WO1990009456A1

WO1990009456A1 - Malignancy test (cancer test) using the polymerase chain reaction

Info

Publication number: WO1990009456A1
Application number: PCT/DE1990/000102
Authority: WO
Inventors: Viktor Balazs; Margit BALAZS-FRÖHLICH
Original assignee: Viktor Balazs
Priority date: 1989-02-16
Filing date: 1990-02-16
Publication date: 1990-08-23
Also published as: EP0458831A1

Abstract

In a malignancy test (cancer test), the RNA is concentrated under the constant effect of a reliable RNase inhibitor by in vitro enzymatic multiplication of the specific RNA sequence of the substances of cancer cell origin contained in an acellular biological liquid. The product so obtained undergoes in vitro reverse transcription in order to synthesise the complementary DNA (cDNA). The product so obtained is used for repeated enzymatic synthesis of the target-specific sequence of the desired substance of cancer cell origin and thus multiplied. The product so obtained is detected by determination of the multiplication of the nucleic acids.

Description

Malignancy test (cancer test) using the polymerase etteπ reaction.

The invention relates to a method for the detection of the specific mRNA sequence (target sequence) of substances of cancer cell origin from an acellular biological fluid according to the preamble of claim 1.

The more information, the earlier it is known about the given malignant cell population, the better its host, the patient, can be saved. There has been an uninterrupted bilateral interaction between the malignant process and the host since the first malignantly transformed cell was created.

This mutual interaction is a very complicated, multifactorial and versatile mechanism in which the mRNA of cell cell origin can play an important role, which is described in detail below.

1. We have reported for the first time that the blood plasma RNA franking of malignancy carriers in a protein-synthesizing cell-free system functions as a mesenger and substantially prevents the translation activity of other mRNAs when they are in competition with it.

2. This was later confirmed in RNA transfer (experiments) to normal cells: the translation product of the plasma RNA from malignant carriers was produced in the recipient cells, while the production of the corresponding normal protein was drastically inhibited.

This phenomenon is actually the functional mimicry at the molecular biological and cellular level of the main features of the malicious process itself: promotion of one's own existence at the expense of the host.

3. It has been known that malignant cells omit or excrete poly (A) ⁺ RNA, protected in a lipoprotein shell or bound to other substances, and isolate them from the blood plasma in the overwhelming majority of patients with malignant diseases can be. Messenger RNA of more than one substance from cancer cell origin can occur in the circulation of malignancy carriers.

4. A large spectrum of normal and malignant cells is able to take up mRNA from its environment if it is presented protected by lipid, lipoprotein or other substances. The mRNA then exerts its messenger activity in the recipient cells. As a result, the translation product of the mRNA taken up is produced by these cells until the replenishment from the environment reaches from the circulation.

The recipient cell has acquired a new phenotypic quality, a new ability to produce, which it either does not have or cannot express genetically.

We recognized this new biological phenomenon and its meaning for the first time and labeled it with the name "phenotype lending".

Phenotype lending is one of the most important mechanisms by which the malignant cells achieve their main goals:

a. Promoting their own existence, b. Hinderimg (inhibiting) the functions of the host, even c. The malignant cells force the host cells to produce what is advantageous for the malignant process.

The influencing messages essentially go in two directions:

1. From the malignant cell population to the host cells.

2. From a subpopulation of malignant cells to other subpopulations either

a. within the tumor or b. from the mother tumor cells to distant colonizing tumor cell colonies, and c. vice versa. There are a number of published clinical and experimental observations describing phenomena in malignancy in which the above-mentioned information exchange through phenotype borrowing with mRNA can be really operational:

A. Clinical observations

1. The enzyme profile of the otherwise normal liver of malignant carriers is more similar to the malignant cells than in normal humans.

2. Normal lymphocytes in the overwhelming majority of patients with myelαm have the myelαma protein as their surface immunoglobulin.

3. Normal leukocytes of the malignant carriers produce large amounts of enzymes with basement membrane-destructive activity, which do not in their normal state.

B. Experimental observations

1. A subpopulation of malignant cells that is unable to metastatize when it s.c. is injected, but will metatatize after a subpopulation with metastatic potential of the same tumor i.v. in the same animal. was injected.

2. A subpopulation of malignant cells became resistant to a drug with which it had never come into contact before, if only humoral contacts between this and another subpopulation that was resistant to this drug were established.

The list is not complete.

It must be mentioned here that transcripts or their fragments of cellular oncogenes, which are activated by over-transcription in malignant diseases, from the blood plasma of malignancy carriers by i vitro hybridization can be detected. Phenotype borrowing from these transcripts can cause phenomena similar to AI. and Bl. cause in malignant diseases, or transfer production capabilities of growth factors, enzymes or other substances in host cells which are removed from the tumor. The environment of these host cells could become attractive for the incoming metastatic cancer cells and then feed them with growth factors and other substances. The inhibition of phenotypes by mRNA of malignant origin simultaneously prevents its own functions in the recipient cells of the host, which can lead to a reduction in the local and systematic defense mechanisms of the host. Small fragments of transcripts from cancer cell origin also have inhibitory activity.

The occurrence of the phenotype loan by the circulating mRNA was examined and proven in Myelo patients (A2 see list) by us and others.

It was possible to transfer the production of the myeloma protein into the normal human lymphocytes with the plasma RNA from Myelαma patients, which also caused the change in the production of our own surface immunoglobin. The RNase-treated sample of the same plasma RNA was ineffective.

However, the RNA transfer process is a very complicated, arduous method and is not sensitive enough to give positive results even in the early stages of malignancy.

The specific mRNA sequence of the H and L chains, corresponding to the chain combination of the respective myeloma protein, was detected from the blood plasma of the myeloma patients. The presence of mRNA in the bloodstream is the most important prerequisite for phenotype lending. For this reason, the detection of the mRNA or its specific fragments of the substances of cancer cell origin in the bloodstream of malignancy carriers in accordance with the method of the invention can serve as a sensitive and well practicable test method which already provides important information about the malignant diseases in the early stages fundamental fundamental molecular-genetic changes in the malignant cells, their activities, the possible interaction can deliver between tumor and host by mRNA at a time when the cancer cell mass cannot be visualized with the usual method and cannot be reached for a histological examination.

The circulating mRNA transcripts or their specific fragments can be detected using very sensitive and specific methods. One such technical possibility is in vitro hybridization and the other is the in vitro enzymatic multiplication of the specific target sequence of the respective mRNA by polymerase chain reaction, PCR (polymerase chain reaction).

The polymerase chain reaction, which has been known since 1985 (Science 230: 1350-1356), is a reliable, relatively simple method for obtaining the desired sequence of low-concentration DNA from tissue, cells and even from a single hair in vitro synthesize and amplify. The amplified product is then easily identifiable by a spectrum of different methods including in vitro hybridization with corresponding, labeled DNA or oligonucleotide samples. Thus, PCR has been used to spots or traces of the cellular body fluids (blood, semen) or Kör ^¬ perzellen detect and identify.

The mRNA sequences can also be amplified by PCR in vitro if the corresponding complementary DNA (cDNA) is first synthesized by reverse transcription and this is amplified by PCR. This RNA amplification has so far only been used for cells and cellular body fluids such as blood, especially to identify RNA viruses in the blood cells. In PCR, two oligonucleotide primers are used which are complementary to the sequences which flank the desired specific sequence, a primer for the 3'-strand, a primer for the 5'-strand, they "designate" the sequence that synthesize and amplify the DNA polymerase enzyme.

The target-specific sequence can be amplified by PCR to such an extent that the direct detection of the product is possible. When using labeled components or pri eres, the PCR products can be visualized by their labeling and do not have to be detected by in vitro hybridization. The PCR has so many plans Share, such as high specificity, very high sensitivity, which is in the same or an order of magnitude higher than in vitro hybridization and it is easier, faster and automatable. Therefore PCR is particularly suitable for the detection of the mRNA sequence of the substances of cancer cell origin from an acellular biological fluid such as blood plasma and can serve as a sensitive malignancy test for diagnosis, early detection and monitoring of malignant diseases.

The detection of the mRNA transcripts or their specific fragments of the substances of cancer cell origin as a malignancy test has many advantages over the detection of the substances themselves:

1. The sensitivity of the mRNA detection method according to the invention is significantly greater (lies in the region of 10 " ¹⁸ g) than the detection methods of the translation products, ie the substances themselves (lies in the region of pg).

2. Antibodies to the translation product, either produced by the host or introduced (submitted) for therapy purposes, do not affect the test results in the mRNa transcript detection.

3. RNA transcripts or their specific fragments are omitted or excreted in detectable amounts and in a form protected from degrading enzymes only by malignant cells. That is why their detection (in the bloodstream) from the blood plasma is diagnostic, on the contrary with their translation product, which can also be produced by normal cells (such as: oncogene products; some tumor markers).

4. The half-life of the mRNA transcripts is considerably shorter (60 min for onc-fos, onc-myc; 7 hours for CEA) than their translation products (several days for oncogene products, more than one week for CEA).

This results in important practical advantages for the detection methods of the mRNA transcripts or their specific fragments, which can be used with the method of the invention as a malignancy test:

a. Any changes can be recognized much earlier and faster; b. Therapy effect or ineffectiveness can be observed and assessed more quickly; c. the outcome of every initiated chemotherapy or immuno (chemo) therapy can be predicted in one to two days. Investigations with malignant cells have shown that the effective chemotherapy leads to a substantial change even to a complete standstill of the transcription of the activated oncogenes. In this way, mRNA transcripts or their fragments of activated oncogenes are no longer present in the blood plasma, or only in a reduced concentration. If the oncogene-specific mRNA sequences persist undiminished in the bloodstream, this means the ineffectiveness of the chemotherapy initiated. Thus, the unnecessary risk of chemotherapy subsequently proven to be ineffective can be avoided at an early stage and a new combination of antineoplastic agents tailored to the patient "individually" " become. d. Resistance emergence through multi-drug resistance factor can be observed even earlier and treated accordingly.

5. Recognizing new tumor markers or cancer substances that are also produced in malignant carriers by their normal cells: If the mRNA transcript or its specific fragments of this substance can be detected in the circulation, in the blood plasma, the production ability of this substance is evident then not or not only the own property of the host cells, but the consequence of "phenotype lending" through the property of the circulating mRNA derived from the cancer cell and thus acquired.

In this way, the appearance and the reality can be reconciled. There are phenomena in which reality (this reality) is recognizable at first glance: production of the Myelαmaproteins as surface immunoglobulin through the otherwise normal lymphocytes of the host. But there are also phenomena in which this is not immediately recognizable: when the production of an enzyme that is produced simultaneously by the cancer cells but also by the otherwise normal liver in malignancy carriers takes place.

These cases can be verified by detecting the corresponding mRNA. whose specific fragments are clarified in the circulation.

6. Finally, there are several therapeutic options from knowledge of the circulating mRNA profile. By inhibiting the production, excretion or translation of the corresponding mRNA of cancer cell origin, a disadvantageous effect for the host or a beneficial effect for the malignant cells can be eliminated and avoided very early, for example by means of an antisense oligonucleotide and others.

a. In plasacytoma, the prevention of the transfer of the myeloma protein production ability to the normal lymphocytes of the host in an early stage of malignancy can prevent the immune system from being inhibited so much so that the immune system can eliminate the relatively small tumor cell mass without further chemotherapy if the malignancy recognized early and treated according to the above-mentioned possibility.

b. By preventing the endothelial basement membrane-destroying enzymes, the tumor cells present in the bloodstream cannot leave the circulation and thus cannot metastatize. This is particularly important during and after surgery as a large number of cancer cells can enter the bloodstream.

c. The lower (20 - 25%) success rate of the various forms of immunotherapy can be explained, at least in part, by the phenotype loan, because the host cells cannot participate sufficiently because of this, or the cells which have been proliferated and activated in vitro shortly after their Administration in the malignant carrier host inhibited in its function, ineffective can be.

d. By removing the lipoprotein mRNA complexes, e.g. B. by hemoadsorption similar to that used for the removal of the dangerous lipids in certain forms of hyperlipidemia, or by other suitable methods (plasmaphesis), in the early stage of the disease the influence of the host by the malignant cells could be interrupted , which could destroy the malignant cells with full force. .

If the in vitro amplification of the specific mRNA sequences is combined with the in vitro hybridization, the sensitivity of the malignancy test is increased by at least 4 to 5 orders of magnitude in comparison to the hybridization alone or PCR alone.

Early in clinical oncology means healing, in at least 80% to 90% of cases. Therefore, every method is welcome in clinical practice that can significantly improve the early detection of malignant processes in terms of time and percentage.

A head start of several months in the early detection and thus several vital months for the early initiation of therapy which can lead to complete healing. That is the main advantage of this invention.

The activation of two or more cellular oncogenes by increased transcription or by mutation is generally considered to be a very important step in the emergence, maintenance and progression of the malignant transformation. This increase in transcription can be multiple or even 100 times that. reach normal values. Because of the peculiarities of malignant cells and the malignant tumors, the activated oncogene transcripts or their fragments can enter the bloodstream and be protected or partially protected there without further significant degradation, and they can pass through from the blood plasma of patients with an active malignant process a sensitive method such as in vitro hybridization can be detected. This method can be used as a malignancy test are and is suitable as a screening test or progress control test (monitoring) in order to detect relatively small amounts of malignant cell mass which cannot be recognized with the usual diagnostic methods in clinical practice.

With the method of this invention one can e.g. B. the oncogene-specific mRNA sequences also detect such oncogenes in the blood plasma which are present there in an even lower concentration than others, such as, for example, the transcripts or transcript fragments of the oncogenes which are activated by point mutation and not by increased transcription and therefore their concentration is lower in the malignant cells and subsequently also in the blood plasma compared to oncogenes which have been activated by increased transcription and even in vivo amplification. The result is that the plasma-oncogene profile (oncogenes whose mRNA sequence is present in the blood plasma) can better reflect the cancer cell-oncogene profile (oncogenes that are activated in the malignant cells). Thus, one could not only predict from the blood plasma the presence of an active malignant process, but also which oncogenes are at least partially activated in the malignant cells, at a time when the malignancy cannot yet be visualized and is not yet accessible for histological and molecular-genetic studies.

Over 50% of adenomas with precancerous changes in the large intestine have ras oncogenes activated by point mutation (especially Ki-ras), while the cancerous-modified adenomas have a slightly lower percentage of these oncogenes. The mutation occurred most frequently with the Ki-ras oncogenes in the position of codon 12, GGT is mutated to GAT in both states. The malignancy test, carried out without prior amplification of the above-mentioned mutated oncogene sequence from the blood plasma RNA, gave negative results in both conditions; after in vitro amplification, the malignancy test was positive only in the case of cancer, but not in the case of precancerous adenomas. This example clearly shows that the invention, despite its increased sensitivity, is a reliable malignancy test.

The goal of cancer research and clinical oncology is the molecular kular-genetically causal, rational, meaningful therapy. In this regard, knowledge and especially early knowledge of which oncogenes are actually activated in the malignant cells are very important. These oncogenes can serve as a good target of a molecular-genetically meaningful therapy, and can be attacked at several levels, namely (a) at the gene level: by preventing transcription; (b) at the transcript level: by preventing translation of the activated oncogenes; (c) or at the oncogene product level: by preventing the function of the OKP. For a. and b. very stimulating results with cancer cell cultures are known in vitro.

An oligonucleotide with a specific sequence for the initiation of protein synthesis is preferably taken up by the cancer cells in larger amounts than by normal cells and inhibits the translation of the targeted oncogene RNA transcripts, with the result that the cancer cells lose their properties and are no longer malignant multiples ¬ adorn. This possibility is a good candidate to develop a causal therapy in practice.

Experiments carried out with monoclonal antibodies with malignant cells or with tumors in animal experiments have proven that as long as the OKP is neutralized by specific antibodies, the malignant phenotype disappears. These examples clearly show that the molecular, genetically causal, meaningful therapy is in principle possible, and this is inconceivable without the early knowledge of which oncogenes are activated in the malignant cells. The oncogene profile of the blood plasma helps here early on with the method of this invention.

If the anti-cancer cell antibodies are bound with chemotherapeutic, toxic or radioactive substances, therapeutic effects can be achieved in animals and patients, but the success rate is generally not very high. Several factors are responsible for this, one of which is the difference in the expression of the targeted antigen on the different cancer cells of the same tumors because of their diversification. Better results can be achieved by targeting several antigens on the cell surface at the same time immunologically attacks. As such antigens, the oncogene products of the activated oncogenes would be particularly suitable, in particular those which have their oncogene product in the cell membrane and those which do not occur in normal cells at all, such as the oncogene products altered by point mutation or some tumor markers. Another advantage is that the oncogene transcripts or their sequences can be detected as early as is not possible with the most sensitive immune method.

The immunological detection of products of the oncogenes as a malignancy test is not suitable because the normal and the pathological values (in malignancies) overlap, and some abnormal but non-aligning states produce higher values than the malignancies, apart from that much lower sensitivity of the immunological methods compared to the present invention.

Another particular advantage is that changes in the activation of the oncogenes during the follow-up can be more reliably and earlier reflected by the plasma oncogene profile than in previous methods. In this way, oncogene changes associated with a deterioration in the prognosis due to diversification of the cancer cells, or with an amplification of one of the activated oncogenes, can be detected at an early stage and the appropriate therapy can be initiated in good time. The disappearance of an existing oncogene transcript or the appearance of a new oncogene transcript not yet present in the blood plasma or its sequence is also a sign of the deterioration in progressiveness. If the proportion of two or more oncogene transcripts to one another changes significantly in the blood plasma during the follow-up, this can reflect the amplification in vivo of one of the oncogenes, which could usually mean an increase in aggressiveness and increased progressiveness of the malignancy.

The mechanism of the phenomenon "phenotype lending" practiced by nature can be mimicked and exploited for therapeutic purposes by administration of mRNA-lipoprotein complexes 13

1. to replace the lack of production of substances,

2. to increase the production of one or more substances and thus to combat a pathological condition,

3. or to enable the production of such substances that “Lo” does not occur in the human organism, but would be therapeutically “advantageous”.

These therapeutic options have the great advantage that the effect is controllable and can be terminated at any time by interrupting the administration, in contrast to the genetic transfer with DNA, ¹ which is anyway not practicable on patients (humans) for several reasons.

The possibility of therapy with mRNA, however, requires careful monitoring of the mRNA used or its specific sequence in the bloodstream. The method of the invention is very suitable for these purposes because of its very high sensitivity and reliable specificity.

The invention has for its object to detect specific mRNA sequences of the substances of cancer cell origin from an acellular biological fluid, even if they or their fragments are present in a very low concentration and degraded to a certain extent, but have the specific sequence and for in vitro Amplifizie ^¬ tion are suitable, and this process so as Malignitätstest, be¬ to use Sonder as a very sensitive screening test.

This object is achieved by the method according to claim 1. The degradation of the RNA or its fragments is prevented by using an effective and reliable RNase inhibitor, which does not cause RNA to emerge from the cells, even when the cellular biological fluid is being sampled. Since the chosen RNase inhibitor does not cause RNA to escape from the cells before and during their removal, it is important because this sensitive method can detect even small contamination.

The PCR products can be radioactive or non-radioactive already during the PCR by incorporating marked components or primers be marked and visualized in this way. The unlabelled PCR products can be identified by direct detection after ethidium bromide staining, or by their size, or according to their sequence either by sequence analysis or especially with in vitro hybridization.

This achieves a high degree of sensitivity, an extremely high level of specificity, reliability and reproducibility. Because of the peculiarities of the malignant cells and tumors, the method is suitable as a malignancy test, especially for early detection.

The invention is explained in more detail below. The cellular biological fluid (such as blood, exudates, etc.) is mixed with a reliable RNase inhibitor which does not cause RNA cell leakage when the sample is taken and the cells are removed. From the acellular biological fluid thus obtained, the total RNA is mixed with an aqueous medium under the constant action of the RNase inhibitor and in the presence of a detergent and a proteolytic enzyme such as Proteinase K and at 37 degrees C for 5 to 8 h in one Incubated buffer solution. Then yeast tRNA is added as a carrier (50 µg / ml) and extracted with phenol and chloroform at 60 ° C and precipitated with alcohol at -20 ° C. The extract can be further purified quickly using ion exchange column chromatography.

The blood plasma RNA is mixed with a buffer solution, which is composed according to the optimal mode of action of the selected reverse transcriptase (Tris.Cl. ph 8.3, KC1, MgCl ₂ ). It also contains RNasin, reverse transcriptase enzyme, each of the four deoxyribonucleoside triphosphates, the 3'primer all in sufficient concentration. The total reaction mixture is then incubated for a total of 20 microliters at 37 degrees C for 30 minutes.

The reaction mixture is then mixed with 80 microliters of PCR buffer and 100 micrograms of bovine serum albumin, with the 3 'primer and the 5' primer and the thermostable Taq DNA poly erase enzyme, each in a suitable concentration. The reaction mixture is then covered with mineral oil to prevent evaporation. By heating the reaction mixture to 95 degrees C for 20 see the RNA.cDNA complex dissociates, and annealing of the primers is performed at 55 degrees C for 15 seconds. The primers are extended at 72 degrees C for 1 min. The cycle is started again by heating and repeated 40 to 50 times.

After the last cycle, the reaction mixture is left at 72 degrees C for 10 minutes and then cooled in ice.

The multiplication during PCR is detected by ethidium bromide staining in comparison to the negative control. The size of the product or products can be identified by electrophoresis in gel or by chromatography or according to their sequence.

The products can be labeled with radioisotope, biotin, enzymes, fluorescent dyes or other substances during the amplification by labeled components or primers and then recognized according to the labeling.

Identification of the PCR products with the highest sensitivity and with the greatest specificity is achieved by in vitro hybridization.

10 microliters of each reaction mixture is applied to nylon or nitrocellulose filters and immobilized by baking at 80 degrees C for 60 ml, prehybridized at 60 degrees C in a suitable buffer and then in the presence of 2 x 10 ⁶ cqm of end-labeled oncogene specific oligonucleotide samples per ml hybridized for 5 to 7 h at 60 degrees C. Washing is carried out at 60 degrees C in 0.75 M NaCl / 0.075 Na citrate, 0.% SDS. The result of the hybridization is visualized by autoradiography.

By means of a variant of this method, which is actually its mirror image, the products of the simultaneous pooled PCR can be identified at the same time. The unlabeled corresponding samples are immobilized on a solid support, such as a nylon filter, and brought into contact with the (bio tin) labeled PCR products in order to hybridize with one another. The results are visualized by a color reaction due to enzyme affinity. A series of purified molecular-cloned DNA containing the sequence as the code of the oncogenes is labeled either radioisotopically or non-radioisotopically (J. Mol Biol. 113: 237-251 1977). The non-radioisotopic labeling can be done with biotin. In the case of oligonucleotide samples, end labeling is used to achieve high specific activity.

DNA samples and oncogene-specific oligonucleotide samples labeled or unlabeled are commercially available (ONCOR, Inc. Gaithersburgh, Ma. 20877, USA; ONCOGENE SCIENCE Inc. Mineola, NY 11501, USA; Amersham, Little Chalfont, England). A biotin labeling and visualization kit is commercially available (Amersham, Little Chalfont, England ONCOR, Gaithersburgh, USA). Oligonucleotides with the desired sequences can be ordered and obtained from the Custom Service in Europe and the USA.

All measures are taken to prevent contamination with the respective target sequence before, during and after the examination processes.

The risk of admixing the ubiquitous, highly resistant RNase enzyme from exogenous sources is particularly evident in all stages of the RNA phase of the process (stages a to c) through the use of baked glassware, autoclaved solutions, baked spatulas, tools, dry chemical preparations, distilled from glass, reduced with autoclave-sterilized water, and wearing gloves.

The following example serves to further explain the invention without restricting it.

example

10 ml of blood with 20 IU heparin are withdrawn and immediately mixed with a solution of RNase inhibitors such as RNasin (Promega Biotec Maidison WI. USA) final concentration 2000 U / ml). The blood plasma is separated as quickly as possible. There are two single-use plastic centifuge tube each pipetted 2.5 ml of blood plasma, one is kept frozen for repetition or as a reserve for additional examinations. The other is being processed.

A mixture of 0.2 M Tris.Cl (pH 8.5); 25 M ethylenediaminetetraacetic acid (EDTA); 2% (w / v) sodium duodecyl sulfate (SDS) and proteinase K (final concentration: 300 micrograms / ml) were added and incubated in the presence of RNase inhibitors at 37 ° C. for 5 to 8 hours.

Then yeast tRNA (50 µg / ml) is mixed in and then an equal volume of phenol and chloroform-isoamyl alcohol (24: 1) is mixed in and extracted at 60 ° C for 15 min by shaking vigorously. The interphase is additionally extracted once as above and the combined aqueous phases are treated once with chloroform-isoamyl alcohol as above but at room temperature. The nucleic acid is precipitated by alcohol in the presence of Na acetate (0.3 M, pH 5.2) at -20 degrees C and centrifuged. The sediment is dissolved and subjected to RNase-free DNase enzyme treatment.

In this case, RNase-free DNase enzyme and MgCl ₂ (at 2 mM) are mixed to the plasma RNA solution (50 mM Tris.Cl, pH 7.5 in 1 mM EDTA) and in the presence of RNase inhibitors at 37 degrees C. incubated for 30 min, then phenol-chloroform is extracted and in the presence of Na acetate (pH 5.2, 0.3 M) the RNA is precipitated with 70% ethanol at -20 ° C.

Before the DNase treatment, a further purification process by ion exchange column chromatography ("The Extractror", Molecular Biosystem, San Diego, CA 92121) can be carried out in about 30 minutes in accordance with the manufacturer's instructions.

If the extraction of the RNA from the RNA-lipoprotein fraction is carried out, an RNA fraction is obtained which preferably has poly (A) ⁺ RNA. The RNA-liproprotein fraction can be separated from the serum of malignancy carriers by flotation in a KBr density gradient (discontinuous: 1,006-1,221 g / ml) after 16 hours of flotation in an ultracentrifuge at 105,000 xg; it is separated as an opal band visible between the HDL and LDL fractions.

The eluate can be used directly for in vitro hygridization or for PCR amplification, or after alcohol precipitation and DNase treatment.

The sediment is then in a buffer solution which corresponds to the optimal effectiveness of the reverse transcriptase enzyme used (and the regulations of the respective manufacturer) (Bethesda Research Laboratories; promega Biotec, USA) (50 mM Tris.Cl, pH 8.3, 6mM MgCl ₂ , 40 mM KC1, 1 nM dithiorheitol, 1 U RNasin). The solution is supplemented with 100 mM of each deoxyribonucleoside triphosphate and 1000 U reverse transcriptase, 10 pM of the respective 3'PCR primer.

For each target sequence or each pooled target sequence system, 20 ul of this reaction mixture are incubated at 37 degrees C for 30 min.

80 microliters of PCR buffer (50 mM Tris.Cl, 50 mM KCl, 2.5 mM MgCl ₂ , 100 micrograms bovine serum albumin / ml, pH 8,440 pM 3'primer, 50 pM 5'primer and 1 U thermostabi) are added to this reaction mixture ¬ les Tag DNA polymerase (Perkin-Elmer-Cetus, USA; New England Biolab, (USA)) is mixed in. Mineral oil is layered over the reaction mixture to prevent evaporation.

The RNa-cDNA complex is dissociated by heating to 95 degrees C for 20 seconds and the primers are anealed at 55 degrees C for 15 seconds, the extension of the primers takes place at 72 degrees C for 1 min. The cycle is started again by heating and repeated 40 to 50 times.

After the last cycle, the reaction mixture is left at 72 degrees C for 10 minutes and then cooled in ice. The "Thermal Cycler" instrument (Perkin-Elmer-Cetus, USA) significantly facilitates the reliable and fast execution of the PCR.

Primer pairs to synthesize PCR products of different sizes. An example:

Primer pair for Ha-rasl2 sequence Size of the amplified product in base pair (

5'Primer (sequence) GACGGAATATAAGCTGGTGG 63 3'Primer (sequence) TGGATGGTCAGCGCACTCTT

Primer pair for Ki-ras12

5'Primer (sequence) GACTGAATATAAACTTGTGG 108 3'Primer (sequence) CTATTGTTGGATCATATTCC

Primer pair for Ki-ras61

5'Primer (sequence) TTCCTACAGGAAGCAAGTAG _ .128 3'Primer (sequence) CΑ <_ÄAAGÄAAGCCCTCCCCA

Labeling of the PCR product is carried out during the amplification by incorporating either labeled deoxyribonucleoside triphosphate or labeled primers. The label can be radioactive or non-radioactive such as: biotin, enzymes, dyes and other substances. Fluorescent dyes have found an advantageous use as a label for primers: these dyes, a different color for each amplifying sequence, who conjugate to the oligonucleotide primers (Applied Biosystem, Foster City, Ca, USA).

The detection of the PCR products or the determination of the occurrence of the amplification is possible by several methods:

Direct method according to Ethidium Brα id staining: The unincorporated components and primers must first be removed. The reaction mixture is diluted to 2.5 ml with 10 mM Tris.Cl pH 8.0 and loaded onto a Centricon-100 microfiltration tube (Amicon) and centrifuged at 5000 (Sorvall SS35, fixed angle rotor). The _J amplified can be recovered from the top of the filter (45-50 µl). Approx. 5 ul are then applied to an agarose plate containing 0.5 ug / ml ethide bromide and fluorescence induced by UV transluminator compared to the negative control (same composition minus plasma RNA, same treatment) and visualized evaluated.

1. Labeled PCR products are identified by their labeling. In this case, the unincorporated marked elements must be removed (as above).

a. Radioactive-labeled PCR products are determined by measuring the radioactivity compared to the negative control, or visualized by agarose gel electrophoresis without prior treatment by autoradiography and even identified by the size of the product.

b. Biotin-labeled PCR products are recognized after the elimination of the unincorporated, labeled elements due to a color reaction due to enzyme affinity. Visualization kits are commercially available (ONCOR, Gaithersburgh, MD 20884 U.S.A.; Amersham, Little Chalfont, England).

c. PCR products labeled with fluorescent dyes are identified by their color using a fluorometer (Perkin-Elmer LS-5).

2. Detection of unmarked products by their size:

There are two technical options available here. Previous treatment is not necessary:

a. Electrophoresis in agarose or acrylic amide gel, according to the size of the products. Visualization either by EB fluorescence or according to the marking. The size of the products is determined by comparison with markers of a known size running in parallel.

b. Ion exchange chromatography (high resolution separation): The reaction mixture after amplification is placed on a Mono Q HR 5/5 column (Parmacia Uppsala, Sweden) and passed through the specified gradient of buffer solutions A and B at a flow rate of 0. 15 ml / min eluted. Buffer solution A: 20 mM Tris.Cl. pH 8.3, 0.4% M NaCl; Buffer solution B: A + 1.0 M NaCl. Gradient: 40 to 60% B in 2 h and 60 to 80% B in 6 h. Simultaneously multi-target sequence PCR (pooled PCR).

This method causes special difficulties for the identification of several PCR products amplified in the same reaction mixture in a tube. In this form of PCR, more than one sequence of either the same molecule or fragment or a sequence of several different mRNAs or their fragments are amplified simultaneously if the corresponding primer pairs are present in sufficient concentration.

In this case, EB fluorescence is used to determine whether amplification has taken place or not, but which sequence (s) has been amplified must be determined with special additional measures. In the case of unmarked products, identification is achieved by the product size. For this purpose, the size of the different PCR products is programmed beforehand by selecting and inserting the corresponding primer pairs so that the product of each amplifying target sequence is synthesized and amplified in an individual, characteristic, different size during the PR (see example) . It is thus achieved that the PCR products are identified by their size with gel electrophoresis or by ion exchange chromatography

^" _ The second possibility is the differentiation» of the products by color, if they are marked differently, each with its own color by fluorescent dyes.

The third possibility for the differentiation of simultaneously amplified products is the identification by their sequence. Here are three solutions, which are also suitable and necessary to control the authenticity of the Taq Poly erase activity because of the occurring misreading and its amplification:

a. Sequence analysis is particularly suitable for checking the authenticity of enzyme activity.

b. In principle, scanning-tuning microscopy can be used to identify the PCR products. It is currently possible to differentiate only the purine and pyrimidine bases from each other with this microscopy. By improving the resolution capability of the microscope, it will be possible in the near future to identify the different bases, even from a concentrated RNA or DNA extract.

c. In vitro hybridization is the most practiced method for identifying nucleic acids according to their sequence, in their conventional form such as dot, slot or Southern blot. In this form, the PCR product is immobilized on a solid substrate and is brought into contact with labeled specific oligonucleotide or DNa samples which are freely available in solution in order to hybridize with one another if there is a complementary sequence. The non-specifically bound samples are removed by washing.

From each reaction mixture, 20 microliters is applied to nylon or nitrocellulose filters previously moistened with 20 x SSPE using a dotting apparatus under the action of a mild vacuum, then the filters are washed in a small volume of 20 x SSPE solution and baked at 80 ° C. for Immobilized for 60 min. Then the filters are in a solution of 0.75 M NaCl, 0.075 M sodium citrate, pH 7.0, 20 mM naphosphate, pH 7.0, 5 mM ^' EDTA, 200 micrograms / ml yeast tRNA, 1% sarcosyl (Signma) for 60 min prehybridized at 60 degrees C. The buffer in which the prehybridization took place is removed and with the buffer of the same composition, which also contains 2 × 10 ⁶ cpm / ml of 5'-end-labeled, denatured oligonucleotides with an oncogene-specific sequence, or with added to the sequence containing the mutant codon of an oncogene (such as ras oncogenes) and incubated at 60 degrees C for 6 to 8 h to take place the hybridization. The filters are then washed in a solution of 0.75 M NaCl, 0.075 M Na citrate, 0.1% SDS at 60 degrees C. The visualization of the occurrence of the hybridization is achieved by autoradiography with the aid of an intensifying plate.

In the case of oncogene oligonucleotide samples which contain the sequence with the mutated code (such as Ki-ras, HS-ras, N-ras, codon 12, 13, 61), it is more advantageous if the buffer solution for prehybridization, hybrid and washing still contains tetramenthylammonium chloride (3 M tetramethyl ammonium chloride, 50 M Tris.Cl, pH 7.5, 2 mM EDTA, 0.3% SDS, 100 micrograms / ml sonicated Sa__mon sperm DNA, 5 x Denhardt's solution ( 1 x Denhardt's solution: Ficoll, polyvinylpirrolidone, bovine serum-albι_min each 0.02%), in which case the filters are then washed twice in 2 x SSPE (1 x SSPE: 10 M Na-phosphate, p 7.2, 0.18 M NaCl, 1 mM EDTA, 0.1% SDS) for 10 min at room temperature, then they are rinsed with 3 M tetramethylammonium-Cl hybridization buffer minus Karrier DNA and Denhardt's solution and then in this solution for 30 to 60 min washed at 60 degrees C. The filters are evaluated by autoradiography, as above.

The following known, 18 molecularly cloned human oncogene or its oncogene-specific sequences can be used as samples. The oncogenes are grouped below according to their frequency of increased activity in human malignancies:

Group A: fos, myc, Ha-ras, Ki-ras

Group B: fes, yb, fms, N-ras, src, abl, raf, Ertf, N-mye

Group C: Erb ^, mos, sis, alu, bcr.

The oncogene samples are usually radioisotopically with P ³² (Spezifi¬ specific activity: 10 ^8-10 ⁹ cpm / microgram) or labeled with biotin. Okogen oligonucleotide samples, including those which have a point mutation-modified sequence of oncogenes activated by point mutation, are radioisotopically labeled by end labeling in order to achieve high specific activity. If new oncogenes were discovered, additional oncogene oligonucleotide samples might be necessary, which can be used according to the diagnostic goal.

There is an in vitro hybridization process, which is the mirror image of the conventional method mentioned above. In this the unlabeled various oligonucleotide samples are immobilized on a piece of nylon filter and the filter is hybridized with PCR products which were then labeled with biotin during the amplification; Reverse hybridization process. 100 ul of oligonucleotide sample solution (100 pmol; in lOmM Tris.Cl. 0.1 mM EDTA) is applied to nylon filter (membrane) (Genetrans-45, Plasco Woburn, MA, USA) and immobilized by UV light or by baking, then wash with 200 ml of 5 x SSPE and 0.5% for 30 min at 55 degrees C to remove the unbound oligonucleotide. A filter has several different oligonucleotide samples.

Each filter with the various specific oligonucleotide samples immobilized on it is composed in 4 ml of hybridization solution of 20 ul of the amplified, labeled (biotin) DNA and 5 x SSPE, 0.5% SDS. Previously, the amplified DNA was mixed by mixing 400 iriM NaOH, 10 mM EDTA and was added quickly to the hybridization solution. Then incubate at 55 degrees C for 4 to 6 h. They are quickly with 2 x SSPE, 0.1% SDS at room temperature, once with the same solution at 55 degrees C for 10 min. washed and a short rinse twice in 2 x PBS (1 x PBS: 137 mM NaCl, 2.7 mM KC1, 8 MM Na ₂ HP0 ₄ , 1.5 M KH ₂ P0 ₄ , pH 7.4) at room temperature. Visualization according to the marking.

Oligonucleotides coupled to a poly-dT tail (several hundred BP long): This tail is then used to immobilize the samples on a piece of nylon filter by UV light so that the specific sequence or sequences of the fragment are free in Is a solution and so the hybridization takes place quickly.

The point mutation possibilities of some oncogenes are numerous and require quick examination procedures. One possibility is the simultaneous, pooled sequence PCR and the differentiation of the different products by different fluorescent dye labeling, by using labeled primer pairs, a primer of which is labeled with a different dye and complementary to the mutated sequence. Each 5 to 6 mutated sequence is drawn with its own dyes, its own color. The amplification of these mutated sequences can be identified quickly and easily in a pooled PCR system.

PCR can be used for substances whose nucleotide sequence is not is known not to be carried out. In these cases, in vitro hybridization with the corresponding DNA samples is the method of choice.

The plasma RNA concentrate is denatured by incubation at 65 degrees C for 15 min and then by rapid cooling. Then the RNA is on a solid support such as nitrocellulose paper that was previously with 20 x NaCl / Cit. was equilibrated and then dried by a dotting apparatus (Schleicher & Schuell, Keene, New Hampshire USA). The nitrocellulose paper treated in this way is then baked in a vacuum oven at 80 ° C. for 2 h, after baking it is dissolved in a solution (Prehybridization buffer): Formamide (50% (Vol / Vόl) 5 x NaCl / Cit; mM sodium phosphate, pH 6.5; sonicated denatured Salmon Sperma DN (250 micrograms / ml) and 0.2% per Bovine Serum Albumin (BSA); Ficoll and Polyinylpyrrolidon incubated for 6-8 hr at 55 degrees C.

The biotin-labeled oncogene and other samples (labeled samples or labeling kit: ONCOR, Gaithersburgh, USA) are first denatured and become the prehybridization solution which contains the nitrocellulose paper with the plasma RNA immobilized thereon mixes. The concentration of the sample or samples (pooled samples) is high: 600 ng / ml. In the case of pooled samples of 5 components, each 120 ng / ml. Hybridization at 55 degrees C for 7 to 10 h.

The hybridization is detected with the visualization kit according to the manufacturer's instructions (ONCOR, Gaithersburgh USA) after the prescribed washes.

Use of biotin-labeled samples and visualization kits from ONCO enables rehybridization after removal of the hybridized samples.

The pooled samples (each 5) the plasma RNA can be tested relatively quickly and get a negative or a positive result with the Tester¬ ih ^* menschli chen malignancies frequently activated oncogenes. The positive pool is then further tested with its components (the individual samples) by hybridization and / or by re-hybridization in order to determine the plasma oncogene profile. men.

The sensitivity of this method is in the range of 0.1 pg. Numerous other modifications are possible.

The intensity of the black spot after autoradiography due to the intensity of the color can be measured quantitatively and quantitative comparisons can thus be made.

Quantitative test:

A serial dilution is made from the plasma RNa with 10 microgram / ml yeast tRNa as diluent carrier RNA, then with each dilution first the reverse transcription, then the PCR, and the product by in vitro hybridization with corresponding specific oligonucleotide samples identified by other methods. The highest dilution from which there is still a positive signal is de titer. In this way, quantitative monitoring can be carried out during the monitoring of a patient during the observation period. In this way, one can observe, for example, amplification of one of the activated oncogenes. If the titer of one oncogene is increased disproportionately compared to the other oncogenes detectable in the plasma during the follow-up, this can increase the in vivo amplification of this oncogene, among other things. mean.

This method is particularly suitable for screening people who are particularly at risk of malignancy, such as people who are exposed to X-rays or radioactive radiation, workers in chemical or asbestos plants, patients with impaired immune systems (after chemotherapy) or members of families with genetic -conditional tendency for various malignant diseases.

Because of the increased sensitivity of this method, there can be such non-malignant cases in which the malignancy test gives a positive result. Referencing is possible through follow-up. In the case of non-malignant cases, the positivity persists temporarily, then subsides, in contrast to the malignant cases, where the positivity persists and then increases. The simultaneous multiplication of several target sequences made it easier to investigate the large number of substances such as oncogenes or variants of poultices. Example: Three PCR systems (pooled PCR), each programmed for 5 target sequences, two of which are for the most frequently activated oncogenes, and the third for other sequences of cancer cell origin. EB staining shows in which system amplification has taken place and the increased sequence (s) are then identified according to their size, if they were programmed in this way, by chromatography or electrophoresis in gel.

It is even quicker if fluorescent dye-labeled primers have a separate color for each sequence to be synthesized in the pool and the increased product (s) are identified by (with) fluorometers after removal of the unincorporated labeled primers according to their color without major delay.

The same can be done with the point mutated sequences. Each mutated sequence in the pool is drawn with its own color by means of fluorescent dye-labeled primers, which is complementary to the mutated codon region.

The most sensitive test method is when the PCR products are detected by in vitro hybridization. In the case of pooled PCR, the reaction mixture is hybridized with the appropriately labeled oligonucleotide or pooled DNA samples after amplification. The positive pooled PCR mixture is then further hybridized with labeled individual oligonucleotide or DNA samples in order to know which sequence was amplified in the pool. In this way a sensitivity can be achieved which is in the range of ag (10 ^-18 g). Theoretically, this means the detectability of some target sequences (3-5 target sequence pieces) in the plasma pattern.

This highly sensitive and, to a large extent, specific detection method for the specific mRNA sequence of the substances of cancer cell origin results in a malignancy test which, because of the special features of the malignant cells and tumors, is used for diagnosis, early detection, screening and for predicting the outcome of therapy with antineo - plastic means is suitable.

This test is able to reflect not only the fundamental molecular-genetic changes, mainly responsible for the malignant transformation, its maintenance and progression, but also one of the most important ways of influencing the host organism by the malignant cancer cell population.

To achieve healing, both events (mechanisms) must be combated:

The activated oncogenes drive up the "motor" of the malignant cells, which have to be "switched back" in order for the host to be able to save the patient.

The influencing of the host organism by the cancer cell population in the manner specified here, which leads to the weakening of the immune system and other functions of the host, must be prevented.

For this purpose, this method of the invention creates the most important prerequisites: the early detection of these events in each patient individually.

Claims

Expectations

1. Malignancy test (cancer test) by in vitro enzymatic propagation of the specific mRNA sequence of the substances of cancer cell origin from an acellular biological fluid in which "one

a. the RNA is concentrated from the acellular biological fluid under the constant action of a reliable RNase inhibitor, b. the product of stage a. undergoes an in vitro reverse transcription to synthesize the complementary DNA (cDNA) c. the product of stage b. used to repeatedly synthesize and thus multiply the target-specific sequence of the desired substance of cancer cell origin enzymatically in vitro, and d. the product of stage c. by determining the amplification of the nucleic acid.

2. The method according to claim 1, characterized in that the product of step a. an in vitro hybridization with the desired oligonucleotide or the DNA sample before the sample b. under pulls.

3. The method according to claim 1, characterized in that the in vitro propagation of the product of stage b. is carried out repeatedly by polymerase chain reaction (polymerase chain reaction = PCR).

4. The method according to any one of claims 1 to 3, characterized in that the acellular biological fluid is preferably human blood plasma.

5. The method according to claim 1, characterized in that the specific target sequence (s) of two or more substances of cancer cell origin simultaneously in the same system in vitiro enzy matically multiplied (pooled PCR).

6. The method according to claim 1, characterized in that in the simultaneous in vitro multiplication of several substances of cancer cell origin, each target sequence for synthesis is programmed by appropriate selection of the primer pairs so that each in a particular characteristic Size synthesized.

7. The method according to claim 5, characterized in that during the pooled PCR the synthesizing sequences are marked by incorporating primers conjugated with fluorescent dyes so that each target sequence product has its own color and is identified accordingly.

8. The method according to any one of claims 1 and 3 to 6, characterized gekenn¬ characterized in that the in vitro propagation of nucleic acids with ethidium bromide is determined by color reaction.

9. The method according to claim 1, characterized in that the product of step c. is identified according to its specific sequence by in vitro hybridization, by sequence determination or by scanning tunneling microscopy.

10. The method according to claim 1, characterized in that the product of step c. is identified according to its size by electrophoresis in gel or by column chromatography.

11. The method according to claim 1, characterized in that the product of step c. Claim 1 is marked during the PCR,

a. using labeled primers, or b. by incorporating labeled nucleotides where the label is radioisotopic or non-radioisotopic.

12. The method according to any one of claims 1, 2 and 3 to 9, characterized ge indicates that the in vitro hybridization is carried out a. with labeled DNA or oligonucleotide samples while the PCR-amplified, unlabeled target DNA or oligonucleotides are either immobilized on a solid substrate or freely in solution, b. or the target DNA or oligonucleotide amplified by PCR is labeled free in solution and the various oncogene samples are unlabeled immobilized on a solid substrate, hybridization after appropriate treatment being determined by the detection of the labeling substance.

13. The method according to any one of claims 1, 2, 6, 9 and 12, characterized in that an individual DNA or oligonucleotide sample or a mixture of individual DNA or oligonucleotides is taken as a sample (pooled probe).

14. The method according to any one of claims 1 to 6, 9, 11 and 12, characterized in that one removes the labeled samples that hybridized with the target DNA or oligonucleotide bound to the solid support in order to use the solid substrate to hybridize the remaining target DNA or oligonucleotide with a new DNA or oligonucleotide sample.