CYSTEINE-DEPLETED MUTEINS OF BIOLOGICALLY ACTIVE HUMAN TUMOR NECROSIS FACTOR PROTEINS
This invention is in the general area of recombinant DNA technology. More specifically it relates to mutationally altered biologically active tumor necrosis factor proteins that differ from their parent analogs by one or more substitutions/deletions of cysteine residues. This application is related to EP 109,748, published May 30, 1984.
Background Art Human tumor necrosis factor (hTNF) has been known for many years as an antitumor substance found in sera of bacillus Calmette- Guerin (BCG)-infected mice treated with endotoxin. TNF was first reported by Carswell, et al. Proc. Nat'l. Acad. Sci. (USA) (1975) 72:3666; and has been shown to be cytotoxic selectively to neoplastic cells. TNF has been purified from cell culture, by Matthews, et al., Brit J. Cancer (1981) _44_:418 (from mononuclear phagocytes derived from BCG-injected rabbits) and. by Mannel, et al. Infect. Immun. (1980) _3p_:523, ibid (1981) _33_:156 from cultures of macrophage enriched peritoneal exudate cells from BCG infected mice. It was reported in EP 131,789, published January 23, 1985 to Old et al. that hTNF could be purified from TNF sensitive L-M cells derived from cloned mouse cells deposited at the American Type Culture Collection (ATCC) under deposit number L929.
Recently, it has been reported that hTNF cDNA and the hTNF gene had been cloned and recombinant hTNF is produced using them. See Pennica, D. et al. (1984) Nature (London) 312, 724-729; Shirai et al . (1985) Nature (London) 313, 803-806; Wang, A.M., et al. (1985) Science 228, 149-154; and Ya ada, M., et al. (1985) J. Biotechnology, 3, 141- 153. Similar disclosures have appeared in the patent literature, e.g., EP 155,549, published September 29, 1985; EP 158,286, published October 16, 1985; and EP 168,214, published January 15, 1986. From these disclosures hTNF is a protein containing two cysteine residues. Assuming hTNF as having 157 amino acids (see Pennica, D.
et al. and Wang, A.M. et al. supra), the cysteine residues are at positions 69 and 101. Shirai et al. and Yamada, M. et al. supra, report cloning of a hTNF having 155 amino acids, i.e., where the first two amino acids, Val. Arg., are missing. For the purpose of the present invention, reference will be made to the hTNF having 157 amino acids. As used herein, the term "hTNF", "cysteine-depleted muteins of hTNF" and "hTNF muteins" denotes a protein that is produced by a microorganism that has been transformed with a human TNF DNA sequence or a modification of the human TNF DNA sequence that encodes a protein having: (a) an amino acid sequence that is at least substantially identical to the amino acid sequence of mature native human tumor necrosis factor and (b) has the biological activity that is common to native human TNF. Substantial identity of amino acid sequences means the sequences are identical or differ by one or more amino acid alterations (deletions, additions, or substitutions) that do not cause an adverse functional dissimilarity between the synthetic protein and the native human TNF. Specific examples include the N-terminal deletions of hTNF wherein any one or more of the first 1-11 amino acids are deleted, the -4, -7 and -8 being most preferred. Also, included are the hTNF proteins wherein the amino acid residues at positions 35-66, 110-133, 150-157 or 67-109 have been substituted with another amino acid or deleted. (See EP 168,214)
Numerous biologically active proteins such as human tumor necrosis factor that are icrobially produced via recombinant DNA (rDNA) technology contain cysteine residues that are nonessential to their activity but are free to form undesirable intermolecular links. One such protein is microbially produced human tumor necrosis factor. In the course of the preparation of hTNF or rDNA techniques, it has been observed that dimers and oligomers of microbially produced hTNF are formed in E. coli extracts containing high concentrations of hTNF. This multimer formation renders purification and separation of hTNF very laborious and time-consuming and necessitates several additional steps in purification and isolation procedures such as reducing the protein during purification.
The present invention is directed to producing, by directed mutagenesis techniques, mutationally altered biologically active tuπor necrosis factor proteins (such proteins are called "muteins", Glossary of Genetics and Cytogenetics, 4th Ed, p 381, Springer-Verlag (1976)) that retain the activity of their parent analogs but lack the ability to form intermolecular links or undesirable intramolecular disulfide bonds. Also, see EP 109,748, published May 30, 1984.
Directed mutagenesis techniques are well known and have been reviewed by Lather, R.F. and Lecoq, J.P. in Genetic Engineering Academic Press (1983) pp 31-50. 01igonucleotide-directed mutagenesis is specifically reviewed by Smith, M. and Gillam, S. in Genetic
Engineering: Principles and Methods, Plenum Press (1981) _3_:l-32.
Disclosure of the Invention
One aspect of the invention is a synthetic mutein of a biologically active hTNF protein, said mutein having at least one of its two cysteine residues deleted or replaced by another amino acid.
Another aspect of the invention relates to synthetic structural genes having DNA sequences that have been specifically designed ("designer genes") to encode the above-described synthetic hTNF muteins. Sub-aspects of this aspect are expression vectors that include such structural designer genes, host cells or organisms transformed with such vectors, and processes for making the synthetic mutein by culturing such transformants or their progeny and recovering the mutein from the culture. In the case of the hTNF muteins that have therapeutic utility, therapeutic compositions that contain therapeutically effective amounts of the muteins and therapeutic methods are other aspects of the invention.
Still another aspect of the invention is a method for making the above-described synthetic structural gene by oligonucleotide- directed mutagenesis comprising the following steps:
(a) hybridizing single-stranded DNA comprising a strand of a structural gene that encodes the parent protein with a mutant ol igonucleotide primer that is complementary to a region of the strand
that includes the codon for the cysteine to be deleted or replaced or the antisense triplet paried with the codon, as the case may be, except for a mismatch with that codon or antisense triplet, as the case may be, that defines a deletion of the codon or a triplet that encodes said other amino acid;
(b) extending the primer with DNA polymerase to form a utational heteroduplex; and
(c) replicating the mutational heteroduplex.
The mutant oligonucleotide primers used in this process are another aspect of the invention.
Brief Description of the Drawings
FIGURE 1 shows the complete nucleotide sequence of pE4, and the deduced amino acid sequence.
FIGURE 2 shows a restriction map of the pE4 insert. FIGURES 3a and 3b show the complete nucleotide sequence of the insert encoding the mature TNF protein in pAW731, and the deduced amino acid sequence, respectively.
FIGURE 4 shows the single 17,000 dalton protein band corresponding to ser 69 TNF in the extracts of clone pAW711 and pAW731.
Modes for Carrying Out the Invention
The present invention provides: muteins of biologically active hTNF proteins in which cysteine residues which have been found to be nonessential to biological activity and have been deliberately deleted or replaced with other amino acids to eliminate sites for intermolecular crosslinking; mutant genes coding for such muteins; and means for making such muteins.
Proteins that may be mutationally altered according to this invention may be identified from available information regarding the cysteine content of biologically active proteins and the roles played
by the cysteine residues with respect to activity and tertiary structure. For proteins for which such information is not available in the literature, this * information may be determined by systematically altering each of the cysteine residues of the protein by the procedures described herein and testing the biological activity of the resulting muteins and their proclivity to form undesirable intermolecular disulfide bonds. Accordingly, while the invention is specifically described and exemplified below, as regards muteins of human tumor necrosis factor, it will be appreciated that the following teachings apply to any other biologically active hTNF proteins that contain functionally nonessential amino acid residues, i.e., which contain other modifications to the protein.
The cysteine residues are either deleted or replaced with amino acids which do not affect the biological activity of the resulting hTNF mutein. Appropriate amino acid residues are selected from the group consisting of serine, threonine, glycine, alanine, valine, leucine, isoleucine, histidine, tyrosine, phenylalanine, tryptophan, and methionine. Preferred among this group are the residues of serine, threonine, alanine, and valine. Particularly preferred is replacement by a serine or alanine residue.
As stated above, mature human TNF is a 157 amino acid protein containing two cysteine residues, one at position 69, and the other at position 101. The sequence encoding TNF produced by the human promyelocytic leukemia cell line (HL-60, ATCC #CCL240) has been cloned and expressed in E. coli, and has been shown to have the sequence set forth in Figure 1. Also, see Wang, A.M. et al., supra, incorporated herein by reference.
As will be shown below, neither of the cysteine residues in the TNF sequence appears to be involved in disulfide linkages, and either may be replaced or deleted according to the method of the invention to obtain a stable and biologically active mutein. This is surprising since hTNF only has two cysteine residues which ordinarily would be believed to be necessary for retention of biological activity.
By the use of the oligonucleotide-directed mutagenesis procedure with a synthetic oligonucleotide primer that is complementray to the region of the hTNF gene at the codon for cys 69 but which contains single or multiple base changes in that codon, a designer gene may be produced that results in cys 69 being replaced with any other amino acid of choice. When deletion is desired the oligonucleotide primer lacks the codon for cys 69. Conversion of cys 69 to neutral amino acids such as glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histidine, tryptophan, serine, threonine and methionine is the preferred approach. Serine, threonine and alanine are the most preferred replacements because of their chemical analogy to cysteine. When the cysteine is deleted, the mature mutein is one amino acid shorter than the native parent protein or the microbially produced hTNF. The size of the oligonucleotide primer is determined by the requirement for stable hybridization of the primer to the region of the gene in which the mutation is to be induced, and by the limitations of the currently available methods for synthesizing oligonueclotides. The factors to be considered in designing oligonucleotides for use in oligonucleotide-directed mutagenesis (e.g., overall size, size of portions flanking the mutation site) are described by Smith, M. and Gillam S. , supra. In general the overall length of the oligonucleotide will be such as to optimize stable, unique hybridization at the mutation site with the 5' and 3' extensions from the mutation site being of sufficient size to avoid editing of the mutation by the exonuclease activity of the DNA polymerase. Oligonucleotides used for mutagenesis in accordance with the present invention usually contain from about 12 to about 24 bases, preferably from about 14 to about 20 bases, and still more preferably, from about 15 to about 18 bases. They will usually contain at least about three bases 3' of the altered or missing codon.
The method for preparing the modified IFN-β gene broadly involves inducing a site-specific mutagenesis in the hTNF gene at codon 69 (TGT) using a synthetic nucleotide primer which omits the codon or alters it so that it codes for another amino acid. It must
be recognized that when deletions are introduced, the proper reading frame for the DNA sequence must be maintained for expression of the desired protein.
The primer is hybridized to single-stranded phage such as M13, fd, or 0X174 into which a strand of hTNF gene has been cloned. It will be appreciated that the phage may carry either the sense strand or antisense strand of the gene. When the phage carries the antisense strand the primer is identical to the region of the sense strand that contains the codon to be mutated except for a mismatch with that codon that defines a deletion of the codon or a triplet that codes for another amino acid. When the phage carries the sense strand the primer is complementary to the region of the sense strand that contains the codon to be mutated except for an appropriate mismatch in the triplet that is paired with the codon to be deleted. Conditions that may be used in the hybridization are described by Smith, M. and Gillam, S., supra, the temperature will usually range between about 0°C and 70°C, more usually about 10°C to 50°C. After the hybridization, the primer is extended on the phage DNA by reaction with DNA polymerase I, T* DNA polymerase, reverse transcriptase or other suitable DNA polymerase. The resulting dsDNA is converted to closed circular dsDNA by treatment with a DNA ligase such as T^ DNA ligase. DNA molecules containing single-stranded regions may be destroyed by SI endonuclease treatment.
Oligonucleotide directed mutagenesis is employed to obtain a TNF gene that encodes a mutein having TNF activity, but with cys6g changed to an alternate or deleted amino acid, and/or the cys-. -, residue replaced or deleted. For the exemplified conversion of the c sgg to sergg, a preferred oligonucleotide primer is 5'- CATGGGTGCTCGGGCTGCCTT-3'. This oligonucleotide has a T —> A change in the triplet that is paired with codon 69 of the TNF gene. Similarly, cysιoi ma-' ~e converted to ser-jQ-. with a primer CAAGAGCCCCTCTCAGAGGGAG which contains a corresponding change at the triplet paired with the codon at 101, using ssM13 phage DNA containing the appropriate strand of the human TNF cDNA sequence.
The resulting mutational heteroduplex is then used to transform a competent host organism or cell. Replications of the heteroduplex by the host provides progeny from both strands. Following replication the mutant gene may be isolated from progeny of the mutant strand, inserted into an appropraite expression vector, and the vector used to transform a suitable host organism or cell. Preferred vectors are plasmids pBR322, pCRl, and variants thereof, synthetic vectors and the like. Suitable host organisms are E. coli, Pseudomonas, Bacillus subtilis, Bacillus thυringiensis, various strains of yeast, Bacillus thermophilus, animal cells such as mice, rat or Chinese hamster ovary (CHO) cells, plant cells, animal and plant hosts and the like. It must be recognized that when a host of choice is transformed with the vector, appropriate promoter-operator sequences are also introduced in order for the mutein to be expressed. Hosts may be prokaryotic or eukaryotic (processes for inserting DNA into eukaryotic cells are described in PCT Application Nos. US81/00239 and US81/00240 published 3 September 1981). E. coli and CHO cells are the preferred hosts. The muteins obtained in accordance with the present invention may be glycosylated or unglycosylated depending on the glycosylation desired in the mutein. If desired, unglycosylated mutein obtained when E. coli or a Bacillus is the host organism, may be optionally glycosylated j_n_ vitro by chemical, enzymatic and other types of modifications known in the art.
The following examples are presented to help in the better understanding of the subject invention and for purposes of illustration only. They are not to be construed as limiting the scope of the invention in any manner. Examples 1-9 describe the preparation of a TNF mutein, and its assay.
Preparation and Purification of Human TNF: 1. Induction of TNF
High density (= 2 x IO6 cells/ml) stationary HL-60 cells were centrifuged, washed with RPMI 1640 medium in the absence of serum, and then resuspended at a density of 1 x IO7 cells/ml. The
cells were then treated with 100 ng/ml of a phorbol ester, 12-0- tetradecanorylphorbol-13-acetate (TPA) for 30 min at 37°C in a suspension culture with constant agitation. The cultures were centrifuged, the supernatant was decanted, the cells wre resuspended at 1 x 107 cells/ml in RPMI, containing 10 μg/ml bacterial l popolysaccharide (LPS) and 10 μM Ca ionophore (A23817) for 4 hr at 37°C with constant agitation. The cells were spun down at 1200 rpm for 10 min. and the supernatants recentπ'fuged at 8000 rpm for 20 min. The resulting supernatant was used in the purification scheme below to obtain native TNF.
2. Purification of TNF
About 4-8 liters of the supernatant prepared from induced HL-60 in the previous paragraph were concentrated via Amicon hollow fiber (1 square foot cartridge/10,000 MW cutoff) to approximately 300 ml. . The concentrated culture fluid was centrifuged to remove cell debris, and supernatant adjusted with 30 mM ammonium bicarbonate buffer (pH 812) to a conductance of 6.2 mS. The solution was further concentrated by ultrafiltration using a PM10 (Amicon) membrane, and the concentrated fluid clarified by centrifugation (20,000 x g for 10 min).
The supernatant was then applied to a DEAE ion exchange column equilibrated in 30 mM ammonium bicarbonate/1 mM NaCl pH 8.2, and the column washed with the same buffer. Fractions were collected and protein monitored at 280 nm. These unbound fractions were assayed using the L-929 cytotoxicity assay and those having TNF activity pooled and again concentrated by ultrafiltration.
The concentrate was applied to Sephadex G75 Superfine
(Pharmacia) equilibrated in 30 mM ammonium bicarbonate buffer (pH
7.4). Unbound fractions obtained by washing with the same buffer were monitored at 280 nm and assayed for TNF. Fractions containing peak
TNF bioactivity were lyophilized.
The lyophilized protein was resuspended in Laemml SDS sample buffer and electrophoresed on SDS-polyacrylamide gel. The gel
was sliced into 2 mm sections, and the protein from each section was eluted by immersion in 1 ml of 30 M ammonium bicarbonate buffer (pH 7.4) and overnight shaking at room temperature.
The sections containing the TNF bioactivity were applied onto a Vydac C-4 reverse phage HPLC column equilibrated in 0.1% trifluoroacetic acid (TFA), and the activity eluted using a linear gradient 0%-60% acetonitrile in 0.1% TFA. Protein was monitored at 280 nm and 214 nm, and the fractions bioassayed after lyophilization and suspended in 30 mM ammonium bicarbonate buffer pH 7.4. Fractions containing TNF activity were again lyophilized.
T e resulting protein was of sufficient purity to be useful in sequence analysis. The sequence was determined using a gas phase sequenator (Applied Biosyεtems Inc.). The sequence obtained from the first 22 amino acids is shown below.
1 2 3 4 5 6 7 B 9
Val - Arg - Ser - Arg - Thr Pro - - Ser - Asp - Lys
10 11 12 13 14 15 16 17 18
Pro - Val - Ala - Val - Ser Val - - Ala - Asn - Pro
19 20 21 22 (Gin) - (Ala) - Glu - Gly.
In addition, the purified protein (from the G-75 gel) was tested with a modification of the L-929 cytotoxicity assay using alternate human tumor and normal cell lines as substrate. The G-75 fractions which were cytotoxic in this assay against L-929 cells were also cytotoxic against Hs939T (a melanoma line) BT-20 (breast carcinoma), A427 (lung carcinoma) HT-1080 (colon carcinoma) and HT-2.9 (colon carcinoma). These fractions were not cytotoxic against Hs939sk (skin fibroblasts) . HeLa cells (cervical carcinoma) Hβ27F (foreskin fibroblasts) or COS7 (SV40-transformed monkey cells) .
Preparation of the Coding Sequence:
An intronless DNA sequence encoding human TNF was prepared by the procedure herein described. A human promyelocytic leukemia cell line which produces large amounts of TNF when induced, the HL-60 line, obtainable from ATCC, accession no. CCL 240. was used as the source of mRNA to obtain a cDNA library. Using oligomeric probes constructed on the basis of the protein sequence determined from TNF purified from these cells, this cDNA library was probed to retrieve the entire coding sequence for the protein.
1. Preparation of Enriched mRNA
Total messenger RNA was extracted and purified from HL-60 cells as follows: HL-60 cells were induced for TNF production as set forth in VD.l.a. and the 4-hr cell suspension harvested by centrifugation. Total cytoplasmic ribonucleic acid (RNA) was isolated as follows; all steps are at 4°C. Cells are washed twice in PBS (phosphate buffered saline) and resuspended in IHB (140 mM NaCl, 10 mM Tris, 1.5 mM MgCl2# pH 8) containing 10 mM vanadyl adenosine complex (Berger. S. L.. et al. Biochem (1979) 18.:5143).
A non-ionic detergent of the ethylene oxide polymer type (NP-40) was added to 0.3* to lyse the cellular, but not nuclear membranes. Nuclei were removed by centrifugation at 1,000 x g for 10 min. The post-nuclear supernatant was added to an equal volume of TE (10 mM Trie, 1 mM ethylenediaminetetraacetic acid (EDTA). pH 7.5) saturated phenol/chloroform (1:1) containing 0.5* sodium dodecyl sulfate (SDS) and 10 mM EDTA. The supernatant was re-extracted 4 times and phase separated by centrifugation at 2,000 x g for 10 min. The RNA was precipitated by adjusting the sample to 0.25 M NaCl, adding 2 volumes of 100* ethanol. and storing at -20°C. The RNA was pelleted at 5,000 x g for 30 min, washed with 70* and 100* ethanol, and dried. Polyadenylated (Poly A+) messenger RNA (mRNA) was obtained from the total cytoplasmic RNA by chroma¬ tography on oligo dT cellulose (Aviv, J., et al, Proc Natl Acad Sci (1972) 69.:1408-1412) : The RNA was dissolved in ETS (10 mM Tris, 1 mM EDTA, 0.5* SDS, pH 7.5) at a concentration of 2 mg/ml. This solution was heated to 65
βC for 5 min, then quickly chilled to 4
βC. After bringing the RNA solution to room temperature, it was adjusted to 0.4 M NaCl and slowly passed through an oligo dT cellulose column previously equilibrated with binding buffer (500 mM NaCl. 10 mM Tris, 1 mM EDTA. pH 7.5). The flow-through was passed over the column twice more, and the column washed with 10 volumes of binding buffer. Poly A
+ mRNA was eluted with aliquots of ETS, extracted once with TE-saturated phenol chloroform and precipitated by the addition of NaCl to 0.2 M and 2 volumes of 100* ethanol. The RNA was reprecipitated twice, washed once in 70* and then in 100* ethanol prior to drying.
The poly A
+ mRNA was fractionated on a sucrose gradient in 10 mM Tris-HCl, pH 7.4. 1 mM EDTA, 10 mM NaCl and 0.1* SDS. After centrifugation in a Beckman SW40 rotor at 38,000 rpm for 17 hr. mRNA fractions were recovered from the gradient by ethanol precipitation. The fractions containing TNF mRNA were identified by injecting the mRNA into oocytes and assaying the oocyte extracts for cytotoxic activity. Fractions containing peak activity were pooled for use in cDNA library construction.
2. Construction of a cDNA Library cDNA was made from the enriched 16S mRNA fraction using oligo dT priming of the poly A tails and AMV reverse transcriptase employing the method of Okayama. H. , et al. Mol Cell Biol (1983) 1:280, incorporated herein by reference. This method results in a higher proportion of full length clones and effectively uses as host vector portions of two .vectors therein described, and readily obtainable from the authors. pcDVl and pLl. The resulting vectors contain the insert between vector fragments containing proximal BamHI and Xhol restriction sites; the vector contains the pBR322 origin of replication, and Amp resistance gene. Other methods of preparing cDNA libraries are. of course, well known in the art. One, now classical, method uses oligo dT primer, reverse transcriptase, tailing of the double stranded cDNA with poly dG, and annealing into a suitable vector, such as pBR322 or a derivative thereof, which has been cleaved at the desired restriction site and tailed with poly dC. A detailed description of this alternate method is found, for example, in U.S. Patent No. 4,578,584, issued May 21, 1985, and assigned to the same assignee, incorporated herein by reference.
In the method used here, the enriched mRNA (5 -μg) was denatured by treatment with 10 mM methyl mercury at 22βc for 5 min and detoxified by the addition of 100 mM 2-mercaptoethanol (Payvar. F., et al, J Biol Chem (1979) 254.:7636-7642) . Plasmid pcDVl was cleaved with Kpnl, tailed with dTTP. and annealed to the denatured mRNA. This oligo dT primed mRNA was treated with reverse transcriptase. and the newly synthesized DNA strand tailed with dCTP. Finally, the unwanted portion of the pcDVl vector was removed by cleavage with Hindlll. Separately, pLl was cleaved with PstI, tailed with dGTP, cleaved with Hindlll, and then mixed with the poly T tailed mRNA/cDNA complex extended by the pcDVl vector fragment, ligated with E. coli ligase and the mixture treated with DNA polymerase I (Klenow) E. coli ligase, and RNaβe H. The resulting vectors are transformed into E. coli K12 MM294 to Amp .
3. Selection of Probe
Oligomers complementary to the coding sequence for amino acids 8-12 of the purified TNF sequence were prepared. Because of codon redundancy, a total of sixty-four 14-mers are candidates for complementation to the messenger encoding this portion. All sixty-four 14-mers were prepared, and divided into four pools of sixteen. Each pool was mixed with the sucrose gradient size-fractionated enriched mRNA preparation, prepared as above, and the mixture injected into the oocyte translation system. Controls were run using untreated messenger RNA. The proteins produced in the oocyte systems were subjected to L-929 cytotoxicity assay ( 35S release), and the proteins derived from oocytes injected with control and with a mixture of mRNA with three of the oligomer pools showed activity. In this
"hybrid arrest" assay, only the oocyte injected with
messenger which had been treated with the pool having the sequence
A T
GC(G)AC(C)GGCTTGTC T A
C G
was inactive. The specificity of this oligomer pool was further determined using "dot blot" hybridization with enriched mRNA prepared as above from both induced and uninduced HL-60 cells, as well as the corresponding mRNA fraction obtained from cells known to be producers of lymphotoxin. This pool hybridized well to the induced mRNA, but failed to hybridize with the corresponding fractions from the uninduced or lymphotoxin producing cells. However, Northern blots using the kinased pool as probe demonstrated that it contained sequences which cross hybridize with the 18S (ribosomal) RNA fraction and to pBR322 DNA.
The successful pool was therefore further fractionated by synthesizing its members as eight pairs of 14-mers, each of which was used in the "hybrid arrest" assay performed as set forth above. Only the pair with the sequence
GC(c)ACAGGCTTGTC
was successful in inhibiting the synthesis of TNF in the oocytes. Dot blot experiments using the fractionated induced HL-60 mRNA fraction, induced total HL-60 poly A+ RNA, uninduced HL-60 poly A+ RNA. and ρBR322 DNA confirmed the specificity of the foregoing 14-mer pair and the inability of the remaining pairs to hybridize to the desired messenger.
4. Recovery of the Coding Sequence The cDNA library was probed with the 14-mer pair identified above. Twenty-eight colonies which hybridized with probe were picked, cultured, and the plaβmid DNA isolated. Plasmids containing inserts of sufficient length to encode the entire sequence were selected and several were assayed for the correct sequence using hybrid translation in combination with the 35S release version of the cytotoxic assay, as described below. Hybrid translation assays use the test sequence to retrieve the correct mRNA from unfractionated preparations as verified by assaying the protein produced by the oocyte translation system injected with the retrieved messenger. The plaβmid cDNA to be tested is bound to filters, and the filters treated with poly A+ RNA isolated from induced HL-60 cells. The filters are then eluted, and the eluates injected into the oocyte translation system. The oocytes are extracted for protein, which is then tested in the 35-S version of the L-929 cytotoxic assay. The results for several hybridizing clones, designated E2-E4. E6 and E8 are shown below:
Sample * Release of 35S El 7
E2 23
E3 32
E4 33
E6 26 E8 11
PBR322 9
A+ 34
B+ 24
(A+ and B+ are controls using enriched mRNA as obtained by sucrose gradient; El and pBR322 are negative controls.)
Restriction analysis and partial sequencing of the inserts indicated that two candidate plasmids, pE4 and pBll were likely to have the complete TNF encoding sequence. The results of this analysis for pE4 are shown in Figure 19. pE4 was deposited at ATCC on 15 October 1984 and has accession no. 39,894. pE4 was sequenced and the correct reading frame for TNF identified by matching the amino acid sequence deduced from translation of all three possible reading frames with the known N-terminal sequence of the native mature TNF as determined by N-terminal sequencing of the purified protein (see Figure 18). The amino acids in the mature protein are numbered starting with the valine at position 1. As noted above, homology was not complete. However, the high degree of homology indicated that the correct cDNA had been chosen. Verification of the experimentally determined restriction cleavage sites shown in Figure 19 is also provided. The Hindlll site upstream of the 3' PstI site in the 1.1 kb PstI fragment is downstream of the stop codon, thus permitting excision of the coding sequence as a Hindlll cassette, after modification of the upstream region as described below.
5. Characteristics of Human TNF as Determined from the DNA Sequence As deduced from the cDNA sequence set forth in Figure 18, the mature TNF protein contains 157 amino acid residues, and has a molecular weight, without glycosylation, of approximately 17,354. The leader sequence apparently contains roughly 76 amino acids, beginning with the first available Met start codon. There are 2 cysteine residues, at positions 69 and 101.
Example .3
Modification of the N-terminal Codons in pE4:
It was convenient, in effecting the expression of the mature protein, to introduce an ATG start codon immediately preceding the GTC sequence encoding N-terminal valine of the mature protein (designated l in Figure 18), as well as to provide a Hindlll site immediately upstream of the ATG for ligation into suitable host expression vectors. This was accomplished by site-directed mutagenesis in a manner analogous to that described in Examples "1. 2 and 5 of U.S. Patent No. 4,578,584, Incorporated herein by reference.
The DNA fragment containing the upstream portion of the coding sequence was excised from pE4 by digestion with PstI, isolated by agarose gel electrophoresis, recovered by electroelution, and ligated into the PstI site of bacteriophage M13mρl8.
The ligated phage were transduced into frozen competent E. coli K12 strain DG98 (ATCC #39768) and cultured by plating on media containing 5 x 10 M isopropyl thiogalactoside (IPTG) obtained from Sigma Chem. (St. Louis. MO) and 40 μg/ml X-gal. Non α-complementing white plaques were picked onto fresh media. Mini-cultures were screened for .recombinant single strand phage DNA containing inserts of the expected (1.1 kb) size. The structure of the desired recombinant phage, designated clone 4.1, was confirmed using restriction analysis.
A chemically synthesized, purified, 33-mer oligodeoxyribonucleotide having the sequence:
5'-GAAGATGATCTGACCATAAGCTTTGCCTGGGCC-3■ was used to introduce a Hindlll restriction enzyme site and an ATG-initiation codon before the GTC codon coding for the first amino acid (valine) of the mature TNF protein.
Ten picorooles of the oligonucleotide were hybridized to 2.6 μg of ss clone 4.1 DNA in 15 μl of a mixture containing 100 mM NaCl, 20 mM Tris-HCl, pH 7.9. 20 mM MgCl. and 20 mM β-mercaptoethanol, by heating at 67βC for 5 min and 42βC for 25 min. The annealed mixtures were chilled on ice and then adjusted to a final volume of 25 μl of a reaction mixture containing 0.5 mM of each dNTP, 17 mM Tris-HCl. pH 7.9, 17 mM MgCl_. 83 mM NaCl, 17 mM /3-raercaptoethanol, 5 unite of DNA polymerase I Klenow fragment, incubated at 37°C for 1 hr. The reactions were terminated by heating to 80°C and the reaction mixtures used to transform competent DG98 cells, plated onto agar plates and incubated overnight to obtain phage plaques.
Plates containing mutagenized clone 4.1 plaques as well as 2 plates containing unrautagenized clone 4.1 phage plaques, were chilled to 4°C and phage plaques from each plate were transferred onto 2 nitrocellulose 5 filter circles by layering a dry filter on the agar plate for 5 min for the first filter and 15 min for the second filter. The filters were then placed on thick filter papers soaked in 0.2 N NaOH. 1.5 M NaCl and 0.2* Triton X-100 for 5 min. and neutralized by layering onto 0 filter papers soaked with 0.5 M Tris-HCl, pH 7.5, and 1.5 M NaCl for another 5 min. The filters were washed in a similar fashion twice on filters soaked in 2 x SSC. dried and then baked in a vacuum oven at 80°C for 2 hr. The duplicate filters were pre-hybridized at 42βC for 4 5 hr with 10 ml per filter of DNA hybridization buffer (5 x SSC, pH 7.0, 4 x Denhardts solution (polyvinyl- pyrrolidine, ficoll and bovin serum albumin, lx - 0.02* of each), 0.1* SDS, 50 mM sodium phosphate buffer, pH 7.0 and 100 μg/ml of denatured salmon sperm DNA. Θ P-labeled probes were prepared by kinasing the primer with labeled ATP. The filters were hybridized to
6 32
5 x 10 cp /ml of P-labeled primer in 1-5 ml per filter of DNA hybridization buffer at 64βC for 8 hr.
The filters were washed once at room 5 temperature for 10 min in 0.1* SDS, 20 mM sodium phosphate (buffer) and 6 x SSC; once at 37°C for 20 min in buffer and 2 x SSC; once at 50°C for 20 min in buffer and 2 x SSC; and finally at 60°C for 20 min in buffer and 1 x SSC. The filters were air dried and 0 autoradiographed at -70°C for 4 hr.
Since the oligonucleotide primer was designed to create a new Hindlll restriction site in the mutagenized clones. RF-DNA from a number of the clones which hybridized with the primer were digested with this restriction enzyme. One of the mutagenized clone 4.1 plaques which has a new Hindlll reβtriciton site (M13-AW701) was picked and inoculated into a culture of DG98, ssDNA was prepared from the culture supernatant and dsRF-DNA was prepared from the cell pellet. The correct sequence is confirmed by dideoxy sequencing.
The correctly synthesized strands were isolated and cleaved with PstI and Hindlll (partial) or with Hindlll alone for ligation into expression vectors.
Example 4
Expression of TNF:
For procaryotic expression, the coding sequence (along with some 3' untranslated nucleotides) was excised from dsM13-AW701 in two ways:
In the first method, the dsM13-AH701 was digested with PstI and then digested partially with
Hindlll to obtain the Hindlll-PstI TNF coding sequence. (Partial Hindlll digestion is required because there are several Hindlll sites in M13-AW701.) The partial digestion of the DNA fragment can be accomplished by using one-tenth the amount of restriction enzyme required for complete digestion of the DNA. The mixture was incubated at the appropriate temperature for the enzyme and aliquots of the digestion mixture were removed at 10 min intervals for up to 1 hr. The aliquots were then loaded onto a gel and the DNA fragments analyzed. The time point that provided the highest yield of the DNA fragment needed was chosen for
a preparative digestion with the restriction enzyme and the appropriate fragment purified from the gel by electroelution.
The Pstl/BamHI fragment containing the 3'-non-coding sequence of the TNF gene (see Figure 2) was purified from pE4 following digestion of the DNA with the enzymes PstI and BamHI.
Together, the Hindlll/PstI and Pstl/BamHI fragments comprise the coding sequence plus a 600bp 3' untranslated portion of DNA. The two fragments were ligated into Hindlll/BamHI digested host vector pTRP3 as follows:
PTRP3 (ATCC 39946), contains the E_j_ coli trp promoter and ribosorae binding site. pTRP3 was dige
.sted with Hindlll and BamHI. and the vector fragment purified on agarose gel. The isolated fragment was then ligated with the above Hindlll/PstI and Pstl/BamHI segments in a 3-way ligation, and the mixture used to transform E. coli MM294 to Amp
R, giving pAW701.
In a second method. dsM13-AW701 was digested with Hindlll and the fragment containing the gene isolated on agarose gel. The isolated fragment was ligated with Hindlll cleaved, BAPped pTRP3, and transformed into E. coli T-M294 to obtain pAW702.. pFC54.t (ATCC 39789) or pPLOP (ATCC 39947), containing the P. promoter and bacillus positive retroregulatory sequence can also be used as host vectors. These vectors are digested with Hindlll and BamHI and the large plas id fragments containing the control sequences purified on agarose gel. The Hindlll/PstI and Pstl/BamHI portions of the TNF gene, prepared as set forth above, are ligated. in a three way ligation, into the Hindlll and BamHI sites of these vectors resulting in plasmids pAH711 and pAH712 respectively. Alternatively, the purified Hindlll fragment from mutagenized pE4 is ligated into Hindlll cleaved, BAPped pFC54.t or pPLOP to give pAW713 and pAH714, respectively. Plasmid pAH711 was deposited with ATCC on 8 November 1984 and has accession no. 39,918.
PAW701 and pAW702 were transferred into E. coli MM294 and the cultures grown under conditions which suppress the trp promoter. Upon induction by tryptophan depletion, production of TNF was initiated. In an analogous fashion. pAN711 was constructed and transferred into E. coli MClOOO-39531, and the cells were induced by high temperature. After several hours of culturing under induction conditions, the cells were sonicated and the sonicates verified to contain TNF by the L-929 cytotoxicity assay. The results are:
Plasmid U/ml
701 1. 3 x IO4
702 1. 3 x IO4 711 2 X IO5
Units of TNF activity are as defined below in
Example 9.
The vector pBll isolated from the cDNA library above, contains the SV40 promoter in operable linkage to the TNF coding sequence. All of the 28 positively hybridizing colonies would be expected to contain this linkage, including, specifically pE4 and pBll, and are thus capable of expression in suitable mammalian hosts. Accordingly, pBll was used to transform COS-7 monkey kidney cells, and the cells cultured under conditions which effect the induction of the SV40 promoter. As the signal sequence is still present in pBll. and functions in mammalian cell systems, the TNF was secreted into the medium. TNF was assayed in the supernatant above the monolayered COS-7 cells by 35S release from L-929 cells, with results as follows:
Plasmid 35S Release (com)
Bll 22,763
E9 (neg controoll)) 2,739
-DNA 2,565
Example 5
Preparation of Coding Sequence and Expression Vectors for TNF Muteins:
Clone 4.1 prepared by PstI treatment of pE4 as described in Example 23 was subjected to site-specific mutagenesis substantially as described in Example 23. but using as primer 5'-CATGGGTGCTCGGGCTGCCTT-3• . which is complementary to the sequence adjacent to the cysteine at position 69, but contains nucleotides complementary to that codon so as to effect a change from TGC to AGC. Mutagenized plaques were identified and confirmed by sequencing as described above. One plaque containing the desired mutation, MB-AH731 was digested with Aval and PstI. and the fragment ligated into Pstl/Aval digested pAW711. The ligation mixture was transferred into E. coli MC1000-39531 to Amp R and the transformants screened with the primer probe for the correct sequence. One colony, designated pAH731, was used for expression of the modified sequence. pAW731 was deposited with ATCC 25 January 1985 and has accession no. 53007.
In an analogous manner, pAH741, an expression vector for βer.-. TNF was prepared using the primer
CAAGAGCCCCTCTCAGAGGGAG.
Expression of the Coding Sequence for and Activity of TNF Muteins:
E. coli MC1000-39531 harboring pAW731 was grown and induced at high temperature in the manner set forth in Example 24. The < sonicates from the induced cells were assayed and found to have approximately the same TNF activity per ml as the pAW711 transformants. However, SDS analysis showed that the amount of 17 kD TNF protein in these extracts is about 5x less, showing that the specific activity of Serg- TNF is higher than that of the natural or wild-type recombinant TNF protein.
Example 7
Expression of the Coding Sequence for Recombinant Ser^g Serιπι Human TNF Mutein
Plasmid ρAW731 (ser69) is digested with Hindlll and Hindi, and the small Hindi I I-HincI I fragment containing the ser69 mutation is purified on agarose gel. Similarly, plasmid pAW732 (serlOl) is digested with the enzymes Hindi and BamHI, and the HincII-BamHI fragment containing the serlOl mutation is purified. The previously purified Hindlll-BamHI vector fragment from pFC54.t is then ligated with the Hindlll-HincII (ser69) fragment and the HincII-BamHI (serlOl) fragment to generate the ser69serl01 TNF clone, pAW735. This dimutein, ser69serl01 TNF, is less likely to dimerize on purification due to the absence of any free cysteines.
Exa pl e 8
Cysteine Residues in Native or Wild-Type Human TNF are not Needed for Biological Activity
Purified (95%) unaltered protein was reduced and alkylated by treating with DTT and iodoacetate according the protocol set forth below. While the untreated protein had an activity in U/ml of 2.6 x
104, reduced, or reduced alkylated protein had activities of 4.4-4.8 x IO4 U/ml:
Treatment Acti IV
No DTT 2.6 X IO4 0.1 mM DTT 3.3 X IO4
1 mM DTT 4.8 X IO4
2 i-M DTT 3.9 X IO4 10 mM DTT 1.2 X IO4 20 mM DTT 1.7 X IO4 buffer + 2.4 mM IAA 1.5 X IO4 1 mM DTT + 2.4 mM IAA 4.4 X IO4
The above data demonstrates that the cysteines in the wild- type recombinant human TNF are not required for biological activity, thus, one or both of the cysteines may be deleted or substituted with another amino acid as provided within the scope of the invention.
Example 9
Cytotoxic Assay Procedure for TNF:
The L-929 assay system is an improved convenient jLri vitro assay which permits rapid measurement of TNF activity. Its degree of correlation with the iri vivo tumor necrosis assay of Carswell (supra) is. at present, unknown; however, as it utilizes murine tumor cells specifically, the correlation is expected to be high. The protein designated lymphotoxin in EPO publication no. 0100641 also gives activity in this assay. The assay is similar in concept to that disclosed in U.S. 4,457,916 which used murine L-M cells and methylene blue staining. However, the L-929 assay has been shown herein to correlate (for HL-60-derived TNF) with human tumor cell line cytotoxicity.
In the L-929 assay system, L-929 cells are prepared overnight as monolayers in microtiter plates. The test samples are diluted 2-fold across the plate, UV irradiated, and then added onto the prepared cell monolayers. The culture media in the wells are then brought to 1 μg/ml actinomycin D. The plates are allowed to incubate 18 hr at 37°C and the plates are scored visually under the microscope. Each well is given a 25. 50, 75 or 100* mark signifying the extent of cell death in the well. One unit of TNF activity is defined as the reciprocal of the dilution at which 50* killing occurs.
In addition, a more sensitive version of this assay was developed that monitors the release of S labeled peptideβ from prelabeled cells, when treated with the test sample and actinomycin D. This version of the assay can be used to quantitate potency, e.g., to evaluate the relative potency of oocyte translated material. Briefly, actively growing L-929 cultures are labeled with 35S methionine (200 μCi/ml) for 3 hr in methionine-free media supplemented with 2* dialyzed fetal calf serum. The cells are then washed and plated into 96 well plates, incubated overnight, and treated the next day with 2-fold dilutions of test samples and 1 μg/ml actinomycin D. The cultures were then incubated at 37°C for 18 hr. 100 μl supernatant aliquots from each well were then transferred onto another 96 well plate, acid (TCA) precipitated, and harvested onto glass fiber filters. The filters were washed with 95* ethanol. dried and counted. An NP4Q detergent control is included in every assay to measure maximum release of
35 radioactivity from the cells. The percent S release is then calculated by the ratio of the difference in count between the treated cells and untreated controls divided by the difference between NP treated cells and untreated controls, i.e., by the ratio:
* release » sample - cell control x 100,
NP 4.υ_ - cell control
Higher TNF potency results in higher values of this ratio.
The TNF muteins of the invention are conveniently formulated into suitable therapeutic formulations which will typically includes a therapeutic effective amount of the mutein and a suitable physiologically acceptable carrier as described above with respect to the IL-2 muteins. Alternatively, other cytotoxic, antiviral or anti-cancer agents may be used in combination with the TNF muteins of the invention such as- gamma interferon.
On 15 October 1984. Applicants have deposited with the American Type Culture Collection, Rockville, MD. USA (ATCC) the plasmid pE4. described hererin. ATCC accession no.39,894 . on 8 November 1984. pAW711 was deposited and given ATCC accession no.39,918 . On 25 January 1985, pAH731 was deposited and given ATCC accession no.53,007 . These deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and the Regulations, thereunder (Budapest Treaty). This assures maintenance of a viable culture for 30 years from date of deposit. The organisms will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Applicants and ATCC which assures unrestricted availability upon issuance of the pertinent US patent. Availability of the deposited strains is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws.
Modifications of the above described modes for carrying out the invention that are obvious to those of skill in the fields of genetic engineering, protein chemistry, medicine, and related fields are intended to be within the scope of the following claims.