WO1990014443A1 - Co-expression of heteromeric receptors - Google Patents

Co-expression of heteromeric receptors Download PDF

Info

Publication number
WO1990014443A1
WO1990014443A1 PCT/US1990/002890 US9002890W WO9014443A1 WO 1990014443 A1 WO1990014443 A1 WO 1990014443A1 US 9002890 W US9002890 W US 9002890W WO 9014443 A1 WO9014443 A1 WO 9014443A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna sequences
receptors
vector
vectors
polypeptides
Prior art date
Application number
PCT/US1990/002890
Other languages
French (fr)
Inventor
William D. Huse
Original Assignee
Huse William D
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huse William D filed Critical Huse William D
Priority to AU58344/90A priority Critical patent/AU652539B2/en
Publication of WO1990014443A1 publication Critical patent/WO1990014443A1/en
Priority to FI915411A priority patent/FI915411A0/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/468Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL

Definitions

  • Proteins which are composed of linear arrays of amino acid subunits. Proteins can function as enzymes, antibodies or structural proteins, among other things. Proteins whose function is binding other protein, or non-protein molecules, and thereby effect a chemical reaction are termed receptors.
  • proteins When expressed in a living cell the functional characteristics of proteins are determined by the sequence of their amino acids that are, in turn, encoded by DNA sequences termed genes. While many proteins are single molecules encoded by a single gene, other proteins are composed of two or more separate polypeptides which associate spatially to form an active protein, each polypeptide being encoded by a separate gene. Such proteins are termed heteromers. Where such proteins function as receptors, they are thus heteromeric receptors.
  • a particular category of protein as defined by either its characteristic structure or function, exhibits variations in its function, which reflect differences in the particular amino acid sequence. For example, in color vision the receptors for the three different primary colors are the three different rhodopsin molecules which are structurally related but functionally different. Structural differences can also be important in diseases. For example, the hemoglobin of most healthy people and the hemoglobin of individuals with sickle cell anemia differ by a single amino acid. Some categories of proteins in fact exhibit immense variability. Such variability is important because of the particular function of the protein.
  • Antibodies are an example of a category of proteins with two well defined structural and functional domains which coincide. One of these domains which bind antigen is functionally diverse and the other, the effector domain, is function restricted.
  • Antibodies are protein comprising four associated polypeptides, two so-called heavy chains, and two light Chains. The four polypeptides associate to form a structure which can be thought of as resembling a " ⁇ ", with the tip of the two arms being binding sites which are able to selectively recognize and bind to molecules called antigens, which the body recognizes as foreign.
  • the binding site of the heavy chain is termed VH, while the binding site of the light chain is termed VL.
  • Each arm of the "Y" is called a Fab fragment because it contains the antigen binding functional domain. Such binding is important in order to effect the removal of deleterious foreign materials, for example viruses or bacteria. Because of the vast array of different antigens which an organism may encounter, a vast array of different antibodies are necessary. Such an array, or repertoire, is achieved by an individual having many genes encoding portions of the Vh and VL binding regions. In cells of the immune system, random combinations of these various VH and VL encoding genes can randomly associate in order to allow the expression of upwards of 10 7 different antibody molecules. This possibility arises because the VL and the VH structural domains are smaller than the binding functional domain which is shared between these two structural domains.
  • the invention provides a composition of matter comprising a plurality of procaryotic cells containing diverse combinations of first and second DNA sequences encoding first and second polypeptides that can be expressed and which form heteromeric receptors and at least one of the plurality of procaryotic cells expressing a heteromer exhibiting binding activity towards a preselected molecule.
  • the invention further provides a kit for the preparation of vectors useful for the coexpression of two or more DNA sequences, comprising two vectors, a first vector having a first combining site on a defined side of a cloning site which defines orientation and a second vector with a second combining site and a cloning site of orientation asymmetric to that of the first vector, wherein one or both of the vectors contains a promoter for expressing polypeptides which form heteromeric receptors encoded by DNA sequences inserted in the cloning sites.
  • the invention still further provides a method of constructing a diverse population of vectors having first and second DNA sequences encoding first and second polypeptides which associate to form heteromeric receptors, comprising the steps of (a) operationally linking a diverse population of first dna sequences encoding the first polypeptides to a first vector having a combining site and a cloning site in a defined orientation;
  • step (c) combining the vector products of step (a) with the vector products of step (b) under conditions to permit their combination into a combined vector having the first and second dna sequences operationally linked thereon.
  • the combining can be accomplished for example, by restriction endonuclease cleavage of the vectors of step (a) and (b) and combining the cleaved vectors of step (a) and (b) with DNA ligase or combining by Flp recombinase.
  • Figure 1 shows a schematic diagram of the light chain vector (lambda LCI) , the heavy chain vector (lambda Hc2) and the combinatorial vector.
  • Figure 2 shows nucleotide sequences of the synthetic oligonucleotides inserted into lambda Zap II to create the (A) light chain vector (lambda Lcl) and (B) heavy chain vector (lambda Hc2) of Figure 1.
  • Figure 3 shows autoradiographs of library screens for the combinatorial (A and B) , the heavy chain (E and F) and for the light chain (G and H) libraries.
  • Filter C and D represent the cored positive from a primary filter A.
  • Figure 4 shows the specificity of antigen binding by competitive inhibition.
  • Figure 5 is a schematic diagram representing the plasmids which can be excised from the combinatorial vector.
  • Figure 6 shows the characterization of an antigen binding protein derived from the combinatorial library.
  • Figure 7 shows the construction of a vector system for a combinatorial vector using the Flp recognition sequence as the combining site.
  • reverse combinations means that a substantial number of the possible nucleic acids encoding the first polypeptide are combined with a substantial number of the possible nucleic acids encoding the second polypeptide. Thus, a substantial number of the possible combinations are represented.
  • heteromeric receptors means a polypeptide comprised of at least two polypeptides, at least one of which is encoded on a different DNA. Thus, heteromer is composed of two or more polypeptides which associate and exhibit a common function. Receptor refers toi a polypeptide which is capable of binding any ligand. Therefore, receptor also includes a protein which when bound to its ligand can affect a second process. Examples of heteromeric receptors which can be formed include antibodies, T-cell receptors, integrins, hormone receptors and transmitter receptors.
  • binding activity means the heteromer exhibits an affinity for a molecule. This affinity can be specific for the molecule and can be used, for example, to detect or affect a function on the molecule.
  • preselected molecule means a particular molecule to which binding activity is desired. Since practically any molecule can be bound, this molecule is selected from the group of all possible molecules. Specific heteromers can be created which specifically bind this molecule and allow for detection or to affect the molecule's function.
  • first and second polypeptides which can associate means the polypeptides encoded by the first and second nucleotide sequences are chemically or physically attracted to each other and form a heteromer.
  • combining site means a nucleotide sequence which can be cleaved and joined with another nucleotide sequence. Such cleavage and joining results in a nucleic acid having both sequences in proper orientation to allow translation of the desired polypeptide.
  • asymmetric means a non-identical or a non-correspondence in form, size or arrangement of parts on opposite sides of a boundary such as a dividing line or around an axis.
  • the arrangement of 2 different restriction sites with respect to the 5' and 3 • ends of a DNA sequence are asymmetric if they are arranged in one vector in the opposite orientation as that for a second vector.
  • transfect or “transform” refers to introducing nucleic acids into a living cell such that the nucleic acid is fully separated from extracellular fluids by a lipid membrane.
  • in vitro refers to performing the process in a system in which a particular expression does not naturally occur, thus, in vitro can refer both to expression in procaryotic cells as well as eucaryotic ⁇ cells, provided the latter does not naturally express the gene combination.
  • the invention provides a composition of matter comprising a plurality of procaryotic cells containing diverse combinations of first and second DNA sequences encoding first and second polypeptides that can be expressed and which form heteromeric receptors and at least one of the plurality of procaryotic cells expressing a heteromer exhibiting binding activity towards a preselected molecule.
  • the procaryotic cells are preferably E. coli, however any suitable procaryotic cell can be utilized. Suitable alternative cells would be selected by reviewing the literature to determine which vector and cells could be adapted by the methods taught herein. Therefore, alternative cells require compatible vectors capable of expressing first and second DNA sequences in the selected host cell. Alternatively, eucaryotic cells could be used. Such use would simply require substituting eucaryotic control and expression elements which function in a compatible eucaryotic host. Therefore, for procaryotic and eucaryotic systems, compatibility means that the vector/host combination contains all necessary signals and factors to perform the desired function.
  • the first and second DNA sequences which encode functional portions of heteromeric receptors can for example be antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors.
  • the first and second DNA sequences can encode functional portions of the variable heavy and variable light chains of an antibody including Fab, F'ab and the like.
  • any heteromer which is formed from a diverse combination or repertoire of alternative coding sequences can be made by the methods of this invention.
  • specific hormone and transmitter receptors can be made by combination of alpha and beta subunits.
  • the invention is easily applicable to any later discovered alternative-type, diverse combination heteromers.
  • the invention also provides a composition of matter comprising a plurality of procaryotic cells containing various combinations of diverse first and second DNA sequences encoding first and second polypeptides which can associate to form heteromeric receptors exhibiting binding activity towards preselected molecules, the diversity of first DNA sequence being greater than about 100 different sequences and the diversity of the second DNA sequence being greater than about 1000 different sequences.
  • the invention is effective with such diversity since the upper limit is greater than a billion combinations.
  • the invention further provides a kit for the preparation of vectors useful for the coexpression of two or more DNA sequences, comprising two vectors, a first vector having a first combining site on a defined side of a cloning site which defines orientation and a second vector with a second combining site and a cloning site of orientation asymmetric to that of the first vector, wherein one or both of the vectors contains a promoter for expressing polypeptides which form heteromeric receptors encoded by DNA sequences inserted in the cloning sites.
  • the vectors can be in a virus. Suitable virus can include mammalian as well as bacteriophages. One would apply the teachings set forth herein to utilize such vectors.
  • the vectors can be a plasmid.
  • the first and second combining sites of the vectors of the invention are of many possible types.
  • the specific sites utilized herein are EcoRI-EcoRI, and Notl-Notl and the specific cloning site was selected from the group consisting of Xhol-Spel, Sacl-Xbal, and Sacl-Spel. Additionally, the first and second combining sites can be site specific recombination sites, especially Flp recombination sites. Alternative sites can be practiced based on the disclosure of this invention.
  • the invention also provides a vector, capable of expressing a heteromer exhibiting binding activity towards a preselected molecule when combined with a second vector, having a first combining site on a defined side of a cloning site which defines orientation and which can be combined with a second vector with a second combining site and a cloning site of orientation asymmetric to that of the first vector, wherein one or both of the vectors contains a promoter for expressing polypeptides which form heteromers encoded by DNA sequences inserted in the cloning sites.
  • the invention still further provides a cloning system for the coexpression of two DNA sequences encoding polypeptides which associate to form a heteromer, comprising a set of uniform first vectors having a diverse population of first DNA sequences and a set of uniform second vectors having a diverse population of second DNA sequences, the first and second vectors having compatible combining sites so as to allow the operational combination of the first and second DNA sequences.
  • the invention also provides a plurality of expression vectors containing a plurality of possible first and second DNA sequences, wherein each of the expression vectors has operationally linked thereon a first DNA sequence and a second DNA sequence, and wherein substantially each of the vectors contains a different combination of first and second DNA sequence.
  • the invention still further provides a method of constructing a diverse population of vectors having first and second DNA sequences encoding first and second polypeptides which associate to form heteromeric receptors, comprising the steps of (a) operationally linking a diverse population of first DNA sequences encoding the first polypeptides to a first vector having a combining site and a cloning site in a defined orientation;
  • step (c) combining the vector products of step (a) with the vector products of step (b) under conditions to permit their combination into a combined vector having the first and second DNA sequences operationally linked thereon.
  • the combining can be accomplished for example, by restriction endonuclease cleavage of the vectors of step (a) and (b) and combining the cleaved vectors of step (a) and (b) with DNA ligase or combining by Flp recombinase.
  • a method of selecting a procaryotic cell which expresses a heteromer specific for a preselected molecule comprises randomly combining first vectors having a diverse population of DNA sequences encoding polypeptides with second vectors having different diverse populations of DNA sequences which encode polypeptides and which form heteromeric receptors with the polypeptides encoded by the first vector, transfecting a sufficient number of the randomly combined sequences into the procaryotic cells, screening the cells to determine the cell expressing a heteromer specific for the preselected molecule.
  • the combining can be accomplished with restriction endonuclease cleavage of the first and second vectors and ligating the cleaved first and second vectors or utilizing Flp recombinase. Additionally, the number of randomly combined sequences can be sufficiently equivalent to the possible combinations of the populations of the first and second DNAs in order to reasonably assure obtaining the desired heteromer.
  • a method for identifying functional heteromeric receptors composed of a plurality of polypeptides comprising coexpressing random combinations of first and second DNA homologs which encode polypeptides which associate to form heteromeric receptors so as to form a diverse population of the first and second DNA homologs, the diversity being at least enough that at least one heteromer formed by the polypeptides resulting from the coexpression has a desired functional property and restricted so that the heteromeric receptors can be screened for a predetermined function.
  • random combination in vitro or An vivo can be accomplished using two expression vectors distinguished from one another by the location of an endonuclease recognition site common to both.
  • the vectors are linear double stranded DNA, such as a lambda ZapTM derived vector as described herein which are symmetric with respect to the protein expression elements.
  • the recognition site is located 5* terminal to the coding sequence of at least one of the complementary determining regions (CDR's).
  • the recognition site is located 3' to at least one of the CDR's.
  • the recognition site in one vector can be located between a ribosome binding site and a RNA polymerase promoter site and in the second vector the restriction is located 3' to a cloning site.
  • the recognition site can be a restriction endonuclease recognition site, a recombinase recognition site such as a
  • each of the vectors defines a nucleotide sequence coding for a ribosome binding site and a leader, the sequence being located between the promoter and the polylinker, but downstream (3' terminal from a shared restriction site if that site is between the promoter and the polylinker) . Also preferred are vectors containing a stop codon downstream from the polylinker.
  • the first and/or second vector can also define a nucleotide sequence coding for a polypeptide which can function as a tag.
  • tags examples include (1) a short peptide sequence, (2) a sequence that encodes a protein, which binds to a receptor such as another predetermined antibody or protein G, such as a CHI domain of an antibody, (3) a protein that can function as an enzyme (such as beta- galactosidase or alkaline phosphatase) or (4) a phage coat protein that causes the phage to become attached to the coat of the phage.
  • the tag sequence is typically downstream from the polylinker but upstream of any stop codon that may be present.
  • the vectors contain selectable markers such that the presence of a portion of that vector, i.e. a particular lambda arm, can be selected for or selected against.
  • selectable markers are well known to those skilled in the art. Examples of such markers are antibiotic resistance genes, genetically selectable markers, suppressible mutations, such as amber mutations, and the like.
  • the selectable markers are typically located upstream and/or downstream of the promoter or polylinker. In preferred embodiments, one selectable marker is located upstream of the promoter on the first vector containing the
  • VH-coding (variable heavy chain-coding) DNA sequences A second selectable marker is located on the other side of the combination site on the vector containing the VL-coding (variable light chain-coding) DNA sequences. This second selectable marker may be the same or different from the first as long as when the VH-coding vectors and the VL- coding vectors are randomly combined at the combining site the resulting vectors containing both VH and VL can be selected preferentially.
  • the polylinker is a nucleotide sequence that defines one or more, preferably at least two, restriction sites.
  • the polylinker restriction sites are oriented to permit ligation of VH- or VL-coding DNA homologs into the vectors in the same reading frame at the leader, tag, linker, tag, or stop codon sequence present.
  • Random combination is accomplished by ligating VH- coding DNA homologs into the first vector, typically at a restriction site or sites within the polylinker. Similarly, VL-coding DNA homologs are ligated into the second vector, thereby creating two diverse populations of vectors. It does not matter which type of DNA homolog, i.e., VH or VL, is ligated to which vector, but it is preferred, for example, that all VH coding DNA homologs are ligated to either the first or second vector, and all of the VL-coding DNA homologs are ligated to the other of the first or second vector. The members of both populations are combined at the combination site.
  • the combination site is a restriction site and the members of both populations are then cleaved with an appropriate restriction endonuclease.
  • the resulting products are two diverse populations of restriction fragments where the members of one have cohesive termini complementary to the cohesive termini of the members of the other.
  • V H , V L , Fv (fragment of the variable region) , and Fab sequences are diagrammed in Figures 1 and 2. They were constructed by a modification of lambda Zap II, (Stratagene, La Jolla, CA) ; Short et al.. Nucleic Acids Res.. 16:7583 (1988) which is incorporated herein by reference, in which we inserted synthetic oligonucleotides into the multiple cloning site.
  • the methods described here and below are known to one skilled in the art and are described in detail in Maniatis et al. , Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, 1982 and Ausubel et al., and Current Protocols on Molecular Biology.
  • the vectors were designed to be asymmetric with respect to the Not I and Eco RI restriction sites that flank the cloning and expression sequences. This asymmetry in the placement of restriction sites in a linear vector such as bacteriophage allows a library expressing light chains to be combined with one expressing heavy chains in order to construct combinatorial Fab expression libraries.
  • the lambda Lc 1 vector was constructed for the cloning of PCR amplified products of mRNA that code for light chain protein, as described in Example II, by inserting the nucleotide sequence shown in figure 2A into the Sac I and Xho I sites of lambda Zap II.
  • the vector was prepared by digesting 10 ⁇ g of lambda arms from the Uni-ZapTM XR Vector Kit (Stratagene, La Jolla, CA) with Sac I.
  • the sequence shown in Figure 2A was constructed from overlapping synthetic oligonucleotides and cloned into the above Sac I digested arms as follows.
  • Oligonucleotides LI through L5 and L7 - L9 (LI, L2, L3, L4, L5, L7, L8 and L9) (shown in Table 1) were kinased by adding 1 ⁇ l of each oligonucleotide (0.1 ⁇ g/ ⁇ l) and 20 units of T polynucleotide kinase (BRL, Gaithersburg, MD) to a solution containing 70 mM Tris HCL at pH 7.6, 0.1 M KCl, 10 mM MgCl 2 , 5 mM DTT, 1 mM adenosine triphosphate (ATP) , 10 mM 2 ME, 500 micrograms per ml of BSA.
  • T polynucleotide kinase BRL, Gaithersburg, MD
  • the solution was maintained at 37°C for 30 minutes and the reaction stopped by maintaining the solution at 65 ⁇ C for 10 minutes.
  • the two end oligonucleotides L6 and L10 were added to the above kinasing reaction solution together with 1/10 volume of a solution containing 20 mM Tris-HCL at pH 7.4, 2.0 mM MgCl 2 and 50.0 mM NaCl.
  • This solution was heated to 70"C for 5 minutes and allowed to cool slowly to room temperature. During this time period all oligonucleotides annealed to form the double stranded synthetic DNA insert shown in Figure 2A.
  • the annealed oligonucleotides were covalently linked to each other by adding 40 ⁇ l of the above reaction to a solution containing 66 mM Tris-HCL at pH 7.6, 6.6 mM MgCl 2 , 1 mM DTT, 1 mM ATP and 10 units of T4 DNA ligase (BRL, Gaithersburg, MD) .
  • This solution was maintained at 25"C for 30 minutes and then the T4 DNA ligase was inactivated by heating the solution at 65°C for 10 minutes.
  • the unphosphorylated ends of the resultant oligonuleotides were kinased by mixing 52 ⁇ l of the above reaction, 4 ⁇ l of a solution containing 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37°C for 30 minutes and then the T4 polynucleotide kinase was inactivated by heating the solution at 65 ⁇ C for 10 minutes.
  • the phosphorylated synthetic DNA insert was ligated directly into the above prepared lambda Zap II vector arms.
  • the lambda He 2 vector was constructed for cloning PCR amplified products coding for heavy chain Fd sequences, as described in Example II, by inserting the nucleotide sequence shown in Figure 2B into the Not I and Xho I sites of lambda Zap II.
  • the heavy chain vector was prepared by digesting lambda arms
  • oligonucleotides described above include elements for construction, expression, and secretion of Fab fragments. These oligonucleotides introduce the asymmetric Not I and Eco RI restriction sites; a leader peptide for the bacterial pel B gene, which has previously been successfully used in E. coli to secrete Fab fragments, Better et al., Science. 240:1041 (1988); Skerra and Pluckthun, Science.
  • a ribosome binding site at the optimal distance for expression of the cloned sequence cloning sites for either the light or heavy chain PCR product; and, in lambda He 2, a decapeptide tag at the carboxyl terminus of the expressed heavy chain protein fragment.
  • the sequence of the decapeptide tag was useful because of the availability of monoclonal antibodies to this peptide that were used for immunoaffinity purification of fusion proteins, Field et al. Mol. Cell Biol. , 8:2159 (1988), which is incorporated herein by reference.
  • the vectors were characterized by restriction digest analysis and DNA sequencing, Sanger et al., Proc. Natl. Acad. Sci.. USA. 74:5463-5467 (1977), which is incorporated herein by reference and using AMV Reverse Transcriptase 35 S-ATP Sequencing Kit (Stratagene, La Jolla, CA) .
  • the initial Fab expression library was constructed from mRNA isolated from a mouse that had been immunized with the KLH-coupled p-nitrophenyl phosphonamidate antigen 1 (NPN) .
  • NPN was coupled to keyhole limpet hemocyanin (KLH) using the techniques described in Antibodies: A Laboratory Manual. Harlow and Lowe, eds., Cold Spring Harbor, New York (1988) , which is incorporated herein by reference. Briefly, 10.0 milligrams (mg) of keyhole limpet hemocyanin and 0.5 mg of NPN with a glutaryl spacer arm N- hydroxysuccinimide linker appendages. Coupling was performed as in Jonda et al., Science. 241:1188 (1988), which is incorporated herein by reference. The unbound NPN was removed by gel filtration chromatography through Sephadex G-25.
  • the KLH-NPN conjugate was prepared for injection into mice by adding 100 ⁇ g of the conjugate to 250 ⁇ l of phosphate buffered saline (PBS) . An equal volume of complete Freund's adjuvant was added and emulsified the entire solution for 5 minutes. A 129 G ⁇ + mouse was injected with 300 ⁇ l of the emulsion. Injections were given subcutaneously at several sites using a 21 gauge needle. A second immunization with KLH-NPN was given two weeks later. This injection was prepared as follows: 50 ⁇ g of KLH-NPN were diluted in 250 ⁇ L of PBS and an equal volume of alum was mixed with the KLH-NPN solution.
  • PBS phosphate buffered saline
  • mice The mouse was injected intraperitoneally with 500 ⁇ l of the solution using a 23 gauge needle. One month later the mice were given a final injection of 50 ⁇ g of the KLH-NPN conjugate diluted to 200 ⁇ L in PBS. This injection was given intravenously in the lateral tail vein using a 30 gauge needle. Five days after this final injection the mice were sacrificed and total cellular RNA was isolated from their spleens.
  • RNA was isolated from the spleen of a single mouse immunized as described above by the method of Chomczynski and Sacchi, Anal. Biochem.. 162:156-159 (1987), which is incorporated herein by reference. Briefly, immediately after removing the spleen from the immunized mouse, the tissue was homogenized in 10 ml of a denaturing solution containing 4.0 M guanine isothiocyanate, 0.25 M sodium citrate at pH 7.0, and 0.1 M 2-mercaptoethanol using a glass homogenizer. One ml of sodium acetate at a concentration of 2 M at pH 4.0 was mixed with the homogenized spleen.
  • RNA-containing aqueous layer was transferred to a fresh 50 ml polypropylene centrifuge tube and mixed with an equal volume of isopropyl alcohol.
  • This solution was maintained at -20°C for at least one hour to precipitate the RNA.
  • the solution containing the precipitated RNA was centrifuged at 10,000 x g for twenty minutes at 4°C.
  • the pelleted total cellular RNA was collected and dissolved in 3 ml of the denaturing solution described above. Three ml of isopropyl alcohol was added to the resuspended total cellular RNA and vigorously mixed.
  • This solution was maintained at -20°C for at least 1 hour to precipitate the RNA.
  • the solution containing the precipitated RNA was centrifuged at 10,000 x g for ten minutes at 4°C.
  • the pelleted RNA was washed once with a solution containing 75% ethanol.
  • the pelleted RNA was dried under vacuum for 15 minutes and then resuspended in dimethyl pyrocarbonate (DEPC) treated (DEPC-H 2 0) H 2 0.
  • DEPC dimethyl pyrocarbonate
  • RNA for use in first strand cDNA synthesis was prepared from the above isolated total RNA using methods described by Aviv and Leder, Proc. Natl. Acad. Sci.. USA. 69:1408-1412 (1972), which is incorporated herein by reference. Briefly, one half of the total RNA isolated from a single immunized mouse spleen prepared as described above was resuspended in one ml of DEPC-treated dH 2 0 and maintained at 65 ⁇ C for five minutes.
  • 2x high salt loading buffer 100 mM Tris-HCL at pH 7.5, 1 M sodium chloride, 2.0 mM disodium ethylene diamine tetraacetic acid (EDTA) at pH 8.0, and 0.2% sodium dodecyl sulfate (SDS) ) was added to the resuspended RNA and the mixture was allowed to cool to room temperature. The mixture was then applied to an oligo-dT (Collaborative Research Type 2 or Type 3) column that was previously prepared by washing the oligo-dT with a solution containing 0.1 M sodium hydroxide and 5 mM EDTA and then equilibrating the column with DEPC- treated dH 2 0.
  • oligo-dT Collaborative Research Type 2 or Type 3
  • the eluate was collected in a sterile polypropylene tube and reapplied to the same column after heating the eluate for 5 minutes at 65 ⁇ C.
  • the oligo dT column was then washed with 2 ml of high salt loading buffer consisting of 50 mM Tris-HCL at pH 7.5, 500 mM sodium chloride, 1 mM EDTA at pH 8.0 and 0.1% SDS.
  • the oligo dT column was then washed with 2 ml of 1 X medium salt buffer (50 mM Tris-HCL at pH 7.5, 100 mM sodium chloride, 1 mM EDTA at pH 8.0 and 0.1% SDS) .
  • the mRNA was eluted with 1 ml of buffer consisting of 10 mM Tris-HCL at pH 7.5, 1 mM EDTA at pH 8.0 and 0.05% SDS.
  • the messenger RNA was purified by extracting this solution with phenol/chloroform followed by a single extraction with 100% chloroform, ethanol precipitated and resuspended in DEPC treated dH 2 0.
  • mRNA was used as a template for cDNA synthesis.
  • 5-10 ⁇ g of spleen mRNA in water was first annealed with 500 ng (0.5 pmol) of either the 3* V H primer (primer 12, Table 3) or the 3' V L primer (primer 9, Table 4) at 65"C for 5 minutes.
  • the mixture was adjusted to contain 0.8 mM dATP, 0.8 mM dCTP, 0.8 M dGTP, 0.8 mM dTTP, 100 mM Tris-HCL (pH 8.6), 10 mM MgCl 2 , 40 mM KCl, and 20 mM 2-ME.
  • Moloney-Murine Leukemia Virus (Stratagene, La Jolla, CA) Reverse transcriptase, 26 units, was added and the solution was incubated for 1 hour at 40"C.
  • the resultant first strand cDNA was phenol extracted, ethanol precipitated and then used in the polymerase chain reaction (PCR) procedures described below for amplification of heavy and light chain sequences.
  • Primers used for amplification of heavy chain Fd fragments for construction of the lambda He 2 library is shown in Table 3. Amplification was performed in eight separate reactions, as described by Saiki et al., Science. 239:487-491 (1988), which is incorporated herein by reference, each reaction containing one of the 5' primers (primers 2 to 9) and one of the 3' primers (primer 12) listed in Table 3. The remaining 5' primers were used for amplification in a single reaction are either a degenerate primer (primer 1) or a primer that incorporates inosine at four degenerate positions (primer 10) . The remaining 3' primer (primer 11) was used to construct Fv fragments.
  • the underlined portion of the 5' primers incorporates an Xho I site and that of the 3' primer an Spe I restriction site for cloning the amplified fragments into a lambda phage vector in a predetermined reading frame for expression.
  • Primers used for amplification of mouse kappa light chain sequences for construction of the lambda Lc 1 library is Fab's are shown in Table 4. These primers were chosen to contain restriction sites which were compatible with vector and not present in the conserved sequences of the mouse light chain mRNA. Amplification was performed as described by Saiki et al., Supra. in five separate reactions, each containing one of the 5' primers (primers 3 to 7) and one of the 3* primers (primer 9) listed in Table 4. The remaining 3* primer (primer 8) was used to construct Fv fragments.
  • the underlined portion of the 5 1 primers depicts a Sac I restriction site and that of the 3 ' primers an Xba I restriction site for cloning of the amplified fragments into a lambda phage vector in a predetermined reading frame for expression.
  • PCR amplification for heavy and light chain fragments was performed in a 100- ⁇ l reaction mixture containing the above described products of the reverse transcription reaction ( «5 ⁇ g of the cDNA-RNA hybrid), 300 nmol of 3 ' V H primer (primer 12, Table 1), and one of the 5' V H primers (primers 2-9, Table 1) for heavy chain amplification, or, 300 nmol of 3 * V L primer (primer 9, Table 2) , and one of the 5' V L primers (primers 3-7, Table 2) for each light chain amplification, a mixture of dNTPs at 200 mM, 50 mM KCl, 10 mM Tris-HCl (pH 8.3) , 15 mM MgCl 2 , 0.1% gelatin, and 2 units of Thermus aquaticus DNA polymerase.
  • the reaction mixture was overlaid with mineral oil and subjected to 40 cycles of amplification. Each amplification cycle involved denaturation at 92"C for 1 minute, annealing at 52°C for 2 minutes, and elongation at 72°C for 1.5 minutes.
  • the amplified samples were extracted twice with phenol/CHC1 3 and once with CHC1 3 , ethanol-precipitated, and stored at -70°C in 10 mM Tris-HCl, pH 7.5/1 mM EDTA.
  • the mixed products of heavy chain primer PCR amplification were digested at 37°C with Xho I (125 units, Stratagene, La Jolla, CA) and Spe I (10 units, Stratagene, La Jolla, CA) in 2.5 ⁇ g/30 ⁇ l of buffer containing 150 mM NaCl, 8 mM Tris-HCl (pH 7.5), 6 mM MgS0 4 , 1 mM dithiothreitol, and bovine serum albumin (200 ⁇ g/ l) .
  • the mixed products of amplification with light chain primers were digested with 200 units Sac I and 200 units Xba I in 33 mM Tris Acetate pH 7.85, 66 mM K Acetate, 10 mM Mg Acetate, 0.5 mM DTT in 500 ⁇ l at 37°C for 1 hour for the light chain amplified products and purified on a 1% agarose gel.
  • a combinatorial library was constructed in two steps. In the first step, separate heavy and light chain libraries were constructed in lambda He 2 and lambda Lc 1 vectors, respectively ( Figure 1) . In the second step, the two resultant libraries were combined at the asymmetric Eco RI sites present in each vector.
  • NZCYM broth (lOg/1 NZ amine, 5g/l yeast extract, 5g/l NaCl, lg/1 casamino acids, 2g/l MgS0 4 -7H-O, pH 7.5) was inoculated with a single colony of XLl-Blue and incubated overnight with vigorous agitation at 37'C. 1 ml of this culture was used to inoculate four 2 liter flasks containing 500 ml prewarmed (37°C) NZCYM. These four flasks were agitated at 37 ⁇ C 3 to 4 hours.
  • each flask then received an inoculation of 10 ° pfu of the purified recombinant bacteriophage vector prepared in Example I, and was shaken for an additional 3 to 5 hours until lysis of the host was complete. 10 ml of chloroform was added to each flask and incubation continued for another 10 minutes at 37 ⁇ C. Cultures were treated with l ⁇ g/ml each DNAsE I and RNAseA for 30 minutes at room temperature. NaCl was added to 1 M final concentration and the cultures were chilled on ice for 1 hour.
  • Debris was removed by centrifugation at ll,000xg for 10 minutes, and polyethylene glycol (PEG 8000) was added to the supernatants to a final concentration of 10% w/v. Bacteriophage precipitated out of the suspensions after 1 hour on ice and was pelleted by centrifugation at ll,000xg for 10 minutes. Phage was resuspended in SM buffer (5.8g/l NaCl, 2g/l MgS0 4 -7 H 2 0, 50ml/l 1 M Tris-Cl pH 7.5, 5ml 2% gelatin) and chloroform extracted to remove cell debris.
  • SM buffer 5.8g/l NaCl, 2g/l MgS0 4 -7 H 2 0, 50ml/l 1 M Tris-Cl pH 7.5, 5ml 2% gelatin
  • Solid cesium chloride (CsCl) was added to 0.5g/ml, and the phage suspension was layered onto CsCl step gradients (1.7g/ml, 1.5g/ml, 1.45g/ml, all in SM) and spun at 22,0 0 0 rpm for 2 hours at 4°C in a swinging bucket rotor. Banded phage particles were collected and spun in 1.5g/ml CsCl/ S M at 38,000 rpm for 24 hours at 4°C. Re-banded phage was again collected, and the suspension was dialysed in lO M NaCl, 50mM Tris-Cl pH 8.0, lOmM MgCl 2 .
  • EDTA pH 8.0 was added to 20mM, pronase was added to 0.5mg/ml, and SDS was added to 0.5%; incubation at 37° for 1 hour was followed by phenol extraction, chloroform extraction, and dialysis overnight in lOmM Tris-Cl pH 8.0, ImM EDTA pH 8.0. Sodium acetate was added to 0.3 M and the DNA was precipitated with 2 volumes of ethanol. Vector DNA was recovered by centrifugation and resuspended in lOmM Tris-Cl pH 7.6, ImM EDTA pH 8.0.
  • Hc2 vector arms 200 ⁇ g purified Hc2 DNA was cut with 600 units Xho I in 50mM Tris-Cl pH 8.0, lOmM MgCl 2 , 50mM NaCl, at 37 ⁇ C for 1 hour. Cut HC2 DNA was phenol extracted and ethanol precipitated, then re-cut with 600 units of Spe I in 20mM Tris Cl pH 7.4, 5mM MgCl 2 , 50mM KCl at 37°C for 1 hour. Double-cut Hc2 DNA was phenol extracted and ethanol precipitated.
  • Recovered vector DNA was dephosphorylated with 0.5 units/ ⁇ g HK phosphatase (Epicenter, Madison, WI) in 30mM Tris Acetate pH 7.85, 30mM KAC, 5mM CaCl 2 , 0.5mM DTT, and 100 ⁇ g/ml BSA, at 30" for 1 hour, followed by 65° for 10 minutes, then phenol extracted, ethanol precipitated and resuspended in lOmM Tris Cl pH 7.5, 1 mM EDTA pH 8.0.
  • Lcl vector arms were prepared as above, except that the first digestion was with 600 units of Xba I in 50mM Tris-Cl pH 8.0, lOmM MgCl 2 , 50mM NaCl, and the second digestion was with 600 units of Sac I in 6mM Tris Cl pH 7.4, 20mM NaCl, 6mM.MgCl 2 , 6mM 2-ME, 0.1 mg/ml BSA.
  • a portion of each ligation mixture (1 ⁇ l) was packaged for 2 hours at room temperature using Gigapack Gold packaging extract (Stratagene, La Jolla, CA) , and the packaged material was titered and plated on XLl-Blue host cells as described by the manufacturer.
  • serial dilutions of the library were made into a buffer containing 100 mM NaCl, 50 mM Tris-HCL at pH 7.5 and 10 mM MgS0 4 .
  • Ten ⁇ l of each dilution was added to 200 ⁇ l of exponentially growing E. coli cells and maintained at 37 ⁇ C for 15 minutes to allow the phage to absorb to the bacterial cells.
  • Three ml of top agar consisting of 5 g/L NaCl, 2 g/L of MgS0 4 , 5 g/L yeast extract, 10 g/L NZ amine (casein hydrolysate) and 0.7% melted, 50C agarose.
  • the phage, the bacteria and the top agar were mixed and then evenly distribute across the surface of a prewarmed bacterial agar plate (g g/L NaCl, 2 g/L MgS0 4 , 5 g/L yeast extract, 10 g/L NZ amine (casein hydrolysate) and 15 g/L Difco agar.
  • the plates were maintained at 37°C for 12 to 24 hours during which time period the lambda plaques were counted to determine the total number of plaque forming units per ml in the original library.
  • the lambda He 2 primary library contained 1.3 x 10 6 plaque-forming units (pfu) and has been screened for the expression of the decapeptide tag to determine the percentage of clones expressing Fd sequences.
  • the sequence for this peptide is only in frame for expression after the genes for an Fd (or V H ) fragment have been cloned into the vector. At least 80 percent of the clones in the library express Fd fragments when assayed by immunodetection of the decapeptide tag.
  • Immunodetection was performed as follows. A volume of the titred library that would yield 20,000 plaques per 150 millimeter plate was added to 600 ⁇ l of exponentially growing E. coli cells and maintained at 37 ⁇ c for 15 minutes to allow the phage to absorb to the bacterial cells. Then 7.5 ml of top agar was admixed to the solution containing the bacterial cells and the absorbed phage and the entire mixture distributed evenly across the surface of a prewarmed bacterial agar plate. This process was repeated for a sufficient number of plates to plate out a total number of plaques at least equal to the library size. These plates were then maintained at 37"C for 5 hours.
  • nitrocellulose filters that had been pretreated with a solution containing 10 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) and maintained at 37"C for 4 hours.
  • IPTG isopropyl-beta-D-thiogalactopyranoside
  • the orientation of the nitrocellulose filters in relation to the plate were marked by punching a hole with a needle dipped in waterproof ink through the filter and into the bacterial plates at several locations.
  • the nitrocellulose filters were removed with forceps and washed once in a TBST solution containing 20 mM Tris-HCL at pH 7.5, 150 mM NaCl and 0.05% polyoxyethylene soriban monolaurate (Tween-20) .
  • a second nitrocellulose filter that had also been soaked in a solution containing 10 mM IPTG was reapplied to the bacterial plates to produce duplicate filters.
  • the filters were further washed in a fresh solution of TBST for 15 minutes.
  • Filters were then placed in a blocking solution consisting of 20 mM Tris-HCL at pH 7.5, 150 mM NaCl and 1% BSA and agitated for 1 hour at room temperature.
  • the nitrocellulose filters were transferred to a fresh blocking solution containing a 1 to 500 dilution of the primary antibody and gently agitated for at least 1 hour at room temperature.
  • the filters were washed 3 to 5 times in TBST for 5 minutes each time to remove any of the residual unbound primary antibody.
  • the filters were transferred into a solution containing fresh blocking solution and a 1 to 500 to a 1 to 1,000 dilution of alkaline phosphatase conjugated secondary antibody.
  • the filters were gently agitated in the solution for at least 1 hour at room temperature.
  • the filters were washed 3 to 5 times in a solution of TBST for at least 5 minutes each time to remove any residual unbound secondary antibody.
  • the filters were washed once in a solution containing 20 mM Tris-HCL at pH 7.5 and 150 mM NaCl.
  • the filters were removed from this solution ad the excess moisture blotted from them with filter paper.
  • the color was developed by placing the filter in a solution containing 100 mM Tris-HCL at pH 8.5, 100 mM NaCl, 5 mM MgCl 2 , 0.3 mg/ml of nitro Blue Tetrazolium (NBT) and 0.15 mg/ml of 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) for at least 30 minutes at room temperature.
  • the residual color development solution was rinsed from the filter with a solution containing 20 mM Tris-HCL at pH 7.5 and 150 mM NaCl.
  • the filter was then placed in a stop solution consisting of 20 mM Tris-HCL at pH 2.9 and 1 mM EDTA. The development of an intense purple color indicates at positive results.
  • the filters are used to locate the phage plaque that produced the desired protein. That phage plaque is segregated and then grown up for further analysis.
  • the light chain library was constructed in the same way as the heavy chain and shown to contain 2 x 10 6 members. Plaque screening, with an antibody to mouse kappa chain, indicated that 60 percent of the library contained expressed light chain inserts. This relatively small percentage of inserts probably resulted from incomplete dephosphorylation of the vector after cleavage with Sac I and Xba I.
  • RI site as follows. DNA was first purified from each library as described above. The light chain library was cleaved with Mlu I restriction endonuclease, the resulting
  • DNA's so prepared were then mixed and ligated. After " ligation, only clones that resulted from combination of a right arm of light chain-containing clones and left arm of heavy chain-containing clones reconstituted a viable phage.
  • antigen-binding was subjected to competition with free unlabeled antigen (Figure 4) .
  • Filter lifts from positive plaques were exposed to 125I-labeled BSA-NPN i•n the presence of increasing concentrations of the inhibitor NPN.
  • a number of phages correlated with NPN-binding as in Figure 3 were spotted in duplicate (about 100 particles per spot) directly onto a bacterial lawn.
  • the plate was then overlaid with an IPTG-soaked filter and incubated for 19 hours at 25°C. The filters were then blocked in 1 percent
  • a plasmid containing the heavy and light chain genes was excised with helper phage in an analogous fashion as that for lambda Zap II ( Figure 5) .
  • M13mp8 was used as helper phage and the excised plasmid was infected into a F + derivative of MC1061.
  • the excised plasmid contains the same constructs for antibody fragment expression as do the parent vectors ( Figure 1) .
  • These plasmid constructs are more conveniently analyzed for restriction pattern and protein expression of the lambda phage clones identified and isolated on the basis of antigen binding.
  • the plasmid also contains an fl origin of replication which facilitates the preparation of single- stranded DNA for sequence analysis and in vitro mutagenesis. Mapping of the excised plasmid demonstrated a restriction pattern consistent with incorporation of heavy and light chain sequences.
  • the protein products of one of the clones was analyzed by enzyme-linked immunosorbent assay (ELISA) and immunoblotting to establish the composition of the NPN binding protein.
  • ELISA enzyme-linked immunosorbent assay
  • a bacterial supernatant after IPTG induction was concentrated and subjected to gel filtration. Fractions in the molecular size range 40 to 60 kD were pooled, concentrated, and subjected to a further gel filtration separation.
  • ELISA analysis of the eluted fractions ( Figure 6) indicated that NPN binding was associated with a protein of a molecular size of about 50 kD, which contained both heavy and light chains.
  • the concentration partially purified bacterial supernatant of an NPN binding clone was separated by gel filtration and samples from each fraction were applied to microtiter plates coated with BSA- NPN. Addition of either antibody to decapeptide ( ) or antibody to K chain (-, left-hand scale) conjugated with alkaline phosphatase was followed by color development. The arrow indicates the position of elution of known Fab fragment. The results show that antigen binding is a property of a 50-kD protein containing both heavy and light chains.
  • Microtiter plates were coated with BSA-NPN at 1 ⁇ g/ml, 50 ⁇ l samples from the eluted fractions, were mixed with 50 ⁇ l of PBS-Tween 20 (0.05 percent) BSA (0.1 percent) added, and the plates were incubated for 2 hours at 25°C. The plated material was then washed with PBS- Tween 20-BSA and 50 ⁇ l of appropriate concentrations of a rabbit antibody to decapeptide or a goat antibody to mouse K light chain (Southern Biotech, Oakridge, TN) conjugated with alkaline phosphatase were added and incubated for 2 hours at 25°C.
  • PBS-Tween 20-BSA 50 ⁇ l of appropriate concentrations of a rabbit antibody to decapeptide or a goat antibody to mouse K light chain (Southern Biotech, Oakridge, TN) conjugated with alkaline phosphatase were added and incubated for 2 hours at 25°C.
  • the plates were again washed, 50 ⁇ l of p- nitrophenyl phosphate (1 mg/ml in 0.1 tris, pH 9.5, containing 50 mM MgCl 2 ) was added, and the plates were incubated for 15 to 30 minutes and the absorbance was read at 405 nm.
  • a moderately restricted library was prepared only because a limited number of primers was used for polymerase chain reaction (PCR) amplification of Fd sequences.
  • the library is expected to contain only clones expressing K- gammal sequences.
  • this is not an inherent limitation of the method since the addition of more primers can amplify any antibody class or subclass.
  • PCR polymerase chain reaction
  • a central issue is how the phage library compares with the in vivo antibody repertoire in terms of size, characteristics of diversity, and ease of access.
  • phage library of this size or larger can readily be constructed by a modification of the method described. Once an initial combinatorial library has been constructed, heavy and light chains can be shuffled to obtain libraries of exceptionally large numbers.
  • the diversity characteristics of the naive (unimmunized) in vivo repertoire and corresponding phage library are expected to be similar in that both involve a random combination of heavy and light chains.
  • different factors act to restrict the diversity expressed by an in vivo repertoire and phage library.
  • a physiological modification such as tolerance will restrict the expression of certain antigenic specificities from the in vivo repertoire, but these specificities may still appear in the phage library.
  • bias in the cloning process may introduce restrictions into the diversity of the phage library.
  • the representation of mRNA for sequences expressed by stimulated B cells can be expected to predominate over those of unstimulated cells because of higher levels of expression.
  • the resting repertoire might overrepresent spontaneously activated B cells whose immunoglobulins have been suggested to be less specific. I any event, methods exist to selectively exclude such populations of cells. Also, the fortuitous presence of restriction sites in the variable gene similar to those used for cloning and combination will cause them to be eliminated. We can circumvent some of these difficulties by making minor changes, such as introducing amber mutations in the vector system. Different source tissues (for example, peripheral blood, bone marrow, or regional lymph nodes) and different PCR primers (for example, those to amplify different antibody classes) , may result in libraries with different diversity characteristics.
  • Different source tissues for example, peripheral blood, bone marrow, or regional lymph nodes
  • different PCR primers for example, those to amplify different antibody classes
  • .in vivo repertoire and phage library Another difference between .in vivo repertoire and phage library is that antibodies isolated from the repertoire may have benefited from affinity maturation as a result of somatic mutations after combination of heavy and light chains whereas the phage library randomly combines the matured heavy and light chains. Given a large enough phage library derived from a particular .in vivo repertoire, the original matured heavy and light chains will be recombined. However, since one of the potential benefits of this technology is to obviate the need for immunization by the generation of a single highly diverse "generic" phage library, it would be useful to have methods to optimize sequences to compensate for the absence of somatic mutation and clonal selection. Three procedures are made readily available through the vector system presented.
  • saturation mutagenesis may be performed on the complementarity-determining regions (CDR's) (23) and the resulting Fab's can be assayed for increased function.
  • CDR's complementarity-determining regions
  • a heavy or a light chain of a clone that binds antigen can be recombined with the entire light or heavy chain libraries, respectively, in a procedure identical to that used to construct the combinatorial library.
  • iterative cycles of the two above procedures can be performed to further optimize the affinity or catalytic properties of the immunoglobulin. The last two procedures are not permitted in B cell clonal selection, which suggests that the methods described here may actually increase the ability to identify optimal sequences.
  • Access is the third area where it is of interest to compare the in vivo antibody repertoire and phage library.
  • the phage library is much easier to access.
  • the screening methods used have allowed one to survey the gene products of at least 50,000 clones per plate so that 10 6 to 10 7 antibodies can be readily examined in a day but the most powerful screening methods depend on selection. In the catalytic antibody system, this may be accomplished by incorporating into the antigen leaving groups necessary for replication of auxotrophic bacterial strains or toxic substituents susceptible to catalytic inactivation. Further advantages are related to the fact that the jln vivo antibody repertoire can only be accessed via immunization, which is a selection on the basis of binding affinity.
  • the phage library is not similarly restricted.
  • the data show that it is now possible to construct and screen at least three orders of magnitude more clones with monospecificity than previously possible.
  • the data also invite speculation concerning the production of antibodies without the use of live animals.
  • the lambda Lc 2 vector was constructed for the cloning of PCR amplified products of mRNA that code for light chain protein, as described in Example II, by inserting the nucleotide sequence shown in Table 3 into the Sac I and Xho I sites of lambda Zap II.
  • the vector was prepared by digesting 10 ⁇ g of lambda arms from the Uni-ZapTM XR Vector Kit (Stratagene, La Jolla, CA) with 30 units in 100 ⁇ l reaction Sac I. Overlapping synthetic oligonucleotides were cloned into the above Sac I digested arms as follows.
  • Oligonucleotides Lll through L15 and L17 - L19 were kinased by adding 1 ⁇ l of each oligonucleotide (0.1 ⁇ g/ ⁇ l) and 20 units of T 4 polynucleotide kinase (BRL, Gaithersburg, MD) to a solution containing 70 mM Tris HCL at pH 7.6, 0.1 M KCl, 10 mM MgCl 2 , 5 mM DTT, 1 mM adenosine triphosphate (ATP) , 10 mM 2 ME, 500 micrograms per ml of BSA.
  • T 4 polynucleotide kinase BRL, Gaithersburg, MD
  • the solution was maintained at 37 "C for 30 minutes and the reaction stopped by maintaining the solution at 65 ⁇ C for 10 minutes.
  • the two end oligonucleotides L16 and L110 were added to the above kinasing reaction solution together with 1/10 volume of a solution containing 20 mM Tris-HCL at pH 7.4, 2.0 mM MgCl 2 and 50.0 mM NaCl.
  • This solution was heated to 70"C for 5 minutes and allowed to cool slowly to room temperature. During this time period all oligonucleotides annealed to form the double stranded synthetic DNA insert similar to the one shown in Figure 2A.
  • the annealed oligonucleotides were covalently linked to each other by adding 40 ⁇ l of the above reaction to a solution containing 66 mM Tris-HCL at pH 7.6, 6.6 mM MgCl 2 , 1 mM DTT, 1 mM ATP and 10 units of T4 DNA ligase (BRL, Gaithersburg, MD) .
  • This solution was maintained at 25°C for 30 minutes and then the T4 DNA ligase was inactivated by heating the solution at 65°C for 10 minutes.
  • the unphosphorylated ends of the resultant oligonuleotides were kinased by mixing 52 ⁇ l of the above reaction, 4 ⁇ l of a solution containing 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37°C for 30 minutes and then the T4 polynucleotide kinase was inactivated by heating the solution at 65°C for 10 minutes.
  • the phosphorylated synthetic DNA insert was ligated directly into the above prepared lambda Zap II vector arms.
  • the lambda He 2 vector was constructed for cloning PCR amplified products coding for heavy chain Fd sequences, as described in Example II, by inserting the nucleotide sequence shown in Figure 2B into the Not I and Xho I sites of lambda Zap II.
  • the heavy chain vector was prepared by digesting lambda arms
  • oligonucleotides described above include elements for construction, expression, and secretion of Fab fragments. These oligonucleotides introduce the asymmetric Not I and Eco RI restriction sites; a leader peptide for the bacterial pel B gene, which has previously been successfully used in E. coli to secrete Fab fragments, Better et al., Science, 240:1041 (1988); Skerra and Pluckthun, Science.
  • a ribosome binding site at the optimal distance for expression of the cloned sequence cloning sites for either the light or heavy chain PCR product; and, in lambda He 2, a decapeptide tag at the carboxyl terminus of the expressed heavy chain protein fragment.
  • the sequence of the decapeptide tag was useful because of the availability of monoclonal antibodies to this peptide that were used for immunoaffinity purification of fusion proteins, Field et al. Mol. Cell Biol.. 8:2159 (1988), which is incorporated herein by reference.
  • the vectors were characterized by restriction digest analysis and DNA sequencing, Sanger et al., Proc. Natl. Acad. Sci.. USA. 74:5463-5467 (1977), which is incorporated herein by reference and using AMV Reverse Transcriptase 35 S-ATP Sequencing Kit (Stratagene, La Jolla, CA) .
  • the lambda LcRF and lambda LcLF were constructed from lambda Lc2 by inserting the oligonucleotides F01 and F02 or F03 and F04 into the EcoRI site of the lambda Lc2 vector.
  • the vector was prepared for ligation by cleaving 10 ⁇ g of lambda Lc2 DNA with 30 units of EcoRI restriction enzyme (NEB Beverly Ma.) in 100 ⁇ l of reaction buffer at 37°C for one hour. The solution was heated to 65 ⁇ C for 30 minutes and then chilled to 30°C. CaCl 2 was added to a final concentration of 5 mM and 5 units Heat-Killable (HK) phosphatase (Epicenter, Madison, WI) was added.
  • EcoRI restriction enzyme NEB Beverly Ma.
  • Lambda LcRF was constructed by ligating three molar equivalence of phosporylated oligonucleotides F03 and F04 to 1 ⁇ g of EcoRI digested lambda Lc2 in a 10 ⁇ l reaction volume at 4"C overnight. A portion (1 ⁇ l) of the ligation was packaged with in vitro lambda phage packaging extract and plated on a lawn of XLl-Blue bacteria.
  • Lambda LcLF was constructed by ligating three molar equivalence of phosphorylated oligonucleotides F01 and F02 to 1 ⁇ g of EcoRI digested lambda Lc2 in 10 ⁇ l reaction volume at 4"C overnight. A portion (1 ⁇ l) of the ligation mixture was packaged with in vitro lambda phage packaging extract and plated on a lawn of XLl-Blue bacteria.
  • LB medium 1% tryptone, 0.5% yeast extract, 1% NaCl, pH 7.5
  • XL1- Blue Stratagene, La Jolla, CA
  • Bacteria were pelleted by centrifugation and resuspended in 1/2 volume of 10 mM MgS0 4 1000 pfu of recombinant phage were mixed with 100 ⁇ l of the XLl-Blue suspension and incubated at 37 ⁇ C for twenty minutes.
  • This mixture was quickly dispersed into 7 ml melted and cooled 0.7% top agarose in LB medium, and the slurry was plated on warmed LB plates.
  • the agarose was allowed to solidify at room temperature and then the plates were warmed at 37°C for 10 to 12 hours, then chilled at 4°C for 1 more hour.
  • MSI Magna Nylon membranes (Fisher Scientific, California) were placed directly onto the agarose surfaces of the plates for 1 minute, and then lifted off carefully.
  • plaque lifts were immersed in denaturing solution (0.5 N NaOH, 1.5 M NaCl) for 5 minutes, transferred to neutralization solution (1.5 M NaCl, 0.5 M Tris at pH 7.4) for 5 minutes, rinsed in 2X SSC (0.3 M NaCl, 0.3 M sodium citrate, pH 7.0) , and air dried on paper towels.
  • denaturing solution 0.5 N NaOH, 1.5 M NaCl
  • neutralization solution 1.5 M NaCl, 0.5 M Tris at pH 7.4
  • 2X SSC 0.3 M NaCl, 0.3 M sodium citrate, pH 7.0
  • Duplicate filters were generated from the same plates as above. All filters were interleaved between sheets of filter paper and baked at 80 ⁇ C under constant vacuum for 1 hour.
  • the filters were removed from the filter paper and immersed in wash solution (5X SSC, 0.5% SDS, 1 mM EDTA pH 8.0) at 42 ⁇ C for 1 to 2 hours; bacterial debris was removed by gently wiping each filter with a sponge soaked in the wash solution.
  • the filters were then prehybridized in prehybridization solution (6X SSC, 0.2% Ficoll 400, 0.2% polyvinylpyrrolidone, 0.2% borine serum albumin (Pentax fraction V) , 0.5% SDS, 50 mM sodium phosphate pH 6.5, and 250 ⁇ g/ml denatured and sheared herring sperm DNA) .
  • the prehybridization solution was decanted, fresh solution was added along with the oligo probe (see below) , and the filters were shaken at room temperature for 14 to 24 hours. The filters were washed three times for 30 minutes at 37'C with 6X SSC/0.5% SDS and then autoradiographed. Plaques showing positive hybridization on both filter and duplicate were isolated and checked by restriction mapping as well as sequencing.
  • Oligomeric probe was prepared as followed: 10 ⁇ g oligo was mixed in a 50 ⁇ l reaction volume with 50 mM Tris 7.4, 10 mM MgCl 2 , 5 mM DTT, 0.1 mM EDTA pH 8.0, 0.1 mM spermidine, 100 ⁇ Ci [ ⁇ - 32 PJ ATP (Amersham, Arlington Heights, IL) , and 10 ⁇ T4 polynucleotide kinase (BRL, Gaithersburg, MD) . Oligonucleotide LLF was used to identify lambda LcLF and LRF was used to identify lambda LcRF.
  • lambda LcLF and lambda LcRF vector were crossed at the Xba I site as follows. DNA was first purified from each vector. The lambda LcRF was cleaved with Mlu I restriction endonuclease, the resulting 5' ends were dephosphorylated, and the product was digested with Xba I. This process cleaved the left arm of the vector into several pieces, but the right arm remained intact. The DNA of lambda LcLF was cleaved with Hind III, dephosphorylated, and then cleaved with Xba I; this process destroyed the right arm, but the left arm remained intact.
  • the DNA's so prepared were then mixed and ligated. After ligation, only clones that resulted from combination of a right arm of light chain- containing clones and left arm of heavy chain-containing clones reconstituted a viable phage. After ligation and packaging, the desired vector, lamba LcF was identified as above by sequence analysis.
  • the lambda HcRF and lambda HcLF were constructed from lambda Hc3 by inserting the oligonucleotides F01 and F02 or F03 and F04 into the EcoRI site of the lambda Hc2 vector.
  • the vector was prepared for ligation by cleaving 10 ⁇ g of lambda Hc2 DNA with 30 units of EcoRI restriction enzyme (NEB Beverly Ma.) in 100 ⁇ l of reaction buffer at 37°C for one hour. The solution was heated to 65°C for 30 minutes and then chilled to 30°C. CaCl 2 was added to a final concentration of 5 mM and 5 units Heat-Killable (HK) phosphatase (Epicenter, Madison, WI) was added.
  • EcoRI restriction enzyme NEB Beverly Ma.
  • Lambda HcRF was constructed by ligating three molar equivalence of phosporylated oligonucleotides F03 and F04 to 1 ⁇ g of EcoRI digested lambda Hc2 in a 10 ⁇ l reaction volume at 4°C overnight. A portion (1 ⁇ l) of the ligation was packaged with in vitro lambda phage packaging extract and plated on a lawn of XLl-Blue bacteria.
  • Lambda HcLF was constructed by ligating three molar equivalence of phosphorylated oligonucleotides F01 and F02 to 1 ⁇ g of EcoRI digested lambda Hc2 in 10 ⁇ l reaction volume at 4°C overnight. A portion (1 ⁇ l) of the ligation mixture was packaged with in vitro lambda phage packaging extract and plated on a lawn of XLl-Blue bacteria. Oligonucleotide HLF was used to identify lambda HcLF and LRF was used to identify lambda LcRF by hybridization, as above.
  • lambda HcF vector For construction of the lambda HcF vector, lambda HcLF and lambda HcRF vectors were crossed at the Xba I site. DNA from the two vectors was first purified. The lambda HcRF vector DNA was cleaved with Mlu I restriction endonuclease, the resulting 5 » ends were dephosphorylated, and the product was digested with Eco RI. This process cleaved the left arm of the vector into several pieces, but the right arm remained intact. The lambda HcLF DNA was cleaved with Hind III, dephosphorylated, and then cleaved with Eco RI; this process destroyed the right arm, but the left arm remained intact. The DNA's so prepared were then mixed and ligated.
  • a light chain vector was constructed that contains two amber mutations in the left arm.
  • the left arm was from EMBL3A
  • the right arm was from lambda LcF were combined to construct lambda LcFA.
  • DNA was prepared from each of the two parent lambda phage vectors. 10 ug of lambda EMBL3A was digested with Hindlll, dephosphorylated and digested with Kpnl. 10 ug of lambda LcF was digested with Mlul then dephosphorylated. This DNA was then digested with Kpnl. One ⁇ g of digested DNA from each of the two parent vectors were mixed and ligated. After packaging in vitro, the phage were infected into BB4 E. coli. All phage had the two amber mutations from EMBL and the cloning site from lambda LcF one of these phage was named lambda LcFA.
  • a heavy chain vector, lambda HcFA, with an amber mutation in the right arm was constructed from lambda zap
  • Zapl was digested with Not I and EcoRI and dephosporylated with heat-kill phosphatase and phage vectors were grown on E. coli BB4.

Abstract

The invention provides a composition of matter comprising a plurality of procaryotic cells containing diverse combinations of first and second DNA sequences encoding first and second polypeptides that can be expressed and which form heteromeric receptors and at least one of the plurality of procaryotic cells expressing heteromer exhibiting binding activity towards a preselected molecule.

Description

CO-EXPRESSION OF HETEROMERIC RECEPTORS
BACKGROUND OF THE INVENTION
Many biologically important molecules are proteins, which are composed of linear arrays of amino acid subunits. Proteins can function as enzymes, antibodies or structural proteins, among other things. Proteins whose function is binding other protein, or non-protein molecules, and thereby effect a chemical reaction are termed receptors.
When expressed in a living cell the functional characteristics of proteins are determined by the sequence of their amino acids that are, in turn, encoded by DNA sequences termed genes. While many proteins are single molecules encoded by a single gene, other proteins are composed of two or more separate polypeptides which associate spatially to form an active protein, each polypeptide being encoded by a separate gene. Such proteins are termed heteromers. Where such proteins function as receptors, they are thus heteromeric receptors.
A particular category of protein, as defined by either its characteristic structure or function, exhibits variations in its function, which reflect differences in the particular amino acid sequence. For example, in color vision the receptors for the three different primary colors are the three different rhodopsin molecules which are structurally related but functionally different. Structural differences can also be important in diseases. For example, the hemoglobin of most healthy people and the hemoglobin of individuals with sickle cell anemia differ by a single amino acid. Some categories of proteins in fact exhibit immense variability. Such variability is important because of the particular function of the protein.
Many proteins have multiple structural and functional domains. In some cases the two different types of domains can coincide. Antibodies are an example of a category of proteins with two well defined structural and functional domains which coincide. One of these domains which bind antigen is functionally diverse and the other, the effector domain, is function restricted. Antibodies are protein comprising four associated polypeptides, two so-called heavy chains, and two light Chains. The four polypeptides associate to form a structure which can be thought of as resembling a "ϊ", with the tip of the two arms being binding sites which are able to selectively recognize and bind to molecules called antigens, which the body recognizes as foreign. The binding site of the heavy chain is termed VH, while the binding site of the light chain is termed VL. Each arm of the "Y" is called a Fab fragment because it contains the antigen binding functional domain. Such binding is important in order to effect the removal of deleterious foreign materials, for example viruses or bacteria. Because of the vast array of different antigens which an organism may encounter, a vast array of different antibodies are necessary. Such an array, or repertoire, is achieved by an individual having many genes encoding portions of the Vh and VL binding regions. In cells of the immune system, random combinations of these various VH and VL encoding genes can randomly associate in order to allow the expression of upwards of 10 7 different antibody molecules. This possibility arises because the VL and the VH structural domains are smaller than the binding functional domain which is shared between these two structural domains. When a great diversity of functionality can result from the combination of structural domains, the specific function of the combination of any two specific structural domains is not predictable. Therefore, there has been a longstanding problem in protein engineering that combinations of structural domains of proteins which results in predictable function can only generate limited functional diversity, whereas combination of structural domains which generate the diverse functions are usually unpredictable. Therefore, unpredictability has hampered the construction of protein molecules with highly diverse potential functions. One approach to this problem has been to attempt to increase the predictability of protein design by the rational design of proteins using 3D protein structures and computer algorithms. This approach has not been generally successful. A radically different approach to dealing with the unpredictability would be to construct a very large number of proteins each of which potentially have a desired function. When the unpredictability is matched by the number of potentially correct polypeptides which can be constructed and assayed for a desired function then the problem of unpredictability can be overcome. This has fundamental implications for gene cloning and the design of proteins with predetermined properties.
In the last 15 years, method have been developed in order to produce by expression polypeptide-encoding genes in bacteria, or other cells. This process, which is termed gene cloning, provides the tremendous advantage of allowing the production of large amounts of a particular protein. Genes must be cloned on the basis of their sequence structure or on the basis of the function of the expressed protein. However, until recently it has only been possible to identify single gene clones from a gene library in E. coli, when the cloned genes are to be identified by the function of the expressed protein. Thus it has not been possible to, for example, reproduce the variety of different forms of functions in E. coli. Moreover, even hybridoma technology, which results in large amounts of a single antibody species, suffers from the inability to recreate the vast repertoire of antibody species which can be made even by a single organism, much less those which could be generated within or between species. The ability to generate and screen large repertoires of hetero ers .in vitro would potentially allow the selection of particular heteromers having a particular desired function.
There thus exists a long-felt need for a method which can produce vast repertoires of heteromers composed of a plurality of polypeptides each encoded by separate DNA sequences. The present invention satisfies this need and provides related advantages as well.
SUMMARY OF THE INVENTION
The invention provides a composition of matter comprising a plurality of procaryotic cells containing diverse combinations of first and second DNA sequences encoding first and second polypeptides that can be expressed and which form heteromeric receptors and at least one of the plurality of procaryotic cells expressing a heteromer exhibiting binding activity towards a preselected molecule.
The invention further provides a kit for the preparation of vectors useful for the coexpression of two or more DNA sequences, comprising two vectors, a first vector having a first combining site on a defined side of a cloning site which defines orientation and a second vector with a second combining site and a cloning site of orientation asymmetric to that of the first vector, wherein one or both of the vectors contains a promoter for expressing polypeptides which form heteromeric receptors encoded by DNA sequences inserted in the cloning sites.
The invention still further provides a method of constructing a diverse population of vectors having first and second DNA sequences encoding first and second polypeptides which associate to form heteromeric receptors, comprising the steps of (a) operationally linking a diverse population of first dna sequences encoding the first polypeptides to a first vector having a combining site and a cloning site in a defined orientation;
(b) operationally linking a diverse population of second dna sequences encoding the second polypeptides to a second vector having a combining site compatible with the combining site on the first vector and a cloning site in an asymmetric orientation to that of the first vector;
(c) combining the vector products of step (a) with the vector products of step (b) under conditions to permit their combination into a combined vector having the first and second dna sequences operationally linked thereon. The combining can be accomplished for example, by restriction endonuclease cleavage of the vectors of step (a) and (b) and combining the cleaved vectors of step (a) and (b) with DNA ligase or combining by Flp recombinase.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows a schematic diagram of the light chain vector (lambda LCI) , the heavy chain vector (lambda Hc2) and the combinatorial vector.
Figure 2 shows nucleotide sequences of the synthetic oligonucleotides inserted into lambda Zap II to create the (A) light chain vector (lambda Lcl) and (B) heavy chain vector (lambda Hc2) of Figure 1.
Figure 3 shows autoradiographs of library screens for the combinatorial (A and B) , the heavy chain (E and F) and for the light chain (G and H) libraries. Filter C and D represent the cored positive from a primary filter A.
Figure 4 shows the specificity of antigen binding by competitive inhibition.
Figure 5 is a schematic diagram representing the plasmids which can be excised from the combinatorial vector.
Figure 6 shows the characterization of an antigen binding protein derived from the combinatorial library.
Figure 7 shows the construction of a vector system for a combinatorial vector using the Flp recognition sequence as the combining site.
DETAILED DESCRIPTION OF THE INVENTION
As used herein "diverse combinations" means that a substantial number of the possible nucleic acids encoding the first polypeptide are combined with a substantial number of the possible nucleic acids encoding the second polypeptide. Thus, a substantial number of the possible combinations are represented.
As used herein "heteromeric receptors" means a polypeptide comprised of at least two polypeptides, at least one of which is encoded on a different DNA. Thus, heteromer is composed of two or more polypeptides which associate and exhibit a common function. Receptor refers toi a polypeptide which is capable of binding any ligand. Therefore, receptor also includes a protein which when bound to its ligand can affect a second process. Examples of heteromeric receptors which can be formed include antibodies, T-cell receptors, integrins, hormone receptors and transmitter receptors.
As used herein "binding activity" means the heteromer exhibits an affinity for a molecule. This affinity can be specific for the molecule and can be used, for example, to detect or affect a function on the molecule.
As used herein "preselected molecule" means a particular molecule to which binding activity is desired. Since practically any molecule can be bound, this molecule is selected from the group of all possible molecules. Specific heteromers can be created which specifically bind this molecule and allow for detection or to affect the molecule's function.
As used herein "first and second polypeptides which can associate" means the polypeptides encoded by the first and second nucleotide sequences are chemically or physically attracted to each other and form a heteromer.
As used herein "combining site" means a nucleotide sequence which can be cleaved and joined with another nucleotide sequence. Such cleavage and joining results in a nucleic acid having both sequences in proper orientation to allow translation of the desired polypeptide.
As used herein "asymmetric" means a non-identical or a non-correspondence in form, size or arrangement of parts on opposite sides of a boundary such as a dividing line or around an axis. For example, the arrangement of 2 different restriction sites with respect to the 5' and 3 • ends of a DNA sequence are asymmetric if they are arranged in one vector in the opposite orientation as that for a second vector.
As used herein "transfect" or "transform" refers to introducing nucleic acids into a living cell such that the nucleic acid is fully separated from extracellular fluids by a lipid membrane.
As used herein as it relates to combinatorial gene expression, the term "in vitro" refers to performing the process in a system in which a particular expression does not naturally occur, thus, in vitro can refer both to expression in procaryotic cells as well as eucaryotic δ cells, provided the latter does not naturally express the gene combination.
The invention provides a composition of matter comprising a plurality of procaryotic cells containing diverse combinations of first and second DNA sequences encoding first and second polypeptides that can be expressed and which form heteromeric receptors and at least one of the plurality of procaryotic cells expressing a heteromer exhibiting binding activity towards a preselected molecule.
The procaryotic cells are preferably E. coli, however any suitable procaryotic cell can be utilized. Suitable alternative cells would be selected by reviewing the literature to determine which vector and cells could be adapted by the methods taught herein. Therefore, alternative cells require compatible vectors capable of expressing first and second DNA sequences in the selected host cell. Alternatively, eucaryotic cells could be used. Such use would simply require substituting eucaryotic control and expression elements which function in a compatible eucaryotic host. Therefore, for procaryotic and eucaryotic systems, compatibility means that the vector/host combination contains all necessary signals and factors to perform the desired function.
For this invention, including cells, vectors, and methods utilizing the vectors, the first and second DNA sequences which encode functional portions of heteromeric receptors can for example be antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors. Thus, the first and second DNA sequences can encode functional portions of the variable heavy and variable light chains of an antibody including Fab, F'ab and the like. In fact, any heteromer which is formed from a diverse combination or repertoire of alternative coding sequences can be made by the methods of this invention. For example, specific hormone and transmitter receptors can be made by combination of alpha and beta subunits. Thus, the invention is easily applicable to any later discovered alternative-type, diverse combination heteromers.
The invention also provides a composition of matter comprising a plurality of procaryotic cells containing various combinations of diverse first and second DNA sequences encoding first and second polypeptides which can associate to form heteromeric receptors exhibiting binding activity towards preselected molecules, the diversity of first DNA sequence being greater than about 100 different sequences and the diversity of the second DNA sequence being greater than about 1000 different sequences. The invention is effective with such diversity since the upper limit is greater than a billion combinations.
The invention further provides a kit for the preparation of vectors useful for the coexpression of two or more DNA sequences, comprising two vectors, a first vector having a first combining site on a defined side of a cloning site which defines orientation and a second vector with a second combining site and a cloning site of orientation asymmetric to that of the first vector, wherein one or both of the vectors contains a promoter for expressing polypeptides which form heteromeric receptors encoded by DNA sequences inserted in the cloning sites. The vectors can be in a virus. Suitable virus can include mammalian as well as bacteriophages. One would apply the teachings set forth herein to utilize such vectors. Alternatively, the vectors can be a plasmid.
The first and second combining sites of the vectors of the invention are of many possible types. The specific sites utilized herein are EcoRI-EcoRI, and Notl-Notl and the specific cloning site was selected from the group consisting of Xhol-Spel, Sacl-Xbal, and Sacl-Spel. Additionally, the first and second combining sites can be site specific recombination sites, especially Flp recombination sites. Alternative sites can be practiced based on the disclosure of this invention.
The invention also provides a vector, capable of expressing a heteromer exhibiting binding activity towards a preselected molecule when combined with a second vector, having a first combining site on a defined side of a cloning site which defines orientation and which can be combined with a second vector with a second combining site and a cloning site of orientation asymmetric to that of the first vector, wherein one or both of the vectors contains a promoter for expressing polypeptides which form heteromers encoded by DNA sequences inserted in the cloning sites.
The invention still further provides a cloning system for the coexpression of two DNA sequences encoding polypeptides which associate to form a heteromer, comprising a set of uniform first vectors having a diverse population of first DNA sequences and a set of uniform second vectors having a diverse population of second DNA sequences, the first and second vectors having compatible combining sites so as to allow the operational combination of the first and second DNA sequences.
The invention also provides a plurality of expression vectors containing a plurality of possible first and second DNA sequences, wherein each of the expression vectors has operationally linked thereon a first DNA sequence and a second DNA sequence, and wherein substantially each of the vectors contains a different combination of first and second DNA sequence.
The invention still further provides a method of constructing a diverse population of vectors having first and second DNA sequences encoding first and second polypeptides which associate to form heteromeric receptors, comprising the steps of (a) operationally linking a diverse population of first DNA sequences encoding the first polypeptides to a first vector having a combining site and a cloning site in a defined orientation;
(b) operationally linking a diverse population of second DNA sequences encoding the second polypeptides to a second vector having a combining site compatible with the combining site on the first vector and a cloning site in an asymmetric orientation to that of the first vector;
(c) combining the vector products of step (a) with the vector products of step (b) under conditions to permit their combination into a combined vector having the first and second DNA sequences operationally linked thereon. The combining can be accomplished for example, by restriction endonuclease cleavage of the vectors of step (a) and (b) and combining the cleaved vectors of step (a) and (b) with DNA ligase or combining by Flp recombinase.
A method of selecting a procaryotic cell which expresses a heteromer specific for a preselected molecule is also provided. The method comprises randomly combining first vectors having a diverse population of DNA sequences encoding polypeptides with second vectors having different diverse populations of DNA sequences which encode polypeptides and which form heteromeric receptors with the polypeptides encoded by the first vector, transfecting a sufficient number of the randomly combined sequences into the procaryotic cells, screening the cells to determine the cell expressing a heteromer specific for the preselected molecule. In this method the combining can be accomplished with restriction endonuclease cleavage of the first and second vectors and ligating the cleaved first and second vectors or utilizing Flp recombinase. Additionally, the number of randomly combined sequences can be sufficiently equivalent to the possible combinations of the populations of the first and second DNAs in order to reasonably assure obtaining the desired heteromer.
Finally, a method is provided for identifying functional heteromeric receptors composed of a plurality of polypeptides, comprising coexpressing random combinations of first and second DNA homologs which encode polypeptides which associate to form heteromeric receptors so as to form a diverse population of the first and second DNA homologs, the diversity being at least enough that at least one heteromer formed by the polypeptides resulting from the coexpression has a desired functional property and restricted so that the heteromeric receptors can be screened for a predetermined function.
In the methods utilized herein, random combination in vitro or An vivo can be accomplished using two expression vectors distinguished from one another by the location of an endonuclease recognition site common to both. Preferably the vectors are linear double stranded DNA, such as a lambda Zap™ derived vector as described herein which are symmetric with respect to the protein expression elements. Preferably, in one of the vectors the recognition site is located 5* terminal to the coding sequence of at least one of the complementary determining regions (CDR's). In the second vector the recognition site is located 3' to at least one of the CDR's. For example, the recognition site in one vector can be located between a ribosome binding site and a RNA polymerase promoter site and in the second vector the restriction is located 3' to a cloning site.
The recognition site can be a restriction endonuclease recognition site, a recombinase recognition site such as a
Flp site, or other equivalent site. In one preferred embodiment of the invention, each of the vectors defines a nucleotide sequence coding for a ribosome binding site and a leader, the sequence being located between the promoter and the polylinker, but downstream (3' terminal from a shared restriction site if that site is between the promoter and the polylinker) . Also preferred are vectors containing a stop codon downstream from the polylinker. The first and/or second vector can also define a nucleotide sequence coding for a polypeptide which can function as a tag. Examples of such a tag include (1) a short peptide sequence, (2) a sequence that encodes a protein, which binds to a receptor such as another predetermined antibody or protein G, such as a CHI domain of an antibody, (3) a protein that can function as an enzyme (such as beta- galactosidase or alkaline phosphatase) or (4) a phage coat protein that causes the phage to become attached to the coat of the phage. The tag sequence is typically downstream from the polylinker but upstream of any stop codon that may be present. In the preferred embodiments, the vectors contain selectable markers such that the presence of a portion of that vector, i.e. a particular lambda arm, can be selected for or selected against.
Typical selectable markers are well known to those skilled in the art. Examples of such markers are antibiotic resistance genes, genetically selectable markers, suppressible mutations, such as amber mutations, and the like. The selectable markers are typically located upstream and/or downstream of the promoter or polylinker. In preferred embodiments, one selectable marker is located upstream of the promoter on the first vector containing the
VH-coding (variable heavy chain-coding) DNA sequences. A second selectable marker is located on the other side of the combination site on the vector containing the VL-coding (variable light chain-coding) DNA sequences. This second selectable marker may be the same or different from the first as long as when the VH-coding vectors and the VL- coding vectors are randomly combined at the combining site the resulting vectors containing both VH and VL can be selected preferentially.
Typically the polylinker is a nucleotide sequence that defines one or more, preferably at least two, restriction sites. The polylinker restriction sites are oriented to permit ligation of VH- or VL-coding DNA homologs into the vectors in the same reading frame at the leader, tag, linker, tag, or stop codon sequence present.
Random combination is accomplished by ligating VH- coding DNA homologs into the first vector, typically at a restriction site or sites within the polylinker. Similarly, VL-coding DNA homologs are ligated into the second vector, thereby creating two diverse populations of vectors. It does not matter which type of DNA homolog, i.e., VH or VL, is ligated to which vector, but it is preferred, for example, that all VH coding DNA homologs are ligated to either the first or second vector, and all of the VL-coding DNA homologs are ligated to the other of the first or second vector. The members of both populations are combined at the combination site. In a preferred embodiment where the combination site is a restriction site and the members of both populations are then cleaved with an appropriate restriction endonuclease. The resulting products are two diverse populations of restriction fragments where the members of one have cohesive termini complementary to the cohesive termini of the members of the other.
The following examples are intended to illustrate but not limit the invention. While they are typical of those that might be used, other procedures known to those skilled in the art may be alternatively employed. EXAMPLE I VECTOR CONSTRUCTION
The vectors for expression of VH, VL, Fv (fragment of the variable region) , and Fab sequences are diagrammed in Figures 1 and 2. They were constructed by a modification of lambda Zap II, (Stratagene, La Jolla, CA) ; Short et al.. Nucleic Acids Res.. 16:7583 (1988) which is incorporated herein by reference, in which we inserted synthetic oligonucleotides into the multiple cloning site. The methods described here and below are known to one skilled in the art and are described in detail in Maniatis et al. , Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, 1982 and Ausubel et al., and Current Protocols on Molecular Biology. John Wiley and Sons, 1987, both of which are incorporated herein by reference. The vectors were designed to be asymmetric with respect to the Not I and Eco RI restriction sites that flank the cloning and expression sequences. This asymmetry in the placement of restriction sites in a linear vector such as bacteriophage allows a library expressing light chains to be combined with one expressing heavy chains in order to construct combinatorial Fab expression libraries.
The lambda Lc 1 vector was constructed for the cloning of PCR amplified products of mRNA that code for light chain protein, as described in Example II, by inserting the nucleotide sequence shown in figure 2A into the Sac I and Xho I sites of lambda Zap II. The vector was prepared by digesting 10 μg of lambda arms from the Uni-Zap™ XR Vector Kit (Stratagene, La Jolla, CA) with Sac I. The sequence shown in Figure 2A was constructed from overlapping synthetic oligonucleotides and cloned into the above Sac I digested arms as follows. Oligonucleotides LI through L5 and L7 - L9 (LI, L2, L3, L4, L5, L7, L8 and L9) (shown in Table 1) were kinased by adding 1 μl of each oligonucleotide (0.1 μg/μl) and 20 units of T polynucleotide kinase (BRL, Gaithersburg, MD) to a solution containing 70 mM Tris HCL at pH 7.6, 0.1 M KCl, 10 mM MgCl2, 5 mM DTT, 1 mM adenosine triphosphate (ATP) , 10 mM 2 ME, 500 micrograms per ml of BSA. The solution was maintained at 37°C for 30 minutes and the reaction stopped by maintaining the solution at 65βC for 10 minutes. The two end oligonucleotides L6 and L10 were added to the above kinasing reaction solution together with 1/10 volume of a solution containing 20 mM Tris-HCL at pH 7.4, 2.0 mM MgCl2 and 50.0 mM NaCl. This solution was heated to 70"C for 5 minutes and allowed to cool slowly to room temperature. During this time period all oligonucleotides annealed to form the double stranded synthetic DNA insert shown in Figure 2A. The annealed oligonucleotides were covalently linked to each other by adding 40 μl of the above reaction to a solution containing 66 mM Tris-HCL at pH 7.6, 6.6 mM MgCl2, 1 mM DTT, 1 mM ATP and 10 units of T4 DNA ligase (BRL, Gaithersburg, MD) . This solution was maintained at 25"C for 30 minutes and then the T4 DNA ligase was inactivated by heating the solution at 65°C for 10 minutes. The unphosphorylated ends of the resultant oligonuleotides were kinased by mixing 52 μl of the above reaction, 4 μl of a solution containing 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37°C for 30 minutes and then the T4 polynucleotide kinase was inactivated by heating the solution at 65βC for 10 minutes. The phosphorylated synthetic DNA insert was ligated directly into the above prepared lambda Zap II vector arms. TABLE 1
LI TGAATTCTAAACTAGTCGCCAAGGAGACAG
L2 TCATAATGAAATACCTATTGCCTACGGCAG L3 CCGCTGGATTGTTATTACTCGCTGCCCAAC
L4 CAGCCATGGCCGAGCTCGTCAGTTCTAGAG
L5 TTAAGCGGCCGCAA
L6 TCGATTGCGGCCGCTTAACTCTAGAACTGACGA
L7 GCTCGGCCATGGCTGGTTGGGCAGCGAGTA L8 ATAACAATCCAGCGGCTGCCGTAGGCAATA
L9 GGTATTTCATTATGACTGTCTCCTTGGCGA
L10 CTAGTTTAGAATTCAAGCT
TABLE 2
HI GGCCGCAAATTCTATTTCAAGGAGACAGTC
H2 ATAATGAAATACCTATTGCCTACGGCAGCC
H3 GCTGGATTGTTATTACTCGCTGCCCAACC
H4 AGCCATGGCCCAGGTGAAACTGCTCGAGA
H5 TTTCTAGACTAGTTACCCGTACGACGTTCC H6 GGACTACGGTTCTTAATAGAATTCG
H7 TCGACGAATTCTATTA
H8 AGAACCGTAGTCCGGAACGTCGTACGGG
H9 TAACTAGTCTAGAAATCTCGAGCAGTTTC
HI0 ACCTGGGCCATGGCTCCTTGGGCAGCGAGT Hll AATAACAATCCAGCGGCTGCCGTAGGCAA
HI2 TAGGTATTTCATTATGACTGTCTCCTT
HI3 GAAATAGAATTTGC
The lambda He 2 vector was constructed for cloning PCR amplified products coding for heavy chain Fd sequences, as described in Example II, by inserting the nucleotide sequence shown in Figure 2B into the Not I and Xho I sites of lambda Zap II. As with the light chain vector, the heavy chain vector was prepared by digesting lambda arms
• TM from the Uni-Zap XR Vector Kit (Stratagene, La Jolla, CA) with Not I. This was accomplished by digestion of 10 μg of vector in 100 μl reaction buffer for 1 hour at 37°C, after digestion the DNA was extracted, precipitated and dried as above. The inserted sequence shown in Figure 2B was constructed from the overlapping synthetic oligonucleotides H1-H13 depicted in Table 2 as outlined above. Correctly constructed vectors were confirmed by DNA sequence analysis as described below.
The sequence of the oligonucleotides described above include elements for construction, expression, and secretion of Fab fragments. These oligonucleotides introduce the asymmetric Not I and Eco RI restriction sites; a leader peptide for the bacterial pel B gene, which has previously been successfully used in E. coli to secrete Fab fragments, Better et al., Science. 240:1041 (1988); Skerra and Pluckthun, Science. 240:1038 (1988), both of which are incorporated herein by reference, a ribosome binding site at the optimal distance for expression of the cloned sequence; cloning sites for either the light or heavy chain PCR product; and, in lambda He 2, a decapeptide tag at the carboxyl terminus of the expressed heavy chain protein fragment. The sequence of the decapeptide tag was useful because of the availability of monoclonal antibodies to this peptide that were used for immunoaffinity purification of fusion proteins, Field et al. Mol. Cell Biol. , 8:2159 (1988), which is incorporated herein by reference. The vectors were characterized by restriction digest analysis and DNA sequencing, Sanger et al., Proc. Natl. Acad. Sci.. USA. 74:5463-5467 (1977), which is incorporated herein by reference and using AMV Reverse Transcriptase 35S-ATP Sequencing Kit (Stratagene, La Jolla, CA) . EXAMPLE II
Isolation of RNA and PCR
Amplification of Antibody Fragments
The initial Fab expression library was constructed from mRNA isolated from a mouse that had been immunized with the KLH-coupled p-nitrophenyl phosphonamidate antigen 1 (NPN) . NPN was coupled to keyhole limpet hemocyanin (KLH) using the techniques described in Antibodies: A Laboratory Manual. Harlow and Lowe, eds., Cold Spring Harbor, New York (1988) , which is incorporated herein by reference. Briefly, 10.0 milligrams (mg) of keyhole limpet hemocyanin and 0.5 mg of NPN with a glutaryl spacer arm N- hydroxysuccinimide linker appendages. Coupling was performed as in Jonda et al., Science. 241:1188 (1988), which is incorporated herein by reference. The unbound NPN was removed by gel filtration chromatography through Sephadex G-25.
The KLH-NPN conjugate was prepared for injection into mice by adding 100 μg of the conjugate to 250 μl of phosphate buffered saline (PBS) . An equal volume of complete Freund's adjuvant was added and emulsified the entire solution for 5 minutes. A 129 Gιχ+ mouse was injected with 300 μl of the emulsion. Injections were given subcutaneously at several sites using a 21 gauge needle. A second immunization with KLH-NPN was given two weeks later. This injection was prepared as follows: 50 μg of KLH-NPN were diluted in 250 μL of PBS and an equal volume of alum was mixed with the KLH-NPN solution. The mouse was injected intraperitoneally with 500 μl of the solution using a 23 gauge needle. One month later the mice were given a final injection of 50 μg of the KLH-NPN conjugate diluted to 200 μL in PBS. This injection was given intravenously in the lateral tail vein using a 30 gauge needle. Five days after this final injection the mice were sacrificed and total cellular RNA was isolated from their spleens.
Total RNA was isolated from the spleen of a single mouse immunized as described above by the method of Chomczynski and Sacchi, Anal. Biochem.. 162:156-159 (1987), which is incorporated herein by reference. Briefly, immediately after removing the spleen from the immunized mouse, the tissue was homogenized in 10 ml of a denaturing solution containing 4.0 M guanine isothiocyanate, 0.25 M sodium citrate at pH 7.0, and 0.1 M 2-mercaptoethanol using a glass homogenizer. One ml of sodium acetate at a concentration of 2 M at pH 4.0 was mixed with the homogenized spleen. One ml of saturated phenol was also mixed with the denaturing solution containing the homogenized spleen. Two ml of a chloroform:isoamyl alcohol (24:1 v/v) mixture was added to this homogenate. The homogenate was mixed vigorously for ten seconds and maintained on ice for 15 minutes. The homogenate was then transferred to a thick-walled 50 ml polypropylene centrifuge tube (Fisher Scientific Company, Pittsburgh, PA). The solution was centrifuged at 10,000 x g for 20 minutes at 4"C. The upper RNA-containing aqueous layer was transferred to a fresh 50 ml polypropylene centrifuge tube and mixed with an equal volume of isopropyl alcohol. This solution was maintained at -20°C for at least one hour to precipitate the RNA. The solution containing the precipitated RNA was centrifuged at 10,000 x g for twenty minutes at 4°C. The pelleted total cellular RNA was collected and dissolved in 3 ml of the denaturing solution described above. Three ml of isopropyl alcohol was added to the resuspended total cellular RNA and vigorously mixed. This solution was maintained at -20°C for at least 1 hour to precipitate the RNA. The solution containing the precipitated RNA was centrifuged at 10,000 x g for ten minutes at 4°C. The pelleted RNA was washed once with a solution containing 75% ethanol. The pelleted RNA was dried under vacuum for 15 minutes and then resuspended in dimethyl pyrocarbonate (DEPC) treated (DEPC-H20) H20.
Poly A+ RNA for use in first strand cDNA synthesis was prepared from the above isolated total RNA using methods described by Aviv and Leder, Proc. Natl. Acad. Sci.. USA. 69:1408-1412 (1972), which is incorporated herein by reference. Briefly, one half of the total RNA isolated from a single immunized mouse spleen prepared as described above was resuspended in one ml of DEPC-treated dH20 and maintained at 65βC for five minutes. One ml of 2x high salt loading buffer (100 mM Tris-HCL at pH 7.5, 1 M sodium chloride, 2.0 mM disodium ethylene diamine tetraacetic acid (EDTA) at pH 8.0, and 0.2% sodium dodecyl sulfate (SDS) ) was added to the resuspended RNA and the mixture was allowed to cool to room temperature. The mixture was then applied to an oligo-dT (Collaborative Research Type 2 or Type 3) column that was previously prepared by washing the oligo-dT with a solution containing 0.1 M sodium hydroxide and 5 mM EDTA and then equilibrating the column with DEPC- treated dH20. The eluate was collected in a sterile polypropylene tube and reapplied to the same column after heating the eluate for 5 minutes at 65βC. The oligo dT column was then washed with 2 ml of high salt loading buffer consisting of 50 mM Tris-HCL at pH 7.5, 500 mM sodium chloride, 1 mM EDTA at pH 8.0 and 0.1% SDS. The oligo dT column was then washed with 2 ml of 1 X medium salt buffer (50 mM Tris-HCL at pH 7.5, 100 mM sodium chloride, 1 mM EDTA at pH 8.0 and 0.1% SDS) . The mRNA was eluted with 1 ml of buffer consisting of 10 mM Tris-HCL at pH 7.5, 1 mM EDTA at pH 8.0 and 0.05% SDS. The messenger RNA was purified by extracting this solution with phenol/chloroform followed by a single extraction with 100% chloroform, ethanol precipitated and resuspended in DEPC treated dH20.
In preparation for PCR amplification, mRNA was used as a template for cDNA synthesis. In a typical 250 μl transcription reaction mixture, 5-10μg of spleen mRNA in water was first annealed with 500 ng (0.5 pmol) of either the 3* VH primer (primer 12, Table 3) or the 3' VL primer (primer 9, Table 4) at 65"C for 5 minutes. Subsequently, the mixture was adjusted to contain 0.8 mM dATP, 0.8 mM dCTP, 0.8 M dGTP, 0.8 mM dTTP, 100 mM Tris-HCL (pH 8.6), 10 mM MgCl2, 40 mM KCl, and 20 mM 2-ME. Moloney-Murine Leukemia Virus (Stratagene, La Jolla, CA) Reverse transcriptase, 26 units, was added and the solution was incubated for 1 hour at 40"C. The resultant first strand cDNA was phenol extracted, ethanol precipitated and then used in the polymerase chain reaction (PCR) procedures described below for amplification of heavy and light chain sequences.
Primers used for amplification of heavy chain Fd fragments for construction of the lambda He 2 library is shown in Table 3. Amplification was performed in eight separate reactions, as described by Saiki et al., Science. 239:487-491 (1988), which is incorporated herein by reference, each reaction containing one of the 5' primers (primers 2 to 9) and one of the 3' primers (primer 12) listed in Table 3. The remaining 5' primers were used for amplification in a single reaction are either a degenerate primer (primer 1) or a primer that incorporates inosine at four degenerate positions (primer 10) . The remaining 3' primer (primer 11) was used to construct Fv fragments. The underlined portion of the 5' primers incorporates an Xho I site and that of the 3' primer an Spe I restriction site for cloning the amplified fragments into a lambda phage vector in a predetermined reading frame for expression. TABLE 3 HEAVY CHAIN PRIMERS
CC G G T 1) 5'- AGGT A CT CTCGAGTC GG - 3 '
GA A T A
2) 5' - AGGTCCAGCTGCTCGAGTCTGG - 3' 3) 5' - AGGTCCAGCTGCTCGAGTCAGG - 3'
4) 5• - AGGTCCAGCTTCTCGAGTCTGG - 3'
5) 5' - AGGTCCAGCTTCTCGAGTCAGG - 3' 6) 5' - AGGTCCAACTGCTCGAGTCTGG - 3'
7) 5' - AGGTCCAACTGCTCGAGTCAGG - 3'
8) 5' - AGGTCCAACTTCTCGAGTCTGG - 3' 9) 5' - AGGTCCAACTTCTCGAGTCAGG - 3*
T 10) 5» - AGGTIIAICTICTCGAGTC GG - 3 '
A 11) 5' - CTATTAACTAGTAACGGTAACAGT -
GGTGCCTTGCCCCA - 3'
12) 5* - AGGCTTACTAGTACAATCCCTGG - GCACAAT - 3'
Primers used for amplification of mouse kappa light chain sequences for construction of the lambda Lc 1 library is Fab's are shown in Table 4. These primers were chosen to contain restriction sites which were compatible with vector and not present in the conserved sequences of the mouse light chain mRNA. Amplification was performed as described by Saiki et al., Supra. in five separate reactions, each containing one of the 5' primers (primers 3 to 7) and one of the 3* primers (primer 9) listed in Table 4. The remaining 3* primer (primer 8) was used to construct Fv fragments. The underlined portion of the 51 primers depicts a Sac I restriction site and that of the 3 ' primers an Xba I restriction site for cloning of the amplified fragments into a lambda phage vector in a predetermined reading frame for expression.
TABLE 4 LIGHT CHAIN PRIMERS
1) 5• - CCAGTTCCGAGCTCGTTGTGACTCAGGAATCT - 3'
2) 5' - CCAGTTCCGAGCTCGTGTTGACGCAGCCGCCC - 3*
3) 5' - CCAGTTCCGAGCTCGTGCTCACCCAGTCTCCA - 3'
4) 5' - CCAGTTCCGAGCTCCAGATGACCCAGTCTCCA - 3'
5) 5' - CCAGATGTGAGCTCGTGATGACCCAGACTCCA - 3' 6) 5' - CCAGATGTGAGCTCGTCATGACCCAGTCTCCA - 3»
7) 5' - CCAGTTCCGAGCTCGTGATGACACAGTCTCCA - 3'
8) 5' - GCAGCATTCTAGAGTTTCAGCTCCAGCTTGCC - 3'
9) 5' - GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA - 3'
PCR amplification for heavy and light chain fragments was performed in a 100-μl reaction mixture containing the above described products of the reverse transcription reaction («5μg of the cDNA-RNA hybrid), 300 nmol of 3 ' VH primer (primer 12, Table 1), and one of the 5' VH primers (primers 2-9, Table 1) for heavy chain amplification, or, 300 nmol of 3 * VL primer (primer 9, Table 2) , and one of the 5' VL primers (primers 3-7, Table 2) for each light chain amplification, a mixture of dNTPs at 200 mM, 50 mM KCl, 10 mM Tris-HCl (pH 8.3) , 15 mM MgCl2, 0.1% gelatin, and 2 units of Thermus aquaticus DNA polymerase. The reaction mixture was overlaid with mineral oil and subjected to 40 cycles of amplification. Each amplification cycle involved denaturation at 92"C for 1 minute, annealing at 52°C for 2 minutes, and elongation at 72°C for 1.5 minutes. The amplified samples were extracted twice with phenol/CHC13 and once with CHC13, ethanol-precipitated, and stored at -70°C in 10 mM Tris-HCl, pH 7.5/1 mM EDTA.
In preparation for cloning into the lambda He 2 or lambda Vc 1 vectors equal volumes (50 μl) of the above, respective, PCR-amplified products were mixed, purified by phenol/ChCl3 extraction, ethanol precipitated and resuspended at 1 μg/μl in 10 mM Tris-HCl, pH 7.5/1 mM EDTA. The mixed products of heavy chain primer PCR amplification were digested at 37°C with Xho I (125 units, Stratagene, La Jolla, CA) and Spe I (10 units, Stratagene, La Jolla, CA) in 2.5 μg/30 μl of buffer containing 150 mM NaCl, 8 mM Tris-HCl (pH 7.5), 6 mM MgS04, 1 mM dithiothreitol, and bovine serum albumin (200 μg/ l) . The mixed products of amplification with light chain primers were digested with 200 units Sac I and 200 units Xba I in 33 mM Tris Acetate pH 7.85, 66 mM K Acetate, 10 mM Mg Acetate, 0.5 mM DTT in 500 μl at 37°C for 1 hour for the light chain amplified products and purified on a 1% agarose gel. After gel electrophoresis of the digested PCR-amplified spleen mRNA the region of the gel containing DNA fragments of 700 base pairs (bp) was excised, electroeluted into a dialysis membrane, ethanol-precipitated, and resuspended in 10 mM Tris-HCl, pH 7.5/1 mM EDTA to a final concentration of 10 ng/μl. These products were used in the library constructions described in Example III.
EXAMPLE III LIBRARY CONSTRUCTION
A combinatorial library was constructed in two steps. In the first step, separate heavy and light chain libraries were constructed in lambda He 2 and lambda Lc 1 vectors, respectively (Figure 1) . In the second step, the two resultant libraries were combined at the asymmetric Eco RI sites present in each vector.
For construction of lambda He 2 and Lambda Lc 1 libraries, 3 molar equivalence of the gel isolated inserts described in Example II were ligated with 1 molar equivalence of vector arm, as described below overnight at 5°C to lambda He 2 or lambda Lc 1, described in Example I. The heavy chain inserts were ligated to lambda He 2 arms previously digested with Xho I and Spe I and dephosphorylated. The light chain inserts were ligated to lambda Lc 1 arms previously digested with Sac I and Xba I and dephosphorylated. Vector arms were prepared using the techniques described in Maniatis et al. , Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, which is incorporated herein by reference. 10 ml of NZCYM broth (lOg/1 NZ amine, 5g/l yeast extract, 5g/l NaCl, lg/1 casamino acids, 2g/l MgS04-7H-O, pH 7.5) was inoculated with a single colony of XLl-Blue and incubated overnight with vigorous agitation at 37'C. 1 ml of this culture was used to inoculate four 2 liter flasks containing 500 ml prewarmed (37°C) NZCYM. These four flasks were agitated at 37βC 3 to 4 hours. Each flask then received an inoculation of 10 ° pfu of the purified recombinant bacteriophage vector prepared in Example I, and was shaken for an additional 3 to 5 hours until lysis of the host was complete. 10 ml of chloroform was added to each flask and incubation continued for another 10 minutes at 37βC. Cultures were treated with l μg/ml each DNAsE I and RNAseA for 30 minutes at room temperature. NaCl was added to 1 M final concentration and the cultures were chilled on ice for 1 hour. Debris was removed by centrifugation at ll,000xg for 10 minutes, and polyethylene glycol (PEG 8000) was added to the supernatants to a final concentration of 10% w/v. Bacteriophage precipitated out of the suspensions after 1 hour on ice and was pelleted by centrifugation at ll,000xg for 10 minutes. Phage was resuspended in SM buffer (5.8g/l NaCl, 2g/l MgS04-7 H20, 50ml/l 1 M Tris-Cl pH 7.5, 5ml 2% gelatin) and chloroform extracted to remove cell debris. Solid cesium chloride (CsCl) was added to 0.5g/ml, and the phage suspension was layered onto CsCl step gradients (1.7g/ml, 1.5g/ml, 1.45g/ml, all in SM) and spun at 22,000 rpm for 2 hours at 4°C in a swinging bucket rotor. Banded phage particles were collected and spun in 1.5g/ml CsCl/SM at 38,000 rpm for 24 hours at 4°C. Re-banded phage was again collected, and the suspension was dialysed in lO M NaCl, 50mM Tris-Cl pH 8.0, lOmM MgCl2. EDTA pH 8.0 was added to 20mM, pronase was added to 0.5mg/ml, and SDS was added to 0.5%; incubation at 37° for 1 hour was followed by phenol extraction, chloroform extraction, and dialysis overnight in lOmM Tris-Cl pH 8.0, ImM EDTA pH 8.0. Sodium acetate was added to 0.3 M and the DNA was precipitated with 2 volumes of ethanol. Vector DNA was recovered by centrifugation and resuspended in lOmM Tris-Cl pH 7.6, ImM EDTA pH 8.0.
To make Hc2 vector arms, 200 μg purified Hc2 DNA was cut with 600 units Xho I in 50mM Tris-Cl pH 8.0, lOmM MgCl2, 50mM NaCl, at 37βC for 1 hour. Cut HC2 DNA was phenol extracted and ethanol precipitated, then re-cut with 600 units of Spe I in 20mM Tris Cl pH 7.4, 5mM MgCl2, 50mM KCl at 37°C for 1 hour. Double-cut Hc2 DNA was phenol extracted and ethanol precipitated. Recovered vector DNA was dephosphorylated with 0.5 units/μg HK phosphatase (Epicenter, Madison, WI) in 30mM Tris Acetate pH 7.85, 30mM KAC, 5mM CaCl2, 0.5mM DTT, and 100 μg/ml BSA, at 30" for 1 hour, followed by 65° for 10 minutes, then phenol extracted, ethanol precipitated and resuspended in lOmM Tris Cl pH 7.5, 1 mM EDTA pH 8.0.
Lcl vector arms were prepared as above, except that the first digestion was with 600 units of Xba I in 50mM Tris-Cl pH 8.0, lOmM MgCl2, 50mM NaCl, and the second digestion was with 600 units of Sac I in 6mM Tris Cl pH 7.4, 20mM NaCl, 6mM.MgCl2, 6mM 2-ME, 0.1 mg/ml BSA. A portion of each ligation mixture (1 μl) was packaged for 2 hours at room temperature using Gigapack Gold packaging extract (Stratagene, La Jolla, CA) , and the packaged material was titered and plated on XLl-Blue host cells as described by the manufacturer.
Specifically, serial dilutions of the library were made into a buffer containing 100 mM NaCl, 50 mM Tris-HCL at pH 7.5 and 10 mM MgS04. Ten μl of each dilution was added to 200 μl of exponentially growing E. coli cells and maintained at 37βC for 15 minutes to allow the phage to absorb to the bacterial cells. Three ml of top agar consisting of 5 g/L NaCl, 2 g/L of MgS04, 5 g/L yeast extract, 10 g/L NZ amine (casein hydrolysate) and 0.7% melted, 50C agarose. The phage, the bacteria and the top agar were mixed and then evenly distribute across the surface of a prewarmed bacterial agar plate (g g/L NaCl, 2 g/L MgS04, 5 g/L yeast extract, 10 g/L NZ amine (casein hydrolysate) and 15 g/L Difco agar. The plates were maintained at 37°C for 12 to 24 hours during which time period the lambda plaques were counted to determine the total number of plaque forming units per ml in the original library.
The lambda He 2 primary library contained 1.3 x 106 plaque-forming units (pfu) and has been screened for the expression of the decapeptide tag to determine the percentage of clones expressing Fd sequences. The sequence for this peptide is only in frame for expression after the genes for an Fd (or VH) fragment have been cloned into the vector. At least 80 percent of the clones in the library express Fd fragments when assayed by immunodetection of the decapeptide tag.
Immunodetection was performed as follows. A volume of the titred library that would yield 20,000 plaques per 150 millimeter plate was added to 600 μl of exponentially growing E. coli cells and maintained at 37βc for 15 minutes to allow the phage to absorb to the bacterial cells. Then 7.5 ml of top agar was admixed to the solution containing the bacterial cells and the absorbed phage and the entire mixture distributed evenly across the surface of a prewarmed bacterial agar plate. This process was repeated for a sufficient number of plates to plate out a total number of plaques at least equal to the library size. These plates were then maintained at 37"C for 5 hours. The plates were then overlaid with nitrocellulose filters that had been pretreated with a solution containing 10 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) and maintained at 37"C for 4 hours. The orientation of the nitrocellulose filters in relation to the plate were marked by punching a hole with a needle dipped in waterproof ink through the filter and into the bacterial plates at several locations. The nitrocellulose filters were removed with forceps and washed once in a TBST solution containing 20 mM Tris-HCL at pH 7.5, 150 mM NaCl and 0.05% polyoxyethylene soriban monolaurate (Tween-20) . A second nitrocellulose filter that had also been soaked in a solution containing 10 mM IPTG was reapplied to the bacterial plates to produce duplicate filters. The filters were further washed in a fresh solution of TBST for 15 minutes. Filters were then placed in a blocking solution consisting of 20 mM Tris-HCL at pH 7.5, 150 mM NaCl and 1% BSA and agitated for 1 hour at room temperature. The nitrocellulose filters were transferred to a fresh blocking solution containing a 1 to 500 dilution of the primary antibody and gently agitated for at least 1 hour at room temperature. After the filters were agitated in the solution containing the primary antibody the filters were washed 3 to 5 times in TBST for 5 minutes each time to remove any of the residual unbound primary antibody. The filters were transferred into a solution containing fresh blocking solution and a 1 to 500 to a 1 to 1,000 dilution of alkaline phosphatase conjugated secondary antibody. The filters were gently agitated in the solution for at least 1 hour at room temperature. The filters were washed 3 to 5 times in a solution of TBST for at least 5 minutes each time to remove any residual unbound secondary antibody. The filters were washed once in a solution containing 20 mM Tris-HCL at pH 7.5 and 150 mM NaCl. The filters were removed from this solution ad the excess moisture blotted from them with filter paper. The color was developed by placing the filter in a solution containing 100 mM Tris-HCL at pH 8.5, 100 mM NaCl, 5 mM MgCl2, 0.3 mg/ml of nitro Blue Tetrazolium (NBT) and 0.15 mg/ml of 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) for at least 30 minutes at room temperature. The residual color development solution was rinsed from the filter with a solution containing 20 mM Tris-HCL at pH 7.5 and 150 mM NaCl. The filter was then placed in a stop solution consisting of 20 mM Tris-HCL at pH 2.9 and 1 mM EDTA. The development of an intense purple color indicates at positive results. The filters are used to locate the phage plaque that produced the desired protein. That phage plaque is segregated and then grown up for further analysis.
The light chain library was constructed in the same way as the heavy chain and shown to contain 2 x 106 members. Plaque screening, with an antibody to mouse kappa chain, indicated that 60 percent of the library contained expressed light chain inserts. This relatively small percentage of inserts probably resulted from incomplete dephosphorylation of the vector after cleavage with Sac I and Xba I.
For construction of the combinatorial library, the above two libraries were used by crossing them at the Eco
RI site as follows. DNA was first purified from each library as described above. The light chain library was cleaved with Mlu I restriction endonuclease, the resulting
5' ends were dephosphorylated, and the product was digested with Eco RI. This process cleaved the left arm of the vector into several pieces, but the right arm containing the light chain sequences remained intact. The DNA of heavy chain library was cleaved with Hind III, dephosphorylated, and then cleaved with Eco RI; this process destroyed the right arm, but the left arm containing the heavy chain sequences remained intact. The
DNA's so prepared were then mixed and ligated. After " ligation, only clones that resulted from combination of a right arm of light chain-containing clones and left arm of heavy chain-containing clones reconstituted a viable phage.
After ligation and packaging, 2.5 x 107 clones were obtained. This is the combinatorial Fab expression library that was screened to identify clones having affinity for
NPN as described below in Example IV. For determining the frequency of the phage clones that coexpress the light and heavy chain fragments, duplicate lifts of the combinatorial library for light and heavy expression were screened. In the examination of approximately 500 recombinant phage, approximately 60 percent coexpressed light and heavy chain proteins.
EXAMPLE IV
ANTIGEN BINDING
All three libraries, the light chain, the heavy chain, and Fab were screened to determine whether they contained recombinant phage that expressed antibody fragments binding NPN. In a typical procedure, 30,000 phage were plated and duplicate lifts with nitrocellulose were screened as described in Example III for binding to NPN coupled to 15I- labeled bovine serum albumin (BSA) (Figure 3) . Duplicate screens of 90,000 recombinant phage from the light chain library and a similar number from the heavy chain library did not identify any clones that bound the antigen. In contrast, the screen of a similar number of clones from the Fab expression library identified many phage plaques that bound NPN (Figure 5) . Briefly, duplicate plaque lifts of Fab (filters A and B) , heavy chain (filters E and F) , and light chain (filters G and H) expression libraries were screened agai .nst 125I-labeled BSA conjugated with NPN at a density of approximately 30,000 plaques per plate. Filters C and D illustrate the duplicate secondary screening of a cored positive from a primary filter A (arrows) . BSA was labeled as described in Harlow et al.. Supra. which is incorporated herein by reference, and coupling reactions were as described in Example II. Standard plaque lift methods were used in screening as described in Example II and in Ausubel et al., Current Protocols in Molecular Biology. John Wiley and Sons, (1987), Supra. Briefly, cells (XLI blue) infected with phage were incubated on 150- mm plates for 4 hours at 37 'C, protein expression was induced by overlay with nitrocellulose filters soaked in 1 mM Isopropyl-1-thio-β-D-galactoside (IPTG) and the plates were incubated at 25eC for 8 hours. Duplicate filters were obtained during a second incubation under the same conditions. Filters were then blocked in a solution of 1 percent BSA in phosphate-buffered saline (PBS) for 1 hour before incubation (with rocking) at 25°C for 1 hour with a solution of 125I-labeled BSA (at 0.1 μM) conjugated to NPN (2 x 106 cpm/ml; approximately 15 NPN per BSA molecule) , in 1 percent BSA in PBS. Background was reduced by preliminary centrifugation of stock 125I-labeled BSA solution at 100,000g for 15 minutes and preliminary incubation of solutions with plaque lifts from plates containing bacterial infected with a phage having no insert. After labeling, filters were washed repeatedly with PBS containing 0.05 percent Tween 20 before the overnight development of autoradiographs.
This observation indicates that, under conditions where many heavy chains in combination with light chains bind to antigen, heavy or light chains alone do not. Therefore, in the case of NPN, there are many heavy and light chains that only bind antigen when they are combined with specific light and heavy chains, respectively. This result supports our decision to screen large combinatorial Fab expression libraries. To assess our ability to screen large numbers of clones and obtain a more quantitative estimate of the frequency of antigen binding clones in the combinatorial library, we screened one million phage plaques and identified approximately 100 clones that bound to antigen. For six clones, a region of the plate containing the positive phage plaques and approximately 20 surrounding them was "cored," replated, and screened with duplicate lifts (Figure 3) . The expression products of approximately 1 in 20 of the phage specifically bind to antigen. Phage which were believed to be negative on the initial screen did not give positives on replating.
To determine the specificity of the antigen-antibody interaction, antigen-binding was subjected to competition with free unlabeled antigen (Figure 4) . Filter lifts from positive plaques were exposed to 125I-labeled BSA-NPN i•n the presence of increasing concentrations of the inhibitor NPN. A number of phages correlated with NPN-binding as in Figure 3 were spotted in duplicate (about 100 particles per spot) directly onto a bacterial lawn. The plate was then overlaid with an IPTG-soaked filter and incubated for 19 hours at 25°C. The filters were then blocked in 1 percent
BSA i .n PBS before i.ncubati.on .n 125I-labeled-BSA-NPN as done previously with the inclusion of varying amounts of NPN in the labeling solution. Other conditions and procedures were as described for Figure 3. The results for a phage of moderate affinity are shown in duplicate in the figure.
Similar results were obtained for four other phages with some differences in the effective inhibitor concentration ranges. These studies showed that individual clones could be distinguished on the basis of antigen affinity. The concentration of free haptens required for complete inhibition of binding varied between 10 to 100 x 10"M, suggesting that the expressed Fab fragments had binding constants in the nanomolar range.
In preparation for characterization of the protein products, a plasmid containing the heavy and light chain genes was excised with helper phage in an analogous fashion as that for lambda Zap II (Figure 5) . Briefly, M13mp8 was used as helper phage and the excised plasmid was infected into a F+ derivative of MC1061. The excised plasmid contains the same constructs for antibody fragment expression as do the parent vectors (Figure 1) . These plasmid constructs are more conveniently analyzed for restriction pattern and protein expression of the lambda phage clones identified and isolated on the basis of antigen binding. The plasmid also contains an fl origin of replication which facilitates the preparation of single- stranded DNA for sequence analysis and in vitro mutagenesis. Mapping of the excised plasmid demonstrated a restriction pattern consistent with incorporation of heavy and light chain sequences. The protein products of one of the clones was analyzed by enzyme-linked immunosorbent assay (ELISA) and immunoblotting to establish the composition of the NPN binding protein. A bacterial supernatant after IPTG induction was concentrated and subjected to gel filtration. Fractions in the molecular size range 40 to 60 kD were pooled, concentrated, and subjected to a further gel filtration separation. ELISA analysis of the eluted fractions (Figure 6) indicated that NPN binding was associated with a protein of a molecular size of about 50 kD, which contained both heavy and light chains.
For ELISA characterization, the concentration partially purified bacterial supernatant of an NPN binding clone was separated by gel filtration and samples from each fraction were applied to microtiter plates coated with BSA- NPN. Addition of either antibody to decapeptide ( ) or antibody to K chain (-, left-hand scale) conjugated with alkaline phosphatase was followed by color development. The arrow indicates the position of elution of known Fab fragment. The results show that antigen binding is a property of a 50-kD protein containing both heavy and light chains. To permit protein characterization, a single plaque of a NPN-positive clone (Figure 3) was picked, and the plasmid containing the heavy and light chain inserts (Figure 5) was excised as described above. Cultures (500 ml) in L broth were inoculated with 3 ml of a saturated culture of the clone and incubated for 4 hours at 37βC. Protein synthesis was induced by the addition of IPTG to a final concentration of 1 mM, and the cultures were incubated for 10 hours at 25"C. The supernatant from 200 ml of cells was concentrated to 2 ml and applied to a TSK- G4000 column. Microtiter plates were coated with BSA-NPN at 1 μg/ml, 50 μl samples from the eluted fractions, were mixed with 50 μl of PBS-Tween 20 (0.05 percent) BSA (0.1 percent) added, and the plates were incubated for 2 hours at 25°C. The plated material was then washed with PBS- Tween 20-BSA and 50 μl of appropriate concentrations of a rabbit antibody to decapeptide or a goat antibody to mouse K light chain (Southern Biotech, Oakridge, TN) conjugated with alkaline phosphatase were added and incubated for 2 hours at 25°C. The plates were again washed, 50 μl of p- nitrophenyl phosphate (1 mg/ml in 0.1 tris, pH 9.5, containing 50 mM MgCl2) was added, and the plates were incubated for 15 to 30 minutes and the absorbance was read at 405 nm.
An immunoblot of a concentrated bacterial supernatant preparation under nonreducing conditions was developed with antibody to decapeptide. This revealed a 50-kD protein band. We have found that the antigen-binding protein can be purified to homogeneity from bacterial supernate in two steps involving affinity chromatography on protein G followed by gel filtration. SDS-PAGE analysis of the protein revealed a single band at approximately 50 kD under nonreducing conditions and a doublet at approximately 25 kD under reducing conditions. Taken together, these results are consistent with NPN-binding being a function of Fab fragments in which heavy and light chains are covalently linked by a disulfide bond. EXAMPLE V
PROPERTIES OF THE IN VIVO REPERTOIRE
COMPARED TO THE PHAGE COMBINATORIAL LIBRARY
A moderately restricted library was prepared only because a limited number of primers was used for polymerase chain reaction (PCR) amplification of Fd sequences. The library is expected to contain only clones expressing K- gammal sequences. However, this is not an inherent limitation of the method since the addition of more primers can amplify any antibody class or subclass. Despite this restriction, a large number of clones producing antigen binding proteins were able to be isolated.
A central issue is how the phage library compares with the in vivo antibody repertoire in terms of size, characteristics of diversity, and ease of access.
The size of the mammalian antibody repertoire is difficult to judge, but a figure of the order of 106 to 108 different antigen specificities is often quoted. With some of the reservations discussed below, a phage library of this size or larger can readily be constructed by a modification of the method described. Once an initial combinatorial library has been constructed, heavy and light chains can be shuffled to obtain libraries of exceptionally large numbers.
In principle, the diversity characteristics of the naive (unimmunized) in vivo repertoire and corresponding phage library are expected to be similar in that both involve a random combination of heavy and light chains. However, different factors act to restrict the diversity expressed by an in vivo repertoire and phage library. For example, a physiological modification such as tolerance will restrict the expression of certain antigenic specificities from the in vivo repertoire, but these specificities may still appear in the phage library. However, bias in the cloning process may introduce restrictions into the diversity of the phage library. For example, the representation of mRNA for sequences expressed by stimulated B cells can be expected to predominate over those of unstimulated cells because of higher levels of expression. In addition, the resting repertoire might overrepresent spontaneously activated B cells whose immunoglobulins have been suggested to be less specific. I any event, methods exist to selectively exclude such populations of cells. Also, the fortuitous presence of restriction sites in the variable gene similar to those used for cloning and combination will cause them to be eliminated. We can circumvent some of these difficulties by making minor changes, such as introducing amber mutations in the vector system. Different source tissues (for example, peripheral blood, bone marrow, or regional lymph nodes) and different PCR primers (for example, those to amplify different antibody classes) , may result in libraries with different diversity characteristics.
Another difference between .in vivo repertoire and phage library is that antibodies isolated from the repertoire may have benefited from affinity maturation as a result of somatic mutations after combination of heavy and light chains whereas the phage library randomly combines the matured heavy and light chains. Given a large enough phage library derived from a particular .in vivo repertoire, the original matured heavy and light chains will be recombined. However, since one of the potential benefits of this technology is to obviate the need for immunization by the generation of a single highly diverse "generic" phage library, it would be useful to have methods to optimize sequences to compensate for the absence of somatic mutation and clonal selection. Three procedures are made readily available through the vector system presented. First, saturation mutagenesis may be performed on the complementarity-determining regions (CDR's) (23) and the resulting Fab's can be assayed for increased function. Second, a heavy or a light chain of a clone that binds antigen can be recombined with the entire light or heavy chain libraries, respectively, in a procedure identical to that used to construct the combinatorial library. Third, iterative cycles of the two above procedures can be performed to further optimize the affinity or catalytic properties of the immunoglobulin. The last two procedures are not permitted in B cell clonal selection, which suggests that the methods described here may actually increase the ability to identify optimal sequences.
Access is the third area where it is of interest to compare the in vivo antibody repertoire and phage library. In practical terms the phage library is much easier to access. The screening methods used have allowed one to survey the gene products of at least 50,000 clones per plate so that 106 to 107 antibodies can be readily examined in a day but the most powerful screening methods depend on selection. In the catalytic antibody system, this may be accomplished by incorporating into the antigen leaving groups necessary for replication of auxotrophic bacterial strains or toxic substituents susceptible to catalytic inactivation. Further advantages are related to the fact that the jln vivo antibody repertoire can only be accessed via immunization, which is a selection on the basis of binding affinity. The phage library is not similarly restricted. For example, the only general method to identify antibodies with catalytic properties has been by preselection on the basis of affinity of the antibody to a transition state analog. Such restrictions do not apply to the in vitro library where catalysis can, in principle, be assayed directly. The ability to assay directly large numbers of antibodies for function may allow selection for catalysts in reactions where a mechanism is not well defined or synthesis of the transition state analog is difficult. Assaying for catalysts directly eliminates the bias of the screening procedure for reaction mechanisms limited to a particular synthetic analog; therefore, simultaneous exploration of multiple reaction pathways for a given chemical transformation are possible.
We have described procedures for the generation of Fab fragments that are clearly different in a number of important respects from antibodies. There is undoubtedly a loss of affinity in having monovalent Fab antigen binders, but it is possible to compensate for this by selection of suitably tight binders. For a number of applications such as diagnostics and biosensors, monovalent Fab fragments may be preferable. For applications requiring Fc effector functions, the technology already exists for extending the heavy chain gene and expressing the glycosylated whole antibody in mammalian cells.
The data show that it is now possible to construct and screen at least three orders of magnitude more clones with monospecificity than previously possible. The data also invite speculation concerning the production of antibodies without the use of live animals.
EXAMPLE VI
Flp RECOMBINANCE
The lambda Lc 2 vector was constructed for the cloning of PCR amplified products of mRNA that code for light chain protein, as described in Example II, by inserting the nucleotide sequence shown in Table 3 into the Sac I and Xho I sites of lambda Zap II. The vector was prepared by digesting 10 μg of lambda arms from the Uni-Zap™ XR Vector Kit (Stratagene, La Jolla, CA) with 30 units in 100 μl reaction Sac I. Overlapping synthetic oligonucleotides were cloned into the above Sac I digested arms as follows. Oligonucleotides Lll through L15 and L17 - L19 (Lll, L12, L13, L14, L15, L17, L18 and L19) (shown in Table 3) were kinased by adding 1 μl of each oligonucleotide (0.1 μg/μl) and 20 units of T4 polynucleotide kinase (BRL, Gaithersburg, MD) to a solution containing 70 mM Tris HCL at pH 7.6, 0.1 M KCl, 10 mM MgCl2, 5 mM DTT, 1 mM adenosine triphosphate (ATP) , 10 mM 2 ME, 500 micrograms per ml of BSA. The solution was maintained at 37 "C for 30 minutes and the reaction stopped by maintaining the solution at 65βC for 10 minutes. The two end oligonucleotides L16 and L110 were added to the above kinasing reaction solution together with 1/10 volume of a solution containing 20 mM Tris-HCL at pH 7.4, 2.0 mM MgCl2 and 50.0 mM NaCl. This solution was heated to 70"C for 5 minutes and allowed to cool slowly to room temperature. During this time period all oligonucleotides annealed to form the double stranded synthetic DNA insert similar to the one shown in Figure 2A. The annealed oligonucleotides were covalently linked to each other by adding 40 μl of the above reaction to a solution containing 66 mM Tris-HCL at pH 7.6, 6.6 mM MgCl2, 1 mM DTT, 1 mM ATP and 10 units of T4 DNA ligase (BRL, Gaithersburg, MD) . This solution was maintained at 25°C for 30 minutes and then the T4 DNA ligase was inactivated by heating the solution at 65°C for 10 minutes. The unphosphorylated ends of the resultant oligonuleotides were kinased by mixing 52 μl of the above reaction, 4 μl of a solution containing 10 mM ATP and 5 units of T4 polynucleotide kinase. This solution was maintained at 37°C for 30 minutes and then the T4 polynucleotide kinase was inactivated by heating the solution at 65°C for 10 minutes. The phosphorylated synthetic DNA insert was ligated directly into the above prepared lambda Zap II vector arms. TABLE 5
Lll TGAATTCTAAACTAGTCGCCAAGGAGACAG
L12 TCATAATGAAATACCTATTGCCTACGGCAG LI3 CCGCTGGATTGTTATTACTCGCTGCCCAAC
L14 CAGCCATGGCCGAGCTCGTCAGTACTAGTG
L15 TTAAGCGGCCGCAA
LI6 TCGATTGCGGCCGCTTAACACTAGTACTGACGA
LI7 GCTCGGCCATGGCTGGTTGGGCAGCGAGTA LI8 ATAACAATCCAGCGGCTGCCGTAGGCAATA
LI9 GGTATTTCATTATGACTGTCTCCTTGGCGA
LI10 CTAGTTTAGAATTCAAGCT
TABLE 6
Hll GGCCGCAAATTCTATTTCAAGGAGACAGTC
H12 ATAATGAAATACCTATTGCCTACGGCAGCC
HI3 GCTGGATTGTTATTACTCGCTGCCCAACC H14 AGCCATGGCCCAGGTGAAACTGCTCGAGA
HI5 TTCTAGCTAGTTACCCGTACGACGTTCC
HI6 GGACTACGGTTCTTAATAGAATTCG
H17 TCGACGAATTCTATTA
H18 AGAACCGTAGTCCGGAACGTCGTACGGG HI9 TAACTAGACTAGTAATCTCGAGCAGTTTC
HI10 ACCTGGGCCATGGCTCCTTGGGCAGCGAGT
Hill AATAACAATCCAGCGGCTGCCGTAGGCAA
H112 TAGGTATTTCATTATGACTGTCTCCTT
H113 GAAATAGAATTTGC
The lambda He 2 vector was constructed for cloning PCR amplified products coding for heavy chain Fd sequences, as described in Example II, by inserting the nucleotide sequence shown in Figure 2B into the Not I and Xho I sites of lambda Zap II. As with the light chain vector, the heavy chain vector was prepared by digesting lambda arms
TM from the Unι-Zapm XR Vector Kit (Stratagene, La Jolla, CA) with 30 units of Not I restriction enzyme in 100 μl reaction buffer. The inserted sequence similar to the one in Figure 2B was constructed from the overlapping synthetic oligonucleotides depicted in Table Hll to H113 as outlined above.
The sequence of the oligonucleotides described above include elements for construction, expression, and secretion of Fab fragments. These oligonucleotides introduce the asymmetric Not I and Eco RI restriction sites; a leader peptide for the bacterial pel B gene, which has previously been successfully used in E. coli to secrete Fab fragments, Better et al., Science, 240:1041 (1988); Skerra and Pluckthun, Science. 240:1038 (1988), both of which are incorporated herein by reference, a ribosome binding site at the optimal distance for expression of the cloned sequence; cloning sites for either the light or heavy chain PCR product; and, in lambda He 2, a decapeptide tag at the carboxyl terminus of the expressed heavy chain protein fragment. The sequence of the decapeptide tag was useful because of the availability of monoclonal antibodies to this peptide that were used for immunoaffinity purification of fusion proteins, Field et al. Mol. Cell Biol.. 8:2159 (1988), which is incorporated herein by reference. The vectors were characterized by restriction digest analysis and DNA sequencing, Sanger et al., Proc. Natl. Acad. Sci.. USA. 74:5463-5467 (1977), which is incorporated herein by reference and using AMV Reverse Transcriptase 35S-ATP Sequencing Kit (Stratagene, La Jolla, CA) .
The lambda LcRF and lambda LcLF were constructed from lambda Lc2 by inserting the oligonucleotides F01 and F02 or F03 and F04 into the EcoRI site of the lambda Lc2 vector. The vector was prepared for ligation by cleaving 10 μg of lambda Lc2 DNA with 30 units of EcoRI restriction enzyme (NEB Beverly Ma.) in 100 μl of reaction buffer at 37°C for one hour. The solution was heated to 65βC for 30 minutes and then chilled to 30°C. CaCl2 was added to a final concentration of 5 mM and 5 units Heat-Killable (HK) phosphatase (Epicenter, Madison, WI) was added. The reaction was allowed to preceded for 60 minutes at 30°C. The EcoRI digested lambda Lc2 DNA was purified by phenol chloroform extraction and ethanol precipitation. Lambda LcRF was constructed by ligating three molar equivalence of phosporylated oligonucleotides F03 and F04 to 1 μg of EcoRI digested lambda Lc2 in a 10 μl reaction volume at 4"C overnight. A portion (1 μl) of the ligation was packaged with in vitro lambda phage packaging extract and plated on a lawn of XLl-Blue bacteria.
Lambda LcLF was constructed by ligating three molar equivalence of phosphorylated oligonucleotides F01 and F02 to 1 μg of EcoRI digested lambda Lc2 in 10 μl reaction volume at 4"C overnight. A portion (1 μl) of the ligation mixture was packaged with in vitro lambda phage packaging extract and plated on a lawn of XLl-Blue bacteria.
For identification of desired recombinant phage, fresh LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl, pH 7.5) with 10 μg/ml tetracycline was inoculated with XL1- Blue (Stratagene, La Jolla, CA) and shaken overnight at 37°C. Bacteria were pelleted by centrifugation and resuspended in 1/2 volume of 10 mM MgS04 1000 pfu of recombinant phage were mixed with 100 μl of the XLl-Blue suspension and incubated at 37βC for twenty minutes. This mixture was quickly dispersed into 7 ml melted and cooled 0.7% top agarose in LB medium, and the slurry was plated on warmed LB plates. The agarose was allowed to solidify at room temperature and then the plates were warmed at 37°C for 10 to 12 hours, then chilled at 4°C for 1 more hour. MSI Magna Nylon membranes (Fisher Scientific, California) were placed directly onto the agarose surfaces of the plates for 1 minute, and then lifted off carefully. The plaque lifts were immersed in denaturing solution (0.5 N NaOH, 1.5 M NaCl) for 5 minutes, transferred to neutralization solution (1.5 M NaCl, 0.5 M Tris at pH 7.4) for 5 minutes, rinsed in 2X SSC (0.3 M NaCl, 0.3 M sodium citrate, pH 7.0) , and air dried on paper towels. Duplicate filters were generated from the same plates as above. All filters were interleaved between sheets of filter paper and baked at 80βC under constant vacuum for 1 hour. The filters were removed from the filter paper and immersed in wash solution (5X SSC, 0.5% SDS, 1 mM EDTA pH 8.0) at 42βC for 1 to 2 hours; bacterial debris was removed by gently wiping each filter with a sponge soaked in the wash solution. The filters were then prehybridized in prehybridization solution (6X SSC, 0.2% Ficoll 400, 0.2% polyvinylpyrrolidone, 0.2% borine serum albumin (Pentax fraction V) , 0.5% SDS, 50 mM sodium phosphate pH 6.5, and 250 μg/ml denatured and sheared herring sperm DNA) . After 2 to 14 hours at 65"C, the prehybridization solution was decanted, fresh solution was added along with the oligo probe (see below) , and the filters were shaken at room temperature for 14 to 24 hours. The filters were washed three times for 30 minutes at 37'C with 6X SSC/0.5% SDS and then autoradiographed. Plaques showing positive hybridization on both filter and duplicate were isolated and checked by restriction mapping as well as sequencing. Oligomeric probe was prepared as followed: 10 μg oligo was mixed in a 50 μl reaction volume with 50 mM Tris 7.4, 10 mM MgCl2, 5 mM DTT, 0.1 mM EDTA pH 8.0, 0.1 mM spermidine, 100 μCi [α-32PJ ATP (Amersham, Arlington Heights, IL) , and 10 μ T4 polynucleotide kinase (BRL, Gaithersburg, MD) . Oligonucleotide LLF was used to identify lambda LcLF and LRF was used to identify lambda LcRF.
For construction of the lambda LcF vector, lambda LcLF and lambda LcRF vector were crossed at the Xba I site as follows. DNA was first purified from each vector. The lambda LcRF was cleaved with Mlu I restriction endonuclease, the resulting 5' ends were dephosphorylated, and the product was digested with Xba I. This process cleaved the left arm of the vector into several pieces, but the right arm remained intact. The DNA of lambda LcLF was cleaved with Hind III, dephosphorylated, and then cleaved with Xba I; this process destroyed the right arm, but the left arm remained intact. The DNA's so prepared were then mixed and ligated. After ligation, only clones that resulted from combination of a right arm of light chain- containing clones and left arm of heavy chain-containing clones reconstituted a viable phage. After ligation and packaging, the desired vector, lamba LcF was identified as above by sequence analysis.
The lambda HcRF and lambda HcLF were constructed from lambda Hc3 by inserting the oligonucleotides F01 and F02 or F03 and F04 into the EcoRI site of the lambda Hc2 vector. The vector was prepared for ligation by cleaving 10 μg of lambda Hc2 DNA with 30 units of EcoRI restriction enzyme (NEB Beverly Ma.) in 100 μl of reaction buffer at 37°C for one hour. The solution was heated to 65°C for 30 minutes and then chilled to 30°C. CaCl2 was added to a final concentration of 5 mM and 5 units Heat-Killable (HK) phosphatase (Epicenter, Madison, WI) was added. The reaction was allowed to preceded for 60 minutes at 30°C. The EcoRI digested lambda Hc3 DNA was purified by phenol chloroform extraction and ethanol precipitation. Lambda HcRF was constructed by ligating three molar equivalence of phosporylated oligonucleotides F03 and F04 to 1 μg of EcoRI digested lambda Hc2 in a 10 μl reaction volume at 4°C overnight. A portion (1 μl) of the ligation was packaged with in vitro lambda phage packaging extract and plated on a lawn of XLl-Blue bacteria.
Lambda HcLF was constructed by ligating three molar equivalence of phosphorylated oligonucleotides F01 and F02 to 1 μg of EcoRI digested lambda Hc2 in 10 μl reaction volume at 4°C overnight. A portion (1 μl) of the ligation mixture was packaged with in vitro lambda phage packaging extract and plated on a lawn of XLl-Blue bacteria. Oligonucleotide HLF was used to identify lambda HcLF and LRF was used to identify lambda LcRF by hybridization, as above.
For construction of the lambda HcF vector, lambda HcLF and lambda HcRF vectors were crossed at the Xba I site. DNA from the two vectors was first purified. The lambda HcRF vector DNA was cleaved with Mlu I restriction endonuclease, the resulting 5» ends were dephosphorylated, and the product was digested with Eco RI. This process cleaved the left arm of the vector into several pieces, but the right arm remained intact. The lambda HcLF DNA was cleaved with Hind III, dephosphorylated, and then cleaved with Eco RI; this process destroyed the right arm, but the left arm remained intact. The DNA's so prepared were then mixed and ligated. After ligation, only clones that resulted from combination of a right arm of light chain- containing clones and left arm of heavy chain-containing clones reconstituted a viable phage. After ligation and packaging the desired heavy chain vector was confirmed by sequence analysis.
Libraries were constructed in these vectors as in Example III except the lambda LcF was cleaved with Sad and Spel instead of Sad and Xbal in preparation for cloning. The light chain PCR inserts prepared by cleaving with Sad and Xbal were compatible with these arms. TABLE 7
F01 5 AATTCGAAGTTCCTATACTTTCTAGAG 3' F02 5 AATTCTCTAGAAAGTATAGGAACTTCG 3' F03 5 AATTCTCTAGAGAATAGGAACTTCGGAATAGGAACTTCG 3' F04 5 AATTCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAG 3' LLF 5 TTTCTAGAGAATTCTAAA LRF 5 GGAACTTCGAATTCTAAA HLF 5 TTTCTAGAGAATTCGTCGA HRF 5 GGAACTTCGAATTCGTCGA
EXAMPLE VII
A light chain vector was constructed that contains two amber mutations in the left arm. The left arm was from EMBL3A the right arm was from lambda LcF were combined to construct lambda LcFA. DNA was prepared from each of the two parent lambda phage vectors. 10 ug of lambda EMBL3A was digested with Hindlll, dephosphorylated and digested with Kpnl. 10 ug of lambda LcF was digested with Mlul then dephosphorylated. This DNA was then digested with Kpnl. One μg of digested DNA from each of the two parent vectors were mixed and ligated. After packaging in vitro, the phage were infected into BB4 E. coli. All phage had the two amber mutations from EMBL and the cloning site from lambda LcF one of these phage was named lambda LcFA.
A heavy chain vector, lambda HcFA, with an amber mutation in the right arm was constructed from lambda zap
(Stratagene, La Jolla, CA) in a manner identical to the construction of Lambda HcFA of example VI except Lambda
Zapl was digested with Not I and EcoRI and dephosporylated with heat-kill phosphatase and phage vectors were grown on E. coli BB4.
When heavy and light chain libraries were constructed in these vectors as in Example VI, combination could be performed by co-infecting the phage libraries into BB4 (Stratagene, La Jolla, CA) cells which had been transformed with plasmid pUC19F, as described in Govinal and Jayaram, Gene. 51:31-41 (1987), which is incorporated herein by reference, and combined phage were selected by platting on MC1061 (ATCC) E. coli. which selected against SupF amber mutations.
Although the invention has been described with reference to the presently preferred embodiment, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.

Claims

I CLAIM:
1. A composition of matter comprising a plurality of procaryotic cells containing diverse combinations of first and second DNA sequences encoding first and second polypeptides that can be expressed and which form heteromeric receptors and at least one of the plurality of procaryotic cells expressing a heteromer exhibiting binding activity towards a preselected molecule.
2. The composition of matter of claim 1 wherein said procaryotic cells are E. coli.
3. The composition of matter of claim 1 wherein the first and second DNA sequences encode functional portions of heteromeric receptors selected from the group consisting of antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors.
4. The composition of matter of claim 3 wherein said first and second DNA sequences encode functional portions of the variable heavy and variable light chains of an antibody.
5. A composition of matter comprising a plurality of procaryotic cells containing various combinations of diverse first and second DNA sequences encoding first and second polypeptides which can associate to form heteromeric receptors exhibiting binding activity towards preselected molecules, said diversity of first DNA sequence being greater than about 100 different sequences and said diversity of said second DNA sequence being greater than about 1000 different sequences.
6. The composition of matter of claim 5 wherein said procaryotic cells are E. coli.
7. The composition of matter of claim 5 wherein the first and second DNA sequences encode functional portions of heteromeric receptors selected from the group consisting of antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors.
8. The composition of matter of claim 7 wherein said first and second DNA sequences encode functional portions of the variable heavy and variable light chains of an antibody.
9. A kit for the preparation of vectors useful for the coexpression of two or more DNA sequences, comprising two vectors, a first vector having a first combining site on a defined side of a cloning site which defines orientation and a second vector with a second combining site and a cloning site of orientation asymmetric to that of the first vector, wherein one or both of said vectors contains a promoter for expressing polypeptides which form heteromeric receptors encoded by DNA sequences inserted in said cloning sites.
10. The kit of claim 9 wherein said vectors are in a virus.
11. The kit of claim 9 wherein said vectors are plasmid.
12. The kit of claim 9 wherein said DNA sequences encode functional portions selected from the group consisting of antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors.
13. The kit of claim 12 wherein said DNA sequences encode functional portions of the variable heavy and variable light chains of an antibody.
14. The kit of claim 9 wherein said first and second combining sites are selected from the group consisting of EcoRI-EcoRI, and Notl-Notl.
15. The kit of claim 14 wherein the cloning site is selected from the group consisting of Xhol-Spel, Sacl-Xbal, and Sacl-Spel.
16. A vector, capable of expressing a heteromer exhibiting binding activity towards a preselected molecule when combined with a second vector, having a first combining site on a defined side of a cloning site which defines orientation and which can be combined with a second vector with a second combining site and a cloning site of orientation asymmetric to that of the first vector, wherein one or both of said vectors contains a promoter for expressing polypeptides which form heteromers encoded by DNA sequences inserted in said cloning sites.
17. The vector of claim 16 wherein said DNA sequences encode functional portions of heteromeric receptors selected from the group consisting of antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors.
18. The vector of claim 16 wherein said DNA sequences encode functional portions of the variable heavy and variable light chains of an antibody.
19. A cloning system for the coexpression of two DNA sequences encoding polypeptides which associate to form a heteromer, comprising a set of uniform first vectors having a diverse population of first DNA sequences and a set of uniform second vectors having a diverse population of second DNA sequences, said first and second vectors having complementary combining sites so as to allow the operational combination of said first and second DNA sequences.
20. The cloning system of claim 19 wherein said two DNA sequences encode polypeptides which associate to form heteromeric receptors selected from the group consisting of antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors.
21. The cloning system of claim 20 wherein said two DNA sequences encode functional proteins of the variable heavy and variable light chains of an antibody.
22. The cloning system of claim 19 wherein the combining sites are selected from the group consisting of EcoRI-EcoRI and Notl-Notl.
23. A plurality of expression vectors containing a plurality of possible first and second DNA sequences, wherein each of said expression vectors has operationally linked thereon a first DNA sequence and a second DNA sequence, and wherein substantially each of said vectors contains a different combination of first and second DNA sequence.
24. A method of constructing a diverse population of vectors having first and second DNA sequences encoding first and second polypeptides which associate to form heteromeric receptors, comprising the steps of (a) operationally linking a diverse population of first DNA sequences encoding said first polypeptides to a first vector having a combining site and a cloning site in a defined orientation;
(b) operationally linking a diverse population of second DNA sequences encoding said second polypeptides to a second vector having a combining site compatible with the combining site on said first vector and a cloning site in an asymmetric orientation to that of the first vector;
(c) combining the vector products of step (a) with the vector products of step (b) under conditions to permit their combination into a combined vector having said first and second DNA sequences operationally linked thereon.
25. The method of claim 24 wherein said first and second DNA sequences encode functional portions of heteromeric receptors selected from the group consisting of antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors.
26. The method of claim 25 wherein said first and second DNA sequences encode functional portions of the variable heavy and variable light chains of an antibody.
27. The method of claim 24 wherein said combining is accomplished by restriction endonuclease cleavage of said vectors of step (a) and (b) and combining said cleaved vectors of step (a) and (b) with DNA ligase.
28. The method of claim 24 wherein said combining is accomplished by Flp recombinase.
29. A method of selecting a procaryotic cell which expresses a heteromer specific for a preselected molecule comprising randomly combining first vectors having a diverse population of DNA sequences encoding polypeptides with second vectors having different diverse populations of DNA sequences which encode polypeptides and which form heteromeric receptors with said polypeptides encoded by said first vector, transfecting a sufficient number of said randomly combined sequences into said procaryotic cells, screening said cells to determine the cell expressing a heteromer specific for said preselected molecule.
30. The method of claim 29 wherein said first and second DNA sequences encode functional portions of heteromeric receptors selected from the group consisting of antibodies, T cell receptors, integrins, hormone receptors and transmitter receptors.
31. The method of claim 30 wherein said first and second DNA sequences encode functional portions of the variable heavy and variable light chains of an antibody.
32. The method of claim 29 wherein said combining is accomplished with restriction endonuclease cleavage of said first and second vectors and ligating the cleaved first and second vectors.
33. The method of claim 29 wherein said combining is accomplished with Flp recombinase.
34. The method of claim 29 wherein the number of randomly combined sequences is sufficiently equivalent to the possible combinations of said populations of said first and second DNAs.
35. A method for identifying functional heteromeric receptors composed of a plurality of polypeptides, comprising coexpressing random combinations of first and second DNA homologs which encode polypeptides which associate to form heteromeric receptors so as to form a diverse population of said first and second DNA homologs, said diversity being at least enough that at least one heteromer formed by the polypeptides resulting from said coexpression has a desired functional property and restricted so that said heteromeric receptors can be screened for a predetermined function.
PCT/US1990/002890 1989-05-16 1990-05-15 Co-expression of heteromeric receptors WO1990014443A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU58344/90A AU652539B2 (en) 1989-05-16 1990-05-15 Co-expression of heteromeric receptors
FI915411A FI915411A0 (en) 1989-05-16 1991-11-15 SAMEXPRESSION AV HETEROMERISKA RECEPTORER.

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US35323589A 1989-05-16 1989-05-16
US353,235 1989-05-16
US41073589A 1989-09-20 1989-09-20
US410,735 1989-09-20
US44633389A 1989-12-04 1989-12-04
US446,333 1989-12-04

Publications (1)

Publication Number Publication Date
WO1990014443A1 true WO1990014443A1 (en) 1990-11-29

Family

ID=27408104

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1990/002890 WO1990014443A1 (en) 1989-05-16 1990-05-15 Co-expression of heteromeric receptors

Country Status (5)

Country Link
EP (1) EP0478627A4 (en)
AU (1) AU652539B2 (en)
CA (1) CA2057923A1 (en)
FI (1) FI915411A0 (en)
WO (1) WO1990014443A1 (en)

Cited By (193)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992001047A1 (en) * 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1992020791A1 (en) * 1990-07-10 1992-11-26 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1993006213A1 (en) * 1991-09-23 1993-04-01 Medical Research Council Production of chimeric antibodies - a combinatorial approach
WO1993011236A1 (en) * 1991-12-02 1993-06-10 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
EP0550645A1 (en) * 1990-09-28 1993-07-14 Ixsys, Inc. Surface expression libraries of heteromeric receptors
EP0563296A1 (en) * 1990-12-20 1993-10-06 Ixsys, Inc. Optimization of binding proteins
US5498530A (en) * 1991-10-16 1996-03-12 Affymax Technologies, N.V. Peptide library and screening method
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5580717A (en) * 1990-05-01 1996-12-03 Affymax Technologies N.V. Recombinant library screening methods
US5733743A (en) * 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US5733731A (en) * 1991-10-16 1998-03-31 Affymax Technologies N.V. Peptide library and screening method
US5837242A (en) * 1992-12-04 1998-11-17 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US5858657A (en) * 1992-05-15 1999-01-12 Medical Research Council Methods for producing members of specific binding pairs
US5871907A (en) * 1991-05-15 1999-02-16 Medical Research Council Methods for producing members of specific binding pairs
US5872215A (en) * 1991-12-02 1999-02-16 Medical Research Council Specific binding members, materials and methods
US5962255A (en) * 1992-03-24 1999-10-05 Cambridge Antibody Technology Limited Methods for producing recombinant vectors
EP1024191A2 (en) * 1991-12-02 2000-08-02 Medical Research Council Production of chimeric antibodies from antibody segment repertoires and displayed on phage
US6140471A (en) * 1992-03-24 2000-10-31 Cambridge Antibody Technology, Ltd. Methods for producing members of specific binding pairs
US6172197B1 (en) 1991-07-10 2001-01-09 Medical Research Council Methods for producing members of specific binding pairs
US6225447B1 (en) 1991-05-15 2001-05-01 Cambridge Antibody Technology Ltd. Methods for producing members of specific binding pairs
US6248516B1 (en) 1988-11-11 2001-06-19 Medical Research Council Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors
US6291161B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertiore
US6291158B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
US6291159B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6291160B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6358742B1 (en) 1996-03-25 2002-03-19 Maxygen, Inc. Evolving conjugative transfer of DNA by recursive recombination
US6358740B1 (en) 1999-03-05 2002-03-19 Maxygen, Inc. Recombination of insertion modified nucleic acids
US6492160B1 (en) 1991-05-15 2002-12-10 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6492123B1 (en) 1992-12-04 2002-12-10 Medical Research Council Multivalent and multispecific binding proteins and their use
US6596539B1 (en) 1997-10-31 2003-07-22 Maxygen, Inc. Modification of virus tropism and host range by viral genome shuffling
US6680192B1 (en) 1989-05-16 2004-01-20 Scripps Research Institute Method for producing polymers having a preselected activity
US6806079B1 (en) 1990-07-10 2004-10-19 Medical Research Council Methods for producing members of specific binding pairs
US6969586B1 (en) 1989-05-16 2005-11-29 Scripps Research Institute Method for tapping the immunological repertoire
US7063943B1 (en) 1990-07-10 2006-06-20 Cambridge Antibody Technology Methods for producing members of specific binding pairs
US7151169B2 (en) 1999-04-30 2006-12-19 Cambridge Antibody Technology Limited Specific binding members for TGFβ1
WO2007024715A2 (en) 2005-08-19 2007-03-01 Abbott Laboratories Dual variable domain immunoglobin and uses thereof
US7368111B2 (en) 1995-10-06 2008-05-06 Cambridge Antibody Technology Limited Human antibodies specific for TGFβ2
EP2067788A2 (en) 1999-05-18 2009-06-10 Dyax Corp. Fab fragment libraries and methods for their use
US7553617B1 (en) 1990-06-20 2009-06-30 Affymax, Inc. Peptide library and screening systems
EP2090657A2 (en) 2000-08-07 2009-08-19 Centocor Ortho Biotech Inc. Anti-IL-12 antibodies, compositions, methods and uses
US7612181B2 (en) 2005-08-19 2009-11-03 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2116556A1 (en) 2008-05-09 2009-11-11 Abbott GmbH & Co. KG Antibodies to receptor of advanced glycation end products (rage) and uses thereof
WO2009149185A2 (en) 2008-06-03 2009-12-10 Abbott Laboratories Dual variable domain immunoglobulins and uses thereof
EP2159230A1 (en) 2000-08-07 2010-03-03 Centocor Ortho Biotech Inc. Anti-TNF antibodies, compositions, methods and uses
US7700739B2 (en) 2005-06-30 2010-04-20 Abbott Laboratories IL-12/p40 binding proteins
WO2010099079A1 (en) 2009-02-24 2010-09-02 Abbott Laboratories Antibodies to troponin i and methods of use thereof
EP2253646A1 (en) 2000-08-07 2010-11-24 Centocor Ortho Biotech Inc. Anti-dual integrin antibody and compositions and conjugates comprising said antibody
US7858559B2 (en) 2000-11-17 2010-12-28 University Of Rochester In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells
WO2011025964A2 (en) 2009-08-29 2011-03-03 Abbott Laboratories Therapeutic dll4 binding proteins
US7915388B2 (en) 2006-09-08 2011-03-29 Abbott Laboratories Interleukin-13 binding proteins
EP2308888A1 (en) 2001-11-14 2011-04-13 Centocor Ortho Biotech Inc. Anti-IL-6 antibodies, compositions, methods and uses
WO2011070045A1 (en) 2009-12-08 2011-06-16 Abbott Gmbh & Co. Kg Monoclonal antibodies against the rgm a protein for use in the treatment of retinal nerve fiber layer degeneration
WO2011100403A1 (en) 2010-02-10 2011-08-18 Immunogen, Inc Cd20 antibodies and uses thereof
WO2011123507A1 (en) 2010-03-30 2011-10-06 Centocor Ortho Biotech Inc. Humanized il-25 antibodies
WO2011130377A2 (en) 2010-04-15 2011-10-20 Abbott Laboratories Amyloid-beta binding proteins
WO2011143562A2 (en) 2010-05-14 2011-11-17 Abbott Laboratories Il-1 binding proteins
WO2012006500A2 (en) 2010-07-08 2012-01-12 Abbott Laboratories Monoclonal antibodies against hepatitis c virus core protein
US8101553B1 (en) 2000-02-22 2012-01-24 Medical & Biological Laboratories Co., Ltd. Antibody library
WO2012024187A1 (en) 2010-08-14 2012-02-23 Abbott Laboratories Amyloid-beta binding proteins
WO2012024650A2 (en) 2010-08-19 2012-02-23 Abbott Laboratories Anti-ngf antibodies and their use
EP2452694A1 (en) 2005-06-30 2012-05-16 Janssen Biotech, Inc. Anti-IL-23 antibodies, compositions, methods and uses
WO2012088094A2 (en) 2010-12-21 2012-06-28 Abbott Laboratories Il-1 binding proteins
WO2012121775A2 (en) 2010-12-21 2012-09-13 Abbott Laboratories Dual variable domain immunoglobulins and uses thereof
EP2500359A2 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2548577A1 (en) 2005-12-29 2013-01-23 Janssen Biotech, Inc. Human anti-il-23 antibodies, compositions, methods and uses
US8367586B2 (en) 2010-11-19 2013-02-05 Morphosys Ag Collection and methods for its use
US8383778B2 (en) 2009-01-29 2013-02-26 Abbvie Inc. IL-1 binding proteins
US8420083B2 (en) 2009-10-31 2013-04-16 Abbvie Inc. Antibodies to receptor for advanced glycation end products (RAGE) and uses thereof
WO2013063095A1 (en) 2011-10-24 2013-05-02 Abbvie Inc. Immunobinders directed against sclerostin
WO2013078191A1 (en) 2011-11-23 2013-05-30 Medimmune, Llc Binding molecules specific for her3 and uses thereof
WO2013134743A1 (en) 2012-03-08 2013-09-12 Halozyme, Inc. Conditionally active anti-epidermal growth factor receptor antibodies and methods of use thereof
EP2650014A2 (en) 2008-06-20 2013-10-16 Wyeth LLC Compositions and methods of use of ORF1358 from beta-hemolytic streptococcal strains
US8586714B2 (en) 2009-09-01 2013-11-19 Abbvie, Inc. Dual variable domain immunoglobulins and uses thereof
US8663980B2 (en) 2007-10-26 2014-03-04 Janssen Biotech, Inc. Vectors, host cells, and methods of production and uses
WO2014036495A2 (en) 2012-08-31 2014-03-06 Immunogen Inc. Diagnostic assays and kits for detection of folate receptor 1
US8680239B2 (en) 2000-12-22 2014-03-25 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Use of RGM and its modulators
US8685896B2 (en) 2009-05-29 2014-04-01 Morphosys Ag Collection and methods for its use
US8691224B2 (en) 2005-11-30 2014-04-08 Abbvie Inc. Anti-Aβ globulomer 5F7 antibodies
US8716450B2 (en) 2009-10-15 2014-05-06 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US8722855B2 (en) 2009-10-28 2014-05-13 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US8735546B2 (en) 2010-08-03 2014-05-27 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
WO2014100542A1 (en) 2012-12-21 2014-06-26 Abbvie, Inc. High-throughput antibody humanization
US8822645B2 (en) 2008-07-08 2014-09-02 Abbvie Inc. Prostaglandin E2 dual variable domain immunoglobulins and uses thereof
EP2772269A2 (en) 2009-03-05 2014-09-03 Abbvie Inc. IL-17 binding proteins
US8877190B2 (en) 2006-11-30 2014-11-04 Abbvie Inc. Aβ conformer selective anti-Aβ globulomer monoclonal antibodies
US8895004B2 (en) 2007-02-27 2014-11-25 AbbVie Deutschland GmbH & Co. KG Method for the treatment of amyloidoses
US8906864B2 (en) 2005-09-30 2014-12-09 AbbVie Deutschland GmbH & Co. KG Binding domains of proteins of the repulsive guidance molecule (RGM) protein family and functional fragments thereof, and their use
EP2810654A1 (en) 2008-07-08 2014-12-10 AbbVie Inc. Prostaglandin E2 binding proteins and uses thereof
US8962803B2 (en) 2008-02-29 2015-02-24 AbbVie Deutschland GmbH & Co. KG Antibodies against the RGM A protein and uses thereof
EP2842968A1 (en) 2005-04-29 2015-03-04 Janssen Biotech, Inc. Anti-IL-6 antibodies, compositions, methods and uses
WO2015038984A2 (en) 2013-09-12 2015-03-19 Halozyme, Inc. Modified anti-epidermal growth factor receptor antibodies and methods of use thereof
US8987418B2 (en) 2013-03-15 2015-03-24 Abbvie Inc. Dual specific binding proteins directed against IL-1β and/or IL-17
US9029508B2 (en) 2008-04-29 2015-05-12 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US9035027B2 (en) 2008-06-03 2015-05-19 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US9046513B2 (en) 2010-08-26 2015-06-02 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US9045551B2 (en) 2012-11-01 2015-06-02 Abbvie Inc. Anti-DLL4/VEGF dual variable domain immunoglobulin and uses thereof
WO2015097536A2 (en) 2013-12-24 2015-07-02 Janssen Pharmaceutical Nv Anti-vista antibodies and fragments
US9102722B2 (en) 2012-01-27 2015-08-11 AbbVie Deutschland GmbH & Co. KG Composition and method for the diagnosis and treatment of diseases associated with neurite degeneration
US9115195B2 (en) 2010-03-02 2015-08-25 Abbvie Inc. Therapeutic DLL4 binding proteins
US9120870B2 (en) 2011-12-30 2015-09-01 Abbvie Inc. Dual specific binding proteins directed against IL-13 and IL-17
EP2921177A2 (en) 2010-07-09 2015-09-23 AbbVie Inc. Dual variable domain immunoglobulins and uses thereof
WO2015157592A1 (en) 2014-04-11 2015-10-15 Medimmune, Llc Bispecific her2 antibodies
US9176150B2 (en) 2003-01-31 2015-11-03 AbbVie Deutschland GmbH & Co. KG Amyloid beta(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof
US9371374B2 (en) 2013-03-14 2016-06-21 Abbott Laboratories HCV core lipid binding domain monoclonal antibodies
WO2016115345A1 (en) 2015-01-14 2016-07-21 The Brigham And Women's Hospital, Treatment of cancer with anti-lap monoclonal antibodies
KR20160116056A (en) 2008-08-14 2016-10-06 테바 파마슈티컬즈 오스트레일리아 피티와이 엘티디 Anti-il-12/il-23 antibodies
WO2016207717A1 (en) 2015-06-24 2016-12-29 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
WO2017004026A1 (en) 2015-06-29 2017-01-05 Immunogen, Inc. Anti-cd 123 antibodies and conjugates and derivatives thereof
US9617334B2 (en) 2012-06-06 2017-04-11 Zoetis Services Llc Caninized anti-NGF antibodies and methods thereof
US9631017B2 (en) 1999-05-18 2017-04-25 Dyax Corp. Fab fragment libraries and methods for their use
US9670276B2 (en) 2012-07-12 2017-06-06 Abbvie Inc. IL-1 binding proteins
US9708410B2 (en) 2003-05-30 2017-07-18 Janssen Biotech, Inc. Anti-tissue factor antibodies and compositions
EP3196212A1 (en) 2010-02-24 2017-07-26 Immunogen, Inc. Immunoconjugates comprising a folate receptor 1 antibody
WO2017137830A1 (en) 2016-02-12 2017-08-17 Janssen Pharmaceutica Nv Anti-vista (b7h5) antibodies
WO2017156488A2 (en) 2016-03-10 2017-09-14 Acceleron Pharma, Inc. Activin type 2 receptor binding proteins and uses thereof
WO2017161206A1 (en) 2016-03-16 2017-09-21 Halozyme, Inc. Conjugates containing conditionally active antibodies or antigen-binding fragments thereof, and methods of use
WO2017172771A2 (en) 2016-03-29 2017-10-05 Janssen Biotech, Inc. Method of treating psoriasis with increased interval dosing of anti-il12/23 antibody
WO2017175058A1 (en) 2016-04-07 2017-10-12 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US9790478B2 (en) 2013-03-14 2017-10-17 Abbott Laboratories HCV NS3 recombinant antigens and mutants thereof for improved antibody detection
WO2017189805A1 (en) 2016-04-27 2017-11-02 Abbvie Inc. Methods of treatment of diseases in which il-13 activity is detrimental using anti-il-13 antibodies
WO2017210471A1 (en) 2016-06-02 2017-12-07 Abbvie Inc. Glucocorticoid receptor agonist and immunoconjugates thereof
US9840554B2 (en) 2015-06-15 2017-12-12 Abbvie Inc. Antibodies against platelet-derived growth factor (PDGF)
US9841427B2 (en) 2013-03-14 2017-12-12 Abbott Laboratories HCV antigen-antibody combination assay and methods and compositions for use therein
WO2017211928A1 (en) 2016-06-10 2017-12-14 Ucb Biopharma Sprl ANTI-IgE ANTIBODIES
WO2017214322A1 (en) 2016-06-08 2017-12-14 Abbvie Inc. Anti-b7-h3 antibodies and antibody drug conjugates
WO2017214339A1 (en) 2016-06-08 2017-12-14 Abbvie Inc. Anti-b7-h3 antibodies and antibody drug conjugates
WO2017214335A1 (en) 2016-06-08 2017-12-14 Abbvie Inc. Anti-b7-h3 antibodies and antibody drug conjugates
WO2018064436A1 (en) 2016-09-30 2018-04-05 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-il23 specific antibody
WO2018093841A1 (en) 2016-11-16 2018-05-24 Janssen Biotech, Inc. Method of treating psoriasis with anti-il-23 specific antibody
WO2018098363A2 (en) 2016-11-23 2018-05-31 Bioverativ Therapeutics Inc. Bispecific antibodies binding to coagulation factor ix and coagulation factor x
US10017580B2 (en) 2014-04-15 2018-07-10 ADC Therpeutics S.A. Humanized anti-Tn-MUC1 antibodies and their conjugates
WO2018129029A1 (en) 2017-01-04 2018-07-12 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
US10093733B2 (en) 2014-12-11 2018-10-09 Abbvie Inc. LRP-8 binding dual variable domain immunoglobulin proteins
WO2019025299A1 (en) 2017-07-31 2019-02-07 F. Hoffmann-La Roche Ag Three-dimensional structure-based humanization method
US10208109B2 (en) 2005-11-30 2019-02-19 Abbvie Inc. Monoclonal antibodies against amyloid beta protein and uses thereof
WO2019058345A2 (en) 2017-09-25 2019-03-28 Janssen Biotech, Inc. Safe and effective method of treating lupus with anti-il12/il23 antibody
WO2019075090A1 (en) 2017-10-10 2019-04-18 Tilos Therapeutics, Inc. Anti-lap antibodies and uses thereof
WO2019150309A1 (en) 2018-02-02 2019-08-08 Hammack Scott Modulators of gpr68 and uses thereof for treating and preventing diseases
WO2019171252A1 (en) 2018-03-05 2019-09-12 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
EP3574919A1 (en) 2011-07-13 2019-12-04 AbbVie Inc. Methods and compositions for treating asthma using anti-il-13 antibodies
WO2019236671A1 (en) 2018-06-08 2019-12-12 Crystal Bioscience Inc. Transgenic animal for producing diversified antibodies that have the same light chain ii
WO2020014306A1 (en) 2018-07-10 2020-01-16 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
WO2020016838A2 (en) 2018-07-18 2020-01-23 Janssen Biotech, Inc. Sustained response predictors after treatment with anti-il23 specific antibody
EP3626744A1 (en) 2015-05-29 2020-03-25 AbbVie Inc. Anti-cd40 antibodies and uses thereof
WO2020065532A1 (en) 2018-09-24 2020-04-02 Janssen Biotech, Inc. Safe and effective method of treating ulcerative colitis with anti-il12/il23 antibody
WO2020076969A2 (en) 2018-10-10 2020-04-16 Tilos Therapeutics, Inc. Anti-lap antibody variants and uses thereof
WO2020106358A1 (en) 2018-11-20 2020-05-28 Takeda Vaccines, Inc. Novel anti-zika virus antibodies and uses thereof
WO2020104943A2 (en) 2018-11-20 2020-05-28 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-il-23 specific antibody
WO2020128864A1 (en) 2018-12-18 2020-06-25 Janssen Biotech, Inc. Safe and effective method of treating lupus with anti-il12/il23 antibody
WO2020132557A1 (en) 2018-12-21 2020-06-25 Compass Therapeutics Llc Transgenic mouse expressing common human light chain
WO2020148651A1 (en) 2019-01-15 2020-07-23 Janssen Biotech, Inc. Anti-tnf antibody compositions and methods for the treatment of juvenile idiopathic arthritis
WO2020152544A1 (en) 2019-01-23 2020-07-30 Janssen Biotech, Inc. Anti-tnf antibody compositions for use in methods for the treatment of psoriatic arthritis
EP3689325A1 (en) 2014-04-08 2020-08-05 Boston Pharmaceuticals Inc. Binding molecules specific for il-21 and uses thereof
WO2020183271A1 (en) 2019-03-14 2020-09-17 Janssen Biotech, Inc. Methods for producing anti-tnf antibody compositions
WO2020183270A1 (en) 2019-03-14 2020-09-17 Janssen Biotech, Inc. Methods for producing anti-tnf antibody compositions
WO2020183269A1 (en) 2019-03-14 2020-09-17 Janssen Biotech, Inc. Manufacturing methods for producing anti-tnf antibody compositions
WO2020183418A1 (en) 2019-03-14 2020-09-17 Janssen Biotech, Inc. Manufacturing methods for producing anti-il12/il23 antibody compositions
WO2020188466A1 (en) 2019-03-18 2020-09-24 Janssen Biotech, Inc. Method of treating psoriasis in pediatric subjects with anti-il12/il23 antibody
EP3719039A1 (en) 2015-11-10 2020-10-07 Medimmune, LLC Binding molecules specific for asct2 and uses thereof
WO2020245677A1 (en) 2019-06-03 2020-12-10 Janssen Biotech, Inc. Anti-tnf antibodies, compositions, and methods for the treatment of active ankylosing spondylitis
WO2020245676A1 (en) 2019-06-03 2020-12-10 Janssen Biotech, Inc. Anti-tnf antibody compositions, and methods for the treatment of psoriatic arthritis
US10899842B2 (en) 2016-11-23 2021-01-26 Immunoah Therapeutics, Inc. 4-1BB binding proteins and uses thereof
WO2021028752A1 (en) 2019-08-15 2021-02-18 Janssen Biotech, Inc. Anti-tfn antibodies for treating type i diabetes
EP3789403A1 (en) 2014-11-11 2021-03-10 MedImmune Limited Therapeutic combinations comprising anti-cd73 antibodies and a2a receptor inhibitor and uses thereof
US10982002B2 (en) 2018-03-12 2021-04-20 Zoetis Services Llc Anti-NGF antibodies and methods thereof
US11014982B2 (en) 2017-02-07 2021-05-25 Janssen Biotech, Inc. Anti-TNF antibodies, compositions, and methods for the treatment of active ankylosing spondylitis
US11041020B2 (en) 2017-01-30 2021-06-22 Janssen Biotech, Inc. Methods for the treatment of active Psoriatic Arthritis
WO2021159024A1 (en) 2020-02-05 2021-08-12 Larimar Therapeutics, Inc. Tat peptide binding proteins and uses thereof
WO2021207449A1 (en) 2020-04-09 2021-10-14 Merck Sharp & Dohme Corp. Affinity matured anti-lap antibodies and uses thereof
EP3901176A1 (en) 2014-11-10 2021-10-27 MedImmune Limited Binding molecules specific for cd73 and uses thereof
EP3925980A1 (en) 2013-08-30 2021-12-22 ImmunoGen, Inc. Antibodies and assays for detection of folate receptor 1
WO2022053650A1 (en) 2020-09-11 2022-03-17 Medimmune Limited Therapeutic b7-h4 binding molecules
WO2022053685A2 (en) 2020-09-12 2022-03-17 Medimmune Limited A scoring method for an anti-b7h4 antibody-drug conjugate therapy
EP4008781A1 (en) 2010-12-31 2022-06-08 BioAtla, Inc. Express humanization of antibodies
US11390685B2 (en) 2017-01-06 2022-07-19 Biosion, Inc. ErbB2 antibodies and uses therefore
WO2022190033A1 (en) 2021-03-12 2022-09-15 Janssen Biotech, Inc. Safe and effective method of treating psoriatic arthritis with anti-il23 specific antibody
WO2022190034A1 (en) 2021-03-12 2022-09-15 Janssen Biotech, Inc. Method of treating psoriatic arthritis patients with inadequate response to tnf therapy with anti-il23 specific antibody
WO2022195028A2 (en) 2021-03-18 2022-09-22 Medimmune Limited Therapeutic binding molecules
WO2022197782A1 (en) 2021-03-17 2022-09-22 Receptos Llc Methods of treating atopic dermatitis with anti il-13 antibodies
WO2022241057A1 (en) 2021-05-12 2022-11-17 Applied Biomedical Science Institute Binding polypeptides against sars cov-2 and uses thereof
US11512127B2 (en) 2018-02-14 2022-11-29 Viela Bio, Inc. Antibodies to Feline McDonough Sarcoma (FMS)-like tyrosine kinase 3 receptor ligand (FLT3L) and uses thereof for treating autoimmune and inflammatory diseases
WO2023281462A1 (en) 2021-07-09 2023-01-12 Janssen Biotech, Inc. Manufacturing methods for producing anti-tnf antibody compositions
WO2023281463A1 (en) 2021-07-09 2023-01-12 Janssen Biotech, Inc. Manufacturing methods for producing anti-tnf antibody compositions
WO2023281466A1 (en) 2021-07-09 2023-01-12 Janssen Biotech, Inc. Manufacturing methods for producing anti-il12/il23 antibody compositions
WO2023073615A1 (en) 2021-10-29 2023-05-04 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2023084488A1 (en) 2021-11-15 2023-05-19 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2023095000A1 (en) 2021-11-23 2023-06-01 Janssen Biotech, Inc. Method of treating ulcerative colitis with anti-il23 specific antibody
WO2023156434A1 (en) 2022-02-16 2023-08-24 Medimmune Limited Combination therapies for treatment of cancer comprising b7-h4 antibody drug conjugate
US11759527B2 (en) 2021-01-20 2023-09-19 Abbvie Inc. Anti-EGFR antibody-drug conjugates
WO2023187707A1 (en) 2022-03-30 2023-10-05 Janssen Biotech, Inc. Method of treating mild to moderate psoriasis with il-23 specific antibody
US11780911B2 (en) 2019-05-23 2023-10-10 Janssen Biotech, Inc. Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha
US11807685B2 (en) 2021-08-05 2023-11-07 The Uab Research Foundation Anti-CD47 antibody and uses thereof
WO2023223265A1 (en) 2022-05-18 2023-11-23 Janssen Biotech, Inc. Method for evaluating and treating psoriatic arthritis with il23 antibody

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2016842A1 (en) * 1989-05-16 1990-11-16 Richard A. Lerner Method for tapping the immunological repertoire

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4816397A (en) * 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE114723T1 (en) * 1987-03-02 1994-12-15 Enzon Lab Inc ORGANISM AS CARRIER FOR ''SINGLE CHAIN ANTIBODY DOMAIN (SCAD)''.
EP0623679B1 (en) * 1987-05-21 2003-06-25 Micromet AG Targeted multifunctional proteins
AU2318288A (en) * 1987-08-07 1989-03-09 Genelabs Incorporated Coincidence cloning method and library

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816397A (en) * 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Nucleic Acids Research, Vol. 16, No. 15, issued 1988, SHORT et al, "lambda zap 1 bacteriophaged lambda expression vector with in vivo exvision properties", pages 7588-7600, See Fig. 13. *
Science, Vol. 240, issued 20 May 1988, SKERRA et al "Assembly of a Functional Immunoglobulin F, Fragment in Escherichia coli", pages 1038-1040. See Abstract, Fig. 1, page 1039, col. 3. *
See also references of EP0478627A4 *
Stratagene Catalog, issued 1988, pages 16 & 17. See entire document. *

Cited By (345)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7306907B2 (en) 1988-11-11 2007-12-11 Cambridge Antibody Technology Limited Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors
US6545142B1 (en) 1988-11-11 2003-04-08 Medical Research Council Of The United Kingdom Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors
US6248516B1 (en) 1988-11-11 2001-06-19 Medical Research Council Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors
US6291160B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US7189841B2 (en) 1989-05-16 2007-03-13 Scripps Research Institute Method for tapping the immunological repertoire
US8338107B2 (en) 1989-05-16 2012-12-25 Scripps Research Institute Method for producing polymers having a preselected activity
US7858359B2 (en) 1989-05-16 2010-12-28 Stratagene Method for tapping the immunological repertoire
US6291159B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6291158B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
US6291161B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertiore
US6969586B1 (en) 1989-05-16 2005-11-29 Scripps Research Institute Method for tapping the immunological repertoire
US6680192B1 (en) 1989-05-16 2004-01-20 Scripps Research Institute Method for producing polymers having a preselected activity
US5580717A (en) * 1990-05-01 1996-12-03 Affymax Technologies N.V. Recombinant library screening methods
US7553617B1 (en) 1990-06-20 2009-06-30 Affymax, Inc. Peptide library and screening systems
EP1847605A2 (en) * 1990-07-10 2007-10-24 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US7732377B2 (en) 1990-07-10 2010-06-08 Medical Research Council Methods for producing members of specific binding pairs
WO1992001047A1 (en) * 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
EP1433846A2 (en) * 1990-07-10 2004-06-30 Cambridge Antibody Technology LTD Phagemid-based method of producing filamentous bacteriophage particles displaying antibody molecules and the corresponding bacteriophage particles.
WO1992020791A1 (en) * 1990-07-10 1992-11-26 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6806079B1 (en) 1990-07-10 2004-10-19 Medical Research Council Methods for producing members of specific binding pairs
US7662557B2 (en) 1990-07-10 2010-02-16 Medical Research Council Methods for producing members of specific binding pairs
US6916605B1 (en) 1990-07-10 2005-07-12 Medical Research Council Methods for producing members of specific binding pairs
US7635666B1 (en) 1990-07-10 2009-12-22 Medical Research Council Methods for producing members of specific binding pairs
US5969108A (en) * 1990-07-10 1999-10-19 Medical Research Council Methods for producing members of specific binding pairs
EP0774511A1 (en) * 1990-07-10 1997-05-21 Cambridge Antibody Technology Limited Methods of producing members of specific binding pairs
EP2055777A3 (en) * 1990-07-10 2009-05-13 Medimmune Limited Methods for producing members of specific binding pairs
US7063943B1 (en) 1990-07-10 2006-06-20 Cambridge Antibody Technology Methods for producing members of specific binding pairs
EP1754787A2 (en) 1990-07-10 2007-02-21 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
EP1847605A3 (en) * 1990-07-10 2007-10-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
EP1754787A3 (en) * 1990-07-10 2008-06-18 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
EP1433846A3 (en) * 1990-07-10 2004-09-22 Cambridge Antibody Technology LTD Phagemid-based method of producing filamentous bacteriophage particles displaying antibody molecules and the corresponding bacteriophage particles.
EP0844306A1 (en) * 1990-07-10 1998-05-27 Cambridge Antibody Technology Limited Methods of producing members of specific binding pairs
US7723270B1 (en) 1990-07-10 2010-05-25 Medical Research Council Methods for producing members of specific binding pairs
EP0550645A4 (en) * 1990-09-28 1993-09-01 Ixsys, Inc. Surface expression libraries of heteromeric receptors
EP0550645A1 (en) * 1990-09-28 1993-07-14 Ixsys, Inc. Surface expression libraries of heteromeric receptors
EP0563296A4 (en) * 1990-12-20 1994-07-13 Ixsys Inc Optimization of binding proteins
EP0563296A1 (en) * 1990-12-20 1993-10-06 Ixsys, Inc. Optimization of binding proteins
US5955358A (en) * 1990-12-20 1999-09-21 Ixsys, Incorporated Optimization of binding proteins
US6492160B1 (en) 1991-05-15 2002-12-10 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6225447B1 (en) 1991-05-15 2001-05-01 Cambridge Antibody Technology Ltd. Methods for producing members of specific binding pairs
US5871907A (en) * 1991-05-15 1999-02-16 Medical Research Council Methods for producing members of specific binding pairs
US6291650B1 (en) 1991-05-15 2001-09-18 Cambridge Antibody Technology, Ltd. Methods for producing members of specific binding pairs
US6172197B1 (en) 1991-07-10 2001-01-09 Medical Research Council Methods for producing members of specific binding pairs
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
WO1993006213A1 (en) * 1991-09-23 1993-04-01 Medical Research Council Production of chimeric antibodies - a combinatorial approach
AU665025B2 (en) * 1991-09-23 1995-12-14 Cambridge Antibody Technology Limited Production of chimeric antibodies - a combinatorial approach
US6156511A (en) * 1991-10-16 2000-12-05 Affymax Technologies N.V. Peptide library and screening method
US5733731A (en) * 1991-10-16 1998-03-31 Affymax Technologies N.V. Peptide library and screening method
US5498530A (en) * 1991-10-16 1996-03-12 Affymax Technologies, N.V. Peptide library and screening method
US6593081B1 (en) 1991-12-02 2003-07-15 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6521404B1 (en) 1991-12-02 2003-02-18 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US5872215A (en) * 1991-12-02 1999-02-16 Medical Research Council Specific binding members, materials and methods
US6582915B1 (en) 1991-12-02 2003-06-24 Medical Research Council Production of anti-self bodies from antibody segment repertories and displayed on phage
EP1024191A3 (en) * 1991-12-02 2004-03-31 Medical Research Council Production of chimeric antibodies from antibody segment repertoires and displayed on phage
US6555313B1 (en) 1991-12-02 2003-04-29 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6544731B1 (en) 1991-12-02 2003-04-08 Medical Research Council Production of anti-self antibodies from antibody segment repertories and displayed on phage
WO1993011236A1 (en) * 1991-12-02 1993-06-10 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US7195866B2 (en) 1991-12-02 2007-03-27 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
EP1024191A2 (en) * 1991-12-02 2000-08-02 Medical Research Council Production of chimeric antibodies from antibody segment repertoires and displayed on phage
US5885793A (en) * 1991-12-02 1999-03-23 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6140471A (en) * 1992-03-24 2000-10-31 Cambridge Antibody Technology, Ltd. Methods for producing members of specific binding pairs
US5962255A (en) * 1992-03-24 1999-10-05 Cambridge Antibody Technology Limited Methods for producing recombinant vectors
US5733743A (en) * 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US5858657A (en) * 1992-05-15 1999-01-12 Medical Research Council Methods for producing members of specific binding pairs
US5837242A (en) * 1992-12-04 1998-11-17 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US7122646B2 (en) 1992-12-04 2006-10-17 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US6492123B1 (en) 1992-12-04 2002-12-10 Medical Research Council Multivalent and multispecific binding proteins and their use
US7368111B2 (en) 1995-10-06 2008-05-06 Cambridge Antibody Technology Limited Human antibodies specific for TGFβ2
US6387702B1 (en) 1996-03-25 2002-05-14 Maxygen, Inc. Enhancing cell competence by recursive sequence recombination
US6358742B1 (en) 1996-03-25 2002-03-19 Maxygen, Inc. Evolving conjugative transfer of DNA by recursive recombination
US6482647B1 (en) 1996-03-25 2002-11-19 Maxygen, Inc. Evolving susceptibility of cellular receptors to viral infection by recursive recombination
US6391552B2 (en) 1996-03-25 2002-05-21 Maxygen, Inc. Enhancing transfection efficiency of vectors by recursive recombination
US6596539B1 (en) 1997-10-31 2003-07-22 Maxygen, Inc. Modification of virus tropism and host range by viral genome shuffling
US6365377B1 (en) 1999-03-05 2002-04-02 Maxygen, Inc. Recombination of insertion modified nucleic acids
US6358740B1 (en) 1999-03-05 2002-03-19 Maxygen, Inc. Recombination of insertion modified nucleic acids
US6413745B1 (en) 1999-03-05 2002-07-02 Maxygen, Inc Recombination of insertion modified nucleic acids
US6406910B1 (en) 1999-03-05 2002-06-18 Maxygen, Inc. Recombination of insertion modified nucleic acids
US7151169B2 (en) 1999-04-30 2006-12-19 Cambridge Antibody Technology Limited Specific binding members for TGFβ1
EP2067788A2 (en) 1999-05-18 2009-06-10 Dyax Corp. Fab fragment libraries and methods for their use
US9631017B2 (en) 1999-05-18 2017-04-25 Dyax Corp. Fab fragment libraries and methods for their use
EP2067788A3 (en) * 1999-05-18 2010-04-21 Dyax Corp. Fab fragment libraries and methods for their use
US8101553B1 (en) 2000-02-22 2012-01-24 Medical & Biological Laboratories Co., Ltd. Antibody library
EP2090657A2 (en) 2000-08-07 2009-08-19 Centocor Ortho Biotech Inc. Anti-IL-12 antibodies, compositions, methods and uses
EP2305817A2 (en) 2000-08-07 2011-04-06 Centocor Ortho Biotech Inc. Anti-IL-12 antibodies, compositions, methods and uses
EP2159230A1 (en) 2000-08-07 2010-03-03 Centocor Ortho Biotech Inc. Anti-TNF antibodies, compositions, methods and uses
EP2253646A1 (en) 2000-08-07 2010-11-24 Centocor Ortho Biotech Inc. Anti-dual integrin antibody and compositions and conjugates comprising said antibody
EP3597752A1 (en) 2000-08-07 2020-01-22 Janssen Biotech, Inc. Anti-il-12 antibodies, compositions, methods and uses
EP3118318A1 (en) 2000-08-07 2017-01-18 Janssen Biotech, Inc. Anti-tnf antibodies, compositions, methods and uses
EP2330129A2 (en) 2000-08-07 2011-06-08 Centocor Ortho Biotech Inc. Anti-TNF antibodies, compositions, methods and uses
US8741810B2 (en) 2000-11-17 2014-06-03 University Of Rochester In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells
US7858559B2 (en) 2000-11-17 2010-12-28 University Of Rochester In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells
US8680239B2 (en) 2000-12-22 2014-03-25 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Use of RGM and its modulators
EP2308888A1 (en) 2001-11-14 2011-04-13 Centocor Ortho Biotech Inc. Anti-IL-6 antibodies, compositions, methods and uses
US10464976B2 (en) 2003-01-31 2019-11-05 AbbVie Deutschland GmbH & Co. KG Amyloid β(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof
US9176150B2 (en) 2003-01-31 2015-11-03 AbbVie Deutschland GmbH & Co. KG Amyloid beta(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof
US9708410B2 (en) 2003-05-30 2017-07-18 Janssen Biotech, Inc. Anti-tissue factor antibodies and compositions
EP2842968A1 (en) 2005-04-29 2015-03-04 Janssen Biotech, Inc. Anti-IL-6 antibodies, compositions, methods and uses
US8629257B2 (en) 2005-06-30 2014-01-14 Abbvie Inc. IL-12/p40 binding proteins
US7700739B2 (en) 2005-06-30 2010-04-20 Abbott Laboratories IL-12/p40 binding proteins
EP3501537A1 (en) 2005-06-30 2019-06-26 Janssen Biotech, Inc. Anti-il23 antibodies, compositions, methods and uses
EP2452694A1 (en) 2005-06-30 2012-05-16 Janssen Biotech, Inc. Anti-IL-23 antibodies, compositions, methods and uses
EP2500353A2 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2520588A1 (en) 2005-08-19 2012-11-07 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
US7612181B2 (en) 2005-08-19 2009-11-03 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2500358A2 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2500356A2 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2495257A2 (en) 2005-08-19 2012-09-05 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2500354A2 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
WO2007024715A2 (en) 2005-08-19 2007-03-01 Abbott Laboratories Dual variable domain immunoglobin and uses thereof
EP2500359A2 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2500355A2 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2500357A2 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
EP2500352A1 (en) 2005-08-19 2012-09-19 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
US8906864B2 (en) 2005-09-30 2014-12-09 AbbVie Deutschland GmbH & Co. KG Binding domains of proteins of the repulsive guidance molecule (RGM) protein family and functional fragments thereof, and their use
US10208109B2 (en) 2005-11-30 2019-02-19 Abbvie Inc. Monoclonal antibodies against amyloid beta protein and uses thereof
US10323084B2 (en) 2005-11-30 2019-06-18 Abbvie Inc. Monoclonal antibodies against amyloid beta protein and uses thereof
US10538581B2 (en) 2005-11-30 2020-01-21 Abbvie Inc. Anti-Aβ globulomer 4D10 antibodies
US9540432B2 (en) 2005-11-30 2017-01-10 AbbVie Deutschland GmbH & Co. KG Anti-Aβ globulomer 7C6 antibodies
US8691224B2 (en) 2005-11-30 2014-04-08 Abbvie Inc. Anti-Aβ globulomer 5F7 antibodies
EP3760230A1 (en) 2005-12-29 2021-01-06 Janssen Biotech, Inc. Human anti-il-23 antibodies, compositions, methods and uses
EP2548577A1 (en) 2005-12-29 2013-01-23 Janssen Biotech, Inc. Human anti-il-23 antibodies, compositions, methods and uses
EP3219328A1 (en) 2005-12-29 2017-09-20 Janssen Biotech, Inc. Human anti-il-23 antibodies, compositions, method and uses
US7915388B2 (en) 2006-09-08 2011-03-29 Abbott Laboratories Interleukin-13 binding proteins
US11344621B2 (en) 2006-09-08 2022-05-31 Abbvie, Inc. Interleukin-13 binding proteins
US10086076B2 (en) 2006-09-08 2018-10-02 Abbvie Inc. Interleukin-13 binding proteins
EP3910065A1 (en) 2006-09-08 2021-11-17 AbbVie Bahamas Ltd. Interleukin -13 binding proteins
US8604177B2 (en) 2006-09-08 2013-12-10 Abbvie Inc. Interleukin-13 binding proteins
EP3339445A1 (en) 2006-09-08 2018-06-27 AbbVie Bahamas Ltd. Interleukin -13 binding proteins
US9592293B2 (en) 2006-09-08 2017-03-14 Abbvie Inc. Interleukin-13 binding proteins
EP3524685A1 (en) 2006-09-08 2019-08-14 AbbVie Bahamas Ltd. Interleukin -13 binding proteins
US8877190B2 (en) 2006-11-30 2014-11-04 Abbvie Inc. Aβ conformer selective anti-Aβ globulomer monoclonal antibodies
US9359430B2 (en) 2006-11-30 2016-06-07 Abbvie Inc. Abeta conformer selective anti-Abeta globulomer monoclonal antibodies
US9394360B2 (en) 2006-11-30 2016-07-19 Abbvie Inc. Aβ conformer selective anti-Aβ globulomer monoclonal antibodies
US9951125B2 (en) 2006-11-30 2018-04-24 Abbvie Inc. Aβ conformer selective anti-Aβ globulomer monoclonal antibodies
US8895004B2 (en) 2007-02-27 2014-11-25 AbbVie Deutschland GmbH & Co. KG Method for the treatment of amyloidoses
US8663980B2 (en) 2007-10-26 2014-03-04 Janssen Biotech, Inc. Vectors, host cells, and methods of production and uses
US9206248B2 (en) 2007-10-26 2015-12-08 Janssen Biotech, Inc. Vectors, host cells, and methods of production and uses
US8980626B2 (en) 2007-10-26 2015-03-17 Janssen Biotech, Inc. Vectors, host cells, and methods of production and uses
US9605069B2 (en) 2008-02-29 2017-03-28 AbbVie Deutschland GmbH & Co. KG Antibodies against the RGM a protein and uses thereof
EP3309173A1 (en) 2008-02-29 2018-04-18 AbbVie Deutschland GmbH & Co KG Monoclonal antibodies against the rgm a protein and uses thereof
US8962803B2 (en) 2008-02-29 2015-02-24 AbbVie Deutschland GmbH & Co. KG Antibodies against the RGM A protein and uses thereof
EP2899209A1 (en) 2008-04-29 2015-07-29 Abbvie Inc. Dual Variable Domain Immunoglobulins and uses thereof
US9029508B2 (en) 2008-04-29 2015-05-12 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
EP2500361A1 (en) 2008-05-09 2012-09-19 Abbott GmbH & Co. KG Antibodies to receptor of advanced glycation end products (rage) and uses thereof
US8323651B2 (en) 2008-05-09 2012-12-04 Abbott Laboratories Antibodies to receptor of advanced glycation end products (RAGE) and uses thereof
EP2116556A1 (en) 2008-05-09 2009-11-11 Abbott GmbH & Co. KG Antibodies to receptor of advanced glycation end products (rage) and uses thereof
EP3059248A1 (en) 2008-05-09 2016-08-24 Abbvie Deutschland GmbH & Co. KG Antibodies to receptor of advanced glycation end products (rage) and uses thereof
US9394363B2 (en) 2008-05-09 2016-07-19 AbbVie Deutschland GmbH & Co. KG Antibodies to receptor of advanced glycation end products (RAGE) and uses thereof
EP3002299A1 (en) 2008-06-03 2016-04-06 AbbVie Inc. Dual variable domain immunoglobulins and uses thereof
US9035027B2 (en) 2008-06-03 2015-05-19 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
WO2009149185A2 (en) 2008-06-03 2009-12-10 Abbott Laboratories Dual variable domain immunoglobulins and uses thereof
US9109026B2 (en) 2008-06-03 2015-08-18 Abbvie, Inc. Dual variable domain immunoglobulins and uses thereof
EP2650014A2 (en) 2008-06-20 2013-10-16 Wyeth LLC Compositions and methods of use of ORF1358 from beta-hemolytic streptococcal strains
EP2810654A1 (en) 2008-07-08 2014-12-10 AbbVie Inc. Prostaglandin E2 binding proteins and uses thereof
US8822645B2 (en) 2008-07-08 2014-09-02 Abbvie Inc. Prostaglandin E2 dual variable domain immunoglobulins and uses thereof
KR20160116056A (en) 2008-08-14 2016-10-06 테바 파마슈티컬즈 오스트레일리아 피티와이 엘티디 Anti-il-12/il-23 antibodies
US8383778B2 (en) 2009-01-29 2013-02-26 Abbvie Inc. IL-1 binding proteins
US8030026B2 (en) 2009-02-24 2011-10-04 Abbott Laboratories Antibodies to troponin I and methods of use thereof
USRE45763E1 (en) 2009-02-24 2015-10-20 Abbott Laboratories Antibodies to troponin I and methods of use thereof
EP2853540A1 (en) 2009-02-24 2015-04-01 Abbott Laboratories Antibodies to troponin I and methods of use therof
WO2010099079A1 (en) 2009-02-24 2010-09-02 Abbott Laboratories Antibodies to troponin i and methods of use thereof
US9663587B2 (en) 2009-03-05 2017-05-30 Abbvie Inc. IL-17 binding proteins
US9481735B2 (en) 2009-03-05 2016-11-01 Abbvie Inc. IL-17 binding proteins
EP2810652A2 (en) 2009-03-05 2014-12-10 AbbVie Inc. IL-17 binding proteins
US8835610B2 (en) 2009-03-05 2014-09-16 Abbvie Inc. IL-17 binding proteins
EP2772269A2 (en) 2009-03-05 2014-09-03 Abbvie Inc. IL-17 binding proteins
US9481736B2 (en) 2009-03-05 2016-11-01 Abbvie, Inc. IL-17 binding proteins
US9624293B2 (en) 2009-05-29 2017-04-18 Morphosys Ag Collection and methods for its use
US10647757B2 (en) 2009-05-29 2020-05-12 Morphosys Ag Collection and methods for its use
US8685896B2 (en) 2009-05-29 2014-04-01 Morphosys Ag Collection and methods for its use
WO2011025964A2 (en) 2009-08-29 2011-03-03 Abbott Laboratories Therapeutic dll4 binding proteins
US9132190B2 (en) 2009-08-29 2015-09-15 Abbvie Inc. Therapeutic DLL4 binding proteins
US8623358B2 (en) 2009-08-29 2014-01-07 Abbvie Inc. Therapeutic DLL4 binding proteins
US9469688B2 (en) 2009-08-29 2016-10-18 Abbvie Inc. Therapeutic DLL4 binding proteins
EP3029070A1 (en) 2009-08-29 2016-06-08 AbbVie Inc. Therapeutic dll4 binding proteins
US8586714B2 (en) 2009-09-01 2013-11-19 Abbvie, Inc. Dual variable domain immunoglobulins and uses thereof
US8716450B2 (en) 2009-10-15 2014-05-06 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US8722855B2 (en) 2009-10-28 2014-05-13 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US9067996B2 (en) 2009-10-31 2015-06-30 Abbvie Inc. Antibodies to receptor for advanced glycation end products (RAGE) and uses thereof
US8420083B2 (en) 2009-10-31 2013-04-16 Abbvie Inc. Antibodies to receptor for advanced glycation end products (RAGE) and uses thereof
US9175075B2 (en) 2009-12-08 2015-11-03 AbbVie Deutschland GmbH & Co. KG Methods of treating retinal nerve fiber layer degeneration with monoclonal antibodies against a retinal guidance molecule (RGM) protein
WO2011070045A1 (en) 2009-12-08 2011-06-16 Abbott Gmbh & Co. Kg Monoclonal antibodies against the rgm a protein for use in the treatment of retinal nerve fiber layer degeneration
WO2011100403A1 (en) 2010-02-10 2011-08-18 Immunogen, Inc Cd20 antibodies and uses thereof
EP3196212A1 (en) 2010-02-24 2017-07-26 Immunogen, Inc. Immunoconjugates comprising a folate receptor 1 antibody
US9115195B2 (en) 2010-03-02 2015-08-25 Abbvie Inc. Therapeutic DLL4 binding proteins
US9469689B2 (en) 2010-03-02 2016-10-18 Abbvie Inc. Therapeutic DLL4 binding proteins
EP3072904A1 (en) 2010-03-02 2016-09-28 Abbvie Inc. Therapeutic dll4 binding proteins
EP3680253A2 (en) 2010-03-02 2020-07-15 AbbVie Inc. Therapeutic dll4 binding proteins
WO2011123507A1 (en) 2010-03-30 2011-10-06 Centocor Ortho Biotech Inc. Humanized il-25 antibodies
WO2011130377A2 (en) 2010-04-15 2011-10-20 Abbott Laboratories Amyloid-beta binding proteins
US9822171B2 (en) 2010-04-15 2017-11-21 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
US8987419B2 (en) 2010-04-15 2015-03-24 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
US9409986B2 (en) 2010-05-14 2016-08-09 Abbvie Inc. IL-1 binding proteins
US9441038B2 (en) 2010-05-14 2016-09-13 Abbvie Inc. IL-1 binding proteins
US9447184B2 (en) 2010-05-14 2016-09-20 Abbvie Inc. IL-1 binding proteins
US9447183B2 (en) 2010-05-14 2016-09-20 Abbvie Inc. IL-1 binding proteins
WO2011143562A2 (en) 2010-05-14 2011-11-17 Abbott Laboratories Il-1 binding proteins
US9303085B2 (en) 2010-05-14 2016-04-05 Abbvie Inc. IL-1 binding proteins
US8841417B2 (en) 2010-05-14 2014-09-23 Abbvie Inc. IL-1 binding proteins
WO2012006500A2 (en) 2010-07-08 2012-01-12 Abbott Laboratories Monoclonal antibodies against hepatitis c virus core protein
EP2921177A2 (en) 2010-07-09 2015-09-23 AbbVie Inc. Dual variable domain immunoglobulins and uses thereof
EP3252072A2 (en) 2010-08-03 2017-12-06 AbbVie Inc. Dual variable domain immunoglobulins and uses thereof
US9493560B2 (en) 2010-08-03 2016-11-15 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US8735546B2 (en) 2010-08-03 2014-05-27 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
WO2012024187A1 (en) 2010-08-14 2012-02-23 Abbott Laboratories Amyloid-beta binding proteins
EP3533803A1 (en) 2010-08-14 2019-09-04 AbbVie Inc. Amyloid-beta binding antibodies
US9062101B2 (en) 2010-08-14 2015-06-23 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
US10047121B2 (en) 2010-08-14 2018-08-14 AbbVie Deutschland GmbH & Co. KG Amyloid-beta binding proteins
EP4056589A1 (en) 2010-08-19 2022-09-14 Zoetis Belgium S.A. Anti-ngf antibodies and their use
US10125192B2 (en) 2010-08-19 2018-11-13 Zoetis Belgium S.A. Caninized anti-NGF antibodies and their use
US10093725B2 (en) 2010-08-19 2018-10-09 Zoetis Belgium S.A. Anti-NGF antibodies and their use
US9505829B2 (en) 2010-08-19 2016-11-29 Zoetis Belgium S.A. Anti-NGF antibodies and their use
WO2012024650A2 (en) 2010-08-19 2012-02-23 Abbott Laboratories Anti-ngf antibodies and their use
US9046513B2 (en) 2010-08-26 2015-06-02 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US9541559B2 (en) 2010-11-19 2017-01-10 Morphosys Ag Collection and methods for its use
US8367586B2 (en) 2010-11-19 2013-02-05 Morphosys Ag Collection and methods for its use
US8728981B2 (en) 2010-11-19 2014-05-20 Morphosys Ag Collection and methods for its use
WO2012121775A2 (en) 2010-12-21 2012-09-13 Abbott Laboratories Dual variable domain immunoglobulins and uses thereof
WO2012088094A2 (en) 2010-12-21 2012-06-28 Abbott Laboratories Il-1 binding proteins
EP4008781A1 (en) 2010-12-31 2022-06-08 BioAtla, Inc. Express humanization of antibodies
EP3574919A1 (en) 2011-07-13 2019-12-04 AbbVie Inc. Methods and compositions for treating asthma using anti-il-13 antibodies
WO2013063095A1 (en) 2011-10-24 2013-05-02 Abbvie Inc. Immunobinders directed against sclerostin
EP3608340A1 (en) 2011-11-23 2020-02-12 Medlmmune, LLC Binding molecules specific for her3 and uses thereof
WO2013078191A1 (en) 2011-11-23 2013-05-30 Medimmune, Llc Binding molecules specific for her3 and uses thereof
US9120870B2 (en) 2011-12-30 2015-09-01 Abbvie Inc. Dual specific binding proteins directed against IL-13 and IL-17
US9365643B2 (en) 2012-01-27 2016-06-14 AbbVie Deutschland GmbH & Co. KG Antibodies that bind to repulsive guidance molecule A (RGMA)
US9102722B2 (en) 2012-01-27 2015-08-11 AbbVie Deutschland GmbH & Co. KG Composition and method for the diagnosis and treatment of diseases associated with neurite degeneration
US10106602B2 (en) 2012-01-27 2018-10-23 AbbVie Deutschland GmbH & Co. KG Isolated monoclonal anti-repulsive guidance molecule A antibodies and uses thereof
WO2013134743A1 (en) 2012-03-08 2013-09-12 Halozyme, Inc. Conditionally active anti-epidermal growth factor receptor antibodies and methods of use thereof
EP3296320A1 (en) 2012-03-08 2018-03-21 Halozyme, Inc. Conditionally active anti-epidermal growth factor receptor antibodies and methods of use thereof
US9951128B2 (en) 2012-06-06 2018-04-24 Zoetis Services Llc Caninized anti-NGF antibodies and methods thereof
US9617334B2 (en) 2012-06-06 2017-04-11 Zoetis Services Llc Caninized anti-NGF antibodies and methods thereof
US9670276B2 (en) 2012-07-12 2017-06-06 Abbvie Inc. IL-1 binding proteins
WO2014036495A2 (en) 2012-08-31 2014-03-06 Immunogen Inc. Diagnostic assays and kits for detection of folate receptor 1
EP3712175A1 (en) 2012-08-31 2020-09-23 ImmunoGen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US9944720B2 (en) 2012-11-01 2018-04-17 Abbvie Inc. Anti-DLL4/VEGF dual variable domain immunoglobulin and uses thereof
US9163093B2 (en) 2012-11-01 2015-10-20 Abbvie Inc. Anti-DLL4/VEGF dual variable domain immunoglobulin and uses thereof
US9045551B2 (en) 2012-11-01 2015-06-02 Abbvie Inc. Anti-DLL4/VEGF dual variable domain immunoglobulin and uses thereof
US9550986B2 (en) 2012-12-21 2017-01-24 Abbvie Inc. High-throughput antibody humanization
WO2014100542A1 (en) 2012-12-21 2014-06-26 Abbvie, Inc. High-throughput antibody humanization
US9371374B2 (en) 2013-03-14 2016-06-21 Abbott Laboratories HCV core lipid binding domain monoclonal antibodies
US9790478B2 (en) 2013-03-14 2017-10-17 Abbott Laboratories HCV NS3 recombinant antigens and mutants thereof for improved antibody detection
EP3916103A1 (en) 2013-03-14 2021-12-01 Abbott Laboratories Hcv core lipid binding domain monoclonal antibodies
US10345311B2 (en) 2013-03-14 2019-07-09 Abbott Laboratories Detection methods employing HCV core lipid and DNA binding domain monoclonal antibodies
US10444242B2 (en) 2013-03-14 2019-10-15 Abbott Laboratories Detection methods employing HCV core lipid and DNA binding domain monoclonal antibodies
EP3564384A1 (en) 2013-03-14 2019-11-06 Abbott Laboratories Hcv core lipid binding domain monoclonal antibodies
US9841427B2 (en) 2013-03-14 2017-12-12 Abbott Laboratories HCV antigen-antibody combination assay and methods and compositions for use therein
US11428694B2 (en) 2013-03-14 2022-08-30 Abbott Laboratories Detection methods employing HCV core lipid and DNA binding domain monoclonal antibodies
US10197573B2 (en) 2013-03-14 2019-02-05 Abbott Laboratories HCV core lipid binding domain monoclonal antibodies
US8987418B2 (en) 2013-03-15 2015-03-24 Abbvie Inc. Dual specific binding proteins directed against IL-1β and/or IL-17
US9062108B2 (en) 2013-03-15 2015-06-23 Abbvie Inc. Dual specific binding proteins directed against IL-1 and/or IL-17
EP3925980A1 (en) 2013-08-30 2021-12-22 ImmunoGen, Inc. Antibodies and assays for detection of folate receptor 1
WO2015038984A2 (en) 2013-09-12 2015-03-19 Halozyme, Inc. Modified anti-epidermal growth factor receptor antibodies and methods of use thereof
EP3712174A1 (en) 2013-12-24 2020-09-23 Janssen Pharmaceutica NV Anti-vista antibodies and fragments
WO2015097536A2 (en) 2013-12-24 2015-07-02 Janssen Pharmaceutical Nv Anti-vista antibodies and fragments
EP3689325A1 (en) 2014-04-08 2020-08-05 Boston Pharmaceuticals Inc. Binding molecules specific for il-21 and uses thereof
WO2015157592A1 (en) 2014-04-11 2015-10-15 Medimmune, Llc Bispecific her2 antibodies
US10017580B2 (en) 2014-04-15 2018-07-10 ADC Therpeutics S.A. Humanized anti-Tn-MUC1 antibodies and their conjugates
EP3901176A1 (en) 2014-11-10 2021-10-27 MedImmune Limited Binding molecules specific for cd73 and uses thereof
EP3789403A1 (en) 2014-11-11 2021-03-10 MedImmune Limited Therapeutic combinations comprising anti-cd73 antibodies and a2a receptor inhibitor and uses thereof
US10093733B2 (en) 2014-12-11 2018-10-09 Abbvie Inc. LRP-8 binding dual variable domain immunoglobulin proteins
WO2016115345A1 (en) 2015-01-14 2016-07-21 The Brigham And Women's Hospital, Treatment of cancer with anti-lap monoclonal antibodies
EP3626744A1 (en) 2015-05-29 2020-03-25 AbbVie Inc. Anti-cd40 antibodies and uses thereof
EP4047022A1 (en) 2015-05-29 2022-08-24 AbbVie Inc. Anti-cd40 antibodies and uses thereof
US9840554B2 (en) 2015-06-15 2017-12-12 Abbvie Inc. Antibodies against platelet-derived growth factor (PDGF)
EP3722314A1 (en) 2015-06-24 2020-10-14 Janssen Pharmaceutica NV Anti-vista antibodies and fragments
WO2016207717A1 (en) 2015-06-24 2016-12-29 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
EP3842459A1 (en) 2015-06-29 2021-06-30 ImmunoGen, Inc. Anti-cd123 antibodies and conjugates and derivatives thereof
WO2017004026A1 (en) 2015-06-29 2017-01-05 Immunogen, Inc. Anti-cd 123 antibodies and conjugates and derivatives thereof
EP3719039A1 (en) 2015-11-10 2020-10-07 Medimmune, LLC Binding molecules specific for asct2 and uses thereof
WO2017137830A1 (en) 2016-02-12 2017-08-17 Janssen Pharmaceutica Nv Anti-vista (b7h5) antibodies
WO2017156488A2 (en) 2016-03-10 2017-09-14 Acceleron Pharma, Inc. Activin type 2 receptor binding proteins and uses thereof
WO2017161206A1 (en) 2016-03-16 2017-09-21 Halozyme, Inc. Conjugates containing conditionally active antibodies or antigen-binding fragments thereof, and methods of use
WO2017172771A2 (en) 2016-03-29 2017-10-05 Janssen Biotech, Inc. Method of treating psoriasis with increased interval dosing of anti-il12/23 antibody
WO2017175058A1 (en) 2016-04-07 2017-10-12 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
EP4276108A2 (en) 2016-04-27 2023-11-15 AbbVie Inc. Methods of treatment of diseases in which il-13 activity is detrimental using anti-il-13 antibodies
WO2017189805A1 (en) 2016-04-27 2017-11-02 Abbvie Inc. Methods of treatment of diseases in which il-13 activity is detrimental using anti-il-13 antibodies
WO2017210471A1 (en) 2016-06-02 2017-12-07 Abbvie Inc. Glucocorticoid receptor agonist and immunoconjugates thereof
EP3901162A1 (en) 2016-06-02 2021-10-27 AbbVie Inc. Glucocorticoid receptor agonist and immunoconjugates thereof
US10640563B2 (en) 2016-06-08 2020-05-05 Abbvie Inc. Anti-B7-H3 antibodies and antibody drug conjugates
WO2017214335A1 (en) 2016-06-08 2017-12-14 Abbvie Inc. Anti-b7-h3 antibodies and antibody drug conjugates
WO2017214339A1 (en) 2016-06-08 2017-12-14 Abbvie Inc. Anti-b7-h3 antibodies and antibody drug conjugates
WO2017214322A1 (en) 2016-06-08 2017-12-14 Abbvie Inc. Anti-b7-h3 antibodies and antibody drug conjugates
WO2017211928A1 (en) 2016-06-10 2017-12-14 Ucb Biopharma Sprl ANTI-IgE ANTIBODIES
WO2018064436A1 (en) 2016-09-30 2018-04-05 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-il23 specific antibody
WO2018093841A1 (en) 2016-11-16 2018-05-24 Janssen Biotech, Inc. Method of treating psoriasis with anti-il-23 specific antibody
US11208474B2 (en) 2016-11-16 2021-12-28 Janssen Biotech, Inc. Method of treating psoriasis with anti-IL23 specific antibody
WO2018098363A2 (en) 2016-11-23 2018-05-31 Bioverativ Therapeutics Inc. Bispecific antibodies binding to coagulation factor ix and coagulation factor x
US10899842B2 (en) 2016-11-23 2021-01-26 Immunoah Therapeutics, Inc. 4-1BB binding proteins and uses thereof
WO2018129029A1 (en) 2017-01-04 2018-07-12 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
US11390685B2 (en) 2017-01-06 2022-07-19 Biosion, Inc. ErbB2 antibodies and uses therefore
US11041020B2 (en) 2017-01-30 2021-06-22 Janssen Biotech, Inc. Methods for the treatment of active Psoriatic Arthritis
US11014982B2 (en) 2017-02-07 2021-05-25 Janssen Biotech, Inc. Anti-TNF antibodies, compositions, and methods for the treatment of active ankylosing spondylitis
WO2019025299A1 (en) 2017-07-31 2019-02-07 F. Hoffmann-La Roche Ag Three-dimensional structure-based humanization method
WO2019058345A2 (en) 2017-09-25 2019-03-28 Janssen Biotech, Inc. Safe and effective method of treating lupus with anti-il12/il23 antibody
US11230601B2 (en) 2017-10-10 2022-01-25 Tilos Therapeutics, Inc. Methods of using anti-lap antibodies
WO2019075090A1 (en) 2017-10-10 2019-04-18 Tilos Therapeutics, Inc. Anti-lap antibodies and uses thereof
WO2019150309A1 (en) 2018-02-02 2019-08-08 Hammack Scott Modulators of gpr68 and uses thereof for treating and preventing diseases
US11512127B2 (en) 2018-02-14 2022-11-29 Viela Bio, Inc. Antibodies to Feline McDonough Sarcoma (FMS)-like tyrosine kinase 3 receptor ligand (FLT3L) and uses thereof for treating autoimmune and inflammatory diseases
WO2019171252A1 (en) 2018-03-05 2019-09-12 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
US10982002B2 (en) 2018-03-12 2021-04-20 Zoetis Services Llc Anti-NGF antibodies and methods thereof
WO2019236670A1 (en) 2018-06-08 2019-12-12 Crystal Bioscience Inc. Transgenic animal for producing diversified antibodies that have the same light chain i
WO2019236671A1 (en) 2018-06-08 2019-12-12 Crystal Bioscience Inc. Transgenic animal for producing diversified antibodies that have the same light chain ii
WO2020014306A1 (en) 2018-07-10 2020-01-16 Immunogen, Inc. Met antibodies and immunoconjugates and uses thereof
WO2020016838A2 (en) 2018-07-18 2020-01-23 Janssen Biotech, Inc. Sustained response predictors after treatment with anti-il23 specific antibody
WO2020065532A1 (en) 2018-09-24 2020-04-02 Janssen Biotech, Inc. Safe and effective method of treating ulcerative colitis with anti-il12/il23 antibody
WO2020076969A2 (en) 2018-10-10 2020-04-16 Tilos Therapeutics, Inc. Anti-lap antibody variants and uses thereof
US11130802B2 (en) 2018-10-10 2021-09-28 Tilos Therapeutics, Inc. Anti-lap antibody variants
US11548941B2 (en) 2018-11-20 2023-01-10 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-IL-23 specific antibody
WO2020104943A2 (en) 2018-11-20 2020-05-28 Janssen Biotech, Inc. Safe and effective method of treating psoriasis with anti-il-23 specific antibody
WO2020106358A1 (en) 2018-11-20 2020-05-28 Takeda Vaccines, Inc. Novel anti-zika virus antibodies and uses thereof
WO2020128864A1 (en) 2018-12-18 2020-06-25 Janssen Biotech, Inc. Safe and effective method of treating lupus with anti-il12/il23 antibody
WO2020132557A1 (en) 2018-12-21 2020-06-25 Compass Therapeutics Llc Transgenic mouse expressing common human light chain
WO2020148651A1 (en) 2019-01-15 2020-07-23 Janssen Biotech, Inc. Anti-tnf antibody compositions and methods for the treatment of juvenile idiopathic arthritis
WO2020152544A1 (en) 2019-01-23 2020-07-30 Janssen Biotech, Inc. Anti-tnf antibody compositions for use in methods for the treatment of psoriatic arthritis
WO2020183271A1 (en) 2019-03-14 2020-09-17 Janssen Biotech, Inc. Methods for producing anti-tnf antibody compositions
WO2020183418A1 (en) 2019-03-14 2020-09-17 Janssen Biotech, Inc. Manufacturing methods for producing anti-il12/il23 antibody compositions
WO2020183269A1 (en) 2019-03-14 2020-09-17 Janssen Biotech, Inc. Manufacturing methods for producing anti-tnf antibody compositions
WO2020183270A1 (en) 2019-03-14 2020-09-17 Janssen Biotech, Inc. Methods for producing anti-tnf antibody compositions
WO2020188466A1 (en) 2019-03-18 2020-09-24 Janssen Biotech, Inc. Method of treating psoriasis in pediatric subjects with anti-il12/il23 antibody
US11780911B2 (en) 2019-05-23 2023-10-10 Janssen Biotech, Inc. Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha
WO2020245677A1 (en) 2019-06-03 2020-12-10 Janssen Biotech, Inc. Anti-tnf antibodies, compositions, and methods for the treatment of active ankylosing spondylitis
WO2020245676A1 (en) 2019-06-03 2020-12-10 Janssen Biotech, Inc. Anti-tnf antibody compositions, and methods for the treatment of psoriatic arthritis
WO2021028752A1 (en) 2019-08-15 2021-02-18 Janssen Biotech, Inc. Anti-tfn antibodies for treating type i diabetes
WO2021159024A1 (en) 2020-02-05 2021-08-12 Larimar Therapeutics, Inc. Tat peptide binding proteins and uses thereof
WO2021207449A1 (en) 2020-04-09 2021-10-14 Merck Sharp & Dohme Corp. Affinity matured anti-lap antibodies and uses thereof
WO2022053650A1 (en) 2020-09-11 2022-03-17 Medimmune Limited Therapeutic b7-h4 binding molecules
WO2022053685A2 (en) 2020-09-12 2022-03-17 Medimmune Limited A scoring method for an anti-b7h4 antibody-drug conjugate therapy
US11759527B2 (en) 2021-01-20 2023-09-19 Abbvie Inc. Anti-EGFR antibody-drug conjugates
WO2022190033A1 (en) 2021-03-12 2022-09-15 Janssen Biotech, Inc. Safe and effective method of treating psoriatic arthritis with anti-il23 specific antibody
WO2022190034A1 (en) 2021-03-12 2022-09-15 Janssen Biotech, Inc. Method of treating psoriatic arthritis patients with inadequate response to tnf therapy with anti-il23 specific antibody
US11964005B2 (en) 2021-03-17 2024-04-23 Receptos, Llc Methods of treating atopic dermatitis
WO2022197782A1 (en) 2021-03-17 2022-09-22 Receptos Llc Methods of treating atopic dermatitis with anti il-13 antibodies
WO2022195028A2 (en) 2021-03-18 2022-09-22 Medimmune Limited Therapeutic binding molecules
WO2022241057A1 (en) 2021-05-12 2022-11-17 Applied Biomedical Science Institute Binding polypeptides against sars cov-2 and uses thereof
WO2023281463A1 (en) 2021-07-09 2023-01-12 Janssen Biotech, Inc. Manufacturing methods for producing anti-tnf antibody compositions
WO2023281466A1 (en) 2021-07-09 2023-01-12 Janssen Biotech, Inc. Manufacturing methods for producing anti-il12/il23 antibody compositions
WO2023281462A1 (en) 2021-07-09 2023-01-12 Janssen Biotech, Inc. Manufacturing methods for producing anti-tnf antibody compositions
US11807685B2 (en) 2021-08-05 2023-11-07 The Uab Research Foundation Anti-CD47 antibody and uses thereof
WO2023073615A1 (en) 2021-10-29 2023-05-04 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2023084488A1 (en) 2021-11-15 2023-05-19 Janssen Biotech, Inc. Methods of treating crohn's disease with anti-il23 specific antibody
WO2023095000A1 (en) 2021-11-23 2023-06-01 Janssen Biotech, Inc. Method of treating ulcerative colitis with anti-il23 specific antibody
WO2023156434A1 (en) 2022-02-16 2023-08-24 Medimmune Limited Combination therapies for treatment of cancer comprising b7-h4 antibody drug conjugate
WO2023187707A1 (en) 2022-03-30 2023-10-05 Janssen Biotech, Inc. Method of treating mild to moderate psoriasis with il-23 specific antibody
WO2023223265A1 (en) 2022-05-18 2023-11-23 Janssen Biotech, Inc. Method for evaluating and treating psoriatic arthritis with il23 antibody

Also Published As

Publication number Publication date
EP0478627A4 (en) 1992-08-19
CA2057923A1 (en) 1990-11-17
FI915411A0 (en) 1991-11-15
AU652539B2 (en) 1994-09-01
AU5834490A (en) 1990-12-18
EP0478627A1 (en) 1992-04-08

Similar Documents

Publication Publication Date Title
AU652539B2 (en) Co-expression of heteromeric receptors
Huse et al. Generation of a large combinatorial library of the immunoglobulin repertoire in phage lambda
US7858359B2 (en) Method for tapping the immunological repertoire
EP1026239B1 (en) A new method for tapping the immunological repertoire
JP3321159B2 (en) Method for isolating a receptor having a preselected specificity
JP3373510B2 (en) Heteromeric receptor surface expression library
US6291161B1 (en) Method for tapping the immunological repertiore
DE69133545T2 (en) Process for the preparation of specific binding pair members
JP3672306B2 (en) Heterodimeric receptor library using phagemids
US6969586B1 (en) Method for tapping the immunological repertoire
CA2002868C (en) Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors
US5747334A (en) Random peptide library
EP0528881A1 (en) Methods for phenotype creation from multiple gene populations
CA2196679A1 (en) Target specific screens and their use for discovering small organic molecular pharmacophores
JP4524445B2 (en) Protein screening method
Foti et al. Rabbit monoclonal Fab derived from a phage display library
JPH04506600A (en) Co-expression of heteromeric receptors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR CA CH DE DK FI GB HU JP KP KR LK LU MC MG MW NL NO RO SD SE SU US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE BF BJ CF CG CH CM DE DK ES FR GA GB IT LU ML MR NL SE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 915411

Country of ref document: FI

WWE Wipo information: entry into national phase

Ref document number: 2057923

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1990909432

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1990909432

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1990909432

Country of ref document: EP