WO1992015678A1 - Pcr generated dicistronic dna molecules for producing antibodies - Google Patents

Abstract

A method of producing dicistronic DNA molecules each having upstream and downstream cistrons respectively coding for the first and second polypeptides of a heterodimeric receptor. Kits including, in separate containers, the primers and/or vectors of the invention in amounts sufficient to produce and/or express the dicistronic DNA molecules.

Description

PCR GENERATED DICISTRONIC DNA MOLECULES FOR PRODUCING ANTIBODIES

Technical Field

The present invention relates to a method for producing a library of dicistronic DNA molecules useful in expressing heterodimeric receptors, such as antibodies, T cell receptors and the like.

Background The expression of antibody libraries in bacteria has opened up new ways to uncover monoclonal antibody specificities. The antigen binding domain of the antibody is composed of a heavy and a light chain. These chains are each encoded by separate genes. To reconstruct a complete binding domain in bacteria, both heavy and light chain coding sequences are typically coexpressed, which involves two cloning steps, one for the heavy chain and one for the light. This is generally accomplished by either inserting both heavy and light chain coding sequences into one vector, or by first making separate heavy and light chain libraries and recombining the genomes to make a combinatorial library encoding random combinations of the heavy and light sequences. In either case, the need to clone two separate DNA fragments is cumbersome and, therefore, a method that could fuse both heavy and light chain sequences together prior to vector ligation would be desirable.

Brief Description of the Invention

The present invention contemplates a method of producing dicistronic DNA molecules each having upstream and downstream cistrons respectively coding for first and second polypeptides of a heterodimeric protein, such as a receptor. The method comprises the following steps:

(A) Forming a first polymeraεe chain reaction (PCR) admixture by combining, in a PCR buffer, first polypeptide-encoding genes and a first PCR primer pair defined by an outside first gene primer and an inside first gene primer. The inside first gene primer has a 3 '-terminal priming portion and, preferably, a 5'- terminal non-priming portion. The 3'-terminal priming portion comprises a nucleotide sequence homologous to a conserved portion of a first gene.

(B) Subjecting the first PCR admixture to a plurality of PCR thermocycleε to produce a plurality of first polypeptide coding DNA homologs in double stranded form. (C) Forming a second PCR admixture by combining, in a PCR buffer, second polypeptide- encoding genes and a second PCR primer pair defined by an outside second gene primer and an inside second gene primer. The inside gene primer has a 3'-terminal priming portion and, preferably, a 5'-terminal hybridizing portion complementary to a hybridizable portion of the 5'-terminal non-priming portion of the first inside gene primer. The 3 '-terminal priming portion comprises a nucleotide sequence homologous to a conserved portion of a second polypeptide-coding gene.

The first and second inside primers, when hybridized, form a duplex that codes for a double- stranded cistronic bridge that links the upstream and downstream cistrons. One strand of the bridge codes for (i) at least one stop codon in the same reading frame as said upstream cistron, (ii) signals for the initiation of translation of the downstream in cistron. Preferably, such signals include a riboso e binding site downstream from the stop codon, and at least one translation initiation codon in the same reading frame as the downstream cistron, the initiation codon being located downstream from the ribosome binding site. (D) Subjecting the second PCR admixture to a plurality of PCR thermocycles to produce a plurality of second polypeptide-coding DNA ho ologs in double stranded form.

(E) Separating the double stranded DNA homologs produced in steps (B) and (D) .

(F) Hybridizing the separated strands of step (E) to form internally-primed duplexes.

(G) Subjecting the internally-primed duplexes to conditions for primer extension to produce a dicistronic DNA molecule. Each of the dicistronic DNA molecules produced contains a first polypeptide-coding sequence and a second polypeptide-coding sequence linked by the cistronic bridge. The upstream cistron comprises one of the first polypeptide- or second polypeptide-coding DNA homologs. The downstream cistron comprises the other of the first polypeptide- or second polypeptide-coding DNA homologs.

Preferably, steps (A)-(D) are performed concurrently in one reaction vessel. Preferably, the polypeptide-encoding genes of steps (A) and (B) are present in respective repertoires of conserved genes. When used, the repertoires of steps (A) and (C) are usually formed by isolating mRNA from at least about 10³, preferably at least about 10⁷ lymphocytes. It is preferred that the repertoire of first polypeptide genes comprises at least 10⁵ different first polypeptide genes, and that the repertoire of second polypeptide genes comprises at least 10⁵ different second polypeptide genes. However, it should be noted that the method of the present invention can be used to operatively link for polyciεtronic expression any two genes. Thus, this invention can be used to physically link two genes from a single cell, such as a B cell, T cell, and the like, and thereby take advantage of a native immune system's ability to select operative gene pairs from the immunological repertoire. Similarly, operative gene pairs, i.e., a pair of genes encoding a heterodimeric receptor, from cells such as hybridomas, quadromas and the like, can be physically linked using the method of this invention.

Preferably the method further comprises step (H) wherein the dicistronic DNA molecules are PCR amplified by combining them with the outside first gene primer and the outside second gene primer to form a third PCR admixture. The third PCR admixture is then subjected to a plurality of PCR thermocycles. When a repertoire of first and/or second polypeptide- encoding genes is used, an amplified library of dicistronic DNA molecules is produced.

In preferred embodiments, the amplified products of step (H) are operatively linked for expression to a vector, preferably a phage vector. Preferably, the steps for operatively linking the dicistronic DNA molecules to a vector and isolating a recombinant vector that expresses a desired heterodimeric receptor include the following:

(i) Preparation of vector DNA and the dicistronic DNA molecules by cleavage with appropriate restriction enzyme(s) to form cohesive termini.

(ii.) Ligation of the digested vector with the dicistronic DNA molecules via the cohesive termini. (iii) Packaging of the ligated DNA (rDNA) into bacteriophage particles that can form plaques on appropriate bacterial hosts.

(iv) Identification of recombinant bacteriophages carrying the desired dicistronic DNA molecules.

(v) Plaque purification of selected recombinant bacteriophages.

Where the heterodimeric receptor is an antibody, the outside first gene primer hybridizes to a framework, leader or promoter region of a V_H im unoglobulin gene, and the outside second gene primer hybridizes to a J_L, constant or framework region, of a V_L immunoglobulin gene. The 3'-terminal priming portion of the inside first gene primer hybridizes to a J_H/ hinge, constant, or framework region of a V_H immunoglobulin gene, and the 3'- ter inal priming portion of the inside second gene primer hybridizes to a framework, leader or promoter region of a V_L immunoglobulin gene.

In another embodiment, a library of dicistronic DNA molecules comprising an upstream cistron and a downstream cistron, is produced by the following steps: (A) forming a poly erase chain reaction (PCR) admixture by combining, in a PCR buffer: (i) V_H genes, (ii) V_L genes,

(iii) an outside V_H gene primer (iv) an outside V_L gene primer, and

(v) a linking primer having a 3'- terminal priming portion, a cistronic bridge coding portion, and a 5'-terminal primer-template portion. The 3 '-terminal priming portion has a nucleotide base sequence complementary to a portion of the primer extension product of one of the outside primers. The 5'-terminal primer template portion has a nucleotide base sequence homologous to a portion of the primer extension product of the other of the outside primers. The cistronic bridge coding portion is as previously described.

(B) Subjecting the PCR admixture of step (A) to a plurality of PCR thermocycles.

In preferred embodiments, the method further comprises steps (C)-(H) as follows:

(C) Subjecting the internally-primed duplexes to conditions for primer extension to produce dicistronic DNA molecules, each containing a V_H-coding sequence and a V_L-coding sequence linked by the cistronic bridge. The upstream cistron comprises one of the V_κ- or "^-coding DNA homologs, and the downstream cistron comprising the other of the V_H- V_L- coding DNA homologs.

(D) Operatively linking for expression the different dicistronic ^'DNA molecules produced in step

(C) to expression vectors, preferably phage vectors, thereby forming a plurality of V_HL expression vectors.

(E) Transforming a population of host cells, preferably E. coli compatible with the expression vector with a plurality of the V_HL-expression vectors to produce a transformed population of host cells whose members contain the V_HL-expression vectors.

(F) Culturing the transformed population under conditions for expressing the V_H and V_L polypeptides coded for by the dicistronic DNA molecules.

(G) Assaying the members of the transformed population for expression of an antibody molecule capable of binding a preselected ligand, thereby identifying transformants containing the dicistronic DNA molecule.

(H) Segregating an identified transformant in step (G) from the population, thereby producing the isolated dicistronic DNA molecule. Also contemplated are kits for producing a dicistronic DNA molecule as described herein. In one embodiment, the kit is an enclosure containing, in separate containers, an outside first polypeptide, preferably a V_H, gene primer, an outside second polypeptide, preferably a V_L, gene primer, and a linking primer defining a 3'-terminal priming portion, a cistronic bridge coding portion, and a 5'-terminal primer-template portion. The 3'-terminal priming portion has a nucleotide base sequence complementary to a portion of the primer extension product of one of the outside primers. The 5'-terminal primer-template portion encoding a nucleotide base sequence homologous to a portion of the primer extension product of the other of the outside primers. The cistronic bridge coding portion is as previously described.

Another contemplated kit comprises an enclosure containing, in separate containers, an outside first polypeptide, preferably a V_H, gene primer, an outside second polypeptide, preferably a v_L, gene primer, an inside first polypeptide, preferably a V_H, gene primer having a 3 '-terminal priming portion and a 5'-terminal non-priming portion. The 3'-terminal priming portion comprises a nucleotide sequence homologous to a conserved portion of a V_H gene. The kit also contains an inside second polypeptide, preferably a V_L, gene primer having a 3'- terminal priming portion and a 5'-terminal hybridizing portion complementary to the 5'-terminal non-priming portion of the first polypeptide gene primer, the 3'- terminal priming portion of which comprises a nucleotide sequence homologous to a conserved portion of a second polypeptide gene. The first polypeptide inside and second polypeptide inside primers, when hybridized, form a duplex that codes for a double- stranded DNA molecule containing the before described cistronic bridge for linking the upstream and downstream ciεtrons.

Brief Description of the Drawings Figure 1 illuεtrateε the principal structural features of an immunoglobulin molecule. The circled areas on the heavy and light chains represent the variable regions, (V_H) and (V_L) , a heterodimeric polypeptide containing a biologically active (ligand binding) portion of that region, and genes coding for the individual polypeptides, are produced by the methods of the present invention.

Figure 2 containε three panels. Panel 2A illustrateε variouε features of the heavy chain of human IgG (IgGl subclass) . Numbering is from the N- terminus on the left to the C-terminus on the right. Note the presence of four domains, each containing an intrachain diεulfide bond (S-S) and spanning approximately 110 amino acid residues. The symbol CHO stands for carbohydrate. The V region of the heavy (H) chain (V_H) resembles V_L in having three hypervariable complementarity determining regions (CDR'S) (not εhown) .

Panel 2B and 2C illustrate various features of a human kappa ( ) chain. Numbering is from the N- ter inus on the left to the C-terminus on the right. Note in Panel 2B the intrachain disulfide bond (S-S) spanning about the same number of amino acid residueε in the V_L and C_L domains. Panel 2C shows the locations of the CDRs in the V_L domain. Segments outεide the CDR are the framework segments (FR) .

Figure 3 illustrates a portion of the nucleotide base sequence of the 1661 base pair gene la B εequence from residue number 250 to reεidue number 651. The base sequences are shown conventionally from left to right and in the direction of 5' terminus to 3' terminus using the single letter nucleotide base code (A *_ adenine, T = thymine, C = cytosine and G = guanine) . The position of the nucleotide base sequence is indicated by the numbers in the left margin of the figure.

The reading frame of the structural lamB gene is indicated by placement of the deduced amino acid residue sequence of the lambda receptor protein for which it codes below the nucleotide sequence such that the triple letter code for each amino acid residue is located directly below the three baseε (codon) coding for each reεidue. The reεidue sequence iε εhown conventionally from left to right and in the direction of amino terminus to carboxy terminuε. The po ition of the amino acid reεidue εequence iε indicated by the numberε in the right margin of the figure.

Figure 4 illuεtrateε the strategy used to create immunoglobulin heavy and light chain PCR fusion products. RNA and DNA are represented by dotted and solid lines, respectively. Regions of the immunoglobulin heavy chain coding εtrand area deεignated V_H, C_H1, C_H2, and C_H3 correεpond to those functional regions in the protein. The corresponding regions of the non-coding strand are designated by a prime (') following the symbol. Regions V_L and C_L are similarly labelled for the light chain. A region, X, unrelated to the natural immunoglobulin sequences is introduced into the fusion product by attaching X to the 5' endε of the C_H1' inside and V_L inεide primerε. Figure 5 illuεtrateε human fuεion PCR inεide primers. The heavy chain C_H1' inside primer sequence is written 3* to 5* and the light chain V_L inside primer sequence is written 5' to 3 ' . Note that it is not the primer strands that crosε-prime to create the fusion molecule, but the complementary PCR product strands. Boxed nucleotides represent regions where the C_H1' primer hybridizes to the 3 ' end of C_hl on human IgG heavy chain mRNA or where the V_L primer hybridizes to the 5' end of V_L framework-1 on human kappa light chain cDNA. Underlined sequenceε indicate the two stop codons. The italicized amino acid and nucleotides indicate changes in sequence from the original pelB leader sequence. The mouse fuεion-PCR internal primers overlap in a similar manner.

Figure 6 illustrates the sequences of the synthetic DNAs inserted into Lambda ZAP to produce Lambda Zap II V_H (ImmunoZAP H) (Panel A) and Lambda Zap V_L (ImmunoZAP L) (Panel B) expression vectors. The various features required for these vectors to express the V_H and V_L-coding DNA homologs include the Shine-Dalgarno ribosome binding εite, a leader sequence to direct the expresεed protein to the periplaεm aε deεcribed by Mouva et al. , J. Biol. Chem. , 255:27, 1980, and various restriction enzyme sites used to operatively link the V_H and V_L homologs to the expresεion vector. The V_H expression-vector sequence also contains a short nucleic acid sequence that codes for amino acids typically found in variable regions heavy chain (V_H Backbone) . This V_H Backbone is just upstream and in the proper reading as the V_H DNA homologs that are operatively linked into the Xho I and Spe I restriction sites. The V_L DNA homologs are operatively linked into the V_L sequence (Panel B) at the Sac I and Xba I restriction enzyme sites. Figure 7 illustrates the major features of the bacterial expression vector Lambda Zap II V_H (ImmunoZAP H) (V_H- expression vector) . The amino acids encoded by the synthetic DNA sequence from Figure 6A is shown at the top along with the T₃ polymerase promoter from Lambda Zap II. The orientation of the insert in Lambda Zap II is as presented. The V_H DNA homologs were inserted into the phagemid that is produced by the in vivo excision protocol described by Short et al.. Nucleic Acids

Res.. 16:7583-7600, 1988. The V_H DNA homologs were inserted into the Xho I and Spe I restriction enzyme εiteε. The read through transcription produces the decapeptide epitope (tag) that is located just 3 ' of the cloning sites.

Figure 8 illustrates, in Panels 8A and 8B, the major features of the bacterial expression vector Lambda ZAP II Modified V_H (Modified ImmunoZAP H) (V_H- expreεεion vector) (IZ H) . The amino acids encoded by the synthetic DNA sequence from Panel 8A is shown along with the T₃ polymerase promoter from Lambda ZAP II. The orientation of the insert in Lambda ZAP II is as presented. The insert was modified by the elimination of the Sac I site between the T₃ polymerase and Not I site and by the change of amino acids at the 5' end of the heavy chain rom QVKL to QVQL (a lysine residue was changed to a gluta ine residue) . The V_H and V_L DNA homologs were inserted into the Xho I and Xba I cloning sites of the phagemid as described in Figure 7 and shown in Panel 8B. The modifications were made to create a fusion-PCR library from hybridoma RNA, to overcome decreased efficiency of secretion of positively charged amino acids in the amino terminus of the protein. Inouye et al., Proc. Natl. Acad. Sci.. USA. 85:7685-7689 (1988), and to make the V_L Sac I cloning site a unique restriction site.

Figure 9 illustrates the major features of the bacterial expression vector Lambda Zap II V_L (ImmunoZAP L) (V_L expression vector) . The amino acids encoded by the synthetic DNA sequence shown in Figure 6B is shown at the top along with the T₃ polymerase promoter from Lambda Zap II, The orientation of the insert in Lambda Zap II is as presented. The V_L DNA homologs are inεerted into the Sac I and Xba I cloning sites of the phagemid as described in Figure 7.

Figure 10 illustrates an ethidium bromide εtained agaroεe gel. After PCR amplification from human cloned DNA of heavy chain alone (HC) , light chain alone (LC) , and the heavy/light dicistronic DNA molecule (H/L) , DNA samples were electrophoresed. The expected sizeε of the HC, LC, and H/L products visualized on the gel were approximately 730, 690, and 1,390 base pairε, reεpectively. Figure 11 illustrates an autoradiogram shoving εignalε obtained from human phage cloneε. Approximately 100 lambda phage were spotted onto E. ccli lawns, creating plaques that were overlaid with nitrocellulose filters previously soaked in 10 mM isopropylbeta-D-thiogalactopyranoside (IPTG) to induce Fab expreεsion. Following overnight incubation, the filters were reacted with ¹²⁵I-tetanuε toxoid probe. After washing, the filters were exposed to X-ray film. The column on the right repreεentε the parental cloneε that were selected from a combinatorial library.

Mullinax et al. , Proc. Natl. Acad. Sci.. USA. 87:8095- 8099 (1990). The column on the left representε cloneε that were generated by amplifying, the combinatorial lambda clone DNA with the V_H and C_L' outside primers, C_hl' and V_L inside primers, followed by recloning in the modified ImmunoZAP H vector. Clone 7G1 iε a negative control which expresεeε an Fab that does not react with tetanus toxoid. Clones 10C1 and 6C1 both produce Fabs that react with tetanus toxoid. IZ H is the modified heavy chain ImmunoZAP H vector without an insert.

Figure 12 illustrates the major features of the bacterial expresεion vector lambda ZAP H/L (ImmunoZAP H/L) (combined V_H- and V_L-expreεsion vector) . The ImmunoZAP H/L vector is created from the heavy and light chain libraries by fusing the vectors at the Eco Rl site. DNA is purified from the light chain library and restriction digested with Mlu 1 and Eco Rl. This cleaves the DNA from the left arm of the vector into several pieces while leaving the right arm with the light chain inserts intact. DNA iε purified from the heavy chain librarieε and reεtriction digested with Hind III and Eco Rl. This cleaveε the DNA from the right arm of the vector into εeveral pieces while leaving the left arm with the heavy chain inεertε intact. The intact left arm of the heavy chain vector containing the heavy chain inserts and right arm of the light chain vector containing the light chain insertε are then mixed and ligated at the common Eco Rl reεtriction site.

Detailed Description of the Invention A. Definitions

Nucleotide: A monomeric unit of DNA or RNA consisting of a sugar moiety (pentose) , a phoεphate, and a nitrogenous heterocyclic base. The base is linked to the sugar moiety via the glycosidic carbon (1' carbon of the pentoεe) and that combination of baεe and sugar is a nucleoside. When the nucleoside contains a phosphate group bonded to the 3 ' or 5* position of the pentose it is referred to as a nucleotide.

Base Pair (bp) : A partnership of adenine (A) with thymine (T) , or of cytosine (C) with guanine (G) in a double stranded DNA molecule. In RNA, uracil (U) is substituted for thymine.

Nucleic Acid: A polymer of nucleotides, either single or double stranded.

Gene: A nucleic acid whose nucleotide sequence codes for an RNA or polypeptide. A gene can be either RNA or DNA.

Complementary Bases: Nucleotides that normally pair up when DNA or RNA adopts a double stranded configuration. Complementary Nucleotide Seguence: A sequence of nucleotides in a single-stranded molecule of DNA or RNA that is sufficiently complementary to that on another single strand to specifically hybridize to it with consequent hydrogen bonding. Conserved: A nucleotide εequence iε conserved with respect to a preselected (reference) εequence if it non-randomly hybridizes to an exact complement of the preselected sequence.

Hybridization: The pairing of substantially complementary nucleotide sequences (strandε of nucleic acid) to form a duplex or heteroduplex by the establishment of hydrogen bonds between complementary base pairε. It is a specific, i.e. non-random, interaction between two complementary polynucleotides that can be competitively inhibited.

Nucleotide Analog; A purine or pyrimidine nucleotide that differs structurally from A, T, G, C, or U, but is sufficiently similar to substitute or the normal nucleotide in a nucleic acid molecule. DNA Homolog: Iε a nucleic acid having a preεelected conserved nucleotide sequence and a sequence coding for a receptor capable of binding a preselected ligand. Receptor: A receptor iε a molecule, εuch as a protein, glycoprotein and the like, that can specifically (non-randomly) bind to another molecule.

Antibody: The term antibody in its variouε grammatical formε iε uεed herein to refer to immunoglobulin molecules and immunologically active portionε of immunoglobulin moleculeε, i.e., moleculeε that contain an antibody combining site or paratope. Exemplary antibody molecules are intact immunoglobulin moleculeε, εubεtantially intact immunoglobulin molecules and portions of an immunoglobulin molecule, including those portions known in the art aε Fab, Fab¹ , F(ab')₂ and F(v) .

Antibody Combining Site: An antibody combining site is that structural portion of an antibody molecule comprised of a heavy and light chain variable and hypervariable regions that εpecifically bindε (immunoreacts with) an antigen. The term immunoreact in itε variouε forms meanε specific binding between an antigenic determinant-containing molecule and a molecule containing an antibody combining site εuch aε a whole antibody molecule or a portion thereof.

Monoclonal Antibody: The phraεe monoclonal antibody in its various grammatical forms refers to a population of antibody molecules that containε only one species of antibody combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreactε. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining εiteε, each immunoεpecific for a different antigen, e.g., a biεpecific monoclonal antibody. Up t eam: In the direction oppoεite to the direction of DNA tranεcription, and therefore going from 5* to 3' on the non-coding εtrand, or 3' to 5' on the mRNA.

Downstream: Further along a DNA sequence in the direction of sequence transcription or read out, that iε traveling in a 3'- to 5'-direction along the non-coding εtrand of the DNA or 5•- to 3'- direction along the RITA tranεcript.

Ciεtron: Sequence of nucleotides in a DNA molecule coding for an amino acid residue sequence.

Stop Codon: Any of three codons that do not code for an amino acid, but inεtead cauεe_s termination of protein εynthesis. They are UAG, UAA and UGA. Alεo referred to as a nonsenεe or termination codon.

Leader Polypeptide: A short length of amino acid sequence at the amino end of a protein, which carries or directs the protein through the inner membrane and so ensures its eventual secretion into the periplasmic space and perhaps beyond. The leader sequence peptide is commonly removed before the protein becomes active.

Reading Frame: Particular sequence of contiguous nucleotide triplets (codons) employed in translation. The reading frame depends on the location of the translation initiation codon.

Inside Primer: An inside primer is a polynucleotide that has a priming region located at the 3' terminuε of the primer which typically consists of 15 to 30 nucleotide baεes. The 3' terminal-priming portion iε capable of acting as a primer to catalyze nucleic acid εynthesiε. The 5'-terminal priming portion compriεeε a non-priming portion.

Outside Primer: An outside primer comprises a 3'-terminal priming portion and a portion that may define an endonuclease reεtriction εite which iε typically located in a 5'-terminal non-priming portion of the outside primer.

B. Methods

The present invention contemplates a method of isolating from a repertoire of conserved genes a pair of genes coding for a dimeric receptor having a preselected activity. Preferably, the receptor will be a heterodimeric polypeptide capable of binding a ligand, such as an antibody molecule or immunologically active portion thereof, a cellular receptor, or a cellular adhesion protein coded for by one of the members of a family of conserved genes, i.e., genes containing a conserved nucleotide sequence of at least about 10 nucleotides in length.

Exemplary conserved gene families encoding different polypeptide claimε of a dimeric receptor are thoεe coding for immunoglobulins, major hiεtocompatibility complex antigenε of class I or II, lymphocyte receptors, integrins and the like.

A gene can be identified aε belonging to a repertoire of conserved genes using several methods. For example, an isolated gene may be used as a hybridization probe under low stringency conditions to detect other members of the repertoire of conserved genes present in genomic DNA using the methods described by Southern, J. Mol. Biol.. 98:503 (1975). If the gene used aε a hybridization probe hybridizeε to multiple restriction endonuclease fragments of the genome, that gene is a member of a repertoire of conserved genes.

Immunoglobulins

The immunoglobulins, or antibody moleculeε, are a large family of moleculeε that include εeveral types of molecules, εuch as IgD, IgG, IgA, IgM and IgE. The antibody molecule is typically comprised of two heavy (H) and light (L) chains with both a variable (V) and constant (C) region present on each chain as shown in Figure 1. Schematic diagrams of human IgG heavy chain and human kappa light chain are shown in Figureε 2A and 2B, reεpectively. Several different regionε of an immunoglobulin contain conεerved εe uenceε useful for isolating an immunoglobulin repertoire. Extenεive amino acid and nucleic acid εeguence data diεplaying exemplary conεerved εequenceε iε compiled for immunoglobulin moleculeε by Kabat et al., in Seguences of Proteins of Immunological Interest. National Institutes of Health, Bethesda, MD, 1987.

The C region of the H chain defines the particular immunoglobulin type. Therefore the selection of conserved sequences aε defined herein from the C region of the H chain reεultε in the preparation of a repertoire of immunoglobulin geneε having memberε of the immunoglobulin type of the selected C region. The V region of the H or L chain typically comprises four framework (FR) regions each containing relatively lower degreeε of variability that includeε lengthε of conεerved sequences. The use of conserved sequenceε from the FR1 and FR4 (J region) framework regionε of the V_H chain iε a preferred exemplary embodiment and is described herein in the Examples. Framework regions are typically conserved acrosε εeveral or all immunoglobulin types and thus conserved sequences contained therein are particularly suited for preparing repertoires having several immunoglobulin types.

Major Histocompatibility Complex

The major histocompatibility complex (MHC) is a large genetic locus that encodes an extensive family of proteins that include several classeε of moleculeε referred to aε claεε I, claεε II or claεs III MHC moleculeε. Paul et al., in Fundamental Immunology. Raven Press, NY, pp. 303-378 (1984). Claεs I MHC molecules are a polymorphic group of transplantation antigens representing a conserved family in which the antigen is comprised of a heavy chain and a non-MHC encoded light chain. The heavy chain includes several regions, termed the N^* Cl, C2, membrane and cytoplasmic regionε. Conεerved εequenceε useful in the preεent invention are found primarily in the N, Cl and C2 regionε and are identified aε continuouε εequenceε of "invariant reεidueε" in Kabat et al. , supra. Clasε II MHC moleculeε comprise a conserved family of polymorphic antigens that participate in immune responεiveneεs and are comprised of an alpha and a beta chain. The genes coding for the alpha and beta chain each include several regions that contain conserved sequences suitable for producing MHC class

II alpha or beta chain repertoires. Exemplary conserved nucleotide sequences include those coding for amino acid residues 26-30 of the Al region, residueε 161-170 of the A2 region and residueε 195-206 of the membrane region, all of the alpha chain. Conεerved sequences are also present in the Bl, B2 and membrane regionε of the beta chain at nucleotide sequences coding for amino acid residues 41-45, 150- 162 and 200-209, respectively.

Lymphocyte Receptors and Cell Surface Antigenε

Lymphocytes contain several families of proteins on their cell surfaceε including the T-cell receptor, Thy-1 antigen and numerouε T-cell surface antigens including the antigens defined by the monoclonal antibodies 0KT4 (leu3) , OKUT5/8 (leu2) , OKUT3, 0KUT1 (leul) , OKT 11 (leu5) 0KT6 and 0KT9. Paul, supra at pp. 458-479.

The T-cell receptor is a term used for a family of antigen binding molecules found on the surface of T-cellε. The T-cell receptor aε a family exhibitε polymorphic binding specificity similar to immunoglobulins in its diversity. The mature T-cell receptor iε comprised of alpha and beta chains each having a variable (V) and constant (C) region. The similarities that the T-cell receptor has to immunoglobulins in genetic organization and function shows that T-cell receptor contains regions of conserved εequence. Lai et al.. Nature. 331:543-546 (1988).

Exemplary conεerved εequenceε include thoεe coding for amino acid reεidues 84-90 of alpha chain, amino acid reεidueε 107-115 of beta chain, and amino acid residues 91-95 and 111-116 of the gamma chain. Kabat et al., supra. p. 279.

Integrins And Adheεionε

Adhesive proteins involved in cell attachment are members of a large family of related proteins termed integrinε. Integrins are heterodimers co priεed of a beta and an alpha subunit. Members of the integrin family include the cell surface glycoproteins platelet receptor GpIIb-IIIa, vitronectin, receptor (VnR) fibronectin receptor (FnR) and the leukocyte adhesion receptors LFA-1, Mac-1, Mo- 1 and 60.3. Rouεlahti et al., Science, 238:491-497 (1987) . Nucleic acid and protein sequence data demonstrates regions of conserved sequences exist in the memberε of theεe familieε, particularly between the beta chain of GpIIb-IIIa VnR and FnR, and between the alpha εubunit of VnR, Mac-1, LFA-1, FnR and GpIIb- IIIa. Suzuki et al., Proc. Natl. Acad. Sci. USA. 83:8614-8618, 1986? Ginsberg et al., J. Biol. Chem.. 262:5437-5440, 1987.

Fusion PCR

In the present invention, fusion PCR is used to generate two PCR-amplified DNA fragments, each of which have one of their ends modified by directed mispriming so that those ends share regionε of complementarity, i.e., cohesive termini. When the two fragments are mixed, denatured and reannealed in a PCR cycle, the cohesive termini on two strandε hybridize to form an "overlapping" DNA duplex that iε internally primed. The subεequent PCR cycle primer-extendε the non-overlapping regionε to form a hybrid DNA molecule that iε dicistronic. See Figure 4.

PCR amplification methods are described in detail in U.S. Patent Nos. 4,683,192, 4,683,202, 4,800,159, and 4,965,188, and at least in several texts including "PCR Technology: Principles and Applications for DNA Amplification", H. Erlich, ed. , Stockton Press, New York (1989) ; and "PCR Protocols: A Guide to Methods and Applications", Inniε et al., edε. , Academic Preεε, San Diego, California (1990). Cloning From Gene Repertoires

The following discussion illustrates the method of the present invention applied to isolating a pair of V_H and V_L genes from the immunoglobulin gene repertoire. This discuεεion iε not to be taken aε limiting, but rather aε illustrating application of principles that can be used to operatively link and isolate a functionally similar pair of genes. The illustrated method can be used with any family of conserved genes coding for functionally related dimeric receptors, whether obtained directly from a natural source, such naive or in vivo immunized cells, or from cells or one or more genes that have been treated or mutagenized in vitro. Generally, the method, combines the following elements:

1. Producing V_H and V_L gene repertoires.

2. Preparing sets of outεide and inεide polynucleotide primerε for cloning polynucleotide segmentε containing immunoglobulin V_H and V_L region geneε.

3. Preparing a library containing a plurality of different dicistronic DNA molecules, each containing a V_H and a V gene from the respective repertoires.

4. Expressing the diciεtronic DNA moleculeε in suitable host cells.

5. Screening the receptors formed by the polypeptides expresεed by the diciεtronic DNA moleculeε for the preεelected activity, and εegregating a dicistronic DNA molecule identified by the screening proceεε.

In one method of producing a library of dicistronic DNA molecules containing upεtream and downstream cistrons, firεt and εecond PCR amplification products are produced uεing reεpective firεt and second PCR primer pairs. The firεt PCR primer pair comprises a first polypeptide outside primer and a first polypeptide inside primer. Similarly, the second PCR primer pair compriseε a εecond polypeptide outεide primer and a εecond polypeptide inεide primer. The firεt and second polypeptide inside primers contain complementary 5'- terminal sequenceε that allow their DNA complements to hybridize and form an internally-primed duplex having 3'-overhanging termini. The internally-primed duplex is then subjected to primer extenεion reaction conditionε to produce a double εtranded, dicistronic DNA having substantially blunt or blunt ends. The diciεtronic DNA iε then PCR amplified uεing the outεide primerε aε a PCR primer pair.

A diciεtronic DNA molecule of this invention contains two amino acid residue-coding sequenceε on the εame εtrand εeparated by at leaεt one εtop codon and at least one signal sequence necesεary for tranεlation of the downεtream ciεtron, εuch aε a translation initiation codon, ribosome binding site, and the like. Thus, the upstream and downstream ciεtrons of the diciεtronic DNA molecule are operatively linked by a ciεtronic bridge. The ciεtronic bridge containε the genetic elementε necessary to terminate translation of the upstream ciεtron and initiate tranεlation of the downstream cistron. For instance, the coding εtrand of the bridge codeε for one or more stop codonε, preferably two, in the same translational reading frame aε the upεtream ciεtron. The cistronic bridge coding strand preferably also encodeε a ribosome binding site for the downstream ciεtron located downstream from the upεtream cistron's stop codon(ε). Typically, the coding εtrand of the cistronic bridge will alεo encode a leader polypeptide segment in the εame tranεlational reading frame aε the downεtream cistron. When present, the nucleotide base sequence encoding the leader usually begins with an initiation codon located within an operative distance, i.e., iε operatively linked, to the ribosome binding site.

A receptor produced by the preεent invention aεεumes a conformation having a binding site εpecific for, as evidenced by its ability to be competitively inhibited, a preselected or predetermined ligand such aε an antigen, enzymatic εubεtrate and the like. In one embodiment, a receptor of thiε invention iε a ligand binding heterodimeric polypeptide that formε an antigen binding εite which specifically binds to a preselected antigen to form a complex having a sufficiently strong binding between the antigen and the binding site for the complex to be isolated. When the receptor iε an antigen binding polypeptide itε affinity or avidity iέ generally greater than 10⁵ M^"1 more uεually greater than 10⁶ M^*1 and preferably greater than 10⁸ M^"1.

In another embodiment, a receptor of the subject invention binds a substrate and catalyzes the formation of a product from the substrate. While the topology of the ligand binding site of a catalytic receptor is probably more important for its preselected activity than its affinity (asεociation conεtant or pKa) for the subεtrate, the subject catalytic receptors have an asεociation constant for the preselected substrate generally greater than 10³ M^"1, more usually greater than 10⁵ M^*1 or 10⁶ M^"1 and preferably greater than 10⁷ M^"1.

Preferably the receptor produced by the subject invention iε heterodimeric and is therefore normally comprised of two different polypeptide chains, which together asεume a conformation having a binding affinity, or aεsociation constant for the preεelected ligand that iε different, preferably higher, than the affinity or association constant of either of the polypeptides alone, i.e., aε monomerε. One or both of the different polypeptide chainε is derived from the variable region of the light and heavy chains of an immunoglobulin. Typically, polypeptides comprising the light (V_L) and heavy (V_H) variable regionε are employed together for binding the preselected ligand.

A receptor produced by the subject invention can be comprised of active monomerε V_H and V_L ligand binding polypeptideε produced by the present invention can be advantageously combined in the heterodimer to modulate the activity of either or to produce an activity unique to the heterodimer.

The individual ligand polypeptides will be referred to as V_H and V_L and the heterodimer will be referred to as a F_v. However, it εhould be underεtood that a V_H may contain in addition to the V_H; εubstantially all or a portion of the heavy chain constant region. Similarly, a V_L may contain, in addition to the V_L, εubstantially all or a portion of the light chain constant region. A heterodimer comprised of a V_H containing a portion of the heavy chain constant region and a V_L containing subεtantially all of the light chain constant region iε termed a Fab fragment. The production of Fab can be advantageouε in some εituationε becauεe the additional conεtant region εequenceε contained in a Fab aε compared to a F_v can εtabilize the V_H and V_L interaction. Such stabilization can cause the Fab to have higher affinity for antigen. In addition the Fab iε more commonly used in the art and thus there are more commercial antibodieε available to εpecifically recognize a Fab in εcreening procedureε.

The individual V_H and V_L polypeptideε can be produced in lengthε equal to or substantially equal to their naturally occurring lengthε. See Figure 2. However, in preferred embodiments, the v_H and V_L polypeptides will generally have fewer than 125 amino acid residueε, more uεually fewer than about 120 amino acid residues, while normally having greater than 60 amino acid residueε, uεually greater than about 95 amino acid reεidueε, more uεually greater than about 100 amino acid residues. Preferably, the V_H will be from about 110 to.about 125 amino acid reεidueε in length while V_L will be from about 95 to about 115 amino acid reεidueε in length.

The amino acid reεidue εequenceε will vary widely, depending upon the particular idiotype involved. Uεually, there will be at leaεt two cyεteines separated by from about 60 to 75 amino acid residues and joined by a disulfide bond. The polypeptides produced by the subject invention will normally be substantial copies of idiotypes of the variable regions of the heavy and/or light chains of immunoglobulins, but in some situations a polypeptide may contain random mutations in amino acid residue sequences in order to advantageously improve the desired activity.

In some εituationε, it is desirable to provide for covalent croεs linking of the V_H and V_L polypeptides, which can be accomplished by providing cyεteine resides at the carboxyl termini. The polypeptide will normally be prepared free of the immunoglobulin constant regions, however a small portion of the J region may be included aε a result of the advantageouε selection of DNA syntheεiε primerε. The D region will normally be included in the tranεcript of the V_H.

Typically the C terminuε region of the V_H and V_L polypeptideε will have a greater variety of εequenceε than the N terminuε and, baεed on the preεent εtrategy, can be further modified to permit a variation of the normally occurring V_H and V_L chains. A synthetic polynucleotide can be employed to vary one or more amino acid in a hypervariable region.

1. Producing A Gene Repertoire A gene repertoire useful in practicing the present invention contains at least 10³, preferably at least 10⁴, more preferably at least 10⁵, and most preferably at least 10⁷ different conserved genes. Methods for evaluating the diversity of a repertoire of conεerved geneε iε well known to one εkilled in the art. Variouε well known methods can be employed to produce a uεeful gene repertoire. For instance, V_H and V_L gene repertoires can be produced by isolating V_H- and V_L-coding mRNA from a heterogeneouε population of antibody producing cellε, i.e., B lymphocyteε (B cellε) , preferably rearranged B cells such as those found in the circulation or spleen of a vertebrate. Rearranged B cellε are those in which immunoglobulin gene tranεlocation, i.e., rearrangement, has occurred as evidenced by the presence in the cell of mRNA with the immunoglobulin gene V, D and J region transcriptε adjacently located thereon. Typically, the B cellε are collected in a 1-100 ml sample of blood which usually contains 10⁶ B cells/ml.

In some caseε, it iε deεirable to biaε a repertoire for a preεelected activity, such aε by using as a source of nucleic acid cells (source cells) from vertebrates in any one of variouε εtageε of age, health and immune reεponεe. For example, repeated immunization of a healthy animal prior to collecting rearranged B cells results in obtaining a repertoire enriched for genetic material producing a receptor of high affinity. Mullinax et al., Proc. Natl. Acad. Sci. USA. 87:8095-8099 (1990). Conversely, collecting rearranged B cellε from a healthy animal whose immune system has not been recently challenged results in producing a repertoire that is not biased towards the production of high affinity V_H and/or V_L polypeptides.

It should be noted the greater the genetic heterogeneity of the population of cells for which the nucleic acids are obtained, the greater the diversity of the immunological repertoire (comprising V_H- and V_L-coding genes) that will be made available for screening according to the method of the present invention. Thus, cells from different individuals, particularly those having an immunologically significant age difference, and cells from individuals of different strainε, raceε or εpecieε can be advantageously combined to increase the heterogeneity (diversity) of a repertoire. Thus, in one preferred embodiment, the source cellε are obtained from a vertebrate, preferably a mammal, which has been immunized or partially immunized with an antigenic ligand (antigen) against which activity is sought, i.e., a preselected antigen. The immunization can be carried out conventionally. Antibody titer in the animal can be monitored to determine the stage of immunization desired, which stage correspondε to the amount of enrichment or biasing of the repertoire desired. Partially immunized animals typically receive only one immunization and cells are collected from thoεe animalε εhortly after a reεponse is detected. Fully immunized animals display a peak titer, which iε achieved with one or more repeated injections of the antigen into the host mammal, normally at 2 to 3 week intervals. Usually three to five days after the last challenge, the spleen is removed and the genetic repertoire of the spleenocytes, about 90% of which are rearranged B cells, is isolated using standard procedures. See, Current Protocols in Molecular

Biology. Ausubel et al., edε., John Wiley & Sonε, NY. Nucleic acids coding for V_H and V_L polypeptides can be derived from cells producing IgA, IgD, IgE, IgG or IgM, most preferably from IgM and IgG, producing cells.

Methods for preparing fragments of genomic DNA from which immunoglobulin variable region geneε can be cloned aε a diverεe population are well known in the art. See for example Herrmann et al., Methods In Enzv ol.. 152:180-183, (1987); Friεchauf, Methodε In Enzy ol.. 152:183-190 (1987); Frischauf, Methods In Enzvmol.. 152:190-199 (1987); and DiLella et al., Methods In Enzvmol.. 152:199-212 (1987). (The teachings of the references cited herein are hereby incorporated by reference.)

The desired gene repertoire can be isolated from either genomic material containing the gene expresεing the variable region or the meεsenger RNA (mRNA) which represents a transcript of the variable region. The difficulty in using the genomic DNA from other than non-rearranged B lymphocytes is in juxtaposing the sequences coding for the variable region, where the sequences are separated by introns. The DNA fragment(ε) containing the proper exonε muεt be iεolated, the introns excised, and the exons then spliced in the proper order and in the proper orientation. For the most part, this will be difficult, so that the alternative technique employing rearranged B cells will be the method of choice because the V, D and J immunoglobulin gene regions have translocated to become adjacent, so that the sequence is continuous (free of introns) for the entire variable regions.

Where mRNA is utilized the cells will be lysed under RNaεe inhibiting conditions. In one embodiment, the first step is to isolate the total cellular mRNA. Poly A+ mRNA can then be selected by hybridization to an oligo-dT cellulose column. The preεence of mRNAε coding for the heavy and/or light chain polypeptideε can then be assayed by hybridization with DNA single strandε of the appropriate genes. Conveniently, the sequences coding for the constant portion of the V_H and V_L can be used as polynucleotide probes, which sequences can be obtained from available sources. See for example. Early and Hood, Genetic Engineering.

Setlow and Hollaender, eds., Vol. 3, Plenum Publishing Corporation, NY, (1981), pages 157-188; and Kabat et al. , Seguences of Immunological Interest. National Instituteε of Health, Betheεda, MD, (1987) . In preferred embodimentε, the preparation containing the total cellular mRNA iε first enriched for the presence of V_H and/or V_L coding mRNA. Enrichment is typically accomplished by subjecting the total mRNA preparation or partially purified mRNA product thereof to a primer extension reaction employing a polynucleotide synthesis primer of the present invention. Exemplary methods for producing V_H and V_L gene repertoires are deεcribed in PCT Application No. PCT/US 90/02836 (International Publication No. WO 90/14430) . In preferred embodiments, isolated B cellε are immunized in vitro against a preselected antigen. In vitro immunization iε defined aε the clonal expansion of epitope-εpecific B cells in culture, in responεe to antigen stimulation. The end reεult iε to increaεe the frequency of antigen-specific B cellε in the immunoglobulin repertoire, and thereby decrease the number of clones in an expreεsion library that must be screened to identify a clone expresεing an antibody of the deεired specificity. The advantage of in vitro immunization is that human monoclonal antibodies can be generated against a limitless number of therapeutically valuable antigenε, including toxic or weak immunogenε. For example, antibodieε εpecific for the polymorphic determinants of tumor-associated antigens, rheumatoid factors, and histocompatibility antigens can be produced, which can not be elicited in immunized animals. In addition, it may be posεible to generate immune responseε which are normally suppressed in vivo.

In vitro immunization can be used to give rise to either a primary or secondary immune responεe. A primary immune response, resulting from first time exposure of a B cell to an antigen, results in clonal expansion of epitope-specific cells and the secretion of IgM antibodies with low to moderate apparent affinity constantε (lO^lO^^'1) . Primary immunization of human splenic and tonsillar lymphocytes in culture can be used to produce monoclonal antibodies against a variety of antigens, including cells, peptides, macromolecules, haptens, and tumor-associated antigens. Memory B cellε from immunized donors can also be stimulated in culture to give rise to a secondary immune response characterized by clonal expansion and the production of high affinity antibodieε (>10⁹ M^"1) of the IgG iεotype, particularly againεt viral antigenε by clonally expanding sensitized lymphocytes derived from seropositive individuals. In one embodiment, peripheral blood lymphocytes are depleted of various cytolytic cells that appear to down-modulate antigen-specific B cell activation. When lysoεome-rich εubpopulationε (natural killer cellε, cytotoxic and suppressor T cells, monocytes) are first removed by treatment with the lysoεmotropic methyl eεter of leucine, the remaining cells (including B cells, T helper cells, accesεory cellε) reεpond antigen-εpecifically during in vitro immunization. The lymphokine requirements for inducing antibody production in culture are satisfied by a culture supernatant from activated, irradiated T cells.

In addition to in vitro immunization, cell panning (immunoaffinity abεorption) can be uεed to further increaεe the frequency of antigen-εpecific B cellε. Techniqueε for εelecting B cell εubpopulationε via εolid-phaεe antigen binding are well eεtablished. Panning conditions can be optimized to selectively enrich for B cells which bind with high affinity to a , variety of antigens, including cell surface proteins. Panning can be used alone, or in combination with in vitro immunization to increase the frequency of antigen-specific cellε above the levels which can be obtained with either technique alone. Immunoglobulin expression libraries constructed from enriched populations of B cells are biased in favor of antigen- specific antibody cloneε, and thuε, enabling identification of clones with the desired specificities from smaller, less complex libraries. 2. Preparation Of Polynucleotide Primers The term "polynucleotide" as used herein in reference to primers, probes and nucleic acid fragments or segments to be εyntheεized by primer extension is defined as a molecule comprised of two or more deoxyribonucleotides or ribonucleotideε, preferably more than 3. Its exact size will depend on many factors, which in turn depends on the ultimate conditions of use. The term "primer" as used herein refers to a polynucleotide whether purified from a nucleic acid reεtriction digest or produced synthetically, which is capable of acting as a point of initiation of nucleic acid syntheεiε when placed under conditions in which syntheεiε of a primer extenεion product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase, reverse transcriptaεe and the like, and at a suitable temperature and pH. The primer is preferably single stranded for maximum efficiency, but may alternatively be in double stranded form. If double stranded, the primer iε firεt treated to separate it from its complementary strand before being used to prepare extension products. Preferably, the primer is a polydeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agentε for polymerization. The exact lengthε of the primerε will depend on may factorε, including temperature and the source of primer. For example, depending on the complexity of the target sequence, a polynucleotide primer typically contains 15 to 25 or more nucleotides, although it can contain fewer nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with template.

The primers used herein are selected to be "subεtantially" complementary to the different strands of each specific sequence to be synthesized or amplified. This means that the primer muεt be sufficiently complementary to non-randomly hybridize with its respective template strand. Therefore, the primer sequence may or may not reflect the exact sequence of the template. For example, a non- complementary nucleotide fragment can be attached to the 5' end of the primer, with the remainder of the primer sequence being εubεtantially complementary to the εtrand. Such non-complementary fragmentε typically code for an endonucleaεe reεtriction site. Alternatively, non-complementary baseε or longer sequences can be intersperεed into the primer, provided the primer εequence has εufficient complementarily with the sequence of the εtrand to be synthesized or amplified to non-randomly hybridize therewith and thereby form an extension product under polynucleotide syntheεizing conditionε.

Primerε of the preεent invention may alεo contain a DNA-dependent RNA polymeraεe promoter εequence or itε complement. See for example, Krieg et al., Nucleic Acidε Reεearch. 12:7057-70 (1984); Studier et al., J. Mol. Biol.. 189:113-130 (1986); and Molecular Cloning: A Laboratory Manual. Second Edition. Maniatis et al., eds. , Cold Spring Harbor, NY (1989).

When a primer containing a DNA-dependent RNA polymerase promoter is used the primer is hybridized to the polynucleotide strand to be amplified and the εecond polynucleotide strand of the DNA-dependent RNA polymerase promoter is completed uεing an inducing agent such as E. coli DNA polymerase I, or the Klenow fragment of E. coli DNA polymerase. The starting polynucleotide is amplified by alternating between the production of an RNA polynucleotide and DNA polynucleotide.

Primers may also contain a template sequence or replication initiation site for a RNA-directed RNA polymerase. Typical RNA-directed RNA polymerase include the QB replicase described by Lizardi et al., Biotechnology. 6:1197-1202 (1988). RNA-directed polymeraseε produce large numberε of RNA εtrandε from a small number of template RNA strandε that contain a template sequence or replication initiation site. These poly eraεeε typically give a one million-fold amplification of the template εtrand aε haε been described by Kramer et al., J. Mol. Biol.. 89:719-736 (1974) .

The polynucleotide primerε can be prepared using any suitable method, such aε, for example, the phosphotriester or phosphodiester methods see Narang et al., Meth. Enzvmol.. 68:90, (1979); U.S. Patent No. 4,356,270; and Brown et al., Meth. Enzvmol.. 68:109, (1979) .

The choice of a primer's nucleotide sequence depends on factors such aε the distance on the nucleic acid from the region coding for the desired receptor, its hybridization site on the nucleic acid relative to any second primer to be used, the number of genes in the repertoire it is to hybridize to, and the like. (a) Primers for Producing Gene

Repertoires V_H and V_L gene repertoires can be separately prepared prior to their utilization in the present invention. Repertoire preparation iε typically accomplished by primer extension, preferably by primer extension in a PCR format.

To produce a repertoire of V_H-coding DNA homologs by primer extension, the nucleotide sequence of a primer is selected to hybridize with a plurality of immunoglobulin heavy chain genes at a site substantially adjacent to the V_H-coding region so that a nucleotide sequence coding for a functional (capable of binding) polypeptide is obtained. To hybridize to a plurality of different V_H-coding nucleic acid strands, the primer must be a substantial complement of a nucleotide sequence conserved among the different strands. Such sites include nucleotide sequences in the constant region, any of the variable region framework regionε, preferably the third framework region, leader region, promoter region, J region and the like.

If the repertoires V_H-coding and V_L-coding DNA homologs are to be produced by polymerase chain reaction (PCR) amplification, two primers, i.e., a PCR primer pair, must be used for each coding strand of nucleic acid to be amplified. The first primer becomes part of the nonsenεe (minuε or complementary) εtrand and hybridizeε to a nucleotide sequence conserved among V_H (plus or coding) strands within the repertoire. To produce V_H coding DNA homologs, first primers are therefore chosen to hybridize to (i.e. be complementary to) conserved regions within the J region, CHI region, hinge region, CH2 region, or CH3 region of immunoglobulin genes and the like. To produce a V_L coding DNA homolog, first primers are chosen to hybridize with (i.e. be complementary to) a conserved region within the J region or constant region of immunoglobulin light chain genes and the like. Second primers become part of the coding (pluε) strand and hybridize to a nucleotide sequence conserved among minus εtrandε. To produce the V_H- coding DNA homologε, εecond primerε are therefore choεen to hybridize with a conεerved nucleotide εequence at the 5' end of the V_H-coding immunoglobulin gene εuch aε in that area coding for the leader or first framework region. It should be noted that in the amplification of both V_H- and V_L-coding DNA homologε the conεerved 5' nucleotide εequence of the εecond primer can be complementary to a sequence exogenously added uεing terminal deoxynucleotidyl tranεferaεe aε described by Loh et al., Sci. Vol 243:217-220 (1989). One or both of the firεt and εecond primerε can contain a nucleotide sequence defining an endonuclease recognition εite. The εite can be heterologouε to the immunoglobulin gene being amplified and typically appearε at or near the 5' end of the primer.

(b) Inside and Outεide Primerε In one embodiment, the preεent invention utilizes a set of polynucleotides that form inεide primerε compriεed of an upεtream inside primer and a downεtream inεide primer. Each of the inεide primerε haε a priming region located at the 3'-terminuε of the primer. The priming region iε typically the 3'-moεt (3 '-terminal) 15 to 30 nucleotide baεeε. The 3'- terminal priming portion of each inεide primer iε capable of acting as a primer to catalyze nucleic acid εyntheεiε, i.e., initiate a primer extenεion reaction off itε 3' terminuε. One or both of the inεide primerε iε further characterized by the preεence of a 5'-terminal (5'-moεt) non-priming portion, i.e., a region that doeε not participate in hybridization to repertoire template. - 38 -

In fusion PCR, each inside primer works in combination with an outside primer to amplify a target nucleic acid sequence. The choice of PCR primer pairs for use in fuεion PCR aε deεcribed herein is governed by the same considerationε aε previously discuεεed for chooεing PCR primer pairε uεeful in producing gene repertoireε. That iε, the primerε have a nucleotide εequence that iε complementary to a εequence conserved in the repertoire. Useful V_L and V_H inside priming εequenceε are εhown in Tableε 1 and 2, reεpectively, below.

Table 1 3' Priming Portionε of Variouε Inεide V, Primers

GTGATGACCCACTCTCC 3' GTGATGACCCAGTCTCCA 3' GTTGTGACTCAGGAATCT 3¹ GTGTTGACGCAGCCGCCC 3' GTGCTCACCCAGTCTCCA 3' CAGATGACCCAGTCTCCA 3' GTGATGACCCAGACTCCA 3' GTCATGACCCAGTCTCCA 3' TTGATGACCCAAACTCAA 3'

GTGATAACCCAGGATGAA 3'

Nucleotide sequences 1-10 are unique 5' primers for the amplification of kappa light chain variable regionε. Table 2 3' Priming Portionε of Variouε Inεide V_H Primerε

ACAAGATTTGGGCTC 3' TGGGGTTTTGAGCTC 3' GAGACAGTGACCGGGTTCCTTGGCCCCA 3 TGGAATGGGCACATGCAG 3' TTATCATTTACCCGGAGA 3' AACGGTAACAGTGGTGCCTTGGCCCCA 3 ' ACAATCCCTGGGCACAAT 3' CACCTTGGTGCTGCTGGC 3 ' ACAACCACAATCCCTGGGCACAATTTT 3 ^• ACAATCCCTGGGCACAAT 3 '

GAGTTCACTAGTTGGGCACGGTGGGCA 3 '

Unique 3' primer for human IgGl, 2, 3 and 4 Fd.

Unique 3' primer for human V_H amplification.

3 ' primer for amplifying human heavy chain variable regionε.

3 ' primer for amplifying the Fd region of mouεe IgM.

3 ' primer located in the CH3 region of human IgGl to amplify the entire heavy chain.

Unique 3' primer for amplification of mouse F_v.

Unique 3' primer for amplification of mouse IgGl Fd.

Unique 3' primer for amplification of V_H including part of the mouse gamma 1 first constant region.

Unique 3' primer for amplification of V_H including part of mouse gamma 1 first conεtant region and hinge region.

3' primer for amplifying mouεe Fd including part of the mouεe IgG firεt conεtant region and part of the hinge region. 11 3' primer for amplifying human IgGl Fd including part of the human IgG first constant region and part of the hinge region including the two cyεteines which create the disulfide bridge for producing Fab'2 (the primer corresponds to Kabat numbers 2 1QQ to 247) .

A preferred set of inεide primers used herein haε primerε with complementary 5'-terminal non-priming regionε, the complementary εtrandε of which are capable of hybridizing to each other to form a duplex with 3' overhangε. The duplex encodeε all or part of a double stranded cistronic bridge. That is, if the 3' overhangε of the duplex are filled in with complementary baεeε εo aε to define a double εtranded DNA extending from the 3'-terminuε of one of the inεide primerε to the 3'-terminuε of the other of the inεide primerε, that double εtranded DNA εegment for ε a εequence of nucleotideε that operatively linkε the upεtream and downεtream ciεtronε for polyciεtronic expreεεion. Thuε, while each of the inεide primerε in a εet containε only a portion of the εe uence information neceεεary to form the double stranded ciεtronic bridge, the two inεide primerε in combination encode both the pluε and minuε εtrandε of all or part of the bridge.

For example, one inεide upεtream primer can have a sequence that forms a portion of the pluε strand of the bridge, and the other inεide primer encodeε the εequence, through complementarity, of the downstream portion of the plus strand.

In a preferred embodiment, the plus εtrand of the ciεtronic bridge containε, in the tranεlational reading frame and from an upstream position to a downstream position, sequenceε coding for (i) at leaεt one εtop codon, preferably two, in the same reading frame aε the upεtream ciεtron, (ii) a riboεome binding εite, and (iii) a polypeptide leader, the tranεlation initiation codon of which iε in the same reading frame as the downεtream ciεtron. The εtop codon iε preεent to terminate tranεlation of the upεtream ciεtron. The riboεome binding εite iε preεent to initiate translation of the downstream ciεtron from the polyciεtronic mRNA.

The predicted amino acid reεidue sequences of two pelB gene product variants from Erwinia Carotova are εhown in Table 3. Lei, et al., supra.. Amino Acid reεidue εequences for other leaders from E. coli uεeful in this invention are alεo liεted in Table 3. Oliver, In Neidhart, F. C. (ed.), Eεcherichia coli and Salmonella Tvphimuriu , American Society for Microbiology, Waεhington, D.C., 1:56-69 (1987). Theεe regionε for the heavy chain are contained in the modified ImmunoZAP H expreεεion vector. Mullinax, et al., Proc. Natl. Acad. Sci.. USA. 87:8095-8099 (1990).

Table 3

Leader Sequenceε Seq.

Id. No. Type Amino Acid Residue Seσuence

(22) pelB¹ MetLysTyrLeuLeuProThrAlaAlaAlaGlyLeuLeu LeuLeuAlaAlaGlnProAlaGlnProAlaMetAla

(23) pelB² MetLysSerLeuIleThrProIleAlaAlaGlyLeuLeu

LeuAlaPheSerGlnTyrSerLeuAl

(24) MalE³ MetLyεlleLyεThrGlyAlaArglleLeuAlaLeuSer

AlaLeuThrThrMetMetPheSerAlaSerAlaLeuAla Lyεlle

(25) OmpF³ MetMetLyεArgAεnlleLeuAlaVallleValProAla

LeuLeuValAlaGlyThrAlaAεnAlaAlaGlu (26) PhoA³ MetLyεGlnSerThrlleAlaLeuAlaLeuLeuProLeu

LeuPheThrProValThrLyεAlaArgThr (27) Bla³ MetSerlleGlnHiεPheArgValAlaLeuIleProPhe

PheAlaAlaPheCyεLeuProValPheAlaHiεPro

(28) LamB³ MetMetlleThrLeuArgLyεLeuProLeuAlaValAla

ValAlaAlaGlyValMetSerAlaGlnAlaMetAlaVal Aεp

(29) Lpp³ MetLyεAlaThrLyεLeuValLeuGlyAlaVallleLeu

GlySerThrLeuLeuAlaGlyCyεSer

' pelB from Erwinia carotovora gene ² pelB from Erwinia carotovora EC 16 gene leader sequences from E. coli

To achieve high levels of gene expresεion in E. coli, it iε necessary to use not only strong promoters to generate large quantities of mRNA, but also ribosome binding εiteε to enεure that the mRNA iε efficiently tranεlated. In E. coli, the riboεome binding site includes an initiation codon (AUG) and a sequence 3-9 nucleotides long located 3 11 nucleotides upstream from the initiation codon [Shine et al.,

Nature. 254:34 (1975). The sequence, AGGAGGU, which is called the Shine-Dalgarno (SD) sequence, is complementary to the 3' end of E. coli 16S mRNA.

Binding of the ribosome to mRNA and the sequence at the 3' end of the mRNA can be affected by several factors:

(i) The degree of complementarity between the

SD sequence and 3' end of the 16S tRNA.

(ii) The spacing and possibly the DNA sequence lying between the SD sequence and the AUG

[Roberts et al., Proc. Natl. Acad. Sci. USA. 76:760

(1979a); Robertε et al., Proc. Natl. Acad. Sci. USA.

76:5596 (1979b); Guarente et al.. Science. 209:1428

(1980); and Guarente et al., Cell. 20:543 (1980).] Optimization iε achieved by meaεuring the level of expression of geneε in plaεmidε in which thiε εpacing iε εystematically altered. Comparison of different mRNAε εhowε that there are εtatistically preferred sequences from positionε -20 to +13 (where the A of the AUG iε poεition 0) [Gold et al., Annu. Rev.

Microbiol.. 35:365 (1981)]. Leader sequenceε have been εhown to influence tranεlation dramatically (Robertε et al., 1979 a, b εupra) .

(iii) The nucleotide εequence following the AUG, which affectε riboεome binding [Taniguchi et al., J. Mol. Biol.. 118:533 (1978)].

Uεeful ribosome binding sites are shown in Table 4 below.

Table 4

Ribosome Binding Sites*

AAUCUUGGAGGCUUUUUU ΠGGUUCGUUCU UAACUAAGGAUGAAAUGCAΠ UCUAAGACA

UCCUAGGAGGUUUGACCU IGCGAGCUUUU

AUGUACUAAGGAGGUUGUAIIGGAACAACGC * Sequences of initiation regions for protein εynthesis in four phage mRNA moleculeε are underlined.

AUG = initiation codon (double underlined)

1. = Phage φX174 gene-A protein

2. = Phage Qβ replicaεe

3. = Phage R17 gene-A protein A . - Phage lambda gene-cro protein

It iε preferred that the complementary (overlapping) region of the inside primerε and the priming portion of the inεide primerε have about the εame denaturation temperature, Td. The Td of a sequence can be estimated by the following formula: Td = 4(C+G) + 2(A+T), where C, G, A and T represent the respective number of cytosine, guanine, adenine and thymine baεeε in the εequence. A Td for the above-identified hybridizing region of about 45-55^βC, preferably about 50*C, iε preferred. Typically, overlapping regionε in the range of about 15 to 20 nucleotides works well in conjunction with priming regions in the range of 15-30 nucleotides. The set of outside primers forms the termini of the diciεtronic DNA molecule. The set of outεide primerε compriεeε an upεtream outεide primer and a ownεtream outεide primer. The outεide primerε each comprise a 3'-terminal priming portion, and preferably a portion that defines an endonuclease restriction site. When present, the reεtriction site-defining portion is typically located in a 5'-terminal non- priming portion of the outside primer. The restriction site defined by the upεtream outεide primer iε typically choεen to be one recognized by a restriction enzyme that doeε not recognize the reεtriction εite defined by the downεtream outεide primer, the objective being to be able to produce a diciεtronic DNA having cohesive termini that are non- complementary to each other and thus allow directional insertion into a vector.

Useful outside primer sequenceε are εhown in Tableε 5 and 6 below. Table 5 Outside V_H Primers

AGGTCCAGCTGCTCGAGTCTGG3 ^» AGGTCCAGCTGCTCGAGTCAGG3 ' AGGTCCAGCTTCTCGAGTCTGG3 ' AGGTCCAGCTTCTCGAGTCAGG3 ' AGGTCCAACTGCTCGAGTCTGG3 ' AGGTCCAACTGCTCGAGTCAGG3 ^• AGGTCCAACTTCTCGAGTCTGG3 ' GGTCCAACTTCTCGAGTCAGG3 ' AGGTGCAGCTGCTCGAGTCTGG3 ' AGGTGCAGCTGCTCGAGTCGGG3 ' AGGTGCAACTGCTCGAGTCTGG3 '

AGGTGCAACTGCTCGAGTCGGG3 '

Nucleotide εequenceε 21-28 are unique 5' primerε for the amplification of mouse V_H geneε. Nucleotide sequences 29-32 are unique 5' primers for amplification of nucleic acids coding for human variable regions.

Table 6 Outside V_L Primers

ACGTCTAGATTCCACCTTGGTCCC 3 ' TCCTTCTAGATTACTAACACTCTCCCCTGTTGAA 3 ' GCATTCTAGACTATTAACATTCTGTAGGGGC 3 ' GCAGCATTCTAGAGTTTCAGCTCCAGCTTGCC 3 ' CCGCCGTCTAGAACACTCATTCCTGTTGAAGCT 3 '

CCGCCGTCTAGAACATTCTGCAGGAGACAGACT 3 ' (52)⁷ 5' GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA 3'

(53)⁸ 5' GCCGCTCTAGAACACTCATTCCTGTTGAA 3'

(54)⁹ 5' TCCTTCTAGATTACTAACACTCTCCCCTGTTGAA 3'

(55)¹⁰ 5^» GCATTCTAGACTATTATGAACATTCTGTAGGGGC 3'

¹ 3' primer for amplifying human kappa chain variable regions.

² 3' primer in human kappa light chain constant region.

³ 3* primer in human lambda light chain conεtant region. ^Λ Unique 3' primer for amplification of kappa light chain variable regionε.

Unique 3' primer for mouεe kappa light chain amplification including the conεtant region.

Unique 3' primer for mouεe lambda light chain amplification including the conεtant region.

Unique 3' primer for amplification of kappa light chain.

⁸ Unique 3 ' primer for amplification of mouse kappa light chain. ⁹ Unique 3' primer for kappa V_L amplification.

10 Unique 3' primer for human, mouse and rabbit lambda V_L amplification.

3. Preparing a Dicistronic DNA Molecule

Library The strategy used for cloning the V_H and V_L genes contained within a repertoire will depend, as is well known in the art, on the type, complexity, and purity of the nucleic acids making up the repertoire. Other factors include whether or not the genes are contained in one or a plurality of repertoires and whether or not they are to be amplified and/or mutagenized. In one embodiment, a library of diciεtronic DNA molecules containing upstream and downεtream ciεtrons operatively linked by a cistronic bridge can be produced by the following steps: (a) Subjecting a repertoire of first polypeptide geneε (e.g., V_H-coding geneε), to PCR amplification uεing firεt outside and first inside primerε, i.e., a firεt PCR primer pair, to form a first primary PCR product. (b) Subjecting a repertoire of εecond polypeptide geneε (e.g., V_L-coding genes) to PCR amplification uεing εecond outεide and second inside primers, i.e., a second PCR primer pair, to form a second primary PCR product. (c) Hybridizing the first and εecond primary

PCR products to form internally (self) primed duplexes, i.e., duplexes having 3 '-hybridized and 5'- overhanging termini.

(d) Subjecting the internally-primed duplexes to primer extension reaction conditions to form double stranded duplexes having subεtantially blunt, preferably blunt, termini and a diciεtronic εtrand containing the upεtream and downεtream ciεtronε linked by a ciεtronic bridge encoded by the inεide primerε. By "εubεtantially blunt" iε meant having no more than about one or two overhanging nucleotideε. (Subεtan¬ tially blunt double εtranded DNA iε εometimeε produced by primer overextenεion by Tag polymeraεe, uεually by the addition of one or two terminal adenine reεidueε.) The V_H- and V_L-coding gene repertoireε are compriεed of polynucleotide coding εtrandε, εuch aε mRNA and/or the sense strand of genomic DNA. If the repertoire iε in the form of double εtranded genomic DNA, it iε uεually firεt denatured, typically by melting, into εingle εtrandε. A repertoire is εubjected to a PCR reaction by treating (contacting) the repertoire with a PCR primer pair, each member of the pair having a preεelected nucleotide εequence. The PCR primer pair iε capable of initiating primer extenεion reactionε by hybridizing to nucleotide εequences, preferably at least about 10 nucleotides in length and more preferably at leaεt about 20 nucleotideε in length, conεerved within the repertoire. The firεt primer of a PCR primer pair iε sometimes referred to herein as the "sense primer" because it hybridizes to the coding or sense stran of a nucleic acid. In addition, the second primer of a PCR primer pair is sometimeε referred to herein aε the "anti-sense primer" because it hybridizes to a non- coding or anti-senεe εtrand of a nucleic acid, i.e., a εtrand complementary to a coding εtrand.

The PCR reaction iε performed by mixing the PCR primer pair, preferably a predetermined amount thereof, with the nucleic acidε of the repertoire, preferably a predetermined amount thereof, in a PCR buffer to form a PCR reaction admixture. The admixture iε maintained under polynucleotide syntheεizing conditionε for a time period, which iε typically predetermined, sufficient for the formation of a PCR reaction product, thereby producing a plurality of different V_κ-coding and/or V_L-coding DNA homologs.

A plurality of first primer and/or a plurality of second primers can be uεed in each amplification, e.g., one εpecieε of firεt primer can be paired with a number of different εecond primerε to form εeveral different primer pairε. Alternatively, an individual pair of firεt and εecond primerε can be uεed. In any case, the amplification productε of amplificationε uεing the same or different combinations of first and second primers can be combined^' to increaεe the diverεity of the gene library.

In another εtrategy, the object iε to clone the V_H- and/or V_L-coding geneε from a repertoire by providing a polynucleotide complement of the repertoire, εuch aε the anti-εenεe εtrand of genomic dεDNA or the polynucleotide produced by εubjecting mRNA to a reverεe tranεcriptase reaction. Methods for producing εuch complementε are well known in the art. The PCR reaction is performed using any suitable method. Generally it occurs in a buffered aqueous solution, i.e., a PCR buffer, preferably at a pH of 7-9, most preferably about 8. Preferably, a molar excess (for genomic nucleic acid, usually about 10⁶:1 primer:tempiate) of the primer is admixed to the buffer containing the template εtrand. A large molar excess is preferred to improve the efficiency of the process.

In preferred embodiments the ratio of gene moleculeε and their reεpective primerε iε aε followε: about l x lθ³ V_H gene moleculeε to about 1 x 10⁸ outεide V_H primer moleculeε, about 1 x 10 V_H gene molecules, to about 1 x 10⁷ inεide V_H gene primer moleculeε, about 1 x 10³ V_L gene moleculeε to about 1 x 10⁸ outεide V_L gene primer molecules, about 1 x 10⁴ V_L gene moleculeε to about 1 x 10⁷ V_L gene primer moleculeε. In more preferred embodimentε, 10^A outεide V_H gene primer moleculeε and 10³ inεide V_H gene primer moleculeε are uεed for every V_H gene molecule preεent in the PCR admixture. Similarly, 10 outεide V_L gene primer moleculeε and 10³ V_L inside gene primer molecules are used for every V_L gene molecule present in the PCR admixture. Thus, there iε typically a 10 fold molar excess of outside primer to inside primer. In the fuεion PCR reaction, the gene repertoires are admixed with outside and inside primers, the outεide primerε being preεent in exceεε relative to the inεide primerε. The initial PCR thermocycleε produce intermediate products having complementary termini from each of the first and second gene repertoires. That is, the end of one strand from one primary PCR product is capable of hybridizing with the complementary end from the other primary PCR product. The strands having the overlap at their 3' ends can act as primerε for one another, i.e., from an internally primed duplex, and be extended by the polymeraεe to form the full length final product. The final product iε then amplified by the set of outεide primerε, which act aε a third PCR pair when the inεide primerε have been exhauεted, to form a secondary PCR product. Typically the molar ratio of outside primers to inside primers iε εuch that the inside primers are effectively exhausted within about 2 to about 12, preferably about 5, 6 or 7 thermocycles.

The PCR buffer alεo containε the deoxyribonucleotide triphoεphateε dATP, dCTP, dGTP, and dTTP and a polymeraεe, typically thermoεtable, all in adequate amountε for primer extenεion

(polynucleotide synthesiε) reaction. The resulting solution (PCR admixture) is heated to about 90*C - 100*C for about 1 to 10 minutes, preferably from 1 to 4 minutes. After thiε heating period the εolution iε allowed to cool to 54*C, which is preferable for primer hybridization. The synthesiε reaction may occur at from room temperature up to a temperature above which the polymeraεe (inducing agent) no longer functionε efficiently. Thuε, for example, if DNA polymeraεe iε uεed aε inducing agent, the temperature iε generally no greater than about 40*C An exemplary PCR buffer compriεeε the following: 50 mM KCI; 10 mM Triε-HCl; pH 8.3; 1.5 mM MgCl₂; 0.001% (wt/vol) gelatin, 200 μM dATP; 200 μM dTTP; 200 μM dCTP; 200 μM dGTP; and 2.5 unitε Thermus aquaticuε DNA polymeraεe I (U.S. Patent No. 4,889,818) per 100 microliterε of buffer.

The inducing agent may be any compound or εyεtem which will function to accomplish the synthesis of primer extenεion productε, including enzymes. Suitable enzymes for thiε purpoεe include, for example, E. coli DNA polymeraεe I, Klenow fragment of E. coli DNA polymerase I, T4 DNA polymerase, other available DNA polymeraεeε, reverεe transcriptase, and other -enzymes, including heat-εtable enzymes, which will facilitate combination of the nucleotides in the proper manner to form the primer extension productε which are complementary to each nucleic acid εtrand. Generally, the synthesis will be initiated at the 3' end of each primer and proceed in the 5' direction along the template strand, until synthesiε terminateε, producing molecules of different lengthε. There may be inducing agentε, however, which initiate syntheεiε at the 5' end and proceed in the above direction, uεing the same process as described above.

The inducing agent also may be a compound or syεtem which will function to accomplish the synthesiε of RNA primer extension productε, including enzymeε. In preferred embodiments, the inducing agent may be a DNA-dependent RNA polymeraεe such as T7 RNA polymerase, T3 RNA polymerase or SP6 RNA polymerase. These polymeraεeε produce a complementary RNA polynucleotide. The high turn over rate of the RNA polymerase amplifies the starting polynucleotide as haε been deεcribed by Chamberlin et al., The Enzymes. ed. P. Boyer, PP. 87-108^', Academic Presε, New York (1982) . Another advantage of T7 RNA polymeraεe iε that mutations can be introduced into the polynucleotide synthesiε by replacing a portion of cDNA with one or more mutagenic oligodeoxynucleotides (polynucleotides) and tranεcribing the partially- miεmatched template directly aε haε been previouεly described by Joyce et al., Nucleic Acid Research. 17:711-722 (1989). Amplification syεtemε baεed on transcription have been described by Gingeras et al., in PCR Protocols. A Guide to Methods and Applications, pp 245-252, Academic Press, Inc., San Diego, CA (1990) .

If the inducing agent iε a DNA-dependent RNA polymerase and therefore incorporates ribonucleotide triphoεphateε, εufficient amountε of ATP, CTP, GTP and UTP are admixed to the primer extenεion reaction admixture and the reεulting εolution iε treated aε deεcribed above. The newly εyntheεized εtrand and itε complementary nucleic acid εtrand form a double- stranded molecule which can be used in the succeeding stepε of the proceεε.

The firεt and/or second PCR reactions discussed above can advantageously be used to incorporate into the receptor a preselected epitope useful in immunologically detecting and/or isolating a receptor. Thiε iε accompliεhed by utilizing a firεt and/or second polynucleotide synthesis primer or expression vector to incorporate a predetermined amino acid residue εequence into the amino acid residue sequence of the receptor.

After producing operatively linked V_H- and V_L- coding DNA homologε for a plurality of different V_H- and V_L-coding genes within the repertoires, the diciεtronic DNA moleculeε are typically further amplified. While the diciεtronic DNA moleculeε can be amplified by classic techniques εuch aε incorporation into an autonomouεly replicating vector, it is preferred to first amplify the molecules by subjecting them to a polymeraεe chain reaction (PCR) prior to inεerting them into a vector. In fact, in preferred εtrategieε, the firεt and second PCR reactions are performed in the same admixture that iε εubject to a multiplicity of PCR thermocycleε where the outεide primerε are in molar exceεε. Preferably the number of PCR thermocycleε iε at leaεt n+5, wherein n iε the number of PCR thermocycleε neceεεary to decreaεe by a factor of 10, and preferably exhauεt, the number of inside primerε by consumption in the formation of inside primer-primed productε.

PCR iε typically carried out by thermocycling i.e., repeatedly increasing and decreasing the temperature of a PCR reaction admixture within a temperature range whose lower limit is about 10*C to about 40^eC and whose upper limit is about 90"C to about 100*C. The increasing and decreasing can be continuous, but iε preferably phaεic with time periods of relative temperature εtability at each of temperatureε favoring polynucleotide εyntheεiε, denaturation and hybridization.

In preferred embodimentε only one pair of firεt and second primerε iε uεed per amplification reaction. The amplification reaction productε obtained from a plurality of different amplificationε, each uεing a plurality of different primer pairε, are then combined.

However, the preεent invention alεo contemplateε DNA homolog production via co- amplification (using two pairs of primerε) , and - 54 - multiplex amplification (uεing up to about 8, 9 or 10 primer pairε) .

A diverεe library of diciεtronic DNA rooleculeε having upεtream and downεtream ciεtronε can alεo be produced by combining, in a PCR buffer, double εtranded V_H and V_L repertoireε, V_H and V_L outεide primerε, and an inεide primer having a 3'-terminal priming portion, a ciεtronic bridge coding portion, and a 5'-terminal inεide primer-template (primer- coding) portion. The 3'-terminal priming portion haε a nucleotide baεe εequence complementary to a portion of the primer extenεion product of one of the outεide primerε. The 5'-terminal primer-template portion haε a nucleotide baεe εequence homologouε (identical) to a portion of the primer extenεion product of the other of the outεide primerε. That iε, the linking primer haε terminal εequenceε homologouε to εequenceε in both repertoireε. The cistronic bridge coding portion codes for, either directly or through complementarily, at leaεt one εtop codon in the same reading frame aε the upεtream cistron, a ribosome binding site located downstream from the εtop codon, and a polypeptide leader haying a tranεlation initiation codon in the εame reading frame aε the downεtream cistron, the initiation codon being located downstream from the ribosome binding εite.

The diciεtronic DNA molecules containing operatively linked V_H- and V_L-coding DNA homologε produced by PCR amplification are typically in double- stranded form and may have contiguouε or adjacent to each of their termini a nucleotide sequence defining an endonuclease restriction site. Digestion of the dicistronic DNA molecules having restriction εiteε at or near their termini with one or more appropriate endonucleaεeε results in the production of DNA moleculeε having cohesive termini of predetermined specificity.

When individual PCR admixtures contain diverse gene repertoires the present invention produces many non-naturally occurring antibodieε, i.e., combinations of V_H and V_L in a heterodimer. To take advantage of the mammalian immune syεtem'ε capacity to select V_H and V_L combinationε, the preεent invention also contemplates using fusion PCR to operatively link, and thereby recover, naturally occurring V_H and V_L combinations.

In preferred embodiments, a fusion PCR method of the present invention is performed on repertoires comprising a plurality of substantially isolated cells containing genes coding for a heterodimeric receptor. For example, a plurality of PCR admixtures iε formed, each of which containε (i) a εample of substantially isolated B lymphocytes from a mammal producing antibody molecules against a preselected antigen, (ii) a PCR buffer, and (iv) either the previously described V_H and V_L PCR primer pairε or the set of outside V_H and \ PCR primerε in combination with the linking primer(ε) , alεo aε previously described. The plurality of PCR admixtures iε then subjected to a multiplicity of PCR thermocycles aε deεcribed herein.

By "substantially isolated" is meant a sample containing lesε than about 100 target cellε, εuch aε B lymphocyteε, T cellε, and the like. In preferred embodiments, the plurality of PCR ad ixtureε contain only about one cell. The cellε are typically obtained from an individual mammal whose serum contains antibody molecules againεt the preεelected antigen. The collected cellε are typically seeded, usually at densities in the range of 0.5 to 100 cells per unit volume, into a plurality of individual PCR vesεelε, εuch aε microtiter plate wellε and the like. Uεually, the plurality of PCR admixtureε iε in the range of 800 to 1200, and preferably is about 1000, separate admixtures. Typically, fewer cells are needed in each PCR admixture where the cellε are obtained from individualε expreεεing a high serum antibody titer against the preselected antigen. For example, where B lymphocytes are obtained from an individual having a frequency of circulating B cells producing the antibody molecules of preselected εpecificity of 1/3000, each of about 800 to 1200 individual PCR admixtureε need only contain about one B lymphocyte to reεult in iεolation of the desired antibody. Where the circulating B cell frequency is in the range of 1/500,000, a density of about 100 cellε per PCR admixture in each of about 800 to 1200 individual PCR admixtureε will be needed before the proceεε will reεult in iεolation of the deεired antibody. In preferred embodimentε, the PCR proceεε iε uεed not only to produce a library of diciεtronic DNA molecules, but also to ^'induce mutations within the library or to create diversity from a single parental clone and thereby provide a library having a greater heterogeneity. First, it εhould be noted that the PCR proceεε itself is inherently mutagenic due to a variety of factors well known in the art. Second, in addition to the mutation inducing variations described in the above referenced U.S. Patent No. 4,683,195, other mutation inducing PCR variations can be employed. For example, the PCR reaction admixture, can be formed with different amounts of one or more of the nucleotides to be incorporated into the extension product. Under such conditions, the PCR reaction proceeds to produce nucleotide substitutions within the extenεion product aε a result of the εcarcity of a particular base. Similarly, approximately equal molar amounts of the nucleotides can be incorporated into the initial PCR reaction admixture in an amount to efficiently perform X number of cycles, and then cycling the admixture through a number of cycles in excess of X, such as, for instance, 2X. Alternatively, mutations can be induced during the PCR reaction by incorporating into the reaction admixture nucleotide derivatives such as inosine, not normally found in the nucleic acidε of the repertoire being amplified. During subsequent in vivo amplification, the nucleotide derivative will be replaced with a subεtitute nucleotide thereby inducing a point mutation.

4. Expressing the Dicistronic DNA Molecules

The diciεtronic DNA molecules produced by the above-described method can be operatively linked to a vector for amplification and/or expresεion.

Aε used herein, the term "vector" refers to a nucleic acid molecule capable of transporting between different genetic environments another nucleic acid to which it has been operatively linked. One type of preferred vector iε an episome, i.e., a nucleic acid molecule capable of extra-chromoεomal replication. Preferred vectorε are thoεe capable of autonomouε replication and/or expreεεion of nucleic acidε to which they are linked. Vectorε capable of directing the expreεεion of geneε to which they are operatively linked are referred to herein aε "expreεεion vectorε".

The choice of vector to which a V_H- and V_L- coding DNA homolog iε operatively linked dependε directly, aε iε well known in the art, on the functional propertieε desired, e.g., replication or protein expression, and the host cell to be transformed, these being limitationε inherent in the art of conεtructing recombinant DNA moleculeε. In preferred embodimentε, the vector utilized includeε a prokaryotic replicon i.e., a DNA εequence having the ability to direct autonomouε replication and maintenance of the recombinant DNA molecule extra chromoεomally in a prokaryotic hoεt cell, εuch aε a bacterial hoεt cell, tranεformed therewith. Such repliconε are well known in the art. In addition, those embodiments that include a prokaryotic replicon also include a gene whoεe expreεεion conferε a selective advantage, such as drug reεiεtance, to a bacterial hoεt tranεformed therewith. Typical bacterial drug reεiεtance geneε are thoεe that confer reεiεtance to ampicillin or tetracycline.

Those vectors that include a prokaryotic replicon can also include a prokaryotic promoter capable of directing the expresεion (transcription and translation) of the V_H- and V_L-coding homologs in a bacterial hoεt cell, εuch aε E. coli tranεformed therewith. A promoter iε an expreεεion control element formed by a DNA εeguence that permitε binding of RNA polymeraεe and tranεcription to occur. Promoters contain two highly conserved regions, one located about 10 bp (-10 region on Priberow box) and the other about 35 bp (-35 region) upstream from the point at which transcription starts. These two regionε typically determine promoter strength. In addition, the number of nucleotides that separate the conserved sequences is important for efficient promoter function. For example, 16 to 19 nucleotides typically separate the -10 and -35 regionε, and changes in that spacing can change the efficiency of a promoter. Promoter sequences compatible with bacterial hoεtε are typically provided in plaεmid vectors containing convenient restriction εiteε for inεertion of a DNA εegment of the preεent invention. Typical of such vector plasmidε are pUC8, pUC9, pBR322, and pBR329 available from BioRad Laboratorie , (Richmond, CA) and pPL and pKK223 available from Pharmacia, (Piscataway, NJ) .

Promoters useful in this invention include Ptac φ 1.1A, φ 1.1B and φlO, which are recognized by T7 polymerase. See U.S. Patent No. 4,946,786. Useful regulatable promoters include the E. coli lac promoter described in U.S. Patent No. 4,946,786 and the promoters for the temperature sensitive genes in U.S. Patent No. 4,806,471. See also U.S. Patent No. 4,711,845.

A variety of methods have been developed to operatively link DNA to vectors via complementary cohesive termini. For instance, complementary cohesive termini can be engineered into the diciεtronic DNA moleculeε during the primer extension reaction by use of an appropriately designed polynucleotide synthesis primer, aε previouεly diεcuεεed. The diciεtronic DNA molecule, and vector if neceεεary, iε cleaved with a reεtriction endonucleaεe to produce termini complementary to thoεe of the vector. The complementary coheεive termini of the vector and the diciεtronic DNA molecule are then operatively linked (ligated) to produce a unitary double stranded DNA molecule. The present method produces a diverse population of double stranded DNA expression vectors wherein each vector expresses, under the control of a single promoter, one V_H-coding DNA homolog and one V_L- coding DNA homolog, the diversity of the population being the result of different V_H- and V_L-coding DNA - 60 - homolog combinations that occurs during the PCR reaction where both outside and both inside primers are present in effective amounts. Preferably the vectorε are linear double stranded DNA, such aε a Lambda Zap derived vector aε deεcribed herein.

In preferred embodimentε, the vector defineε a nucleotide εeguence coding for a riboεome binding site and a leader, the sequence being located downεtream from a promoter and upstream from a sequence coding for a polypeptide leader. In preferred embodiments, the vector contains a selectable marker such that the presence of a dicistronic DNA molecule of thiε invention inserted into the vector, can be εelected. Typical selectable markers are well known to those skilled in the art. Examples of εuch markerε are antibiotic reεiεtance geneε, genetically εelectable markerε, mutation suppresεors εuch aε amber εuppreεεorε and the like. The εelectable markerε are typically located upεtream of the promoter. The resulting construct is then introduced into an appropriate host to provide amplification and/or expression of the V_H- and V_L-coding DNA homologs. When coexpresεed within the same organism, a functionally active heterodimeric receptor, such as an F_v, is produced. Cellular hoεtε into which a V_h- and V_L-coding DNA homolog-containing conεtruct haε been introduced are referred to herein aε having been "tranεformed" or aε "tranεformantε".

The hoεt cell can be either prokaryotic or eukaryotic. Bacterial cellε are preferred prokaryotic host cellε for library screening, and typically are a strain of E. coli such as, for example, the E. coli strain DH5 available from Bethesda Reεearch Laboratorieε, Inc., Bethesda, MD. Preferred eukaryotic hoεt cellε include yeast and mammalian

SUBS cellε, preferably vertebrate cellε εuch aε thoεe from a mouεe, rat, monkey or human cell line.

Transformation of appropriate cell hostε with a recombinant DNA molecule of the preεent invention iε accomplished by methodε that typically depend on the type of vector used. With regard to transformation of prokaryotic host cellε, see, for example, Cohen et al., Proc. Natl. Acad. Sci.. USA, 69:2110 (1972); and Maniatis et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY (1982) . With regard to the transformation of vertebrate cells with retroviral vectorε containing rDNAs, εee for example, Sorge et al., Mol. Cell. Biol.. 4:1730-1737 (1984); Graham et al., Virol.. 52:456 (1973); and Wigler et al., Proc. Natl. Acad. Sci.. USA, 76:1373-1376 (1979).

5. Screening For Expreεεion of V_u and/or V,

Polypeptideε Successfully transformed cells, i.e., cells containing a dicistronic DNA molecule operatively linked to a vector, can be identified by any εuitable well known technique for detecting the binding of a receptor to a ligand or the preεence of a polynucleotide coding for the receptor, preferably itε active εite. Preferred screening assays are those where the binding of ligand by the receptor produces a detectable signal, either directly or indirectly. Such signals include, for example, the production of a complex, formation of a catalytic reaction product, the release or uptake of energy, and the like. For example, cells from a population subjected to transformation with a subject recombinant DNA (rDNA) can be cloned to produce monoclonal colonies. Cellε form thoεe colonieε can be harveεted, lyεed and their DNA content examined for the preεence of the rDNA

SUBSTITUTESHEET uεing a method εuch aε that described by Southern, J. Mol. Biol.. 98:503 (1975) or Berent et al., Biotech.. 3:208 (1985).

In addition to directly aεεaying for the preεence of a diciεtronic DNA molecule, εucceεεful transformation can be confirmed by well known immunological methods, especially when the V_H and/or V_L polypeptides produced contain a preselected epitope. For example, samples of cellε suspected of being transformed are asεayed for the preεence of the preeelected epitope uεing an antibody againεt the epitope. Surface Expreεεion

The preεent invention includeε a method for expreεεing a polypeptide on the outer surface of E. coli. The surface expresεion of a polypeptide provideε a particularly advantageouε technique for screening diverse libraries for a polypeptide, such aε a receptor, having a pre-εelected activity. For example, E. coli expreεεing a diverεe library of Fab fragmentε on their εurface can be "panned" for tranεformantε carrying antibody activity against a specific antigen.

E. coli εurface expreεεion iε accompliεhed by fuεing a portion of the lamB protein of E. coli to the polypeptide whoεe surface expression is desired. Any protein expressed on the cell surface of E. coli can provide the outer membrane spanning signal (surface expresεion εignal) for uεe in the preεent invention. More specifically, it has been diεcovered that amino acid reεidueε 57-181 of mature lamB can act aε a signal for εurface expreεεion. Such fuεion polypeptides are represented by the formula, shown in the direction of amino- to carboxy-ter inuε: (Fl) NH₂ - B - Z - COOH ,

wherein B repreεentε the amino acid reεidue sequence of a polypeptide, preferably heterologous to lamB, and Z representε a εequence of amino acid reεidueε correεponding, and preferably identical, to the εequence of lamB from about reεidue poεition 57 to about reεidue position 181 as shown in Figure 3. The heterologous polypeptide can itself be a fusion protein, and typically contains a periplasmic secretion εignal εequence (polypeptide leader) , εuch as the pelB εecretion εignal, and the like. Thuε, a preferred fuεion polypeptide is represented by the formula,

(F2) NH₂ - leader - J - Z - COOH

wherein the leader iε a εequence of amino acid reεidueε that εignal secretion to the periplasm, J is a εequence of amino acid reεidueε of from 6 to 350 residueε in length, and Z iε as described before in formula (Fl) . Preferably J is from about 50 to about 150 amino acid reεidueε. More preferably, J iε a V_H or V_L aε deεcribed herein.

Recombinant DNA Moleculeε

In view of the foregoing, the preεent invention contemplateε. In living organisms, the amino acid residue sequence of a protein or polypeptide is directly related via the genetic code to the deoxyribonucleic acid (DNA) sequence of the structural gene that codes for the protein. Thuε, a structural gene for a fusion protein of this invention can be defined in terms of the amino acid residue sequence, i.e., protein or polypeptide, for which it

SUBSTITUTESHEET codeε. In addition an important and well known feature of the genetic code is itε redundancy. That iε, for oεt of the amino acidε uεed to make proteinε, more than one coding nucleotide triplet (codon) can code for or deεignate a particular amino acid reεidue. Therefore, a number of different nucleotide sequences may code for a particular amino acid residue sequence. Such nucleotide sequenceε are conεidered functionally equivalent εince they can result in the production of the same amino acid residue εequence in all organiεms. Occasionally, a methylated variant of a purine or pyrimidine may be incorporated into a given nucleotide sequence. However, such methylations do not affect the coding relationεhip in any way. Recombinant DNA moleculeε containing a nucleic acid sequence coding for a fusion polypeptide according to formulaε (Fl) or (F2) are contemplated by thiε invention. Thuε, the preεent invention provideε for linking a nucleotide sequence coding for any polypeptide immunogen against which antibody production is desired to the outer membrane spanning εignal (lamB) polypeptide and/or the εecretion signal (pel B) polypeptide aε described herein. In preferred embodiments the polypeptide immunogen iε a pathogen related immunogen and the conjugate haε the capacity to induce the production of antibodieε that immunoreact with the pathogen when injected in an effective amount into an animal. Exemplary immunogenε of particular importance are derived from bacteria such aε B. pertuεεiε. S. typhoεa. S. paratyphoid A and B, C. diptheriae. C. tetani. C. botulinum. C. perfringenε, B. anthraciε. P, . pestis. P. multocida, V. cholerae, N. eningitideε. N. gonorrhea. H. influenzae. T. palladium, and the like; immunogenε derived from viruεeε εuch aε polio viruε, adenoviruε,

SUBSTI parainfluenza virus, measles, mumps, respiratory εyncytical viruε, influenza viruε, equine encephalomyeitiε viruε, hog cholera viruε, Newcastle viruε, fowl pox viruε, rabieε viruε, pεeudorabieε viruε, feline and canine diεtemper viruεeε and the like; rickettεiae immunogen εuch aε epidemic and endemic typhuε, and the εpotted fever groupε, and the like. Immunogenε are well known to the prior art in numerouε references εuch aε U.S. Patent No. 3,149,036, No. 3,983,228, and No. 4,069,313; in gsεential

Immunology. 3rd Ed. , by Roit, publiεhed by Blackwell Scientific Publicationε; in Fundamentalε of Clinical Immunology, by Alexander and Good, publiεhed by W.B. Saunderε; and in Immunology, by Bellanti, publiεhed by W.B. Saunderε.

Methods for determining the presence of antibodieε to an immunogen in a body εample from an immunized animal are well known in the art.

In preferred embodimentε the polypeptide immunogen iε a pathogen related immunogen that im unoreactε with, i.e., iε immunologically bound by, antibodieε induced by the pathogen. More preferably, the pathogen related immunogen iε capable of inducing an antibody response that provides protection against infection by the pathogen. Methods for determining the presence of both crosε-reactive and protective antibodieε are well known in the art.

Expresεion Vectorε The preεent invention also contemplates various expression vectors useful in performing, inter alia, the ethodε of the present invention. Each of the expresεion vectors is a novel derivative of Lambda Zap. 1. Lambda Zap II

SUBSTITUTESHEET Lambda Zap II is prepared by replacing the -Lambda S gene of the vector Lambda Zap with the Lambda S gene from the Lambda gtlO vector, aε deεcribed in Example 7. 2. Lambda ImmunoZAP H

Lambda ImmunoZAP H iε prepared by inserting the synthetic DNA εequences illustrated in Figure 6A into the above-described Lambda Zap II vector. The inserted nucleotide sequence advantageously provides a ribosome binding εite

(Shine-Dalgarno εequence) to permit proper initiation of mRNA tranεlation into protein, and a leader sequence to efficiently direct the translated protein to the periplasm. The preparation of Lambda ImmunoZAP H iε deεcribed in more detail in Example 8, and itε featureε illuεtrated in Figureε 6A and 7.

3. Modified Lambda ImmunoZAP H Modified Lambda ImmunoZAP H is prepared by inserting the modified synthetic DNA sequenceε illuεtrated in Figure 8A into the above-deεcribed Lambda ZAP II vector. The preparation of modified Lambda ImmunoZAP H and the detailε of the modificationε are deεcribed in Example 8B. Itε featureε are illuεtrated in Figure 8A and 8B. 4. Lambda ImmunoZAP L

Lambda ImmunoZAP L iε prepared aε deεcribed in Example 9 by inεerting into Lambda Zap II the synthetic DNA sequence illustrated in Figure 6B. Important features of Lambda ImmunoZAP L are illuεtrated in Figure 9.

Transformants and Vaccineε

A hoεt tranεformed with a recombinant DNA molecule of thiε invention iε alεo contemplated by thiε invention. The tranεformantε are uεeful, not

SU only in isolating a heterodimeric receptor according to the methods described herein, but also aε vaccine εtrainε where the fuεion polypeptide immunologically croεε-reactε with pathogen-neutralizing antibodieε. Methodε of formulating and uεing vaccine εtrainε are deεcribed in U.S. Patentε No. 4,764,370 and No. 4,337,314.

For heterodimeric moleculeε that assemble in the cell or in the periplasm, operatively linking the lamB outer membrane spanning εignal sequence to the carboxy-terminus of one of the polypeptide chainε of the heterodimer, e.g., the heavy chain of a Fab, reεultε in εurface expreεεion of the aεεembled heterodimer. One of the advantages of the preεent invention is that a vaccine containing a transformant of thiε invention can be eaεily prepared, lyophilized in the presence of appropriate inert, non-toxic carrier(s) (infra) in vials and stored at room temperature without loss of potency. No refrigeration or special storage equipment iε required.

The compoεition of vaccine preparationε muεt be known and conεiεtent. Thiε achieved by uεing εpecified amountε of quality-controlled chemical and biological ingredientε in their preparation. Methodε for the quality control of chemical componentε are well establiεhed in the art and will not be diεcuεεed here. Chemical purity in the vaccine preparationε iε defined aε freedom from toxic waste or cellular breakdown products and interfering or spurious immunogenic material. Thiε iε aεεured by working with pure cultureε (the vaccine strain free of other cellε or viruε) and harveεting the cells while the culture is in the logarithmic phase of growth (before the syntheεiε of autolytic enzymes) . The collection and

SUBSTITUTESHEET - 68 - waεhing of cells from the medium by physical methods (centrifugation) should leave low molecular weight impurities in the supernatant.

The vaccines of the present invention can be administered to any warm-or cold-blooded animals susceptible to infection with pathogenic microorganisms. Human and non-human animals may benefit as hosts.

Administration can be parenteral, but preferably oral or intranasal, depending upon the natural route of infection. In farm animalε, for example, the vaccine may be administered orally, by incorporation of the vaccine in feed or feed water. The dosage administered may be dependent upon the age, health and weight of the recipient, kind of concurrent treatment if any, and nature of the organism. Generally, a dosage of active ingredient will be from about lθ' to lθ'° cells per application per host. The preferred dose for intranasal administration would generally be about 10⁶ organisms, suεpended in 0.05 to 0.1 ml of an immunologically inert carrier. Peroral administration of a vaccine strain of, for example, Salmonella typhi developed according to the method deεcribed in this invention would probably require 10⁶ to 10⁸ organismε suspended in 1-2 mis of, for example, skim milk. The vaccines can be employed in dosage forms such as capsuleε, liquid solutions, suεpenεionε, or elixirs, for oral administration, or sterile liquid for formulations such as solutions or suspensions for parenteral, intranasal or topical (e.g. wounds or burns) use. An inert, immunologically acceptable carrier is preferably used, such as saline, phosphate buffered saline or skim milk.

Compositions and Kits Many of the reagents deεcribed herein (e.g., nucleic acidε εuch aε primerε, vectorε, and the like) have a number of formε, particularly variably protonated formε, and in equilibrium with each other. Aε the εkilled practitioner will underεtand, repreεentation herein of one form of a compound or reagent iε intended to include all formε thereof that are in equilibrium with each other.

The reagentε deεcribed herein can be packaged in kit form. Aε uεed herein, the term "package" referε to a εolid matrix or material cuεtomarily utilized in a εyεtem and capable of holding within fixed limitε one or more of the reagent componentε for uεe in a method of the preεent invention. Such materials include glass and plastic (e.g., polyethylene, polypropylene and polycarbonate) bottles, vials, paper, plastic and plastic-foil laminated envelopeε and the like. Thus, for example, a package can be a glasε vial used to contain the appropriate quantities of polynucleotide primer(ε) , vectorε, reεtriction enzyme(ε), DNA polymeraεe, DNA ligaεe, or a combination thereof. An aliquot of each component sufficient to perform at least one PCR thermocycle will be provided in each container. Kits useful for producing a template- complement or for amplification of a specific nucleic acid sequence uεing a primer extenεion reaction methodology alεo typically include, in separate containers within the kit, dNTPε where N is adenine, thymine, guanine and cytosine, and other like agentε for performing primer extenεion reactions.

The reagent species of any system deεcribed herein can be provided in solution, aε a liquid diεperεion or aε a εubstantially dry powder, e.g., the plaεmidε may be provided in lyophilized form.

SUBSTITUTESHEET In one embodiment, the kit iε an encloεure containing, in εeparate containerε, an outεide firεt polypeptide, preferably a V_H, gene primer, an outεide εecond polypeptide, preferably a V_L gene primer, and a linking primer defining a 3^»-terminal priming portion, a cistronic bridge coding portion, and a 5'-terminal primer template portion. The 3 '-terminal priming portion has a nucleotide base sequence complementary to a portion of the primer extension product of one of the outεide primers. The 5'-terminal primer-template portion encoding a nucleotide base sequence homologouε to a portion of the primer extenεion product of the other of the outεide primerε. The ciεtronic bridge coding portion iε aε previouεly deεcribed. Another contemplated kit compriεeε an encloεure containing, in separate containers, an outεide firεt polypeptide, preferably a V_H, gene primer, an outεide εecond polypeptide, preferably a V_L, gene primer, an inεide firεt polypeptide, preferably a V_H, gene primer having a 3'-terminal priming portion and a 5'-terminal non-priming portion. The 3'-terminal priming portion compriεeε a nucleotide εequence homologouε to a conεerved portion of a V_H gene. The kit alεo containε an inεide εecond polypeptide, preferably a V_L, gene primer having a 3'- terminal priming portion and a 5'-terminal hybridizing portion complementary to the 5•-terminal non-priming portion of the first polypeptide gene primer, the 3'- terminal priming portion of which comprises a nucleotide sequence homologous to a conserved portion of a second polypeptide gene. The first polypeptide inside and second polypeptide inside primerε, when hybridized, form a duplex that codeε for a double- εtranded DNA molecule containing the before deεcribed ciεtronic bridge for linking the upεtream and downεtream ciεtronε.

Examples

The following exampleε are intended to illuεtrate, but not limit, the preεent invention.

1- Oligonucleotide Primer Deεign for Producing Diciεtronic DNA A method baεed on PCR amplification that fuεeε heavy and light chain sequenceε haε been uεed to conεtruct a complete antigen binding domain of a Fab protein fragment compoεed of a heavy and a light chain. Schematic diagramε of an immunoglobulin molecule composed of heavy and light chains containing conεtant and variable regionε iε εhown in Figure 1.

Human heavy chain IgG and human kappa light chain are diagrammatically εketched in Figureε 2A and 2B, respectively. To accomplish this procedure, immunoglobulin heavy and light chain primers were designed to produce a region of homology between two polymeraεe chain reaction (PCR) products. The complementary regions have been shown to hybridize predominantly under conditions where one set of primers ("inside primer pair") is used in a limiting amount relative to the other set of primers ("outside primer pair"). After the 3' ends of the PCR products have hybridized, the DNA polymerase has been shown to extend the ends creating a fusion sequence carrying the unique sequences of both PCR fragments separated by one copy of region X cistronic bridge. A two-step cloning procedure is thus avoided. When the recombinant εequence is then inserted into an expression vector such as ImmunoZAP, a fusion product capable of simultaneouεly expreεεing the heavy and light chainε can be produced.

SUBSTITUTESHEET The strategy used for producing immunoglobulin heavy and light chain PCR diciεtronic DNA iε εhown schematically in Figure 4. Regions of the immunoglobulin heavy chain coding strand are designated V_H, C_H1, C_H2, and C_H3 corresponding to functional regions in the protein. The corresponding regions of the non-coding strand are designated by a prime (*) . Regionε V_L and C_L are εimilarly labelled for the kappa light chain. Thiε procedure can alεo be performed uεing lambda light chain specific regions. A region, X, unrelated to the natural immunoglobulin sequenceε, is introduced into the fusion product by attaching X to the 5' ends of both of the C_H1^» and V_L inεide primerε. Overlapping oligonucleotide primerε uεed in the fuεion-PCR reactionε to produce diciεtronic DNA were deεigned to encode the following: amino acidε of 225 to 230 of the IgG heavy chain hinge region which are common to all human IgG iεotypes; an Spe "i reεtriction εite; two εtop codonε; a ribosome binding site; a periplaεmic (pelB) leader sequence (Better, et al., Science. 240:1041-1043 (1988); Lei, et al., J. Bacteriol. , 169: 4379-4383 (1988)); a Sac I restriction εite which encodeε amino acidε 1 and 2 of the mature kappa light chain; and amino acidε 3 to 8 of the mature kappa light chain. The X region waε designed to contain a ribosome binding εite and a pelB leader to ensure expreεεion of the light chain. Nucleotide εequenceε for all human and mouεe PCR primerε, both inεide and outεide, are liεted in Table 7. Primers followed by a prime (') represent non- coding strand sequenceε. Table 7 Human and Mouse PCR Primers Seq.

Id. No. Human (56) V_H 5'-GTCCTGTCCGAGGTGCAGCTGCTCGAGTCTGG-^3'

(57) C_H1^» 5'-AATAACAATCCAGCGGCTGCCGTAGGCAATAGGT

ATTTCATTATGACTGTCTCCTTGCTATTAACTAG TACAAGATTTGGGCTC-3'

(58) V_L 5'-GCCTACGGCAGCCGCTGGATTGTTATTAATCGCT GCCCAACCTGCCATGGCTGAGCTCGTGATGACCC

CAGTCTCC-3'

(59) C_L' 5'-TCCTTCTAGATTACTAACACTCTCCCCTGTTGAA

GCTCTTTGTGACGGGCGAACTC-3'

Mouse

(60) V_H 5'-AGGTCCAGCTGCTCGAGTCTGG-3'

(61) C_H1' 5'-AATAACAATCCAGCGGCTGCCGTAGGCAATAGG

TATTTCATTATGACTGTCTCCTTGCTATTAACT AGTATACAATCCCTGGGCACAAT-3' (62) V_L 5'-GCCTACGGCAGCCGCTGGATTGTTATTAATCGC

TGCCCAACCTGCCATGGCTGAGCTCGTGATGAC CCAGTCTCC-3' (63) C_L' 5'-TCCTTCTAGATTACTAACACTCTCCCCTGTTGAA-3 ^•

The overlapping regions of the human C_H1' inεide and V_L inside primers are illustrated in Figure 5. The heavy chain downstream C_H1' inside primer sequence is written 3' to 5' and the light chain upstream V_L inside primer sequence is written 5' to 3'. The complementary PCR product strands, and not the primer εtrandε, croεε-prime to create the diciεtronic molecule. Bold nucleotideε represent regions where the C_H1' inεide primer hybridizeε to the 3 ' end of C_H1 on human IgG heavy chain mRNA or where

SUBSTITUTESHEE the V_L inεide primer hybridizes to the 5' end of V_L framework on human kappa light chain cDNA. The amino acid and nucleotides in italics represent changeε in sequence from the original pelB leader εequence. At amino acid 15 of the pelB leader εequence, the codon waε changed from CTC to ATC reεulting in a conεervative amino acid change from a leucine to an iεoleucine aε εhown in Figure 5 and Table 7. Hydrophobic amino acidε in the core region of periplaεmic leader εequenceε have been εhown to be eεsential for correct procesεing of the leader sequence and transport. of the mature protein to the periplasm. Oliver, in Neidhardt, R.C. (ed.), Eεcherichia coli and Salmonella Tvphimuriu .. Am. Soc. Microbiol., 1:56-69 (1987). The nucleotide changeε were made to allow for the artifactual inεertion of one or two dATPε at the 3' end of the overlapping dicistronic moleculeε. Thermuε aquaticuε (Taq) DNA polymeraεe may add a dATP to the 3' end of the PCR product becauεe of terminal tranεferaεe activity. Jiang, et al. Oncogene. 4: 923-928 (1989). The additional dATP would then cauεe a miεmatch between the overlapping PCR productε at the 3' terminuε and inhibit elongation by Taq DNA polymeraεe. Sommer, et al. Nucl. Acidε Reε.. 17: 6749 (1989) . Therefore, the change to two dTTPs in this position of the oligonucleotide primers would allow proper baεe pairing if up to two dATPε were added to the 3' terminuε of the heavy chain PCR product. The kappa light chain PCR product waε deεigned to terminate at a poεition where two dTTPs occur 5' of the end of the product and did not require alterations of the nucleotide εequence. Nucleotideε were changed in the kappa light chain primer encoding the pelB leader sequence without introducing amino acid changes in order to decrease the number of mismatcheε between the primer and the leader εequence of the kappa light chain mRNA aε εhown in Figure 5 and Table 7.

All primerε were εyntheεized on an Applied Bioεyεtemε DNA εyntheεizer, model 381A, following the manufacturer'ε inεtructionε.

2. Preparation of a V_u-and V_L-Coding Repertoire a. Preparation of a v_u-and V_t-Coding Repertoire from a Human cDNA

Combinatorial Library

Cloned DNA, previously isolated from a combinatorial library that encodes human Fab fragments which bind tetanus toxoid (TT) waε uεed aε a template for .preparing a V_H-and V_L-coding repertoire.

Mullinax, et al., supra. Briefly, the combinatorial library was prepared by the following approach. Volunteer donors, who had been previously immunized against tetanus but had not received booster* injections within the last year, received injectionε on 2 conεecutive days of 0.5 milliliters (ml) of alum- abεorbed TT (40 microgram/ml (ug)/ml) (Connaught Laboratorieε, Swiftwater, Pennεylvania) .

One hundred ml of blood waε drawn from the volunteerε 6 dayε poεt injection and anticoagulated with a mixture of 0.14 M citric acid, 0.2 M triεodium citrate, and 0.22 M dextroεe. The peripheral blood lymphocyteε (PBLε) were recovered and isolated from the whole blood by layering the whole blood on Histopaque-1077 (Sigma, St. Louiε, Missouri) and centrifuging at 400 x g for 30 minutes at 25 degrees Celsiuε (25'C). Iεolated PBLε were waεhed twice with phoεphate buffered εaline (PBS) (150 mM sodium chloride and 150 mM sodium phosphate, pH 7.2 at 25'C) .

SUBSTITUTESHEE Total RNA was then purified from the PBLs (10⁶ B cellε per ml blood per 100 ml of blood) for an enriched εource of B-cell mRNA coding for anti-TT IgG uεing an RNA iεolation kit according to manufacturer'ε inεtructionε (Stratagene, La Jolla, California) and alεo deεcribed by Chomczynεki et al., Anal. Biochem.. 162:156-159 (1987). Briefly, the iεolated PBLε were homogenized in 10 ml of a denaturing εolution containing 4.0 M guanine isothiocyanate, 0.25 M sodium citrate at pH 7.0, and 0.1 M beta-mercaptoethanol.

One ml of sodium acetate at a concentration of 2 M at pH 4.0 was admixed with the homogenized cellε. Ten ml of phenol that had been previouεly εaturated with H₂0 was also admixed to the denaturing solution containing the homogenized cellε. Two ml of a chloroform:iεoamyl alcohol (24:1 v/v) mixture waε added to this homogenate. The homogenate was mixed vigorouεly for ten εecondε and maintained on ice for 15 minuteε. The homogenate waε then tranεferred to a thick-walled 50 ml polypropylene centrifuged tube (Fiεher Scientific Company, Pittεburgh, Pennεylvania) . The εolution waε centrifuged at 10,000 x g for 20 minuteε at 4*C. The upper RNA-containing aqueouε layer waε tranεferred to a freεh 50 ml polypropylene centrifuge tube and mixed with an equal volume of isopropyl alcohol. This solution waε maintained at -20*C for at leaεt one hour to precipitate the RNA. The solution containing the precipitated RNA was centrifuged at 10,000 x g for twenty minuteε at 4*C. The pelleted total cellular RNA waε collected and diεεolved in 3 ml of the denaturing solution described above. Three ml of isopropyl alcohol was added to the re-suspended total cellular RNA and inverted to mix. This solution was maintained at -20*C for at least 1 hour to precipitate the RNA. The εolution containing the precipitated RNA

SUBSTI was centrifuged at 10,000 x g for ten minutes at 4'C. The pelleted RNA was washed once with a solution containing 75% ethanol. The pelleted RNA was dried under vacuum for 15 minuteε and then re-suspended in diethyl pyrocarbonate (DEPC) treated (DEPC-H₂0) H₂0. Messenger RNA (mRNA) was prepared from the total cellular RNA using methodε deεcribed in Molecular Cloning A Laboratory Manual. Maniatis et al., edε., Cold Spring Harbor, NY, (1982). Briefly, 500 mg of the total RNA iεolated from a PBLε prepared aε described above was re-εuεpended in one ml of IX εample buffer (1 mM Tris-HCl, (Tris [hydroxylmethyl- aminomethane]) pH 7.5; 0.1 mM EDTA (disodium ethylene diamine tetra-acetic acid), 0.5 M NaCl) and maintained at 65*C for five minutes and then on ice for five more minutes. The mixture was then applied to an oligo-dT (Stratagene) column that was previously prepared by washing the oligo-dT with a solution containing 10 mM Tris-HCl, pH 7.5; 1 mM EDTA, 0.5 M NaCl. The eluate was collected in a sterile polypropylene tube and reapplied to the same column after heating the eluate for five minuteε at 65*C. The oligo dT column waε then washed with 0.4 ml of high εalt loading buffer conεiεting of 10 mM Triε-HCl at pH 7.5, 500 mM sodium chloride, and 1 mM EDTA. The oligo dT column was then washed with 2 ml of 1 X low salt buffer consisting of 10 mM Triε-HCl at pH 7.5, 100 mM sodium chloride, and 1 mM EDTA. The mesεenger RNA waε eluted from the oligo dT column with 0.6 ml of buffer consiεting of 10 mM Triε-HCl at pH 7.5, and 1 mM EDTA. The messenger RNA was purified by extracting this solution with phenol/chloroform followed by a single extraction with 100% chloroform. The mesεenger RNA waε concentrated by ethanol precipitation and re-εuεpended in DEPC H₂0.

SUBSTITUTESHEET The messenger RNA isolated by the above process contains a plurality of different V_H and V_L coding polynucleotideε, i.e., greater than about 10⁴ different V_H- and V_L-coding geneε. 5 Iεolated RNA waε converted to cDNA by a primer extenεion reaction with a firεt-strand syntheεis kit according to manufacturer'ε inεtructionε (Stratagene) by uεing an oligo (dT) primer for the light chain and a specific primer, C_H1', for the heavy chain.

10 Mullinax et al., εupra. In a typical 50 μl transcription reaction, 5 ug of PBL mRNA in water was first hybridized (annealed) with 200 ng (50.0 pmol) of an oligo (dT) primer for the light chain. In a separate reaction, 5 ug of PBL mRNA in water was first

^'15 hybridized (annealed' with 200 ng (20 pmol) of the heavy chain primer, C_H1', at 65*C for five minutes. Subsequently, the .mixture waε adjuεted to 0.5 mM each of dATP, dCTP, dGTP and dTTP, 50 mM Triε-HCl at pH S.3, 3 mM MgCl_2f 75 mM KCI, 10 mM DTT, 20 unitε of

20 RNaεe block II (Stratagene) , and 20 unitε of Moloney- Murine Leukemia viruε reverεe tranεcriptaεe (Stratagene Cloning Syεtemε) , waε added and the εolution waε maintained for 1 hour at 37*C. PCR amplification of the heavy and light chain εequenceε

25 waε done εeparately uεing 0.25-0.5 ug of firεt-strand synthesis product as template with sets of primer pairs uεing Taq DNA polymeraεe aε deεcribed in Example 3.

The PCR amplified light chain DNA fragmentε

30 were then digeεted with Sac I and Xba I and ligated into a modified Lambda Zap II vector as prepared in Example 9 to form a light chain ImmunoZap Library (ImmunoZAP L; Stratacyte, La Jolla, California) . The PCR amplified heavy chain DNA was digested with Spe I

35 and Xho I and lioated into a different modified Lambda

SUBSTIT T Zap II vector as prepared in Example 7 to form a heavy chain ImmunoZap Library (ImmunoZAP H; Stratacyte) . The resulting libraries were amplified and the resulting DNA waε packaged into bacteriophage with in vitro packaging extract, Gigapack II gold (Stratagene) and uεed to infect E. coli strain XLl-Blue (Stratagene) .

To construct a library for coexpresεion, the right arm of the heavy chain library phage DNA waε digeεted with Hind III, preserving the left arm of

ImmunoZAP H with heavy chain inserts. The left arm of the light chain library phage DNA was digested with Mlu I resulting in a right arm of ImmunoZAP with kappa light chain insertε. Both productε were then digeεted with Eco Rl and ligated to create a combinatorial library that encoded human Fab fragmentε including those εpecific for TT. Mullinax, et al., εupra.

Reactive plaqueε were firεt identified by binding to tetanuε toxoid aε deεcribed in Example 11. Bacteriophage from purified reactive plaques were then converted to the plasmid format by in vivo exciεion with R408 helper phage (Stratagene) following methodε deεcribed in Example 11 and familiar to one εkilled in the art. Short, et al., Nucl. Acidε. Reε.. 16:7583- 7600 (1988) . The reεulting purified plaεmid DNA encoding heavy and light chain waε then uεed in PCR reactionε aε deεcribed below in Example 3. b. Preparation of a V^- and V_L-Coding

Repertoire from mRNA from Tiεsues and Cellε

1) Human

Purified populationε of PBLε, other lymphocytes, and hybridomaε which express immunoglobulins including IgG, IgM, IgE, IgD, and IgA are uεed aε εourceε for isolating mRNA encoding

SUBSTITUTESHEET immunoglobulinε. PBL'ε and other immunoglobulin expreεsing lymphocytes are iεolated from either spleen, lymphoid tisεue or plaεma. Following purification of the cells, total RNA is then purified from these cells using a RNA isolation kit

(Stratagene) as described in Example 2a. The purified RNA is then converted to cDNA with a first-εtrand εyntheεis kit as deεcribed in Example 2a. The resultant cDNA iε then uεed aε a template in PCR amplication reactionε aε described below in Example 3 for the production of dicistronic moleculeε expreεsing heavy and light chains. 2) Mouse

Populations of cellε deεcribed above can be iεolated from other mammalian sources such as mouse or rabbit. Both mRNA and rearranged DNA can be iεolated aε deεcribed above and uεed aε templateε in PCR amplification reactionε. cDNA εyntheεized from mRNA iεolated from a mouεe anti-human fibronectin hybridoma (ATCC, CRL-1606) waε uεed aε a preferred template for the production of dicistronic moleculeε expressing heavy and light chain. c. Preparation of a V_H-Coding Repertoire From Rearranged DNA Rearranged DNA isolated from PBLs, other lymphocyteε, and hybridomaε which expreεs immunoglobulinε can be uεed to prepare a V_H-coding repertoire. The amplification procedure for preparing a V_κ-coding repertoire uεing rearranged DNA iε performed aε described in Example 3.

3. Preparation of DNA Homologs a. V_H-Coding Double Stranded DNA Homologs

Cloned DNA, prepared in Example 2 from a combinatorial library that encodes human Fab fragments

SUBST which bind tetanuε toxoid (TT) , waε uεed aε a template for preparing a V_H-coding double εtranded DNA homolog. Human heavy chain, containing both the V_H and C_H1 coding region and deεignated aε Fd, waε amplified in a PCR reaction. The amplification waε performed in a 100 ul reaction containing 5 nanogramε (ng) of the cloned DNA in PCR buffer conεiεting of the following: 10 mM .Triε-HCl, pH 8.3; 50 mM KCI, 1.5 mM MgCl₂; 0.001% (w/v) gelatin; 200 mM of each dNTP; 200 nanomolar (nM) of each primer; and 2.5 unitε of Taq DNA polymeraεe. The human V_H outside primer and C_H1' inside primer were used aε a PCR primer pair for amplification of the heavy chain (Table 7 and Figure 4) . The reaction mixture waε overlaid with mineral oil and εubjected to 40 cycleε of amplification. Each amplification cycle (thermocycle) involved denaturation at 94^*C for 1.5 minuteε, annealing at 54 ' C for 2.5 minuteε and polynucleotide εyntheεis by primer extension (elongation) at 72*C for 3.0 minutes followed by a return to the denaturation temperature. The resultant amplified V_H-coding DNA homolog containing sampleε were then gel purified, extracted twice with phenol/chloroform, once with chloroform followed by ethanol precipitation and were εtored at -70*C in 10 mM Triε-HCl, pH 7.5, and 1 mM EDTA.

To verify the amplification of the heavy chain, the PCR purified productε were electrophoreεed in an agaroεe gel. The expected size of the heavy chain was approximately 730 base pairs as shown in Figure 10. The V_H-coding double stranded DNA homologε were then uεed in subsequent PCR amplification reactionε with V_L-coding counterparts prepared below for the production of dicistronic DNA molecules having V_H and V_L cistronic portions as illustrated in Example 4.

SUBSTITUTESHEET b. V_L-Coding Double Stranded DNA Homologs

Cloned DNA, prepared in Example 2 from a combinatorial library that encodes human Fab fragments which bind tetanus toxoid (TT) , waε uεed as a template for preparing a V_L-coding double εtranded DNA homolog. Human light chain, containing the entire coding region of kappa light chain (V_L and C_L) , waε amplified uεing the same PCR conditions deεcribed for human heavy chain with the exception that a human V_L inεide primer and C_L* outεide primer were uεed aε the PCR primer pair (Table 7 and Figure 4) . The reεultant V_L-coding double εtranded DNA homolog waε gel purified and stored as described above.

To verify the amplification of the light chain, the PCR purified products were electrophoreεed in an agaroεe gel. The expected εize of the light chain waε approximately 690 baεe pairε aε shown in Figure 10. The V_L-coding double stranded DNA homologs were then used in subsequent PCR amplification reactions with V_H-coding counterparts prepared above for the production of dicistronic DNA molecules aε illuεtrated in Example 4.

4. Preparation of Internally-Primed Duplexeε of V_h- and V_L-Coding DNA Homologε a. Hybridization of V_H- with V_L-Coding DNA Homologε

The V_κ- and V-coding double εtranded DNA homologε prepare in Example 3a and 3b, reεpectively, were admixed together and denatured at 95*C for 5 minuteε to εeparate the strands of each homolog. The denatured V_H-and V_L-coding DNA strands in the admixture were then annealed at 54*C for 5 minutes to form a V_H- and V_L-coding duplex DNA molecule hybridized at the 3' ends at region X of each original

SUBSTITUTE homolog. One εtrand of the X region (ciεtronic) bridge encodes at leaεt one εtop codon in the εame reading frame aε the upεtream ciεtron, a riboεome binding εite downεtream from the εtop codon, and a polypeptide leader (pelB) having a tranεlation initiation codon in the εame reading frame aε the downεtream ciεtron located downεtream from the riboεome binding εite. b. Primer Extension to Produce Diciεtronic DNA Molecules

The hybridized recombinant V_H- and V_L- coding DNA molecule (internally primed duplex) was subjected to primer extension and then amplified with only the V_H and C_L' primerε following the PCR reaction procedure described in Example 3a. Thiε εecond PCR reaction iε εchematically repreεented in Figure 4. The PCR reaction productε were gel electrophoreεed to verify the preεence of the reεultant V_H-and V_L-coding diciεtronic DNA moleculeε. The expected εize of the diciεtronic molecule waε about 1390 base pairs and iε εhown in Figure 10. The reεultant V_H- and V_L-coding dicistronic DNA moleculeε were then ligated into the modified ImmunoZAP H vector (Figure 8) for the construction of expresεion vectorε aε deεcribed in Example 10.

5. Preparation of Mouεe Hybrido a V_H- and V_L- Coding Double Stranded DNA Homologε and Production of Dicistronic DNA Moleculeε in a Single Amplification Reaction

Mouse hybridoma heavy and light chain cDNA prepared in Example 2b was amplified in a single PCR reaction using the reaction conditions given above with an exceεε of the outεide primers (200 nM concentration of both the mouεe V_H primer and C_L'

SUBSTITUTESHEET primer) and a limiting amount of the inεide primerε (20 nM concentration of both the mouse C_H1' and V primer) (Table 7). The resultant mouse heavy and light chain dicistronic molecules were then inserted into a modified ImmunoZAP H for construction of an expression vector as described in Example 10.

6. Preparation of Internally-Primed Duplexes

Using a Single Internal Primer that Overlapε Both the V_H and V_L Repertoires

Another approach to producing a library of diciεtronic DNA moleculeε iε to uεe a single internal primer inεtead of uεing two εeparately internal primerε. The proceεε of creating a diciεtronic molecule compriεing an upεtream V_H ciεtron and a downεtream V_L ciεtron iε to combine in a PCR buffer the following: a repertoire of V_H geneε conεiεting of at least 10⁵ different genes; a repertoire of V_L genes consisting of at least 10⁴ different genes; an outside V_H primer; an outside V_L primer; and a polynucleotide strand having a 3'-terminal priming portion, a ciεtronic bridge coding portion, and a 5'-terminal primer-template portion. The PCR reaction is performed as described in Example 2a. The 3'-terminal priming portion of a polynucleotide strand (linker) has a nucleotide base sequence homologous to a portion of the primer extenεion product of one of the outside primers. The 5'-terminal priming portion encodes a nucleotide base sequence homologous to a portion of the primer extension product of the other outside primer. The cistronic bridge coding portion encodes at least one εtop codon in the same reading frame aε the upεtream cistron, a riboεome binding site downstream from the εtop codon and a polypeptide leader (pelB) having a

SUBST translation initiation codon in the same reading frame as the downstream ciεtron where the initiation codon iε located downεtream from the riboεome binding εite. Polynucleotide εtrand (linker) primerε uεeful in thiε invention are liεted in Table 8.

Table 8 Polynucleotide Strand (Linker) Primerε

Seq.

Id. No.

(64)' 1' 5' GGAGAGTGGGTCATCACGAGCTCAGCCATGGCAGGTTGG

GCAGCGATTAATAACAATCCAGCGGCTGCCGTAGGCAAT AGGTATTTCATTATGACTGTCTCCTTGCTATTAACTAGT ACAAGATTTGGGCTC 3'

(65)² 2' 5' GAGCCCAAATCTTGTACTAGTTAATAGCAAGGAGACAGT

CATAATGAAATACCTATTGCCTACGGCAGCCGCTGGATT GTTATTAATCGCTGCCCAACCTGCCATGGCTGAGCTCGT GATGACCCACTCTCC 3'

' Primeε mRNA (εenεe εtrand) of heavy chain C_H1 region; antiεenεe εtrand of light chain V_L with diciεtronic bridge in between heavy and light chainε will be in the same relative orientation as given in the example.

² Primes antisense strand of heavy chain C_H1 regionε; and εenεe εtrand of light chain V_L region with dicistronic in between heavy and light chains will be in the same relative orientation as given in the example.

The resultant single step internally primed diciεtronic DNA molecule can then be ligated into modified ImmunoZAP H for conεtruction of an expreεεion vector aε deεcribed in Example 10.

SUBSTITUTE SHEET 7. Preparation of Lambda Zap II Expresεion Vector

The vector Lambda Zap™ II (Stratagene) iε a derivative of the original Lambda Zap (ATCC # 40,298) that maintains all of the characteristicε of the original Lambda Zap including 6 unique cloning εiteε, fuεion protein expreεεion, and the ability to rapidly exciεe the inεert in the form of a phagemid (Blueεcript SK-) , but lackε the SAM 100 mutation, allowing growth on many Non-Sup F strains, including XLl-Blue. The Lambda Zap II was constructed as deεcribed in Short et al., Nucleic Acids Reε.. 16:7583-7600, 1988, by replacing the Lambda S gene contained in a 4254 baεe pair (bp) DNA fragment produced by digeεting Lambda Zap with the restriction enzyme Ncol. This 4254 bp DNA fragment was replaced with the 4254 bp DNA fragment containing the Lambda S gene iεolated from Lambda gtlO (ATCC # 40,179) after digeεting the vector with the reεtriction enzyme Ncol. The 4254 bp DNA fragment iεolated from lambda gtlO waε ligated into the original Lambda Zap vector uεing T4 DNA ligaεe and standard protocols for εuch procedureε deεcribed in Current Protocolε in Molecular Biology. Auεubel et al., edε., John Wiley and Sonε, NY, 1987.

8. Preparation of V_ti-Expresεion Vectors.

ImmunoZAP H and Modified ImmunoZAP H. Construction a. ImmunoZAP H

The main criterion uεed in chooεing a vector εyεtem waε the necessity of generating the largest number of Fab fragments which could be screened directly. Bacteriophage lambda was selected aε the expression vector for three reasons. First, in vitro packaging of phage DNA is the most efficient method of reintroducing DNA into host cells. Second,

SUBSTI T it iε poεεible to detect protein expreεsion at the level of single phage plaques. Finally, the εcreening of phage librarieε typically involve leεε difficulty with nonεpecific binding. The alternative, plaεmid cloning vectorε, are only advantageouε in the analyεiε of cloneε after they have been identified. Thiε advantage iε not loεt in the preεent εyεtem becauεe of the uεe of lambda Zap, thereby permitting a plaεmid containing the heavy chain, light chain, or Fab expreεεing inεertε to be exciεed.

To expreεε the plurality of V_H-coding DNA homologε in an E. coli hoεt cell, a vector waε conεtructed that placed the V_H-coding DNA homologε in the proper reading frame, provided a riboεome binding εite aε deεcribed by Shine et al., Nature. 254:34, 1975, provided a leader εequence directing the expreεεed protein to the periplaεmic εpace, provided a polynucleotide εequence that coded for a known epitope (epitope tag) and also provided a polynucleotide that coded for a εpacer protein between the V_H-coding DNA homolog and the polynucleotide coding for the epitope tag. A εynthetic DNA εequence containing all of the above polynucleotideε and featureε waε conεtructed by deεigning εingle εtranded polynucleotide εegmentε of 20-40 baεeε that would hybridize to each other and form the double stranded synthetic DNA sequence εhown in Figure 6A. The individual εingle-εtranded polynucleotideε (N_T-N^) are εhown in Table 9 below.

Table 9

GGCCGCAAATTCTATTTCAAGGAGACAGTCAT 3' AATGAAATACCTATTGCCTACGGCAGCCGCTGGATT 3'

GTTATTACTCGCTGCCCAACCAGCCATGGCCC 3'

SUBSTITUTESHEET AGGTGAAACTGCTCGAGAATTCTAGACTAGGTTAATAG 3 * TCGACTATTAACTAGTCTAGAATTCTCGAG 3' CAGTTTCACCTGGGCCATGGCTGGTTGGG 3' CAGCGAGTAATAACAATCCAGCGGCTGCCGTAGGCAATAG 3 ' GTATTTCATTATGACTGTCTCCTTGAAATAGAATTTGC 3' AGGTGAAACTGCTCGAGATTTCTAGACTAGTTACCCGTAC 3 ' GACGTTCCGGACTACGGTTCTTAATAGAATTCG 3' TCGACGAATTCTATTAAGAACCGTAGTC 3'

CGGAACGTCGTACGGGTAACTAGTCTAGAAATCTCGAG 3'

Polynucleotideε 2, 3, 9-4', 11, 10-5', 6, 7 and 8 were kinaεed by adding 1 μl of each polynucleotide (0.1 ug/μl) and 20 unitε of T₄ polynucleotide kinaεe to a εolution containing 70 mM Triε-HCl at pH 7.6, 10 mM MgCl₂, 5 mM DTT, 10 mM beta mercaptoethanol, 500 ug/ml of BSA. The solution was maintained at 37*C for 30 minutes and the reaction stopped by maintaining the εolution at 65*C for 10 minuteε. The two end polynucleotideε, 20 ng, of polynucleotideε Nl and polynucleotideε N12, were added to the above kinaεing reaction εolution together with 1/10 volume of a εolution containing 20 mM Triε-HCl, pH 7.4, 2 mM MgCl₂ and 50 mM NaCl. Thiε εolution waε heated to 70^*C for 5 minuteε and allowed to cool to room temperature, approximately 25*C, over 1.5 hourε in a 500 ml beaker of water. During thiε time period all 10 polynucleotideε annealed to form the double stranded synthetic DNA insert shown in Figure 6A. The individual polynucleotides were covalently linked to each other to εtabilize the εynthetic DNA inεert by adding 40 μl of the above reaction to a solution containing 50 mM Tris-HCl, pH 7.5, 7 mM MgCl₂, 1 mM DTT, 1 mM ATP and 10 units of T4 DNA ligase. This solution was maintained at 37*C for 30 minutes and then the T4 DNA ligase was inactivated by maintaining

SUBSTI the εolution at 65^*C for 10 minuteε. The end polynucleotideε were kinaεed by mixing 52 μl of the above reaction, 4 μl of a εolution containing 10 mM ATP and 5 unitε of T4 polynucleotide kinaεe. Thiε εolution waε maintained at 37 'C for 30 minuteε and then the T4 polynucleotide kinaεe waε inactivated by maintaining the εolution at 65^*C for 10 minuteε.

The completed εynthetic DNA inεert waε ligated directly into a lambda Zap II vector prepared in Example 7 that had been previouεly digeεted with the restriction enzymeε Not I and Xho I. The ligation mixture waε packaged according to the manufacture'ε instructions using Gigapack II Gold packing extract (Stratagene) . The packaged ligation mixture was plated on XLl-blue cells (Stratagene) . Individual Lambda Zap II plaques were cored and the insertε exciεed according to the in. vivo excision protocol provided by the manufacturer (Stratagene) . Thiε in vivo exciεion protocol convertε the cloned inεert from the Lambda Zap II vector into a plaεmid vector to allow eaεy manipulation and εequencing. The accuracy of the above cloning steps was confirmed by εequencing the inεert uεing the Sanger dideoxy method deεcribed in by Sanger et al., Proc. Natl. Acad. Sci. USA. 74:5463-5467, (1977) and uεing the manufacture'ε inεtructionε in the AMV Reverεe Tranεcriptaεe ³⁵S-ATP sequencing kit (Stratagene) . The sequence of the resulting V_H expreεsion vector is shown in Figure 6A and Figure 7. b. Modified ImmunoZAP H

To create a fusion-PCR library from hybridoma RNA for expreεεing the plurality of V_H- coding DNA homologε in an E. coli hoεt cell, a vector baεed on the ImmunoZAP H vector deεcribed above waε conεtructed. The procedure for conεtructing the

SUBSTITUTESHEET vector waε performed as described above with the following modifications: elimination of the Sac I εite between the T₃ polymerase and Not I siteε and changing the nucleotide base residue sequence from AAA to CAG which resulted in an amino acid residue change from lysine to glutamine aε shown in Figure 8A and 8B. The individual single-stranded polynucleotideε (N-i, ₄, N and N₇) , which were modified from their counterparts liεted in Table 9, are liεted in Table 10 below.

Table 10

AGCTGCGGCCGCAAATTCTATTTCAAGGAGACAGTCAT 3' AATGAAATACCTATTGCCTACGGCAGCCGCTGGATT 3' GTTATTACTCGCTGCCCAACCAGCCATGGCCC 3' AGGTGCAGCTGCTCGAGAATTCTAGACTAGGTTAATAG 3 ' TCGACTATTAACTAGTCTAGAATTCTCGAG 3' CAGCTGCACCTGGGCCATGGCTGGTTGGG 3' CAGCGAGTAATAACAATCCAGCGGCTGCCGTAGGCAATAG 3' GTATTTCATTATGACTGTCTCCTTGAAATAGAATTTGCGGCCGC 3' AGGTGAAACTGCTCGAGATTTCTAGACTAGTTACCCGTAC 3' GACGTTCCGGACTACGGTTCTTAATAGAATTCG 3' TCGACGAATTCTATTAAGAACCGTAGTC 3'

CGGAACGTCGTACGGGTAACTAGTCTAGAAATCTCGAG 3'

The modified ImmunoZAP H vector waε created to eliminate an unneceεsary Sac I site in the ImmunoZAP H vector, (Example 9) , when the heavy and light chain vectors were combined. The modifications also improved the efficiency of secretion of positively changed amino acidε in the amino terminuε of the expreεεed protein. Inouye et al., Proc. Natl. Acad. Sci. USA. 85:7685-7689 (1988).

SUB 9. Preparation of V, Expreεεion Vector

ImmunoZAP L Conεtruction To expreεε the plurality of V_L coding polynucleotideε in an E. coli hoεt cell, a vector waε conεtructed that placed the V_L coding polynucleotide in the proper reading frame, provided a riboεome binding εite aε deεcribed by Shine et al., Nature. 254:34, (1975), provided a leader εequence directing the expreεεed protein to the periplaεmic εpace and alεo provided a polynucleotide that coded for a εpacer protein between the V_L polynucleotide. A εynthetic DNA εequence containing all of the above polynucleotideε and featureε waε conεtructed by deεigning εingle εtranded polynucleotide εegmentε of 20-40 baεeε that would hybridize to each other and form the double εtranded εynthetic DNA sequence shown in Figure 6B. The individual single-stranded polynucleotides (N^Ne) are shown in Table 9 above.

Polynucleotides N2, N3, N4, N6, N7 and N8 were kinaεed by adding 1 μl of each polynucleotide and 20 unitε of T* polynucleotide kinaεe to a εolution containing 70 mM Triε-HCl, pH 7.6, 10 mM MgCl₂, 5 mM DDT, 10 mM 2ME, 500 microgramε per ml of BSA. The εolution waε maintained at 37*C for 30 minutes and the reaction stopped by maintaining the solution at 65 ' C for 10 minuteε. The two end polynucleotideε 20 ng of polynucleotideε Nl and polynucleotideε N5 were added to the above kinaεing reaction εolution together with 1/10 volume of a solution containing 20 mM Tris-HCl, pH 7.4, 2 mM MgCl₂ and 50 mM NaCl. This solution waε heated to 70*C for 5 minuteε and allowed to cool to room temperature, approximately 25*C, over 1.5 hourε in a 500 ml beaker of water. During this time period all the polynucleotideε annealed to form the double εtranded synthetic DNA insert. The individual

SUBSTITUTESHEET polynucleotideε were covalently linked to each other to εtabilize the εynthetic DNA insert with adding 40 μl of the above reaction to a solution containing 50 μl Triε-HCl, pH 7.5, 7 mM MgCl₂, 1 mM DTT, 1 mM ATP and 10 unitε of T4 DNA ligaεe. Thiε εolution waε maintained at 37'C for 30 minuteε and then the T4 DNA ligaεe waε inactivated by maintaining the εolution at 65*C for 10 minuteε. The end polynucleotideε were kinaεed by mixing 52 μl of the above reaction, 4 μl of a solution recontaining 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37*C for 30 minutes and then the T4 polynucleotide kinase was inactivated by maintaining the εolution at 65'C for 10 minuteε. The completed εynthetic DNA inεert waε ligated directly into a Lambda Zap II vector prepared in Example 7 that had been previouεly digeεted with the restriction enzymes Not I and Xho I. The ligation mixture was packaged according to the manufacture's instructionε uεing Gigapack II Gold packing extract and the packaged ligation mixture waε plated on XL1- Blue cellε aε deεcribed in Example 8a. Individual lambda Zap II plaques were cored and the insertε excised according to the in vivo excision protocol as deεcribed in Example 8a. Thiε in vivo exciεion protocol convertε the cloned inεert from the Lambda Zap II vector into a phagemid vector to allow eaεy manipulation and sequencing and also produces the phagemid version of the V_L expression vectors. The accuracy of the above cloning steps was confirmed by sequencing the insert uεing the Sanger dideoxy method deεcribed by Sanger et al., Proc. Natl. Acad. Sci. USA. 74:5463-5467, (1977) and uεing the anufacturer'ε instructionε in the AMV reverεe tranεcriptaεe ³⁵S-dATP sequencing kit (Stratagene) . The εequence of the

S - ^'93 - resulting V_L expression vector is shown in Figure 6B and Figure 9.

The V_L expresεion vector used to conεtruct the V_L library waε the phagemid produced to allow the DNA of the V_L expreεεion vector to be determined. The phagemid was produced, as detailed above, by the in vivo exciεion proceεε from the Lambda Zap V_L expreεεion vector (Figure 9) .

10. Construction of V_HL Expreεεion Vectorε and

Library a. Ligation of Dicistronic DNA Molecules with Modified ImmunoZAP H In preparation for cloning a library enriched in V_H-V_L-coding (V_HL) dicistronic DNA moleculeε, PCR amplified productε (human or mouεe) prepared in Exampleε 4, 5 and 6 (50 mM NaCl, 25 M Triε-HCl, pH 7.7, 10 mM MgCl₂, 10 M β- mercaptoethanol, 100 ug/ml BSA, at 37 ' C were digested with restriction enzymes Xho I and Xba I at a concentration of 60 unitε of enzyme per ug of DNA, and purified on a 1% agaroεe gel. After gel electrophoreεiε of the digeεted PCR amplified diciεtronic DNA moleculeε, the region of the gel containing the DNA fragmentε of approximately 1360 baεe pairε in size was excised, purified using Gene- Clean (BIO 101, La Jolla, California) , ethanol precipitated and resuspended in 10 mM Triε-HCl, pH 7.5, and 1 mM EDTA to a final concentration of 10 ng/ul. Equimolar amountε of the inεert were then ligated overnight at 4*C to 1 ug of modified ImmunoZAP H vector, prepared in Example 8b, (Stratagene) previouεly digested with Xho I and Xba I. A portion of the ligation mixture (1 ul) waε packaged for 2 hours at room temperature uεing Gigapack Gold packaging extract (Stratagene) and the packaged material was plated on a permissive E. coli (strain XLl-blue) lawn to generate plaques. The library was determined to consiεt of predominantly V_HL with leεε than 5% non-recombinant background. b. Screening of Antibody-Producing Plagueε 1) Human

To screen for expression of V_HL diciεtronic moleculeε, E. coli were infected to yield approximately 100 plaqueε per plate. Replica filter liftε of the plaqueε on an agar plate were produced by overlaying a nitrocelluloεe filter that had been εoaked in 10 mM iεopropyl beta-dithiogalactopyranoside on each plate with transfer for 15 hours at 23*C. ^• For detection of V_HL antibody fragment expresεion, the filterε were screened with rabbit anti-human heavy and light chain antibodies followed by goat anti-rabbit antibody coupled to alkaline phoεphataεe (Cappel Laboratorieε, Malvern, Pennεylvania) . The detection of immunoreactive product confirmed the presence and expreεεion of V_HL antibody fragmentε.

To identify human DNA cloneε expreεεing antibody that bound TT, plaqueε were plated and proteinε expressed aε deεcribed above. Replica filterε were incubated with 0.2 nM ¹²⁵I-tetanus toxoid and washed. Positive plaques were identified by autoradiography and isolated. The frequency of positive clones in the library was equivalent to (number of positive clones)/[number of plaques screened) X (fraction of plaques expresεing V_HL) .

Concentrated nonadεorbed tetanuε toxoid waε iodinated with sodium iodide ¹²⁵I (ICN, Irvine, California) by the Chloramine-T method aε deεcribed in Botton et al. , Biochem. I.. 133:529-539 (1973) and available in a kit (Iodo-Beadε, Pierce, Rockford, Illinois).

SUBST Human DNA clones were re-plated at approximately 100 phage per plaque side by side with the parental phage that were used aε templateε for PCR amplification and εcreened in the primary antigen binding εcreen. The reεultε of the εcreening procedure are seen in Figure 11. Similar signals between the parental clones and the V_HL diciεtronic DNA moleculeε demonεtrated that the sequence differences introduced with the C_H1' and V_L primers did not adversely affect gene expression. Also, it should be noted in Figure 11 that a random parental clone that did not react with tetanus toxoid, 7G1, was unreactive before and after the PCR dicistronic fusion, as waε the control ImmunoZAP H vector (IZ H) . 2) Mouεe

Mouεe antibody-producing plaqueε prepared in Example 7 were εcreened for antibody expresεion with rabbit anti-mouse heavy and light chain antibody (Cappel Laboratories) as described above.

11. Characterization of Cloned Dicistronic V_L Repertoire in Expresεion Library a. Verification of Preεence and Size of Cloned Diciεtronic V_Hl Repertoire Bacteriophage from purified reactive plaqueε prepared in Example 10b were converted to the plaεmid format by in vivo exciεion with R408 helper phage according to manufacturer'ε protocol (Stratagene) and also described in Short et al., Nucl. Acids Res.. 16:7583-7600 (1988). In the in vivo excision protocol, the cloned insert from the ImmunoZAP H vector was converted into a phagemid vector to allow easy manipulation and sequencing. Briefly, phage plaqueε were cored from the agar plateε and tranεferred to εterile microfuge tubeε containing

SUBSTITUTESHEET 500 ul of a buffer containing 50 mM Triε-HCl, pH 7.5, 100 mM NaCl, 10 mM MgS0₄, and 0.01% (w/v) gelatin and 20 ul of chloroform.

For exciεionε, 200 ul of the phage εtock, 200 ul of XLl-Blue cellε (A^o = 1.00) and 1 ul of R408 helper phage (1 x lθ'° plaque forming unitε (pfu)/ml) were incubated at 37'C for 15 minuteε. After a 4 hour incubation in Luria-Bertani (LB) broth and heating at 70^*C for 20 minuteε to heat kill the XLl-blue cellε, the phagemidε were re-infected into XLl-Blue cellε and plated onto LB plateε containing ampicillin. Double εtranded DNA waε prepared from the phagemid containing cellε according to the methods described by Holmeε et al., Anal. Bioche .. 114:193, (1981). Cloneε were firεt εcreened for DNA inεertε by restriction digests with Xho 1 and Xba 1. The detection of 1390 baεe pair fragment on an agaroεe gel confirmed the preεence of a V_KL diciεtronic molecule insert. b. Sequencing of Plasmidε from Expreεεion Library

Cloneε containing the putative V_HL inεert were εequenced uεing reverεe tranεcriptaεe according to the general method deεcribed by Sanger et al. , Proc. Natl. Acad. Sci.. USA. 74:5463-5467, (1977) and the εpecific modifications of this method provided in the manufacturer's instructionε in the AMV reverεe tranεcriptaεe ³⁵S-dATP sequencing kit (Stratagene) .

Nucleotide sequence analysis of several fusion clones indicated that the sequence of the fusion region was identical to that shown in Figure 5, proving that the clones were actually generated through a fuεion PCR intermediate. c. Advantages of Fuεion-PCR to Produce Dicistronic DNA Moleculeε

SUB PCR amplification can, therefore, be uεed to fuεe εeguenceε reεponεible for encoding εubunitε of a heterodimeric protein together into a εingle DNA fragment that can then direct the expreεεion of both subunits from one expression vector. In the case of antibodies, if the source of nucleic acid template comes from hybridoma mRNA, there is only one heavy and light chain sequence to choose from, and thuε the heavy:light pair iε a "natural" pair. However, if spleen, peripheral blood B-cell, or other lymphocyte mRNA is used aε the εource of template, the PCR fuεion reaction to form a diciεtronic DNA molecule can randomly pair heavy and light chainε from different cellε, producing a combinatorial library. In εuch a library, only a εmall fraction of the cloneε contain the original heavy and light chain pairε. Thiε may not be a problem if the deεired natural pair iε well repreεented in the original B-cell population, aε iε the caεe with hyperimmunized donorε. However, if one wiεhes to find a naturally occurring rare εpecificity in a combinatorial library, one may have to εcreen an large number of cloneε.

The fuεion method preεented here may offer a εolution to the random combinatorial problem. If one beginε with a very dilute population of B-cells (poεεibly in a medium that limitε diffuεion) , it may be poεεible for the diciεtronic event to occur between naturally paired heavy and light chain sequences before significant mixing between B-cell RNA occurε. Thuε, the fuεed heavy and light chain εeguenceε would be the original pairε, and the reεulting library would expreεε predominantly the naturally occurring antibody εpecificitieε. Such a library would be highly preferable when rare natural εpecificitieε are sought.

SUBSTITUTESHEET Another advantage to thiε method iε that only one vector and one cloning εtep are neceεεary. Thiε εaveε a εubstantial amount of time, resources, and effort. Moreover, the ease of the single PCR reaction greatly simplified the procesε of going from B-cell RNA to an E. coli library, making thiε approach a noteworthy alternative to εtandard hybridoma technology.

12. Production of An Expreεεion Vector for Fuεing the LamB Outer Membrane Spanning Signal to a Polypeptide

The following PCR primerε are uεed to produce a DNA εegment encoding the εurface expreεεion εignal amino acid reεidue sequence of lamB, (i.e., residue positions 51-184 as shown in Figure 3) :

Table 11 LamB Primers

Seq. Id. No.

(82) upstream' 5' TTACTAACTAGTTTCTATTTCGACACTAACGTG3

(83) downstream² 5' TTAGATCTAGATTTCCATCTGCGCTAAACGCAC3

¹ Underlined sequence designateε the location of an

Spe I reεtriction site.

² Underlined sequence designateε the location of an Xba I reεtriction site.

The primers are mixed pairviεe with genomic DNA uεed from E. coli having the lamB gene aε template. The amplified DNA segment iε purified by preparative agarose gel electrophoresiε, digeεted with Spe I and Xba I restriction endonucleaseε, and

SUBSTIT T subsequently ligated into I munoZap H/L at the Spe I restriction εiteε flanking the decapeptide tag sequence, i.e., the decapeptide tag sequence iε replaced with the outer membrane spanning signal sequence.

The immunoZAP vector (H/L) is created from the heavy and light chain libraries, prepared in Exampleε 8 and 9, respectively, by fusing the vectorε at the Eco Rl εite aε followε. DNA iε purified from the light chain library and restriction digested with Mlu 1 and Eco Rl. This cleaves the DNA from the left arm of the vector into several pieces while leaving the right arm with the light chain inserts intact. DNA is purified from the heavy chain libraries and reεtriction digested with Hind III and Eco Rl. This cleaves the DNA from the right arm of the vector into several pieces while leaving the left arm with the heavy chain inserts intact. The intact left arm of the heavy chain vector containing the heavy chain inεertε and right arm of the light chain vector containing the light chain inεerts are then mixed and ligated at the common Eco Rl reεtriction site. The reεultant ImmunoZAP H/L vector is shown in Figure 12. The ligations and packaging are aε deεcribed in Example 2 to create the ImmunoZAP H/L library.

A DNA segment coding for a preselected polypeptide, such as a V_H, can then be ligated into the lamB-modified ImmunoZap H expression vector at position between, and is the same reading frame with, the pelB leader and the lamB signal sequences. The vector thus produced expresses the preselected polypeptide as a double-fusion protein, i.e., having pelB leader and lamB surface expression signal polypeptide segments operatively linked to the preselected polypeptides amino- and carboxy-ter ini,

SUBSTITUTESHEET respectively.

To increaεe the diεtance of the preεelected polypeptide from the εurface membrane of E. coli which reεultε in decreaεed εteric hinderance and competition of the preεelected polypeptide with the lipopolysaccharide coat of E. coli_r insertε of variouε lengthε can be conεtructed in the recombinant plaεmid vector (Tableε 12 and 13) .

The amino acid reεidue εequence of the inεertε A, B, C or D following expreεsion in E. coli aε described in Example 10 are listed in Table 12.

Table 12 Insert Amino Acid Reεidue Seguence

GluProLyεSerCyεAεpLyεThrHiεThrSerProProAla

ProAlaProGluLeuLeuLysSerSerPheTyrPheAεpThr

ProLyεSerCyεAεpLyεThrHiεThrGluProLyεSerThr AεpLyεThrHiεThrSerProProAlaProAlaProGluLeu

LeuLyεSerSerPheTyr

ProLyεSerCyεAεpLyεThrHiεThrSerLyεSerSerPhe

TyrPheAsp

GluProLysSerCyεAspLysThrHiεThrSerTyrPheTyr AεpValProAεpTyrGlySerLyεSerSerPheTyrPheAεp

Thr

¹ Inεert A: Moveε Spe 1 εite, retainε native IgGl upper hinge region; retainε original lamB sequence, ² Insert B: Moveε Spe 1 site, retains original IgGl upper hinge region, retains original lamB sequence. ³ Insert C: Moves Spe 1 εite, retainε original IgGl upper hinge region, duplicateε 10 amino acidε in the upper hinge region. Inεert D: Moveε Spe 1 εite, retainε native IgGl

SUBSTITUTESH upper hinge region; retains original lamB sequence.

Table 13 Insert Primerε

GTCCTGTCCGAGGTGCAGCTGCTCGAGTCTGG 3 ' GTCCACCGGCCCCAGCACCTGAACTCCTGAAGAGCAGC TTCTAT 3'

CTCGGGTTTAGAACACTGTTTTGAGTGTGATCAGGTGGC

CGGGGTCGTGGAC 5'

GTCCACCGGCCCCAGCACCTGAACTCCTGAAGAGCAGC TTCTAT 3' CTCGGGTTTAGAACACTGTTTTGAGTGTGATCAGGTGGC CGGGGTCGTGGAC 5'

GTGACAAAACTCACACTAGTAAGAGCAGCTTCTAT 3 ' CTCGGGTTTAGAACACTGTTTTGAGTGTGATCA 5' GTGACAAAACTCACACTAGTTACCCGTACGACGTTCCGGAC TACGGTTCTAAGAGCAGCTTGTAT 3' CTCGGGTTTAGAACACTGTTTTGAGTGTGATCATCA 5'

CACGCAAATCGCGTCTACCTTAAGATCGTTCCTCTGTCA GTATTACTTTATGGATAACGGATGCCGTCGGCGACCTAA CAATAA 5' (96)" 5' GCCTACGGCAGCCGCTGGATTGTTATTAATCGCTGCCCA ACCTGCCATGGCTGAGCTCGTGATGACCCATGCTCC 3'

(97)'² 5' TCCTTCTAGATTACTAACACTCTCCCCTGTTGAAGCTCT TTGTGACGGGCGAACTC 3'

5' heavy chain V_H primer used for all constructionε.

5' lamB overlapping primer for insert A.

3' heavy chain C_Hl overlapping primer for insert A.

5' lamB overlapping primer for insert B.

3' heavy chain C_H1 overlapping primer for insert B. 5' lamB overlapping primer for insert C.

SUBSTITUTESHEET 7 3' heavy chain C_H1 overlapping primer for inεert C. 8 5' lamB overlapping primer for inεert D. 9 3' heavy chain C_H1 overlapping primer for inεert D. 103^• lamB overlapping primer with 5' light chain primer.

11 5' light chain overlapping primer with 3' light chain prime.

123' lamB overlapping primer with 5' light chain primer.

The inserts between the heavy chain and lamB sequences are made using the PCR-fusion procedure for producing dicistronic DNA as prepared in Examples 2 and 3 with the following exceptions. The light chain and lamB sequences are fused together uεing the outεide primerε and limiting amountε of the inεide primerε (Table 13) . The reεultant PCR productε are gel purified uεing Gene Clean (BIO 101) aε described in Example 10 before PCR- fuεing it to the heavy chain uεing only outεide primerε (Table 13) . The reεultant PCR-fuεion product conεists of V_H-inεert A, B, C or D-lamB-light chain. The region inεerted by the PCR primerε between the lamB and light chain createε the same diciεtronic bridge previouεly inεerted between the heavy and light chain DNAε. Thiε product is ligated with the modified ImmunoZAP H vector restriction digested with the enzymes Xho I and Xba I as prepared in Example 10. After insertion, the diciεtronic eεεage encoded by the DNA allows expresεion of the heavy chain and lamB aε a fuεion protein and the light chain aε a separate protein.

Surface expression is accomplished by transforming the recombinant plasmid vector into an E. coli εtrain, lacking itε endogeneouε lamB gene, thuε avoiding competition between the recombinant lamB

SUBSTI T εignal-containing product and a normal lamB gene product for available membrane-spanning εiteε. A preferred hoεt iε a lamB deletion mutant of the E. coli SURE εtrain. The E. coli SURE strain iε commercially available from Stratagene.

13. Production of Antigen-Specific B Cellε a. In Vitro Immunization

1) Preparation of T Cell Replacing Factor. ε-PWM-T

Blood waε collected from healthy donorε and PBLε were iεolated aε deεcribed in Example 2. Iεolated PBLs were then fractionated into T and non-T cellε by AET-SRBC (2-aminoethylthiouronium bromide- εheep red blood cell) roεetting according to the procedure deεcribed by Callard. Callard et al., Eur. J. Immunol.. 11, 206 (1981). Briefly, the isolated PBLs were treated with a 1% suspenεion of AET-modified εheep red blood cellε. The roεette waε purified over a Ficoll gradient and the red blood cellε removed by hypotonic lyεiε.

The procedure for preparing the T cell replacing factor, ε-PWM-T, was performed as deεcribed by Danielεon. Danielson et al., Immunol.. 61:51-55 (1987). The resultant enriched T cell population waε εuεpended in RPMI-1640 medium (Gibco Laboratorieε, Santa Clara, California) supplemented with 1% (v/v) non-eεεential amino acidε, 4 mM L-glutamine, streptomycin (50 ug/ml) , penicillin (50 IU/ml) and 10% heat-inactivated human AB serum at a concentration of 2 X 10⁶ cells/ml, and irradiated (2000 radε; 1 rad «= 0.01 Gy) . Following irradiation, the T cellε were activated by treatment with 10 ug of pokeweed itogen (PWM)/ml (Sigma) for 24 hourε at 37*C. The εupernatant waε collected and εtored at 4^*C. PWM

SUBSTITUTESHEET activation of T cells resultε in εecretion of gamma interferon, interleukin-2 (IL-2) and various undefined B cell growth factorε into the medium. Growth factor containing supernatant from the PWM-treated T cells, hereinafter designated s-PWM-T, was collected and added to lymphocyte cell cultures prepared below.

2) Preparation of In Vitro Immunization

Cultureε The procedure for in vitro immunization of PBLε waε performed as described by Borrebaeck. Borrebaeck et al., Proc. Natl. Acad. Sci. USA. 85:3995-3999 (1988). Human PBLs, isolated as described in Example 2, were resuεpended to a concentration of 1 X 10⁷ cellε/ml in serum-free, εupplemented RPMI-1640, prepared aε deεcribed above, containing 2.5 mM L-leucine methyl ester hydrochloride (Leu-OMe) from a 0.5 M stock εolution prepared in water. (Sigma Chemical Co., St. Louiε, Miεεouri) . The cellε were incubated at room temperature for 40 minuteε and then waεhed three timeε in RPMI-1640 containing 2% heat-inactivated human serum. Cell recovery after treatment with Leu-OMe ranged from 30- 90%. The treatment with Leu-OMe was performed to effect the removal of a Leu-OMe-sensitive εubpopulation leaving a population of cellε that reεpond to T-cell dependent antigen stimulation in vitro.

Leu-OMe-treated PBLs were immunized in vitro with either keyhole limpet hemocyanin (KLH) (Sigma) or tetanus toxoid (TT) (Example 2). For this protocol, and for the subsequent ELISPOT assayε, the Leu-OMe- treated T cells were first suspended in supplemented RPMI-1640, containing 50 uM beta- ercaptoethanol, 10% heat-inactivated human AB serum, 30% (v/v) s-PWM-T, and antigen (1-lOOOng/ml) . For determination of total

S immunoglobulin content in the culture εupernatantε, the cellε were maintained in heat-inactivated fetal bovine εerum inεtead of human AB εerum. The antigen- treated Leu-OMe-treated PBLε were then plated at a concentration of 2 X 10⁶ cells/ml in a 4-ml (six-well plates) or 30-ml (75-cm² flask) and maintained at 37^*C in 5% C0₂ for three days. The cellε were pelleted and waεhed one time with RPMI-1640 supplemented medium prepared above lacking antigen to effect the removal of antigen. The washed antigen-treated cells were resuεpended in fresh medium containing s-PWM-T, but lacking antigen. The cells were thereafter cultured for three to four more days for a total maintenance period of six to seven days, at which time the levelε of antigen-εpecific antibody and/or the number of antigen-εpecific antibody εecreting cellε were determined by ELISA and ELISPOT aεεayε, reεpectively. b. Immunoasεavε

1) ELISA Aεεav for Determining the Levelε of Antigen-Specific Antibody

The antigen-εpecific immunoglobulin (IgM and IgG) secreted into the medium from antigen-treated PBLε prepared above waε determined by ELISA. Briefly, 100 ng/ml of antigen, either KLH or TT, diluted in PBS, pH 7.5, waε added to individual wellε of 96-well microtitre plateε. The plateε were allowed to stand at room temperature for 16 to 18 hours. After removing unabsorbed proteins, wellε were blocked with 0.2% gelatin-PBS for 1 hour at room temperature. One hundred ul of culture medium samples were added to the antigen-coated wells and incubated at room temperature for 1 hour. The wells were then rinsed three times with PBS-containing 0.05% Tween 20. Alkaline phosphataεe (AP) conjugated to iεotype- specific antibodieε (goat-anti-human IgM or IgG) (1

SUBSTITUTESHEET ug/ml-final concentration) (Boehringer Mannheim, Indianapolis, Indiana) waε diluted in 50 mM PBS, pH 7.5, containing 1.5 M sodium chloride and 0.1% Tween 20 and 100 ul of diluted AP antiglobulin conjugate were then added to each well and maintained at room temperature for one hour or at 4'C overnight. The wellε were then rinεed three timeε with PBS 0.05% Tween 20.

The waεhed wells were then inverted to remove the remaining buffer. A 1 mg/ml solution of PNPP

(Sigma) p-nitro phenylphosphate diεεolved in PBS waε then added to each well for detection of antigen- εpecific antibodies and optical density measured at 405 nm. 2) ELISPOT Aεεav for Determining the

Number of Antigen-Specific Antibody- Secreting Cellε ELISPOT assayε are performed aε deεcribed by Czerkinsky. Czerkinsky et al., J. Immunol. Methodε, 65:190-121 (1983). For meaεuring the number of antigen-specific antibody-secreting cells in the in vitro immunized PBL cultures ELISPOT was performed. For this asεay, 3.5 centimeter diameter polyεtyrene petri diεheε (Falcon, Oxnard, California) were filled with 1.5 ml of either KLH or TT antigen at a concentration of 1 ug/ml. Borrebaeck et al., εupra. The plateε were washed as described for the ELISA assay. The antigen-coated plates were then blocked with 0.2% gelatin at 37*C. Lymphocytes (10⁵ to 10⁶) were added to each dish and allowed to incubate undisturbed overnight at 37*C. The cells were removed and the plates were washed twice with cold PBS and then maintained for 10 minutes with cold 10 mM EDTA- PBS. The plates were then rinsed three times with PBS containing 0.5% Tween-20. Antigen-specific human

SUB antibody waε detected with alkaline phosphataεe-goat anti-human IgG or IgM, followed by the addition of enzyme εubεtrateε 150 ug/ml BCIP (5-bromo-4-chloro-3- indolyl phoεphate) , and 300 ug/ml NBT (nitroblue tetrazolium) , diεεolved in molten 1% agaroεe in PBS. The plateε were then incubated for one to εeveral hours at room temperature, after which time, blue spotε appeared correεponding to the poεitionε of antigen-εpecific antibody εecreting cellε. The frequency of antigen-εpecific B cellε waε determined aε (number of antigen-specific antibody εecreting cellε)/(number of B cellε added per plate). In vitro immunization waε demonεtrated by an increaεe in the frequency of antigen-specific B cells, in reεponεe to antigen εtimulation. The number of B cellε added to each ELISPOT plate waε aεεumed to be approximately 10% of the total number of Leu-OMe- treated PBLε baεed on immunofluoreεcence analyεiε of Ohlin. Ohlin et al., Immunolology. 66:485-90 (1989). The total number of lymphocyteε waε determined by trypan excluεion. The reεultε of theεe aεεayε are deεcribed below.

3) Panning to Increase the Frequency of Antigen-Specific B Cells PBLs, prepared in Example 2, were treated with Leu-OMe and resuεpended in supplemented RPMI-1640 medium containing 2% fetal bovine serum as described above. Approximately 1 to 10 x 10⁶ Leu-OMe-treated PBLs were added to polystyrene petri dishes, previously coated with 1 μg/ml of either KLH or TT antigen and blocked with 0.2% gelatin. The cells were then maintained at 4^*C for 1 hour. After the non- adherant cells were decanted, the plates were washed three times with chilled medium and the non-adherent fractions were pooled.

SUBSTITUTESHEET Depletion of antigen-specific B cellε waε demonstrated by culturing the non-adherent cellε in the preεence of ε-PWM-T, as described above, for 6 days. The number of antigen-εpecific antibody producing cellε was then determined by the ELISPOT asεay. The number of B cellε which adhere under the conditionε deεcribed above was determined using two different methods. An enriched population of B cellε waε obtained by roεetting with AET-treated εheep red blood cellε. The non-roεetting cellε were then panned on autologouε plasma-coated petri dishes, and the non- adherent lymphocytes (B cellε) recovered. In one εet of experimentε, the B cellε were labelled overnight with ³⁵S-methionine, panned aε deεcribed above, and the percent radioactivity adhering to the diεhes determined. In the εecond εet of experimentε, the number of purified cellε which adhered waε determined microεcopically uεing an ocular grid. The reεultε of the experimentε are deεcribed below. 4) Panning In Vitro Immunized Cellε

Panning and in vitro immunization were combined to enrich the frequency of antigen-εpecific B cellε beyond the level which can be achieved with either technique alone. I_n vitro stimulated lymphocytes were cultured as described above for 5 days, transferred to fresh medium and panned as deεcribed on antigen coated diεheε, The reεultε of theεe experimentε are described below. c. Results of In Vitro Immunization and Cell Panning

Using KLH and tetanus toxoid (TT) aε model antigenε in the above-deεcribed procedure reεulted in a 2-3 fold increaεe in the frequency of both TT- and KLH-εpecific B cellε. The frequency of KLH-εpecific B cellε waε conεiderably influenced by

S resuspending the cells in fresh media, containing T cell εupernatant and lacking antigen, εeveral dayε after expoεure to antigen. Aε Table 14 εhowε, a 7 to 17-fold increaεe in the number of antigen-specific B cells waε obεerved when the cellε were pulεed with antigen for 2 to 3 dayε. Expoεing the cellε for the entire culture period (6-7 dayε) , on the other hand, reεulted in an average increase of only 3-fold.

Table 14

Expansion of KLH-specific B cells*

Expt. Donor Day Media Exchange/KLH Removed

1 1 2 1 2 2 3

* ratio = (# anti-KLH Ig secreting cellε cultured with s-PWM-T and KLH)/(# anti-KLH Ig secreting cells cultured with s-PWM-T) detected with ELISPOT

As expected for induction of a primary immune reεponεe, the KLH-εpecific antibodies secreted were of the IgM isotype. Antigen pulsing resulted in an average increase of 9-fold and a mean frequency of 3.3 x 10^"3 (Table 15) . These resultε indicate that primary immunization of naive human B cellε can give riεe to frequencieε of antigen-specific B cells which are comparable to those found when B cells were collected from human donors booεted with TT. Mullinax

SUBSTITUTESHEET et al. , supra.

Table 15

Freguencv of KLH-εpecific Cellε

After Primary Immunization

Antigen Pulse Freq anti-KLH IgM B Cellε

panning techniques.have alεo been developed for the enrichment of antigen-εpecific B cellε. Table 16 summarizes the degree of enrichment observed for a single cycle of panning against a model antigen.

Table 16 n chment o n -S ec c B Cellε

Peripheral blood lymphocyteε from unboosted donors were panned on TT- and gelatin-coated petri dishes and the number of TT-specific B cells in the non-adherent cell population determined. In experiments 1 and 2, 100% and 90% of the anti-TT antibody secreting cells, respectively, were depleted when panned on TT plates, while only 28% and 8% were depleted when panned on gelatin (not shown) . The number of purified B cells which adhere under analogous

SUBST - Ill - conditionε ranged from 1.5 to 10% and waε determined either by labeling the cellε with ³⁵S-methionine (expt. 3) or by examining the adherent cellε microεcopically with an ocular grid (expt. 4). Theεe preliminary reεultε indicate that a εingle cycle of cell panning can be uεed to increaεe the frequency of antigen-εpecific B cellε by at leaεt 9-fold, and poεεibly aε high aε 67-fold. It should be possible to further deplete B cells which bind non- εpecifically or with low affinity to antigen by performing εequential iεolationε or by altering the epitope density of the solid matrix.

By combining the resultε found in Tables 15 and 16, it iε evident that cell panning can be uεed alone or in combination with in vitro immunization to increaεe the frequency of antigen-εpecific B cellε in the naive repertoire by 2 to 3 orders of magnitude. Analysis of the non-adherent cells recovered after panning, before and up to 7 dayε after culturing with T cell εupernatant (ε-PWM- T) , indicateε that the majority of KLH-εpecific antibody producing cellε are depleted when panned at 0 to 5 dayε. Aε Table 17 indicateε, panning at dayε 6 and 7 (peak of antibody production) is inefficient, possibly due to either down-modulation of surface IgM receptors or interference by secreted anti-KLH antibody. To recover the greatest enrichment antigen-specific B cells, panning should be performed at day 5 to^' ensure maximal clonal expansion.

Table 17 of Anti-KLH IgM-Secreting

Cells in the Non-Adherent Fraction

Panning Antigen Day Panned KLH Gelatin 2 1 9 4 1 17

5 2 17

6 17 20

7 18 5

Theεe εtudieε have demonεtrated, with model antigenε, that in vitro immunization or cell panning can be uεed to increaεe the frequency of antigen-εpecific B cellε by at leaεt 10-fold. Preliminary reεultε indicate that the two techniqueε can be combined to give riεe to frequencieε which are comparable to thoεe of the lymphocyte population uεed to construct the TT-specific library (10^"3) . Theεe techniqueε may obviate the requirement for .in vivo immunization, thereby eliminating one of the major obεtacleε to the routine production of human monoclonal antibodieε. By cloning human immunoglobulin sequences from E. coli expreεεion librarieε, the difficultieε encountered in immortalizing antibody producing cell lineε are avoided as well. Thus, preparing immunoexpresεion librarieε from enriched populationε of naive B cellε εhould render it poεεible to generate human monoclonal antibodies against a variety of antigenε of therapeutic and diagnoεtic intereεt.

The foregoing iε intended aε illuεtrative of the present invention but not limiting. Numerous variations and modifications can be effected without departing from the true spirit and εcope of the invention.

Claims

What iε claimed iε:

1. A method of producing a library of diciεtronic DNA moleculeε compriεing an upεtream ciεtron and a downεtream ciεtron, said upstream and downstream cistronε encoding reεpective first and εecond polypeptideε of a heterodimeric receptor, which method comprises:

(a) forming a first polymerase chain reaction (PCR) admixture by combining, in a PCR buffer, a repertoire of first polypeptide geneε and a first PCR primer pair defined by an outεide firεt gene primer and an inεide firεt gene primer, εaid inεide firεt gene primer having a 3 •-terminal priming portion and a 5 '-terminal non-priming portion, said 3 '-terminal priming portion compriεing a nucleotide εequence homologouε to a conεerved portion of a first gene;

(b) subjecting said first PCR admixture to a plurality of PCR thermocycles to produce a plurality of firεt polypeptide coding DNA homologε in double εtranded form; (c) forming a εecond PCR admixture by combining, in a PCR buffer, a repertoire of εecond polypeptide geneε and a εecond PCR primer pair defined by an outεide εecond gene primer and an inεide second gene primer, εaid inεide gene primer having a 3 '-terminal priming portion and a 5'-terminal hybridizing portion complementary to the 5'-terminal non-priming portion of said first gene primer, said 3 '-terminal priming portion compriεing a nucleotide sequence homologous to a conserved portion of a εecond polypeptide-coding gene; said first inside and second inside primers, when hybridized, forming a duplex encoding a double- stranded cistronic bridge for linking said upstream and downstream ciεtronε, one strand of said bridge encoding (i) at leaεt one εtop codon in the εame reading frame aε said upstream ciεtron, (ii) a riboεome binding site downεtream from εaid εtop codon, and (iii) a polypeptide leader having a translation initiation codon in the εame reading frame aε εaid downεtream ciεtron, εaid initiation codon located downεtream from εaid riboεome binding εite; (d) εubjecting εaid εecond PCR admixture to a plurality of PCR thermocycleε to produce a plurality of second polypeptide-coding DNA homologε in double εtranded form;

(e) separating the double εtranded DNA homologs produced in stepε (b) and (d) ;

(f) hybridizing the separated εtrandε to form a plurality of internally-primed duplexeε; and

(g) subjecting the internally-primed duplexeε to conditionε for primer extenεion to produce a plurality of different diciεtronic DNA moleculeε, each containing a firεt polypeptide-coding εequence and a εecond polypeptide-coding εequence linked by said cistronic bridge, said upstream ciεtron compriεing one of εaid firεt polypeptide- or εecond polypeptide-coding DNA homologε, and εaid downεtream ciεtron compriεing the other of εaid firεt polypeptide- or second polypeptide-coding DNA homologs.

2. The method of claim 1 wherein steps (a)-(d) are performed concurrently in one reaction vesεel.

3. The method of claim 1 wherein εaid signals for the initiation of translation of the downεtream ciεtron are located downεtream from the εtop codon and include a riboεome binding site and a translation initiation codon encoding the first amino acid residue of a polypeptide leader, said codon located in the same reading frame aε the downεtream ciεtron.

4. A method of producing diciεtronic DNA molecules compriεing an upεtream ciεtron and a downεtream ciεtron, εaid upεtream and downεtream ciεtronε encoding reεpective first and second polypeptides of a heterodimeric protein, which method compriseε:

(a) forming a first polymeraεe chain reaction (PCR) admixture by combining, in a PCR buffer, firεt polypeptide-encoding geneε and a firεt PCR primer pair defined by an outεide firεt gene primer and an inεide firεt gene primer, εaid inεide firεt gene primer having a 3 '-terminal priming portion and a 5'-terminal non-priming portion, εaid 3 '-terminal priming portion compriεing a nucleotide sequence homologouε to a conεerved portion of εaid firεt polypeptide gene;

(b) εubjecting εaid first PCR admixture to a plurality of PCR thermocycles to produce a plurality of firεt polypeptide coding DNA homologε in double εtranded form; (c) forming a εecond PCR admixture by combining, in a PCR buffer, εecond polypeptide-encoding geneε and a εecond PCR primer pair defined by an outεide εecond gene primer and an inεide second gene primer, said inside gene primer having a 3*-terminal priming portion and a 5 '-terminal hybridizing portion complementary to the 5'-terminal non-priming portion of said first gene primer, said 3'-terminal priming portion compriεing a nucleotide εequence homologouε to a conεerved portion of εaid εecond polypeptide-coding geneε; said first inside and second inside primers, when hybridized, forming a duplex encoding a double- stranded cistronic bridge for linking εaid upstream and downstream cistronε, one strand of said bridge encoding (i) at least one stop codon in the same reading frame as said upstream cistron, and (ii) signals for the initiation of translation of the downstream cistron;

(d) subjecting said second PCR admixture to a plurality of PCR thermocycles to produce a plurality of εecond polypeptide-coding DNA homologε in double stranded form; ^{0 92/15678} K /lBM/tKK

- 116 -

(e) separating the double stranded DNA homologs produced in steps (b) and (d) ;

(f) hybridizing the separated strandε to form a plurality of internally-primed duplexeε; and (g) εubjecting the internally-primed duplexeε to conditionε for primer extenεion to produce diciεtronic DNA moleculeε, each containing a firεt polypeptide-coding sequence and a second polypeptide- coding sequence linked by εaid cistronic bridge, said upstream cistron comprising one of said first polypeptide- or second polypeptide-coding DNA homologε, and εaid downεtream cistron compriεing the other of εaid first polypeptide- or second polypeptide-coding DNA homologs.

5. The method of claim 4 wherein stepε (a)-(d) are performed concurrently in one reaction veεεel.

6. The method of claim 4 wherein the genes of steps (a) and (c) are present in gene repertoires formed by isolating mRNA from at leaεt 10³ peripheral blood lymphocyteε.

7. The method of claim 6 wherein εaid repertoire of firεt polypeptide geneε compriεeε at leaεt 10³ different firεt polypeptide geneε.

8. The method of claim 6 wherein εaid repertoire of second polypeptide genes compriεeε at leaεt 10 different εecond polypeptide geneε.

9. The method of claim 4 further compriεing εtep (h) wherein εaid plurality of different diciεtronic DNA moleculeε iε combined with εaid outεide firεt gene primer and εaid outεide εecond gene primer to form a third PCR admixture, and subjecting said third PCR admixture to a plurality of PCR thermocycles to produce an amplified library of dicistronic DNA molecules.

10. The method of claim 4 wherein said outside firεt gene primer hybridizeε to a framework, leader or promoter region of a V_H immunoglobulin gene.

11. The method of claim 4 wherein said outside second gene primer hybridizes to a J_L or framework region of a V_L immunoglobulin gene.

12. The method of claim 4 wherein said 3'- terminal priming portion of said inside first gene primer hybridizes to a J_H, hinge or framework region of a V_H immunoglobulin gene.

13. The method of claim 4 wherein εaid 3'- terminal priming portion of εaid inεide εecond gene primer hybridizeε to a framework, leader or promoter region of a V_L immunoglobulin gene.

14. A method for producing a library of diciεtronic DNA moleculeε, which method compriεeε:

(a) forming a polymeraεe chain reaction (PCR) admixture by combining, in a PCR buffer:

(i) a repertoire of V_H geneε, (ii) a repertoire of V_L geneε, (iii) a V_H PCR primer pair defined by an outεide V_H gene primer and an inεide V_H gene primer having a 3'-terminal priming portion and a 5'-terminal non-priming portion; and

(iv) a V_L PCR primer pair defined by an outεide V_L gene primer and an inεide V_L gene primer having a 3'-terminal priming portion and a 5'-terminal hybridizing portion complementary to εaid 5'-terminal non- priming portion of εaid inεide V_H gene primer, said V_H inside and V_L inside primers, when hybridized, forming a duplex encoding a double-stranded cistronic bridge for linking said upstream and downεtream ciεtronε, one strand of said bridge encoding at least one stop codon in the same reading frame as εaid upεtream ciεtron, and εignalε for the initiation of tranεlation of the downεtream ciεtron, εaid outεide primerε being preεent in εaid compoεition in molar exceεε relative to εaid inside primers; and

(b) subjecting said PCR admixture to a plurality of PCR thermocycleε, thereby producing εaid library.

15. The method of claim 14 wherein said εignalε include a riboεome binding site downstream from said stop codon and a translation initiation codon for εaid downεtream ciεtron, εaid tranεlation initiation codon located downεtream from εaid riboεome binding εite.

16. The method of claim 15 wherein εaid tranεlation initiation codon iε operatively linked to a polypeptide leader-encoding εequence that iε in the same reading frame as the downstream cistron.

17. The method of claim 14 wherein εaid plurality of PCR thermocycleε iε at leaεt n+5, wherein n iε the number of PCR thermocycleε neceεεary to decreaεe by a factor of 10 the number of εaid inεide primerε by conεumption in the formation of inεide primer-primed productε.

18. The method of claim 17 wherein said repertoire of V_H genes and said outside V_H gene primer are present at a respective molar ratio in the range of 1:10 to 1:10⁷, εaid repertoire of V_H geneε and said inside V_H gene primer are preεent at a reεpective molar ratio in the range of 1:10² to 1:10⁶, said repertoire of V_L genes and said outside V_L gene primer are present at a respective molar ratio in the range of 1:10³ to 1:10⁷, and said repertoire of V_L genes and said inside V_L gene primer are present at a respective molar ratio in the range of 1:10² to 1:10⁶.

19. The method of claim 17 wherein said repertoire of V_H genes and said outside V_H gene primer are present at a respective molar ratio of about 1:10⁴, said repertoire of V_H genes and said inside V_H gene primer are present at a respective molar ratio of about 1:10³, said repertoire of V_L geneε and said outεide V_L gene primer are present at a respective molar ratio of about 1:10*, and εaid repertoire of V_L geneε and εaid inεide V_L gene primer are present at a respective molar ratio of about 1:10.

20. A method of producing a library of dicistronic DNA moleculeε compriεing an upstream cistron and a downεtream ciεtron, which method comprises:

(a) forming a polymerase chain reaction (PCR) admixture by combining, in a PCR buffer: (i) a repertoire of V_H genes,

(ii) a repertoire of V_L genes, (iii) an outside V_H gene primer (iv) an outside V_L gene primer, and (v) a polynucleotide strand having a 3'- terminal priming portion, a cistronic bridge coding portion, and a 5'-terminal primer-template portion, said 3*-terminal priming portion having a nucleotide base εequence complementary to a portion of the primer extenεion product of one of said outside primers, said 5'- terminal primer template portion having a nucleotide base εequence homologouε to a portion of the primer extenεion product of the other of εaid outεide primerε and said ciεtronic bridge coding portion encoding at leaεt one εtop codon in the εame reading frame aε εaid upεtream ciεtron, and εignalε for the initiation of tranεlation of the downεtream ciεtron; and

(b) subjecting said PCR admixture to a plurality of PCR thermocycles, thereby producing said library.

21. A method of producing an iεolated diciεtronic expreεεion vector capable of expressing V_H and V_L polypeptideε from reεpective V_H- and V_L-coding DNA homologε, said V_H and V_L polypeptide being capable of forming an antibody molecule that bindε a preεelected antigen, which method comprises: (a) forming a firεt polymerase chain reaction (PCR) admixture by combining, in a PCR buffer, a repertoire of V_H genes and a first PCR primer pair defined by an outside V_H gene primer and an inside V_H gene primer having a 3 *-terminal priming portion and a 5'-terminal non-priming portion, εaid 3 '-terminal priming portion compriεing a nucleotide εequence homologouε to a conεerved portion of a V_H gene;

(b) εubjecting said first PCR admixture to a plurality of PCR thermocycleε to produce a plurality of

V_h-coding, double εtranded DNA homologs in a double stranded form;

(c) forming a εecond PCR admixture by combining, in a PCR buffer, a repertoire of V_L geneε and a εecond PCR primer pair defined by an outεide V_L gene primer and an inεide V_L gene primer having a 3 '-terminal priming portion and a 5'-terminal hybridizing portion complementary to the 5'-terminal non-priming portion of εaid V_H gene primer, εaid 3 '-terminal priming portion compriεing a nucleotide εequence homologouε to a conεerved portion of a V_L gene, εaid V_H inside and V_L inside primers, when hybridized, forming a duplex encoding a double- stranded ciεtronic bridge for linking εaid upstream and downstream cistronε, one εtrand of εaid bridge encoding at leaεt one εtop codon in the same reading frame as said upεtream ciεtron and signals necesεary for the initiation of tranεlation of the downεtream ciεtron;

(d) subjecting said second PCR admixture to a plurality of PCR thermocycles to produce a plurality of V_L-coding DNA homologs in double stranded form;

(e) separating said double stranded DNA homologε of steps (b) and (d) ;

(f) hybridizing said separated strands to form a plurality of internally-primed duplexes; (g) εubjecting εaid internally-primed duplexes to conditionε for primer extenεion to produce a plurality of different dicistronic DNA moleculeε, each containing a V_H-coding εequence and a V_L-coding εequence linked by εaid ciεtronic bridge, εaid upεtream ciεtron compriεing one of εaid V_H- or V_L-coding DNA homologs, and said downstream ciεtron compriεing the other of εaid V_H- V_L-coding DNA homologε;

(h) operatively linking for expreεεion each of a plurality of εaid different diciεtronic DNA moleculeε to expreεsion vectors thereby forming a plurality of different V_H expresεion vectorε;

(i) tranεforming a population of host cellε compatible with εaid expreεεion vector with a plurality of εaid different V_HL-expreεεion vectorε to produce a tranεformed population of hoεt cells whose members contain εaid V_HL-expreεεion vectorε;

(j) culturing εaid tranεformed population under conditionε for expreεεing the V_H and V_L polypeptideε coded for by εaid diciεtronic DNA moleculeε;

(k) assaying the members of said transformed population for expression of an antibody molecule capable of binding said preselected ligand, thereby identifying tranεformantε containing εaid diciεtronic DNA molecule; and

(1) εegregating an identified tranεformant to εtep (d) from said population, thereby producing said isolated diciεtronic DNA molecule.

22. A kit compriεing an encloεure containing, in εeparate containerε, an outεide firεt polypeptide-encoding gene primer, an outεide εecond polypeptide-encoding gene primer, and a polynucleotide εtrand having a 3 '-terminal priming portion, a ciεtronic bridge coding portion, and a 5'-terminal primer template portion, εaid 3'-terminal priming portion having a nucleotide baεe εequence homologouε to a portion of the primer extenεion product of one of said outside primerε, said 5'-terminal primer template portion encoding a nucleotide base sequence homologous to a portion of the primer extension product of the other of said outside primerε and εaid ciεtronic bridge coding portion encoding at leaεt one εtop codon in the same reading frame as εaid upεtream ciεtron, and εignals for the initiation of translation of the downstream cistron.

23. The kit of claim 22 wherein said outεide first and outside second polypeptide-encoding gene primerε are V_H and V_L gene primerε, reεpectively.

24. A kit compriεing an encloεure containing, in εeparate containerε, an outεide firεt polypeptide-encoding gene primer, an outεide εecond polypeptide-encoding gene primer, an inεide firεt polypeptide-encoding gene primer having a 3*-terminal priming portion and a 5'-terminal non-priming portion, εaid 3'-terminal priming portion compriεing a nucleotide εequence homologouε to a conεerved portion of a firεt polypeptide-encoding gene, and an inside second polypeptide-encoding gene primer having a 3'-terminal priming portion and a 5'-terminal hybridizing portion complementary to the 5'-terminal non-priming portion of said inside firεt polypeptide-encoding gene primer, εaid 3'-terminal priming portion compriεing a nucleotide εequence homologouε to a conεerved portion of a second polypeptide-encoding gene, said first polypeptide inside and second polypeptide inside primers, when hybridized, forming a duplex encoding a double-stranded cistronic bridge for linking said upstream and downstream cistrons, one strand of said bridge encoding at least one stop codon in the same reading frame as said upεtream ciεtron, and εignalε for the initiation of tranεlation of the downεtream ciεtron.

25. The kit of claim 24 wherein said outside first and outside second polypeptide-encoding gene primers are V_H and V_L gene primerε, respectively.

26. A library of dicistronic DNA molecules produced by the method of any one of Claims 1-3, or 14-20.

27. A dicistronic DNA molecule produced by the method of any one of Claims 4-13.

28. An isolated dicistronic expression vector produced by the method of Claim 21.