Search Images Maps Play YouTube News Gmail Drive More »
Advanced Patent Search | Web History | Sign in

Patents

Publication numberUS5945283 A
Publication typeGrant
Application number08/767,979
Publication date31 Aug 1999
Filing date17 Dec 1996
Priority date
18 Dec 1995
Also published as
Publication number
US 5945283 A
US 5945283A
US5945283 A
US5945283A
Inventors
Original Assignee
U.S. Classification
International Classification
Cooperative Classification
European Classification
C12Q 1/68B2B
References
External Links
Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer
US 5945283 A
Abstract

A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

Claims
What is claimed is:

1. A method for detecting presence of a target site of at least one nucleotide in a sequence of contiguous nucleotides in a sample of nucleic acid comprising:

(a) synthesizing, in the sample, an oligonucleotide on and directed by a template of the contiguous nucleotides including the target site wherein the oligonucleotide comprises two fluorophores each of which is covalently linked to a separate nucleotide; and

(b) detecting a fluorescence energy transfer from one fluorophore to the other upon denaturation and release of the oligonucleotide from the contiguous nucleotides including the target site wherein the detecting of fluorescence energy transfer indicates the presence of the target site.

2. The method according to claim 1 wherein the synthesizing step comprises template-directed 3' extension of a polynucleotide, which is covalently linked to one fluorophore and bound either to the target site or immediately 3' to the target site on the template, by addition of a dideoxynucleoside triphosphate covalently linked to the other fluorophore.

3. The method according to claim 2 wherein one fluorophore is selected from the group consisting of fluorescein, cascade blue, 4,4-difluoro-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid, 4,4-difluoro-5,p-methoxyphenyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid and 4,4-difluoro-5-styryl-4-bora-3a,4-adiaza-S-indacene-propionic acid and the other fluorophore is selected from the group consisting of 6-carboxy-X-rhodamine, N,N,N',N'-tetramethyl-6-carboxyrhodamine, Texas Red, Eosin, fluorescein, 4,4-difluoro-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid, 4,4-difluoro-5,p-methoxyphenyl-4-bora-3a,4a-diaza-s-indacene 3-propionic acid and 4,4-difluoro-5-styryl-4-bora-3a,4a-diaza-S-indacene-propionic acid.

4. The method according to claim 3 wherein one fluorophore is fluorescein and the other fluorophore is 6-carboxy-X-rhodamine or N,N,N',N'-tetramethyl-6-carboxyrhodamine.

5. The method according to claim 3 wherein detecting an increase in emission of one fluorophore upon excitation of the other indicates the presence of the target site in the nucleic acid.

6. The method according to claim 3 wherein detecting a quenching of one fluorophore indicates the presence of the target site in the nucleic acid.

7. The method according to claim 3 wherein the method detects single nucleotide polymorphism.

8. The method according to claim 1 wherein the synthesizing step comprises a template-directed ligation of a first polynucleotide, which is covalently linked to one fluorophore and bound to the target site on the template, to a second polynucleotide covalently linked to the other fluorophore.

9. The method according to claim 8 wherein one fluorophore is selected from the group consisting of fluorescein, cascade blue, 4,4-difluoro-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid, 4,4-difluoro-5,p-methoxyphenyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid and 4,4-difluoro-5-styryl-4-bora-3a,4-adiaza-S-indacene-propionic acid and the other fluorophore is selected from the group consisting of 6-carboxy-X-rhodamine, N,N,N',N'-tetramethyl-6-carboxyrhodamine, Texas Red, Eosin, fluorescein, 4,4-difluoro-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid, 4,4-difluoro-5,p-methoxyphenyl-4-bora-3a,4a-diaza-s-indacene 3-propionic acid and 4,4-difluoro-5-styryl-4-bora-3a,4-adiaza-S-indacene-propionic acid.

10. The method according to claim 9 wherein one fluorophore is fluorescein and the other fluorophore is 6-carboxy-X-rhodamine or N,N,N',N'-tetramethyl-6-carboxyrhodamine.

11. The method according to claim 9 wherein detecting an increase in emission of one fluorophore upon excitation of the other indicates the presence of the target site in the nucleic acid.

12. The method according to claim 9 wherein detecting a quenching of one fluorophore indicates the presence of the target site in the nucleic acid.

13. The method according to claim 9 wherein the method detects single nucleotide polymorphism.

14. A method for detecting presence of a target site of at least one nucleotide in a sequence of contiguous nucleotides in a sample of nucleic acid comprising:

(a) performing, in the sample, a reaction which synthesizes an oligonucleotide on and directed by a template of the contiguous nucleotides including the target site if the target site is present in said sample, wherein the oligonucleotide comprises two fluorophores each of which is covalently linked to a separate nucleotide; and

(b) detecting a fluorescence energy transfer from one fluorophore to the other upon denaturation and release of oligonucleotide if it is synthesized in step (a), wherein the detecting of fluorescence energy transfer indicates the presence of the target site.

Description
DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is based upon the discovery that an oligonucleotide labeled with two fluorophores capable of showing a detectable fluorescence energy transfer can be constructed on a target nucleotide or nucleotide sequence in a nucleic acid so that the synthesized oligonucleotide becomes a probe hybridized to the nucleic acid. Surprisingly, the oligonucleotide can serve as an indicator of the presence of the target nucleotide or nucleotide sequence upon denaturation and release of the oligonucleotide from hybridization to the nucleic acid.

The doubly labeled oligonucleotide of the present invention is formed on the target nucleotide or nucleotide sequence of the nucleic acid from a singly labeled nucleotide or polynucleotide. Thus, upon formation of the doubly labeled oligonucleotide, fluorescence resonance energy transfer can be measured either as a quenching of the donor or increased emission of the acceptor.

Formation, i.e. synthesis, of the doubly labeled oligonucleotide on the target nucleic acid can be by any suitable method so long as the formation step requires the presence of the target nucleotide or nucleotides and a change in fluorescent energy transfer between the two fluorophores can be detected upon denaturation of the oligonucleotide. Preferably, in one embodiment a DNA or RNA polymerase enzyme and in another embodiment a DNA or RNA ligase enzyme is used to form the doubly labeled oligonucleotide on the target nucleic acid template.

One preferred method for preparation of the doubly labeled oligonucleotide hybridized to the target involves first providing a polynucleotide primer designed to hybridize to a target nucleic acid and labeled with one of two fluorophore substances (either a donor or acceptor) capable of fluorescence resonance energy transfer. In the case of genotyping assays where a single nucleotide polymorphism is being detected, the probe binds immediately 3' to the polymorphic site. Each of two dideoxynucleotides representing two possible alleles are labeled with the second fluorophore substance of the donor/acceptor pair. Two samples of target DNA are placed in separate reaction vessels and then to each sample is added a polynucleotide labeled with one member of the donor/acceptor fluorescent dye pair and one of the two dideoxynucleotides complementary to the alleles which is labeled with the other member of the dye pair. The two samples are then incubated under suitable conditions under which the polynucleotide hybridizes to the nucleic acid sample and in the presence of a thermostable DNA polymerase. The reaction is cycled between thermophilic and mesophilic temperatures under conditions such that the polynucleotide is extended by one base when the dideoxynucleoside triphosphate is complementary to the base on the target DNA responsible for the allele. Such conditions suitable for hybridization and for 3' addition of dideoxynucleoside triphosphates are known in the art (see for example, Sambrook et al., supra; Nikiforov et al, Nuc Acids Res 22:4167-4175, 1994; Yershov et al., Proc Natl Acad Sci 93:4913-1918, 1996 which are incorporated by reference). The hybridized primer is only extended when the added dideoxynucleotide is complementary to the target DNA at the polymorphic site. After denaturing to release the doubly labeled oligonucleotide from hybridization to the target, the reaction mixture can be analyzed in a fluorescence spectrophotometer. Fluorescence energy transfer occurs in the single strand, doubly labeled oligonucleotide when a labeled dideoxynucleotide has been incorporated into the hybridized polynucleotide probe. Alternatively, instead of identifying the different alleles in separate incubation reactions, the dideoxynucleoside triphosphates can contain different and distinguishable acceptor or donor fluorescent dyes in which the excitation or emission spectrum differs. This allows the detection of both alleles in the same reaction vessel by detecting a different donor/acceptor reaction for each allele. At least from two to four or more individual acceptor fluorophore-labeled dideoxynucleoside triphosphates can be used in a single reaction so long as the enhanced emission spectra from the acceptor fluorophores are distinguishable. A significant advantage of this method allows for the sequential amplification of a target template nucleotide, the degradation of excess deoxy nucleoside triphosphates and single stranded polynucleotides, and the detection of a target nucleotide sequence to be accomplished in one reaction vessel without the requirement for separation or purification steps.

In a second embodiment, the doubly labeled oligonucleotide is formed by ligation of two singly labeled polynucleotides, each polynucleotide having a sequence complementary to the target nucleic acid. In the case of genotyping assays where a single nucleotide polymorphism is being detected, a first of the two labeled polynucleotides contains a nucleotide complementary to one of two possible nucleotides at the allelic site at either its 3' or 5' end and is otherwise complementary to nucleotides in the nucleic acid that are contiguous with the allelic site. Two such labeled polynucleotides are prepared, one for each allele with one of two different and distinguishable acceptors covalently linked to the allele specific polynucleotide. The second of the two labeled polynucleotides is complementary to the nucleotides that are contiguous to and positioned in the nucleic acid sequence on the other side of the allelic site. The other of the two donor/acceptor fluorescent dye substances is covalently linked to the second polynucleotide. In two parallel reactions, the target DNA sample is incubated with one of the first allele-specific, labeled polynucleotide probes along with the second labeled polynucleotide probe in the presence of a thermostable ligase followed by cycling between thermophilic and mesophilic temperatures. If the acceptor dye-labeled, allele-specific probe perfectly complements the target DNA, it is ligated to the donor dye-labeled probe. After stopping the reaction and denaturing to release the formed, doubly labeled oligonucleotide from hybridization to the nucleic acid, fluorescence is analyzed in a fluorescence spectrophotometer. Alternatively, instead of identifying the different alleles in separate incubation reactions, the allele-specific, first labeled polynucleotides can contain different acceptor or donor fluorescent dyes in which the excitation or emission spectrum is distinguishably different. As with the single nucleotide addition above, this approach allows the detection of two or more alleles in the same reaction vessel by detecting a different donor/acceptor reaction for each allele.

As described earlier, the oligonucleotide is released from the nucleic acid for measurement of fluorescence energy transfer from donor to acceptor. In certain variations of this embodiment, however, the doubly labeled oligonucleotide need not be free in solution, but can be anchored to a support to facilitate automation. Furthermore, the present invention is applicable to DNA chip technology such that a particular marker polynucleotide is at a particular address site on the chip (Pease et al., Proc. Natl. Acad. Sci. 91:5022-6, 1994 which is incorporated by reference).

Fluorescent dye-labeled dideoxynucleoside triphosphates and polynucleotide probes can be purchased from commercial sources. Labeled polynucleotides probes can also be prepared by any of a number of approaches. For example, unlabeled polynucleotides can be prepared by excision, transcription or chemical synthesis. Labeling of the polynucleotide probe with a fluorescent dye can be done internally or by end labeling using methods well known in the art (see, for example, Ju et al., Proc Nat Acad Sci 92:4347-4351, 1995; Nelson et al. Nucleic Acids Res 20:6253-6259, 1992 which are incorporated by reference).

The oligonucleotides and polynucleotides of the present invention are able to form a hybrid structure with a nucleic acid sequence containing the specific target nucleotide or nucleotide sequence, due to complementarity with the target or to a portion of the nucleic acid sequence containing the target. Oligomers suitable for hybridizing to the nucleic acid contain a minimum of about 6-12 contiguous nucleotides which are substantially complementary to the nucleic acid, and preferably about 15 to about 60 nucleotides in length; more preferably from about 18 to about 40 nucleotides in length; and still more preferably from about 20 to about 30 nucleotides in length. Where the fluorophores are not positioned at the 5' and 3' ends of the synthesized oligonucleotides but, instead, are placed internally, the oligonucleotides and polynucleotides from which they are made can be substantially longer: preferably from about 18 to about 1000; preferably from about 20 to about 200 or more nucleotides, more preferably from about 30 to about 100 nucleotides and more preferably from about 40 to about 80 nucleotides.

The oligonucleotide or polynucleotide includes linear oligomers of natural or modified monomers including deoxyribonucleotides, ribonucleotides and the like, capable of specifically binding to a target polynucleotide by way of monomer to monomer interactions such as through Watson-Crick type base pairing.

Specific hybridization or specific binding with respect to a polynucleotide to a complementary polynucleotide as used herein is intended to mean the formation of hybrids between a polynucleotide and a particular target polynucleotide sequence wherein the polynucleotide preferentially hybridizes to the target polynucleotide sequence over sequences other than the target polynucleotide. The polynucleotide or oligonucleotide can be perfectly matched such that the strands making up the duplex form a double stranded structure with one another and every nucleotide in each strand undergoes Watson-Crick base pairing with a nucleotide in the other strand. A mismatch in a duplex between a target polynucleotide and an oligonucleotide or polynucleotide means that a pair of nucleotides in the duplex fails to undergo Watson-Crick bonding.

The stringency of hybridization is determined by a number of factors during hybridization and during the washing procedure including temperature, ionic strength, length of time and concentration of formamide. These factors are outlined in, for example, Sambrook et al. (Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed., 1989 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. which is incorporated by reference).

The present invention uses fluorescence resonance energy transfer between two fluorophores each covalently linked to a separate nucleotide in the detection of a specific nucleotide or nucleotide sequence in a sample of nucleic acid. The emission spectrum of one of the two fluorophores, the donor, overlaps the excitation spectrum of the other, the acceptor. As a result, when the donor is excited its emission is diminished or quenched due to resonance transfer of energy to the acceptor fluorophore and the emission of the acceptor fluorophore is enhanced.

Any of a number of fluorophore combinations can be selected for use in the present invention (see for example, Pesce et al,. eds, Fluorescence Spectroscopy, Marcel Dekker, New York, 1971; White et al., Fluorescence Analysis: A practical Approach, Marcel Dekker, New York, 1970; Handbook of Fluorescent Probes and Research Chemicals, 6th Ed, Molecular Probes, Inc., Eugene, Oreg., 1996; which are incorporated by reference). In general, a preferred donor fluorophore is selected that has a substantial spectrum of the acceptor fluorophore. Furthermore, in may also be desirable in certain applications that the donor have an excitation maximum near a laser frequency such as Helium-Cadmium 442 nM or Argon 488 nM. In such applications the use of intense laser light can serve as an effective means to excite the donor fluorophore. The acceptor fluorophore has a substantial overlap of its excitation spectrum with the emission spectrum of the donor fluorophore. In addition, the wavelength maximum of the emission spectrum of the acceptor moiety is preferably at least 10 nm greater than the wavelength maximum of the excitation spectrum of the donor moiety. The emission spectrum of the acceptor fluorophore is typically in the red portion of the visible spectrum, although, it is believed that acceptor fluorophores having emission at longer wavelengths in the infrared region of the spectrum can be used. A list of examples of fluorophore donor/acceptor combinations is shown in Table 1. The combinations shown are intended to be exemplary only and are not intended to be construed as a limitation of the present invention.

              TABLE 1______________________________________Donor           Acceptor______________________________________Fluorescein     ROX.sup.1           TAMRA.sup.2           Rhodamine           Texas Red           EosinCascade Blue    FluoresceinBODIPY            BODIPY BODIPY            BODIPY ______________________________________ .sup.1. 6carboxy-X-rhodamine (Applied Biosystems Division of PerkinElmer Corporation, Foster City, CA). .sup.2. N,N,N',Ntetramethyl-6-carboxy-rhodamine (Applied Biosystems Division of PerkinElmer Corporation, Foster City, CA), herein tetramethyl6-carboxy-rhodamine. .sup.3. BODIPY  Oregon) used for the fluorophore 4,4difluoro-5,7-diphenyl-4-bora-3a,4a-diaza-S-indacene. The numbers following the name (BODIPY  maxima of derivatives or the parent compound. .sup.4. BODIPY  Oregon) used for the fluorophore 4,4difluoro-5-p-methoxyphenyl-4-bora-3a,4a-diaza-S-indacene. .sup.5. BODIPY  Oregon) used for the fluorophore 4,4difluoro-5-styryl-4-bora-3a,4a-diaza-S-indacene.

Fluorescence resonance energy transfer from a donor to an acceptor fluorophore is known to be dependent upon the distance between the fluorophores. In one study, the transfer efficiency was shown to decrease from a value close to 100% for separation distances of about 12 Angstroms (equivalent to about 3.5 nucleotides) to 16% for a separation distance of about 45 Angstroms (equivalent to about 13 nucleotides). Heller et al. (EP application 0229943) reported that when attached to individual nucleotides of a polynucleotide by 14 Angstrom linker arms, the highest efficiency of energy transfer amounting to 82% occurs at a separation of 5 nucleotide base units when hybridized to the target DNA although a range of 2 to 7 intervening base pairs is taught in this reference. In the unhybridized state, the maximum efficiency was 50% at a separation of 9 nucleotide base units. At a distance of 12 nucleotides separation, the efficiency dropped to 12%.

In contrast, in the present study, separations of the donor and acceptor fluorophores by about 20 nucleotides and about 40 nucleotides produced detectable fluorescence resonance energy transfer. It is noted, however, that in the earlier work reported by Heller et al. the linker arms could also produce an additional separation of fluorophores which could be comparable to longer nucleotide sequences for a given percent efficiency. Nevertheless, although not intending to be bound by any theory, it is possible that fluorescence resonance energy transfer is achieved in the present invention as a result of a hydrophobic interaction between the organic dye molecules when the doubly labeled oligonucleotide is free and in solution. Because the oligonucleotide conformation is no longer restricted by hybridization to the nucleic acid, hydrophobic interaction of the two dyes could result in the donor/acceptor pair of fluorophores being in close proximity to one another even when placed on the oligonucleotide as much as 20 to 40 base pairs apart. Such extreme separation would not have been predicted to allow fluorescence resonance energy transfer based upon the earlier data obtained using probes hybridized to the target nucleic acid.

A significant disadvantage of earlier approaches arose from the requirement that the fluorescent dyes be in close proximity. As a result, in order to hybridize to the target sequence it was necessary to internally label longer oligonucleotide probes. Because the present method measures fluorescence resonance energy transfer upon denaturation and release from hybridization to the target nucleic acid, the oligonucleotide of the present invention can be end labeled with each of the donor/acceptor fluorophores.

Thus, in the present invention the preferred distances between fluorophores is determined not only by the fluorescence resonance energy transfer but, also by the polynucleotide lengths required for hybridization. Because the hybridization is crucial to the assay method, the polynucleotide and oligonucleotide lengths suitable for hybridization are generally believed to be more important so long as a detectable fluorescence resonance energy transfer can be detected. Thus, because the polynucleotide probes must first hybridize to the target nucleic acid for the dideoxynucleoside triphosphate method, doubly labeled oligonucleotides with a fluorophore separation of about 20 nucleotides is preferred. With the ligation method, however, oligonucleotides with a fluorophore separation of about 40 oligonucleotides is preferred because each of two 20-mer polynucleotides that form the oligonucleotide are each required to hybridize to the targeted nucleic acid.

The nucleic acid sample for testing according to the methods in this invention can be obtained from virtually any source including virus, bacteria, fungi, plants, invertebrates and vertebrates including humans and other mammals, birds and the like. If only small amounts of a particular target nucleic acid are available in the sample, amplification by polymerase chain reaction can be used in preparation for analysis (see, for example, Kwok et al., Genomics 23:138-144, 1994 which is incorporated by reference).

Four species are monitored at the end of the assay for three types of fluorescence emission. Two species are the free donor (D.sub.f) and acceptor (A.sub.f) dye ligands; the others are the donor and acceptor dye ligands (D.sub.b and A.sub.b) covalently linked to the oligonucleotide. Total acceptor emission (A.sub.f +A.sub.b) is determined by exciting the reaction mixture at the acceptor's excitation maximum wavelength and measuring emission at its emission maximum. Exciting the reaction mixture at the donor ligand's excitation maximum and measuring emitted light at the donor's emission maximum gives (D.sub.f +D.sub.b) fluorescence due to free donor ligands and quenched fluorescence due to the donor ligands covalently linked to the oligonucleotide. Enhanced acceptor emission (A.sub.e) is determined by exciting at the donor ligand's excitation maximum and measuring emitted light at the acceptor ligand's emission maximum. (A.sub.e / A.sub.f +A.sub.b !) normalizes the acceptor fluorescence to account for variations in acceptor dye ligand concentrations between reactions.

Typically assays include appropriate controls that are commonly used in the art. For example, two DNA samples known to contain one allele and two DNA samples known to contain the second allele can be used. These can serve as positive and negative controls for the alleles assayed. A random PCR product without the allelic site can also serve as a negative control.

Fluorescence enhancement (FE) is measured from the formula FE= A.sub.e /(A.sub.f +A.sub.b)!/(D.sub.f +D.sub.b). Results are positive when FE.sub.sample > FE.sub.control +6.95.times.Standard Deviation.sub.control ! which is equivalent to statistical significance at the 99% confidence level in the Students t-Test.

Unlike the prior art, the present invention does not require radioactive reagents, product capture, product separation, or multi-step post-reaction processing and purification. The invention is highly suitable for processing large numbers of DNA samples in parallel, is easier to use than those in the prior art, and can be automated.

Kits are packaged to aid research, clinical, and testing labs to carry out the invention. For the dideoxynuclooside triphosphate based assays, kits contain an oligonucleotide that binds immediately 3'- to a polymorphic site labeled with one member of a donor/acceptor fluorescent dye pair and each of two or more dideoxynucleoside triphosphates complementary to the alleles labeled with different fluorophores constituting the other member of the dye pair, and may include thermostable DNA polymerase, other buffers and reagents needed for the procedure, and instructions for carrying out the assay.

For oligonucleotide ligation assays, kits contain two polynucleotides, each having a sequence complementary to the target DNA that includes an allelic site, and each is labeled with one of two or more different fluorescent acceptors dyes having different emission maxima, and an polynucleotide having a sequence complementary to the target DNA at a site immediately adjacent to the allelic site labeled with a donor fluorescent dye chosen so that its emission spectrum overlaps the excitation spectrum of both acceptor dyes. Oligonucleotide ligation assay kits may also include a thermostable ligase, other buffers and reagents needed for the procedure, and instructions for carrying out the assay.

The kits contain a single set of polynucleotide and/or dideoxynucleoside triphosphate reagents to detect a single allelic difference or sets of reagents to detect multiple alleles. Kits can be packaged for manual or automated procedures. All reagents are packaged in containers for storage at either freezer, refrigerator, or room temperature.

Preferred embodiments of the invention are described in the following examples. Other embodiments within the scope of the claims herein will be apparent to one skilled in the art from consideration of the specification or practice of the invention as disclosed herein. It is intended that the specification, together with the examples, be considered exemplary only, with the scope and spirit of the invention being indicated by the claims which follow the examples.

EXAMPLE 1

This example Illustrates the identification of a single base difference between four unique synthetic forty mer nucleic acid molecules using a template directed nucleotide incorporation assay.

Synthetic polynucleotides were used to establish the sensitivity and specificity of fluorescence resonance energy transfer in detecting fluorophore labeled dideoxynucleoside incorporation. A set of four 40 mers comprised of an identical sequence except for the base at position twenty-one were synthesized. Each of the four possible bases A, C, G or T were uniquely represented at position 21 in each of the four different templates as shown in Table 2. The fluorescein-labeled polynucleotide was synthesized and purified by reverse-phase HPLC by the supplier (GENSET Corp., La Jolla, Calif.). The template 40 mers were synthesized by the Genome Sequencing Center at Washington University (St. Louis, Mo.).

                                  TABLE 2__________________________________________________________________________Oligomer Nucleotide Sequence.sup.2     SEQ ID NO:__________________________________________________________________________s14102-40A 5'-ATTTTACAAAAATAAAACAAAGAAACCACTAAGCCATAAA                               1s14102-40C 5'-ATTTTACAAAAATAAAACAACGAAACCACTAAGCCATAAA                               2s14102-40G 5'-ATTTTACAAAAATAAAACAAGGAAACCACTAAGCCATAAA                               3s14102-40T 5'-ATTTTACAAAAATAAAACAATGAAACCACTAAGCCATAAA                               4s14102-F.sup.1 5'-F.sup.1 -TTTATGGCTTAGTGGTTTC                               5__________________________________________________________________________ .sup.1. Fluorescein label. .sup.2. Underlined nucleotides are unique to that sequence.

Each 40 mer served as a template in four separate reactions where it was incubated with the 5' fluorescein-labeled polynucleotide and one of four 6-carboxy-X-rhodamine conjugated dideoxynucleoside triphosphates in the presence of Klentaq1-FY (obtained from the laboratories of Dr. Wayne Barnes, Washington University, St. Louis, Mo.) and the other three non-labeled dideoxynucleoside terminators. 6-carboxy-X-rhodamine conjugated dideoxynucleoside triphosphates were obtained from DuPont NEN (Boston, Mass.). Non-labeled dideoxynucleoside triphosphates were purchased from Pharmacia Biotech (Piscataway, N.J.). Reactions were performed in 20 μl reaction volumes containing 50 mM Tris-HCl, pH 9.0, 50 mM KCl, 5 mM NaCl, 5 mM MgCl.sub.2, 8% glycerol, 0.1% Triton X-100, 25 nM fluorescein-labeled primer, 100 nM 6-carboxy-X-rhodamine conjugated dideoxynucleoside triphosphate, >50 nM of a synthetic 40-mer, and 250 nM of the other three non-labeled dideoxynucleoside triphosphates. Reactions were incubated in a GeneAmp 9600 thermo cycler (Perkin/Elmer) at 93 93 Reactions were terminated by the addition of 10 μL of 50 mM EDTA, pH 9

At the end of the reaction, products may be analyzed by at least one of three independent methods. One method resolves products and reactants in a sequencing gel (6% polyacrylamide, 8 M urea, 1 buffer) on an Applied Biosystems 373A automatic DNA sequencer (Perkin/Elmer Applied Biosystems Division, Foster City, Calif.). Fluorescent species are analyzed using GeneScan 672 software (Perkin/Elmer) to monitor the incorporation of fluorophore-labeled dideoxynucleoside triphosphates. Another method involves denaturing and diluting the reaction mixtures with the addition of 150 μl 0.2 N NaOH. The diluted reaction mixtures are transferred to a 96-well white microplate (Perkin/Elmer). The fluorescence emission of the fluorophores is determined using a Luminescence Spectrometer LS-50B (Perkin/Elmer). A preferred method measures the fluorescence intensity changes during thermal cycling using the Sequence Detection System 7700 (Perkin/Elmer) without any further manipulations or reaction sampling.

The reactions above were analyzed after electrophoresis on a sequencing gel using the GeneScan analysis software. 2 μl of each reaction mixture was added to 3 μL of loading buffer (98% formamide and 10 mM EDTA) and loaded onto a sequencing gel and reactants and products were resolved by electrophoresis for 1.5 hours at 300 V constant. Fluorescent species were analyzed using GeneScan 672 software to monitor the incorporation of fluorophore-labeled dideoxynucleoside triphosphates. The GeneScan gel image confirmed that only the one base that was perfectly complementary to the specific template was incorporated in each reaction (FIG. 3). Fluorescein labeled polynucleotides migrate slightly differently depending on the terminator incorporated. For example, the fluorescein signals for lanes 12, 16, and 20, in which non-labeled dideoxyadenosine was incorporated, migrated the same distance in the gel. The same was observed for the signals in lanes 7, 15, and 19 for dideoxycytosine incorporation, lanes 6, 10, and 18 for dideoxyguanidine incorporation, and lanes 5, 9, and 13 for dideoxyuridine incorporation. In lanes in which a 6-carboxy-X-rhodamine conjugated dideoxynucleoside was incorporated, the fluorescein and 6-carboxy-X-rhodamine signals comigrated and were retarded due to the fluorophore molecule as noted in lanes 8, 11, 14 and 17. Chromatograms of the control lanes (1-4) and the positive reaction lanes (8, 11, 14, 17) were produced (FIG. 4). The emission signals from fluorescein and from 6-carboxy-X-rhodamine are seen as separate peaks in the control lanes. However, the dual labeled oligonucleotide appears as a new peak, indicated as a comigrating fluorescein and 6-carboxy-X-rhodamine emission peak in the positive reaction samples, confirming the specificity of each reaction.

Fluorescence spectrophotometric analysis as shown in FIG. 3 of the reaction mixture at the end of the TDI assay showed that 3 types of changes in fluorescence intensity were observed when dye-terminators were incorporated. The first two types of changes were seen when the reaction mixture was excited by light at the fluorescein-specific absorption wavelength (488 nm), namely, a reduction in fluorescein-specific emission (FF) due to quenching by the incorporated dye and an increase in 6-carboxy-X-rhodamine-specific emission (FR) due to fluorescence resonance energy transfer. The third type of change was observed when the mixture was excited by light at the 6-carboxy-X-rhodamine-specific absorption wavelength (580 nm): a reduction in acceptor 6-carboxy-X-rhodamine (RR) emission due to quenching by the DNA oligomer to which the acceptor had attached. The fluorescence readings for each lane in FIG. 3 show these changes and in each of the 3 intensity changes, the difference between the positive reactions and negative reactions was highly significant, with the exception of the RR reading for 6-carboxy-X-rhodamine conjugated dideoxyguanidine. The FE.sub.S /FE.sub.C ratios for the positive assays ranged from 190% to 360%.

Based on a series of dilution experiments using the single-stranded synthetic templates, significant differences were found between positive and negative reactions at >5 nM template concentrations (data not shown).

EXAMPLE 2

This example illustrates the identification of single nucleotide polymorphisms in human PCR amplified sequence tagged sites using a template directed nucleotide incorporation assay.

The most common DNA sequence variations are represented by single base pair mutations known as single nucleotide polymorphism. Approximately one polymorphic site is found for every 500 to 1,500 base pairs in human genomic DNA (D. N. Cooper et al., Human Genetics, 69:201-205, 1985). A significant fraction of these polymorphisms are known to be linked to genetic diseases. The template directed nucleotide incorporation assay provides a unique method for detecting the presence of a single nucleotide polymorphism in a nucleotide sample. Two human polymorphic sequence tagged sites, D18S8 (Parry et al., Nucl. Acids Res., 19:6983, 1991, incorporated herein by reference), and DXS17 (Kornreich et al., Genomics, 13:70-74, 1992, incorporated herein by reference), each previously shown to contain a single nucleotide polymorphism, were used to show the sensitivity and specificity of the template directed nucleotide incorporation assay in typing these polymorphic alleles.

Polynucleotides for PCR amplification of these two independent sequence tagged sites, and sequence tagged site specific 5' end fluorescein-labeled polynucleotide probes were synthesized as in example 1. The DNA sequence of each sequence tagged site flanking the allelic marker, and the polynucleotides used to generate and identify those sequences are shown in Table 3. Forty independent human DNA sources with known genotypes were PCR amplified for each sequence tagged site. Target nucleic acid sequences were amplified in 200 μl thin walled polyallomer MicroAmp tubes (Perkin/Elmer) on a GeneAmp 9600 thermo cycler (Perkin/Elmer). AmpliTaq DNA polymerase was purchased from Perkin/Elmer Corporation (Foster City, Calif.). Fluorophore-labeled dideoxynucleoside triphosphates were obtained from DuPont NEN (Boston, Mass.). Unlabeled dideoxynucleoside triphosphates were purchased from Pharmacia Biotech (Piscataway, N.J.). Human genomic DNA (20 ng) from test subjects was amplified in 40 μl in 50 mM Tris HCl, pH 9.0, 50 mM KCl, 5 mM NaCl, 1.5 mM MgCl.sub.2, 0.2 mM dNTP, 1 μM of each PCR primer, and AmpliTaq DNA polymerase (2U). PCR reaction mixtures were held at 94 cycles of 94 ninety seconds, held at 68 thirty cycles of 94 thirty seconds. The PCR products expected are a 367 base pair D18S8 segment, and a 620 base pair DXS17 segment. The PCR products were gel purified on a 1% agarose gel in 1 bromide, excised under long wavelength UV transillumination (365 nm), and extracted using the Promega Wizard PCR purification system (Promega Inc., Madison, Wis.).

The gel purified PCR reaction products were used as templates and subjected to template directed nucleotide incorporation analysis using appropriate fluorescein-labeled polynucleotides DXS17-F (SEQ ID:15) or D18S8-F (SEQ ID:10) as in Table 3. The templates were placed in two parallel reactions containing an appropriate fluorescein-labeled primer and one of the allelic 6-carboxy-X-rhodamine conjugated dideoxynucleoside triphosphates. Reactions were performed as in example 1, except that 25 nM fluorescein-labeled polynucleotide, 100 nM 6-carboxy-X-rhodamine conjugated dideoxynucleoside triphosphate, and >50 ng gel purified PCR reaction product were used. Samples of the reactions were analyzed by fluorescence spectroscopy, and the results are presented in Table 4 for DXS17 and in Table 5 for D18S8.

                                  TABLE 3__________________________________________________________________________Oligomer  Sequence                    SEQ ID NO:__________________________________________________________________________D18S8-p1  5'-TTGCACCATGCTGAAGATTGT     6D18S8-p2  5'-ACCCTCCCCCTGATGACTTA      7D18S8  5'-AGGAGAATTGCTTGAACCCAGGAGGCAGAGCTTGCAGTGA                               8Allele AD18S8  5'-AGGAGAATTGCTTGAACCCGGGAGGCAGAGCTTGCAGTGA                               9Allele GD18D8 ProbeF.sup.1 -CACTGCAAGCTCTGCCTCC  10DXS17-p1  5'-GCAATTATCTGTATTACTTGAAT  11DXS17-p2  5'-GGTACATGACAATCTCCCAATAT  12DXS17  5'-ATTGGATTATTTGTAACTCGAAGGATAAGTGCATAAGGG                              13Allele ADXS17  5'-ATTGGATTATTTGTAAACTCGAAGGATAAGT GCATAAAGGG                              14Allele GDXS17 Probe  5'-ATTGGATTATTTGTAACTCGAAGGATAAGTGCATATAAGGG                              15__________________________________________________________________________ .sup.1 Fluorescein

Fluorescence enhancement (FE) was calculated by the formula FE= A.sub.e /(A.sub.f +A.sub.b)!/(D.sub.f +D.sub.b). PCR products that do not contain the specific alleles served as controls. Samples were scored positive when FE.sub.sample > FE.sub.control +6.95.times.Standard Deviation.sub.control !. This corresponds to a cutoff ratio for FE.sub.sample /FE.sub.control of 1.25. FF, FR, and RR values were obtained as in Example 1.

                                  TABLE 4__________________________________________________________________________TDI assay data for diallelic marker DXS17Rox-ddC             Rox-ddUSampleFF FR/RR       FE FE.sub.s /FE.sub.c               FF FR/RR                      FE FE.sub.s /FE.sub.c                              Genotype__________________________________________________________________________1    239   0.17       0.07          0.84 178                  0.35                      0.20                         1.84 T/T2    160   0.32       0.20          2.29 172                  0.31                      0.18                         1.68 C/T3    143   0.37       0.26          3.02 203                  0.20                      0.10                         0.90 C/C4    208   0.19       0.09          1.05 136                  0.44                      0.32                         3.00 T/T5    174   0.28       0.16          1.84 203                  0.19                      0.10                         0.89 C/C6    220   0.18       0.08          0.95 134                  0.47                      0.35                         3.26 T/T7    214   0.18       0.08          0.98 133                  0.43                      0.33                         3.05 T/T8    150   0.39       0.26          3.00 149                  0.40                      0.27                         2.52 C/T9    132   0.42       0.32          3.66 199                  0.20                      0.10                         0.93 C/C10   214   0.18       0.08          0.98 138                  0.42                      0.31                         2.89 T/T11   214   0.18       0.08          0.97 127                  0.48                      0.38                         3.54 T/T12   213   0.18       0.09          0.99 132                  0.44                      0.33                         3.11 T/T13   208   0.19       0.09          1.04 145                  0.36                      0.25                         2.33 T/T14   154   0.35       0.23          2.63 157                  0.36                      0.23                         2.17 C/T15   214   0.18       0.09          0.99 200                  0.19                      0.10                         0.91 --16   126   0.44       0.35          4.00 200                  0.20                      0.10                         0.95 C/C17   207   0.17       0.08          0.95 143                  0.40                      0.28                         2.61 T/T18   216   0.17       0.08          0.92 136                  0.44                      0.32                         3.03 T/T19   207   0.17       0.08          0.95 176                  0.24                      0.14                         1.28 T/T20   139   0.38       0.27          3.15 197                  0.20                      0.10                         0.93 C/C21   174   0.25       0.14          1.63 189                  0.19                      0.10                         0.94 C/C22   190   0.25       0.13          1.51 200                  0.19                      0.10                         0.91 C/C23   167   0.30       0.18          2.10 193                  0.19                      0.10                         0.94 C/C24   175   0.28       0.16          1.83 196                  0.20                      0.10                         0.95 C/C25   183   0.25       0.14          1.61 203                  0.20                      0.10                         0.91 C/C26   199   0.19       0.10          1.10 195                  0.21                      0.11                         0.99 --27   189   0.22       0.12          1.37 201                  0.19                      0.10                         0.90 C/C28   172   0.27       0.16          1.80 194                  0.20                      0.10                         0.96 C/C29   207   0.18       0.08          0.98 160                  0.32                      0.20                         1.897                              T/T30   195   0.23       0.12          1.34 182                  0.25                      0.14                         1.29 C/T31   193   0.20       0.10          1.19 138                  0.39                      0.28                         2.62 T/T32   159   0.35       0.22          2.51 205                  0.20                      0.10                         0.92 C/C33   209   0.18       0.09          0.99 155                  0.32                      0.21                         1.94 T/T34   213   0.17       0.08          0.94 142                  0.39                      0.27                         2.54 T/T35   139   0.38       0.27          3.17 167                  0.21                      0.13                         1.19 C/C36   212   0.18       0.08          0.96 136                  0.41                      0.30                         2.83 T/T37   190   0.19       0.10          1.16 158                  0.23                      0.14                         1.35 T/T38   165   0.33       0.20          2.31 158                  0.34                      0.22                         2.04 C/T39   209   0.18       0.08          0.98 146                  0.30                      0.27                         2.50 T/T40   155   0.33       0.21          2.43 151                  0.35                      0.23                         2.18 C/Tcontrol 1213   0.18       0.09    193                  0.21                      0.11control 2214   0.18       0.08    196                  0.20                      0.10control 3205   0.17       0.08    192                  0.20                      0.10control 4211   0.18       0.08    193                  0.20                      0.11control 5200   0.18       0.09    189                  0.20                      0.11control 6204   0.18       0.09    190                  0.21                      0.11control 7201   0.18       0.09    188                  0.19                      0.10control 8205   0.18       0.09    188                  0.21                      0.11__________________________________________________________________________

                                  TABLE 5__________________________________________________________________________TDI assay data for diallelic marker D18S8Rox-ddC             Rox-ddUSampleFF FR/RR       FE FE.sub.s /FE.sub.c               FF FR/RR                      FE FE.sub.s /FE.sub.c                              Genotype__________________________________________________________________________1    231   0.30       0.13          1.35 238                  0.36                      0.15                         1.19 C/T2    185   0.37       0.20          2.09 235                  0.28                      0.12                         0.96 C/C3    191   0.38       0.20          2.09 238                  0.28                      0.12                         0.92 C/C4    207   0.33       0.16          1.66 230                  0.29                      0.12                         0.99 C/C5    1888   0.40       0.21          2.24 231                  0.28                      0.12                         0.96 C/C6    197   0.37       0.19          1.96 250                  0.27                      0.11                         0.85 C/C7    187   0.38       0.20          2.13 236                  0.29                      0.12                         0.96 C/C8    218   0.32       0.15          1.53 217                  0.38                      0.17                         1.38 C/T9    192   0.38       0.20          2.10 245                  0.27                      0.11                         0.88 C/C10   235   0.22       0.09          1.00 200                  0.46                      0.23                         1.82 T/T11   190   0.35       0.19          1.95 231                  0.28                      0.12                         0.96 C/C12   192   0.38       0.20          2.05 237                  0.27                      0.12                         0.91 C/C13   176   0.41       0.23          2.44 232                  0.29                      0.12                         0.97 C/C14   188   0.37       0.20          2.06 243                  0.28                      0.11                         0.91 C/C15   186   0.37       0.20          2.11 239                  0.27                      0.11                         0.90 C/C16   202   0.33       0.16          1.70 212                  0.37                      0.17                         1.36 C/T17   181   0.39       0.21          2.24 234                  0.27                      0.12                         0.93 C/C18   176   0.39       0.22          2.33 241                  0.27                      0.11                         0.89 C/C19   193   0.33       0.17          1.76 205                  0.40                      0.19                         1.54 C/T20   169   0.43       0.25          2.65 231                  0.29                      0.12                         0.98 C/C21   187   0.35       0.19          1.95 204                  0.42                      0.21                         1.63 C/T22   196   0.31       0.17          1.76 211                  0.36                      0.17                         1.37 C/T23   194   0.32       0.16          1.72 212                  0.37                      0.18                         1.39 C/T24   195   0.33       0.17          1.75 208                  0.39                      0.19                         1.50 C/T25   221   0.31       0.14          1.48 228                  0.34                      0.15                         1.19 C/T26   212   0.30       0.14          1.48 214                  0.36                      0.17                         1.35 C/T27   192   0.37       0.19          2.02 236                  0.27                      0.12                         0.91 C/C28   198   0.31       0.16          1.65 204                  0.38                      0.19                         1.47 C/T29   182   0.41       0.23          2.37 237                  0.29                      0.12                         0.98 C/C30   188   0.39       0.21          2.164               236                  0.29                      0.12                         0.97 C/C31   205   0.31       0.15          1.57 236                  0.28                      0.12                         0.94 C/C32   204   0.32       0.16          1.64 207                  0.38                      0.18                         1.47 C/T33   211   0.30       0.14          1.51 205                  0.37                      0.18                         1.43 C/T34   191   0.36       0.19          1.98 226                  0.30                      0.13                         1.04 C/C35   174   0.39       0.22          2.33 224                  0.28                      0.12                         0.98 C/C36   237   0.22       0.09          0.97 190                  0.47                      0.24                         1.94 T/T37   181   0.39       0.21          2.24 226                  0.29                      0.13                         1.03 C/C38   189   0.37       0.20          2.06 227                  0.28                      0.12                         0.98 C/C39   212   0.3O       0.14          1.50 206                  0.38                      0.19                         1.50 C/T40   184   0.34       0.19          1.96 227                  0.29                      0.13                         1.01 C/Ccontrol 1235   0.22       0.09    234                  0.29                      0.12    --control 2244   0.22       0.09    243                  0.29                      0.12    --control 3234   0.22       0.09    226                  0.30                      0.13    --control 4230   0.23       0.10    230                  0.29                      0.13    --control 5232   0.23       0.10    229                  0.28                      0.12    --control 6231   0.22       0.10    229                  0.29                      0.13    --control 7229   0.22       0.10    227                  0.29                      0.13    --control 8228   0.22       0.10    222                  0.29                      0.13    --__________________________________________________________________________

All but two of the forty samples tested for the DXS17 locus provided definitive genotypes with the positive threshold set at FE.sub.Sample /FE.sub.Control greater than 1.25. The two samples which yielded no definitive genotypes were analyzed by agarose gel electrophoresis and were shown to have very weak product bands, indicating suboptimal PCR amplification as the reason for this result. However, all D18S8 locus DNA samples were amplified successfully. All forty D18S8 samples provided definitive genotypes when the positive threshold is set at FE.sub.Sample /FE.sub.Control greater than 1.15.

The D18S8 results were also analyzed by plotting the enhanced emission ratio of a sample in one allelic reaction over that for the same sample in the other allelic reaction against the fluorescein emission intensity ratios in the same reactions and are shown in FIG. 5. The homozygous and heterozygous alleles segregate into three groups with the homozygous thymidine samples identified using dideoxyuridine incorporation occupying the lower right corner of the plot, the homozygous cytosine samples in the upper left corner, and the heterozygotes in the center. External controls are not required when this type of plot is used.

EXAMPLE 3

This example illustrates the identification of a RET oncogene mutation in individual PCR amplified human DNA samples in a template directed nucleotide incorporation assay.

Heterozygous carriers of a single mutant RET allele are at high risk for developing multiple endocrine neoplasia, type 2 (MEN2), or familial medullary thyroid carcinoma (FMTC). Over twenty different single base-pair mutations in the RET oncogene have been found in families with MEN2/FMTC and the majority of these mutations are found in exons 10 and 11. The largest group of MEN2 families in our samples are affected by a change in codon 634 of exon 11. The mutation changes a cysteine codon (TGC) to a phenylalanine codon (TTC). A template directed nucleotide incorporation assay was used to detect the presence of the normal cysteine and the mutant phenylalanine codons in human DNA samples.

The PCR primers and fluorescein labeled template dependent nucleotide incorporation assay polynucleotide used to detect the MEN2C634F allele are shown in Table 6.

              TABLE 6______________________________________                      Annealing SEQPrimer Sequence.sup.1      Temp.     ID NO:______________________________________MEN11p1  5'cctctgcggtgccaagcctc                      -         16MEN11p2  5'-caccggaagaggagtagctg                      -         17MENC634F  5'-F.sup.1 -ccactgtgcgacgagctgt                      60                                18______________________________________ .sup.1 Fluorescein

PCR reactions for amplification of target template DNA were prepared as in Example 2 with the following exceptions. The PCR primers MEN11p1 (SEQ ID:16) and MEN11p2 (SEQ ID:17) were used to amplify a 234 base pair product from exon 11 of the RET oncogene. The annealing and extension temperature was maintained at 60 at 53

30 μl of an enzymatic cocktail containing 5 U shrimp alkaline phosphatase (Amersham), 2.5 U exonuclease I (Amersham), and 5 μl of lox shrimp alkaline phosphatase (SAP) buffer (200 mM Tris HCl, pH 8.0, 100 mM MgCl.sub.2) was added to 20 μl of each PCR reaction mixture to degrade excess polynucleotides and dephosphorylate excess deoxynucleoside triphosphates. Each mixture was incubated at 37 minutes before heat inactivation at 95 samples were maintained at 4 directed nucleotide incorporation assay without further quantitation or characterization.

Reaction mixtures containing 60 nM of the RET oncogene fluorescein-labeled polynucleotide primer MENC634F (SEQ ID:18) and an appropriate 6-carboxy-X-rhodamine conjugated dideoxynucleoside triphosphate were mixed with 10 μl of each enzymatically treated PCR product, thermally cycled, and terminated as in example 1, except that the annealing temperature was set at 60

The bases to be discriminated lie immediately 3' of the fluorescein-labeled polynucleotide. Therefore, two reactions were prepared. One reaction contained 6-carboxy-X-rhodamine conjugated dideoxyguanidine and the other reaction contained 6-carboxy-X-rhodamine conjugated dideoxyuridine.

After the reactions were completed, samples were transferred to microplates, denatured, and fluorescence enhancement was determined as in Example 2. All tests were completed in duplicate and the results were then compared to those obtained by the DNA Diagnostic Laboratory (Washington University, St. Louis, Mo.) using the same PCR amplified alleles to which restriction fragment length polymorphism analysis (RFLP) is applied using the restriction endonuclease BsoF1. The results of the assay for twenty-nine individuals from these families are shown in Table 7.

              TABLE 7______________________________________TDI Assay Results for Mutation MENC634F    FE.sub.sample /FE.sub.control                Expected ObservedSample I.D.      ddG     ddT       Genotype                               Genotype______________________________________93-739     1.27    1.29      G/T    G/T94-740     2.16    0.91      G/G    G/G94-744     2.04    0.94      G/G    G/G94-745     1.32    1.37      G/T    G/T94-775     1.35    1.48      G/T    G/T94-776     1.33    1.49      G/G    G/G94-777     2.24    0.89      G/T    G/T94-778     2.28    0.91      G/G    G/G95-100     1.32    1.58      G/T    G/T95-101     1.37    1.59      G/T    G/T95-102     1.29    1.53      G/T    G/T95-103     1.35    1.48      G/T    G/T95-104     1.37    1.36      G/T    G/T95-105     1.31    1.47      G/T    G/T95-106     1.32    1.39      G/T    G/T95-107     1.31    1.53      G/T    G/T95-108     1.34    1.55      G/T    G/T95-109     1.91    1.08      G/G    G/G95-110     1.33    1.41      G/T    G/T95-111     1.31    1.54      G/T    G/T95-112     1.31    1.45      G/T    G/T95-113     2.30    0.91      G/G    G/G95-114     1/35    1.52      G/T    G/T95-115     2.34    0.88      G/G    G/G95-116     2.29    0.93      G/G    G/G95-117     1.35    1.59      G/T    G/T95-118     1.34    1.62      G/T    G/T95-119     2.28    0.92      G/G    G/G95-120     2.46    0.93      G/G    G/G______________________________________

There are three results that may be expected when screening for this particular allelic mutation. Normal homozygous alleles each contain guanidine at the target position. Heterozygous individuals contain one normal and one mutant allele, indicated by the presence of a normal guanidine at one target position, and a thymidine in the other. The other expected genotype is also a homozygous individual in which both alleles are mutant and contain thymidine at the target position. The results show that these alleles are easily discriminated using the template directed nucleotide incorporation assay. The expected genotype from each allele matched the genotype observed using the PCR-RFLP method.

EXAMPLE 4

This example illustrates the identification of a three base mutation in the human cystic fibrosis gene using one fluorophore-labeled dideoxynucleoside triphosphate in a single sample using the template directed nucleotide incorporation assay.

Seventy percent of cystic fibrosis patients have a three base pair deletion in exon 5 of the cystic fibrosis gene (CF508). The carrier rate of this mutation is about five percent in the Caucasian population. Thirty-eight individuals from families with cystic fibrosis provided blood, from which DNA was obtained. These DNA samples were tested for the presence of the CF508 mutation in the cystic fibrosis gene. The PCR primers and fluorescein labeled template directed nucleotide incorporation assay polynucleotide used to detect the CF508 allele are shown in Table 8. The PCR primers CF508p1 (SEQ ID:19) and CF508p2 (SEQ ID:20) were used as in example 2 to amplify a 578 base pair segment from exon 5 of the cystic fibrosis gene in DNA from each of these thirty-eight individual patients. The PCR product is useful in testing for the presence of the unique three base pair deletion.

                                  TABLE 8__________________________________________________________________________                       Annealing                              SEQPrimer Sequence.sup.1        Temp.  ID NO:__________________________________________________________________________CF508p1 5'-gtgcatagcagagtacctgaaacaggaagta                       -      19CF508p2 5'-tgatccattcacagtagcttacccatagagg                       -      20CF508F25 5'-F.sup.1 -ctggcaccattaaagaaaatatcat                       50                              21__________________________________________________________________________ .sup.1 Fluorescein.

The bases to be discriminated in carriers of the CF508 allele are known from DNA sequence analysis to be either a cytosine or a thymidine. These lie immediately 3' of the fluorescein-labeled polynucleotide, CF508F25 (SEQ ID:21), when hybridized to the template nucleotide sequence. Separate reactions were used, each containing only one fluorophore-labeled dideoxynucleoside triphosphate, to determine the presence or absence of the CF508 mutation in each DNA sample. PCR amplified DNA samples were subjected to a template directed nucleotide incorporation assay without further purification of products after treatment with shrimp alkaline phosphatase and exonuclease III as in example 3. Template directed nucleotide incorporation reaction conditions were as in example 3, except that each reaction contained either 6-carboxy-X-rhodamine conjugated dideoxycytosine or 6-carboxy-X-rhodamine conjugated dideoxyuridine. Therefore, individual reactions were carried out to distinguish the presence or absence of the respective alleles.

The results are shown in FIG. 6 after plotting the enhanced emission ratios of each allelic reaction as in example 2 and show a distribution of data points similar to those observed in FIG. 5. The homozygous and heterozygous alleles segregate into three groups with the homozygous thymidine samples identified using dideoxyuridine incorporation occupying the lower right corner of the plot, the homozygous cytosine samples in the upper left corner, and the heterozygotes in the center.

EXAMPLE 5

This example illustrates the identification of a three base mutation in exon 5 of the cystic fibrosis gene using two different fluorophore-labeled dideoxynucleoside triphosphates in a single sample using the template directed dideoxynucleotide incorporation assay.

The PCR amplified, phosphatase and exonuclease treated DNA samples used in example 4 were subjected to a template directed nucleotide incorporation assay. The presence of wild type and mutant CF508 alleles were detected in single reaction volumes for each patient DNA sample. Thus, each individual template dependent nucleotide incorporation assay contained 6-carboxy-X-rhodamine conjugated dideoxycytosine and tetramethyl-6-carboxyrhodamine conjugated dideoxyuridine as acceptor fluorophore-conjugated dideoxynucleoside triphosphates. Template directed nucleotide incorporation assays were completed as in example 4, and the fluorescence emission of the fluorophores was determined using an LS-50B spectrometer.

Fluorescein emission of each sample (FF.sub.obs) was determined by exciting the sample at 488 nm with a slit width of 5 mm and detecting the emission at 515 nm with a slit width of 4 mm. 6-carboxy-X-rhodamine emission (RR.sub.obs) was determined by exciting the sample at 580 nm with a slit width of 5 mm and detecting the emission at 605 nm with a slit width of 6 mm. Tetramethyl-6-carboxyrhodamine (TT.sub.obs) emission was determined by exciting the sample at 547 nm with a slit width of 5 mm and detecting the emission at 583 nm with a slit width of 6 mm. The enhanced emission due to energy transfer was determined for 6-carboxy-X-rhodamine (FR.sub.obs) by exciting the sample as 488 nm with a slit width of 5 mm and detecting the emission at 605 nm. Tetramethyl-6-carboxyrhodamine enhanced emission due to energy transfer (FT.sub.obs) was determined by exciting the sample at 488 nm and detecting the emission at 583 nm.

A matrix was constructed using single fluorophores in order to analyze the data. As an example, the FR reading represents the fraction of fluorescein emission (FR.sub.f) when only fluorescein is present in the system. Similarly, FR.sub.t is defined as the tetramethyl-6-carboxyrhodamine contribution to FR in the presence of only tetramethyl-6-carboxyrhodamine (TAMRA). FT.sub.f and FT.sub.r represent the contributions of fluorescein and 6-carboxy-X-rhodamine (ROX) to FT. The matrix is shown in Table 9.

              TABLE 9______________________________________  Fluorophore PresentReadings Fluorescein    ROX     TAMRA______________________________________FF       1.0000         0.0000  0.0000FR       0.1255         0.0549  0.0409FT       0.2254         0.0074  0.0480RR       0.0000         1.0000  0.2252TT       0.0000         0.1286  1.0000______________________________________

The above values are used to determine if a sample is positive or negative using the following formulas.

FR.sub.corrected =FR.sub.obs -FR.sub.f -FR.sub.t =FR.sub.obs -0.1255FF.sub.obs -0.0409TT.sub.obs

FT.sub.corrected =FT.sub.obs -FT.sub.f -FT.sub.r =FT.sub.obs -0.2254FF.sub.obs -0.0074RR.sub.obs

RR.sub.corrected =RR.sub.obs -RR.sub.t =RR.sub.obs -0.2252TT.sub.obs

TT.sub.corrected =TT.sub.obs -TT.sub.r =TT.sub.obs -0.1286RR.sub.obs

The corrected FR and FT values are used to calculate fluorescence enhancement (FE). A sample is scored as positive if the fluorescence enhancement value of the sample (FE.sub.sample) is greater than the sum of the fluorescence enhancement value of the control (FE.sub.control) and seven standard deviations of the controls and represented by the following formula:

FE.sub.sample >FE.sub.control +(6.95.times.Standard deviation.sub.control).

The results for the assay detecting the cystic fibrosis allele are shown in Table 10. There are three results that may be expected using this particular allelic mutation. Normal homozygous individuals have cytosine at the same position in both alleles. The presence of a cytosine in one allele and a thymidine in another indicates a heterozygous carrier. The only other allele type expected is a homozygous cystic fibrosis affected individual in which both alleles contain a thymidine, indicating that both alleles contain the three base pair deletion. The results show that these alleles are easily discriminated using this method. The expected genotype from each allele matched perfectly with the observed genotype.

Fluorescence intensity was also monitored during thermo cycling using an Applied Biosystems Incorporated Sequence Detection System 7700 (Perkin/Elmer) and the accompanying ABI 7700 software to do the analysis and export the multicomponent data as shown in Table 11. This data contains the intensity changes for fluorescein, tetramethyl-6-carboxyrhodamine, and 6-carboxy-X-rhodamine along with the standard deviation for each well. For a positive reaction, the intensity of 6-carboxy-X-rhodamine should be increasing over 200 units, and that of tetramethyl-6-carboxyrhodamine should be increasing over 100 units. Because the fluorescent intensities are monitored along with the reaction, the change of intensity along the reaction is adequate to determine whether reaction is positive or negative.

              TABLE 10______________________________________Two Acceptor TDI Assay: Results for Cystic Fibrosis SamplesFE.sub.sample /FE.sub.control                Expected  ObservedSample I.D.   Rox-ddC   Tamra-ddU  Genotype                                Genotype______________________________________93-014  1.24      2.12       C/T     C/T93-019  1.19      2.15       C/T     C/T93-21c  1.21      2.22       C/T     C/T94-015  1.23      1.01       C/C     C/C94-018  1.20      2.24       C/T     C/T94-022  1.27      1.07       C/C     C/C94-023  1.28      1.11       C/C     C/C94-024  1.25      0.88       C/C     C/C94-151  1.18      2.13       C/T     C/T94-152  1.21      1.98       C/T     C/T94-217  1.07      2.65       T/T     T/T94-417  1.29      0.98       C/C     C/C94-528  1.05      2.46       T/T     T/T95-049  1.10      2.48       T/T     T/T95-093  1.22      1.94       C/T     C/T95-167  1.23      2.15       C/T     C/T95-182  1.21      2.26       C/T     C/T95-184  1.17      2.28       C/T     C/T95-241  1.18      1.98       C/T     C/T95-262  1.04      2.59       T/T     T/T95-291  1.20      1.93       C/T     C/T95-316  1.18      2.09       C/T     C/T95-615  1.26      3.99       C/T     C/T95-808  1.19      2.05       C/T     C/T95-897  1.22      2.03       C/T     C/T95-898  1.09      2.83       T/T     T/T 95-1005   1.08      2.72       T/T     T/T 96-0344   1.20      2.14       C/T     C/T______________________________________

                                  TABLE 11__________________________________________________________________________Two Acceptor TDI Assay:Results from PE7700Sample    FF FR FT FF FR FT FF FR FT Expected                               Genotype__________________________________________________________________________93-014    5028   980     1134        2610           1838              1337                 2106                    2189                       1429                          C/T  C/T94-025    4549   885     1070        2530           1940              1058                 2170                    2315                       1078                          C/C  C/C94-330    3120   651      885        1581           1240               873                 1408                    1402                        892                          C/C  C/C95-182    3902   708     1092        1994           1256              1226                 1590                    1488                       1298                          C/T  C/T95-808    4000   717     1105        2568           1048              1181                 2140                    1342                       1256                          C/T  C/T93-019    3916   729     1030        2101           1284              1144                 1752                    1549                       1207                          C/T  C/T94-202    5312  1025     1305        2983           1762              1184                 1910                    1860                       1017                          C/C  C/C94-488    4925  1024     1041        3109           1565               979                 2794                    1895                        989                          C/C  C/C94-217    4550   970      991        2159           1101              1196                 1880                    1200                       1273                          T/T  T/T94-528    4914   991     1350        2173           1135              1682                 1810                    1239                       1810                          T/T  T/T__________________________________________________________________________
EXAMPLE 6

This example illustrates the identification of a single base change in target DNA molecules in a polynucleotide ligation assay using fluorescence enhancement.

s14102 (Genbank accession number L33276) is a 217 base pair human sequence tagged site containing a known single nucleotide polymorphism. A set of four 40-mers comprised of an identical sequence except for the base at position twenty-one and corresponding to the DNA sequence flanking the known SNP site were synthesized as in example 1. Each of the four possible bases A, C, G, or T were uniquely represented in each of the four different 40-mer templates as shown in Table 2. Allele specific polynucleotides containing Texas Red or rhodamine as the acceptor fluorophore at various positions and 5' phosphorylated polynucleotides containing fluorescein as the donor fluorophore at various positions were prepared as in example 1. The DNA sequence of the donor and allele specific acceptor polynucleotides corresponds to the complementary sequence of the template molecule and are shown in Table 12.

              TABLE 12______________________________________                           SEQOligomer      Nucleotide Sequence                           ID NO:______________________________________Donor Sequence         5'-TTGTTTTATTTTTGTAAAAT                           22Acceptor Sequence-A         5'-TTTATGGCTTAGTGGTTTCA                           23Acceptor Sequence-G         5'-TTTATGGCTTAGTGGTTCG                           24s14102p1      5'-CAGTATGCTCACTAAAGCC                           25s14102P2      5'-CTCATATTCACATCTCTCCG                           26______________________________________

Donor polynucleotides were additionally labeled with digoxigenin using dig-11-deoxyuridine triphosphate and terminal transferase according to the manufacturers instructions (Boehringer Mannheim Biochemicals, Indianapolis, Ind.). 1 pM of 40 mer template was used in each reaction. In other reactions, the gel purified 217 bp PCR product generated using the s14102 PCR primers (SEQ ID:25, SEQ ID:26) in a 20 μl reaction was used as a template. An allele specific acceptor polynucleotide labeled with Texas Red at position 16, 5 nucleotide 5' to the site of ligation, was incubated with a donor polynucleotide labeled with fluorescein at position 5, 5 nucleotides 3' to the site of ligation and 3' end labeled with digoxygenin conjugated deoxyuridine triphosphate in the presence of a 40-mer template with a one-base mismatch or with a 40-mer template that was perfectly complementary to the donor and acceptor polynucleotides. Ligation reactions contained 5 pM each of the polynucleotide ligation assay specific primers and Ampligase thermostable DNA ligase (Epicenter Technologies, Madison, Wis.) in a buffer supplied by the manufacturer. The primer/ligase mixture was added to the template in a 20 μl reaction volume and subjected to thirty cycles of 94 one minute followed by 45 minutes. Control reactions contained no Ampligase.

10 μl of each ligation reaction were denatured with 200 μl of 0.5 N NaOH and placed in a cuvette to obtain an emission spectrum excited at 490 nm using the LS-50B luminescence spectrometer (Perkin-Elmer, Norwalk, Conn.). Alternatively, the sample was denatured with 40 μl of 0.6 N NaOH and placed in a well of a white MicroFLUOR microtiter plate (Baxter, McGaw Park, Ill.) and read directly using the LS-50B spectrometer. Energy transfer between the two fluorophores was observed when the emission spectra of the reactions with the correct perfectly matched template were compared to those with the mismatched template. Energy transfer in the form of quenching of donor emission was much more pronounced than that due to the enhanced emission of the acceptor (FIG. 7). The ratio of the emission of acceptor to emission of donor (A/D) was used to establish whether energy transfer has occurred. The A/D of a control sample without ligase was used as the baseline to determine the A/D of the test samples to show that, in the presence of a perfectly matched template, A/D of the test sample is significantly larger than A/D of the control. A sample with the mismatched template shows an A/D similar to that of the no ligase control. When excited at 490 nm, the excitation maximum of the donor fluorescein, both quenching of the donor emission at 515 nm and enhanced emission of the acceptor Texas Red fluorescence at 610 nm were observed in the test sample when compared to the control sample (FIG. 7 A). The shape of the subtraction curve is characteristic of energy transfer (FIG. 7 B).

EXAMPLE 7

This example illustrates the identification of a single base change in PCR amplified human sequence tagged sites in a polynucleotide ligation assay using fluorescence enhancement.

The sequence tagged sites DXS17 and S14102 amplified as in examples 2 and 6 respectively. Allele specific polynucleotides 5' end labeled with Texas Red or rhodamine as the acceptor fluorophore and 5' phosphorylated polynucleotides 3' end labeled with fluorescein as the donor fluorophore were prepared as in example 6 and are shown in Table 13.

                                  TABLE 13__________________________________________________________________________                                    SEQ IDOligomer      Nucleotide Sequence        NO:__________________________________________________________________________DXS17 Common Probe         5'-GAGTTACAAATAATCCAAT--F.sup.3 -3'                                    27DXS17 Allelic Probe (1)         5'-F.sup.2 --CCCTTATGCACTTATCCTTT-3'                                    28DXS17 Allelic Probe (2)         5'-F.sup.2 --CCCTTATGCACTTATCCTTC-3'                                    29s14102 Allele T         5'-ATTTTACAAAAATAAAACAATGAAACCACTAAGCCATAAA                                    30s14102 Allele C         5'-ATTTTACAAAAATAAAACAACGAAACCACTAAGCCATAAA                                    31s14102 Common Probe         5'-TTGTTTTATTTTTGTAAAAT--F.sup.3 -3'                                    32S14102 Allelic Probe         5'-F.sup.1 --TTTATGGCTTAGTGGTTTCA-3'40                                    33(1)S14102 Allelic Probe         5'-F.sup.2 --TTTATGGCTTAGTGGTTTCG-3'                                    34(2)__________________________________________________________________________ .sup.1 Rhodamine .sup.2 Texas Red .sup.3 Fluorescein

Purified PCR products for each sequence tagged site from five individual samples were incubated in two parallel 20 μl reactions with 5 pM of 5' fluorescein-labeled common polynucleotide probe, 5 pM of one of the fluorophore-labeled allele-specific polynucleotide probes, and 2 U Ampligase in a ligase buffer containing 20 mM Tris HCl, Ph 7.6, 150 mM KCl, 0.1% Triton X-100, 1 mM NAD, and 10 mM MgCl.sub.2. Two control reactions without ligase were included for each sequence tagged site. Each reaction mixture was cycled sixty times using thermal conditions as in example 6. The reaction was terminated by adding 1.5 μl 0.5 M EDTA, pH 8.0 and the products were denatured by addition of 50 μl 0.2 N NaOH.

Fluorescence intensities were determined using a fluorescent spectrophotometer as in example 6. Total donor emission (D.sub.f +D.sub.b) was measured by exciting each reaction mixture at 495 nm and measuring emission at 515 nm. Total acceptor emission (A.sub.f +A.sub.b) for rhodamine was measured by exciting at 547 nm and measuring emission at 572 nm, and for Texas Red by exciting at 589 nm and measuring emission at 615 nm. Enhanced fluorescence (A.sub.e) was determined by exciting the reaction mixture at 495 nm and measuring emission at 572 nm for rhodamine and 615 nm for Texas Red.

Fluorescence enhancement (FE) was calculated by the formula FE= A.sub.e /(A.sub.f +A.sub.b)!/(D.sub.f +D.sub.b). PCR products that do not contain the specific alleles served as controls. Samples were scored positive when FE.sub.sample > FE.sub.control +6.95.times.Standard Deviation.sub.control !. This corresponds to a cutoff ratio for FE.sub.sample /FE.sub.control of 1.25. The results are shown in Table 14. The assay correctly identified the alleles present in each sample.

                                  TABLE 14__________________________________________________________________________Oligonucleotide Ligation Assay Analysis of PCR Products with KnownGenotype__________________________________________________________________________Marker - DXS17    T Allele Probe (Rhodamine Label)                         C Allele Probe (Texas Red Label)Sample    Genotype    A.sub.e / A.sub.f + A.sub.b !          D.sub.f + D.sub.b              FE.sup.1                 FE.sub.s /FE.sub.c                     Result.sup.2                         A.sub.e / A.sub.f + A.sub.b !                               D.sub.f + D.sub.b                                   FE.sup.1                                      FE.sub.s /FE.sub.c                                          Result.sup.2__________________________________________________________________________3   C/C  0.34  0.63              0.54                 1.17                     -   0.07  0.62                                   0.11                                      1.25                                          +42  T/T  0.35  0.56              0.63                 1.36                     +   0.06  0.65                                   0.09                                      1.03                                          -70  T/T  0.35  0.56              0.63                 1.36                     +   0.07  0.73                                   0.10                                      1.07                                          -71  C/C  0.34  0.63              0.54                 1.17                     -   0.07  0.62                                   0.11                                      1.25                                          +75  T/T  0.35  0.58              0.60                 1.31                     +   0.07  0.74                                   0.09                                      1.05                                          -Control    --   0.34  0.72              0.47                 --  -   0.07  0.77                                   0.09                                      --  -Control    --   0.34  0.76              0.45                 --  -   0.07  0.79                                   0.09                                      --  -__________________________________________________________________________ .sup.1 The average FE of controls for the T Allele Probe is 0.4654 .+-. 0.018 and for the C Allele Probe is 0.09 .+-. 0.0013. FE.sub.s is fluorescence enhancement of sample and FE.sub.c the average value for control. .sup.2 Samples are scored positive if Fe.sub.sample >  FE.sub.control + 6.965  interval in the Students ttest.

Marker - S14102    T Allele Probe (Rhodamine Label)                         C Allele Probe (Texas Red Label)Sample    Genotype    A.sub.e / A.sub.f + A.sub.b !          D.sub.f + D.sub.b              FE.sup.1                 FE.sub.s /FE.sub.c                     Result.sup.2                         A.sub.e / A.sub.f + A.sub.b !                               D.sub.f + D.sub.b                                   FE FE.sub.s /FE.sub.c                                          Result.sup.2__________________________________________________________________________1   T/T  0.42  1.58              0.27                 1.30                     +   0.06  1.79                                   0.03                                      1.12                                          -2   T/T  0.41  1.46              0.28                 1.37                     +   0.06  1.84                                   0.03                                      1.09                                          -4   T/T  0.41  1.60              0.26                 1.25                     +   0.06  1.85                                   0.03                                      1.08                                          -6   T/T  0.41  1.54              0.27                 1.30                     +   0.06  1.87                                   0.03                                      1.07                                          -9   T/T  0.41  1.58              0.26                 1.27                     +   0.06  2.09                                   0.03                                       0.965                                          -Control    --   0.39  1.91              0.20                 --  -   0.07  2.47                                   0.03                                      --  -Control    --   0.39  1.83              0.21                 --  -   0.07  2.33                                   0.03                                      --  -__________________________________________________________________________ .sup.1 The average FE of controls for the T Allele Probe is 0.2028 .+-. 0.134 and for the C Allele Probe is 0.0287 .+-. 0.0018. FE.sub.s is fluorescence enhancement of sample and FE.sub.c the average value for control. .sup.2 Samples are scored positive if FE.sub.sample >  FE.sub.control + 6.965  interval in the Students ttest.

In view of the above, it will be seen that the several advantages of the invention are achieved and other advantageous results attained.

As various changes could be made in the above methods and compositions without departing from the scope of the invention, it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.

__________________________________________________________________________#             SEQUENCE LISTING- (1) GENERAL INFORMATION:-    (iii) NUMBER OF SEQUENCES: 34- (2) INFORMATION FOR SEQ ID NO:1:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 40 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "s14102-40A; SYNTHETIC FORTYc     NUCLEOTIDE TEMPLATE CONTAI - #NING ADENOSINE AT POSITION 21"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:#    40            ACAA AGAAACCACT AAGCCATAAA- (2) INFORMATION FOR SEQ ID NO:2:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 40 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "s14102-40C; SYNTHETIC FORTYc     NUCLEOTIDE TEMPLATE CONTAI - #NING CYTOSINE AT POSITION 21."-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:#    40            ACAA CGAAACCACT AAGCCATAAA- (2) INFORMATION FOR SEQ ID NO:3:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 40 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "s14102-40G; SYNTHETIC FORTYc     NUCLEOTIDE TEMPLATE CONTAI - #NING GUANIDINE AT POSITION 21."-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:#    40            ACAA GGAAACCACT AAGCCATAAA- (2) INFORMATION FOR SEQ ID NO:4:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 40 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "s14102-40T; SYNTHETIC FORTYc     NUCLEOTIDE TEMPLATE CONTAI - #NING THYMIDINE AT POSITION 21."-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:#    40            ACAA TGAAACCACT AAGCCATAAA- (2) INFORMATION FOR SEQ ID NO:5:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 19 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "S14102-F; SYNTHETICON: /desc#COMPLEMENTARY TO NUCLEOTIDES 22-40#ID NO:2, SEQ ID NO:3, AND SEQ ID NO:4;#FLUORESCEIN LABELED THYMIDINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "FLUORESCEIN LABELED THYMIDINE"-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:# 19               TTC- (2) INFORMATION FOR SEQ ID NO:6:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 21 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "D18S8p1; SYNTHETIC PCR /desc#NO:7 TO GENERATE A 367 BP FRAGMENT     CONTAINING SEQUENCE TAGGED - # SITE D18S8;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:#21                ATTG T- (2) INFORMATION FOR SEQ ID NO:7:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "D18S8p2; SYNTHETIC PCR /desc#NO:6 TO GENERATE A 367 BP FRAGMENT     CONTAINING SEQUENCE TAGGED - # SITE D18S8;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:# 20               CTTA- (2) INFORMATION FOR SEQ ID NO:8:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 40 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "D18S8 ALLELE A; DNA SEQUENCE     OF A PORTION OF HUMA - #N D18S8 STS CONTAINING ADENOSINE AT     ALLELIC NUCLEOTIDE POSITIO - #N 20;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:#    40            CCCA GGAGGCAGAG CTTGCAGTGA- (2) INFORMATION FOR SEQ ID NO:9:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 40 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "D18S8 ALLELE G; DNA SEQUENCE     OF A PORTION OF HUMA - #N D18S8 STS CONTAINING GUANIDINE AT     ALLELIC NUCLEOTIDE POSITIO - #N 20;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:#    40            CCCG GGAGGCAGAG CTTGCAGTGA- (2) INFORMATION FOR SEQ ID NO:10:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 19 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "D18S8 PROBE; SYNTHETIC /desc     NUCLEOTIDE SEQUENCE COMPLE - #MENTARY TO NUCLEOTIDES 21-39 IN#ID NO:9; 5'END FLUORESCEIN LABELED     CYTOSINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "N REPRESENTS 5' FLUORESCEIN          LABELED C - #YTOSINE;"-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:# 19               TCC- (2) INFORMATION FOR SEQ ID NO:11:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 23 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DXS17p1; SYNTHETIC PCR PRIMER#TO GENERATE 620 BP FRAGMENT FROM     HUMAN DNA SOURCE CONTAI - #NING A PORTION OF  DXS17 STS;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:#                23CTTG AAT- (2) INFORMATION FOR SEQ ID NO:12:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 23 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DXS17p2; SYNTHETIC PCR PRIMER     USED WITH SEQ ID NO: - #11 TO GENERATE A 620 BP FRAGMENT FROM#A PORTION OF DXS17 STS;"NTAINING-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:#                23CCAA TAT- (2) INFORMATION FOR SEQ ID NO:13:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 39 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DXS17 ALLELE A; NUCLEOTIDEsc#OF A HUMAN DXS17 STS CONTAINING     ADENOSINE AT ALLELIC NU - #CLEOTIDE POSITION 20;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:#    39            CTCA AAGGATAAGT GCATAAGGG- (2) INFORMATION FOR SEQ ID NO:14:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 39 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DXS17 ALLELE G; NUCLEOTIDEsc#OF A HUMAN DXS17 STS CONTAINING     GUANIDINE AT ALLELIC NU - #CLEOTIDE POSITION 20;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:#    39            CTCG AAGGATAAGT GCATAAGGG- (2) INFORMATION FOR SEQ ID NO:15:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 19 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DXS17 PROBE; SYNTHETIC /desc     NUCLEOTIDE SEQUENCE COMPLE - #MENTARY TO POSITIONS 21-39#SEQ ID NO:14; N REPRESENTS 5' END     FLUORESCEIN LABELED CYTOSI - #NE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "N REPRESENTS 5'ENDTION:#LABELED CYTOSINE;"RESCEIN-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:# 19               CTT- (2) INFORMATION FOR SEQ ID NO:16:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "MEN11p1; PCR PRIMER USEDdesc     W/SEQ ID NO:17 TO GE - #NERATE A 234 BP FRAGMENT OF EXON     11 OF HUMAN RET ONCO - #GENE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:# 20               CCTC- (2) INFORMATION FOR SEQ ID NO:17:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "MEN11p2; PCR PRIMER USEDdesc     W/SEQ ID NO:16 TO GE - #NERATE A 234 BP FRAGMENT OF EXON     11 OF HUMAN RET ONCO - #GENE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:# 20               GCTG- (2) INFORMATION FOR SEQ ID NO:18:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 19 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "MEN C634F; SYNTHETICN: /desc     NUCLEOTIDE PROBE COMPLEMEN - #TARY TO A PORTION OF THE#REPRESENTS 5'END FLUORESCEIN N     LABELED CYTOSINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "N REPRESENTS 5'ENDTION:#LABELED CYTOSINE;"RESCEIN-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:# 19               TGT- (2) INFORMATION FOR SEQ ID NO:19:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 31 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "CF508p1; PCR PRIMER USEDdesc     W/SEQ ID NO:20 TO GE - #NERATE A 578 BP FRAGMENT FROM EXON     5 OF HUMAN CYSTIC FI - #BROSIS GENE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:#          31      CTGA AACAGGAAGT A- (2) INFORMATION FOR SEQ ID NO:20:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 31 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "CF508p2; PCR PRIMER USEDdesc     W/SEQ ID NO:19 TO GE - #NERATE A 578 BP FRAGMENT FROM EXON     5 OF HUMAN CYSTIC FI - #BROSIS GENE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:#          31      GCTT ACCCATAGAG G- (2) INFORMATION FOR SEQ ID NO:21:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 25 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "CF508F25; SYNTHETIC DNA PROBE     COMPLEMENTARY TO A PORT - #ION OF EXON 5 OF A HUMAN CYSTIC     FIBROSIS GENE; N REPRES - #ENTS 5'END FLUORESCEIN LABELED     CYTOSINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "N REPRESENTS 5'ENDTION:#LABELED CYTOSINE;"RESCEIN-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:#               25 AAAT ATCAT- (2) INFORMATION FOR SEQ ID NO:22:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DONOR SEQ; SYNTHETIC NUCLEOTIDE#NUCLEOTIDES 1-20 IN SEQ IDNTARY TO     NO:1, SEQ ID NO:2, S - #EQ ID NO:3, AND SEQ ID NO:4;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:# 20               AAAT- (2) INFORMATION FOR SEQ ID NO:23:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "ACCEPTOR SEQ A; SYNTHETICesc     NUCLEOTIDE SEQUENCE COMPLE - #MENTARY TO NUCLEOTIDES 21-40     IN SEQ ID NO:1; TEXA - #S RED OR RHODAMINE LABELED THYMIDINE     AT VARIOUS POSITIONS;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:# 20               TTCA- (2) INFORMATION FOR SEQ ID NO:24:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "ACCEPTOR SEQ G; SYNTHETICesc     NUCLEOTIDE SEQUENCE COMPLE - #MENTARY TO NUCLEOTIDES 21-40     IN SEQ ID NO:3;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:# 20               TTCG- (2) INFORMATION FOR SEQ ID NO:25:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 18 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "s14102p1; SYNTHETIC PCR PRIMER#TO GENERATE A 217 BP HUMAN STS;     SEQUENCE DESCRIBED IN G - #ENBANK ACCESSION NO:L33276."-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:#  18              CC- (2) INFORMATION FOR SEQ ID NO:26:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "a14102p2; SYNTHETIC PCR PRIMER#TO GENERATE A 217 BP HUMAN STS     FRAGMENT; SEQUENCE DESCRIB - #ED IN GENBANK ACCESSION NO:L33276;-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:# 20               TCCG- (2) INFORMATION FOR SEQ ID NO:27:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 19 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DXS17 COMMON PROBE; SYNTHETIC     NUCLEOTIDE PROBE COMPLEMEN - #TARY TO NUCLEOTIDES 1-19 IN     SEQ ID NO:13 AND SEQ - # ID NO:14; N REPRESENTS 3'END FLUORESCEIN     LABELED THYMIDINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 19#/note= "N REPRESENTS 3'ENDTION:#LABELED THYMIDINE;"ESCEIN-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:# 19               AAN- (2) INFORMATION FOR SEQ ID NO:28:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DXS17 ALLELIC PROBE 1; SYNTHETIC#NUCLEOTIDES 21-39 IN SEQ IDY TO#LABELED CYTOSINE;"END RHODAMINE-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "5' END RHODAMINE LABELED          THYMIDINE;"-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:# 20               CTTT- (2) INFORMATION FOR SEQ ID NO:29:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "DXS17 ALLELIC PROBE 2; SYNTHETIC#NUCLEOTIDES 21-39 IN SEQ IDY TO     NO:14; 5'END TEXAS R - #ED LABELED CYTOSINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "5' END TEXAS RED LABELED          CYTOSINE;"-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:# 20               CTTC- (2) INFORMATION FOR SEQ ID NO:30:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 40 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "S14102 ALLELE T; A PORTION OF#SEQUENCE CONTAINING THYMIDINE AT     POSITION 21;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:#    40            ACAA TGAAACCACT AAGCCATAAA- (2) INFORMATION FOR SEQ ID NO:31:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 40 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "S14102 ALLELE C; HUMAN S14102     STS DNA SEQUENCE CONTAI - #NING CYTOSINE AT POSITION 21;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:#    40            ACAA CGAAACCACT AAGCCATAAA- (2) INFORMATION FOR SEQ ID NO:32:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "S14102 COMMON PROBE; SYNTHETIC     NUCLEOTIDE SEQUENCE COMPLE - #MENTARY TO NUCLEOTIDES 1-20#SEQ ID NO:31; 5'END PHOSPHORYLATED;     3'END FLUORESCEIN LABEL - #ED THYMIDINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 20#/note= "N AT POSITION 20 ISION:#LABELED THYMIDINE;"ESCEIN-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:# 20               AAAN- (2) INFORMATION FOR SEQ ID NO:33:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "S14102 ALLELIC PROBE 1; SYNTHETIC     NUCLEOTIDE SEQUENCE COMPLE - #MENTARY TO NUCLEOTIDES 21-40#REPRESENTS 5'END RHODAMINE LABELED     THYMIDINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "N REPRESENTS 5'ENDTION:#LABELED THYMIDINE;"MINE-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:# 20               TTCA- (2) INFORMATION FOR SEQ ID NO:34:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: other nucleic acid#= "S14102 ALLELIC PROBE 2; SYNTHETIC     NUCLEOTIDE SEQUENCE COMPLE - #MENTARY TO NUCLEOTIDES 21-40#REPRESENTS 5'END TEXAS RED LABELED     THYMIDINE;"-    (iii) HYPOTHETICAL: NO-     (iv) ANTI-SENSE: NO-     (ix) FEATURE:     (A) NAME/KEY: misc.sub.-- - #feature     (B) LOCATION: 1#/note= "N REPRESENTS 5'END TEXAS          RED LABEL - #ED THYMIDINE;"-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:# 20               TTCG__________________________________________________________________________
BRIEF DESCRIPTION OF THE DRAWINGS

The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of necessary fee.

FIG. 1 illustrates the template directed nucleotide incorporation detection method.

FIG. 2 illustrates the template directed polynucleotide ligation detection method.

FIG. 3 illustrates a GeneScan gel image of template directed nucleotide incorporation assay samples separated on a 6% sequencing gel showing the positions of donor fluorophore-labeled primer, acceptor fluorophore-labeled dideoxynucleotide triphosphate, donor/acceptor fluorophore dual labeled primer, and the fluorescence intensities measured for each.

FIG. 4 illustrates a chromatogram of the fluorescence intensities observed in negative controls in lanes 1 through 4, and in positive samples in lanes 8, 11, 14 and 17 in FIG. 3.

FIG. 5 illustrates the results of a template directed nucleotide incorporation assay detecting sequence tagged site D18S8 alleles as a distribution of points after plotting enhanced emission ratios of acceptor fluorophores against the donor fluorophore emission intensity ratios.

FIG. 6 illustrates the results of a template directed nucleotide incorporation assay detecting a cystic fibrosis allele as a distribution of points after plotting enhanced emission ratios of acceptor fluorophores against the donor fluorophore emission intensity ratios.

FIGS. 7A and 7B illustrate (A) the fluorescence emission spectra of template directed ligation assay products detected in the presence or absence of ligase; and (B) the same curve after subtracting the control emission spectra from that of the Ampligase positive sample.

BACKGROUND OF THE INVENTION

(1) Field of the Invention

This invention relates generally to nucleic acid analysis and, more particularly, to methods for detecting nucleic acid target sites with fluorescence labeled oligonucleotides and to use of the methods in DNA genotyping.

(2) Description of the Related Art

Nucleic acid analysis has become increasingly important in a number of applications including the genotyping of individuals such as in the diagnosis of hereditary diseases, the detecting of infectious agents, tissue typing for histocompatability, the identifying of individuals in forensic and paternity testing and monitoring the genetic make up of plants and animals in agricultural breeding programs (see, for example, Alford and Caskey, Cur Opin Biotech 5:29-33, 1994 which is incorporated by reference).

One approach to nucleic acid analysis uses probes which are complementary to a nucleotide or nucleotides in the nucleic acid. These analyses are typically performed in conjunction with amplification of the DNA being tested by the polymerase chain reaction (Saiki et al., Science 239:487-491, 1988 which is incorporated by reference). Two variations of this approach are the Genetic bit analysis method and the oligonucleotide ligation assay.

The Genetic bit analysis method involves hybridization of an oligonucleotide to a DNA sequence immediately adjacent to a target-nucleotide. The oligonucleotide then undergoes a 3' extension with a labeled dideoxynucleoside triphosphate and the labeled oligonucleotide is subsequently detected using enzyme linked colorimetry. (Nikiforov et al, Nucleic Acids Res 22:4167-4175, 1994 which is incorporated by reference).

The oligonucleotide ligation assay involves hybridization of a DNA sequence to two probes, one of which is labeled. One of the probes hybridizes to the nucleotides immediately contiguous to a target nucleotide and a second, allele-specific probe hybridizes to the target nucleotide and immediately contiguous nucleotides on the opposite side to the first probe. The two probes are then ligated and the resultant labeled oligonucleotide is detected using enzyme linked colorimetry (Nickerson et al., Proc Natl Acad Sci 87:8923-8927, 1990; U.S. Pat. Nos. 4,883,750, 4,988,617 and 5,242,794 all of which are incorporated by reference).

Both the genetic bit analysis and oligonucleotide ligation assay are time consuming and not readily adaptable to automation because they require capturing, separation, and washing of the labeled oligonucleotide followed by a multi-step detection procedure using an enzyme-linked immunosorbent assay.

In another approach, the detection of one or more nucleotides in a nucleic acid is accomplished using oligonucleotide probes labeled with two fluorescent substances in close proximity. One of the fluorophores (donor) has an emission spectrum that overlaps the excitation spectrum of the other fluorophore (acceptor) and transfer of energy takes place from the donor to the acceptor through fluorescence resonance energy transfer (T. Foster, Modern Quantum Chemistry, Istanbul Lectures, Part III, 93-137, 1965, Academic Press, New York which is incorporated by reference). The energy transfer is mediated by dipole-dipole interaction. Spectroscopically, when the donor is excited, its specific emission intensity decreases while the acceptor's specific emission intensity increases, resulting in fluorescence enhancement.

The fluorescence enhancement has been used in detection systems in which either two singly labeled oligonucleotides (Heller et al., EPO patent applications 0070685, 1983 which is incorporated by reference) or one doubly labeled oligonucleotide probe (Heller, EPO patent application 0229943, 1986 which is incorporated by reference) are first prepared and then hybridized to a target DNA or RNA sequence. The two fluorescent labels are separated by less than 22 nucleotides in the case of two singly labeled oligonucleotides or from 2 to 7 intervening base units in the case of doubly labeled oligonucleotide probes such that enhanced emission from fluorescent energy transfer can be detected from the hybridized probes.

The so-called Taqman assay uses a fluorescent energy transfer detection method which takes advantage of the decrease in emission intensity, i.e. or quenching observed in the first fluorophore. (Livak et al., PCR Methods and Applications 4:357-362, 1995; U.S. Pat. No. 5,528,848 which are incorporated by reference). An oligonucleotide containing the two fluorescent substances is hybridized to a target DNA sequence. The fluorescent substances are covalently linked to the oligonucleotide at a distance such that fluorescent energy transfer takes place which is then measured as a quenching of donor fluorescence. During amplification by polymerase chain reaction, the oligonucleotide is degraded thus separating the two fluorescent substances. As a result, the donor shows a loss of quenching and increase in fluorescent emission. Thus, by monitoring the loss of quenching of the donor, the target DNA sequence is detected.

One application of the TaqMan assay is in detecting single nucleotide polymorphisms, i.e. single base mutations in DNA. This method provides significant advantages over earlier assays for single nucleotide polymorphisms which were labor intensive and not readily automated. (see, for example, Botstein et al., Am J Human Genetics 32:314-331, 1980; Hayashi, PCT Methods and Applications 1:34-38, 1991; Meyers et al., Methods in Enzymology 155:501-527, 1987; Keen et al., Trends in Genetics 7:5, 1991; Cotton et al., Proc Natl Acad Sci 85:4397-4401; Myers et al., Science 230:1242-1246, 1985; and Kwok et al., Genomics 23:138-144, 1994 which are incorporated by reference). Nevertheless, a significant problem with the TaqMan assay results from a relative intolerance to mismatches which is disadvantageous for allelic discrimination. (Livak et al, PCR Methods and Applications 4:357-362, 1995 which is incorporated by reference). Thus, there remains a continuing need for an effective nucleic acid assay method that is simple to perform and readily automated.

SUMMARY OF THE INVENTION

Accordingly, therefore, the inventors herein have succeeded in discovering a new approach for detecting the presence of a target site of at least one nucleotide in a sample of nucleic acid using a fluorescent energy transfer detection method. The method involves synthesizing an oligonucleotide hybridized to a sequence of contiguous nucleotides, which include a target site of at least one nucleotide, in a nucleic acid. An essential feature of the oligonucleotide is that once formed, the oligonucleotide contains at least two fluorophores each of which is covalently bound to a separate nucleotide in the oligonucleotide. The two fluorophores are selected so that the emission spectrum of one fluorophore, referenced herein as the donor fluorophore, overlaps the excitation spectrum of the other, referenced herein as the acceptor fluorophore. The position of the two fluorophores on the oligonucleotide is such that upon release of the oligonucleotide from hybridization to the nucleic acid target site, the two fluorophores are separated by a distance that allows a fluorescence energy transfer to take place from the donor to the acceptor. The fluorescence energy transfer is then detected, either by decreased emission of the donor fluorophore or by an increase in emission of the acceptor fluorophore to indicate that the target site is present in the nucleic acid.

In one embodiment of the present invention, the oligonucleotide is formed by hybridizing a first polynucleotide which contains one of the two fluorophores to the nucleic acid. The hybridization is to a sequence of nucleotides in the nucleic acid that either includes or is immediately 3' to the target site. The second fluorophore is covalently linked to a dideoxynucleoside triphosphate which binds to the nucleic acid immediately 5' to the binding of the polynucleotide and is added by template directed synthesis to the 3' end of the polynucleotide at the target site. Fluorescence energy transfer from one fluorophore to the other is then detected upon denaturation and release of the oligonucleotide from the nucleic acid.

In another embodiment of the present invention the oligonucleotide is formed by hybridizing a first polynucleotide covalently linked to one fluorophore to the nucleic acid. A second polynucleotide covalently linked to the other fluorophore is hybridized to a sequence at contiguous nucleotides in the nucleic acid and immediately adjacent to the sequence of nucleotides hybridized to the first polynucleotide. The two polynucleotides are then covalently bonded together by template directed ligation to produce the oligonucleotide. Upon denaturation and release of the oligonucleotide from the nucleic acid, the fluorescent energy transfer from one fluorophore to the other is detected.

The present invention also provides for kit for detecting the presence of a target site of at least one nucleotide in a nucleic acid. The kit is comprised of (a) a polynucleotide covalently linked to one fluorophore and capable of binding to the target site or immediately 3' to the target site; and (b) a second other fluorophore covalently linked to a dideoxynucleoside triphosphate which is capable of binding to a target nucleotide in the nucleic acid at a position immediately 5' to the polynucleotide capable of adding by 3' extension to the polynucleotide. The emission spectrum of one of the fluorophores overlaps the excitation spectrum of the other.

Another embodiment of the present invention provides for a kit for detecting the presence of a target site of at least one nucleotide in a nucleic acid, the kit comprising (a) a first polynucleotide covalently linked to one fluorophore; and (b) a second polynucleotide covalently linked to a second fluorophore wherein the second polynucleotide is capable of being ligated to the first polynucleotide to form an oligomer which binds to the target site.

Among the several advantages found to be achieved by the present invention, therefore, may be noted the provision of new methods for detecting the presence of a specific nucleotide sequence in a nucleic acid; the provision of new methods for detecting nucleotide polymorphisms; the provision of methods that permit nucleic acid analysis that is inexpensive, simple, accurate, and adaptable to automation; the provision of methods that are adaptable for use in diagnosis of hereditary diseases and pathologic conditions, in the detecting of infectious agents, in tissue typing for histocompatability, in forensic identification and paternity testing and in monitoring the genetic make up of plant and animal.

This application is a continuation of U.S. application Ser. No. 60/008,743, filed Dec. 18, 1995, now abandoned.

REFERENCE TO GOVERNMENT GRANT

This invention was made with government support under Grant Numbers DE-FG06-94ER61909 and 1-F32-HG00156-01. The government has certain rights in this invention.

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4828979 *8 Nov 19849 May 1989Life Technologies, Inc.Nucleotide analogs for nucleic acid labeling and detection
US4883750 *13 Dec 198428 Nov 1989Applied Biosystems, Inc.Detection of specific sequences in nucleic acids
US4988617 *25 Mar 198829 Jan 1991California Institute Of TechnologyMethod of detecting a nucleotide change in nucleic acids
US5242794 *5 Jun 19897 Sep 1993Applied Biosystems, Inc.Detection of specific sequences in nucleic acids
US5538848 *16 Nov 199423 Jul 1996Applied Biosystems Division, Perkin-Elmer Corp.Method for detecting nucleic acid amplification using self-quenching fluorescence probe
EP0070685A2 *14 Jul 198226 Jan 1983Amoco CorporationHomogeneous nucleic acid hybridization diagnostics by non-radiative energy transfer
EP0229943A2 *1 Dec 198629 Jul 1987Molecular Biosystems, Inc.Fluorescent stokes shift probes for polynucleotide hybridization assays
EP0601889A2 *10 Dec 199315 Jun 1994Maine Medical Center Research InstituteNucleic acid probes
Non-Patent Citations
Reference
1 *Cardullo et al., Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer, Proc. Natl. Acad. Sci. USA 85:8790 8794 (1988).
2Cardullo et al., Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer, Proc. Natl. Acad. Sci. USA 85:8790-8794 (1988).
3 *Gibson et al., A Novel Method for Real Time Quantitative PCR, Genome Research 6:695 1001, 1996.
4Gibson et al., A Novel Method for Real Time Quantitative PCR, Genome Research 6:695-1001, 1996.
5 *Heid et al., Real Time Quantitative PCR, Genome Research 6:986 994, 1996.
6Heid et al., Real Time Quantitative PCR, Genome Research 6:986-994, 1996.
7 *Holland et al., Detection of Specific Polymerase Chain Reaction Product by Utilizing the F 3 Exonuclease Activity of Thermus Aquaticus DNA Polymerase, PNAS, USA 88:7276 7280, 1991.
8Holland et al., Detection of Specific Polymerase Chain Reaction Product by Utilizing the F'→3' Exonuclease Activity of Thermus Aquaticus DNA Polymerase, PNAS, USA 88:7276-7280, 1991.
9 *Landegren et al., A Ligase Mediated Gene Detection Technique, Science 241:1077 1080, 1988.
10Landegren et al., A Ligase-Mediated Gene Detection Technique, Science 241:1077-1080, 1988.
11 *Lee et al., Allelic discrimination by nick translation PCR with fluorogenic probes, Nucleic Acids Research , 21, 16:3761 3766 (1993).
12Lee et al., Allelic discrimination by nick-translation PCR with fluorogenic probes, Nucleic Acids Research, 21, 16:3761-3766 (1993).
13 *Livak et al., Oligonucleotides with Fluorescent Dies at Opposite Ends Provide a Quenched Probe System useful for Detecting PCR Product and Nucleic Acid Hybridization, PCR Meth. App. 4:357 362, 1995.
14Livak et al., Oligonucleotides with Fluorescent Dies at Opposite Ends Provide a Quenched Probe System useful for Detecting PCR Product and Nucleic Acid Hybridization, PCR Meth. App. 4:357-362, 1995.
15 *Nickerson et al., Automated DNA Diagnostics Using an ELISA Based Oligonucleotide Ligation Assay, PNAS, USA 87:8923 8927, 1990.
16Nickerson et al., Automated DNA Diagnostics Using an ELISA-Based Oligonucleotide Ligation Assay, PNAS, USA 87:8923-8927, 1990.
17 *Nikiforov et al., Genetic Bit Analysis: A Solid Phase Method for Typing Single Nucleotide Polymorphisms, Nuc. Acids Res. 22:4167 4175, 1994.
18Nikiforov et al., Genetic Bit Analysis: A Solid Phase Method for Typing Single Nucleotide Polymorphisms, Nuc. Acids Res. 22:4167-4175, 1994.
19 *Tyagi et al., Molecular Beacons: Probes that Fluoresce upon Hybridization, Nature Biotechnology 14:303 308, 1996.
20Tyagi et al., Molecular Beacons: Probes that Fluoresce upon Hybridization, Nature Biotechnology 14:303-308, 1996.
21 *Yershov et al., DNA Analysis and Diagnostics on Oligonucleotide Microships, PNAS, USA 93:4913 4918, 1996.
22Yershov et al., DNA Analysis and Diagnostics on Oligonucleotide Microships, PNAS, USA 93:4913-4918, 1996.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6177249 *20 Apr 199923 Jan 2001Washington UniversityMethod for nucleic acid analysis using fluorescence resonance energy transfer
US6232075 *13 Dec 199915 May 2001Li-Cor, Inc.Heterogeneous assay for pyrophosphate detection
US6235535 *30 Jun 199722 May 2001Valtion Teknillinen TutkimuskeskusFluorescent energy transfer ligand interaction assay on a lipid film
US633544018 Mar 19991 Jan 2002Pe Corporation (Ny)Method for detecting oligonucleotides using energy transfer dyes with long stoke shift
US63554332 Jun 200012 Mar 2002Dna Sciences, Inc.Determination of nucleotide sequence variations through limited primer extension
US64585441 Dec 20001 Oct 2002Dna Sciences, Inc.Methods for determining single nucleotide variations and genotyping
US6459805 *24 Apr 19981 Oct 2002Childrens Hospital Los AngelesFluorescence digital imaging microscopy system
US65251853 May 199925 Feb 2003Affymetrix, Inc.Polymorphisms associated with hypertension
US6531583 *29 Jan 199911 Mar 2003Uab Research Foundation, TheNucleic acid probes and method for detecting Ureaplasma urealyticum
US654474420 Jan 20008 Apr 2003The Regents Of The University Of CaliforniaProbes labeled with energy transfer coupled dyes
US657304711 Apr 20003 Jun 2003Dna Sciences, Inc.Detection of nucleotide sequence variation through fluorescence resonance energy transfer label generation
US662774811 Sep 200030 Sep 2003The Trustees Of Columbia University In The City Of New YorkCombinatorial fluorescence energy transfer tags and their applications for multiplex genetic analyses
US6638722 *13 Jun 200128 Oct 2003Invitrogen CorporationMethod for rapid amplification of DNA
US664200113 Jul 20004 Nov 2003Whitehead Institute For Biomedical ResearchGeneric SBE-FRET protocol
US66640795 Oct 200116 Dec 2003The Trustees Of Columbia University In The City Of New YorkMassive parallel method for decoding DNA and RNA
US666543013 Aug 200216 Dec 2003Childrens Hospital Los AngelesFluorescence digital imaging microscopy system
US670322824 Sep 19999 Mar 2004Massachusetts Institute Of TechnologyMethods and products related to genotyping and DNA analysis
US6803201 *24 Jan 200212 Oct 2004StratageneCompositions and methods for polynucleotide sequence determination
US68183956 Nov 200016 Nov 2004California Institute Of TechnologyMethods and apparatus for analyzing polynucleotide sequences
US684974529 Oct 20011 Feb 2005Applera CorporationEnergy transfer dyes with enhanced fluorescence
US691134518 Jul 200128 Jun 2005California Institute Of TechnologyMethods and apparatus for analyzing polynucleotide sequences
US694965923 Jan 200427 Sep 2005Enzo Life Sciences, Inc.Dye labeling composition
US7029846 *4 Oct 200118 Apr 2006University Of Medicine And Dentistry Of New JerseySite-specific protein modification
US707459712 Jul 200211 Jul 2006The Trustees Of Columbia University In The City Of New YorkMultiplex genotyping using solid phase capturable dideoxynucleotides and mass spectrometry
US71575727 Feb 20032 Jan 2007Applera CorporationUV excitable energy transfer reagents
US71609968 Jun 20009 Jan 2007Bioresearch Technologies, Inc.Fluorescence energy transfer probes with stabilized conformations
US716379623 Jan 200416 Jan 2007C/O Enzo Biochem, Inc.Process for detecting the presence or quantity of enzymatic activity in a sample
US716647812 Mar 200223 Jan 2007Enzo Life Sciences, Inc., C/O Enzo Biochem, Inc.Labeling reagents and labeled targets, target labeling processes and other processes for using same in nucleic acid determinations and analyses
US716993926 Feb 200430 Jan 2007Applera CorporationEnergy transfer dyes with enhanced fluorescence
US724189721 Jan 200410 Jul 2007Enzo Life Sciences, Inc.Process for preparing cyanine dye labeling reagents
US72502987 Apr 200531 Jul 2007The University Of ChicagoMonomeric red fluorescent proteins
US725629122 Jan 200414 Aug 2007Enzo Life Sciences, Inc.Labeling reagents comprising aphenylic analogs of rhodamine dyes
US725629923 Jan 200414 Aug 2007Enzo Life Sciences, Inc. C/O Enzo Biochem, Inc.Chemiluminescent reagents
US732357123 Jan 200429 Jan 2008Enzo Life Sciences, Inc. C/O Enzo Biochem, Inc.Heterodimeric dye composition
US73451596 Nov 200318 Mar 2008The Trustees Of Columbia University In The City Of New YorkMassive parallel method for decoding DNA and RNA
US7364851 *7 Jul 200429 Apr 2008Intel CorporationNucleic acid sequencing by Raman monitoring of uptake of precursors during molecular replication
US737851731 Jul 200627 May 2008Applera CorporationUV excitable energy transfer reagents
US738809228 Dec 200617 Jun 2008Applera CorporationOligonucleotides and analogs labeled with energy transfer dyes
US73975468 Mar 20068 Jul 2008Helicos Biosciences CorporationSystems and methods for reducing detected intensity non-uniformity in a laser beam
US739985428 Dec 200615 Jul 2008Applera CorporationRegents labeled with energy transfer dyes
US740267110 Mar 200622 Jul 2008Applera CorporationUV excitable fluorescent energy transfer dyes
US741713113 Oct 200626 Aug 2008Evrogen Joint Stock CompanyModified green fluorescent proteins and methods for using same
US742314028 Dec 20069 Sep 2008Applied Biosystems Inc.Oligonucleotides and analogs labeled with energy transfer dyes
US743205829 Dec 20067 Oct 2008Applera CorporationMethods of labeling nucleic acids with energy transfer dyes
US744914929 Dec 200611 Nov 2008Applied Biosystems Inc.Kits useful for sequencing nucleic acids
US744929829 Dec 200611 Nov 2008Applied Biosystems Inc.Methods of analyzing polynucleotides employing energy transfer dyes
US745267229 Dec 200618 Nov 2008Applied Biosystems Inc.Methods of analyzing polynucleotides employing energy transfer dyes
US753775122 Jan 200426 May 2009Enzo Life Science, Inc.Labeling reagents and labeled targets comprising nonmetallic porphyrins
US755395923 Jan 200430 Jun 2009Enzo Life Sciences, Inc.Fluorescent dye composition and target labeled therewith
US759516229 Dec 200629 Sep 2009Applied Biosystems, LlcMethods of labeling polynucleotides with energy transfer dyes
US760523024 Jul 200820 Oct 2009Evrogen Joint Stock CompanyModified green fluorescent proteins and methods for using same
US76222793 Mar 200524 Nov 2009The Trustees Of Columbia University In The City Of New YorkPhotocleavable fluorescent nucleotides for DNA sequencing on chip constructed by site-specific coupling chemistry
US763557820 Aug 200722 Dec 2009The Trustees Of Columbia University In The City Of New YorkMassive parallel method for decoding DNA and RNA
US76386159 Jan 200729 Dec 2009Evrogen IP Joint Stock CompanyFluorescent proteins and methods for using same
US767118515 May 20072 Mar 2010The University Of ChicagoMonomeric red fluorescent proteins
US767889326 Nov 200316 Mar 2010Zakrytoe Aktsionernoe Obschestvo “Evrogen”Fluorescent proteins from Copepoda species and methods for using same
US771369820 Aug 200711 May 2010The Trustees Of Columbia University In The City Of New YorkMassive parallel method for decoding DNA and RNA
US776744121 Oct 20083 Aug 2010Industrial Technology Research InstituteBioassay system including optical detection apparatuses, and method for detecting biomolecules
US77908695 Jun 20077 Sep 2010The Trustees Of Columbia University In The City Of New YorkMassive parallel method for decoding DNA and RNA
US78118109 Jul 200912 Oct 2010Industrial Technology Research InstituteBioassay system including optical detection apparatuses, and method for detecting biomolecules
US78252374 Sep 20092 Nov 2010Applied Biosystems, LlcOligonucleotides and analogs labeled with energy transfer dyes
US785830227 Sep 200528 Dec 2010Enzo Life Sciences, Inc.Processes for incorporating nucleic acid sequences into an analyte or library of analytes
US786343122 Jan 20044 Jan 2011Enzo Life Sciences, Inc.Label target and labeling reagents comprising rigid group backbones
US788811324 Jul 200815 Feb 2011Evrogen Joint Stock CompanyModified green fluorescent proteins and methods for using same
US788850723 May 200815 Feb 2011Applied Biosystems, Inc.UV excitable fluorescent energy transfer dyes
US791071419 Jan 201022 Mar 2011The University Of ChicagoMonomeric red fluorescent proteins
US804837824 Aug 20101 Nov 2011Fluidigm CorporationOptical lens system and method for microfluidic devices
US805051613 Sep 20071 Nov 2011Fluidigm CorporationMethods and systems for determining a baseline during image processing
US805503413 Sep 20078 Nov 2011Fluidigm CorporationMethods and systems for image processing of microfluidic devices
US808857519 Jul 20103 Jan 2012The Trustees Of Columbia University In The City Of New YorkMassive parallel method for decoding DNA and RNA
US81295292 Dec 20106 Mar 2012Applied Biosystems, LlcUV excitable fluorescent energy transfer dyes
US813832016 Nov 200920 Mar 2012Evrogen IP Joint Stock CompanyFluorescent proteins and methods for using same
US8239142 *9 Jul 20097 Aug 2012Centre National De La Recherche Scientifique (Cnrs)System, method, device, and computer program product for extraction, gathering, manipulation, and analysis of peak data from an automated sequencer
US824717915 Oct 200921 Aug 2012Enzo Life Sciences, Inc.Processes for quantitative or qualitative detection of single-stranded nucleic acids
US82987928 Feb 201130 Oct 2012The Trustees Of Columbia University In The City Of New YorkFour-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US835779322 Jan 200422 Jan 2013Enzo Life Sciences, Inc.Label target and labeling reagents comprising backbones with at least two consecutive peptide bonds
EP1377686A1 *11 Apr 20027 Jan 2004Caliper Technologies CorporationSystems and methods for high throughput genetic analysis
EP2100958A15 Nov 200316 Sep 2009Zakrytoe Aktsionernoe Obschestvo 'Evrogen'Fluorescent proteins and chromoproteins from non-aequorea hydrozoa species and methods for using same
EP2110439A14 May 200521 Oct 2009F. Hoffmann-Roche AGSENP1 as a marker for cancer
EP2149612A129 Jul 20083 Feb 2010Merck Serono SAGenetic markers of response to efalizumab
EP2248911A19 Feb 200510 Nov 2010Helicos Biosciences CorporationMethods and kits for analyzing polynucleotide sequences
EP2340890A15 Apr 20046 Jul 2011Fluidigm CorporationMicrofluidic devices and methods of using same
EP2360234A127 Nov 200224 Aug 2011Fluidigm CorporationMicrofluidic device and methods of using same
EP2366798A1 *6 Mar 200321 Sep 2011Enzo Life Sciences, Inc.Nucleic acid detection process involving energy transfer labels on nucleotide
EP2476763A229 Aug 200818 Jul 2012Monsanto Technology LLCMethods and compositions for breeding for preferred traits
EP2477029A12 Jun 200618 Jul 2012Fluidigm CorporationAnalysis using microfluidic partitioning devices
EP2514841A123 Jan 200924 Oct 2012Theranostics LaboratoryMethods and compositions for the assessment of drug response
EP2518161A120 Mar 200631 Oct 2012Fluidigm CorporationMethod for detection of mutant alleles
EP2527472A230 May 200828 Nov 2012Yale University, Inc.A genetic lesion associated with cancer
WO2000075378A18 Jun 200014 Dec 2000Biosearch Technologies, Inc.Fluorescence energy transfer probes with stabilized conformations
WO2002022883A111 Sep 200121 Mar 2002Ju, JingyueCombinatorial fluorescence energy transfer tags and uses thereof
WO2002028884A14 Oct 200111 Apr 2002Rana, TariqSite-specific protein modification
WO2002083952A111 Apr 200224 Oct 2002Caliper Technologies Corp.Systems and methods for high throughput genetic analysis
WO2002101022A212 Jun 200219 Dec 2002Davis, ScottMethod for rapid amplification of dna
WO2003062454A223 Jan 200331 Jul 2003Arezi, BahramCompositions and methods for polynucleotide sequence determination
WO2004081182A25 Mar 200423 Sep 2004Firmin, AndrewCompositions and methods for polynucleotide sequence detection
WO2005010211A128 Jul 20043 Feb 2005Banin, UriOptical detection of analytes by use of semiconductor nanoparticles
WO2007085923A29 Jan 20072 Aug 2007Chudakov, Dmitry M.Novel fluorescent proteins and methods for using same
WO2008151004A130 May 200811 Dec 2008Chin, Lena, J.A genetic lesion associated with cancer
WO2010077832A114 Dec 20098 Jul 2010Wisconsin Alumni Research FoundationMethods and compositions for testing and breeding cattle for improved fertility and embryonic survival
WO2010101696A15 Feb 201010 Sep 2010Yale UniversityA snp marker of breast and ovarian cancer risk
WO2012112883A117 Feb 201223 Aug 2012Yale UniversityThe kras-variant and endometriosis
WO2012129352A122 Mar 201227 Sep 2012Yale UniversityThe kras variant and tumor biology
WO2012149193A226 Apr 20121 Nov 2012Monsanto Technology LlcDiagnostic molecular markers for seed lot purity traits in soybeans