed the 509-695 loop.
It has also been discovered that addition of botrocetin at a concentration of approximately 0.4 μg/ml up to about 10 μg/ml or higher, to a suitable concentration of bacterially- expressed residue 441-733 vWF fragment (such as approximately 0.5 μ Molar) substantially enhances the ability of the vWF fragment to inhibit the binding of an anti-GPIbα monoclonal antibody to GPIbα, as measured by the concentration of the vWF fragment necessary to achieve half-maximal inhibition. Specific variants of the vWF fragment for which the effect can be demonstrated includes the p5E molecule containing an intrachain disulfide bond, reduced and alkylated p5E polypeptide, the p7E polypeptide, and the fragment comprising residues 445-733 when reduced and alkylated. As was previously noted, the expressed residue 441-733 fragments of the invention contain attached to the amino terminal residue (441) a 17 residue amino acid sequence derived from the gene 10 capsid protein of the pET-3A vector. It is very likely
that complexes of the residue 441-730 mature vWF subunit fragment or subfragments thereof (and whether or not glycosylated) , formed with other appropriate molecules will enhance the affinity (and resultant antithrombotic utility) of the vWF fragment or subfrag ent for GPIbα, or for other known or potential receptors or ligands. In addition, the therapeutic effects of such complexes may be appropriately mimicked or duplicated by effecting within the residue 441- 730 fragment appropriate amino acid sequence mutations.
Example 24 - Inhibition of antibody binding to platelets by mutant and non-mutant homodimeric 116 kg/mol fragments expressed from CHO-Kl cells
For this example, measurement of binding inhibition was performed according to the procedure of Example 23 except that ristocetin (Sigma, St. Louis, MO) was added to a final concentration of 1 mg/ml at a point in time 30 minutes prior to centrifugation. Wild type recombinant 116 kg/mol homodimer (Trp550) was prepared as described in Example 7. The DNA corresponding to mutant 116 kg/mol homodimer (Cys550) was prepared according to the procedure of Example 21 with expression thereof following the procedure of Example 7, as modified in Example 21.
The inhibitory effects of mammalian-expressed vWF fragments on anti-GPIbα antibody binding to platelets were found to be different in certain respects than those of the fragments expressed from bacteria. The wild type recombinant 116 kg/mol homodimers performed similarly to native multimeric vWF in that they effectively inhibit antibody binding in the presence of ristocetin (and also botrocetin) but are ineffective in its absence (Figure 7) . However, in contrast to the results seen with the native sequence 116 kg/mol homodimer (referred to as rll6/Trp550 in Figure 7) , the rll6/Cys550 homodimer effectively inhibits LJ-Ibl binding without ristocetin, although the inhibitory effect is further enhanced when ristocetin is added thus reproducing the classic functional abnormality of Type IIB von Willebrand factor. In the presence of ristocetin, the ability of the 116 kg/mol homodimer to inhibit antibody binding is increased
approximately 10 fold as a result of the Trp550 → Cys550 mutation.
The combined results of Examples 23 and 24 strongly suggest that the two segments of the 52/48 kg/mol fragment believed to represent the actual GPIbα binding site (residues 474-488 and 694-708) may be prevented from effectively interacting with the GPIbα receptor when the vWF subunits possess a native conformation such as presented by circulating vWF. Disruption of tertiary structure (as in the case of reduced and alkylated E.coli-expressed polypeptides) or modulation thereof (as in circulating vWF of Type IIB patients, or in normal vWF molecules affected by a stimulus associated with a thrombotic or wound event) results in proper exposure of the binding sequences of vWF for GPIbα. An additional procedure to test the behavior of homodimeric vWF polypeptides containing Type IIB mutations (or antithrombotic monomers patterned thereon and derived by mutation of cysteine residues at one or more of positions 459, 462 and 464) is dependent on direct binding of 125I- labelled polypeptide to platelets.
III. Development of Additional Antithrombotic Polypeptides
Example 25 - Screening of mutant antithrombotic polypeptide fragments patterned on the residue 441-730 region of mature von Willebrand factor subunit having enhanced affinity for collagen
Following the procedure of Method 1 of Example 16, random mutagenesis can be performed on a cDNA corresponding to the residue 441-730 vWF fragment, to target the collagen binding domain encoded therein. Mohri, H. et al. , J. Biol. Chem.. 264(29), 17361-17367 (1989) have determined that the mature subunit residue sequence 512-673 is necessary (in the dimeric 116 kg/mol vWF fragment) to support binding to collagen. Binding to collagen was further reported therein to require intact disulfide bonds, an observation which was stated to have at least two possible explanations.
As stated by Mohri, H. et al., collagen may bind elements within the residue sequence 512-673, or to the residue 597-621 subdomain thereof, when an appropriate
disulfide-stabilized tertiary structure is present. Alternatively, the actual binding regions in the 52/48 kg/mol fragment are outside the 512-673 region but require stabilization of a functional conformation by said internal region. Roth, G.J. et al., Biochemistry, 25, 8357-8361
(1986) have identified a Type III collagen-binding domain as within the residue 542-662 sequence of the fragment.
For the purpose of identifying vWF-derived antithrombotic polypeptides with enhanced collagen binding ability, all or part of a cDNA encoding the 441-730 fragment can be subject to random mutagenesis. The population of resultant mutagenized vWF DNA sequences is then reinserted into pET-3A plasmid, as an Xbal-Hindlll insert, for transformation of host bacterial cells followed by expression therein and large scale screening for desired mutant phenotypes. Mutations giving enhanced binding may then be inserted into mammalian or other eucaryotic host cell constructs for further testing.
A large scale screening assay suitable for detecting enhanced affinity of the mutant polypeptides for collagen can be patterned upon the screening assay for GPIbα binding in Example 16, with appropriate modifications.
Specifically, the mutagenized population of M13mpl8 constructs is cloned into pET-3A plasmid followed by transformation of E.coli BL21(DE3). Partial purification of bacterial inclusion body lysates follows the procedure of Example 16. Contacting of the resultant vWF fragments with ristocetin or botrocetin is omitted. 125I-monomeric type III collagen is applied to the nitrocellulose instead of ,25l- GPIbα as in Example 16. Monomeric type III collagen is prepared according to the procedure of Roth, G.J. et al., Biochemistry, 25, 6357-8361 (1986) and iodinated following the method of Bolton, A.E. and Hunter, W.M. , Biochem. J.. 133, 529-539 (1973). Application of 50 μl aliquots of monomeric collagen (0.25 μg/ml) having a specific activity of between approximately 5 x 108 and approximately 5 x 1010 cpm/mg should result in an adequate bound signal in relation to nonspecific binding. Other suitable quantities and specific activities can be determined and substituted as
necessary. The alternate assay of Example 16 based upon incubation with SDS and then DTT to prepare lysates is equally applicable.
Additional screening strategies useful to confirm the 5 properties of a much smaller number of bacterial clones which gave positive responses in the above assay (and using labelled vWF fragments and unlabelled collagen) are provided by the binding assays of Pareti, F.I. et al., J. Biol. Chem.. 262(28), 13835-13841 (1987) and Mohri, H. et al. , J. Biol. 10 Chem.. 264(29), 17361-17367 (1989). The 15I labelling procedures described herein allow for specific activities varying over many orders of magnitude so that a wide range of receptor (ligand) and vWF fragment concentrations can be interacted.
15 Example 26 - Screening of mutant antithrombotic polypeptide fragments patterned on the residue 441-730 region of mature von Willebrand factor subunit having enhanced affinity for glycosaminoglycans or proteoglycans
20 The binding of heparin to vWF has been determined to involve one or more amino acid subsequences within the residue 512-673 domain. It is likely that this binding activity is conferred by limited linear subsequences within the above stated region since it has been demonstrated that
25 both the intact disulfide-stabilized 116 kg/mol homodimer and the reduced and alkylated 52/48 kg/mol monomer are equally effective in inhibiting vWF-heparin interaction. Mohri, H. et al., J. Biol. Chem.. 264(29), 17361-17367 (1989).
The mutagenesis strategy of Example 16, method 1 is used
30 to create a randomized population of DNA sequences in bacterial clones, with the screening of suitable colonies following the procedure of Example 25 except that radiolabelled heparin is substituted for collagen as binding ligand. Labelling is accomplished by subjecting heparin
35. sodium salt (porcine intestinal mucosa, grade II, Sigma, St. Louis, MO) or similar material to derivatization with fluoresceinamine followed by iodination of the conjugate. The 125I labelling procedure allows for specific activities of heparin varying over many orders of magnitude so that a wide
range of receptor (ligand) and vWF fragment concentrates can be interacted. Smith, J.W. and Knauer, D.J. Anal. Biochem.. 160, 105-114 (1987).
As noted previously, it is possible that the collagen, and more importantly, the heparin binding domains of antithrombotic polypeptides patterned upon 52/48 kg/mol vWF fragment will prevent the anti-GPIbα activity of the molecule, such as by causing the polypeptide to be bound at nonspecific "heparin binding sites" throughout the vascular system. The random mutagenesis procedure of this Example could also be used to screen for a mutant binding subsequence having less affinity for glycosaminoglycans (or proteoglycans) or collagen than present in the wild type sequence, thereby providing an additional alternate method of inactivating said binding activities.
Additional screening strategies useful to confirm the desired properties expressed in a much smaller number of clones giving positive responses in the first assay (and using labelled vWF fragments and unlabelled heparin) are provided by Mohri, H. et al., J. Biol. Chem.. 264(29), 17361- 17367 (1989) and Fugimura, Y. et al., J. Biol. Chem. , 262(4), 1734-1739 (1987).
Example 27 - Screening of mutant antithrombotic polypeptide fragments patterned on the A3 domain of mature von
Willebrand factor subunit having enhanced affinity for collagen
Following the procedure of Example l, a double stranded cDNA encoding the entire vWF protein (for the pre-propeptide) is amplified in a polymerase chain reaction using synthetic oligonucleotides selected to flank the A3 domain encoding region, said oligonucleotides carrying also 5' or 3' restriction sequences suitable for creating a vWF insert in the multiple cloning site of M13mpl8. The strategy of Examples 16 and 25 is again applied to generate, by random mutagenesis of subregions of the encoding cDNA, mutant vWF polypeptides with potential enhanced binding activity toward collagen. The collagen binding region of the A3 domain is stated to comprise residues 948-998 thereof (Roth, G.J. et
al., Biochemistry, 25, 8357-8361 (1986)) although it is anticipated that other subdomains of the domain may participate in binding.
Example 28 - Screening of mutant antithrombotic polypeptide fragments patterned on mature von Willebrand factor subunit having enhanced affinity for the platelet glycoprotein Ilb/IIIa receptor site The screening assay of Example 16 for mutant vWF-derived polypeptides having enhanced platelet GPIbα binding activity is modified as described below to identify mutant vWF polypeptides having enhanced platelet GPIIb/IIIa receptor binding affinity. The region of vWF cDNA selected for PCR amplification is recommended to encompass a region corresponding to approximately 100 amino acid residues on either side of the Arg*Gly-Asp- Ser sequence (subunit residues 1744-1747). Oligonucleotides for amplification are again designed to contain 5' and 3' terminal restriction sequences so that the cDNA may be inserted into M13mpl8 phage for random mutagenesis.
Preparation of oligonucleotides for random mutagenesis of the target domain (focusing on the residues directly proximal to and including Arg-GlyAsp- Ser) follows Method 1 of Example 16. With respect to the binding assay, neither botrocetin or ristocetin is applied to the nitrocellulose. 125I-GPIIb/IIIa purified by the method of Fitzgerald, L.A. et al.. Anal. Biochem., 151, 169-177 (1985) or Newman, P.J. and Kahn, R.A. , Anal. Biochem. , 132, 215-218 (1983) and labelled by the method of Bolton, A.E. and Hunter, W.M. , Biochem. J.. 133,529-539 (1973) is substituted for 125I-GPIbα. Applied to the 96-well plates are 50 μl aliquots of HEPES/BSA containing GPIIb/IIIa at a suitable concentration thereof, such as approximately 0.25 μg/ml or higher, with a specific activity of between approximately 5 x 108 and approximately 5 x 1010 cpm/mg. The 125I labelling procedure allows for specific activities varying over many orders of magnitude so that a wide range of receptor (ligand) and vWF fragment concentrations can be interacted.
An additional screening strategy useful to confirm the properties of a much smaller number of bacterial clones giving positive responses in the first assay (and using labelled vWF fragments and unlabelled GPIIb/IIIa is provided by Ruggeri, Z.M. et al., J. Clin. Invest.. 72, 1-12 (1983).
Example 29 - Screening of mutant antithrombotic polypeptide fragments patterned on the residue 1-272 region of mature von Willebrand factor subunit having enhanced affinity for glycosaminoglycans and proteoglycans
The strategy of Example 26 is applied using a suitable amplified cDNA to generate mutant polypeptides derived from the residue 1-272 domain of mature vWF subunit with potential enhanced binding activity toward glycosaminoglycans and proteoglycans.
Example 30 - Screening of mutant antithrombotic polypeptide fragments patterned on the residue 1-272 region of mature von Willebrand factor subunit having enhanced affinity for factor VIII
The general strategy of Examples 16 and 25 is applied to generate and detect mutant polypeptides patterned on vWF with enhanced binding activity toward factor VIII. Coagulation factor VIII, purified by the method of Fulcher, CA. and Zimmerman, T.S., Proc. Natl. Acad. Sci. USAr 79, 1648-1652 (1982) and labelled with 125I to specific activities comparable to that of the other ligands in Examples 25-29 is used. The I25I labelling procedure allows for specific activities varying over many orders of magnitude so that a wide range of receptor (ligand) and vWF fragment concentrates can be interacted.
Deposit of Strains Useful in Practicing the Invention
Deposits of biologically pure cultures of the following strains were made under the Budapest Treaty with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland. The accession numbers indicated were assigned
after successful viability testing, and the requisite fees were paid.
Access to said cultures will be available during pendency of the patent application to one determined by the Commissioner of the United States Patent and Trademark Office to be entitled thereto under 37 CF.R. §1.14 and 35 U.S.C §122, or if and when such access is required by the Budapest Treaty. All restriction on availability of said cultures to the public will be irrevocably removed upon the granting of a patent based upon the application and said cultures will remain permanently available for a term of at least five years after the most recent request for the furnishing of samples and in any case for a period of at least 30 years after the date of the deposits. Should the cultures become nonviable or be inadvertantly destroyed, they will be replaced with viable culture(s) of the same taxonomic description.
Strain/Plasmid ATCC No. Deposit Date
E.coli p5E BL21 (DE3) 96.3 ATCC 68406 9/19/90 E.COli XS127 96.4 ATCC 68407 9/19/90
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Ruggeri, Zaverio M. and
Ware, Jerry, inventors on behalf of Scripps Clinic and Research
Foundation (ii) TITLE OF INVENTION: Therapeutic Fragments of von
Willebrand Factor (iii)NUMBER OF SEQUENCES: 20 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Scripps Clinic and Research Foundation
(B) STREET: 10666 North Torrey Pines Road
(C) CITY: La Jolla (D) STATE: California
(E) COUNTRY: United States
(F) ZIP: 92037 (V) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 1.2 megabyte 5 1/4" floppy (B) COMPUTER: AST Bravo 386SX IBM PC comp.
(C) OPERATING SYSTEM: MS DOS version 3.2
(D) SOFTWARE: WordPerfect 5.1 conv. to ASCII (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: Express Mail Label TB002596077US
(B) FILING DATE: 27-Mar-92
(C) CLASSIFICATION:
(vii)PRIOR APPLICATION DATA: This appl. is a c-i-p of (A) APPLICATION NUMBER: US 07/613,004 (B) FILING DATE: 13-NOV-1990
(vii)PRIOR APPLICATION DATA: This appl. is a c-i-p of
(A) APPLICATION NUMBER: US 07/600,183
(B) FILING DATE: 17-Oct-1990 (viii)ATTORNEY/AGENT INFORMATION: (A) NAME: Barron, Alexis
(B) REGISTRATION NUMBER: 22,702
(C) REFERENCE/DOCKET NUMBER: P16,633-E PCT (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (215) 923-4466
(B) TELEFAX: (215) 923-2189
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 960
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: GAA GAC TGT CCA GTG TGT GAG GTG GCT GGC 30
Glu Asp Cys Pro Val Cys Glu Val Ala Gly
435 440
CGG CGT TTT GCC TCA GGA AAG AAA GTC ACC 60
Arg Arg Phe Ala Ser Gly Lys Lys Val Thr 445 450
TTG AAT CCC AGT GAC CCT GAG CAC TGC CAG 90
Leu Asn Pro Ser Asp Pro Glu His Cys Gin
455 460
ATT TGC CAC TGT GAT GTT GTC AAC CTC ACC 120 lie Cys His Cys Asp Val Val Asn Leu Thr
465 470
TGT GAA GCC TGC CAG GAG CCG GGA GGC CTG 150
Cys Glu Ala Cys Gin Glu Pro Gly Gly Leu
475 480 GTG GTG CCT CCC ACA GAT GCC CCG GTG AGC 180
Val Val Pro Pro Thr Asp Ala Pro Val Ser
485 490
CCC ACC ACT CTG TAT GTG GAG GAC ATC TCG 210
Pro Thr Thr Leu Tyr Val Glu Asp lie Ser 495 500
GAA CCG CCG TTG CAC GAT TTC TAC TGC AGC 240
Glu Pro Pro Leu His Asp Phe Tyr Cys Ser
505 510
AGG CTA CTG GAC CTG GTC TTC CTG CTG GAT 270 Arg Leu Leu Asp Leu Val Phe Leu Leu Asp
515 520
GGC TCC TCC AGG CTG TCC GAG GCT GAG TTT 300
Gly Ser Ser Arg Leu Ser Glu Ala Glu Phe
525 530
GAA GTG CTG AAG GCC TTT GTG GTG GAC ATG 330
Glu Val Leu Lys Ala Phe Val Val Asp Met
535 540
ATG GAG CGG CTG CGC ATC TCC CAG AAG TGG 360 Met Glu Arg Leu Arg lie Ser Gin Lys Trp
545 550
GTC CGC GTG GCC GTG GTG GAG TAC CAC GAC 390
Val Arg Val Ala Val Val Glu Tyr His Asp
555 560 GGC TTC CAC GCC TAC ATC GGG CTC AAG GAC 420
Gly Ser His Ala Tyr lie Gly Leu Lys Asp
565 570
CGG AAG CGA CCG TCA GAG CTG CGG CGC ATT 450
Arg Lys rg Pro Ser Glu Leu Arg Arg lie 575 580
GCC AGC CAG GTG AAG TAT GCG GGC AGC CAG 480
Ala Ser Gin Val Lys Tyr Ala Gly Ser Gin
585 590
GTG GCC TCC ACC AGC GAG GTC TTG AAA TAC 510 Val Ala Ser Thr Ser Glu Val Leu Lys Tyr
595 600
ACA CTG TTC CAA ATC TTC AGC AAG ATC GAC 540
Thr Leu Phe Gin lie Phe Ser Lys lie Asp
605 610 CGC CCT GAA GCC TCC CGC ATC GCC CTG CTC 570
Arg Pro Glu Ala Ser Arg lie Ala Leu Leu
615 620
CTG ATG GCC AGC CAG GAG CCC CAA CGG ATG 600
Leu Met Ala Ser Gin Glu Pro Gin Arg Met 625 630
TCC CGG AAC TTT GTC CGC TAC GTC CAG GGC 630
Ser Arg Asn Phe Val Arg Tyr Val Gin Gly
635 640
CTG AAG AAG AAG AAG GTC ATT GTG ATC CCG 660 Leu Lys Lys Lys Lys Val lie Val lie Pro
645 650
GTG GGC ATT GGG CCC CAT GCC AAC CTC AAG 690
Val Gly lie Gly Pro His Ala Asn Leu Lys
655 660 CAG ATC CGC CTC ATC GAG AAG CAG GCC CCT 720
Gin lie Arg Leu lie Glu Lys Gin Ala Pro
665 670
GAG AAC AAG GCC TTC GTG CTG AGC AGT GTG 750
Glu Asn Lys Ala Phe Val Leu Ser Ser Val
675 680
GAT GAG CTG GAG CAG CAA AGG GAC GAG ATC 780 Asp Glu Leu Glu Gin Gin Arg Asp Glu lie
685 690
GTT AGC TAC CTC TGT GAC CTT GCC CCT GAA 810
Val Ser Tyr Leu Cys Asp Leu Ala Pro Glu
695 700 GCC CCT CCT CCT ACT CTG CCC CCC CAC ATG 840
Ala Pro Pro Pro Thr Leu Pro Pro His Met
705 710
GCA CAA GTC ACT GTG GGC CCG GGG CTC TTG 870
Ala Gin .Val Thr Val Gly Pro Gly Leu Leu 715 720
GGG GTT TCG ACC CTG GGG CCC AAG AGG AAC 900
Gly Val Ser Thr Leu Gly Pro Lys Arg Asn
725 730
TCC ATG GTT CTG GAT GTG GCG TTC GTC CTG 930 Ser Met Val Leu Asp Val Ala Phe Val Leu
735 740
GAA GGA TCG GAC AAA ATT GGT GAA GCC GAC 960
Glu Gly Ser Asp Lys lie Gly Glu Ala Asp
745 750
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4
(B) TYPE: Amino acid
(C) STRANDEDNESS: (D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Arg Gly Asp Ser
4
(2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
ACGAATTC CGG CGT TTT GCC TCA GGA 26
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: GAAGCT TAC CAT GGA GTT CCT CTT GGG CCC CAG GG 35
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: Nucleic acid (C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
GAC AAC ATC AAC GTG GCC AAT CTG GCC GTG CTC AGG 36
(2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
CGG CTC CTG GCC GGC TTC ACC GGT GAG GTT 30
(2) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
G CCT GCT GCC GTA GAA ATC 19
(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: Nucleic acid (C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
GGC AAG GTC ACC GAG GTA GCT 21
(2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
GT CGACGCCACC ATG ATT CCT GCC AGA 27
(2) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 (B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
TCAGTTTCTA GATACAGCCC 20
(2) INFORMATION FOR SEQ ID NO: 11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded (D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:
ACGAATTC CGG CGT TTT GCC TCA GGA 26
(2) INFORMATION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: GAAGCTTAC CAT GGA GTT CCT CTT GGG 27
(2) INFORMATION FOR SEQ ID NO: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39
(B) TYPE: Nucleic acid (C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:
GGG ACC CTT TGT GCA GAA GGA • 21
CGG CGT TTT GCC TCA GGA 39
(2) INFORMATION FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded (D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:
GGG CCC AAG AGG AAC TGA 18
TCTAGAAAGC TTGGCACTGG C 39
(2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:
GAC AAC ATC ACC GTG GCC 18
AAT CTG GCC GTG CTC AGG 36
(2) INFORMATION FOR SEQ ID NO: 16:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
( i) SEQUENCE DESCRIPTION: SEQ ID O: 16: AAGCTT GGA GCA GCA CCT 18
CTG CAG CAC CAG GTC AGG 36
(2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 (B) TYPE: Nucleic acid
(C) STRANDEDNESS: single stranded
(D) TOPOLOGY: Linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
GAATTC GTT GAC CCT GAA 18 GAC TGT CCA GTG TGT 33
(2) INFORMATION FOR SEQ ID NO: 18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21
(B) TYPE: Nucleic acid (C) STRANDEDNESS: Single stranded
(D) TOPOLOGY: Linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:
TC CAG TAG CCA GCT GCC GTA G 21
(2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: Single stranded
(D) TOPOLOGY: Linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:
C CAC GCG GAC GCA CTT CTG GG 21
(2) INFORMATION FOR SEQ ID NO: 20:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 (B) TYPE: Nucleic acid
(C) STRANDEDNESS: Single stranded
(D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:
TT CAG TAG CCA GCT GCA GTA G 21
(2) INFORMATION FOR SEQ ID NO: 21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 320
(B) TYPE: Amino acid
(C) STRANDEDNESS: (D) TOPOLOGY: Linear
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:
Glu Asp Cys Pro Val Cys Glu Val Ala Gly
435 440
Arg Arg Phe Ala Ser Gly Lys Lys Val Thr 445 450
Leu Asn Pro Ser Asp Pro Glu His Cys Gin
455 460 lie Cys His Cys Asp Val Val Asn Leu Thr
465 470 Cys Glu Ala Cys Gin Glu Pro Gly Gly Leu
475 480
Val Val Pro Pro Thr Asp Ala Pro Val Ser
485 490
Pro Thr Thr Leu Tyr Val Glu Asp lie Ser 495 500
Glu Pro Pro Leu His Asp Phe Tyr Cys Ser
505 510
Arg Leu Leu Asp Leu Val Phe Leu Leu Asp
515 520 Gly Ser Ser Arg Leu Ser Glu Ala Glu Phe
525 530
Glu Val Leu Lys Ala Phe Val Val Asp Met
535 540
Met Glu Arg Leu Arg lie Ser Gin Lys Trp 545 550
Val Arg Val Ala Val Val Glu Tyr His Asp
555 560
Gly Ser His Ala Tyr lie Gly Leu Lys Asp
565 570
Arg Lys Arg Pro Ser Glu Leu Arg Arg lie
575 580 Ala Ser Gin Val Lys Tyr Ala Gly Ser Gin
585 590
Val Ala Ser Thr Ser Glu Val Leu Lys Tyr
595 600
Thr Leu Phe Gin lie Phe Ser Lys lie Asp 605 610
Arg Pro Glu Ala Ser Arg lie Ala Leu Leu
615 620
Leu Met Ala Ser Gin Glu Pro Gin Arg Met
625 630 Ser Arg Asn Phe Val Arg Tyr Val Gin Gly
635 640
Leu Lys Lys Lys Lys Val lie Val lie Pro
645 650
Val Gly lie Gly Pro His Ala Asn Leu Lys 655 660
Gin lie Arg Leu lie Glu Lys Gin Ala Pro
665 670
Glu Asn Lys Ala Phe Val Leu Ser Ser Val
675 680 Asp Glu Leu Glu Gin Gin Arg Asp Glu lie
685 690
Val Ser Tyr Leu Cys Asp Leu Ala Pro Glu
695 700
Ala Pro Pro Pro Thr Leu Pro Pro His Met 705 710
Ala Gin Val Thr Val Gly Pro Gly Leu Leu
715 720
Gly Val Ser Thr Leu Gly Pro Lys Arg Asn
725 730 Ser Met Val Leu Asp Val Ala Phe Val Leu
735 740
Glu Gly Ser Asp Lys lie Gly Glu Ala Asp
745 750