US20150284719A1 - Methods and compositions involving mirna and mirna inhibitor molecules - Google Patents

Methods and compositions involving mirna and mirna inhibitor molecules Download PDF

Info

Publication number
US20150284719A1
US20150284719A1 US14/738,706 US201514738706A US2015284719A1 US 20150284719 A1 US20150284719 A1 US 20150284719A1 US 201514738706 A US201514738706 A US 201514738706A US 2015284719 A1 US2015284719 A1 US 2015284719A1
Authority
US
United States
Prior art keywords
mir
seq
mirna
hsa
mmu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/738,706
Inventor
David Brown
Lance Ford
Angie Cheng
Rich Jarvis
Mike Byrom
Dmitriy Ovcharenko
Eric Devroe
Kevin Kelnar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Asuragen Inc
Original Assignee
Asuragen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=37570916&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20150284719(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Asuragen Inc filed Critical Asuragen Inc
Priority to US14/738,706 priority Critical patent/US20150284719A1/en
Assigned to AMBION, INC. reassignment AMBION, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BROWN, DAVID, BYROM, MIKE, CHENG, ANGIE, DEVROE, ERIC, FORD, LANCE, JARVIS, RICH, KELNAR, KEVIN, OVCHARENKO, DMITRIY
Assigned to APPLERA CORPORATION reassignment APPLERA CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: AMBION, INC.
Assigned to ASURAGEN, INC. reassignment ASURAGEN, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: APPLERA CORPORATION
Publication of US20150284719A1 publication Critical patent/US20150284719A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Liposomes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61NELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N5/00Radiation therapy
    • A61N5/10X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • A61P31/06Antibacterial agents for tuberculosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/312Phosphonates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/344Position-specific modifications, e.g. on every purine, at the 3'-end
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3527Other alkyl chain
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/353Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3535Nitrogen
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/533Physical structure partially self-complementary or closed having a mismatch or nick in at least one of the strands
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/12Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/10Production naturally occurring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates generally to the field of molecular biology. More particularly, it concerns methods and compositions involving nucleic acid molecules that simulate microRNA (miRNAs) and that inhibit miRNAs. Methods and compositions involving synthetic miRNAs and miRNA inhibitor molecules are described. In addition, methods and compositions for identifying miRNAs that contribute to cellular processes are also described. In addition, the identification of miRNAs that contribute to cellular processes provides targets for therapeutic intervention as well as diagnostic and/or prognostic analysis.
  • miRNAs microRNA
  • miRNAs miRNAs
  • C. elegans, Drosophila , and humans Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001.
  • miRNAs Several hundreds of miRNAs have been identified in plants and animals—including humans—which do not appear to have endogenous siRNAs. Thus, while similar to siRNAs, miRNAs are nonetheless distinct.
  • miRNAs thus far observed have been approximately 21-22 nucleotides in length and they arise from longer precursors, which are transcribed from non-protein-encoding genes. See review of Carrington et al. (2003). The precursors form structures that fold back on each other in self-complementary regions; they are then processed by the nuclease Dicer in animals or DCL1 in plants. miRNA molecules interrupt translation through precise or imprecise base-pairing with their targets.
  • miRNAs seem to be involved in gene regulation. Some miRNAs, including lin-4 and let-7, inhibit protein synthesis by binding to partially complementary 3′ untranslated regions (3′ UTRs) of target mRNAs. Others, including the Scarecrow miRNA found in plants, function like siRNA and bind to perfectly complementary mRNA sequences to destroy the target transcript (Grishok et al., 2001).
  • miRNAs that play critical roles in cell differentiation, early development, and cellular processes like apoptosis and fat metabolism.
  • lin-4 and let-7 both regulate passage from one larval state to another during C. elegans development (Ambros, 2003).
  • mir-14 and bantam are drosophila miRNAs that regulate cell death, apparently by regulating the expression of genes involved in apoptosis (Brennecke et al., 2003, Xu et al., 2003).
  • MiR14 has also been implicated in fat metabolism (Xu et al., 2003).
  • Lsy-6 and miR-273 are C. elegans miRNAs that regulate asymmetry in chemosensory neurons (Chang et al., 2004).
  • miRNA-181 Another animal miRNA that regulates cell differentiation is miR-181, which guides hematopoietic cell differentiation (Chen et al., 2004). These molecules represent the full range of animal miRNAs with known functions. Enhanced understanding of the functions of miRNAs will undoubtedly reveal regulatory networks that contribute to normal development, differentiation, inter- and intra-cellular communication, cell cycle, angiogenesis, apoptosis, and many other cellular processes. Given their important roles in many biological functions, it is likely that miRNAs will offer important points for therapeutic intervention or diagnostic analysis.
  • Characterizing the functions of biomolecules like miRNAs often involves introducing the molecules into cells or removing the molecules from cells and measuring the result. If introducing a miRNA into cells results in apoptosis, then the miRNA undoubtedly participates in an apoptotic pathway. Methods for introducing and removing miRNAs from cells have been described. Two recent publications describe antisense molecules that can be used to inhibit the activity of specific miRNAs (Meister et al., 2004; Hutvagner et al., 2004). Another publication describes the use of plasmids that are transcribed by endogenous RNA polymerases and yield specific miRNAs when transfected into cells (Zeng et al., 2002). These two reagent sets have been used to evaluate single miRNAs.
  • a limitation of the plasmid-based miRNA expression system is that the transfection efficiencies for plasmids tend to be very low, with only approximately 50% of cells expressing RNA from the plasmid in cells that are easy to transfect. Transfection efficiencies for plasmids in primary cells are much lower, with fewer than 10% of cells typically expressing the desired RNA. Therefore, there is a need for alternative compositions and methods for introducing miRNA molecules into cells so that they can be characterized and studied.
  • the present invention is based on the inventors' studies regarding the introduction into cells of one or more nucleic acids that function like miRNA or inhibit the activities of one or more miRNAs in cells to characterize their roles in various biological processes.
  • the invention concerns nucleic acids that perform the activities of endogenous miRNAs when introduced into cells. These nucleic acids are synthetic miRNA in some embodiments.
  • the invention further concerns a library of synthetic miRNAs specific to a variety of known miRNAs that can be used to introduce sequentially or in combination one or more miRNAs into cells in vitro or in vivo for the purpose of identifying miRNAs that participate in cellular processes.
  • the invention further involves a library of sequence-specific miRNA inhibitors that can be used to inhibit sequentially or in combination the activities of one or more miRNAs in cells.
  • the two libraries of miRNA-specific reagents are used to introduce or eliminate specific miRNAs or combinations of miRNAs to define the roles of miRNAs in cells.
  • miRNA is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. See, e.g., Carrington et al., 2003, which is hereby incorporated by reference. The term will be used to refer to the single-stranded RNA molecule processed from a precursor. Individual miRNAs have been identified and sequenced in different organisms, and they have been given names. Names of miRNAs and their sequences are provided herein. Additionally, other miRNAs are known to those of skill in the art and can be readily implemented in embodiments of the invention. The methods and compositions should not be limited to miRNAs identified in the application, as they are provided as examples, not necessarily as limitations of the invention.
  • the present invention concerns, in some embodiments of the invention, short nucleic acid molecules that function as miRNAs or as inhibitors of miRNA in a cell.
  • short refers to a length of a single polynucleotide that is 150 nucleotides or fewer.
  • the nucleic acid molecules are synthetic.
  • synthetic means the nucleic acid molecule is isolated and not identical in sequence (the entire sequence) and/or chemical structure to a naturally-occurring nucleic acid molecule, such as an endogenous precursor miRNA molecule.
  • nucleic acids of the invention do not have an entire sequence that is identical to a sequence of a naturally-occurring nucleic acid, such molecules may encompass all or part of a naturally-occurring sequence. It is contemplated, however, that a synthetic nucleic acid administered to a cell may subsequently be modified or altered in the cell such that its structure or sequence is the same as non-synthetic or naturally occurring nucleic acid, such as a mature miRNA sequence.
  • a synthetic nucleic acid may have a sequence that differs from the sequence of a precursor miRNA, but that sequence may be altered once in a cell to be the same as an endogenous, processed miRNA.
  • isolated means that the nucleic acid molecules of the invention are initially separated from different (in terms of sequence or structure) and unwanted nucleic acid molecules such that a population of isolated nucleic acids is at least about 90% homogenous, and may be at least about 95, 96, 97, 98, 99, or 100% homogenous with respect to other polynucleotide molecules.
  • a nucleic acid is isolated by virtue of it having been synthesized in vitro separate from endogenous nucleic acids in a cell. It will be understood, however, that isolated nucleic acids may be subsequently mixed or pooled together.
  • a “synthetic nucleic acid” of the invention means that the nucleic acid does not have a chemical structure or sequence of a naturally occurring nucleic acid. Consequently, it will be understood that the term “synthetic miRNA” refers to a “synthetic nucleic acid” that functions in a cell or under physiological conditions as a naturally occurring miRNA.
  • nucleic acid molecule(s) need not be “synthetic.”
  • a non-synthetic miRNA employed in methods and compositions of the invention may have the entire sequence and structure of a naturally occurring miRNA precursor or the mature miRNA.
  • non-synthetic miRNAs used in methods and compositions of the invention may not have one or more modified nucleotides or nucleotide analogs.
  • the non-synthetic miRNA may or may not be recombinantly produced.
  • the nucleic acid in methods and/or compositions of the invention is specifically a synthetic miRNA and not a non-synthetic miRNA (that is, not an miRNA that qualifies as “synthetic”); though in other embodiments, the invention specifically involves a non-synthetic miRNA and not a synthetic miRNA. Any embodiments discussed with respect to the use of synthetic miRNAs can be applied with respect to non-synthetic miRNAs, and vice versa.
  • a synthetic miRNA molecule does not have the sequence of a naturally occurring miRNA molecule.
  • a synthetic miRNA molecule may have the sequence of a naturally occurring miRNA molecule, but the chemical structure of the molecule, particularly in the part unrelated specifically to the precise sequence (non-sequence chemical structure) differs from chemical structure of the naturally occurring miRNA molecule with that sequence.
  • the synthetic miRNA has both a sequence and non-sequence chemical structure that are not found in a naturally-occurring miRNA.
  • the sequence of the synthetic molecules will identify which miRNA is effectively being provided or inhibited; the endogenous miRNA will be referred to as the “corresponding miRNA.”
  • Corresponding miRNA sequences that can be used in the context of the invention include, but are not limited to, those sequences in SEQ ID NOs: 1-593 and those miRNAs listed in the appendix.
  • synthetic nucleic acids of the invention may include SEQ ID NOs:594-703 as well as any other miRNA sequence, miRNA precursor sequence, or any sequence complementary thereof.
  • the sequence is or is derived from a probe sequence identified in the appendix to target the particular miRNA (or set of miRNAs) that can be used with that probe sequence.
  • Synthetic miRNA of the invention are RNA or RNA analogs in some embodiments of the invention.
  • MiRNA inhibitors may be DNA or RNA, or analogs thereof.
  • miRNA and miRNA inhibitors of the invention are collectively referred to as “synthetic nucleic acids.”
  • a synthetic miRNA having a length of between 17 and 130 residues.
  • the present invention concerns synthetic miRNA molecules that are, are at least, or are at most 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109
  • synthetic miRNA have a) an “miRNA region” whose sequence from 5′ to 3′ is identical to a mature miRNA sequence, and b) a “complementary region” whose sequence from 5′ to 3′ is between 60% and 100% complementary to the miRNA sequence.
  • these synthetic miRNA are also isolated, as defined above.
  • miRNA region refers to a region on the synthetic miRNA that is at least 90% identical to the entire sequence of a mature, naturally occurring miRNA sequence.
  • the miRNA region is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% identical to the sequence of a naturally-occurring miRNA.
  • complementary region refers to a region of a synthetic miRNA that is or is at least 60% complementary to the mature, naturally occurring miRNA sequence that the miRNA region is identical to.
  • the complementary region is or is at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein.
  • the complementary region is on a different nucleic acid molecule than the miRNA region, in which case the complementary region is on the complementary strand and the miRNA region is on the active strand.
  • an miRNA inhibitor is between about 17 to 25 nucleotides in length and comprises a 5′ to 3′ sequence that is at least 90% complementary to the 5′ to 3′ sequence of a mature miRNA.
  • an miRNA inhibitor molecule is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range derivable therein.
  • an miRNA inhibitor has a sequence (from 5′ to 3′) that is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein, to the 5′ to 3′ sequence of a mature miRNA, particularly a mature, naturally occurring miRNA.
  • Probe sequences for miRNAs are disclosed in the appendix. While they have more sequence than an miRNA inhibitor, one of skill in the art could use that portion of the probe sequence that is complementary to the sequence of a mature miRNA as the sequence for an miRNA inhibitor. Table 1 indicates what the mature sequence of an miRNA is. Moreover, that portion of the probe sequence can be altered so that it is still 90% complementary to the sequence of a mature miRNA.
  • a synthetic miRNA contains one or more design elements. These design elements include, but are not limited to: i) a replacement group for the phosphate or hydroxyl of the nucleotide at the 5′ terminus of the complementary region; ii) one or more sugar modifications in the first or last 1 to 6 residues of the complementary region; or, iii) noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3′ end of the complementary region and the corresponding nucleotides of the miRNA region.
  • a synthetic miRNA has a nucleotide at its 5′ end of the complementary region in which the phosphate and/or hydroxyl group has been replaced with another chemical group (referred to as the “replacement design”).
  • the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2′O-Me (2′ oxygen-methyl), DMTO (4,4′-dimethoxytrityl with oxygen), fluoroscein, a thiol, or acridine, though other replacement groups are well known to those of skill in the art and can be used as well.
  • This design element can also be used with an miRNA inhibitor.
  • Additional embodiments concern a synthetic miRNA having one or more sugar modifications in the first or last 1 to 6 residues of the complementary region (referred to as the “sugar replacement design”).
  • sugar modifications in the first 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein there is one or more sugar modifications in the last 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein, have a sugar modification.
  • first and “last” are with respect to the order of residues from the 5′ end to the 3′ end of the region.
  • the sugar modification is a 2′O-Me modification.
  • an miRNA inhibitor can have this design element and/or a replacement group on the nucleotide at the 5′ terminus, as discussed above.
  • noncomplementarity design there is a synthetic miRNA in which one or more nucleotides in the last 1 to 5 residues at the 3′ end of the complementary region are not complementary to the corresponding nucleotides of the miRNA region.
  • the noncomplementarity may be in the last 1, 2, 3, 4, and/or 5 residues of the complementary miRNA.
  • synthetic miRNA of the invention have one or more of the replacement, sugar modification, or noncomplementarity designs.
  • synthetic RNA molecules have two of them, while in others these molecules have all three designs in place.
  • the miRNA region and the complementary region may be on the same or separate polynucleotides. In cases in which they are contained on or in the same polynucleotide, the miRNA molecule will be considered a single polynucleotide. In embodiments in which the different regions are on separate polynucleotides, the synthetic miRNA will be considered to be comprised of two polynucleotides.
  • the RNA molecule is a single polynucleotide
  • the single polynucleotide is capable of forming a hairpin loop structure as a result of bonding between the miRNA region and the complementary region.
  • the linker constitutes the hairpin loop. It is contemplated that in some embodiments, the linker region is, is at least, or is at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 residues in length, or any range derivable therein. In certain embodiments, the linker is between 3 and 30 residues (inclusive) in length.
  • flanking sequences as well at either the 5′ or 3′ end of the region.
  • the present invention also concerns a collection of synthetic nucleic acid molecules, referred to as a library.
  • a collection may contain, contain at least or contain at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106
  • Embodiments involving libraries and methods of using nucleic acids of the invention may be applied to miRNA and miRNA inhibitors.
  • any embodiment discussed with respect to nucleic acids of the invention may generally be applicable to miRNA and miRNA inhibitor molecules, and vice versa.
  • embodiments discussed with respect to miRNA may be applied to miRNA inhibitors and vice versa.
  • a method comprises: a) introducing into one or more cells a synthetic miRNA molecule; and b) comparing one or more characteristics of cell(s) having the RNA molecule with cells in which the synthetic miRNA molecule has not been introduced.
  • the cells with the synthetic miRNA may be compared to cells in which a different molecule was introduced (such as a negative control that does not include an miRNA region or has an miRNA region for a different miRNA). It is contemplated that the compared cells need not be evaluated at the same time. In fact, the comparison cells need not have been cultured at the same time; one may refer to a report or previous observation.
  • methods include reducing or eliminating activity of one or more miRNAs from a cell comprising: a) introducing into a cell an miRNA inhibitor. In certain embodiment, methods also include comparing one or more characteristics of a cell having the miRNA inhibitor with a cell not having the miRNA inhibitor.
  • the synthetic nucleic acids discussed above and herein can be used in methods of the invention.
  • the methods involve synthetic nucleic acids with the different designs in them.
  • Characteristics of cells that may be evaluated are not limited. They include the following characteristics and characteristics associated with the following: cell proliferation, mitotic index, cell cycle, apoptosis, motility, adhesion, signal transduction, protein localization, gene expression, RNA localization, cell division, DNA replication, post-translational modification, differentiation, de-differentiation, transcriptional activation, protein activation, angiogenesis, metabolism (energy production and/or consumption), protein degradation, chromatin condensation, microtubule production, DNA replication, recombination, and DNA repair functions. It is contemplated that these characteristics may be relevant globally to the cell (for example, overall protein production reduced) or to individual species in the cell (for example, induction of a specific protein(s)).
  • this method may be applied with respect to a variety of different synthetic and/or nonsynthetic miRNAs in separate or the same cells.
  • the following numbers of different synthetic miRNA molecules may be introduced into different cells: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99
  • the invention is not limited by cell type. It is contemplated that any cell expressing miRNA or any cell having a characteristic altered by an miRNA is amenable to the methods and compositions of the invention. Use of two or more miRNAs may be combined in a single pharmaceutical composition as a cocktail or may be used in any therapeutic, diagnostic or prognostic method of the invention.
  • methods of the invention may involve, involve at least, or involve at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,
  • methods include assaying the cell for the presence of the miRNA that is effectively being introduced by the synthetic miRNA molecule or inhibited by an miRNA inhibitor. Consequently, in some embodiments, methods include a step of generating an miRNA profile for a sample.
  • miRNA profile refers to a set of data regarding the expression pattern for a plurality of miRNAs in the sample; it is contemplated that the miRNA profile can be obtained using an miRNA array.
  • an miRNA profile is generated by steps that include: a) labeling miRNA in the sample; b) hybridizing the miRNA to an miRNA array; and, c) determining miRNA hybridization to the array, wherein an miRNA profile is generated.
  • a cell that is introduced with a synthetic miRNA or an miRNA inhibitor may be subsequently evaluated or assayed for the amount of endogenous or exogenous miRNA or miRNA inhibitor.
  • Any cell type is contemplated for use with the invention.
  • the cell may be from or in a mammal, such as a monkey, horse, cow, pig, sheep, dog, cat, rabbit, mouse, rat, or human.
  • a step of synthesizing or obtaining the synthetic RNA molecule is included.
  • the synthetic nucleic acid is introduced into the cell by calcium phosphate transfection, lipid transfection, electroporation, microinjection, or injection.
  • a cell may be in a subject, which may be a patient or an animal model.
  • synthetic nucleic acids can be administered to the subject or patient using modes of administration that are well known to those of skill in the art, particularly for therapeutic applications. It is particularly contemplated that a patient is human or any other mammal or animal having miRNA.
  • the present invention also concerns inducing certain cellular characteristics by providing to a cell a particular nucleic acid, such as a specific synthetic miRNA molecule or a synthetic miRNA inhibitor molecule.
  • a particular nucleic acid such as a specific synthetic miRNA molecule or a synthetic miRNA inhibitor molecule.
  • the miRNA molecule or miRNA inhibitor need not be synthetic. They may have a sequence that is identical to a naturally occurring miRNA or they may not have any design modifications.
  • the miRNA molecule and/or an miRNA inhibitor are synthetic, as discussed above.
  • the particular nucleic acid molecule provided to the cell is understood to correspond to a particular miRNA in the cell, and thus, the miRNA in the cell is referred to as the “corresponding miRNA.”
  • the corresponding miRNA will be understood to be the induced miRNA. It is contemplated, however, that the miRNA molecule provided introduced into a cell is not a mature miRNA but is capable of becoming a mature miRNA under the appropriate physiological conditions. In cases in which a particular corresponding miRNA is being inhibited by a miRNA inhibitor, the particular miRNA will be referred to as the targeted miRNA. It is contemplated that multiple corresponding miRNAs may be involved.
  • more than one miRNA molecule is introduced into a cell.
  • more than one miRNA inhibitor is introduced into a cell.
  • a combination of miRNA molecule(s) and miRNA inhibitor(s) may be introduced into a cell.
  • Methods include identifying a cell or patient in need of inducing those cellular characteristics. Also, it will be understood that an amount of a synthetic nucleic acid that is provided to a cell or organism is an “effective amount,” which refers to an amount needed to achieve a desired goal, such as inducing a particular cellular characteristic(s).
  • methods of the methods include providing or introducing to a cell a nucleic acid molecule corresponding to a mature miRNA in the cell in an amount effective to achieve a desired physiological result. Such methods are disclosed herein. Moreover, methods of the invention involve diagnosing a patient based on an miRNA expression profile. In certain embodiments, the elevation or reduction in the level of expression of a particular miRNA in a cell is correlated with a disease state compared to the expression level of that miRNA in a normal cell. This correlation allows for diagnostic methods to be carried out when that the expression level of an miRNA is measured in a biological sample being assessed and then compared to the expression level of a normal cell.
  • the corresponding miRNA involved in the method may be one or more of at least the following: Let 7a, let 7a-1, let 7b, let 7b-1, let-7c, let-7d, let 7g, miR-1, miR-1-d, miR-1-2, miR-9, miR-10a, miR-10b, miR-15a, miR-16, miR-17, miR-17-3p, miR-18, miR-19a, miR-20, miR-21, miR-22, miR-23, miR-23a, miR-23b, miR-24, miR-25, miR-26a, miR-27a, miR-28, miR-29a, miR-29b, miR-30a-3p, miR-30a, miR-30e-5p, miR-31, miR-32, miR-34a, miR-92, miR-93, miR-95, miR-96, miR-98, miR-99a, miR-100, miR-101, miR-101,
  • methods can involve providing synthetic or nonsynthetic miRNA molecules. It is contemplated that in these embodiments, methods may or may not be limited to providing only one or more synthetic miRNA molecules or only on or more nonsynthetic miRNA molecules. Thus, in certain embodiments, methods may involve providing both synthetic and nonsynthetic miRNA molecules. In this situation, a cell or cells are most likely provided a synthetic miRNA molecule corresponding to a particular miRNA and a nonsynthetic miRNA molecule corresponding to a different miRNA. Furthermore, any method articulated a list of miRNAs using Markush group language may be articulated without the Markush group language and a disjunctive article (i.e., or) instead, and vice versa.
  • there is a method for reducing or inhibiting cell proliferation in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves introducing into the cell an effective amount of i) an miRNA inhibitor molecule having a 5′ to 3′ sequence that is at least 90% complementary to the 5′ to 3′ sequence of a mature miRNA selected from the group consisting of: mir-31, mir-92, mir-99a, mir-100, mir-125a, mir-129, mir-130a, mir-150, mir-187, miR-190, miR-191, miR-193, miR 204, mir-210, mir-211, mir-212, mir-213, mir-215, mir-216, mir-217, miR 218, mir-224, mir-292, mir-294, mir-320, mir-324, mir-325, mir-326, mir-330, mir-331, mir-338, mir-341, mir-369, and mir-370; or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence selected from the group consisting of: miR-15a, miR-16, miR 21, miR 24, miR-96
  • any of the following may be included in the group from which the miRNA inhibitor molecule (i) may be chosen: Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-26a, miR-26a, mir-30e-5p, mir-31, mir-32, mir-92, mir-93, miR-100, miR-125a, miR-125b, mir-127, miR-128, miR-129, mir-130a, mir-135, mir-138, mir-139, miR-140, mir-141, mir-143, mir-145, mir-146, miR-150, mir-154, mir-155, mir-181a, miR-182, mir-186, miR-187, miR-188, mir-190, mir-191, mir-193, mir-196, mir-197, mir-198,
  • any of the following may be included in the group from which the miRNA molecule that corresponds to an miRNA sequence (ii) may be chosen: let7a-1, Let-7a, Let-7b, let7b-1, let7c, let7d, Let-7g, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-21, mir-23a, mir-23b, mir-24, mir-25, mir-92, mir-95, mir-133a, mir-133a-2, mir-133b, mir-142, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-191, mir-193, mir-194, mir-196, mir-199a-1, mir-200b, mir-204, mir-206, mir-211, mir-222, mir-223, mir-298, mir-328, mir-342, mir-371, and mir-412.
  • methods involve providing a synthetic miRNA inhibitor having a sequence that is at least 90% complementary to the 5′ to 3′ sequence of a corresponding miRNA that is mir-31, mir-92, mir-99a, mir-100, mir-125a, mir-129, mir-130a, mir-150, mir-187, miR-190, miR-191, miR-193, miR 204, mir-210, mir-211, mir-212, mir-213, mir-215, mir-216, mir-217, miR 218, mir-224, mir-292, mir-294, mir-320, mir-324, mir-325, mir-326, mir-330, mir-331, mir-338, mir-341, mir-369, mir-370, Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-26a, miR-26a, miR
  • methods involve providing a synthetic or nonsynthetic miRNA molecule that corresponds to miR-15a, miR-16, miR 21, miR 24, miR-96, miR-101, miR-105, miR-124, miR-126, miR-142, miR-147, miR-192, miR-194, miR-206, miR-215, miR-346, let7a-1, Let-7a, Let-7b, let7b-1, let7c, let7d, Let-7g, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-21, mir-23a, mir-23b, mir-24, mir-25, mir-92, mir-95, mir-133a, mir-133a-2, mir-133b, mir-142, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-191, mir-193, mir-194, mir-196, mir-199a-1, mir-200b, mir-
  • the present invention also concerns methods for inducing or increasing cell proliferation in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves introducing into or providing the cell an effective amount of i) an miRNA inhibitor corresponding to let7a-1, Let-7a, Let-7b, let7b-1, let7c, let7d, Let-7g, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-21, mir-23a, mir-23b, mir-24, mir-25, mir-92, mir-95, mir-133a, mir-133a-2, mir-133b, mir-142, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-191, mir-193, mir-194, mir-196, mir-199a-1, mir-200b, mir-204, mir-206, mir-211, mir-222, mir-223, mir-298, mir-328, mir-342, mir-371, and mir-412; or ii) a miRNA molecule corresponding to Let-7a, Let-7b, Let-7c, Let-7d, Let-7
  • the group of miRNA inhibitors includes miR-15a, miR-16, miR 21, miR 24, miR-96, miR-101, miR-105, miR-124, miR-126, miR-142, miR-147, miR-192, miR-194, miR-206, miR-215, or miR-346 and the group of miRNAs molecules corresponding to miRNAs includes mir-31, mir-92, mir-99a, mir-100, mir-125a, mir-129, mir-130a, mir-150, mir-187, miR-190, miR-191, miR-193, miR 204, mir-210, mir-211, mir-212, mir-213, mir-215, mir-216, mir-217, miR 218, mir-224, mir-292, mir-294, mir-320, mir-324, mir-325, mir-326, mir-330, mir-331, mir-338, mir-341, mir-369, and mir-370.
  • Such methods can be used for the treatment of wounds, burns, ischemia, or any other condition, disease, or symptom in which cell proliferation is desirable.
  • a cell or other biological matter such as an organism (including patients) can be provided an miRNA or miRNA molecule corresponding to a particular miRNA by administering to the cell or organism a nucleic acid molecule that functions as the corresponding miRNA once inside the cell.
  • the form of the molecule provided to the cell may not be the form that acts an miRNA once inside the cell.
  • biological matter is provided a synthetic miRNA or a nonsynthetic miRNA, such as one that becomes processed into a mature and active miRNA once it has access to the cell's miRNA processing machinery.
  • the miRNA molecule provided to the biological matter is not a mature miRNA molecule but a nucleic acid molecule that can be processed into the mature miRNA once it is accessible to miRNA processing machinery.
  • nonsynthetic in the context of miRNA means that the miRNA is not “synthetic,” as defined herein.
  • the use of corresponding nonsynthetic miRNAs is also considered an aspect of the invention, and vice versa.
  • the methods involve reducing cell viability comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves introducing into one or more cells an effective amount of i) an miRNA inhibitor corresponding to miR-107, miR-133, miR-137, miR-152, miR-155, miR-181a, miR-191, miR-203, or miR-215; or ii) an miRNA molecule corresponding to let-7a, let-7b, mir-1, mir-7, miR-10b, miR-17-3p, miR-19a, mir-23, mir-24, mir-27a, miR-29a, miR-30a-3p, mir-31, mir-32, miR-34a, miR-101, miR-107, miR-108, miR-122, mir-124, miR-133a, miR-134, mi
  • the group of miRNA inhibitors includes let-7a, let-7b, let-7c, let-7d, let-7g, miR-10a, miR-10b, miR-15a, miR-17-3p, miR-18, miR-19a, miR-20, mir-23a, mir-23b, mir-24, miR-25, miR-26a, mir-32, miR-107, miR-125a, miR-126, mir-128, miR-129, miR-133, miR-137, mir-139, miR-143, miR-152, miR-155, miR-181a, miR-182, miR-191, miR-203, miR-215, and mir-331
  • aspects of the invention include a method for increasing cell viability comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves introducing into one or more cells an effective amount of i) an miRNA inhibitor corresponding to miR-7, miR-19a, miR-23, miR-24, miR-27a, miR-31, miR-32, miR-134, miR-140, miR-150, miR-192, or miR-193; or ii) an miRNA molecule corresponding to let-7a, let-7b, let-7c, let-7d, let-7g, miR-10a, miR-10b, miR-15a, miR-17-3p, miR-18, miR-19a, miR-20, mir-23a, mir-23b, mir-24, miR-25, miR-26a, mir-32, miR-107, miR-125a, miR-126, mir-128, miR-129, miR-133, miR-137, mir-139, miR-143, miR-152, miR-155, miR-181a, miR-182, miR-191, miR-203, miRNA inhibitor
  • the group of miRNA inhibitors (group i) includes let-7a, let-7b, mir-1, mir-7, miR-10b, miR-17-3p, miR-19a, mir-23, mir-24, mir-27a, miR-29a, miR-30a-3p, mir-31, mir-32, miR-34a, miR-101, miR-107, miR-108, miR-122, mir-124, miR-133a, miR-134, miR-135, miR-139, mir-140, miR-141, miR-145, mir-150, mir-192, mir-193, mir-195, mir-206, mir-208, mir-210, mir-210, mir-292-3p, mir-293, mir-297, mir-299, mir-329, mir-337, mir-337, mir-345, mir-346, or mir-409, and the group of miRNAs molecules corresponding to miRNAs (group ii) includes.
  • the present invention also concerns a method for inducing apoptosis in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves introducing into the cell an effective amount of i) an miRNA inhibitor corresponding to miR-31 or miR-214; or ii) an miRNA molecule corresponding to let-7b, let-7g, mir-1, mir-1d, mir-7, mir-10a, miR-10b, miR-17-3p, miR-19a, miR-28, miR-28, miR-28, miR-29a, miR-32, miR-34a, miR-122, mir-148, mir-149, mir-154, mir-184, mir-186, mir-188, mir-192, mir-195, mir-196, mir-199a, mir-204, mir-208, mir-210, mir-211, mir-212, mir-214, mir-215, mir-216, mir-217, mir-218, mir-293, mir-296, mir-299, mir-321, mir-328, or mir-344.
  • the group of miRNA inhibitors includes Let-7b, mir-21, mir-23b, mir-25, miR-26a, mir-28, mir-29a, mir-31, miR-32, mir-30a-3p, mir-34a, mir-96, miR-98, mir-100, mir-101, mir-105, mir-108, miR-125b, miR-126, mir-126, mir-128, mir-137, miR-143, miR-155, mir-207, mir-214, mir-216, mir-223, mir-292-3p, mir-328, mir-335, mir-340, mir-341, mir-367, mir-368, mir-380-3p, and mir-410.
  • Methods for inducing apoptosis have a number of therapeutic applications including, but not limited to, the treatment of cancer.
  • inventions involve a method for inhibiting apoptosis in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves introducing into the cell an effective amount of i) an miRNA inhibitor corresponding to miR-7, miR-1-2, miR-148, miR-195, miR-196, miR-199a, miR-204, miR-210, miR-211, miR-212, miR-215, miR-216, miR-218, miR-296, or miR-321; or ii) an miRNA molecule corresponding to Let-7b, mir-21, mir-23b, mir-25, miR-26a, mir-28, mir-29a, mir-31, miR-32, mir-30a-3p, mir-34a, mir-96, miR-98, mir-100, mir-101, mir-105, mir-108, miR-125b, miR-126, mir-126, mir-128, mir-137, miR-143, miR-155, mir-207, mir-214, mir-216, mir-223, mir-292-3p, mir-328, mir-335, mir-340, mir-3
  • the group of miRNA inhibitors includes let-7b, let-7g, mir-1, mir-1d, mir-7, mir-10a, miR-10b, miR-17-3p, miR-19a, miR-28, miR-28, miR-28, miR-29a, miR-32, miR-34a, miR-122, mir-148, mir-149, mir-154, mir-184, mir-186, mir-188, mir-192, mir-195, mir-196, mir-199a, mir-204, mir-208, mir-210, mir-211, mir-212, mir-214, mir-215, mir-216, mir-217, mir-218, mir-293, mir-296, mir-299, mir-321, mir-328, or mir-344.
  • the present invention also concerns using miRNA compositions to treat diseases or conditions or to prepare therapeutics for the treatment of diseases or conditions.
  • the invention involves one or more human miRNA selected from the group consisting of let-7, miR-10a, miR-15a, miR-16, miR-17, miR-21, miR-22, miR-23, miR-24, miR-26a, miR-29b, miR-30a, miR-96, miR-101, miR-105, miR-106, miR-124, miR-125a, miR-126, miR-130, miR130a, miR-133, miR-142, miR-143, miR-144, miR-145, miR-147, miR-181a, miR-182, miR-183, miR-188, miR-189, miR-192, miR-194, miR-195, miR-199a, miR-200b, miR-201, miR-205, miR-219, 206, miR-215, miR
  • methods involve one or more miRNA inhibitors and/or an miRNA molecules corresponding to any of these miRNAs, particularly for the treatment or prevention of cancer.
  • Cancer includes, but is not limited to, malignant cancers, tumors, metastatic cancers, unresectable cancers, chemo- and/or radiation-resistant cancers, and terminal cancers.
  • methods involve one or more miRNA inhibitors and/or an miRNA molecules corresponding to miR-17, miR-21, miR-126, miR-143, miR-145, miR-188, miR-200b, miR-219, or miR-331.
  • methods involve one or more of 1) an inhibitor of miR-17, miR-21, miR-182, miR-183, miR-200b, miR-205, miR-223, and/or miR-224; and/or 2) an miRNA corresponding to let-7, miR-10a, miR-16, miR-22, miR-23, miR-24, miR-26a, miR-29b, miR-30a, miR-106, miR-125a, miR-126, miR-130, miR-133, miR-143, miR-144, miR-145, miR-181a, miR-188, miR-219, miR-192, miR-194, miR-195, miR-199a, mmu-miR-201, miR-215, miR-321, miR-328, miR-331, and/or miR-342.
  • Such methods can be used, in some embodiments to treat cancer, including specific cancers.
  • an miRNA corresponding to one or more of miR-15a, miR-16, miR-96, miR-101, miR-105, miR-124, miR-126, miR-142, miR-147, miR-192, miR-194, miR-206, miR-215, or miR-346 may be used to treat cancer or inhibit cell proliferation. It is contemplated that these miRNAs may be used regardless of the source of the cell in which proliferation is undesirable.
  • miRNA refers to any of its gene family members (distinguished by a number), unless otherwise indicated.
  • a “gene family” refers to a group of genes having the same miRNA coding sequence.
  • members of a gene family are identified by a number following the initial designation.
  • miR-16-1 and miR-16-2 are members of the miR-16 gene family and “mir-7” refers to miR-7-1, miR-7-2 and miR-7-3.
  • a shorthand notation refers to related miRNAs (distinguished by a letter).
  • let-7 refers to let-7a-1, let7-a-2, let-7b, let-7c, let-7d, let-7e, let-7f-1, and let-7f-2.” Exceptions to this shorthand notations will be otherwise identified.
  • the present invention concerns treating breast cancer or decreasing cell proliferation of breast cancer cells by introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to miR-21, miR-15a, miR-16, miR-24, and/or miR-25, and/or 2) one or more miRNAs corresponding to miR-99, miR-100, miR-205, miR-197, miR-126, miR-143, miR-145 and/or miR-321.
  • the miRNAs molecules corresponding to miRNAs (group ii) can include mir-27a, mir-92, mir-96, mir-98, mir-99a, mir-101, mir-105, mir-124, mir-126, mir-129, mir-132, mir-142, mir-147, mir-192, mir-201, mir-206, mir-208, mir-210, mir-211, mir-214, mir-215, mir-219, mir-220, mir-221, mir-223, mir-297, mir-329, mir-331, mir-345, mir-346, mir-409, or mir-411.
  • providing an agent is used to include “administering” the agent to a patient.
  • the present invention also relates to treating colon cancer by introducing into or providing to a colon cancer cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing 1) one or more miRNA inhibitors corresponding to miR-21, miR-106, miR-200b, miR-223, miR-224, miR-31, and/or miR-17; and/or 2) one or more miRNAs corresponding to miR-145, miR-143, miR-133, miR-342, miR-125a, miR-195, miR-30a, miR-10a, miR-130, miR-192, miR-194, miR-215, miR-144, miR-23, miR-26a, miR-126, miR-199a, miR-188, miR-331, and/or miR-21.
  • methods for treating thyroid cancer involve introducing into or providing to a thyroid cancer cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to the patient 1) one or more miRNA inhibitors corresponding to miR-21 miR-125, miR-24, miR-200b, miR-29b, miR-221, miR-222, miR-224, miR-10a, and/or miR-183; and/or 2) one or more miRNAs corresponding to miR-145, miR-22, miR-331, miR-126, miR-30a, miR-199a, miR-223, and/or miR-321.
  • Methods involve introducing into or providing to a lung cancer cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to the patient 1) one or more miRNA inhibitors corresponding to miR-223, miR-106, miR-21, miR-200b, miR-321, miR-182, miR-183, miR-17, and/or miR-205; and/or 2) one or more miRNAs corresponding to miR-130a, miR-145, miR-126, miR-331, miR-342, miR-143, Let-7, miR-30a, miR-16, miR-26a, miR-125a, miR-29b, miR-24, miR-328, miR-195, miR-22, miR-181a, miR-331, and/or miR-321.
  • the group of miRNA inhibitors includes mir-30e-5p, mir-25, mir-32, mir-92, mir-130a, mir-135, mir-145, mir-216, mir-293, mir-294, mir-333, mir-335, mir-338, mir-341, mir-350, mir-369, or mir-412
  • the group of miRNAs molecules corresponding to miRNAs includes ambi-mir7100, Let-7b, Let-7d, Let-7g, mir-7, mir-15a, mir-16, mir-22, mir-28, mir-29a, mir-34a, mir-96, mir-101, mir-105, mir-108, mir-122, mir-124, mir-125a, mir-125b, mir-126, mir-128, mir-129, mir-132, mir-133A, mir-136, mir-137, mir-141, mir-142, mir-147, mir-149, mir-151, mir-152, mir-182, mir-183, mir-186, mir-188, mir-192,
  • the present invention concerns treating cervical cancer or decreasing cell proliferation of cervical cancer cells by providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, mir-9, mir-145, mir-155, mir-181a, mir-186, mir-190, mir-191, or mir-199, and/or 2) one or more miRNAs corresponding to mir-1, mir-34a, mir-101, mir-124, mir-192, mir-193, mir-195, mir-201, mir-206, mir-208, mir-210, mir-215, mir-292-3p, mir-293, mir-297, mir-299, mir-337, mir-339, mir-340, mir-344, mir-345, mir-367, or mir-409.
  • the present invention concerns treating prostate cancer or decreasing cell proliferation of prostate cancer cells by introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to Let-7a, Let-7b, mir-93, mir-127, mir-154, mir-181a, mir-194, mir-198, mir-199, mir-201, or mir-369, and/or 2) one or more miRNAs corresponding to mir-15a, mir-16, mir-27a, mir-28, mir-30a-3p, mir-34a, mir-101, mir-103, mir-105, mir-107, mir-124, mir-126, mir-128, mir-129, mir-132, mir-135, mir-137, mir-141, mir-142, mir-147, or mir-297.
  • the present invention concerns treating skin cancer or decreasing cell proliferation of skin cancer cells by introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to miR-26a, miR-125a, miR-128, mir-138, mir-139, mir-141, mir-143, miR-145, mir-146, miR-150, miR-187, mir-188, mir-190, mir-196, mir-197, mir-198, mir-199, miR-201, mir-204, mir-216, miR-223, miR-291-3p, miR-294, miR-295, miR-322, miR-373, mir-410, or mir-412, and/or 2) one or more miRNAs corresponding to let 7a, mir-1, mir-7, mir-15a, mir-16, mir-20, mir-26a, mir-28, mir-34a, mir-96, mir-101, mir-105, miR-105, mir-124, mir-126, mir-128, mir-132, mir-133A, mir-136, mir-137, mir-141, mir-142, mir-
  • the present invention concerns treating leukemia or decreasing cell proliferation of cancerous T cells by introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to miR-15a, miR-23b, miR-25, miR-26a, miR-100, miR-125b, miR-126, miR-129, miR-140, miR-143, or miR-155, and/or 2) one or more miRNAs corresponding to let-7a, let-7b, miR-10b, miR-17-3p, miR-29a, miR-30a-3p, miR-34a, miR-101, miR-122, or miR-133a.
  • the group of miRNA inhibitors includes let-7a, let-7b, let-7c, let-7d, let-7g, miR-7, miR-10a, miR-10b, miR-15a, miR-17-3p, miR-18, miR-19a, miR-20, miR-125a, miR-126, or miR-182, and the group of miRNAs molecules corresponding to miRNAs (group 2) includes miR-107, miR-134, miR-135, miR-139, miR-141, or miR-145. Moreover, such methods can extend to T-cells generally.
  • embodiments of the invention include methods for decreasing cell proliferation comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing or introducing an effective amount of at least 1) one or more miRNA inhibitors corresponding to Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-15a, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-25, miR-26a, miR-26a, mir-30e-5p, mir-32, mir-92, mir-93, miR-100, miR-125a, miR-125b, miR-126, mir-127, miR-128, miR-129, mir-130a, mir-135, mir-138, mir-139, miR-140, mir-141, mir-143, mir-145, mir-146, miR-150, mir-154, mir-155, mir-181a, miR-182, mir-186, miR-187, miR-188, mir-190, mir-191, mir-194, mir-196, mir
  • the present invention also concerns embodiments methods for increasing cell proliferation comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing or introducing an effective amount of at least 1) one or more miRNA inhibitors corresponding to ambi-mir7100, let 7a, let-7b, let-7d, let-7g, mir-1, mir-7, miR-10b, mir-15a, mir-16, miR-17-3p, mir-20, mir-22, mir-26a, mir-27a, mir-28, mir-28, miR-29a, mir-30a-3p, mir-34a, mir-92, mir-96, mir-98, mir-99a, mir-101, mir-103, mir-105, mir-107, mir-108, mir-122, mir-124, mir-125a, mir-125b, mir-126, mir-128, mir-129, mir-132, miR-133a, miRNA
  • aspects of the invention include the treatment of systemic lupus erythrematosus (SLE).
  • methods concern introducing into or providing to a patient an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to a patient with SLE or suspect of having SLE 1) one or more miRNA inhibitors corresponding to miR-21, miR-223, and/or mir-342 expression; and/or 2) one or more miRNAs corresponding to miR-95, miR-105, miR-137, miR-186, miR-188, miR-199, miR-211, miR-215, mu-miR-290, miR-301, and/or miR-331.
  • method include introducing into or providing to a patient with a prion disease an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to a patient 1) one or more miRNA inhibitors corresponding miR-7, miR-9, miR-16, miR-24, miR-26A, miR-27A, and/or miR-130A; and/or 2) one or more miRNAs corresponding to miR-95 and/or miR-135A.
  • the patient may be one diagnosed with a prion disease, one at risk for a prion disease, or one suspected of having a prion disease.
  • a nucleic acid molecule corresponding to an miRNA is double stranded, wherein both strands have the sequence of the mature miRNA it corresponds to.
  • Such a molecule may be designated with an “as” suffix in embodiments of the invention.
  • miR-9-as was used in some experiments described herein. It is contemplated that in some embodiments, a nucleic acid molecule is an miRNA-as molecule.
  • the present invention also concerns patients diagnosed as having ischemia, those at risk for ischemia, those suspected of having ischemia, or patients with symptoms of ischemia.
  • Methods involve introducing into or providing to a patient an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to a patient 1) one or more miRNA inhibitors corresponding to miR-28, miR-30A, miR-31, miR-138, miR-139, miR-140, miR-291 and/or mmu-miR-298; and/or 2) one or more miRNAs corresponding to Let-7f-2 and/or miR-16.
  • a synthetic miRNA in which both the sense and antisense strand are derived from a single precursor miRNA is used in methods and compositions of the invention. These are frequently designated with a “P” suffix in which “5P” indicates that the mature miRNA derives from the 5′ end of the precursor and a corresponding “3P” indicates that it derives from the 3′ end of the precursor, as described on the world wide web at sanger.ac.uk/cgi-bin/rfam/mirna. Moreover, in some embodiments, an miRNA that does not correspond to a known human miRNA was evaluated. It is contemplated that these non-human miRNAs may be used in embodiments of the invention or that there may exist a human miRNA that is homologous to the non-human miRNA.
  • the present invention in some embodiments concerns methods for reducing cell viability comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7a, let-7b, miR-1, miR-10b, miR-17, miR-19a, miR-20, miR-28, miR-29a, miR-30a, miR-32, miR-34a, miR-96, miR-101, miR-122, miR-124, miR-132, miR-133a, miR-134, miR-139, miR-140, miR-144, miR-145, miR-147, miR-155, miR-182, miR-183, miR-184, miR-186, miR-190, miR-193, miR-197, miR-206, miR-208, miR-210, miR-216, miR-217, miR-224, mu-miR-292, mu-miR-293, mu
  • Methods concerning cell viability and cell proliferation may generally be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.
  • miRNAs that selectively reduce the proliferation of cancer cells may be employed as therapeutics since they can be delivered to cancer and non-cancer cells alike but will only affect the growth of the cancerous cells.
  • methods may be used to halt or prevent metastasis or reduce the number of metastases.
  • the cell in which the effect is desired may be a cell that is diseased or involved in maintaining, promoting, or causing a disease or condition.
  • the cell is a cancer cell, while in other embodiments, it is contemplated to be a healthy (non-diseased) cell.
  • a targeted cell is in an organism.
  • nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell is a synthetic miRNA in some embodiments of the invention.
  • the present invention involves methods for increasing cell viability comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7a, let-7b, let-7c, miR-9, miR-10a, miR-10b, miR-15a, miR-17, miR-18, miR-20, mir-23b, miR-25, miR-26a, miR-98, miR-100, miR-125a, miR-125b, miR-126, miR-129, miR-140, miR-141, miR-143, miR-155, or miR-181-a; or 2) at least one miRNA inhibitor corresponding to let-7a, let-7b, miR-1, miR-10b, miR-17, miR-19a, miR-20, miR-28, miR-29a, miR-30a, miR-32, miR-34a, miR-96, miR-101, miR-122, miR
  • a cancer cell such as a leukemia cell
  • a nucleic acid capable of being processed into a mature let-7a, let-7b, or miR-10b molecule.
  • Methods of the invention also relate to inhibiting cellular proliferation comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7a, let-7b, let-7c, let-7d, let-7g, miR-1, miR-7, miR-15a, miR-16, miR-19a, miR-22, miR-28, miR-29a, miR-34a, miR-92, miR-96, miR-98, miR-101, miR-122, miR-124, miR-126, miR-129, miR-133b, miR-137, miR-147, miR-192, miR-193, miR-195, miR-205, miR
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-25, miR-27a, miR-31, miR-32, miR-92, miR-139, miR-145, miR-198, miR-212, mu-miR-290, mu-miR-294, miR-323, miR-324, miR-325, miR-331, miR-335, mu-miR-351, miR-369, miR-370, or miR-373; or 2) at least one miRNA inhibitor corresponding to let-7a, let-7b, let-7c, let-7d, let-7g,
  • the present invention also covers methods of inhibiting ERK activation introducing into or providing to a cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves comprising providing to or introducing into cells an effective amount of one or more miRNA inhibitor corresponding to let-7a, mir-294, mir-295, miR-19a, miR-25, miR-96, miR-125a, miR-134, miR-148, miR-152, miR-206, miR-207, miR-210, miR-212, miR-216, miR-217, miR-218, miR-223, mu-miR-294, mu-miR-295, miR-301, miR-328, mu-miR-329, miR-339, miR-370, or miR-372.
  • it also covers methods of activating ERK by introducing into or providing to a cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing or introducing into cells an effective amount of one or more nucleic acids capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-19a, miR-25, miR-96, miR-125a, miR-134, miR-148, miR-152, miR-206, miR-207, miR-210, miR-212, miR-216, miR-217, miR-218, miR-223, mu-miR-294, mu-miR-295, miR-301, miR-328, mu-miR-329, miR-339, miR-370, or miR-372.
  • the mature miRNA is miR-19a, miR-25, miR-96, miR-125a, miR-134, miR-148, miR-152, miR-206, miR-207, miR-210, miR-212, miR-216, miR-217, miR-218, miR-223, mu-miR-294
  • miR-19a miR-25, miR-96, miR-125a, miR-134, miR-148, miR-152, miR-206, miR-207, miR-210, miR-212, miR-216, miR-217, miR-218, miR-223, mu-miR-294, mu-miR-295, miR-301, miR-328, mu-miR-329, miR-339, miR-370, or miR-372.
  • there are methods of increasing the percentage of apoptotic cells in a population comprising introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) one or more nucleic acid molecules capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7d, miR-22, miR-23a, miR-23b, miR-24, miR-27a, miR-31, miR-128, miR-181a, miR-196, miR-198, miR-199, miR-214, miR-217, mu-miR-290, mu-miR-293, miR-324, miR-338, or mu-miR-412; or 2) an miRNA inhibitor corresponding to miR-34a, miR-96, miR-101, miR-105, miR-126, miR-137, or mu-miR-292. It is specifically contemplated that the population of cells may be diseased or related to a disease or condition.
  • there are methods of decreasing the percentage of apoptotic cells in a population comprising introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-34a, miR-96, miR-101, miR-105, miR-126, miR-137, or mu-miR-292; or 2) at least one miRNA inhibitor corresponding to let-7d, miR-22, miR-23a, miR-23b, miR-24, miR-27a, miR-31, miR-128, miR-181a, miR-196, miR-198, miR-199, miR-214, miR-217, mu-miR-290, mu-miR-293, miR-324, miR-338, or mu-miR-412.
  • the population of cells may be involved in diseases or conditions involving atrophy or the decrease in the number of healthy cells as a result of apoptosis.
  • One or more of the miRNAs that induce apoptosis may be introduced into abnormal cells like cancer cells to induce cell death, providing a therapeutic response. This could be especially beneficial if the apoptosis-inducing synthetic miRNAs were injected directly into tumor tissues or otherwise delivered with high efficiency to primary or metastatic cancer cells. These same miRNAs may be co-delivered with other therapeutic agents like chemotherapies to supplement their activities and evoke a therapeutic response.
  • the miRNAs that reduce apoptosis may be introduced into normal cells at the same time that a chemotherapeutic reagent that induces apoptosis is introduced, providing some level of protection to the normal cells while the cancer cells are induced to undergo cell death.
  • the miRNAs may also be used as targets for diagnostic assays or to differentiate cells or to create cell lines with interesting research properties.
  • Methods of the invention include methods for inhibiting or preventing hTert activity in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into the cell an effective amount of at least one i) miRNA inhibitor corresponding to miR-15a, miR-16, miR-21, mir-24, miR-26a, miR-92, miR-105, miR-125a, miR-125b, miR-128, mir-147, miR-195, miR-207, miR-224, miR-295, mir-301, miR-337, mir-368, or mir-371 or ii) a nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-26a, miR-147, mir-195, and mir-368.
  • miRNA inhibitor corresponding to miR-15a, miR-16, miR-21, mir-24, miR-26a, miR-92, miR-105, miR-125a, miR-125b, miR-128, mir-147, miR-195, miR-207, miR-224, miR-295, mir
  • Methods of the invention include methods for inducing hTert activity in a cell comprising providing to or introducing into the cell an effective amount of at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-15a, miR-16, miR-21, mir-24, miR-26a, miR-92, miR-105, miR-125a, miR-125b, miR-128, mir-147, miR-195, miR-207, miR-224, miR-295, mir-301, miR-337, mir-368, or mir-371.
  • hTert activity may be induced in a cell comprising providing to or introducing into the cell an miRNA inhibitor corresponding to miR-26a, miR-147, mir-195, or mir-368.
  • identifying an miRNA that inhibits an hTert activating gene product comprising: a) introducing into a cell a candidate miRNA into a cell; and, b) assaying the level of hTert expression or hTert activity in the cell, wherein a reduction in hTert expression or activity compared to a cell lacking the miRNA identifies the miRNA as a potential inhibitor of an hTert activating gene product.
  • the sequence of the candidate miRNA was previously evaluated for an ability to inhibit an hTert activating gene product.
  • Computer programs and algorithms may be employed to assess whether a particular miRNA sequence can target a particular cellular gene.
  • thTert activating gene product is selected from the group consisting of ACOX1, AKT1, APAF1, COX-5B, COX6, COX7B, CPOX, DUOX2, GPX1, GPX2, GPX4, LPO, MAPK1, MAPK4, MTCO1, NOX3, NOX5, PAOX, PPDX, PRKCA, PRKCD, and TNFRSF6. These methods may be used for combating telomerase activity and cancer progression.
  • the invention also includes methods for inhibiting stimulation of Stat3 in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to the cell an effective amount of an miRNA selected from the group consisting of mir-93, mir-100, mir-134, mir-99a, mir-103, mir-128, mir-129, mir-181b, mir-193, mir-197, mir-212, mir-218, mir-219, mir-302, mir-323, mir-324-3p, mir-325, mir-330, mir-331, mir-340, mmu-mir-350, mir-425, mir-491, mir-518f, mir-520a*.
  • miRNA selected from the group consisting of mir-93, mir-100, mir-134, mir-99a, mir-103, mir-128, mir-129, mir-181b, mir-193, mir-197, mir-212, mir-218, mir-219, mir-302, mir-323, mir-324-3p, mir-325, mir-330, mir-331, mir-340, mmu-mir-350, mir-425, mir-491, mir-518f, mir-520a*.
  • Such methods can be used for
  • tissue destruction include, but are not limited to, tissue destruction, organ failure or inflammatory diseases such as Rheumatoid arthritis, Psoriasis, Asthma, Inflammatory bowel disease (Crohn's disease and related conditions), Multiple Sclerosis, obstructive pulmonary disease (COPD), Allergic rhinitis (hay fever), and Cardiovascular disease. Additionally, such methods may be used for therapeutics, diagnostics, prognostics, creating cell lines with interesting research properties, and inducing differentiation.
  • the present invention also concerns methods of influencing the cell cycle of a cell or population of cells. It is contemplated that methods can involve relatively increasing the number of cells in a particular phase of the cell cycle, such as S, G1, G2/M, or when the number of chromosomes is greater than 2N. Alternatively, it can involve inducing DNA synthesis in a cell. One or more of the miRNAs involved in the cell cycle can be used to modulate a cell, particularly a cancer cell, to achieve a therapeutic benefit for a patient with such cells. Such methods may be used, for example, to enhance the efficacy of a therapeutic agent or they may be employed in the context of research, for instance, to synchronize cells so as to generate a more homogeneous population of cells.
  • these miRNAs may regulate genes that are involved in controlling cell cycle progression. Mis-expression of one or more of these miRNAs may profoundly affect the cells in which they reside, leading potentially toward cancer or other diseases associated with altered cell cycle regulation. In addition to using these miRNAs as diagnostic analytes, they might also provide targets for treating disease. For instance, a cancer cell that has bypassed a critical cell cycle signal by having a cell cycle-specific miRNA might be returned to normalcy by introducing the miRNA.
  • Methods of promoting cells to be in S phase can be achieved by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7a, mir-15a, mir-16, mir-20, mir-26a, mir-191, mir-197, mir-205, mir-220, mir-224, mir-290, mir-291, mir-294, mir-295, mir-302, mir-345, mir-372, or mir-411; or 2) at least one miRNA inhibitor corresponding to mir-108, mir-122, mir-128, mir-129, mir-137, mir-142, mir-146, mir-147, mir-186, mir-187, mir-195, mir-297, mir-324-3p, mir-337, or mir
  • the invention also includes methods of inhibiting cells to be in S phase by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is mir-108, mir-122, mir-128, mir-129, mir-137, mir-142, mir-146, mir-147, mir-186, mir-187, mir-195, mir-297, mir-324-3p, mir-337, or mir-376b; or 2) at least one miRNA inhibitor corresponding to let-7a, mir-15a, mir-16, mir-20, mir-26a, mir-191, mir-197, mir-205, mir-220, mir-224, mir-290, mir-291, mir-294, mir-295, mir-302, mir-345, mir-372, or
  • Methods of promoting cells to be in G1 phase can be achieved by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is mir-108, mir-122, mir-124, mir-125a, mir-126, mir-128, mir-129, mir-137, mir-142, mir-146, mir-147, mir-195, mir-201, mir-297, mir-320, mir-325, mir-324-3p, mir-337, mir-371, mir-376b, or mir-409; or 2) at least one miRNA inhibitor corresponding to Let-7a, mir-1, mir-7d, mir-20, mir-21, mir-26a, mir-192, mir-193, mir-206, mir-220, mir-290, mir-294, mir-329, mir-371, mir-373, or mir-409.
  • Other methods concern inhibiting cells in G1 phase by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is Let-7a, mir-1, mir-7d, mir-20, mir-21, mir-26a, mir-192, mir-193, mir-206, mir-220, mir-290, mir-294, mir-329, mir-371, mir-373, mir-409; or 2) at least one miRNA inhibitor corresponding to mir-108, mir-122, mir-124, mir-125a, mir-126, mir-128, mir-129, mir-137, mir-142, mir-146, mir-147, mir-195, mir-201, mir-297, mir-320, mir-325, mir-324-3p, mir-3
  • promoting cells to be in G2/M phase by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is mir-1, mir-7a, mir-7d, mir-7g, mir-20, mir-21, mir-26a, mir-145, mir-187, mir-192, mir-193, mir-206, mir-215, mir-220, mir-223, mir-294, mir-329, mir-371, mir-373, or mir-409; or 2) at least one miRNA inhibitor corresponding to mir-15a, mir-18, mir-122, mir-124, mir-126, mir-128, mir-129, mir-137, mir-146, mir-147, mir-195, mir-219, mir-337, or mir-371.
  • the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is mir-15a, mir-18, mir-122, mir-124, mir-126, mir-128, mir-129, mir-137, mir-146, mir-147, mir-195, mir-219, mir-337, or mir-371; or 2) at least one miRNA inhibitor corresponding to mir-1, mir-7a, mir-7d, mir-7g, mir-20, mir-21, mir-26a, mir-145, mir-187, mir-192, mir-193, mir-206, mir-215, mir-220, mir-223, mir-294, mir-329, mir-371, mir-373, or mir-409.
  • the present invention also includes methods of increasing the number of cells with 2 ⁇ or more DNA in the cell comprising introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence.
  • the methods involves providing to or introducing into cells an effective amount of at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-1, miR-20, miR-21, miR-337, miR-345, or miR-373.
  • the present invention is also concerned with reducing the number of cells with 2 ⁇ (also referred to as 2N, where N is the number of sets of chromosomes) comprising providing to or introducing into cells an effective amount of an miRNA inhibitor corresponding to miR-1, miR-20, miR-21, miR-337, miR-345, or miR-373.
  • 2 ⁇ also referred to as 2N, where N is the number of sets of chromosomes
  • methods also include targeting an miRNA to modulate in a cell or organism.
  • targeting an miRNA to modulate means a nucleic acid of the invention will be employed so as to modulate the selected miRNA.
  • the modulation is achieved with a synthetic or non-synthetic miRNA that corresponds to the targeted miRNA, which effectively provides the targeted miRNA to the cell or organism (positive modulation).
  • the modulation is achieved with an miRNA inhibitor, which effectively inhibits the targeted miRNA in the cell or organism (negative modulation).
  • the miRNA targeted to be modulated is an miRNA that affects a disease, condition, or pathway.
  • the miRNA is targeted because a treatment can be provided by negative modulation of the targeted miRNA.
  • the miRNA is targeted because a treatment can be provided by positive modulation of the targeted miRNA.
  • a nucleic molecule of the invention that achieves negative modulation of the targeted miRNA.
  • a nucleic molecule of the invention that achieves positive modulation of the targeted miRNA.
  • methods involve selecting and/or obtaining a synthetic miRNA, non-synthetic miRNA or an miRNA inhibitor (collectively “miRNA modulators”) that corresponds to a targeted miRNA, such as one that is involved with, affects or is characteristic of a particular disease, condition, pathway, or factor in the pathway.
  • a further step of administering the selected miRNA modulator to a cell, tissue, organ, or organism in need of treatment related to modulation of the targeted miRNA or in need of the physiological or biological results discussed herein (such as with respect to a particular cellular pathway or result like decrease in cell viability). Consequently, in some methods of the invention there is a step of identifying a patient in need of treatment that can be provided by the miRNA modulator(s). It is contemplated that an effective amount of an miRNA modulator can be administered in some embodiments.
  • a “therapeutic benefit” refers to an improvement in the one or more conditions or symptoms associated with a disease or condition or an improvement in the prognosis, duration, or status with respect to the disease. It is contemplated that a therapeutic benefit includes, but is not limited to, a decrease in pain, a decrease in morbidity, a decrease in a symptom.
  • a therapeutic benefit can be inhibition of tumor growth, prevention of metastasis, reduction in number of metastases, inhibition of cancer cell proliferation, inhibition of cancer cell proliferation, induction of cell death in cancer cells, inhibition of angiogenesis near cancer cells, induction of apoptosis of cancer cells, reduction in pain, reduction in risk of recurrence, induction of chemo- or radiosensitivity in cancer cells, prolongation of life, and/or delay of death directly or indirectly related to cancer.
  • miRNA profiles for patients can be generated by evaluating any of the miRNAs discussed in this application.
  • the miRNA profile that is generated from the patient will be one that provides information regarding the particular disease or condition.
  • the miRNA profile is generated using the miRNA array discussed.
  • the miRNA compositions may be provided as part of a therapy to a patient, in conjunction with traditional therapies or preventative agents.
  • any method discussed in the context of therapy may be applied as preventatively, particularly in a patient identified to be potentially in need of the therapy or at risk of the condition or disease for which a therapy is needed.
  • the invention concerns a method for inducing transformation in a cell comprising administering to the cell an effective amount of at least one miRNA selected from the group consisting of mir-192, mir-198, and mir-199.
  • methods for preventing cell transformation may be achieved by administering to the cell an effective amount of at least one miRNA inhibitor of mir-192, mir-198, or mir-199.
  • methods of the invention concern employing one or more nucleic acids corresponding to an miRNA and a therapeutic drug.
  • the nucleic acid can enhance the effect or efficacy of the drug, reduce any side effects or toxicity, modify its bioavailability, and/or decrease the dosage or frequency needed.
  • the therapeutic drug is a cancer therapeutic. Consequently, in some embodiments, there is a method of treating cancer in a patient comprising administering to the patient the cancer therapeutic and an effective amount of at least one miRNA molecule that improves the efficacy of the cancer therapeutic or protects non-cancer cells.
  • the miRNA molecule enhances the efficacy of the cancer therapeutic and is selected from the group consisting of ambi-miR-7100, mir-28, mir-101, mir-124, mir-125a, mir-126, mir-132, mir-136, mir-147, mir-155, mir-182, mir-186, mir-202, mir-206, mir-216, mir-221, mir-224, mir-291, mir-292-3p, mir-297, mir-302, mir-337, mir-372, mir-373, and mir-376b.
  • Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments.
  • Combination chemotherapies include but are not limited to, for example, bevacizumab, cisplatin (CDDP), carboplatin, EGFR inhibitors (gefitinib and cetuximab), procarbazine, mechlorethamine, cyclophosphamide, camptothecin, COX-2 inhibitors (e.g., celecoxib) ifosfamide, melphalan, chlorambucil, busulfan, nitrourea, dactinomycin, daunorubicin, doxorubicin (adriamycin), bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, taxotere, gemcitabine, navelbine, farnesyl-protein transferase inhibitors, transplatinum, 5-
  • the miRNA molecule in methods of the invention protects non-cancer cells from the cancer therapeutic and is selected from the group consisting of mir-16, mir-24, mir-30a-3p, mir-125b, mir-152, mir-194, mir-197, mir-214, and mir-331.
  • inhibitors of miRNAs can be given to achieve the opposite effect as compared to when nucleic acid molecules corresponding to the mature miRNA are given.
  • nucleic acid molecules corresponding to the mature miRNA can be given to achieve the opposite effect as compared to when inhibitors of the miRNA are given.
  • miRNA molecules that increase cell proliferation can be provided to cells to increase proliferation or inhibitors of such molecules can be provided to cells to decrease cell proliferation.
  • the present invention contemplates these embodiments in the context of the different physiological effects observed with the different miRNA molecules and miRNA inhibitors disclosed herein.
  • Methods of the invention are generally contemplated to include providing or introducing one or more different nucleic acid molecules corresponding to one or more different miRNA molecules.
  • nucleic acid molecules may be provided or introduced: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or any range derivable therein. This also applies to the number of different miRNA molecules that
  • kits can be used to evaluate one or more miRNA molecules.
  • a kit contains, contains at least or contains at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more synthetic miRNA molecules or miRNA inhibitors, or any range and combination derivable therein.
  • there are kits for evaluating miRNA activity in a cell contains kits for evaluating miRNA activity in a cell.
  • Kits may comprise components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means.
  • compositions may also be provided in a kit in concentrated amounts; in some embodiments, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as 1 ⁇ , 2 ⁇ , 5 ⁇ , 10 ⁇ , or 20 ⁇ or more.
  • Kits for using synthetic miRNAs, nonsynthetic, and/or miRNA inhibitors of the invention for therapeutic, prognostic, or diagnostic applications are included as part of the invention. Specifically contemplated are any such molecules corresponding to any miRNA reported to influence biological activity, such as those discussed herein.
  • Control molecules can be used to verify transfection efficiency and/or control for transfection-induced changes in cells.
  • any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined. It is specifically contemplated that any methods and compositions discussed herein with respect to miRNA molecules or miRNA may be implemented with respect to synthetic miRNAs to the extent the synthetic miRNA is exposed to the proper conditions to allow it to become a mature miRNA under physiological circumstances.
  • the claims originally filed are contemplated to cover claims that are multiply dependent on any filed claim or combination of filed claims.
  • Any embodiment of the invention involving specific miRNAs by name is contemplated also to cover embodiments involving miRNAs whose sequences are at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to the mature sequence of the specified miRNA.
  • FIG. 1 Overview of miRNA Expression and Activation.
  • MiRNAs are transcribed as part of longer RNA molecules that can be as long as a thousand nucleotides (Lee, 2002).
  • the RNAs are processed in the nucleus into hairpin RNAs of 70-100 nucleotides by the dsRNA-specific ribonuclease Drosha (Lee 2003) ( FIG. 1 ).
  • the hairpin RNAs are transported to the cytoplasm and digested by a second, double-strand specific ribonuclease called Dicer.
  • the resulting 19-23mer miRNA is bound by a complex that is similar to or identical to the RNA-Induced Silencing Complex (RISC) that participates in RNA interference (Hutvagner, 2002).
  • RISC RNA-Induced Silencing Complex
  • the complex-bound, single-stranded miRNA binds mRNAs with sequences that are significantly, though not completely, complementary to the miRNA. By a mechanism that is not fully understood, but that does not involve mRNA degradation, the bound mRNA is not translated, resulting in reduced expression of the corresponding gene.
  • FIG. 2 Methods for Introducing miRNAs into Cells.
  • a DNA bearing a promoter upstream of a sequence encoding a miRNAs is introduced into cells where it is transcribed to produce an RNA molecule that includes the mature miRNA. Processing and uptake by the protein complex for miRNA-induced gene regulation results in the activation of the miRNA. This method suffers from inefficient introduction of the DNA construct into cells.
  • an siRNA-like dsRNA molecule one of whose strands is identical to an active miRNA is introduced into cells where it is taken up by the protein complex for miRNA activation. This method provides efficient deliver, but often uptake of the unintended complementary RNA molecule.
  • the third method, described herein involves modifying the complementary strand so as to favor uptake and activation of the active strand of the synthetic miRNA construct.
  • FIG. 3 Preferential Uptake of Active Strands in synthetic miRNAs of the invention.
  • FIG. 4 Synthetic miRNA Activity for various miRNAs. Synthetic miRNAs with siRNA and Pre-miR (5′ amine) design were prepared and transfected into HeLa cells at 3 and 10 nM final concentration. The synthetic miRNAs were co-transfected with reporter vectors bearing target sites for the mature miRNAs. The expression of the luciferase reporter in co-transfected cells was measured twenty-four hours post-transfected and expressed in the figure as the reporter expression relative to cells co-transfected with negative control synthetic miRNAs.
  • FIG. 5 Synthetic miRNA Activity across Cell Types and against Natural Targets. Synthetic miRNAs were tested for proper strand activation and cell-type specificity to ensure that the design is robust. Four different cell types were co-transfected with synthetic miRNA and associated active and complementary strand activation. Panel A shows that different cell types respond similarly to synthetic miRNAs. Four different synthetic miRNAs were then transfected into various cell types and the expression levels of natural targets of the miRNAs were measured (Panel B).
  • FIG. 6 Schematic for screening with libraries of synthetic miRNAs or miRNA inhibitors. Synthetic miRNAs and/or miRNA inhibitors are distributed to wells of a microtiter plate. Transfection reagent and then cells are added to each well. At some time post-transfection, samples are evaluated for a phenotype. MiRNAs that induce a change that is significant relative to a negative control are selected for further study.
  • FIG. 7 Screen for miRNAs that affect cell proliferation.
  • 8,000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection, cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% TritonX 100 and stained with propidium iodide to look at total cell number. The plates were scanned using the TTP labtech Acumen Explorer. Morphology changes in cells inhibited for mir 31. HeLa cells were transfected with Anti-mir31 and cells were fixed and stained with anti-beta actin antibody and DAPI to visualize cell morphology changes in response to inhibition to mir-31 micro-RNA function.
  • FIG. 8 Screen for miRNAs that affect cell proliferation in A549 cells. Screen for miRNA involved in cell viability in A549 cells. In 96-well plates, 8,000 A549 cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection cells were trypsinized and counted using the Guava cell counting instrument. Cell number was graphed and normalized to a gap inhibitor. In this figure, “mir1d” refers to mir-1-2.
  • FIG. 9 Screen for miRNAs that affect apoptosis in HeLa cells. Effects of miRNA inhibitors on caspase activity in HeLa. In 96-well plates, 8,000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection cells were analyzed using caspase activity assay and normalized based on esterase activity assay. In this figure, “mir1d” refers to mir-1-2.
  • FIG. 10 miRNA Expression in Lung and Colon Cancer Patients.
  • the miRNA expression profiles of tumor vs normal adjacent tissues were compared for lung and colon cancer patients.
  • the miRNAs are provided in rows; the patients are presented in columns.
  • Green in the heat map shows miRNAs that are down-regulated in the tumor sample relative to the normal adjacent tissue sample, and red shows miRNAs that are up-regulated in the tumor sample relative to the normal adjacent tissue sample.
  • FIG. 11 Validation of miRNA Array Expression Results in Lung Cancer Patients.
  • Total RNA samples from two lung cancer patients were analyzed for expression of miR-16, miR-21, miR-143, miR-145, and let-7 using Northern analysis.
  • the graphs show the relative abundance of each miRNA (ratio of tumor:NAT) from the array analysis and Northern phosphorimager analysis.
  • FIG. 12 Some miRNAs are differentially expressed in multiple cancer types. miRNA array analysis comparing tumor and normal adjacent tissues from patients with various types of cancer was used to identify miRNAs that are differentially expressed in cancer. The percentage of patients exhibiting up- or down-regulation of a given miRNA was calculated for each cancer type. The eight that were most often differentially expressed across sample types are presented.
  • FIG. 13 Shown are miRNAs having greater than 1.5-fold expression changes between both infected vs. uninfected and sensitive vs. insensitive. On the right is a cluster of the results from 2 arrays of each model.
  • FIG. 14 Differentially expressed miRNAs in 3 preconditioned mice relative to non-treated mice.
  • FIG. 15A-C Synthetic miRNAs that decrease cell proliferation.
  • A. BT549 and MCF12A (breast), HeLa (cervical) and 22 Rv1 (prostate) cells were evaluated for cell proliferation.
  • B. TE354T and TE353SK (skin), BJ (skin), and A549 (lung) cells were examined for cell proliferation.
  • FIG. 16 Synthetic miRNAs that increase cell proliferation.
  • HeLa cervical
  • 22 Rv1 prostate
  • TE354T and TE353SK skin
  • BJ skin
  • A549 lung
  • Jurkats T cell
  • primary T cells CRL5826 and HTB-57 (lung) cells were evaluated for cell proliferation.
  • FIG. 17 miRNA inhibitors that reduce cell proliferation. 22 Rv1 (prostate), TE354T (skin), MCF12a (breast), and A549 (lung) cells were evaluated for cell proliferation.
  • FIG. 18 miRNA inhibitors that increase cell proliferation. 22 Rv1 (prostate), TE354T (skin), MCF12a (breast), and A549 (lung) cells were evaluated for cell proliferation.
  • FIG. 19 miRNAs that affect cell viability.
  • Jurkats T cell
  • primary T cells HeLa (cervical)
  • A549 (lung) cells were evaluated for increases and decreases in cell viability.
  • FIG. 20 miRNAs that affect apoptosis. 22 Rv1 (prostate), TE354T (skin), Jurkats (T cell), and HeLa (cervical) cells were evaluated for increases and decreases in apoptosis.
  • FIG. 21 miRNAs that affect cell viability in the presence of a therapeutic.
  • A549 (lung) cells were evaluated for increases and decreases in cell viability in the presence and absence of TRAIL or etoposide.
  • HTB-57 and CRL5826 (lung) and HeLa (cervical) cells were evaluated for a reduction in cell viability in the absence and presence of etoposide.
  • FIG. 22 miRNAs that affect cell cycle.
  • BJ (skin) and HeLa (cervical) cells were evaluated for increases or decreases in the number of cells at certain phases of the cell cycle (G1, S, G2/M, DNA replication).
  • FIG. 23 Phenotypes of miRNAs with similar sequences. Comparison of related let-7 sequences and their effects on A549 and Jurkat cell proliferation. The sequences correspond to positions 6-27 of SEQ ID NO:3 (let-7a-1), 6-27 of SEQ ID NO:6 (let-7b), 11-32 of SEQ ID NO:7 (let-7c), 8-28 of SEQ ID NO:8 (let-7d), and 5-25 of SEQ ID NO:15 (let-7g).
  • FIG. 24 Genes associated with hTert regulation and miRNA sequences predicted to modulate their expression.
  • FIG. 23 exemplifies 4 miRNAs (miR-26a, miR-147, miR-195, and miR-368) and the thTert activating gene products with which they interact.
  • the present invention is directed to compositions and methods relating to preparation and characterization of miRNAs, as well as use of miRNAs for therapeutic, prognostic, and diagnostic applications.
  • the inventors developed small, partially double-stranded RNAs that can be delivered with high efficiency to both immortalized and primary cells.
  • the small RNAs have the same functional activities as endogenously expressed miRNAs. Because the small RNAs can be delivered to cells with much higher efficiency than can plasmids, they induce a much stronger phenotype that is easier to detect and quantify, making it possible to identify many of the functions of miRNAs in cells.
  • the inventors have also created a library of the small, double-stranded RNA molecules that can be used to introduce miRNAs into cells, as well as a library of antisense molecules that inhibit the activities of known miRNAs that are present in cells. These libraries have been used to sequentially up- or down-regulate one or more miRNAs in cells to identify those miRNAs that are critical for cellular processes like cell cycle, apoptosis, differentiation, viability, angiogenesis, metabolism, and other processes with therapeutic potential. miRNAs that regulate the expression of important genes like p53, MYC, and RAS are also being identified and characterized to further pinpoint miRNAs that might provide important intervention points for treating disease. For example, let-7 has been shown to be involved with RAS. See Johnson et al., 2005, which is hereby incorporated by reference. These processes of serially modulating miRNA activities and assaying for cellular phenotypes are collectively referred to as miRNA functional screening.
  • miRNAs are generally 21 to 22 nucleotides in length, though lengths of 17 and up to 25 nucleotides have been reported.
  • the miRNAs are each processed from a longer precursor RNA molecule (“precursor miRNA”).
  • Precursor miRNAs are transcribed from non-protein-encoding genes.
  • the precursor miRNAs have two regions of complementarity that enables them to form a stem-loop- or fold-back-like structure, which is cleaved by an enzyme called Dicer in animals.
  • Dicer is ribonuclease III-like nuclease.
  • the processed miRNA is typically a portion of the stem.
  • the processed miRNA (also referred to as “mature miRNA”) become part of a large complex to down-regulate a particular target gene.
  • animal miRNAs include those that imperfectly basepair with the target, which halts translation (Olsen et al., 1999; Seggerson et al., 2002).
  • SiRNA molecules also are processed by Dicer, but from a long, double-stranded RNA molecule. SiRNAs are not naturally found in animal cells, but they can function in such cells in a RNA-induced silencing complex (RISC) to direct the sequence-specific cleavage of an mRNA target (Denli et al., 2003).
  • RISC RNA-induced silencing complex
  • miRNAs are apparently active in the cell when the mature, single-stranded RNA is bound by a protein complex that regulates the translation of mRNAs that hybridize to the miRNA.
  • Introducing exogenous RNA molecules that affect cells in the same way as endogenously expressed miRNAs requires that a single-stranded RNA molecule of the same sequence as the endogenous mature miRNA be taken up by the protein complex that facilitates translational control.
  • a variety of RNA molecule designs have been evaluated. Three general designs that maximize uptake of the desired single-stranded miRNA by the miRNA pathway have been identified. An RNA molecule with an miRNA sequence having at least one of the three designs is referred to as a synthetic miRNA.
  • Synthetic miRNAs of the invention comprise, in some embodiments, two RNA molecules wherein one RNA is identical to a naturally occurring, mature miRNA.
  • the RNA molecule that is identical to a mature miRNA is referred to as the active strand.
  • the second RNA molecule, referred to as the complementary strand is at least partially complementary to the active strand.
  • the active and complementary strands are hybridized to create a double-stranded RNA, called the synthetic miRNA, that is similar to the naturally occurring miRNA precursor that is bound by the protein complex immediately prior to miRNA activation in the cell. Maximizing activity of the synthetic miRNA requires maximizing uptake of the active strand and minimizing uptake of the complementary strand by the miRNA protein complex that regulates gene expression at the level of translation.
  • the molecular designs that provide optimal miRNA activity involve modifications to the complementary strand.
  • the first modification involves creating a complementary RNA with a chemical group other than a phosphate or hydroxyl at its 5′ terminus.
  • the presence of the 5′ modification apparently eliminates uptake of the complementary strand and subsequently favors uptake of the active strand by the miRNA protein complex.
  • the 5′ modification can be any of a variety of molecules including NH 2 , NHCOCH 3 , biotin, and others.
  • the second chemical modification strategy that significantly reduces uptake of the complementary strand by the miRNA pathway is incorporating nucleotides with sugar modifications in the first 2-6 nucleotides of the complementary strand. It should be noted that the sugar modifications consistent with the second design strategy can be coupled with 5′ terminal modifications consistent with the first design strategy to further enhance synthetic miRNA activities.
  • the third synthetic miRNA design involves incorporating nucleotides in the 3′ end of the complementary strand that are not complementary to the active strand. Hybrids of the resulting active and complementary RNAs are very stable at the 3′ end of the active strand but relatively unstable at the 5′ end of the active strand. Studies with siRNAs indicate that 5′ hybrid stability is a key indicator of RNA uptake by the protein complex that supports RNA interference, which is at least related to the miRNA pathway in cells. The inventors have found that the judicious use of mismatches in the complementary RNA strand significantly enhances the activity of the synthetic miRNA.
  • a key application for the synthetic miRNAs is the identification of cellular functions for individual or groups of miRNAs.
  • the inventors have created a library of synthetic miRNAs that can be used to sequentially introduce each of the known miRNAs into cultured cells ( FIG. 6 ). Cell populations with each of the different synthetic miRNAs can then be assayed to identify miRNAs whose presence induces a cellular phenotype.
  • the inventors have created a library of antisense molecules that inhibit miRNA activity.
  • the miRNA inhibitors are used to serially inhibit the activities of miRNAs in cells to identify miRNAs whose absence induces a cellular phenotype.
  • the number of different synthetic miRNAs or miRNA inhibitors in the libraries is variable. It is contemplated that there may be, be at least, or be at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180
  • libraries have between 5 and 1000 different miRNA-specific molecules, between 20 and 500 different miRNA-specific molecules, between 50 and 250 different miRNA-specific molecules, or between 100 and 225 different miRNA-specific molecules.
  • “Different” miRNA-specific molecules refers to nucleic acids that are specific to miRNAs with different sequences.
  • Synthetic miRNAs are contemplated to be made primarily of RNA, though in some embodiments, they may be RNA, nucleotide analogs, DNA, or any combination of DNA, RNA, nucleotide analogs, and PNAs.
  • libraries of the invention may be specific for one or more miRNAs.
  • a library has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180,
  • RNA molecules of the invention have miRNA regions or complementary regions.
  • a synthetic miRNA or miRNA inhibitor has a sequence or complementary sequence that derives from any of SEQ ID NOs: 1-805, inclusive. It is particularly contemplated that synthetic nucleic acid molecules of the invention may be derived from any of the mature miRNA sequences in SEQ ID NOs:1-805 or their complement.
  • miRNAs are processed from a precursor molecule.
  • the specific length of a mature miRNA is unknown.
  • versions of the synthetic miRNA and miRNA inhibitor libraries will include sequence that extends at least 1 to 5 nucleotides of coding sequence upstream and/or downstream of the predicted miRNA sequence.
  • molecules have up to 1, 2, 3, 4, 5, 6, 7, or more contiguous nucleotides, or any range derivable therein, that flank the sequence encoding the predominant processed miRNA on one or both sides (5′ and/or 3′ end).
  • the present invention concerns methods for creating functional profile for all of the known miRNAs.
  • the term “functional profile” refers to a set of data regarding the cellular phenotypes that result from introducing and inhibiting miRNAs in cells using synthetic miRNA and miRNA inhibitor libraries. Functional profiles for individual miRNAs will enable identification of miRNAs with therapeutic or diagnostic potential. For instance, a functional profile for a miRNA might reveal that its absence leads to uncontrolled cell proliferation and an inability to induce apoptosis following DNA damage. Furthermore, the expression of p53 correlates with whether the miRNA is being up-regulated with a synthetic miRNA or down-regulated with a miRNA inhibitor. Based on its ties to cell proliferation, apoptosis, and p53 expression, this miRNA might be a target for cancer therapeutics.
  • methods concern identifying miRNAs indicative of a disease or condition by detecting a correlation between the activity of particular miRNAs and cellular phenotypes that coincide with a disease or condition.
  • Libraries of the invention can contain miRNA sequences from any organism having miRNAs, specifically including but not limited to, mammals such as humans, mice, and rats.
  • libraries having, having at least, or having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,
  • the present invention concerns nucleic acid molecules that can introduce or inhibit miRNAs in cultured cells.
  • the nucleic acids may have been produced in cells or in vitro by purified enzymes though they are preferentially produced by chemical synthesis. They may be crude or purified.
  • an miRNA is derived from genomic sequences or a gene.
  • the term “gene” is used for simplicity to refer to the genomic sequence encoding the precursor miRNA for a given miRNA.
  • embodiments of the invention may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences.
  • the term “recombinant” may be used and this generally refers to a molecule that has been manipulated in vitro or that is the replicated or expressed product of such a molecule.
  • nucleic acid is well known in the art.
  • a “nucleic acid” as used herein will generally refer to a molecule (one or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase.
  • a nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine “A,” a guanine “G,” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, an uracil “U” or a C).
  • the term “nucleic acid” encompass the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.”
  • RNA generally refers to a single-stranded molecule, but in specific embodiments, molecules implemented in the invention will also encompass a region or an additional strand that is partially (between 10 and 50% complementary across length of strand), substantially (greater than 50% but less than 100% complementary across length of strand) or fully complementary to another region of the same single-stranded molecule or to another nucleic acid.
  • nucleic acids may encompass a molecule that comprises one or more complementary or self-complementary strand(s) or “complement(s)” of a particular sequence comprising a molecule.
  • precursor miRNA may have a self-complementary region, which is up to 100% complementary.
  • hybridization As used herein, “hybridization”, “hybridizes” or “capable of hybridizing” is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature.
  • anneal as used herein is synonymous with “hybridize.”
  • hybridization “hybridize(s)” or “capable of hybridizing” encompasses the terms “stringent condition(s)” or “high stringency” and the terms “low stringency” or “low stringency condition(s).”
  • nucleic acids of the invention will comprise, in some embodiments the miRNA sequence of any miRNA described in SEQ ID NOs:1-805, and/or any sequence with the complement thereof. It is contemplated that nucleic acids sequences of the invention can have, have at least, or have at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95
  • nucleic acids are, are at least, or are at most 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% identical or complementary to the miRNA sequence of SEQ ID NOs:1-805 or to the entire sequence of any of SEQ ID NOs:1-805, or any combination or range derivable therein.
  • sequences are provided in the appendix.
  • the appendix provides a list of 1) miRNAs that were screened, any one of which can be screened for using any array or method of the present invention; 2) the names of the probe used to screen for that miRNA; and, 3) the sequence of the named probe. It is clear that a particular probe can be used for identifying the level of expression of one or more target miRNAs, or set of target miRNAs (sets of targeted miRNAs may include completely unrelated RNAs, in additions to sets that are either related or in the same gene family). It is contemplated that any of these sequences in the appendix can be used in embodiments of the invention.
  • nucleobase refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase.
  • a nucleobase generally can form one or more hydrogen bonds (“anneal” or “hybridize”) with at least one naturally occurring nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U).
  • “Purine” and/or “pyrimidine” nucleobase(s) encompass naturally occurring purine and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof, including but not limited to, those a purine or pyrimidine substituted by one or more of an alkyl, carboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or alkylthiol moeity.
  • Preferred alkyl (e.g., alkyl, carboxyalkyl, etc.) moieties comprise of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms.
  • a purine or pyrimidine include a deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bromothymine, a 8-aminoguanine, a 8-hydroxyguanine, a 8-methylguanine, a 8-thioguanine, an azaguanine, a 2-aminopurine, a 5-ethylcytosine, a 5-methylcytosine, a 5-bromouracil, a 5-ethyluracil, a 5-iodouracil, a 5-chlorouracil, a 5-propyluracil, a thiouracil, a 2-methyladenine, a methylthioadenine, a N,N-dimethyladenine, an aza
  • a nucleobase may be comprised in a nucleoside or nucleotide, using any chemical or natural synthesis method described herein or known to one of ordinary skill in the art. Such nucleobase may be labeled or it may be part of a molecule that is labeled and contains the nucleobase.
  • nucleoside refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety.
  • a non-limiting example of a “nucleobase linker moiety” is a sugar comprising 5-carbon atoms (i.e., a “5-carbon sugar”), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar.
  • Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2′-fluoro-2′-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring.
  • nucleoside comprising a purine (i.e., A or G) or a 7-deazapurine nucleobase typically covalently attaches the 9 position of a purine or a 7-deazapurine to the 1′-position of a 5-carbon sugar.
  • a nucleoside comprising a pyrimidine nucleobase i.e., C, T or U
  • a nucleoside comprising a pyrimidine nucleobase typically covalently attaches a 1 position of a pyrimidine to a 1′-position of a 5-carbon sugar (Kornberg and Baker, 1992).
  • nucleotide refers to a nucleoside further comprising a “backbone moiety”.
  • a backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid.
  • the “backbone moiety” in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3′- or 5′-position of the 5-carbon sugar.
  • other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety.
  • a nucleic acid may comprise, or be composed entirely of, a derivative or analog of a nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid.
  • RNA with nucleic acid analogs may also be labeled according to methods of the invention.
  • a “derivative” refers to a chemically modified or altered form of a naturally occurring molecule, while the terms “mimic” or “analog” refer to a molecule that may or may not structurally resemble a naturally occurring molecule or moiety, but possesses similar functions.
  • a “moiety” generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art, and have been described (see for example, Scheit, 1980, incorporated herein by reference).
  • nucleosides, nucleotides or nucleic acids comprising 5-carbon sugar and/or backbone moiety derivatives or analogs include those in: U.S. Pat. No. 5,681,947, which describes oligonucleotides comprising purine derivatives that form triple helixes with and/or prevent expression of dsDNA; U.S. Pat. Nos. 5,652,099 and 5,763,167, which describe nucleic acids incorporating fluorescent analogs of nucleosides found in DNA or RNA, particularly for use as fluorescent nucleic acids probes; U.S. Pat. No.
  • nucleoside analogs and nucleic acid analogs are U.S. Pat. No. 5,728,525, which describes nucleoside analogs that are end-labeled; U.S. Pat. Nos. 5,637,683, 6,251,666 (L-nucleotide substitutions), and 5,480,980 (7-deaza-2′deoxyguanosine nucleotides and nucleic acid analogs thereof).
  • analogs may be used in synthetic nucleic acid molecules of the invention, both throughout the molecule or at selected nucleotides. They include, but are not limited to, 1) ribose modifications (such as 2′F, 2′ NH 2 , 2′N 3 , 4′thio, or 2′ O—CH 3 ) and 2) phosphate modifications (such as those found in phosphorothioates, methyl phosphonates, and phosphoroborates). Such analogs have been created to confer stability on RNAs by reducing or eliminating their capacity to be cleaved by ribonucleases.
  • nucleotide analogs When these nucleotide analogs are present in RNAs, they can have profoundly positive effects on the stability of the RNAs in animals. It is contemplated that the use of nucleotide analogs can be used alone or in conjunction with any of the design modifications of a synthetic miRNA for any nucleic acid of the invention.
  • nucleotides that are modified to enhance their activities.
  • Such nucleotides include those that are at the 5′ or 3′ terminus of the RNA as well as those that are internal within the molecule.
  • Modified nucleotides used in the complementary strands of synthetic miRNAs either block the 5′OH or phosphate of the RNA or introduce internal sugar modifications that enhance uptake of the active strand of the synthetic miRNA.
  • Modifications for the miRNA inhibitors include internal sugar modifications that enhance hybridization as well as stabilize the molecules in cells and terminal modifications that further stabilize the nucleic acids in cells. Further contemplated are modifications that can be detected by microscopy or other methods to identify cells that contain the synthetic miRNAs or miRNA inhibitors.
  • a nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production.
  • synthetic miRNAs according to the invention could be produced using recombinant methods, it is preferred to produce synthetic miRNAs by chemical synthesis or enzymatic production.
  • miRNA inhibitors are preferentially produced by chemical synthesis or enzymatic production.
  • Non-synthetic miRNAs can be produced by a number of methods, including methods involving recombinant DNA technology.
  • Nucleic acid synthesis is performed according to standard methods. See, for example, Itakura and Riggs (1980). Additionally, U.S. Pat. No. 4,704,362, U.S. Pat. No. 5,221,619, and U.S. Pat. No. 5,583,013 each describe various methods of preparing synthetic nucleic acids.
  • Non-limiting examples of a synthetic nucleic acid include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986 and U.S. Pat. No. 5,705,629, each incorporated herein by reference.
  • one or more oligonucleotide may be used.
  • Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.
  • a non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCRTM (see for example, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Pat. No. 5,645,897, incorporated herein by reference.
  • PCRTM see for example, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195, each incorporated herein by reference
  • synthesis of an oligonucleotide described in U.S. Pat. No. 5,645,897 incorporated herein by reference.
  • Oligonucleotide synthesis is well known to those of skill in the art. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.
  • chemical synthesis can be achieved by the diester method, the triester method polynucleotides phosphorylase method and by solid-phase chemistry. These methods are discussed in further detail below.
  • the diester method was the first to be developed to a usable state, primarily by Khorana and co-workers. (Khorana, 1979).
  • the basic step is the joining of two suitably protected deoxynucleotides to form a dideoxynucleotide containing a phosphodiester bond.
  • the diester method is well established and has been used to synthesize DNA molecules (Khorana, 1979).
  • the main difference between the diester and triester methods is the presence in the latter of an extra protecting group on the phosphate atoms of the reactants and products (Itakura et al., 1975).
  • the phosphate protecting group is usually a chlorophenyl group, which renders the nucleotides and polynucleotide intermediates soluble in organic solvents. Therefore purification's are done in chloroform solutions.
  • Other improvements in the method include (i) the block coupling of trimers and larger oligomers, (ii) the extensive use of high-performance liquid chromatography for the purification of both intermediate and final products, and (iii) solid-phase synthesis.
  • polynucleotide phosphorylase adds predominantly a single nucleotide to a short oligonucleotide. Chromatographic purification allows the desired single adduct to be obtained. At least a trimer is required to start the procedure, and this primer must be obtained by some other method.
  • the polynucleotide phosphorylase method works and has the advantage that the procedures involved are familiar to most biochemists.
  • Phosphoramidite chemistry (Beaucage and Lyer, 1992) has become by far the most widely used coupling chemistry for the synthesis of oligonucleotides.
  • phosphoramidite synthesis of oligonucleotides involves activation of nucleoside phosphoramidite monomer precursors by reaction with an activating agent to form activated intermediates, followed by sequential addition of the activated intermediates to the growing oligonucleotide chain (generally anchored at one end to a suitable solid support) to form the oligonucleotide product.
  • Recombinant methods for producing nucleic acids in a cell are well known to those of skill in the art. These include the use of vectors, plasmids, cosmids, and other vehicles for delivery a nucleic acid to a cell, which may be the target cell or simply a host cell (to produce large quantities of the desired RNA molecule). Alternatively, such vehicles can be used in the context of a cell free system so long as the reagents for generating the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference.
  • the present invention concerns nucleic acid molecules that are not synthetic.
  • the nucleic acid molecule has a chemical structure of a naturally occurring nucleic acid and a sequence of a naturally occurring nucleic acid, such as the exact and entire sequence of a single stranded primary miRNA (see Lee 2002), a single-stranded precursor miRNA, or a single-stranded mature miRNA.
  • non-synthetic nucleic acids may be generated chemically, such as by employing technology used for creating oligonucleotides.
  • Synthetic miRNAs typically comprise two strands, an active strand that is identical in sequence to the mature miRNA that is being studied and a complementary strand that is at least partially complementary to the active strand.
  • the active strand is the biologically relevant molecule and should be preferentially taken up by the complex in cells that modulates translation either through mRNA degradation or translational control.
  • Preferential uptake of the active strand has two profound results: (1) the observed activity of the synthetic miRNA increases dramatically and (2) non-intended effects induced by uptake and activation of the complementary strand are essentially eliminated.
  • several synthetic miRNA designs can be used to ensure the preferential uptake of the active strand.
  • 5′ modifications include, but are not limited to, NH 2 , biotin, an amine group, a lower alkylamine group, an acetyl group, 2′O-Me, DMTO, fluoroscein, a thiol, or acridine or any other group with this type of functionality.
  • nucleotide modifications like 2′-OMe, NH 2 , biotin, an amine group, a lower alkylamine group, an acetyl group, DMTO, fluoroscein, a thiol, or acridine or any other group with this type of functionality in the complementary strand of the synthetic miRNA can eliminate the activity of the complementary strand and enhance uptake of the active strand of the miRNA.
  • the relative stability of the 5′ and 3′ ends of the active strand of the synthetic miRNA apparently determines the uptake and activation of the active by the miRNA pathway. Destabilizing the 5′ end of the active strand of the synthetic miRNA by the strategic placement of base mismatches in the 3′ end of the complementary strand of the synthetic miRNA enhances the activity of the active strand and essentially eliminates the activity of the complementary strand.
  • the cells used to understand miRNA function may be derived from or contained in any organism (e.g., plant, animal, protozoan, virus, bacterium, or fungus).
  • the plant may be a monocot, dicot or gymnosperm; the animal may be a vertebrate or invertebrate.
  • Preferred microbes are those used in agriculture or by industry, and those that a pathogenic for plants or animals.
  • Fungi include organisms in both the mold and yeast morphologies. Examples of vertebrates include fish and mammals, including cattle, goat, pig, sheep, hamster, mouse, rate and human; invertebrate animals include nematodes, insects, arachnids, and other arthropods.
  • the cell is a vertebrate cell. More preferably, the cell is a mammalian cell.
  • the cells used to understand miRNA function may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like.
  • the cell can be a gamete or an embryo; if an embryo, it can be a single cell embryo or a constituent cell or cells from a multicellular embryo.
  • the term “embryo” thus encompasses fetal tissue.
  • the cell used for miRNA functional analysis may be an undifferentiated cell, such as a stem cell, or a differentiated cell, such as from a cell of an organ or tissue, including fetal tissue, or any other cell present in an organism.
  • Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells, of the endocrine or exocrine glands.
  • cells may be qualified as germ cells, nurse cells, epithelial cells, endothelial cells, hormone secreting cells, contractile cells, skeletal muscle cells, cardiac muscle cells, blood cells, or cells from the bone, bone marrow, brain, breast, cervix, colon, gastrointestinal tract, heart, kidney, large intestine, liver, lung, lymph nodes, ovary, pancreas, prostate, small intestine, spine or spinal cord, spleen, stomach, testes, thymus , or uterus.
  • the terms “cell,” “cell line,” and “cell culture” may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations formed by cell division. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations.
  • a host cell may be “transfected” or “transformed,” which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • a transformed cell includes the primary subject cell and its progeny.
  • the terms “engineered” and “recombinant” cells or host cells are intended to refer to a cell into which an exogenous nucleic acid sequence, such as, for example, a small, interfering RNA or a template construct encoding a reporter gene has been introduced. Therefore, recombinant cells are distinguishable from naturally occurring cells that do not contain a recombinantly introduced nucleic acid.
  • a tissue may comprise a host cell or cells to be transformed or contacted with a nucleic acid delivery composition and/or an additional agent.
  • the tissue may be part or separated from an organism.
  • a tissue and its constituent cells may comprise, but is not limited to, blood (e.g., hematopoietic cells (such as human hematopoietic progenitor cells, human hematopoietic stem cells, CD34 + cells CD4 + cells), lymphocytes and other blood lineage cells), bone marrow, brain, stem cells, blood vessel, liver, lung, bone, breast, cartilage, cervix, colon, cornea, embryonic, endometrium, endothelial, epithelial, esophagus, facia, fibroblast, follicular, ganglion cells, glial cells, goblet cells, kidney, lymph node, muscle, neuron, ovaries, pancreas, peripheral blood, prostate, skin, skin, small intestine, spleen, stomach, teste
  • the host cell or tissue may be comprised in at least one organism.
  • the organism may be, human, primate or murine.
  • the organism may be any eukaryote or even a prokayrote (e.g., a eubacteria, an archaea), as would be understood by one of ordinary skill in the art (see, for example, webpage http://phylogeny.arizona.edu/tree/phylogeny.html).
  • a prokayrote e.g., a eubacteria, an archaea
  • Synthetic miRNAs and miRNA inhibitors may be labeled with a radioactive, enzymatic, colorimetric, or other label or tag for detection or isolation purposes.
  • Nucleic acids may be labeled with fluorescence in some embodiments of the invention.
  • the fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, TET, Tetramethylrhodamine, and/or Texas Red.
  • FRET fluorescence resonance energy transfer
  • nucleic acids may be labeled or tagged to allow for their efficient isolation.
  • nucleic acids are biotinylated.
  • the present invention involves in some embodiments delivering a nucleic acid into a cell. This may be done as part of a screening method, or it may be related to a therapeutic or diagnostic application.
  • RNA molecules may be encoded by a nucleic acid molecule comprised in a vector.
  • vector is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated.
  • a nucleic acid sequence can be “exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found.
  • Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs).
  • a vector may encode non-modified polypeptide sequences such as a tag or targeting molecule.
  • a targeting molecule is one that directs the desired nucleic acid to a particular organ, tissue, cell, or other location in a subject's body.
  • expression vector refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed.
  • Expression vectors can contain a variety of “control sequences,” which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism.
  • control sequences refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism.
  • vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described
  • the expression vector comprises a virus or engineered vector derived from a viral genome.
  • the first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. They can accommodate only up to 8 kb of foreign genetic material but can be readily introduced in a variety of cell lines and laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986).
  • the retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells; they can also be used as vectors.
  • Other viral vectors may be employed as expression constructs in the present invention.
  • Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988; Horwich et al., 1990).
  • a nucleic acid e.g., DNA, including viral and nonviral vectors
  • Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S. Pat. Nos.
  • organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
  • screening is a process wherein multiple miRNA-specific reagents are delivered separately into individual cell populations or animals. At one or more designated times after delivery, the cell populations or animals are assayed for one or more phenotypes. Those cells or animals that have a significantly different phenotype than cells or animals in the negative control group are classified as positives. The miRNA that was being manipulated in the sample is defined as a hit. Hits represent targets for additional research and potential therapeutic development.
  • Assays that measure the intensity of a cellular phenotype range from microscopic assays that monitor cell size, cell cycle status, or antibody staining to enzymatic assays that assess the turnover of a specific substrate in a cell lysate to direct measurements of biomolecules or small molecules in lysates, on cells, or in medium.
  • the first step in this process is identifying a transfection reagent and plating conditions that maximize the uptake of synthetic miRNAs or miRNA inhibitors while maintaining high cell viability.
  • Transfection can be optimized for the reagent or electroporation condition that worked best among the conditions tested. Screening miRNA-specific libraries requires conditions for high-throughput transfection.
  • the inventors have developed and used a rapid process that facilitates the transfection of up to 1,000 wells in less than an hour without the need for robotics (see delivery below).
  • a library of synthetic miRNAs or miRNA inhibitors can be introduced sequentially into cells in a 24- or 96-well plate. Triplicate transfections for each reagent provide enough data for reasonable statistical analysis.
  • Validating a hit involves showing that the observed phenotype is due to the miRNA being targeted. Hits are typically confirmed by delivering a dilution series of the miRNA inhibitor or synthetic miRNA that registered as a hit into the cell that was originally assayed. It has been the experience of the inventors that true hits show a dose response.
  • the present invention concerns the preparation and use of synthetic miRNA and miRNA inhibitor libraries to induce changes in the activity of specific miRNAs in cells.
  • Preparation of synthetic miRNAs and miRNA inhibitors typically involves the chemical synthesis of the active and complementary strands of the synthetic miRNA and the single-stranded miRNA inhibitor using any of the methods described in this application. If the active and complementary strands of the synthetic miRNAs are two distinct molecules, then the two strands must be hybridized prior to delivery. Hybridization can be achieved by mixing the two nucleic acids together in roughly equimolar amounts and incubating for a time and at a temperature that is appropriate for hybridization. The addition of salt (e.g., NaCl or NaOAC) enhances hybridization as does the inclusion of a heat denaturation step prior to the incubation used for hybridization.
  • salt e.g., NaCl or NaOAC
  • Libraries of the invention can be used to sequentially up- or down-regulate one or more miRNAs in samples. This requires methods for introducing the synthetic miRNAs and miRNA inhibitors into cell types with associated cell assays. Lipid-based transfection is typically employed to introduce the nucleic acids into immortalized cells and electroporation for primary cells.
  • nucleic acid delivery Suitable methods for nucleic acid delivery according to the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, RNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of nucleic acids such as by injection (U.S. Pat. Nos.
  • organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
  • PTDs Protein Transduction Domains
  • terminal cholesterol groups apparently interact with receptors or lipids on the surfaces of cells and facilitate the internalization of the modified oligonucleotides.
  • poly-1-lysine has been conjugated to oligonucleotides to decrease the net negative charge and improve uptake into cells (Leonetti 1990).
  • a variety of compounds have been developed that complex with nucleic acids, deliver them to surfaces of cells, and facilitate their uptake in and release from endosomes.
  • lipids such as DOTAP (or other cationic lipid), DDAB, DHDEAB, and DOPE and (2) non-lipid-based polymers like polyethylenimine, polyamidoamine, and dendrimers of these and other polymers.
  • DOTAP cationic lipid
  • DDAB DDAB
  • DHDEAB DHDEAB
  • DOPE non-lipid-based polymers like polyethylenimine, polyamidoamine, and dendrimers of these and other polymers.
  • DOTAP DOTAP
  • cholesterol or a cholesterol derivative U.S. Pat. No. 6,770,291, which is hereby incorporated by reference.
  • Several of these reagents have been shown to facilitate nucleic acid uptake in animals.
  • the cellular components involved in the miRNA pathway are becoming known. Proteins that stabilize and/or transport miRNAs within cells might enhance the stability and activity of miRNAs because they should protect and guide the bound miRNAs once they are in cells. Mixtures of miRNA-transporter proteins and miRNAs could enhance the efficacy of miRNA-based therapeutics.
  • RNAs are hydrophilic molecules by virtue of their anionic phosphate and sugar backbone. Although the nucleobases are hydrophobic, hydrophilicity dominates owing to the extensive hydrogen bonding resulting from the phosphate and sugar residues. The hydrophilic character and anionic backbone reduces cellular permeation. Conjugation of lipophilic groups like cholesterol (Manoharan, 2002) and lauric and lithocholic acid derivatives with C32 functionality (Lorenz et al., 2004), have been shown to improve cellular uptake. Moreover binding of steroid conjugated oligonucleotides to different lipoproteins in the bloodstream, such as LDL, protect their integrity and govern their biodistribution (Rump et al., 2000).
  • Cholesterol attached to anti-sense molecules (Bijsterbosch et al., 2001) and aptamers (Rusconi et al., 2004) has also been shown to stabilize oligonucleotides by allowing binding to lipoproteins. Cholesterol has been demonstrated to enhance uptake and serum stability of siRNAs in vitro (Lorenz et al., 2004) and in vivo (Soutschek et al., 2004).
  • a library of synthetic miRNAs and/or miRNA inhibitors can be created using methods of the invention. This library may then be used in high throughput assays, including microarrays.
  • chip-based nucleic acid technologies such as those described by Ziauddin and Sabatini (2001). Briefly, nucleic acids can be immobilized on solid supports. Cells can then be overlaid on the solid support and take up the nucleic acids at the defined locations. The impact on the cells can then be measured to identify cocktails that are having a desirable effect.
  • the present invention concerns miRNA that are labeled, such as for screening assays to evaluate the therapeutic or diagnostic relevance of a particular miRNA species. It is contemplated that miRNA may first be isolated (either from a cell in which the miRNA is endogenous to the cell or from a cell in which miRNA is exogenous to the cell) and/or purified prior to labeling. This may achieve a reaction that more efficiently labels the miRNA, as opposed to other RNA in a sample in which the miRNA is not isolated or purified prior to labeling. In many embodiments of the invention, the label is non-radioactive. Generally, nucleic acids may be labeled by adding labeled nucleotides (one-step process) or adding nucleotides and labeling the added nucleotides (two-step process).
  • miRNA may be labeled as is described in U.S. Patent Application Ser. No. 60/649,584, which is hereby incorporated by reference.
  • nucleotides include those that can be labeled with a dye, including a fluorescent dye, or with a molecule such as biotin. Labeled nucleotides are readily available; they can be acquired commercially or they can be synthesized by reactions known to those of skill in the art.
  • Nucleotides for labelling are not naturally occurring nucleotides, but instead, refer to prepared nucleotides that have a reactive moiety on them.
  • Specific reactive functionalities of interest include: amino, sulfhydryl, sulfoxyl, aminosulfhydryl, azido, epoxide, isothiocyanate, isocyanate, anhydride, monochlorotriazine, dichlorotriazine, mono- or dihalogen substituted pyridine, mono- or disubstituted diazine, maleimide, epoxide, aziridine, sulfonyl halide, acid halide, alkyl halide, aryl halide, alkylsulfonate, N-hydroxysuccinimide ester, imido ester, hydrazine, azidonitrophenyl, azide, 3-(2-pyridyl dithio)-propionamide, glyoxal,
  • the reactive functionality may be bonded directly to a nucleotide, or it may be bonded to the nucleotide through a linking group.
  • the functional moiety and any linker cannot substantially impair the ability of the nucleotide to be added to the miRNA or to be labeled.
  • Representative linking groups include carbon containing linking groups, typically ranging from about 2 to 18, usually from about 2 to 8 carbon atoms, where the carbon containing linking groups may or may not include one or more heteroatoms, e.g. S, O, N etc., and may or may not include one or more sites of unsaturation.
  • alkyl linking groups typically lower alkyl linking groups of 1 to 16, usually 1 to 4 carbon atoms, where the linking groups may include one or more sites of unsaturation.
  • the functionalized nucleotides (or primers) used in the above methods of functionalized target generation may be fabricated using known protocols or purchased from commercial vendors, e.g., Sigma, Roche, Ambion, and NEN.
  • Functional groups may be prepared according to ways known to those of skill in the art, including the representative information found in U.S. Pat. Nos. 4,404,289; 4,405,711; 4,337,063 and 5,268,486, and Br. Pat. No. 1,529,202, which are all incorporated by reference.
  • Amine-modified nucleotides are used in several embodiments of the invention.
  • the amine-modified nucleotide is a nucleotide that has a reactive amine group for attachment of the label. It is contemplated that any ribonucleotide (G, A, U, or C) or deoxyribonucleotide (G, A, T, or C) can be modified for labeling.
  • Examples include, but are not limited to, the following modified ribo- and deoxyribo-nucleotides: 5-(3-aminoallyl)-UTP; 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N 6 -(4-amino)butyl-ATP, N 6 -(6-amino)butyl-ATP, N 4 -[2,2-oxy-bis-(ethylamine)]-CTP; N 6 -(6-Amino)hexyl-ATP; 8-[(6-Amino)hexyl]-amino-ATP; 5-propargylamino-CTP, 5-propargylamino-UTP; 5-(3-aminoallyl)-dUTP; 8-[(4-amino)butyl]-amino-dATP and 8-[(6-amino)butyl
  • nucleotides can be prepared according to methods known to those of skill in the art. Moreover, a person of ordinary skill in the art could prepare other nucleotide entities with the same amine-modification, such as a 5-(3-aminoallyl)-CTP, GTP, ATP, dCTP, dGTP, dTTP, or dUTP in place of a 5-(3-aminoallyl)-UTP.
  • nucleic acids are labeled by catalytically adding to the nucleic acid an already labeled nucleotide or nucleotides.
  • One or more labeled nucleotides can be added to miRNA molecules. See U.S. Pat. No. 6,723,509, which is hereby incorporated by reference.
  • an unlabeled nucleotide or nucleotides is catalytically added to an miRNA, and the unlabeled nucleotide is modified with a chemical moiety that enables it to be subsequently labeled.
  • the chemical moiety is a reactive amine such that the nucleotide is an amine-modified nucleotide.
  • amine-modified nucleotides are well known to those of skill in the art, many being commercially available such as from Ambion, Sigma, Jena Bioscience, and TriLink.
  • the present invention concerns the use of an enzyme capable of using a di- or tri-phosphate ribonucleotide or deoxyribonucleotide as a substrate for its addition to an miRNA, a small RNA molecule. Moreover, in specific embodiments, it involves using a modified di- or tri-phosphate ribonucleotide, which is added to the 3′ end of an miRNA.
  • the source of the enzyme is not limiting. Examples of sources for the enzymes include yeast, gram-negative bacteria such as E. coli, lactococcus lactis , and sheep pox virus.
  • Enzymes capable of adding such nucleotides include, but are not limited to, poly(A) polymerase, terminal transferase, and polynucleotide phosphorylase.
  • ligase is contemplated as NOT being the enzyme used to add the label, and instead, a non-ligase enzyme is employed.
  • Poly(A) polymerase has been cloned from a number of organisms from plants to humans. It has been shown to catalyze the addition of homopolymer tracts to RNA (Martin et al., RNA, 4(2):226-30, 1998).
  • Terminal transferase catalyzes the addition of nucleotides to the 3′ terminus of a nucleic acid.
  • Polynucleotide phosphorylase can polymerize nucleotide diphosphates without the need for a primer.
  • Labels on miRNA or miRNA probes may be colorimetric (includes visible and UV spectrum, including fluorescent), luminescent, enzymatic, or positron emitting (including radioactive). The label may be detected directly or indirectly. Radioactive labels include 125 I, 32 P, 33 P, and 35 S. Examples of enzymatic labels include alkaline phosphatase, luciferase, horseradish peroxidase, and ⁇ -galactosidase. Labels can also be proteins with luminescent properties, e.g., green fluorescent protein and phycoerythrin.
  • the colorimetric and fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL; Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4-methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate; macrocyclic chelates of lanthanide ions, such as Quantum DyeTM; Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red; fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer; and, TOTAB.
  • Alexa Fluor dyes such as BODIPY FL
  • Cascade Blue
  • dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY dyes, such as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIP
  • fluorescently labeled ribonucleotides are available from Molecular Probes, and these include, Alexa Fluor 488-5-UTP, Fluorescein-12-UTP, BODIPY FL-14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14-UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP.
  • Other fluorescent ribonucleotides are available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP.
  • fluorescently labeled deoxyribonucleotides include Dinitrophenyl (DNP)-11-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546-14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY TR-14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650-14-dUTP, BODIPY 650/665-14-dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-d
  • FRET fluorescence resonance energy transfer
  • the label may not be detectable per se, but indirectly detectable or allowing for the isolation or separation of the targeted nucleic acid.
  • the label could be biotin, digoxigenin, polyvalent cations, chelator groups and the other ligands, include ligands for an antibody.
  • FRET fluorescent resonance energy transfer
  • the present invention can be employed with miRNA arrays, which are ordered macroarrays or microarrays of nucleic acid molecules (probes) that are fully or nearly complementary or identical to a plurality of miRNA molecules or precursor miRNA molecules and that are positioned on a support material in a spatially separated organization.
  • Macroarrays are typically sheets of nitrocellulose or nylon upon which probes have been spotted.
  • Microarrays position the nucleic acid probes more densely such that up to 10,000 nucleic acid molecules can be fit into a region typically 1 to 4 square centimeters.
  • Microarrays can be fabricated by spotting nucleic acid molecules, e.g., genes, oligonucleotides, etc., onto substrates or fabricating oligonucleotide sequences in situ on a substrate. Spotted or fabricated nucleic acid molecules can be applied in a high density matrix pattern of up to about 30 non-identical nucleic acid molecules per square centimeter or higher, e.g. up to about 100 or even 1000 per square centimeter. Microarrays typically use coated glass as the solid support, in contrast to the nitrocellulose-based material of filter arrays. By having an ordered array of miRNA-complementing nucleic acid samples, the position of each sample can be tracked and linked to the original sample.
  • nucleic acid molecules e.g., genes, oligonucleotides, etc.
  • array devices in which a plurality of distinct nucleic acid probes are stably associated with the surface of a solid support are known to those of skill in the art.
  • Useful substrates for arrays include nylon, glass and silicon Such arrays may vary in a number of different ways, including average probe length, sequence or types of probes, nature of bond between the probe and the array surface, e.g. covalent or non-covalent, and the like.
  • the arrays can be high density arrays, such that they contain 100 or more different probes. It is contemplated that they may contain 1000, 16,000, 65,000, 250,000 or 1,000,000 or more different probes.
  • the probes can be directed to targets in one or more different organisms.
  • the oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, or 15 to 40 nucleotides in length in some embodiments. In certain embodiments, the oligonucleotide probes are 20 to 25 nucleotides in length.
  • each different probe sequence in the array is generally known. Moreover, the large number of different probes can occupy a relatively small area providing a high density array having a probe density of generally greater than about 60, 100, 600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 different oligonucleotide probes per cm 2 .
  • the surface area of the array can be about or less than about 1, 1.6, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cm 2 .
  • miRNA of a wide variety of samples can be analyzed using assays described herein. While endogenous miRNA is contemplated for use with some embodiments, recombinant miRNA—including nucleic acids that are complementary or identical to endogenous miRNA or precursor miRNA—can also be handled and analyzed as described herein.
  • Samples may be biological samples, in which case, they can be from blood, tissue, organs, semen, saliva, tears, other bodily fluid, hair follicles, skin, or any sample containing or constituting biological cells. Alternatively, the sample may not be a biological sample, but be a chemical mixture, such as a cell-free reaction mixture (which may contain one or more biological enzymes).
  • the population of target nucleic acids is contacted with the array under hybridization conditions, where such conditions can be adjusted, as desired, to provide for an optimum level of specificity in view of the particular assay being performed.
  • Suitable hybridization conditions are well known to those of skill in the art and reviewed in Sambrook et al., 1989 and WO 95/21944. Of particular interest in many embodiments is the use of stringent conditions during hybridization. Stringent conditions are known to those of skill in the art.
  • a single array may be contacted with multiple samples.
  • the samples may be labeled with different labels to distinguish the samples.
  • a single array can be contacted with a tumor tissue sample labeled with Cy3, and normal tissue sample labeled with Cy5. Differences between the samples for particular miRNAs corresponding to probes on the array can be readily ascertained and quantified.
  • the small surface area of the array permits uniform hybridization conditions, such as temperature regulation and salt content. Moreover, because of the small area occupied by the high density arrays, hybridization may be carried out in extremely small fluid volumes (e.g., about 250 ⁇ l or less, including volumes of about or less than about 5, 10, 25, 50, 60, 70, 80,90, 100 ⁇ l, or any range derivable therein). In small volumes, hybridization may proceed very rapidly.
  • extremely small fluid volumes e.g., about 250 ⁇ l or less, including volumes of about or less than about 5, 10, 25, 50, 60, 70, 80,90, 100 ⁇ l, or any range derivable therein. In small volumes, hybridization may proceed very rapidly.
  • Arrays can be used to detect differences between two samples. This can also be used for diagnostic purposes. Specifically contemplated applications include identifying and/or quantifying differences between miRNA from a sample that is normal and from a sample that is not normal or between two differently treated samples. Also, miRNA may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition. A sample that is not normal is one exhibiting phenotypic trait(s) of a disease or condition or one believed to be not normal with respect to that disease or condition. It may be compared to a cell that is normal with respect to that disease or condition. Phenotypic traits include symptoms of, or susceptibility to, a disease or condition of which a component is or may or may not be genetic.
  • RNA molecules of the present invention can be used to treat any of the diseases or conditions discussed in the previous section or modulate any of the cellular pathways discussed in the previous section.
  • RNAs that contribute to cellular processes that are themselves parts of a disease or might otherwise be associated with a particular disease state.
  • miRNA functions may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition.
  • autoimmune diseases rheumatoid arthritis, multiple sclerosis, diabetes—insulin-dependent and non-independent, systemic lupus erythematosus and Graves disease
  • cancer e.g., malignant, benign, metastatic, precancer
  • cardiovascular diseases heart disease or coronary artery disease, stroke—ischemic and hemorrhagic, and rheumatic heart disease
  • diseases of the nervous system e.g., malignant, benign, metastatic, precancer
  • cardiovascular diseases heart disease or coronary artery disease, stroke—ischemic and hemorrhagic, and rheumatic heart disease
  • diseases of the nervous system e.g., malignant, benign, metastatic, precancer
  • cardiovascular diseases heart disease or coronary artery disease, stroke—ischemic and hemorrhagic, and rheumatic heart disease
  • diseases of the nervous system e.g., malignant, benign, metastatic, precancer
  • cardiovascular diseases heart disease or coronary
  • miRNA can be evaluated with respect to the following diseases, conditions, and disorders: Abdominal Adhesions; Anal Abscess; Brain Abscess; Peritonsillar Abscess; Absence Seizures; Achalasia; Acne; Acoustic Neuroma; Acquired Immunodeficiency Syndrome (AIDS); Acrochordon; Actinic Keratosis; Adenocarcinoma of the Lung; ADHD; Adult-Onset Diabetes; Aero-Otitis; Age Spots; Age-Related Hearing Loss; Age-Related Macular Degeneration; Age-Related Vision Change (Presbyopia); Agoraphobia; Alcohol Withdrawal; Alcoholism; Allergen Immunotherapy; Allergic Rhinitis; Allergies; Alopecia (Areata, Hereditary-Patterned, and Traumatic); Altitude Sickness; Alzheimer's Disease; Amaurotic Familial Infantile Idiocy; Amblyopia; Amenorrhea; Amyloid
  • Difficile Colitis Calcaneal Apophysitis; Calcium Pyrophosphate Deposition Disease; Campylobacteriosis; Cancer; Candidiasis; Carbon-Monoxide Poisoning; Carbuncles; Cardiac Arrhythmias (Atrial Fibrillation, Bradycardia); Cardiomyopathy; Carpal Tunnel Syndrome; Cataracts; Cellulitis; Central Serous Retinopathy; Cerebral Palsy; Cerebromacular Degeneration; Cerumen Impaction; Cervicitis, Nabothian Cysts, Cervical Polyps, Cervical Warts; Chalazion; Chickenpox; Chlamydia ; Chloasma; Cholangitis; Cholecystitis; Cholesteatoma; Chondromalacia; Chorea; Choroidal Melanoma; Chronic Bronchitis; Chronic Fatigue Syndrome; Chronic Hepatitis; Chronic Leukemia; Chronic Obstructive Pulmonary Disease; Chronic Otitis Media;
  • Cancers that may be evaluated, diagnosed, and/or treated by methods and compositions of the invention include cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus.
  • the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli ; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma;
  • the invention can be used to evaluate or diagnose differences between stages of disease, such as between pre-cancer and cancer, or between a primary tumor and a metastasized tumor.
  • chemotherapeutic drugs include, but are not limited to, chemotherapeutic drugs.
  • a “chemotherapeutic agent” is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.
  • chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including
  • anti-hormonal agents that act to regulate or inhibit hormone action on tumors
  • SERMs selective estrogen receptor modulators
  • aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate, exemestane, formestanie, fadrozole, vorozole, letrozole, and anastrozole
  • anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dio
  • Such cellular pathways include but are not limited to the following: any adhesion or motility pathway including but not limited to those involving cyclic AMP, protein kinase A, G-protein couple receptors, adenylyl cyclase, L-selectin, E-selectin, PECAM, VCAM-1, ⁇ -actinin, paxillin, cadherins, AKT, integrin- ⁇ , integrin- ⁇ , RAF-1, ERK, PI-3 kinase, vinculin, matrix metalloproteinases, Rho GTPases, p85, trefoil factors, profilin, FAK, MAP kinase, Ras, caveolin, calpain-1, calpain-2, epidermal growth factor receptor, ICAM-1, ICAM-2, cofilin, actin, gelsolin, RhoA, RAC1, myosin light chain kinase, platelet-derived growth factor receptor or ezrin; any
  • nucleic acids molecules of the invention can be employed in diagnostic and therapeutic methods with respect to any of the above pathways or factors.
  • a synthetic miRNA, nonsynthetic nucleic acid, or miRNA inhibitor inhibits, eliminate, activates, induces, increases, or otherwise modulates one or more of the above pathways or factors is contemplated as part of methods of the invention.
  • the nucleic acid can be used to diagnosis a disease or condition based on the relation of that miRNA to any of the pathways described above.
  • Phenotypic traits also include characteristics such as longevity, appearance (e.g., baldness, obesity), strength, speed, endurance, fertility, and susceptibility or receptivity to particular drugs or therapeutic treatments. Synthetic miRNAs or miRNA inhibitors that affect phenotypic traits may provide intervention points for therapeutic development.
  • RNAs In addition to the use of arrays and microarrays, it is contemplated that a number of difference assays could be employed to analyze miRNAs, their activities, and their effects.
  • assays include, but are not limited to, RT-PCR, in situ hybridization, hybridization protection assay (HPA)(GenProbe), branched DNA (bDNA) assay (Chiron), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies), and Bridge Litigation Assay (Genaco). It is contemplated that such methods may be used in the context of arrays, as well as in the context of diagnostic assays.
  • RNA molecules of the present invention can be used to treat any of the diseases or conditions discussed in the previous section.
  • any of the methods described above can also be employed with respect to therapeutic and diagnostic aspects of the invention. For example, methods with respect to detecting miRNAs or screening for them can also be employed in a diagnostic context.
  • an effective amount of the synthetic miRNAs or miRNA inhibitors of the present invention is administered to a cell, which may or may not be in an animal.
  • a therapeutically effective amount of the synthetic miRNAs or miRNA inhibitors of the present invention is administered to an individual for the treatment of disease or condition.
  • effective amount as used herein is defined as the amount of the molecules of the present invention that are necessary to result in the desired physiological change in the cell or tissue to which it is administered.
  • therapeutically effective amount as used herein is defined as the amount of the molecules of the present invention that achieves a desired effect with respect to a disease or condition.
  • an amount of molecules that provides a physiological change is considered an “effective amount” or a “therapeutically effective amount.”
  • the molecule has a sequence that corresponds to the miRNA sequence from that particular animal, as opposed to from another animal.
  • a human sequence is utilized in the RNA molecules of the present invention.
  • nucleic acid molecules of the invention may be administered to a subject alone or in the form of a pharmaceutical composition for the treatment of a condition or disease.
  • Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the proteins into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the proteins of the invention may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art.
  • Systemic formulations include those designed for administration by injection, e.g. subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, inhalation, oral or pulmonary administration.
  • the nucleic acids of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer.
  • the solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the nucleic acid molecules may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • a suitable vehicle e.g., sterile pyrogen-free water
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the nucleic acids can be readily formulated by combining the molecules with pharmaceutically acceptable carriers well known in the art. Such carriers enable the nucleic acids of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
  • suitable excipients include fillers such as sugars, e.g. lactose, sucrose, mannitol and sorbitol; cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP); granulating agents; and binding agents.
  • disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • solid dosage forms may be sugar-coated or enteric-coated using standard techniques.
  • suitable carriers, excipients or diluents include water, glycols, oils, alcohols, etc. Additionally, flavoring agents, preservatives, coloring agents and the like may be added.
  • the molecules may take the form of tablets, lozenges, etc. formulated in conventional manner.
  • the molecules for use according to the present invention are conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the nucleic acids and a suitable powder base such as lactose or starch.
  • the RNA molecules may also be formulated in rectal or vaginal compositions such as suppositories
  • the molecules may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • the molecules may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • Liposomes and emulsions are well-known examples of delivery vehicles that may be used to deliver nucleic acids of the invention.
  • a nucleic acid of the invention may be administered in combination with a carrier or lipid to increase cellular uptake.
  • the oligonucleotide may be administered in combination with a cationic lipid.
  • cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE, and DOTAP.
  • WO0071096, which is specifically incorporated by reference, describes different formulations, such as a DOTAP:cholesterol or cholesterol derivative formulation that can effectively be used for gene therapy.
  • Other disclosures also discuss different lipid or liposomal formulations including nanoparticles and methods of administration; these include, but are not limited to, U.S.
  • Patent Publication 20030203865, 20020150626, 20030032615, and 20040048787 which are specifically incorporated by reference to the extent they disclose formulations and other related aspects of administration and delivery of nucleic acids.
  • Methods used for forming particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972,900, which are incorporated by reference for those aspects.
  • the nucleic acids may also be administered in combination with a cationic amine such as poly (L-lysine). Nucleic acids may also be conjugated to a chemical moiety, such as transferrin and cholesteryls.
  • oligonucleotides may be targeted to certain organelles by linking specific chemical groups to the oligonucleotide. For example, linking the oligonucleotide to a suitable array of mannose residues will target the oligonucleotide to the liver.
  • the molecules may be delivered using a sustained-release system, such as semipermeable matrices of solid polymers containing the therapeutic agent.
  • sustained-release materials have been established and are well known by those skilled in the art.
  • Sustained-release capsules may, depending on their chemical nature, release the molecules for a few weeks up to over 100 days.
  • additional strategies for molecule stabilization may be employed.
  • Nucleic acids may be included in any of the above-described formulations as the free acids or bases or as pharmaceutically acceptable salts.
  • Pharmaceutically acceptable salts are those salts that substantially retain the biologic activity of the free bases and which are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous and other protic solvents than are the corresponding free base forms.
  • compositions of the present invention comprise an effective amount of one or more synthetic miRNA molecules or miRNA inhibitors dissolved or dispersed in a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate.
  • the preparation of an pharmaceutical composition that contains at least one chimeric polypeptide or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference.
  • preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
  • “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
  • the chimeric molecules may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection.
  • the present invention can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, inhalation (e.g.
  • aerosol inhalation injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).
  • lipid compositions e.g., liposomes
  • the actual dosage amount of a composition of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration.
  • the practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
  • compositions may comprise, for example, at least about 0.1% of an active compound.
  • the an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein.
  • a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein.
  • a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc. can be administered, based on the numbers described above.
  • the composition may comprise various antioxidants to retard oxidation of one or more component.
  • the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
  • parabens e.g., methylparabens, propylparabens
  • chlorobutanol phenol
  • sorbic acid thimerosal or combinations thereof.
  • the molecules may be formulated into a composition in a free base, neutral or salt form.
  • Pharmaceutically acceptable salts include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
  • a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods.
  • isotonic agents such as, for example, sugars, sodium chloride or combinations thereof.
  • nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays.
  • Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained.
  • the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5.
  • antimicrobial preservatives similar to those used in ophthalmic preparations, drugs, or appropriate drug stabilizers, if required, may be included in the formulation.
  • various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines.
  • the molecules are prepared for administration by such routes as oral ingestion.
  • the solid composition may comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules (e.g., hard or soft shelled gelatin capsules), sustained release formulations, buccal compositions, troches, elixirs, suspensions, syrups, wafers, or combinations thereof.
  • Oral compositions may be incorporated directly with the food of the diet.
  • Preferred carriers for oral administration comprise inert diluents, assimilable edible carriers or combinations thereof.
  • the oral composition may be prepared as a syrup or elixir.
  • a syrup or elixir and may comprise, for example, at least one active agent, a sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or combinations thereof.
  • an oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof.
  • a composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia , cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the
  • the dosage unit form When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both.
  • composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less that 0.5 ng/mg protein.
  • prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin or combinations thereof.
  • the molecules of the invention will generally be used in an amount effective to achieve the intended purpose.
  • the molecules of the invention, or pharmaceutical compositions thereof are administered or applied in a therapeutically effective amount.
  • a therapeutically effective amount is an amount effective to ameliorate or prevent the symptoms, or prolong the survival of, the patient being treated. Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • a therapeutically effective dose can be estimated initially from in vitro assays.
  • a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC 5 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
  • Initial dosages can also be estimated from in vivo data, e.g., animal models, using techniques that are well known in the art. One having ordinary skill in the art could readily optimize administration to humans based on animal data.
  • Dosage amount and interval may be adjusted individually to provide plasma levels of the molecules which are sufficient to maintain therapeutic effect.
  • Usual patient dosages for administration by injection range from about 0.1 to 5 mg/kg/day, preferably from about 0.5 to 1 mg/kg/day.
  • Therapeutically effective serum levels may be achieved by administering multiple doses each day.
  • the effective local concentration of the proteins may not be related to plasma concentration.
  • One having skill in the art will be able to optimize therapeutically effective local dosages without undue experimentation.
  • the amount of molecules administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.
  • the therapy may be repeated intermittently while symptoms detectable or even when they are not detectable.
  • the therapy may be provided alone or in combination with other drugs or treatment (including surgery).
  • a therapeutically effective dose of the molecules described herein will provide therapeutic benefit without causing substantial toxicity.
  • Toxicity of the molecules described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD50 (the dose lethal to 50% of the population) or the LD 100 (the dose lethal to 100% of the population).
  • the dose ratio between toxic and therapeutic effect is the therapeutic index. Proteins which exhibit high therapeutic indices are preferred.
  • the data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human.
  • the dosage of the proteins described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • a “pendant group” may be attached or conjugated to the nucleic acid.
  • Pendant groups may increase cellular uptake of the nucleic acid.
  • Pendant groups can be linked to any portion of the nucleic acid but are commonly linked to the end(s) of the oligonucleotide chain. Examples of pendant groups include, but are not limited to: acridine derivatives (i.e.
  • nucleic acid is conjugated to a carbohydrate, sulfated carbohydrate, or glycan.
  • compositions described herein may be comprised in a kit.
  • individual synthetic miRNAs are included in a kit.
  • the kit may further include one or more negative control synthetic miRNAs that can be used to control for the effects of synthetic miRNA delivery.
  • the kit may further include water and hybridization buffer to facilitate hybridization of the two strands of the synthetic miRNAs.
  • the kit may also include one or more transfection reagent(s) to facilitate delivery of the synthetic miRNA to cells.
  • kits may further include one or more negative control synthetic miRNAs and/or miRNA inhibitors that can be used to control for the effects of synthetic miRNA and/or miRNA inhibitor delivery.
  • the kit may also include one or more transfection reagents to facilitate delivery into cells.
  • kits may be packaged either in aqueous media or in lyophilized form.
  • the container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit (labeling reagent and label may be packaged together), the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial.
  • the kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.
  • the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • the components of the kit may be provided as dried powder(s).
  • the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
  • the container means will generally include at least one vial, test tube, flask, bottle, syringe and/or other container means, into which the nucleic acid formulations are placed, preferably, suitably allocated.
  • the kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other diluent.
  • kits of the present invention will also typically include a means for containing the vials in close confinement for commercial sale, such as, e.g., injection and/or blow-molded plastic containers into which the desired vials are retained.
  • a means for containing the vials in close confinement for commercial sale such as, e.g., injection and/or blow-molded plastic containers into which the desired vials are retained.
  • kits may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses.
  • kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.
  • kits will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.
  • Kits of the invention may also include one or more of the following: synthetic miRNA, nonsynthetic miRNA, library of synthetic miRNAs, library of miRNA inhibitors, library of nonsynthetic miRNA, combination library of synthetic miRNA, miRNA inhibitors, and/or nonsynthetic miRNAs, negative control synthetic miRNA, negative control miRNA inhibitor, negative control nonsynthetic miRNA, nuclease-free water; RNase-free containers, such as 1.5 ml tubes; hybridization buffer; and transfection reagent(s).
  • kits of the invention are embodiments of kits of the invention. Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA.
  • catalog numbers refer to products available by that number from Ambion, Inc.®, The RNA Company.
  • luciferase reporter vectors were created to measure the activities of synthetic miRNAs in cells.
  • the reporter vectors were based on plasmids that had been used to monitor the activity of endogenous miRNAs (Tuschl paper). Briefly, a mammalian expression vector with the luciferase gene under the control of the CMV early promoter was created. Down-stream of the luciferase coding sequence, in the 3′ UTR of the gene, sequences complementary to mature miR-1-2, miR-10, miR-124, miR-19a, and miR-130 were added. The reporter vectors were co-transfected into HeLa cells along with synthetic miRNAs designed to introduce one of the five miRNAs listed above.
  • the transfections involved mixing 200 ng of reporter vector with 0.3, 1, and 3 pmoles of each corresponding synthetic miRNA.
  • the reporter/miRNA mixture was mixed with 0.3 ⁇ l of Lipofectamine 2000 (Invitrogen) and incubated for 5-15 minutes.
  • Approximately 8,000 cells were added to each miRNA/reporter/transfection reagent complex in individual wells of a 96-well plate.
  • HeLa cells were grown in D-MEM (GIBCO) supplemented with 10% fetal bovine serum (GIBCO) at 37° C. and 5% CO 2 . 24-48 hrs post transfection, the cells were harvested and assayed using the Luciferase assay as described by the manufacturer (Promega).
  • the level of luciferase expression in the cell populations was compared to cells transfected with the same reporter but a synthetic miRNA with a sequence that does not correspond to the vector. This non-targeting miRNA was referred to as the negative control miRNA.
  • synthetic let-7 miRNAs were created and used to transfect HepG2 cells in 24-well plates using siPORT NeoFX (Ambion) according to the manufacturer's suggestions. Three days post-transfection, the cells were fixed with 4% paraformaldehyde, stained with DAPI to localize cell nuclei, and stained with FITC-conjugated antibodies specific to MYC or RAS (US Biological) according to the manufacturer's suggestions. The relative reduction in target protein expression in synthetic let-7 transfected cells was determined by comparing the staining intensity of MYC and RAS to cells transfected with a negative control miRNA using MetaMorph software.
  • the first referred to as the “miRNA design”
  • the second design referred to as the “mismatch design” was a hybrid of the same active strand as above with a complementary strand with a di-nucleotide, 3′ overhang and two mismatches in the final five nucleotides that preceded the 3′ overhang (see below).
  • the third design referred to as the “siRNA design,” comprised the same active strand as above hybridized to a second RNA that was fully complementary except that it left 3′ di-nucleotide overhangs at either end of the double-stranded molecule (two polynucleotides) (see below).
  • the examples below involve or correspond to human miRNAs.
  • the following cells were transfected: HepG2 cells with three designs of the let-7 synthetic miRNAs, A549 with three designs of the miR-196 synthetic miRNAs, and HeLa with the G6PD reporter vector and three designs of the miR-1-2 synthetic miRNA.
  • the reporter vectors all three synthetic miRNA designs proved capable of reducing the expression of the target genes, though it is notable that the siRNA design performed most poorly.
  • siRNA design proved problematic in that it exhibited a high rate of complementary strand uptake by the miRNA pathway, it did have the advantage that it was easy to hybridize and easy to deliver to cells. For these reasons, ways to overcome the problems with complementary strand uptake were explored.
  • the siRNA design was used to test the effects of chemical modifications at the 5′ ends of the synthetic miRNAs. For these studies, several different complementary strands were synthesized with unique 5′ ends. One featured four deoxyribose nucleotides at the 5′ end; one was a combination of four deoxyribose nucleotides at the 5′ end and a 5′ NH 2 ; one had a 5′ NH 2 ; one had a 5′ NHCOCH 3 (see below).
  • Luciferase expression from the active and complementary strand-specific reporter vectors was measured according to the manufacturer's (Promega) protocol.
  • the synthetic miRNA designs with the 5′ NH 2 and 5′ NHCOCH 3 provided higher active strand activity and significantly reduced complementary strand activity relative to the unmodified, synthetic miRNAs. This is ideal for synthetic miRNAs since the effects seen following transfection will be specific to the activity of the active strand of the synthetic miRNA.
  • the high efficacy of the 5′ modified designs will allow lower concentrations to be used for transfections and reduce toxicity that is often observed when transfecting cells with higher amounts of nucleic acid.
  • siRNA design was also used to test the effects of chemical modifications at internal domains within the complementary strand.
  • 2′O-Me modifications were placed at various locations along the length of the complementary strand.
  • a hallmark of cancer is uncontrolled cell proliferation; cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis. A cell proliferation assay was used in conjunction with the miRNA inhibitor library to identify miRNAs that influence cell proliferation.
  • the inventors transfected HeLa cells in triplicate with fifteen different synthetic miRNAs using siPORT NeoFX (Ambion) according to the manufacturer's instructions ( FIG. 6 ).
  • Transfected HeLa cells were analyzed using Alamar Blue (BioSource International, Inc., CA) at 24 hr intervals.
  • Alamar Blue is a compound, that when reduced by cellular metabolism, changes from a non-fluorescent blue color to a fluorescent red form that is easily quantified.
  • the amount of Alamar Blue reduced is directly proportional to the cell number, providing a rapid method for assessing cell proliferation.
  • the Alamar Blue reagent was added into the tissue culture media at a 10% final concentration.
  • a hallmark of cancer is uncontrolled cell proliferation.
  • Cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis.
  • a cell proliferation assay was used in conjunction with our miRNA inhibitor library to identify miRNAs that influence cell proliferation.
  • Cells were transfected with a library of over 90 miRNA inhibitors to identify miRNAs that are involved in cell growth.
  • HeLa cells 8000 cells/well of 96 well plate
  • the media was changed 24 hrs after transfection.
  • 72 hours post-transfection we fixed cells with 4% paraformaldehyde, permeabilized with 0.1% TritonX 100, and stained with propidium iodide to look at total cell number.
  • the plates were scanned using the TTP labtech Acumen Explorer. Cell number was plotted relative to cells transfected with a negative control miRNA inhibitor ( FIG. 7 ). The red horizontal bars bracket normal variation in cell proliferation (20% variation).
  • a group of nine miRNA inhibitors were identified that caused significant decreases (miR 31, 150, 187, 125a, 190, 191, 193, 204 and 218) in cell growth and two miRNA inhibitors that caused a significant increase (miR 24 and miR 21) in cell growth following transfection into HeLa cells (Table 4).
  • MiRNA-31 inhibition also caused a distinct cellular morphology.
  • a relative cut off of 20% above and below 100% was chosen as genes that were considered significantly changed.
  • a caspase 3/7 activity assay was used in conjunction with a library of synthetic miRNAs to identify miRNAs that are involved in regulating apoptosis.
  • a library of eighteen synthetic miRNAs was used to transfect A549 cells (8000 cells/well of 96 well plate) in triplicate using siPORTTM NeoFXTM (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at ⁇ 80° C. 2) Cells were lysed by adding 40 ⁇ l of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4° C.
  • cold lysis buffer 50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA
  • miRNA inhibitors were also used to identify miRNAs that influence cell viability.
  • a library of over 90 miRNA inhibitors was used to transfect A549 cells (8000 cells/well of 96 well plate) in triplicate using siPORTTM NeoFXTM (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. Cells were trypsinized and stained with ViaCount Flex Reagent, which distinguishes between viable and non-viable cells based on permeability of the DNA binding dyes in the reagent. Cells were analyzed using the Guava PCA-96 (Personal Cell Analysis).
  • Apoptosis is a natural cellular process that helps control cancer by inducing death in cells with oncogenic potential. Many oncogenes function by altering induction of apoptosis.
  • an apoptosis assay was used with the miRNA inhibitor library.
  • telomeres In addition to using phenotypic assays to identify miRNAs that influence gross cellular processes or cellular pathways, collections of synthetic miRNAs and/or miRNA inhibitors can be used to identify miRNAs that directly regulate the expression of a gene.
  • a plasmid was created that had a luciferase gene immediately upstream of the 3′UTR of the G6PD gene.
  • A549 cells were co-transfected with the reporter vector and eighteen different synthetic miRNAs. 24 hours post-transfection, luciferase activity in the various cell populations was measured.
  • the miR-1-2 significantly reduced the expression of the luciferase/G6PD gene, indicating that this family of miRNAs regulates the expression of the G6PD gene.
  • Similar experiments can be used to identify miRNAs that regulate the expression of such important genes as p53, BRCA1 and BRCA2, RAS, MYC, BCL-2, and others.
  • NAT tumor and normal adjacent tissue
  • Confirming miRNA target site predictions can be done in a variety of ways.
  • Drosophila and C. elegans genetic approaches have been applied wherein mutations in the miRNA and the putative miRNA target site(s) are made and shown to result in similar phenotypes (Ha et al., 1996; Vella et al., 2004).
  • reporter constructs have been used to show that the 3′ UTRs of putative target genes are regulated in cells at levels that are disproportionate to reporter vector controls that contain mutations in the putative miRNA binding sites (Lewis et al. 2003).
  • vectors and oligonucleotides have been used to introduce or inhibit miRNAs in cells to determine the effects on endogenous levels of putative target genes (Lewis et al., 2003; Kiriakidou et al. 2004). The latter approach has been undertaken to validate the miRNA target site predictions.
  • Synthetic miRNAs and miRNA inhibitors have been developed that can be transfected into mammalian cells to either introduce miRNAs into cells or inhibit the activity of miRNAs in cells, respectively. See USN 60/627,171, which is hereby incorporated by reference. A synthetic miRNA and a miRNA inhibitor corresponding to let-7b were used to determine if the target site predictions were correct. In these experiments, cultured cells that express undetectable levels of the miRNA were transfected with the synthetic miRNA using siPORTTM NeoFXTM Transfection Agent (Ambion). Immunofluorescence assays were used to RAS and C-MYC in the transfected cells.
  • the proteins from both oncogenes were expressed at almost three-fold lower levels in cells transfected with the synthetic miRNA than cells transfected with a Negative Control miRNA (Ambion).
  • cells that naturally express high levels of the miRNA were transfected with the let-7 miRNA inhibitor.
  • the proteins from both oncogenes were higher in cells transfected with the miRNA inhibitor than in cells transfected with the Negative Control inhibitor (Ambion).
  • Systemic lupus erythematosus (SLE; Lupus) is a chronic inflammatory auto-immune disease that ultimately leads to immune complex-mediated end-organ failure. It is characterized by an over activation of CD4+ T helper cells and repression of CD8+ T cytotoxic activity, leading to an overproduction of natural antibodies and pathogenic autoantibodies. Recently several histone modifications were reported in peripheral blood mononuclear cells (PBMCs) isolated from lupus patients. Diagnosis of lupus is still frequently incorrect mainly because the symptoms vary so widely and they come and go frequently, and because the disease mimics so many other disorders. Furthermore, diagnosis does not indicate the particular therapy to be used. In the absence of a cure, present-day treatment of lupus is still primarily tailored to symptomatic relief and not to the diagnosis. A diagnostic assay with high specificity and sensitivity would be very important.
  • PBMCs peripheral blood mononuclear cells
  • RNA samples were analyzed from 16 individuals, 8 with clinically verified lupus and 8 non-lupus patients that were age- and gender-matched with the lupus patients.
  • Total RNA from these samples was isolated using the glass fiber filter method described above. The total RNA was fractionated by tube electrophoresis to recover the miRNAs.
  • the miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above.
  • the labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above.
  • the signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the lupus and normal sample signals were compared to identify differentially expressed miRNAs. Each array experiment included duplicate arrays.
  • miRNAs were differentially expressed in all of the lupus samples relative to the matched samples.
  • miR-301, miR-199, miR-95, miR-105, mu-miR-290, miR-215, miR-188, miR-186, miR-211, miR-331, and miR-137 were expressed at 50% or less in the lupus samples than the corresponding normal samples.
  • miR-21, miR-223, and miR-342 were expressed at 50% or greater in the lupus samples than the corresponding normal samples.
  • Several of the miRNAs were differentially expressed by as much as ten-fold between the lupus and normal samples. These miRNAs represent targets for diagnostic assay of therapeutic development.
  • Novel infectious particles termed prions, composed largely and perhaps solely of a single protein, are the likely causative agents of a group of transmissible spongiform encephalopathies that produce lethal decline of cognitive and motor function.
  • Evidence indicates that the responsible protein arrives at a pathogenic state by misfolding from a normal form that has ubiquitous tissue distribution.
  • One model system comprises two cell lines, one of which is susceptible to prion formation and one that is not.
  • the second model system involves cells before and after they have been infected with prions.
  • Total RNA from prion-sensitive cells, prion-insensitive cells, and prion-infected cells was isolated using the glass fiber filter method described above.
  • the total RNA was fractionated by tube electrophoresis to recover the miRNAs.
  • the miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above.
  • the labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above.
  • the signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the signal from each of the samples was compared to identify differentially expressed miRNAs.
  • miRNAs were significantly up- or down-regulated in both prion-sensitive and prion-infected cells relative to prion resistant, uninfected cells. Arrays on multiple biological replicates for both model systems have confirmed these results. Based on their expression profiles, miR-95, 135a, 7, 9, 27a, 130a, 16, 26a, and 24 likely are involved directly or indirectly in prion infection and might represent diagnostic or therapeutic targets for prion disease.
  • Stroke is a major cause of death and permanent disability in humans. They occur when blood flow to a region of the brain is obstructed and may result in death of brain tissue. There are two main types of stroke: ischemic and hemorrhagic. Ischemic stroke is caused by blockage in an artery that supplies blood to the brain, resulting in a deficiency in blood flow (ischemia). Hemorrhagic stroke is caused by the bleeding of ruptured blood vessels (hemorrhage) in the brain. Understanding miRNAs involved in stroke might enhance detection and/or treatment.
  • mice are “preconditioned” by reducing oxygen flow to the brain (Kitagawa 1991). An equivalent set of six mice were used; three were preconditioned and three were untreated. 24 hours after pre-conditioning, the mice were sacrificed. Total RNA from these samples was isolated using the glass fiber filter method described above. The total RNA was fractionated by tube electrophoresis to recover the miRNAs. The miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above. The labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above. The signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the preconditioned and normal sample signals were compared to identify differentially expressed miRNAs.
  • GenePix 4000B Scanner Axon
  • a hallmark of cancer is uncontrolled cell proliferation; cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis. A cell proliferation assay was used in conjunction with the miRNA inhibitor library to identify miRNAs that influence cell proliferation.
  • HeLa (human ovarian cancer) and A549 (human lung cancer) cells were transfected in triplicate with 150 synthetic miRNAs using siPORT NeoFX (Ambion) according to the manufacturer's instructions.
  • the 150 are as follows: Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, mir-1, mir-7, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-18, mir-19a, mir-17-3p, mir-20, mir-21, mir-22, mir-23a, mir-23b, mir-24, mir-25, mir-26a, mir-27a, mir-28, mir-29a, mir-31, mir-32, mir-30a-3p, mir-34a, mir-92, mir-95, mir-96, mir-98, mir-99a, mir-100, mir-101, mir-103, mir-105, mir-107, mir-108, mir-122, mir-124, mir-125a, mir-125b, mir-126, mir-128, mir-129, mir-
  • the synthetic miRNAs were double stranded nucleic acid molecules composed of an active strand and a complementary strand.
  • the active strand contained a sequence that was identical to the corresponding mature miRNA.
  • the complementary strand contained a sequence that was 100% complementary to the relevant region of the mature miRNA sequence, but 1) lacking two nucleotides on its 3′ end that were complementary to the mature miRNA sequence (at the 5′ end of the active strand) and 2) having a dinucleotide overhang on its 5′ end with respect to the active strand.
  • the two strands were fully complementary to the other's sequence except that each strand has a dinucleotide 5′ overhang with respect to the other strand.
  • the same kind of synthetic miRNAs were used for Examples 17-20 as well. Any exceptions are described below.
  • the miRNAs indicated in the tables identify the miRNA that corresponds to the provided synthetic sequence.
  • Jurkat cells human leukemia cell
  • primary human T-cells in triplicate were electroporated with the same set of synthetic miRNAs using siPorter-96 (Ambion) according to the manufacturer's instruction. All cells were analyzed for viable and non-viable cells 72 hours post-transfection using the PCA-96 (Guava) with the Viacount Assay.
  • Viable cell number is the number of live cells in a well at the point of the assay. The numbers provided in the tables below are equal to the average number of viable cells in wells transfected with a particular miRNA divided by the number of viable cells in wells transfected with negative control synthetic miRNAs multiplied by 100 to yield the % Cell Viability of miRNA-transfected cells relative to negative control transfected cells.
  • the sequence of miRNA-325 is 5′-ccuaguagguguguccaguaagugu-3′ (SEQ ID NO:807).
  • miRNAs that affect one cell type often fail to affect other cell types. This is likely due to the fact that the cellular processes that are active vary between different cell types. This can be vitally important when considering the potential of miRNA-based therapeutics. Abnormal (disease) cells are different from normal cells owing to the fact that different cellular processes are active in the two cell types. Identifying miRNAs that have differential effects on normal and abnormal cells would be ideal since they could be delivered globally and expected to have an effect on only disease cells.
  • let-7a, let-7b, and miR-10b all significantly reduce the percentage of viable cells in the leukemia cells while essentially having no effect on the corresponding normal T-cells. These miRNAs are candidates for leukemia drugs.
  • Ras-family of membrane associated GTPases transmit signals into the interior of the cell by the activation of a number of cytosolic signal transduction pathways such as the Raf>MEK>ERK MAP kinase signaling pathway. Disregulation of the Ras/Raf/MEK/ERK pathway plays a major role in cancer pathogenesis (Meijer).
  • HeLa cells were transfected in a 96-well plate format with 150 different synthetic miRNAs. Prior to transfection, the HeLa cells were trypsinized to remove adherent cells and diluted in normal growth medium to 10 5 cells/mL. 0.5 of siPort NeoFX in 9.5 ⁇ l of Optimem I medium was added to the cells and incubated for 10 minutes at room temp (10 ⁇ L for each sample). miRNAs were rehydrated with 10 ⁇ l of diluted siPORT NeoFX. The samples were incubated at 37° C. and then the transfected samples were evaluated 72 hours after transfection.
  • the controls for ERK activation were performed by depriving the wells of a phosphate source for detection of ERK phosphorylation. 100 ⁇ l of serum-free media (DMEM) to 37° C. was added per well and the cells were incubated for 4 hours at 37° C. to attain basal phosphorylation levels. For the positive control wells, serum-free media was aspirated from wells and 100 ⁇ L of 100 ng/mL EGF was added before incubating the cells for 7.5 minutes at 37° C.
  • DMEM serum-free media
  • the wells were washed three times with 1 ⁇ PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer.
  • the fluorescently labeled secondary antibody was diluted in Odyssey Blocking Buffer (Goat anti-rabbit Alexa Fluor 680 (1:200 dilution; Molecular Probes) Goat anti-mouse IRDye 800CW (1:800 diution; Rockland Immunochemicals)).
  • the antibody solutions were mixed well and 50 ⁇ L of the secondary antibody solution was added to each well.
  • the antibody solution was incubated for 60 minutes with gentle shaking at room temp.
  • the plate was washed three times with 1 ⁇ PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer.
  • Apoptosis is a natural cellular process that helps control cancer by inducing death in cells with oncogenic potential. Many oncogenes function by altering induction of apoptosis.
  • an apoptosis assay was used with the miRNA inhibitor library.
  • HeLa cells (8000 cells/well of 96 well plate) were transfected in triplicate with more than 150 synthetic miRNAs (described above) (3 pmoles) using Ambion siPORTTM NeoFXTM. The media was changed 24 hrs after transfection and cells were processed 72 hrs after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at ⁇ 80° C. 2) Cells were lysed by adding 40 ⁇ l of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4° C.
  • cold lysis buffer 50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA
  • miRNAs that affect apoptosis are listed in the table below. These miRNAs apparently regulate pathways that lead to apoptosis. Mis-regulation of these miRNAs could induce cells to undergo apoptosis or might keep the cells from undergoing apoptosis. Introducing or inhibiting these miRNAs in cancer (or other disease) cells that have overcome apoptotic signaling pathways or Parkinson's (or other disease) cells that have prematurely induced apoptosis could be used to treat the diseases.
  • Telomerase is a complex of proteins and RNA that maintains the ends of chromosomes by appending telomeres. With rare exceptions, terminally differentiated cells lack active telomerase. One of the exceptions is cancer cells. More than 90% of human cancer samples have active telomerase (reviewed in Dong et al. 2005).
  • the hTert gene encodes the catalytic domain of telomerase. The expression of hTert correlates with telomerase activity in cells making it a good surrogate for telomerase activity.
  • An RT-PCR based assay for monitoring hTert mRNA expression in telomerase negative cells has been developed and used to identify miRNAs that participate in the regulation of telomerase. The miRNAs that regulate telomerase activity represent intervention points for cancer therapeutics.
  • BJ cells are normal human foreskin fibroblasts that lack hTert mRNA and telomerase activity. BJ cells were trypsinized and diluted to 13,000 cells/ml in normal growth media. 0.3 of lipofectamine 2000 agent was diluted into 40 ⁇ l of OPTI-MEM and incubated for five minutes. The diluted transfection reagent was added to the wells of 96-well plates that contained 150 synthetic miRNAs (as described above) as well as two different negative control synthetic miRNAs. Each well housed a different synthetic miRNA. The synthetic miRNAs and transfection agent were incubated for 15 minutes at room temperature and then 200 ⁇ l (2,600 cells) were added on top of the lipid/miRNA complex.
  • Real time PCR reactions were assembled to quantify hTert mRNA and 18S rRNA in each of the samples. Nuclease-free water, 10 ⁇ Complete PCR buffer/SYBR, 25 mM MgCl2, 2.5 mM dNTPs, 50 ⁇ ROX, 18S- or hTert-specific primers (for & rev mix 3 uM), cDNA from the various samples, and Super taq polymerase into a PCR tube. The reaction was heated to 95° C. for 5 minutes and then subjected to 40 cycles of 95° C. for 15 seconds, 60° C. for 30 seconds, 72° C. for 30 seconds. The amplification products were monitored using the ABI 7600 (Applied Biosystems).
  • BJ cells ordinarily fail to yield amplification products with the hTert primers.
  • Those miRNA-transfected samples that yielded a hTert PCR product were also analyzed for 18S rRNA lavels to ensure that there were not significantlyt more cells in the samples that might have contributed to the amount of hTert in the samples.
  • the hTert mRNA was detected in duplicate transfections of each of the miRNAs listed below. These miRNAs presumably affect pathways that regulate the expression of the hTert gene. Over-expression of any of these miRNAs might contribute to cancer by activating telomerase. Regulating the activities of these miRNAs in cancer cells could limit their transformation and overcome oncogenesis.
  • the adult human body consists of about 50-100 trillion cells. Each day, several billion of these cells divide in two to replace the billions of cells that die and are removed. In the course of an average lifetime, this adds up to an astronomical number of cell divisions, most of which go perfectly well. Errors do occur, however, and if they are not corrected they may lead to cancer. Cell growth and division are normally controlled by an intricate system of checks and balances. But occasionally a cell will start to proliferate wildly, dividing again and again and defying all normal restraints on its growth. That is the beginning of most common forms of cancer.
  • the inventors transfected 4,000 BJ cells/well in triplicate with 46 synthetic miRNAs using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
  • Cell proliferation assays were used in conjunction with our synthetic miRNA library to identify miRNAs that influence cell proliferation in a broad range of cells, including those from lung, breast, prostate, skin, cervix, T-cell, and foreskin tissues.
  • Cervical (HeLa), lung (A549, CRL-5826, and HTB-57), breast (MCF12A and BT549), prostate (22Rv1), T-cells (Jurkat and primary normal), and skin (TE354T, TE353SK, and BJ) cells were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library.
  • each cell type was transfected with 5 picomoles of each of the miRNAs in the synthetic miRNA library using siPORTTM NeoFXTM (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate.
  • the Jurkats and primary T-cells were mixed at a rate of approximately 50,000 cells/well with 500 picomoles of each of the synthetic miRNAs.
  • the media was changed 24 hrs after transfection. 72 hours post-transfection, cell number was estimated by one of three methods:
  • FIG. 15A-C are synthetic miRNAs that significantly reduced the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.
  • miRNAs significantly reduced cell proliferation for at least four different cell types. These miRNAs (presented in ranked order in the table below) are provided below and can be implemented in methods and compositions of the invention.
  • a cell proliferation assay was used in conjunction with our synthetic miRNA library to identify miRNAs that influence cell proliferation in a broad range of cells, including those from lung, breast, prostate, skin, cervix, T-cell, and foreskin tissues.
  • MCF12A breast (MCF12A), prostate (22Rv1), lung (A549), and skin (TE354T) cells were transfected in triplicate with each of the more than 150 miRNA inhibitors in our library.
  • Each cell type was transfected with 10 picomoles of each of the miRNA inhibitors in the library using siPORTTM NeoFXTM (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate. 72 hours post-transfection, cell number was estimated by one of three methods:
  • miRNAs whose inhibition significantly reduced the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.
  • miRNA inhibitors that significantly increase the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.
  • cancer initiates with the immortalization and transformation of a single cell which then divides repeatedly to form a tumor.
  • Compounds that reduce the viability of disease cells are used routinely to treat patients with cancer and other diseases.
  • each cell type was transfected with 5 picomoles of each of the miRNAs in the synthetic miRNA library using siPORTTM NeoFXTM (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate.
  • the Jurkats and primary T-cells were mixed at a rate of approximately 50,000 cells/well with 500 picomoles of each of the synthetic miRNAs.
  • the media was changed 24 hrs after transfection. 72 hours post-transfection, cell viability was estimated by one of two methods:
  • FIG. 19 Presented in FIG. 19 are synthetic miRNAs that significantly decrease or increase viability in the various cell types that were analyzed.
  • an apoptosis assay was used with the miRNA inhibitor library.
  • Approximately 8000 cervical (HeLa), prostate (22Rv1), T-cell (Jurkat), and skin (TE354T) cells per well were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library using siPORTTM NeoFXTM (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at ⁇ 80° C.
  • FDA substrate 0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile
  • dilution buffer 40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc.
  • miRNAs As seen in FIG. 20 , many different miRNAs were able to increase or decrease apoptosis in the four cell types that were analyzed. A few miRNAs (miR-126, miR-26a, miR-1, miR-149, and let-7g) affected apoptosis in multiple cell types suggesting that they regulate apoptosis via genes that are common in multiple cell types.
  • Transformation is necessary for tumor formation as it overcomes the cell's natural response to stop dividing when placed in a crowded environment.
  • a transformation assay featuring NIH3T3 cells was used with the synthetic miRNA library.
  • NIH 3T3 cells are used in transformation assays as they lack the capacity to form colonies when plated in soft agar. Modulation of cell processes that inhibit transformation can be readily detected because they induce NIH3T3 cells to begin forming colonies when plated in soft agar.
  • NIH 3T3 cells were transfected in duplicate with each of the more than 150 synthetic miRNAs in our library using siPORTTM NeoFXTM (Ambion). Media was changed after 24 hrs and the cells were transferred to 24-well dishes containing soft agar. The soft agar limits mobility and ensures that sister cells must remain in contact following cell division. Close contact with other cells typically induces the NIH 3T3 cells to stop dividing. The total number of cells in each well was measured by taking an absorbance reading at 495 nm. The absorbance reading for each well was divided by the average absorbance reading for cells transfected with negative control miRNAs and multiplied by 100 to get the percent change in transformation.
  • Approximately 8000 cervical (HeLa) and lung (A549, HTB-57, and CRL-5826) cells per well were transfected in triplicate with synthetic miRNAs from our library using siPORTTM NeoFXTM (Ambion). Media was changed after 24 hrs and etoposide and TRAIL were introduced at a final concentration of approximately 25 ⁇ M after 48 hours. The cells were visually inspected under a microscope to qualitatively inspect cell death 64 hours after transfection.
  • the cells treated with etoposide were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at ⁇ 80° C. 2) Cells were lysed by adding 40 ⁇ l of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4° C. 3) Add 160 ⁇ l ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 ⁇ M DEVDafc substrate.
  • cold lysis buffer 50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA
  • the cells treated with TRAIL were assessed for cell viability by adding alamar blue each well and analyzing fluorescence using a plate reader.
  • Alamar blue is a substrate for a metabolic enzyme in cells and the reaction product is fluorescent.
  • the fluorescence in each well correlates with the total number of cells in each well.
  • each miRNA on the treatments was measured by dividing the caspase 3 or alamar blue reading of the cells transfected with miRNAs and treated with TRAIL or etoposide by the same readings for cells that were only transfected with the miRNAs.
  • the change in caspase 3 activity or alamar blue staining for each miRNA was then divided by the differences observed for two negative control miRNAs and multiplied by 100 to calculate the relative effect induced by the combination of each miRNA and the therapeutic compound. These values are listed as % NC in Figure G.
  • a number of miRNAs significantly increased the capacity of the two therapeutic compounds to induce cell death in the cancer cells that were treated.
  • mir-292-3p, mir-132, mir-124, and mir-28 all worked extremely well in combination with both TRAIL and etoposide.
  • the adult human body consists of about 50-100 trillion cells. Each day, several billion of these cells divide in two to replace the billions of cells that die and are removed. In the course of an average lifetime, this adds up to an astronomical number of cell divisions, most of which go perfectly well. Errors do occur, however, and if they are not corrected they may lead to cancer. Cell growth and division are normally controlled by an intricate system of checks and balances. But occasionally a cell will start to proliferate wildly, dividing again and again and defying all normal restraints on its growth. That is the beginning of most common forms of cancer.
  • HeLa and 4000 skin (BJ) cells were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library.
  • HeLa cells were transfected using siPORTTM NeoFXTM (Ambion) and BJ cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
  • 24 hours post-transfection half of the cells from each well were removed to fresh medium.
  • 72 hrs post-transfection the cells were fixed with 4% paraformaldehyde at a final concentration of 2%. The fixed cells were stained with propidium iodide (TTP LabTech protocol) and assessed using the TTP LabTech cell scanner.
  • TTP LabTech protocol propidium iodide
  • Propidium iodide stains DNA and the relative DNA content in a cell corresponds with its position in the cell cycle.
  • the cell scanner measured propidium iodide staining in each cell and assigned its position in the cell cycle.
  • the percentage of cells in each stage of cell cycle was calculated and compared to cells transfected with negative control synthetic miRNAs.
  • the relative change in cells in each stage was calculated for each miRNA that was used.
  • Those synthetic miRNAs that induced a significant shift toward or away from a specific stage of cell cycle are listed below. These represent miRNAs that regulate key points in the cell cycle and offer key intervention points for cancer-related therapeutic development.
  • Ras-family of membrane associated GTPases transmit signals into the interior of the cell by the activation of a number of cytosolic signal transduction pathways such as the Raf>MEK>ERK MAP kinase signaling pathway.
  • Disregulation of the Ras/Raf/MEK/ERK pathway plays a major role in cancer pathogenesis (reviewed in Meijer et al.).
  • HeLa cells were transfected in a 96-well plate format with 160 different synthetic miRNAs. Prior to transfection, the HeLa cells were trypsinized to remove adherent cells and diluted in normal growth medium to 10 5 cells/mL. 0.5 ⁇ l of siPort NeoFX in 9.5 ⁇ l of Optimem I medium was added to the cells and incubated for 10 minutes at room temp (10 ⁇ L for each sample). miRNAs were rehydrated with 10 ⁇ l of diluted siPORT NeoFX. The samples were incubated at 37° C. and then the transfected samples were evaluated 72 hours after transfection.
  • the controls for ERK activation were performed by depriving the wells of a phosphate source for detection of ERK phosphorylation. 100 ⁇ l of serum-free media (DMEM) to 37° C. was added per well and the cells were incubated for 4 hours at 37° C. to attain basal phosphorylation levels. For the positive control wells, serum-free media was aspirated from wells and 100 ⁇ L of 100 ng/mL EGF was added before incubating the cells for 7.5 minutes at 37° C.
  • DMEM serum-free media
  • the wells were washed three times with 1 ⁇ PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer.
  • the fluorescently labeled secondary antibody was diluted in Odyssey Blocking Buffer (Goat anti-rabbit Alexa Fluor 680 (1:200 dilution; Molecular Probes) Goat anti-mouse IRDye 800CW (1:800 diution; Rockland Immunochemicals)).
  • the antibody solutions were mixed well and 50 ⁇ L of the secondary antibody solution was added to each well.
  • the antibody solution was incubated for 60 minutes with gentle shaking at room temp.
  • the plate was washed three times with 1 ⁇ PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. After a final wash, wash solution was completely removed from wells.
  • the plates were scanned with the Odyssey Infrared Imaging System (700 nm detection for Alexa Fluor 680 antibody and 800 nm detection for IRDye 800CW antibody
  • Telomerase is a complex of proteins and RNA that maintains the ends of chromosomes by appending telomeres. With rare exceptions, terminally differentiated cells lack active telomerase. One of the exceptions is cancer cells. More than 90% of human cancer samples have active telomerase (reviewed in Dong et al., 2005).
  • the hTert gene encodes the catalytic domain of telomerase. The expression of hTert correlates with telomerase activity in cells making it a good surrogate for telomerase activity.
  • BJ cells are normal foreskin fibroblasts that lack hTert mRNA and telomerase activity. BJ cells were trypsinized and diluted to 13,000 cells/ml in normal growth media. 0.3 ⁇ l of lipofectamine 2000 agent was diluted into 40 ⁇ l of OPTI-MEM and incubated for five minutes. The diluted transfection reagent was added to the wells of 96-well plates that contained 151 synthetic miRNAs as well as two different negative control synthetic miRNAs. Each well housed a different synthetic miRNA. The synthetic miRNAs and transfection agent were incubated for 15 minutes at room temperature and then 200 ⁇ l (2,600 cells) were added on top of the lipid/miRNA complex.
  • Real time PCR reactions were assembled to quantify hTert mRNA and 18S rRNA in each of the samples.
  • Nuclease-free water, 10 ⁇ Complete PCR buffer/SYBR, 25 mM MgCl2, 2.5 mM dNTPs, 50 ⁇ ROX, 18S- or hTert-specific primers (for & rev mix 3 ⁇ M), cDNA from the various samples, and Super taq polymerase were placed into a PCR tube. The reaction was heated to 95° C. for 5 minutes and then subjected to 40 cycles of 95° C. for 15 seconds, 60° C. for 30 seconds, 72° C. for 30 seconds. The amplification products were monitored using the ABI 7600 (Applied Biosystems).
  • BJ cells ordinarily fail to yield amplification products with the hTert primers.
  • Those miRNA-transfected samples that yielded a hTert PCR product were also analyzed for 18S rRNA levels to ensure that there were not significantly more cells in the samples that might have contributed to the amount of hTert in the samples.
  • the hTert mRNA was detected in duplicate transfections of each of the miRNAs listed below. These miRNAs presumably affect pathways that regulate the expression of the hTert gene. Over-expression of any of these miRNAs might contribute to cancer by activating telomerase. Regulating the activities of these miRNAs in cancer cells could limit their transformation and overcome oncogenesis.
  • telomerase activity screen was repeated using a series of siRNAs targeting kinases, phosphatases, GPCRs, transcription factors, and assorted other genes. Targeting the genes below with siRNAs resulted in increased hTert expression. Interestingly, many of these genes are predicted to be targets for the miRNAs that we found to be hTert regulators (see table below).
  • let-7a is a member of the let-7 gene family, which includes 7 unique genes within the human genome.
  • the let-7 genes encode miRNAs that vary by as little as a single nucleotide and as many as four nucleotides.
  • Inflammation is the body's natural protective response to an injury or infection. It is designed to hyper-stimulate biological pathways that initiate tissue repair or attack invading pathogens. This response is a delicate balance of both pro- and anti-inflammatory genes and their proteins. If the inflammatory response is maintained too long it can lead to tissue destruction, organ failure or inflammatory diseases such as Rheumatoid arthritis, Psoriasis, Asthma, Inflammatory bowel disease (Crohn's disease and related conditions), Multiple Sclerosis, coronary obstructive pulmonary disease (COPD), Allergic rhinitis (hay fever), and Cardiovascular disease.
  • Stat3 is the subject of intense scientific investigation, because it's known to be an important transcription factor that turns on genes required for the cell division, induction and suppression of apoptosis, and cell motility.
  • Many STAT3 target genes are known, including those encoding the anti-apoptotic proteins Bcl-xl, Mcl-1, and Bcl-2, the proliferation-associated proteins Cyclin D1 and Myc, and the pro-angiogenic factor VEGF.
  • the inflammatory disease psoriasis is characterized by lesions, which contain epidermal keratinocytes that express high levels of activated Stat3.
  • Stat3 has also recently been discovered to play an important role as an anti-inflammatory regulator.
  • mice In normal mice, the immune system is initially upregulated in response to bacterial protein challenge creating systemic inflammation followed by down regulation of the initiating factors.
  • Mice with a deletional mutation for Stat3-beta lacked the ability to down regulate the initial inflammatory reaction after bacterial protein challenge which lead to irreversible damage to the animals' own tissues and finally to animal death.
  • a stat3 response assay was used to identify miRNAs that regulate cellular inflammatory response.
  • the stable Stat3-luciferase reporter cell line from Panomics which contains a chromosomal integration of a luciferase reporter construct regulated by 3 copies of the Stat1 response element was used for this purpose.
  • the chemical agent Phorbol-12-myristate 13 acetate (PMA) is known to induce an inflammatory response in exposed cells and was used to stimulate inflammation in this experiment. These cells were transfected in triplicate with each of the more than 206 synthetic miRNAs in our library using siPORTTM NeoFXTM (Ambion) at a plating density of approximately 6000 cells/well of 96 well plate.
  • the media was changed 24 h post transfection and exposed to 100 nM PMA for 6 hours starting at 67 hours post transfection.
  • the cells were assayed for changes in total cell number by alamarBlue as previously described and finally harvested at 72 hours post initial transfection.
  • a luciferase assay was performed on all sample lysates to measure Stat3 responsiveness to the procedure.
  • the data was normalized to total cell number using the alamar Blue data and compared to cells transfected with a negative control miRNA that underwent the same procedure.
  • compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods, and in the steps or in the sequence of steps of the methods, described herein without departing from the concept, spirit, and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Abstract

The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a continuation of U.S. application Ser. No. 14/712,591, filed May 14, 2015, which is a continuation of U.S. application Ser. No. 13/887,008, filed May 3, 2013, which is a continuation of U.S. application Ser. No. 13/299,255, filed Nov. 17, 2011, now issued as U.S. Pat. No. 8,946,177 on Feb. 3, 2015, which is a division of U.S. application Ser. No. 11/273,640, filed Nov. 14, 2005, now issued as U.S. Pat. No. 8,173,611 on May 8, 2012, which claims the benefit of priority to U.S. Provisional Patent Application No. 60/683,736, filed on May 23, 2005, U.S. Provisional Patent Application No. 60/649,634, filed on Feb. 3, 2005, and U.S. Provisional Patent Application No. 60/627,171, filed on Nov. 12, 2004, all of which are hereby incorporated by reference in their entireties.
  • INCORPORATION BY REFERENCE OF SEQUENCE LISTING
  • The present application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created Sep. 12, 2012, is named “48436701311.txt” and is 180,224 bytes in size.
  • BACKGROUND OF THE INVENTION
  • 1. Field of the Invention
  • The present invention relates generally to the field of molecular biology. More particularly, it concerns methods and compositions involving nucleic acid molecules that simulate microRNA (miRNAs) and that inhibit miRNAs. Methods and compositions involving synthetic miRNAs and miRNA inhibitor molecules are described. In addition, methods and compositions for identifying miRNAs that contribute to cellular processes are also described. In addition, the identification of miRNAs that contribute to cellular processes provides targets for therapeutic intervention as well as diagnostic and/or prognostic analysis.
  • 2. Description of the Related Art
  • In 2001, several groups used a novel cloning method to isolate and identify a large group of “microRNAs” (miRNAs) from C. elegans, Drosophila, and humans (Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001). Several hundreds of miRNAs have been identified in plants and animals—including humans—which do not appear to have endogenous siRNAs. Thus, while similar to siRNAs, miRNAs are nonetheless distinct.
  • miRNAs thus far observed have been approximately 21-22 nucleotides in length and they arise from longer precursors, which are transcribed from non-protein-encoding genes. See review of Carrington et al. (2003). The precursors form structures that fold back on each other in self-complementary regions; they are then processed by the nuclease Dicer in animals or DCL1 in plants. miRNA molecules interrupt translation through precise or imprecise base-pairing with their targets.
  • miRNAs seem to be involved in gene regulation. Some miRNAs, including lin-4 and let-7, inhibit protein synthesis by binding to partially complementary 3′ untranslated regions (3′ UTRs) of target mRNAs. Others, including the Scarecrow miRNA found in plants, function like siRNA and bind to perfectly complementary mRNA sequences to destroy the target transcript (Grishok et al., 2001).
  • Research on microRNAs is increasing as scientists are beginning to appreciate the broad role that these molecules play in the regulation of eukaryotic gene expression. The two best understood miRNAs, lin-4 and let-7, regulate developmental timing in C. elegans by regulating the translation of a family of key mRNAs (reviewed in Pasquinelli, 2002). Several hundred miRNAs have been identified in C. elegans, Drosophila, mouse, and humans. As would be expected for molecules that regulate gene expression, miRNA levels have been shown to vary between tissues and developmental states. In addition, one study shows a strong correlation between reduced expression of two miRNAs and chronic lymphocytic leukemia, providing a possible link between miRNAs and cancer (Calin, 2002). Although the field is still young, there is speculation that miRNAs could be as important as transcription factors in regulating gene expression in higher eukaryotes.
  • There are a few examples of miRNAs that play critical roles in cell differentiation, early development, and cellular processes like apoptosis and fat metabolism. lin-4 and let-7 both regulate passage from one larval state to another during C. elegans development (Ambros, 2003). mir-14 and bantam are drosophila miRNAs that regulate cell death, apparently by regulating the expression of genes involved in apoptosis (Brennecke et al., 2003, Xu et al., 2003). MiR14 has also been implicated in fat metabolism (Xu et al., 2003). Lsy-6 and miR-273 are C. elegans miRNAs that regulate asymmetry in chemosensory neurons (Chang et al., 2004). Another animal miRNA that regulates cell differentiation is miR-181, which guides hematopoietic cell differentiation (Chen et al., 2004). These molecules represent the full range of animal miRNAs with known functions. Enhanced understanding of the functions of miRNAs will undoubtedly reveal regulatory networks that contribute to normal development, differentiation, inter- and intra-cellular communication, cell cycle, angiogenesis, apoptosis, and many other cellular processes. Given their important roles in many biological functions, it is likely that miRNAs will offer important points for therapeutic intervention or diagnostic analysis.
  • Characterizing the functions of biomolecules like miRNAs often involves introducing the molecules into cells or removing the molecules from cells and measuring the result. If introducing a miRNA into cells results in apoptosis, then the miRNA undoubtedly participates in an apoptotic pathway. Methods for introducing and removing miRNAs from cells have been described. Two recent publications describe antisense molecules that can be used to inhibit the activity of specific miRNAs (Meister et al., 2004; Hutvagner et al., 2004). Another publication describes the use of plasmids that are transcribed by endogenous RNA polymerases and yield specific miRNAs when transfected into cells (Zeng et al., 2002). These two reagent sets have been used to evaluate single miRNAs.
  • A limitation of the plasmid-based miRNA expression system is that the transfection efficiencies for plasmids tend to be very low, with only approximately 50% of cells expressing RNA from the plasmid in cells that are easy to transfect. Transfection efficiencies for plasmids in primary cells are much lower, with fewer than 10% of cells typically expressing the desired RNA. Therefore, there is a need for alternative compositions and methods for introducing miRNA molecules into cells so that they can be characterized and studied.
  • SUMMARY OF THE INVENTION
  • The present invention is based on the inventors' studies regarding the introduction into cells of one or more nucleic acids that function like miRNA or inhibit the activities of one or more miRNAs in cells to characterize their roles in various biological processes. The invention concerns nucleic acids that perform the activities of endogenous miRNAs when introduced into cells. These nucleic acids are synthetic miRNA in some embodiments. The invention further concerns a library of synthetic miRNAs specific to a variety of known miRNAs that can be used to introduce sequentially or in combination one or more miRNAs into cells in vitro or in vivo for the purpose of identifying miRNAs that participate in cellular processes. The invention further involves a library of sequence-specific miRNA inhibitors that can be used to inhibit sequentially or in combination the activities of one or more miRNAs in cells. The two libraries of miRNA-specific reagents are used to introduce or eliminate specific miRNAs or combinations of miRNAs to define the roles of miRNAs in cells.
  • The term “miRNA” is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. See, e.g., Carrington et al., 2003, which is hereby incorporated by reference. The term will be used to refer to the single-stranded RNA molecule processed from a precursor. Individual miRNAs have been identified and sequenced in different organisms, and they have been given names. Names of miRNAs and their sequences are provided herein. Additionally, other miRNAs are known to those of skill in the art and can be readily implemented in embodiments of the invention. The methods and compositions should not be limited to miRNAs identified in the application, as they are provided as examples, not necessarily as limitations of the invention.
  • The present invention concerns, in some embodiments of the invention, short nucleic acid molecules that function as miRNAs or as inhibitors of miRNA in a cell. The term “short” refers to a length of a single polynucleotide that is 150 nucleotides or fewer. The nucleic acid molecules are synthetic. The term “synthetic” means the nucleic acid molecule is isolated and not identical in sequence (the entire sequence) and/or chemical structure to a naturally-occurring nucleic acid molecule, such as an endogenous precursor miRNA molecule. While in some embodiments, nucleic acids of the invention do not have an entire sequence that is identical to a sequence of a naturally-occurring nucleic acid, such molecules may encompass all or part of a naturally-occurring sequence. It is contemplated, however, that a synthetic nucleic acid administered to a cell may subsequently be modified or altered in the cell such that its structure or sequence is the same as non-synthetic or naturally occurring nucleic acid, such as a mature miRNA sequence. For example, a synthetic nucleic acid may have a sequence that differs from the sequence of a precursor miRNA, but that sequence may be altered once in a cell to be the same as an endogenous, processed miRNA. The term “isolated” means that the nucleic acid molecules of the invention are initially separated from different (in terms of sequence or structure) and unwanted nucleic acid molecules such that a population of isolated nucleic acids is at least about 90% homogenous, and may be at least about 95, 96, 97, 98, 99, or 100% homogenous with respect to other polynucleotide molecules. In many embodiments of the invention, a nucleic acid is isolated by virtue of it having been synthesized in vitro separate from endogenous nucleic acids in a cell. It will be understood, however, that isolated nucleic acids may be subsequently mixed or pooled together.
  • Of course, it is understood that a “synthetic nucleic acid” of the invention means that the nucleic acid does not have a chemical structure or sequence of a naturally occurring nucleic acid. Consequently, it will be understood that the term “synthetic miRNA” refers to a “synthetic nucleic acid” that functions in a cell or under physiological conditions as a naturally occurring miRNA.
  • While many of the embodiments of the invention involve synthetic miRNAs or synthetic nucleic acids, in some embodiments of the invention, the nucleic acid molecule(s) need not be “synthetic.” In certain embodiments, a non-synthetic miRNA employed in methods and compositions of the invention may have the entire sequence and structure of a naturally occurring miRNA precursor or the mature miRNA. For example, non-synthetic miRNAs used in methods and compositions of the invention may not have one or more modified nucleotides or nucleotide analogs. In these embodiments, the non-synthetic miRNA may or may not be recombinantly produced. In particular embodiments, the nucleic acid in methods and/or compositions of the invention is specifically a synthetic miRNA and not a non-synthetic miRNA (that is, not an miRNA that qualifies as “synthetic”); though in other embodiments, the invention specifically involves a non-synthetic miRNA and not a synthetic miRNA. Any embodiments discussed with respect to the use of synthetic miRNAs can be applied with respect to non-synthetic miRNAs, and vice versa.
  • It will be understood that the term “naturally occurring” refers to something found in an organism without any intervention by a person; it could refer to a naturally-occurring wildtype or mutant molecule. In some embodiments a synthetic miRNA molecule does not have the sequence of a naturally occurring miRNA molecule. In other embodiments, a synthetic miRNA molecule may have the sequence of a naturally occurring miRNA molecule, but the chemical structure of the molecule, particularly in the part unrelated specifically to the precise sequence (non-sequence chemical structure) differs from chemical structure of the naturally occurring miRNA molecule with that sequence. In some cases, the synthetic miRNA has both a sequence and non-sequence chemical structure that are not found in a naturally-occurring miRNA. Moreover, the sequence of the synthetic molecules will identify which miRNA is effectively being provided or inhibited; the endogenous miRNA will be referred to as the “corresponding miRNA.” Corresponding miRNA sequences that can be used in the context of the invention include, but are not limited to, those sequences in SEQ ID NOs: 1-593 and those miRNAs listed in the appendix. In addition synthetic nucleic acids of the invention may include SEQ ID NOs:594-703 as well as any other miRNA sequence, miRNA precursor sequence, or any sequence complementary thereof. In some embodiments, the sequence is or is derived from a probe sequence identified in the appendix to target the particular miRNA (or set of miRNAs) that can be used with that probe sequence.
  • Synthetic miRNA of the invention are RNA or RNA analogs in some embodiments of the invention. MiRNA inhibitors may be DNA or RNA, or analogs thereof. miRNA and miRNA inhibitors of the invention are collectively referred to as “synthetic nucleic acids.”
  • In some embodiments, there is a synthetic miRNA having a length of between 17 and 130 residues. The present invention concerns synthetic miRNA molecules that are, are at least, or are at most 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, or 130 residues in length, or any range derivable therein.
  • In certain embodiments, synthetic miRNA have a) an “miRNA region” whose sequence from 5′ to 3′ is identical to a mature miRNA sequence, and b) a “complementary region” whose sequence from 5′ to 3′ is between 60% and 100% complementary to the miRNA sequence. In certain embodiments, these synthetic miRNA are also isolated, as defined above. The term “miRNA region” refers to a region on the synthetic miRNA that is at least 90% identical to the entire sequence of a mature, naturally occurring miRNA sequence. In certain embodiments, the miRNA region is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% identical to the sequence of a naturally-occurring miRNA.
  • The term “complementary region” refers to a region of a synthetic miRNA that is or is at least 60% complementary to the mature, naturally occurring miRNA sequence that the miRNA region is identical to. The complementary region is or is at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein. With single polynucleotide sequences, there is a hairpin loop structure as a result of chemical bonding between the miRNA region and the complementary region. In other embodiments, the complementary region is on a different nucleic acid molecule than the miRNA region, in which case the complementary region is on the complementary strand and the miRNA region is on the active strand.
  • In other embodiments of the invention, there are synthetic nucleic acids that are miRNA inhibitors. An miRNA inhibitor is between about 17 to 25 nucleotides in length and comprises a 5′ to 3′ sequence that is at least 90% complementary to the 5′ to 3′ sequence of a mature miRNA. In certain embodiments, an miRNA inhibitor molecule is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range derivable therein. Moreover, an miRNA inhibitor has a sequence (from 5′ to 3′) that is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100% complementary, or any range derivable therein, to the 5′ to 3′ sequence of a mature miRNA, particularly a mature, naturally occurring miRNA. Probe sequences for miRNAs are disclosed in the appendix. While they have more sequence than an miRNA inhibitor, one of skill in the art could use that portion of the probe sequence that is complementary to the sequence of a mature miRNA as the sequence for an miRNA inhibitor. Table 1 indicates what the mature sequence of an miRNA is. Moreover, that portion of the probe sequence can be altered so that it is still 90% complementary to the sequence of a mature miRNA.
  • In some embodiments, of the invention, a synthetic miRNA contains one or more design elements. These design elements include, but are not limited to: i) a replacement group for the phosphate or hydroxyl of the nucleotide at the 5′ terminus of the complementary region; ii) one or more sugar modifications in the first or last 1 to 6 residues of the complementary region; or, iii) noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3′ end of the complementary region and the corresponding nucleotides of the miRNA region.
  • In certain embodiments, a synthetic miRNA has a nucleotide at its 5′ end of the complementary region in which the phosphate and/or hydroxyl group has been replaced with another chemical group (referred to as the “replacement design”). In some cases, the phosphate group is replaced, while in others, the hydroxyl group has been replaced. In particular embodiments, the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2′O-Me (2′ oxygen-methyl), DMTO (4,4′-dimethoxytrityl with oxygen), fluoroscein, a thiol, or acridine, though other replacement groups are well known to those of skill in the art and can be used as well. This design element can also be used with an miRNA inhibitor.
  • Additional embodiments concern a synthetic miRNA having one or more sugar modifications in the first or last 1 to 6 residues of the complementary region (referred to as the “sugar replacement design”). In certain cases, there is one or more sugar modifications in the first 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein. In additional cases, there is one or more sugar modifications in the last 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or any range derivable therein, have a sugar modification. It will be understood that the terms “first” and “last” are with respect to the order of residues from the 5′ end to the 3′ end of the region. In particular embodiments, the sugar modification is a 2′O-Me modification. In further embodiments, there is one or more sugar modifications in the first or last 2 to 4 residues of the complementary region or the first or last 4 to 6 residues of the complementary region. This design element can also be used with an miRNA inhibitor. Thus, an miRNA inhibitor can have this design element and/or a replacement group on the nucleotide at the 5′ terminus, as discussed above.
  • In other embodiments of the invention, there is a synthetic miRNA in which one or more nucleotides in the last 1 to 5 residues at the 3′ end of the complementary region are not complementary to the corresponding nucleotides of the miRNA region (“noncomplementarity”) (referred to as the “noncomplementarity design”). The noncomplementarity may be in the last 1, 2, 3, 4, and/or 5 residues of the complementary miRNA. In certain embodiments, there is noncomplementarity with at least 2 nucleotides in the complementary region.
  • It is contemplated that synthetic miRNA of the invention have one or more of the replacement, sugar modification, or noncomplementarity designs. In certain cases, synthetic RNA molecules have two of them, while in others these molecules have all three designs in place.
  • The miRNA region and the complementary region may be on the same or separate polynucleotides. In cases in which they are contained on or in the same polynucleotide, the miRNA molecule will be considered a single polynucleotide. In embodiments in which the different regions are on separate polynucleotides, the synthetic miRNA will be considered to be comprised of two polynucleotides.
  • When the RNA molecule is a single polynucleotide, there is a linker region between the miRNA region and the complementary region. In some embodiments, the single polynucleotide is capable of forming a hairpin loop structure as a result of bonding between the miRNA region and the complementary region. The linker constitutes the hairpin loop. It is contemplated that in some embodiments, the linker region is, is at least, or is at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 residues in length, or any range derivable therein. In certain embodiments, the linker is between 3 and 30 residues (inclusive) in length.
  • In addition to having an miRNA region and a complementary region, there may be flanking sequences as well at either the 5′ or 3′ end of the region. In some embodiments, there is or is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides or more, or any range derivable therein, flanking one or both sides of these regions.
  • The present invention also concerns a collection of synthetic nucleic acid molecules, referred to as a library. A collection may contain, contain at least or contain at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550 or more different types (by structure and/or sequence) of nucleic acids. Libraries may contain synthetic miRNAs and/or miRNA inhibitors.
  • Embodiments involving libraries and methods of using nucleic acids of the invention may be applied to miRNA and miRNA inhibitors. Thus, any embodiment discussed with respect to nucleic acids of the invention may generally be applicable to miRNA and miRNA inhibitor molecules, and vice versa. Moreover, embodiments discussed with respect to miRNA may be applied to miRNA inhibitors and vice versa.
  • The present invention also concerns methods of characterizing an miRNA activity or function in a cell. In some embodiments, a method comprises: a) introducing into one or more cells a synthetic miRNA molecule; and b) comparing one or more characteristics of cell(s) having the RNA molecule with cells in which the synthetic miRNA molecule has not been introduced. In certain embodiments, the cells with the synthetic miRNA may be compared to cells in which a different molecule was introduced (such as a negative control that does not include an miRNA region or has an miRNA region for a different miRNA). It is contemplated that the compared cells need not be evaluated at the same time. In fact, the comparison cells need not have been cultured at the same time; one may refer to a report or previous observation.
  • Other methods include reducing or eliminating activity of one or more miRNAs from a cell comprising: a) introducing into a cell an miRNA inhibitor. In certain embodiment, methods also include comparing one or more characteristics of a cell having the miRNA inhibitor with a cell not having the miRNA inhibitor.
  • The synthetic nucleic acids discussed above and herein can be used in methods of the invention. Thus, in certain embodiments, the methods involve synthetic nucleic acids with the different designs in them.
  • Characteristics of cells that may be evaluated are not limited. They include the following characteristics and characteristics associated with the following: cell proliferation, mitotic index, cell cycle, apoptosis, motility, adhesion, signal transduction, protein localization, gene expression, RNA localization, cell division, DNA replication, post-translational modification, differentiation, de-differentiation, transcriptional activation, protein activation, angiogenesis, metabolism (energy production and/or consumption), protein degradation, chromatin condensation, microtubule production, DNA replication, recombination, and DNA repair functions. It is contemplated that these characteristics may be relevant globally to the cell (for example, overall protein production reduced) or to individual species in the cell (for example, induction of a specific protein(s)).
  • It is contemplated that this method may be applied with respect to a variety of different synthetic and/or nonsynthetic miRNAs in separate or the same cells. In some cases, the following numbers of different synthetic miRNA molecules may be introduced into different cells: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300 or more, or any range derivable therein (or at least or at most these numbers). The invention is not limited by cell type. It is contemplated that any cell expressing miRNA or any cell having a characteristic altered by an miRNA is amenable to the methods and compositions of the invention. Use of two or more miRNAs may be combined in a single pharmaceutical composition as a cocktail or may be used in any therapeutic, diagnostic or prognostic method of the invention. It is contemplated that methods of the invention may involve, involve at least, or involve at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300 or more, or any range derivable therein, nucleic acid molecules corresponding to different miRNAs. Such nucleic acid molecules include synthetic miRNAs molecules, nonsynthetic miRNA molecules, and miRNA inhibitors.
  • In some embodiments, it may be useful to know whether a cell expresses a particular miRNA endogenously or whether such expression is affected under particular conditions or when it is in a particular disease state. Thus, in some embodiments of the invention, methods include assaying the cell for the presence of the miRNA that is effectively being introduced by the synthetic miRNA molecule or inhibited by an miRNA inhibitor. Consequently, in some embodiments, methods include a step of generating an miRNA profile for a sample. The term “miRNA profile” refers to a set of data regarding the expression pattern for a plurality of miRNAs in the sample; it is contemplated that the miRNA profile can be obtained using an miRNA array. In some embodiments of the invention, an miRNA profile is generated by steps that include: a) labeling miRNA in the sample; b) hybridizing the miRNA to an miRNA array; and, c) determining miRNA hybridization to the array, wherein an miRNA profile is generated. See U.S. Provisional Patent Application 60/575,743 and the U.S. Provisional Patent Application 60/649,584, and U.S. patent application Ser. No. 11/141,707, all of which are hereby incorporated by reference.
  • Additionally, a cell that is introduced with a synthetic miRNA or an miRNA inhibitor may be subsequently evaluated or assayed for the amount of endogenous or exogenous miRNA or miRNA inhibitor. Any cell type is contemplated for use with the invention. The cell may be from or in a mammal, such as a monkey, horse, cow, pig, sheep, dog, cat, rabbit, mouse, rat, or human.
  • In other methods of the invention, a step of synthesizing or obtaining the synthetic RNA molecule is included.
  • In additional embodiments, the synthetic nucleic acid is introduced into the cell by calcium phosphate transfection, lipid transfection, electroporation, microinjection, or injection. In addition, a cell may be in a subject, which may be a patient or an animal model. In this case, synthetic nucleic acids can be administered to the subject or patient using modes of administration that are well known to those of skill in the art, particularly for therapeutic applications. It is particularly contemplated that a patient is human or any other mammal or animal having miRNA.
  • The present invention also concerns inducing certain cellular characteristics by providing to a cell a particular nucleic acid, such as a specific synthetic miRNA molecule or a synthetic miRNA inhibitor molecule. However, in methods of the invention, the miRNA molecule or miRNA inhibitor need not be synthetic. They may have a sequence that is identical to a naturally occurring miRNA or they may not have any design modifications. In certain embodiments, the miRNA molecule and/or an miRNA inhibitor are synthetic, as discussed above.
  • The particular nucleic acid molecule provided to the cell is understood to correspond to a particular miRNA in the cell, and thus, the miRNA in the cell is referred to as the “corresponding miRNA.” In situations in which a named miRNA molecule is introduced into a cell, the corresponding miRNA will be understood to be the induced miRNA. It is contemplated, however, that the miRNA molecule provided introduced into a cell is not a mature miRNA but is capable of becoming a mature miRNA under the appropriate physiological conditions. In cases in which a particular corresponding miRNA is being inhibited by a miRNA inhibitor, the particular miRNA will be referred to as the targeted miRNA. It is contemplated that multiple corresponding miRNAs may be involved. In particular embodiments, more than one miRNA molecule is introduced into a cell. Moreover, in other embodiments, more than one miRNA inhibitor is introduced into a cell. Furthermore, a combination of miRNA molecule(s) and miRNA inhibitor(s) may be introduced into a cell.
  • Methods include identifying a cell or patient in need of inducing those cellular characteristics. Also, it will be understood that an amount of a synthetic nucleic acid that is provided to a cell or organism is an “effective amount,” which refers to an amount needed to achieve a desired goal, such as inducing a particular cellular characteristic(s).
  • In certain embodiments of the methods include providing or introducing to a cell a nucleic acid molecule corresponding to a mature miRNA in the cell in an amount effective to achieve a desired physiological result. Such methods are disclosed herein. Moreover, methods of the invention involve diagnosing a patient based on an miRNA expression profile. In certain embodiments, the elevation or reduction in the level of expression of a particular miRNA in a cell is correlated with a disease state compared to the expression level of that miRNA in a normal cell. This correlation allows for diagnostic methods to be carried out when that the expression level of an miRNA is measured in a biological sample being assessed and then compared to the expression level of a normal cell.
  • In these different methods, the corresponding miRNA involved in the method may be one or more of at least the following: Let 7a, let 7a-1, let 7b, let 7b-1, let-7c, let-7d, let 7g, miR-1, miR-1-d, miR-1-2, miR-9, miR-10a, miR-10b, miR-15a, miR-16, miR-17, miR-17-3p, miR-18, miR-19a, miR-20, miR-21, miR-22, miR-23, miR-23a, miR-23b, miR-24, miR-25, miR-26a, miR-27a, miR-28, miR-29a, miR-29b, miR-30a-3p, miR-30a, miR-30e-5p, miR-31, miR-32, miR-34a, miR-92, miR-93, miR-95, miR-96, miR-98, miR-99a, miR-100, miR-101, miR-105, miR-106, miR-107, miR-108, miR-122, miR-124, miR-125, miR-125b, miR-126, miR-127, miR-128, miR-129, miR-130, miR-130a, miR-133, miR-133a, miR-133a-2, miR-133b, miR-134, miR-135, miR-137, miR-138, miR-139, miR-140, miR-141, miR-142, miR-143, miR-145, miR-147, miR-148, miR-149, miR-150, miR-152, miR-153, miR-154, miR-155, miR-181, miR-182, miR-183, miR-184, miR-186, miR-187, miR-188, miR-190, miR-191, miR-192, miR-193, miR-194, miR-195, miR-196, miR-197, miR-198, miR-199, miR-199a-1, miR-200b, miR-201, miR-203, miR-204, miR-206, miR-207, miR-208, miR-210, miR-211, miR-212, miR-213, miR-214, miR-215, miR-216, miR-217, miR-218, miR-222, miR-223, miR-224, miR-291-3p, miR-292, miR-292-3p, miR-293, miR-294, miR-295, miR-296, miR-297, miR-298, miR-299, miR-320, miR-321, miR-322, miR-324, miR-325, miR-326, miR-328, miR-329, miR-330, miR-331, miR-333, miR-335, miR-337, miR-338, miR-340, miR-341, miR-342, miR-344, miR-345, miR-346, miR-350, miR-367, miR-368, miR-369, miR-370, miR-371, miR-373, miR-380-3p, miR-409, miR-410, or miR-412.
  • Moreover, methods can involve providing synthetic or nonsynthetic miRNA molecules. It is contemplated that in these embodiments, methods may or may not be limited to providing only one or more synthetic miRNA molecules or only on or more nonsynthetic miRNA molecules. Thus, in certain embodiments, methods may involve providing both synthetic and nonsynthetic miRNA molecules. In this situation, a cell or cells are most likely provided a synthetic miRNA molecule corresponding to a particular miRNA and a nonsynthetic miRNA molecule corresponding to a different miRNA. Furthermore, any method articulated a list of miRNAs using Markush group language may be articulated without the Markush group language and a disjunctive article (i.e., or) instead, and vice versa.
  • In some embodiments, there is a method for reducing or inhibiting cell proliferation in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves introducing into the cell an effective amount of i) an miRNA inhibitor molecule having a 5′ to 3′ sequence that is at least 90% complementary to the 5′ to 3′ sequence of a mature miRNA selected from the group consisting of: mir-31, mir-92, mir-99a, mir-100, mir-125a, mir-129, mir-130a, mir-150, mir-187, miR-190, miR-191, miR-193, miR 204, mir-210, mir-211, mir-212, mir-213, mir-215, mir-216, mir-217, miR 218, mir-224, mir-292, mir-294, mir-320, mir-324, mir-325, mir-326, mir-330, mir-331, mir-338, mir-341, mir-369, and mir-370; or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence selected from the group consisting of: miR-15a, miR-16, miR 21, miR 24, miR-96, miR-101, miR-105, miR-124, miR-126, miR-142, miR-147, miR-192, miR-194, miR-206, miR-215, or miR-346.
  • In addition or alternatively, any of the following may be included in the group from which the miRNA inhibitor molecule (i) may be chosen: Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-26a, miR-26a, mir-30e-5p, mir-31, mir-32, mir-92, mir-93, miR-100, miR-125a, miR-125b, mir-127, miR-128, miR-129, mir-130a, mir-135, mir-138, mir-139, miR-140, mir-141, mir-143, mir-145, mir-146, miR-150, mir-154, mir-155, mir-181a, miR-182, mir-186, miR-187, miR-188, mir-190, mir-191, mir-193, mir-196, mir-197, mir-198, mir-199, mir-201, mir-204, mir-216, mir-218, miR-223, mir-293, miR-291-3p, miR-294, miR-295, miR-322, mir-333, mir-335, mir-338, mir-341, mir-350, mir-369, miR-373, mir-410, and mir-412. In addition or alternatively, any of the following may be included in the group from which the miRNA molecule that corresponds to an miRNA sequence (ii) may be chosen: let7a-1, Let-7a, Let-7b, let7b-1, let7c, let7d, Let-7g, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-21, mir-23a, mir-23b, mir-24, mir-25, mir-92, mir-95, mir-133a, mir-133a-2, mir-133b, mir-142, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-191, mir-193, mir-194, mir-196, mir-199a-1, mir-200b, mir-204, mir-206, mir-211, mir-222, mir-223, mir-298, mir-328, mir-342, mir-371, and mir-412.
  • In other words, methods involve providing a synthetic miRNA inhibitor having a sequence that is at least 90% complementary to the 5′ to 3′ sequence of a corresponding miRNA that is mir-31, mir-92, mir-99a, mir-100, mir-125a, mir-129, mir-130a, mir-150, mir-187, miR-190, miR-191, miR-193, miR 204, mir-210, mir-211, mir-212, mir-213, mir-215, mir-216, mir-217, miR 218, mir-224, mir-292, mir-294, mir-320, mir-324, mir-325, mir-326, mir-330, mir-331, mir-338, mir-341, mir-369, mir-370, Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-26a, miR-26a, mir-30e-5p, mir-31, mir-32, mir-92, mir-93, miR-100, miR-125a, miR-125b, mir-127, miR-128, miR-129, mir-130a, mir-135, mir-138, mir-139, miR-140, mir-141, mir-143, mir-145, mir-146, miR-150, mir-154, mir-155, mir-181a, miR-182, mir-186, miR-187, miR-188, mir-190, mir-191, mir-193, mir-196, mir-197, mir-198, mir-199, mir-201, mir-204, mir-216, mir-218, miR-223, mir-293, miR-291-3p, miR-294, miR-295, miR-322, mir-333, mir-335, mir-338, mir-341, mir-350, mir-369, miR-373, mir-410, or mir-412. Alternatively or additionally, methods involve providing a synthetic or nonsynthetic miRNA molecule that corresponds to miR-15a, miR-16, miR 21, miR 24, miR-96, miR-101, miR-105, miR-124, miR-126, miR-142, miR-147, miR-192, miR-194, miR-206, miR-215, miR-346, let7a-1, Let-7a, Let-7b, let7b-1, let7c, let7d, Let-7g, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-21, mir-23a, mir-23b, mir-24, mir-25, mir-92, mir-95, mir-133a, mir-133a-2, mir-133b, mir-142, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-191, mir-193, mir-194, mir-196, mir-199a-1, mir-200b, mir-204, mir-206, mir-211, mir-222, mir-223, mir-298, mir-328, mir-342, mir-371, or mir-412. Methods for reducing or inhibiting cell proliferation can be used as a treatment for diseases and conditions that include, but are not limited to, hyperproliferative diseases, such as cancer.
  • The present invention also concerns methods for inducing or increasing cell proliferation in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves introducing into or providing the cell an effective amount of i) an miRNA inhibitor corresponding to let7a-1, Let-7a, Let-7b, let7b-1, let7c, let7d, Let-7g, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-21, mir-23a, mir-23b, mir-24, mir-25, mir-92, mir-95, mir-133a, mir-133a-2, mir-133b, mir-142, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-191, mir-193, mir-194, mir-196, mir-199a-1, mir-200b, mir-204, mir-206, mir-211, mir-222, mir-223, mir-298, mir-328, mir-342, mir-371, and mir-412; or ii) a miRNA molecule corresponding to Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-15a, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-26a, miR-26a, mir-30e-5p, mir-31, mir-32, mir-92, mir-93, miR-100, miR-125a, miR-125b, miR-126, mir-127, miR-128, miR-129, mir-130a, mir-135, mir-138, mir-139, miR-140, mir-141, mir-143, mir-145, mir-146, miR-150, mir-154, mir-155, mir-181a, miR-182, mir-186, miR-187, miR-188, mir-190, mir-191, mir-193, mir-194, mir-196, mir-197, mir-198, mir-199, mir-201, mir-204, mir-216, mir-218, miR-223, mir-293, miR-291-3p, miR-294, miR-295, miR-322, mir-333, mir-335, mir-338, mir-341, mir-350, mir-369, miR-373, mir-410, and mir-412. Alternatively or additionally, the group of miRNA inhibitors includes miR-15a, miR-16, miR 21, miR 24, miR-96, miR-101, miR-105, miR-124, miR-126, miR-142, miR-147, miR-192, miR-194, miR-206, miR-215, or miR-346 and the group of miRNAs molecules corresponding to miRNAs includes mir-31, mir-92, mir-99a, mir-100, mir-125a, mir-129, mir-130a, mir-150, mir-187, miR-190, miR-191, miR-193, miR 204, mir-210, mir-211, mir-212, mir-213, mir-215, mir-216, mir-217, miR 218, mir-224, mir-292, mir-294, mir-320, mir-324, mir-325, mir-326, mir-330, mir-331, mir-338, mir-341, mir-369, and mir-370.
  • Such methods can be used for the treatment of wounds, burns, ischemia, or any other condition, disease, or symptom in which cell proliferation is desirable.
  • It will be understood in methods of the invention that a cell or other biological matter such as an organism (including patients) can be provided an miRNA or miRNA molecule corresponding to a particular miRNA by administering to the cell or organism a nucleic acid molecule that functions as the corresponding miRNA once inside the cell. The form of the molecule provided to the cell may not be the form that acts an miRNA once inside the cell. Thus, it is contemplated that in some embodiments, biological matter is provided a synthetic miRNA or a nonsynthetic miRNA, such as one that becomes processed into a mature and active miRNA once it has access to the cell's miRNA processing machinery. In certain embodiments, it is specifically contemplated that the miRNA molecule provided to the biological matter is not a mature miRNA molecule but a nucleic acid molecule that can be processed into the mature miRNA once it is accessible to miRNA processing machinery. The term “nonsynthetic” in the context of miRNA means that the miRNA is not “synthetic,” as defined herein. Furthermore, it is contemplated that in embodiments of the invention that concern the use of synthetic miRNAs, the use of corresponding nonsynthetic miRNAs is also considered an aspect of the invention, and vice versa.
  • In other embodiments, the methods involve reducing cell viability comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves introducing into one or more cells an effective amount of i) an miRNA inhibitor corresponding to miR-107, miR-133, miR-137, miR-152, miR-155, miR-181a, miR-191, miR-203, or miR-215; or ii) an miRNA molecule corresponding to let-7a, let-7b, mir-1, mir-7, miR-10b, miR-17-3p, miR-19a, mir-23, mir-24, mir-27a, miR-29a, miR-30a-3p, mir-31, mir-32, miR-34a, miR-101, miR-107, miR-108, miR-122, mir-124, miR-133a, miR-134, miR-135, miR-139, mir-140, miR-141, miR-145, mir-150, mir-192, mir-193, mir-195, mir-206, mir-208, mir-210, mir-210, mir-292-3p, mir-293, mir-297, mir-299, mir-329, mir-337, mir-337, mir-345, mir-346, and mir-409. Alternatively or additionally, the group of miRNA inhibitors (group i) includes let-7a, let-7b, let-7c, let-7d, let-7g, miR-10a, miR-10b, miR-15a, miR-17-3p, miR-18, miR-19a, miR-20, mir-23a, mir-23b, mir-24, miR-25, miR-26a, mir-32, miR-107, miR-125a, miR-126, mir-128, miR-129, miR-133, miR-137, mir-139, miR-143, miR-152, miR-155, miR-181a, miR-182, miR-191, miR-203, miR-215, and mir-331
  • Other aspects of the invention include a method for increasing cell viability comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves introducing into one or more cells an effective amount of i) an miRNA inhibitor corresponding to miR-7, miR-19a, miR-23, miR-24, miR-27a, miR-31, miR-32, miR-134, miR-140, miR-150, miR-192, or miR-193; or ii) an miRNA molecule corresponding to let-7a, let-7b, let-7c, let-7d, let-7g, miR-10a, miR-10b, miR-15a, miR-17-3p, miR-18, miR-19a, miR-20, mir-23a, mir-23b, mir-24, miR-25, miR-26a, mir-32, miR-107, miR-125a, miR-126, mir-128, miR-129, miR-133, miR-137, mir-139, miR-143, miR-152, miR-155, miR-181a, miR-182, miR-191, miR-203, miR-215, and mir-331. Alternatively or additionally, the group of miRNA inhibitors (group i) includes let-7a, let-7b, mir-1, mir-7, miR-10b, miR-17-3p, miR-19a, mir-23, mir-24, mir-27a, miR-29a, miR-30a-3p, mir-31, mir-32, miR-34a, miR-101, miR-107, miR-108, miR-122, mir-124, miR-133a, miR-134, miR-135, miR-139, mir-140, miR-141, miR-145, mir-150, mir-192, mir-193, mir-195, mir-206, mir-208, mir-210, mir-210, mir-292-3p, mir-293, mir-297, mir-299, mir-329, mir-337, mir-337, mir-345, mir-346, or mir-409, and the group of miRNAs molecules corresponding to miRNAs (group ii) includes. The present invention also concerns a method for inducing apoptosis in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves introducing into the cell an effective amount of i) an miRNA inhibitor corresponding to miR-31 or miR-214; or ii) an miRNA molecule corresponding to let-7b, let-7g, mir-1, mir-1d, mir-7, mir-10a, miR-10b, miR-17-3p, miR-19a, miR-28, miR-28, miR-28, miR-29a, miR-32, miR-34a, miR-122, mir-148, mir-149, mir-154, mir-184, mir-186, mir-188, mir-192, mir-195, mir-196, mir-199a, mir-204, mir-208, mir-210, mir-211, mir-212, mir-214, mir-215, mir-216, mir-217, mir-218, mir-293, mir-296, mir-299, mir-321, mir-328, or mir-344. Alternatively or additionally, the group of miRNA inhibitors (group i) includes Let-7b, mir-21, mir-23b, mir-25, miR-26a, mir-28, mir-29a, mir-31, miR-32, mir-30a-3p, mir-34a, mir-96, miR-98, mir-100, mir-101, mir-105, mir-108, miR-125b, miR-126, mir-126, mir-128, mir-137, miR-143, miR-155, mir-207, mir-214, mir-216, mir-223, mir-292-3p, mir-328, mir-335, mir-340, mir-341, mir-367, mir-368, mir-380-3p, and mir-410.
  • Methods for inducing apoptosis have a number of therapeutic applications including, but not limited to, the treatment of cancer.
  • Other embodiments of the invention involve a method for inhibiting apoptosis in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves introducing into the cell an effective amount of i) an miRNA inhibitor corresponding to miR-7, miR-1-2, miR-148, miR-195, miR-196, miR-199a, miR-204, miR-210, miR-211, miR-212, miR-215, miR-216, miR-218, miR-296, or miR-321; or ii) an miRNA molecule corresponding to Let-7b, mir-21, mir-23b, mir-25, miR-26a, mir-28, mir-29a, mir-31, miR-32, mir-30a-3p, mir-34a, mir-96, miR-98, mir-100, mir-101, mir-105, mir-108, miR-125b, miR-126, mir-126, mir-128, mir-137, miR-143, miR-155, mir-207, mir-214, mir-216, mir-223, mir-292-3p, mir-328, mir-335, mir-340, mir-341, mir-367, mir-368, mir-380-3p, or mir-410. Alternatively or additionally, the group of miRNA inhibitors (group i) includes let-7b, let-7g, mir-1, mir-1d, mir-7, mir-10a, miR-10b, miR-17-3p, miR-19a, miR-28, miR-28, miR-28, miR-29a, miR-32, miR-34a, miR-122, mir-148, mir-149, mir-154, mir-184, mir-186, mir-188, mir-192, mir-195, mir-196, mir-199a, mir-204, mir-208, mir-210, mir-211, mir-212, mir-214, mir-215, mir-216, mir-217, mir-218, mir-293, mir-296, mir-299, mir-321, mir-328, or mir-344.
  • The present invention also concerns using miRNA compositions to treat diseases or conditions or to prepare therapeutics for the treatment of diseases or conditions. In some embodiments, the invention involves one or more human miRNA selected from the group consisting of let-7, miR-10a, miR-15a, miR-16, miR-17, miR-21, miR-22, miR-23, miR-24, miR-26a, miR-29b, miR-30a, miR-96, miR-101, miR-105, miR-106, miR-124, miR-125a, miR-126, miR-130, miR130a, miR-133, miR-142, miR-143, miR-144, miR-145, miR-147, miR-181a, miR-182, miR-183, miR-188, miR-189, miR-192, miR-194, miR-195, miR-199a, miR-200b, miR-201, miR-205, miR-219, 206, miR-215, miR-219, miR-223, miR-224, miR-321, miR-328, miR-331, miR-342, and miR-219,346. It is contemplated that 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 more miRNA (or any range derivable therein) may be used for these embodiments. In certain embodiments, methods involve one or more miRNA inhibitors and/or an miRNA molecules corresponding to any of these miRNAs, particularly for the treatment or prevention of cancer. Cancer includes, but is not limited to, malignant cancers, tumors, metastatic cancers, unresectable cancers, chemo- and/or radiation-resistant cancers, and terminal cancers.
  • In some embodiments of the invention, methods involve one or more miRNA inhibitors and/or an miRNA molecules corresponding to miR-17, miR-21, miR-126, miR-143, miR-145, miR-188, miR-200b, miR-219, or miR-331. In certain embodiments, methods involve one or more of 1) an inhibitor of miR-17, miR-21, miR-182, miR-183, miR-200b, miR-205, miR-223, and/or miR-224; and/or 2) an miRNA corresponding to let-7, miR-10a, miR-16, miR-22, miR-23, miR-24, miR-26a, miR-29b, miR-30a, miR-106, miR-125a, miR-126, miR-130, miR-133, miR-143, miR-144, miR-145, miR-181a, miR-188, miR-219, miR-192, miR-194, miR-195, miR-199a, mmu-miR-201, miR-215, miR-321, miR-328, miR-331, and/or miR-342. Such methods can be used, in some embodiments to treat cancer, including specific cancers. Additionally, an miRNA corresponding to one or more of miR-15a, miR-16, miR-96, miR-101, miR-105, miR-124, miR-126, miR-142, miR-147, miR-192, miR-194, miR-206, miR-215, or miR-346 may be used to treat cancer or inhibit cell proliferation. It is contemplated that these miRNAs may be used regardless of the source of the cell in which proliferation is undesirable.
  • It will be understood that shorthand notations are employed such that a generic description of an miRNA refers to any of its gene family members (distinguished by a number), unless otherwise indicated. It is understood by those of skill in the art that a “gene family” refers to a group of genes having the same miRNA coding sequence. Typically, members of a gene family are identified by a number following the initial designation. For example, miR-16-1 and miR-16-2 are members of the miR-16 gene family and “mir-7” refers to miR-7-1, miR-7-2 and miR-7-3. Moreover, unless otherwise indicated, a shorthand notation refers to related miRNAs (distinguished by a letter). Thus, “let-7,” for example, refers to let-7a-1, let7-a-2, let-7b, let-7c, let-7d, let-7e, let-7f-1, and let-7f-2.” Exceptions to this shorthand notations will be otherwise identified.
  • The present invention concerns treating breast cancer or decreasing cell proliferation of breast cancer cells by introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to miR-21, miR-15a, miR-16, miR-24, and/or miR-25, and/or 2) one or more miRNAs corresponding to miR-99, miR-100, miR-205, miR-197, miR-126, miR-143, miR-145 and/or miR-321. Alternatively or additionally, the miRNAs molecules corresponding to miRNAs (group ii) can include mir-27a, mir-92, mir-96, mir-98, mir-99a, mir-101, mir-105, mir-124, mir-126, mir-129, mir-132, mir-142, mir-147, mir-192, mir-201, mir-206, mir-208, mir-210, mir-211, mir-214, mir-215, mir-219, mir-220, mir-221, mir-223, mir-297, mir-329, mir-331, mir-345, mir-346, mir-409, or mir-411.
  • It will be understand that the term “providing” an agent is used to include “administering” the agent to a patient.
  • The present invention also relates to treating colon cancer by introducing into or providing to a colon cancer cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing 1) one or more miRNA inhibitors corresponding to miR-21, miR-106, miR-200b, miR-223, miR-224, miR-31, and/or miR-17; and/or 2) one or more miRNAs corresponding to miR-145, miR-143, miR-133, miR-342, miR-125a, miR-195, miR-30a, miR-10a, miR-130, miR-192, miR-194, miR-215, miR-144, miR-23, miR-26a, miR-126, miR-199a, miR-188, miR-331, and/or miR-21.
  • Moreover, methods for treating thyroid cancer involve introducing into or providing to a thyroid cancer cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to the patient 1) one or more miRNA inhibitors corresponding to miR-21 miR-125, miR-24, miR-200b, miR-29b, miR-221, miR-222, miR-224, miR-10a, and/or miR-183; and/or 2) one or more miRNAs corresponding to miR-145, miR-22, miR-331, miR-126, miR-30a, miR-199a, miR-223, and/or miR-321.
  • The treatment of lung cancer is also contemplated as part of the invention. Methods involve introducing into or providing to a lung cancer cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to the patient 1) one or more miRNA inhibitors corresponding to miR-223, miR-106, miR-21, miR-200b, miR-321, miR-182, miR-183, miR-17, and/or miR-205; and/or 2) one or more miRNAs corresponding to miR-130a, miR-145, miR-126, miR-331, miR-342, miR-143, Let-7, miR-30a, miR-16, miR-26a, miR-125a, miR-29b, miR-24, miR-328, miR-195, miR-22, miR-181a, miR-331, and/or miR-321. Alternatively or additionally, the group of miRNA inhibitors (group 1) includes mir-30e-5p, mir-25, mir-32, mir-92, mir-130a, mir-135, mir-145, mir-216, mir-293, mir-294, mir-333, mir-335, mir-338, mir-341, mir-350, mir-369, or mir-412, and the group of miRNAs molecules corresponding to miRNAs (group 2) includes ambi-mir7100, Let-7b, Let-7d, Let-7g, mir-7, mir-15a, mir-16, mir-22, mir-28, mir-29a, mir-34a, mir-96, mir-101, mir-105, mir-108, mir-122, mir-124, mir-125a, mir-125b, mir-126, mir-128, mir-129, mir-132, mir-133A, mir-136, mir-137, mir-141, mir-142, mir-147, mir-149, mir-151, mir-152, mir-182, mir-183, mir-186, mir-188, mir-192, mir-193, mir-195, mir-223, mir-292-3p, mir-337, mir-337, mir-344, mir-345, mir-346, mir-377, or mir-526b*.
  • The present invention concerns treating cervical cancer or decreasing cell proliferation of cervical cancer cells by providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, mir-9, mir-145, mir-155, mir-181a, mir-186, mir-190, mir-191, or mir-199, and/or 2) one or more miRNAs corresponding to mir-1, mir-34a, mir-101, mir-124, mir-192, mir-193, mir-195, mir-201, mir-206, mir-208, mir-210, mir-215, mir-292-3p, mir-293, mir-297, mir-299, mir-337, mir-339, mir-340, mir-344, mir-345, mir-367, or mir-409.
  • The present invention concerns treating prostate cancer or decreasing cell proliferation of prostate cancer cells by introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to Let-7a, Let-7b, mir-93, mir-127, mir-154, mir-181a, mir-194, mir-198, mir-199, mir-201, or mir-369, and/or 2) one or more miRNAs corresponding to mir-15a, mir-16, mir-27a, mir-28, mir-30a-3p, mir-34a, mir-101, mir-103, mir-105, mir-107, mir-124, mir-126, mir-128, mir-129, mir-132, mir-135, mir-137, mir-141, mir-142, mir-147, or mir-297.
  • The present invention concerns treating skin cancer or decreasing cell proliferation of skin cancer cells by introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to miR-26a, miR-125a, miR-128, mir-138, mir-139, mir-141, mir-143, miR-145, mir-146, miR-150, miR-187, mir-188, mir-190, mir-196, mir-197, mir-198, mir-199, miR-201, mir-204, mir-216, miR-223, miR-291-3p, miR-294, miR-295, miR-322, miR-373, mir-410, or mir-412, and/or 2) one or more miRNAs corresponding to let 7a, mir-1, mir-7, mir-15a, mir-16, mir-20, mir-26a, mir-28, mir-34a, mir-96, mir-101, mir-105, miR-105, mir-124, mir-126, mir-128, mir-132, mir-133A, mir-136, mir-137, mir-141, mir-142, mir-144, miR-147, mir-154, mir-181a, mir-192, mir-193, miR-195, mir-201, mir-206, mir-206, mir-215, mir-221, mir-223, mir-291, miR-297, mir-302, miR-324-3p, mir-329, mir-330, miR-337, mir-346, mir-346, mir-373, mu-mir-376b, mir-380-3p, or mir-411. The present invention concerns treating leukemia or decreasing cell proliferation of cancerous T cells by introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing an effective amount of at least 1) one or more miRNA inhibitors corresponding to miR-15a, miR-23b, miR-25, miR-26a, miR-100, miR-125b, miR-126, miR-129, miR-140, miR-143, or miR-155, and/or 2) one or more miRNAs corresponding to let-7a, let-7b, miR-10b, miR-17-3p, miR-29a, miR-30a-3p, miR-34a, miR-101, miR-122, or miR-133a. Alternatively or additionally, the group of miRNA inhibitors (group 1) includes let-7a, let-7b, let-7c, let-7d, let-7g, miR-7, miR-10a, miR-10b, miR-15a, miR-17-3p, miR-18, miR-19a, miR-20, miR-125a, miR-126, or miR-182, and the group of miRNAs molecules corresponding to miRNAs (group 2) includes miR-107, miR-134, miR-135, miR-139, miR-141, or miR-145. Moreover, such methods can extend to T-cells generally.
  • In addition to any miRNAs disclosed herein in the context of decreasing cell proliferation, embodiments of the invention include methods for decreasing cell proliferation comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing or introducing an effective amount of at least 1) one or more miRNA inhibitors corresponding to Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-15a, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-25, miR-26a, miR-26a, mir-30e-5p, mir-32, mir-92, mir-93, miR-100, miR-125a, miR-125b, miR-126, mir-127, miR-128, miR-129, mir-130a, mir-135, mir-138, mir-139, miR-140, mir-141, mir-143, mir-145, mir-146, miR-150, mir-154, mir-155, mir-181a, miR-182, mir-186, miR-187, miR-188, mir-190, mir-191, mir-194, mir-196, mir-197, mir-198, mir-199, mir-201, mir-204, mir-216, miR-223, mir-293, miR-291-3p, miR-294, miR-295, miR-322, mir-333, mir-335, mir-338, mir-341, mir-350, mir-369, miR-373, mir-410, or mir-412, and/or 2) one or more miRNAs corresponding to ambi-mir7100, let 7a, let-7b, let-7d, let-7g, mir-1, mir-7, miR-10b, mir-15a, mir-16, miR-17-3p, mir-20, mir-22, mir-26a, mir-27a, mir-28, mir-28, miR-29a, mir-30a-3p, mir-34a, mir-92, mir-96, mir-98, mir-99a, mir-101, mir-103, mir-105, mir-107, mir-108, mir-122, mir-124, mir-125a, mir-125b, mir-126, mir-128, mir-129, mir-132, miR-133a, miR-134, mir-135, mir-136, mir-137, miR-139, mir-141, mir-142, mir-144, miR-145, mir-147, mir-149, mir-151, mir-152, mir-154, mir-181a, mir-182, mir-183, mir-186, mir-188, mir-192, mir-193, mir-195, mir-195, mir-201, mir-206, mir-208, mir-210, mir-211, mir-214, mir-215, mir-219, mir-220, mir-221, mir-223, mir-291, mir-292-3p, mir-293, mir-297, mir-299, mir-302, miR-324-3p, mir-329, mir-330, mir-331, mir-337, mir-339, mir-340, mir-344, mir-345, mir-346, mir-367, mir-373, miR-376b, mir-377, mir-380-3p, mir-409, mir-411, or mir-526b*. It is particularly contemplated that such methods may be employed in the context of treating cancer or another disease or condition in which cell proliferation plays a role, such as hyproliferative diseases and conditions.
  • The present invention also concerns embodiments methods for increasing cell proliferation comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing or introducing an effective amount of at least 1) one or more miRNA inhibitors corresponding to ambi-mir7100, let 7a, let-7b, let-7d, let-7g, mir-1, mir-7, miR-10b, mir-15a, mir-16, miR-17-3p, mir-20, mir-22, mir-26a, mir-27a, mir-28, mir-28, miR-29a, mir-30a-3p, mir-34a, mir-92, mir-96, mir-98, mir-99a, mir-101, mir-103, mir-105, mir-107, mir-108, mir-122, mir-124, mir-125a, mir-125b, mir-126, mir-128, mir-129, mir-132, miR-133a, miR-134, mir-135, mir-136, mir-137, miR-139, mir-141, mir-142, mir-144, miR-145, mir-147, mir-149, mir-151, mir-152, mir-154, mir-181a, mir-182, mir-183, mir-186, mir-188, mir-192, mir-193, mir-195, mir-195, mir-201, mir-206, mir-208, mir-210, mir-211, mir-214, mir-215, mir-219, mir-220, mir-221, mir-223, mir-291, mir-292-3p, mir-293, mir-297, mir-299, mir-302, miR-324-3p, mir-329, mir-330, mir-331, mir-337, mir-339, mir-340, mir-344, mir-345, mir-346, mir-367, mir-373, miR-376b, mir-377, mir-380-3p, mir-409, mir-411, or mir-526b*, and/or 2) one or more miRNAs corresponding to Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-15a, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-25, miR-26a, miR-26a, mir-30e-5p, mir-32, mir-92, mir-93, miR-100, miR-125a, miR-125b, miR-126, mir-127, miR-128, miR-129, mir-130a, mir-135, mir-138, mir-139, miR-140, mir-141, mir-143, mir-145, mir-146, miR-150, mir-154, mir-155, mir-181a, miR-182, mir-186, miR-187, miR-188, mir-190, mir-191, mir-194, mir-196, mir-197, mir-198, mir-199, mir-201, mir-204, mir-216, miR-223, mir-293, miR-291-3p, miR-294, miR-295, miR-322, mir-333, mir-335, mir-338, mir-341, mir-350, mir-369, miR-373, mir-410, or mir-412. While not limited to such an embodiment, one use for such a method is to increase or induce proliferation of normal cells or other desirable cells in the context of pretreatment or therapy.
  • Other aspects of the invention include the treatment of systemic lupus erythrematosus (SLE). In certain embodiments, methods concern introducing into or providing to a patient an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to a patient with SLE or suspect of having SLE 1) one or more miRNA inhibitors corresponding to miR-21, miR-223, and/or mir-342 expression; and/or 2) one or more miRNAs corresponding to miR-95, miR-105, miR-137, miR-186, miR-188, miR-199, miR-211, miR-215, mu-miR-290, miR-301, and/or miR-331.
  • Treatment or prevention of prion diseases is included in methods of the invention. In some cases, method include introducing into or providing to a patient with a prion disease an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to a patient 1) one or more miRNA inhibitors corresponding miR-7, miR-9, miR-16, miR-24, miR-26A, miR-27A, and/or miR-130A; and/or 2) one or more miRNAs corresponding to miR-95 and/or miR-135A. The patient may be one diagnosed with a prion disease, one at risk for a prion disease, or one suspected of having a prion disease. It is specifically contemplated that in some embodiments of the invention, a nucleic acid molecule corresponding to an miRNA is double stranded, wherein both strands have the sequence of the mature miRNA it corresponds to. Such a molecule may be designated with an “as” suffix in embodiments of the invention. For example, a nucleic acid molecule called miR-9-as was used in some experiments described herein. It is contemplated that in some embodiments, a nucleic acid molecule is an miRNA-as molecule.
  • The present invention also concerns patients diagnosed as having ischemia, those at risk for ischemia, those suspected of having ischemia, or patients with symptoms of ischemia. Methods involve introducing into or providing to a patient an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to a patient 1) one or more miRNA inhibitors corresponding to miR-28, miR-30A, miR-31, miR-138, miR-139, miR-140, miR-291 and/or mmu-miR-298; and/or 2) one or more miRNAs corresponding to Let-7f-2 and/or miR-16.
  • In certain experiments, a synthetic miRNA in which both the sense and antisense strand are derived from a single precursor miRNA is used in methods and compositions of the invention. These are frequently designated with a “P” suffix in which “5P” indicates that the mature miRNA derives from the 5′ end of the precursor and a corresponding “3P” indicates that it derives from the 3′ end of the precursor, as described on the world wide web at sanger.ac.uk/cgi-bin/rfam/mirna. Moreover, in some embodiments, an miRNA that does not correspond to a known human miRNA was evaluated. It is contemplated that these non-human miRNAs may be used in embodiments of the invention or that there may exist a human miRNA that is homologous to the non-human miRNA.
  • The present invention in some embodiments concerns methods for reducing cell viability comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7a, let-7b, miR-1, miR-10b, miR-17, miR-19a, miR-20, miR-28, miR-29a, miR-30a, miR-32, miR-34a, miR-96, miR-101, miR-122, miR-124, miR-132, miR-133a, miR-134, miR-139, miR-140, miR-144, miR-145, miR-147, miR-155, miR-182, miR-183, miR-184, miR-186, miR-190, miR-193, miR-197, miR-206, miR-208, miR-210, miR-216, miR-217, miR-224, mu-miR-292, mu-miR-293, mu-miR-298, miR-299, miR-301, mu-miR-329, miR-337, mu-miR-344, miR-345, miR-346, miR-369, mu-miR-380, or mu-miR-409; or 2) at least one miRNA inhibitor corresponding to let-7a, let-7b, let-7c, miR-9, miR-10a, miR-10b, miR-15a, miR-17, miR-18, miR-20, mir-23b, miR-25, miR-26a, miR-98, miR-100, miR-125a, miR-125b, miR-126, miR-129, miR-140, miR-141, miR-143, miR-155, or miR-181-a. The term “reducing cell viability” means reducing the number of live cells.
  • Methods concerning cell viability and cell proliferation may generally be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation. miRNAs that selectively reduce the proliferation of cancer cells may be employed as therapeutics since they can be delivered to cancer and non-cancer cells alike but will only affect the growth of the cancerous cells. In addition, methods may be used to halt or prevent metastasis or reduce the number of metastases.
  • It is contemplated in some embodiments that the cell in which the effect is desired (referred to as a “targeted cell”), such as a reduction in cell viability, may be a cell that is diseased or involved in maintaining, promoting, or causing a disease or condition. In certain embodiments, the cell is a cancer cell, while in other embodiments, it is contemplated to be a healthy (non-diseased) cell. In certain embodiments, a targeted cell is in an organism.
  • Moreover, it is particularly contemplated that a nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell is a synthetic miRNA in some embodiments of the invention.
  • In other embodiments, the present invention involves methods for increasing cell viability comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7a, let-7b, let-7c, miR-9, miR-10a, miR-10b, miR-15a, miR-17, miR-18, miR-20, mir-23b, miR-25, miR-26a, miR-98, miR-100, miR-125a, miR-125b, miR-126, miR-129, miR-140, miR-141, miR-143, miR-155, or miR-181-a; or 2) at least one miRNA inhibitor corresponding to let-7a, let-7b, miR-1, miR-10b, miR-17, miR-19a, miR-20, miR-28, miR-29a, miR-30a, miR-32, miR-34a, miR-96, miR-101, miR-122, miR-124, miR-132, miR-133a, miR-134, miR-139, miR-140, miR-144, miR-145, miR-147, miR-155, miR-182, miR-183, miR-184, miR-186, miR-190, miR-193, miR-197, miR-206, miR-208, miR-210, miR-216, miR-217, miR-224, mu-miR-292, mu-miR-293, mu-miR-298, miR-299, miR-301, mu-miR-329, miR-337, mu-miR-344, miR-345, miR-346, miR-369, mu-miR-380, or mu-miR-409. The term “increasing cell viability” means that cell death is inhibited. In particular embodiments, a cancer cell, such as a leukemia cell, is provided with an effective amount of a nucleic acid capable of being processed into a mature let-7a, let-7b, or miR-10b molecule.
  • Methods of the invention also relate to inhibiting cellular proliferation comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7a, let-7b, let-7c, let-7d, let-7g, miR-1, miR-7, miR-15a, miR-16, miR-19a, miR-22, miR-28, miR-29a, miR-34a, miR-92, miR-96, miR-98, miR-101, miR-122, miR-124, miR-126, miR-129, miR-133b, miR-137, miR-147, miR-192, miR-193, miR-195, miR-205, miR-206, miR-208, miR-210, mu-miR-292, mu-miR-297, miR-299, miR-337, mu-miR-344, miR-345, or miR-346; or 2) at least one miRNA inhibitor corresponding to miR-25, miR-27a, miR-31, miR-32, miR-92, miR-139, miR-145, miR-198, miR-212, mu-miR-290, mu-miR-294, miR-323, miR-324, miR-325, miR-331, miR-335, mu-miR-351, miR-369, miR-370, or miR-373.
  • In some embodiments there are methods of increasing cellular proliferation comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-25, miR-27a, miR-31, miR-32, miR-92, miR-139, miR-145, miR-198, miR-212, mu-miR-290, mu-miR-294, miR-323, miR-324, miR-325, miR-331, miR-335, mu-miR-351, miR-369, miR-370, or miR-373; or 2) at least one miRNA inhibitor corresponding to let-7a, let-7b, let-7c, let-7d, let-7g, miR-1, miR-7, miR-15a, miR-16, miR-19a, miR-22, miR-28, miR-29a, miR-34a, miR-92, miR-96, miR-98, miR-101, miR-122, miR-124, miR-126, miR-129, miR-133b, miR-137, miR-147, miR-192, miR-193, miR-195, miR-205, miR-206, miR-208, miR-210, mu-miR-292, mu-miR-297, miR-299, miR-337, mu-miR-344, miR-345, or miR-346.
  • The present invention also covers methods of inhibiting ERK activation introducing into or providing to a cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves comprising providing to or introducing into cells an effective amount of one or more miRNA inhibitor corresponding to let-7a, mir-294, mir-295, miR-19a, miR-25, miR-96, miR-125a, miR-134, miR-148, miR-152, miR-206, miR-207, miR-210, miR-212, miR-216, miR-217, miR-218, miR-223, mu-miR-294, mu-miR-295, miR-301, miR-328, mu-miR-329, miR-339, miR-370, or miR-372.
  • In certain embodiments, it also covers methods of activating ERK by introducing into or providing to a cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing or introducing into cells an effective amount of one or more nucleic acids capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-19a, miR-25, miR-96, miR-125a, miR-134, miR-148, miR-152, miR-206, miR-207, miR-210, miR-212, miR-216, miR-217, miR-218, miR-223, mu-miR-294, mu-miR-295, miR-301, miR-328, mu-miR-329, miR-339, miR-370, or miR-372. Alternatively or in addition to the mature miRNA is let-7, miR-19a, miR-25, miR-96, miR-125a, miR-134, miR-148, miR-152, miR-206, miR-207, miR-210, miR-212, miR-216, miR-217, miR-218, miR-223, mu-miR-294, mu-miR-295, miR-301, miR-328, mu-miR-329, miR-339, miR-370, or miR-372.
  • In other embodiments of the invention, there are methods of increasing the percentage of apoptotic cells in a population comprising introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) one or more nucleic acid molecules capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7d, miR-22, miR-23a, miR-23b, miR-24, miR-27a, miR-31, miR-128, miR-181a, miR-196, miR-198, miR-199, miR-214, miR-217, mu-miR-290, mu-miR-293, miR-324, miR-338, or mu-miR-412; or 2) an miRNA inhibitor corresponding to miR-34a, miR-96, miR-101, miR-105, miR-126, miR-137, or mu-miR-292. It is specifically contemplated that the population of cells may be diseased or related to a disease or condition.
  • In further embodiments of the invention, there are methods of decreasing the percentage of apoptotic cells in a population comprising introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-34a, miR-96, miR-101, miR-105, miR-126, miR-137, or mu-miR-292; or 2) at least one miRNA inhibitor corresponding to let-7d, miR-22, miR-23a, miR-23b, miR-24, miR-27a, miR-31, miR-128, miR-181a, miR-196, miR-198, miR-199, miR-214, miR-217, mu-miR-290, mu-miR-293, miR-324, miR-338, or mu-miR-412. It is specifically contemplated that the population of cells may be involved in diseases or conditions involving atrophy or the decrease in the number of healthy cells as a result of apoptosis. One or more of the miRNAs that induce apoptosis may be introduced into abnormal cells like cancer cells to induce cell death, providing a therapeutic response. This could be especially beneficial if the apoptosis-inducing synthetic miRNAs were injected directly into tumor tissues or otherwise delivered with high efficiency to primary or metastatic cancer cells. These same miRNAs may be co-delivered with other therapeutic agents like chemotherapies to supplement their activities and evoke a therapeutic response. Alternatively, the miRNAs that reduce apoptosis may be introduced into normal cells at the same time that a chemotherapeutic reagent that induces apoptosis is introduced, providing some level of protection to the normal cells while the cancer cells are induced to undergo cell death. The miRNAs may also be used as targets for diagnostic assays or to differentiate cells or to create cell lines with interesting research properties.
  • Methods of the invention include methods for inhibiting or preventing hTert activity in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into the cell an effective amount of at least one i) miRNA inhibitor corresponding to miR-15a, miR-16, miR-21, mir-24, miR-26a, miR-92, miR-105, miR-125a, miR-125b, miR-128, mir-147, miR-195, miR-207, miR-224, miR-295, mir-301, miR-337, mir-368, or mir-371 or ii) a nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-26a, miR-147, mir-195, and mir-368. It is specifically contemplated that it is desirable to inhibit hTert activity in cancer cells or in a patient at risk for or suspected of having cancer. Methods of the invention include methods for inducing hTert activity in a cell comprising providing to or introducing into the cell an effective amount of at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-15a, miR-16, miR-21, mir-24, miR-26a, miR-92, miR-105, miR-125a, miR-125b, miR-128, mir-147, miR-195, miR-207, miR-224, miR-295, mir-301, miR-337, mir-368, or mir-371. Alternatively or additionally, hTert activity may be induced in a cell comprising providing to or introducing into the cell an miRNA inhibitor corresponding to miR-26a, miR-147, mir-195, or mir-368.
  • In other embodiments of the invention there are methods for identifying an miRNA that inhibits an hTert activating gene product comprising: a) introducing into a cell a candidate miRNA into a cell; and, b) assaying the level of hTert expression or hTert activity in the cell, wherein a reduction in hTert expression or activity compared to a cell lacking the miRNA identifies the miRNA as a potential inhibitor of an hTert activating gene product. In particular embodiments, the sequence of the candidate miRNA was previously evaluated for an ability to inhibit an hTert activating gene product. Computer programs and algorithms may be employed to assess whether a particular miRNA sequence can target a particular cellular gene. In certain embodiments, thTert activating gene product is selected from the group consisting of ACOX1, AKT1, APAF1, COX-5B, COX6, COX7B, CPOX, DUOX2, GPX1, GPX2, GPX4, LPO, MAPK1, MAPK4, MTCO1, NOX3, NOX5, PAOX, PPDX, PRKCA, PRKCD, and TNFRSF6. These methods may be used for combating telomerase activity and cancer progression. The invention also includes methods for inhibiting stimulation of Stat3 in a cell comprising introducing into or providing to the cell an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to the cell an effective amount of an miRNA selected from the group consisting of mir-93, mir-100, mir-134, mir-99a, mir-103, mir-128, mir-129, mir-181b, mir-193, mir-197, mir-212, mir-218, mir-219, mir-302, mir-323, mir-324-3p, mir-325, mir-330, mir-331, mir-340, mmu-mir-350, mir-425, mir-491, mir-518f, mir-520a*. Such methods can be used for treating diseases and conditions characterized by inflammation. These include, but are not limited to, tissue destruction, organ failure or inflammatory diseases such as Rheumatoid arthritis, Psoriasis, Asthma, Inflammatory bowel disease (Crohn's disease and related conditions), Multiple Sclerosis, obstructive pulmonary disease (COPD), Allergic rhinitis (hay fever), and Cardiovascular disease. Additionally, such methods may be used for therapeutics, diagnostics, prognostics, creating cell lines with interesting research properties, and inducing differentiation.
  • The present invention also concerns methods of influencing the cell cycle of a cell or population of cells. It is contemplated that methods can involve relatively increasing the number of cells in a particular phase of the cell cycle, such as S, G1, G2/M, or when the number of chromosomes is greater than 2N. Alternatively, it can involve inducing DNA synthesis in a cell. One or more of the miRNAs involved in the cell cycle can be used to modulate a cell, particularly a cancer cell, to achieve a therapeutic benefit for a patient with such cells. Such methods may be used, for example, to enhance the efficacy of a therapeutic agent or they may be employed in the context of research, for instance, to synchronize cells so as to generate a more homogeneous population of cells. Moreover, these miRNAs may regulate genes that are involved in controlling cell cycle progression. Mis-expression of one or more of these miRNAs may profoundly affect the cells in which they reside, leading potentially toward cancer or other diseases associated with altered cell cycle regulation. In addition to using these miRNAs as diagnostic analytes, they might also provide targets for treating disease. For instance, a cancer cell that has bypassed a critical cell cycle signal by having a cell cycle-specific miRNA might be returned to normalcy by introducing the miRNA.
  • Methods of promoting cells to be in S phase can be achieved by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7a, mir-15a, mir-16, mir-20, mir-26a, mir-191, mir-197, mir-205, mir-220, mir-224, mir-290, mir-291, mir-294, mir-295, mir-302, mir-345, mir-372, or mir-411; or 2) at least one miRNA inhibitor corresponding to mir-108, mir-122, mir-128, mir-129, mir-137, mir-142, mir-146, mir-147, mir-186, mir-187, mir-195, mir-297, mir-324-3p, mir-337, or mir-376b.
  • The invention also includes methods of inhibiting cells to be in S phase by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is mir-108, mir-122, mir-128, mir-129, mir-137, mir-142, mir-146, mir-147, mir-186, mir-187, mir-195, mir-297, mir-324-3p, mir-337, or mir-376b; or 2) at least one miRNA inhibitor corresponding to let-7a, mir-15a, mir-16, mir-20, mir-26a, mir-191, mir-197, mir-205, mir-220, mir-224, mir-290, mir-291, mir-294, mir-295, mir-302, mir-345, mir-372, or mir-411.
  • Methods of promoting cells to be in G1 phase can be achieved by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is mir-108, mir-122, mir-124, mir-125a, mir-126, mir-128, mir-129, mir-137, mir-142, mir-146, mir-147, mir-195, mir-201, mir-297, mir-320, mir-325, mir-324-3p, mir-337, mir-371, mir-376b, or mir-409; or 2) at least one miRNA inhibitor corresponding to Let-7a, mir-1, mir-7d, mir-20, mir-21, mir-26a, mir-192, mir-193, mir-206, mir-220, mir-290, mir-294, mir-329, mir-371, mir-373, or mir-409.
  • Other methods concern inhibiting cells in G1 phase by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is Let-7a, mir-1, mir-7d, mir-20, mir-21, mir-26a, mir-192, mir-193, mir-206, mir-220, mir-290, mir-294, mir-329, mir-371, mir-373, mir-409; or 2) at least one miRNA inhibitor corresponding to mir-108, mir-122, mir-124, mir-125a, mir-126, mir-128, mir-129, mir-137, mir-142, mir-146, mir-147, mir-195, mir-201, mir-297, mir-320, mir-325, mir-324-3p, mir-337, mir-371, mir-376b, or mir-409.
  • Also, there are methods of promoting cells to be in G2/M phase by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is mir-1, mir-7a, mir-7d, mir-7g, mir-20, mir-21, mir-26a, mir-145, mir-187, mir-192, mir-193, mir-206, mir-215, mir-220, mir-223, mir-294, mir-329, mir-371, mir-373, or mir-409; or 2) at least one miRNA inhibitor corresponding to mir-15a, mir-18, mir-122, mir-124, mir-126, mir-128, mir-129, mir-137, mir-146, mir-147, mir-195, mir-219, mir-337, or mir-371.
  • In other embodiments there are methods relating to inhibiting cells to be in G2/M phase by introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of 1) at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is mir-15a, mir-18, mir-122, mir-124, mir-126, mir-128, mir-129, mir-137, mir-146, mir-147, mir-195, mir-219, mir-337, or mir-371; or 2) at least one miRNA inhibitor corresponding to mir-1, mir-7a, mir-7d, mir-7g, mir-20, mir-21, mir-26a, mir-145, mir-187, mir-192, mir-193, mir-206, mir-215, mir-220, mir-223, mir-294, mir-329, mir-371, mir-373, or mir-409.
  • The present invention also includes methods of increasing the number of cells with 2× or more DNA in the cell comprising introducing into or providing to the cells an effective amount of i) an miRNA inhibitor molecule or ii) a synthetic or nonsynthetic miRNA molecule that corresponds to an miRNA sequence. In certain embodiments the methods involves providing to or introducing into cells an effective amount of at least one nucleic acid molecule capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is miR-1, miR-20, miR-21, miR-337, miR-345, or miR-373. The present invention is also concerned with reducing the number of cells with 2× (also referred to as 2N, where N is the number of sets of chromosomes) comprising providing to or introducing into cells an effective amount of an miRNA inhibitor corresponding to miR-1, miR-20, miR-21, miR-337, miR-345, or miR-373.
  • In certain embodiments, methods also include targeting an miRNA to modulate in a cell or organism. The term “targeting an miRNA to modulate” means a nucleic acid of the invention will be employed so as to modulate the selected miRNA. In some embodiments the modulation is achieved with a synthetic or non-synthetic miRNA that corresponds to the targeted miRNA, which effectively provides the targeted miRNA to the cell or organism (positive modulation). In other embodiments, the modulation is achieved with an miRNA inhibitor, which effectively inhibits the targeted miRNA in the cell or organism (negative modulation).
  • In some embodiments, the miRNA targeted to be modulated is an miRNA that affects a disease, condition, or pathway. In certain embodiments, the miRNA is targeted because a treatment can be provided by negative modulation of the targeted miRNA. In other embodiments, the miRNA is targeted because a treatment can be provided by positive modulation of the targeted miRNA.
  • In further embodiments of the invention, there is a step of obtaining a nucleic molecule of the invention that achieves negative modulation of the targeted miRNA. Alternatively, in some cases there is a step of obtaining a nucleic molecule of the invention that achieves positive modulation of the targeted miRNA. Thus, it is contemplated that methods involve selecting and/or obtaining a synthetic miRNA, non-synthetic miRNA or an miRNA inhibitor (collectively “miRNA modulators”) that corresponds to a targeted miRNA, such as one that is involved with, affects or is characteristic of a particular disease, condition, pathway, or factor in the pathway.
  • In certain methods of the invention, there is a further step of administering the selected miRNA modulator to a cell, tissue, organ, or organism (collectively “biological matter”) in need of treatment related to modulation of the targeted miRNA or in need of the physiological or biological results discussed herein (such as with respect to a particular cellular pathway or result like decrease in cell viability). Consequently, in some methods of the invention there is a step of identifying a patient in need of treatment that can be provided by the miRNA modulator(s). It is contemplated that an effective amount of an miRNA modulator can be administered in some embodiments. In particular embodiments, there is a therapeutic benefit conferred on the biological matter, where a “therapeutic benefit” refers to an improvement in the one or more conditions or symptoms associated with a disease or condition or an improvement in the prognosis, duration, or status with respect to the disease. It is contemplated that a therapeutic benefit includes, but is not limited to, a decrease in pain, a decrease in morbidity, a decrease in a symptom. For example, with respect to cancer, it is contemplated that a therapeutic benefit can be inhibition of tumor growth, prevention of metastasis, reduction in number of metastases, inhibition of cancer cell proliferation, inhibition of cancer cell proliferation, induction of cell death in cancer cells, inhibition of angiogenesis near cancer cells, induction of apoptosis of cancer cells, reduction in pain, reduction in risk of recurrence, induction of chemo- or radiosensitivity in cancer cells, prolongation of life, and/or delay of death directly or indirectly related to cancer.
  • It is specifically contemplated that miRNA profiles for patients, particularly those suspected of having a particular disease or condition, can be generated by evaluating any of the miRNAs discussed in this application. The miRNA profile that is generated from the patient will be one that provides information regarding the particular disease or condition. In many embodiments, the miRNA profile is generated using the miRNA array discussed.
  • Furthermore, it is contemplated that the miRNA compositions may be provided as part of a therapy to a patient, in conjunction with traditional therapies or preventative agents. Moreover, it is contemplated that any method discussed in the context of therapy may be applied as preventatively, particularly in a patient identified to be potentially in need of the therapy or at risk of the condition or disease for which a therapy is needed.
  • In other embodiments, the invention concerns a method for inducing transformation in a cell comprising administering to the cell an effective amount of at least one miRNA selected from the group consisting of mir-192, mir-198, and mir-199. Alternatively, methods for preventing cell transformation may be achieved by administering to the cell an effective amount of at least one miRNA inhibitor of mir-192, mir-198, or mir-199.
  • In addition, methods of the invention concern employing one or more nucleic acids corresponding to an miRNA and a therapeutic drug. The nucleic acid can enhance the effect or efficacy of the drug, reduce any side effects or toxicity, modify its bioavailability, and/or decrease the dosage or frequency needed. In certain embodiments, the therapeutic drug is a cancer therapeutic. Consequently, in some embodiments, there is a method of treating cancer in a patient comprising administering to the patient the cancer therapeutic and an effective amount of at least one miRNA molecule that improves the efficacy of the cancer therapeutic or protects non-cancer cells. Furthermore, in some cases the miRNA molecule enhances the efficacy of the cancer therapeutic and is selected from the group consisting of ambi-miR-7100, mir-28, mir-101, mir-124, mir-125a, mir-126, mir-132, mir-136, mir-147, mir-155, mir-182, mir-186, mir-202, mir-206, mir-216, mir-221, mir-224, mir-291, mir-292-3p, mir-297, mir-302, mir-337, mir-372, mir-373, and mir-376b.
  • Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments. Combination chemotherapies include but are not limited to, for example, bevacizumab, cisplatin (CDDP), carboplatin, EGFR inhibitors (gefitinib and cetuximab), procarbazine, mechlorethamine, cyclophosphamide, camptothecin, COX-2 inhibitors (e.g., celecoxib) ifosfamide, melphalan, chlorambucil, busulfan, nitrourea, dactinomycin, daunorubicin, doxorubicin (adriamycin), bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, taxotere, gemcitabine, navelbine, farnesyl-protein transferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastin and methotrexate, or any analog or derivative variant of the foregoing.
  • Alternatively or additionally, the miRNA molecule in methods of the invention protects non-cancer cells from the cancer therapeutic and is selected from the group consisting of mir-16, mir-24, mir-30a-3p, mir-125b, mir-152, mir-194, mir-197, mir-214, and mir-331.
  • Generally, inhibitors of miRNAs can be given to achieve the opposite effect as compared to when nucleic acid molecules corresponding to the mature miRNA are given. Similarly, nucleic acid molecules corresponding to the mature miRNA can be given to achieve the opposite effect as compared to when inhibitors of the miRNA are given. For example, miRNA molecules that increase cell proliferation can be provided to cells to increase proliferation or inhibitors of such molecules can be provided to cells to decrease cell proliferation. The present invention contemplates these embodiments in the context of the different physiological effects observed with the different miRNA molecules and miRNA inhibitors disclosed herein. These include, but are not limited to, the following physiological effects: increase and decreasing cell proliferation, increasing or decreasing apoptosis, increasing transformation, increasing or decreasing cell viability, activating ERK, activating/inducing or inhibiting hTert, inhibit stimulation of Stat3, reduce or increase viable cell number, and increase or decrease number of cells at a particular phase of the cell cycle. Methods of the invention are generally contemplated to include providing or introducing one or more different nucleic acid molecules corresponding to one or more different miRNA molecules. It is contemplated that the following, at least the following, or at most the following number of different nucleic acid molecules may be provided or introduced: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or any range derivable therein. This also applies to the number of different miRNA molecules that can be provided or introduced into a cell.
  • The present invention also concerns kit containing compositions of the invention or compositions to implement methods of the invention. In some embodiments, kits can be used to evaluate one or more miRNA molecules. In certain embodiments, a kit contains, contains at least or contains at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more synthetic miRNA molecules or miRNA inhibitors, or any range and combination derivable therein. In some embodiments, there are kits for evaluating miRNA activity in a cell.
  • Kits may comprise components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means.
  • Individual components may also be provided in a kit in concentrated amounts; in some embodiments, a component is provided individually in the same concentration as it would be in a solution with other components. Concentrations of components may be provided as 1×, 2×, 5×, 10×, or 20× or more.
  • Kits for using synthetic miRNAs, nonsynthetic, and/or miRNA inhibitors of the invention for therapeutic, prognostic, or diagnostic applications are included as part of the invention. Specifically contemplated are any such molecules corresponding to any miRNA reported to influence biological activity, such as those discussed herein.
  • Negative and/or Positive Control synthetic miRNAs and/or miRNA inhibitors are included in some kit embodiments. The Control molecules can be used to verify transfection efficiency and/or control for transfection-induced changes in cells.
  • It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined. It is specifically contemplated that any methods and compositions discussed herein with respect to miRNA molecules or miRNA may be implemented with respect to synthetic miRNAs to the extent the synthetic miRNA is exposed to the proper conditions to allow it to become a mature miRNA under physiological circumstances. The claims originally filed are contemplated to cover claims that are multiply dependent on any filed claim or combination of filed claims.
  • Any embodiment of the invention involving specific miRNAs by name is contemplated also to cover embodiments involving miRNAs whose sequences are at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to the mature sequence of the specified miRNA.
  • Throughout this application, the term “about” is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.
  • The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”
  • It is specifically contemplated that any embodiments described in the Examples section are included as an embodiment of the invention.
  • Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
  • FIG. 1 Overview of miRNA Expression and Activation. MiRNAs are transcribed as part of longer RNA molecules that can be as long as a thousand nucleotides (Lee, 2002). The RNAs are processed in the nucleus into hairpin RNAs of 70-100 nucleotides by the dsRNA-specific ribonuclease Drosha (Lee 2003) (FIG. 1). The hairpin RNAs are transported to the cytoplasm and digested by a second, double-strand specific ribonuclease called Dicer. The resulting 19-23mer miRNA is bound by a complex that is similar to or identical to the RNA-Induced Silencing Complex (RISC) that participates in RNA interference (Hutvagner, 2002). The complex-bound, single-stranded miRNA binds mRNAs with sequences that are significantly, though not completely, complementary to the miRNA. By a mechanism that is not fully understood, but that does not involve mRNA degradation, the bound mRNA is not translated, resulting in reduced expression of the corresponding gene.
  • FIG. 2. Methods for Introducing miRNAs into Cells. There are three basic methods for introducing miRNAs into cells. In the first, a DNA bearing a promoter upstream of a sequence encoding a miRNAs is introduced into cells where it is transcribed to produce an RNA molecule that includes the mature miRNA. Processing and uptake by the protein complex for miRNA-induced gene regulation results in the activation of the miRNA. This method suffers from inefficient introduction of the DNA construct into cells. In the second method, an siRNA-like dsRNA molecule, one of whose strands is identical to an active miRNA is introduced into cells where it is taken up by the protein complex for miRNA activation. This method provides efficient deliver, but often uptake of the unintended complementary RNA molecule. The third method, described herein, involves modifying the complementary strand so as to favor uptake and activation of the active strand of the synthetic miRNA construct.
  • FIG. 3. Preferential Uptake of Active Strands in synthetic miRNAs of the invention. Reporter vectors with luciferase under the control of target sites for miR-33 or let-7 or the complementary strands of the afore-mentioned siRNAs. Co-transfection of synthetic miRNAs and reporter vectors followed by luciferase assay 24 hours post-transfection revealed miRNAs that are activated following transfection.
  • FIG. 4. Synthetic miRNA Activity for various miRNAs. Synthetic miRNAs with siRNA and Pre-miR (5′ amine) design were prepared and transfected into HeLa cells at 3 and 10 nM final concentration. The synthetic miRNAs were co-transfected with reporter vectors bearing target sites for the mature miRNAs. The expression of the luciferase reporter in co-transfected cells was measured twenty-four hours post-transfected and expressed in the figure as the reporter expression relative to cells co-transfected with negative control synthetic miRNAs.
  • FIG. 5. Synthetic miRNA Activity across Cell Types and Against Natural Targets. Synthetic miRNAs were tested for proper strand activation and cell-type specificity to ensure that the design is robust. Four different cell types were co-transfected with synthetic miRNA and associated active and complementary strand activation. Panel A shows that different cell types respond similarly to synthetic miRNAs. Four different synthetic miRNAs were then transfected into various cell types and the expression levels of natural targets of the miRNAs were measured (Panel B).
  • FIG. 6. Schematic for screening with libraries of synthetic miRNAs or miRNA inhibitors. Synthetic miRNAs and/or miRNA inhibitors are distributed to wells of a microtiter plate. Transfection reagent and then cells are added to each well. At some time post-transfection, samples are evaluated for a phenotype. MiRNAs that induce a change that is significant relative to a negative control are selected for further study.
  • FIG. 7. Screen for miRNAs that affect cell proliferation. In 96-well plates, 8,000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection, cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% TritonX 100 and stained with propidium iodide to look at total cell number. The plates were scanned using the TTP labtech Acumen Explorer. Morphology changes in cells inhibited for mir 31. HeLa cells were transfected with Anti-mir31 and cells were fixed and stained with anti-beta actin antibody and DAPI to visualize cell morphology changes in response to inhibition to mir-31 micro-RNA function.
  • FIG. 8. Screen for miRNAs that affect cell proliferation in A549 cells. Screen for miRNA involved in cell viability in A549 cells. In 96-well plates, 8,000 A549 cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection cells were trypsinized and counted using the Guava cell counting instrument. Cell number was graphed and normalized to a gap inhibitor. In this figure, “mir1d” refers to mir-1-2.
  • FIG. 9. Screen for miRNAs that affect apoptosis in HeLa cells. Effects of miRNA inhibitors on caspase activity in HeLa. In 96-well plates, 8,000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection cells were analyzed using caspase activity assay and normalized based on esterase activity assay. In this figure, “mir1d” refers to mir-1-2.
  • FIG. 10. miRNA Expression in Lung and Colon Cancer Patients. The miRNA expression profiles of tumor vs normal adjacent tissues were compared for lung and colon cancer patients. The miRNAs are provided in rows; the patients are presented in columns. Green in the heat map shows miRNAs that are down-regulated in the tumor sample relative to the normal adjacent tissue sample, and red shows miRNAs that are up-regulated in the tumor sample relative to the normal adjacent tissue sample.
  • FIG. 11. Validation of miRNA Array Expression Results in Lung Cancer Patients. Total RNA samples from two lung cancer patients were analyzed for expression of miR-16, miR-21, miR-143, miR-145, and let-7 using Northern analysis. The graphs show the relative abundance of each miRNA (ratio of tumor:NAT) from the array analysis and Northern phosphorimager analysis.
  • FIG. 12. Some miRNAs are differentially expressed in multiple cancer types. miRNA array analysis comparing tumor and normal adjacent tissues from patients with various types of cancer was used to identify miRNAs that are differentially expressed in cancer. The percentage of patients exhibiting up- or down-regulation of a given miRNA was calculated for each cancer type. The eight that were most often differentially expressed across sample types are presented.
  • FIG. 13. Shown are miRNAs having greater than 1.5-fold expression changes between both infected vs. uninfected and sensitive vs. insensitive. On the right is a cluster of the results from 2 arrays of each model.
  • FIG. 14. Differentially expressed miRNAs in 3 preconditioned mice relative to non-treated mice.
  • FIG. 15A-C. Synthetic miRNAs that decrease cell proliferation. A. BT549 and MCF12A (breast), HeLa (cervical) and 22 Rv1 (prostate) cells were evaluated for cell proliferation. B. TE354T and TE353SK (skin), BJ (skin), and A549 (lung) cells were examined for cell proliferation. C. CRL5826 and HTB-57 (lung), Jurkats (T cell), and primary T cells were evaluated for cell proliferation.
  • FIG. 16. Synthetic miRNAs that increase cell proliferation. HeLa (cervical), 22 Rv1 (prostate), TE354T and TE353SK (skin), BJ (skin), A549 (lung), Jurkats (T cell), primary T cells, CRL5826 and HTB-57 (lung) cells were evaluated for cell proliferation.
  • FIG. 17. miRNA inhibitors that reduce cell proliferation. 22 Rv1 (prostate), TE354T (skin), MCF12a (breast), and A549 (lung) cells were evaluated for cell proliferation.
  • FIG. 18. miRNA inhibitors that increase cell proliferation. 22 Rv1 (prostate), TE354T (skin), MCF12a (breast), and A549 (lung) cells were evaluated for cell proliferation.
  • FIG. 19. miRNAs that affect cell viability. Jurkats (T cell), primary T cells, HeLa (cervical) and A549 (lung) cells were evaluated for increases and decreases in cell viability.
  • FIG. 20. miRNAs that affect apoptosis. 22 Rv1 (prostate), TE354T (skin), Jurkats (T cell), and HeLa (cervical) cells were evaluated for increases and decreases in apoptosis.
  • FIG. 21. miRNAs that affect cell viability in the presence of a therapeutic. A549 (lung) cells were evaluated for increases and decreases in cell viability in the presence and absence of TRAIL or etoposide. HTB-57 and CRL5826 (lung) and HeLa (cervical) cells were evaluated for a reduction in cell viability in the absence and presence of etoposide.
  • FIG. 22. miRNAs that affect cell cycle. BJ (skin) and HeLa (cervical) cells were evaluated for increases or decreases in the number of cells at certain phases of the cell cycle (G1, S, G2/M, DNA replication).
  • FIG. 23. Phenotypes of miRNAs with similar sequences. Comparison of related let-7 sequences and their effects on A549 and Jurkat cell proliferation. The sequences correspond to positions 6-27 of SEQ ID NO:3 (let-7a-1), 6-27 of SEQ ID NO:6 (let-7b), 11-32 of SEQ ID NO:7 (let-7c), 8-28 of SEQ ID NO:8 (let-7d), and 5-25 of SEQ ID NO:15 (let-7g).
  • FIG. 24. Genes associated with hTert regulation and miRNA sequences predicted to modulate their expression. FIG. 23 exemplifies 4 miRNAs (miR-26a, miR-147, miR-195, and miR-368) and the thTert activating gene products with which they interact.
  • DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
  • The present invention is directed to compositions and methods relating to preparation and characterization of miRNAs, as well as use of miRNAs for therapeutic, prognostic, and diagnostic applications. To overcome the problem with previous inefficient plasmid-based systems for introducing miRNA into cells, the inventors developed small, partially double-stranded RNAs that can be delivered with high efficiency to both immortalized and primary cells. The small RNAs have the same functional activities as endogenously expressed miRNAs. Because the small RNAs can be delivered to cells with much higher efficiency than can plasmids, they induce a much stronger phenotype that is easier to detect and quantify, making it possible to identify many of the functions of miRNAs in cells.
  • The inventors have also created a library of the small, double-stranded RNA molecules that can be used to introduce miRNAs into cells, as well as a library of antisense molecules that inhibit the activities of known miRNAs that are present in cells. These libraries have been used to sequentially up- or down-regulate one or more miRNAs in cells to identify those miRNAs that are critical for cellular processes like cell cycle, apoptosis, differentiation, viability, angiogenesis, metabolism, and other processes with therapeutic potential. miRNAs that regulate the expression of important genes like p53, MYC, and RAS are also being identified and characterized to further pinpoint miRNAs that might provide important intervention points for treating disease. For example, let-7 has been shown to be involved with RAS. See Johnson et al., 2005, which is hereby incorporated by reference. These processes of serially modulating miRNA activities and assaying for cellular phenotypes are collectively referred to as miRNA functional screening.
  • I. miRNA Molecules
  • MicroRNA molecules (“miRNAs”) are generally 21 to 22 nucleotides in length, though lengths of 17 and up to 25 nucleotides have been reported. The miRNAs are each processed from a longer precursor RNA molecule (“precursor miRNA”). Precursor miRNAs are transcribed from non-protein-encoding genes. The precursor miRNAs have two regions of complementarity that enables them to form a stem-loop- or fold-back-like structure, which is cleaved by an enzyme called Dicer in animals. Dicer is ribonuclease III-like nuclease. The processed miRNA is typically a portion of the stem.
  • The processed miRNA (also referred to as “mature miRNA”) become part of a large complex to down-regulate a particular target gene. Examples of animal miRNAs include those that imperfectly basepair with the target, which halts translation (Olsen et al., 1999; Seggerson et al., 2002). SiRNA molecules also are processed by Dicer, but from a long, double-stranded RNA molecule. SiRNAs are not naturally found in animal cells, but they can function in such cells in a RNA-induced silencing complex (RISC) to direct the sequence-specific cleavage of an mRNA target (Denli et al., 2003).
  • The study of endogenous miRNA molecules is described in U.S. Patent Application 60/575,743, which is hereby incorporated by reference in its entirety.
  • Synthetic miRNAs
  • miRNAs are apparently active in the cell when the mature, single-stranded RNA is bound by a protein complex that regulates the translation of mRNAs that hybridize to the miRNA. Introducing exogenous RNA molecules that affect cells in the same way as endogenously expressed miRNAs requires that a single-stranded RNA molecule of the same sequence as the endogenous mature miRNA be taken up by the protein complex that facilitates translational control. A variety of RNA molecule designs have been evaluated. Three general designs that maximize uptake of the desired single-stranded miRNA by the miRNA pathway have been identified. An RNA molecule with an miRNA sequence having at least one of the three designs is referred to as a synthetic miRNA.
  • Synthetic miRNAs of the invention comprise, in some embodiments, two RNA molecules wherein one RNA is identical to a naturally occurring, mature miRNA. The RNA molecule that is identical to a mature miRNA is referred to as the active strand. The second RNA molecule, referred to as the complementary strand, is at least partially complementary to the active strand. The active and complementary strands are hybridized to create a double-stranded RNA, called the synthetic miRNA, that is similar to the naturally occurring miRNA precursor that is bound by the protein complex immediately prior to miRNA activation in the cell. Maximizing activity of the synthetic miRNA requires maximizing uptake of the active strand and minimizing uptake of the complementary strand by the miRNA protein complex that regulates gene expression at the level of translation. The molecular designs that provide optimal miRNA activity involve modifications to the complementary strand.
  • Two designs incorporate chemical modifications in the complementary strand. The first modification involves creating a complementary RNA with a chemical group other than a phosphate or hydroxyl at its 5′ terminus. The presence of the 5′ modification apparently eliminates uptake of the complementary strand and subsequently favors uptake of the active strand by the miRNA protein complex. The 5′ modification can be any of a variety of molecules including NH2, NHCOCH3, biotin, and others.
  • The second chemical modification strategy that significantly reduces uptake of the complementary strand by the miRNA pathway is incorporating nucleotides with sugar modifications in the first 2-6 nucleotides of the complementary strand. It should be noted that the sugar modifications consistent with the second design strategy can be coupled with 5′ terminal modifications consistent with the first design strategy to further enhance synthetic miRNA activities.
  • The third synthetic miRNA design involves incorporating nucleotides in the 3′ end of the complementary strand that are not complementary to the active strand. Hybrids of the resulting active and complementary RNAs are very stable at the 3′ end of the active strand but relatively unstable at the 5′ end of the active strand. Studies with siRNAs indicate that 5′ hybrid stability is a key indicator of RNA uptake by the protein complex that supports RNA interference, which is at least related to the miRNA pathway in cells. The inventors have found that the judicious use of mismatches in the complementary RNA strand significantly enhances the activity of the synthetic miRNA.
  • MiRNA Libraries
  • A key application for the synthetic miRNAs is the identification of cellular functions for individual or groups of miRNAs. The inventors have created a library of synthetic miRNAs that can be used to sequentially introduce each of the known miRNAs into cultured cells (FIG. 6). Cell populations with each of the different synthetic miRNAs can then be assayed to identify miRNAs whose presence induces a cellular phenotype.
  • The inventors have created a library of antisense molecules that inhibit miRNA activity. The miRNA inhibitors are used to serially inhibit the activities of miRNAs in cells to identify miRNAs whose absence induces a cellular phenotype.
  • The number of different synthetic miRNAs or miRNA inhibitors in the libraries is variable. It is contemplated that there may be, be at least, or be at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 31, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 6000, 7000, 8000, 9000, 10000 or more, or any range derivable therein, different miRNA-specific molecules in the library. In specific embodiments, libraries have between 5 and 1000 different miRNA-specific molecules, between 20 and 500 different miRNA-specific molecules, between 50 and 250 different miRNA-specific molecules, or between 100 and 225 different miRNA-specific molecules. “Different” miRNA-specific molecules refers to nucleic acids that are specific to miRNAs with different sequences.
  • Synthetic miRNAs are contemplated to be made primarily of RNA, though in some embodiments, they may be RNA, nucleotide analogs, DNA, or any combination of DNA, RNA, nucleotide analogs, and PNAs.
  • As suggested above, it is contemplated that libraries of the invention may be specific for one or more miRNAs. In embodiments of the invention, a library has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 31, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 6000, 7000, 8000, 9000, 10000 or more, or any range derivable therein, different miRNAs or miRNA inhibitors. Accordingly, it is understood that the library contains one or more nucleic acids for these different miRNAs. In specific embodiments, the library is specific to human miRNAs, though libraries for multiple organisms are contemplated.
  • RNA molecules of the invention have miRNA regions or complementary regions. In specific embodiments, a synthetic miRNA or miRNA inhibitor has a sequence or complementary sequence that derives from any of SEQ ID NOs: 1-805, inclusive. It is particularly contemplated that synthetic nucleic acid molecules of the invention may be derived from any of the mature miRNA sequences in SEQ ID NOs:1-805 or their complement.
  • As discussed above, miRNAs are processed from a precursor molecule. In certain embodiments, the specific length of a mature miRNA is unknown. It is contemplated that versions of the synthetic miRNA and miRNA inhibitor libraries will include sequence that extends at least 1 to 5 nucleotides of coding sequence upstream and/or downstream of the predicted miRNA sequence. In some embodiments, molecules have up to 1, 2, 3, 4, 5, 6, 7, or more contiguous nucleotides, or any range derivable therein, that flank the sequence encoding the predominant processed miRNA on one or both sides (5′ and/or 3′ end).
  • The present invention concerns methods for creating functional profile for all of the known miRNAs. The term “functional profile” refers to a set of data regarding the cellular phenotypes that result from introducing and inhibiting miRNAs in cells using synthetic miRNA and miRNA inhibitor libraries. Functional profiles for individual miRNAs will enable identification of miRNAs with therapeutic or diagnostic potential. For instance, a functional profile for a miRNA might reveal that its absence leads to uncontrolled cell proliferation and an inability to induce apoptosis following DNA damage. Furthermore, the expression of p53 correlates with whether the miRNA is being up-regulated with a synthetic miRNA or down-regulated with a miRNA inhibitor. Based on its ties to cell proliferation, apoptosis, and p53 expression, this miRNA might be a target for cancer therapeutics.
  • In certain embodiments, methods concern identifying miRNAs indicative of a disease or condition by detecting a correlation between the activity of particular miRNAs and cellular phenotypes that coincide with a disease or condition.
  • Libraries of the invention can contain miRNA sequences from any organism having miRNAs, specifically including but not limited to, mammals such as humans, mice, and rats. Specifically contemplated are libraries having, having at least, or having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, 10000 or more different synthetic miRNAs and/or miRNA inhibitors (that is, miRNA-specific molecules having different sequences derived from different miRNA genes). Specifically contemplated are such libraries described in the previous sentence with respect to any of SEQ ID NOs:1-805, particularly those corresponding to miRNA sequences (mature sequence) or the complement thereof.
  • A. Nucleic Acids
  • The present invention concerns nucleic acid molecules that can introduce or inhibit miRNAs in cultured cells. The nucleic acids may have been produced in cells or in vitro by purified enzymes though they are preferentially produced by chemical synthesis. They may be crude or purified. The term “miRNA,” unless otherwise indicated, refers to the processed RNA, after it has been cleaved from its precursor. Table 1 indicates which SEQ ID NO corresponds to the particular precursor sequence of an miRNA and what sequences within the SEQ ID NO correspond to the mature sequence. The name of the miRNA is often abbreviated and referred to without the prefix and will be understood as such, depending on the context. Unless otherwise indicated, miRNAs referred to in the application are human sequences identified as mir-X or let-X, where X is a number and/or letter.
  • TABLE 1
    Human miRNA Sequences
    Processed Sequence
    miRNA name Precursor Relative to Precursor
    hsa-mir-1-2 SEQ ID NO: 1 53-73
    hsa-mir-1-1 SEQ ID NO: 2 46-66
    hsa-let-7a-1 SEQ ID NO: 3  6-27
    hsa-let-7a-2 SEQ ID NO: 4  5-26
    hsa-let-7a-3 SEQ ID NO: 5  4-25
    hsa-let-7b SEQ ID NO: 6  6-27
    hsa-let-7c SEQ ID NO: 7 11-32
    hsa-let-7d SEQ ID NO: 8  8-28
    hsa-let-7e SEQ ID NO: 9  8-28
    hsa-let-7f-1 SEQ ID NO: 10  7-28
    hsa-let-7f-2 SEQ ID NO: 11  8-29
    hsa-mir-7-1 SEQ ID NO: 12 24-44
    hsa-mir-7-2 SEQ ID NO: 13 32-52
    hsa-mir-7-3 SEQ ID NO: 14 31-51
    hsa-let-7g SEQ ID NO: 15  5-25
    hsa-let-7i SEQ ID NO: 16  6-24
    hsa-mir-9-1 SEQ ID NO: 17 16-38 and/or 56-76
    hsa-mir-9-2 SEQ ID NO: 18 16-38 and/or 54-74
    hsa-mir-9-3 SEQ ID NO: 19 16-38 and/or 56-76
    hsa-mir-10a SEQ ID NO: 20 22-44
    hsa-mir-10b SEQ ID NO: 21 27-48
    hsa-mir-15a SEQ ID NO: 22 14-35
    hsa-mir-15b SEQ ID NO: 23 20-41
    hsa-mir-16-1 SEQ ID NO: 24 14-35
    hsa-mir-16-2 SEQ ID NO: 25 10-31
    hsa-mir-17 SEQ ID NO: 26 14-37 and/or 51-70
    hsa-mir-18 SEQ ID NO: 27  6-27
    hsa-mir-19a SEQ ID NO: 28 49-71
    hsa-mir-19b-1 SEQ ID NO: 29 54-76
    hsa-mir-19b-2 SEQ ID NO: 30 62-84
    hsa-mir-20 SEQ ID NO: 31  8-29
    hsa-mir-21 SEQ ID NO: 32  8-29
    hsa-mir-22 SEQ ID NO: 33 53-74
    hsa-mir-23a SEQ ID NO: 34 45-65
    hsa-mir-23b SEQ ID NO: 35 58-80
    hsa-mir-24-1 SEQ ID NO: 36  6-28 and/or 44-65
    hsa-mir-24-2 SEQ ID NO: 37 50-71
    hsa-mir-25 SEQ ID NO: 38 52-73
    hsa-mir-26a-1 SEQ ID NO: 39 10-31
    hsa-mir-26b SEQ ID NO: 40 12-32
    hsa-mir-26a-2 SEQ ID NO: 41 14-35
    hsa-mir-27a SEQ ID NO: 42 51-72
    hsa-mir-27b SEQ ID NO: 43 61-80
    hsa-mir-28 SEQ ID NO: 44 14-35
    hsa-mir-29a SEQ ID NO: 45 41-62
    hsa-mir-29b-1 SEQ ID NO: 46 51-70
    hsa-mir-29b-2 SEQ ID NO: 47 52-71
    hsa-mir-29c SEQ ID NO: 48 54-75
    hsa-mir-30a SEQ ID NO: 49 47-68
    hsa-mir-30c-2 SEQ ID NO: 50  7-29
    hsa-mir-30d SEQ ID NO: 51  6-27
    hsa-mir-30b SEQ ID NO: 52 17-37
    hsa-mir-30c-1 SEQ ID NO: 53 17-39
    hsa-mir-30e SEQ ID NO: 54  2-21
    hsa-mir-31 SEQ ID NO: 55  9-29
    hsa-mir-32 SEQ ID NO: 56  6-26
    hsa-mir-33 SEQ ID NO: 57  6-24
    hsa-mir-34a SEQ ID NO: 58 22-43
    hsa-mir-34b SEQ ID NO: 59 14-35
    hsa-mir-34c SEQ ID NO: 60 13-34
    hsa-mir-92-1 SEQ ID NO: 61 48-69
    hsa-mir-92-2 SEQ ID NO: 62 48-69
    hsa-mir-93 SEQ ID NO: 63 12-33
    hsa-mir-95 SEQ ID NO: 64 49-70
    hsa-mir-96 SEQ ID NO: 65  9-30
    hsa-mir-98 SEQ ID NO: 66  2-23
    hsa-mir-99a SEQ ID NO: 67 13-34
    hsa-mir-99b SEQ ID NO: 68  7-28
    hsa-mir-100 SEQ ID NO: 69 13-34
    hsa-mir-101-1 SEQ ID NO: 70 47-68
    hsa-mir-101-2 SEQ ID NO: 71 49-70
    hsa-mir-103-2 SEQ ID NO: 72 48-70
    hsa-mir-103-1 SEQ ID NO: 73 48-70
    hsa-mir-105-1 SEQ ID NO: 74 13-32
    hsa-mir-105-2 SEQ ID NO: 75 13-32
    hsa-mir-106a SEQ ID NO: 76 13-36
    hsa-mir-106b SEQ ID NO: 77 12-32
    hsa-mir-107 SEQ ID NO: 78 50-72
    hsa-mir-122a SEQ ID NO: 79 15-37
    hsa-mir-124a-1 SEQ ID NO: 80 52-73
    hsa-mir-124a-2 SEQ ID NO: 81 61-82
    hsa-mir-124a-3 SEQ ID NO: 82 52-73
    hsa-mir-125b-1 SEQ ID NO: 83 15-36
    hsa-mir-125a SEQ ID NO: 84 15-37
    hsa-mir-125b-2 SEQ ID NO: 85 17-38
    hsa-mir-126 SEQ ID NO: 86 15-35 and/or 52-72
    hsa-mir-127 SEQ ID NO: 87 57-78
    hsa-mir-128a SEQ ID NO: 88 50-71
    hsa-mir-128b SEQ ID NO: 89 52-73
    hsa-mir-129-2 SEQ ID NO: 90 15-35
    hsa-mir-130a SEQ ID NO: 91 55-74
    hsa-mir-130b SEQ ID NO: 92 51-72
    hsa-mir-132 SEQ ID NO: 93 59-80
    hsa-mir-133a-1 SEQ ID NO: 94 54-75
    hsa-mir-133a-2 SEQ ID NO: 95 60-81
    hsa-mir-133b SEQ ID NO: 96 67-87
    hsa-mir-134 SEQ ID NO: 97  8-28
    hsa-mir-135a-1 SEQ ID NO: 98 17-39
    hsa-mir-135a-2 SEQ ID NO: 99 23-45
    hsa-mir-135b SEQ ID NO: 100 16-37
    hsa-mir-136 SEQ ID NO: 101 15-37
    hsa-mir-137 SEQ ID NO: 102 60-81
    hsa-mir-138-2 SEQ ID NO: 103 10-26
    hsa-mir-138-1 SEQ ID NO: 104 23-39
    hsa-mir-139 SEQ ID NO: 105  7-24
    hsa-mir-140 SEQ ID NO: 106 24-44
    hsa-mir-141 SEQ ID NO: 107 60-80
    hsa-mir-142 SEQ ID NO: 108 16-35 and/or 52-74
    hsa-mir-143 SEQ ID NO: 109 61-82
    hsa-mir-144 SEQ ID NO: 110 52-73
    hsa-mir-145 SEQ ID NO: 111 16-39
    hsa-mir-146 SEQ ID NO: 112 21-42
    hsa-mir-147 SEQ ID NO: 113 47-66
    hsa-mir-148a SEQ ID NO: 114 44-65
    hsa-mir-148b SEQ ID NO: 115 63-84
    hsa-mir-149 SEQ ID NO: 116 15-36
    hsa-mir-150 SEQ ID NO: 117 16-37
    hsa-mir-151 SEQ ID NO: 118 46-67
    hsa-mir-152 SEQ ID NO: 119 54-74
    hsa-mir-153-1 SEQ ID NO: 120 54-73
    hsa-mir-153-2 SEQ ID NO: 121 53-72
    hsa-mir-154 SEQ ID NO: 122 15-36
    hsa-mir-155 SEQ ID NO: 123  4-25
    hsa-mir-181a SEQ ID NO: 124 39-61
    hsa-mir-181b-1 SEQ ID NO: 125 36-59
    hsa-mir-181c SEQ ID NO: 126 27-48
    hsa-mir-181b-2 SEQ ID NO: 127 16-39
    hsa-mir-182 SEQ ID NO: 128 23-44 and/or 67-87
    hsa-mir-183 SEQ ID NO: 129 27-49
    hsa-mir-184 SEQ ID NO: 130 53-74
    hsa-mir-185 SEQ ID NO: 131 15-32
    hsa-mir-186 SEQ ID NO: 132 15-37
    hsa-mir-187 SEQ ID NO: 133 71-91
    hsa-mir-188 SEQ ID NO: 134 15-36
    hsa-mir-190 SEQ ID NO: 135 15-36
    hsa-mir-191 SEQ ID NO: 136 16-37
    hsa-mir-192 SEQ ID NO: 137 24-44
    hsa-mir-193 SEQ ID NO: 138 55-75
    hsa-mir-194-1 SEQ ID NO: 139 15-36
    hsa-mir-194-2 SEQ ID NO: 140 15-36
    hsa-mir-195 SEQ ID NO: 141 15-35
    hsa-mir-196-1 SEQ ID NO: 142  7-27
    hsa-mir-196-2 SEQ ID NO: 143 25-45
    hsa-mir-197 SEQ ID NO: 144 48-69
    hsa-mir-198 SEQ ID NO: 145  6-24
    hsa-mir-199a-1 SEQ ID NO: 146  6-28 and/or 46-67
    hsa-mir-199a-2 SEQ ID NO: 147 31-53 and/or 69-90
    hsa-mir-199b SEQ ID NO: 148 26-48
    hsa-mir-200b SEQ ID NO: 149 54-77
    hsa-mir-200c SEQ ID NO: 150 45-66
    hsa-mir-200a SEQ ID NO: 151 54-75
    hsa-mir-203 SEQ ID NO: 152 65-86
    hsa-mir-204 SEQ ID NO: 153 33-54
    hsa-mir-205 SEQ ID NO: 154 34-55
    hsa-mir-206 SEQ ID NO: 155 53-74
    hsa-mir-208 SEQ ID NO: 156 44-65
    hsa-mir-210 SEQ ID NO: 157 66-86
    hsa-mir-211 SEQ ID NO: 158 26-47
    hsa-mir-212 SEQ ID NO: 159 71-91
    hsa-mir-213 SEQ ID NO: 160 24-46 and/or 64-85
    hsa-mir-214 SEQ ID NO: 161 71-91
    hsa-mir-215 SEQ ID NO: 162 27-47
    hsa-mir-216 SEQ ID NO: 163 19-39
    hsa-mir-217 SEQ ID NO: 164 35-58
    hsa-mir-218-1 SEQ ID NO: 165 25-45
    hsa-mir-218-2 SEQ ID NO: 166 25-45
    hsa-mir-219-1 SEQ ID NO: 167 21-41
    hsa-mir-219-2 SEQ ID NO: 168 19-39
    hsa-mir-220 SEQ ID NO: 169 23-43
    hsa-mir-221 SEQ ID NO: 170 65-87
    hsa-mir-222 SEQ ID NO: 171 69-92
    hsa-mir-223 SEQ ID NO: 172 68-88
    hsa-mir-224 SEQ ID NO: 173  8-30
    hsa-mir-296 SEQ ID NO: 174 14-34
    hsa-mir-299 SEQ ID NO: 175  7-28
    hsa-mir-301 SEQ ID NO: 176 51-73
    hsa-mir-302 SEQ ID NO: 177 44-66
    hsa-mir-320 SEQ ID NO: 178 48-70
    hsa-mir-321 SEQ ID NO: 179 10-30
    hsa-mir-323 SEQ ID NO: 180 50-71
    hsa-mir-324 SEQ ID NO: 181 16-38 and/or 51-72
    hsa-mir-326 SEQ ID NO: 182 60-79
    hsa-mir-328 SEQ ID NO: 183 48-69
    hsa-mir-330 SEQ ID NO: 184 57-79
    hsa-mir-331 SEQ ID NO: 185 61-81
    hsa-mir-335 SEQ ID NO: 186 16-38
    hsa-mir-337 SEQ ID NO: 187 56-78
    hsa-mir-338 SEQ ID NO: 188 42-64
    hsa-mir-339 SEQ ID NO: 189 15-35
    hsa-mir-340 SEQ ID NO: 190 58-80
    hsa-mir-342 SEQ ID NO: 191 61-84
    hsa-mir-345 SEQ ID NO: 573 17-37
    hsa-mir-346 SEQ ID NO: 574  4-26
    hsa-mir-367 SEQ ID NO: 575 44-65
    hsa-mir-368 SEQ ID NO: 576 44-65
    hsa-mir-369 SEQ ID NO: 577 44-64
    hsa-mir-370 SEQ ID NO: 578 48-68
    hsa-mir-371 SEQ ID NO: 579 44-64
    hsa-mir-372 SEQ ID NO: 580 42-64
    hsa-mir-373 SEQ ID NO: 581 44-66
    hsa-mir-374 SEQ ID NO: 582 12-33
    hsa-mir-375 SEQ ID NO: 677 40-61
    hsa-mir-376a SEQ ID NO: 678 44-64
    hsa-mir-377 SEQ ID NO: 679 45-66
    hsa-mir-378 SEQ ID NO: 680  5-26 and 44-65
    hsa-mir-379 SEQ ID NO: 681  6-24
    hsa-mir-380 SEQ ID NO: 682  5-26 and 40-61
    hsa-mir-381 SEQ ID NO: 683 49-70
    hsa-mir-382 SEQ ID NO: 684 11-32
    hsa-mir-383 SEQ ID NO: 685  7-28
    hsa-mir-384 SEQ ID NO: 686 57-76
    hsa-mir-422a SEQ ID NO: 687 11-32
    hsa-mir-423 SEQ ID NO: 688 53-74
    hsa-mir-424 SEQ ID NO: 689 11-32
    hsa-mir-425 SEQ ID NO: 690 55-75
    hsa-mir-448 SEQ ID NO: 691 71-92
    hsa-mir-429 SEQ ID NO: 692 51-72
    hsa-mir-449 SEQ ID NO: 693 16-37
    hsa-mir-450-1 SEQ ID NO: 694 17-38
    hsa-mir-450-2 SEQ ID NO: 704 22-43
    hsa-mir-451 SEQ ID NO: 705 17-39
    hsa-mir-452 SEQ ID NO: 706 17-38
    hsa-mir-453 SEQ ID NO: 707 43-64
    hsa-mir-455 SEQ ID NO: 708 16-37
    hsa-mir-483 SEQ ID NO: 709 48-70
    hsa-mir-484 SEQ ID NO: 710  2-23
    hsa-mir-485 SEQ ID NO: 711  9-30
    hsa-mir-486 SEQ ID NO: 712  4-25
    hsa-mir-487 SEQ ID NO: 713 49-70
    hsa-mir-488 SEQ ID NO: 714 14-34
    hsa-mir-489 SEQ ID NO: 715 51-73
    hsa-mir-490 SEQ ID NO: 716 76-97
    hsa-mir-491 SEQ ID NO: 717 16-38
    hsa-mir-492 SEQ ID NO: 718 30-52
    hsa-mir-493 SEQ ID NO: 719 16-37
    hsa-mir-494 SEQ ID NO: 720 48-71
    hsa-mir-495 SEQ ID NO: 721 50-72
    hsa-mir-496 SEQ ID NO: 722 61-77
    hsa-mir-497 SEQ ID NO: 723 24-44
    hsa-mir-498 SEQ ID NO: 724 34-56
    hsa-mir-499 SEQ ID NO: 725 33-55
    hsa-mir-500 SEQ ID NO: 726 52-73
    hsa-mir-501 SEQ ID NO: 727 14-35
    hsa-mir-502 SEQ ID NO: 728  1-21
    hsa-mir-503 SEQ ID NO: 729  6-28
    hsa-mir-504 SEQ ID NO: 730 13-33
    hsa-mir-505 SEQ ID NO: 731 52-73
    hsa-mir-506 SEQ ID NO: 732 71-91
    hsa-mir-507 SEQ ID NO: 733 56-76
    hsa-mir-508 SEQ ID NO: 734 61-83
    hsa-mir-509 SEQ ID NO: 735 55-77
    hsa-mir-510 SEQ ID NO: 736 10-32
    hsa-mir-511-1 SEQ ID NO: 737 16-36
    hsa-mir-511-2 SEQ ID NO: 738 16-36
    hsa-mir-512-1 SEQ ID NO: 739 14-36
    hsa-mir-512-2 SEQ ID NO: 740 20-42
    hsa-mir-513-1 SEQ ID NO: 741 37-58
    hsa-mir-513-2 SEQ ID NO: 742 36-57
    hsa-mir-514-1 SEQ ID NO: 743 39-58
    hsa-mir-514-2 SEQ ID NO: 744 39-58
    hsa-mir-514-3 SEQ ID NO: 745 39-58
    hsa-mir-515-1 SEQ ID NO: 746 14-37
    hsa-mir-515-2 SEQ ID NO: 747 14-37
    hsa-mir-516-1 SEQ ID NO: 748 61-78
    hsa-mir-516-2 SEQ ID NO: 749 61-78
    hsa-mir-516-3 SEQ ID NO: 750 15-37
    hsa-mir-516-4 SEQ ID NO: 751 15-37
    hsa-mir-517a SEQ ID NO: 752 15-36
    hsa-mir-517b SEQ ID NO: 753  6-27
    hsa-mir-517c SEQ ID NO: 754 20-41
    hsa-mir-518a-1 SEQ ID NO: 755 14-34
    hsa-mir-518a-2 SEQ ID NO: 756 15-34
    hsa-mir-518b SEQ ID NO: 757 51-72
    hsa-mir-518c SEQ ID NO: 758 24-46
    hsa-mir-518d SEQ ID NO: 759 16-36
    hsa-mir-518e SEQ ID NO: 760 54-75
    hsa-mir-518f SEQ ID NO: 761 16-38
    hsa-mir-519a-1 SEQ ID NO: 762 15-38
    hsa-mir-519a-2 SEQ ID NO: 763 54-78
    hsa-mir-519b SEQ ID NO: 764 13-36
    hsa-mir-519c SEQ ID NO: 765 16-39
    hsa-mir-519d SEQ ID NO: 766 54-76
    hsa-mir-519e SEQ ID NO: 767 14-35
    hsa-mir-520a SEQ ID NO: 768 15-35
    hsa-mir-520b SEQ ID NO: 769 41-61
    hsa-mir-520c SEQ ID NO: 770 16-36
    hsa-mir-520d SEQ ID NO: 771 15-37
    hsa-mir-520e SEQ ID NO: 772 54-74
    hsa-mir-520f SEQ ID NO: 773 55-76
    hsa-mir-520g SEQ ID NO: 774 55-78
    hsa-mir-520h SEQ ID NO: 775 55-76
    hsa-mir-521-1 SEQ ID NO: 776 54-75
    hsa-mir-521-2 SEQ ID NO: 777 54-75
    hsa-mir-522 SEQ ID NO: 778 16-39
    hsa-mir-523 SEQ ID NO: 779 16-39
    hsa-mir-524 SEQ ID NO: 780 16-37
    hsa-mir-525 SEQ ID NO: 781 15-35
    hsa-mir-526a-1 SEQ ID NO: 782 15-35
    hsa-mir-526a-2 SEQ ID NO: 783  7-27
    hsa-mir-526b SEQ ID NO: 784 14-37
    hsa-mir-527 SEQ ID NO: 785 14-34
    ambi-mir-7100 SEQ ID NO: 803
    mir-526b* SEQ ID NO: 804
    mir-520a* SEQ ID NO: 805
  • TABLE 2
    Mouse miRNA Sequences
    Processed Sequence
    miRNA name Precursor Relative to Precursor
    mmu-mir-1-1 SEQ ID NO: 192 49-69
    mmu-mir-1-2 SEQ ID NO: 193 47-67
    mmu-let-7g SEQ ID NO: 194  7-27
    mmu-let-7i SEQ ID NO: 195  6-24
    mmu-let-7d SEQ ID NO: 196 16-36 + 70-91
    mmu-let-7a-1 SEQ ID NO: 197 13-34
    mmu-let-7a-2 SEQ ID NO: 198 17-38
    mmu-let-7b SEQ ID NO: 199  7-28
    mmu-let-7c-1 SEQ ID NO: 200 16-37
    mmu-let-7c-2 SEQ ID NO: 201 14-35
    mmu-let-7e SEQ ID NO: 202 15-35
    mmu-let-7f-1 SEQ ID NO: 203  8-29
    mmu-let-7f-2 SEQ ID NO: 204  8-29
    mmu-mir-7-1 SEQ ID NO: 205 24-44
    mmu-mir-7-2 SEQ ID NO: 206 19-39
    mmu-mir-7b SEQ ID NO: 207 30-50
    mmu-mir-9-2 SEQ ID NO: 208  8-30 and/or 46-66
    mmu-mir-9-1 SEQ ID NO: 209 16-38 and/or 56-76
    mmu-mir-9-3 SEQ ID NO: 210 16-38 and/or 56-76
    mmu-mir-10b SEQ ID NO: 211  7-28
    mmu-mir-10a-1 SEQ ID NO: 212 22-44
    mmu-mir-10a-2 SEQ ID NO: 213 22-44
    mmu-mir-15b SEQ ID NO: 214  4-25
    mmu-mir-15a SEQ ID NO: 215 15-36
    mmu-mir-16-1 SEQ ID NO: 216 16-37
    mmu-mir-16-2 SEQ ID NO: 217 17-38
    mmu-mir-17 SEQ ID NO: 218 14-37 and/or 51-70
    mmu-mir-18 SEQ ID NO: 219 17-38
    mmu-mir-19b-2 SEQ ID NO: 220 54-76
    mmu-mir-19a SEQ ID NO: 221 49-71
    mmu-mir-19b-1 SEQ ID NO: 222 54-76
    mmu-mir-20 SEQ ID NO: 223 27-49
    mmu-mir-21 SEQ ID NO: 224 18-39
    mmu-mir-22 SEQ ID NO: 225 57-78
    mmu-mir-23b SEQ ID NO: 226 46-68
    mmu-mir-23a SEQ ID NO: 227 46-66
    mmu-mir-24-1 SEQ ID NO: 228  6-28 and/or 44-65
    mmu-mir-24-2 SEQ ID NO: 229 61-82
    mmu-mir-25 SEQ ID NO: 230 52-73
    mmu-mir-26a-1 SEQ ID NO: 231 16-37
    mmu-mir-26b SEQ ID NO: 232 15-36
    mmu-mir-26a-2 SEQ ID NO: 233 14-35
    mmu-mir-27b SEQ ID NO: 234 49-68
    mmu-mir-27a SEQ ID NO: 235 56-76
    mmu-mir-28 SEQ ID NO: 236 14-35
    mmu-mir-29b-1 SEQ ID NO: 237 47-68
    mmu-mir-29a SEQ ID NO: 238 53-74
    mmu-mir-29c SEQ ID NO: 239 54-75
    mmu-mir-29b-2 SEQ ID NO: 240 52-73
    mmu-mir-30a SEQ ID NO: 241 47-68
    mmu-mir-30b SEQ ID NO: 242  2-22
    mmu-mir-30e SEQ ID NO: 243  2-21
    mmu-mir-30c-1 SEQ ID NO: 244 17-39
    mmu-mir-30c-2 SEQ ID NO: 245 14-36
    mmu-mir-30d SEQ ID NO: 246 12-33
    mmu-mir-31 SEQ ID NO: 247 28-49
    mmu-mir-32 SEQ ID NO: 248  6-26
    mmu-mir-33 SEQ ID NO: 249  6-24
    mmu-mir-34c SEQ ID NO: 250 13-35
    mmu-mir-34b SEQ ID NO: 251 13-35
    mmu-mir-34a SEQ ID NO: 252 20-42
    mmu-mir-92-2 SEQ ID NO: 253 55-75
    mmu-mir-92-1 SEQ ID NO: 254 50-70
    mmu-mir-93 SEQ ID NO: 255 15-37
    mmu-mir-96 SEQ ID NO: 256 24-46
    mmu-mir-98 SEQ ID NO: 257  2-23
    mmu-mir-99a SEQ ID NO: 258  6-25
    mmu-mir-99b SEQ ID NO: 259  7-28
    mmu-mir-100 SEQ ID NO: 260 13-34
    mmu-mir-101 SEQ ID NO: 261 38-57
    mmu-mir-101b SEQ ID NO: 262 61-82
    mmu-mir-103-1 SEQ ID NO: 263 52-74
    mmu-mir-103-2 SEQ ID NO: 264 52-74
    mmu-mir-106a SEQ ID NO: 265  5-26
    mmu-mir-106b SEQ ID NO: 266 12-32
    mmu-mir-107 SEQ ID NO: 267 52-74
    mmu-mir-122a SEQ ID NO: 268  6-28
    mmu-mir-124a-3 SEQ ID NO: 269 43-64
    mmu-mir-124a-1 SEQ ID NO: 270 52-73
    mmu-mir-124a-2 SEQ ID NO: 271 61-82
    mmu-mir-125a SEQ ID NO: 272  6-28
    mmu-mir-125b-2 SEQ ID NO: 273  7-28
    mmu-mir-125b-1 SEQ ID NO: 274 15-36
    mmu-mir-126 SEQ ID NO: 275  9-29 and/or 46-66
    mmu-mir-127 SEQ ID NO: 276 43-64
    mmu-mir-128a SEQ ID NO: 277 44-65
    mmu-mir-128b SEQ ID NO: 278 48-69
    mmu-mir-129-1 SEQ ID NO: 279  6-27
    mmu-mir-129-2 SEQ ID NO: 280 15-36
    mmu-mir-130a SEQ ID NO: 281 42-61
    mmu-mir-130b SEQ ID NO: 282 51-72
    mmu-mir-132 SEQ ID NO: 283 42-63
    mmu-mir-133a-1 SEQ ID NO: 284 44-65
    mmu-mir-133a-2 SEQ ID NO: 285 60-81
    mmu-mir-133b SEQ ID NO: 286 67-87
    mmu-mir-134 SEQ ID NO: 287  7-27
    mmu-mir-135a-1 SEQ ID NO: 288 17-39
    mmu-mir-135b SEQ ID NO: 289 16-37
    mmu-mir-135a-2 SEQ ID NO: 290 23-45
    mmu-mir-136 SEQ ID NO: 291  5-27
    mmu-mir-137 SEQ ID NO: 292 46-67
    mmu-mir-138-2 SEQ ID NO: 293  2-18
    mmu-mir-138-1 SEQ ID NO: 294 23-39
    mmu-mir-139 SEQ ID NO: 295  7-24
    mmu-mir-140 SEQ ID NO: 296  7-27
    mmu-mir-141 SEQ ID NO: 297 49-69
    mmu-mir-142 SEQ ID NO: 298 4-23 and/or 40-61
    mmu-mir-143 SEQ ID NO: 299 40-61
    mmu-mir-144 SEQ ID NO: 300 43-64
    mmu-mir-145 SEQ ID NO: 301  7-30
    mmu-mir-146 SEQ ID NO: 302  6-27
    mmu-mir-148a SEQ ID NO: 303 61-82
    mmu-mir-149 SEQ ID NO: 304  4-25
    mmu-mir-150 SEQ ID NO: 305  6-27
    mmu-mir-151 SEQ ID NO: 306 43-63
    mmu-mir-152 SEQ ID NO: 307 47-67
    mmu-mir-153 SEQ ID NO: 308 44-63
    mmu-mir-154 SEQ ID NO: 309  6-27
    mmu-mir-155 SEQ ID NO: 310  4-25
    mmu-mir-181a SEQ ID NO: 311  7-29
    mmu-mir-181b-1 SEQ ID NO: 312 12-35
    mmu-mir-181c SEQ ID NO: 313 17-38
    mmu-mir-181b-2 SEQ ID NO: 314 16-39
    mmu-mir-182 SEQ ID NO: 315  7-28
    mmu-mir-183 SEQ ID NO: 316  6-28
    mmu-mir-184 SEQ ID NO: 317 45-66
    mmu-mir-185 SEQ ID NO: 318  7-24
    mmu-mir-186 SEQ ID NO: 319  7-29
    mmu-mir-187 SEQ ID NO: 320 40-61
    mmu-mir-188 SEQ ID NO: 321  6-27
    mmu-mir-190 SEQ ID NO: 322  6-27
    mmu-mir-191 SEQ ID NO: 323  7-28
    mmu-mir-192 SEQ ID NO: 324 14-31
    mmu-mir-193 SEQ ID NO: 325 41-61
    mmu-mir-194-1 SEQ ID NO: 326  7-28
    mmu-mir-194-2 SEQ ID NO: 327 16-37
    mmu-mir-195 SEQ ID NO: 328  1-21
    mmu-mir-196-1 SEQ ID NO: 329 24-44
    mmu-mir-196-2 SEQ ID NO: 330 16-36
    mmu-mir-199a-1 SEQ ID NO: 331  6-28 and/or 45-66
    mmu-mir-199a-2 SEQ ID NO: 332 31-53 and/or 69-90
    mmu-mir-199b SEQ ID NO: 333 26-48
    mmu-mir-200b SEQ ID NO: 334 45-67
    mmu-mir-200a SEQ ID NO: 335 54-75
    mmu-mir-200c SEQ ID NO: 336 46-67
    mmu-mir-201 SEQ ID NO: 337  6-26
    mmu-mir-202 SEQ ID NO: 338 45-66
    mmu-mir-203 SEQ ID NO: 339 49-69
    mmu-mir-204 SEQ ID NO: 340  6-28
    mmu-mir-205 SEQ ID NO: 341  7-28
    mmu-mir-206 SEQ ID NO: 342 46-67
    mmu-mir-207 SEQ ID NO: 343 52-74
    mmu-mir-208 SEQ ID NO: 344 50-71
    mmu-mir-210 SEQ ID NO: 345 66-86
    mmu-mir-211 SEQ ID NO: 346 26-47
    mmu-mir-212 SEQ ID NO: 347 56-76
    mmu-mir-213 SEQ ID NO: 348 14-36 and/or 54-75
    mmu-mir-214 SEQ ID NO: 349 71-91
    mmu-mir-215 SEQ ID NO: 350 30-50
    mmu-mir-216 SEQ ID NO: 351  7-27
    mmu-mir-217 SEQ ID NO: 352 34-57
    mmu-mir-218-2 SEQ ID NO: 353 25-45
    mmu-mir-219-1 SEQ ID NO: 354 21-41
    mmu-mir-219-2 SEQ ID NO: 355 19-39
    mmu-mir-221 SEQ ID NO: 356 60-81
    mmu-mir-222 SEQ ID NO: 357 49-71
    mmu-mir-223 SEQ ID NO: 358 68-88
    mmu-mir-224 SEQ ID NO: 359  8-30
    mu-miR-290 SEQ ID NO: 360 15-37
    mmu-mir-291 SEQ ID NO: 361 14-35 and/or 50-72
    mmu-mir-292 SEQ ID NO: 362 12-33 and/or 51-73
    mmu-mir-293 SEQ ID NO: 363 48-69
    mmu-mir-294 SEQ ID NO: 364 51-72
    mmu-mir-295 SEQ ID NO: 365 43-65
    mmu-mir-296 SEQ ID NO: 366 13-33
    mmu-mir-297-1 SEQ ID NO: 367 15-35
    mmu-mir-297-2 SEQ ID NO: 368 36-56
    mmu-mir-298 SEQ ID NO: 369 11-32
    mmu-mir-299 SEQ ID NO: 370  7-28
    mmu-mir-300 SEQ ID NO: 371 51-72
    mmu-mir-301 SEQ ID NO: 372 51-73
    mmu-mir-302 SEQ ID NO: 373 44-66
    mmu-mir-320 SEQ ID NO: 374 48-70
    mmu-mir-321 SEQ ID NO: 375 10-30
    mmu-mir-323 SEQ ID NO: 376 50-71
    mmu-mir-324 SEQ ID NO: 377 18-40 and/or 53-74
    mmu-mir-325 SEQ ID NO: 378 16-38
    mmu-mir-326 SEQ ID NO: 379 60-80
    mmu-mir-328 SEQ ID NO: 380 61-82
    mmu-mir-329 SEQ ID NO: 381 61-82
    mmu-mir-330 SEQ ID NO: 382 61-83
    mmu-mir-331 SEQ ID NO: 383 61-81
    mmu-mir-337 SEQ ID NO: 384 61-83
    mmu-mir-338 SEQ ID NO: 385 61-83
    mmu-mir-339 SEQ ID NO: 386 16-36
    mmu-mir-340 SEQ ID NO: 387 61-83
    mmu-mir-341 SEQ ID NO: 388 61-81
    mmu-mir-342 SEQ ID NO: 389 61-84
    mmu-mir-344 SEQ ID NO: 390 61-83
    mmu-mir-345 SEQ ID NO: 391 16-36
    mmu-mir-346 SEQ ID NO: 392 16-38
    mmu-mir-350 SEQ ID NO: 393 61-84
    mmu-mir-351 SEQ ID NO: 583 16-39
    mmu-mir-370 SEQ ID NO: 584 48-70
    mmu-mir-376a SEQ ID NO: 585 44-64
    mmu-mir-376b SEQ ID NO: 586 51-72
    mmu-mir-380 SEQ ID NO: 587 40-61
    mmu-mir-409 SEQ ID NO: 588 47-69
    mmu-mir-410 SEQ ID NO: 589 50-71
    mmu-mir-411 SEQ ID NO: 590 56-78
    mmu-mir-412 SEQ ID NO: 591 50-72
    mmu-mir-425 SEQ ID NO: 695 54-74
    mmu-mir-429 SEQ ID NO: 696 51-72
    mmu-mir-448 SEQ ID NO: 697 72-93
    mmu-mir-449 SEQ ID NO: 698 16-37
    mmu-mir-450 SEQ ID NO: 699 17-38
    mmu-mir-451 SEQ ID NO: 786 17-38
    mmu-mir-452 SEQ ID NO: 787 17-38
    mmu-mir-463 SEQ ID NO: 788  4-24
    mmu-mir-464 SEQ ID NO: 789 47-69
    mmu-mir-465 SEQ ID NO: 790  5-27
    mmu-mir-466 SEQ ID NO: 791 51-73
    mmu-mir-467 SEQ ID NO: 792 50-71
    mmu-mir-468 SEQ ID NO: 793 53-75
    mmu-mir-469 SEQ ID NO: 794  6-31
    mmu-mir-470 SEQ ID NO: 795  9-29
    mmu-mir-471 SEQ ID NO: 796  7-29
    mmu-mir-483 SEQ ID NO: 797 45-67
    mmu-mir-484 SEQ ID NO: 798  2-23
    mmu-mir-485 SEQ ID NO: 799  9-30
    mmu-mir-486 SEQ ID NO: 800  4-25
  • TABLE 3
    Rat miRNA Sequences
    Processed Sequence
    miRNA name Precursor Relative to Precursor
    rno-let-7d SEQ ID NO: 394 14-34 and/or 68-89
    rno-mir-7-1 SEQ ID NO: 395 19-39 and/or 61-82
    rno-let-7a-1 SEQ ID NO: 396 13-34
    rno-let-7a-2 SEQ ID NO: 397 17-38
    rno-let-7b SEQ ID NO: 398  7-28
    rno-let-7c-1 SEQ ID NO: 399 16-37
    rno-let-7c-2 SEQ ID NO: 400 14-35
    rno-let-7e SEQ ID NO: 401 15-35
    rno-let-7f-1 SEQ ID NO: 402  8-29
    rno-let-7f-2 SEQ ID NO: 403  8-29
    rno-let-7i SEQ ID NO: 404  6-24
    rno-mir-7-2 SEQ ID NO: 405 19-39
    rno-mir-7b SEQ ID NO: 406 29-49
    rno-mir-9-1 SEQ ID NO: 407 16-38
    rno-mir-9-3 SEQ ID NO: 408 16-38
    rno-mir-9-2 SEQ ID NO: 409 16-38
    rno-mir-10a SEQ ID NO: 410 22-44
    rno-mir-10b SEQ ID NO: 411 26-47
    rno-mir-15b SEQ ID NO: 412 20-41
    rno-mir-16 SEQ ID NO: 413 17-38
    rno-mir-17 SEQ ID NO: 414 14-37
    rno-mir-18 SEQ ID NO: 415 17-38
    rno-mir-19b-1 SEQ ID NO: 416 54-76
    rno-mir-19b-2 SEQ ID NO: 417 62-84
    rno-mir-19a SEQ ID NO: 418 49-71
    rno-mir-20 SEQ ID NO: 419 16-38 and/or 52-72
    rno-mir-21 SEQ ID NO: 420 18-39
    rno-mir-22 SEQ ID NO: 421 57-78
    rno-mir-23a SEQ ID NO: 422 46-66
    rno-mir-23b SEQ ID NO: 423 58-80
    rno-mir-24-1 SEQ ID NO: 424 44-65
    rno-mir-24-2 SEQ ID NO: 425 61-82
    rno-mir-25 SEQ ID NO: 426 52-73
    rno-mir-26a SEQ ID NO: 427 16-37
    rno-mir-26b SEQ ID NO: 428 15-36
    rno-mir-27b SEQ ID NO: 429 61-80
    rno-mir-27a SEQ ID NO: 430 56-76
    rno-mir-28 SEQ ID NO: 431 14-35
    rno-mir-29b-2 SEQ ID NO: 432 52-73
    rno-mir-29a SEQ ID NO: 433 53-74
    rno-mir-29b-1 SEQ ID NO: 434 51-72
    rno-mir-29c SEQ ID NO: 435 54-75
    rno-mir-30c-1 SEQ ID NO: 436 17-39
    rno-mir-30e SEQ ID NO: 437  2-21
    rno-mir-30b SEQ ID NO: 438 16-36
    rno-mir-30d SEQ ID NO: 439 12-33
    rno-mir-30a SEQ ID NO: 440 47-68
    rno-mir-30c-2 SEQ ID NO: 441 14-36
    rno-mir-31 SEQ ID NO: 442 28-49
    rno-mir-32 SEQ ID NO: 443  6-26
    rno-mir-33 SEQ ID NO: 444  6-24
    rno-mir-34b SEQ ID NO: 445 13-35
    rno-mir-34c SEQ ID NO: 446 13-35
    rno-mir-34a SEQ ID NO: 447 20-42
    rno-mir-92-1 SEQ ID NO: 448 48-68
    rno-mir-92-2 SEQ ID NO: 449 55-75
    rno-mir-93 SEQ ID NO: 450 15-37
    rno-mir-96 SEQ ID NO: 451 24-46
    rno-mir-98 SEQ ID NO: 452  2-23
    rno-mir-99a SEQ ID NO: 453 13-34
    rno-mir-99b SEQ ID NO: 454  7-28
    rno-mir-100 SEQ ID NO: 455 13-34
    rno-mir-101b SEQ ID NO: 456 61-82
    rno-mir-101 SEQ ID NO: 457 47-68
    rno-mir-103-2 SEQ ID NO: 458 52-74
    rno-mir-103-1 SEQ ID NO: 459 52-74
    rno-mir-106b SEQ ID NO: 460 12-32
    rno-mir-107 SEQ ID NO: 461 52-74
    rno-mir-122a SEQ ID NO: 462 15-37
    rno-mir-124a-3 SEQ ID NO: 463 52-73
    rno-mir-124a-1 SEQ ID NO: 464 52-73
    rno-mir-124a-2 SEQ ID NO: 465 61-82
    rno-mir-125a SEQ ID NO: 466 15-37
    rno-mir-125b-1 SEQ ID NO: 467 15-36
    rno-mir-125b-2 SEQ ID NO: 468 17-38
    rno-mir-126 SEQ ID NO: 469 9-29 and/or 46-66
    rno-mir-127 SEQ ID NO: 470 57-78
    rno-mir-128a SEQ ID NO: 471 50-71
    rno-mir-128b SEQ ID NO: 472 52-73
    rno-mir-129-2 SEQ ID NO: 473 19-40 and/or 61-82
    rno-mir-129-1 SEQ ID NO: 474  6-27
    rno-mir-130a SEQ ID NO: 475 55-74
    rno-mir-130b SEQ ID NO: 476 51-72
    rno-mir-132 SEQ ID NO: 477 59-80
    rno-mir-133a SEQ ID NO: 478 53-74
    rno-mir-134 SEQ ID NO: 479  8-28
    rno-mir-135b SEQ ID NO: 480 16-37
    rno-mir-135a SEQ ID NO: 481 23-45
    rno-mir-136 SEQ ID NO: 482 15-37
    rno-mir-137 SEQ ID NO: 483 60-81
    rno-mir-138-2 SEQ ID NO: 484  9-25
    rno-mir-138-1 SEQ ID NO: 485 23-39
    rno-mir-139 SEQ ID NO: 486  7-24
    rno-mir-140 SEQ ID NO: 487 23-43 and/or 61-84
    rno-mir-141 SEQ ID NO: 488 59-79
    rno-mir-142 SEQ ID NO: 489 16-35 and/or 52-74
    rno-mir-143 SEQ ID NO: 490 60-81
    rno-mir-144 SEQ ID NO: 491 50-71
    rno-mir-145 SEQ ID NO: 492 16-39
    rno-mir-146 SEQ ID NO: 493 17-38
    rno-mir-148b SEQ ID NO: 494 61-82
    rno-mir-150 SEQ ID NO: 495 16-37
    rno-mir-151 SEQ ID NO: 496 16-37 and/or 50-71
    rno-mir-152 SEQ ID NO: 497 53-73
    rno-mir-153 SEQ ID NO: 498 53-72
    rno-mir-154 SEQ ID NO: 499 15-36
    rno-mir-181c SEQ ID NO: 500 24-45
    rno-mir-181a SEQ ID NO: 501 39-61
    rno-mir-181b-1 SEQ ID NO: 502 36-59
    rno-mir-181b-2 SEQ ID NO: 503 15-38
    rno-mir-183 SEQ ID NO: 504 27-49
    rno-mir-184 SEQ ID NO: 505 47-68
    rno-mir-185 SEQ ID NO: 506 14-31
    rno-mir-186 SEQ ID NO: 507 15-37
    rno-mir-187 SEQ ID NO: 508 66-86
    rno-mir-190 SEQ ID NO: 509 15-36
    rno-mir-191 SEQ ID NO: 510 15-36
    rno-mir-192 SEQ ID NO: 511 24-44
    rno-mir-193 SEQ ID NO: 512 54-74
    rno-mir-194-1 SEQ ID NO: 513 15-36
    rno-mir-194-2 SEQ ID NO: 514 15-36
    rno-mir-195 SEQ ID NO: 515 15-35
    rno-mir-196 SEQ ID NO: 516 25-45
    rno-mir-199a SEQ ID NO: 517 31-53
    rno-mir-200c SEQ ID NO: 518 46-67
    rno-mir-200a SEQ ID NO: 519 54-75
    rno-mir-200b SEQ ID NO: 520 54-77
    rno-mir-203 SEQ ID NO: 521 52-73
    rno-mir-204 SEQ ID NO: 522 33-54
    rno-mir-205 SEQ ID NO: 523 33-54
    rno-mir-206 SEQ ID NO: 524 51-72
    rno-mir-208 SEQ ID NO: 525 50-71
    rno-mir-210 SEQ ID NO: 526 66-86
    rno-mir-211 SEQ ID NO: 527 26-47
    rno-mir-212 SEQ ID NO: 528 72-92
    rno-mir-213 SEQ ID NO: 529 55-76
    rno-mir-214 SEQ ID NO: 530 71-91
    rno-mir-216 SEQ ID NO: 531 19-39
    rno-mir-217 SEQ ID NO: 532 32-55
    rno-mir-218-2 SEQ ID NO: 533 25-45
    rno-mir-218-1 SEQ ID NO: 534 25-45
    rno-mir-219-1 SEQ ID NO: 535 21-41
    rno-mir-219-2 SEQ ID NO: 536 19-39
    rno-mir-221 SEQ ID NO: 537 65-87
    rno-mir-222 SEQ ID NO: 538 62-85
    rno-mir-223 SEQ ID NO: 539 68-88
    rno-mir-290 SEQ ID NO: 540 14-36
    rno-mir-291 SEQ ID NO: 541 14-35 and/or 50-72
    rno-mir-292 SEQ ID NO: 542 12-33 and/or 51-73
    rno-mir-296 SEQ ID NO: 543 13-33
    rno-mir-297 SEQ ID NO: 544 26-48
    rno-mir-298 SEQ ID NO: 545 11-32
    rno-mir-299 SEQ ID NO: 546  7-28
    rno-mir-300 SEQ ID NO: 547 51-72
    rno-mir-301 SEQ ID NO: 548 61-85
    rno-mir-320 SEQ ID NO: 549 48-70
    rno-mir-321 SEQ ID NO: 550 10-30
    rno-mir-322 SEQ ID NO: 551 61-80
    rno-mir-323 SEQ ID NO: 552 50-71
    rno-mir-324 SEQ ID NO: 553 16-38 and/or 51-72
    rno-mir-325 SEQ ID NO: 554 16-38
    rno-mir-326 SEQ ID NO: 555 60-80
    rno-mir-328 SEQ ID NO: 556 48-69
    rno-mir-329 SEQ ID NO: 557 61-82
    rno-mir-330 SEQ ID NO: 558 60-82
    rno-mir-331 SEQ ID NO: 559 61-81
    rno-mir-333 SEQ ID NO: 560 16-35
    rno-mir-336 SEQ ID NO: 561 16-36
    rno-mir-337 SEQ ID NO: 562 60-82
    rno-mir-338 SEQ ID NO: 563 41-63
    rno-mir-339 SEQ ID NO: 564 16-36
    rno-mir-341 SEQ ID NO: 565 61-81
    mo-mir-342 SEQ ID NO: 566 61-84
    rno-mir-344 SEQ ID NO: 567 61-83
    rno-mir-345 SEQ ID NO: 568 16-36
    rno-mir-346 SEQ ID NO: 569 16-38
    rno-mir-349 SEQ ID NO: 570 61-82
    rno-mir-350 SEQ ID NO: 571 61-84
    rno-mir-351 SEQ ID NO: 572 16-39
    rno-mir-352 SEQ ID NO: 592 61-81
    rno-mir-421 SEQ ID NO: 593 10-30
    rno-mir-429 SEQ ID NO: 700 53-74
    rno-mir-448 SEQ ID NO: 701 72-93
    rno-mir-449 SEQ ID NO: 702 16-37
    rno-mir-450 SEQ ID NO: 703 17-38
    rno-mir-451 SEQ ID NO: 801 17-38
    rno-mir-483 SEQ ID NO: 802 45-67
  • It is understood that an miRNA is derived from genomic sequences or a gene. In this respect, the term “gene” is used for simplicity to refer to the genomic sequence encoding the precursor miRNA for a given miRNA. However, embodiments of the invention may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences.
  • The term “recombinant” may be used and this generally refers to a molecule that has been manipulated in vitro or that is the replicated or expressed product of such a molecule.
  • The term “nucleic acid” is well known in the art. A “nucleic acid” as used herein will generally refer to a molecule (one or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine “A,” a guanine “G,” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, an uracil “U” or a C). The term “nucleic acid” encompass the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.”
  • The term “miRNA” generally refers to a single-stranded molecule, but in specific embodiments, molecules implemented in the invention will also encompass a region or an additional strand that is partially (between 10 and 50% complementary across length of strand), substantially (greater than 50% but less than 100% complementary across length of strand) or fully complementary to another region of the same single-stranded molecule or to another nucleic acid. Thus, nucleic acids may encompass a molecule that comprises one or more complementary or self-complementary strand(s) or “complement(s)” of a particular sequence comprising a molecule. For example, precursor miRNA may have a self-complementary region, which is up to 100% complementary.
  • As used herein, “hybridization”, “hybridizes” or “capable of hybridizing” is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term “anneal” as used herein is synonymous with “hybridize.” The term “hybridization”, “hybridize(s)” or “capable of hybridizing” encompasses the terms “stringent condition(s)” or “high stringency” and the terms “low stringency” or “low stringency condition(s).”
  • Synthetic nucleic acids of the invention will comprise, in some embodiments the miRNA sequence of any miRNA described in SEQ ID NOs:1-805, and/or any sequence with the complement thereof. It is contemplated that nucleic acids sequences of the invention can have, have at least, or have at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 contiguous nucleotides from SEQ ID NOs:1-805 (or any ranger derivable therein), or be a complement thereof. In other embodiments, nucleic acids are, are at least, or are at most 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% identical or complementary to the miRNA sequence of SEQ ID NOs:1-805 or to the entire sequence of any of SEQ ID NOs:1-805, or any combination or range derivable therein.
  • Moreover, sequences are provided in the appendix. The appendix provides a list of 1) miRNAs that were screened, any one of which can be screened for using any array or method of the present invention; 2) the names of the probe used to screen for that miRNA; and, 3) the sequence of the named probe. It is clear that a particular probe can be used for identifying the level of expression of one or more target miRNAs, or set of target miRNAs (sets of targeted miRNAs may include completely unrelated RNAs, in additions to sets that are either related or in the same gene family). It is contemplated that any of these sequences in the appendix can be used in embodiments of the invention.
  • 1. Nucleobases
  • As used herein a “nucleobase” refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase. A nucleobase generally can form one or more hydrogen bonds (“anneal” or “hybridize”) with at least one naturally occurring nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U).
  • “Purine” and/or “pyrimidine” nucleobase(s) encompass naturally occurring purine and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof, including but not limited to, those a purine or pyrimidine substituted by one or more of an alkyl, carboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or alkylthiol moeity. Preferred alkyl (e.g., alkyl, carboxyalkyl, etc.) moieties comprise of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. Other non-limiting examples of a purine or pyrimidine include a deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bromothymine, a 8-aminoguanine, a 8-hydroxyguanine, a 8-methylguanine, a 8-thioguanine, an azaguanine, a 2-aminopurine, a 5-ethylcytosine, a 5-methylcytosine, a 5-bromouracil, a 5-ethyluracil, a 5-iodouracil, a 5-chlorouracil, a 5-propyluracil, a thiouracil, a 2-methyladenine, a methylthioadenine, a N,N-dimethyladenine, an azaadenines, a 8-bromoadenine, a 8-hydroxyadenine, a 6-hydroxyaminopurine, a 6-thiopurine, a 4-(6-aminohexyl/cytosine), and the like. Other examples are well known to those of skill in the art.
  • A nucleobase may be comprised in a nucleoside or nucleotide, using any chemical or natural synthesis method described herein or known to one of ordinary skill in the art. Such nucleobase may be labeled or it may be part of a molecule that is labeled and contains the nucleobase.
  • 2. Nucleosides
  • As used herein, a “nucleoside” refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety. A non-limiting example of a “nucleobase linker moiety” is a sugar comprising 5-carbon atoms (i.e., a “5-carbon sugar”), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar. Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2′-fluoro-2′-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring.
  • Different types of covalent attachment(s) of a nucleobase to a nucleobase linker moiety are known in the art. By way of non-limiting example, a nucleoside comprising a purine (i.e., A or G) or a 7-deazapurine nucleobase typically covalently attaches the 9 position of a purine or a 7-deazapurine to the 1′-position of a 5-carbon sugar. In another non-limiting example, a nucleoside comprising a pyrimidine nucleobase (i.e., C, T or U) typically covalently attaches a 1 position of a pyrimidine to a 1′-position of a 5-carbon sugar (Kornberg and Baker, 1992).
  • 3. Nucleotides
  • As used herein, a “nucleotide” refers to a nucleoside further comprising a “backbone moiety”. A backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid. The “backbone moiety” in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3′- or 5′-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety.
  • 4. Nucleic Acid Analogs
  • A nucleic acid may comprise, or be composed entirely of, a derivative or analog of a nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid. RNA with nucleic acid analogs may also be labeled according to methods of the invention. As used herein a “derivative” refers to a chemically modified or altered form of a naturally occurring molecule, while the terms “mimic” or “analog” refer to a molecule that may or may not structurally resemble a naturally occurring molecule or moiety, but possesses similar functions. As used herein, a “moiety” generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art, and have been described (see for example, Scheit, 1980, incorporated herein by reference).
  • Additional non-limiting examples of nucleosides, nucleotides or nucleic acids comprising 5-carbon sugar and/or backbone moiety derivatives or analogs, include those in: U.S. Pat. No. 5,681,947, which describes oligonucleotides comprising purine derivatives that form triple helixes with and/or prevent expression of dsDNA; U.S. Pat. Nos. 5,652,099 and 5,763,167, which describe nucleic acids incorporating fluorescent analogs of nucleosides found in DNA or RNA, particularly for use as fluorescent nucleic acids probes; U.S. Pat. No. 5,614,617, which describes oligonucleotide analogs with substitutions on pyrimidine rings that possess enhanced nuclease stability; U.S. Pat. Nos. 5,670,663, 5,872,232 and 5,859,221, which describe oligonucleotide analogs with modified 5-carbon sugars (i.e., modified 2′-deoxyfuranosyl moieties) used in nucleic acid detection; U.S. Pat. No. 5,446,137, which describes oligonucleotides comprising at least one 5-carbon sugar moiety substituted at the 4′ position with a substituent other than hydrogen that can be used in hybridization assays; U.S. Pat. No. 5,886,165, which describes oligonucleotides with both deoxyribonucleotides with internucleotide linkages and ribonucleotides with internucleotide linkages; U.S. Pat. No. 5,714,606, which describes a modified internucleotide linkage wherein a 3′-position oxygen of the internucleotide linkage is replaced by a carbon to enhance the nuclease resistance of nucleic acids; U.S. Pat. No. 5,672,697, which describes oligonucleotides containing one or more 5′ methylene phosphonate internucleotide linkages that enhance nuclease resistance; U.S. Pat. Nos. 5,466,786 and 5,792,847, which describe the linkage of a substituent moiety which may comprise a drug or label to the 2′ carbon of an oligonucleotide to provide enhanced nuclease stability and ability to deliver drugs or detection moieties; U.S. Pat. No. 5,223,618, which describes oligonucleotide analogs with a 2 or 3 carbon backbone linkage attaching the 4′ position and 3′ position of adjacent 5-carbon sugar moiety to enhanced cellular uptake, resistance to nucleases and hybridization to target RNA; U.S. Pat. No. 5,470,967, which describes oligonucleotides comprising at least one sulfamate or sulfamide internucleotide linkage that are useful as nucleic acid hybridization probe; U.S. Pat. Nos. 5,378,825, 5,777,092, 5,623,070, 5,610,289 and 5,602,240, which describe oligonucleotides with three or four atom linker moiety replacing phosphodiester backbone moiety used for improved nuclease resistance, cellular uptake and regulating RNA expression; U.S. Pat. No. 5,858,988, which describes hydrophobic carrier agent attached to the 2′-O position of oligonucleotides to enhanced their membrane permeability and stability; U.S. Pat. No. 5,214,136, which describes oligonucleotides conjugated to anthraquinone at the 5′ terminus that possess enhanced hybridization to DNA or RNA; enhanced stability to nucleases; U.S. Pat. No. 5,700,922, which describes PNA-DNA-PNA chimeras wherein the DNA comprises 2′-deoxy-erythro-pentofuranosyl nucleotides for enhanced nuclease resistance, binding affinity, and ability to activate RNase H; and U.S. Pat. No. 5,708,154, which describes RNA linked to a DNA to form a DNA-RNA hybrid; U.S. Pat. No. 5,728,525, which describes the labeling of nucleoside analogs with a universal fluorescent label.
  • Additional teachings for nucleoside analogs and nucleic acid analogs are U.S. Pat. No. 5,728,525, which describes nucleoside analogs that are end-labeled; U.S. Pat. Nos. 5,637,683, 6,251,666 (L-nucleotide substitutions), and 5,480,980 (7-deaza-2′deoxyguanosine nucleotides and nucleic acid analogs thereof).
  • The use of other analogs is specifically contemplated for use in the context of the present invention. Such analogs may be used in synthetic nucleic acid molecules of the invention, both throughout the molecule or at selected nucleotides. They include, but are not limited to, 1) ribose modifications (such as 2′F, 2′ NH2, 2′N3, 4′thio, or 2′ O—CH3) and 2) phosphate modifications (such as those found in phosphorothioates, methyl phosphonates, and phosphoroborates). Such analogs have been created to confer stability on RNAs by reducing or eliminating their capacity to be cleaved by ribonucleases. When these nucleotide analogs are present in RNAs, they can have profoundly positive effects on the stability of the RNAs in animals. It is contemplated that the use of nucleotide analogs can be used alone or in conjunction with any of the design modifications of a synthetic miRNA for any nucleic acid of the invention.
  • 5. Modified Nucleotides
  • Both synthetic miRNAs and miRNA inhibitors of the invention specifically contemplate the use of nucleotides that are modified to enhance their activities. Such nucleotides include those that are at the 5′ or 3′ terminus of the RNA as well as those that are internal within the molecule. Modified nucleotides used in the complementary strands of synthetic miRNAs either block the 5′OH or phosphate of the RNA or introduce internal sugar modifications that enhance uptake of the active strand of the synthetic miRNA. Modifications for the miRNA inhibitors include internal sugar modifications that enhance hybridization as well as stabilize the molecules in cells and terminal modifications that further stabilize the nucleic acids in cells. Further contemplated are modifications that can be detected by microscopy or other methods to identify cells that contain the synthetic miRNAs or miRNA inhibitors.
  • B. Preparation of Nucleic Acids
  • A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production. Though synthetic miRNAs according to the invention could be produced using recombinant methods, it is preferred to produce synthetic miRNAs by chemical synthesis or enzymatic production. Likewise, miRNA inhibitors are preferentially produced by chemical synthesis or enzymatic production. Non-synthetic miRNAs can be produced by a number of methods, including methods involving recombinant DNA technology.
  • Nucleic acid synthesis is performed according to standard methods. See, for example, Itakura and Riggs (1980). Additionally, U.S. Pat. No. 4,704,362, U.S. Pat. No. 5,221,619, and U.S. Pat. No. 5,583,013 each describe various methods of preparing synthetic nucleic acids. Non-limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986 and U.S. Pat. No. 5,705,629, each incorporated herein by reference. In the methods of the present invention, one or more oligonucleotide may be used. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.
  • A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Pat. No. 5,645,897, incorporated herein by reference.
  • Oligonucleotide synthesis is well known to those of skill in the art. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.
  • Basically, chemical synthesis can be achieved by the diester method, the triester method polynucleotides phosphorylase method and by solid-phase chemistry. These methods are discussed in further detail below.
  • Diester Method.
  • The diester method was the first to be developed to a usable state, primarily by Khorana and co-workers. (Khorana, 1979). The basic step is the joining of two suitably protected deoxynucleotides to form a dideoxynucleotide containing a phosphodiester bond. The diester method is well established and has been used to synthesize DNA molecules (Khorana, 1979).
  • Triester Method.
  • The main difference between the diester and triester methods is the presence in the latter of an extra protecting group on the phosphate atoms of the reactants and products (Itakura et al., 1975). The phosphate protecting group is usually a chlorophenyl group, which renders the nucleotides and polynucleotide intermediates soluble in organic solvents. Therefore purification's are done in chloroform solutions. Other improvements in the method include (i) the block coupling of trimers and larger oligomers, (ii) the extensive use of high-performance liquid chromatography for the purification of both intermediate and final products, and (iii) solid-phase synthesis.
  • Polynucleotide Phosphorylase Method.
  • This is an enzymatic method of DNA synthesis that can be used to synthesize many useful oligonucleotides (Gillam et al., 1978; Gillam et al., 1979). Under controlled conditions, polynucleotide phosphorylase adds predominantly a single nucleotide to a short oligonucleotide. Chromatographic purification allows the desired single adduct to be obtained. At least a trimer is required to start the procedure, and this primer must be obtained by some other method. The polynucleotide phosphorylase method works and has the advantage that the procedures involved are familiar to most biochemists.
  • Solid-Phase Methods.
  • Drawing on the technology developed for the solid-phase synthesis of polypeptides, it has been possible to attach the initial nucleotide to solid support material and proceed with the stepwise addition of nucleotides. All mixing and washing steps are simplified, and the procedure becomes amenable to automation. These syntheses are now routinely carried out using automatic nucleic acid synthesizers.
  • Phosphoramidite chemistry (Beaucage and Lyer, 1992) has become by far the most widely used coupling chemistry for the synthesis of oligonucleotides. As is well known to those skilled in the art, phosphoramidite synthesis of oligonucleotides involves activation of nucleoside phosphoramidite monomer precursors by reaction with an activating agent to form activated intermediates, followed by sequential addition of the activated intermediates to the growing oligonucleotide chain (generally anchored at one end to a suitable solid support) to form the oligonucleotide product.
  • Recombinant Methods.
  • Recombinant methods for producing nucleic acids in a cell are well known to those of skill in the art. These include the use of vectors, plasmids, cosmids, and other vehicles for delivery a nucleic acid to a cell, which may be the target cell or simply a host cell (to produce large quantities of the desired RNA molecule). Alternatively, such vehicles can be used in the context of a cell free system so long as the reagents for generating the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference.
  • In certain embodiments, the present invention concerns nucleic acid molecules that are not synthetic. In some embodiments, the nucleic acid molecule has a chemical structure of a naturally occurring nucleic acid and a sequence of a naturally occurring nucleic acid, such as the exact and entire sequence of a single stranded primary miRNA (see Lee 2002), a single-stranded precursor miRNA, or a single-stranded mature miRNA. In addition to the use of recombinant technology, such non-synthetic nucleic acids may be generated chemically, such as by employing technology used for creating oligonucleotides.
  • C. Design of Synthetic miRNAs
  • Synthetic miRNAs typically comprise two strands, an active strand that is identical in sequence to the mature miRNA that is being studied and a complementary strand that is at least partially complementary to the active strand. The active strand is the biologically relevant molecule and should be preferentially taken up by the complex in cells that modulates translation either through mRNA degradation or translational control. Preferential uptake of the active strand has two profound results: (1) the observed activity of the synthetic miRNA increases dramatically and (2) non-intended effects induced by uptake and activation of the complementary strand are essentially eliminated. According to the invention, several synthetic miRNA designs can be used to ensure the preferential uptake of the active strand.
  • 5′ Blocking Agent.
  • The introduction of a stable moiety other than phosphate or hydroxyl at the 5′ end of the complementary strand impairs its activity in the miRNA pathway. This ensures that only the active strand of the synthetic miRNA will be used to regulate translation in the cell. 5′ modifications include, but are not limited to, NH2, biotin, an amine group, a lower alkylamine group, an acetyl group, 2′O-Me, DMTO, fluoroscein, a thiol, or acridine or any other group with this type of functionality.
  • Other Sense Strand Modifications.
  • The introduction of nucleotide modifications like 2′-OMe, NH2, biotin, an amine group, a lower alkylamine group, an acetyl group, DMTO, fluoroscein, a thiol, or acridine or any other group with this type of functionality in the complementary strand of the synthetic miRNA can eliminate the activity of the complementary strand and enhance uptake of the active strand of the miRNA.
  • Base Mismatches in the Sense Strand.
  • As with siRNAs (Schwarz 2003), the relative stability of the 5′ and 3′ ends of the active strand of the synthetic miRNA apparently determines the uptake and activation of the active by the miRNA pathway. Destabilizing the 5′ end of the active strand of the synthetic miRNA by the strategic placement of base mismatches in the 3′ end of the complementary strand of the synthetic miRNA enhances the activity of the active strand and essentially eliminates the activity of the complementary strand.
  • D. Host Cells and Target Cells
  • The cells used to understand miRNA function may be derived from or contained in any organism (e.g., plant, animal, protozoan, virus, bacterium, or fungus). The plant may be a monocot, dicot or gymnosperm; the animal may be a vertebrate or invertebrate. Preferred microbes are those used in agriculture or by industry, and those that a pathogenic for plants or animals. Fungi include organisms in both the mold and yeast morphologies. Examples of vertebrates include fish and mammals, including cattle, goat, pig, sheep, hamster, mouse, rate and human; invertebrate animals include nematodes, insects, arachnids, and other arthropods. Preferably, the cell is a vertebrate cell. More preferably, the cell is a mammalian cell.
  • The cells used to understand miRNA function may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like. The cell can be a gamete or an embryo; if an embryo, it can be a single cell embryo or a constituent cell or cells from a multicellular embryo. The term “embryo” thus encompasses fetal tissue. The cell used for miRNA functional analysis may be an undifferentiated cell, such as a stem cell, or a differentiated cell, such as from a cell of an organ or tissue, including fetal tissue, or any other cell present in an organism. Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells, of the endocrine or exocrine glands. Alternatively, cells may be qualified as germ cells, nurse cells, epithelial cells, endothelial cells, hormone secreting cells, contractile cells, skeletal muscle cells, cardiac muscle cells, blood cells, or cells from the bone, bone marrow, brain, breast, cervix, colon, gastrointestinal tract, heart, kidney, large intestine, liver, lung, lymph nodes, ovary, pancreas, prostate, small intestine, spine or spinal cord, spleen, stomach, testes, thymus, or uterus.
  • As used herein, the terms “cell,” “cell line,” and “cell culture” may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations formed by cell division. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. A host cell may be “transfected” or “transformed,” which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny. As used herein, the terms “engineered” and “recombinant” cells or host cells are intended to refer to a cell into which an exogenous nucleic acid sequence, such as, for example, a small, interfering RNA or a template construct encoding a reporter gene has been introduced. Therefore, recombinant cells are distinguishable from naturally occurring cells that do not contain a recombinantly introduced nucleic acid.
  • A tissue may comprise a host cell or cells to be transformed or contacted with a nucleic acid delivery composition and/or an additional agent. The tissue may be part or separated from an organism. In certain embodiments, a tissue and its constituent cells may comprise, but is not limited to, blood (e.g., hematopoietic cells (such as human hematopoietic progenitor cells, human hematopoietic stem cells, CD34+ cells CD4+ cells), lymphocytes and other blood lineage cells), bone marrow, brain, stem cells, blood vessel, liver, lung, bone, breast, cartilage, cervix, colon, cornea, embryonic, endometrium, endothelial, epithelial, esophagus, facia, fibroblast, follicular, ganglion cells, glial cells, goblet cells, kidney, lymph node, muscle, neuron, ovaries, pancreas, peripheral blood, prostate, skin, skin, small intestine, spleen, stomach, testes.
  • In certain embodiments, the host cell or tissue may be comprised in at least one organism. In certain embodiments, the organism may be, human, primate or murine. In other embodiments the organism may be any eukaryote or even a prokayrote (e.g., a eubacteria, an archaea), as would be understood by one of ordinary skill in the art (see, for example, webpage http://phylogeny.arizona.edu/tree/phylogeny.html). One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit their division to form progeny.
  • E. Labels and Tags
  • Synthetic miRNAs and miRNA inhibitors may be labeled with a radioactive, enzymatic, colorimetric, or other label or tag for detection or isolation purposes. Nucleic acids may be labeled with fluorescence in some embodiments of the invention. The fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, TET, Tetramethylrhodamine, and/or Texas Red.
  • It is contemplated that synthetic miRNAs and miRNA inhibitors may be labeled with two different labels. Furthermore, fluorescence resonance energy transfer (FRET) may be employed in methods of the invention (e.g., Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001, each incorporated by reference).
  • A number of techniques for visualizing or detecting labeled nucleic acids are readily available. The reference by Stanley T. Crooke, 2000 has a discussion of such techniques (Chapter 6) which is incorporated by reference. Such techniques include, microscopy, arrays, Fluorometry, Light cyclers or other real time PCR™ machines, FACS analysis, scintillation counters, Phosphoimagers, Geiger counters, MRI, CAT, antibody-based detection methods (Westerns, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC (Griffey et al., 1997, spectroscopy, capillary gel electrophoresis (Cummins et al., 1996), spectroscopy; mass spectroscopy; radiological techniques; and mass balance techniques. Alternatively, nucleic acids may be labeled or tagged to allow for their efficient isolation. In other embodiments of the invention, nucleic acids are biotinylated.
  • F. Delivery Methods
  • The present invention involves in some embodiments delivering a nucleic acid into a cell. This may be done as part of a screening method, or it may be related to a therapeutic or diagnostic application.
  • RNA molecules may be encoded by a nucleic acid molecule comprised in a vector. The term “vector” is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be “exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Sambrook et al., 1989 and Ausubel et al., 1996, both incorporated herein by reference. In addition to encoding a modified polypeptide such as modified gelonin, a vector may encode non-modified polypeptide sequences such as a tag or targeting molecule. A targeting molecule is one that directs the desired nucleic acid to a particular organ, tissue, cell, or other location in a subject's body.
  • The term “expression vector” refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. Expression vectors can contain a variety of “control sequences,” which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described
  • There are a number of ways in which expression vectors may be introduced into cells. In certain embodiments of the invention, the expression vector comprises a virus or engineered vector derived from a viral genome. The ability of certain viruses to enter cells via receptor-mediated endocytosis, to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; Temin, 1986). The first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. They can accommodate only up to 8 kb of foreign genetic material but can be readily introduced in a variety of cell lines and laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986).
  • The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells; they can also be used as vectors. Other viral vectors may be employed as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988; Horwich et al., 1990).
  • Other suitable methods for nucleic acid delivery to effect expression of compositions of the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harlan and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated herein by reference); by electroporation (U.S. Pat. No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE-dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Pat. Nos. 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. Nos. 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055, each incorporated herein by reference); or by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993; U.S. Pat. Nos. 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985). Through the application of techniques such as these, organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
  • II. Screening with Synthetic miRNA and miRNA Inhibitor Libraries
  • As used in the patent application, screening is a process wherein multiple miRNA-specific reagents are delivered separately into individual cell populations or animals. At one or more designated times after delivery, the cell populations or animals are assayed for one or more phenotypes. Those cells or animals that have a significantly different phenotype than cells or animals in the negative control group are classified as positives. The miRNA that was being manipulated in the sample is defined as a hit. Hits represent targets for additional research and potential therapeutic development.
  • In some embodiments, there is a multi-step process for screening. In certain embodiments, there are four general steps:
  • (1) Develop Quantitative Assay to Monitor Cellular Process being Studied.
  • Assays that measure the intensity of a cellular phenotype range from microscopic assays that monitor cell size, cell cycle status, or antibody staining to enzymatic assays that assess the turnover of a specific substrate in a cell lysate to direct measurements of biomolecules or small molecules in lysates, on cells, or in medium.
  • Critical to the success of a screen is creating an assay that truly measures the cellular phenotype and maximizing the signal-to-noise ratio of the assay. Maximizing signal-to-noise involves testing variables like assay time, assay components, cell type, and length of time between transfection and assay. The greater the difference in the assay results between a positive phenotype and a negative control phenotype, the greater the spread will be in the screening results and the better the opportunity will be to identify interesting genes.
  • (2) Optimize Transfection Conditions for the Desired Cells.
  • The first step in this process is identifying a transfection reagent and plating conditions that maximize the uptake of synthetic miRNAs or miRNA inhibitors while maintaining high cell viability. We find it useful to test 2-5 different transfection reagents when using cell lines or 5-10 electroporation conditions when using primary or suspension cells. Transfection can be optimized for the reagent or electroporation condition that worked best among the conditions tested. Screening miRNA-specific libraries requires conditions for high-throughput transfection. The inventors have developed and used a rapid process that facilitates the transfection of up to 1,000 wells in less than an hour without the need for robotics (see delivery below).
  • (3) Screen
  • Once the assay and transfection process have been developed, a library of synthetic miRNAs or miRNA inhibitors can be introduced sequentially into cells in a 24- or 96-well plate. Triplicate transfections for each reagent provide enough data for reasonable statistical analysis.
  • (4) Validate Hits
  • Validating a hit involves showing that the observed phenotype is due to the miRNA being targeted. Hits are typically confirmed by delivering a dilution series of the miRNA inhibitor or synthetic miRNA that registered as a hit into the cell that was originally assayed. It has been the experience of the inventors that true hits show a dose response.
  • A. Synthetic miRNA and miRNA Inhibitor Library Preparation
  • The present invention concerns the preparation and use of synthetic miRNA and miRNA inhibitor libraries to induce changes in the activity of specific miRNAs in cells. Preparation of synthetic miRNAs and miRNA inhibitors typically involves the chemical synthesis of the active and complementary strands of the synthetic miRNA and the single-stranded miRNA inhibitor using any of the methods described in this application. If the active and complementary strands of the synthetic miRNAs are two distinct molecules, then the two strands must be hybridized prior to delivery. Hybridization can be achieved by mixing the two nucleic acids together in roughly equimolar amounts and incubating for a time and at a temperature that is appropriate for hybridization. The addition of salt (e.g., NaCl or NaOAC) enhances hybridization as does the inclusion of a heat denaturation step prior to the incubation used for hybridization.
  • B. Delivery of Synthetic miRNAs and miRNA Inhibitors
  • Libraries of the invention can be used to sequentially up- or down-regulate one or more miRNAs in samples. This requires methods for introducing the synthetic miRNAs and miRNA inhibitors into cell types with associated cell assays. Lipid-based transfection is typically employed to introduce the nucleic acids into immortalized cells and electroporation for primary cells.
  • Suitable methods for nucleic acid delivery according to the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, RNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of nucleic acids such as by injection (U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated herein by reference); by electroporation (U.S. Pat. No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE-dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Pat. Nos. 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. Nos. 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055, each incorporated herein by reference); or by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993; U.S. Pat. Nos. 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985). Through the application of techniques such as these, organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
  • A variety of compounds have been attached to the ends of oligonucleotides to facilitate their transport across cell membranes. Short signal peptides found in the HIV TAT, HSV VP22, Drosphila antennapedia, and other proteins have been found to enable the rapid transfer of biomolecules across membranes (reviewed by Schwarze 2000). These signal peptides, referred to as Protein Transduction Domains (PTDs), have been attached to oligonucleotides to facilitate their delivery into cultured cells. Cholesterols have been conjugated to oligonucleotides to improve their uptake into cells in animals (MacKellar 1992). The terminal cholesterol groups apparently interact with receptors or lipids on the surfaces of cells and facilitate the internalization of the modified oligonucleotides. Likewise, poly-1-lysine has been conjugated to oligonucleotides to decrease the net negative charge and improve uptake into cells (Leonetti 1990).
  • A variety of compounds have been developed that complex with nucleic acids, deliver them to surfaces of cells, and facilitate their uptake in and release from endosomes. Among these are: (1) a variety of lipids such as DOTAP (or other cationic lipid), DDAB, DHDEAB, and DOPE and (2) non-lipid-based polymers like polyethylenimine, polyamidoamine, and dendrimers of these and other polymers. In certain of these embodiments a combination of lipids is employed such as DOTAP and cholesterol or a cholesterol derivative (U.S. Pat. No. 6,770,291, which is hereby incorporated by reference). Several of these reagents have been shown to facilitate nucleic acid uptake in animals.
  • The cellular components involved in the miRNA pathway are becoming known. Proteins that stabilize and/or transport miRNAs within cells might enhance the stability and activity of miRNAs because they should protect and guide the bound miRNAs once they are in cells. Mixtures of miRNA-transporter proteins and miRNAs could enhance the efficacy of miRNA-based therapeutics.
  • RNAs are hydrophilic molecules by virtue of their anionic phosphate and sugar backbone. Although the nucleobases are hydrophobic, hydrophilicity dominates owing to the extensive hydrogen bonding resulting from the phosphate and sugar residues. The hydrophilic character and anionic backbone reduces cellular permeation. Conjugation of lipophilic groups like cholesterol (Manoharan, 2002) and lauric and lithocholic acid derivatives with C32 functionality (Lorenz et al., 2004), have been shown to improve cellular uptake. Moreover binding of steroid conjugated oligonucleotides to different lipoproteins in the bloodstream, such as LDL, protect their integrity and govern their biodistribution (Rump et al., 2000). Cholesterol attached to anti-sense molecules (Bijsterbosch et al., 2001) and aptamers (Rusconi et al., 2004) has also been shown to stabilize oligonucleotides by allowing binding to lipoproteins. Cholesterol has been demonstrated to enhance uptake and serum stability of siRNAs in vitro (Lorenz et al., 2004) and in vivo (Soutschek et al., 2004). Additionally, a number of small molecules like SB-435495 (Blackie et al., (2002), Isradipine (Oravcova et al., 1994), amlodipine (Oravcova et al., 1994) and 2,2′,4,4′,5,5′-hexachlorobiphenyl (Borlakoglu et al., 1990) could enhance cellular uptake, and improve nuclease resistance by promoting lipoprotein association.
  • The present methods and kits may be employed for high volume screening. A library of synthetic miRNAs and/or miRNA inhibitors can be created using methods of the invention. This library may then be used in high throughput assays, including microarrays. Specifically contemplated by the present inventors are chip-based nucleic acid technologies such as those described by Ziauddin and Sabatini (2001). Briefly, nucleic acids can be immobilized on solid supports. Cells can then be overlaid on the solid support and take up the nucleic acids at the defined locations. The impact on the cells can then be measured to identify cocktails that are having a desirable effect.
  • C. Labeling and Labeling Techniques
  • In some embodiments, the present invention concerns miRNA that are labeled, such as for screening assays to evaluate the therapeutic or diagnostic relevance of a particular miRNA species. It is contemplated that miRNA may first be isolated (either from a cell in which the miRNA is endogenous to the cell or from a cell in which miRNA is exogenous to the cell) and/or purified prior to labeling. This may achieve a reaction that more efficiently labels the miRNA, as opposed to other RNA in a sample in which the miRNA is not isolated or purified prior to labeling. In many embodiments of the invention, the label is non-radioactive. Generally, nucleic acids may be labeled by adding labeled nucleotides (one-step process) or adding nucleotides and labeling the added nucleotides (two-step process).
  • Moreover, miRNA may be labeled as is described in U.S. Patent Application Ser. No. 60/649,584, which is hereby incorporated by reference. Such nucleotides include those that can be labeled with a dye, including a fluorescent dye, or with a molecule such as biotin. Labeled nucleotides are readily available; they can be acquired commercially or they can be synthesized by reactions known to those of skill in the art.
  • 1. Nucleotides for Labeling
  • Nucleotides for labelling are not naturally occurring nucleotides, but instead, refer to prepared nucleotides that have a reactive moiety on them. Specific reactive functionalities of interest include: amino, sulfhydryl, sulfoxyl, aminosulfhydryl, azido, epoxide, isothiocyanate, isocyanate, anhydride, monochlorotriazine, dichlorotriazine, mono- or dihalogen substituted pyridine, mono- or disubstituted diazine, maleimide, epoxide, aziridine, sulfonyl halide, acid halide, alkyl halide, aryl halide, alkylsulfonate, N-hydroxysuccinimide ester, imido ester, hydrazine, azidonitrophenyl, azide, 3-(2-pyridyl dithio)-propionamide, glyoxal, aldehyde, iodoacetyl, cyanomethyl ester, p-nitrophenyl ester, o-nitrophenyl ester, hydroxypyridine ester, carbonyl imidazole, and the other such chemical groups. In some embodiments, the reactive functionality may be bonded directly to a nucleotide, or it may be bonded to the nucleotide through a linking group. The functional moiety and any linker cannot substantially impair the ability of the nucleotide to be added to the miRNA or to be labeled. Representative linking groups include carbon containing linking groups, typically ranging from about 2 to 18, usually from about 2 to 8 carbon atoms, where the carbon containing linking groups may or may not include one or more heteroatoms, e.g. S, O, N etc., and may or may not include one or more sites of unsaturation. Of particular interest in many embodiments are alkyl linking groups, typically lower alkyl linking groups of 1 to 16, usually 1 to 4 carbon atoms, where the linking groups may include one or more sites of unsaturation. The functionalized nucleotides (or primers) used in the above methods of functionalized target generation may be fabricated using known protocols or purchased from commercial vendors, e.g., Sigma, Roche, Ambion, and NEN. Functional groups may be prepared according to ways known to those of skill in the art, including the representative information found in U.S. Pat. Nos. 4,404,289; 4,405,711; 4,337,063 and 5,268,486, and Br. Pat. No. 1,529,202, which are all incorporated by reference.
  • Amine-modified nucleotides are used in several embodiments of the invention. The amine-modified nucleotide is a nucleotide that has a reactive amine group for attachment of the label. It is contemplated that any ribonucleotide (G, A, U, or C) or deoxyribonucleotide (G, A, T, or C) can be modified for labeling. Examples include, but are not limited to, the following modified ribo- and deoxyribo-nucleotides: 5-(3-aminoallyl)-UTP; 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N6-(4-amino)butyl-ATP, N6-(6-amino)butyl-ATP, N4-[2,2-oxy-bis-(ethylamine)]-CTP; N6-(6-Amino)hexyl-ATP; 8-[(6-Amino)hexyl]-amino-ATP; 5-propargylamino-CTP, 5-propargylamino-UTP; 5-(3-aminoallyl)-dUTP; 8-[(4-amino)butyl]-amino-dATP and 8-[(6-amino)butyl]-amino-dATP; N6-(4-amino)butyl-dATP, N6-(6-amino)butyl-dATP, N4-[2,2-oxy-bis-(ethylamine)]-dCTP; N6-(6-Amino)hexyl-dATP; 8-[(6-Amino)hexyl]-amino-dATP; 5-propargylamino-dCTP, and 5-propargylamino-dUTP. Such nucleotides can be prepared according to methods known to those of skill in the art. Moreover, a person of ordinary skill in the art could prepare other nucleotide entities with the same amine-modification, such as a 5-(3-aminoallyl)-CTP, GTP, ATP, dCTP, dGTP, dTTP, or dUTP in place of a 5-(3-aminoallyl)-UTP.
  • 2. Labeling Techniques
  • In some embodiments, nucleic acids are labeled by catalytically adding to the nucleic acid an already labeled nucleotide or nucleotides. One or more labeled nucleotides can be added to miRNA molecules. See U.S. Pat. No. 6,723,509, which is hereby incorporated by reference.
  • In other embodiments, an unlabeled nucleotide or nucleotides is catalytically added to an miRNA, and the unlabeled nucleotide is modified with a chemical moiety that enables it to be subsequently labeled. In embodiments of the invention, the chemical moiety is a reactive amine such that the nucleotide is an amine-modified nucleotide.
  • Examples of amine-modified nucleotides are well known to those of skill in the art, many being commercially available such as from Ambion, Sigma, Jena Bioscience, and TriLink.
  • In contrast to labeling of cDNA during its synthesis, the issue for labeling miRNA is how to label the already existing molecule. The present invention concerns the use of an enzyme capable of using a di- or tri-phosphate ribonucleotide or deoxyribonucleotide as a substrate for its addition to an miRNA, a small RNA molecule. Moreover, in specific embodiments, it involves using a modified di- or tri-phosphate ribonucleotide, which is added to the 3′ end of an miRNA. The source of the enzyme is not limiting. Examples of sources for the enzymes include yeast, gram-negative bacteria such as E. coli, lactococcus lactis, and sheep pox virus.
  • Enzymes capable of adding such nucleotides include, but are not limited to, poly(A) polymerase, terminal transferase, and polynucleotide phosphorylase. In specific embodiments of the invention, ligase is contemplated as NOT being the enzyme used to add the label, and instead, a non-ligase enzyme is employed.
  • Poly(A) polymerase has been cloned from a number of organisms from plants to humans. It has been shown to catalyze the addition of homopolymer tracts to RNA (Martin et al., RNA, 4(2):226-30, 1998).
  • Terminal transferase catalyzes the addition of nucleotides to the 3′ terminus of a nucleic acid.
  • Polynucleotide phosphorylase can polymerize nucleotide diphosphates without the need for a primer.
  • 3. Labels
  • Labels on miRNA or miRNA probes may be colorimetric (includes visible and UV spectrum, including fluorescent), luminescent, enzymatic, or positron emitting (including radioactive). The label may be detected directly or indirectly. Radioactive labels include 125I, 32P, 33P, and 35S. Examples of enzymatic labels include alkaline phosphatase, luciferase, horseradish peroxidase, and β-galactosidase. Labels can also be proteins with luminescent properties, e.g., green fluorescent protein and phycoerythrin.
  • The colorimetric and fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL; Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4-methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate; macrocyclic chelates of lanthanide ions, such as Quantum Dye™; Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red; fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer; and, TOTAB.
  • Specific examples of dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY dyes, such as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2′,4′,5′,7′-Tetrabromosulfonefluorescein, and TET.
  • Specific examples of fluorescently labeled ribonucleotides are available from Molecular Probes, and these include, Alexa Fluor 488-5-UTP, Fluorescein-12-UTP, BODIPY FL-14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14-UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP.
  • Examples of fluorescently labeled deoxyribonucleotides include Dinitrophenyl (DNP)-11-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546-14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY TR-14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650-14-dUTP, BODIPY 650/665-14-dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 594-7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP.
  • It is contemplated that nucleic acids may be labeled with two different labels. Furthermore, fluorescence resonance energy transfer (FRET) may be employed in methods of the invention (e.g., Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001, each incorporated by reference).
  • Alternatively, the label may not be detectable per se, but indirectly detectable or allowing for the isolation or separation of the targeted nucleic acid. For example, the label could be biotin, digoxigenin, polyvalent cations, chelator groups and the other ligands, include ligands for an antibody.
  • 4. Visualization Techniques
  • A number of techniques for visualizing or detecting labeled nucleic acids are readily available. The reference by Stanley T. Crooke, 2000 has a discussion of such techniques (Chapter 6), which is incorporated by reference. Such techniques include, microscopy, arrays, Fluorometry, Light cyclers or other real time PCR machines, FACS analysis, scintillation counters, Phosphoimagers, Geiger counters, MRI, CAT, antibody-based detection methods (Westerns, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC (Griffey et al., 1997, spectroscopy, capillary gel electrophoresis (Cummins et al., 1996), spectroscopy; mass spectroscopy; radiological techniques; and mass balance techniques.
  • When two or more differentially colored labels are employed, fluorescent resonance energy transfer (FRET) techniques may be employed to characterize the dsRNA. Furthermore, a person of ordinary skill in the art is well aware of ways of visualizing, identifying, and characterizing labeled nucleic acids, and accordingly, such protocols may be used as part of the invention. Examples of tools that may be used also include fluorescent microscopy, a BioAnalyzer, a plate reader, Storm (Molecular Dynamics), Array Scanner, FACS (fluorescent activated cell sorter), or any instrument that has the ability to excite and detect a fluorescent molecule.
  • C. Array Preparation
  • The present invention can be employed with miRNA arrays, which are ordered macroarrays or microarrays of nucleic acid molecules (probes) that are fully or nearly complementary or identical to a plurality of miRNA molecules or precursor miRNA molecules and that are positioned on a support material in a spatially separated organization. Macroarrays are typically sheets of nitrocellulose or nylon upon which probes have been spotted. Microarrays position the nucleic acid probes more densely such that up to 10,000 nucleic acid molecules can be fit into a region typically 1 to 4 square centimeters. Microarrays can be fabricated by spotting nucleic acid molecules, e.g., genes, oligonucleotides, etc., onto substrates or fabricating oligonucleotide sequences in situ on a substrate. Spotted or fabricated nucleic acid molecules can be applied in a high density matrix pattern of up to about 30 non-identical nucleic acid molecules per square centimeter or higher, e.g. up to about 100 or even 1000 per square centimeter. Microarrays typically use coated glass as the solid support, in contrast to the nitrocellulose-based material of filter arrays. By having an ordered array of miRNA-complementing nucleic acid samples, the position of each sample can be tracked and linked to the original sample. A variety of different array devices in which a plurality of distinct nucleic acid probes are stably associated with the surface of a solid support are known to those of skill in the art. Useful substrates for arrays include nylon, glass and silicon Such arrays may vary in a number of different ways, including average probe length, sequence or types of probes, nature of bond between the probe and the array surface, e.g. covalent or non-covalent, and the like.
  • Representative methods and apparatus for preparing a microarray have been described, for example, in U.S. Pat. Nos. 5,143,854; 5,202,231; 5,242,974; 5,288,644; 5,324,633; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,432,049; 5,436,327; 5,445,934; 5,468,613; 5,470,710; 5,472,672; 5,492,806; 5,525,464; 5,503,980; 5,510,270; 5,525,464; 5,527,681; 5,529,756; 5,532,128; 5,545,531; 5,547,839; 5,554,501; 5,556,752; 5,561,071; 5,571,639; 5,580,726; 5,580,732; 5,593,839; 5,599,695; 5,599,672; 5,610,287; 5,624,711; 5,631,134; 5,639,603; 5,654,413; 5,658,734; 5,661,028; 5,665,547; 5,667,972; 5,695,940; 5,700,637; 5,744,305; 5,800,992; 5,807,522; 5,830,645; 5,837,196; 5,871,928; 5,847,219; 5,876,932; 5,919,626; 6,004,755; 6,087,102; 6,368,799; 6,383,749; 6,617,112; 6,638,717; 6,720,138, as well as WO 93/17126; WO 95/11995; WO 95/21265; WO 95/21944; WO 95/35505; WO 96/31622; WO 97/10365; WO 97/27317; WO 99/35505; WO 09923256; WO 09936760; WO0138580; WO 0168255; WO 03020898; WO 03040410; WO 03053586; WO 03087297; WO 03091426; WO03100012; WO 04020085; WO 04027093; EP 373 203; EP 785 280; EP 799 897 and UK 8 803 000; the disclosures of which are all herein incorporated by reference.
  • It is contemplated that the arrays can be high density arrays, such that they contain 100 or more different probes. It is contemplated that they may contain 1000, 16,000, 65,000, 250,000 or 1,000,000 or more different probes. The probes can be directed to targets in one or more different organisms. The oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, or 15 to 40 nucleotides in length in some embodiments. In certain embodiments, the oligonucleotide probes are 20 to 25 nucleotides in length.
  • The location and sequence of each different probe sequence in the array are generally known. Moreover, the large number of different probes can occupy a relatively small area providing a high density array having a probe density of generally greater than about 60, 100, 600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 different oligonucleotide probes per cm2. The surface area of the array can be about or less than about 1, 1.6, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cm2.
  • Moreover, a person of ordinary skill in the art could readily analyze data generated using an array. Such protocols are disclosed above, and include information found in WO 9743450; WO 03023058; WO 03022421; WO 03029485; WO 03067217; WO 03066906; WO 03076928; WO 03093810; WO 03100448A1, all of which are specifically incorporated by reference.
  • D. Sample Preparation
  • It is contemplated that the miRNA of a wide variety of samples can be analyzed using assays described herein. While endogenous miRNA is contemplated for use with some embodiments, recombinant miRNA—including nucleic acids that are complementary or identical to endogenous miRNA or precursor miRNA—can also be handled and analyzed as described herein. Samples may be biological samples, in which case, they can be from blood, tissue, organs, semen, saliva, tears, other bodily fluid, hair follicles, skin, or any sample containing or constituting biological cells. Alternatively, the sample may not be a biological sample, but be a chemical mixture, such as a cell-free reaction mixture (which may contain one or more biological enzymes).
  • E. Hybridization
  • After the array is prepared and the miRNA in the sample is labeled, the population of target nucleic acids is contacted with the array under hybridization conditions, where such conditions can be adjusted, as desired, to provide for an optimum level of specificity in view of the particular assay being performed. Suitable hybridization conditions are well known to those of skill in the art and reviewed in Sambrook et al., 1989 and WO 95/21944. Of particular interest in many embodiments is the use of stringent conditions during hybridization. Stringent conditions are known to those of skill in the art.
  • It is specifically contemplated that a single array may be contacted with multiple samples. The samples may be labeled with different labels to distinguish the samples. For example, a single array can be contacted with a tumor tissue sample labeled with Cy3, and normal tissue sample labeled with Cy5. Differences between the samples for particular miRNAs corresponding to probes on the array can be readily ascertained and quantified.
  • The small surface area of the array permits uniform hybridization conditions, such as temperature regulation and salt content. Moreover, because of the small area occupied by the high density arrays, hybridization may be carried out in extremely small fluid volumes (e.g., about 250 μl or less, including volumes of about or less than about 5, 10, 25, 50, 60, 70, 80,90, 100 μl, or any range derivable therein). In small volumes, hybridization may proceed very rapidly.
  • F. Differential Expression Analyses
  • Arrays can be used to detect differences between two samples. This can also be used for diagnostic purposes. Specifically contemplated applications include identifying and/or quantifying differences between miRNA from a sample that is normal and from a sample that is not normal or between two differently treated samples. Also, miRNA may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition. A sample that is not normal is one exhibiting phenotypic trait(s) of a disease or condition or one believed to be not normal with respect to that disease or condition. It may be compared to a cell that is normal with respect to that disease or condition. Phenotypic traits include symptoms of, or susceptibility to, a disease or condition of which a component is or may or may not be genetic.
  • G. Cell Assays to Identify miRNAs with Ties to Disease
  • Specifically contemplated applications include identifying miRNAs that contribute to cellular processes that are themselves parts of a disease or might otherwise be associated with a particular disease state. Also, miRNA functions may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition. It is specifically contemplated that RNA molecules of the present invention can be used to treat any of the diseases or conditions discussed in the previous section or modulate any of the cellular pathways discussed in the previous section.
  • Specifically contemplated applications include identifying miRNAs that contribute to cellular processes that are themselves parts of a disease or might otherwise be associated with a particular disease state. Also, miRNA functions may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition.
  • AIDS, autoimmune diseases (rheumatoid arthritis, multiple sclerosis, diabetes—insulin-dependent and non-independent, systemic lupus erythematosus and Graves disease); cancer (e.g., malignant, benign, metastatic, precancer); cardiovascular diseases (heart disease or coronary artery disease, stroke—ischemic and hemorrhagic, and rheumatic heart disease); diseases of the nervous system; and infection by pathogenic microorganisms (Athlete's Foot, Chickenpox, Common cold, Diarrheal diseases, Flu, Genital herpes, Malaria, Meningitis, Pneumonia, Sinusitis, Skin diseases, Strep throat, Tuberculosis, Urinary tract infections, Vaginal infections, Viral hepatitis); inflammation (allergy, asthma); prion diseases (e.g., CJD, kuru, GSS, FFI).
  • Moreover, miRNA can be evaluated with respect to the following diseases, conditions, and disorders: Abdominal Adhesions; Anal Abscess; Brain Abscess; Peritonsillar Abscess; Absence Seizures; Achalasia; Acne; Acoustic Neuroma; Acquired Immunodeficiency Syndrome (AIDS); Acrochordon; Actinic Keratosis; Adenocarcinoma of the Lung; ADHD; Adult-Onset Diabetes; Aero-Otitis; Age Spots; Age-Related Hearing Loss; Age-Related Macular Degeneration; Age-Related Vision Change (Presbyopia); Agoraphobia; Alcohol Withdrawal; Alcoholism; Allergen Immunotherapy; Allergic Rhinitis; Allergies; Alopecia (Areata, Hereditary-Patterned, and Traumatic); Altitude Sickness; Alzheimer's Disease; Amaurotic Familial Infantile Idiocy; Amblyopia; Amenorrhea; Amyloidosis; Amyotrophic Lateral Sclerosis (ALS); Anaphylaxis; Androgenetic Alopecia; Anemia (Aplastic, Hemolytic, Pernicious, and Sickle Cell); Angina; Angiomas, Spider; Angioplasty; Ankylosing Spondylitis; Anorexia Nervosa; Anovulatory Bleeding; Antibiotic-Associated Diarrhea; Antiphospholipid Antibody Syndrome; Antisocial Personality Disorder; Anus Fissure, Fistula, Hemorrhoids, Anus Itch, Stricture; Anxiety Disorders (Generalized, Obsessive-Compulsive Disorder, Panic Disorder, Phobia, and Post-Traumatic Stress Disorder); Aortic Aneurysm; Aortic Arch Syndrome; Appendicitis; Arrhythmias, Cardiac; Arteritis, Takayasu's; Arthritic Diseases (Ankylosing Spondylitis, Gout, Infectious, Juvenile, Osteoarthritis, Pseudogout, Psoriatic Arthritis, and Rheumatoid); Asbestosis; Ascending Cholangitis; Asteatotic Eczema; Asthma; Astigmatism; Asymptomatic Bacteriuria; Ataxia, Friedreich's; Atherosclerosis; Athlete's Foot; Atopic Dermatitis; Atrial Fibrillation; Atrophic Vaginitis; Attention-Deficit Hyperactivity Disorder; Autism; Autoimmune Diseases (Celiac Disease, Crohn's Disease, Diabetes Mellitus, Type 1 (Insulin-Dependent; Juvenile-Onset), Diabetes Mellitus, Type 2 (Non-Insulin-Dependent; Adult-Onset), Graves' Disease, Hyperthyroidism, Immune Thrombocytopenic Purpura, Lupus, Myasthenia Gravis, Polyarteritis Nodosa, Rheumatoid Arthritis, Scleroderma, Takayasu's Arteritis, and Ulcerative Colitis); B12 Deficiency; Bacillary Dysentery; Bacterial Gastroenteritis; Bacterial Vaginosis; Balanitis; Baldness, Hereditary-Patterned; Barber's Itch; Barotitis; Barotrauma; Bartholin's Gland Cyst; Basal-Cell Carcinoma; Bed-Wetting; Bedsores; Behcet's Syndrome; Bell's Palsy; Bends; Benign Prostatic Hyperplasia; Bile-Duct Diseases; Biliary Colic; Biopsy; Bipolar Disorder; Bladder conditions (Infection; Interstitial Cystitis; Prolapse; Urethritis; Urinary Incontinence; Urinary Tract Infection); Blepharitis; Blepharoptosis; Blighted Ovum; Friction Blisters; Blood Pressure, High; Boils; Bone diseases and conditions (Osteoporosis; Paget's Disease); Bone Yaws; Borderline Personality Disorder; Bornholm Disease; Botulism; Bowel Obstruction; Bradycardia; Bronchitis; Bulimia Nervosa; Bunion; Bursitis; C. Difficile Colitis; Calcaneal Apophysitis; Calcium Pyrophosphate Deposition Disease; Campylobacteriosis; Cancer; Candidiasis; Carbon-Monoxide Poisoning; Carbuncles; Cardiac Arrhythmias (Atrial Fibrillation, Bradycardia); Cardiomyopathy; Carpal Tunnel Syndrome; Cataracts; Cellulitis; Central Serous Retinopathy; Cerebral Palsy; Cerebromacular Degeneration; Cerumen Impaction; Cervicitis, Nabothian Cysts, Cervical Polyps, Cervical Warts; Chalazion; Chickenpox; Chlamydia; Chloasma; Cholangitis; Cholecystitis; Cholesteatoma; Chondromalacia; Chorea; Choroidal Melanoma; Chronic Bronchitis; Chronic Fatigue Syndrome; Chronic Hepatitis; Chronic Leukemia; Chronic Obstructive Pulmonary Disease; Chronic Otitis Media; Cirrhosis; Cluster Headache; Cogan's Syndrome; Cold, Common; Colic, Biliary; Pseudomembranous Colitis, Ulcerative Colitis, Collapsed Lung; Collarbone Fracture; Coma; Complex Regional Pain Syndrome; Congestive Heart Failure; Conjunctivitis; Constipation; Contact Dermatitis; Conversion Disorder; COPD; Cornea Abrasion, Cornea Keratitis; Corns; Coronary Artery Disease; Creutzfeldt-Jakob Disease; Crossed Eyes; Croup; Cryptorchidism; Cystic Fibrosis; Interstitial Cystitis; Cystocele; Cysts; Cytomegalovirus infection; Dacryocystitis; Dandruff; Decompression Sickness; Decubitus Ulcers; Delirium Tremens; Delusional Disorder; Dementia; Depressive Disorders (Bipolar Disorder, Dysthymia, Major Depression, Manic Depression, Postpartum Depression); Dermatitis; Dermatofibroma; Dermatomyositis; Detached Retina; Developmental Dysplasia of the Hip; Deviated Septum; Devil's Grip; Diabetes (Gestational Diabetes; Type 1 Diabetes (Insulin-Dependent; Juvenile); Type 2 Diabetes (Non-Insulin-Dependent; Adult-Onset); Hypoglycemia, Ketoacidosis, Nephropathy, Neuropathies, Retinopathy) Antibiotic-Associated Diarrhea; Diplopia; Herniated Disk; Dislocated Lens; Hip Dislocation (Developmental); Diverticulitis; Diverticulosis; Dizziness; Doerderland's Vaginitis; Double Vision; Down Syndrome; Drooping Eyelid; Dry Skin; Sun-Damaged Skin; Dry-Eye Syndrome; Duck-Foot; Dysautonomia, Familial; Dysfunctional Uterine Bleeding; Dyslexia; Dyspareunia; Dysthymia; Dysuria; Eating Disorders (Anorexia Nervosa, Bulimia Nervosa); Eclampsia; Eczema; Edema; Emphysema; Encephalitis; Encopresis; End-Stage Renal Disease; Endocarditis; Endometriosis; Endophthalmitis; Endoscopy; Enlarged Prostate; Enuresis; Epidemic Benign Dry Pleurisy; Epididymitis; Epiglottitis; Epilepsy; Epistaxis; Erectile Dysfunction; Erythema Infectiosum; Esophagitis; Esophagus Achalasia; Esophagitis; Essential Hypertension; Essential Tremor; Ewing's Sarcoma; Familial Dysautonomia; Farsightedness; Febrile Seizures; Fecal Incontinence; Fever; Fever-Induced Seizures; Fibroids; Fibromyalgia; Fifth Disease; Filiform Warts; Flat Warts; Flatulence; Flu; Focal Seizures; Food Allergy; Food Poisoning; Forefoot Neuroma; Fragile X Syndrome; Friction Blisters; Friedreich's Ataxia; Frostbite; Fungal Infections (Athlete's Foot, Brain Abscess, Infectious Arthritis, Jock Itch, Onychomycosis, Ringworm, Swimmer's Ear, Tinea Cruris, Tinea Unguium, Tinea Versicolor); Furuncle; Gallstones; Gardnerella Vaginitis; Gastritis; Gastrocnemius Strain; Gastroenteritis; Gastroesophageal Reflux Disease; Gastrointestinal Amebiasis; Generalized Anxiety Disorder; Generalized Barotrauma; Genital Herpes; Genital Warts; GERD; Germ Cell Tumors, Extragonadal; Giant Cell Arteritis; Giardiasis; Glaucoma; Glomerulonephritis; Gluten-Sensitive Enteropathy; GM2 Gangliosidosis; Gonorrhea; Gout; Grand Mal Seizures; Graves' Disease; Graves' Ophthalmopathy; Guillain-Barré Syndrome; Hammertoe; Hay Fever; Headache; Hearing Loss; Heart Attack; Heat Stroke; Heel Spur; Heloma; Spider Hemangiomas; Hematoma; Hematuria; Hemochromatosis; Hemolytic Anemia; Hemophilia; Hemorrhagic Stroke; Subarachnoid Hemorrhagic Stroke; Hemorrhoids; Hepatitis A; Hepatitis B; Hepatitis C; Hereditary-Patterned Baldness; Hernia; Herniated Disk; High Blood Pressure; High Cholesterol; Hirsutism; Histiocytosis X; HIV/AIDS; Hordeolum; Human Papilloma Virus (HPV); Huntington's Disease; Hydatidiform Mole; Hydrocephalus; Hyperactivity; Hypercholesterolemia; Hyperkeratosis; Hyperopia; Hypertension; Ocular Hypertension; Secondary Hypertension; Hypertensive Retinopathy; Hyperthermia; Hyperthyroidism; Hypochondriasis; Hypoglycemia; Hypoparathyroidism; Hypothyroidism; IBS; ICD; Ichthyosis; Immune Thrombocytopenic Purpura; Impetigo; Impotence; Incontinence; Infantile Ganglioside Lipidosis; Infectious Arthritis; Infectious Mononucleosis; Infertility; Inflammatory Bowel Disease; Inguinal Hernia; Insomnia; Intercerebral Hemorrhage; Interdigital Neuroma; Intermetatarsal Neuroma; Intermittent Claudication; Interstitial Cystitis; Intestinal Obstruction; Iron Deficiency; Irritable Bowel Syndrome; Juvenile Arthritis; Kaposi's Sarcoma; Kawasaki Syndrome; Keloids; Keratitis; Actinic Keratosis; Labyrinthitis; Lactose Intolerance; Lacunar Stroke; Langerhans' Cell Histiocytosis; Laryngitis; Laryngotracheitis; Lateral Epicondylitis; Latex Allergy; Lazy Eye; Lead Poisoning; Intermittent Claudication; Restless Legs Syndrome; Shin Splints; Leg Strain; Cataract; Dislocated Lens; Leukemia; Lice; Lichen Simplex Chronicus; Cirrhosis; Hepatitis; Liver Spots; Lockjaw; Lou Gehrig's Disease; Lupus Erythematosus, Systemic; Lyme Disease; Lymphedema; Lymphoma; Macular Degeneration; Malabsorption Syndromes; Malaria; Male Pattern Baldness; Malignant Hyperthermia; Manic Depression; Marfan's Syndrome; Mastoiditis; Measles; Meckel's Diverticulum; Melasma; Meniere's Disease; Meningitis; Menopause; Mental Retardation; Phenylketonuria; Migraine; Miscarriage; Mitral-Valve Prolapse; Mittelschmerz; Molar Pregnancy; Molluscum Contagiosum; Mononucleosis; Morton's Neuroma; Mosaic Warts; Motor Tics; Mucocutaneous Lymph Node Syndrome; Multiple Sclerosis; Mumps; Muscular Dystrophy; Musculoskeletal Disorders (Fibromyalgia, Giant Cell Arteritis, Gout, Infectious Arthritis, Muscular Dystrophy, Myositis, Osteoarthritis, Osteoporosis, Paget's Disease Of Bone, Polymyalgia Rheumatica, Pseudogout, Reflex Sympathetic Dystrophy, Rheumatoid Arthritis, Scleroderma, Systemic Lupus Erythematosus, Tendonitis); Myasthenia Gravis; Myocardial Infarction; Myocarditis; Myopia; Myositis; Nail Felon; Onycholysis; Onychomycosis; Paronychia; Subungual Hematoma; Narcolepsy; Nasal Polyps; Nausea; Nearsightedness; Needle Biopsy; Nephrectomy; Nephroblastoma; Nephrolithiasis; Nephropathy, Diabetic; Neuritis, Retrobulbar; Neuroblastoma; Neuromuscular Disorders; Neuropathies; Guillain-Barre Syndrome; Retrobulbar; Nevi; Nevus Flammeus; Nevus Simplex; Nocturnal Enuresis; Non-Tropical Sprue; Obesity; Obsessive-Compulsive Disorder; Occupational Hearing Loss; Ocular Hypertension; Ocular Rosacea; Onycholysis; Onychomycosis; Glaucoma; Retrobulbar Neuritis; Optic Nerve Swelling; Orbit Fracture; Orchitis; Osgood-Schlatter Disease; Osteoarthritis; Osteoporosis; Osteosarcoma; Otitis Externa; Otitis Media; Chronic Otitis Media; Otosclerosis; Ototoxicity; Pelvic Inflammatory Disease; Polycystic Ovary Syndrome; Painful-Bladder Syndrome; Pancreatitis; Panic Disorder; Papilledema; Paraphimosis; Parkinson's Disease; Paronychia; Partial Seizures; PCL Injuries; Pedunculated Warts; Pelvic Relaxation; Paraphimosis; Peyronie's Disease; Peptic Ulcer; Perforated Eardrum; Pericarditis; Perimenopause; Peripheral Vascular Disease; Peritonsillar Abscess; Persistent Vegetative State; Personality Disorders; Petit Mal Seizures; Peyronie's Disease; Pharyngitis; Pharynx Cancer; Phenylketonuria; Phimosis; Phobia; Photosensitivity; Pigmentation Disorders (Chloasma, Melasma, Vitiligo); Piles; Pinkeye; Pityriasis Rosea; PKU; Plague; Plantar Fasciitis; Plantar Warts; Plantaris Strain; Pleurisy; Pleurodynia; PMS; Pneumoconiosis; Pneumonectomy; Pneumonia; Pneumothorax; Lead Poisoning; Polio; Poliomyelitis; Polyarteritis Nodosa; Polychondritis; Polymyalgia Rheumatica; Polymyositis; Colonic Polyps; Nasal Polyps; Vocal Cord Polyps; Port-Wine Stain; Post-Polio Syndrome; Postinfectious Thrombocytopenia; Postpartum Depression; Preeclampsia; Pregnancy-Induced Hypertension; Premenstrual Syndrome; Pressure Sores; Primary Sclerosing Cholangitis; Prolapse; Enlarged Prostate; Acute Prostatitis; Chronic Prostatitis; Pruritus Ani; Pseudogout; Psoriasis; Psoriatic Arthritis; Ptosis; Pulseless Disease; Pyelonephritis; Quadriceps Strain; Quinsy; Rash; Raynaud's Phenomenon; Rectal Itch; Rectocele; Reflex Sympathetic Dystrophy; Renal Failure; Respiratory Disorders Respiratory Syncytial Virus; Retina Detachment; Retinitis Pigmentosa; Retinopathy; Retrobulbar Neuritis; Reye's Syndrome; Rhabdomyosarcoma; Rheumatoid Arthritis; Allergic Rhinitis; Viral Rhinitis (Common Cold); Riley-Day Syndrome; Ringworm; Rocky Mountain Spotted Fever; Rosacea; Rubeola; Mumps; Salivary Gland Disorders; Salmon Patch; Sarcoidosis; Scabies; Scarlet Fever; Scars; Schizophrenia; Schizotypal Personality Disorder; Sciatica; Scleritis; Scleroderma; Scoliosis; Sebaceous Cysts; Seborrhea; Seborrheic Keratoses; Secondary Hypertension; Seizures; Sexual Dysfunction; Sexually Transmitted Diseases; Shigellosis; Shingles; Sialadenitis; Sialadenosis; Sialolithiasis; Sickle-Cell Anemia; Siderosis; Silicosis; Sinus Cancer; Sjögren's Syndrome; Sleep Disorders; Smallpox; Social Anxiety Disorder; Solar Lentigo; Somatoform Disorders (Hypochondriasis, Somatization Disorder); Somnambulism; Spastic Colon; Spider Veins; Spina Bifida; Spinal Cord Trauma; Spontaneous Abortion; Stasis Dermatitis; Strabismus; Strep Throat; Streptococcal Toxic Shock Syndrome; Stroke; Subarachnoid Hemorrhage; Transient Ischemic Attack; Stuttering; Subungual Hematoma; Sun Allergy; Sun-Damaged Skin; Sylvest's Disease; Systemic Lupus Erythematosus; Systemic Sclerosis; Tachycardia; Takayasu's Arteritis; Tay-Sachs Disease; Tear-Duct Infection; Telogen Effluvium; Temporal Arteritis; Tendonitis; Tennis Elbow; Tension Headache; Testicular Torsion; Undescended Testicles; Tetanus; Thrombocytopenia; Thrombophlebitis; Thrombotic Stroke; Tinea; Tinnitus; Tonsillitis; Torsional Deformities; Toxemia Of Pregnancy; Toxic Shock Syndrome, Streptococcal; Toxoplasmosis; Trichomoniasis; Trigeminal Neuralgia (Tic Douloureux); Tuberculosis; Tylosis; Ulcer; Urethritis; Urinary Tract disorders and conditions; Uroliniasis; Urticaria; Uterine disorders; Uterine Prolapse; Uveitis; Vaginitis; Bacterial (Gardnerella) Vaginosis; Varicella; Varices, Esophageal; Varicose Veins; Vascular Disorders (Hypertension, Intermittent Claudication, Peripheral Vascular Disease, Polyarteritis Nodosa, Raynaud's Phenomenon, Takayasu's Arteritis, Thrombophlebitis, Vasculitis, Wegener's Granulomatosis); Vein Inflammation; Varicose Veins; Vertigo; Vestibular Schwannoma; Viral Rhinitis; Vitamin B12 Deficiency; Vitiligo; Vocal Tics; Vocal-Cord Disorders; Common Warts; Genital Warts; Plantar Warts; Water On The Brain; Wax Blockage Of Ear Canal; Esophageal Webs; Werlhofs Disease; Wrinkles; Yersinia Pestis Infection. It is contemplated that such diseases can be diagnosed or treated using a nucleic acids of the invention that correspond to miRNAs.
  • Cancers that may be evaluated, diagnosed, and/or treated by methods and compositions of the invention include cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malig melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyo sarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia. Moreover, miRNA can be evaluated in precancers, such as metaplasia, dysplasia, and hyperplasia.
  • It is specifically contemplated that the invention can be used to evaluate or diagnose differences between stages of disease, such as between pre-cancer and cancer, or between a primary tumor and a metastasized tumor.
  • The efficacy of different therapeutic drugs is altered by miRNAs according to the present invention. Such therapeutic drugs include, but are not limited to, chemotherapeutic drugs. A “chemotherapeutic agent” is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.
  • Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2′,2″-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel and doxetaxel; chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
  • Also included in this definition are anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen, raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene; aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate, exemestane, formestanie, fadrozole, vorozole, letrozole, and anastrozole; and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; ribozymes such as a VEGF expression inhibitor and a HER2 expression inhibitor; vaccines such as gene therapy vaccines and pharmaceutically acceptable salts, acids or derivatives of any of the above. A list of U.S. FDA approved oncology drugs with their approved indications can be found on the World Wide Web at accessdata.fda.gov/scripts/cder/onctools/druglist.cfm. Moreover, it is contemplated that samples that have differences in the activity of certain pathways may also be compared. Such cellular pathways include but are not limited to the following: any adhesion or motility pathway including but not limited to those involving cyclic AMP, protein kinase A, G-protein couple receptors, adenylyl cyclase, L-selectin, E-selectin, PECAM, VCAM-1, α-actinin, paxillin, cadherins, AKT, integrin-α, integrin-β, RAF-1, ERK, PI-3 kinase, vinculin, matrix metalloproteinases, Rho GTPases, p85, trefoil factors, profilin, FAK, MAP kinase, Ras, caveolin, calpain-1, calpain-2, epidermal growth factor receptor, ICAM-1, ICAM-2, cofilin, actin, gelsolin, RhoA, RAC1, myosin light chain kinase, platelet-derived growth factor receptor or ezrin; any apoptosis pathway including but not limited to those involving AKT, Fas ligand, NFKB, caspase-9, PI3 kinase, caspase-3, caspase-7, ICAD, CAD, EndoG, Granzyme B, Bad, Bax, Bid, Bak, APAF-1, cytochrome C, p53, ATM, Bcl-2, PARP, Chk1, Chk2, p21, c-Jun, p′73, Rad51, Mdm2, Rad50, c-Abl, BRCA-1, perforin, caspase-4, caspase-8, caspase-6, caspase-1, caspase-2, caspase-10, Rho, Jun kinase, Jun kinase kinase, Rip2, lamin-A, lamin-B1, lamin-B2, Fas receptor, H2O2, Granzyme A, NADPH oxidase, HMG2, CD4, CD28, CD3, TRADD, IKK, FADD, GADD45, DR3 death receptor, DR4/5 death receptor, FLIPs, APO-3, GRB2, SHC, ERK, MEK, RAF-1, cyclic AMP, protein kinase A, E2F, retinoblastoma protein, Smac/Diablo, ACH receptor, 14-3-3, FAK, SODD, TNF receptor, RIP, cyclin-D1, PCNA, Bcl-XL, PIP2, PIP3, PTEN, ATM, Cdc2, protein kinase C, calcineurin, IKKα, IKKβ, IKKγ, SOS-1, c-FOS, Traf-1, Traf-2, IKBβ or the proteasome; any cell activation pathway including but not limited to those involving protein kinase A, nitric oxide, caveolin-1, actin, calcium, protein kinase C, Cdc2, cyclin B, Cdc25, GRB2, SRC protein kinase, ADP-ribosylation factors (ARFs), phospholipase D, AKAP95, p68, Aurora B, CDK1, Eg7, histone H3, PKAc, CD80, PI3 kinase, WASP, Arp2, Arp3, p16, p34, p20, PP2A, angiotensin, angiotensin-converting enzyme, protease-activated receptor-1, protease-activated receptor-4, Ras, RAF-1, PLCβ, PLCγ, COX-1, G-protein-coupled receptors, phospholipase A2, IP3, SUMO1, SUMO 2/3, ubiquitin, Ran, Ran-GAP, Ran-GEF, p53, glucocorticoids, glucocorticoid receptor, components of the SWI/SNF complex, RanBP1, RanBP2, importins, exportins, RCC1, CD40, CD40 ligand, p38, IKKα, IKKβ, NFKB, TRAF2, TRAF3, TRAF5, TRAF6, IL-4, IL-4 receptor, CDK5, AP-1 transcription factor, CD45, CD4, T cell receptors, MAP kinase, nerve growth factor, nerve growth factor receptor, c-Jun, c-Fos, Jun kinase, GRB2, SOS-1, ERK-1, ERK, JAK2, STAT4, IL-12, IL-12 receptor, nitric oxide synthase, TYK2, IFNγ, elastase, IL-8, epithelins, IL-2, IL-2 receptor, CD28, SMAD3, SMAD4, TGFβ or TGFβ receptor; any cell cycle regulation, signaling or differentiation pathway including but not limited to those involving TNFs, SRC protein kinase, Cdc2, cyclin B, Grb2, Sos-1, SHC, p68, Aurora kinases, protein kinase A, protein kinase C, Eg7, p53, cyclins, cyclin-dependent kinases, neural growth factor, epidermal growth factor, retinoblastoma protein, ATF-2, ATM, ATR, AKT, CHK1, CHK2, 14-3-3, WEE1, CDC25 CDC6, Origin Recognition Complex proteins, p15, p16, p27, p21, ABL, c-ABL, SMADs, ubiquitin, SUMO, heat shock proteins, Wnt, GSK-3, angiotensin, p73 any PPAR, TGFα, TGFβ, p300, MDM2, GADD45, Notch, cdc34, BRCA-1, BRCA-2, SKP1, the proteasome, CUL1, E2F, p107, steroid hormones, steroid hormone receptors, IKBα, IKBβ, Sin3A, heat shock proteins, Ras, Rho, ERKs, IKKs, PI3 kinase, Bcl-2, Bax, PCNA, MAP kinases, dynein, RhoA, PKAc, cyclin AMP, FAK, PIP2, PIP3, integrins, thrombopoietin, Fas, Fas ligand, PLK3, MEKs, JAKs, STATs, acetylcholine, paxillin calcineurin, p38, importins, exportins, Ran, Rad50, Rad51, DNA polymerase, RNA polymerase, Ran-GAP, Ran-GEF, NuMA, Tpx2, RCC1, Sonic Hedgehog, Crm1, Patched (Ptc-1), MPF, CaM kinases, tubulin, actin, kinetochore-associated proteins, centromere-binding proteins, telomerase, TERT, PP2A, c-MYC, insulin, T cell receptors, B cell receptors, CBP, IKB, NFKB, RAC1, RAF1, EPO, diacylglycerol, c-Jun, c-Fos, Jun kinase, hypoxia-inducible factors, GATA4, β-catenin, α-catenin, calcium, arrestin, survivin, caspases, procaspases, CREB, CREM, cadherins, PECAMs, corticosteroids, colony-stimulating factors, calpains, adenylyl cyclase, growth factors, nitric oxide, transmembrane receptors, retinoids, G-proteins, ion channels, transcriptional activators, transcriptional coactivators, transcriptional repressors, interleukins, vitamins, interferons, transcriptional corepressors, the nuclear pore, nitrogen, toxins, proteolysis, or phosphorylation; or any metabolic pathway including but not limited to those involving the biosynthesis of amino acids, oxidation of fatty acids, biosynthesis of neurotransmitters and other cell signaling molecules, biosynthesis of polyamines, biosynthesis of lipids and sphingolipids, catabolism of amino acids and nutrients, nucleotide synthesis, eicosanoids, electron transport reactions, ER-associated degradation, glycolysis, fibrinolysis, formation of ketone bodies, formation of phagosomes, cholesterol metabolism, regulation of food intake, energy homeostasis, prothrombin activation, synthesis of lactose and other sugars, multi-drug resistance, biosynthesis of phosphatidylcholine, the proteasome, amyloid precursor protein, Rab GTPases, starch synthesis, glycosylation, synthesis of phoshoglycerides, vitamins, the citric acid cycle, IGF-1 receptor, the urea cycle, vesicular transport, or salvage pathways. It is further contemplated that nucleic acids molecules of the invention can be employed in diagnostic and therapeutic methods with respect to any of the above pathways or factors. Thus, in some embodiments of the invention, a synthetic miRNA, nonsynthetic nucleic acid, or miRNA inhibitor inhibits, eliminate, activates, induces, increases, or otherwise modulates one or more of the above pathways or factors is contemplated as part of methods of the invention. The nucleic acid can be used to diagnosis a disease or condition based on the relation of that miRNA to any of the pathways described above.
  • Phenotypic traits also include characteristics such as longevity, appearance (e.g., baldness, obesity), strength, speed, endurance, fertility, and susceptibility or receptivity to particular drugs or therapeutic treatments. Synthetic miRNAs or miRNA inhibitors that affect phenotypic traits may provide intervention points for therapeutic development.
  • H. Other Assays
  • In addition to the use of arrays and microarrays, it is contemplated that a number of difference assays could be employed to analyze miRNAs, their activities, and their effects. Such assays include, but are not limited to, RT-PCR, in situ hybridization, hybridization protection assay (HPA)(GenProbe), branched DNA (bDNA) assay (Chiron), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies), and Bridge Litigation Assay (Genaco). It is contemplated that such methods may be used in the context of arrays, as well as in the context of diagnostic assays.
  • III. Therapeutic and Diagnostic Applications
  • Synthetic miRNAs or miRNA inhibitors that affect phenotypic traits provide intervention points for therapeutic applications as well as diagnostic applications (by screening for the presence or absence of a particular miRNA). It is specifically contemplated that RNA molecules of the present invention can be used to treat any of the diseases or conditions discussed in the previous section. Moreover, any of the methods described above can also be employed with respect to therapeutic and diagnostic aspects of the invention. For example, methods with respect to detecting miRNAs or screening for them can also be employed in a diagnostic context.
  • In therapeutic applications, an effective amount of the synthetic miRNAs or miRNA inhibitors of the present invention is administered to a cell, which may or may not be in an animal. In some embodiments, a therapeutically effective amount of the synthetic miRNAs or miRNA inhibitors of the present invention is administered to an individual for the treatment of disease or condition. The term “effective amount” as used herein is defined as the amount of the molecules of the present invention that are necessary to result in the desired physiological change in the cell or tissue to which it is administered. The term “therapeutically effective amount” as used herein is defined as the amount of the molecules of the present invention that achieves a desired effect with respect to a disease or condition. A skilled artisan readily recognizes that in many cases the molecules may not provide a cure but may provide a partial benefit, such as alleviation or improvement of at least one symptom. In some embodiments, a physiological change having some benefit is also considered therapeutically beneficial. Thus, in some embodiments, an amount of molecules that provides a physiological change is considered an “effective amount” or a “therapeutically effective amount.”
  • In some embodiments the molecule has a sequence that corresponds to the miRNA sequence from that particular animal, as opposed to from another animal. Thus, in some embodiments, a human sequence is utilized in the RNA molecules of the present invention.
  • A. Modes of Administration and Formulations
  • The nucleic acid molecules of the invention may be administered to a subject alone or in the form of a pharmaceutical composition for the treatment of a condition or disease. Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the proteins into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • For topical administration the proteins of the invention may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art. Systemic formulations include those designed for administration by injection, e.g. subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, inhalation, oral or pulmonary administration. For injection, the nucleic acids of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer. The solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the nucleic acid molecules may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. For oral administration, the nucleic acids can be readily formulated by combining the molecules with pharmaceutically acceptable carriers well known in the art. Such carriers enable the nucleic acids of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. For oral solid formulations such as, for example, powders, capsules and tablets, suitable excipients include fillers such as sugars, e.g. lactose, sucrose, mannitol and sorbitol; cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP); granulating agents; and binding agents. If desired, disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. If desired, solid dosage forms may be sugar-coated or enteric-coated using standard techniques. For oral liquid preparations such as, for example, suspensions, elixirs and solutions, suitable carriers, excipients or diluents include water, glycols, oils, alcohols, etc. Additionally, flavoring agents, preservatives, coloring agents and the like may be added. For buccal administration, the molecules may take the form of tablets, lozenges, etc. formulated in conventional manner. For administration by inhalation, the molecules for use according to the present invention are conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the nucleic acids and a suitable powder base such as lactose or starch. The RNA molecules may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • In addition to the formulations described previously, the molecules may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the molecules may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • Alternatively, other pharmaceutical delivery systems may be employed. Liposomes and emulsions are well-known examples of delivery vehicles that may be used to deliver nucleic acids of the invention.
  • A nucleic acid of the invention may be administered in combination with a carrier or lipid to increase cellular uptake. For example, the oligonucleotide may be administered in combination with a cationic lipid. Examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE, and DOTAP. The publication of WO0071096, which is specifically incorporated by reference, describes different formulations, such as a DOTAP:cholesterol or cholesterol derivative formulation that can effectively be used for gene therapy. Other disclosures also discuss different lipid or liposomal formulations including nanoparticles and methods of administration; these include, but are not limited to, U.S. Patent Publication 20030203865, 20020150626, 20030032615, and 20040048787, which are specifically incorporated by reference to the extent they disclose formulations and other related aspects of administration and delivery of nucleic acids. Methods used for forming particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972,900, which are incorporated by reference for those aspects.
  • The nucleic acids may also be administered in combination with a cationic amine such as poly (L-lysine). Nucleic acids may also be conjugated to a chemical moiety, such as transferrin and cholesteryls. In addition, oligonucleotides may be targeted to certain organelles by linking specific chemical groups to the oligonucleotide. For example, linking the oligonucleotide to a suitable array of mannose residues will target the oligonucleotide to the liver.
  • Additionally, the molecules may be delivered using a sustained-release system, such as semipermeable matrices of solid polymers containing the therapeutic agent. Various of sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the molecules for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the chimeric molecules, additional strategies for molecule stabilization may be employed.
  • Nucleic acids may be included in any of the above-described formulations as the free acids or bases or as pharmaceutically acceptable salts. Pharmaceutically acceptable salts are those salts that substantially retain the biologic activity of the free bases and which are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous and other protic solvents than are the corresponding free base forms.
  • Pharmaceutical compositions of the present invention comprise an effective amount of one or more synthetic miRNA molecules or miRNA inhibitors dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases “pharmaceutical or pharmacologically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of an pharmaceutical composition that contains at least one chimeric polypeptide or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
  • As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
  • The chimeric molecules may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. The present invention can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, inhalation (e.g. aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).
  • The actual dosage amount of a composition of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
  • In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, the an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.
  • In any case, the composition may comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
  • The molecules may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
  • In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof.
  • In other embodiments, one may use eye drops, nasal solutions or sprays, aerosols or inhalants in the present invention. Such compositions are generally designed to be compatible with the target tissue type. In a non-limiting example, nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, in preferred embodiments the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, drugs, or appropriate drug stabilizers, if required, may be included in the formulation. For example, various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines.
  • In certain embodiments, the molecules are prepared for administration by such routes as oral ingestion. In these embodiments, the solid composition may comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules (e.g., hard or soft shelled gelatin capsules), sustained release formulations, buccal compositions, troches, elixirs, suspensions, syrups, wafers, or combinations thereof. Oral compositions may be incorporated directly with the food of the diet. Preferred carriers for oral administration comprise inert diluents, assimilable edible carriers or combinations thereof. In other aspects of the invention, the oral composition may be prepared as a syrup or elixir. A syrup or elixir, and may comprise, for example, at least one active agent, a sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or combinations thereof.
  • In certain preferred embodiments an oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof. In certain embodiments, a composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the foregoing. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both.
  • The composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less that 0.5 ng/mg protein.
  • In particular embodiments, prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin or combinations thereof.
  • Any embodiment discussed above with respect to delivery or transport to cells can also be employed with respect to implementing delivery of medicinal compounds discussed in this section.
  • B. Effective Dosages
  • The molecules of the invention will generally be used in an amount effective to achieve the intended purpose. For use to treat or prevent a disease condition, the molecules of the invention, or pharmaceutical compositions thereof, are administered or applied in a therapeutically effective amount. A therapeutically effective amount is an amount effective to ameliorate or prevent the symptoms, or prolong the survival of, the patient being treated. Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • For systemic administration, a therapeutically effective dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC5 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
  • Initial dosages can also be estimated from in vivo data, e.g., animal models, using techniques that are well known in the art. One having ordinary skill in the art could readily optimize administration to humans based on animal data.
  • Dosage amount and interval may be adjusted individually to provide plasma levels of the molecules which are sufficient to maintain therapeutic effect. Usual patient dosages for administration by injection range from about 0.1 to 5 mg/kg/day, preferably from about 0.5 to 1 mg/kg/day. Therapeutically effective serum levels may be achieved by administering multiple doses each day.
  • In cases of local administration or selective uptake, the effective local concentration of the proteins may not be related to plasma concentration. One having skill in the art will be able to optimize therapeutically effective local dosages without undue experimentation.
  • The amount of molecules administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.
  • The therapy may be repeated intermittently while symptoms detectable or even when they are not detectable. The therapy may be provided alone or in combination with other drugs or treatment (including surgery).
  • C. Toxicity
  • Preferably, a therapeutically effective dose of the molecules described herein will provide therapeutic benefit without causing substantial toxicity.
  • Toxicity of the molecules described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD50 (the dose lethal to 50% of the population) or the LD100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index. Proteins which exhibit high therapeutic indices are preferred. The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human. The dosage of the proteins described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See, e.g., Fingl et al., 1975, In: The Pharmacological Basis of Therapeutics, Ch. 1, p. 1).
  • D. Pendant Groups
  • A “pendant group” may be attached or conjugated to the nucleic acid. Pendant groups may increase cellular uptake of the nucleic acid. Pendant groups can be linked to any portion of the nucleic acid but are commonly linked to the end(s) of the oligonucleotide chain. Examples of pendant groups include, but are not limited to: acridine derivatives (i.e. 2-methoxy-6-chloro-9-aminoacridine); cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin; artificial endonucleases; metal complexes such as EDTA-Fe(II), o-phenanthroline-Cu(I), and porphyrin-Fe(II); alkylating moieties; nucleases such as amino-1-hexanolstaphylococcal nuclease and alkaline phosphatase; terminal transferases; abzymes; cholesteryl moieties; lipophilic carriers; peptide conjugates; long chain alcohols; phosphate esters; amino; mercapto groups; radioactive markers; nonradioactive markers such as dyes; and polylysine or other polyamines. In one example, the nucleic acid is conjugated to a carbohydrate, sulfated carbohydrate, or glycan.
  • IV. Kits
  • Any of the compositions described herein may be comprised in a kit. In a non-limiting example, individual synthetic miRNAs are included in a kit. The kit may further include one or more negative control synthetic miRNAs that can be used to control for the effects of synthetic miRNA delivery. The kit may further include water and hybridization buffer to facilitate hybridization of the two strands of the synthetic miRNAs. The kit may also include one or more transfection reagent(s) to facilitate delivery of the synthetic miRNA to cells.
  • In another non-limiting example, multiple synthetic miRNAs and/or multiple miRNA inhibitors are included in a kit. The kit may further include one or more negative control synthetic miRNAs and/or miRNA inhibitors that can be used to control for the effects of synthetic miRNA and/or miRNA inhibitor delivery. The kit may also include one or more transfection reagents to facilitate delivery into cells.
  • The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit (labeling reagent and label may be packaged together), the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.
  • When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
  • The container means will generally include at least one vial, test tube, flask, bottle, syringe and/or other container means, into which the nucleic acid formulations are placed, preferably, suitably allocated. The kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other diluent.
  • The kits of the present invention will also typically include a means for containing the vials in close confinement for commercial sale, such as, e.g., injection and/or blow-molded plastic containers into which the desired vials are retained.
  • Such kits may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.
  • A kit will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.
  • Kits of the invention may also include one or more of the following: synthetic miRNA, nonsynthetic miRNA, library of synthetic miRNAs, library of miRNA inhibitors, library of nonsynthetic miRNA, combination library of synthetic miRNA, miRNA inhibitors, and/or nonsynthetic miRNAs, negative control synthetic miRNA, negative control miRNA inhibitor, negative control nonsynthetic miRNA, nuclease-free water; RNase-free containers, such as 1.5 ml tubes; hybridization buffer; and transfection reagent(s).
  • It is contemplated that such reagents are embodiments of kits of the invention. Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA.
  • EXAMPLES
  • The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
  • Unless otherwise designated, catalog numbers refer to products available by that number from Ambion, Inc.®, The RNA Company.
  • Example 1 Assay for Measuring Activity of Precursor miRNAs (Reporter)
  • A series of luciferase reporter vectors was created to measure the activities of synthetic miRNAs in cells. The reporter vectors were based on plasmids that had been used to monitor the activity of endogenous miRNAs (Tuschl paper). Briefly, a mammalian expression vector with the luciferase gene under the control of the CMV early promoter was created. Down-stream of the luciferase coding sequence, in the 3′ UTR of the gene, sequences complementary to mature miR-1-2, miR-10, miR-124, miR-19a, and miR-130 were added. The reporter vectors were co-transfected into HeLa cells along with synthetic miRNAs designed to introduce one of the five miRNAs listed above. The transfections involved mixing 200 ng of reporter vector with 0.3, 1, and 3 pmoles of each corresponding synthetic miRNA. The reporter/miRNA mixture was mixed with 0.3 μl of Lipofectamine 2000 (Invitrogen) and incubated for 5-15 minutes. Approximately 8,000 cells were added to each miRNA/reporter/transfection reagent complex in individual wells of a 96-well plate. HeLa cells were grown in D-MEM (GIBCO) supplemented with 10% fetal bovine serum (GIBCO) at 37° C. and 5% CO2. 24-48 hrs post transfection, the cells were harvested and assayed using the Luciferase assay as described by the manufacturer (Promega). The level of luciferase expression in the cell populations was compared to cells transfected with the same reporter but a synthetic miRNA with a sequence that does not correspond to the vector. This non-targeting miRNA was referred to as the negative control miRNA.
  • Final analysis of the synthetic miRNA designs involved measuring the activity of both the active and complementary strands of our synthetic miRNAs. For these studies, reporter vectors with luciferase 3′ UTR sequences were created that included regions complementary to both the active and the complementary strands of our synthetic miR-33 and let-7b miRNA designs. When co-transfected with malfunctioning synthetic miRNAs, the reporters with a sequence targeted by the complementary strand exhibit reduced luciferase expression because the complementary strand of the synthetic miRNAs are entering the miRNA pathway in addition to or even instead of the active strand that is desired. For these experiments, the co-transfection and reporter analysis protocols are identical to what is described above.
  • Example 2 Assay for Measuring Activity of Precursor miRNAs (Endogenous Gene)
  • While the luciferase reporter constructs were extremely valuable in evaluating the synthetic miRNA designs, it was important to verify the findings of the reporter constructs by measuring the effects of the synthetic miRNAs on endogenous gene targets. For these studies, the expression of RAS and MYC in cells transfected with let-7 miRNAs was chosen for monitoring. Both RAS and MYC are down-regulated by the various members of the let-7 family in humans and C. elegans (publication pending). Using a microarray system specific to miRNAs, the inventors have found that HepG2 cells express undetectable levels of let-7. To test the activities of our various designs of our synthetic miRNAs, synthetic let-7 miRNAs were created and used to transfect HepG2 cells in 24-well plates using siPORT NeoFX (Ambion) according to the manufacturer's suggestions. Three days post-transfection, the cells were fixed with 4% paraformaldehyde, stained with DAPI to localize cell nuclei, and stained with FITC-conjugated antibodies specific to MYC or RAS (US Biological) according to the manufacturer's suggestions. The relative reduction in target protein expression in synthetic let-7 transfected cells was determined by comparing the staining intensity of MYC and RAS to cells transfected with a negative control miRNA using MetaMorph software.
  • To ensure that the results of our let-7 assays could be verified by additional miRNA interactions that are observed naturally in cells, we created assays for two additional miRNAs with verified targets. In the first, a real-time PCR™ assay was developed to measure the level of the HOXB8 mRNA in cells transfected with synthetic miR-196. It has been shown that miR-196 induces degradation of the HOXB8 mRNA in cells. When transfected into cultured cells using siPORT NeoFX according to the manufacturer's instructions, effective miR-196 synthetic miRNA designs reduce the levels of the HOXB8 mRNA.
  • To monitor the effectiveness of synthetic miR-1-2 miRNAs, a reporter vector was created wherein the 3′ UTR of the G6PD gene was placed immediately down-stream of the luciferase coding region. An interaction between miR-1-2 and the G6PD 3′ UTR has been published (Lewis, 2003). Synthetic miR-1-2 designs were co-transfected with the reporter vector and assayed as described in Example 1.
  • Example 3 Effectiveness of Partially Complementary miRNAs
  • Three general sequence designs were compared for miRNA activity. The first, referred to as the “miRNA design,” featured an active strand identical to the mature miRNA found in animals and a complementary strand that was identical to the hairpin sequence that is predicted to exist in cells during the processing of the miRNA prior to activation of the miRNA (see below). The second design, referred to as the “mismatch design,” was a hybrid of the same active strand as above with a complementary strand with a di-nucleotide, 3′ overhang and two mismatches in the final five nucleotides that preceded the 3′ overhang (see below). The third design, referred to as the “siRNA design,” comprised the same active strand as above hybridized to a second RNA that was fully complementary except that it left 3′ di-nucleotide overhangs at either end of the double-stranded molecule (two polynucleotides) (see below). The examples below involve or correspond to human miRNAs.
  • miR-1-2
    mature miR-1-2 sequence-UGGAAUGUAAAGAAGUAUGUA (53-73 of SEQ ID NO: 1)
    miRNA design = CAUACUUCUUUAUAUGCCCAUA (SEQ ID NO: 594) +
    UGGAAUGUAAAGAAGUAUGUA (SEQ ID NO: 595)
    mismatch design = CAUACUUCUUUACAUUCUGTT (SEQ ID NO: 596) +
    UGGAAUGUAAAGAAGUAUGUA (SEQ ID NO: 597)
    siRNA design = CAUACUUCUUUACAUUCCATT (SEQ ID NO: 598) +
    UGGAAUGUAAAGAAGUAUGUA (SEQ ID NO: 599)
    mir-124a-1
    mature miR-124 sequence-UUAAGGCACGCGGUGAAUGCCA (52-73 of SEQ ID NO: 80)
    miRNAdesign = GUGUUCACAGCGGACCUUGAUU (SEQ ID NO: 600) +
    UUAAGGCACGCGGUGAAUGCCA (SEQ ID NO: 601)
    mismatch design = GCAUUCACCGCGUGCCUUGGTT (SEQ ID NO: 602) +
    UUAAGGCACGCGGUGAAUGCCA (SEQ ID NO: 603)
    siRNA design = GCAUUCACCGCGUGCCUUAATT (SEQ ID NO: 604) +
    UUAAGGCACGCGGUGAAUGCCA (SEQ ID NO: 605)
    miR-130a
    mature miR-130 sequence-CAGUGCAAUGUUAAAAGGGC (55-74 of SEQ ID NO: 91)
    miRNA design = UCUUUUCACAUUGUGCUAC (SEQ ID NO: 606) +
    CAGUGCAAUGUUAAAAGGGC (SEQ ID NO: 607)
    mismatch design = UAUUUUAACAUUGCACUGTT (SEQ ID NO: 608) +
    CAGUGCAAUGUUAAAAGGGC (SEQ ID NO: 609)
    siRNA design = CCUUUUAACAUUGCACUGTT (SEQ ID NO: 610) +
    CAGUGCAAUGUUAAAAGGGC (SEQ ID NO: 611)
    miR-19a
    mature miR-19a sequence-UGUGCAAAUCUAUGCAAAACUGA (49-71 of SEQ ID NO: 28)
    miRNA design = AGUUUUGCAUAGUUGCACUA (SEQ ID NO: 612) +
    UGUGCAAAUCUAUGCAAAACUGA (SEQ ID NO: 613)
    mismatch design = ACAUUUGCAUAGAUUUGCACATT (SEQ ID NO: 614) +
    UGUGCAAAUCUAUGCAAAACUGA (SEQ ID NO: 615)
    siRNA design = AGUUUUGCAUAGAUUUGCACATT (SEQ ID NO: 616) +
    UGUGCAAAUCUAUGCAAAACUGA (SEQ ID NO: 617)
    mmu-miR-10a-1 (mouse)
    mature miR-10 sequence-UACCCUGUAGAUCCGAAUUUGUG (22-44 of SEQ ID NO: 212)
    miRNA design = CAAAUUCGUAUCUAGGGGAAUA (SEQ ID NO: 618) +
    UACCCUGUAGAUCCGAAUUUGUG (SEQ ID NO: 619)
    mismatch design = AGAAUUCGGAUCUACAGGGUATT (SEQ ID NO: 620) +
    UACCCUGUAGAUCCGAAUUUGUG (SEQ ID NO: 621)
    siRNA design = CAAAUUCGGAUCUACAGGGUATT (SEQ ID NO: 622) +
    UACCCUGUAGAUCCGAAUUUGUG (SEQ ID NO: 623)
    miR-33
    mature miR-33 sequence-GUGCAUUGUAGUUGCAUUG (6-24 of SEQ ID NO: 57)
    miRNA = AUGUUUCCACAGUGCAUCA (SEQ ID NO: 624) +
    GUGCAUUGUAGUUGCAUUG (SEQ ID NO: 625)
    mismatch design = GUCCAACUACAAUGCACTT (SEQ ID NO: 626) +
    GUGCAUUGUAGUUGCAUUG (SEQ ID NO: 627)
    siRNA design = AUGCAACUACAAUGCACTT (SEQ ID NO: 628) +
    GUGCAUUGUAGUUGCAUUG (SEQ ID NO: 629)
    let-7b
    mature let-7b sequence-UGAGGUAGUAGGUUGUGUGGUU (6-27 of SEQ ID NO: 6)
    miRNA design = CUAUACAACCUACUGCCUUCC (SEQ ID NO: 630) +
    UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 631)
    mismatch design = CCACACAACCUACUAUCUUATT (SEQ ID NO: 632) +
    UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 633)
    siRNA design = CCACACAACCUACUACCUCATT (SEQ ID NO: 634) +
    UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 635)
    miR-196-2
    mature miR-196 sequence-UAGGUAGUUUCAUGUUGUUGG (7-27 of SEQ ID NO: 143)
    siRNA design = AACAACAUGAAACUACCUATT (SEQ ID NO: 636) +
    UAGGUAGUUUCAUGUUGUUGG (SEQ ID NO: 637)
    miRNA design = CAAAUUCGUAUCUAGGGGAAUA (SEQ ID NO: 638) +
    UAGGUAGUUUCAUGUUGUUGG (SEQ ID NO: 639)
    mismatch design = AAUAACAUGAAACUACCUATT (SEQ ID NO: 640) +
    UAGGUAGUUUCAUGUUGUUGG (SEQ ID NO: 641)

    The assorted mir-1-2, mmu-miR-10a-1, miR-19a, mir-124a-1, and mir-130a synthetic miRNAs were tested for their capacity to reduce the expression of the reporter gene in vectors with appropriate miRNA target sites using the assay described in Example 1. All three designs were similarly capable of down-regulating the appropriate reporter vectors.
  • To assess whether there were differences between the various miRNA designs ini their ability to affect the expression of endogenous genes, the following cells were transfected: HepG2 cells with three designs of the let-7 synthetic miRNAs, A549 with three designs of the miR-196 synthetic miRNAs, and HeLa with the G6PD reporter vector and three designs of the miR-1-2 synthetic miRNA. As with the reporter vectors, all three synthetic miRNA designs proved capable of reducing the expression of the target genes, though it is notable that the siRNA design performed most poorly.
  • As a final comparison of the three synthetic miRNA designs, synthetic miRNAs were co-transfected with reporter vectors that included target sites for the complementary strands of the synthetic miRNAs according to the procedure described in Example 1. In this assay, it was apparent that the siRNA design significantly affected the reporter vectors, indicating that the wrong strand of the miRNA was entering the miRNA pathway (FIG. 3). Because the complementary strand might impact the expression of genes that are not natural targets of the miRNA that is being studied, the siRNA design is inappropriate for effective synthetic miRNAs.
  • Example 4 Effectiveness of Chemically 5′ End-Modified Synthetic miRNAs
  • Although the siRNA design proved problematic in that it exhibited a high rate of complementary strand uptake by the miRNA pathway, it did have the advantage that it was easy to hybridize and easy to deliver to cells. For these reasons, ways to overcome the problems with complementary strand uptake were explored. The siRNA design was used to test the effects of chemical modifications at the 5′ ends of the synthetic miRNAs. For these studies, several different complementary strands were synthesized with unique 5′ ends. One featured four deoxyribose nucleotides at the 5′ end; one was a combination of four deoxyribose nucleotides at the 5′ end and a 5′ NH2; one had a 5′ NH2; one had a 5′ NHCOCH3 (see below).
  • miR-33
    mature miR-33 sequence-GUGCAUUGUAGUUGCAUUG (6-24 of SEQ ID NO: 57)
    siRNA design = AUGCAACUACAAUGCACTT (SEQ ID NO: 642) +
    GUGCAUUGUAGUUGCAUUG (SEQ ID NO: 643)
    5′ amino design = (NH2)AUGCAACUACAAUGCACTT (SEQ ID NO: 644) +
    GUGCAUUGUAGUUGCAUUG (SEQ ID NO: 645)
    5′ acetyl design = (CH3OCNH)AUGCAACUACAAUGCACTT (SEQ ID NO: 646) +
    GUGCAUUGUAGUUGCAUUG (SEQ ID NO: 647)
    5′ DNA design = dAdUdGdCAACUACAAUGCACTT (SEQ ID NO: 648) +
    GUGCAUUGUAGUUGCAUUG (SEQ ID NO: 649)
    5′ amino DNA design = (NH2)dAdUdGdCAACUACAAUGCACTT (SEQ ID NO: 650) +
    GUGCAUUGUAGUUGCAUUG (SEQ ID NO: 651)
    let-7b
    mature let-7b sequence-UGAGGUAGUAGGUUGUGUGGUU (6-27 of SEQ ID NO: 6)
    siRNA design = CCACACAACCUACUACCUCATT (SEQ ID NO: 652) +
    UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 653)
    5′ amino design = NH2CCACACAACCUACUACCUCATT (SEQ ID NO: 654) +
    UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 655)
    5′ DNA design = dCdCdAdCACAACCUACUACCUCATT (SEQ ID NO: 656) +
    UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 657)
    5′ amino DNA design = NH2dCdCdAdCACAACCUACUACCUCATT (SEQ ID NO: 658) +
    UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 659)
    miR-1-2
    mature miR-1-2 sequence-UGGAAUGUAAAGAAGUAUGUA (53-73 of SEQ ID NO: 1)
    siRNA design = CAUACUUCUUUACAUUCCATT (SEQ ID NO: 660) +
    UGGAAUGUAAAGAAGUAUGUA (SEQ ID NO: 661)
    5′ amino design = NH2CAUACUUCUUUACAUUCCATT (SEQ ID NO: 662) +
    UGGAAUGUAAAGAAGUAUGUA (SEQ ID NO: 663)
    miR-124a-1
    mature miR-124 sequence-UUAAGGCACGCGGUGAAUGCCA (52-73 of SEQ ID NO: 80)
    siRNA design = GCAUUCACCGCGUGCCUUAATT (SEQ ID NO: 664) +
    UUAAGGCACGCGGUGAAUGCCA (SEQ ID NO: 665)
    5′ amino design = NH2GCAUUCACCGCGUGCCUUAATT (SEQ ID NO: 666) +
    UUAAGGCACGCGGUGAAUGCCA (SEQ ID NO: 667)
    miR-130a
    mature miR-130 sequence-CAGUGCAAUGUUAAAAGGGC (55-74 of SEQ ID NO: 91)
    siRNA design = CCUUUUAACAUUGCACUGTT (SEQ ID NO: 668) +
    CAGUGCAAUGUUAAAAGGGC (SEQ ID NO: 669)
    5′ amino design = NH2 CCUUUUAACAUUGCACUGTT (SEQ ID NO: 670) +
    CAGUGCAAUGUUAAAAGGGC (SEQ ID NO: 671)
    miR-10a-1
    mature miR-10 sequence-UACCCUGUAGAUCCGAAUUUGUG (22-44 of SEQ ID NO: 212)
    siRNA design = CAAAUUCGGAUCUACAGGGUATT (SEQ ID NO: 672) +
    UACCCUGUAGAUCCGAAUUUGUG (SEQ ID NO: 673)
    5′ amino design = NH2CAAAUUCGGAUCUACAGGGUATT (SEQ ID NO: 674) +
    UACCCUGUAGAUCCGAAUUUGUG (SEQ ID NO: 675)

    The miR-33 and let-7b synthetic miRNAs were co-transfected into HeLa and HepG2 cells, respectively, with reporter vectors bearing target sites for the active and complementary strands of miR-33 and let-7b as described in Example 1. Luciferase expression from the active and complementary strand-specific reporter vectors was measured according to the manufacturer's (Promega) protocol. As shown in FIG. 3, the synthetic miRNA designs with the 5′ NH2 and 5′ NHCOCH3 provided higher active strand activity and significantly reduced complementary strand activity relative to the unmodified, synthetic miRNAs. This is ideal for synthetic miRNAs since the effects seen following transfection will be specific to the activity of the active strand of the synthetic miRNA. Furthermore, the high efficacy of the 5′ modified designs will allow lower concentrations to be used for transfections and reduce toxicity that is often observed when transfecting cells with higher amounts of nucleic acid.
  • To confirm that the 5′ amino modification is superior to the standard siRNA design for a broad set of synthetic miRNAs, the effectiveness of both synthetic miRNA designs was measured in cells co-transfected with reporter vectors with miRNA target sites. As seen in FIG. 4, the 5′ NH2 is reproducibly superior to the unmodified siRNA design.
  • Example 5 Effectiveness of Chemically Internally Modified Synthetic miRNAs
  • The siRNA design was also used to test the effects of chemical modifications at internal domains within the complementary strand. For these studies, 2′O-Me modifications were placed at various locations along the length of the complementary strand. Below is provided an example of a series of synthetic miRNAs with chemically modified complementary strands.
  • (SEQ ID NO:  676)
    miRNA Strand - 5′-UAU ACA AGA GAU GAA AUC CUC-3′
    Complementary Strands -
    (SEQ ID NO:  806)
    Position 1 - 5′-GGA UUU CAU CUC UUG UAU AUt-3′
    (SEQ ID NO:  806)
    Position 2 - 5′-GGA UUU CAU CUC UUG UAU AUt-3′
    (SEQ ID NO:  806)
    Position 3 - 5′-GGA UUU CAU CUC UUG UAU AUt-3′
    (SEQ ID NO:  806)
    Position 4 - 5′-GGA UUU CAU CUC UUG UAU AUt-3′
    (SEQ ID NO:  806)
    Position 5 - 5′-GGA UUU CAU CUC UUG UAU AUt-3′
    (SEQ ID NO:  806)
    Position 6 - 5′-GGA UUU CAU CUC UUG UAU AUt-3′
    Note - Positions that are 2′-O-Me are denoted
    in bold.
  • Synthetic miRNAs with the designs described above were tested for miRNA and complementary strand activity. Interestingly, complementary strand modifications at positions 1 and 5 significantly reduced complementary strand activity without altering the activity of the miRNA strand (FIG. 3).
  • Example 6 Synthetic miRNA Library Screen for miRNAs that Influence Cell Proliferation
  • A hallmark of cancer is uncontrolled cell proliferation; cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis. A cell proliferation assay was used in conjunction with the miRNA inhibitor library to identify miRNAs that influence cell proliferation.
  • The inventors transfected HeLa cells in triplicate with fifteen different synthetic miRNAs using siPORT NeoFX (Ambion) according to the manufacturer's instructions (FIG. 6). Transfected HeLa cells were analyzed using Alamar Blue (BioSource International, Inc., CA) at 24 hr intervals. Alamar Blue is a compound, that when reduced by cellular metabolism, changes from a non-fluorescent blue color to a fluorescent red form that is easily quantified. The amount of Alamar Blue reduced is directly proportional to the cell number, providing a rapid method for assessing cell proliferation. To perform the assay, the Alamar Blue reagent was added into the tissue culture media at a 10% final concentration. The mixture was incubated for 3-6 hr in growth conditions after which fluorescence was quantified using a Spectra Max™ GeminiXS™ (Molecular Devices, Sunnyvale, Calif.). Cells transfected with synthetic miR-124 and miR-106 exhibited significantly lower proliferation than negative control-transfected samples, as well as smaples transfected with the other synthetic miRNAs.
  • Example 7 MiRNA Inhibitor Library Screen for miRNAs that Influence Cell Proliferation
  • A hallmark of cancer is uncontrolled cell proliferation. Cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis. A cell proliferation assay was used in conjunction with our miRNA inhibitor library to identify miRNAs that influence cell proliferation.
  • Cells were transfected with a library of over 90 miRNA inhibitors to identify miRNAs that are involved in cell growth. HeLa cells (8000 cells/well of 96 well plate) were transfected in triplicate with 5 pmoles of miRNA inhibitors using siPORT™ NeoFX™ (Ambion). The media was changed 24 hrs after transfection. 72 hours post-transfection, we fixed cells with 4% paraformaldehyde, permeabilized with 0.1% TritonX 100, and stained with propidium iodide to look at total cell number. The plates were scanned using the TTP labtech Acumen Explorer. Cell number was plotted relative to cells transfected with a negative control miRNA inhibitor (FIG. 7). The red horizontal bars bracket normal variation in cell proliferation (20% variation). Insets: Specific miRNA inhibitors that either increased cell proliferation (left arrow) or did not affect cell proliferation (right arrow) were used in a second round of screening. HeLa cells were transfected with these miRNA inhibitors and cells were fixed and stained with anti b-actin antibody and DAPI to visualize cell morphology changes in response to specific miRNA function. Cells transfected with the miRNA inhibitor that increased cell proliferation show marked alteration in cell morphology (left inset) vs. normal morphology (right inset).
  • A group of nine miRNA inhibitors were identified that caused significant decreases ( miR 31, 150, 187, 125a, 190, 191, 193, 204 and 218) in cell growth and two miRNA inhibitors that caused a significant increase (miR 24 and miR 21) in cell growth following transfection into HeLa cells (Table 4). MiRNA-31 inhibition also caused a distinct cellular morphology. A relative cut off of 20% above and below 100% was chosen as genes that were considered significantly changed. These results demonstrate the ability of individual human miRNAs to regulate important cellular processes. Furthermore, the diversity of the observed effects demonstrates the potential complexity of cellular outcomes of miRNA-mediated regulation of gene expression.
  • TABLE 4
    MiRNAs that affect cell proliferation
    Relative Impact on Cell
    miRNA Proliferation
    miR-31 Up regulation
    miR-150 Up regulation
    miR-187 Up regulation
    miR-125a Up regulation
    miR-190 Up regulation
    miR-191 Up regulation
    miR-193 Up regulation
    miR-204 Up regulation
    miR218 Up regulation
    miR-21 Down regulation
    miR-24 Down regulation
  • Example 8 Synthetic miRNA Library Screen for miRNAs that Influence Apoptosis
  • Many diseases including cancer are characterized by an inability to institute programmed cell death, or apoptosis. A caspase 3/7 activity assay was used in conjunction with a library of synthetic miRNAs to identify miRNAs that are involved in regulating apoptosis.
  • A library of eighteen synthetic miRNAs was used to transfect A549 cells (8000 cells/well of 96 well plate) in triplicate using siPORT™ NeoFX™ (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at −80° C. 2) Cells were lysed by adding 40 μl of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4° C. 3) Add 160 μl ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 μM DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em.
  • Cells transfected with miR-1-2 and miR-33 synthetic miRNAs exhibited reduced caspase 3/7 activity and cells transfected with miR-20 exhibited much higher levels of apoptosis. These three miRNAs likely regulate genes that are involved in controlling apoptosis.
  • Example 9 Screen for miRNAs that Influence Cell Viability
  • miRNA inhibitors were also used to identify miRNAs that influence cell viability. A library of over 90 miRNA inhibitors was used to transfect A549 cells (8000 cells/well of 96 well plate) in triplicate using siPORT™ NeoFX™ (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. Cells were trypsinized and stained with ViaCount Flex Reagent, which distinguishes between viable and non-viable cells based on permeability of the DNA binding dyes in the reagent. Cells were analyzed using the Guava PCA-96 (Personal Cell Analysis).
  • Twenty-one miRNA inhibitors induced a significantly different ratio of live to dead cells than did the negative control miRNA inhibitor (FIG. 8). Twelve reduced cell viability and nine increased cell viability (Table 5). Interestingly, there was little overlap in the miRNAs that affected cell viability in A549 cells and those that affected cell proliferation in HeLa cells, suggesting that different cells respond differently to have reduced miRNA activities or cell viability and cell proliferation are not affected by the same cellular pathways.
  • TABLE 5
    MiRNAs that affect cell viability
    Relative Impact on Cell
    miRNA Viability
    miR-7 Down
    miR-19a Down
    miR-23 Down
    miR-24 Down
    miR-27a Down
    miR-31 Down
    miR-32 Down
    miR-134 Down
    miR-140 Down
    miR-150 Down
    miR-192 Down
    miR-193 Down
    miR-107 Up
    miR-133 Up
    miR-137 Up
    miR-152 Up
    miR-155 Up
    miR-181a Up
    miR-191 Up
    miR-203 Up
    miR-215 Up
  • Example 10 Screen for miRNAs that Influence Apoptosis
  • Apoptosis is a natural cellular process that helps control cancer by inducing death in cells with oncogenic potential. Many oncogenes function by altering induction of apoptosis. To identify miRNAs that participate in apoptosis, an apoptosis assay was used with the miRNA inhibitor library.
  • Using a library of over 90 miRNA inhibitors, we screened for miRNAs that affect apoptosis. HeLa cells (8000 cells/well of 96 well plate) were transfected in triplicate with miRNA inhibitors (5 pmoles) using Ambion siPORT™ NeoFX™. The media was changed 24 hrs after transfection and processed cells 72 hours after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at −80° C. 2) Cells were lysed by adding 40 μl of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4° C. 3) Add 160 μl ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 μM DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em.
  • Samples were also analyzed for cell number using a general esterase assay to normalize the caspase 3 results. FDA substrate (0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile) was diluted 1:19 into dilution buffer (40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc). 40 μl buffer (40 mM TrisCl pH 7.5, 0.5% NP-40) was added to each sample well. Samples were incubated 10 min on ice. 160 μl of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min at 37° C. (ex=488, em=529). The slope of fluorescence increase over time is a function of the cell number in the plate.
  • Normalized screening data are displayed in FIG. 9. miRNAs that affect apoptosis are listed in Table 6 and 7.
  • TABLE 6
    MiRNAs that affect apoptosis
    Relative Impact on Cell
    miRNA Proliferation
    miR-31 Down
    miR-214 Down
    miR-7 Up
    miR-1-2 Up
    miR-148 Up
    miR-195 Up
    miR-196 Up
    miR-199a Up
    miR-204 Up
    miR-210 Up
    miR-211 Up
    miR-212 Up
    miR-215 Up
    miR-216 Up
    miR-218 Up
    miR-296 Up
    miR-321 Up
  • Example 11 Expression Analyses Using Synthetic RNAs
  • In addition to using phenotypic assays to identify miRNAs that influence gross cellular processes or cellular pathways, collections of synthetic miRNAs and/or miRNA inhibitors can be used to identify miRNAs that directly regulate the expression of a gene. A plasmid was created that had a luciferase gene immediately upstream of the 3′UTR of the G6PD gene. A549 cells were co-transfected with the reporter vector and eighteen different synthetic miRNAs. 24 hours post-transfection, luciferase activity in the various cell populations was measured. Interestingly, the miR-1-2 significantly reduced the expression of the luciferase/G6PD gene, indicating that this family of miRNAs regulates the expression of the G6PD gene. Similar experiments can be used to identify miRNAs that regulate the expression of such important genes as p53, BRCA1 and BRCA2, RAS, MYC, BCL-2, and others.
  • Example 12 Oncogeneic miRNAs—Differential Expression and Cancer Regulation
  • As noted in previous examples, a number of miRNAs have been identified that are differentially expressed between tumor and normal adjacent tissue samples from the same cancer patients. Interestingly, there is significant overlap in the miRNAs that are differentially expressed between different cancers, suggesting there is a core set of miRNAs that influence cellular processes that when altered, lead to cancer. The following describes experiments aimed at developing a link between miRNA mis-regulation and cancer.
  • miRNA Expression in Lung Cancer
  • Twenty-two tumor and normal adjacent tissue (NAT) samples from lung cancer patients were analyzed using the miRNA array system described above. The arrays were analyzed and the relative expression of each miRNA was compared between the tumor and normal adjacent tissues from each patient. The various miRNAs were clustered based on their relative expression in tumors across different patients (FIG. 14). Six miRNAs (miR-126, 30a, 143, 145, 188, and 331) were expressed at significantly lower levels in the tumors of more than 70% of the patients. Two miRNAs (miR-21 and 200b) were expressed at significantly higher levels in the tumors of more than 70% of the patients. The differential expression of a number of these miRNAs was verified by Northern analysis (FIG. 15).
  • miRNA Expression in Colon Cancer
  • Twenty-five tumor and NAT samples from colon cancer patients were analyzed using our miRNA array process. Like the lung cancer comparisons, the various miRNAs were clustered based on their relative expression in tumors across the different colon cancer patients (FIG. 14). Five miRNAs (miR-143, 145, 195, 130a, and miR-331) were expressed at significantly lower levels in the tumors of more than 70% of the patients. Five miRNAs (miR-223, 21, 31, 17, and 106) were expressed at significantly higher levels in the tumors of more than 70% of the patients.
  • miRNAs as Cancer Markers
  • It is interesting that eight different miRNAs were differentially expressed between the tumor and normal adjacent samples for most of the lung and colon patient samples that we analyzed (FIG. 16). These same miRNAs were also found to be differentially expressed in the breast, thymus, bladder, pancreatic, and prostate cancer patients that we analyzed, suggesting that these miRNAs might control cellular processes that when altered lead to cancer.
  • miRNAs as Regulators of Oncogene Expression
  • To address whether specific miRNAs might be participating in cancer through the mis-regulation of oncogenes, we scanned the 3′ untranslated regions (UTRs) of 150 well-known oncogenes for sequences with significant homology to the miRNAs identified in our microarray analysis. Potential target sites were selected based on two criteria:
      • (1) Perfect complementarity between positions 2-9 of the miRNA and the oncogene. This miRNA core sequence has been identified as critical to the activities of miRNAs and the known miRNA target sites have essentially 100% complementarity at this site (Doench et al. 2004).
      • (2) Overall Tm of the miRNA/mRNA interaction. In addition to the core sequence, overall binding stability between miRNAs and mRNAs has been shown to be an important indicator of miRNA activity (Doench et al., 2004).
  • As seen in Table 8, potential target sites in the 3′UTRs of known oncogenes were identified for all of the miRNAs that were observed to be routinely differentially expressed in tumor samples. Interestingly, KRAS2, MYCL1, and CBL have multiple predicted miRNA binding sites which could provide the cooperative miRNA binding that has been implicated as an important factor in miRNA regulation (Doench et al. 2003); Zeng et al., 2003). Many of the genes listed in Table 8 become oncogenic when they are over-expressed, thus it is conceivable that reduced expression of a miRNA could lead to up-regulation of one or more oncogenes and subsequently lead to oncogenesis.
  • TABLE 7
    Cancer-related miRNAs and their putative oncogene targets
    miRNA Predicted Gene Target
    let-7 RAS
    let-7 C-MYC
    miR-21 mutS homolog 2 (MSH2)
    miR-21 v-ski sarcoma viral oncogene homolog (avian) (SKI)
    miR-143 breakpoint cluster region (BCR)
    miR-143 MCF.2 cell line derived transforming sequence (MCF2)
    miR-143 von Hippel-Lindau tumor suppressor (VHL)
    miR-143 v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog (KRAS2)
    miR-143 v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog (KRAS2)
    Cas-Br-M (murine) ecotropic retroviral transforming sequence
    miR-143 (CBL)
    Cas-Br-M (murine) ecotropic retroviral transforming sequence
    miR-143 (CBL)
    miR-145 v-myc myelocytomatosis viral related oncogene (MYCN)
    miR-145 fibroblast growth factor receptor 2 (FGFR2)
    Cas-Br-M (murine) ecotropic retroviral transforming sequence
    miR-145 (CBL)
    miR-188 v-myc myelocytomatosis viral oncogene homolog 1 (MYCL1)
    miR-200b cadherin 13 (CDH13)
    v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
    miR-200b (KIT)
    miR-219 v-myc myelocytomatosis viral oncogene homolog 1 (MYCL1)
    miR-219 B-cell CLL/lymphoma 2 (BCL2)
    miR-219 cadherin 1, type 1, E-cadherin (epithelial) (CDH1)
    miR-331 vav 1 oncogene (VAV1)
    miR-331 fibroblast growth factor receptor 1 (FGFR1)
    miR-331 BCL2-antagonist/killer 1 (BAK1)
    miR-331 retinoic acid receptor, alpha (RARA)
    v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
    miR-331 (SRC)
  • Example 13 Measuring the Effect of miRNAs on Oncogene Expression
  • Confirming miRNA target site predictions can be done in a variety of ways. In Drosophila and C. elegans, genetic approaches have been applied wherein mutations in the miRNA and the putative miRNA target site(s) are made and shown to result in similar phenotypes (Ha et al., 1996; Vella et al., 2004). In mammalian cells, where genetic approaches are far more difficult, reporter constructs have been used to show that the 3′ UTRs of putative target genes are regulated in cells at levels that are disproportionate to reporter vector controls that contain mutations in the putative miRNA binding sites (Lewis et al. 2003). In addition, vectors and oligonucleotides have been used to introduce or inhibit miRNAs in cells to determine the effects on endogenous levels of putative target genes (Lewis et al., 2003; Kiriakidou et al. 2004). The latter approach has been undertaken to validate the miRNA target site predictions.
  • Synthetic miRNAs and miRNA inhibitors have been developed that can be transfected into mammalian cells to either introduce miRNAs into cells or inhibit the activity of miRNAs in cells, respectively. See USN 60/627,171, which is hereby incorporated by reference. A synthetic miRNA and a miRNA inhibitor corresponding to let-7b were used to determine if the target site predictions were correct. In these experiments, cultured cells that express undetectable levels of the miRNA were transfected with the synthetic miRNA using siPORT™ NeoFX™ Transfection Agent (Ambion). Immunofluorescence assays were used to RAS and C-MYC in the transfected cells. The proteins from both oncogenes were expressed at almost three-fold lower levels in cells transfected with the synthetic miRNA than cells transfected with a Negative Control miRNA (Ambion). In a reciprocal experiment, cells that naturally express high levels of the miRNA were transfected with the let-7 miRNA inhibitor. As expected, the proteins from both oncogenes were higher in cells transfected with the miRNA inhibitor than in cells transfected with the Negative Control inhibitor (Ambion). These results are consistent with the model that the miRNA regulates the expression of the two oncogenes. These data suggest that mis-regulation of a key miRNA could participate in cancer progression by failing to regulate the expression of one or more oncogenes.
  • Example 14 miRNAs in Lupus
  • Systemic lupus erythematosus (SLE; Lupus) is a chronic inflammatory auto-immune disease that ultimately leads to immune complex-mediated end-organ failure. It is characterized by an over activation of CD4+ T helper cells and repression of CD8+ T cytotoxic activity, leading to an overproduction of natural antibodies and pathogenic autoantibodies. Recently several histone modifications were reported in peripheral blood mononuclear cells (PBMCs) isolated from lupus patients. Diagnosis of lupus is still frequently incorrect mainly because the symptoms vary so widely and they come and go frequently, and because the disease mimics so many other disorders. Furthermore, diagnosis does not indicate the particular therapy to be used. In the absence of a cure, present-day treatment of lupus is still primarily tailored to symptomatic relief and not to the diagnosis. A diagnostic assay with high specificity and sensitivity would be very important.
  • Samples were analyzed from 16 individuals, 8 with clinically verified lupus and 8 non-lupus patients that were age- and gender-matched with the lupus patients. Total RNA from these samples was isolated using the glass fiber filter method described above. The total RNA was fractionated by tube electrophoresis to recover the miRNAs. The miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above. The labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above. The signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the lupus and normal sample signals were compared to identify differentially expressed miRNAs. Each array experiment included duplicate arrays.
  • Fourteen miRNAs were differentially expressed in all of the lupus samples relative to the matched samples. miR-301, miR-199, miR-95, miR-105, mu-miR-290, miR-215, miR-188, miR-186, miR-211, miR-331, and miR-137 were expressed at 50% or less in the lupus samples than the corresponding normal samples. miR-21, miR-223, and miR-342 were expressed at 50% or greater in the lupus samples than the corresponding normal samples. Several of the miRNAs were differentially expressed by as much as ten-fold between the lupus and normal samples. These miRNAs represent targets for diagnostic assay of therapeutic development.
  • Example 15 miRNAs and Prion Diseases
  • Novel infectious particles, termed prions, composed largely and perhaps solely of a single protein, are the likely causative agents of a group of transmissible spongiform encephalopathies that produce lethal decline of cognitive and motor function. Evidence indicates that the responsible protein arrives at a pathogenic state by misfolding from a normal form that has ubiquitous tissue distribution.
  • Using two cell-based prion model systems, the identification of miRNAs that might be associated with the process was pursued. One model system comprises two cell lines, one of which is susceptible to prion formation and one that is not. The second model system involves cells before and after they have been infected with prions. Total RNA from prion-sensitive cells, prion-insensitive cells, and prion-infected cells was isolated using the glass fiber filter method described above. The total RNA was fractionated by tube electrophoresis to recover the miRNAs. The miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above. The labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above. The signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the signal from each of the samples was compared to identify differentially expressed miRNAs.
  • As seen in FIG. 13, ten miRNAs were significantly up- or down-regulated in both prion-sensitive and prion-infected cells relative to prion resistant, uninfected cells. Arrays on multiple biological replicates for both model systems have confirmed these results. Based on their expression profiles, miR-95, 135a, 7, 9, 27a, 130a, 16, 26a, and 24 likely are involved directly or indirectly in prion infection and might represent diagnostic or therapeutic targets for prion disease.
  • Example 16 Stroke-Associated miRNAs
  • Stroke is a major cause of death and permanent disability in humans. They occur when blood flow to a region of the brain is obstructed and may result in death of brain tissue. There are two main types of stroke: ischemic and hemorrhagic. Ischemic stroke is caused by blockage in an artery that supplies blood to the brain, resulting in a deficiency in blood flow (ischemia). Hemorrhagic stroke is caused by the bleeding of ruptured blood vessels (hemorrhage) in the brain. Understanding miRNAs involved in stroke might enhance detection and/or treatment.
  • A stroke model system was used wherein mice are “preconditioned” by reducing oxygen flow to the brain (Kitagawa 1991). An equivalent set of six mice were used; three were preconditioned and three were untreated. 24 hours after pre-conditioning, the mice were sacrificed. Total RNA from these samples was isolated using the glass fiber filter method described above. The total RNA was fractionated by tube electrophoresis to recover the miRNAs. The miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above. The labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above. The signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the preconditioned and normal sample signals were compared to identify differentially expressed miRNAs.
  • Analysis of the miRNA profiles of the preconditioned animals (labeled P1, P2, and P4) revealed 10 miRNAs that were expressed at significantly different levels in all three pre-conditioned animals relative to the three non-treated animals (FIG. 14). These miRNAs resulted from ischemic pre-conditioning and represent potential targets for stroke diagnosis, prevention, or treatment.
  • Example 17 Synthetic miRNA Library Screens for miRNAs that Influence Cell Proliferation and Cell Viability in Various Cell Types
  • A hallmark of cancer is uncontrolled cell proliferation; cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis. A cell proliferation assay was used in conjunction with the miRNA inhibitor library to identify miRNAs that influence cell proliferation.
  • HeLa (human ovarian cancer) and A549 (human lung cancer) cells were transfected in triplicate with 150 synthetic miRNAs using siPORT NeoFX (Ambion) according to the manufacturer's instructions. The 150 are as follows: Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, mir-1, mir-7, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-18, mir-19a, mir-17-3p, mir-20, mir-21, mir-22, mir-23a, mir-23b, mir-24, mir-25, mir-26a, mir-27a, mir-28, mir-29a, mir-31, mir-32, mir-30a-3p, mir-34a, mir-92, mir-95, mir-96, mir-98, mir-99a, mir-100, mir-101, mir-103, mir-105, mir-107, mir-108, mir-122, mir-124, mir-125a, mir-125b, mir-126, mir-128, mir-129, mir-132, mir-133A, mir-133B, mir-134, mir-135, mir-136, mir-137, mir-139, mir-140, mir-141, mir-142, mir-143, mir-144, mir-145, mir-146, mir-147, mir-148, mir-149, mir-150, mir-151, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-188, mir-190, mir-191, mir-192, mir-193, mir-194, mir-195, mir-196, mir-197, mir-198, mir-199, mir-201, mir-203, mir-204, mir-205, mir-206, mir-207, mir-208, mir-210, mir-211, mir-212, mir-214, mir-215, mir-216, mir-217, mir-218, mir-219, mir-220, mir-221, mir-223, mir-224, mir-299, mir-301, mir-302, mir-320, mir-322, mir-323, mir-325, mir-324-3p, mir-328, mir-330, mir-331, mir-335, mir-337, mir-338, mir-339, mir-340, mir-345, mir-346, mir-367, mir-368, mir-369, mir-370, mir-371, mir-372, mir-373, mir-374, mu-mir-290, mu-mir-291, mu-mir-292-3p, mu-mir-293, mu-mir-294, mu-mir-295, mu-mir-297, mu-mir-298, mu-mir-329, mu-mir-341, mu-mir-344, mu-mir-351, mu-mir-376b, mu-mir-380-3p, mu-mir-409, mu-mir-411, mu-mir-412
  • The synthetic miRNAs were double stranded nucleic acid molecules composed of an active strand and a complementary strand. The active strand contained a sequence that was identical to the corresponding mature miRNA. The complementary strand contained a sequence that was 100% complementary to the relevant region of the mature miRNA sequence, but 1) lacking two nucleotides on its 3′ end that were complementary to the mature miRNA sequence (at the 5′ end of the active strand) and 2) having a dinucleotide overhang on its 5′ end with respect to the active strand. In other words, the two strands were fully complementary to the other's sequence except that each strand has a dinucleotide 5′ overhang with respect to the other strand. The same kind of synthetic miRNAs were used for Examples 17-20 as well. Any exceptions are described below. The miRNAs indicated in the tables identify the miRNA that corresponds to the provided synthetic sequence.
  • Jurkat cells (human leukemia cell) and primary human T-cells in triplicate were electroporated with the same set of synthetic miRNAs using siPorter-96 (Ambion) according to the manufacturer's instruction. All cells were analyzed for viable and non-viable cells 72 hours post-transfection using the PCA-96 (Guava) with the Viacount Assay. Viable cell number is the number of live cells in a well at the point of the assay. The numbers provided in the tables below are equal to the average number of viable cells in wells transfected with a particular miRNA divided by the number of viable cells in wells transfected with negative control synthetic miRNAs multiplied by 100 to yield the % Cell Viability of miRNA-transfected cells relative to negative control transfected cells.
  • Significance was assigned based on the average values of the negative control transfecetd samples. miRNAs that were significantly different than the negative controls were qualified as “significant” based on being at least two standard deviations above or below the negative control data.
  • The sequence of miRNA-325 is 5′-ccuaguagguguccaguaagugu-3′ (SEQ ID NO:807).
  • TABLE 8
    miRNAs That Significantly
    Reduce Cell Viability of HeLa Cells
    Viability std dev
    mir-345 75 5.9
    mir-346 77.8 8.2
    mir-193 79.6 14.7
    mir-206 79.6 6.5
    mir-337 80.8 3.1
    mmu-mir-293 82.6 1.7
    mir-299 84.0 4.0
    mmu-mir-329 84.5 4.5
    mmu-mir-409 86 2.8
    mmu-mir-292-3p 86.2 2.8
    mir-210 86.4 5.1
    mmu-mir-344 86.4 5.3
    mmu-mir-298 86.7 4.2
    mir-208 87.4 4.5
    mir-197 87.6 7.5
    mir-217 87.9 3.5
    mir-1 88.2 9.0
    mir-124 88.8 4.2
  • TABLE 9
    miRNAs That Significantly Reduce
    Viable Cell Number of HeLa Cells
    Total Cell std dev
    Let-7b 16.2 8.1
    Let-7g 22.7 8.2
    Let-7c 24.1 7.2
    mir-124 24.5 3.4
    Let-7a 25.4 1.2
    Let-7d 37.3 2.3
    mir-337 37.5 16.9
    mir-1 38.7 2.2
    miR-299 38.9 4.2
    mir-34a 40.5 13.3
    mmu-mir-292 41.2 8.3
    mir-122 41.2 6.5
    mir-346 41.9 4.3
    mir-101 43.4 6.4
    mir-210 47.1 8.4
    mir-147 47.7 8.2
    mir-98 50.6 2.6
    mir-345 51.8 6.8
    miR-92 52.4 6.8
    miR-96 53.2 0.9
    mir-7 54.0 5.3
    mir-133b 55.9 3.1
    mir-206 56.0 12.4
    mmu-mir-297 56.0 5.7
    mir-19a 57.2 20.6
    mmu-mir-344 57.5 14.1
    mir-205 58.9 18.7
    mir-208 60.5 11.1
  • TABLE 10
    miRNAs That Significantly Increase
    Viable Cell Number of HeLa Cells
    Std
    Total Cell dev
    mir-32 142.9 25.4
    mu-miR-290 143.5 17.6
    mir-212 143.5 10.4
    mir-92 144.7 16.8
    mir-323 147.3 25.9
    mir-145 148.1 22.2
    mir-324 148.2 9.0
    mir-198 152.1 67.8
    mir-27a 156.2 13.4
    mir-369 158.4 27.3
    mir-31 159.3 16.1
    mir-335 161.7 20.8
    mmu-mir-351 162.3 6.9
    mir-370 164.3 4.5
    mir-325 169.6 19.8
    mir-331 172.5 24.0
    mir-139 181.3 11.2
  • TABLE 11
    miRNAs That Significantly
    Reduce Cell Viability of A549 Cells
    Viability St dev
    mir-193 92.4 2.5
    mir-224 92.5 1.4
    mir-96 92.6 0.1
    mir-346 93.9 1.6
    mmu-mir-293 94.9 0.7
    mir-34a 95 0.2
    mir-216 95.1 1.0
    mmu-mir-380 95.2 0.8
    mir-182 95.6 0.8
    mir-301 95.6 1.0
    mmu-mir-344 95.8 0.2
    mmu-mir-409 95.8 0.6
    mir-369 95.9 0.7
  • TABLE 12
    miRNAs That Significantly Reduce
    Viable Cell Number in A549 Cells
    Cell Number St Dev
    mir-124 44.3 2.2
    mir-16 52.9 1.3
    mir-337 54.7 7.0
    mir-195 59.3 6.7
    mir-34a 60.8 2.1
    mir-15a 60.9 3.7
    mir-28 61.3 0.8
    Let-7g 61.9 0.8
    mmu-mir-292 62.2 2.3
    mmu-mir-344 62.6 9.1
    mir-7 62.9 4.6
    mir-193 63.7 3.3
    mir-137 63.9 1.3
    mir-147 64.8 0.5
    mir-29a 67.0 3.8
    mir-129 67.2 3.3
    mir-22 67.5 3.4
    mir-126 68.0 2.6
    mir-345 69.2 7.4
    mir-192 69.5 5.9
    Let-7b 70.2 2.2
    Let-7d 70.5 2.7
    mir-346 70.9 7.1
  • TABLE 13
    miRNAs That Significantly Increase
    Viable Cell Number in A549
    Std
    Total cell dev
    mir-373 110.4 7.9
    mir-25 111.8 6.0
    mmu-mir-294 112.1 5.9
    mir-32 120.8 4.3
    mir-92 122.4 4.0
  • TABLE 14
    miRNAs That Significantly Reduce
    Cell Viability of Jurkats Cells
    % Viability St Dev
    let-7a 20.54 0.70
    miR-10b 35.98 2.92
    let-7b 48.79 5.08
    miR-17-3p 61.55 15.63
    miR-30a-3p 64.36 26.60
    miR-34a 65.45 20.44
    miR-122 65.63 17.80
    miR-29a 66.44 7.14
    miR-101 67.44 29.56
    miR-133a 71.51 17.82
    miR-19a 71.77 23.79
    miR-32 75.59 11.69
    miR-1 75.74 12.92
    miR-132 76.32 16.22
    miR-28 77.07 16.58
    miR-20 77.60 15.23
    miR-134 78.96 1.75
  • TABLE 15
    miRNAs That Significantly Increase
    Cell Viability in Jurkat Cells
    Total cell Std dev
    miR-181-a 122.77 22.40
    miR-9 124.63 9.98
    miR-141 126.08 24.03
    miR-98 126.24 11.90
    miR-10a 126.86 8.93
    miR-125b 128.71 3.50
    miR-126 130.69 18.20
    miR-100 130.77 14.60
    miR-23b 132.18 3.50
    miR-140 135.73 4.08
    miR-155 142.57 22.40
    miR-15a 143.01 11.29
    miR-129 146.94 9.92
    miR-25 150.25 17.85
    miR-143 158.74 1.86
    miR-26a 166.09 13.65
  • TABLE 16
    miRNAs that Significantly Reduce
    Cell Viability in Primary T-Cells
    % Viability St Dev
    miR-184 61.04 12.16
    miR-145 68.98 11.23
    miR-186 69.64 6.99
    miR-139 69.85 0.29
    miR-134 71.90 22.42
    miR-190 75.59 2.43
    miR-144 77.13 4.18
    miR-183 77.71 2.86
    miR-147 78.09 0.33
    miR-140 78.70 5.81
    miR-155 79.26 10.68
  • TABLE 17
    miRNAs that Significantly Increase
    Cell Viability of Primary T-Cells
    % Viability St Dev
    miR-126 120.81 40.08
    miR-10b 121.28 18.86
    miR-17 122.46 3.71
    miR-10a 124.11 9.46
    miR-20 124.75 13.60
    let-7c 124.81 4.00
    miR-125a 125.66 5.13
    miR-15a 129.07 10.96
    let-7b 130.11 13.48
    let-7a 130.88 16.16
    miR-18 131.73 1.75
  • It is interesting to note that the miRNAs that affect one cell type often fail to affect other cell types. This is likely due to the fact that the cellular processes that are active vary between different cell types. This can be vitally important when considering the potential of miRNA-based therapeutics. Abnormal (disease) cells are different from normal cells owing to the fact that different cellular processes are active in the two cell types. Identifying miRNAs that have differential effects on normal and abnormal cells would be ideal since they could be delivered globally and expected to have an effect on only disease cells. When the cell viability data were compared for the leukemia (cancerous T-cell) cells and primary T-cells, it was noted that let-7a, let-7b, and miR-10b all significantly reduce the percentage of viable cells in the leukemia cells while essentially having no effect on the corresponding normal T-cells. These miRNAs are candidates for leukemia drugs.
  • Example 18 Synthetic miRNA Library Screen for miRNAs that Influence ERK Activation
  • In order for cancer cells to proliferate they must subvert both the machinery that controls the cell division cycle and the process of programmed cell death (apoptosis). This is frequently achieved by mutation of specific proto-oncogenes such as Ras or tumor suppressors such as p53. The Ras-family of membrane associated GTPases transmit signals into the interior of the cell by the activation of a number of cytosolic signal transduction pathways such as the Raf>MEK>ERK MAP kinase signaling pathway. Disregulation of the Ras/Raf/MEK/ERK pathway plays a major role in cancer pathogenesis (Meijer).
  • To identify miRNAs that affect ERK activation, HeLa cells were transfected in a 96-well plate format with 150 different synthetic miRNAs. Prior to transfection, the HeLa cells were trypsinized to remove adherent cells and diluted in normal growth medium to 105 cells/mL. 0.5 of siPort NeoFX in 9.5 μl of Optimem I medium was added to the cells and incubated for 10 minutes at room temp (10 μL for each sample). miRNAs were rehydrated with 10 μl of diluted siPORT NeoFX. The samples were incubated at 37° C. and then the transfected samples were evaluated 72 hours after transfection.
  • The controls for ERK activation were performed by depriving the wells of a phosphate source for detection of ERK phosphorylation. 100 μl of serum-free media (DMEM) to 37° C. was added per well and the cells were incubated for 4 hours at 37° C. to attain basal phosphorylation levels. For the positive control wells, serum-free media was aspirated from wells and 100 μL of 100 ng/mL EGF was added before incubating the cells for 7.5 minutes at 37° C.
  • Media from all wells was removed by aspiration and the cells were immediately fixed in 150 μL of 3.7% Formaldehyde in 1×PBS for 20 minutes at room temp with no shaking. Fixing solution was removed to an appropriate waste container. The fixed cells were washed three times with 1×PBS. The wells were then washed three times with 200 μL of 1×PBS containing 0.1% Triton X-100 for 5 minutes per wash, with shaking at room temp.
  • Cells were blocked by adding 150 μL of Li-COR Odyssey Blocking Buffer to each well. The solution was moved carefully by pipetting down the sides of the wells to avoid detaching the cells. Blocking was for 90 minutes at room temp with moderate shaking on a rotator and the two primary antibodies were added to a tube containing Odyssey Blocking Buffer. The primary antibody was incubated for 2 hours with gentle shaking at room temp (Phosho-ERK (Rabbit, 1:100 dilution; Cell Signaling Technology 9101). Total ERK2 (Mouse; 1:75 dilution; Santa Cruz Biotechnology SC-1647)). The wells were washed three times with 1×PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. The fluorescently labeled secondary antibody was diluted in Odyssey Blocking Buffer (Goat anti-rabbit Alexa Fluor 680 (1:200 dilution; Molecular Probes) Goat anti-mouse IRDye 800CW (1:800 diution; Rockland Immunochemicals)). The antibody solutions were mixed well and 50 μL of the secondary antibody solution was added to each well. The antibody solution was incubated for 60 minutes with gentle shaking at room temp. The plate was washed three times with 1×PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. After a final wash, wash solution was completely removed from wells. The plates were scanned with the Odyssey Infrared Imaging System (700 nm detection for Alexa Fluor 680 antibody and 800 nm detection for IRDye 800CW antibody). Negative control transfected cells yield 100% erk activation (meaning background levels of active erk). Transfecting cells with some of our miRNAs alters the level of active erk.
  • TABLE 18
    miRNAs That Activate ERK
    miR % Activation Std Dev
    mir-218 312.96 22.91
    mir-210 291.74 38.23
    mir-217 273.49 26.84
    mir-152 265.54 35.82
    mir-148 264.38 43.55
    mir-223 264.15 39.72
    mir-301 261.36 61.77
    mir-328 259.48 45.87
    mir-206 255.51 55.53
    mir-125a 252.46 27.34
    mmu-mir-329 243.38 5.43
    mir-19a 241.52 31.33
    mir-25 238.90 44.94
    mmu-mir-294 235.51 24.60
    mir-212 231.36 23.61
    mmu-mir-295 221.47 14.05
    mir-370 220.60 22.88
    mir-216 219.17 25.98
    mir-96 213.93 57.07
    mir-339 213.9 42.25
    mir-134 211.15 12.84
    mir-372 211.13 5.67
    Positive 245.36 10.76
    Control
  • Example 19 Screen for miRNAs that Influence Apoptosis
  • Apoptosis is a natural cellular process that helps control cancer by inducing death in cells with oncogenic potential. Many oncogenes function by altering induction of apoptosis. To identify miRNAs that participate in apoptosis, an apoptosis assay was used with the miRNA inhibitor library.
  • HeLa cells (8000 cells/well of 96 well plate) were transfected in triplicate with more than 150 synthetic miRNAs (described above) (3 pmoles) using Ambion siPORT™ NeoFX™. The media was changed 24 hrs after transfection and cells were processed 72 hrs after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at −80° C. 2) Cells were lysed by adding 40 μl of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4° C. 3) Add 160 ul ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 uM DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em.
  • Samples were also analyzed for cell number using a general esterase assay to normalize the caspase 3 results. FDA substrate (0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile) was diluted 1:19 into dilution buffer (40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc). 40 μl buffer (40 mM TrisCl pH 7.5, 0.5% NP-40) was added to each sample well. Samples were incubated 10 min on ice. 160 ul of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min at 37 deg (ex=488, em=529). The slope of fluorescence increase over time is a function of the cell number in the plate.
  • miRNAs that affect apoptosis are listed in the table below. These miRNAs apparently regulate pathways that lead to apoptosis. Mis-regulation of these miRNAs could induce cells to undergo apoptosis or might keep the cells from undergoing apoptosis. Introducing or inhibiting these miRNAs in cancer (or other disease) cells that have overcome apoptotic signaling pathways or Parkinson's (or other disease) cells that have prematurely induced apoptosis could be used to treat the diseases.
  • TABLE 19
    miRNAs that Significantly Increase
    the Percentage of Apoptotic Cells
    Relative change in
    apoptotic cells St Dev
    mir-338 773.46 69.82
    mir-27a 607.24 150.08
    mir-128 594.42 260.06
    mir-23a 473.44 208.82
    mir-324 442.99 101.03
    mir-22 439.13 62.59
    mir-181a 409.97 65.14
    mmu-mir-293 403.86 53.41
    mmu-mir-412 402.27 42.04
    mir-196 378.13 28.15
    mir-31 373.90 61.39
    Let-7d 369.10 88.94
    mir-23b 360.68 81.97
    mu-miR-290 354.90 46.63
    mir-217 347.38 56.49
    mir-199 345.75 67.55
    mir-24 317.43 62.85
    mir-214 312.25 7.38
    mir-198 303.24 44.25
  • TABLE 20
    miRNAs that Significantly Decrease
    the Percentage of Apoptotic Cells
    Relative change in St
    apoptotic cells Dev
    mir-105 39.97 8.91
    mir-34a 37.75 8.41
    mir-96 31.89 13.40
    mmu-mir-292 30.72 4.27
    mir-126 28.71 4.24
    mir-137 12.69 11.80
    mir-101 7.50 6.91
  • Example 20 Synthetic miRNA Library Screen for miRNAs that Influence hTert Expression
  • Telomerase is a complex of proteins and RNA that maintains the ends of chromosomes by appending telomeres. With rare exceptions, terminally differentiated cells lack active telomerase. One of the exceptions is cancer cells. More than 90% of human cancer samples have active telomerase (reviewed in Dong et al. 2005). The hTert gene encodes the catalytic domain of telomerase. The expression of hTert correlates with telomerase activity in cells making it a good surrogate for telomerase activity. An RT-PCR based assay for monitoring hTert mRNA expression in telomerase negative cells has been developed and used to identify miRNAs that participate in the regulation of telomerase. The miRNAs that regulate telomerase activity represent intervention points for cancer therapeutics.
  • BJ cells are normal human foreskin fibroblasts that lack hTert mRNA and telomerase activity. BJ cells were trypsinized and diluted to 13,000 cells/ml in normal growth media. 0.3 of lipofectamine 2000 agent was diluted into 40 μl of OPTI-MEM and incubated for five minutes. The diluted transfection reagent was added to the wells of 96-well plates that contained 150 synthetic miRNAs (as described above) as well as two different negative control synthetic miRNAs. Each well housed a different synthetic miRNA. The synthetic miRNAs and transfection agent were incubated for 15 minutes at room temperature and then 200 μl (2,600 cells) were added on top of the lipid/miRNA complex. Cells were placed in an incubator and RNA was isolated 72 hours later. RNA was isolated from the cells in each well using RNAqueous™-MagMAX96 Total RNA Isolation kit (Cat#1830) standard protocol (lyse cells in wells). Reverse transcription was done using the RETROscript reaction by adding 11 μl of total RNA (20-100 ng/μl) to 1 ul of random decamers and incubated in 70° C. water bath for 3 minutes then place on ice. Next, 8 ul of the cocktail containing Nuc-free water 3.8 μl, 10× Reverse Transcription buffer 2.0 ul, 2.5 mM dNTPs 2.0 ul, RNase Inhibitor Protein (40 U/ul), 0.1 ul MMLV-RT (100 U/μl), and incubated at 42° C. for 1 hour, then 92° C. for 10 minutes.
  • Real time PCR reactions were assembled to quantify hTert mRNA and 18S rRNA in each of the samples. Nuclease-free water, 10× Complete PCR buffer/SYBR, 25 mM MgCl2, 2.5 mM dNTPs, 50×ROX, 18S- or hTert-specific primers (for & rev mix 3 uM), cDNA from the various samples, and Super taq polymerase into a PCR tube. The reaction was heated to 95° C. for 5 minutes and then subjected to 40 cycles of 95° C. for 15 seconds, 60° C. for 30 seconds, 72° C. for 30 seconds. The amplification products were monitored using the ABI 7600 (Applied Biosystems). BJ cells ordinarily fail to yield amplification products with the hTert primers. Those miRNA-transfected samples that yielded a hTert PCR product were also analyzed for 18S rRNA lavels to ensure that there were not significantlyt more cells in the samples that might have contributed to the amount of hTert in the samples.
  • The hTert mRNA was detected in duplicate transfections of each of the miRNAs listed below. These miRNAs presumably affect pathways that regulate the expression of the hTert gene. Over-expression of any of these miRNAs might contribute to cancer by activating telomerase. Regulating the activities of these miRNAs in cancer cells could limit their transformation and overcome oncogenesis.
  • TABLE 21
    hTert Activators
    mmu-
    mir-295
    mir-92
    mir-337
    mir-26a
    mir-224
    mir-21
    mir-195
    mir-16
    mir-15a
    mir-128
    mir-125b
    mir-125a
    mir-105
  • Example 21 Synthetic miRNA Library Screens for miRNAs that Influence Cell Cycle
  • The adult human body consists of about 50-100 trillion cells. Each day, several billion of these cells divide in two to replace the billions of cells that die and are removed. In the course of an average lifetime, this adds up to an astronomical number of cell divisions, most of which go perfectly well. Errors do occur, however, and if they are not corrected they may lead to cancer. Cell growth and division are normally controlled by an intricate system of checks and balances. But occasionally a cell will start to proliferate wildly, dividing again and again and defying all normal restraints on its growth. That is the beginning of most common forms of cancer.
  • The inventors transfected 4,000 BJ cells/well in triplicate with 46 synthetic miRNAs using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
  • TABLE 22
    46 Synthetic miRNAs
    let7a
    let7a
    mir1
    mir1
    mir105
    mir125a
    mir128
    mir142
    mir145
    mir146
    mir147
    mir150
    mir15a
    mir16
    mir186
    mir187
    mir188
    mir19l
    mir195
    mir20
    mir206
    mir21
    mir211
    mir223
    mir224
    mir26a
    mir320
    mir324-3p
    mir325
    mir335
    mir337
    mir338
    mir345
    mir371
    mir373
    mir92
    mmu201
    mmu207
    mmu290
    mmu291-3p
    mmu294
    mmu295
    mmu297
    mmu322
    mmu376b
    mmu409
  • The 24 hours post-transfection, half of the BJ cells from each well were removed to fresh medium. 72 hrs post-transfection, the cells were fixed with 4% paraformaldehyde at a final concentration of 2%. The fixed cells were stained with propidium iodide (TTP LabTech protocol) and assessed using the TTP LabTech cell scanner. Propidium iodide stains DNA and the relative DNA content in a cell corresponds with its position in the cell cycle. The cell scanner measured propidium iodide staining in each cell and assigned its position in the cell cycle. The percentage of cells in each stage of cell cycle was calculated and compared to cells transfected with negative control synthetic miRNAs. The relative change in cells in each stage was calculated for each miRNA that was used. Those synthetic miRNAs that induced a significant shift toward or away from a specific stage of cell cycle are listed below. These represent miRNAs that regulate key points in the cell cycle and offer key intervention points for cancer-related therapeutic development.
  • TABLE 23
    miRNAs that significantly reduce the percentage
    of BJ cells in G1 phase of the cell cycle
    % Diff in Cells St.
    miRNA in G1 Dev.
    mir-21 54.4 4.2
    mir-20 63.6 9.3
    mir-1 65.3 9.5
    mir-206 66.8 9.0
    mir-373 72.6 5.7
    mir-26a 78.0 4.0
  • TABLE 24
    miRNAs that significantly increase the percentage
    of BJ cells in G1 phase of the cell cycle
    % Diff in Cells St.
    miRNA in G1 Dev.
    rno-mir-325 121.7 5.3
    mmu-409 123.2 13.7
    mir-324 123.7 4.9
    mir-195 125.1 2.5
    mmu-376b 126.5 3.1
    mir-142 127.0 13.0
    mir-371 128.9 2.8
    let-7a 131.5 4.5
    mir-146 141.5 7.7
    mir-128 143.0 2.4
  • TABLE 25
    miRNAs that significantly reduce the
    percentage of BJ cells in S phase of the cell cycle
    % Diff in St.
    miRNA Cells in S Dev.
    mir-128 55.5 3.8
    let-7a 57.6 8.7
    mir-142 59.5 24.7
    mir-146 63.5 16.8
    mmu-297 65.0 14.1
    mir-337 65.3 11.3
    mir-195 65.6 0.1
    mmu-376b 69.1 11.6
    mir-324 72.2 9.4
    mir-187 72.3 10.9
    mir-186 72.8 6.1
  • TABLE 26
    miRNAs that significantly increase the
    percentage of BJ cells in S phase of the cell cycle
    % Diff in Cells St.
    miRNA in S Dev.
    mir-92 132.0 14.7
    mir-15a 134.8 13.9
    mir-191 135.9 29.1
    mir-26a 136.0 7.6
    mir-20 139.7 17.6
    mmu-290 141.0 11.7
    let-7a 141.1 19.9
    mir-345 143.3 45.8
    mir-16 150.1 24.8
    mir-224 150.6 9.8
  • TABLE 27
    miRNAs that significantly reduce the percentage
    of BJ cells in G2/M phase of the cell cycle
    % Diff in Cells St.
    miRNA in G2/M Dev.
    mir-147 51.2 6.1
    mir-371 52.8 2.7
    mir-146 57.2 5.3
    mir-195 58.9 4.4
    mir-128 65.4 2.7
    mir-15a 67.4 13.7
    let-7a 69.1 2.8
  • TABLE 28
    miRNAs that significantly increase the percentage of
    BJ cells in G2/M phase of the cell cycle
    % Diff in Cells St.
    miRNA in G2/M Dev.
    mir-26a 130.2 5.8
    mir-187 132.0 4.3
    mir-145 136.8 13.7
    mir-373 137.9 5.2
    mir-20 143.0 10.6
    mir-21 160.3 7.1
  • TABLE 29
    miRNAs that significantly increase the percentage of BJ cells
    with greater than 2X amount of DNA
    % Diff in Cells St.
    miRNA w/>2X DNA Dev.
    mir-20 157.9 23.4
    mir-1 161.9 13.6
    mir-345 176.1 17.4
    mir-373 177.9 32.7
    mir-337 195.0 52.1
    mir-21 209.4 45.7
  • Example 22 Synthetic miRNA Library Screen for miRNAs that Influence Cell Proliferation
  • Cell proliferation assays were used in conjunction with our synthetic miRNA library to identify miRNAs that influence cell proliferation in a broad range of cells, including those from lung, breast, prostate, skin, cervix, T-cell, and foreskin tissues.
  • Cervical (HeLa), lung (A549, CRL-5826, and HTB-57), breast (MCF12A and BT549), prostate (22Rv1), T-cells (Jurkat and primary normal), and skin (TE354T, TE353SK, and BJ) cells were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library. With the exceptions of Jurkats and Primary T-cells, each cell type was transfected with 5 picomoles of each of the miRNAs in the synthetic miRNA library using siPORT™ NeoFX™ (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate. The Jurkats and primary T-cells were mixed at a rate of approximately 50,000 cells/well with 500 picomoles of each of the synthetic miRNAs. The media was changed 24 hrs after transfection. 72 hours post-transfection, cell number was estimated by one of three methods:
      • (1) Alamar blue was added to each well and the 96-well plates were analyzed using a plate reader. Alamar blue is a substrate for a metabolic enzyme in cells and the reaction product is fluorescent. The fluorescence in each well correlates with the total number of cells in each well.
      • (2) ViaCount Flex Reagent (Guava), a dye that fluoresces when it interacts with DNA, was added to each well and fluorescence was quantified using the Guava PCA-96 according to the manufacturer's instructions.
      • (3) Propidium iodide, a dye that fluoresces when it interacts with DNA, was added to each well and the total number of cells in the well was estimated by counting unique sites of stained DNA using the TTP LabTech Cell Scanner according to the manufacturer's instructions.
        The impact of each miRNA on cell proliferation was assessed by dividing the cell number reading of each well by the average cell number reading for wells transfected with a negative control (NC) miRNA.
  • Presented in FIG. 15A-C are synthetic miRNAs that significantly reduced the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.
  • Approximately 10% of the miRNAs significantly reduced cell proliferation for at least four different cell types. These miRNAs (presented in ranked order in the table below) are provided below and can be implemented in methods and compositions of the invention.
  • TABLE 30
    Common Anti-Proliferation miRNAs
    miRNA # Positives
    miR-124 7
    miR-16 6
    miR-101 6
    miR-126 6
    miR-147 6
    miR-15a 5
    miR-96 5
    miR-105 5
    miR-142 5
    miR-215 5
    miR-346 4
    miR-206 4
    miR-192 4
    miR-194 4
  • Among the cells that were used in the synthetic miRNA library screens are matched pairs of cancer and non-cancer cells from breast, skin, and T-cell. Interestingly, many synthetic miRNAs differentially affected proliferation in the cell pairs (see table below).
  • TABLE 31
    Breast
    Non-
    Cancer Cancer
    % %
    % Std % Std
    miRNA NC Dev NC Dev
    mir-201 79 14 103 17
    mir-192 81 3 95 17
    mir-92 85 11 104 24
    Skin
    Cancer Normal
    % of % ST % of % ST
    pre-MIR NC DEV NC DEV
    mir-154 51 5 93 10
    mir-195 58 3 87 5
    mu-mir-376b 65 3 99 8
    mir-201 67 8 106 4
    mir-26a 69 12 97 17
    mir-193 69 4 105 10
    T-Cell
    Leukemia Normal
    % % St % % St
    NC Dev NC Dev
    let-7a 21 1 137 15
    let-7b 50 5 136 13
    miR-101 69 30 95 5
    miR-10b 37 3 115 18
    miR-122 67 18 104 18
    miR-17-3p 63 16 116 4
    miR-29a 68 7 111 8
    miR-30a-3p 66 27 97 18
    miR-34a 67 21 100 1

    Presented in FIG. 16 are synthetic miRNAs that significantly increase the proliferation of the various cell types that were analyzed.
  • Example 23 miRNA Inhibitor Library Screens Identify miRNAs that Influence Cell Proliferation
  • A cell proliferation assay was used in conjunction with our synthetic miRNA library to identify miRNAs that influence cell proliferation in a broad range of cells, including those from lung, breast, prostate, skin, cervix, T-cell, and foreskin tissues.
  • Breast (MCF12A), prostate (22Rv1), lung (A549), and skin (TE354T) cells were transfected in triplicate with each of the more than 150 miRNA inhibitors in our library. Each cell type was transfected with 10 picomoles of each of the miRNA inhibitors in the library using siPORT™ NeoFX™ (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate. 72 hours post-transfection, cell number was estimated by one of three methods:
      • (1) Alamar blue was added to each well and the 96-well plates were analyzed using a plate reader. Alamar blue is a substrate for a metabolic enzyme in cells and the reaction product is fluorescent. The fluorescence in each well correlates with the total number of cells in each well.
      • (2) ViaCount Flex Reagent (Guava), a dye that fluoresces when it interacts with DNA, was added to each well and fluorescence was quantified using the Guava PCA-96 according to the manufacturer's instructions.
      • (3) Propidium iodide, a dye that fluoresces when it interacts with DNA, was added to each well and the total number of cells in the well was estimated by counting unique sites of stained DNA using the TTP LabTech Cell Scanner according to the manufacturer's instructions.
  • The impact of each miRNA inhibitor on cell proliferation was assessed by dividing the cell number reading of each well by the average cell number reading for wells transfected with a negative control (NC) miRNA.
  • Presented in FIG. 17 are miRNAs whose inhibition significantly reduced the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.
  • Presented in FIG. 18 are miRNA inhibitors that significantly increase the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.
  • Example 24 Synthetic miRNA Library Screen for miRNAs that Influence Cell Viability
  • The basis for most human diseases is the subversion of one or more cells to function in ways that are outside what they normally do. For instance, cancer initiates with the immortalization and transformation of a single cell which then divides repeatedly to form a tumor. Compounds that reduce the viability of disease cells are used routinely to treat patients with cancer and other diseases.
  • Cervical (HeLa), lung (A549), and T-cells (Jurkat and primary normal) were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library. With the exceptions of Jurkats and Primary T-cells, each cell type was transfected with 5 picomoles of each of the miRNAs in the synthetic miRNA library using siPORT™ NeoFX™ (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate. The Jurkats and primary T-cells were mixed at a rate of approximately 50,000 cells/well with 500 picomoles of each of the synthetic miRNAs. For the HeLa and A549 cells, the media was changed 24 hrs after transfection. 72 hours post-transfection, cell viability was estimated by one of two methods:
      • (1) ViaCount Flex Reagent (Guava), which includes a dye that can only enter dead cells and that fluoresces when it interacts with DNA, was added to each well and fluorescence was quantified using the Guava PCA-96 according to the manufacturer's instructions. The percentage of viable cells was measured by dividing the number of non-dead and non-apoptotic cells in the sample by the total number of cells in the well and multiplying by 100.
      • (2) Propidium iodide, a dye that fluoresces when it interacts with DNA, was added to each well. Each cell was analyzed using the TTP LabTech Cell Scanner according to the manufacturer's instructions to detect cells with staining patterns consistent with cell death or apoptosis. The percentage of viable cells was measured by dividing the number of non-dead and non-apoptotic cells in the sample by the total number of cells in the well and multiplying by 100.
  • Presented in FIG. 19 are synthetic miRNAs that significantly decrease or increase viability in the various cell types that were analyzed. A comparison of the viability of jurkat and primary T-cells, which represent the leukemic and normal forms of T-cells, let-7, miR-10, miR-101, miR-17-3p, miR-19, and miR-34a severely reduced the viability of the leukemia cells without adversely affecting the normal T-cells.
  • Example 25 Synthetic miRNA Library Screen for miRNAs that Influence Apoptosis
  • To identify miRNAs that participate in apoptosis, an apoptosis assay was used with the miRNA inhibitor library.
  • Approximately 8000 cervical (HeLa), prostate (22Rv1), T-cell (Jurkat), and skin (TE354T) cells per well were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library using siPORT™ NeoFX™ (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at −80° C. 2) Cells were lysed by adding 40 μl of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4° C. 3) Add 160 μl ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 μM DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em. Samples were also analyzed for cell number using a general esterase assay to normalize the caspase 3 results. FDA substrate (0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile) was diluted 1:19 into dilution buffer (40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc). 40 μl buffer (40 mM TrisCl pH 7.5, 0.5% NP-40) was added to each sample well. Samples were incubated 10 min on ice. 160 μl of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min at 37 deg (ex=488, em=529). The slope of fluorescence increase over time is a function of the cell number in the plate.
  • The impact of each miRNA on apoptosis was assessed by dividing the caspase 3 reading of each well by the average caspase 3 reading for wells transfected with a negative control (NC) miRNA.
  • As seen in FIG. 20, many different miRNAs were able to increase or decrease apoptosis in the four cell types that were analyzed. A few miRNAs (miR-126, miR-26a, miR-1, miR-149, and let-7g) affected apoptosis in multiple cell types suggesting that they regulate apoptosis via genes that are common in multiple cell types.
  • Example 26 Synthetic miRNA Library Screen for miRNAs that Induce Transformation
  • Transformation is necessary for tumor formation as it overcomes the cell's natural response to stop dividing when placed in a crowded environment. To identify miRNAs that participate in transformation, a transformation assay featuring NIH3T3 cells was used with the synthetic miRNA library. NIH 3T3 cells are used in transformation assays as they lack the capacity to form colonies when plated in soft agar. Modulation of cell processes that inhibit transformation can be readily detected because they induce NIH3T3 cells to begin forming colonies when plated in soft agar.
  • Approximately 8000 NIH 3T3 cells were transfected in duplicate with each of the more than 150 synthetic miRNAs in our library using siPORT™ NeoFX™ (Ambion). Media was changed after 24 hrs and the cells were transferred to 24-well dishes containing soft agar. The soft agar limits mobility and ensures that sister cells must remain in contact following cell division. Close contact with other cells typically induces the NIH 3T3 cells to stop dividing. The total number of cells in each well was measured by taking an absorbance reading at 495 nm. The absorbance reading for each well was divided by the average absorbance reading for cells transfected with negative control miRNAs and multiplied by 100 to get the percent change in transformation. An initial screen revealed miR-10, miR-23, miR-24, miR-198, miR-192, and miR-199 as miRNAs that increased transformation relative to cells transfected with negative control. A repeat of the experiment with the initial candidates yielded the following hit as shown below:
  • TABLE 32
    miRNA % NC % SD
    198 103 2.07
    192 108 5.7
    199 113 5.59
  • Example 27 MiRNAs that Affect the Efficacy of Therapeutic Compounds
  • Many compounds have been tested in clinical trials for their capacity to positively affect the outcome of patients. In some cases, these compounds meet the standards set for by the FDA and they become therapeutics. Unfortunately, very few therapeutics are 100% effective. Enhancing the activities of therapeutic compounds provides a significant opportunity within the medical industry. The two most common methods that are used to enhance therapeutics are modifying the chemical structure of the compounds or using multiple therapeutic compounds simultaneously. Whether it would be beneficial to introduce miRNAs in advance of adding compounds that are known to significantly reduce the viability of cancer cells was evaluated. One of the anti-cancer compounds that was introduced was TRAIL, a compound that binds at least two different receptors and activates the apoptosis pathway to induce cell death primarily in cancer cells. The second compound that was tested in combination with synthetic miRNAs was etoposide, a topoisomerase II inhibitor that activates the apoptosis pathway of cancer and normal cells alike by reducing the repair of DNA damage within the cells.
  • Approximately 8000 cervical (HeLa) and lung (A549, HTB-57, and CRL-5826) cells per well were transfected in triplicate with synthetic miRNAs from our library using siPORT™ NeoFX™ (Ambion). Media was changed after 24 hrs and etoposide and TRAIL were introduced at a final concentration of approximately 25 μM after 48 hours. The cells were visually inspected under a microscope to qualitatively inspect cell death 64 hours after transfection.
  • The cells treated with etoposide were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at −80° C. 2) Cells were lysed by adding 40 μl of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4° C. 3) Add 160 μl ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 μM DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em. Samples were also analyzed for cell number using a general esterase assay to normalize the caspase 3 results. FDA substrate (0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile) was diluted 1:19 into dilution buffer (40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc). 40 μl buffer (40 mM TrisCl pH 7.5, 0.5% NP-40) was added to each sample well. Samples were incubated 10 min on ice. 160 μl of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min at 37 deg (ex=488, em=529). The slope of fluorescence increase over time is a function of the cell number in the plate.
  • The cells treated with TRAIL were assessed for cell viability by adding alamar blue each well and analyzing fluorescence using a plate reader. Alamar blue is a substrate for a metabolic enzyme in cells and the reaction product is fluorescent. The fluorescence in each well correlates with the total number of cells in each well.
  • The effect of each miRNA on the treatments was measured by dividing the caspase 3 or alamar blue reading of the cells transfected with miRNAs and treated with TRAIL or etoposide by the same readings for cells that were only transfected with the miRNAs. The change in caspase 3 activity or alamar blue staining for each miRNA was then divided by the differences observed for two negative control miRNAs and multiplied by 100 to calculate the relative effect induced by the combination of each miRNA and the therapeutic compound. These values are listed as % NC in Figure G.
  • As shown in FIG. 21, a number of miRNAs significantly increased the capacity of the two therapeutic compounds to induce cell death in the cancer cells that were treated. Interestingly, mir-292-3p, mir-132, mir-124, and mir-28 all worked extremely well in combination with both TRAIL and etoposide.
  • Example 28 Synthetic miRNA Library Screen for miRNAs that Affect Cell Cycle
  • The adult human body consists of about 50-100 trillion cells. Each day, several billion of these cells divide in two to replace the billions of cells that die and are removed. In the course of an average lifetime, this adds up to an astronomical number of cell divisions, most of which go perfectly well. Errors do occur, however, and if they are not corrected they may lead to cancer. Cell growth and division are normally controlled by an intricate system of checks and balances. But occasionally a cell will start to proliferate wildly, dividing again and again and defying all normal restraints on its growth. That is the beginning of most common forms of cancer.
  • Approximately 8000 cervical (HeLa) and 4000 skin (BJ) cells per well were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library. HeLa cells were transfected using siPORT™ NeoFX™ (Ambion) and BJ cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. 24 hours post-transfection, half of the cells from each well were removed to fresh medium. 72 hrs post-transfection, the cells were fixed with 4% paraformaldehyde at a final concentration of 2%. The fixed cells were stained with propidium iodide (TTP LabTech protocol) and assessed using the TTP LabTech cell scanner. Propidium iodide stains DNA and the relative DNA content in a cell corresponds with its position in the cell cycle. The cell scanner measured propidium iodide staining in each cell and assigned its position in the cell cycle. The percentage of cells in each stage of cell cycle was calculated and compared to cells transfected with negative control synthetic miRNAs. The relative change in cells in each stage was calculated for each miRNA that was used. Those synthetic miRNAs that induced a significant shift toward or away from a specific stage of cell cycle are listed below. These represent miRNAs that regulate key points in the cell cycle and offer key intervention points for cancer-related therapeutic development.
  • As seen in FIG. 22, many different miRNAs significantly altered the percentage of cells in the various stages of cell cycle in the two cell types that were analyzed.
  • Example 29 Synthetic miRNA Library Screen for miRNAs that Influence ERK Activity
  • In order for cancer cells to proliferate they must subvert both the machinery that controls the cell division cycle and the process of programmed cell death (apoptosis). This is frequently achieved by mutation of specific proto-oncogenes such as Ras or tumor suppressors such as p53. The Ras-family of membrane associated GTPases transmit signals into the interior of the cell by the activation of a number of cytosolic signal transduction pathways such as the Raf>MEK>ERK MAP kinase signaling pathway. Disregulation of the Ras/Raf/MEK/ERK pathway plays a major role in cancer pathogenesis (reviewed in Meijer et al.).
  • To identify miRNAs that affect ERK activation, HeLa cells were transfected in a 96-well plate format with 160 different synthetic miRNAs. Prior to transfection, the HeLa cells were trypsinized to remove adherent cells and diluted in normal growth medium to 105 cells/mL. 0.5 μl of siPort NeoFX in 9.5 μl of Optimem I medium was added to the cells and incubated for 10 minutes at room temp (10 μL for each sample). miRNAs were rehydrated with 10 μl of diluted siPORT NeoFX. The samples were incubated at 37° C. and then the transfected samples were evaluated 72 hours after transfection.
  • The controls for ERK activation were performed by depriving the wells of a phosphate source for detection of ERK phosphorylation. 100 μl of serum-free media (DMEM) to 37° C. was added per well and the cells were incubated for 4 hours at 37° C. to attain basal phosphorylation levels. For the positive control wells, serum-free media was aspirated from wells and 100 μL of 100 ng/mL EGF was added before incubating the cells for 7.5 minutes at 37° C.
  • Media from all wells was removed by aspiration and the cells were immediately fixed in 150 μL of 3.7% Formaldehyde in 1×PBS for 20 minutes at room temp with no shaking. Fixing solution was removed to an appropriate waste container. The fixed cells were washed three times with 1×PBS. The wells were then washed three times with 200 μL of 1×PBS containing 0.1% Triton X-100 for 5 minutes per wash, with shaking at room temp.
  • Cells were blocked by adding 150 μL of Li-COR Odyssey Blocking Buffer to each well. The solution was moved carefully by pipetting down the sides of the wells to avoid detaching the cells. Blocking was for 90 minutes at room temp with moderate shaking on a rotator and the two primary antibodies were added to a tube containing Odyssey Blocking Buffer. The primary antibody was incubated for 2 hours with gentle shaking at room temp (Phosho-ERK (Rabbit, 1:100 dilution; Cell Signaling Technology 9101). Total ERK2 (Mouse; 1:75 dilution; Santa Cruz Biotechnology SC-1647)). The wells were washed three times with 1×PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. The fluorescently labeled secondary antibody was diluted in Odyssey Blocking Buffer (Goat anti-rabbit Alexa Fluor 680 (1:200 dilution; Molecular Probes) Goat anti-mouse IRDye 800CW (1:800 diution; Rockland Immunochemicals)). The antibody solutions were mixed well and 50 μL of the secondary antibody solution was added to each well. The antibody solution was incubated for 60 minutes with gentle shaking at room temp. The plate was washed three times with 1×PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. After a final wash, wash solution was completely removed from wells. The plates were scanned with the Odyssey Infrared Imaging System (700 nm detection for Alexa Fluor 680 antibody and 800 nm detection for IRDye 800CW antibody).
  • TABLE 33
    miRNAs That Activate ERK
    miRNA % NC % StDev
    let-7 250 25
    mir-125a 252 27
    mir-134 211 13
    mir-148 264 44
    mir-152 266 36
    mir-19a 242 31
    mir-206 256 56
    mir-207 224 3
    mir-210 292 38
    mir-212 231 24
    mir-216 219 26
    mir-217 273 27
    mir-218 313 23
    mir-223 264 40
    mir-25 239 45
    mir-294 236 25
    mir-295 221 14
    mir-301 261 62
    mir-328 259 46
    mir-329 243 5
    mir-339 214 42
    mir-370 221 23
    mir-372 211 6
    mir-96 214 57
    Positive Control 245 11
  • Example 30 Synthetic miRNA Library Screen for miRNAs that Influence hTert Expression
  • Telomerase is a complex of proteins and RNA that maintains the ends of chromosomes by appending telomeres. With rare exceptions, terminally differentiated cells lack active telomerase. One of the exceptions is cancer cells. More than 90% of human cancer samples have active telomerase (reviewed in Dong et al., 2005). The hTert gene encodes the catalytic domain of telomerase. The expression of hTert correlates with telomerase activity in cells making it a good surrogate for telomerase activity. We have developed and used an RT-PCR based assay for monitoring hTert mRNA expression in telomerase negative cells to identify miRNAs that participate in the regulation of telomerase. The miRNAs that regulate telomerase activity represent intervention points for cancer therapeutics.
  • BJ cells are normal foreskin fibroblasts that lack hTert mRNA and telomerase activity. BJ cells were trypsinized and diluted to 13,000 cells/ml in normal growth media. 0.3 μl of lipofectamine 2000 agent was diluted into 40 μl of OPTI-MEM and incubated for five minutes. The diluted transfection reagent was added to the wells of 96-well plates that contained 151 synthetic miRNAs as well as two different negative control synthetic miRNAs. Each well housed a different synthetic miRNA. The synthetic miRNAs and transfection agent were incubated for 15 minutes at room temperature and then 200 μl (2,600 cells) were added on top of the lipid/miRNA complex. Cells were placed in an incubator and RNA was isolated 72 hours later. RNA was isolated from the cells in each well using RNAqueous™-MagMAX96 Total RNA Isolation kit (Cat#1830) standard protocol (lyse cells in wells). Reverse transcription was done using the RETROscript reaction by adding 11 ul of total RNA (20-100 ng/μl) to 1 μl of random decamers and incubated in 70° C. water bath for 3 minutes then place on ice. Next, 8 μl of the cocktail containing Nuc-free water 3.8 μl, 10× Reverse Transcription buffer 2.0 μl, 2.5 mM dNTPs 2.0 μl, RNase Inhibitor Protein (40 U/μl), 0.1 μl MMLV-RT (100 U/μl), and incubated at 42° C. for 1 hour, then 92° C. for 10 minutes.
  • Real time PCR reactions were assembled to quantify hTert mRNA and 18S rRNA in each of the samples. Nuclease-free water, 10× Complete PCR buffer/SYBR, 25 mM MgCl2, 2.5 mM dNTPs, 50×ROX, 18S- or hTert-specific primers (for & rev mix 3 μM), cDNA from the various samples, and Super taq polymerase were placed into a PCR tube. The reaction was heated to 95° C. for 5 minutes and then subjected to 40 cycles of 95° C. for 15 seconds, 60° C. for 30 seconds, 72° C. for 30 seconds. The amplification products were monitored using the ABI 7600 (Applied Biosystems). BJ cells ordinarily fail to yield amplification products with the hTert primers. Those miRNA-transfected samples that yielded a hTert PCR product were also analyzed for 18S rRNA levels to ensure that there were not significantly more cells in the samples that might have contributed to the amount of hTert in the samples.
  • The hTert mRNA was detected in duplicate transfections of each of the miRNAs listed below. These miRNAs presumably affect pathways that regulate the expression of the hTert gene. Over-expression of any of these miRNAs might contribute to cancer by activating telomerase. Regulating the activities of these miRNAs in cancer cells could limit their transformation and overcome oncogenesis.
  • TABLE 34
    hTert miRNA Activators
    Log(2)
    hTert
    miRNA Expression
    mir-147 3.14
    mir-195 4.25
    miR-21 1.55
    mir-24 4.68
    mir-26a 4.35
    mir-301 4.14
    mir-368 5.30
    mir-371 2.43
  • The telomerase activity screen was repeated using a series of siRNAs targeting kinases, phosphatases, GPCRs, transcription factors, and assorted other genes. Targeting the genes below with siRNAs resulted in increased hTert expression. Interestingly, many of these genes are predicted to be targets for the miRNAs that we found to be hTert regulators (see table below).
  • TABLE 35
    hTert Gene Activators
    Log(2)
    hTert
    Gene Expression
    ACOX1 3.44
    AKT1 1.80
    APAF1 3.40
    COX-5B 2.78
    COX6 2.28
    COX7B 3.95
    CPOX 4.66
    DUOX2 3.80
    GPX1 1.85
    GPX2 2.56
    GPX4 3.17
    LPO 3.37
    MAPK1 3.07
    MAPK4 3.61
    MTCO1 1.58
    NOX3 2.30
    NOX5 2.54
    PAOX 1.72
    PPOX 2.09
    PRKCA 2.24
    PRKCD 4.39
    TNFRSF6 2.25
  • Example 31 Effect of miRNA Primary Sequence on Function
  • Many miRNAs appear to be very closely related to others based on their primary sequences. For instance, let-7a is a member of the let-7 gene family, which includes 7 unique genes within the human genome. The let-7 genes encode miRNAs that vary by as little as a single nucleotide and as many as four nucleotides. In our synthetic miRNA and miRNA inhibitor libraries, we have five different human let-7 miRNAs. These miRNAs have been used in many different cell types in screens designed to identify miRNAs involved in a variety of different cellular processes. In many of the screens, the various let-7 miRNAs generate similar phenotypes. In some screens, all of the let-7 family members yield similar responses. In contrast, there are some screens wherein the various let-7 family miRNAs yield significantly different results (FIG. 23).
  • Example 32 Synthetic miRNA Library Screen for miRNAs that Influence Inflammation
  • Inflammation is the body's natural protective response to an injury or infection. It is designed to hyper-stimulate biological pathways that initiate tissue repair or attack invading pathogens. This response is a delicate balance of both pro- and anti-inflammatory genes and their proteins. If the inflammatory response is maintained too long it can lead to tissue destruction, organ failure or inflammatory diseases such as Rheumatoid arthritis, Psoriasis, Asthma, Inflammatory bowel disease (Crohn's disease and related conditions), Multiple Sclerosis, coronary obstructive pulmonary disease (COPD), Allergic rhinitis (hay fever), and Cardiovascular disease.
  • Stat3 is the subject of intense scientific investigation, because it's known to be an important transcription factor that turns on genes required for the cell division, induction and suppression of apoptosis, and cell motility. Many STAT3 target genes are known, including those encoding the anti-apoptotic proteins Bcl-xl, Mcl-1, and Bcl-2, the proliferation-associated proteins Cyclin D1 and Myc, and the pro-angiogenic factor VEGF. The inflammatory disease psoriasis is characterized by lesions, which contain epidermal keratinocytes that express high levels of activated Stat3. Stat3 has also recently been discovered to play an important role as an anti-inflammatory regulator. In normal mice, the immune system is initially upregulated in response to bacterial protein challenge creating systemic inflammation followed by down regulation of the initiating factors. Mice with a deletional mutation for Stat3-beta lacked the ability to down regulate the initial inflammatory reaction after bacterial protein challenge which lead to irreversible damage to the animals' own tissues and finally to animal death.
  • A stat3 response assay was used to identify miRNAs that regulate cellular inflammatory response. The stable Stat3-luciferase reporter cell line from Panomics, which contains a chromosomal integration of a luciferase reporter construct regulated by 3 copies of the Stat1 response element was used for this purpose. The chemical agent Phorbol-12-myristate 13 acetate (PMA) is known to induce an inflammatory response in exposed cells and was used to stimulate inflammation in this experiment. These cells were transfected in triplicate with each of the more than 206 synthetic miRNAs in our library using siPORT™ NeoFX™ (Ambion) at a plating density of approximately 6000 cells/well of 96 well plate. The media was changed 24 h post transfection and exposed to 100 nM PMA for 6 hours starting at 67 hours post transfection. The cells were assayed for changes in total cell number by alamarBlue as previously described and finally harvested at 72 hours post initial transfection. A luciferase assay was performed on all sample lysates to measure Stat3 responsiveness to the procedure. The data was normalized to total cell number using the alamar Blue data and compared to cells transfected with a negative control miRNA that underwent the same procedure.
  • TABLE 36
    The following miRNA were able to reduce
    the ability of PMA to stimulate Stat3.
    % of NC % STDEV
    mir-93 34 74
    mir-100 13 10
    mir-134 50 18
    mir-99a 38 96
    mir-103 38 40
    mir-128 49 115
    mir-129 44 112
    mir-181b 11 21
    mir-193 42 92
    mir-197 36 78
    mir-212 42 92
    mir-218 38 84
    mir-219 39 86
    mir-302 40 87
    mir-323 22 49
    mir-324-3p 29 63
    mir-325 29 63
    mir-330 21 47
    mir-331 39 86
    mir-340 34 75
    mmu-mir-350 11 22
    mir-425 24 49
    mir-491 25 49
    mir-518f 26 52
    mir-520a* 28 55
  • All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods, and in the steps or in the sequence of steps of the methods, described herein without departing from the concept, spirit, and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
  • REFERENCES
  • The following references are specifically incorporated by reference to the extent they relate to topics and subject matter discussed herein.
    • U.S. Pat. No. 4,337,063
    • U.S. Pat. No. 4,404,289
    • U.S. Pat. No. 4,405,711
    • U.S. Pat. No. 4,659,774
    • U.S. Pat. No. 4,682,195
    • U.S. Pat. No. 4,683,202
    • U.S. Pat. No. 4,684,611
    • U.S. Pat. No. 4,704,362
    • U.S. Pat. No. 4,816,571
    • U.S. Pat. No. 4,828,979
    • U.S. Pat. No. 4,849,513
    • U.S. Pat. No. 4,910,300
    • U.S. Pat. No. 4,952,500
    • U.S. Pat. No. 4,959,463
    • U.S. Pat. No. 5,141,813
    • U.S. Pat. No. 5,143,854
    • U.S. Pat. No. 5,202,231
    • U.S. Pat. No. 5,214,136
    • U.S. Pat. No. 5,221,619
    • U.S. Pat. No. 5,223,618
    • U.S. Pat. No. 5,242,974
    • U.S. Pat. No. 5,264,566
    • U.S. Pat. No. 5,268,486
    • U.S. Pat. No. 5,288,644
    • U.S. Pat. No. 5,302,523
    • U.S. Pat. No. 5,322,783
    • U.S. Pat. No. 5,324,633
    • U.S. Pat. No. 5,378,825
    • U.S. Pat. No. 5,384,253
    • U.S. Pat. No. 5,384,261
    • U.S. Pat. No. 5,405,783
    • U.S. Pat. No. 5,412,087
    • U.S. Pat. No. 5,424,186
    • U.S. Pat. No. 5,428,148
    • U.S. Pat. No. 5,429,807
    • U.S. Pat. No. 5,432,049
    • U.S. Pat. No. 5,436,327
    • U.S. Pat. No. 5,445,934
    • U.S. Pat. No. 5,446,137
    • U.S. Pat. No. 5,464,765
    • U.S. Pat. No. 5,466,786
    • U.S. Pat. No. 5,468,613
    • U.S. Pat. No. 5,470,710
    • U.S. Pat. No. 5,470,967
    • U.S. Pat. No. 5,472,672
    • U.S. Pat. No. 5,480,980
    • U.S. Pat. No. 5,492,806
    • U.S. Pat. No. 5,503,980
    • U.S. Pat. No. 5,510,270
    • U.S. Pat. No. 5,525,464
    • U.S. Pat. No. 5,527,681
    • U.S. Pat. No. 5,529,756
    • U.S. Pat. No. 5,532,128
    • U.S. Pat. No. 5,538,877
    • U.S. Pat. No. 5,538,880
    • U.S. Pat. No. 5,545,531
    • U.S. Pat. No. 5,547,839
    • U.S. Pat. No. 5,550,318
    • U.S. Pat. No. 5,554,501
    • U.S. Pat. No. 5,554,744
    • U.S. Pat. No. 5,556,752
    • U.S. Pat. No. 5,561,071
    • U.S. Pat. No. 5,563,055
    • U.S. Pat. No. 5,571,639
    • U.S. Pat. No. 5,573,913
    • U.S. Pat. No. 5,574,146
    • U.S. Pat. No. 5,580,726
    • U.S. Pat. No. 5,580,732
    • U.S. Pat. No. 5,580,859
    • U.S. Pat. No. 5,583,013
    • U.S. Pat. No. 5,589,466
    • U.S. Pat. No. 5,591,616
    • U.S. Pat. No. 5,593,839
    • U.S. Pat. No. 5,599,672
    • U.S. Pat. No. 5,599,695
    • U.S. Pat. No. 5,602,240
    • U.S. Pat. No. 5,602,244
    • U.S. Pat. No. 5,610,042
    • U.S. Pat. No. 5,610,287
    • U.S. Pat. No. 5,610,289
    • U.S. Pat. No. 5,614,617
    • U.S. Pat. No. 5,623,070
    • U.S. Pat. No. 5,624,711
    • U.S. Pat. No. 5,631,134
    • U.S. Pat. No. 5,637,683
    • U.S. Pat. No. 5,639,603
    • U.S. Pat. No. 5,645,897
    • U.S. Pat. No. 5,652,099
    • U.S. Pat. No. 5,654,413
    • U.S. Pat. No. 5,656,610
    • U.S. Pat. No. 5,658,734
    • U.S. Pat. No. 5,661,028
    • U.S. Pat. No. 5,665,547
    • U.S. Pat. No. 5,667,972
    • U.S. Pat. No. 5,670,663
    • U.S. Pat. No. 5,672,697
    • U.S. Pat. No. 5,681,947
    • U.S. Pat. No. 5,695,940
    • U.S. Pat. No. 5,700,637
    • U.S. Pat. No. 5,700,922
    • U.S. Pat. No. 5,702,932
    • U.S. Pat. No. 5,705,629
    • U.S. Pat. No. 5,708,154
    • U.S. Pat. No. 5,714,606
    • U.S. Pat. No. 5,728,525
    • U.S. Pat. No. 5,736,524
    • U.S. Pat. No. 5,744,305
    • U.S. Pat. No. 5,763,167
    • U.S. Pat. No. 5,777,092
    • U.S. Pat. No. 5,780,448
    • U.S. Pat. No. 5,789,215
    • U.S. Pat. No. 5,792,847
    • U.S. Pat. No. 5,800,992
    • U.S. Pat. No. 5,807,522
    • U.S. Pat. No. 5,830,645
    • U.S. Pat. No. 5,837,196
    • U.S. Pat. No. 5,847,219
    • U.S. Pat. No. 5,858,988
    • U.S. Pat. No. 5,859,221
    • U.S. Pat. No. 5,871,928
    • U.S. Pat. No. 5,872,232
    • U.S. Pat. No. 5,876,932
    • U.S. Pat. No. 5,886,165
    • U.S. Pat. No. 5,919,626
    • U.S. Pat. No. 5,945,100
    • U.S. Pat. No. 5,981,274
    • U.S. Pat. No. 5,994,624
    • U.S. Pat. No. 6,004,755
    • U.S. Pat. No. 6,087,102
    • U.S. Pat. No. 6,251,666
    • U.S. Pat. No. 6,262,252
    • U.S. Pat. No. 6,368,799
    • U.S. Pat. No. 6,376,179
    • U.S. Pat. No. 6,383,749
    • U.S. Pat. No. 6,617,112
    • U.S. Pat. No. 6,638,717
    • U.S. Pat. No. 6,720,138
    • U.S. Pat. No. 6,723,509
    • U.S. Patent Ser. 60/649,584
    • U.S. Patent Ser. 60/575,743
    • British Appln. 1,529,202
    • European Appl. 266,032
    • European Appl. 373 203
    • European Appl. 785 280
    • European Appl. 799 897
    • PCT Appln. WO 94/09699
    • PCT Appln. WO 95/06128
    • PCT Appln. WO 0138580
    • PCT Appln. WO 0168255
    • PCT Appln. WO 03020898
    • PCT Appln. WO 03022421
    • PCT Appln. WO 03023058
    • PCT Appln. WO 03029485
    • PCT Appln. WO 03040410
    • PCT Appln. WO 03053586
    • PCT Appln. WO 03066906
    • PCT Appln. WO 03067217
    • PCT Appln. WO 03076928
    • PCT Appln. WO 03087297
    • PCT Appln. WO 03091426
    • PCT Appln. WO 03093810
    • PCT Appln. WO 03100448A1
    • PCT Appln. WO 04020085
    • PCT Appln. WO 04027093
    • PCT Appln. WO 09923256
    • PCT Appln. WO 09936760
    • PCT Appln. WO 93/17126
    • PCT Appln. WO 95/11995
    • PCT Appln. WO 95/21265
    • PCT Appln. WO 95/21944
    • PCT Appln. WO 95/35505
    • PCT Appln. WO 96/31622
    • PCT Appln. WO 97/10365
    • PCT Appln. WO 97/27317
    • PCT Appln. WO 9743450
    • PCT Appln. WO 99/35505
    • PCT Appln. WO03100012
    • UK 8 803 000;
    • Agrawal and Zamecnik, Nucleic Acids Research, 18(18):5419-5423, 1990.
    • Allen et al., Biochemistry, 28:4601-4607, 1989.
    • Ambros, Cell, 107(7):823-826, 2001.
    • Baglioni and Nilson, Interferon, 5:23-42, 1983.
    • Bayer and Wilchek, Methods of Biochemical Analysis, 26:1-45, 1980.
    • Bayer et al, Analytical Biochemistry, 149:529-536, 1985.
    • Beaucage, and Lyer, Tetrahedron, 48:2223-2311, 1992.
    • Bernstein et al., Nature, 409: 363-366, 2001.
    • Bijsterbosch et al., Biochem. Pharmacol., 62(5):627-633, 2001.
    • Blackie et al., Bioorg. Med. Chem. Lett., 12(18):2603-2606, 2002.
    • Bobo et al., In: Diagnosis of Chlamydia trachomatis Cervical Infection by Detection of Amplified DNA with an Enzyme Immunoassay, 1990.
    • Borlakoglu et al., Biochem. Pharmacol., 40(2):265-272, 1990.
    • Bosher and Labouesse, Nat. Cell Biol., 2:E31-E36, 2000.
    • Brennecke et al., Cell, 113:25-36, 2003.
    • Brumbaugh et al., Proc Natl Acad Sci USA, 85(15):5610-5614, 1988.
    • Brummelkamp et al., Science, 296(5567):550-553, 2002 Calin et al., Proc. Natl. Acad. Sci. USA, 99:15524-15529, 2002.
    • Caplen et al., Proc Natl Acad Sci USA, 98: 9742-9747, 2001.
    • Cardullo et al., Proc Natl Acad Sci USA, 85(23):8790-8794, 1988 Carrington et al. Science, 301(5631):336-338, 2003.
    • Chang et al., Nature, 430(7001):785-789, 2004.
    • Chen and Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987.
    • Chen et al., Science, 303(5654):83-86, 2004.
    • Cogoni, C., and Macino, Science, 286:342-2344, 1999.
    • Cogoni, and Macino, Nature 399:166-169, 1999.
    • Conway et al., Nucleic Acids Res. Symposium Series, 21:43-44, 1989.
    • Crooke, In: Antisense Drug Technology, Marcel Dekker and Co, Basel, Switzerland, Chapter 6, 2001.
    • Cummins et al., In: IRT: Nucleosides and nucleosides, La Jolla Calif., 72, 1996.
    • Dalmay et al. EMBO J, 20:2069-2078, 2001.
    • Dalmay et al., Cell, 101:543-553, 2000.
    • Denli et al., Trends Biochem. Sci., 28:196, 2003.
    • Dewanjee et al., Biotechniques, 5: 844-846, 1994.
    • Didenko, Biotechniques, 31(5):1106-16, 1118, 1120-1, 2001.
    • Doench et al., Genes & Dev. 17: 438-442, 2003.
    • Doench et al., Genes Dev. 18(5):504-11, 2004.
    • Dong et al., Crit Rev Oncol Hematol. 54(2):85-93, 2005.
    • Dostie et al., RNA, 9:180-186, 2003.
    • Draper and Gold, Biochemistry, 19:1774-1781, 1980.
    • Elbashir et al., Nature, 411:494-498, 2001.
    • Emptage et al., Neuron, 2001 January; 29(1):197-208, 2001.
    • Fechheimer et al., Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987.
    • Fire et al., Nature, 391:806-811, 1998.
    • Forster et al. Nucleic Acids Res., 13(3):745-761, 1985.
    • Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979.
    • Froehler et al., Nucleic Acids Res., 14(13):5399-5407, 1986.
    • Gillam et al., J. Biol. Chem., 253:2532, 1978.
    • Gillam et al., Nucleic Acids Res., 6:2973, 1979.
    • Gopal, Mol. Cell Biol., 5:1188-1190, 1985.
    • Graham and Van Der Eb, Virology, 52:456-467, 1973.
    • Griffey et al., J Mass Spectrom, 32(3):305-13, 1997.
    • Grishok et al., Cell, 106: 23-34, 2001.
    • Ha et al., Genes Dev., 10, 3041-3050, 1996.
    • Hamilton and Baulcombe, Science, 286:950-952, 1999.
    • Hammond et al., Nat. Rev. Genet., 2(2):110-9, 2001.
    • Haralambidis et al., Nucleic Acids Res., 18(3):493-9, 1990.
    • Harland and Weintraub, J. Cell Biol., 101:1094-1099, 1985.
    • Holtke and Kessler, Nucleic Acids Res., 18(19):5843-51, 1990.
    • Hutvagner and Zamore, Science, 297(5589):2056-2060, 2002.
    • Hutvagner et al., PLoS Biol. 2(4):E98, 2004.
    • Hutvagner et al., Science, 293:834-838, 2001.
    • Itakura and Riggs, Science, 209:1401-1405, 1980.
    • Itakura et al., J. Biol. Chem., 250:4592, 1975.
    • Jablonski et al., Nucleic Acids Res., 14(15):6115-6128, 1986.
    • Kaeppler et al., Plant Cell Reports, 9: 415-418, 1990.
    • Kaneda et al., Science, 243:375-378, 1989.
    • Kato et al, J. Biol. Chem., 266:3361-3364, 1991.
    • Keller et al., Analytical Biochemistry, 170:441-450, 1988.
    • Ketting et al., Cell, 99:133-141, 1999.
    • Khorana, Science, 203, 614 1979.
    • Kimura et al., Cancer Research, 55:1379-1384, 1995.
    • Kiriakidou et al. Genes Dev. 18(10):1165-78, 2004.
    • Kitagawa et al., Brain Res., 561:203-11, 1991.
    • Klostermeier and Millar, Biopolymers, 61(3):159-79, 2001-2002 Knight et al., Science, 2:2, 2001.
    • Kornberg and Baker, In: DNA Replication, 2d Ed., Freeman, San Francisco, 1992.
    • Kuhnast et al., Bioconjug Chem, 5:627-636, 2000.
    • Lagos-Quintana et al., Science, 294(5543):853-858, 2001.
    • Langer et al., Proc. Natl. Acad. Sci. USA, 78(11):663-6637, 1981.
    • Lau et al., Science, 294(5543):858-862, 2001.
    • Lee and Ambros, Science, 294(5543):862-864, 2001.
    • Lee et al., Nature, 425(6956):415-419 2003.
    • Lee, EMBO J., 21(17):4663-4670 2002.
    • Leonetti et al., Bioconjugate Chem., 1:149-153, 1990.
    • Lewis, Cell, 115(7):787-798 2003.
    • Lin and Avery, Nature, 402:128-129, 1999.
    • Liu et al., Anal. Biochem., 289:239-245, 2001.
    • Lorenz et al., Bioorg. Med. Chem. Lett. 14(19):4975-4977, 2004.
    • MacKellar et al., Nucl. Acids Res., 20:3411-3417, 1992.
    • Manoharan, Antisense Nucleic Acid Drug Dev., 12(2):103-128, 2002.
    • Martin et al., RNA, 4(2):226-20, 1998.
    • Meijer et al., Progress in Cell cycle research Vol 5, 219-224. (Meijer, L., Jezequel, A., and Roberge, M. eds), Chapter 22.
    • Meister et al., RNA, 10(3):544-50, 2004.
    • Montgomery et al., Proc. Natl. Acad. Sci. USA, 95:155-2-15507, 1998.
    • Mourrain et al., Cell, 101:533, 2000.
    • Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982.
    • Nicolau et al., Methods Enzymol., 149:157-176, 1987.
    • Nykanen et al., Cell, 107(3):309-321, 2001.
    • Olsen et al., Dev. Biol., 216:671, 1999.
    • Omirulleh et al., Plant Mol. Biol., 21(3):415-428, 1993.
    • Oravcova et al., Blood Press Suppl., 1:61-64, 1994.
    • Pasquinelli and Ruvkun, Ann. Rev. Cell Dev. Biol., 18:495-513, 2002.
    • Piutlle et al., Gene, 112(1):101-5, 1992.
    • Plasterk and Ketting, Curr. Opin. Genet. Dev., 10:562-567, 2000.
    • Potrykus et al., Mol. Gen. Genet., 199(2):169-77, 1985.
    • Regnier and Preat, Pharm Res, 10:1596-602, 1998.
    • Reinhart et al., Nature, 403:901-906, 2000.
    • Reisfeld et al. Biochem Biophysic Res Comm, 142(2):519-526, 1987.
    • Richardson and Gumport, Nucleic Acids Res, 11(18):6167-84, 1983.
    • Richardson and Macy, Biochemistry, 20(5):1133-9, 1981.
    • Rippe et al., Mol. Cell Biol., 10:689-695, 1990.
    • Roychoudhury and Kossel, Eur J Biochem, 22(3):310-20, 1971.
    • Rump et al., Biochem Pharmacol 59(11): 1407-16, 2000.
    • Rusckowski et al., Antisense Nucleic Acid Drug Dev., 5:333-345, 2000.
    • Rusconi et al., Nat. Biotechnol., 22(11):1423-1428, 2004.
    • Saiki et al. Science, 230:1350-1354, 1985
    • Sambrook et al., In: DNA microaarays: a molecular cloning manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2003.
    • Sambrook et al., In: Molecular cloning: a laboratory manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.
    • Sambrook et al., In: Molecular cloning: a laboratory manual, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001.
    • Scheit, In: Synthesis and Biological Function, Wiley-Interscience, New York, 171-172, 1980.
    • Schwarze et al., Trends in Cell Biol., 10:290-295, 2000.
    • Sedelnikova et al., Antisense Nucleic Acid Drug Dev., 6:443-452, 2000.
    • Seggerson et al., Dev. Biol., 243:215, 2002.
    • Sharp and Zamore, Science, 287:2431-2433, 2000.
    • Smardon et al., Curr. Biol., 10:169-178, 2000.
    • Sodja et al., Nucleic Acids Res., 5(2):385-401, 1978.
    • Soutschek et al., Nature, 432(7014):173-178, 2004.
    • Sproat et al., Nucleic Acids Res., 17(9):3373-3386, 1989.
    • Stalnacke et al., Eur. J. Nucl. Med., 5:166-170, 1985.
    • Sui et al., Proc. Natl. Acad. Sci. USA, 99(8):5515-5520, 2002.
    • Tabara et al., Cell, 99:123-132, 1999.
    • Takeda and Ikeda, Nucl. Acids Res., 15:101-104, 1984.
    • Tuschl, Chembiochem, 2:239-245, 2001.
    • Uhlenbeck et al., Nucleic Acids Res., 10(11):3341-52, 1982.
    • Urdea et al., Clinical Chemistry, 35(8):1571-1575, 1989.
    • Vella et al., Genes Dev. 18(2):132-7, 2004.
    • Viscidi et al., J. Clinical Microbiology, 23(2):311-317, 1986.
    • Vyas et al., Crit. Rev. Ther. Drug Carrier Syst., 18:1-76, 2001.
    • Waterhouse et al., Nature, 411:834-842, 2001.
    • Weeks et al., Clin. Chem., 29(8):1474-1479, 1983.
    • Williams et al., Int. J. Dev. Biol., 41(2):359-364, 1997.
    • Winter and Brownlee, Nucleic Acids Res., 5(9):3129-39, 1978.
    • Wong et al., Gene, 10:87-94, 1980.
    • Wu et al., Eur. J. Pharm. Sci., 3:179-186, 2000.
    • Wu-Scharf et al., Science, 290:1159-1162, 2000.
    • Xu et al., Curr. Biol., 13:790-795, 2003.
    • Yoo et al., Nucleic Acids Res., 21:4225-4231, 2000.
    • Zamore et al., Cell. 101:25-33, 2000.
    • Zamore, Nat. Struct. Biol., 8:746-750, 2001.
    • Zeng et al., Mol Cell. 9, 1327-33, 2002.
    • Zeng et al., Proc. Natl. Acad. Sci. 100: 9779-9784, 2003.
    • Zhang et al., Eur. J. Nucl. Med., 11:1700-1707, 2000.
    • Zhang et al., J. Mol. Neurosci., 1:13-28, 1996.
    • Zhang et al., J. Nucl. Med., 11:1660-1669, 2001.
    • Ziauddin and Sabatini, Nature, 411(6833):107-110, 2001.

Claims (13)

What is claimed is:
1. A method of treating hepatitis C in an individual in need thereof, comprising administering to the individual a therapeutically-effective amount of a miRNA inhibitor comprising a nucleic acid sequence that is at least 90% complementary to a miR-122 sequence.
2. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to 5-85 nucleotides of SEQ ID NO: 79.
3. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to at least 50 contiguous nucleotides of SEQ ID NO: 79.
4. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to at least 25 contiguous nucleotides of SEQ ID NO: 79.
5. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to at least 23 contiguous nucleotides of SEQ ID NO: 79.
6. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to at least 20 contiguous nucleotides of SEQ ID NO: 79.
7. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to at least 15 contiguous nucleotides of SEQ ID NO: 79.
8. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to at least 10 contiguous nucleotides of SEQ ID NO: 79.
9. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to at least 5 contiguous nucleotides of SEQ ID NO: 79.
10. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to nucleotides 15-37 of SEQ ID NO: 79.
11. The method of claim 1, wherein the miRNA inhibitor comprises a sequence that is at least 90% complementary to a mature, naturally-occurring miR-122 sequence.
12. The method of claim 1, wherein the miRNA inhibitor further comprises a pendant group conjugated to an end of the nucleic acid sequence.
13. The method of claim 1, wherein the miRNA inhibitor is administered subcutaneously or intravenously.
US14/738,706 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules Abandoned US20150284719A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/738,706 US20150284719A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US62717104P 2004-11-12 2004-11-12
US64963405P 2005-02-03 2005-02-03
US68373605P 2005-05-23 2005-05-23
US11/273,640 US8173611B2 (en) 2004-11-12 2005-11-14 Methods and compositions involving miRNA and miRNA inhibitor molecules
US13/299,255 US8946177B2 (en) 2004-11-12 2011-11-17 Methods and compositions involving miRNA and miRNA inhibitor molecules
US13/887,008 US20130303591A1 (en) 2004-11-12 2013-05-03 Methods and compositions involving mirna and mirna inhibitor molecules
US14/712,591 US9506061B2 (en) 2004-11-12 2015-05-14 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/738,706 US20150284719A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US14/712,591 Continuation US9506061B2 (en) 2004-11-12 2015-05-14 Methods and compositions involving miRNA and miRNA inhibitor molecules

Publications (1)

Publication Number Publication Date
US20150284719A1 true US20150284719A1 (en) 2015-10-08

Family

ID=37570916

Family Applications (25)

Application Number Title Priority Date Filing Date
US11/273,640 Expired - Fee Related US8173611B2 (en) 2004-11-12 2005-11-14 Methods and compositions involving miRNA and miRNA inhibitor molecules
US11/837,488 Expired - Fee Related US8058250B2 (en) 2004-11-12 2007-08-10 Methods and compositions involving miRNA and miRNA inhibitor molecules
US11/837,490 Expired - Fee Related US7960359B2 (en) 2004-11-12 2007-08-10 Methods and compositions involving miRNA and miRNA inhibitor molecules
US11/837,487 Expired - Fee Related US8563708B2 (en) 2004-11-12 2007-08-10 Methods and compositions involving miRNA and miRNA inhibitor molecules
US13/190,232 Abandoned US20110313025A1 (en) 2004-11-12 2011-07-25 Methods and compositions involving mirna and mirna inhibitor molecules
US13/299,255 Expired - Fee Related US8946177B2 (en) 2004-11-12 2011-11-17 Methods and compositions involving miRNA and miRNA inhibitor molecules
US13/761,284 Abandoned US20130143945A1 (en) 2004-11-12 2013-02-07 Methods and compositions involving mirna and mirna inhibitor molecules
US13/887,008 Abandoned US20130303591A1 (en) 2004-11-12 2013-05-03 Methods and compositions involving mirna and mirna inhibitor molecules
US14/012,302 Expired - Fee Related US8765709B2 (en) 2004-11-12 2013-08-28 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/254,532 Expired - Fee Related US9051571B2 (en) 2004-11-12 2014-04-16 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/459,119 Abandoned US20140348907A1 (en) 2004-11-12 2014-08-13 Methods and compositions involving mirna and mirna inhibitor molecules
US14/459,182 Expired - Fee Related US9382537B2 (en) 2004-11-12 2014-08-13 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/459,192 Abandoned US20140348908A1 (en) 2004-11-12 2014-08-13 Methods and compositions involving mirna and mirna inhibitor molecules
US14/459,158 Abandoned US20150005366A1 (en) 2004-11-12 2014-08-13 Methods and compositions involving mirna and mirna inhibitor molecules
US14/459,074 Expired - Fee Related US9068219B2 (en) 2004-11-12 2014-08-13 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/712,591 Expired - Fee Related US9506061B2 (en) 2004-11-12 2015-05-14 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/735,046 Abandoned US20150275213A1 (en) 2004-11-12 2015-06-09 Methods and compositions involving mirna and mirna inhibitor molecules
US14/738,716 Abandoned US20150284720A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules
US14/738,706 Abandoned US20150284719A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules
US14/738,646 Abandoned US20150342981A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules
US14/738,734 Abandoned US20150344883A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules
US14/738,728 Abandoned US20150299705A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules
US14/741,064 Expired - Fee Related US9447414B2 (en) 2004-11-12 2015-06-16 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/841,377 Abandoned US20150361431A1 (en) 2004-11-12 2015-08-31 Methods and compositions involving mirna and mirna inhibitor molecules
US15/298,781 Abandoned US20170037404A1 (en) 2004-11-12 2016-10-20 Methods and compositions involving mirna and mirna inhibitor molecules

Family Applications Before (18)

Application Number Title Priority Date Filing Date
US11/273,640 Expired - Fee Related US8173611B2 (en) 2004-11-12 2005-11-14 Methods and compositions involving miRNA and miRNA inhibitor molecules
US11/837,488 Expired - Fee Related US8058250B2 (en) 2004-11-12 2007-08-10 Methods and compositions involving miRNA and miRNA inhibitor molecules
US11/837,490 Expired - Fee Related US7960359B2 (en) 2004-11-12 2007-08-10 Methods and compositions involving miRNA and miRNA inhibitor molecules
US11/837,487 Expired - Fee Related US8563708B2 (en) 2004-11-12 2007-08-10 Methods and compositions involving miRNA and miRNA inhibitor molecules
US13/190,232 Abandoned US20110313025A1 (en) 2004-11-12 2011-07-25 Methods and compositions involving mirna and mirna inhibitor molecules
US13/299,255 Expired - Fee Related US8946177B2 (en) 2004-11-12 2011-11-17 Methods and compositions involving miRNA and miRNA inhibitor molecules
US13/761,284 Abandoned US20130143945A1 (en) 2004-11-12 2013-02-07 Methods and compositions involving mirna and mirna inhibitor molecules
US13/887,008 Abandoned US20130303591A1 (en) 2004-11-12 2013-05-03 Methods and compositions involving mirna and mirna inhibitor molecules
US14/012,302 Expired - Fee Related US8765709B2 (en) 2004-11-12 2013-08-28 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/254,532 Expired - Fee Related US9051571B2 (en) 2004-11-12 2014-04-16 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/459,119 Abandoned US20140348907A1 (en) 2004-11-12 2014-08-13 Methods and compositions involving mirna and mirna inhibitor molecules
US14/459,182 Expired - Fee Related US9382537B2 (en) 2004-11-12 2014-08-13 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/459,192 Abandoned US20140348908A1 (en) 2004-11-12 2014-08-13 Methods and compositions involving mirna and mirna inhibitor molecules
US14/459,158 Abandoned US20150005366A1 (en) 2004-11-12 2014-08-13 Methods and compositions involving mirna and mirna inhibitor molecules
US14/459,074 Expired - Fee Related US9068219B2 (en) 2004-11-12 2014-08-13 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/712,591 Expired - Fee Related US9506061B2 (en) 2004-11-12 2015-05-14 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/735,046 Abandoned US20150275213A1 (en) 2004-11-12 2015-06-09 Methods and compositions involving mirna and mirna inhibitor molecules
US14/738,716 Abandoned US20150284720A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules

Family Applications After (6)

Application Number Title Priority Date Filing Date
US14/738,646 Abandoned US20150342981A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules
US14/738,734 Abandoned US20150344883A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules
US14/738,728 Abandoned US20150299705A1 (en) 2004-11-12 2015-06-12 Methods and compositions involving mirna and mirna inhibitor molecules
US14/741,064 Expired - Fee Related US9447414B2 (en) 2004-11-12 2015-06-16 Methods and compositions involving miRNA and miRNA inhibitor molecules
US14/841,377 Abandoned US20150361431A1 (en) 2004-11-12 2015-08-31 Methods and compositions involving mirna and mirna inhibitor molecules
US15/298,781 Abandoned US20170037404A1 (en) 2004-11-12 2016-10-20 Methods and compositions involving mirna and mirna inhibitor molecules

Country Status (11)

Country Link
US (25) US8173611B2 (en)
EP (21) EP1838852A2 (en)
JP (11) JP2008519606A (en)
AU (1) AU2005333165B2 (en)
CA (7) CA2857878A1 (en)
DK (1) DK2302055T3 (en)
ES (13) ES2534304T3 (en)
HK (1) HK1204656A1 (en)
PL (1) PL2302055T3 (en)
SI (1) SI2302055T1 (en)
WO (1) WO2006137941A2 (en)

Families Citing this family (374)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2386637B1 (en) 2001-09-28 2018-05-16 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Microrna molecules
AU2005250432B2 (en) 2004-05-28 2011-09-15 Asuragen, Inc. Methods and compositions involving microRNA
EP1791954A1 (en) * 2004-09-07 2007-06-06 Yissum Research Development Company Of The Hebrew University Of Jerusalem Agents, compositions and methods for treating pathologies in which regulating an ache-associated biological pathway is beneficial
US7642348B2 (en) * 2004-10-04 2010-01-05 Rosetta Genomics Ltd Prostate cancer-related nucleic acids
US7825229B2 (en) * 2005-03-25 2010-11-02 Rosetta Genomics Ltd. Lung cancer-related nucleic acids
US20090186353A1 (en) * 2004-10-04 2009-07-23 Rosetta Genomics Ltd. Cancer-related nucleic acids
ES2534304T3 (en) 2004-11-12 2015-04-21 Asuragen, Inc. Procedures and compositions involving miRNA and miRNA inhibitor molecules
EP1877557A2 (en) 2005-04-04 2008-01-16 The Board of Regents of The University of Texas System Micro-rna's that regulate muscle cells
EP2631294A3 (en) 2005-04-29 2013-11-20 The Rockefeller University Human microRNAs and methods for inhibiting same
WO2006133022A2 (en) * 2005-06-03 2006-12-14 The Johns Hopkins University Compositions and methods for decreasing microrna expression for the treatment of neoplasia
CN103820562B (en) 2005-08-01 2015-05-13 俄亥俄州立大学研究基金会 MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
EP2796554A3 (en) 2005-09-12 2014-12-10 The Ohio State University Research Foundation Compositions for use in treating BCL2-associated cancers
WO2007044413A2 (en) * 2005-10-05 2007-04-19 The Ohio State University Research Foundation Wwox gene, vectors containing the same, and uses in treatment of cancer
CN104027818A (en) * 2005-12-12 2014-09-10 北卡罗来纳大学查珀尔希尔分校 Micrornas That Regulate Muscle Cell Proliferation and Differentiation
US7670840B2 (en) 2006-01-05 2010-03-02 The Ohio State University Research Foundation Micro-RNA expression abnormalities of pancreatic, endocrine and acinar tumors
AU2016203848B2 (en) * 2006-01-05 2017-12-14 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
EP2514433B1 (en) 2006-01-05 2015-10-21 The Ohio State University Research Foundation MicroRNA-based methods for the diagnosis, prognosis and treatment of lung cancer
ES2544713T3 (en) * 2006-01-05 2015-09-03 The Ohio State University Research Foundation MicroRNA based methods and compositions for the diagnosis and treatment of solid cancers
AU2007227423B2 (en) * 2006-03-20 2013-11-07 The Ohio State University Research Foundation MicroRNA fingerprints during human megakaryocytopoiesis
EP2261333B1 (en) 2006-04-03 2016-03-30 Roche Innovation Center Copenhagen A/S Pharmaceutical composition comprising anti-miRNA antisense oligonucleotides
JP5814505B2 (en) 2006-04-03 2015-11-17 ロシュ・イノベーション・センター・コペンハーゲン・アクティーゼルスカブRoche Innovation Center Copenhagen A/S Pharmaceutical composition comprising antimiRNA antisense oligonucleotide
EP2436786B1 (en) 2006-07-13 2014-04-16 The Ohio State University Research Foundation MIR-10a for diagnosing poor survival prognosis colon adenocarcinoma.
EP2434017A3 (en) 2006-08-01 2012-09-05 Board of Regents of the University of Texas System Identification of a micro-RNA that activates expression of beta-myosin heavy chain
CA2658301A1 (en) 2006-08-04 2008-02-07 Dublin City University A method of producing recombinant biological products
DK2061482T3 (en) * 2006-08-28 2015-04-20 Univ Western Australia PROCEDURE FOR MODULATING EXPRESSION OF EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) CONCERNING MIRNA
EP2077326A4 (en) * 2006-09-04 2010-11-10 Kyowa Hakko Kirin Co Ltd Novel nucleic acid
WO2008036776A2 (en) * 2006-09-19 2008-03-27 Asuragen, Inc. Mir-15, mir-26, mir -31,mir -145, mir-147, mir-188, mir-215, mir-216 mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention
AU2007346101B2 (en) 2006-09-19 2013-08-15 The Ohio State University Research Foundation TCL1 expression in chronic lymphocytic leukemia (CLL) regulated by miR-29 and miR-181
EP2086590A4 (en) * 2006-10-24 2011-04-06 Univ Leland Stanford Junior Modulation of t cell signaling threshold and t cell sensitivity to antigens
US8252538B2 (en) 2006-11-01 2012-08-28 The Ohio State University MicroRNA expression signature for predicting survival and metastases in hepatocellular carcinoma
US20080131878A1 (en) * 2006-12-05 2008-06-05 Asuragen, Inc. Compositions and Methods for the Detection of Small RNA
DK2104737T3 (en) * 2006-12-08 2013-05-27 Asuragen Inc Functions and Purposes of Easy-7 Micro-RNAs
AU2007333108A1 (en) * 2006-12-08 2008-06-19 Asuragen, Inc. miR-126 regulated genes and pathways as targets for therapeutic intervention
CN101622349A (en) * 2006-12-08 2010-01-06 奥斯瑞根公司 miR-20 regulated genes and pathways as targets for therapeutic intervention
WO2008073920A2 (en) * 2006-12-08 2008-06-19 Asuragen, Inc. Mir-21 regulated genes and pathways as targets for therapeutic intervention
AU2007333106A1 (en) * 2006-12-08 2008-06-19 Asuragen, Inc. miR-20 regulated genes and pathways as targets for therapeutic intervention
US20090175827A1 (en) * 2006-12-29 2009-07-09 Byrom Mike W miR-16 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
EP2111408A4 (en) * 2007-01-17 2010-02-03 Univ Johns Hopkins Compositions and methods featuring micronas for treating neoplasia
AU2008211142A1 (en) 2007-01-31 2008-08-07 The Ohio State University Research Foundation Mic orna-based methods and compositions for the treatment of acute myeloid leukemia
US9006206B2 (en) 2007-02-27 2015-04-14 Rosetta Genomics Ltd. Composition and methods for modulating cell proliferation and cell death
EP2126078B2 (en) 2007-02-27 2023-01-04 Rosetta Genomics Ltd Composition and methods for modulating cell proliferation and cell death
WO2008107901A2 (en) * 2007-03-07 2008-09-12 Yissum Research Development Company Of The Hebrew University Of Jerusalem Agents, compositions and methods for treating pathologies in which regulating an ache-associated biological pathway is beneficial
WO2008115387A2 (en) * 2007-03-15 2008-09-25 University Hospitals Of Cleveland Screening, diagnosing, treating and prognosis of pathophysiologic states by rna regulation
WO2008116267A1 (en) 2007-03-26 2008-10-02 Crc For Asthma And Airways Ltd Therapeutic targets and molecules
US20100273172A1 (en) * 2007-03-27 2010-10-28 Rosetta Genomics Ltd. Micrornas expression signature for determination of tumors origin
US20090117562A1 (en) 2007-04-09 2009-05-07 Valerie Wailin Hu Method and kit for diagnosing Autism using gene expression profiling
EP2142659A4 (en) * 2007-04-30 2010-06-09 Univ Ohio State Res Found Methods for differentiating pancreatic cancer from normal pancreatic function and/or chronic pancreatitis
EP1990414A1 (en) * 2007-05-10 2008-11-12 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Means for treating inflammatory diseases, autoimmune diseases and cancer
US20090232893A1 (en) * 2007-05-22 2009-09-17 Bader Andreas G miR-143 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
US8415096B2 (en) 2007-05-23 2013-04-09 University Of South Florida Micro-RNAs modulating immunity and inflammation
CN101801419A (en) * 2007-06-08 2010-08-11 米尔纳疗法公司 Gene and path as the miR-34 regulation and control for the treatment of the target of intervening
US8465917B2 (en) 2007-06-08 2013-06-18 The Ohio State University Research Foundation Methods for determining heptocellular carcinoma subtype and detecting hepatic cancer stem cells
EP2719773A3 (en) 2007-06-15 2014-07-30 The Ohio State University Research Foundation miRNA as marker for acute lamphomic leucemia
US20090012031A1 (en) * 2007-07-03 2009-01-08 The Regents Of The University Of Michigan EZH2 Cancer Markers
MX2010001217A (en) 2007-07-31 2010-04-07 Regents The Unuversity Of Texa A micro-rna family that modulates fibrosis and uses thereof.
EP2187896B1 (en) 2007-07-31 2016-01-13 The Board of Regents of The University of Texas System Inhibitors of mir-499 and mir-208b for use in the treatment of pathologic cardiac hypertrophy, heart failure or myocardial infarction
JP2010535782A (en) 2007-07-31 2010-11-25 ズィ、オハイオウ、ステイト、ユーニヴァーサティ、リサーチ、ファウンデイシャン Method for reversing methylation by targeting DNMT3A and DNMT3B
WO2009017803A2 (en) * 2007-08-02 2009-02-05 The Texas A & M University System Antisense microrna and uses therefor
ES2562077T3 (en) 2007-08-03 2016-03-02 The Ohio State University Research Foundation Ultraconserved regions encoding RNAnc
US20120070442A1 (en) * 2007-08-09 2012-03-22 The Regents Of The University Of Colorado, A Body Corporate Methods and compositions for treating cancer
WO2009021325A1 (en) 2007-08-10 2009-02-19 British Columbia Cancer Agency Branch Microrna compositions and methods for the treatment of myelogenous leukemia
CA2926831A1 (en) 2007-08-22 2009-02-26 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of epha7 and erk phosphorylation in human acute leukemias
CN101376910B (en) * 2007-08-27 2012-01-11 中国科学院上海生命科学研究院 Use of miRNA genes in systemic lupus erythematosus disease diagnose and treatment
US20100249213A1 (en) * 2007-09-06 2010-09-30 The Ohio State University Research Foundation MicroRNA Signatures in Human Ovarian Cancer
US8361714B2 (en) 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
WO2009044895A1 (en) * 2007-10-03 2009-04-09 Kyowa Hakko Kirin Co., Ltd. Composition inhibiting the expression of target gene
JPWO2009044899A1 (en) * 2007-10-03 2011-02-17 協和発酵キリン株式会社 Nucleic acids that control cell growth
EP2203559B1 (en) 2007-10-04 2014-02-26 Stella ApS Combination treatment for the treatment of hepatitis c virus infection
CA2702241A1 (en) * 2007-10-11 2009-04-16 The Ohio State University Research Foundation Methods and compositions for the diagnosis and treatment of esophageal adenocarcinomas
US20090186015A1 (en) * 2007-10-18 2009-07-23 Latham Gary J Micrornas differentially expressed in lung diseases and uses thereof
WO2009055773A2 (en) 2007-10-26 2009-04-30 The Ohio State University Research Foundation Methods for identifying fragile histidine triad (fhit) interaction and uses thereof
CN101980712B (en) 2007-10-29 2015-02-18 雷古拉斯治疗公司 Targeting microRNAs for the treatment of liver cancer
EP2207475A4 (en) * 2007-11-05 2010-12-22 Kci Licensing Inc Identification of tissue for debridement
EP2219653B1 (en) 2007-11-09 2016-12-21 The Board of Regents of The University of Texas System Micro-rnas of the mir-15 family modulate cardiomyocyte survival and cardiac repair
ITRM20070595A1 (en) * 2007-11-15 2009-05-16 Univ Roma MIRNA AND SIRNA AND THEIR USE IN THERAPY
JP2011504110A (en) * 2007-11-23 2011-02-03 パナジェン インコーポレイテッド MicroRNA antisense PNA, composition containing the same, and use and evaluation method thereof
WO2009070653A1 (en) * 2007-11-30 2009-06-04 The Ohio State University Research Foundation Microrna expression profiling and targeting in peripheral blood in lung cancer
WO2009070805A2 (en) * 2007-12-01 2009-06-04 Asuragen, Inc. Mir-124 regulated genes and pathways as targets for therapeutic intervention
WO2009086156A2 (en) * 2007-12-21 2009-07-09 Asuragen, Inc. Mir-10 regulated genes and pathways as targets for therapeutic intervention
JP5116026B2 (en) 2008-01-23 2013-01-09 富士フイルム株式会社 Cancer detection method and cancer inhibitor
KR101325186B1 (en) 2008-01-23 2013-11-07 (주)바이오니아 An Anticancer Agent Comprising Double-stranded miRNAs as an Active Ingredient
AU2009207291B2 (en) * 2008-01-27 2014-11-06 Mor Research Applications Methods and compositions for diagnosing complications of pregnancy
EP2260110B1 (en) * 2008-02-08 2014-11-12 Asuragen, INC. miRNAs DIFFERENTIALLY EXPRESSED IN LYMPH NODES FROM CANCER PATIENTS
ES2600165T3 (en) * 2008-02-28 2017-02-07 The Ohio State University Research Foundation MiR-32 antagonists to increase the response of prostate cancer to apoptosis
JP2011517932A (en) * 2008-02-28 2011-06-23 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション MicroRNA signatures associated with human chronic lymphocytic leukemia (CCL) and uses thereof
CN102007223B (en) * 2008-02-28 2014-06-18 俄亥俄州立大学研究基金会 Microrna-based methods and compositions for the diagnosis, prognosis and treatment of gastric cancer
EP2268811A1 (en) 2008-03-07 2011-01-05 Santaris Pharma A/S Pharmaceutical compositions for treatment of microrna related diseases
CN102036689B (en) 2008-03-17 2014-08-06 得克萨斯系统大学董事会 Identification of micro-RNAs involved in neuromuscular synapse maintenance and regeneration
WO2009120712A2 (en) * 2008-03-24 2009-10-01 New York University Compositions and methods for diagnosing and treating melanoma
US20090253780A1 (en) * 2008-03-26 2009-10-08 Fumitaka Takeshita COMPOSITIONS AND METHODS RELATED TO miR-16 AND THERAPY OF PROSTATE CANCER
WO2009121031A1 (en) * 2008-03-27 2009-10-01 Vascular Biosciences, Inc. Methods of novel therapeutic candidate identification through gene expression analysis in vascular-related diseases
WO2009126650A2 (en) * 2008-04-07 2009-10-15 Cornell Research Foundation, Inc. Inhibition of angiognesis
US20090258928A1 (en) * 2008-04-08 2009-10-15 Asuragen, Inc. Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
US20090280167A1 (en) * 2008-05-07 2009-11-12 Abraxis Bioscience, Llc Enhancement of drug therapy by mirna
US20110178159A1 (en) * 2008-05-08 2011-07-21 Hua Gu Inhibitory rnas that regulate hematopoietic cells
EP2285960B1 (en) 2008-05-08 2015-07-08 Asuragen, INC. Compositions and methods related to mir-184 modulation of neovascularization or angiogenesis
US20110071215A1 (en) * 2008-06-02 2011-03-24 Harvey Pass Compositions and methods for diagnosis, prognosis and treatment of mesothelioma
US8927207B2 (en) * 2008-06-05 2015-01-06 Research Foundation Of State University Of New York miRNAs as therapeutic targets in cancer
US8247388B2 (en) * 2008-06-06 2012-08-21 The Board Of Trustees Of The Leland Stanford Junior University Role of miRNA in T cell leukemia
CN102112110A (en) * 2008-06-06 2011-06-29 米尔纳医疗股份有限公司 Novel compositions for the in vivo delivery of RNAi agents
EP2307028B1 (en) 2008-06-11 2013-10-02 The Government of the United States of America as represented by The Secretary of the Department of Health and Human Services Use of mir-26 family as a predictive marker of hepatocellular carcinoma and responsiveness to therapy
US8252534B2 (en) * 2008-06-12 2012-08-28 City Of Hope Micro RNAs and their methods of use for the treatment and diagnosis of schizophrenia and schizophrenia spectrum disorders
US20110077168A1 (en) * 2008-06-17 2011-03-31 Nitzan Rosenfeld Methods for distinguishing between specific types of lung cancers
WO2009153774A2 (en) * 2008-06-17 2009-12-23 Rosetta Genomics Ltd. Compositions and methods for prognosis of ovarian cancer
MX2010014242A (en) 2008-06-27 2011-06-24 Edrich Miescher Inst For Biomedical Res Novartis Forschungsstiftung Zweigniederlassung Fri Prediction of antiviral therapy response.
WO2010002984A1 (en) * 2008-07-01 2010-01-07 Monsanto Technology, Llc Recombinant dna constructs and methods for modulating expression of a target gene
JP5322066B2 (en) * 2008-07-03 2013-10-23 国立大学法人神戸大学 Rheumatoid arthritis-related microRNA
ES2541442T3 (en) 2008-08-01 2015-07-20 Roche Innovation Center Copenhagen A/S MicroRNA-mediated modulation of colony stimulating factors
KR101042052B1 (en) * 2008-08-05 2011-06-16 사회복지법인 삼성생명공익재단 Composition containing anti-microRNA for treating or preventing solid cancers
WO2010017551A2 (en) * 2008-08-08 2010-02-11 The General Hospital Corporation Method for mir-125a in promoting hematopoietic stem cell self renewal and expansion
EP2320913A4 (en) 2008-08-09 2012-10-03 Univ Iowa Res Found Nucleic acid aptamers
US20110196017A1 (en) * 2008-08-11 2011-08-11 Olson Eric N Micro-rna that promotes vascular integrity and uses thereof
EP2323677A4 (en) * 2008-08-12 2013-01-09 Univ Ohio State Res Found Micro-rna-based compositions and methods for the diagnosis, prognosis and treatment of multiple myeloma
WO2010019874A1 (en) * 2008-08-15 2010-02-18 The Translational Genomics Research Institute (Tgen) Methods of predicting the risk of recurrence of cancer
US8557786B2 (en) * 2008-08-19 2013-10-15 Maine Institute of Human Genetics and Health Micro RNA (MiRNA) and neurofibromatosis type 1: a role in diagnosis and therapy
WO2010033822A2 (en) * 2008-09-19 2010-03-25 Immune Disease Institute, Inc Therapeutic and diagnostic strategies
US8748101B2 (en) * 2008-11-10 2014-06-10 Battelle Memorial Institute Methods, compositions, and devices utilizing MicroRNA to determine physiological conditions
WO2010056737A2 (en) * 2008-11-11 2010-05-20 Mirna Therapeutics, Inc. Methods and compositions involving mirnas in cancer stem cells
EP2633854B1 (en) 2008-12-05 2015-09-16 Yeda Research And Development Co. Ltd. miRNA-9 or miRNA-9* for use in treating ALS
JP2012511031A (en) 2008-12-05 2012-05-17 ホワイトヘッド・インスティテュート・フォー・バイオメディカル・リサーチ Compositions and methods related to miR-31
EP2208785A1 (en) 2009-01-15 2010-07-21 Newbiotechnic, S.A. Methods and kits to generate miRNA- and smallRNA-expressing vectors, and its application to develop lentiviral expression libraries
EP2379720B1 (en) 2009-01-20 2016-08-17 Alona Zilberberg Mir-21 promoter driven targeted cancer therapy
CA2751213A1 (en) 2009-02-02 2010-08-05 Cepheid Methods of detecting sepsis
NZ594365A (en) 2009-02-04 2013-03-28 Univ Texas Dual targeting of miR-208a or miR-208b and miR-499 in the treatment of cardiac disorders or musculoskeletal disorders
EP2218458A1 (en) * 2009-02-13 2010-08-18 Fondazione Telethon Molecules able to modulate the expression of at least a gene involved in degradative pathways and uses thereof
US20100311815A1 (en) * 2009-02-23 2010-12-09 The Regents Of The University Of Michigan Mir-101 cancer markers
JP2012518997A (en) * 2009-02-26 2012-08-23 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション MicroRNA in smoking inexperienced persons and related materials and methods
WO2010107397A1 (en) * 2009-03-19 2010-09-23 Agency For Science, Technology And Research Modulators of apoptosis and the uses thereof
US20120087992A1 (en) * 2009-03-20 2012-04-12 Jingfang Ju miRNAS AS THERAPEUTIC TARGETS IN CANCER
AU2010234806B2 (en) 2009-03-31 2014-05-22 The United States Of America As Represented By The Secretary Department Of Health And Human Services Differentially expressed microRNAs as biomarkers for the diagnosis and treatment of Sjogren's syndrome
WO2010120969A1 (en) * 2009-04-15 2010-10-21 Board Of Regents, The University Of Texas System Targeting of the mir-30 family and let-7 family as a treatment for heart disease
WO2010122538A1 (en) 2009-04-24 2010-10-28 Santaris Pharma A/S Pharmaceutical compositions for treatment of hcv patients that are non-responders to interferon
KR101758667B1 (en) 2009-04-29 2017-07-18 아카데미쉬 메디쉬 센트륨 Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure
US9085798B2 (en) 2009-04-30 2015-07-21 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
WO2010129860A2 (en) * 2009-05-08 2010-11-11 The Ohio State University Research Foundation Microrna expression profiling and targeting in chronic obstructive pulmonary disease (copd) lung tissue and methods of use thereof
US20130177624A1 (en) * 2009-05-08 2013-07-11 David Brian Corry Mirna expression in allergic disease
EP2430579A2 (en) * 2009-05-11 2012-03-21 Koninklijke Philips Electronics N.V. Device and method for comparing molecular signatures
US8592388B2 (en) 2009-05-20 2013-11-26 Eth Zurich Targeting MicroRNAs for metabolic disorders
EP2437750A4 (en) 2009-05-20 2014-11-05 Univ Texas Identification of micro-rnas involved in post-myocardial infarction remodeling and heart failure
US9034838B2 (en) 2009-05-25 2015-05-19 Universita Degli Studi Di Roma “La Sapienza” miR-31 in duchenne muscular dystrophy therapy
US20120059159A1 (en) * 2009-05-25 2012-03-08 Carola Ponzetto Differentiation therapy for sarcomas
WO2010144698A2 (en) * 2009-06-10 2010-12-16 Henry Ford Health System Methods, systems, and compositions for neuronal differentiation of multipotent stromal cells
US20100322909A1 (en) 2009-06-17 2010-12-23 The University Of Pittsburgh - Of The Commonwealth System Of Higher Education Th1-associated micrornas and their use for tumor immunotherapy
WO2010151755A2 (en) * 2009-06-25 2010-12-29 The Brigham And Women's Hospital, Inc. TREATMENT OF INFLAMMATORY DISEASES USING miR-124
WO2011012136A1 (en) * 2009-07-28 2011-02-03 Exiqon A/S A method for classifying a human cell sample as cancerous
FR2948687B1 (en) * 2009-07-29 2015-09-04 Centre Nat Rech Scient USE OF MICROARN FOR THE TREATMENT OF CHRONIC RESPIRATORY DISEASES
EP2460005A4 (en) 2009-07-31 2012-11-21 Translational Genomics Res Inst Methods of assessing a risk of cancer progression
CN102762731B (en) * 2009-08-05 2018-06-22 库尔纳公司 By inhibiting to treat insulin gene (INS) relevant disease for the natural antisense transcript of insulin gene (INS)
US20120214863A1 (en) * 2009-08-05 2012-08-23 The Ohio State University Research Foundation Anti-miR-1 Therapy for Wound Healing
EP2283846A1 (en) * 2009-08-12 2011-02-16 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. miRNA compounds for treatment of prostate carcinoma
US8796238B2 (en) 2009-09-17 2014-08-05 Sigma-Aldrich Co. Llc Short RNA mimetics
WO2011047147A1 (en) * 2009-10-14 2011-04-21 Baylor College Of Medicine Microrna mirna-31 as a therapeutic approach for the treatment of cancer
WO2011059752A1 (en) * 2009-10-28 2011-05-19 Board Of Regents Of The University Of Texas System Methods and compositions for anti-egfr treatment
WO2011057003A2 (en) 2009-11-04 2011-05-12 Samuil Umansky Methods of using small rna from bodily fluids for diagnosis and monitoring of neurodegenerative diseases
CA2781547A1 (en) 2009-11-23 2011-05-26 The Ohio State University Materials and methods useful for affecting tumor cell growth, migration and invasion
WO2011063456A1 (en) * 2009-11-24 2011-06-03 The University Of Western Australia Methods and compositions for increasing sensitivity to tyrosine kinase inhibitors
EP2327783A1 (en) * 2009-11-27 2011-06-01 Universitätsklinikum Freiburg Pharmaceutical composition comprising miRNA-100 and its use in the modulation of blood vessel growth
US8354520B2 (en) * 2009-12-10 2013-01-15 Kaohsiung Medical University Composition and method for treating atherosclerosis, method for determining if a subject has atherosclerosis and method of screening an anti-atherosclerotic drug
US20120315640A1 (en) 2009-12-21 2012-12-13 Hidetoshi Tahara Senescence marker, method for evaluating senescence inhibitor, and cancer inhibitor
WO2011084815A1 (en) * 2009-12-21 2011-07-14 Board Of Trustees Of Southern Illinois University Inhibition of ubc9-mediated cancer cell invasion and metastasis
EP2518144B1 (en) * 2009-12-21 2015-08-05 Hiroshima University Aging marker, method for evaluating aging inhibitor, and cancer inhibitor
WO2011079299A1 (en) * 2009-12-23 2011-06-30 The George Washington University Compositions and methods for identifying autism spectrum disorders
EP2341145A1 (en) * 2009-12-30 2011-07-06 febit holding GmbH miRNA fingerprint in the diagnosis of diseases
US8846631B2 (en) 2010-01-14 2014-09-30 Regulus Therapeutics Inc. MicroRNA compositions and methods
WO2011091209A1 (en) * 2010-01-21 2011-07-28 North Carolina State University Small molecule modifiers of microrna mir-122
JP2011188849A (en) * 2010-02-18 2011-09-29 Okayama Univ miR-7 EXPRESSION PLASMID HAVING ANTITUMOR EFFECT
US8841269B2 (en) * 2010-02-23 2014-09-23 Creighton University Polynucleotides for use in treating and diagnosing cancers
ES2631458T3 (en) * 2010-03-04 2017-08-31 Interna Technologies B.V. MRNA molecule defined by its source and its therapeutic uses in cancer associated with EMT
WO2011111715A1 (en) * 2010-03-09 2011-09-15 協和発酵キリン株式会社 Nucleic acid capable of regulating cell cycle
US10787701B2 (en) 2010-04-05 2020-09-29 Prognosys Biosciences, Inc. Spatially encoded biological assays
PT2556171E (en) 2010-04-05 2015-12-21 Prognosys Biosciences Inc Spatially encoded biological assays
US20190300945A1 (en) 2010-04-05 2019-10-03 Prognosys Biosciences, Inc. Spatially Encoded Biological Assays
US8993532B2 (en) 2010-04-23 2015-03-31 Cold Spring Harbor Laboratory Structurally designed shRNAs
WO2011150420A1 (en) * 2010-05-28 2011-12-01 Baylor College Of Medicine Modified gold nanoparticles for therapy
CA2801342A1 (en) 2010-06-04 2011-12-08 Eric N. Olson Regulation of metabolism by mir-378
EP2711423B1 (en) * 2010-06-09 2014-11-05 Chanel Parfums Beauté Inhibitors of micro-RNAs for use for preventing and/or attenuating skin ageing and/or for hydrating skin
EP2591106A1 (en) 2010-07-06 2013-05-15 InteRNA Technologies B.V. Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated braf pathway
EP2594643B1 (en) * 2010-07-12 2017-04-12 National University Corporation Tottori University Method for producing novel hipsc by means of sirna introduction
US8580513B2 (en) * 2010-07-20 2013-11-12 Trustees Of Dartmouth College Methods for determining response to neoadjuvant therapy and survival using MicroRNA-10b
WO2012012716A2 (en) 2010-07-23 2012-01-26 Regulus Therapeutics, Inc. Targeting micrornas for the treatment of fibrosis
US10385314B2 (en) 2010-08-16 2019-08-20 Exostem Biotec Ltd. Methods of generating oligodendrocytes and cell populations comprising same
US9783781B2 (en) 2010-08-16 2017-10-10 Exostem Biotec Ltd. Methods of generating oligodendrocytes and cell populations comprising same
BR112013003506B1 (en) 2010-08-17 2022-02-08 Universite De Geneve METHOD TO DETECT THE PRESENCE OF A BARD1 ISOFORM AND METHOD TO DISCRIMINATE CANCER
US8642342B2 (en) 2010-08-19 2014-02-04 Regents Of The University Of Michigan Methods for regulating neural differentiation
EP2426217A1 (en) * 2010-09-03 2012-03-07 Centre National de la Recherche Scientifique (CNRS) Analytical methods for cell free nucleic acids and applications
US9006195B2 (en) * 2010-09-13 2015-04-14 California Institute Of Technology Regulation of hematopoietic stem cell functions through microRNAs
WO2012044265A1 (en) * 2010-09-27 2012-04-05 Sabanci Universitesi Use of mirnas for the diagnosis, prophylaxis, treatment and follow-up of diseases involving macroautophagy abnormalities
WO2012041959A1 (en) 2010-09-30 2012-04-05 University Of Zurich Treatment of b-cell lymphoma with microrna
AU2011326032B2 (en) * 2010-11-12 2016-10-06 The Ohio State University Research Foundation Materials and methods related to microRNA-21, mismatch repair, and colorectal cancer
WO2012063894A1 (en) * 2010-11-12 2012-05-18 国立大学法人愛媛大学 Compositions containing antisense oligonucleotide to micro rna
JP2014500258A (en) 2010-11-15 2014-01-09 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション Controlled release mucoadhesion system
EP2772550B1 (en) 2010-11-17 2017-03-29 Interpace Diagnostics, LLC Mirnas as biomarkers for distinguishing benign from malignant thyroid neoplasms
US10744151B1 (en) * 2010-12-01 2020-08-18 Gowey Research Group PLLC Micro-RNA profiling, compositions, and methods of treating diseases
US10758578B2 (en) 2010-12-01 2020-09-01 Gowey Research Group PLLC Herbal formulations of carnivorous plants and methods for treating inflammation
US11344505B1 (en) 2010-12-01 2022-05-31 Gowey Research Group, Pllc Herbal formulations of carnivorous plants and methods for treating inflammation
US11414663B2 (en) 2010-12-01 2022-08-16 Gowey Research Group, Pllc Micro-RNA profiling, compositions, and methods of treating diseases
EP2942403B1 (en) * 2010-12-01 2017-04-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Method for predicting the outcome of a cancer by analysing mirna expression
WO2012082821A2 (en) * 2010-12-15 2012-06-21 Medimmune, Llc Melanoma treatments
AU2011343720A1 (en) 2010-12-15 2013-04-11 Miragen Therapeutics MicroRNA inhibitors comprising locked nucleotides
WO2012087242A1 (en) * 2010-12-20 2012-06-28 Agency For Science, Technology And Research Targeting glioma stem cells by sequence-specific functional inhibition of pro-survival oncomir-138
EP2474617A1 (en) 2011-01-11 2012-07-11 InteRNA Technologies BV Mir for treating neo-angiogenesis
SG192252A1 (en) 2011-02-03 2013-09-30 Mirna Therapeutics Inc Synthetic mimics of mir-34
CN103459598B (en) 2011-02-03 2016-08-10 米尔纳医疗股份有限公司 The synthesis analogies of MIR-124
HUE045731T2 (en) * 2011-02-07 2020-01-28 Gabriella Sozzi Micro-rna biomarkers for identifying risk of and/or for diagnosing lung tumour
JP2014509852A (en) 2011-03-07 2014-04-24 ジ・オハイオ・ステート・ユニバーシティ Mutagenic activity induced by microRNA-155 (miR-155) links inflammation and cancer
ES2855577T3 (en) * 2011-03-30 2021-09-23 Transine Therapeutics Ltd Functional nucleic acid molecule and its use
EP2691548B1 (en) * 2011-03-31 2017-11-22 University of Houston Microrna 130a,b as a tumor suppressor and sensitizing agent for chemotherapy
WO2012140234A1 (en) 2011-04-13 2012-10-18 Vib Vzw Modulation of mirna in diseases with aberrant angiogenesis
GB201106254D0 (en) 2011-04-13 2011-05-25 Frisen Jonas Method and product
EP3133147B1 (en) 2011-04-18 2019-03-27 DiamiR, LLC Universal screening test based on mirna (ust)
US8765707B2 (en) 2011-04-22 2014-07-01 University Of Houston System MicroRNA-140-5p as a tumor suppressor and sensitizing agent for chemotherapy
CA2833615C (en) 2011-04-25 2022-08-30 Regulus Therapeutics Inc. Microrna compounds and methods for modulating mir-21 activity
EE201100037A (en) * 2011-05-16 2012-12-17 Tartu Ülikool Use of microRNAs as biomarkers and targets for influencing cell proliferative properties and a method and kit for detecting their expression level
KR102066295B1 (en) 2011-06-27 2020-01-14 갈데르마 리써어치 앤드 디벨로프먼트 New th17 differentiation markers for acne and uses thereof
CA2840405A1 (en) * 2011-06-27 2013-01-03 Galderma Research & Development New th17 differentiation markers for acne and uses thereof
US8747860B2 (en) 2011-07-06 2014-06-10 Institute For Systems Biology Methods and compositions to modulate antiviral and immune activity responses
WO2013019259A1 (en) 2011-08-01 2013-02-07 Thomson Licensing Telepresence communications system and method
EP2739736B1 (en) 2011-08-04 2017-04-19 Yeda Research and Development Co. Ltd. Mir-135 and compositions comprising same for the treatment of serotonin associated medical conditions
US8987224B2 (en) 2011-08-05 2015-03-24 Baylor College Of Medicine MicroRNA-198 as a tumor suppressor in pancreatic cancer
JP2014525749A (en) 2011-08-12 2014-10-02 ヴェストファーレン ヴィルヘルム−ウニヴェルジテート ミュンスター Novel compounds for the treatment of inflammatory bowel disease
WO2013032962A2 (en) * 2011-08-28 2013-03-07 The Board Of Trustees Of The Leland Stanford Junior University Micro rnas to treat stroke, ischemic brain injury, traumatic brain injury, and neurodegenerative disease
WO2013030362A1 (en) * 2011-08-31 2013-03-07 Universität Zürich Prorektorat Mnw Modulators of mir-323-3p for the prevention or treatment of rheumatoid arthritis
EP2755663A4 (en) 2011-09-13 2015-10-07 Ottawa Hospital Res Inst Microrna inhibitors
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
CA2850223A1 (en) 2011-10-06 2013-04-11 Eva Van Rooij Control of whole body energy homeostasis by microrna regulation
CN104364390B (en) 2011-10-14 2016-08-24 俄亥俄州立大学 The method relevant to ovarian cancer and material
EP2584040A1 (en) 2011-10-17 2013-04-24 Pharmahungary 2000 Kft. Compounds for treatment of ischemic injury
US9593331B2 (en) * 2011-11-02 2017-03-14 Osaka City University Double-stranded nucleic acid molecule for gene expression control
JP2015504847A (en) * 2011-11-30 2015-02-16 シーダーズ−サイナイ メディカル センター Targeting microRNAs MIR-409-5P, MIR-379, and MIR-154 * to treat prostate cancer bone metastases and drug resistant lung cancer
CA2857712A1 (en) * 2011-12-01 2013-06-06 Cincinnati Children's Hospital Medical Center Materials and methods related to nsaid chemoprevention in colorectal cancer
AU2012347498A1 (en) * 2011-12-10 2014-06-26 Ohio State Innovation Foundation MiRNAs useful to reduce lung cancer tumorigenesis and chemotherapy resistance and related compositons and methods
WO2013090556A1 (en) * 2011-12-13 2013-06-20 The Ohio State University Methods and compositions related to mir-21 and mir-29a, exosome inhibition, and cancer metastasis
ITRM20110685A1 (en) * 2011-12-23 2013-06-24 Internat Ct For Genetic En Gineering And MICRORNA FOR CARDIAC REGENERATION THROUGH THE INDUCTION OF THE PROLIFERATION OF CARDIAC MYCYCLES
CN104685065B (en) 2012-01-20 2017-02-22 俄亥俄州立大学 Breast cancer biomarker signatures for invasiveness and prognosis
EP3401393B1 (en) 2012-02-22 2020-02-19 Exostem Biotec Ltd Micrornas for the generation of astrocytes
EP2844745A2 (en) 2012-02-22 2015-03-11 Brainstem Biotec Ltd. Generation of neural stem cells and motor neurons
US10924582B2 (en) 2012-03-09 2021-02-16 Interdigital Madison Patent Holdings Distributed control of synchronized content
IN2014DN09134A (en) 2012-04-25 2015-05-22 Regulus Therapeutics Inc
WO2013166240A1 (en) * 2012-05-02 2013-11-07 The Board Of Regents Of The University Of Texas System Micro-rnas involved in macular degeneration
US9334498B2 (en) 2012-05-10 2016-05-10 Uab Research Foundation Methods and compositions for modulating MIR-204 activity
JP6126088B2 (en) 2012-05-26 2017-05-10 株式会社ボナック Single-stranded nucleic acid molecule for gene expression control with delivery function
CN104685056A (en) * 2012-06-21 2015-06-03 米拉根医疗股份有限公司 Oligonucleotide-based inhibitors comprising locked nucleic acid motif
US9163235B2 (en) 2012-06-21 2015-10-20 MiRagen Therapeutics, Inc. Inhibitors of the miR-15 family of micro-RNAs
JP6093358B2 (en) * 2012-07-06 2017-03-08 タカラバイオ株式会社 Adeno-associated virus vector producing cell
EP2877186A4 (en) 2012-07-27 2016-08-31 Agency Science Tech & Res Method of promoting wound healing
WO2014020608A1 (en) 2012-07-31 2014-02-06 Yeda Research And Development Co. Ltd. Methods of diagnosing and treating motor neuron diseases
EP2703498B1 (en) * 2012-08-29 2015-01-14 Chanel Parfums Beauté Inhibitors of micro-RNAs for use for preventing and/or attenuating skin ageing
EP2702998A1 (en) 2012-08-31 2014-03-05 IMBA-Institut für Molekulare Biotechnologie GmbH Therapeutic and diagnostic miRNA regulator in kidney disease
WO2014043159A1 (en) * 2012-09-11 2014-03-20 New York University Sera based mirnas as non-invasive biomarkers in melanoma
UA116639C2 (en) 2012-10-09 2018-04-25 Рег'Юлес Терап'Ютікс Інк. Methods for treatment of alport syndrome
WO2014071205A1 (en) * 2012-11-02 2014-05-08 Dana-Farber Cancer Institute, Inc. Compositions and methods for diagnosis, prognosis and treatment of hematological malignancies
US9340787B2 (en) * 2012-11-15 2016-05-17 Yale University Compositions and methods of using micro RNAs
WO2014099999A1 (en) * 2012-12-18 2014-06-26 Sanford-Burnham Medical Research Institute Methods for improving cardiac contractility
WO2014126233A1 (en) 2013-02-15 2014-08-21 国立大学法人東京医科歯科大学 Method for assaying microrna, cancer therapeutic agent, and medicinal composition containing same for cancer therapy
WO2014164753A1 (en) * 2013-03-11 2014-10-09 Emory University Methods and compositions for managing vascular conditions
US9006200B2 (en) * 2013-03-13 2015-04-14 Asbestos Diseases Research Foundation MicroRNA-based approach to treating malignant pleural mesothelioma
WO2014140856A2 (en) 2013-03-15 2014-09-18 Graham Lord Mir-142 and antagonists thereof for treating disease
JP6410791B2 (en) 2013-03-15 2018-10-24 ミラゲン セラピューティクス, インコーポレイテッド Locked nucleic acid inhibitor of MIR-145 and use thereof
JP2016519076A (en) 2013-03-15 2016-06-30 ミルナ セラピューティクス,インク. Combined treatment of cancer using microRNA and EGFR-TKI inhibitor
US20160032383A1 (en) * 2013-03-15 2016-02-04 Albert Einstein College Of Medicine Of Yeshiva University PANEL OF microRNA BIOMARKERS IN HEALTHY AGING
US9756288B2 (en) 2013-04-10 2017-09-05 Thomson Licensing Tiering and manipulation of peer's heads in a telepresence system
JP2016169158A (en) * 2013-06-14 2016-09-23 北海道公立大学法人 札幌医科大学 Compositions for treating and/or diagnosing colon cancer, and applications thereof
GB201310755D0 (en) * 2013-06-17 2013-07-31 Ucl Business Plc Therapy
WO2014204459A1 (en) 2013-06-20 2014-12-24 Thomson Licensing System and method to assist synchronization of distributed play out of control
AU2014302702A1 (en) 2013-06-24 2015-12-17 Mirna Therapeutics, Inc. Biomarkers of miR-34 activity
WO2014210223A1 (en) 2013-06-25 2014-12-31 Prognosys Biosciences, Inc. Spatially encoded biological assays using a microfluidic device
US9862943B1 (en) * 2013-06-27 2018-01-09 California Institute Of Technology Long noncoding RNAs and cell reprogramming and differentiation
JP6443889B2 (en) * 2013-08-08 2018-12-26 国立大学法人大阪大学 Diagnostic or therapeutic agent for urothelial cancer
KR101566586B1 (en) * 2013-08-21 2015-11-16 서울대학교산학협력단 Composition and method for preventing or treating epilepsy or diseases related to seizure comprising agent targeting microRNA-203
EP3049522A2 (en) * 2013-09-26 2016-08-03 Friedrich Miescher Institute for Biomedical Research Tools and methods using mirna 182, 96 and/or 183 for treating pathologies
US20150089870A1 (en) * 2013-10-01 2015-04-02 Wayne State University Population control of invasive plant species and restoration of native plant communities
KR101598070B1 (en) * 2013-10-17 2016-02-26 한국과학기술연구원 Pharmacology composition for prevention and treatment of drug addiction
WO2015066034A1 (en) 2013-10-28 2015-05-07 Icahn School Of Medicine At Mount Sinai Compositions and methods for modulating neuronal excitability and motor behavior
AU2014348273A1 (en) 2013-11-18 2016-06-09 Diamir, Llc Methods of using mIRNAs from bodily fluids for detection and monitoring of Parkinson's disease (PD)
KR101559131B1 (en) * 2013-11-18 2015-10-07 한국원자력의학원 Composition comprising miRNA for enhancing radiation sensitivity
EP3084008B1 (en) 2013-12-17 2018-07-18 Csir A method for identification of anti-hiv human mirna mimics and mirna inhibitors and anti-hiv pharmaceutical compounds
JP6486836B2 (en) * 2013-12-26 2019-03-20 学校法人東京医科大学 Artificial mimic miRNA for gene expression control and use thereof
JP6492014B2 (en) * 2013-12-27 2019-03-27 株式会社ボナック Artificial match-type miRNA for gene expression control and use thereof
RU2697094C2 (en) * 2013-12-27 2019-08-12 Бонак Корпорейшн ARTIFICIAL miRNA WITH CONFORMITY FOR GENE EXPRESSION CONTROL AND USE THEREFOR
US10125365B2 (en) 2014-02-05 2018-11-13 Yeda Research And Development Co. Ltd. Micro-RNAs and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions
WO2015133637A1 (en) * 2014-03-07 2015-09-11 国立大学法人京都大学 Nanoparticles having microrna enclosed therein, and medicinal use for same
US20160136181A1 (en) 2014-04-01 2016-05-19 Mirna Therapeutics, Inc Microrna dosing regimens
EP2940151A1 (en) * 2014-05-02 2015-11-04 Ruprecht-Karls-Universität Heidelberg Circulating miRNAs as early detection marker and prognostic marker
EP3161165B1 (en) * 2014-06-26 2020-11-18 Icahn School of Medicine at Mount Sinai Method for diagnosing subclinical and clinical acute rejection by analysis of predictive gene sets, therapeutic agent for use in the treatment and kits for determining the expression
WO2016010023A1 (en) * 2014-07-15 2016-01-21 株式会社ミツバ Brushless wiper motor
LU92499B1 (en) 2014-07-16 2016-01-18 Univ Muenster Wilhelms Mirna 320a as biomarker for inflammatory bowel disease
ES2558262B2 (en) 2014-08-01 2016-07-14 Universidad Católica De Valencia "San Vicente Mártir" Diagnostic method of fibromyalgia based on microRNAs
EP3177721A1 (en) 2014-08-07 2017-06-14 Regulus Therapeutics Inc. Targeting micrornas for metabolic disorders
WO2016054094A1 (en) 2014-09-30 2016-04-07 Research Institute At Nationwide Children's Hospital Compositions and methods for treating hepatic fibrosis
JP6471176B2 (en) 2014-12-27 2019-02-13 株式会社ボナック Natural miRNA for gene expression control and use thereof
SG11201705907XA (en) 2015-01-20 2017-08-30 Miragen Therapeutics Inc Mir-92 inhibitors and uses thereof
GB201504772D0 (en) * 2015-03-20 2015-05-06 Univ Aston Preeclampsia
EP3276003B1 (en) 2015-03-27 2022-07-20 Bonac Corporation Single-chain nucleic acid molecule having delivery function and gene expression control ability
WO2016157175A1 (en) 2015-03-27 2016-10-06 Yeda Research And Development Co. Ltd. Methods of treating motor neuron diseases
CN107532207B (en) 2015-04-10 2021-05-07 空间转录公司 Spatially differentiated, multiplexed nucleic acid analysis of biological samples
JPWO2016167366A1 (en) * 2015-04-17 2018-04-05 国立大学法人 東京大学 Eye disease treatment
WO2016183414A1 (en) * 2015-05-14 2016-11-17 The Arizona Board Of Regents On Behalf Of The University Of Arizona Systems and methods for characterizing granulomatous diseases
WO2016190899A1 (en) * 2015-05-23 2016-12-01 Beem Alan M H Pri-mirna libraries and methods for making and using pri-mirna libraries
US10858627B2 (en) 2015-07-30 2020-12-08 Regents Of The University Of Minnesota Regulation of mesodermal specification
WO2017027839A1 (en) 2015-08-13 2017-02-16 Somagenics, Inc. Methods and compositions of short small hairpin rnas and micrornas for wound healing
EP3337899A1 (en) * 2015-08-21 2018-06-27 Universitätsklinikum Jena Human micrornas for treatment of malignant tumours
EP3357498A4 (en) 2015-09-28 2019-05-15 National University Corporation Chiba University Method for suppressing tumors by mir-200 family inhibition
US11180810B2 (en) 2015-09-29 2021-11-23 Research Institute At Nationwide Children's Hospital Methods for detecting hepatic fibrosis and responsiveness to therapy
JP6666002B2 (en) * 2015-10-07 2020-03-13 国立大学法人京都大学 Composition for preventing or treating TDP-43 proteinenopathy
EP3387151A1 (en) * 2015-12-10 2018-10-17 Universität für Bodenkultur Wien Compositions and methods for the diagnosis and treatment of bone fractures and disorders
EP3181698A1 (en) 2015-12-16 2017-06-21 European Molecular Biology Laboratory (EMBL) Microrna mir-142 as stem cell marker
WO2017115789A1 (en) * 2015-12-28 2017-07-06 国立研究開発法人理化学研究所 Compositions for recovering or ameliorating deterioration of physiological functions due to aging
US10975436B2 (en) 2016-01-05 2021-04-13 Diamir, Llc Methods of using miRNA from bodily fluids for diagnosis and monitoring of neurodevelopmental disorders
CN105543225A (en) * 2016-01-07 2016-05-04 华东师范大学 miR143 and application of inductor LTA thereof to preparation of medicine for inhibiting acne inflammation
US10771508B2 (en) 2016-01-19 2020-09-08 Nadejda Sarmova Systems and methods for establishing a virtual shared experience for media playback
WO2017152182A1 (en) * 2016-03-04 2017-09-08 Rhode Island Hospital Targeting microrna for cancer treatment
EP3433381A4 (en) 2016-03-21 2019-10-23 Diamir, LLC Methods of using mirnas from bodily fluids for detection and differentiation of neurodegenerative diseases
US11041152B2 (en) * 2016-04-14 2021-06-22 E-Na Biotec Inc. MicroRNA-143 derivative
US11389479B2 (en) 2016-05-02 2022-07-19 University Of Massachusetts T cell differentiation and function regulation by decreasing let7 expression
WO2017210553A1 (en) * 2016-06-03 2017-12-07 Hough Ear Institute Combination therapies for inner ear sensory hair cell regeneration/replacement
JP6842779B2 (en) * 2016-10-31 2021-03-17 国立大学法人岐阜大学 Double-stranded nucleic acid molecules and their uses
AU2017353907B2 (en) 2016-11-01 2023-11-30 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer
CN107058470B (en) * 2016-11-03 2020-09-01 中国人民解放军陆军军医大学 Diagnostic kit for predicting acute mountain sickness onset risk by combining miR-136 and miR-4791
CN110177544A (en) 2016-11-29 2019-08-27 普尔泰克健康有限公司 For delivering the excretion body of therapeutic agent
EP3410680B1 (en) 2017-04-19 2020-04-01 Shenzhen Goodix Technology Co., Ltd. Light intensity detection method and device and intelligent terminal
JP7083818B2 (en) * 2017-04-28 2022-06-13 一丸ファルコス株式会社 Placenta extract
WO2018204829A1 (en) * 2017-05-04 2018-11-08 University Of Maryland, Baltimore Methods for preventing neural tube defects in diabetic pregnancy
WO2018213412A1 (en) * 2017-05-19 2018-11-22 Georgia State University Research Foundation, Inc. Recombinant oncolytic virus
KR102110103B1 (en) * 2017-06-16 2020-05-13 (주)프로스테믹스 Pharmaceutical composition for prevention or treatment of cancer
US10781487B2 (en) 2017-07-24 2020-09-22 Diamir, Llc miRNA-based methods for detecting and monitoring aging
WO2019116234A1 (en) 2017-12-12 2019-06-20 Nestec S.A. Methods for determining microbiome ribosomal rna composition changes
CA3093844A1 (en) * 2018-03-14 2019-09-19 Beth Israel Deaconess Medical Center Micro-rna and obesity
US20210023118A1 (en) * 2018-04-06 2021-01-28 University Of Massachusetts MLK-Regulated microRNAs in Angiogenesis and Tumor Development
US11519033B2 (en) 2018-08-28 2022-12-06 10X Genomics, Inc. Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample
KR102115960B1 (en) * 2018-11-28 2020-05-27 송미연 A method of differentiating human mesenchymal stem cells to thyrotropic cells
US11649485B2 (en) 2019-01-06 2023-05-16 10X Genomics, Inc. Generating capture probes for spatial analysis
US11926867B2 (en) 2019-01-06 2024-03-12 10X Genomics, Inc. Generating capture probes for spatial analysis
WO2020185781A1 (en) * 2019-03-11 2020-09-17 Ochsner Health System Microrna regulatory network as biomarkers of seizure in patients with spontaneous intracerebral hemorrhage
US20220251552A1 (en) * 2019-03-25 2022-08-11 The Trustees Of The University Of Pennsylvania Regenerative Therapy Based on miRNA-302 Mimics for Enhancing Host Recovery from Pneumonia Caused by Streptococcus pneumoniae
EP3976820A1 (en) 2019-05-30 2022-04-06 10X Genomics, Inc. Methods of detecting spatial heterogeneity of a biological sample
US10844380B1 (en) 2019-06-17 2020-11-24 Biorchestra Co., Ltd. Uses for prevention or treatment of brain diseases using microrna
US11198908B2 (en) 2019-06-17 2021-12-14 Biorchestra Co., Ltd. Method for diagnosis of Alzheimer's disease using microRNA
CN110551809A (en) * 2019-08-21 2019-12-10 昆明医科大学第一附属医院 Application of miR-124 in spinal cord injury repair
WO2021091611A1 (en) 2019-11-08 2021-05-14 10X Genomics, Inc. Spatially-tagged analyte capture agents for analyte multiplexing
WO2021092433A2 (en) 2019-11-08 2021-05-14 10X Genomics, Inc. Enhancing specificity of analyte binding
AU2020415455A1 (en) * 2019-12-23 2022-07-14 University Of Massachusetts Oligonucleotides for tissue specific gene expression modulation
SG11202106899SA (en) 2019-12-23 2021-09-29 10X Genomics Inc Methods for spatial analysis using rna-templated ligation
US11702693B2 (en) 2020-01-21 2023-07-18 10X Genomics, Inc. Methods for printing cells and generating arrays of barcoded cells
US11732299B2 (en) 2020-01-21 2023-08-22 10X Genomics, Inc. Spatial assays with perturbed cells
US11821035B1 (en) 2020-01-29 2023-11-21 10X Genomics, Inc. Compositions and methods of making gene expression libraries
US11898205B2 (en) 2020-02-03 2024-02-13 10X Genomics, Inc. Increasing capture efficiency of spatial assays
US11732300B2 (en) 2020-02-05 2023-08-22 10X Genomics, Inc. Increasing efficiency of spatial analysis in a biological sample
US11835462B2 (en) 2020-02-11 2023-12-05 10X Genomics, Inc. Methods and compositions for partitioning a biological sample
US11891654B2 (en) 2020-02-24 2024-02-06 10X Genomics, Inc. Methods of making gene expression libraries
US11926863B1 (en) 2020-02-27 2024-03-12 10X Genomics, Inc. Solid state single cell method for analyzing fixed biological cells
US11768175B1 (en) 2020-03-04 2023-09-26 10X Genomics, Inc. Electrophoretic methods for spatial analysis
US20230210883A1 (en) * 2020-03-13 2023-07-06 Duke University Compositions for the treatment of nash and associated disorders and methods of using same
EP4242325A3 (en) 2020-04-22 2023-10-04 10X Genomics, Inc. Methods for spatial analysis using targeted rna depletion
WO2021237087A1 (en) 2020-05-22 2021-11-25 10X Genomics, Inc. Spatial analysis to detect sequence variants
WO2021236929A1 (en) 2020-05-22 2021-11-25 10X Genomics, Inc. Simultaneous spatio-temporal measurement of gene expression and cellular activity
WO2021242834A1 (en) 2020-05-26 2021-12-02 10X Genomics, Inc. Method for resetting an array
WO2021247543A2 (en) 2020-06-02 2021-12-09 10X Genomics, Inc. Nucleic acid library methods
EP4158054A1 (en) 2020-06-02 2023-04-05 10X Genomics, Inc. Spatial transcriptomics for antigen-receptors
WO2021252499A1 (en) 2020-06-08 2021-12-16 10X Genomics, Inc. Methods of determining a surgical margin and methods of use thereof
WO2021252591A1 (en) 2020-06-10 2021-12-16 10X Genomics, Inc. Methods for determining a location of an analyte in a biological sample
CN116034166A (en) 2020-06-25 2023-04-28 10X基因组学有限公司 Spatial analysis of DNA methylation
US11761038B1 (en) 2020-07-06 2023-09-19 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
CN112190592B (en) * 2020-08-25 2022-03-11 苏州市立医院(北区) Application of miRNA in preparation of osteoarthritis prevention and treatment drugs, miRNA high-expression exosome and application
US11926822B1 (en) 2020-09-23 2024-03-12 10X Genomics, Inc. Three-dimensional spatial analysis
WO2022076774A2 (en) * 2020-10-08 2022-04-14 The Trustees Of Columbia University In The City Of New York Treatment and detection of liver fibrosis and liver disease using microrna
CN112375823B (en) * 2020-10-22 2022-09-16 上海交通大学医学院附属瑞金医院 Application of miRNA inhibitor in preparation of medicine for treating and/or preventing lymphoma
US11827935B1 (en) 2020-11-19 2023-11-28 10X Genomics, Inc. Methods for spatial analysis using rolling circle amplification and detection probes
AU2021409136A1 (en) 2020-12-21 2023-06-29 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
EP4301870A1 (en) 2021-03-18 2024-01-10 10X Genomics, Inc. Multiplex capture of gene and protein expression from a biological sample
WO2022272269A1 (en) * 2021-06-22 2022-12-29 The Curators Of The University Of Missouri Multianalyte biomarkers for lung cancer
WO2023034489A1 (en) 2021-09-01 2023-03-09 10X Genomics, Inc. Methods, compositions, and kits for blocking a capture probe on a spatial array
WO2023118546A2 (en) 2021-12-23 2023-06-29 Boehringer Ingelheim International Gmbh METHODS AND MOLECULES FOR RNA INTERFERENCE (RNAi)
US11541116B1 (en) 2022-01-07 2023-01-03 Kojin Therapeutics, Inc. Methods and compositions for inducing ferroptosis in vivo
KR102583230B1 (en) * 2023-03-16 2023-09-27 재단법인 전남바이오산업진흥원 Composition for preventing or treating cerebral infarction

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060058266A1 (en) * 2004-08-10 2006-03-16 Muthiah Manoharan Chemically modified oligonucleotides
US7307067B2 (en) * 2004-05-04 2007-12-11 The Board Of Trustees Of The Leland Stanford University Methods and compositions for reducing viral genome amounts in a target cell

Family Cites Families (495)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2007A (en) * 1841-03-16 Improvement in the mode of harvesting grain
US2006A (en) * 1841-03-16 Clamp for crimping leather
US1529202A (en) 1924-07-16 1925-03-10 Joseph H Miller Festooning machine for carrying paper and the like
GB1529202A (en) 1976-02-20 1978-10-18 Ciba Geigy Ag Spectral sensitising dyes
US5221619A (en) 1977-11-08 1993-06-22 Genentech, Inc. Method and means for microbial polypeptide expression
US5583013A (en) 1977-11-08 1996-12-10 Genentech, Inc. Method and means for microbial polypeptide expression
US4704362A (en) 1977-11-08 1987-11-03 Genentech, Inc. Recombinant cloning vehicle microbial polypeptide expression
JPS55116259A (en) 1979-03-01 1980-09-06 Fuji Photo Film Co Ltd Microimmunoassay method
JPS5745460A (en) 1980-09-02 1982-03-15 Fuji Photo Film Co Ltd Inspection sheet for measuring trace component and inspecting method using said sheet
EP0047472B1 (en) 1980-09-02 1985-04-24 Fuji Photo Film Co., Ltd. Method for immunochemical measurement of trace components
NL8200523A (en) 1982-02-11 1983-09-01 Univ Leiden METHOD FOR TRANSFORMING IN VITRO PLANT PROTOPLASTS WITH PLASMIDE DNA.
US4849513A (en) 1983-12-20 1989-07-18 California Institute Of Technology Deoxyribonucleoside phosphoramidites in which an aliphatic amino group is attached to the sugar ring and their use for the preparation of oligonucleotides containing aliphatic amino groups
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
DE3529478A1 (en) 1985-08-16 1987-02-19 Boehringer Mannheim Gmbh 7-DESAZA-2'DESOXYGUANOSINE NUCLEOTIDES, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE FOR NUCLEIC ACID SEQUENCING
US4682195A (en) 1985-09-30 1987-07-21 General Electric Company Insulated gate device with configured emitter contact pad
US4959463A (en) 1985-10-15 1990-09-25 Genentech, Inc. Intermediates
US4659774A (en) 1985-11-01 1987-04-21 American Hoechst Corporation Support for solid-phase oligonucleotide synthesis
US5011769A (en) * 1985-12-05 1991-04-30 Meiogenics U.S. Limited Partnership Methods for detecting nucleic acid sequences
US4876187A (en) 1985-12-05 1989-10-24 Meiogenics, Inc. Nucleic acid compositions with scissile linkage useful for detecting nucleic acid sequences
US4910300A (en) 1985-12-11 1990-03-20 Chiron Corporation Method for making nucleic acid probes
CA1284931C (en) 1986-03-13 1991-06-18 Henry A. Erlich Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids
US5268486A (en) 1986-04-18 1993-12-07 Carnegie-Mellon Unversity Method for labeling and detecting materials employing arylsulfonate cyanine dyes
EP0266032A1 (en) 1986-08-29 1988-05-04 Beecham Group Plc Modified fibrinolytic enzyme
US5525464A (en) 1987-04-01 1996-06-11 Hyseq, Inc. Method of sequencing by hybridization of oligonucleotide probes
US5202231A (en) 1987-04-01 1993-04-13 Drmanac Radoje T Method of sequencing of genomes by hybridization of oligonucleotide probes
US4816571A (en) 1987-06-04 1989-03-28 Applied Biosystems, Inc. Chemical capping by phosphitylation during oligonucleotide synthesis
GB8803000D0 (en) 1988-02-10 1988-03-09 Ekins Roger Philip Determination of ambient concentrations of several analytes
US5824311A (en) 1987-11-30 1998-10-20 Trustees Of The University Of Pennsylvania Treatment of tumors with monoclonal antibodies against oncogene antigens
US4952500A (en) 1988-02-01 1990-08-28 University Of Georgia Research Foundation, Inc. Cloning systems for Rhodococcus and related bacteria
GB8810400D0 (en) 1988-05-03 1988-06-08 Southern E Analysing polynucleotide sequences
US4999290A (en) * 1988-03-31 1991-03-12 The Board Of Regents, The University Of Texas System Detection of genomic abnormalities with unique aberrant gene transcripts
US5700637A (en) 1988-05-03 1997-12-23 Isis Innovation Limited Apparatus and method for analyzing polynucleotide sequences and method of generating oligonucleotide arrays
US5602244A (en) 1988-05-26 1997-02-11 Competitive Technologies, Inc. Polynucleotide phosphorodithioate compounds
GB8822228D0 (en) 1988-09-21 1988-10-26 Southern E M Support-bound oligonucleotides
US5708154A (en) 1989-02-24 1998-01-13 City Of Hope RNA-DNA hybrid molecules of nucleic acid
US6867195B1 (en) 1989-03-21 2005-03-15 Vical Incorporated Lipid-mediated polynucleotide administration to reduce likelihood of subject's becoming infected
US5703055A (en) 1989-03-21 1997-12-30 Wisconsin Alumni Research Foundation Generation of antibodies through lipid mediated DNA delivery
US5744101A (en) 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5143854A (en) 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
US5527681A (en) 1989-06-07 1996-06-18 Affymax Technologies N.V. Immobilized molecular synthesis of systematically substituted compounds
US5547839A (en) 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US5871928A (en) 1989-06-07 1999-02-16 Fodor; Stephen P. A. Methods for nucleic acid analysis
US5424186A (en) 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
US5242974A (en) 1991-11-22 1993-09-07 Affymax Technologies N.V. Polymer reversal on solid surfaces
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US5302523A (en) 1989-06-21 1994-04-12 Zeneca Limited Transformation of plant cells
DE3924454A1 (en) 1989-07-24 1991-02-07 Cornelis P Prof Dr Hollenberg THE APPLICATION OF DNA AND DNA TECHNOLOGY FOR THE CONSTRUCTION OF NETWORKS FOR USE IN CHIP CONSTRUCTION AND CHIP PRODUCTION (DNA CHIPS)
US5550318A (en) 1990-04-17 1996-08-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US7705215B1 (en) 1990-04-17 2010-04-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5141813A (en) 1989-08-28 1992-08-25 Clontech Laboratories, Inc. Multifunctional controlled pore glass reagent for solid phase oligonucleotide synthesis
GB8920097D0 (en) 1989-09-06 1989-10-18 Ici Plc Amplification processes
US5545522A (en) 1989-09-22 1996-08-13 Van Gelder; Russell N. Process for amplifying a target polynucleotide sequence using a single primer-promoter complex
US5366860A (en) 1989-09-29 1994-11-22 Applied Biosystems, Inc. Spectrally resolvable rhodamine dyes for nucleic acid sequence determination
US5322783A (en) 1989-10-17 1994-06-21 Pioneer Hi-Bred International, Inc. Soybean transformation by microparticle bombardment
ATE269870T1 (en) 1989-10-24 2004-07-15 Isis Pharmaceuticals Inc 2'-MODIFIED OLIGONUCLEOTIDES
US5188934A (en) * 1989-11-14 1993-02-23 Applied Biosystems, Inc. 4,7-dichlorofluorescein dyes as molecular probes
EP0430881A3 (en) 1989-11-29 1991-10-23 Ciba-Geigy Ag Photochromic compounds, process for their preparation and their use
US5486603A (en) * 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5872232A (en) 1990-01-11 1999-02-16 Isis Pharmaceuticals Inc. 2'-O-modified oligonucleotides
US6153737A (en) 1990-01-11 2000-11-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5859221A (en) 1990-01-11 1999-01-12 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5484956A (en) 1990-01-22 1996-01-16 Dekalb Genetics Corporation Fertile transgenic Zea mays plant comprising heterologous DNA encoding Bacillus thuringiensis endotoxin
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5288644A (en) 1990-04-04 1994-02-22 The Rockefeller University Instrument and method for the sequencing of genome
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
EP0544824B1 (en) 1990-07-27 1997-06-11 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5432272A (en) * 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5965364A (en) 1990-10-09 1999-10-12 Benner; Steven Albert Method for selecting functional deoxyribonucleotide derivatives
WO1992007095A1 (en) * 1990-10-15 1992-04-30 Stratagene Arbitrarily primed polymerase chain reaction method for fingerprinting genomes
US5384253A (en) 1990-12-28 1995-01-24 Dekalb Genetics Corporation Genetic transformation of maize cells by electroporation of cells pretreated with pectin degrading enzymes
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US6287792B1 (en) 1991-06-17 2001-09-11 The Regents Of The University Of California Drug delivery of antisense oligonucleotides and peptides to tissues in vivo and to cells using avidin-biotin technology
AU662906B2 (en) 1991-06-26 1995-09-21 F. Hoffmann-La Roche Ag Methods for detection of carcinoma metastases by nucleic acid amplification
US6369209B1 (en) 1999-05-03 2002-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
AU2515992A (en) 1991-08-20 1993-03-16 Genpharm International, Inc. Gene targeting in animal cells using isogenic dna constructs
US5639603A (en) 1991-09-18 1997-06-17 Affymax Technologies N.V. Synthesizing and screening molecular diversity
US5610042A (en) 1991-10-07 1997-03-11 Ciba-Geigy Corporation Methods for stable transformation of wheat
IL103674A0 (en) 1991-11-19 1993-04-04 Houston Advanced Res Center Method and apparatus for molecule detection
US5324633A (en) 1991-11-22 1994-06-28 Affymax Technologies N.V. Method and apparatus for measuring binding affinity
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
US5384261A (en) 1991-11-22 1995-01-24 Affymax Technologies N.V. Very large scale immobilized polymer synthesis using mechanically directed flow paths
US5256555A (en) * 1991-12-20 1993-10-26 Ambion, Inc. Compositions and methods for increasing the yields of in vitro RNA transcription and other polynucleotide synthetic reactions
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US5260191A (en) 1992-01-30 1993-11-09 Agracetus, Inc. Method for diagnosing tumors
US5652099A (en) 1992-02-12 1997-07-29 Conrad; Michael J. Probes comprising fluorescent nucleosides and uses thereof
ATE244259T1 (en) 1992-02-12 2003-07-15 Chromagen Inc USES OF FLUORESCENT N-NUCLEOsides and their analogues
DE4204650C1 (en) 1992-02-15 1993-07-08 Hoffmeister, Helmut, Dr., 4400 Muenster, De
DE69333650T2 (en) 1992-02-19 2006-01-12 The Public Health Research Institute Of The City Of New York, Inc. NEW ARRANGEMENT OF OLIGONUCLEOTIDES AND THEIR BENEFITS FOR SORTING, ISOLATING, SEQUENCING AND MANIPULATING NUCLEIC ACIDS
US5262311A (en) 1992-03-11 1993-11-16 Dana-Farber Cancer Institute, Inc. Methods to clone polyA mRNA
EP0592626B1 (en) 1992-03-11 2003-01-29 Dana-Farber Cancer Institute, Inc. METHODS TO CLONE mRNA
ATE173767T1 (en) 1992-04-03 1998-12-15 Perkin Elmer Corp SAMPLES COMPOSITION AND METHODS
GB9208545D0 (en) 1992-04-21 1992-06-03 Gatsby Charitable Foundation T Virus resistant plants
US5428148A (en) 1992-04-24 1995-06-27 Beckman Instruments, Inc. N4 - acylated cytidinyl compounds useful in oligonucleotide synthesis
US5591616A (en) 1992-07-07 1997-01-07 Japan Tobacco, Inc. Method for transforming monocotyledons
US5702932A (en) 1992-07-20 1997-12-30 University Of Florida Microinjection methods to transform arthropods with exogenous DNA
HUT70467A (en) 1992-07-27 1995-10-30 Pioneer Hi Bred Int An improved method of agrobactenium-mediated transformation of cultvred soyhean cells
US5438131A (en) 1992-09-16 1995-08-01 Bergstrom; Donald E. 3-nitropyrrole nucleoside
US5554501A (en) 1992-10-29 1996-09-10 Beckman Instruments, Inc. Biopolymer synthesis using surface activated biaxially oriented polypropylene
GB9222888D0 (en) 1992-10-30 1992-12-16 British Tech Group Tomography
US5503980A (en) 1992-11-06 1996-04-02 Trustees Of Boston University Positional sequencing by hybridization
US5858988A (en) 1993-02-24 1999-01-12 Wang; Jui H. Poly-substituted-phenyl-oligoribo nucleotides having enhanced stability and membrane permeability and methods of use
US5801005A (en) 1993-03-17 1998-09-01 University Of Washington Immune reactivity to HER-2/neu protein for diagnosis of malignancies in which the HER-2/neu oncogene is associated
US5580726A (en) 1994-04-29 1996-12-03 Geron Corporation Method and Kit for enhanced differential display
US5767259A (en) * 1994-12-27 1998-06-16 Naxcor Oligonucleotides containing base-free linking groups with photoactivatable side chains
US5858659A (en) 1995-11-29 1999-01-12 Affymetrix, Inc. Polymorphism detection
WO1995011995A1 (en) 1993-10-26 1995-05-04 Affymax Technologies N.V. Arrays of nucleic acid probes on biological chips
US5470710A (en) 1993-10-22 1995-11-28 University Of Utah Automated hybridization/imaging device for fluorescent multiplex DNA sequencing
US5472672A (en) 1993-10-22 1995-12-05 The Board Of Trustees Of The Leland Stanford Junior University Apparatus and method for polymer synthesis using arrays
US6045996A (en) 1993-10-26 2000-04-04 Affymetrix, Inc. Hybridization assays on oligonucleotide arrays
US5429807A (en) 1993-10-28 1995-07-04 Beckman Instruments, Inc. Method and apparatus for creating biopolymer arrays on a solid support surface
US5925517A (en) 1993-11-12 1999-07-20 The Public Health Research Institute Of The City Of New York, Inc. Detectably labeled dual conformation oligonucleotide probes, assays and kits
US5538848A (en) * 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
AU8102694A (en) 1993-11-17 1995-06-06 Id Biomedical Corporation Cycling probe cleavage detection of nucleic acid sequences
US5610287A (en) 1993-12-06 1997-03-11 Molecular Tool, Inc. Method for immobilizing nucleic acid molecules
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
GB9401833D0 (en) 1994-02-01 1994-03-30 Isis Innovation Method for discovering ligands
WO1995021944A1 (en) 1994-02-14 1995-08-17 Smithkline Beecham Corporation Differentially expressed genes in healthy and diseased subjects
DE4406524A1 (en) 1994-02-28 1995-08-31 Boehringer Mannheim Gmbh 3 'RNA tag with terminal transferase
US5844107A (en) 1994-03-23 1998-12-01 Case Western Reserve University Compacted nucleic acids and their delivery to cells
US5972901A (en) 1994-03-23 1999-10-26 Case Western Reserve University Serpin enzyme complex receptor--mediated gene transfer
US6077835A (en) 1994-03-23 2000-06-20 Case Western Reserve University Delivery of compacted nucleic acid to cells
ES2316148T3 (en) 1994-03-23 2009-04-01 Ohio University COMPACTED NUCLEIC ACIDS AND ITS SUPPLY TO CELLS.
US5571639A (en) 1994-05-24 1996-11-05 Affymax Technologies N.V. Computer-aided engineering system for design of sequence arrays and lithographic masks
US5807522A (en) 1994-06-17 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods for fabricating microarrays of biological samples
US5656610A (en) 1994-06-21 1997-08-12 University Of Southern California Producing a protein in a mammal by injection of a DNA-sequence into the tongue
US6146886A (en) 1994-08-19 2000-11-14 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
GB9506466D0 (en) 1994-08-26 1995-05-17 Prolifix Ltd Cell cycle regulated repressor and dna element
US5574146A (en) 1994-08-30 1996-11-12 Beckman Instruments, Inc. Oligonucleotide synthesis with substituted aryl carboxylic acids as activators
US5554744A (en) 1994-09-23 1996-09-10 Hybridon, Inc. Method for loading solid supports for nucleic acid synthesis
US6096314A (en) 1994-10-07 2000-08-01 Yeda Research And Development Co. Ltd. Peptides and pharmaceutical compositions comprising them
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
US5556752A (en) 1994-10-24 1996-09-17 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
WO1997027317A1 (en) 1996-01-23 1997-07-31 Affymetrix, Inc. Nucleic acid analysis techniques
US5736524A (en) 1994-11-14 1998-04-07 Merck & Co.,. Inc. Polynucleotide tuberculosis vaccine
US5830645A (en) 1994-12-09 1998-11-03 The Regents Of The University Of California Comparative fluorescence hybridization to nucleic acid arrays
US5599695A (en) 1995-02-27 1997-02-04 Affymetrix, Inc. Printing molecular library arrays using deprotection agents solely in the vapor phase
ATE397097T1 (en) * 1995-03-17 2008-06-15 Wayne John Cancer Inst DETECTION OF BREAST METASTASIS USING A MULTIPLE MARKER TEST
US5801155A (en) * 1995-04-03 1998-09-01 Epoch Pharmaceuticals, Inc. Covalently linked oligonucleotide minor grove binder conjugates
GB9507238D0 (en) 1995-04-07 1995-05-31 Isis Innovation Detecting dna sequence variations
US5624711A (en) 1995-04-27 1997-04-29 Affymax Technologies, N.V. Derivatization of solid supports and methods for oligomer synthesis
DE19518505A1 (en) 1995-05-19 1996-11-21 Max Planck Gesellschaft Procedure for gene expression analysis
US5545531A (en) 1995-06-07 1996-08-13 Affymax Technologies N.V. Methods for making a device for concurrently processing multiple biological chip assays
EP1489184A1 (en) 1995-06-07 2004-12-22 Inex Pharmaceutical Corp. Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5981501A (en) 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US6111095A (en) 1995-06-07 2000-08-29 Merck & Co., Inc. Capped synthetic RNA, analogs, and aptamers
US6998268B2 (en) 1995-07-03 2006-02-14 Dainippon Sumitomo Pharma Co. Ltd. Gene preparations
US5637683A (en) 1995-07-13 1997-06-10 Cornell Research Foundation, Inc. Nucleic acid analog with amide linkage and method of making that analog
US5661028A (en) 1995-09-29 1997-08-26 Lockheed Martin Energy Systems, Inc. Large scale DNA microsequencing device
US5658734A (en) 1995-10-17 1997-08-19 International Business Machines Corporation Process for synthesizing chemical compounds
US5705629A (en) 1995-10-20 1998-01-06 Hybridon, Inc. Methods for H-phosphonate synthesis of mono- and oligonucleotides
US5871697A (en) * 1995-10-24 1999-02-16 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US6418382B2 (en) * 1995-10-24 2002-07-09 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US20040142895A1 (en) 1995-10-26 2004-07-22 Sirna Therapeutics, Inc. Nucleic acid-based modulation of gene expression in the vascular endothelial growth factor pathway
US5780448A (en) 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
US5998203A (en) * 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
EP0880598A4 (en) * 1996-01-23 2005-02-23 Affymetrix Inc Nucleic acid analysis techniques
US5837196A (en) 1996-01-26 1998-11-17 The Regents Of The University Of California High density array fabrication and readout method for a fiber optic biosensor
US5670663A (en) 1996-02-14 1997-09-23 Regents Of The University Of California Recovery of taxanes from conifers
US6020481A (en) * 1996-04-01 2000-02-01 The Perkin-Elmer Corporation Asymmetric benzoxanthene dyes
US6458530B1 (en) 1996-04-04 2002-10-01 Affymetrix Inc. Selecting tag nucleic acids
DE69738687D1 (en) 1996-04-12 2008-06-26 Phri Properties Inc PROBES, KITS AND ASSAYS
US5863727A (en) * 1996-05-03 1999-01-26 The Perkin-Elmer Corporation Energy transfer dyes with enhanced fluorescence
US5800996A (en) 1996-05-03 1998-09-01 The Perkin Elmer Corporation Energy transfer dyes with enchanced fluorescence
US5847162A (en) 1996-06-27 1998-12-08 The Perkin Elmer Corporation 4, 7-Dichlororhodamine dyes
US5945526A (en) 1996-05-03 1999-08-31 Perkin-Elmer Corporation Energy transfer dyes with enhanced fluorescence
US6184037B1 (en) 1996-05-17 2001-02-06 Genemedicine, Inc. Chitosan related compositions and methods for delivery of nucleic acids and oligonucleotides into a cell
SE506700C2 (en) 1996-05-31 1998-02-02 Mikael Kubista Probe and Methods for Analysis of Nucleic Acid
US5739169A (en) * 1996-05-31 1998-04-14 Procept, Incorporated Aromatic compounds for inhibiting immune response
EP0912766B2 (en) * 1996-06-04 2011-12-14 University of Utah Research Foundation Monitoring hybridization during pcr
US5898031A (en) * 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US5945100A (en) 1996-07-31 1999-08-31 Fbp Corporation Tumor delivery vehicles
US6770291B2 (en) 1996-08-30 2004-08-03 The United States Of America As Represented By The Department Of Health And Human Services Liposome complexes for increased systemic delivery
GB9618050D0 (en) 1996-08-29 1996-10-09 Cancer Res Campaign Tech Global amplification of nucleic acids
US5981274A (en) 1996-09-18 1999-11-09 Tyrrell; D. Lorne J. Recombinant hepatitis virus vectors
US5886165A (en) 1996-09-24 1999-03-23 Hybridon, Inc. Mixed backbone antisense oligonucleotides containing 2'-5'-ribonucleotide- and 3'-5'-deoxyribonucleotides segments
EP0981614B1 (en) 1997-03-07 2009-08-05 Siemens Healthcare Diagnostics Inc. Prostate cancer-specific marker
CN1226930A (en) 1997-03-10 1999-08-25 日本烟草产业株式会社 Antisense base sequences
US6251666B1 (en) 1997-03-31 2001-06-26 Ribozyme Pharmaceuticals, Inc. Nucleic acid catalysts comprising L-nucleotide analogs
US6090556A (en) 1997-04-07 2000-07-18 Japan Science & Technology Corporation Method for quantitatively determining the expression of a gene
NO972006D0 (en) 1997-04-30 1997-04-30 Forskningsparken I Aas As New method for diagnosis of diseases
JP4656675B2 (en) 1997-05-14 2011-03-23 ユニバーシティー オブ ブリティッシュ コロンビア High rate encapsulation of charged therapeutic agents in lipid vesicles
US6262252B1 (en) 1997-05-19 2001-07-17 Mirus, Inc. Single-step method for labeling nucleic acids with mustard or aziridine labeling reagents
US5919626A (en) 1997-06-06 1999-07-06 Orchid Bio Computer, Inc. Attachment of unmodified nucleic acids to silanized solid phase surfaces
US6368799B1 (en) 1997-06-13 2002-04-09 Affymetrix, Inc. Method to detect gene polymorphisms and monitor allelic expression employing a probe array
US6008379A (en) 1997-10-01 1999-12-28 The Perkin-Elmer Corporation Aromatic-substituted xanthene dyes
US5994624A (en) 1997-10-20 1999-11-30 Cotton Incorporated In planta method for the production of transgenic plants
US6485901B1 (en) 1997-10-27 2002-11-26 Boston Probes, Inc. Methods, kits and compositions pertaining to linear beacons
ATE478090T1 (en) * 1997-10-27 2010-09-15 Boston Probes Inc METHODS, TEST SETS AND COMPOSITIONS RELATED TO ßPNA MOLECULAR BEACONSß
EP1032705B1 (en) 1997-10-30 2011-12-14 Cold Spring Harbor Laboratory Probe arrays and methods of using probe arrays for distinguishing dna
US5936087A (en) 1997-11-25 1999-08-10 The Perkin-Elmer Corporation Dibenzorhodamine dyes
US6232066B1 (en) * 1997-12-19 2001-05-15 Neogen, Inc. High throughput assay system
US6458533B1 (en) 1997-12-19 2002-10-01 High Throughput Genomics, Inc. High throughput assay system for monitoring ESTs
US6238869B1 (en) * 1997-12-19 2001-05-29 High Throughput Genomics, Inc. High throughput assay system
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6121058A (en) 1998-01-02 2000-09-19 Intel Corporation Method for removing accumulated solder from probe card probing features
US6087102A (en) 1998-01-07 2000-07-11 Clontech Laboratories, Inc. Polymeric arrays and methods for their use in binding assays
US6269846B1 (en) 1998-01-13 2001-08-07 Genetic Microsystems, Inc. Depositing fluid specimens on substrates, resulting ordered arrays, techniques for deposition of arrays
US5942398A (en) 1998-02-26 1999-08-24 Millennium Pharmaceuticals, Inc. Nucleic acid molecules encoding glutx and uses thereof
AUPP249298A0 (en) 1998-03-20 1998-04-23 Ag-Gene Australia Limited Synthetic genes and genetic constructs comprising same I
US6004755A (en) 1998-04-07 1999-12-21 Incyte Pharmaceuticals, Inc. Quantitative microarray hybridizaton assays
AU3751299A (en) 1998-04-20 1999-11-08 Ribozyme Pharmaceuticals, Inc. Nucleic acid molecules with novel chemical compositions capable of modulating gene expression
US6037129A (en) * 1998-05-28 2000-03-14 Medical University Of South Carolina Multi-marker RT-PCR panel for detecting metastatic breast cancer
FR2780059B1 (en) 1998-06-17 2002-10-11 Bio Merieux METHOD FOR LABELING A RIBONUCLEIC ACID AND BRANDED RNA FRAGMENTS THUS OBTAINED
US6576420B1 (en) 1998-06-23 2003-06-10 Regents Of The University Of California Method for early diagnosis of, and determination of prognosis in, cancer
GB9815799D0 (en) 1998-07-21 1998-09-16 Pharmagene Lab Limited Quantitative analysis of gene expression
US6730477B1 (en) * 1998-08-04 2004-05-04 Diadexus, Inc. Method of diagnosing, monitoring and staging breast cancer
US6140054A (en) 1998-09-30 2000-10-31 University Of Utah Research Foundation Multiplex genotyping using fluorescent hybridization probes
EP1124990B1 (en) 1998-10-27 2006-01-18 Affymetrix, Inc. Complexity management and analysis of genomic dna
DE19956568A1 (en) 1999-01-30 2000-08-17 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
GB9904991D0 (en) * 1999-03-05 1999-04-28 Univ Nottingham Genetic screening
WO2000056748A1 (en) 1999-03-18 2000-09-28 Exiqon A/S Xylo-lna analogues
US6383752B1 (en) * 1999-03-31 2002-05-07 Hybridon, Inc. Pseudo-cyclic oligonucleobases
US6103576A (en) * 1999-04-13 2000-08-15 Microchip Technology Incorporated Dielectric layer of a memory cell having a stacked oxide sidewall and method of fabricating same
CA2372085C (en) 1999-05-04 2009-10-27 Exiqon A/S L-ribo-lna analogues
US6638717B2 (en) 1999-05-19 2003-10-28 Aventis Pharmaceuticals, Inc. Microarray-based subtractive hybridzation
WO2000071096A2 (en) 1999-05-24 2000-11-30 Introgen Therapeutics, Inc. Methods and compositions for non-viral gene therapy for treatment of hyperproliferative diseases
US6132997A (en) 1999-05-28 2000-10-17 Agilent Technologies Method for linear mRNA amplification
IL146872A0 (en) 1999-06-03 2002-08-14 Methods and compositions for modulating cell proliferation and cell death
AU4332399A (en) 1999-06-04 2000-12-28 Cheng-Ming Chuong Rna polymerase chain reaction
US6964847B1 (en) 1999-07-14 2005-11-15 Packard Biosciences Company Derivative nucleic acids and uses thereof
US6201112B1 (en) 1999-07-22 2001-03-13 Agilent Technologies Inc. Method for 3′ end-labeling ribonucleic acids
US7005261B1 (en) * 1999-07-29 2006-02-28 British Biocell International Limited Method for detecting nucleic acid target sequences involving in vitro transcription from an RNA polymerase promoter
US6140500A (en) 1999-09-03 2000-10-31 Pe Corporation Red-emitting [8,9]benzophenoxazine nucleic acid dyes and methods for their use
US6511832B1 (en) * 1999-10-06 2003-01-28 Texas A&M University System In vitro synthesis of capped and polyadenylated mRNAs using baculovirus RNA polymerase
US20020094546A1 (en) 1999-10-07 2002-07-18 Shimkets Richard A. Growth factor polypeptides and nucleic acids encoding same
AU1086501A (en) 1999-10-15 2001-04-30 Carnegie Institution Of Washington Rna interference pathway genes as tools for targeted genetic interference
US6528254B1 (en) * 1999-10-29 2003-03-04 Stratagene Methods for detection of a target nucleic acid sequence
US6191278B1 (en) * 1999-11-03 2001-02-20 Pe Corporation Water-soluble rhodamine dyes and conjugates thereof
US6458382B1 (en) 1999-11-12 2002-10-01 Mirus Corporation Nucleic acid transfer complexes
US6435245B1 (en) 1999-11-18 2002-08-20 Pitney Bowes Inc. System for folding and tabbing sheets
GB9927444D0 (en) 1999-11-19 2000-01-19 Cancer Res Campaign Tech Inhibiting gene expression
DE10100586C1 (en) 2001-01-09 2002-04-11 Ribopharma Ag Inhibiting gene expression in cells, useful for e.g. treating tumors, by introducing double-stranded complementary oligoRNA having unpaired terminal bases
DE10160151A1 (en) 2001-01-09 2003-06-26 Ribopharma Ag Inhibiting expression of target gene, useful e.g. for inhibiting oncogenes, by administering double-stranded RNA complementary to the target and having an overhang
WO2001038580A2 (en) 1999-11-26 2001-05-31 Curagen Corporation Nucleic acid probe arrays
US6383749B2 (en) 1999-12-02 2002-05-07 Clontech Laboratories, Inc. Methods of labeling nucleic acids for use in array based hybridization assays
US7205105B2 (en) * 1999-12-08 2007-04-17 Epoch Biosciences, Inc. Real-time linear detection probes: sensitive 5′-minor groove binder-containing probes for PCR analysis
US6618679B2 (en) 2000-01-28 2003-09-09 Althea Technologies, Inc. Methods for analysis of gene expression
US20070026394A1 (en) 2000-02-11 2007-02-01 Lawrence Blatt Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies
US8202979B2 (en) 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US20020065406A1 (en) 2000-03-24 2002-05-30 Meyers Rachel A. 18221, a novel dual specificity phosphatase and uses thereof
US6447723B1 (en) 2000-03-13 2002-09-10 Packard Instrument Company, Inc. Microarray spotting instruments incorporating sensors and methods of using sensors for improving performance of microarray spotting instruments
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
US20020037540A1 (en) 2000-03-23 2002-03-28 Shujath Ali Compositions and methods of diagnosing, monitoring, staging, imaging and treating prostate cancer
EP1278766A2 (en) 2000-03-27 2003-01-29 Diadexus, Inc. Polynucleotides for diagnosing mammary gland cancer
US20020065396A1 (en) 2000-03-28 2002-05-30 Fei Yang Compositions and methods of diagnosing, monitoring, staging, imaging and treating colon cancer
WO2001072775A2 (en) 2000-03-29 2001-10-04 Diadexus, Inc. Polynucleotides and polypeptides as well as methods for diagnosing and treating lung cancer
CA2404890C (en) * 2000-03-30 2013-11-19 Whitehead Institute For Biomedical Research Rna sequence-specific mediators of rna interference
US20020068307A1 (en) 2000-03-30 2002-06-06 Jason Pluta Compositions and methods for diagnosing, monitoring, staging, imaging and treating stomach cancer
US6573048B1 (en) * 2000-04-18 2003-06-03 Naxcor Degradable nucleic acid probes and nucleic acid detection methods
MXPA02011093A (en) 2000-05-10 2004-08-19 David A Sirbasku Compositions and methods for the diagnosis, treatment and prevention of steroid hormone responsive cancers.
US20020042388A1 (en) 2001-05-01 2002-04-11 Cooper Mark J. Lyophilizable and enhanced compacted nucleic acids
EP1289565B1 (en) 2000-06-02 2015-04-22 Bracco Suisse SA Compounds for targeting endothelial cells
CA2414396A1 (en) 2000-06-26 2002-01-03 The United States Of America, As Represented By The Secretary Of Agricul Ture Production of vaccines using transgenic plants
WO2002000926A2 (en) 2000-06-30 2002-01-03 Epigenomics Ag Diagnosis of diseases associated with signal transduction
US6596490B2 (en) * 2000-07-14 2003-07-22 Applied Gene Technologies, Inc. Nucleic acid hairpin probes and uses thereof
AU8395501A (en) 2000-07-31 2002-02-13 Hoffmann La Roche Piperazine derivatives
US6797471B2 (en) 2000-08-04 2004-09-28 Board Of Regents, The University Of Texas System Detection and diagnosis of smoking related cancers
JP2002067789A (en) * 2000-09-05 2002-03-08 Yazaki Corp Electric wire connecting structure of lamp unit
WO2002024718A1 (en) 2000-09-19 2002-03-28 Diadexus, Inc. Compositions and methods relating to prostate specific genes and proteins
US20030082604A1 (en) 2000-09-27 2003-05-01 Swanson Melvin J. High density arrays
US6350580B1 (en) * 2000-10-11 2002-02-26 Stratagene Methods for detection of a target nucleic acid using a probe comprising secondary structure
US6617112B2 (en) 2000-10-11 2003-09-09 Monsanto Technology Llc Methods for gene array analysis of nuclear runoff transcripts
US7162371B1 (en) 2000-10-11 2007-01-09 Georgia Tech Research Corporation Differentially-expressed conifer cDNAs, and their use in improving somatic embryogenesis
US20020150626A1 (en) 2000-10-16 2002-10-17 Kohane Daniel S. Lipid-protein-sugar particles for delivery of nucleic acids
AU2002243429A1 (en) * 2000-10-24 2002-06-24 Isis Pharmaceuticals, Inc. Antisense modulation of tnfr1 expression
US7001724B1 (en) * 2000-11-28 2006-02-21 Applera Corporation Compositions, methods, and kits for isolating nucleic acids using surfactants and proteases
GB0029360D0 (en) 2000-12-01 2001-01-17 Univ Nottingham Humanised antibodies and uses thereof
BRPI0115814B8 (en) 2000-12-01 2021-05-25 Europaeisches Laboratorium Fuer Molekularbiologie Embl double-stranded RNA molecules, their method of preparation and pharmaceutical composition comprising them
US6967016B2 (en) 2000-12-04 2005-11-22 Primagen Holding B.V. Method of determining therapeutic activity and/or possible side-effects of a medicament
US20030099976A1 (en) 2001-01-17 2003-05-29 Tai-Jay Chang Androgen receptor complex-associated protein
WO2002057496A2 (en) 2001-01-18 2002-07-25 Socratech L.L.C. Gene expression profiling of endothelium in alzheimer's disease
US7015047B2 (en) * 2001-01-26 2006-03-21 Aviva Biosciences Corporation Microdevices having a preferential axis of magnetization and uses thereof
WO2002064835A2 (en) 2001-01-31 2002-08-22 Ambion, Inc. Methods for nucleic acid fingerprint analysis
US20040058373A1 (en) * 2001-01-31 2004-03-25 Winkler Matthew M. Competitive amplification of fractionated targets from multiple nucleic acid samples
US20040110191A1 (en) * 2001-01-31 2004-06-10 Winkler Matthew M. Comparative analysis of nucleic acids using population tagging
WO2002073504A1 (en) 2001-03-14 2002-09-19 Gene Logic, Inc. A system and method for retrieving and using gene expression data from multiple sources
US20030170623A1 (en) 2001-04-13 2003-09-11 Jingwen Chen Multiplexed gene analysis on a mobile solid support
WO2002086071A2 (en) 2001-04-20 2002-10-31 Ludwig Institute For Cancer Research Cancer-testis antigens
AU2002311869A1 (en) 2001-04-27 2002-11-11 Sunnybrook And Women's College Health Sciences Centre Breast cancer-associated genes and uses thereof
AU2002256398A2 (en) 2001-04-30 2002-11-11 Targeted Genetics Corporation Lipid-comprising drug delivery complexes and methods for their production
AUPR480901A0 (en) 2001-05-04 2001-05-31 Genomics Research Partners Pty Ltd Diagnostic method for assessing a condition of a performance animal
US20040209832A1 (en) 2001-11-30 2004-10-21 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
WO2003070917A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc. Rna interference mediated inhibition of myc and myb genes or genes of their respective pathways
JP2004529440A (en) 2001-06-01 2004-09-24 プロサノス コーポレイション Information processing method for stratifying diseases and judging disease progress
US7171311B2 (en) * 2001-06-18 2007-01-30 Rosetta Inpharmatics Llc Methods of assigning treatment to breast cancer patients
US20040086504A1 (en) 2001-06-21 2004-05-06 Deepak Sampath Cyr61 as a target for treatment and diagnosis of breast cancer
WO2003001335A2 (en) 2001-06-22 2003-01-03 Gene Logic, Inc. Platform for management and mining of genomic data
AU2002346008A1 (en) 2001-06-28 2003-03-03 Dermtech International Method for detection of melanoma
CA2452196A1 (en) 2001-06-29 2003-01-09 The Board Of Trustees Of The Leland Stanford Junior University T cell regulatory genes and methods of use thereof
WO2003087297A2 (en) 2001-08-08 2003-10-23 North Carolina State University Infectious disease microarray
AU2002331777A1 (en) 2001-08-30 2003-03-18 Spectral Genomics, Inc. Arrays comprising pre-labeled biological molecules and methods for making and using these arrays
US20030198627A1 (en) * 2001-09-01 2003-10-23 Gert-Jan Arts siRNA knockout assay method and constructs
AU2002339865A1 (en) 2001-09-05 2003-03-18 The Children's Hospital Of Philadelphia Methods and compositions useful for diagnosis, staging, and treatment of cancers and tumors
US20040241696A1 (en) 2001-09-06 2004-12-02 Peinado Miguel A Genetic analysis of biological samples in arrayed expanded representations of their nucleic acids
JP2005528582A (en) 2001-09-07 2005-09-22 コーニング インコーポレイテッド Array based on a microcolumn platform for high-throughput analysis
DE60234369D1 (en) * 2001-09-19 2009-12-24 Alexion Pharma Inc MANIPULATED MATRICES AND THEIR USE IN SINGLE PRIMER AMPLIFICATION
AU2002305767B2 (en) * 2001-09-20 2008-04-10 Cornell Research Foundation, Inc. Methods and compositions for treating and preventing skin disorders using binding agents specific for PSMA
US6593091B2 (en) * 2001-09-24 2003-07-15 Beckman Coulter, Inc. Oligonucleotide probes for detecting nucleic acids through changes in flourescence resonance energy transfer
EP2386637B1 (en) * 2001-09-28 2018-05-16 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Microrna molecules
WO2003029485A2 (en) 2001-10-02 2003-04-10 Azign Bioscience A/S Specific differential display arrays
CA2463725A1 (en) 2001-10-12 2003-11-06 Spectral Genomics, Inc. Compilations of nucleic acids and arrays and methods of using them
US20040063654A1 (en) * 2001-11-02 2004-04-01 Davis Mark E. Methods and compositions for therapeutic use of RNA interference
IL161733A0 (en) 2001-11-02 2005-11-20 Insert Therapeutics Inc Methods and compositions for therapeutic use of rna interference
US20030087298A1 (en) 2001-11-02 2003-05-08 Roland Green Detection of hybridization on oligonucleotide microarray through covalently labeling microarray probe
US20050095646A1 (en) 2001-11-19 2005-05-05 Sherman Michael I. Method of using a non-antibody protein to detect and measure an analyte
CN1927466A (en) 2001-12-19 2007-03-14 阿菲梅特里克斯公司 Array plate and manufacturing process for array plate assembly
AU2002360773A1 (en) * 2001-12-27 2003-07-24 Agy Therapeutics, Inc. Use of biomolecular targets in the treatment and visualization of tumors
US7141372B2 (en) 2002-01-18 2006-11-28 Health Research Incorporated Universal RT-coupled PCR method for the specific amplification of mRNA
EP1470254A2 (en) 2002-01-30 2004-10-27 Epigenomics AG Method for the analysis of cytosine methylation patterns
US20030148362A1 (en) 2002-02-07 2003-08-07 Eastern Virginia Medical School Of The Medical College Of Hampton Roads Diagnostic microarray and method of use thereof
US20030232356A1 (en) 2002-02-08 2003-12-18 Dooley Thomas P. Skin cell biomarkers and methods for identifying biomarkers using nucleic acid microarrays
AU2003213786A1 (en) 2002-03-07 2003-09-22 University Of Utah Research Foundation Methods for identifying large subsets of differentially expressed genes based on multivariate microarray data analysis
US20040001841A1 (en) 2002-04-03 2004-01-01 Usha Nagavarapu Use of biomolecular targets in the treatment and visualization of brain tumors
US20070025997A1 (en) 2002-04-03 2007-02-01 Usha Nagavarapu Use of biomolecular targets in the treatment and visualization of brain tumors
AU2003245269A1 (en) 2002-05-03 2003-11-17 Vialogy Corporation System and method for characterizing microarray output data
CA2524569C (en) 2002-05-03 2013-10-22 Duke University A method of regulating gene expression
JP2005526522A (en) 2002-05-20 2005-09-08 ノースロップ グラマン コーポレーション Point source biological material detection system
ATE513923T1 (en) 2002-05-24 2011-07-15 Roche Nimblegen Inc MICROARRAYS AND METHOD FOR PERFORMING A HYBRIDIZATION REACTION FOR MULTIPLE SAMPLES ON A SINGLE MICROARRAY
AUPS261402A0 (en) 2002-05-28 2002-06-20 Compusign Pty Ltd Array monitoring
US20030228579A1 (en) 2002-06-05 2003-12-11 Uri Alon Ordering genes by analysis of expression kinetics
SI3222724T1 (en) 2002-08-05 2019-03-29 Silence Therapeutics Gmbh Further novel forms of interfering rna molecules
US8729036B2 (en) * 2002-08-07 2014-05-20 University Of Massachusetts Compositions for RNA interference and methods of use thereof
US20040029128A1 (en) 2002-08-08 2004-02-12 Epigenomics, Inc. Methods and nucleic acids for the analysis of CpG dinucleotide methylation status associated with the calcitonin gene
US20040029121A1 (en) 2002-08-08 2004-02-12 Susan Cottrell Methods and nucleic acids for the analysis of CpG dinucleotide methylation status associated with the calcitonin gene
AU2003268105B2 (en) 2002-08-16 2011-11-03 John Wayne Cancer Institute Molecular lymphatic mapping of sentinel lymph nodes
WO2004025556A2 (en) 2002-09-12 2004-03-25 Baylor College Of Medecine System and method for image segmentation
AU2003267583A1 (en) 2002-09-19 2004-04-08 The Chancellor, Master And Scholars Of The University Of Oxford Molecular arrays and single molecule detection
WO2004029212A2 (en) 2002-09-25 2004-04-08 University Of Massachusetts In vivo gene silencing by chemically modified and stable sirna
JP4443418B2 (en) 2002-11-01 2010-03-31 ザ リサーチ ファウンデーション オブ ステイト ユニバーシティ オブ ニューヨーク Atypical protein kinase C isoforms in nervous system diseases and cancer
EP1418241A1 (en) 2002-11-08 2004-05-12 PrimaGen Holding B.V. Method for quantifying a ratio between at least two nucleic acid sequences
AU2003291433B2 (en) 2002-11-13 2008-05-22 Thomas Jefferson University Compositions and methods for cancer diagnosis and therapy
US7655785B1 (en) 2002-11-14 2010-02-02 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
US7250496B2 (en) * 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US20040175732A1 (en) 2002-11-15 2004-09-09 Rana Tariq M. Identification of micrornas and their targets
AU2003295539A1 (en) 2002-11-15 2004-06-15 University Of Massachusetts Allele-targeted rna interference
AU2003262277A1 (en) 2002-12-03 2004-06-23 Koken Co., Ltd. Inhibitor of proliferation and/or infiltration of tumor cells
US7851150B2 (en) * 2002-12-18 2010-12-14 Third Wave Technologies, Inc. Detection of small nucleic acids
ATE525469T1 (en) * 2002-12-18 2011-10-15 Third Wave Tech Inc DETECTION OF SMALL NUCLEIC ACIDS
CN101061236A (en) 2003-01-13 2007-10-24 艾默瑞大学 Methods of detecting gene expression in normal and cancerous cells
US7994388B2 (en) 2003-01-16 2011-08-09 North Carolina State University Depletion of endogenous primordial germ cells in avian species
WO2004066183A2 (en) * 2003-01-22 2004-08-05 European Molecular Biology Laboratory Microrna
US20040147027A1 (en) * 2003-01-28 2004-07-29 Troy Carol M. Complex for facilitating delivery of dsRNA into a cell and uses thereof
KR20050115231A (en) 2003-02-10 2005-12-07 내셔날 인스티튜트 오브 어드밴스드 인더스트리얼 사이언스 앤드 테크놀로지 Regulation of mammalian cells
US7816337B2 (en) 2003-02-18 2010-10-19 Roche Madison Inc. Reversible attachment of a membrane active polymer to a polynucleotide
US20040224337A1 (en) 2003-03-04 2004-11-11 Erik Foehr Use of biomolecular targets in the treatment and visualization of tumors
WO2004078941A2 (en) 2003-03-06 2004-09-16 Oligo Engine, Inc. Modulation of gene expression using dna-rna hybrids
WO2004090108A2 (en) * 2003-04-03 2004-10-21 Alnylam Pharmaceuticals Irna conjugates
US20050112604A1 (en) 2003-03-14 2005-05-26 Akihide Fujimoto Loss of heterozygosity of the DNA markers in the 12q22-23 region
WO2004086949A2 (en) 2003-03-25 2004-10-14 John Wayne Cancer Institute Dna markers for management of cancer
JP4605799B2 (en) * 2003-04-02 2011-01-05 ダーマコン, インコーポレイテッド Modified polynucleotides for use in RNA interference
US20040198640A1 (en) 2003-04-02 2004-10-07 Dharmacon, Inc. Stabilized polynucleotides for use in RNA interference
US20040229211A1 (en) 2003-05-13 2004-11-18 Yeung Wah Hin Alex Sensitive diagnostic testing methodology using multiplex real time PCR with one dye (MOD) and its use as in severe acute respiratory syndrome (SARS)
US7640114B2 (en) 2003-05-21 2009-12-29 The Wistar Institute Of Anatomy & Biology Method of diagnosis of cancer based on gene expression profiles in cells
US7750144B2 (en) 2003-06-02 2010-07-06 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
WO2005001043A2 (en) 2003-06-02 2005-01-06 University Of Massachusetts METHODS AND COMPOSITIONS FOR ENHANCING THE EFFICACY AND SPECIFICITY OF FNAi
DK1633767T3 (en) 2003-06-02 2019-03-25 Univ Massachusetts METHODS AND COMPOSITIONS FOR MANAGING THE EFFECT OF RNA SILENCING
US20050059024A1 (en) 2003-07-25 2005-03-17 Ambion, Inc. Methods and compositions for isolating small RNA molecules
US7683036B2 (en) 2003-07-31 2010-03-23 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US8106180B2 (en) * 2003-08-07 2012-01-31 Whitehead Institute For Biomedical Research Methods and products for expression of micro RNAs
US20050037362A1 (en) 2003-08-11 2005-02-17 Eppendorf Array Technologies, S.A. Detection and quantification of siRNA on microarrays
US20060183128A1 (en) 2003-08-12 2006-08-17 Epigenomics Ag Methods and compositions for differentiating tissues for cell types using epigenetic markers
WO2005017145A1 (en) 2003-08-13 2005-02-24 Japan Biological Informatics Consortium Method of identifying or presuming gene under regulation regulated by functional rna and method of using the same
KR20060125743A (en) 2003-11-10 2006-12-06 녹손 파르마 아게 Nucleic acids specifically binding bioactive ghrelin
US20050130172A1 (en) 2003-12-16 2005-06-16 Bayer Corporation Identification and verification of methylation marker sequences
US20050130170A1 (en) 2003-12-16 2005-06-16 Jeanne Harvey Identification and verification of methylation marker sequences
EP2295604B1 (en) 2004-02-09 2015-04-08 Thomas Jefferson University Diagnosis and treatment of cancers with microRNA located in or near cancer-associated chromosomal features
US20050182005A1 (en) 2004-02-13 2005-08-18 Tuschl Thomas H. Anti-microRNA oligonucleotide molecules
CA2556435C (en) * 2004-02-13 2014-08-12 The Rockefeller University Anti-microrna oligonucleotide molecules
KR100522307B1 (en) * 2004-02-19 2005-10-19 변영철 Cosmetics brush
US7402389B2 (en) 2004-02-24 2008-07-22 The Translational Genomics Research Institute (Tgen) Compositions and methods for prognosis of cancers
US20060195266A1 (en) 2005-02-25 2006-08-31 Yeatman Timothy J Methods for predicting cancer outcome and gene signatures for use therein
EP1732650A4 (en) * 2004-03-27 2008-06-11 Univ Arizona Composition and method for cancer treatment
US20060134639A1 (en) * 2004-04-06 2006-06-22 Huffel Christophe V Method for the determination of cellular transcriptional regulation
US7365058B2 (en) * 2004-04-13 2008-04-29 The Rockefeller University MicroRNA and methods for inhibiting same
CA2585525A1 (en) 2004-04-20 2005-11-03 Genaco Biomedical Products, Inc. Method for detecting ncrna
EP1784501B1 (en) * 2004-05-14 2015-11-18 Rosetta Genomics Ltd VIRAL AND VIRUS ASSOCIATED MicroRNAS AND USES THEREOF
US20080293581A1 (en) 2004-05-24 2008-11-27 Rogler Charles E Rna Expression Microarrays
US7575863B2 (en) 2004-05-28 2009-08-18 Applied Biosystems, Llc Methods, compositions, and kits comprising linker probes for quantifying polynucleotides
AU2005250432B2 (en) 2004-05-28 2011-09-15 Asuragen, Inc. Methods and compositions involving microRNA
US20050287539A1 (en) 2004-06-29 2005-12-29 Emmanuel Labourier Methods and compositions for preparing capped RNA
EP1828215A2 (en) 2004-07-21 2007-09-05 Alnylam Pharmaceuticals Inc. Oligonucleotides comprising a modified or non-natural nucleobase
EP2298897B1 (en) 2004-09-02 2013-08-14 Yale University Regulation of oncogenes by microRNAs
US20060057595A1 (en) 2004-09-16 2006-03-16 Applera Corporation Compositions, methods, and kits for identifying and quantitating small RNA molecules
US7642348B2 (en) 2004-10-04 2010-01-05 Rosetta Genomics Ltd Prostate cancer-related nucleic acids
US7592441B2 (en) 2004-10-04 2009-09-22 Rosetta Genomics Ltd Liver cancer-related nucleic acids
US7825229B2 (en) 2005-03-25 2010-11-02 Rosetta Genomics Ltd. Lung cancer-related nucleic acids
US20090186353A1 (en) 2004-10-04 2009-07-23 Rosetta Genomics Ltd. Cancer-related nucleic acids
US20060134661A1 (en) 2004-10-12 2006-06-22 Richard Essner Treatment of cancer and compositions
US20060078894A1 (en) * 2004-10-12 2006-04-13 Winkler Matthew M Methods and compositions for analyzing nucleic acids
FR2877350B1 (en) * 2004-11-03 2010-08-27 Centre Nat Rech Scient IDENTIFICATION AND USE OF miRNAs INVOLVED IN THE DIFFERENTIATION OF CELLS FROM MYELOID LEUKEMIA
ES2534304T3 (en) 2004-11-12 2015-04-21 Asuragen, Inc. Procedures and compositions involving miRNA and miRNA inhibitor molecules
US7074622B2 (en) * 2004-11-15 2006-07-11 Eastman Kodak Company Method and system for sorting and separating particles
US20060252057A1 (en) 2004-11-30 2006-11-09 Mitch Raponi Lung cancer prognostics
US20060154275A1 (en) 2004-12-02 2006-07-13 The Board Of Trustees Of The Leland Stanford Junior University Regulated genes in cervical cancer
US20060185027A1 (en) 2004-12-23 2006-08-17 David Bartel Systems and methods for identifying miRNA targets and for altering miRNA and target expression
US20070099196A1 (en) * 2004-12-29 2007-05-03 Sakari Kauppinen Novel oligonucleotide compositions and probe sequences useful for detection and analysis of micrornas and their target mRNAs
AU2006236453B2 (en) 2005-01-25 2012-02-23 Board Of Regents, The University Of Texas System Delivery of siRNA by neutral lipid compositions
WO2006086798A2 (en) * 2005-02-08 2006-08-17 Board Of Regents, The University Of Texas System Compositions and methods involving mda-7 for the treatment of cancer
US7495073B2 (en) * 2005-03-24 2009-02-24 Asia Hepato Gene Company Short isoform of Annexin A10 at chromosome 4q, termed Annexin 10s (ANXA10s) and methods of use
US20090062184A1 (en) 2005-03-24 2009-03-05 Dainippon Sumitomo Pharma Co., Ltd. Fine particulate preparation comprising complex of nucleic acid molecule and collagen
GB2425311A (en) * 2005-04-15 2006-10-25 Ist Superiore Sanita Micro RNA against kit protein
JP2008539731A (en) 2005-05-02 2008-11-20 コールド スプリング ハーバー ラボラトリー Compositions and methods for diagnosis and treatment of cancer
US20070072201A1 (en) * 2005-05-16 2007-03-29 Kohne David E Method for producing improved nucleic acid oligomer functional homogeneity and functional characteristic information and results and oligomer application results
US20060265771A1 (en) * 2005-05-17 2006-11-23 Lewis David L Monitoring microrna expression and function
GB0601102D0 (en) * 2006-01-19 2006-03-01 Nuclea Biomarkers Llc Kinase Peptides And Antibodies
US20070054287A1 (en) * 2005-05-31 2007-03-08 Applera Corporation Method for identifying medically important cell populations using micro rna as tissue specific biomarkers
EP2377559A1 (en) 2005-06-03 2011-10-19 Southern Adelaide Health Service - Flinders Medical Centre Targeting cells with altered microRNA expression
US20070065844A1 (en) * 2005-06-08 2007-03-22 Massachusetts Institute Of Technology Solution-based methods for RNA expression profiling
WO2006135765A1 (en) 2005-06-09 2006-12-21 Epoch Biosciences, Inc. Improved primer-based amplification methods
US20060292616A1 (en) 2005-06-23 2006-12-28 U.S. Genomics, Inc. Single molecule miRNA-based disease diagnostic methods
KR101140575B1 (en) * 2005-06-30 2012-05-02 엘지디스플레이 주식회사 Test process for liquid crystal display device
CN103820562B (en) 2005-08-01 2015-05-13 俄亥俄州立大学研究基金会 MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
IL177006A0 (en) 2005-08-02 2006-12-10 Veridex Llc Predicting bone relapse of breast cancer
US20070213292A1 (en) 2005-08-10 2007-09-13 The Rockefeller University Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
US20070041934A1 (en) 2005-08-12 2007-02-22 Regents Of The University Of Michigan Dendrimer based compositions and methods of using the same
EP2796554A3 (en) 2005-09-12 2014-12-10 The Ohio State University Research Foundation Compositions for use in treating BCL2-associated cancers
US20070117815A1 (en) 2005-11-04 2007-05-24 James Pluda Method of treating cancers with SAHA and pemetrexed
US7390792B2 (en) 2005-12-15 2008-06-24 Board Of Regents, The University Of Texas System MicroRNA1 therapies
EP1976567B1 (en) 2005-12-28 2020-05-13 The Scripps Research Institute Natural antisense and non-coding rna transcripts as drug targets
WO2007073737A1 (en) 2005-12-29 2007-07-05 Exiqon A/S Detection of tissue origin of cancer
US7670840B2 (en) 2006-01-05 2010-03-02 The Ohio State University Research Foundation Micro-RNA expression abnormalities of pancreatic, endocrine and acinar tumors
ES2544713T3 (en) 2006-01-05 2015-09-03 The Ohio State University Research Foundation MicroRNA based methods and compositions for the diagnosis and treatment of solid cancers
EP2514433B1 (en) 2006-01-05 2015-10-21 The Ohio State University Research Foundation MicroRNA-based methods for the diagnosis, prognosis and treatment of lung cancer
US20070259827A1 (en) 2006-01-25 2007-11-08 University Of Massachusetts Compositions and methods for enhancing discriminatory RNA interference
AU2007211082B2 (en) 2006-01-27 2012-09-27 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for the use in modulation of microRNAs
ES2448491T3 (en) 2006-03-02 2014-03-14 The Ohio State University Research Foundation MicroRNA expression profile associated with pancreatic cancer
US7955848B2 (en) 2006-04-03 2011-06-07 Trustees Of Dartmouth College MicroRNA biomarkers for human breast and lung cancer
JP5131927B2 (en) * 2006-06-16 2013-01-30 大正製薬株式会社 Use of RPN2 gene expression inhibitor
US20080076674A1 (en) * 2006-07-06 2008-03-27 Thomas Litman Novel oligonucleotide compositions and probe sequences useful for detection and analysis of non coding RNAs associated with cancer
EP2436786B1 (en) 2006-07-13 2014-04-16 The Ohio State University Research Foundation MIR-10a for diagnosing poor survival prognosis colon adenocarcinoma.
WO2008014008A2 (en) 2006-07-28 2008-01-31 The Johns Hopkins University Compositions and methods for modulating angiogenesis
WO2008036741A2 (en) 2006-09-19 2008-03-27 Asuragen, Inc. Mir-200 regulated genes and pathways as targets for therapeutic intervention
JP5520605B2 (en) * 2006-09-19 2014-06-11 アシュラジェン インコーポレイテッド MicroRNA differentially expressed in pancreatic diseases and uses thereof
WO2008036776A2 (en) 2006-09-19 2008-03-27 Asuragen, Inc. Mir-15, mir-26, mir -31,mir -145, mir-147, mir-188, mir-215, mir-216 mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention
US20080131878A1 (en) * 2006-12-05 2008-06-05 Asuragen, Inc. Compositions and Methods for the Detection of Small RNA
AU2007333106A1 (en) 2006-12-08 2008-06-19 Asuragen, Inc. miR-20 regulated genes and pathways as targets for therapeutic intervention
CN101622349A (en) * 2006-12-08 2010-01-06 奥斯瑞根公司 miR-20 regulated genes and pathways as targets for therapeutic intervention
DK2104737T3 (en) 2006-12-08 2013-05-27 Asuragen Inc Functions and Purposes of Easy-7 Micro-RNAs
WO2008073920A2 (en) 2006-12-08 2008-06-19 Asuragen, Inc. Mir-21 regulated genes and pathways as targets for therapeutic intervention
US20090175827A1 (en) 2006-12-29 2009-07-09 Byrom Mike W miR-16 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
EP2111408A4 (en) 2007-01-17 2010-02-03 Univ Johns Hopkins Compositions and methods featuring micronas for treating neoplasia
EP2124967A4 (en) 2007-01-26 2011-01-05 Rosetta Genomics Ltd Compositions and methods for treating hematopoietic malignancies
US20100310583A1 (en) 2007-01-31 2010-12-09 Immune Disease Institute Let-7 microrna and mimetics thereof as therapeutics for cancer
MX2009011320A (en) 2007-04-20 2009-12-15 Enzon Pharmaceuticals Inc Enzymatic anticancer therapy.
EP2142659A4 (en) 2007-04-30 2010-06-09 Univ Ohio State Res Found Methods for differentiating pancreatic cancer from normal pancreatic function and/or chronic pancreatitis
US8399248B2 (en) * 2007-05-03 2013-03-19 Merck Sharp & Dohme Corp. Methods of using MIR34 as a biomarker for TP53 functional status
US20090131354A1 (en) * 2007-05-22 2009-05-21 Bader Andreas G miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
US20090232893A1 (en) 2007-05-22 2009-09-17 Bader Andreas G miR-143 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
CN101801419A (en) 2007-06-08 2010-08-11 米尔纳疗法公司 Gene and path as the miR-34 regulation and control for the treatment of the target of intervening
US7993831B2 (en) 2007-09-14 2011-08-09 Asuragen, Inc. Methods of normalization in microRNA detection assays
US8361714B2 (en) 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US20090186015A1 (en) 2007-10-18 2009-07-23 Latham Gary J Micrornas differentially expressed in lung diseases and uses thereof
CN101980712B (en) 2007-10-29 2015-02-18 雷古拉斯治疗公司 Targeting microRNAs for the treatment of liver cancer
WO2009070805A2 (en) * 2007-12-01 2009-06-04 Asuragen, Inc. Mir-124 regulated genes and pathways as targets for therapeutic intervention
US20110009469A1 (en) * 2007-12-05 2011-01-13 The Johns Hopkins University Compositions and methods of treating neoplasia
WO2009086156A2 (en) 2007-12-21 2009-07-09 Asuragen, Inc. Mir-10 regulated genes and pathways as targets for therapeutic intervention
EP2260110B1 (en) 2008-02-08 2014-11-12 Asuragen, INC. miRNAs DIFFERENTIALLY EXPRESSED IN LYMPH NODES FROM CANCER PATIENTS
EP2096171A1 (en) * 2008-02-27 2009-09-02 Julius-Maximilians-Universität Würzburg MicroRNA (miRNA) and down-stream targets for diagnostic and therapeutic purposes
JP2011517932A (en) 2008-02-28 2011-06-23 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション MicroRNA signatures associated with human chronic lymphocytic leukemia (CCL) and uses thereof
EP2268832A2 (en) 2008-03-06 2011-01-05 Asuragen, INC. Microrna markers for recurrence of colorectal cancer
EP2268811A1 (en) * 2008-03-07 2011-01-05 Santaris Pharma A/S Pharmaceutical compositions for treatment of microrna related diseases
US20090253780A1 (en) 2008-03-26 2009-10-08 Fumitaka Takeshita COMPOSITIONS AND METHODS RELATED TO miR-16 AND THERAPY OF PROSTATE CANCER
US20090258928A1 (en) 2008-04-08 2009-10-15 Asuragen, Inc. Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
EP2285960B1 (en) 2008-05-08 2015-07-08 Asuragen, INC. Compositions and methods related to mir-184 modulation of neovascularization or angiogenesis
CN102112110A (en) 2008-06-06 2011-06-29 米尔纳医疗股份有限公司 Novel compositions for the in vivo delivery of RNAi agents
US20100090959A1 (en) 2008-10-14 2010-04-15 Sony Ericsson Mobile Communications Ab Forming a keyboard from a combination of keys displayed on a touch sensitive display and on a separate keypad
WO2010056737A2 (en) 2008-11-11 2010-05-20 Mirna Therapeutics, Inc. Methods and compositions involving mirnas in cancer stem cells
EP2379720B1 (en) * 2009-01-20 2016-08-17 Alona Zilberberg Mir-21 promoter driven targeted cancer therapy
US7665785B1 (en) 2009-04-08 2010-02-23 Newton Paul A Column pipe catch tool
WO2011050129A1 (en) * 2009-10-21 2011-04-28 Trustees Of Dartmouth College Microrna-10 antagonists and microrna-10 targets for use in the treatment of a glioma
WO2011059752A1 (en) 2009-10-28 2011-05-19 Board Of Regents Of The University Of Texas System Methods and compositions for anti-egfr treatment
CA2781547A1 (en) 2009-11-23 2011-05-26 The Ohio State University Materials and methods useful for affecting tumor cell growth, migration and invasion
WO2011063456A1 (en) 2009-11-24 2011-06-03 The University Of Western Australia Methods and compositions for increasing sensitivity to tyrosine kinase inhibitors
US8846631B2 (en) 2010-01-14 2014-09-30 Regulus Therapeutics Inc. MicroRNA compositions and methods
WO2012041959A1 (en) 2010-09-30 2012-04-05 University Of Zurich Treatment of b-cell lymphoma with microrna
SG192252A1 (en) * 2011-02-03 2013-09-30 Mirna Therapeutics Inc Synthetic mimics of mir-34
CN103459598B (en) * 2011-02-03 2016-08-10 米尔纳医疗股份有限公司 The synthesis analogies of MIR-124
US8785709B2 (en) 2011-03-30 2014-07-22 University Of Louisville Research Foundation, Inc. Catalytic isomerisation of linear olefinic hydrocarbons
CA2833615C (en) 2011-04-25 2022-08-30 Regulus Therapeutics Inc. Microrna compounds and methods for modulating mir-21 activity
AU2012347498A1 (en) 2011-12-10 2014-06-26 Ohio State Innovation Foundation MiRNAs useful to reduce lung cancer tumorigenesis and chemotherapy resistance and related compositons and methods
UA116639C2 (en) 2012-10-09 2018-04-25 Рег'Юлес Терап'Ютікс Інк. Methods for treatment of alport syndrome
JP2016519076A (en) 2013-03-15 2016-06-30 ミルナ セラピューティクス,インク. Combined treatment of cancer using microRNA and EGFR-TKI inhibitor
AU2014302702A1 (en) 2013-06-24 2015-12-17 Mirna Therapeutics, Inc. Biomarkers of miR-34 activity
US20160136181A1 (en) 2014-04-01 2016-05-19 Mirna Therapeutics, Inc Microrna dosing regimens

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7307067B2 (en) * 2004-05-04 2007-12-11 The Board Of Trustees Of The Leland Stanford University Methods and compositions for reducing viral genome amounts in a target cell
US20060058266A1 (en) * 2004-08-10 2006-03-16 Muthiah Manoharan Chemically modified oligonucleotides

Also Published As

Publication number Publication date
US9506061B2 (en) 2016-11-29
EP2302054A1 (en) 2011-03-30
AU2005333165B2 (en) 2012-07-19
EP2302055A1 (en) 2011-03-30
ES2503738T3 (en) 2014-10-07
ES2503739T3 (en) 2014-10-07
US20150352046A1 (en) 2015-12-10
JP2010178741A (en) 2010-08-19
US8563708B2 (en) 2013-10-22
HK1204656A1 (en) 2015-11-27
EP2287303B1 (en) 2014-07-02
ES2503743T3 (en) 2014-10-07
US20150299705A1 (en) 2015-10-22
JP2014217385A (en) 2014-11-20
US7960359B2 (en) 2011-06-14
US9447414B2 (en) 2016-09-20
CA2850323A1 (en) 2006-12-28
DK2302055T3 (en) 2014-10-13
EP2808389A1 (en) 2014-12-03
US20130143945A1 (en) 2013-06-06
EP1838852A2 (en) 2007-10-03
JP2014217387A (en) 2014-11-20
JP2012228254A (en) 2012-11-22
US20150005366A1 (en) 2015-01-01
EP2281887A1 (en) 2011-02-09
JP5389690B2 (en) 2014-01-15
US20080050744A1 (en) 2008-02-28
ES2534303T3 (en) 2015-04-21
EP2302055B1 (en) 2014-08-27
EP2281889A1 (en) 2011-02-09
ES2503741T3 (en) 2014-10-07
JP2014223080A (en) 2014-12-04
CA2857901A1 (en) 2006-12-28
EP2298894B1 (en) 2014-07-16
US20170037404A1 (en) 2017-02-09
JP5596085B2 (en) 2014-09-24
JP2014217381A (en) 2014-11-20
US20150344883A1 (en) 2015-12-03
US20080176766A1 (en) 2008-07-24
EP2292756B1 (en) 2014-07-16
EP2302054B1 (en) 2014-07-16
EP2302052A1 (en) 2011-03-30
JP2016165292A (en) 2016-09-15
US8946177B2 (en) 2015-02-03
EP2314688B1 (en) 2014-07-16
JP5620556B2 (en) 2014-11-05
US20140348907A1 (en) 2014-11-27
EP2281888B1 (en) 2015-01-07
EP2281886B1 (en) 2014-07-16
ES2503765T3 (en) 2014-10-07
EP2292756A1 (en) 2011-03-09
EP2302053A1 (en) 2011-03-30
ES2534302T3 (en) 2015-04-21
ES2534300T3 (en) 2015-04-21
CA2857880A1 (en) 2006-12-28
EP2281889B1 (en) 2014-07-30
JP2008519606A (en) 2008-06-12
ES2503740T3 (en) 2014-10-07
EP2302056A1 (en) 2011-03-30
US20140031415A1 (en) 2014-01-30
US9382537B2 (en) 2016-07-05
EP2302056B1 (en) 2015-01-07
PL2302055T3 (en) 2015-02-27
JP2014012020A (en) 2014-01-23
EP2284265A1 (en) 2011-02-16
US20140314833A1 (en) 2014-10-23
US20150284720A1 (en) 2015-10-08
US20140348908A1 (en) 2014-11-27
ES2503742T3 (en) 2014-10-07
JP2014217386A (en) 2014-11-20
US20150275213A1 (en) 2015-10-01
US9068219B2 (en) 2015-06-30
CA2857879A1 (en) 2006-12-28
EP2322616A1 (en) 2011-05-18
US20110313025A1 (en) 2011-12-22
CA2857878A1 (en) 2006-12-28
US20150361431A1 (en) 2015-12-17
US20150342981A1 (en) 2015-12-03
ES2507544T3 (en) 2014-10-15
CA2587189A1 (en) 2006-12-28
EP2314688A1 (en) 2011-04-27
US8173611B2 (en) 2012-05-08
JP2014217384A (en) 2014-11-20
US8765709B2 (en) 2014-07-01
US20130303591A1 (en) 2013-11-14
EP2302051A1 (en) 2011-03-30
EP2808390A1 (en) 2014-12-03
EP2298893A1 (en) 2011-03-23
EP2298894A1 (en) 2011-03-23
US20140350086A1 (en) 2014-11-27
EP2302051B1 (en) 2015-01-07
US20080171715A1 (en) 2008-07-17
US9051571B2 (en) 2015-06-09
WO2006137941A9 (en) 2007-03-08
AU2005333165A1 (en) 2006-12-28
US20150344881A1 (en) 2015-12-03
EP2281886A1 (en) 2011-02-09
EP2281888A1 (en) 2011-02-09
ES2534304T3 (en) 2015-04-21
US20150004221A1 (en) 2015-01-01
ES2534301T3 (en) 2015-04-21
WO2006137941A2 (en) 2006-12-28
US8058250B2 (en) 2011-11-15
EP2292755A1 (en) 2011-03-09
SI2302055T1 (en) 2015-01-30
CA2857881A1 (en) 2006-12-28
EP2287303A1 (en) 2011-02-23
EP2284265B1 (en) 2015-01-07
EP2302052B1 (en) 2015-01-07
US20090176723A1 (en) 2009-07-09
US20120065248A1 (en) 2012-03-15
WO2006137941A3 (en) 2008-01-03

Similar Documents

Publication Publication Date Title
US9447414B2 (en) Methods and compositions involving miRNA and miRNA inhibitor molecules

Legal Events

Date Code Title Description
AS Assignment

Owner name: APPLERA CORPORATION, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:AMBION, INC.;REEL/FRAME:035973/0296

Effective date: 20051224

Owner name: AMBION, INC., TEXAS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BROWN, DAVID;FORD, LANCE;CHENG, ANGIE;AND OTHERS;REEL/FRAME:035973/0102

Effective date: 20051221

Owner name: ASURAGEN, INC., TEXAS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:APPLERA CORPORATION;REEL/FRAME:035973/0380

Effective date: 20071009

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION