WO1990015882A1

WO1990015882A1 - Nucleic acid and nucleotidic probes for plasmodium falciparum, and their application in the detection of plasmodium falciparum

Info

Publication number: WO1990015882A1
Application number: PCT/FR1990/000435
Authority: WO
Inventors: Bruno Christian Henri Xavier Oury; Yves Michel Markowicz; Bernabé Fortunato Felipe CHUMPITAZI; Nadine Cristina; Régis MACHE; Pierre Ambroise-Thomas
Original assignee: Centre National De La Recherche Scientifique (Cnrs)
Priority date: 1989-06-16
Filing date: 1990-06-15
Publication date: 1990-12-27
Also published as: FR2648476B1; FR2648476A1

Abstract

The invention relates to a nucleic acid and an oligonucleotide as derivant, as well as the probes constituted by or including said nucleic acid and oligonucleotide, specific to $i(Plasmodium falciparum) DNA. The invention also relates to a hybridation process for the hybridation of said probes with $i(Plasmodium falciparum) DNA as well as a process for the $i(in vitro) detection of $i(Plasmodium falciparum).

Description

Nucleic acid and nucleotide probes specific for plasmodium falciparum, and their application for the detection of plasmodium falciparum

The present invention was made at the Laboratory of Parasitology and Exotic Pathology and the Laboratory of Plant Molecular Biology of the Joseph Fourier-Grenoble I University, both Research Units associated with the CNRS.

Malaria is an infectious parasitic disease caused by an infestation of red blood cells with a hematozoal of the genus Plasmodium. transmitted to humans by an insect, the anopheles. Plasmodium falciparum is the most widespread and dangerous plasmodial species, causing high morbidity. About 40% of the world's population is exposed to malaria. Considerable efforts have been made to control, cure and possibly eradicate this disease; However, to achieve these objectives, it remains necessary to have specific, simple and inexpensive diagnostic means.

The usual diagnostic techniques are based on observation of the patient's blood under a microscope and must be carried out by a trained manipulator; the detection sensitivity of these techniques is from 10 to 200 parasitized red cells / mm3, however weak parasitaemias (less than 1000 parasitized red cells / mm3) require significant reading time and can give rise to false negatives.

Although impossible to automate these techniques are commonly used for screening for malaria access.

Immunological techniques based on the detection of antibodies in the patient's serum have been proposed, but this type of serological analysis is of little interest because the presence of antibodies only shows

REPLACEMENT SHEET previous contact with the parasite and a low positivity of the serum does not allow the conclusion to be made of the presence or absence of parasites in the blood. These techniques are however used in blood transfusion centers to control particularly exposed jets.

To overcome these drawbacks, molecular hybridization techniques have been developed in order to detect in the blood of patients the presence of the DNA of Plasmodium falciparum. The use of specific DNA molecular probes to diagnose malaria has been described for the first time by Franzen, L. et al (The Lancet, 1984, _L, 525-528).

Except for the total genomic DNA used by Pollac et al (Poliack, Y. et al (1985) Am. J. Trop. Med. Hyg., J2, 663-667), other probes, cloned in different vectors (Barker , RH et al (1986) Science, 231, 1434-1436; Ξnea, V. (1986) Mol. Cell. Biol., £., 321-324; Zolg, J.. Et al (1987) Mol. Biochem. Parasitol., 22 _.. 145-151) or prepared by nucleotide synthesis (Me Laughlin, GL et al (1987) The Lancet, 714-716) have been developed.

In parallel, the study of the Plasmodium falciparum genome has revealed the presence of highly repeated nucleotide sequences specific to the parasite. The construction and then the screening of genomic libraries of Plasmodium falciparum made it possible to identify and sequence fragments of genomic DNA containing these highly repeated sequences. The DNA clone, called pRep-Hind described by Aslund, L. and Franzen, L. et al (J. Mol. Biol. 1985, 185. 509-516) contains 1.7 kb and has an insert of 0, 57 kb consisting of the repetition of a unit sequence of 21 nucleotides, this unit sequence has been called PFR1: it has a rate of variation of 25% and has been identified by the same authors in other DNA clones isolated from the same genomic library of Plasmodium falciparum.

European Patent Application No. 135,108 in the name of ROCKFELLER UNIVERSITY also describes fragments of

REPLACEMENT SHEET Plasmodium falciparum genomic DNA containing highly repeating sequences, said fragments making it possible to constitute hybridization probes for the detection of Plasmodium falciparum DNA. This application describes in particular two clones called pPFR1 and _. pPFR5 containing respectively an insert of 1.2 kb and 0.32 kb. The sequencing of these inserts showed that the repeated sequence of pPFR1 contained 51 nucleotides and that of pPFR5 contained 21 nucleotides. Zolg, J.. et al (Mol. Biochem. Parasitol.

1987, 22., 145-151) also describe a clone called "26" containing an insert of 0.147 kb consisting of the repeat of a unit sequence of 21 nucleotides identical to that described by Franzen, L. et al. Hybridization tests carried out using probes from the pRep-Hind and "26" clones allow satisfactory detection of the Plasmodium falciparum DNA, thus the pRep-Hind plasmid probe detects 100 μg of genomic DNA after 18 hours d 'exhibition (Me Laughlin, GE et al (1987) J. Clin. Microbiol., 23., (5), 791-795).

The present invention relates to a new nucleic acid and an oligonucleotide derived therefrom, which constitute nucleotide probes specific for Plasmodium falciparum and which can hybridize the DNA of strains of different geographical origins. The invention also relates to the method of hybridization of the DNA of Plasmodium falciparum with the probes of the invention, as well as to the method for detecting Plasmodium falciparum in a sample and to the kit for carrying out said detection method.

The research carried out by the inventors concerned the cloning and sequencing of fragments of the genomic DNA of Plasmodium falciparum comprising highly repeated sequences. This work made it possible to obtain the nucleic acid of the invention which is represented in FIG. 1, in which the letters indicate the following nucleotides: A for the residue

REPLACEMENT SHEET adenyl, C for the cytidyl residue, G for the guanidylic residue and T for the thymidyl residue; and where (5 ') and (3') indicate the 5 'and 3' ends of said nucleic acid. This nucleic acid which has received the designation pUF 28 comprises 1.846 kb, of which 33.15% is G and C. It consists of the repetition of a unit sequence of 21 nucleotides in 87 copies; these differ from one to 9 nucleotides but have at least 55% homology over the entire nucleic acid pUF 28 sequence. These variations result from the duplication in numerous copies of a basic sequence, and are result in replacements and / or additions and / or deletions of one or more nucleotides. These modifications are clearly shown in FIG. 1, in which the 87 copies of the unit sequence constituting the pUF 2 nucleic acid are superimposed.

The present invention therefore relates to a nucleic acid comprising the nucleotide sequence of FIG. 1 or the corresponding complementary sequence capable of pairing with the same portion of the genomic DNA of Plasmodium falciparum due to its double-stranded nature.

The invention also relates to an oligonucleotide which has been given the name OLI 28 and which is derived from the nucleic acid of the invention pUF 28. The oligonucleotide OLI 28 comprises 20 nucleotides whose sequence is as follows:

(5 ') AGGTCTTAAGGTAACTAAT (3')

The ol igonu cleot ide OLI 28 is present in the nucleic acid pUF 28 in four copies underlined in FIG. 1.

The invention relates, of course, to the oligonucleotide complementary to OLI 28 and having the following nucleotide sequence:

REPLACEMENT SHEET (5 ') ATTAGTTACCTTAAGACCTA (3')

able to pair with the same portion of Plasmodium falciparum genomic DNA due to its double-stranded nature.

Also included in the invention are nucleic acids and oligonucleotides in which the thymidine groups are replaced by uracyl groups.

The oligonucleotide OLI 28 can be prepared by chemical synthesis, the nucleic acid pUF 28 is itself isolated from a recombinant bacterial clone RRlD / pUF28 by methods known in the state of the art.

The nucleic acid pUF 28 and the oligonucleotide OLI 28 have the characteristic of specifically hybridizing with the DNA of Plasmodium falciparum.

The invention therefore also relates to the probes for detecting the presence of Plasmodium falciparum in a biological sample, consisting of or comprising all or part of the complementary sequence of a nucleic acid according to the invention, or any probe which is not distinguished from the preceding ones. level of the nucleotide sequence only by substitutions and / or additions and / or deletions of one or more nucleotides not causing modification of the hybridization properties of said probe with a nucleic acid according to the invention, under the conditions of hybridization defined below:

- pre-hybridization treatment of the support on which the probe is fixed, at 33 ° C for 30 minutes with a pre-hybridization solution having the following composition:

buffer 5 times SSC (1 time SSC = 0.15M Nacl;

Sodium 0.015M)

Ficoll 400 0.1% Weight / Volume

Polyvinylpyrrolidone 0.1% Weight / Volume

Sodium phosphate pH 6.5 50 mM

Glycine 0.1% Weight / Volume

SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume

Denatured herring sperm DNA 100 μg / ml

REPLACEMENT SHEET in the presence of 50% formamide.

- Hybridization with the complementary nucleic acid, for 2 hours at 33 ° C in a buffer solution identical to the previous pre-hybridization solution, in the presence of 50% formamide.

- successive washes with the following solutions:

. 4 washes of 5 minutes in a 5 times SSC buffer in the presence of 0.1% SDS, at room temperature,. 1 wash of 20 minutes in a tampon 2 times

SSC in the presence of 0.1% SDS, at room temperature.

The invention also relates to probes for detecting the presence of Plasmodium falciparum in a biological sample, consisting of or comprising a sequence of 10 to 450 consecutive nucleotides contained in the complementary sequence of a nucleic acid according to the invention.

The invention relates more particularly to probes for detecting Plasmodium falciparum in a sample, constituted by or comprising a nucleotide sequence complementary to an oligonucleotide according to the invention, or any probe distinguished from the previous one at the level of the nucleotide sequence only by substitutions and / or additions and / or deletions of one or more nucleotides which do not modify the hybridization properties of said probe with an oligonucleotide according to the invention, under the hybridization conditions defined below:

- pre-hybridization treatment of the support on which the probe is fixed, at 30 ° C for 30 minutes with a pre-hybridization solution having the following composition:. 5 times SSC buffer

. Ficoll 400 0.1% Weight / Volume

. Polyvinylpyrrolidone 0.1% Weight / Volume. Sodium phosphate pH 6.5 50 mM

. Glycine 0.1% Weight / Volume

. SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume

REPLACEMENT SHEET . Denatured herring sperm DNA 100 μg / ml

hybridization with the complementary oligonucleotide, for 4 hours at 30 ° C. in a buffer solution identical to the previous pre-hybridization solution. successive washes with the following solutions:

. 2 washes of 5 minutes in a buffer 5 times SSC at room temperature,. 1 wash of 5 minutes in a buffer 5 times

SSC in the presence of 0.1% SDS, at room temperature.

. 1 wash for 20 minutes in a 5 ^' SSC buffer in the presence of 0.1% SDS, at room temperature.

The hybridization conditions defined above constitute preferred conditions, but are in no way limiting and can be modified without affecting the recognition and hybridization properties of the probes and of the nucleic acids and of the oligonucleotides in accordance with the invention. It is known to ^"those skilled in the art that a nucleotide sequence can present modifications such as substitutions and / or additions and / or deletions of one or more nucleotides, however, not resulting in modification of the properties, in particular of hybridization of said nucleotide sequence.

The invention also relates to the probes for detecting Plasmodium falciparum in a sample, constituted by the repetition of the sequence of one or more probes containing from 10 to 450 nucleotides. The probe corresponding to the pUF 28 nucleic acid and therefore having the sequence of FIG. 1 will be denoted hereinafter by probe pUF 28 _r and by probe OLI 28, the probe corresponding to oligonucleotide OLI 28 and therefore having the sequence next :

(5 ') TAGGTCTTAAGGTAACTAAT (3')

REPLACEMENT SHEET The probes are advantageously marked with any marker conventionally used. The probes can be marked using a radioactive tracer as ³² P, ³⁵ S,

¹²⁵ I, ³ H, ¹⁴ C. The radioactive labeling can be carried out according to any method known to those skilled in the art.

The probes can be marked in 3 ′ by addition of one or more deoxynucleotides or ribonucleotides or of a dideoxynucleotide, marked in alpha by ³² P, in the presence of the Terminal Deoxynucleotidyl Transferase; the probes can also be labeled in 5 ′ by transfer of a radioactive phosphate group from a deoxynucleotide or from a free dideoxynucleotide labeled in the gamma position, in the presence of the T4 Polynucleotide Kinase, they can also be labeled at each end by addition of any radiolabelled sequence in the presence of T4 DNA ligase.

The pUF 28 probe is advantageously marked with "Nick Translation" or with "Random Priming". The £ _L_L 28 oligonucleotide probe can be labeled during its chemical synthesis by incorporating one or more radioactive deoxynucleotides, the OLI probe 28 is advantageously labeled at its 5 ′ end.

The hybridization detection method will depend on the radioactive marker used and may be based on autoradiography, liquid scintillation, gamma counting or any other technique making it possible to detect the emission of the radiation emitted by the radioactive marker.

Non-radioactive labeling can also be used, by combining with the probes of the invention groups having immunological properties such as an antigen, a specific affinity for certain reagents such as a ligand, physical properties such as fluorescence or luminescence, properties allowing the completion of enzymatic reactions such as an enzyme or an enzyme substrate. Non-radioactive labeling can be done by incorporating a nucleotide analog

REPLACEMENT SHEET comprising one of these groupings, by "Nick Translation" or by "Random Priming"; or by adding to the 3 'or 5' end of one of these analogs. It can also be done directly by chemical modification of DNA, such as photobiotinylation or sulfonation.

The invention also relates to a method of hybridization of a nucleotide probe with the DNA of Plasmodium falciparum, characterized in that it comprises the following stages: - the treatment of pre-hybridization of a support, such as a filter nitrocellulose or a nylon membrane, on which DNA extracted from Plasmodium falciparum is fixed, with a pre-hybridization solution,

hybridization in a solution identical to the pre-hybridization solution further comprising a nucleotide probe according to the invention,

- several successive washes. The invention also relates to a method of in vitro detection of Plasmodium falciparum in a biological sample likely to contain it, characterized in that after having made the DNA of Plasmodium falciparum, possibly contained in the biological sample, accessible and single-stranded, it is puts in contact with a nucleotide probe according to the invention, under conditions favorable to hybridization and the hybrids which are possibly formed are detected, the probe having been previously marked or made capable of being detected as it was said previously.

The probes according to the invention can also be used to detect the DNA of Plasmodium falciparum present at the sporozoite stage in the salivary glands of anopheles.

The subject of the invention is also the malaria diagnostic kits implementing methods of in vitro detection of Plasmodium falciparum mentioned above.

By way of example, such kits include in particular:

REPLACEMENT SHEET a determined quantity of a nucleotide probe in accordance with the invention,

a medium suitable for carrying out a hybridization reaction between the DNA of Plasmodium falciparum and said probe,

- reagents for the detection of the hybrids formed between the DNA and the probe during said hybridization reaction.

The oligonucleotide probes according to the invention can be used as a primer in a process of genetic amplification in vitro consisting in fixing the probe on the DNA of Plasmodium falciparum by hybridization, then in carrying out a process of enzymatic extension to l using DNA polymerase, followed by a denaturation process, and repeating the hybridization-extension-denaturation cycle, known as the PCR ("Polymerase Chain Reaction" cycle described by the company Cetus Corporation) sufficient to increase the quantity of the target sequence of the starting oligonucleotide probe in an exponential proportion relative to the number of cycles used.

In addition to the foregoing characteristics, the invention comprises -other characteristics which will appear during the description which follows and which refer to examples of implementation of the present invention, it being understood that these examples cannot constitute any limitation on the scope of the claims.

I - PREPARATION OF THE PUF 28 PROBE. A) Production of the PUF 28 probe

The pUF 28 nucleic acid is introduced into a host cell using a vector, of the plasmid type capable of replicating in said host cell; advantageously the nucleic acid pUF 28 was introduced into the plasmid pUC 19 and amplified in the strain of Escheri ch-i, a Cûli RR1DM1 (K 12), derived from HP 103. -

REPLACEMENT SHEET From a freezer at -70 ° C, the strain is seeded on a solid SOB medium (Bacto Tryptone 2%,

0.5% Yeast Extract, 10mM NaCl, 2.5mM KC1, 10MM MgC12,

MgSO4 lOmM), in the presence of Ampicillin (50 mg / ml) and cultured for 18 hours at 37 ° C.

10 ml of SOB liquid medium (Ampicillin (50 mg / ml)) are seeded with a colony and cultured for 16 hours, at 37 ° C., with orbital stirring at 200 rpm. 2 ml of this preculture serve as an inoculum for inoculating a liter of SOB liquid medium (Ampicillin 50 mg / ml).

The culture is done over 9 hours, at 37 ° C and with stirring (200rpm).

The addition of Chloramphenicol (170 mg / ml) makes it possible to amplify the number of copies of the plasmid per cell by blocking the bacterial division. This amplification step always takes place at 37 ° C., with stirring

(200 rpm), for 16 hours.

The bacteria are recovered by centrifugation at 5000 g, for 10 minutes and at 4 ° C.

The plasmid is extracted in a conventional manner according to the technique of Birboim and Doly, described by Maniatis et al (1982 "Molecular cloning, A laboratory manual", Cold Spring Harbor Laboratory). It is purified, in the last step, by ultracentrifugation on a CsCl2 gradient (n = 1.3860; 1.55 mg / ml; 100,000 g; 20 ° C; 36 hours; in the presence of 600 mg / ml of Ethidium Bromide. .

Ethidium Bromide is eliminated by 6 extractions with n-Butanol and 3 extractions with Diethyl-Oxide. B) Purification of the pUF 28 probe

After precipitation in 70% ethanol, the plasmid DNA is desiccated under vacuum and then dissolved in water and assayed by measurement with a spectrophotometer of the O.D. of the solution at 260 nm. The purification of the pUF 28 insert is carried out by a double enzymatic digestion of the plasmid by 2 enzymes Sst I (or Sac I) and Xba I whose cleavage sites are

REPLACEMENT SHEET are located on either side of the insert, in the polylinker sequence of the plasmid pUC 19.

In a preparative manner, 100 ITIg of plasmid are digested in at least 200 ml of Sac I buffer (Tris-HCl pH 8, 50 mM; 50 mM NaCl; MgCl 2 10 mM) at a rate of 1 unit / mg of each enzyme. The two digestions are simultaneous and are incubated at 37 ° C for at least 3 hours.

The insert pUF 28 (1.846 kb) and the plasmid pUC 19

(2.686 kb) are separated by 0.8% agarose gel electrophoresis (20 cm by 20 cm gel; two wells 7 cm long by 1.5 mm wide by 0.8 cm deep) , in TAE buffer (0.5 mg / ml of Ethidium Bromide).

The lower strip is cut and the pUF 28 probe is electro-eluted in a BIOTRAP device (trade name), in TAE buffer (0.5 mg / ml of Ethidium Bromide). The insert thus purified is ready for use after 6 extractions of Ethidium Bromide with n-Butanol and 3 extractions with Diethyl Oxide and precipitation in 70% ethanol. After redissolving in water, the quality of the probe is checked by analytical electrophoresis and the DNA concentration is determined by measuring the O.D. at 260nm.

C) Marking of the pUF 28 probe

The results reported below were obtained by labeling the pUF 28 probe at ³² P, via a nucleotide triphosphate labeled in the alpha position; for example alpha ³² P dTTP (800 Ci / mmol; AMERSHAM FRANCE (trade name)). A microgram of insert is thus marked with 140 μCi per nick translation, the specific activity is then from 1 to 5.10 ⁸ cpm / mg. One can also mark the insert by the technique of "Random Priming", the specific activity is then from 1 to 2.10 ⁹ cpm / mg. II - PREPARATION OF THE OLI 28 PROBE. A) Production of the OLI 28 probe The OLI 28 oligonucleotide sequence of 20 bases is produced by chemical synthesis on an automatic device (APPLIED BIOSYSTEM synthesizer (name

REPLACEMENT SHEET commercial)). 300 liters were thus synthesized in single-stranded form at one time.

High concentration concentrates are discarded after pre cip itat ion of monobr DNA in 70% ethanol.

B) Marking of the OLI 28 probe

The oligonucleotide OLI 28 is labeled at the 5 ′ end with the T4 Polynucleotide Kinase, in the presence of gamma ATP. 50 pmol of OLI 28 probe (330 ng) are incubated in the presence of 7 Units of T4 Polynucleotide Kinase and 150 μCi of gamma ³² P ATP in a final volume of 50 IDl. The average specific activity is of the order of 2 to 5.10 ⁸ cpm / mg

III - PREPARATION OF SAMPLES FOR ANALYSIS

A) Preparation of samples

The sample preparation protocol described below was developed by J.. Zolg et al, and described in Am. J. Trop. Med. Hyg. (1987), 3___., 33-41. This technique has 5 steps and allows manipulation of parasitized blood samples of at least 501X11.

- first step: Lysis of parasitized red cells by adding 2 volumes (100 mi) of double-distilled, sterile water. Incubate for 20 minutes. - uxi th step: Lysis of the parasites by adding 0.33 volume (50 mi) of LE buffer (Lauryl Sarcosine 1%; EDTA pH8, 50 mM). EDTA inhibits the enzymatic activity of DNAases.

- third step: Addition of 0.25 volume (50 ml) of cesium trifluoroacetate 5 M. Cesium trifluoroacetate is a highly chaotropic salt which denatures proteins and dissociates them from nucleic acids.

- fourth step: Extraction of the proteins by adding 0.33 volume (83 ml) of an organic mixture (2.5 volume ethanol / 1 volume chloroform / 0.04 volume isoamyl alcohol).

REPLACEMENT SHEET - fifth step: Centrifugation at 12,000 g for 5 minutes and recovery of the upper aqueous phase.

All stock solutions can be stored at room temperature. DNA extracted using this method can be stored at 37 ° C for several months.

B) DNA denaturation

The DNA is denatured by adding 0.25 volume (62.5 ml) of 2.5 N sodium hydroxide solution (20 minutes at room temperature).

The solution is neutralized with 0.5 volume (156 ml) of Tris-HCL buffer (pH8, 3M) and incubated in ice to avoid renaturation of the DNA.

C) Depositing of the samples The samples are deposited in duplicate on a support such as a nitrocellulose filter using a filtration apparatus 8 times 12 wells, under vacuum (HYBRI-DOT MANIFOLD apparatus of BRL (trade name)).

The filter is previously wetted in the buffer 2 times SSC (1 time SSC = 0.15 M NaCl; Sodium Citrate 0.015 M) before being placed in the device. Each sample is placed under vacuum. Before and after each deposit, the well is rinsed with 200 ml of 2 times SSC buffer. After drying at room temperature for 30 minutes, the filter is incubated at 80 ° C for 2 hours, between two sheets of HATMAN 3MM paper (trade name) to fix the DNA on the membrane. IV - HYBRIDIZATION

Hybridization takes place in three stages: prehybridization, hybridization, washes.

A) Prehybridization

The dry filter is placed in a welded plastic bag and incubated in a hybridization buffer, at a rate of 75 ml / cm ² . The hybridization buffer has the following composition: - 5 times SSC buffer

REPLACEMENT SHEET - Ficoll 400 0.1% Weight / Volume

- Polyvinylpyrrolidone 0.1% Weight / Volume

- Sodium phosphate pH 6, 5 50 mM

- Glycine 1% Weight / Volume - SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume

- Denatured herring sperm DNA 100 mg / ml

Prehybridization with the pUF 28 probe is carried out for 30 minutes at 33 ° C in the presence of 50% formamide. Prehybridization with the OLI 28 probe is carried out for 1 hour at 30 ° C, in the absence of formamide.

B) Hybridization

After denaturation of the pUF 28 probe by heating to 100 ° C for 10 minutes then cooling in melting ice (0 ° C) for 10 minutes, hybridization with the single-stranded pUF 28 probe is carried out in the same buffer as the prehybridization; the filter is hybridized with 80 ng / ml of pUF 28 probe for 2 hours at 33 ° C, for a specific activity of at least 10 ⁸ cpm / mg. Hybridization with the OLI 28 probe is done in the same buffer as the prehybridization; the filter is hybridized with 100 ng / ml of OLI 28 probe for 4 hours at 30 ° C, for a specific activity of 2.10 ⁸ cpm / mg at least.

C) Washing of fi 1très The washing conditions are different for each probe.

- washing after hybridization ^* with the pUF 28 probe includes:

. 4 washes of 5 minutes in a buffer 5 times SSC in the presence of 0.1% SDS, at room temperature,

. 1 wash of 20 minutes in 2 times SSC buffer in the presence of 0.1% SDS, at room temperature.

- washing after hybridization with the OLI 28 probe includes:. 2 washes of 5 minutes in a buffer 5 times

SSC, at room temperature,

_FE U. _LLE 0 _E B _E P AC _E MENT . 1 wash of 5 minutes in 5 times SSC buffer in the presence of 0.1% SDS, at room temperature.

1 wash of 20 minutes in 5 times SSC buffer in the presence of 0.1% SDS, at room temperature. D) Revelation of hybridization

The filters are dried at room temperature for 30 minutes, wrapped in plastic film, and exposed to autoradiography film, at -70 ° C, for 24 hours. V - SENSITIVITY OF DETECTION

A) Sensitivity of DNA detection

The pUF 28 probe, radiolabeled at ³² P, can detect 100 μg of purified Plasmodium falciparum DNA. after 24 hours of exposure to the autoradiography film. The radiolabelled OLI 28 probe can detect 1 ng of DNA after 24 hours of exposure.

B) Sensitivity σ_≤ detection of red blood cells

In order to recover the pathophysiological conditions, the detection tests were carried out on red blood cells parasitized in vitro, synchronous at the ring stage.

The ³² P-labeled pUF 28 probe detects 50 red blood cells parasitized per mm ³ of culture blood at 50% hematocrit, after 24 hours of exposure to the film, ie a parasitaemia of 0.001% in a reproducible manner.

The radiolabelled OLI 28 probe detects 500 red blood cells parasitized per mm ^3, ie a parasitemia of 0.01% under the same conditions. Table I below reports the handling time and the sensitivity of the pUF 28 and OLI 28 probes as well as of various probes known to date.

REPLACEMENT SHEET

As indicated in Table I, the pUF 28 and OLI 28 probes have a detection sensitivity at least equivalent to that of pRep-Hind and PFR1 and which is completely reproducible.

In addition, the hybridization conditions developed specifically for these probes made it possible to achieve these performances after only 2 hours of hybridization for the pUF 28 probe and 4 hours for the OLI 28 probe.

The pUF 28 and OLI 28 probes are specific for the DNA of Plasmodium falciparum: thus, in hybridization of

"Southern Blots" they do not recognize human genomic DNA, nor the DNA of the three other plasmodial species: Plasmodium malariae. Plasmodium ovale and Plasmodium vivax as well as Plasmodium cynomolgi bastianellii which infests the monkey. They recognize the DNA of the following strains of Plasmod um falciparum of different geographic origin:

- CAM strain from Senegal

- SGE-1 strain from Gambia

REPLACEMENT SHEET JEAN strain from Central Africa KENYA strain from Kenya LILLY strain from Central Africa NF7 strain from Africa (Amsterdam Airport) NF54 strain from Tanzania UPA strain from Uganda HONDURAS strain from Honduras INDOCHTNΆ-1 strain from Vietnam

10

15

20

25

30

35

REPLACEMENT SHEET FIGURE I

(5 ') GATCCT AACATCAGTAATG TAGGTCTT ACTTCCACTGATC TAGGTCTT AACTTGACTCATA TAGGTCTT ATGATTACTAACC ATGGTAAATCACT AAGGTCTT ACTGTTACTAATA ATGTCAACTAACT TTGGTCTT AAGCTTACTAATT

AAGGTCCT AATTTAACTAATA TAGGTCTT ATGGTTACTAACC TAGGTCAT AAGGTTACTAAC TAGGTCTT AATGTAAATAACG TAGGTCATTAATGTAACTAACG TACGTCTT AACATGACTAACC TACGTCTT AACGTAACTAACA AAGTTCTT ACTTTCATTAATT TAAGTCAT TAAGGTACTAATT CAGGTCCT AACTTCACTAACA TTGGTCTT AACTTAACAAATA TAGGTCCT AACTTGACTAACT TAGGTCCT AACTACAGCAACA TAGGTCTT ACTTTCACTAATA TAGGTCTA TAGGTAAGTAATA TAGGTCTT ACTTTCATTCATA TAGGTCTT ACTTTTACTAACA TAGGTCTT ATGGTAACTAACT TAGGTCTT ACTTTCATTAATT AAGGTCTT AACTTAACTAACT GAGGTCCT AACATTACATACT TAGGTCTT AACTTGACTAACA TAGGTCTT ACGTTGACTAACT TAGGTCTT AGGTTGACTAACT TAGGTCCT TACTATACTAACT TAGGTCTT ACCTTCACTCGTA TAGGTCTT AAGGTAAGTAATA TAGGTCTT ACTTTCACTAACG TAGGTCCT CAATACAGTAACG TAGGCCTC AACTTAACTAACT AAGGTAACTAATA TAGGTCTT AACATAACTAATA

CAGGTCCT AACTACAGCAACA TAGGTCTT AACGTAACTAGCT TAGGTCTA TAGGTAAGTAATA AAGGTCAT ACAATTACTAACC TAGGTCCT AACATTACATACT TAAGTCAT TAAGGTACTAACT TAGGTCTT GACTGGAGTAATG TAGGTCGT AATGTAACTAATA TAGGTCCT AACATTACTAGCT TAG-T ^ TT ^ AC ^ aA AATG TTCGTCTT TGGGT ACT ACT Afy? Rc AA πτAA τ.aATc TAGGTCTT GACTGGAGTAATC TAGGTCCT AACATTAGTAATG TΆFSΠTCT .aaK7TaaC! TVATA TAGGTCTT ACTTTCACTCATA TAGGTCCT ATTATCACTAACG TAGGCCTT ACTTTCACTAACT TAGGTCTT AAGCTAACTAATT TAGGTCTT ACTTTCACTAACT TAGGTCTT ATGGTAACTAATA TAAGTCTT ACTTTCACTAACC AAGCTTACTAACT TAAGTT T CADTC ACTAACT AACTTAGATGCT TAGGTCTT ACCTTCACTAACA AACATAACCAATA TAGGTCTT ATTTTTACTAACT AACTACACTAACT TAGGTCTT AACGTGACTAACA AACTTAGCTAACA CAGGTCTT AACCTGACTAACA TAGGTCTT AACTTAACTAATA TAGGTCTT AACTTAACTAACCT TAGGTCCT AACTTCACTAACT TAGGTCTT ACTTTCACTAAGT TAGGTCTT AAGGTAACTAACA GAGGTCCT TCTTTTACTAATA TAAGTCAT TAAGGTACTAATT TAGGTCCT AACGTAACTAATATA TTGGTCTT AACTTAACAAATA TAGGTCTT ATAGTCACTAACC TAGGTCCT AACATTACTAACA AAGGTCTT ACTCTTACTGATA TAGGTCTT AAGTTAACTAACT TAG GTCTT ATGGTTACTAACC .. AAGGTCAT ACTTTTACTAACT TAGATC (3 ')

Underlined sessions Oligonucleotide OLI 28 repeated four times

REPLACEMENT SHEET

Claims

RESELL ICftT IONS

1 - Nucleic acid characterized in that it comprises the nucleotide sequence of FIG. 1 or the corresponding complementary sequence.

2 - Oligonucleotide derived from a nucleic acid according to claim 1, characterized in that it comprises the following sequence:

(5 ') TAGGTCTTAAGGTAACTAAT (3')

or the following corresponding complementary sequence:

(5 ') TTAGTTACCTTAAGACCTA (3').

3 - Probe to detect the presence of

Plasmodium falciparum in a sample, characterized in that it consists of or that it comprises all or part of the complementary sequence of the nucleic acid of claim 1, or any nucleotide probe which is indistinguishable from the previous one the nucleotide sequence only by substitutions and / or additions and / or deletions of one or more nucleotides which do not modify the hybridization properties of said probe with the nucleic acid of claim 1.

4 - Probe for detecting the presence of Plasmodium falciparum in a sample according to claim 3, characterized in that it consists of or that it comprises a sequence of 10 to 450 consecutive nucleotides contained in the sequence complementary to the nucleic acid according to claim 1.

5 - Probe for detecting the presence of Plasmodium falciparum in a sample according to claim 4, characterized in that it consists of or that it comprises a nucleotide sequence complementary to the oligonucleotide of claim 2, or any nucleotide probe does distinguished from the

REPLACEMENT SHEET above at the nucleotide sequence level only by substitutions and / or additions and / or deletions of one or more nucleotides which do not modify the hybridization properties of said probe with the oligonucleotide of claim 2.

6 - Probe for detecting the presence of Plasmodium falciparum in a sample, characterized in that it consists of the repetition of the sequence of one or more probes according to any one of claims 4 or 5.

7 - Probe according to any one of claims 1 to 6, characterized in that it is radioactively labeled or with a marker of the enzymatic, antigenic, ligand, luminescent or fluorescent type. 8 - A method of hybridization of a nucleotide probe according to any one of claims 3 to

6 with the DNA of Plasmodium falciparum, characterized in that it comprises the following stages:

- the pre-hybridization treatment of a support, such as a nitrocellulose filter or a nylon membrane, on which the DNA extracted from Plasmodium falciparum is fixed. with a pre-hybridization solution,

the hybridization in a solution identical to the pre-hybridization solution further comprising a nucleotide probe according to any one of claims 3 to 6,

- more successive washes.

9 - P ro ced of hybridization of a nucleotide wave according to claim 3 with the DNA of Plasmodium falciparum. characterized in that it comprises the following stages:

- pre-hybridization treatment of the filter. The filter on which the DNA extracted from P smodium falciparum is fixed is placed in a welded plastic bag, and incubated for 30 minutes at 33 ° C. with a prehybridization solution having the following composition: 5 times SSC

REPLACEMENT SHEET - Ficoll 400 0.1% Weight / Volume

- Polyvinylpyrrolidone 0.1% Weight / Volume

- Sodium phosphate pH 6.5 50 mM

- Glycine 1% Weight / Volume

- SDS (Sodium Dodecyl Sulfate) 0.1% Weight / Volume

- denatured herring sperm DNA 100 mg / ml in the presence of 50% formamide,

hybridization in a buffer solution identical to the pre-hybridization solution, further comprising the nucleotide probe according to claim 3 marked in particular radioactively, in the presence of 50% formamide, for 2 hours at 33 ° C,

- the following successive washes:

10 - A method of hybridization of a nucleotide probe according to claim 5 with the DNA of Plasmodium falciparum, characterized in that it comprises the following steps:

- pre-hybridization treatment of the filter. The filter on which the DNA extracted from Plasmodium falciparum is fixed is placed in a welded plastic bag, and incubated for 1 hour at 30 ° C. with a pre-hybridization solution having the following composition:

- 5 times SSC buffer

- Ficoll 400 o, 1% Weight / Volume

- Polyvinylpyrrolidone o, 1% Weight / Volume

- Sodium phosphate pH 6.5 50 mM

- Glycine 1% Weight / Volume

- SDS (Sodium Dodecyl Sulfate) o, 1% Weight / Volume

- Denatured herring sperm DNA 100 mg / ml

- Hybridization in a tamt solution identical to the pre-hybridization solution, further comprising the nucleotide probe according to claim 5

REPLACEMENT SHEET radioactively marked, for 4 hours at 30 ° C,

- the following successive washes:

. 2 washes of 5 minutes in a buffer 5 times SSC, at room temperature,

. 1 wash for 5 minutes in 5 times SSC buffer in the presence of 0.1% SDS, at room temperature,

. 1 wash of 20 minutes in 5 times SSC buffer, in the presence of 0.1% SDS, at room temperature. 11 - Method for in vitro detection of Plasmodium falciparum in a biological sample likely to contain it, characterized in that after having made the DNA of Plasmodium falciparum possibly contained in the biological sample, accessible and single-stranded, it is brought into contact with a Nucleotide probe according to any one of Claims 3 to 6, under conditions favorable to hybridization and the hybrids possibly formed are detected.

12 - Kit for implementing an in vitro detection process for Plasmodium falciparum according to claim 7, characterized in that it comprises: a determined quantity of a nucleotide probe according to one of claims 3 to 6,

REPLACEMENT SHEET