Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberWO1990015882 A1
Publication typeApplication
Application numberPCT/FR1990/000435
Publication date27 Dec 1990
Filing date15 Jun 1990
Priority date16 Jun 1989
Publication numberPCT/1990/435, PCT/FR/1990/000435, PCT/FR/1990/00435, PCT/FR/90/000435, PCT/FR/90/00435, PCT/FR1990/000435, PCT/FR1990/00435, PCT/FR1990000435, PCT/FR199000435, PCT/FR90/000435, PCT/FR90/00435, PCT/FR90000435, PCT/FR9000435, WO 1990/015882 A1, WO 1990015882 A1, WO 1990015882A1, WO 9015882 A1, WO 9015882A1, WO-A1-1990015882, WO-A1-9015882, WO1990/015882A1, WO1990015882 A1, WO1990015882A1, WO9015882 A1, WO9015882A1
InventorsBruno Christian Henri Xavier Oury, Yves Michel Markowicz, Bernabé Fortunato Felipe CHUMPITAZI, Nadine Cristina, Régis MACHE, Pierre Ambroise-Thomas
ApplicantCentre National De La Recherche Scientifique (Cnrs)
Export CitationBiBTeX, EndNote, RefMan
External Links: Patentscope, Espacenet
Nucleic acid and nucleotidic probes for plasmodium falciparum, and their application in the detection of plasmodium falciparum
WO 1990015882 A1
Abstract
The invention relates to a nucleic acid and an oligonucleotide as derivant, as well as the probes constituted by or including said nucleic acid and oligonucleotide, specific to Plasmodium falciparum DNA. The invention also relates to a hybridation process for the hybridation of said probes with Plasmodium falciparum DNA as well as a process for the in vitro detection of Plasmodium falciparum.
Claims  translated from French  (OCR text may contain errors)
REVEND ICftT IONS RESELLS ICftT ION
1 - Acide nucléique caractérisé en ce qu ' il comprend la séquence nucleotidique de la figure 1 ou la séquence complémentaire correspondante . 1 - Nucleic acid characterized in that it comprises the nucleotide sequence of Figure 1 or the corresponding complementary sequence.
2 - Oligonucléotide dérivant d'un acide nucléique selon la revendication 1, caractérisé en ce qu'il comprend la séquence suivante : 2 - An oligonucleotide derived from a nucleic acid according to claim 1, characterized in that it comprises the following sequence:
(5 ' ) TAGGTCTTAAGGTAACTAAT (3 ' ) (5 ') TAGGTCTTAAGGTAACTAAT (3')
ou la séquence complémentaire correspondante suivante : or the corresponding complementary sequence follows:
( 5 ' ) TTAGTTACCTTAAGACCTA ( 3 ' ) . (5 ') TTAGTTACCTTAAGACCTA (3').
3 - Sonde pour détecter la présence de 3 - Probe for detecting the presence of
Plasmodium falciparum dans un échantillon, caractérisée en ce qu'elle est constituée par ou qu'elle comprend tout ou partie de la séquence complémentaire de l'acide nucléique de la revendication 1, ou toute sonde nucleotidique ne se distinguant de la précédente au niveau de la séquence nucleotidique que par des substitutions et/ou additions et/ou suppressions de un ou plusieurs nucléotides n'entraînant pas de modification des propriétés d'hybridation de ladite sonde avec l'acide nucléique de la revendication 1. Plasmodium falciparum in a sample, characterized in that it consists of or comprises all or part of the sequence complementary to the nucleic acid of claim 1, or any nucleotide probe differing from the previous level the nucleotide sequence as substitutions and / or additions and / or deletions of one or more nucleotides not causing modification of the hybridization properties of said probe with the nucleic acid of claim 1.
4 - Sonde pour détecter la présence de Plasmodium falciparum dans un échantillon selon la revendication 3, caractérisée en ce qu'elle est constituée par ou qu'elle comprend une séquence de 10 à 450 nucléotides consécutifs contenus dans la séquence complémentaire de l'acide nucléique selon la revendication 1. 4 - Probe for detecting the presence of Plasmodium falciparum in a sample according to claim 3, characterized in that it consists of or comprises a sequence from 10 to 450 consecutive nucleotides contained in the sequence complementary to the nucleic acid according to claim 1.
5 - Sonde pour détecter la présence de Plasmodium falciparum dans un échantillon selon la revendication 4, caractérisée en ce qu'elle est constituée par ou qu'elle comprend une séquence nucleotidique complémentaire de 1 'oligonucléotide de la revendication 2, ou toute sonde nucleotidique ne se distinguant de la 5 - Probe for detecting the presence of Plasmodium falciparum in a sample according to claim 4, characterized in that it consists of or comprises a complementary nucleotide sequence of one oligonucleotide of claim 2, or any nucleotide probe differing from the
FEUILLE DE REMPLACEMENT précédente au niveau de la séquence nucleotidique que par des substitutions et/ou additions et/ou suppressions de un ou plusieurs nucléotides n'entraînant pas de modification des propriétés d'hybridation de ladite sonde avec 1 'oligonucléotide de la revendication 2. Previous SUBSTITUTE SHEET at the nucleotide sequence as substitutions and / or additions and / or deletions of one or more nucleotides not causing modification of the hybridization properties of said probe with one oligonucleotide of claim 2.
6 - Sonde pour détecter la présence de Plasmodium falciparum dans un échantillon, caractérisée en ce qu'elle est constituée par la répétition de la séquence d'une ou plusieurs sondes selon l'une quelconque des revendications 4 ou 5. 6 - Probe for detecting the presence of Plasmodium falciparum in a sample, characterized in that it is constituted by the repetition of the sequence of one or more probes according to any one of claims 4 or 5.
7 - Sonde selon l'une quelconque des revendications 1 à 6, caractérisée en ce qu'elle est marquée radioactivement ou par un marqueur du type enzymatique, antigènique, ligand, luminescent ou fluorescent . 7 - A probe according to any one of claims 1 to 6, characterized in that it is labeled radioactively or by a marker enzyme type antigenic, ligand, luminescent or fluorescent. 8 - Procédé d'hybridation d'une sonde nucleotidique selon l'une quelconque des revendications 3 à 8 - A method of hybridization of a nucleotide probe according to any one of claims 3 to
6 avec l'ADN de Plasmodium falciparum, caractérisé en ce qu'il comprend les étapes suivantes : 6 with the DNA of Plasmodium falciparum, characterized in that it comprises the following steps:
- le traitement de pré-hybridation d'un support, comme un filtre de nitrocellulose ou une membrane de nylon, sur lequel est fixé l'ADN extrait de Plasmodium falciparum. - The treatment of pre-hybridization of a support, such as nitrocellulose filter or nylon membrane, on which is fixed the DNA extracted from Plasmodium falciparum. avec une solution de pré-hybridation, with a prehybridization solution,
- l'hybridation dans une solution identique à la solution de pré-hybridation comprenant en outre une sonde nucleotidique selon l'une quelconque des revendication 3 à 6, - Hybridization in a solution identical to the prehybridization solution further comprising a nucleotide probe according to any one of claims 3 to 6,
- plus ieurs lavages successifs . - More ieurs successive washes.
9 - P ro cédé d ' hybridat ion d ' une s onde nucleotidique selon la revendicat ion 3 ave cl ' ADN de Plasmodium falciparum. 9 - P ro ceded to hybridat ion of a nucleotide s wave in the revendicat ion 3 ave cl DNA of Plasmodium falciparum. caractérisé en ce qu ' il comprend les étapes suivantes : characterized in that it comprises the following steps:
- le traitement de pré-hybridation du filtre . - The treatment of pre-hybridization of the filter. Le filtre sur lequel est fixé l ' ADN extrait de P la smodium falciparum est placé dans un sac plastique soudé , et incubé pendant 30 minute s à 33°C ave c une s olut ion de pré¬ hybridation ayant la composition suivante : - Tampon 5 fois SSC The filter to which is attached the DNA extracted from the smodium P falciparum is placed in a sealed plastic bag, and incubated for 30 minutes at 33 ° C s w ith a s olut pré¬ hybridization ion having the following composition: - Stamp 5 x SSC
FEUILLE DE REMPLACEMENT - Ficoll 400 0,1 % Poids/Volume SUBSTITUTE SHEET - Ficoll 400 0.1% weight / volume
- Polyvinylpyrrolidone 0,1 % Poids/Volume - Polyvinylpyrrolidone 0.1% weight / volume
- Phosphate de Sodium pH 6,5 50 mM - Sodium phosphate pH 6.5 50 mM
- Glycine 1 % Poids/Volume - Glycine 1% weight / volume
- SDS (Sodium Dodécyl Sulfate) 0,1 % Poids/Volume - SDS (sodium dodecyl sulphate) 0.1% weight / volume
- ADN de sperme de Hareng dénaturé 100 mg/ml en présence de 50 % de formamide, - Denatured herring sperm DNA to 100 mg / ml in the presence of 50% formamide,
- l'hybridation dans une solution tampon identique à la solution de pré-hybridation, comprenant en outre la sonde nucleotidique selon la revendication 3 marquée notamment de manière radioactive, en présence de 50 % de formamide, pendant 2 heures à 33°C, - Hybridization in an identical buffer solution to the prehybridization solution, further comprising the nucleotide probe according to claim 3 characterized in particular by radioactivity, in the presence of 50% formamide for 2 hours at 33 ° C,
- les lavages successifs suivants : - Successive washings the following:
. . 4 lavages de 5 minutes dans un tampon 5 fois SSC en présence de SDS 0,1 %, à température ambiante, Four 5 min washes in 5 x SSC buffer in the presence of 0.1% SDS, at room temperature,
. . 1 lavage de 20 minutes dans un tampon 2 fois SSC en présence de SDS 0,1 %, à température ambiante. 1 wash for 20 minutes in a 2 x SSC buffer in the presence of 0.1% SDS, at room temperature.
10 - Procédé d'hybridation d'un sonde nucleotidique selon la revendication 5 avec l'ADN de Plasmodium falciparum, caractérisé en ce qu'il comprend les étapes suivantes : 10 - A method of hybridization of a nucleotide probe according to claim 5 with Plasmodium falciparum DNA, characterized in that it comprises the following steps:
- le traitement de pré-hybridation du filtre. - The treatment of pre-hybridization of the filter. Le filtre sur lequel est fixé l'ADN extrait de Plasmodium falciparum est placé dans un sac plastique soudé, et incubé pendant 1 heure à 30°C avec une solution de pré-hybridation ayant la composition suivante : Folder to which is attached the DNA extracted from Plasmodium falciparum is placed in a sealed plastic bag and incubated for 1 hour at 30 ° C with a prehybridization solution having the following composition:
- Tampon 5 fois SSC - Buffer 5 x SSC
- Ficoll 400 o, 1 % Poids/Volume - Ficoll 400 o, 1% weight / volume
- Polyvinylpyrrolidone o, 1 % Poids/Volume - Polyvinylpyrrolidone o, 1% weight / volume
- Phosphate de Sodium pH 6,5 50 mM - Sodium phosphate pH 6.5 50 mM
- Glycine 1 % Poids/Volume - Glycine 1% weight / volume
- SDS (Sodium Dodécyl Sulfate) o, 1 % Poids/Volume - SDS (sodium dodecyl sulfate) o, 1% weight / volume
- ADN de sperme de Hareng dénaturé 100 mg/ml - Denatured herring sperm DNA 100 mg / ml
- l'hybridation dans une solution tamt identique à la solution de pré-hybridation, comprenant en outre la sonde nucleotidique selon la revendication 5 - Hybridization in the same solution tamt to the prehybridization solution, further comprising the nucleotide probe according to claim 5
FEUILLE DE REMPLACEMENT marquée notamment de manière radioactive, pendant 4 heures à 30°C, SUBSTITUTE SHEET particular radioactively labeled, for 4 hours at 30 ° C,
- les lavages successifs suivants : - Successive washings the following:
. . 2 lavages de 5 minutes dans un tampon 5 fois SSC, à température ambiante, 2 washes for 5 minutes in a buffer of 5 x SSC, at ambient temperature,
. . 1 lavage de 5 minutes dans un tampon 5 fois SSC en présence de SDS 0,1 %, à température ambiante, One 5 minute wash in buffer 5 x SSC in the presence of 0.1% SDS, at room temperature,
. . 1 lavage de 20 minutes dans un tampon 5 fois SSC, en présence de SDS 0,1 %, à température ambiante. 1 wash for 20 minutes in a 5 x SSC buffer, in the presence of 0.1% SDS, at room temperature. 11 - Procédé de détection in vitro de Plasmodium falciparum dans un prélèvement biologique susceptible de le contenir, caractérisé en ce que après avoir rendu l'ADN de Plasmodium falciparum éventuellement contenu dans le prélèvement biologique, accessible et monocaténaire, on le met en contact avec une sonde nucleotidique selon l'une quelconque des revendications 3 à 6, dans des conditions favorables à l'hybridation et l'on détecte les hybrides éventuellement formés. 11 - A method of in vitro detection of Plasmodium falciparum in a biological sample liable to contain it, characterized in that after making the DNA of Plasmodium falciparum possibly contained in the biological sample, accessible and single-stranded, it is brought into contact with a nucleotide probe according to any one of claims 3 to 6, under conditions conducive to hybridization and detecting the hybrids possibly formed.
12 - Kit pour la mise en oeuvre d'un procédé de détection in vitro de Plasmodium falciparum selon la revendication 7, caractérisé en ce qu'il comprend : une quantité déterminée d'une sonde nucleotidique selon l'une des revendications 3 à 6, 12 - A kit for implementing a method for detecting in vitro of Plasmodium falciparum according to claim 7, characterized in that it comprises: a determined amount of a nucleotide probe according to one of claims 3 to 6,
- un milieu approprié à la réalisation d'une réaction d'hybridation entre l'ADN de Plasmodium falciparum et ladite sonde, - An appropriate medium for carrying out a hybridization reaction between the DNA of Plasmodium falciparum and said probe,
- des réactifs permettant la détection des hybrides formés entre l'ADN et la sonde lors de ladite réaction d'hybridation. - Reagents enabling the detection of the hybrids formed between the DNA and the probe during said hybridization reaction.
FEUILLE DE REMPLACEMENT SUBSTITUTE SHEET
Description  translated from French  (OCR text may contain errors)

Acide nucléique et sondes nucléotidiques spécifiques de plasmodium falciparum, et leur application pour la détection de plasmodium falciparum nucleic acid and nucleotide probes specific for Plasmodium falciparum, and their application for the detection of P. falciparum

La présente invention a été faite au Laboratoire de Parasitologie et Pathologie Exotique et au laboratoire de Biologie moléculaire Végétale de l'Université Joseph Fourier-Grenoble I, tous deux Unités de Recherche associées au CNRS. This invention was made at the Laboratory of Parasitology and Tropical Pathology and Laboratory of Plant Molecular Biology of the University Joseph Fourier-Grenoble I, both research units associated with the CNRS.

Le paludisme est une maladie infectieuse parasitaire due à une infestation des hématies par un hématozoaire du genre Plasmodium. Malaria is a parasitic infectious disease caused by an infestation of red blood cells by a parasite of the genus Plasmodium. transmis à l'homme par un insecte, l'anophèle. transmitted to humans by the anopheles mosquito. Plasmodium falciparum est l'espèce plasmodiale la plus répandue et la plus dangereuse, à l'origine d'une morbidité élevée. Plasmodium falciparum is the parasite species most common and most dangerous, the cause of high morbidity. Environ 40% de la population mondiale est exposée au paludisme. About 40% of the world population is exposed to malaria. Des efforts considérables ont été entrepris pour contrôler, soigner et éventuellement éradiquer cette maladie; Considerable efforts have been made to control, treat and eventually eradicate this disease; il reste toutefois nécessaire pour atteindre ces objectifs de disposer de moyens de diagnostic spécifiques, simples et peu onéreux. However, it remains necessary to achieve those objectives have specific diagnostic tools, simple and inexpensive.

Les techniques usuelles de diagnostic reposent sur l'observation au microscope du sang du malade et doivent être effectuées par un manipulateur entraîné; The usual diagnostic techniques based on microscopic observation of the patient's blood and must be performed by a trained manipulator; la sensibilité de détection de ces techniques est de 10 à 200 hématies parasitées/mm3, cependant les faibles parasitémies (inférieure à 1000 hématies parasitées/mm3) nécessitent un temps de lecture important et peuvent donner lieu à de faux négatifs . these techniques the detection sensitivity is from 10 to 200 parasitized erythrocytes / mm3, however the low parasitaemia (below 1000 parasitized erythrocytes / mm 3) require significant playing time and can result in false negatives.

Bien qu'impossible à automatiser ces techniques sont utilisées couramment pour le dépistage de l'accès palustre. While impossible to automate these techniques are routinely used to screen for malaria.

Des techniques immunologiques reposant sur la détection d'anticorps dans le sérum de malade ont été proposées mais ce type d'analyse sérologique est peu intéressante car la présence d'anticorps ne témoigne que Immunological techniques based on the detection of antibodies in the patient's serum have been proposed but this type of serological analysis is somewhat interesting because the presence of antibodies that testifies

FEUILLE DE REMPLACEMENT d'un contact antérieur avec le parasite et une faible positivité du sérum ne permet pas de conclure à la présence ou à l'absence de parasites dans le sang. SUBSTITUTE SHEET a previous contact with the parasite and a weak positive serum does not conclude the presence or absence of parasites in the blood. Ces techniques sont toutefois utilisées dans les centres de transfusion sanguine pour contrôler les s jets particulièrement exposés . These techniques, however, are used in blood transfusion centers to monitor s particularly exposed jets.

Pour pallier ces inconvénients, des techniques d'hybridation moléculaire ont été développées afin de détecter dans le sang de patients la présence de l'ADN de Plasmodium falciparum. To overcome these drawbacks, molecular hybridization techniques have been developed for detecting in the blood of patients the presence of Plasmodium falciparum DNA. L'utilisation de sondes moléculaires d'ADN spécifiques, pour diagnostiquer le paludisme a été décrite pour la première fois par Franzen, L. et al (The Lancet, 1984, _L, 525-528) . The use of molecular probes specific for DNA, to diagnose malaria has been described for the first time by Franzen, L. et al (The Lancet, 1984 _L, 525-528).

Excepté l'ADN génomique total utilisé par Pollac et al (Poliack, Y. et al (1985) Am. J. Trop. Med. Hyg., J2 , 663-667), d'autres sondes, clonées dans différents vecteurs ( Barker, RH et al (1986) Science, 231 , 1434- 1436; Ξnea, V. (1986) Mol. Cell. Biol., £., 321-324 ; Zolg, J. . et al (1987) Mol. Biochem. Parasitol., 22 .. 145-151) ou préparées par synthèse nucléotidique (Me Laughlin, GL et al (1987) The Lancet, 714-716) ont été développées. Except total genomic DNA used by Pollac et al (Poliack, Y. et al (1985) Am. J. Trop. Med. Hyg., J 2, 663-667), other probes, cloned into different vectors (Barker , RH et al (1986) Science, 231, 1434- 1436; Ξnea, V. (1986) Mol Cell Biol, £, 321-324;.... Zolg, J. et al (1987) Mol Biochem... Parasitol., 22 .. 145-151) or prepared by nucleotide synthesis (McLaughlin, GL et al (1987) Lancet, 714-716) have been developed.

Parallèlement, l'étude du génome de Plasmodium falciparum a mis en évidence la présence de séquences nucléotidiques hautement répétées spécifiques du parasite. Meanwhile, the study of the genome of Plasmodium falciparum revealed the presence of specific highly repeated nucleotide sequences of the parasite. La construction puis le criblage de banques génomiques de Plasmodium falciparum ont permis d'identifier et de séquencer des fragments d'ADN génomique contenant ces séquences hautement répétées. The construction and screening of genomic libraries of Plasmodium falciparum have been identified and sequenced genomic DNA fragments containing these highly repeated sequences. Le clone d'ADN, dénommé pRep- Hind décrit par Aslund, L. et Franzen, L. et al ( J. Mol. Biol. 1985, 185. 509-516) contient 1,7 kb et présente un insert de 0,57 kb constituée de la répétition d'une séquence unitaire de 21 nucléotides, cette séquence unitaire a été dénommée PFR1 : elle présente un taux de variation de 25% et a été identifiée par les mêmes auteurs dans d'autres clones d'ADN isolés de la même banque génomique de Plasmodium falciparum. The DNA clone, called pRep- described by Hind Aslund, L. and Franzen, L. et al (J. Mol. Biol. 1985. 185. 509-516) and contains 1.7 kb has an insert of 0, 57 kb consisting of the repetition of a unit sequence of 21 nucleotides, this unit sequence was designated PFR1: it has a 25% change rate and has been identified by the same authors in other isolated DNA clones the same genomic library of Plasmodium falciparum.

La Demande de Brevet Européen N° 135 108 au nom de ROCKFELLER UNIVERSITY décrit également des fragments de European Patent Application No. 135 108 in the name of Rockefeller University also describes fragments

FEUILLE DE REMPLACEMENT l'ADN génomique de Plasmodium falciparum contenant des séquences hautement répétées, lesdits fragments permettant de constituer des sondes d'hybridation pour la détection de l'ADN de Plasmodium falciparum. SUBSTITUTE SHEET genomic DNA of Plasmodium falciparum containing highly repeated sequences, said fragments to form hybridization probes for the detection of Plasmodium falciparum DNA. Cette demande décrit notamment deux clones dénommés pPFRl et . This application describes in particular two clones and referred pPFRl. pPFR5 contenant respectivement un insert de 1,2 kb et 0,32 kb. pPFR5 respectively containing an insert of 1.2 kb and 0.32 kb. Le séquençage de ces inserts a montré que la séquence répétée de pPFRl contenait 51 nucléotides et celle de pPFR5 contenait 21 nucléotides . Sequencing of the inserts showed that the repeated sequence of pPFRl contained 51 nucleotides and the pPFR5 contained 21 nucleotides. Zolg, J. . Zolg, J.. et al ( Mol. Biochem. Parasitol. et al (Mol. Biochem. Parasitol.

1987, 22., 145-151) décrivent également un clone dénommé "26" contenant un insert de 0,147 kb constitué de la répétition d'une séquence unitaire de 21 nucléotides identique à celle décrite par Franzen, L. et al. 1987, 22., 145-151) also describe a clone called "26" containing a 0.147 kb insert consisting of the repetition of a unit sequence of 21 nucleotides identical to that described by Franzen, L. et al. Les tests d'hybridations réalisés à partir des sondes issues des clones pRep-Hind et "26" permettent une détection satisfaisante de l'ADN de Plasmodium falciparum, ainsi la sonde plasmidique pRep-Hind détecte 100 pg D'ADN génomique après 18 heures d'exposition (Me Laughlin, GE et al (1987) J. Clin. Microbiol . , 23., (5), 791-795) . Hybridizations tests from the probes from clones pRep-Hind and "26" allow satisfactory detection of DNA of Plasmodium falciparum and the pRep-Hind plasmid probe detect 100 pg genomic DNA after 18 hours exposure (McLaughlin, GE et al (1987) J. Clin. Microbiol., 23, (5), 791-795).

La présente invention concerne un nouvel acide nucléique ainsi qu'un oligonucléotide en dérivant, lesquelles constituent des sondes nucléotidiques spécifiques de Plasmodium falciparum et pouvant hybrider l'ADN de souches d'origines géographiques différentes. The present invention relates to a novel nucleic acid and an oligonucleotide derived therefrom, which are specific nucleotide probes of Plasmodium falciparum and can hybridize DNA of different geographical origins strains. L'invention concerne également le procédé d'hybridation de l'ADN de Plasmodium falciparum avec les sondes de l'invention, ainsi que le procédé pour détecter Plasmodium falciparum dans un échantillon et le kit pour la mise en oeuvre dudit procédé de détection. The invention also concerns the DNA hybridization method of Plasmodium falciparum with the probes of the invention and the method for detecting Plasmodium falciparum in a sample and the kit for carrying out said detection method.

Les travaux de recherche réalisés par les Inventeurs ont concerné le clonage et le séquençage de fragments de l'ADN génomique de Plasmodium falciparum comprenant des séquences hautement répétées. The research conducted by the inventors involved cloning and sequencing fragments of genomic DNA of Plasmodium falciparum comprising highly repetitive sequences. Ces travaux ont permis d'obtenir l'acide nucléique de l'invention qui est représenté à la figure 1, dans laquelle les lettres indiquent les nucléotides suivants : A pour le résidu This work has allowed to obtain the nucleic acid invention shown in Figure 1, wherein the letters indicate the following nucleotides: A for the residue

FEUILLE DE REMPLACEMENT adénylique, C pour le résidu cytidylique, G pour le résidu guanidylique et T pour le résidu thymidylique; SHEET adenylic REPLACEMENT C for cytidylic residue, G for guanidylique residue and T for thymidylic residue; et où (5') et (3') indiquent les extrémités 5' et 3' dudit acide nucléique. and where (5 ') and (3') indicate the 5 'and 3' of said nucleic acid. Cet acide nucléique qui a reçu la dénomination pUF 28 comporte 1,846 kb dont 33,15 % de G et C. Il est constitué par la répétition d'une séquence unitaire de 21 nucléotides en 87 copies; This nucleic acid which has received the name PUF 28 comprises 1,846 kb of which 33.15% G and C. It is constituted by the repetition of a unit sequence 21 nucleotides in 87 copies; celles-ci diffèrent entre elles de 1 à 9 nucléotides mais présentent au moins une homologie de 55 % sur toute la séquence de l'acide nucléique pUF 28. Ces variations résultent de la duplication en nombreux exemplaires d'une séquence de base, et se traduisent par des remplacements et/ou des additions et/ou des suppressions de un ou plusieurs nucléotides. they differ by 1 to 9 nucleotides but have at least 55% homology over the entire sequence of the nucleic acid PUF 28. These variations result from the duplication many copies of a base sequence, and result in substitutions and / or additions and / or deletions of one or more nucleotides. Ces modifications apparaissent clairement à la figure 1, dans laquelle les 87 copies de la séquence unitaire constituant l'acide nucléique pUF 2 sont superposées . These changes clearly shown in Figure 1 wherein the 87 copies of the unit sequence constituting nucleic acid PUF 2 are superimposed.

La présente invention concerne donc un acide nucléique comprenant la séquence nucleotidique de la figure 1 ou la séquence complémentaire correspondante capable de s'apparier avec la même portion de l'ADN génomique de Plasmodium falciparum en raison de sa nature bicaténaire. The present invention thus relates to a nucleic acid comprising the nucleotide sequence of Figure 1 or the corresponding complementary sequence capable of pairing with the same portion of the genomic DNA of Plasmodium falciparum because of its double-stranded in nature.

L'invention- concerne également un oligonucléotide qui a reçu la dénomination OLI 28 et qui dérive de l'acide nucléique de l'invention pUF 28. L'oligonucléotide OLI 28 comprend 20 nucléotides dont la séquence est la suivante : The invention-also relates to an oligonucleotide which has received the name OLI 28 and derived from the nucleic acid of the invention PUF 28. The oligonucleotide OLI 28 comprises 20 nucleotides whose sequence is:

(5 ' ) AGGTCTTAAGGTAACTAAT (3 ' ) (5 ') AGGTCTTAAGGTAACTAAT (3')

L ' ol igonu cléot ide OLI 28 est présent dans l ' acide nucléique pUF 28 en quatre copies soulignées dans la figure 1 . The ol igonu cléot ide OLI 28 is present in the nucleic acid PUF 28 in four copies highlighted in Figure 1.

L ' invent ion concerne nature llement , au ssi 1 ' oligonucléotide complémentaire de OLI 28 et ayant la séquence nucleotidique suivante : The invent ion relates kind llement at 1 iff 'oligonucleotide complementary OLI 28 and having the nucleotide sequence:

FEUILLE DE REMPLACEMENT (5 ' )ATTAGTTACCTTAAGACCTA(3 ' ) SUBSTITUTE SHEET (5 ') ATTAGTTACCTTAAGACCTA (3')

capable de s'apparier avec la même portion d'ADN génomique de Plasmodium falciparum en raison de sa nature bicaténaire. capable of pairing with the same portion of the DNA genome of Plasmodium falciparum because of its double-stranded in nature.

Font également partie de l'invention les acides nucléiques et les oligonucléotides dans lesquels les groupes thymidine sont remplacés par des groupes uracyles . also part of the invention the nucleic acids and oligonucleotides in which the thymidine groups are replaced by uracils groups.

L'oligonucléotide OLI 28 peut être préparé par synthèse chimique, l'acide nucléique pUF 28 est lui isolé à partir d'un clone bactérien recombinant RRlD/pUF28 par des méthodes connues dans l'état de la technique. The oligonucleotide OLI 28 can be prepared by chemical synthesis, nucleic acid 28 is PUF him isolated from a recombinant bacterial clone RRlD / pUF28 by methods known in the art.

L'acide nucléique pUF 28 et 1 'oligonucléotide OLI 28 présentent la caractéristique de s'hybrider spécifiquement avec l'ADN de Plasmodium falciparum. The nucleic acid PUF 28 and one oligonucleotide OLI 28 have the characteristic of specifically hybridizing with the DNA of Plasmodium falciparum.

L'invention concerne donc également les sondes pour détecter la présence de Plasmodium falciparum dans un échantillon biologique, constituées par ou comprenant tout ou partie de la séquence complémentaire d'un acide nucléique selon l'invention, ou toute sonde ne se distinguant des précédentes au niveau de la séquence nucleotidique que par des substitutions et/ou additions et/ou suppressions de un ou plusieurs nucléotides n'entraînant pas de modification des propriétés d'hybridation de ladite sonde avec un acide nucléique selon l'invention, dans les conditions d'hybridation définies ci après : The invention therefore also relates to probes for detecting the presence of Plasmodium falciparum in a biological sample, consisting of or comprising all or part of the complementary sequence of a nucleic acid of the invention or any probe differing from the preceding level of the nucleotide sequence as substitutions and / or additions and / or deletions of one or more nucleotides which do not entail changing the hybridization properties of the probe with a nucleic acid of the invention under the conditions of hybridization defined below:

- traitement de pré-hybridation du support sur lequel est fixé la sonde, à 33°C pendant 30 minutes avec une solution de pré-hybridation ayant la composition suivante : - Prehybridization treatment of the support on which is fixed the probe, at 33 ° C for 30 minutes with a prehybridization solution having the following composition:

tampon 5 fois SSC (1 fois SSC=Nacl 0,15M; Citrate de 5 times SSC buffer (1 x SSC = 0.15 M NaCl; Citrate

Sodium 0,015M) Sodium 0.015M)

Ficoll 400 0,1 % Poids/Volume Ficoll 400 0.1% weight / volume

Polyvinylpyrrolidone 0,1 % Poids/Volume Polyvinylpyrrolidone 0.1% weight / volume

Phosphate de Sodium pH 6,5 50 mM Sodium Phosphate pH 6.5 50 mM

Glycine 0,1 % Poids/Volume Glycine 0.1% weight / volume

SDS (Sodium Dodécyl Sulfate) 0,1 % Poids/Volume SDS (sodium dodecyl sulphate) 0.1% weight / volume

ADN de Sperme de Hareng dénaturé 100 μg/ml Herring sperm DNA denatured 100 mcg / ml

FEUILLE DE REMPLACEMENT en présence de 50 % de formamide. SUBSTITUTE SHEET with 50% formamide.

- hybridation avec l'acide nucléique complémentaire, pendant 2 heures à 33°C dans une solution tampon identique à la solution de pré-hybridation précédente, en présence de 50 % de formamide. - Hybridization with complementary nucleic acid, for 2 hours at 33 ° C in a buffer solution identical to the previous pre-hybridization solution in the presence of 50% formamide.

- lavages successifs avec les solutions suivantes : - Successive washes with the following solutions:

. . 4 lavages de 5 minutes dans un tampon 5 fois SSC en présence de SDS 0,1 %, à température ambiante, . Four 5 min washes in 5 x SSC buffer in the presence of 0.1% SDS, at room temperature. 1 lavage de 20 minutes dans un tampon 2 fois 1 wash for 20 minutes in a buffer 2 times

SSC en présence de SDS 0,1 %, à température ambiante. SSC in the presence of 0.1% SDS, at room temperature.

L'invention concerne aussi les sondes pour détecter la présence de Plasmodium falciparum dans un échantillon biologique, constituées par ou comprenant une séquence de 10 à 450 nucléotides consécutifs contenus dans la séquence complémentaire d'un acide nucléique selon 1' invention. The invention also relates to probes for detecting the presence of Plasmodium falciparum in a biological sample, consisting of or comprising a sequence of 10 to 450 consecutive nucleotides contained in the sequence complementary to a nucleic acid according to one invention.

L'invention concerne plus particulièrement les sondes pour détecter Plasmodium falciparum dans un échantillon, constituées par ou comprenant une séquence nucleotidique complémentaire d'un oligonucléotide selon l'invention, ou toute sonde ne se distinguant de la précédente au niveau de la séquence nucleotidique que par des substitutions et/ou additions et/ou suppressions de un ou plusieurs nucléotides n'entraînant pas de modification des propriétés d'hybridation de ladite sonde avec un oligonucléotide selon l'invention, dans les conditions d'hybridation définies ci-après : The invention relates more particularly to probes for detecting Plasmodium falciparum in a sample, consisting of or comprising a complementary nucleotide sequence of an oligonucleotide according to the invention or any probe differing from the previous level of the nucleotide sequence by substitutions and / or additions and / or deletions of one or more nucleotides not causing modification of the hybridization properties of said probe with an oligonucleotide according to the invention in the hybridization conditions defined below:

- traitement de pré-hybridation du support sur lequel est fixé la sonde, à 30°C pendant 30 minutes avec une solution de pré-hybridation ayant la composition suivante : . - Prehybridization treatment of the support on which is fixed the probe at 30 ° C for 30 minutes with a prehybridization solution having the following composition:. tampon 5 fois SSC 5 times SSC buffer

. . Ficoll 400 0,1 % Poids/Volume Ficoll 400 0.1% weight / volume

. . Polyvinylpyrrolidone 0,1 % Poids/Volume . Polyvinylpyrrolidone 0.1% weight / volume. Phosphate de Sodium pH 6,5 50 mM Sodium Phosphate pH 6.5 50 mM

. . Glycine 0,1 % Poids/Volume Glycine 0.1% weight / volume

. . SDS (Sodium Dodécyl Sulfate) 0,1 % Poids/Volume SDS (sodium dodecyl sulphate) 0.1% weight / volume

FEUILLE DE REMPLACEMENT . SUBSTITUTE SHEET. ADN de Sperme de Hareng dénaturé 100 μg/ml Herring sperm DNA denatured 100 mcg / ml

- hybridation avec 1 ' oligonucléotide complémentaire, pendant 4 heures à 30°C dans une solution tampon identique à la solution de pré-hybridation précédente . - Hybridization with one complementary oligonucleotide for 4 hours at 30 ° C in a buffer solution identical to the previous pre-hybridization solution. lavages successifs avec les solutions suivantes : successive washings with the following solutions:

. . 2 lavages de 5 minutes dans un tampon 5 fois SSC à température ambiante, . 2 washes for 5 minutes in a buffer of 5 x SSC at room temperature. 1 lavage de 5 minutes dans un tampon 5 fois One 5 minute wash in a 5 times buffer

SSC en présence de SDS 0,1 %, à température ambiante. SSC in the presence of 0.1% SDS, at room temperature.

. . 1 lavage de 20 minutes dans un tampon 5 ' fois SSC en présence de SDS 0,1 %, à température ambiante. 1 wash for 20 minutes in a buffer 5 'x SSC in the presence of 0.1% SDS, at room temperature.

Les conditions d'hybridation définies ci-dessus constituent des conditions préférées, mais ne sont nullement limitatives et peuvent être modifiées sans affecter pour autant les propriétés de reconnaissance et d'hybridation des sondes et des acides nucléiques et des oligonucléotides conformes à l'invention. The hybridization conditions defined above are preferred conditions, but are in no way limiting and can be modified without affecting the recognition properties and hybridization probes and nucleic acids and oligonucleotides according to the invention. II est connu de " l'homme du métier qu'une séquence nucleotidique peut présenter des modifications comme des substitutions et/ou additions et/ou suppressions de un ou plusieurs nucléotides n'entraînant cependant pas de modification des propriétés, notamment d'hybridation de ladite séquence nucleotidique. It is known as "the art that nucleotide sequence can introduce amendments as substitutions and / or additions and / or deletions of one or more nucleotides does not entail modification of the properties, including hybridization said nucleotide sequence.

L'invention concerne encore les sondes pour détecter Plasmodium falciparum dans un échantillon, constituées par la répétition de la séquence d'une ou plusieurs sondes contenant de 10 à 450 nucléotides. The invention also relates to probes for detecting Plasmodium falciparum in a sample, consisting of the repetition of the sequence of one or more probes containing 10 to 450 nucleotides. On désignera ci-après par sonde pUF 28 r la sonde correspondant à l'acide nucléique pUF 28 et présentant donc la séquence de la figure 1, et par sonde OLI 28, la sonde correspondant à 1 'oligonucléotide OLI 28 et présentant donc la séquence suivante : Hereinafter be referred to as probe PUF 28 r the probe corresponding to the nucleic acid PUF 28 and thus having the sequence of Figure 1, and probe OLI 28, the probe corresponding to 1 oligonucleotide OLI 28 and thus having the sequence next :

(5 ' ) TAGGTCTTAAGGTAACTAAT (3 ' ) (5 ') TAGGTCTTAAGGTAACTAAT (3')

FEUILLE DE REMPLACEMENT Les sondes sont avantageusement marquées par tout marqueur classiquement utilisé. SUBSTITUTE SHEET The probes are preferably labeled with any marker conventionally used. Les sondes peuvent être marquées à l'aide d'un traceur radioactif comme 32 P, 35 S, The probes can be labeled with a radioactive tracer such as 32 P, 35 S,

125 I, 3 H, 14 C. Le marquage radioactif peut être réalisé selon une méthode quelconque connue de l'homme du métier. 125 I, 3 H, 14 C. The radioactive labeling can be carried out according to any method known to those skilled in the art.

Les sondes peuvent être marquées en 3 ' par addition d'un ou plusieurs déoxynucléotides ou ribonucléotides ou d'un didéoxynucléotide, marqués en alpha par le 32 P, en présence de la Terminal Déoxynucléotidyl Transférase; The probes may be labeled at the 3 'by the addition of one or more ribonucleotides or deoxynucleotides or a dideoxynucleotide, labeled alpha 32 P, in the presence of terminal deoxynucleotidyl transferase; les sondes peuvent également être marquées en 5' par transfert d'un groupe Phosphate radioactif d'un déoxynucléotidè ou d'un didéoxynucléotide libre marqué en position gamma, en présence de la T4 Polynucléotide Kinase, elles peuvent encore être marquées à chaque extrémité par adjonction d'une séquence quelconque radiomarquée en présence de T4 DNA ligase. probes may also be labeled at the 5 'by transfer of a radioactive phosphate group of a deoxynucleotide or dideoxynucleotide free labeled gamma position, in the presence of T4 polynucleotide Kinase, they may still be marked at each end by adding of any sequence radiolabeled in the presence of T4 DNA ligase.

La sonde pUF 28 est marquée de manière avantageuse par "Nick Translation" ou par "Random Priming" . PUF probe 28 is advantageously labeled by "nick translation" or "random priming". La sonde oligonucléotidique £_L_L 28 peut être marquée lors de sa synthèse chimique en incorporant un ou plusieurs déoxynucléotides radioactifs, la sonde OLI 28 est de manière avantageuse marquée à son extrémité 5' . The oligonucleotide probe _L_L £ 28 can be marked during its chemical synthesis by incorporating one or more radioactive deoxynucleotides, the OLI probe 28 is advantageously labeled at its 5 'end.

La méthode de détection de l'hybridation dépendra du marqueur radioactif utilisé et pourra reposer sur 1 ' autoradiographie, la scintillation liquide, le comptage gamma ou tout autre technique permettant de détecter l'émission du rayonnement émis par le marqueur radioactif. The hybridization detection method will depend on the radioactive tracer used and may be based on one autoradiography, liquid scintillation, gamma counting or any other technique for detecting the emission of radiation emitted by the radioactive marker.

Un marquage non radioactif peut également être utilisé, en associant aux sondes de l'invention des groupements présentant des propriétés immunologiques comme un antigène, une affinité spécifique pour certains réactifs comme un ligand, des propriétés physiques comme la fluorescence ou la luminescence, des propriétés permettant la complétion de réactions enzymatiques comme une enzyme ou un substrat d'enzyme. A non-radioactive labeling can also be used by associating the probes of the invention groups having immunological properties as an antigen, a specific affinity for some reagents such as a ligand, the physical properties such as fluorescence or luminescence properties for completion of enzymatic reactions such as an enzyme or an enzyme substrate. Le marquage non radioactif peut être fait par incorporation d'un analogue de nucléotide The non-radioactive labeling can be done by incorporation of a nucleotide analog

FEUILLE DE REMPLACEMENT comportant l'un de ces groupements, par "Nick Translation" ou par "Random Priming"; SUBSTITUTE SHEET containing one of these groups, for "Nick Translation" or "Random Priming"; ou par addition à l'extrémité 3' ou 5' de l'un de ces analogues. or by adding to the 3 'end or 5' end of one of these analogs. Il peut être fait également directement par modification chimique de l'ADN, comme la photobiotinylation ou la sulfonation. It can be done also by chemical modification of DNA, such as photobiotinylation or sulfonation.

L'invention concerne également un procédé d'hybridation d'une sonde nucleotidique avec l'ADN de Plasmodium falciparum, caractérisé en ce qu'il comprend les étapes suivantes : - le traitement de pré-hybridation d'un support, comme un filtre de nitrocellulose ou une membrane de nylon, sur lequel est fixé l'ADN extrait de Plasmodium falciparum, avec une solution de pré-hybridation, The invention also relates to a method of hybridization of a nucleotide probe with the DNA of Plasmodium falciparum, characterized in that it comprises the following steps: - treatment of pre-hybridization of a support, such as a filter nitrocellulose or nylon membrane, on which is fixed the extracted DNA of Plasmodium falciparum with a prehybridization solution,

- l'hybridation dans une solution identique à la solution de pré-hybridation comprenant en outre une sonde nucleotidique conforme à l'invention, - Hybridization in a solution identical to the prehybridization solution further comprising a nucleotide probe according to the invention,

- plusieurs lavages successifs. - Successive washes. L'invention concerne aussi un procédé de détection in vitro de Plasmodium falciparum dans un prélèvement biologique susceptible de le contenir, caractérisé en ce que après avoir rendu l'ADN de Plasmodium falciparum, éventuellement contenu dans le prélèvement biologique, accessible et monocaténaire, on le met en contact avec une sonde nucleotidique conforme à l'invention, dans des conditions favorables à l'hybridation et l'on détecte les hybrides éventuellement formés, la sonde ayant été préalablement marquée ou rendue apte à être détectée comme il a été dit précédemment . The invention also relates to a method for detecting in vitro of Plasmodium falciparum in a biological sample liable to contain it, characterized in that after making the DNA of Plasmodium falciparum, optionally contained in the biological sample, accessible and single-stranded, it is brought into contact with a nucleotide probe according to the invention under conditions conducive to hybridization and detecting the hybrids possibly formed, the probe having been previously marked or rendered capable of being detected as it has been said previously.

Les sondes conformes à l'invention peuvent être également utilisées pour détecter l'ADN de Plasmodium falciparum présent au stade sporozoïte dans les glandes salivaires de l'anophèle. The probes according to the invention can also be used to detect DNA present at Plasmodium falciparum sporozoite stage in the salivary glands of Anopheles.

L'invention a en outre pour objet les kits de diagnostic du paludisme mettant en oeuvre des procédés de détection in vitro de Plasmodium falciparum sus-mentionnés . The invention further relates to diagnostic kits for malaria implementing methods of detecting in vitro Plasmodium falciparum aforementioned.

A titre d'exemple de tel kits comprennent notamment : Examples of such kits include:

FEUILLE DE REMPLACEMENT - une quantité déterminée d'une sonde nucleotidique conforme à l'invention, SUBSTITUTE SHEET - a specific amount of a nucleotide probe according to the invention,

- un milieu approprié à la réalisation d'une réaction d'hybridation entre l'ADN de Plasmodium falciparum et ladite sonde, - An appropriate medium for carrying out a hybridization reaction between the DNA of Plasmodium falciparum and said probe,

- des réactifs permettant la détection des hybrides formés entre l'ADN et la sonde lors de ladite réaction d'hybridation. - Reagents enabling the detection of the hybrids formed between the DNA and the probe during said hybridization reaction.

Les sondes oligonucléotidiques conformes à l'invention peuvent être utilisées comme amorce dans un processus d'amplification génétique in vitro consistant à fixer la sonde sur l'ADN de Plasmodium falciparum par hybridation, puis à mettre en oeuvre un processus d'extension enzymatique à l'aide d'ADN-polymérase, suivi d'un processus de dénaturation , et à répéter le cycle hybridation-extension-dénaturation, connu sous le nom de cycle PCR ("Polymerase Chain Reaction" décrit par la société Cetus Corporation) , un nombre de fois suffisant pour augmenter la quantité de la séquence-cible de la sonde oligonucléo idique de départ dans une proportion exponentielle par rapport au nombre de cycles mis en oeuvre. The oligonucleotide probes according to the invention can be used as a primer in a DNA amplification process in vitro of attaching the probe to the DNA of Plasmodium falciparum by hybridization, and to implement an enzymatic extension process to using DNA polymerase, followed by a denaturing process, and repeating the hybridization-extension-denaturation cycle, known as cycle name PCR ( "polymerase Chain Reaction" described by the company Cetus Corporation), a number of time sufficient to increase the amount of the target sequence of the probe idique oligonucléo departure in an exponential proportion with respect to the number of cycles used.

Outre les caractéristiques qui précèdent, l'invention comporte -d'autres caractéristiques qui apparaîtront au cours de la description qui suit et qui se réfèrent à des exemples de mise en oeuvre de la présente invention , étant entendu que ces exemples ne sauraient constituer une quelconque limitation à la portée des revendications . In addition to the features above, the invention includes -other features which appear from the following description which refers to examples of implementation of the present invention, it being understood that these examples do not constitute any limitation on the scope of the claims.

I - PREPARATION DE LA SONDE pUF 28. A) Production de la sonde pUF 28 I - PREPARATION OF THE PROBE 28. PUF) Production Probe PUF 28

L'acide nucléique pUF 28 est introduit dans une cellule hôte à l'aide d'un vecteur, du type plasmide apte à se répliquer dans ladite cellule hôte; The nucleic acid PUF 28 is introduced into a host cell using a vector of the plasmid type capable of replicating in said host cell; de manière avantageuse l'acide nucléique pUF 28 a été introduit dans le plasmide pUC 19 et amplifié dans la souche d'Escheri ch-i,a Cûli RR1DM1 (K 12), dérivée de HP 103. - advantageously the nucleic acid PUF 28 was introduced into the plasmid pUC19 and amplified in the strain Escheri ch-i, a CuLi RR1DM1 (K 12), derived from HP 103. -

FEUILLE DE REMPLACEMENT A partir d'un congelât à -70°C, la souche est ensemencée sur un milieu solide SOB (Bacto Tryptone 2 %, SUBSTITUTE SHEET from a frozen sample at -70 ° C, the strain is seeded on a strong SOB medium (Bacto tryptone 2%

Extrait de Levure 0,5 %, NaCl lOmM, KC1 2,5mM, MgC12 lOmM, Yeast extract 0.5% NaCl lOmM, 2.5 mM KC1, lOmM MgC12,

MgS04 lOmM) , en présence d'Ampicilline (50 mg/ml) et mise en culture pendant 18 heures à 37°C. LOmM MgS04), in the presence of ampicillin (50 mg / ml) and cultured for 18 hours at 37 ° C.

10 ml de milieu liquide SOB (Ampicilline (50 mg/ml) ) sont ensemencés avec une colonie et mis en culture durant 16 heures, à 37°C, sous une agitation orbitale de 200 rpm. 10 ml SOB liquid medium (ampicillin (50 mg / ml)) were inoculated with a colony and cultured for 16 hours at 37 ° C under orbital agitation of 200 rpm. 2 ml de cette préculture servent d'inoculum pour ensemencer un litre de milieu liquide SOB (Ampicilline 50 mg/ml) . 2 ml of this preculture are used as inoculum to inoculate one liter of SOB liquid medium (ampicillin 50 mg / ml).

La culture se fait sur 9 heures, à 37°C et sous agitation (200rpm) . Culture is 9 hours at 37 ° C and stirring (200rpm).

L'addition de Chloramphénicol (170 mg/ml) permet d'amplifier le nombre de copies du plasmide par cellule en bloquant la division bactérienne. The addition of chloramphenicol (170 mg / ml) is used to amplify the number of copies of the plasmid per cell by blocking bacterial division. Cette étape d'amplification se déroule toujours à 37°C, sous agitation This amplification step is always held at 37 ° C with stirring

(200 rpm), durant 16 heures. (200 rpm) for 16 hours.

Les bactéries sont récupérées par centrifugation à 5000 g, pendant 10 minutes et à 4°C. The bacteria are collected by centrifugation at 5000 g for 10 minutes and at 4 ° C.

Le plasmide est extrait de manière classique selon la technique de Birboim et Doly, décrite par Maniatis et al (1982 "Molecular cloning, A laboratory manual", Cold Spring Harbor Laboratory) . The plasmid was extracted in a conventional manner according to Birboim technique and Doly, described by Maniatis et al (1982 "Molecular cloning, A laboratory manual", Cold Spring Harbor Laboratory). Il est purifié, en dernière étape, par ultracentrifugation sur gradient de CsC12 (n = 1,3860; l,55mg/ml; 100000 g; 20°C; 36 heures; en présence de 600 mg/ml de Bromure d'Ethidium. . It is purified in the last step, by ultracentrifugation gradient CsC12 (n = 1.3860; l, 55mg / ml; 100,000 g; 20 ° C; 36 hours; in the presence of 600 mg / ml Ethidium Bromide. .

Le Bromure d'Ethidium est éliminé par 6 extractions au n-Butanol et 3 extractions au Diéthyl-Oxyde. The ethidium bromide is removed by six extractions with n-butanol and 3 extractions Diethyl-oxide. B) Purification de la sonde pUF 28 B) Purification of the probe PUF 28

Après précipitation dans l'éthanol 70 %, l'ADN plasmidial est déssique sous vide puis solubilisé dans l'eau et dosé par mesure au spectrophotomètre de la DO de la solution à 260 nm. After precipitation in 70% ethanol, the plasmidial DNA was desiccated under vacuum and then solubilized in water and assayed by measuring spectrophotometrically the OD at 260 nm of the solution. La purification de l'insert pUF 28 se fait par une double digestion enzymatique du plasmide par 2 enzymes Sst I (ou Sac I) et Xba I dont les sites de coupure se Purification of the insert PUF 28 is via a double enzymatic digestion of the plasmid with two enzymes Sst I (or SacI) and Xbal which cut sites

FEUILLE DE REMPLACEMENT situent de part et d'autre de l' insert, dans la séquence polylinker du plasmide pUC 19. SUBSTITUTE SHEET located on both sides of the insert in the polylinker sequence of plasmid pUC19.

De manière préparative, 100 ITIg de plasmide sont digérés dans 200 mi au moins de tampon Sac I (Tris-HCl pH 8, 50mM; NaCl 50mM; MgC12 lOmM) à raison de 1 unité/mg de chaque enzyme. Preparative manner, 100 ITIG plasmid are digested in 200 ml of buffer at least SacI (Tris-HCl pH 8, 50 mM, 50 mM NaCl; lOmM MgC12) at a rate of 1 unit / mg of each enzyme. Les deux digestions sont simultanées et sont incubées à 37 °C, pendant au moins 3 heures. Both digests are simultaneous and are incubated at 37 ° C for at least 3 hours.

L'insert pUF 28 (1,846 kb) et le plasmide pUC 19 The insert PUF 28 (1,846 kb) and the plasmid pUC 19

(2,686 kb) sont séparés par électrophorèse sur gel à 0,8 % d'agarose, (gel de 20 cm par 20 cm; deux puits de 7 cm de longueur par 1,5 mm de largeur par 0,8 cm de profondeur), dans un tampon TAE (0,5 mg/ml de Bromure d'Ethidium) . (2,686 kb) are separated by gel electrophoresis in 0.8% agarose (gel of 20 cm by 20 cm; two wells 7 cm long by 1.5 mm wide by 0.8 cm deep) , in TAE buffer (0.5 mg / ml Ethidium bromide).

La bande inférieure est découpée et la sonde pUF 28 est électro-éluée dans un appareil BIOTRAP (dénomination commerciale) , dans le tampon TAE (0,5 mg/ml de Bromure d'Ethidium) . The lower band is cut and the probe PUF 28 is electro-eluted into a Biotrap apparatus (trade name) in TAE buffer (0.5 mg / ml Ethidium Bromide). L'insert ainsi purifié est prêt à l'emploi après 6 extractions du Bromure d'Ethidium au n-Butanol et 3 extractions au Diéthyl-Oxyde et précipitation dans l'éthanol 70 %. The thus purified insert is ready for use after 6 Ethidium Bromide extractions of n-Butanol and 3 extractions Diethyl oxide and ethanol precipitation 70%. Après remise en solution dans l'eau, la qualité de la sonde est contrôlée par électrophorèse analytique et la concentration en ADN est déterminée par la mesure de la DO à 260nm. After redissolution in water, the quality of the probe is controlled by analytical electrophoresis and DNA concentration was determined by measuring the OD at 260nm.

C) Marquage de la sonde pUF 28 C) Probe Marking PUF 28

Les résultats rapportés ci-dessous ont été obtenus par marquage de la sonde pUF 28 au 32 P, par l'intermédiaire d'un nucléotide triphosphate marqué en position alpha; The results reported below were obtained by labeling the probe with 32 P 28 PUF, by means of a labeled nucleotide triphosphate in the alpha position; par exemple le alpha 32 P dTTP (800 Ci/mmol; AMERSHAM FRANCE (dénomination commerciale) ) . eg alpha 32 P dTTP (800 Ci / mmol; Amersham FRANCE (trademark)). Un microgramme d'insert est ainsi marqué avec 140 μCi par nick translation, l'activité spécifique est alors de 1 à 5.10 8 cpm/mg. An insert microgram is thus labeled with 140 .mu.Ci by nick translation, then the specific activity is from 1 to 5.10 8 cpm / mg. On peut aussi marquer l'insert par la technique du "Random Priming", l'activité spécifique est alors de 1 à 2.10 9 cpm/mg. It may also mark the insert by the technique of "Random Priming", the specific activity is then 1 2.10 9 cpm / mg. II - PREPARATION DE LA SONDE OLI 28. A) Production de la sonde OLI 28 La séquence oligonucléotidique OLI 28 de 20 bases est produite par synthèse chimique sur un appareil automatique (synthétiseur d'APPLIED BIOSYSTEM (dénomination II - PREPARATION OF THE PROBE 28. OLI) Production of the probe oligonucleotide sequence OLI 28 OLI 28 of 20 bases is produced by chemical synthesis on an automatic device (synthesizer APPLIED BIOSYSTEM (denomination

FEUILLE DE REMPLACEMENT commerciale ) ) . SUBSTITUTE SHEET commercial)). 300 iïlg ont ainsi été synthét i sé s sous forme monocaténaire en une seule fois . 300 IILG have been Synthet se i s single-stranded form in one go.

Les se ls pré sent s à haute concent rat ion sont é l iminé s aprè s pré c ip itat ion de l ' ADN monobr in dan sl ' éthanol 70 % . Ls is the pre feels s high concent rat ion are iminated e l s s Morn pre c ip itat ion DNA monobr dan sl in 70% ethanol.

B) Marquage de la sonde OLI 28 B) probe OLI Marking 28

L ' oligonucléotide OLI 28 est marqué à l'extrémité 5' par la T4 Polynucléotide Kinase, en présence de gamma ATP. The oligonucleotide OLI 28 is labeled at the 5 'end with T4 polynucleotide kinase in the presence of ATP gamma. 50 pmoles de sonde OLI 28 (330 ng) sont incubées en présence de 7 Unités de T4 Polynucléotide Kinase et 150 μCi de gamma 32 P ATP dans un volume final de 50 IDl. 50 pmoles probe OLI 28 (330 ng) are incubated in the presence of 7 units of T4 polynucleotide kinase and 150 uCi gamma 32 P ATP in a final volume of 50 IDl. L'activité spécifique moyenne est de l'ordre de 2 à 5.10 8 cpm/mg The mean specific activity of about 2 to 8 5.10 cpm / mg

III - PREPARATION DES ECHANTILLONS A ANALYSER III - PREPARATION OF SAMPLES ANALYSED

A) Préparation des échantillons A) Sample Preparation

Le protocole de préparation des échantillons décrits ci-dessous a été mis au point par J. . The sample preparation protocol described below was developed by J.. Zolg et al, et décrit dans Am. J. Trop. Zolg et al, and described in Am. J. Trop. Med. Med. Hyg. Hyg. (1987), 3___., 33-41. (1987), 3___., 33-41. Cette technique comporte 5 étapes et permet de manipuler des échantillons de sang parasité d'au moins 501X11. This technique involves 5 steps and can manipulate blood samples parasitized at least 501X11.

- première étape : Lyse des hématies parasitées en ajoutant 2 volumes (100 mi) d'eau bidistillée, stérile. - First step: lysis of parasitized erythrocytes by adding 2 volumes (100 mi) of double-distilled water, sterile. Incuber pendant 20 minutes. Incubate for 20 minutes. - de uxi ème é tape : Lyse des parasites en ajoutant 0,33 volume (50 mi) de tampon LE (Lauryl Sarcosine 1 %; EDTA pH8, 50 mM) . - Of uxi th waypoint: Lyse parasites by adding 0.33 volume (50 mi) of THE buffer (lauryl sarcosine 1% EDTA pH 8, 50 mM). L'EDTA inhibe l'activité enzymatique des DNAases. EDTA inhibits the enzymatic activity of DNAases.

- troisième étape : Addition de 0,25 volume (50 ml) de trifluoroacétate de césium 5 M. Le trifluoroacétate de Césium est un sel fortement chaotropique qui dénature les protéines et les dissocie des acides nucléiques . - Third step: Addition of 0.25 volumes (50 ml) cesium trifluoroacetate -5 M. trifluoroacetate Cesium is a highly chaotropic salt which denatures proteins and nucleic acids dissociated.

- quatrième étape : Extraction des protéines par addition de 0,33 volume (83 ml) d'un mélange organique (éthanol 2,5 volumes /chloroforme 1 volume /alcool isoamylique 0,04 volume) . - Fourth step: Extraction of proteins by addition of 0.33 volume (83 ml) of an organic mixture (2.5 volumes ethanol / chloroform 1 v / isoamyl alcohol 0.04 volume).

FEUILLE DE REMPLACEMENT - cinquième étape : Centrifugation à 12000 g pendant 5 minutes et récupération de la phase aqueuse supérieure. SUBSTITUTE SHEET - fifth step: centrifugation at 12,000 g for 5 minutes and recovery of the upper aqueous phase.

Toutes les solutions mères peuvent être conservées à température ambiante. All stock solutions can be stored at room temperature. Les ADN extraits selon cette méthode peuvent être conservés à 37°C, pendant plusieurs mois. DNA extracted by this method can be stored at 37 ° C for several months.

B) Dénaturâtion de l'ADN B) DNA denaturation

L'ADN est dénaturé en ajoutant 0,25 volume (62,5 mi) de soude 2,5 N (20 minutes à température ambiante) . The DNA is denatured by adding 0.25 volumes (62.5 ml) of 2.5 N sodium hydroxide (20 minutes at room temperature).

La solution est neutralisée avec 0,5 volume (156 ml) de tampon Tris-HCL (pH8, 3M) et incubée dans la glace pour éviter la renaturation de l'ADN. The solution is neutralized with 0.5 volume (156 ml) of Tris-HCl buffer (pH 8, 3M) and incubated in ice to prevent annealing of DNA.

C) Dépôt des échantillons Les échantillons sont déposés en duplica sur un support comme un filtre de nitrocellulose à l'aide d'un appareil de filtration 8 fois 12 puits, sous vide (appareil HYBRI-DOT MANIFOLD de BRL (dénomination commerciale) ) . C) Depositing of the samples The samples are deposited in Duplica on a support such as a nitrocellulose filter using a filtration apparatus 8 times 12 wells, vacuum (Hybri-DOT apparatus MANIFOLD BRL (trademark)).

Le filtre est préalablement mouillé dans le tampon 2 fois SSC (1 fois SSC = NaCl 0,15 M; Citrate de Sodium 0,015M) avant d'être placé dans l'appareil. The filter was prewetted in the buffer 2 x SSC (1 x SSC = 0.15M NaCl; 0.015M sodium citrate) prior to being placed into the machine. Chaque échantillon est déposé sous vide. Each sample is placed under vacuum. Avant et après chaque dépôt, le puits est rincé avec 200 mi de tampon 2 fois SSC. Before and after each deposit, the well is rinsed with 200 ml of buffer 2 times SSC. Après séchage à température ambiante pendant 30 minutes, le filtre est incubé à 80°C pendant 2 heures, entre deux feuilles de papier HATMAN 3MM (dénomination commerciale) pour fixer les ADN sur la membrane. After drying at room temperature for 30 minutes, the filter is incubated at 80 ° C for 2 hours, between two sheets of 3MM paper hatman (trade name) for fixing the DNA on the membrane. IV - HYBRIDATION IV - HYBRIDISATION

L'hybridation se déroule en trois étapes : la préhybridation, l'hybridation, les lavages. Hybridization occurs in three stages: pre-hybridization, hybridization, washing.

A) La préhybridation A) Prehybridization

Le filtre sec est placé dans un sac plastique soudé et incubé dans un tampon d'hybridation, à raison de 75 ml/cm 2 . The dry filter is placed in a sealed plastic bag and incubated in a hybridization buffer at 75 ml / cm 2. Le tampon d'hybridation a la composition suivante : - Tampon 5 fois SSC The hybridization buffer has the following composition: - 5 x SSC buffer

FEUILLE DE REMPLACEMENT - Ficoll 400 0,1 % Poids/Volume SUBSTITUTE SHEET - Ficoll 400 0.1% weight / volume

- Polyvinylpyrrolidone 0,1 % Poids/Volume - Polyvinylpyrrolidone 0.1% weight / volume

- Phosphate de Sodium pH 6, 5 50 mM - Sodium Phosphate pH 6, 5 50 mM

- Glycine 1 % Poids/Volume - SDS (Sodium Dodécyl Sulfate) 0,1 % Poids/Volume - Glycine 1% weight / volume - SDS (sodium dodecyl sulphate) 0.1% weight / volume

- ADN de sperme de Hareng dénaturé 100 mg/ml - Denatured herring sperm DNA 100 mg / ml

La préhybridation avec la sonde pUF 28 est effectuée pendant 30 minutes à 33°C en présence de 50 % de formamide . Prehybridization with the PUF probe 28 is performed for 30 minutes at 33 ° C in the presence of 50% formamide. La préhybridation avec la sonde OLI 28 est effectuée pendant 1 heure à 30°C, en absence de formamide . Prehybridization with the OLI 28 probe is carried out for 1 hour at 30 ° C in the absence of formamide.

B) L'hybridation B) Hybridization

Après dénaturation de la sonde pUF 28 par chauffage à 100°C pendant 10 minutes puis refroidissement dans la glace fondante (0°C) pendant 10 minutes, l'hybridation avec la sonde pUF 28 monocaténaire se fait dans le même tampon que la préhybridation; After denaturation of the PUF probe 28 by heating at 100 ° C for 10 minutes then cooled in melting ice (0 ° C) for 10 minutes, the hybridization with the probe PUF 28 is stranded in the same buffer as the prehybridization; le filtre est hybride avec 80 ng/ml de sonde pUF 28 pendant 2 heures à 33°C, pour une activité spécifique de 10 8 cpm/mg au moins. the filter was hybridized with 80 ng / ml 28 PUF probe for 2 hours at 33 ° C, to a specific activity of 10 8 cpm / mg at least. L'hybridation avec la sonde OLI 28 se fait dans le même tampon que la préhybridation ; Hybridization with the probe OLI 28 is done in the same buffer as the prehybridization; le filtre est hybride avec 100 ng/ml de sonde OLI 28 pendant 4 heures à 30°C, pour une activité spécifique de 2.10 8 cpm/mg au moins. the filter is hybridized with 100 ng / ml probe OLI 28 for 4 hours at 30 ° C, to a specific activity of 2.10 8 cpm / mg at least.

C) Lavaαe des fi 1très Les conditions de lavage sont différentes pour chaque sonde. C) 1 Very Lavaαe fi Washing conditions are different for each probe.

- le lavage après hybridation * avec la sonde pUF 28 comprend : - Washing after hybridization with the PUF * 28 probe includes:

. . 4 lavages de 5 minutes dans un tampon 5 fois SSC en présence de SDS 0,1 %, à température ambiante, Four 5 min washes in 5 x SSC buffer in the presence of 0.1% SDS, at room temperature,

. . 1 lavage de 20 minutes dans un tampon 2 fois SSC en présence de SDS 0,1 %, à température ambiante. 1 wash for 20 minutes in a 2 x SSC buffer in the presence of 0.1% SDS, at room temperature.

- le lavage après hybridation avec la sonde OLI 28 comprend : . - Washing after hybridization with the probe comprises 28 OLI. 2 lavages de 5 minutes dans un tampon 5 fois 2 washes for 5 minutes in a buffer 5 times

SSC, à température ambiante, SSC at room temperature,

FE U. LLE 0 E B E P AC E MENT . FE U. LLE 0 E B E P E MENT AC. 1 lavage de 5 minutes dans un tampon 5 fois SSC en présence de SDS 0,1 %, à température ambiante. One 5 minute wash in buffer 5 x SSC in the presence of 0.1% SDS, at room temperature.

1 lavage de 20 minutes dans un tampon 5 fois SSC en présence de SDS 0,1 %, à température ambiante. 1 wash for 20 minutes in a 5 x SSC buffer in the presence of 0.1% SDS, at room temperature. D) Révélation de l'hybridation D) Detection of hybridization

Les filtres sont séchés à la température ambiante pendant 30 minutes, enveloppés dans un film plastique, et exposés à un film d'autoradiographie, à -70°C, pendant 24 heures. The filters are dried at room temperature for 30 minutes, wrapped in plastic wrap and exposed to autoradiography film at -70 ° C for 24 hours. V - SENSIBILITE DE DETECTION V - DETECTION OF SENSITIVITY

A) Sensibilité de la détection d'ADN A) Sensitivity of the detection of DNA

La ' sonde pUF 28, radiomarquée au 32 P peut détecter 100 pg d'ADN purifié de Plasmodium falciparum. The 'probe PUF 28, radiolabeled 32 P can detect 100 pg of DNA purified Plasmodium falciparum. après 24 heures d'exposition du film d'autoradiographie. after 24 hours exposure of autoradiography film. La sonde OLI 28 radiomarquée peut détecter 1 ng d'ADN après 24 heures d'exposition. The OLI 28 radiolabeled probe can detect 1 ng of DNA after 24 hours of exposure.

B) Sensibilité σ_≤ la détection d'hématies parasitées B) σ_≤ sensitivity detection of parasitized erythrocytes

Afin de retrouver les conditions physiopathologiques, les tests de détection ont été réalisés sur des hématies parasitées in vitro, synchrones au stade ring. To find the pathophysiological conditions, the detection tests were performed on the parasitized red cells in vitro, synchronous ring stage.

La sonde pUF 28 marquée au 32 P détecte 50 hématies parasitées par mm 3 de sang de culture à 50 % d'hématocrite, après 24 heures d'exposition du film, soit une parasitémie de 0,001 % de façon reproductible. PUF probe 28 labeled with 32 P 50 detects parasitized erythrocytes per mm 3 of blood culture at 50% hematocrit after 24 hours of exposure of the film, a parasitemia of 0.001% in a reproducible manner.

La sonde OLI 28 radiomarquée détecte 500 hématies parasitées par mm 3 soit une parasitémie de 0,01 % dans les mêmes conditions . The probe detects OLI radiolabelled 28 500 parasitized erythrocytes per mm 3 or a 0.01% parasitaemia in the same conditions. Le tableau I ci-dessous rapporte la durée de manipulation et la sensibilité des sondes pUF 28 et OLI 28 ainsi que de différentes sondes connues à ce jour. Table I below reports the handling time and sensitivity of the probes PUF OLI 28 and 28 as well as various probes known to date.

FEUILLE DE REMPLACEMENT SUBSTITUTE SHEET

Figure imgf000019_0001

Comme l'indique le tableau I, les sondes pUF 28 et OLI 28 ont une sensibilité de détection au moins équivalente à celle de pRep-Hind et PFR1 et qui est tour à fait reproductible. As indicated in Table I, the PUF probes 28 and 28 have a OLI detection sensitivity at least equivalent to that of pRep-Hind and PFR1 round and is completely reproducible.

En outre, les conditions d'hybridation mises au point spécifiquement pour ces sondes, ont permis d'atteindre ces performances après seulement 2 heures d'hybridation pour la sonde pUF 28 et 4 heures pour la sonde OLI 28. In addition, hybridization conditions developed specifically for these probes have achieved this performance after only 2 hours of hybridization to the probe PUF 28 and 4 hours for the OLI 28 probe.

Les sondes pUF 28 et OLI 28 sont spécifiques de l'ADN de Plasmodium falciparum: ainsi, en hybridation de The probes PUF OLI 28 and 28 are specific for the DNA of Plasmodium falciparum: thus, in hybridization of

"Southern Blots" elles ne reconnaissent pas l'ADN génomique humain, ni l'ADN des trois autre espèces plasmodiales : Plasmodium malariae. "Southern blots" they do not recognize human genomic DNA, or the DNA of three other Plasmodium species: Plasmodium malariae. Plasmodium ovale et Plasmodium vivax ainsi que Plasmodium cynomolgi bastianellii qui infeste le singe. Plasmodium ovale and Plasmodium vivax and Plasmodium cynomoigi bastianellii infesting monkeys. Elles reconnaissent l'ADN des souches de Plasmod um falciparum d'origine géographique différente suivantes : They recognize the DNA strains Plasmod um falciparum following different geographical origin:

- souche CAM du Sénégal - CAM strain of Senegal

- souche SGE-1 de Gambie - EMS-1 strain of Gambia

FEUILLE DE REMPLACEMENT souche JEAN de Centrafrique souche KENYA du Kenya souche LILLY de Centrafrique souche NF7 d'Afrique (aéroport d'Amsterdam) souche NF54 de Tanzanie souche UPA d'Ouganda souche HONDURAS du Honduras souche INDOCHTNΆ-1 du Vietnam REPLACEMENT SHEET JEAN strain of Central Kenya KENYA LILLY strain strain strain NF7 of Central Africa (Amsterdam Airport) NF54 strain strain strain Tanzania Uganda Honduras HONDURAS UPA-1 strain INDOCHTNΆ Vietnam

10 10

15 15

20 20

25 25

30 thirty

35 35

FEUILLE DE REMPLACEMENT FIGURE I SUBSTITUTE SHEET FIGURE I

( 5 ' ) GATCCT AACATCAGTAATG TAGGTCTT ACTTCCACTGATC TAGGTCTT AACTTGACTCATA TAGGTCTT ATGATTACTAACC ATGGTAAATCACT AAGGTCTT ACTGTTACTAATA ATGTCAACTAACT TTGGTCTT AAGCTTACTAATT (5 ') GATCCT AACATCAGTAATG TAGGTCTT ACTTCCACTGATC TAGGTCTT AACTTGACTCATA TAGGTCTT ATGATTACTAACC ATGGTAAATCACT AAGGTCTT ACTGTTACTAATA ATGTCAACTAACT TTGGTCTT AAGCTTACTAATT

AAGGTCCT AATTTAACTAATA TAGGTCTT ATGGTTACTAACC TAGGTCAT AAGGTTACTAAC TAGGTCTT AATGTAAATAACG TAGGTCATTAATGTAACTAACG TACGTCTT AACATGACTAACC TACGTCTT AACGTAACTAACA AAGTTCTT ACTTTCATTAATT TAAGTCAT TAAGGTACTAATT CAGGTCCT AACTTCACTAACA TTGGTCTT AACTTAACAAATA TAGGTCCT AACTTGACTAACT TAGGTCCT AACTACAGCAACA TAGGTCTT ACTTTCACTAATA TAGGTCTA TAGGTAAGTAATA TAGGTCTT ACTTTCATTCATA TAGGTCTT ACTTTTACTAACA TAGGTCTT ATGGTAACTAACT TAGGTCTT ACTTTCATTAATT AAGGTCTT AACTTAACTAACT GAGGTCCT AACATTACATACT TAGGTCTT AACTTGACTAACA TAGGTCTT ACGTTGACTAACT TAGGTCTT AGGTTGACTAACT TAGGTCCT TACTATACTAACT TAGGTCTT ACCTTCACTCGTA TAGGTCTT AAGGTAAGTAATA TAGGTCTT ACTTTCACTAACG TAGGTCCT CAATACAGTAACG TAGGCCTC AACTTAACTAACT AAGGTAACTAATA TAGGTCTT AACATAACTAATA AAGGTCCT AATTTAACTAATA TAGGTCTT ATGGTTACTAACC TAGGTCAT AAGGTTACTAAC TAGGTCTT AATGTAAATAACG TAGGTCATTAATGTAACTAACG TACGTCTT AACATGACTAACC TACGTCTT AACGTAACTAACA AAGTTCTT ACTTTCATTAATT TAAGTCAT TAAGGTACTAATT CAGGTCCT AACTTCACTAACA TTGGTCTT AACTTAACAAATA TAGGTCCT AACTTGACTAACT TAGGTCCT AACTACAGCAACA TAGGTCTT ACTTTCACTAATA TAGGTCTA TAGGTAAGTAATA TAGGTCTT ACTTTCATTCATA TAGGTCTT ACTTTTACTAACA TAGGTCTT ATGGTAACTAACT TAGGTCTT ACTTTCATTAATT AAGGTCTT AACTTAACTAACT GAGGTCCT AACATTACATACT TAGGTCTT AACTTGACTAACA TAGGTCTT ACGTTGACTAACT TAGGTCTT AGGTTGACTAACT TAGGTCCT TACTATACTAACT TAGGTCTT ACCTTCACTCGTA TAGGTCTT AAGGTAAGTAATA TAGGTCTT ACTTTCACTAACG TAGGTCCT CAATACAGTAACG TAGGCCTC AACTTAACTAACT AAGGTAACTAATA TAGGTCTT AACATAACTAATA

CAGGTCCT AACTACAGCAACA TAGGTCTT AACGTAACTAGCT TAGGTCTA TAGGTAAGTAATA AAGGTCAT ACAATTACTAACC TAGGTCCT AACATTACATACT TAAGTCAT TAAGGTACTAACT TAGGTCTT GACTGGAGTAATG TAGGTCGT AATGTAACTAATA TAGGTCCT AACATTACTAGCT TAG-^T TT aA ^AC^AATG TTCGTCTT TGGGT ACT ACT Afy?rc AA πτAA τ.aATc TAGGTCTT GACTGGAGTAATC TAGGTCCT AACATTAGTAATG TΆFSΠTCT .aaK7TaaC!TVATA TAGGTCTT ACTTTCACTCATA TAGGTCCT ATTATCACTAACG TAGGCCTT ACTTTCACTAACT TAGGTCTT AAGCTAACTAATT TAGGTCTT ACTTTCACTAACT TAGGTCTT ATGGTAACTAATA TAAGTCTT ACTTTCACTAACC AAGCTTACTAACT TAAGTT T ACTTT ACTAACT AACTTAGATGCT TAGGTCTT ACCTTCACTAACA AACATAACCAATA TAGGTCTT ATTTTTACTAACT AACTACACTAACT TAGGTCTT AACGTGACTAACA AACTTAGCTAACA CAGGTCTT AACCTGACTAACA TAGGTCTT AACTTAACTAATA TAGGTCTT AACTTAACTAACCT TAGGTCCT AACTTCACTAACT TAGGTCTT ACTTTCACTAAGT TAGGTCTT AAGGTAACTAACA GAGGTCCT TCTTTTACTAATA TAAGTCAT TAAGGTACTAATT TAGGTCCT AACGTAACTAATATA TTGGTCTT AACTTAACAAATA TAGGTCTT ATAGTCACTAACC TAGGTCCT AACATTACTAACA AAGGTCTT ACTCTTACTGATA TAGGTCTT AAGTTAACTAACT TAGGTCTT ATGGTTACTAACC .. AAGGTCAT ACTTTTACTAACT TAGATC (3 ' ) CAGGTCCT AACTACAGCAACA TAGGTCTT AACGTAACTAGCT TAGGTCTA TAGGTAAGTAATA AAGGTCAT ACAATTACTAACC TAGGTCCT AACATTACATACT TAAGTCAT TAAGGTACTAACT TAGGTCTT GACTGGAGTAATG TAGGTCGT AATGTAACTAATA TAGGTCCT AACATTACTAGCT TAG- T ^ TT ^ AC ^ aA AATG TTCGTCTT TGGGT ACT ACT Afy? Rc AA πτAA τ.aATc TAGGTCTT GACTGGAGTAATC TAGGTCCT AACATTAGTAATG TΆFSΠTCT .aaK7TaaC! TVATA TAGGTCTT ACTTTCACTCATA TAGGTCCT ATTATCACTAACG TAGGCCTT ACTTTCACTAACT TAGGTCTT AAGCTAACTAATT TAGGTCTT ACTTTCACTAACT TAGGTCTT ATGGTAACTAATA TAAGTCTT ACTTTCACTAACC AAGCTTACTAACT TAAGTT T CADTC ACTAACT AACTTAGATGCT TAGGTCTT ACCTTCACTAACA AACATAACCAATA TAGGTCTT ATTTTTACTAACT AACTACACTAACT TAGGTCTT AACGTGACTAACA AACTTAGCTAACA CAGGTCTT AACCTGACTAACA TAGGTCTT AACTTAACTAATA TAGGTCTT AACTTAACTAACCT TAGGTCCT AACTTCACTAACT TAGGTCTT ACTTTCACTAAGT TAGGTCTT AAGGTAACTAACA GAGGTCCT TCTTTTACTAATA TAAGTCAT TAAGGTACTAATT TAGGTCCT AACGTAACTAATATA TTGGTCTT AACTTAACAAATA TAGGTCTT ATAGTCACTAACC TAGGTCCT AACATTACTAACA AAGGTCTT ACTCTTACTGATA TAGGTCTT AAGTTAACTAACT TAGGTCTT ATGGTTACTAACC .. AAGGTCAT ACTTTTACTAACT TAGATC (3 ')

Séσuences soulignées Oligonucléotide OLI 28 répétées quatre fois Séσuences underlined oligonucleotide OLI 28 repeated four times

FEUILLE DE REMPLACEMENT SUBSTITUTE SHEET

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
EP0135108A2 *7 Aug 198427 Mar 1985Rockefeller UniversityNucleotide hybridization assay for protozoan parasites
Non-Patent Citations
Reference
1 *Biological Abstracts, Volume 83, No. 11, 1987, Biological Abstracts Inc., (Philadelphia, PA, US), J.W. ZOLG et al.: "Detection of Plasmodium Falciparum DNA using Repetitive DNA Clones as Species Specific Probes" voir Resume No. 110658 & Mol. Biochem. Parasitol. 22 (2/3), 145-152, 1987
2 *Biological Abstracts, Volume 84, No. 2, 1987, Biological Abstracts Inc., (Philadelphia, PA, US), G.L. MCLAUGHLIN et al.: "Comparison of Genomic, Plasmid, Synthetic, and Combined DNA Probes for Detecting Plasmodium Falciparum DNA" voir Resume No. 18004 & J. Clin Microbiol. 25 (5), 791-795, 1987
3 *Biological Abstracts, Volume 85, No. 1, 1988, Biological Abstracts Inc., (Philadelphia, PA, US), M. HOLMBERG et al.: "Use of a DNA Hybridization Assay for the Detection of Plasmodium Falciparum in Field Trials" voir Resume No. 7679 & Am. J. Trop. Med. Hyg. 37 (2), 23-234, 1987
4 *Biological Abstracts, Volume 87, No. 1 1989, Biological Abstracts Inc., (Philadelphia, PA, US), O. SETHABUTR et al.: "A Comparative Field Study of Radiolabeled and Enzyme-Conjugated Synthetic DNA Probes for the Diagnosis of Falciparum Malaria" voir Resume No. 8439 & Am. J. Trop. Med. Hyg. 39 (3), 227-231, 1988
5 *CHEMICAL ABSTRACTS, Volume 104, No. 11, 17 Mars 1986, (Columbus, Ohio, US), P. OQUENDO et al.: "Characterization of a Repetitive DNA Sequence from the Malaria Parasite, Plasmodium Falciparum" voir page 167, Resume No. 83015y & Mol. Biochm. Parasitol. 1986, 18 (1), 89-101
6 *CHEMICAL ABSTRACTS, Volume 106, No. 17, Avril 1987, (Columbus, Ohio, US) J. ZOLG et al.: "Detection of Plasmodium Falciparum DNA using Repetitive DNA Clones as Species Specific Probes" voir pages 178, 179, Resume No. 132851v & Mol. Biochem. Parasitol. 1987, 22 (2-3), 145-51
7 *CHEMICAL ABSTRACTS, Volume 109, No. 11, 12 Septembre 1988, (Columbus, Ohio, US) S. FUCHAROEN et al.: "Differentiation of Plasmodium Falciparum Clones by Means of a Repetive DNA Probe" voir page 343, Resume No. 89035e & Trans. R. Soc. Trop. Med. Hyg. 1988, 82 (2), 209-11
8 *CHEMICAL ABSTRACTS, Volume 110, No. 1, 2 Janvier 1989, (Columbus, Ohio, US), O. SETHABUTR et al.: "A Comparative Field Study of Radiolabeled and Enzyme-Conjugated Synthetic DNA Probes for the Diagnosis of Falciparum Malaria" voir page 364, Resume No. 3901v & Am. J. Trop. Med. Hyg. 1988, 39 (3), 227-31
9 *CHEMICAL ABSTRACTS, Volume 110, No. 17, 24 Avril 1989, (Columbus, Ohio, US) V.S. FRANCIS et al.: "Development of a DNA Diagnostic Probe for the Detection of the Human Malarial Parasite Plasmodium Falciparum" voir page 378, Resume No. 150678f & Indian J. Biochem. Biophys. 1988, 25 (6), 537-41
10 *CHEMICAL ABSTRACTS, Volume 110, No. 17, 24 Avril 1989, (Columbus, Ohio, US), C.J. DELVES et al.: "Identification of Plasmodium Falciparum-Infected Mosquitoes using a Probe Containing Repetitive DNA" voir page 229, Resume No. 149150w & Mol. Biochem. Parasitol. 1989, 32 (2-3), 105-12
Classifications
International ClassificationC12Q1/68
Cooperative ClassificationC12Q1/6893
European ClassificationC12Q1/68M10D
Legal Events
DateCodeEventDescription
27 Dec 1990AKDesignated states
Kind code of ref document: A1
Designated state(s): CA JP US
27 Dec 1990ALDesignated countries for regional patents
Kind code of ref document: A1
Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE
16 Feb 1993NENPNon-entry into the national phase in:
Ref country code: CA