US20070104690A1 - Retroviral vectors - Google Patents

Retroviral vectors Download PDF

Info

Publication number
US20070104690A1
US20070104690A1 US11/646,041 US64604106A US2007104690A1 US 20070104690 A1 US20070104690 A1 US 20070104690A1 US 64604106 A US64604106 A US 64604106A US 2007104690 A1 US2007104690 A1 US 2007104690A1
Authority
US
United States
Prior art keywords
retroviral vector
production system
vector production
vector
hiv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/646,041
Inventor
Alan Kingsman
Susan Kingsman
Narry Kim
Kyriacos Mitrophanous
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9621680.9A external-priority patent/GB9621680D0/en
Priority claimed from GBGB9624457.9A external-priority patent/GB9624457D0/en
Application filed by Individual filed Critical Individual
Priority to US11/646,041 priority Critical patent/US20070104690A1/en
Publication of US20070104690A1 publication Critical patent/US20070104690A1/en
Priority to US12/286,545 priority patent/US20090291491A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0091Purification or manufacturing processes for gene therapy compositions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15051Methods of production or purification of viral material
    • C12N2740/15052Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16051Methods of production or purification of viral material
    • C12N2740/16052Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • This invention relates to retroviral vector production systems and to retroviral vector particles produced by the systems.
  • it relates to systems and vector particles from which certain retroviral auxiliary factors are absent.
  • the invention also relates to uses of retroviral vectors, in particular for gene therapy.
  • Retroviral vectors have been the vehicle of choice for clinical gene transfer-because of their efficacy, safety, and stable long-term gene expression. According to the United States National Institutes of Health RAC report issued in September 1996 (Ross et al., 1996), 76 out of 107 trials reviewed by the NIH were based on vector systems derived from the murine leukaemia virus (MLV).
  • MLV murine leukaemia virus
  • HIV-1 Human immunodeficiency-virus type 1 (HIV-1) belongs to a sub-family within the retroviruses, the lentiviruses and in common with other members of this family HIV can infect quiescent cells. This makes lentiviruses attractive vectors for gene therapy.
  • MA p17 matrix protein
  • vpr vpr
  • MA has karyophilic properties conferred by a conserved stretch of basic residues, which constitute a nuclear localization signal (NLS) (Bukrinsky et al., 1993). Vpr also contains a distinct NLS (Mahalingam et al., 1995).
  • MA-NLS mutant viruses fail to rep licate efficiently in macrophages in the absence of a functional vpr gene (Heinzinger et al., 1994). These data have been interpreted to mean that vpr as well as MA function as karyophilic determinants of HIV-1. In the absence of vpr the transduction efficiency of monocyte-derived macrophages decreases by over 50%, in the presence of functional MA. (Naldini et al., 1996).
  • HIV-1 based gene therapy vector Following work reported in Lever et al., 1989 which showed the sequences required for packaging of HIV-1, there has been much interest in the development of an HIV-1 based gene therapy vector. Transfer of foreign genes into a human T-ell line by a replication defective HIV-1 based vector was demonstrated by Poznanski et al (Poznansky et al., 1991). Other groups have designed HIV-1 based vectors that are tat-inducible (Buchschacher, Jr. and Panganiban, 1992) or that use heterologous promoters (Shimada et al., 1991).
  • helper virus-free vectors were low (at most 10 3 infectious particles per ml), and it was not clear whether the vector system could guarantee the production of helper virus-free vectors. More recently, new efforts to produce helper virus-free vectors have been based on three-plasmid cotransfections (Richardson et al., 1995). HIV vectors can be pseudotyped with Vesicular Stomatitis Virus glycoprotein (VSV-G) and these particles retain infectivity after concentration by ultracentrifugation (Akkina et al., 1996). Pseudotyping With VSV-G confers a broader host range and eliminates the chances of recombination to produce wild type HIV envelope.
  • VSV-G Vesicular Stomatitis Virus glycoprotein
  • HIV-1 contains nine genes, three of which: gag, pol and env are found in all retroviruses. These are the structural genes. The other six: vif, vpu, vpr, nef, tat and rev are referred to as auxiliary genes. Other retroviruses have different sets of auxiliary genes in their wild type genomes. Some of the auxiliary genes of other retroviruses are analogous to those of HIV-1, although they may not always have been given the same names in the literature. Analogous auxiliary genes have homology in their nucleotide sequences and perform the same or similar functions. HIV-2 and SIV strains generally contain env, vpr, vif, tat, and nef genes analogous to those of HIV-1.
  • HIV-2 and some strains of SIV also contain vpx which, in some SIV strains lacking vpr can be considered analogous to vpr.
  • Lentiviruses other than HIV-1 also contain auxiliary genes which are not analogous to the HIV-1 auxiliary genes. Retrovirus auxiliary genes are reviewed for example by Tomonaga and Mikami (1996) and by Joag et al. in Fields Virology, Vol 2.
  • auxiliary genes act as an RNA export protein and tat is a major transactivator of the proviral long terminal repeat (LTR).
  • LTR proviral long terminal repeat
  • the auxiliary genes play a crucial role in viral replication and pathogenesis.
  • the auxiliary genes have not been fully characterized nor their function defined.
  • HIV auxiliary genes are thought to be involved in the pathogenesis of HIV-1. Tat has been implicated in the development of Kaposi's sarcoma (Barillari et al., 1993; Ensoli et al., 1990). HIV vpr has been shown to cause cell arrest and apoptosis and this has been proposed: to be the cause of T-Cell dysfunction seen in AIDS patients (Jowett et al., 1995). Also extracellular Vpr present in peripheral blood has been suggested: to contribute to tissue-specific pathologies associated with HIV infection since Vpr induces cell proliferation and differentiation (Levy et al, 1993 and Levy et al, 1995).
  • auxiliary genes Since the roles of the auxiliary genes are not clear and they probably play a major role in pathogenesis their removal from HIV-1 vector production systems is desirable, provided that sufficiently high retrovirus vector titer and ability to transduce non-proliferating cells can be retained.
  • Naldini et al's data shows that the presence or absence of vpu has no effect on the vector particle titer. That is, a packaging system they used produced a titer of 4 ⁇ 10 5 when pseudotyped with VSV-G and this system was env and vpu negative. In another system which was only env negative they obtained the same titer (Naldini et al. 1996 and Naldini et al. 1996a). However, as already discussed another system of Naldini et al which was vpr negative as well as vpu negative gave a transduction efficiency which was decreased by 50% compared to a vpr positive system.
  • the invention therefore provides in one aspect a retroviral vector production system for producing lentivirus-based, replication defective vector particles for gene therapy, said vector particles capable of infecting and transducing non-dividing mammalian target cells, which system comprises a set of nucleic acid sequences encoding the components of the vector, wherein one or more functional genes chosen from the HIV-1 auxiliary genes vpr, vif, tat and nef or from the analogous auxiliary genes of other lentiviruses, which auxiliary genes are normally present in the lentivirus on which the vector particles are based, is or are absent from the system.
  • the functional vpu gene may also be absent, with the proviso that when the production system is for an HIV-1 based vector and vpr and vpu are both absent, so also is one of the other auxiliary genes.
  • the invention provides retroviral vector particles produced by a retroviral vector particle production system described herein.
  • the invention provides a DNA construct for use in a retroviral vector production system described herein, said DNA construct encoding a packagable RNA vector genome for a retroviral vector particle and operably linked to a promoter, wherein all of the functional retroviral auxiliary genes are absent from the construct, other than rev which is optionally present.
  • the DNA construct may be provided as part of a set of DNA constructs also encoding some or all of the structural components of the vector particles.
  • the invention provides the use of retroviral vector particles as described herein, for gene therapy and in the preparation of a medicament for gene therapy; and a method of performing gene therapy on a target cell which method comprises infecting and transducing the target cell using a retroviral vector particle as described herein.
  • the invention further provides transduced target cells resulting from these uses and methods.
  • the invention thus provides a gene delivery system for use in medicine.
  • lentivirus-based means that the vector particles are derived from a lentivirus.
  • the genome of the vector particle comprises components from the lentivirus as a backbone.
  • the vector particle as a whole contains essential vector components compatible with the RNA genome, including reverse transcription and integration systems. Usually these will include the gag and pol proteins derived from the lentivirus.
  • the retroviral vector particles Being derived from a lentivirus, the retroviral vector particles are capable of infecting and transducing non-dividing cells. Thus, the vector particles are able to deliver a selected gene or genes such as therapeutically active genes, to the genome of a target cell.
  • lentiviruses form a pre-integration complex in the target cell cytoplasm containing integrase, core proteins and proviral DNA. The complex is able to pass across the nuclear membrane of the target cell, by means of signal sequences in the proteins.
  • Non-lentiviral retroviruses either lack the proteins or have the proteins but without the appropriate signal sequences.
  • lentiviruses examples include HIV-1 and HIV-2, SIV, FIV, BLV, EIAV, CEV and visna virus. Of these, HIV and SIV are presently best understood. However, a non-immunodeficiency virus may be preferred for use in gene therapy because the immunodeficiency viruses inevitably bring with them safety considerations and prejudices.
  • the auxiliary genes may be present as part of the vector genome-encoding DNA, or together with the packaging components. The location of an auxiliary gene in a vector production system depends in part on its relationship with other retroviral components. For example, vif is often part of a gag-pol packaging cassette in a packaging cell. Thus, to remove a functional auxiliary gene for the purposes of the invention may involve its removal from the packaging components, or from the vector genome, or perhaps both.
  • a functional auxiliary gene may not require removal of the gene in its entirety. Usually removal of part of the gene, or disruption of the gene in some other way will be sufficient.
  • the absence of a functional auxiliary gene is understood herein to mean that the gene is not present in a form in which it is capable of encoding the functional auxiliary protein.
  • vpr and tat genes or analogous genes normally present in the lentivirus on which the vector particles are based are both absent.
  • auxiliary genes are associated with characteristics of lentiviruses which are particularly undesirable for a gene therapy vector.
  • the invention is not limited with regard to the combination of auxiliary genes that are absent.
  • any combination of three, or more preferably four, of the genes may be absent in their functional form.
  • all five of the auxiliary genes vpr, vif, tat, nef, and vpu are absent in their functional form.
  • it is most preferable that all of the auxiliary genes are absent in their functional form (except rev which is preferably present unless replaced by a system analogous to the rev/RRE system).
  • RNA transcripts of the vector genome from the nucleus to the cytoplasm, it is preferable to include functional rev and rev response element (RRE) sequences in the vector genome, or to include alternative sequences in the genome which perform the same function as the rev/RRE system.
  • RRE rev and rev response element
  • a functional analogue of the rev/RRE system is found in Mason Pfizer monkey virus. This is known as CTE and consists of an RRE-type sequence in the genome which is believed to interact with a factor in the infected cell. The cellular factor can be thought of as a rev analogue.
  • CTE may be used as an alternative to the rev/RRE system.
  • the retroviral vector particles described herein will need to have a reverse transcription system (compatible reverse transcription and primer binding sites) and an integration system (compatible integrase and integration sites) allowing conversion to the provirus and integration of the double-stranded DNA into the target cell genome. Additionally, the vector genome will need to contain a packaging signal. These systems and signals will generally be derived from the lentivirus on which the vector is based. It will be evident that although the vector according to the invention is based on a lentivirus, the elements of the lentivirus incorporated into the vector may be genetically or otherwise altered versions of the elements in the wild type lentivirus.
  • Alterations may be achieved by manipulating either the RNA genome or other components of the retroviral vector particle production system. For example, portions of the lentivirus genome not required for the vector can be excluded. Also, the vector production system can employ substitutes e.g. for the lentivirus env gene, to give the vector a different target cell range (this is known as pseudotyping).
  • a retroviral vector particle according to the invention carries one or more selected genes for delivery to a target cell.
  • the selected genes are chosen according to the effect sought to be achieved.
  • Therapeutic genes may encode for example an antisense RNA, a ribozyme, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen that induces antibodies or helper T-cells or cytotoxic T-cells, a single chain antibody or a tumour suppressor protein.
  • the construction of the vector genome is such that in the DNA provirus, the therapeutic gene or genes is or are under transcriptional control of the 5′ LTR but not otherwise operably linked to any other promoter from the vector.
  • expression of the gene or genes is in a single transcription unit.
  • the 5′ LTR is a modified lentivirus LTR for which the promoter function is not tat-dependent. This may be achieved by replacing the R and U3 lentivirus promoter functions by alternative promoter functions, which may be derived from another retrovirus or may be of non-retroviral origin. A strategy for this is described in Cannon et al 1996 and in the Examples.
  • genes delivered by vectors according to the invention will be cDNAs.
  • Retroviral vector particles according to the invention will also be capable of infecting and transducing cells which are slowly-dividing, and which non-lentiviruses such as MLV would not be able to efficiently infect and transduce.
  • Slowly-dividing cells divide once in about every three to four days.
  • Mammalian non-dividing and slowly-dividing cells include brain cells, stem cells, terminally differentiated macrophages, lung epithelial cells and various other cell types. Also included are certain tumour cells. Although tumours contain rapidly dividing cells, some tumour cells especially those in the centre of the tumour, divide infrequently.
  • the DNA construct encoding the vector genome described herein is preferably linked to a high efficiency promoter such as the CMV promoter.
  • a high efficiency promoter such as the CMV promoter.
  • Other high efficiency promoters are known. This gives rise to a high level of expression of the vector RNA by the retroviral vector production system.
  • Suitable host or producer cells for use in the retroviral vector production system according to the invention are well known in the art. Many retroviruses have already been split into replication defective genomes and packaging components. For those which have not the technology is available for doing so.
  • the producer cell encodes the viral components not encoded by the vector genome such as the gag, pol and env proteins.
  • the gag, pol and env genes may be introduced into the producer cell and stably integrated into the cell genome to give a packaging cell line.
  • the retroviral vector genome is then introduced-into the packaging cell line by transfection or transduction to create a stable cell line that has all of the DNA sequences required to produce a retroviral vector particle.
  • Another approach is to introduce the different DNA sequences that are required to produce a retroviral vector particle e.g. the env coding sequence, the gag-pol coding sequence and the defective retroviral genome into the cell simultaneously by transient triple transfection.
  • both the structural components and the vector genome will all be encoded by DNA stably integrated into a host cell genome.
  • FIG. 1 shows a vector production system according to the invention, using a three-plasmid co-transfection of 293T cells;
  • FIG. 2 shows HIV-based vector genomes for use in the invention
  • FIG. 3 shows HIV-1 gag-pol gene expression plasmids for use in the invention.
  • FIG. 4 shows transduction efficiencies for vectors according to the invention lacking the five auxiliary factors.
  • the system may have additional advantages for HIV therapy.
  • Replacing the HIV-1 LTR with a different promoter such as a constitutive HCMV promoter permits the use of anti-Tat molecules such as Tat transdominant mutants (Echetebu et al, 1994) or TAR decoys (Lisziewicz et al, 1993) as therapeutic agents as they will not affect vector production.
  • minimal lentiviral vectors as described herein, lacking all of the wild-type virus auxiliary genes, may also have applications as vaccines.
  • pGP-RRE1 is a pWI3 (Kim et al., 1989) derived gagpol vif expression plasmid.
  • the RRE of pWI3 (Accession number U26942) was inserted by bunt-ending the Sty I/Sty I fragment (7720-8050) into pBluescript KS+ Sma I cut creating pBSRRE.
  • the Nar I/Eco RI fragment of pWI3 (637-5743) was inserted into pBSRRE cut with Cla I and Eco RI to create pBSGPRRE1.
  • the Xho I/Not I fragment (containing gagpol and RRE) was inserted into the expression plasmid pCI-Neo to create pGR-RRE1.
  • pBSGPRRE1 was cut with NdeI and SmaI, blunt-ended and was relegated to generate pBSGPRRE2.
  • the gagpol gene and RRE were inserted into pCI-neo in XhoI and NotI site to make pGP-RRE2.
  • pTIN406, pTIN408 and pTIN414 has been described (Cannon et al., 1996).
  • the 5′ LTR of pH3Z and pH4Z contain a CMV promoter at the U3 position and the HIV R and U5 regions. HIVdge was made from HIVgpt (Page et al., 1990) by blunt-ending the Cla I site (829) to create a frameshift mutation. HIVdge was cut with Bgl II and Pst I (473-1414) and inserted into pTIN406.
  • pTIN406 has an LTR structure of CMV, R (HIV) and U5 (MLV). This created a hybrid LTR containing CMV, and R, U5 from: HIV called pBS5′.
  • the Eco RI/Xho I fragment (5743-8897) was cut from HIVdge1.2 which is a HIVdge derivative containing a deletion from Nde I to Bgl II (6403-7621) and was inserting into pBS5′ to create pBS5′R.
  • the 3′ LTR was provided by inserting the Not I/Xho I fragment of pBS3′ into pBS5′R creating pH2.
  • pBS3′ was created by a three way ligation of the Xho I/Hind III fragment of pWI3, the Hind III/Kpn I fragment of pTIN408 into pBluescript KS+ (Xho I/Kpn I).
  • a CMV promoter was inserted into the unique Xho I site of pH2 from pSPCMV (Sal I/Xho I) making pH2CMV.
  • pSPCMV was created by inserting pLNCX (Accession number M28246) (Pst I/Hind III) into pSP72 (Promega).
  • the ⁇ -galactosidase gene was inserted from PTIN414 into pSP72 (Xho I/Sph I) to make pSPlacZ.
  • a Xho I/Sal I digest of pSPlacZ gave the ⁇ -galactosidase coding region which was inserted into pH2-CMV to give pH3Z. pH4Z was constructed to create tat-deficient vector.
  • the first 50 bp of the tat-coding region was removed by replacing EcoRI (57433)I-SpeI fragment in pH3 with EcoRI (5881)-SpeI PCR product amplified using PCR primers DELT5 (5′-CGTGAATTCGCCTAAAACTGCTTGTACCA-3′) and DELT3 (5′-GAACTAATGACCCGTAATTG-3′) to create pH4.
  • the Nsi I/Spe I fragment from pH4 was inserted into pH3Z to generate pH4Z.
  • a vpr expression plasmid was constructed by PCR amplification of the vpr coding region from pNL4.3 (Accession number: U26942) using the following primers: 5′ primer GCGAATTCGGATCCACCATGGACAGCCCCAG AAGAC (5563-5583) and 3′ primer GCGAATTCGGATCCTCTAGGATCTACTGGCTCCATT (5834-5853). This amplicon was cloned into pLIGATOR (R & D Systems). The expression plasmid pCI-vpr was made by inserting the Mlu I and Xho I fragment containing the vpr coding region into pCI-Neo (Promega).
  • pAC29.1 was cut by Bam HI to give the VSV-G coding region which was inserted into pSA91 (Bgl II).
  • 293T (293ts/A1609) (DuBridge et al., 1987) cells were maintained in Dulbelco's modified: Eagle's medium (GIBCO), HeLa cells and 208F cells in MEM (GIBCO); all of which containing 10% (v/v) fetal calf serum supplemented with antibiotics.
  • Retroviral vector stocks were produced according to our, previously published protocol (Soneoka et al, 1995). Briefly, human kidney, 293T (1.5 ⁇ 10 6 ) cells were plated on 10-cm plates and transiently transfected with 15 mg of each plasmid (gag-pol and env expression plasmids together with a vector plasmid) by calcium phosphate DNA precipitation (Chen and Okayama, 1987). The culture supernatants were harvested 36 hours later, filtered through 0.45 mm and either used immediately or frozen at ⁇ 70° C. Transduction was carried out by adding virus onto target cells for 2 hours, in the presence of 8 mg/ml polybrene followed by the addition of fresh media.
  • 5-bromo-4-chloro-3-indolylyly b-D-galactoside was used to measure the expression of ⁇ -galactosidase 48 hours later, as previously described (Soneoka et al., 1995). Titers were obtained by counting the number of lac z (blue foci) forming units per ml (l.f.u./ml). G1/S phase arrested cultures were prepared by adding aphidicolin (5 mg/ml) 24 hours before infection and then daily throughout the experiment.
  • H3Z (tat positive) and H4Z (tat negative) are HIV-1 based vectors designed to be produced by three plasmid co-transfection into 293T cells ( FIG. 2 ).
  • the vectors Contain the first 778 bases of gag but a frameshift mutation, introduced 40 bp from the ATG start codon, prevents the expression of gag proteins.
  • RRE was included to boost packaging efficiency and rev is expressed from the vector to support the HIV mRNA export.
  • the internal CMV promoter-driven ⁇ -galactosidase gene was inserted to serve as a reporter gene.
  • transcription is driven by a CMV promoter which has been used to replace the 5′ LTR U3. This makes the vector genome tat independent.
  • gagpol constructs Two HIV-1 gagpol constructs were made ( FIG. 3 ); pGP-RRE1 (vif positive) and pGP-RRE2 (vif negative). Since the gagpol genes have been inserted into pCI-neo which is a CMV driven expression plasmid gagpol expression is tat independent pRV67, the VSV glycoprotein construct was used for the pseudotyping. By placing the different genes on different plasmids the probability of generating replication competent virus by recombination could be minimized.
  • Replication defective retroviral particles were generated by transient co-transfection of human kidney 293T cells with the three plasmids described above and either used immediately or frozen at ⁇ 70° C.
  • the different vector constructs were used to produce virus. It was found that the minimal constructs (H4Z and pGP-RRE2) gave comparable titers to that of the vif, vpr, nef and tat positive viruses (Table 1).
  • vpr was included in the packaging system by co-transfection of pCI-vpr along with pH4Z, pGP-RRE2 and pRV67 plasmids.
  • the transduction efficiencies of the viral particles generated were assayed on growing and growth-arrested 293T cells and HeLa cells ( FIG. 4 ).
  • MLV-derived packaging and transducing vectors (Soneoka, 1995) served as controls.
  • HeLa cells and 293T cells were growth-arrested at G1/S phase by aphidicolin treatment.
  • the minimal HIV vector H4Z was as efficient at transducing G1/S-arrested as proliferating HeLa and 293T cells, whereas the MLV-based-vector was only 0.002% as effective.
  • Vpr-deficient H4Z could transduce the growth-arrested cells as efficiently as vpr-containing vector, suggesting that HIV-1 MA is sufficient for providing the vector with the ability to transduce non-dividing cells.
  • HIV-1 based vector production system which does not contain vpr, vpu, net, vif and tat based on a three-plasmid co-transfection method.
  • This, vector can transduce proliferating cells with a titer of up to 3.2 ⁇ 10 5 l.f.u/ml which is comparable to other MLV-based vectors and can easily be increased by concentration using ultracentrifugation (data not shown). No helper virus has been detected (data not shown).
  • FIG. 2 HIV vector genomes. The numbers indicate the coordinates from HXB2. HCMV promoter ( ⁇ 597 to ⁇ 1). HIV sequences (455 to 1415; 5743 (H3Z) or 5881 (H4Z) to 6403; 7621 to 8897; 8897 to 9720) from HXB2. HQMV promoter as an internal promoter (900 bp). Cloning site (XhoI). Backbone; pBluescriptKS+.
  • FIG. 3 HIV-1 gag-pol gene expression plasmids. HIV-1 gagpol coding region and RRE was cloned into pCl-neo (PROMEGA) at XhoI and NotI site.
  • FIG. 4 Transduction of non-dividing cells. Transduction efficiencies of the H4Z vectors were measured by X-gal staining and are shown in Y-axis as l.f.u./ml. G1/S phase arrested cells were prepared by treating the cells with aphidicolin (5 ⁇ g/ml).

Abstract

Retroviral vector production systems for producing lentivirus-based vector particles which are capable of infecting and transducing non-dividing target cells, wherein one or more of the auxiliary genes such as vpr, vif, tat, and nef in the case of HIV-1 are absent, from the system. The systems and resulting retrovirus vector particles have improved safety over existing systems and vectors.

Description

  • This invention relates to retroviral vector production systems and to retroviral vector particles produced by the systems. In particular, it relates to systems and vector particles from which certain retroviral auxiliary factors are absent. The invention also relates to uses of retroviral vectors, in particular for gene therapy.
  • Retroviral vectors have been the vehicle of choice for clinical gene transfer-because of their efficacy, safety, and stable long-term gene expression. According to the United States National Institutes of Health RAC report issued in September 1996 (Ross et al., 1996), 76 out of 107 trials reviewed by the NIH were based on vector systems derived from the murine leukaemia virus (MLV).
  • One major drawback of these vectors is their inability to infect non-proliferating cells such as neurons, macrophages and haematopoeitic stem cells. These cells are important targets for gene therapy.
  • Human immunodeficiency-virus type 1 (HIV-1) belongs to a sub-family within the retroviruses, the lentiviruses and in common with other members of this family HIV can infect quiescent cells. This makes lentiviruses attractive vectors for gene therapy.
  • The viral determinants for HIV-1 infection of non-dividing cells are thought to reside in the p17 matrix protein (MA) and vpr (Gallay et al., 1996). MA has karyophilic properties conferred by a conserved stretch of basic residues, which constitute a nuclear localization signal (NLS) (Bukrinsky et al., 1993). Vpr also contains a distinct NLS (Mahalingam et al., 1995). MA-NLS mutant viruses fail to rep licate efficiently in macrophages in the absence of a functional vpr gene (Heinzinger et al., 1994). These data have been interpreted to mean that vpr as well as MA function as karyophilic determinants of HIV-1. In the absence of vpr the transduction efficiency of monocyte-derived macrophages decreases by over 50%, in the presence of functional MA. (Naldini et al., 1996).
  • Following work reported in Lever et al., 1989 which showed the sequences required for packaging of HIV-1, there has been much interest in the development of an HIV-1 based gene therapy vector. Transfer of foreign genes into a human T-ell line by a replication defective HIV-1 based vector was demonstrated by Poznanski et al (Poznansky et al., 1991). Other groups have designed HIV-1 based vectors that are tat-inducible (Buchschacher, Jr. and Panganiban, 1992) or that use heterologous promoters (Shimada et al., 1991). However, the viral titers obtained with these vectors was low (at most 103 infectious particles per ml), and it was not clear whether the vector system could guarantee the production of helper virus-free vectors. More recently, new efforts to produce helper virus-free vectors have been based on three-plasmid cotransfections (Richardson et al., 1995). HIV vectors can be pseudotyped with Vesicular Stomatitis Virus glycoprotein (VSV-G) and these particles retain infectivity after concentration by ultracentrifugation (Akkina et al., 1996). Pseudotyping With VSV-G confers a broader host range and eliminates the chances of recombination to produce wild type HIV envelope. In vivo transduction of non-dividing neuronal cells has been demonstrated with VSV-G pseudotyping of HIV-1 in a three-plasmid cotransfection system (Naldini et al., 1996 and Naldini et al., 1996a).
  • HIV-1 contains nine genes, three of which: gag, pol and env are found in all retroviruses. These are the structural genes. The other six: vif, vpu, vpr, nef, tat and rev are referred to as auxiliary genes. Other retroviruses have different sets of auxiliary genes in their wild type genomes. Some of the auxiliary genes of other retroviruses are analogous to those of HIV-1, although they may not always have been given the same names in the literature. Analogous auxiliary genes have homology in their nucleotide sequences and perform the same or similar functions. HIV-2 and SIV strains generally contain env, vpr, vif, tat, and nef genes analogous to those of HIV-1. HIV-2 and some strains of SIV also contain vpx which, in some SIV strains lacking vpr can be considered analogous to vpr. Lentiviruses other than HIV-1 also contain auxiliary genes which are not analogous to the HIV-1 auxiliary genes. Retrovirus auxiliary genes are reviewed for example by Tomonaga and Mikami (1996) and by Joag et al. in Fields Virology, Vol 2.
  • To date all vector systems based on HIV contain some or all of the HIV auxiliary genes. Rev acts as an RNA export protein and tat is a major transactivator of the proviral long terminal repeat (LTR). The auxiliary genes play a crucial role in viral replication and pathogenesis. The auxiliary genes have not been fully characterized nor their function defined.
  • However some of the auxiliary genes are thought to be involved in the pathogenesis of HIV-1. Tat has been implicated in the development of Kaposi's sarcoma (Barillari et al., 1993; Ensoli et al., 1990). HIV vpr has been shown to cause cell arrest and apoptosis and this has been proposed: to be the cause of T-Cell dysfunction seen in AIDS patients (Jowett et al., 1995). Also extracellular Vpr present in peripheral blood has been suggested: to contribute to tissue-specific pathologies associated with HIV infection since Vpr induces cell proliferation and differentiation (Levy et al, 1993 and Levy et al, 1995).
  • Since the roles of the auxiliary genes are not clear and they probably play a major role in pathogenesis their removal from HIV-1 vector production systems is desirable, provided that sufficiently high retrovirus vector titer and ability to transduce non-proliferating cells can be retained.
  • Naldini et al's data shows that the presence or absence of vpu has no effect on the vector particle titer. That is, a packaging system they used produced a titer of 4×105 when pseudotyped with VSV-G and this system was env and vpu negative. In another system which was only env negative they obtained the same titer (Naldini et al. 1996 and Naldini et al. 1996a). However, as already discussed another system of Naldini et al which was vpr negative as well as vpu negative gave a transduction efficiency which was decreased by 50% compared to a vpr positive system.
  • We have now discovered that leaving some or all of the auxiliary genes out of retrovirus vector production systems does not significantly compromise vector particle titers or the ability of the vector particles to transduce non-dividing cells.
  • The invention therefore provides in one aspect a retroviral vector production system for producing lentivirus-based, replication defective vector particles for gene therapy, said vector particles capable of infecting and transducing non-dividing mammalian target cells, which system comprises a set of nucleic acid sequences encoding the components of the vector, wherein one or more functional genes chosen from the HIV-1 auxiliary genes vpr, vif, tat and nef or from the analogous auxiliary genes of other lentiviruses, which auxiliary genes are normally present in the lentivirus on which the vector particles are based, is or are absent from the system. The functional vpu gene may also be absent, with the proviso that when the production system is for an HIV-1 based vector and vpr and vpu are both absent, so also is one of the other auxiliary genes.
  • In another aspect, the invention provides retroviral vector particles produced by a retroviral vector particle production system described herein.
  • In yet another aspect, the invention provides a DNA construct for use in a retroviral vector production system described herein, said DNA construct encoding a packagable RNA vector genome for a retroviral vector particle and operably linked to a promoter, wherein all of the functional retroviral auxiliary genes are absent from the construct, other than rev which is optionally present. The DNA construct may be provided as part of a set of DNA constructs also encoding some or all of the structural components of the vector particles.
  • In further aspects, the invention provides the use of retroviral vector particles as described herein, for gene therapy and in the preparation of a medicament for gene therapy; and a method of performing gene therapy on a target cell which method comprises infecting and transducing the target cell using a retroviral vector particle as described herein. The invention further provides transduced target cells resulting from these uses and methods. The invention thus provides a gene delivery system for use in medicine.
  • The expression “lentivirus-based” means that the vector particles are derived from a lentivirus. The genome of the vector particle comprises components from the lentivirus as a backbone. The vector particle as a whole contains essential vector components compatible with the RNA genome, including reverse transcription and integration systems. Usually these will include the gag and pol proteins derived from the lentivirus.
  • Being derived from a lentivirus, the retroviral vector particles are capable of infecting and transducing non-dividing cells. Thus, the vector particles are able to deliver a selected gene or genes such as therapeutically active genes, to the genome of a target cell. During the infection process, lentiviruses form a pre-integration complex in the target cell cytoplasm containing integrase, core proteins and proviral DNA. The complex is able to pass across the nuclear membrane of the target cell, by means of signal sequences in the proteins. Non-lentiviral retroviruses either lack the proteins or have the proteins but without the appropriate signal sequences.
  • Examples of lentiviruses are HIV-1 and HIV-2, SIV, FIV, BLV, EIAV, CEV and visna virus. Of these, HIV and SIV are presently best understood. However, a non-immunodeficiency virus may be preferred for use in gene therapy because the immunodeficiency viruses inevitably bring with them safety considerations and prejudices.
  • The absence of functional auxiliary genes from the retroviral vector production system means that those functional genes will also be absent from retroviral vector particles produced by the system. Also, any auxiliary proteins that would otherwise be encoded by those genes and incorporated into the vector particles, will be absent from the vector particles. In known retroviral vector production systems, the auxiliary genes may be present as part of the vector genome-encoding DNA, or together with the packaging components. The location of an auxiliary gene in a vector production system depends in part on its relationship with other retroviral components. For example, vif is often part of a gag-pol packaging cassette in a packaging cell. Thus, to remove a functional auxiliary gene for the purposes of the invention may involve its removal from the packaging components, or from the vector genome, or perhaps both.
  • To remove a functional auxiliary gene may not require removal of the gene in its entirety. Usually removal of part of the gene, or disruption of the gene in some other way will be sufficient. The absence of a functional auxiliary gene is understood herein to mean that the gene is not present in a form in which it is capable of encoding the functional auxiliary protein.
  • In a preferred system according to the invention, functional vpr and tat genes or analogous genes normally present in the lentivirus on which the vector particles are based are both absent. These two auxiliary genes are associated with characteristics of lentiviruses which are particularly undesirable for a gene therapy vector. However, other than by the proviso given above, the invention is not limited with regard to the combination of auxiliary genes that are absent. In a system according to the invention for producing HIV-1-base vector particles, any combination of three, or more preferably four, of the genes may be absent in their functional form. Most preferably, all five of the auxiliary genes vpr, vif, tat, nef, and vpu are absent in their functional form. Similarly, for systems concerned Swath other lentiviruses, it is most preferable that all of the auxiliary genes are absent in their functional form (except rev which is preferably present unless replaced by a system analogous to the rev/RRE system).
  • In order to ensure efficient export of RNA transcripts of the vector genome from the nucleus to the cytoplasm, it is preferable to include functional rev and rev response element (RRE) sequences in the vector genome, or to include alternative sequences in the genome which perform the same function as the rev/RRE system. For example, a functional analogue of the rev/RRE system is found in Mason Pfizer monkey virus. This is known as CTE and consists of an RRE-type sequence in the genome which is believed to interact with a factor in the infected cell. The cellular factor can be thought of as a rev analogue. Thus, CTE may be used as an alternative to the rev/RRE system.
  • As will be evident, in order to function as a vector the retroviral vector particles described herein will need to have a reverse transcription system (compatible reverse transcription and primer binding sites) and an integration system (compatible integrase and integration sites) allowing conversion to the provirus and integration of the double-stranded DNA into the target cell genome. Additionally, the vector genome will need to contain a packaging signal. These systems and signals will generally be derived from the lentivirus on which the vector is based. It will be evident that although the vector according to the invention is based on a lentivirus, the elements of the lentivirus incorporated into the vector may be genetically or otherwise altered versions of the elements in the wild type lentivirus. Alterations may be achieved by manipulating either the RNA genome or other components of the retroviral vector particle production system. For example, portions of the lentivirus genome not required for the vector can be excluded. Also, the vector production system can employ substitutes e.g. for the lentivirus env gene, to give the vector a different target cell range (this is known as pseudotyping).
  • A retroviral vector particle according to the invention carries one or more selected genes for delivery to a target cell. The selected genes are chosen according to the effect sought to be achieved. For gene therapy purposes there will be at least one therapeutically active gene encoding a genre product which is active against the condition it is desired to treat or prevent. Additionally there may be a selected gene which acts as a marker by encoding a detectable product. Therapeutic genes may encode for example an antisense RNA, a ribozyme, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen that induces antibodies or helper T-cells or cytotoxic T-cells, a single chain antibody or a tumour suppressor protein.
  • Preferably the construction of the vector genome is such that in the DNA provirus, the therapeutic gene or genes is or are under transcriptional control of the 5′ LTR but not otherwise operably linked to any other promoter from the vector. Thus, expression of the gene or genes is in a single transcription unit. Preferably also the 5′ LTR is a modified lentivirus LTR for which the promoter function is not tat-dependent. This may be achieved by replacing the R and U3 lentivirus promoter functions by alternative promoter functions, which may be derived from another retrovirus or may be of non-retroviral origin. A strategy for this is described in Cannon et al 1996 and in the Examples.
  • It will be evident that the term “gene” is used loosely here, and includes any nucleic acid coding for the desired polypeptide or RNA. Usually, genes delivered by vectors according to the invention will be cDNAs.
  • Retroviral vector particles according to the invention will also be capable of infecting and transducing cells which are slowly-dividing, and which non-lentiviruses such as MLV would not be able to efficiently infect and transduce. Slowly-dividing cells divide once in about every three to four days. Mammalian non-dividing and slowly-dividing cells include brain cells, stem cells, terminally differentiated macrophages, lung epithelial cells and various other cell types. Also included are certain tumour cells. Although tumours contain rapidly dividing cells, some tumour cells especially those in the centre of the tumour, divide infrequently.
  • The DNA construct encoding the vector genome described herein is preferably linked to a high efficiency promoter such as the CMV promoter. Other high efficiency promoters are known. This gives rise to a high level of expression of the vector RNA by the retroviral vector production system.
  • Suitable host or producer cells for use in the retroviral vector production system according to the invention are well known in the art. Many retroviruses have already been split into replication defective genomes and packaging components. For those which have not the technology is available for doing so. The producer cell encodes the viral components not encoded by the vector genome such as the gag, pol and env proteins. The gag, pol and env genes may be introduced into the producer cell and stably integrated into the cell genome to give a packaging cell line. The retroviral vector genome is then introduced-into the packaging cell line by transfection or transduction to create a stable cell line that has all of the DNA sequences required to produce a retroviral vector particle. Another approach is to introduce the different DNA sequences that are required to produce a retroviral vector particle e.g. the env coding sequence, the gag-pol coding sequence and the defective retroviral genome into the cell simultaneously by transient triple transfection. In a preferred system according to the invention, both the structural components and the vector genome will all be encoded by DNA stably integrated into a host cell genome.
  • In the attached figures:
  • FIG. 1 shows a vector production system according to the invention, using a three-plasmid co-transfection of 293T cells;
  • FIG. 2 shows HIV-based vector genomes for use in the invention;
  • FIG. 3 shows HIV-1 gag-pol gene expression plasmids for use in the invention; and
  • FIG. 4 shows transduction efficiencies for vectors according to the invention lacking the five auxiliary factors.
  • To produce a safe HIV packaging system devoid of all unnecessary genes, we have developed a system which does not contain vpr, net, tat, vif or vpu (FIG. 1). The packaging components were placed on three separate plasmids and overlapping sequences were minimised ensuring no recombination and no helper virus production. This HIV vector has been shown to transduce aphidicolin treated non-dividing cells in the absence of vpr. Titers were obtained that are similar to the Naldini et al titers for systems which contain all the auxiliary genes (Naldini et al. 1996a).
  • This is the first minimal lentiviral vector system. The fact that high titers are observed with this system shows that the auxiliary genes (except rev) are redundant for the production of high titers and for the transduction of non-dividing cells. This is contrary to the assumption made by Naldini et al that the reason for the production of high titer virus stocks is due to the incorporation of accessory proteins (such as neo into the viral particle (Naldini et a/1996).
  • The system may have additional advantages for HIV therapy. Replacing the HIV-1 LTR with a different promoter such as a constitutive HCMV promoter permits the use of anti-Tat molecules such as Tat transdominant mutants (Echetebu et al, 1994) or TAR decoys (Lisziewicz et al, 1993) as therapeutic agents as they will not affect vector production.
  • It will be evident that minimal lentiviral vectors: as described herein, lacking all of the wild-type virus auxiliary genes, may also have applications as vaccines.
  • EXAMPLES
  • Materials and Methods
  • Plasmid Construction
  • pGP-RRE1 is a pWI3 (Kim et al., 1989) derived gagpol vif expression plasmid. The RRE of pWI3 (Accession number U26942) was inserted by bunt-ending the Sty I/Sty I fragment (7720-8050) into pBluescript KS+ Sma I cut creating pBSRRE. The Nar I/Eco RI fragment of pWI3 (637-5743) was inserted into pBSRRE cut with Cla I and Eco RI to create pBSGPRRE1. The Xho I/Not I fragment (containing gagpol and RRE) was inserted into the expression plasmid pCI-Neo to create pGR-RRE1. To remove the vif coding region, pBSGPRRE1 was cut with NdeI and SmaI, blunt-ended and was relegated to generate pBSGPRRE2. The gagpol gene and RRE were inserted into pCI-neo in XhoI and NotI site to make pGP-RRE2.
  • The construction of pTIN406, pTIN408 and pTIN414 has been described (Cannon et al., 1996). The 5′ LTR of pH3Z and pH4Z contain a CMV promoter at the U3 position and the HIV R and U5 regions. HIVdge was made from HIVgpt (Page et al., 1990) by blunt-ending the Cla I site (829) to create a frameshift mutation. HIVdge was cut with Bgl II and Pst I (473-1414) and inserted into pTIN406. pTIN406 has an LTR structure of CMV, R (HIV) and U5 (MLV). This created a hybrid LTR containing CMV, and R, U5 from: HIV called pBS5′. To provide the plasmid with rev and RRE the Eco RI/Xho I fragment (5743-8897) was cut from HIVdge1.2 which is a HIVdge derivative containing a deletion from Nde I to Bgl II (6403-7621) and was inserting into pBS5′ to create pBS5′R. The 3′ LTR was provided by inserting the Not I/Xho I fragment of pBS3′ into pBS5′R creating pH2. pBS3′ was created by a three way ligation of the Xho I/Hind III fragment of pWI3, the Hind III/Kpn I fragment of pTIN408 into pBluescript KS+ (Xho I/Kpn I). A CMV promoter was inserted into the unique Xho I site of pH2 from pSPCMV (Sal I/Xho I) making pH2CMV. pSPCMV was created by inserting pLNCX (Accession number M28246) (Pst I/Hind III) into pSP72 (Promega). The β-galactosidase gene was inserted from PTIN414 into pSP72 (Xho I/Sph I) to make pSPlacZ. A Xho I/Sal I digest of pSPlacZ gave the β-galactosidase coding region which was inserted into pH2-CMV to give pH3Z. pH4Z was constructed to create tat-deficient vector. The first 50 bp of the tat-coding region was removed by replacing EcoRI (57433)I-SpeI fragment in pH3 with EcoRI (5881)-SpeI PCR product amplified using PCR primers DELT5 (5′-CGTGAATTCGCCTAAAACTGCTTGTACCA-3′) and DELT3 (5′-GAACTAATGACCCGTAATTG-3′) to create pH4. The Nsi I/Spe I fragment from pH4 was inserted into pH3Z to generate pH4Z.
  • A vpr expression plasmid was constructed by PCR amplification of the vpr coding region from pNL4.3 (Accession number: U26942) using the following primers: 5′ primer GCGAATTCGGATCCACCATGGACAGCCCCAG AAGAC (5563-5583) and 3′ primer GCGAATTCGGATCCTCTAGGATCTACTGGCTCCATT (5834-5853). This amplicon was cloned into pLIGATOR (R & D Systems). The expression plasmid pCI-vpr was made by inserting the Mlu I and Xho I fragment containing the vpr coding region into pCI-Neo (Promega).
  • pAC29.1 was cut by Bam HI to give the VSV-G coding region which was inserted into pSA91 (Bgl II).
  • Cell Lines
  • 293T (293ts/A1609) (DuBridge et al., 1987) cells were maintained in Dulbelco's modified: Eagle's medium (GIBCO), HeLa cells and 208F cells in MEM (GIBCO); all of which containing 10% (v/v) fetal calf serum supplemented with antibiotics.
  • Production and Assays of Vectors
  • Retroviral vector stocks were produced according to our, previously published protocol (Soneoka et al, 1995). Briefly, human kidney, 293T (1.5×106) cells were plated on 10-cm plates and transiently transfected with 15 mg of each plasmid (gag-pol and env expression plasmids together with a vector plasmid) by calcium phosphate DNA precipitation (Chen and Okayama, 1987). The culture supernatants were harvested 36 hours later, filtered through 0.45 mm and either used immediately or frozen at −70° C. Transduction was carried out by adding virus onto target cells for 2 hours, in the presence of 8 mg/ml polybrene followed by the addition of fresh media. 5-bromo-4-chloro-3-indolyly b-D-galactoside (X-Gal) was used to measure the expression of β-galactosidase 48 hours later, as previously described (Soneoka et al., 1995). Titers were obtained by counting the number of lac z (blue foci) forming units per ml (l.f.u./ml). G1/S phase arrested cultures were prepared by adding aphidicolin (5 mg/ml) 24 hours before infection and then daily throughout the experiment.
  • Results
  • HIV Vector Production
  • H3Z (tat positive) and H4Z (tat negative) are HIV-1 based vectors designed to be produced by three plasmid co-transfection into 293T cells (FIG. 2). For efficient packaging by the HIV cores, the vectors Contain the first 778 bases of gag but a frameshift mutation, introduced 40 bp from the ATG start codon, prevents the expression of gag proteins. RRE was included to boost packaging efficiency and rev is expressed from the vector to support the HIV mRNA export. The internal CMV promoter-driven β-galactosidase gene was inserted to serve as a reporter gene. For both the vector genomes transcription is driven by a CMV promoter which has been used to replace the 5′ LTR U3. This makes the vector genome tat independent. Two HIV-1 gagpol constructs were made (FIG. 3); pGP-RRE1 (vif positive) and pGP-RRE2 (vif negative). Since the gagpol genes have been inserted into pCI-neo which is a CMV driven expression plasmid gagpol expression is tat independent pRV67, the VSV glycoprotein construct was used for the pseudotyping. By placing the different genes on different plasmids the probability of generating replication competent virus by recombination could be minimized.
  • Transduction Efficiency of the Vector
  • Replication defective retroviral particles were generated by transient co-transfection of human kidney 293T cells with the three plasmids described above and either used immediately or frozen at −70° C. The different vector constructs were used to produce virus. It was found that the minimal constructs (H4Z and pGP-RRE2) gave comparable titers to that of the vif, vpr, nef and tat positive viruses (Table 1).
  • When the minimal system was tested on various cell lines the titers differed (Table 2). The vectors yielded titers of 3.2×105 l.f.u./ml with polybrene treatment, 9.1×104 l.f.u./ml without polybrene treatment in 293T cells. Also the same vectors, without polybrene, yielded 9.6×103 l.f.u./ml and 8.3×103 l.f.u./ml in HeLa and 208F cells, respectively. These titers are comparable with those obtained by Naldini et al., 1996 (Naldini et al., 1996), which are the highest ones published so far.
  • Effect of vpr on the Transduction of Aphidicolin-Treated Cells
  • To test the effect of vpr on non-dividing cell transduction, vpr was included in the packaging system by co-transfection of pCI-vpr along with pH4Z, pGP-RRE2 and pRV67 plasmids. The transduction efficiencies of the viral particles generated were assayed on growing and growth-arrested 293T cells and HeLa cells (FIG. 4). MLV-derived packaging and transducing vectors (Soneoka, 1995) served as controls. HeLa cells and 293T cells were growth-arrested at G1/S phase by aphidicolin treatment. The minimal HIV vector H4Z was as efficient at transducing G1/S-arrested as proliferating HeLa and 293T cells, whereas the MLV-based-vector was only 0.002% as effective.
  • Vpr-deficient H4Z could transduce the growth-arrested cells as efficiently as vpr-containing vector, suggesting that HIV-1 MA is sufficient for providing the vector with the ability to transduce non-dividing cells.
  • CONCLUSION
  • We have set up an HIV-1 based vector production system, which does not contain vpr, vpu, net, vif and tat based on a three-plasmid co-transfection method. This, vector can transduce proliferating cells with a titer of up to 3.2×105 l.f.u/ml which is comparable to other MLV-based vectors and can easily be increased by concentration using ultracentrifugation (data not shown). No helper virus has been detected (data not shown).
  • This minimal vector has been demonstrated to transduce growth-arrested HeLa cells and 293T cells as efficiently as vpr, vif, nef and tat containing vectors. Therefore it can be concluded that only rev is required for the production of high titer HIV based vectors and that these vectors can transduce non-dividing cells.
  • This is the first report of the construction of a high titer minimal lentiviral vector that can transduce non-dividing cells. The removal of five out of the six auxiliary genes (except rev) and the minimal sequence overlap between the plasmids makes this system the safest one to date for the production of HIV-vectors for gene therapy.
  • FIGURE LEGENDS
  • FIG. 2. HIV vector genomes. The numbers indicate the coordinates from HXB2. HCMV promoter (−597 to −1). HIV sequences (455 to 1415; 5743 (H3Z) or 5881 (H4Z) to 6403; 7621 to 8897; 8897 to 9720) from HXB2. HQMV promoter as an internal promoter (900 bp). Cloning site (XhoI). Backbone; pBluescriptKS+.
  • FIG. 3. HIV-1 gag-pol gene expression plasmids. HIV-1 gagpol coding region and RRE was cloned into pCl-neo (PROMEGA) at XhoI and NotI site.
  • FIG. 4. Transduction of non-dividing cells. Transduction efficiencies of the H4Z vectors were measured by X-gal staining and are shown in Y-axis as l.f.u./ml. G1/S phase arrested cells were prepared by treating the cells with aphidicolin (5 μg/ml).
  • REFERENCES
    • Akkina, R. K., Walton, R. M., Chen, M. L., Li, Q. X., Planelles, V., and Chen, I. S. (1996). J. Virol. 70, 2581-2585.
    • Barillar, G., Gendelman, R., Gallo, R. C., and Ensoli, B. (1993). Proc. Natl. Acad. Sci. U.S.A. 90, 7941-7945.
    • Buchschacher, G. L., Jr. and Panganiban, A. T. (1992). J. Virol. 66, 2731-2739.
    • Bukrinsky, M. I., Haggerty, S., Dempsey, M. P., Sharova, N., Adzhubel, A., Spitz, L., Lewis, P., Goldfarb, D., Emerman, M., and Stevenson, M. (1993). Nature 365, 666-669.
    • Cannon, P. M., Kim, N., Kingsman, S. M., and Kingsman, A. J. (1996). J. Virol. 70, 8234-8240.
    • Chen, C. and Okayama, H. (1987). Mol. Cell Biol. 7, 2745-2752.
    • Echetebu, C. O., H. Rhim, C. H. Herrmann and A. P. Rice. (1994), J. Acquired Immune Defic. Syndrome. 7, 655-664.
    • Ensoli, B., Barillari, G., Salahuddin, S. Z., Gallo, R. C., and Wong Staal, F. (1990). Nature 345, 84-86.
    • Gallay, P., Stitt, V., Mundy, C., Oettinger, M., and Trono, D. (1996). J. Virol. 70, 1027-1032.
    • Heinzinger, N. K., Bukinsky, M. I., Haggerty, S. A., Ragland, A. M., Kewalramani, V., Lee, M. A., Gendelman, H. E., Ratner, L. Stevenson, M., and Emerman, M. (1994). Proc. Natl. Acad. Sci. U.S.A. 91, 7311-7315.
    • Joag, S. V., Stephens, E. B. and Narayan, O. in Fields Virology, Vol 2, 1970-1982 (Lippincott-Raven Publishers).
    • Jowett, J. B., Planelles, V., Poon, B., Shah, N. P., Chen, M. L., and Chen, I. S. (1995). J. Virol. 69, 6304-6313.
    • Kim, S. Y., Byrn, R., Groopman, J., and Baltimore, D. (1989). J. Virol. 63, 3708-3713.
    • Lever, A., Gottlinger, H., Haseltine, W., and Sodroski, J. (1989). J. Virol. 63, 4085-4087.
    • Levy, D. N., L. S. Fernandes, W. V, Williams, and D. B. Weiner (1993), Cell, 72, 541-50.
    • Levy, D. N., Y. Refae; and D. B. Weiner (1995), J. Virol., 69, 1243-52.
    • Lisziewicz, J., D. Sun, J. Smythe, P. Lusso, F. Lori, A. Louie, P. Markham, J. Rossi, M. Reitz and R. C. Gallo (1993), Proc. Natl. Acad. Sci, USA, 90, 8000-4.
    • Mahalingam, S., Coliman, R. G., Patel, M., Monken, C. E., and Srinivasan, A. (1995). Virology 212, 331-339.
    • Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., and Trono, D. (1996). Science 272, 263-267.
    • Naldini, L., Blomer, U., Gage, F. H., Trono, D., and Verma, I. M. (1996). Proc. Natl. Acad. Sci. U.S.A. 93, 11382-11388.
    • Page, K. A., Landau, N. R., and Littman, D. R. (1990). J. Virol. 64, 5270-5276.
    • Poznansky, M., Levet, A., Bergeron, L., Haselfine, W., and Sodroski, J. (1991). J. Virol. 65, 532-536.
    • Richardson, J. H., Kaye, J. F., Child, L. A., and Lever, A. M. (1995). J. Gen. Virol. 76, 691-696.
    • Ross, G., Erickson, R., Knorr, D., Motulsky, A. G., Parkman, R., Samulski, J., Straus, S. E., and Smith, B. R. (1996). Hum. Gene Ther. 7, 1781-1790.
    • Shimada, T., Fujii, H., Mitsuya, H., and Nienhuis, A. W. (1991). J. Clin. Invest 88, 1043-1047.
  • Tomonaga, K. and Mikami, T. (1996). J. General Virol. 77, 1611-1621.
    TABLE 1
    Effects of accessory gene expression on vector titer.
    Accessory genes Plasmids Titer
    Tat Vif Nef Vpr Vector Gagpol Nef Vpr (l.f.u./ml)a
    + + + pH3Z pGP- pCl-Vpr 2.2 × 105
    RRE1
    + + + pH3Z pGP- pC-Nef 2.5 × 105
    RRE1
    + + pH3Z pGP- 4.0 × 105
    RRE1
    + pH3Z pGP- 3.7 × 105
    RRE2
    pH4Z pGP- 4.6 × 105
    RRE2

    aTransduction efficiency was measured in 293T cells by counting the number of blue colonies following X-gal staining 48 hours after transduction and were indicated as lacZ colony forming unit per ml virus stock (l.f.u./ml).
  • TABLE 2
    Transduction efficiency of the minimal
    H4Z vector on various cell lines.
    Titer (l.f.u./ml)a
    Cell line Without polybrene With polybrene
    293T Human kidney 9.1 × 104 3.2 × 105
    HeLa Human epithelium 9.6 × 103 N.D.
    208f Rat fibroblast 8.3 × 103 N.D.

    aTransduction efficiency was measured by counting the number of blue colonies following X-gal staining 48 hours after transduction and were indicated as lacZ colony forming unit per ml virus stock (l.f.u./ml).

Claims (20)

1-19. (canceled)
20. A lentivirus-based retroviral vector production system for producing a replication defective retroviral vector, wherein the retroviral vector production system comprises one or more nucleic acid sequences encoding a genome, gag, pol, and an envelope protein, wherein the retroviral vector production system lacks nucleic acid sequences encoding functional tat, and wherein the retroviral vector production system is capable of producing a replication defective retroviral vector.
21. The retroviral vector production system according to claim 20, wherein tat is absent or disrupted in the vector system and is not functionally expressed in cells.
22. The retroviral vector production system according to claim 20, further comprising a nucleic acid sequence encoding functionally active rev or RRE-type sequences.
23. The retroviral vector production system according to claim 22, wherein at least one RRE-type sequence is a constitutive transport element (CTE).
24. The retroviral vector production system according to claim 23, wherein the CTE is Mason Pfizer monkey virus CTE.
25. The retroviral vector production system according to claim 20, further comprising at least one nucleotide sequence of interest (NOI).
26. The retroviral vector production system according to claim 25, wherein the at least one NOI encodes a therapeutic protein or gene product of interest.
27. A method for producing a replication defective retroviral vector comprising at least one NOI, comprising contacting the retroviral vector production system of claim 25 with a cell, thereby producing the replication defective retroviral vector.
28. An isolated cell comprising the retroviral vector production system of claim 20.
29. A composition comprising the retroviral vector production system of claim 20 and a carrier.
30. The retroviral vector production system according to claim 20, wherein the nucleic acid sequences comprise DNA constructs which encode: (i) the genome, (ii) gag and pol proteins, and (iii) an envelope protein.
31. The retroviral vector production system according to claim 20, wherein the genome comprises an operable promoter.
32. The retroviral vector production system according to claim 31, wherein the promoter is a non-retroviral promoter.
33. The retroviral vector production system according to claim 20, wherein the envelope protein is VSV-G.
34. The retroviral vector production system according to claim 20, wherein the retroviral vector production system is based on HIV-1.
35. A set of isolated nucleic acid sequences encoding the components of the retroviral vector production system according to claim 20, comprising a DNA construct which encodes the genome, a DNA construct which encodes gag and pol proteins, and a DNA construct which encodes an envelope protein.
36. The set of nucleic acid sequences according to claim 35, further comprising a DNA construct which encodes a functionally active rev or RRE-type sequences.
37. The set of nucleic acid sequences according to claim 35, wherein the DNA construct encoding the genome further comprises at least one NOI.
38. A method for producing a replication defective retroviral vector, comprising expressing in a cell the retroviral vector production system according to claim 20, thereby producing the replication defective retroviral vector.
US11/646,041 1996-10-17 2006-12-27 Retroviral vectors Abandoned US20070104690A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US11/646,041 US20070104690A1 (en) 1996-10-17 2006-12-27 Retroviral vectors
US12/286,545 US20090291491A1 (en) 1996-10-17 2008-09-30 Retroviral vectors

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
GB9621680.9 1996-10-17
GBGB9621680.9A GB9621680D0 (en) 1996-10-17 1996-10-17 Lentiviral vectors
GB9624457.9 1996-11-25
GBGB9624457.9A GB9624457D0 (en) 1996-11-25 1996-11-25 Retroviral vectors
US10/661,761 US7198784B2 (en) 1996-10-17 2003-09-11 Retroviral vectors
US11/646,041 US20070104690A1 (en) 1996-10-17 2006-12-27 Retroviral vectors

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/661,761 Continuation US7198784B2 (en) 1996-10-17 2003-09-11 Retroviral vectors

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/286,545 Continuation US20090291491A1 (en) 1996-10-17 2008-09-30 Retroviral vectors

Publications (1)

Publication Number Publication Date
US20070104690A1 true US20070104690A1 (en) 2007-05-10

Family

ID=38003966

Family Applications (3)

Application Number Title Priority Date Filing Date
US10/661,761 Expired - Fee Related US7198784B2 (en) 1996-10-17 2003-09-11 Retroviral vectors
US11/646,041 Abandoned US20070104690A1 (en) 1996-10-17 2006-12-27 Retroviral vectors
US12/286,545 Abandoned US20090291491A1 (en) 1996-10-17 2008-09-30 Retroviral vectors

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/661,761 Expired - Fee Related US7198784B2 (en) 1996-10-17 2003-09-11 Retroviral vectors

Family Applications After (1)

Application Number Title Priority Date Filing Date
US12/286,545 Abandoned US20090291491A1 (en) 1996-10-17 2008-09-30 Retroviral vectors

Country Status (1)

Country Link
US (3) US7198784B2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011043830A3 (en) * 2009-10-09 2011-06-16 New York University Methods, agents and peptides for inducing an innate immune response in hiv vaccination

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7198784B2 (en) * 1996-10-17 2007-04-03 Oxford Biomedica (Uk) Limited Retroviral vectors
JP5324912B2 (en) * 2005-03-08 2013-10-23 モルメド エスピーエー HIVVif mutant
JP5121405B2 (en) * 2007-11-13 2013-01-16 株式会社小松製作所 Engine control device for construction machinery
CA2705862C (en) 2007-11-16 2018-03-27 San Diego State University Research Foundation Compositions and method for manipulating pim-1 activity in circulatory system cells
US8735082B2 (en) 2008-11-10 2014-05-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Gene signature for predicting prognosis of patients with solid tumors
US9150926B2 (en) 2010-12-06 2015-10-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Diagnosis and treatment of adrenocortical tumors using human microRNA-483
WO2012158561A1 (en) 2011-05-13 2012-11-22 The United States Of America As Represented By The Secretary, Dept. Of Health And Human Services Use of zscan4 and zscan4-dependent genes for direct reprogramming of somatic cells
EP2568289A3 (en) 2011-09-12 2013-04-03 International AIDS Vaccine Initiative Immunoselection of recombinant vesicular stomatitis virus expressing hiv-1 proteins by broadly neutralizing antibodies
US9402894B2 (en) 2011-10-27 2016-08-02 International Aids Vaccine Initiative Viral particles derived from an enveloped virus
GB201202516D0 (en) 2012-02-13 2012-03-28 Ucl Business Plc Materials and methods relating to packaging cell lines
US9347065B2 (en) 2012-03-29 2016-05-24 International Aids Vaccine Initiative Methods to improve vector expression and genetic stability
NZ751639A (en) 2013-03-15 2021-07-30 Elixirgen Therapeutics Inc Methods of using zscan4 for rejuvenating human cells
GB201318804D0 (en) 2013-10-24 2013-12-11 Adaptimmune Ltd Vectors for transgene expression
US10801070B2 (en) 2013-11-25 2020-10-13 The Broad Institute, Inc. Compositions and methods for diagnosing, evaluating and treating cancer
US11725237B2 (en) 2013-12-05 2023-08-15 The Broad Institute Inc. Polymorphic gene typing and somatic change detection using sequencing data
WO2015095811A2 (en) 2013-12-20 2015-06-25 The Board Institute Inc. Combination therapy with neoantigen vaccine
US10993997B2 (en) 2014-12-19 2021-05-04 The Broad Institute, Inc. Methods for profiling the t cell repertoire
EP3234193B1 (en) 2014-12-19 2020-07-15 Massachusetts Institute of Technology Molecular biomarkers for cancer immunotherapy
US20180271891A1 (en) 2015-03-11 2018-09-27 The Broad Institute Inc. Selective treatment of prmt5 dependent cancer
IL302102A (en) 2015-05-20 2023-06-01 Dana Farber Cancer Inst Inc Shared neoantigens
TW202241500A (en) 2015-06-09 2022-11-01 美商博德研究所有限公司 Formulations for neoplasia vaccines and methods of preparing thereof
AU2017254477A1 (en) 2016-04-18 2018-11-01 Jennifer G. ABELIN Improved HLA epitope prediction
WO2018140391A1 (en) 2017-01-24 2018-08-02 The Broad Institute, Inc. Compositions and methods for detecting a mutant variant of a polynucleotide
ES2965475T3 (en) 2017-02-12 2024-04-15 Biontech Us Inc HLA-based methods and compositions and uses thereof
US20210382068A1 (en) 2018-10-02 2021-12-09 Dana-Farber Cancer Institute, Inc. Hla single allele lines
CN112912518A (en) 2018-10-15 2021-06-04 再生生物股份有限公司 Methods for measuring infectivity of replication-defective viral vectors and viruses
US20220062394A1 (en) 2018-12-17 2022-03-03 The Broad Institute, Inc. Methods for identifying neoantigens
WO2020132586A1 (en) 2018-12-21 2020-06-25 Neon Therapeutics, Inc. Method and systems for prediction of hla class ii-specific epitopes and characterization of cd4+ t cells
JP2024501482A (en) 2020-12-14 2024-01-12 ビオンテック ユーエス インコーポレイテッド Tissue-specific antigens for cancer immunotherapy
WO2024015892A1 (en) 2022-07-13 2024-01-18 The Broad Institute, Inc. Hla-ii immunopeptidome methods and systems for antigen discovery

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5554524A (en) * 1993-02-17 1996-09-10 Wisconsin Alumni Research Foundation More complex type retroviruses having mixed type LTR, and uses thereof
US5585263A (en) * 1994-05-20 1996-12-17 University Of Alabama At Birmingham Research Foundation Purified retroviral constitutive transport enhancer and its use to facilitate mRNA transport, and to produce recombinant, attenuated HIV
US5650309A (en) * 1995-05-16 1997-07-22 The Regents Of The University Of California Viral vectors
US5665577A (en) * 1989-02-06 1997-09-09 Dana-Farber Cancer Institute Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
US5739118A (en) * 1994-04-01 1998-04-14 Apollon, Inc. Compositions and methods for delivery of genetic material
US5981505A (en) * 1993-01-26 1999-11-09 The Trustees Of The University Of Pennsylvania Compositions and methods for delivery of genetic material
US5994136A (en) * 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US6013516A (en) * 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
US6033672A (en) * 1996-03-15 2000-03-07 University Of Southern California Method of stimulating an immune response to caprine arthritis-encephalitis virus (CAEV) in humans through the administration of CAEV immunogens
US6200575B1 (en) * 1996-03-07 2001-03-13 Neovacs Non-toxic immunogens derived from a retroviral regulatory protein antibodies preparation process and pharmaceutical compositions comprising them
US6312682B1 (en) * 1996-10-17 2001-11-06 Oxford Biomedica Plc Retroviral vectors
US6326007B1 (en) * 1995-07-20 2001-12-04 The Regents Of The University Of California Attenuated lentivirus vectors expressing interferon
US6468539B1 (en) * 1994-09-07 2002-10-22 Universite De Montreal Protein targeting into HIV virions based on HIV-1 VPR fusion molecules
US7198784B2 (en) * 1996-10-17 2007-04-03 Oxford Biomedica (Uk) Limited Retroviral vectors

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU6170486A (en) 1985-08-23 1987-02-26 Advanced Genetics Research Institute Defective viral vaccines
CA2084659A1 (en) 1990-06-20 1991-12-21 Joseph G. Sodroski Vectors containing hiv packaging sequences, packaging defective hiv vectors, and uses thereof
WO1992021750A1 (en) 1991-05-29 1992-12-10 THE UNITED STATES OF AMERICA, represented by THE SCRETARY, DEPARTMENT OF HEALTH & HUMAN SERVICES Eukaryotic expression vectors with regulation of rna processing
EP0759471A4 (en) 1994-05-10 1997-10-15 Hisamitsu Pharmaceutical Co Recombinant human immunodeficiency virus vector and process for producing the same
WO1997014809A2 (en) 1995-10-16 1997-04-24 Dana-Farber Cancer Institute Novel expression vectors and methods of use
JP3623400B2 (en) * 1998-07-13 2005-02-23 株式会社東芝 Semiconductor device and manufacturing method thereof
US7419829B2 (en) * 2000-10-06 2008-09-02 Oxford Biomedica (Uk) Limited Vector system

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5665577A (en) * 1989-02-06 1997-09-09 Dana-Farber Cancer Institute Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
US5981505A (en) * 1993-01-26 1999-11-09 The Trustees Of The University Of Pennsylvania Compositions and methods for delivery of genetic material
US5554524A (en) * 1993-02-17 1996-09-10 Wisconsin Alumni Research Foundation More complex type retroviruses having mixed type LTR, and uses thereof
US5739118A (en) * 1994-04-01 1998-04-14 Apollon, Inc. Compositions and methods for delivery of genetic material
US5585263A (en) * 1994-05-20 1996-12-17 University Of Alabama At Birmingham Research Foundation Purified retroviral constitutive transport enhancer and its use to facilitate mRNA transport, and to produce recombinant, attenuated HIV
US6468539B1 (en) * 1994-09-07 2002-10-22 Universite De Montreal Protein targeting into HIV virions based on HIV-1 VPR fusion molecules
US5650309A (en) * 1995-05-16 1997-07-22 The Regents Of The University Of California Viral vectors
US6326007B1 (en) * 1995-07-20 2001-12-04 The Regents Of The University Of California Attenuated lentivirus vectors expressing interferon
US6013516A (en) * 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
US6200575B1 (en) * 1996-03-07 2001-03-13 Neovacs Non-toxic immunogens derived from a retroviral regulatory protein antibodies preparation process and pharmaceutical compositions comprising them
US6033672A (en) * 1996-03-15 2000-03-07 University Of Southern California Method of stimulating an immune response to caprine arthritis-encephalitis virus (CAEV) in humans through the administration of CAEV immunogens
US6312682B1 (en) * 1996-10-17 2001-11-06 Oxford Biomedica Plc Retroviral vectors
US6669936B2 (en) * 1996-10-17 2003-12-30 Oxford Biomedica (Uk) Limited Retroviral vectors
US7198784B2 (en) * 1996-10-17 2007-04-03 Oxford Biomedica (Uk) Limited Retroviral vectors
US6165782A (en) * 1997-12-12 2000-12-26 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US6428953B1 (en) * 1997-12-12 2002-08-06 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US5994136A (en) * 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011043830A3 (en) * 2009-10-09 2011-06-16 New York University Methods, agents and peptides for inducing an innate immune response in hiv vaccination
US20110159025A1 (en) * 2009-10-09 2011-06-30 Dan Littman Methods, agents and peptides for inducing an innate immune response in HIV vaccination
US9358281B2 (en) 2009-10-09 2016-06-07 New York University Methods, agents and peptides for inducing an innate immune response in HIV vaccination

Also Published As

Publication number Publication date
US7198784B2 (en) 2007-04-03
US20090291491A1 (en) 2009-11-26
US20040086488A1 (en) 2004-05-06

Similar Documents

Publication Publication Date Title
US6669936B2 (en) Retroviral vectors
US7198784B2 (en) Retroviral vectors
US5665577A (en) Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
US6235522B1 (en) Lentiviral vectors
Wagner et al. Rev-independent expression of synthetic gag-pol genes of human immunodeficiency virus type 1 and simian immunodeficiency virus: implications for the safety of lentiviral vectors
US5981276A (en) Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
Poeschla et al. Development of HIV vectors for anti-HIV gene therapy.
ES2343564T3 (en) EIAV VECTORS WITH OPTIMIZED CODONS.
Klimatcheva et al. Lentiviral vectors and gene therapy
US20020123471A1 (en) Lentivirus based vector and vector system
Chang et al. The molecular genetics of lentiviral vectors-current and future perspectives
US7608422B2 (en) Simian immunodeficiency virus (SIV) molecular clone encoding mutant gag gene lacking inhibitory/instability regions
Pandya et al. Lentivirus and foamy virus vectors: novel gene therapy tools
EP1246913B1 (en) Molecular clones with mutated hiv gag/pol, siv gag and siv env genes
US20120034693A1 (en) Recombinant vector and use in gene therapy
Sadaie et al. HIV-derived lentiviral vectors: current progress toward gene therapy and DNA vaccination
Kingsman et al. Minimal Requirement for a Lentivirus Vector
Trono et al. Lentiviral Vectors for Gene Delivery in the Nervous System
Brady et al. High-Titer Human Immunodeficiency Virus

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION