US20050070491A1 - Immunostimulatory nucleic acid molecules - Google Patents

Immunostimulatory nucleic acid molecules Download PDF

Info

Publication number
US20050070491A1
US20050070491A1 US10/613,916 US61391603A US2005070491A1 US 20050070491 A1 US20050070491 A1 US 20050070491A1 US 61391603 A US61391603 A US 61391603A US 2005070491 A1 US2005070491 A1 US 2005070491A1
Authority
US
United States
Prior art keywords
nucleic acid
acid molecule
subject
cpg
immunostimulatory nucleic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/613,916
Inventor
Arthur Krieg
Joel Kline
Dennis Klinman
Alfred Steinberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Iowa Research Foundation UIRF
US Department of Health and Human Services
Original Assignee
University of Iowa Research Foundation UIRF
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=24968901&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20050070491(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from US08/386,063 external-priority patent/US6194388B1/en
Application filed by University of Iowa Research Foundation UIRF, US Department of Health and Human Services filed Critical University of Iowa Research Foundation UIRF
Priority to US10/613,916 priority Critical patent/US20050070491A1/en
Assigned to UNIVERSITY OF IOWA RESEARCH FOUNDATION reassignment UNIVERSITY OF IOWA RESEARCH FOUNDATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KRIEG, ARTHUR M.
Publication of US20050070491A1 publication Critical patent/US20050070491A1/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF IOWA
Abandoned legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/47064-Aminoquinolines; 8-Aminoquinolines, e.g. chloroquine, primaquine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10Antimycotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/17Immunomodulatory nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • oligonucleotides Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen. 1991.
  • Lymphocyte ODN uptake has been shown to be regulated by cell activation.
  • Spleen cells stimulated with the B cell mitogen LPS had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen Con A showed enhanced ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling, M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg. 1991. “Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible”. Antisense Research and Development 1:161).
  • poly (I,C) which is a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity
  • I,C a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity
  • Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace “B cell differentiation factors” (Feldbush, T. L., and Z. K. Ballas. 1985. “Lymphokine-like activity of 8-mercaptoguanosine: induction of T and B cell differentiation”. J. Immunol. 134:3204; and Goodman, M. G. 1986. “Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine”. J. Immunol. 136:3335).
  • 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTL (Feldbush, T. L., 1985. cited supra), augment murine NK activity (Koo, G. C., M. E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988. “Activation of murine natural killer cells and macrophages by 8-bromoguanosine”. J. Immunol. 140:3249), and synergize with IL-2 in inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas. 1990. “Lymphokine-activated killer (LAK) cells.
  • CREB cAMP response element binding protein
  • ATF activating transcription factor
  • CREB/ATF family of transcription factors is a ubiquitously expressed class of transcription factors of which 11 members have so far been cloned (reviewed in de Groot, R. P., and P. Sassone-Corsi: “Hormonal control of gene expression: Multiplicity and versatility of cyclic adenosine 3′,5′-monophosphate-responsive nuclear regulators”. Mol. Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson: “Transcriptional regulation by CREB and its relatives”. Biochim. Biophys. Acta 1174:221, 1993.).
  • bZip basic region/leucine zipper
  • All cells appear to express one or more CREB/ATF proteins, but the members expressed and the regulation of mRNA splicing appear to be tissue-specific. Differential splicing of activation domains can determine whether a particular CREB/ATF protein will be a transcriptional inhibitor or activator. Many CREB/ATF proteins activate viral transcription, but some splicing variants which lack the activation domain are inhibitory.
  • CREB/ATF proteins can bind DNA as homo- or hetero-dimers through the cAMP response element, the CRE, the consensus form of which is the unmethylated sequence TGACGTC (binding is abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W. Schaffner: “CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation”. Genes & Develop. 3:612, 1989.).
  • CREB/ATF proteins appear to regulate the expression of multiple genes through the CRE including immunologically important genes such as fos, jun B, Rb-1, IL-6, IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron: “Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1 ⁇ gene”. Mol. Cell.
  • Ehrlich “Binding of AP-1/CREB proteins and of MDBP to contiguous sites downstream of the human TGF-B1 gene”. Biochim. Biophys. Acta 1219:55, 1994.), TGF- ⁇ 2, class II MHC (Cox, P. M., and C. R. Goding: “An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DRa promoter and activation by SV40 T-antigen”. Nucl. Acids Res. 20:4881, 1992.), E-selectin, GM-CSF, CD-8 ⁇ , the germline Ig ⁇ constant region gene, the TCR V ⁇ gene, and the proliferating cell nuclear antigen (Huang, D., P. M.
  • Activation of CREB through the cyclic AMP pathway requires protein kinase A (PKA), which phosphorylates CREB 341 on ser 133 and allows it to bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman: “Nuclear protein CBP is a coactivator for the transcription factor CREB”. Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X.
  • PKA protein kinase A
  • CBP basal transcription factor
  • TFIIB basal transcription factor
  • CREB also has been reported to interact with dTAFII 110, a TATA binding protein-associated factor whose binding may regulate transcription (Ferreri, K., G. Gill, and M. Montminy: “The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex”. Proc. Natl. Acad. Sci. USA 91:1210, 1994.).
  • CREB/ATF proteins can specifically bind multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbader, and C.-Y. Chen: “Identification of multiple nuclear factors that interact with cyclic adenosine 3′,5′-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions”. Mol. Endocrinol. 5:256, 1991) but the biologic significance of most of these interactions is unknown.
  • CREB is normally thought to bind DNA either as a homodimer or as a heterodimer with several other proteins.
  • CREB monomers constitutively activate transcription Krajewski, W., and K. A. W. Lee: “A monomeric derivative of the cellular transcription factor CREB functions as a constitutive activator”. Mol. Cell. Biol. 14:7204, 1994).
  • cytomegalovirus immediate early promoter one of the strongest known mammalian promoters, contains eleven copies of the CRE which are essential for promoter function (Chang, Y.-N., S. Crawford, J. Stall, D. R. Rawlins, K.-T. Jeang, and G. S. Hayward: “The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements”. J. Virol. 64:264, 1990).
  • At least some of the transcriptional activating effects of the adenovirus E1 A protein, which induces many promoters, are due to its binding to the DNA binding domain of the CREB/ATF protein, ATF-2, which mediates E1 A inducible transcription activation (Liu, F., and M. R. Green: “Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains”. Nature 368:520, 1994). It has also been suggested that E1A binds to the CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M. Livingston, and R.
  • HTLV-1 Human T lymphotropic virus-I
  • Tax the retrovirus which binds to CREB/ATF proteins and redirects them from their normal cellular binding sites to different DNA sequences (flanked by G- and C-rich sequences) present within the HTLV transcriptional enhancer
  • the instant invention is based on the finding that certain nucleic acids containing unmethylated cytosine-guanine (CpG) dinucleotides activate lymphocytes in a subject and redirect a subject's immune response from a Th2 to a Th1 (e.g. by inducing monocytic cells and other cells to produce Th1 cytokines, including IL-12, IFN- ⁇ and GM-CSF).
  • CpG cytosine-guanine
  • the immunostimulatory nucleic acid contains a consensus mitogenic CpG motif represented by the formula: 5 ′X 1 CGX 2 3′ wherein X 1 is selected from the group consisting of A,G and T; and X 2 is C or T.
  • an immunostimulatory nucleic acid molecule contains a consensus mitogenic CpG motif represented by the formula: 5 ′ X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated; and X 1 , X 2 , X 3 and X 4 are nucleotides.
  • X 1 X 2 is selected from the group consisting of GpT, GpG, GpA and ApA and/or X 3 X 4 is selected from the group consisting of TpT, CpT and GpT (Table 5).
  • CpG containing immunostimulatory nucleic acid molecules are preferably in the range of 8 to 40 base pairs in size.
  • nucleic acids of any size are immunostimulatory if sufficient immunostimulatory motifs are present, since such larger nucleic acids are degraded into oligonucleotides inside of cells.
  • Preferred synthetic oligonucleotides do not include a GCG trinucleotide sequence at or near the 5′ and/or 3′ terminals and/or the consensus mitogenic CpG motif is not a palindrome.
  • Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides.
  • the invention features useful therapies, which are based on the immunostimulatory activity of the nucleic acid molecules.
  • the immunostimulatory nucleic acid molecules can be used to treat, prevent or ameliorate an immune system deficiency (e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject).
  • an immune system deficiency e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject.
  • immunostimulatory nucleic acid molecules can be administered to stimulate a subject's response to a vaccine.
  • the instant claimed nucleic acid molecules can be administered to treat or prevent the symptoms of asthma.
  • the instant claimed nucleic acid molecules can be administered in conjunction with a particular allergen to a subject as a type of desensitization therapy to treat or prevent the occurrence of an allergic reaction.
  • immunostimulatory nucleic acid molecules to induce leukemic cells to enter the cell cycle supports the use of immunostimulatory nucleic acid molecules in treating leukemia by increasing the sensitivity of chronic leukemia cells and then administering conventional ablative chemotherapy, or combining the immunostimulatory nucleic acid molecules with another immunotherapy.
  • FIG. 1A -C are graphs plotting dose-dependent IL-6 production in response to various DNA sequences in T cell depleted spleen cell cultures.
  • ODN phosphodiester oligodeoxynucleotide
  • SEQ ID NO:1 ATGGAAGGTCCAGTGTTCTC 3′
  • CpG ODN 5′ ATCGACCTACGTGCGTTCTC 3′
  • SEQ ID NO:3 5′ TCCATAACGTTCCTGATGCT 3′
  • FIG. 2 is a graph plotting IL-6 production induced by CpG DNA in vivo as determined 1-8 hrs after injection. Data represent the mean from duplicate analyses of sera from two mice.
  • BALB/c mice two mice/group were injected iv. with 100 ⁇ l of PBS ( ⁇ ) or 200 ⁇ g of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) ( ⁇ ) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) ( ⁇ ).
  • FIG. 3 is an autoradiograph showing IL-6 mRNA expression as determined by reverse transcription polymerase chain reaction in liver, spleen, and thymus at various time periods after in vivo stimulation of BALB/c mice (two mice/group) injected iv with 100 ⁇ L of PBS, 200 ⁇ g of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8).
  • FIG. 4A is a graph plotting dose-dependent inhibition of CpG-induced IgM production by anti-IL-6.
  • Splenic B-cells from DBA/2 mice were stimulated with CpG ODN 5′ TCCAAGACGTTCCTGATGCT 3′ (SEQ ID NO:9) in the presence of the indicated concentrations of neutralizing anti-IL-6 ( ⁇ ) or isotype control Ab ( ⁇ ) and IgM levels in culture supernatants determined by ELISA.
  • neutralizing anti-IL-6
  • isotype control Ab
  • IgM levels in culture supernatants determined by ELISA.
  • the anti-IL-6 Ab had no effect on IgM secretion ( ⁇ ).
  • FIG. 4B is a graph plotting the stimulation index of CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) ( ⁇ ) or anti-IL-6 antibody only ( ⁇ ). Data present the mean ⁇ standard deviation of triplicates.
  • FIG. 5 is a bar graph plotting chloramphenicol acetyltransferase (CAT) activity in WEHI-231 cells transfected with a promoter-less CAT construct (pCAT), positive control plasmid (RSV), or IL-6 promoter-CAT construct alone or cultured with CpG 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) phosphorothioate ODN at the indicated concentrations. Data present the mean of triplicates.
  • FIG. 6 is a schematic overview of the immune effects of the immunostimulatory unmethylated CpG containing nucleic acids, which can directly activate both B cells and monocytic cells (including macrophages and dendritic cells) as shown.
  • the immunostimulatory oligonucleotides do not directly activate purified NK cells, but render them competent to respond to IL-12 with a marked increase in their IFN- ⁇ production.
  • the immunostimulatory nucleic acids promote a Th1 type immune response. No direct activation of proliferation of cytokine secretion by highly purified T cells has been found. However, the induction of Th1 cytokine secretion by the immunostimulatory oligonucleotides promotes the development of a cytotoxic lymphocyte response.
  • FIG. 7 is an autoradiograph showing NFKB mRNA induction in monocytes treated with E. coli (EC) DNA (containing unmethylated CpG motifs), control (CT) DNA (containing no unmethylated CpG motifs) and lipopolysaccharide (LPS) at various measured times, 15 and 30 minutes after contact.
  • E. coli E. coli
  • CT control
  • LPS lipopolysaccharide
  • FIG. 8A shows the results from a flow cytometry study using mouse B cells with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species.
  • the dye only sample in Panel A of the figure shows the background level of cells positive for the dye at 28.6%.
  • This level of reactive oxygen species was greatly increased to 80% in the cells treated for 20 minutes with PMA and ionomycin, a positive control (Panel B).
  • the cells treated with the CpG oligo (TCCATGACGTTCCTGACGTT SEQ ID NO:10) also showed an increase in the level of reactive oxygen species such that more than 50% of the cells became positive (Panel D).
  • FIG. 8B shows the results from a flow cytometry study using mouse B cells in the presence of chloroquine with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. Chloroquine slightly lowers the background level of reactive oxygen species in the cells such that the untreated cells in Panel A have only 4.3% that are positive. Chloroquine completely abolishes the induction of reactive oxygen species in the cells treated with CpG DNA (Panel B) but does not reduce the level of reactive oxygen species in the cells treated with PMA and ionomycin (Panel E).
  • FIG. 9 is a graph plotting lung lavage cell count over time.
  • the graph shows that when the mice are initially injected with Schistosoma mansoni eggs “egg”, which induces a Th2 immune response, and subsequently inhale Schistosoma mansoni egg antigen “SEA” (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given CpG oligo (SEQ ID NO:10) along with egg, the inflammatory cells in the lung are not increased by subsequent inhalation of SEA (open triangles).
  • FIG. 10 is a graph plotting lung lavage eosinophil count over time. Again, the graph shows that when the mice are initially injected with egg and subsequently inhale SEA (open circle), many eosinophils are present in the lungs. However, when the mice are initially given CpG oligo (SEQ ID NO:10) along with egg, the inflammatory cells in the lung are not increased by subsequent inhalation of the SEA (open triangles).
  • FIG. 11 is a bar graph plotting the effect on the percentage of macrophage, lymphocyte, neutrophil and eosinophil cells induced by exposure to saline alone; egg, then SEA; egg and SEQ ID NO:11, then SEA; and egg and control oligo (SEQ ID NO:11), then SEA.
  • mice are treated with the control oligo at the time of the initial exposure to the egg, there is little effect on the subsequent influx of eosinophils into the lungs after inhalation of SEA.
  • mice inhale the eggs on days 14 or 21 they develop an acute inflammatory response in the lungs.
  • giving a CpG oligo along with the eggs at the time of initial antigen exposure on days 0 and 7 almost completely abolishes the increase in eosinophils when the mice inhale the egg antigen on day 14.
  • FIG. 12 is a bar graph plotting eosinophil count in response to injection of various amounts of the protective oligo SEQ ID NO:10.
  • FIG. 13 is a graph plotting interleukin 4 (IL-4) production (pg/ml) in mice over time in response to injection of egg, then SEA (open diamond); egg and SEQ ID NO:10, then SEA (open circle); or saline, then saline (open square).
  • the graph shows that the resultant inflammatory response correlates with the levels of the Th2 cytokine IL-4 in the lung.
  • FIG. 14 is a bar graph plotting interleukin 12 (IL-12) production (pg/ml) in mice over time in response to injection of saline; egg, then SEA; or SEQ ID NO: 0 and egg, then SEA.
  • the graph shows that administration of an oligonucleotide containing an umethylated CpG motif can actually redirect the cytokine response of the lung to production of IL-12, indicating a Th1 type of immune response.
  • IL-12 interleukin 12
  • FIG. 15 is a bar graph plotting interferon gamma (IFN- ⁇ ) production (pg/ml) in mice over time in response to injection of saline; egg, then saline; or SEQ ID NO:10 and egg, then SEA.
  • the graph shows that administration of an oligonucleotide containing an unmethylated CpG motif can also redirect the cytokine response of the lung to production of IFN- ⁇ , indicating a Th1 type of immune response.
  • allergen refers to a substance that can induce an allergic or asthmatic response in a susceptible subject.
  • the list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores and drugs (e.g. penicillin).
  • Examples of natural, animal and plant allergens include proteins specific to the following genera: Canine ( Canis familiaris ); Dermatophagoides (e.g. Dermatophagoides farinae ); Felis ( Felis domesticus ); Ambrosia ( Ambrosia artemiisfolia; Lolium (e.g.
  • Lolium perenne or Lolium multiflorum Cryptomeria ( Cryptomeria japonica ); Alternaria ( Alternaria alternata ); Alder; Alnus ( Alnus gultinosa ); Betula ( Betula verrucosa ); Quercus ( Quercus alba ); Olea ( Olea europa ); Artemisia ( Artemisia vulgaris ); Plantago (e.g. Plantago lanceolata ); Parietaria (e.g. Parietaria officinalis or Parietaria judaica ); Blattella (e.g. Blattella germanica ); Apis (e.g. Apis multiflorum ); Cupressus (e.g.
  • Juniperus e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei ); Thuya (e.g. Thuya orientalis ); Chamaecyparis (e.g. Chamaecyparis obtusa ); Periplaneta (e.g. Periplaneta americana ); Agropyron (e.g. Agropyron repens ); Secale (e.g. Secale cereale ); Triticum (e.g. Triticum aestivum ); Dactylis (e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei ); Thuya (e.g. Thuya orientalis ); Chamaecyparis (e.g. Chamaecyparis obtusa ); Periplaneta (e.g. Periplaneta americana
  • Avena e.g. Avena sativa
  • Holcus e
  • Allergic conditions include eczema, allergic rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions.
  • Asthma refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms.
  • an “immune system deficiency” shall mean a disease or disorder in which the subject's immune system is not functioning in normal capacity or in which it would be useful to boost a subject's immune response for example to eliminate a tumor or cancer (e.g. tumors of the brain, lung (e.g. small cell and non-small cell), ovary, breast, prostate, colon, as well as other carcinomas and sarcomas) or an infection in a subject.
  • a tumor or cancer e.g. tumors of the brain, lung (e.g. small cell and non-small cell), ovary, breast, prostate, colon, as well as other carcinomas and sarcomas
  • an infection in a subject e.g. tumors of the brain, lung (e.g. small cell and non-small cell), ovary, breast, prostate, colon, as well as other carcinomas and sarcomas
  • Retroviridae e.g., human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses),
  • infectious bacteria examples include: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria spp. (e.g., M tuberculosis, M. avium, M. intracellulare, M.
  • infectious fungi examples include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans .
  • Other infectious organisms i.e., protists
  • Plasmodium falciparum and Toxoplasma gondii examples include: Plasmodium falciparum and Toxoplasma gondii.
  • an “immunostimulatory nucleic acid molecule” refers to a nucleic acid molecule, which contains an unmethylated cytosine, guanine dinucleotide sequence (i.e. “CpG DNA” or DNA containing a cytosine followed by guanosine and linked by a phosphate bond) and stimulates (e.g. has a mitogenic effect on, or induces or increases cytokine expression by) a vertebrate lymphocyte.
  • An immunostimulatory nucleic acid molecule can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules have increased immune activity.
  • the immunostimulatory nucleic acid contains a consensus mitogenic CpG motif represented by the formula: 5 ′ X 1 CGX 2 3′ wherein X 1 is selected from the group consisting of A,G and T; and X 2 is C or T.
  • immunostimulatory nucleic acid molecules are between 2 to 100 base pairs in size and contain a consensus mitogenic CpG motif represented by the formula: 5 ′ X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 , X 2 , X 3 and X 4 are nucleotides.
  • the immunostimulatory CpG DNA is in the range of between 8 to 40 base pairs in size if it is synthesized as an oligonucleotide.
  • CpG dinucleotides can be produced on a large scale in plasmids, which after being administered to a subject are degraded into oligonucleotides.
  • Preferred immunostimulatory nucleic acid molecules e.g. for use in increasing the effectiveness of a vaccine or to treat an immune system deficiency by stimulating an antibody [humoral] response in a subject
  • the stimulation index of a particular immunostimulatory CpG DNA can be tested in various immune cell assays.
  • the stimulation index of the immunostimulatory CpG DNA with regard to B-cell proliferation is at least about 5, preferably at least about 10, more preferably at least about 15 and most preferably at least about 20 as determined by incorporation of 3 H uridine in a murine B cell culture, which has been contacted with a 20 ⁇ M of ODN for 20 h at 37° C. and has been pulsed with 1 ⁇ Ci of 3 H uridine; and harvested and counted 4 h later as described in detail in Example 1.
  • the immunostimulatory CpG DNA be capable of effectively inducing cytokine secretion by monocytic cells and/or Natural Killer (NK) cell lytic activity.
  • Preferred immunostimulatory CpG nucleic acids should effect at least about 500 pg/ml of TNF- ⁇ , 15 pg/ml IFN- ⁇ , 70 pg/ml of GM-CSF, 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the therapeutic indication, as determined by the assays described in Example 12.
  • Other preferred immunostimulatory CpG DNAs should effect at least about 10%, more preferably at least about 15% and most preferably at least about 20% YAC-1 cell specific lysis or at least about 30, more preferably at least about 35 and most preferably at least about 40% 2C11 cell specific lysis as determined by the assay described in detail in Example 4.
  • nucleic acid or “DNA” shall mean multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)).
  • cytosine (C), thymine (T) or uracil (U) or a substituted purine (e.g. adenine (A) or guanine (G)
  • the term refers to ribonucleotides as well as oligodeoxyribonucleotides.
  • the term shall also include polynucleosides (i.e.
  • Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g. genomic or cDNA), but are preferably synthetic (e.g. produced by oligonucleotide synthesis).
  • nucleic acid delivery complex shall mean a nucleic acid molecule associated with (e.g. ionically or covalently bound to; or encapsulated within) a targeting means (e.g. a molecule that results in higher affinity binding to target cell (e.g. B-cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells).
  • a targeting means e.g. a molecule that results in higher affinity binding to target cell (e.g. B-cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells.
  • nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g. cholesterol), a lipid (e.g. a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g. a ligand recognized by target cell specific receptor).
  • Preferred complexes must be sufficiently stable in vivo to prevent significant uncoupling prior to internalization by the target
  • “Palindromic sequence” shall mean an inverted repeat (i.e. a sequence such as ABCDEE′D′C′B′A′ in which A and A′ are bases capable of forming the usual Watson-Crick base pairs. In vivo, such sequences may form double stranded structures.
  • a “stabilized nucleic acid molecule” shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Stabilization can be a function of length or secondary structure. Unmethylated CpG containing nucleic acid molecules that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter immunostimulatory nucleic acid molecules, secondary structure can stabilize and increase their effect. For example, if the 3′ end of a nucleic acid molecule has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop sturcture, then the nucleic acid molecule becomes stabilized and therefore exhibits more activity.
  • Preferred stabilized nucleic acid molecules of the instant invention have a modified backbone.
  • especially preferred stabilized nucleic acid molecules are phosphorothioate modified nucleic acid molecules (i.e. at least one of the phosphate oxygens of the nucleic acid molecule is replaced by sulfur).
  • the phosphate modification occurs at or near the 5′ and/or 3′ end of the nucleic acid molecule.
  • phosphorothioate-modified nucleic acid molecules can increase the extent of immune stimulation of the nucleic acid molecule, which contains an unmethylated CpG dinucleotide as shown herein.
  • nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl-phosphonates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated.
  • Nucleic acid molecules which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
  • a “subject” shall mean a human or vertebrate animal including a dog, cat, horse, cow, pig, sheep, goat, chicken, monkey, rat, mouse, etc.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • Preferred vectors are those capable of autonomous replication and expression of nucleic acids to which they are linked (e.g., an episome).
  • Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as “expression vectors.”
  • expression vectors of utility in recombinant DNA techniques are often in the form of “plasmids” which refer generally to circular double stranded DNA loops which, in their vector form, are not bound to the chromosome.
  • plasmid and vector are used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • ODN 1 and 2 were synthesized. These ODNs, including the two original “controls” (ODN 1 and 2) and two originally synthesized as “antisense” (ODN 3D and 3M; Krieg, A. M. J. Immunol. 143:2448 (1989)), were then examined for in vitro effects on spleen cells (representative sequences are listed in Table 1).
  • ODN that contained CpG dinucleotides induced B cell activation and IgM secretion; the magnitude of this stimulation typically could be increased by adding more CpG dinucleotides (Table 1; compare ODN 2 to 2a or 3D to 3Da and 3 Db). Stimulation did not appear to result from an antisense mechanism or impurity. ODN caused no detectable proliferation of ⁇ or other T cell populations.
  • the optimal stimulatory motif was determined to consist of a CpG flanked by two 5′ purines (preferably a GpA dinucleotide) and two 3′ pyrimidines (preferably a TpT or TpC dinucleotide). Mutations of ODN to bring the CpG motif closer to this ideal improved stimulation (e.g. Table 1, compare ODN 2 to 2e; 3M to 3Md) while mutations that disturbed the motif reduced stimulation (e.g. Table 1, compare ODN 3D to 3Df; 4 to 4b, 4c and 4d).
  • ODNs shorter than 8 bases were non-stimulatory (e.g. Table 1, ODN 4e).
  • ODN 4e the most stimulatory sequence identified was TCAACGTT (ODN 4) which contains the self complementary “palindrome” AACGTT.
  • ODN containing Gs at both ends showed increased stimulation, particularly if the ODN were rendered nuclease resistant by phosphorothioate modification of the terminal internucleotide linkages.
  • ODN 1585 (5′ GGGGTCAACGTTGAGGGGGG 3′ (SEQ ID NO:12)), in which the first two and last five internucleotide linkages are phosphorothioate modified caused an average 25.4 fold increase in mouse spleen cell proliferation compared to an average 3.2 fold increase in proliferation induced by ODN 1638, which has the same sequence as ODN 1585 except that the 10 Gs at the two ends are replaced by 10 As.
  • the effect of the G-rich ends is cis; addition of an ODN with poly G ends but no CpG motif to cells along with 1638 gave no increased proliferation.
  • non-palindromic motifs containing an unmethylated CpG were found to be more immunostimulatory.
  • octamer ODN containing a 6 base palindrome with a TpC dinucleotide at the 5′ end were also active (e.g. Table 1, ODN 4b,4c).
  • Other dinucleotides at the 5′ end gave reduced stimulation (e.g. ODN 4f; all sixteen possible dinucleotides were tested).
  • ODN 4f all sixteen possible dinucleotides were tested.
  • the presence of a 3′ dinucleotide was insufficient to compensate for the lack of a 5′ dinucleotide (e.g. Table 1, ODN 4g).
  • Disruption of the palindrome eliminated stimulation in octamer ODN (e.g. Table 1, ODN 4h), but palindromes were not required in longer ODN.
  • CpG-ODN induced cycling in more than 95% of B cells.
  • Splenic B lymphocytes sorted by flow cytometry into CD23 ⁇ (marginal zone) and CD23+ (follicular) subpopulations were equally responsive to ODN-induced stimulation, as were both resting and activated populations of B cells isolated by fractionation over Percoll gradients.
  • Certain B cell lines such as WEHI-231 are induced to undergo growth arrest and/or apoptosis in response to crosslinking of their antigen receptor by anti-IgM (Jakway, J. P. et al., “Growth regulation of the B lymphoma cell line WEHI-231 by anti-immunoglobulin, lipopolysaccharide and other bacterial products” J. Immunol. 137: 2225 (1986); Tsubata, T., J. Wu and T. Honjo: B-cell apoptosis induced by antigen receptor crosslinking is blocked by a T-cell signal through CD40 .” Nature 364: 645 (1993)).
  • WEHI-231 cells are rescued from this growth arrest by certain stimuli such as LPS and by the CD40 ligand.
  • ODN containing the CpG motif were also found to protect WEHI-231 from anti-IgM induced growth arrest, indicating that accessory cell populations are not required for the effect.
  • CpG ODN induce Bcl-x and myc expression, which may account for the protection from apoptosis.
  • CpG nucleic acids have been found to block apoptosis in human cells. This inhibition of apoptosis is important, since it should enhance and prolong immune activation by CpG DNA.
  • IL-6 secreted by spleen cells after CpG DNA stimulation was measured by ELISA.
  • T cell depleted spleen cell cultures rather than whole spleen cells were used for in vitro studies following preliminary studies showing that T cells contribute little or nothing to the IL-6 produced by CpG DNA-stimulated spleen cells.
  • IL-6 production was markedly increased in cells cultured with E. coli DNA but not in cells cultured with calf thymus DNA.
  • the DNA was digested with DNAse prior to analysis. DNAse pretreatment abolished IL-6 production induced by E.
  • T cell depleted spleen cells from DBA/2 mice were stimulated with phosphodiester modified oligonucleotides (O-ODN) (20 ⁇ M), calf thymus DNA (50 ⁇ g/ml) or E. coli DNA (50 ⁇ g/ml) with or without enzyme treatment, or LPS (10 ⁇ g/ml) for 24 hr.
  • O-ODN phosphodiester modified oligonucleotides
  • calf thymus DNA 50 ⁇ g/ml
  • E. coli DNA 50 ⁇ g/ml
  • LPS 10 ⁇ g/ml
  • the optimal B cell stimulatory CpG motif was identical with the optimal CpG motif for IL-6 secretion
  • a panel of ODN in which the bases flanking the CpG dinucleotide were progressively substituted was studied.
  • This ODN panel was analyzed for effects on B cell proliferation, Ig production, and IL-6 secretion, using both splenic B cells and CH12.LX cells.
  • the optimal stimulatory motif is composed of an unmethylated CpG flanked by two 5′ purines and two 3′ pyrimidines. Generally a mutation of either 5′ purine to pyrimidine or 3′ pymmidine to purine significantly reduced its effects.
  • FIG. 1 Bacterial DNA and CpG ODN induced IL-6 production in T cell depleted murine spleen cells in a dose-dependent manner, but vertebrate DNA and non-CpG ODN did not ( FIG. 1 ).
  • the maximum levels of IL-6 induced by bacterial DNA and CpG ODN were 1-1.5 ng/ml and 2-4 ng/ml respectively. These levels were significantly greater than those seen after stimulation by LPS (0.35 ng/ml) ( FIG. 1A ).
  • CpG ODN with a nuclease-resistant DNA backbone would also induce IL-6 production
  • S-ODN were added to T cell depleted murine spleen cells.
  • CpG S-ODN also induced IL-6 production in a dose-dependent manner to approximately the same level as CpG O-ODN while non-CpG S-ODN failed to induce IL-6 ( FIG. 1C ).
  • CpG S-ODN at a concentration of 0.05 ⁇ M could induce maximal IL-6 production in these cells.
  • mice were injected i.v. with 100 pg of E. coli DNA, calf thymus DNA, or CpG or non-stimulatory S-ODN and bled 2 hr after stimulation.
  • the level of IL-6 in the sera from the E. coli DNA injected group was approximately 13 ng/ml while IL-6 was not detected in the sera from calf thymus DNA or PBS injected groups (Table 4).
  • CpG S-ODN also induced IL-6 secretion in vivo.
  • the IL-6 level in the sera from CpG S-ODN injected groups was approximately 20 ng/ml. In contrast, IL-6 was not detected in the sera from non-stimulatory S-ODN stimulated group (Table 4).
  • CpG S-ODN coli DNA or calf thymus DNA, or 500 ⁇ g of CpG S-ODN or non-CpG control S-ODN.
  • Mice were bled 2 hr # after injection and 1:10 dilution of each serum was analyzed by IL-6 ELISA. Sensitivity limit of IL-6 ELISA was 5 pg/ml. Sequences of the CpG S-ODN is 5′GCATGACGTTGAGCT3′ (SEQ ID NO: 48) # and of the non-stimulatory S-ODN is 5′GCTAGATGTTAGCGT3′ (SEQ ID NO: 49). Note that although there is a CpG in SEQ ID NO: 49, it is too close to the 3′ end to # effect stimulation, as explained herein. Data represent mean ⁇ SD of duplicates. The experiment was done at least twice with similar results.
  • mice were injected i.v. with CpG or control non-CpG S-ODN. Serum IL-6 levels were significantly increased within 1 hr and peaked at 2 hr to a level of approximately 9 ng/ml in the CpG S-ODN injected group ( FIG. 2 ). IL-6 protein in sera rapidly decreased after 4 hr and returned to basal level by 12 hr after stimulation. In contrast to CpG DNA stimulated groups, no significant increase of IL-6 was observed in the sera from the non-stimulatory S-ODN or PBS injected groups ( FIG. 2 ).
  • the level of serum IL-6 increased rapidly after CpG DNA stimulation.
  • BALB/c mice were injected i.v. with CpG or non-CpG S-ODN and RNA was extracted from liver, spleen, thymus, and bone marrow at various time points after stimulation.
  • FIG. 3A the level of 1-6 mRNA in liver, spleen, and thymus was increased within 30 min. after injection of CpG S-ODN.
  • liver IL-6 mRNA peaked at 2 hr post-injection and rapidly decreased and reached basal level 8 hr after stimulation ( FIG. 3A ).
  • Splenic IL-6 mRNA peaked at 2 hr after stimulation and then gradually decreased ( FIG. 3A ).
  • Thymus IL-6 mRNA peaked at 1 hr post-injection and then gradually decreased ( FIG. 3A ).
  • IL-6 mRNA was significantly increased in bone marrow within 1 hr after CpG S-ODN injection but then returned to basal level. In response to CpG S-ODN, liver, spleen and thymus showed more substantial increases in IL-6 mRNA expression than the bone marrow.
  • Oligonucleotide 1619 was the best inducer of TNF- ⁇ and IFN- ⁇ secretion, and was closely followed by a nearly identical motif in oligonucleotide 1634 (GTCGCT) (Table 5).
  • the motifs in oligodeoxynucleotides 1637 and 1614 led to strong IL-6 secretion with relatively little induction of other cytokines.
  • human lymphocytes like murine lymphocytes, secrete cytokines differentially in response to CpG dinucleotides, depending on the surrounding bases.
  • the motifs that stimulate murine cells best differ from those that are most effective with human cells.
  • Certain CpG oligodeoxynucleotides are poor at activating human cells (oligodeoxynucleotides 1707, 1708, which contain the palindrome forming sequences GACGTC and CACGTG respectively).
  • L-LME L-leucyl-L-leucine methyl ester
  • Coli (EC) DNA requires unmethylated CpG motifs, since it is abolished by methylation of the EC DNA (next to the bottom row, Table 6). LPS contamination of the DNA cannot explain the results since the level of contamination was identical in the native and methylated DNA, and since addition of twice the highest amount of contaminating LPS had no effect (not shown).
  • IL-6 mRNA and protein after CpG DNA stimulation could result from transcriptional or post-transcriptional regulation.
  • a murine B cell line, WEHI-231 which produces IL-6 in response to CpG DNA, was transfected with an IL-6 promoter-CAT construct (pIL-6/CAT) (Pottratz, S. T. et al., 17B-estradiol) inhibits expression of human interleukin-6-promoter-reporter constructs by a receptor-dependent mechanism. J. Clin. Invest. 93:944).
  • CAT assays were performed after stimulation with various concentrations of CpG or non-CpG ODN. As shown in FIG. 5 , CpG ODN induced increased CAT activity in dose-dependent manner while non-CpG ODN failed to induce CAT activity. This confirms that CpG induces the transcriptional activity of the IL-6 promoter.
  • the lymphocyte stimulating effects of these ODN were tested at three concentrations (3.3, 10, and 30 ⁇ M) by measuring the total levels of RNA synthesis (by 3 H uridine incorporation) or DNA synthesis (by 3 H thymidine incorporation) in treated spleen cell cultures (Example 10).
  • O—ODN (0/0 phosphorothioate modifications) bearing a CpG motif caused no spleen cell stimulation unless added to the cultures at concentrations of at least 10 ⁇ M (Example 10).
  • this sequence was modified with two S linkages at the 5′ end and at least three S linkages at the 3′ end, significant stimulation was seen at a dose of 3.3 ⁇ M.
  • the level of stimulation showed a progressive increase as the number of 3′ modified bases was increased, until this reached or exceeded six, at which point the stimulation index began to decline.
  • the optimal number of 3′ S linkages for spleen cell stimulation was five. At all three concentrations tested in these experiments, the S-ODN was less stimulatory than the optimal chimeric compounds.
  • S—ODN Phosphorothioate modified ODN
  • O—ODN phosphodiester modified ODN
  • S—ODN and S—O—ODN i.e. chimeric phosphorothioate ODN in which the central linkages are phosphodiester, but the two 5′ and five 3′ linkages are phosphorothioate modified
  • S-O-ODN were far more stimulatory than O-ODN, and were even more stimulatory than S-ODN, at least at concentrations above 3.3 ⁇ M. At concentrations below 3 ⁇ M, the S-ODN with the 3M sequence was more potent than the corresponding S—O-ODN, while the S-ODN with the 3D sequence was less potent than the corresponding S-O-ODN (Example 10).
  • the 3D sequence is a perfect match for the stimulatory motif in that the CpG is flanked by two 5′ purines and two 3′ pyrimidines.
  • the bases immediately flanking the CpG in ODN 3D are not optimal; it has a 5′ pyrimidine and a 3′ purine.
  • S—ODN with poor matches to the optimal CpG motif cause little or no lymphocyte activation (e.g. Sequence 3D).
  • S-ODN with good matches to the motif, most critically at the positions immediately flanking the CpG are more potent than the corresponding S—O—ODN (e.g. Sequence 3M, Sequences 4 and 6), even though at higher concentrations (greater than 3 ⁇ M) the peak effect from the S—O—ODN is greater (Example 10).
  • S 2 —O—ODN were remarkably stimulatory, and caused substantially greater lymphocyte activation than the corresponding S—ODN or S—O—ODN at every tested concentration.
  • nuclease resistance can not be the only explanation, since the MP—O—ODN were actually less stimulatory than the O—ODN with CpG motifs.
  • Prior studies have shown that ODN uptake by lymphocytes is markedly affected by the backbone chemistry (Zhao et al., (1993) Comparison of cellular binding and uptake of antisense phosphodiester, phosphorothioate, and mixed phosphorothioate and methylphosphonate oligonucleotides.
  • CpG DNA can directly activate highly purified B cells and monocytic cells. There are many similarities in the mechanism through which CpG DNA activates these cell types. For example, both require NFKB activation as explained further below.
  • oligo 1668 with the best mouse B cell motif, is a strong inducer of both B cell and natural killer (NK) cell activation, while oligo 1758 is a weak B cell activator, but still induces excellent NK responses (Table 10).
  • Vertebrate DNA is highly methylated and CpG dinucleotides are underrepresented.
  • the stimulatory CpG motif is common in microbial genomic DNA, but quite rare in vertebrate DNA.
  • bacterial DNA has been reported to induce B cell proliferation and immunoglobulin (Ig) production, while mammalian DNA does not (Messina, J. P. et al., J. Immunol. 147:1759 (1991)).
  • Ig immunoglobulin
  • Example 3 in which methylation of bacterial DNA with CpG methylase was found to abolish mitogenicity, demonstrates that the difference in CpG status is the cause of B cell stimulation by bacterial DNA. This data supports the following conclusion: that unmethylated CpG dinucleotides present within bacterial DNA are responsible for the stimulatory effects of bacterial DNA.
  • lymphocyte activation by the CpG motif represents an immune defense mechanism that can thereby distinguish bacterial from host DNA.
  • Host DNA which would commonly be present in many anatomic regions and areas of inflammation due to apoptosis (cell death), would generally induce little or no lymphocyte activation due to CpG suppression and methylation.
  • the presence of bacterial DNA containing unmethylated CpG motifs can cause lymphocyte activation precisely in infected anatomic regions, where it is beneficial. This novel activation pathway provides a rapid alternative to T cell dependent antigen specific B cell activation.
  • B cells bearing antigen receptor specific for bacterial antigens would receive one activation signal through cell membrane Ig and a second signal from bacterial DNA, and would therefore tend to be preferentially activated.
  • the interrelationship of this pathway with other pathways of B cell activation provide a physiologic mechanism employing a polyclonal antigen to induce antigen-specific responses.
  • B cell activation would not be totally nonspecific.
  • B cells bearing antigen receptors specific for bacterial products could receive one activation signal through cell membrane Ig, and a second from bacterial DNA, thereby more vigorously triggering antigen specific immune responses.
  • the response to bacterial DNA could have undesirable consequences in some settings.
  • autoimmune responses to self antigens would also tend to be preferentially triggered by bacterial infections, since autoantigens could also provide a second activation signal to autoreactive B cells triggered by bacterial DNA.
  • the induction of autoimmunity by bacterial infections is a common clinical observance.
  • the autoimmune disease systemic lupus erythematosus which is: i) characterized by the production of anti-DNA antibodies; ii) induced by drugs which inhibit DNA methyltransferase (Cornacchia, E. J. et al., J. Clin. Invest. 92:38 (1993)); and iii) associated with reduced DNA methylation (Richardson, B. L. et al., Arth. Rheum 35:647 (1992)), is likely triggered at least in part by activation of DNA-specific B cells through stimulatory signals provided by CpG motifs, as well as by binding of bacterial DNA to antigen receptors.
  • sepsis which is characterized by high morbidity and mortality due to massive and nonspecific activation of the immune system, may be initiated by bacterial DNA and other products released from dying bacteria that reach concentrations sufficient to directly activate many lymphocytes. Further evidence of the role of CpG DNA in the sepsis syndrome is described in Cowdery, J., et. al., (1996) J. Immunol. 156:4570-4575.
  • CpG-ODN did not induce any detectable Ca 2+ flux, changes in protein tyrosine phosphorylation, or IP 3 generation.
  • Flow cytometry with FITC-conjugated ODN with or without a CpG motif was performed as described in Zhao, Q et al., ( Antisense Research and Development 3:53-66 (1993)), and showed equivalent membrane binding, cellular uptake, efflux, and intracellular localization. This suggests that there may not be cell membrane proteins specific for CpG ODN.
  • NFKB neuropeptide kinases
  • CpG DNA causes a rapid induction of the production of reactive oxygen species in both B cells and monocytic cells, as detected by the sensitive fluorescent dye dihydrorhodamine 123 as described in Royall, J. A., and Ischiropoulos, H. ( Archives of Biochemistry and Biophysics 302:348-355 (1993)).
  • inhibitors of the generation of these reactive oxygen species completely block the induction of NFKB and the later induction of cell proliferation and cytokine secretion by CpG DNA.
  • FIG. 8A shows the results from a flow cytometry study using mouse B cells with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species.
  • the dye only sample in Panel A of the figure shows the background level of cells positive for the dye at 28.6%.
  • this level of reactive oxygen species was greatly increased to 80% in the cells treated for 20 minutes with PMA and ionomycin, a positive control (Panel B).
  • the cells treated with the CpG oligo also showed an increase in the level of reactive oxygen species such that more than 50% of the cells became positive (Panel D).
  • cells treated with an oligonucleotide with the identical sequence except that the CpG was switched did not show this significant increase in the level of reactive oxygen species (Panel E).
  • Chloroquine slightly lowers the background level of reactive oxygen species in the cells such that the untreated cells in Panel A have only 4.3% that are positive. Chloroquine completely abolishes the induction of reactive oxygen species in the cells treated with CpG DNA (Panel B) but does not reduce the level of reactive oxygen species in the cells treated with PMA and ionomycin (Panel E). This demonstrates that unlike the PMA plus ionomycin, the generation of reactive oxygen species following treatment of B cells with CpG DNA requires that the DNA undergo an acidification step in the endosomes. This is a completely novel mechanism of leukocyte activation. Chloroquine, monensin, and bafilomycin also appear to block the activation of NFKB by CpG DNA as well as the subsequent proliferation and induction of cytokine secretion.
  • NFKB or related protein is a component of a protein or protein complex that binds the stimulatory CpG oligonucleotides.
  • the CpG nucleic acids may bind to one of the TRAF proteins that bind to the cytoplasmic region of CD40 and mediate NF ⁇ B activation when CD40 is cross-linked.
  • TRAF proteins include TRAF-2 and TRAF-5.
  • nucleic acids can be synthesized de novo using any of a number of procedures well known in the art.
  • the ⁇ -cyanoethyl phosphoramidite method S. L. Beaucage and M. H. Caruthers, (1981) Tet. Let. 22:1859
  • nucleoside H-phosphonate method Garegg et al., (1986) Tet. Let. 27: 4051-4054
  • Froehler et al. (1986) Nucl. Acid. Res. 14: 5399-5407
  • Garegg et al., (1986) Tet. Let. 27: 4055-4058 Gaffney et al., (1988) Tet. Let.
  • oligonucleotide synthesizers available in the market.
  • oligonucleotides can be prepared from existing nucleic acid sequences (e.g. genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
  • nucleic acids are preferably relatively resistant to degradation (e.g. via endo- and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made e.g. as described in U.S. Pat. No.
  • 4,469,863; and alkylphosphotriesters in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574 can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A. (1990) Chem. Rev. 90:544; Goodchild, J. (1990) Bioconjugate Chem. 1:165). 2′-O-methyl nucleic acids with CpG motifs also cause immune activation, as do ethoxy-modified CpG nucleic acids. In fact, no backbone modifications have been found that completely abolish the CpG effect, although it is greatly reduced by replacing the C with a 5-methyl C.
  • nucleic acids may be associated with a molecule that results in higher affinity binding to target cell (e.g. B-cell, monocytic cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells to form a “nucleic acid delivery complex”.
  • target cell e.g. B-cell, monocytic cell and natural killer (NK) cell
  • Nucleic acids can be ionically, or covalently associated with appropriate molecules using techniques which are well known in the art.
  • a variety of coupling or crosslinking agents can be used e.g. protein A, carbodiimide, and N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP).
  • SPDP N-succinimidyl-3-(2-pyridyldithio) propionate
  • Nucleic acids can alternatively be encapsulated in liposomes or virosomes using well-known techniques.
  • nucleic acid molecules containing at least one unmethylated CpG dinucleotide can be administered to a subject in vivo to treat an “immune system deficiency”.
  • nucleic acid molecules containing at least one unmethylated CpG dinucleotide can be contacted with lymphocytes (e.g. B cells, monocytic cells or NK cells) obtained from a subject having an immune system deficiency ex vivo and activated lymphocytes can then be reimplanted in the subject.
  • lymphocytes e.g. B cells, monocytic cells or NK cells
  • IL-6 As reported herein, in response to unmethylated CpG containing nucleic acid molecules, an increased number of spleen cells secrete IL-6, IL-12, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IL-1, IL-3, IL-10, TNF- ⁇ , TNF- ⁇ , GM-CSF, RANTES, and probably others.
  • the increased IL-6 expression was found to occur in B cells, CD4+ T cells and monocytic cells.
  • Immunostimulatory nucleic acid molecules can also be administered to a subject in conjunction with a vaccine to boost a subject's immune system and thereby effect a better response from the vaccine.
  • the immunostimulatory nucleic acid molecule is administered slightly before or at the same time as the vaccine.
  • a conventional adjuvant may optionally be administered in conjunction with the vaccine, which is minimally comprised of an antigen, as the conventional adjuvant may further improve the vaccination by enhancing antigen absorption.
  • the vaccine is a DNA vaccine
  • the antigen encoded by the vaccine determines the specificity of the immune response.
  • the backbone of the plasmid contains CpG motifs, it functions as an adjuvant for the vaccine.
  • CpG DNA acts as an effective “danger signal” and causes the immune system to respond vigorously to new antigens in the area. This mode of action presumably results primarily from the stimulatory local effects of CpG DNA on dendritic cells and other “professional” antigen presenting cells, as well as from the costimulatory effects on B cells.
  • Immunostimulatory oligonucleotides and unmethylated CpG containing vaccines which directly activate lymphocytes and co-stimulate an antigen-specific response, are fundamentally different from conventional adjuvants (e.g. aluminum precipitates), which are inert when injected alone and are thought to work through absorbing the antigen and thereby presenting it more effectively to immune cells.
  • conventional adjuvants e.g. aluminum precipitates
  • conventional adjuvants only work for certain antigens, only induce an antibody (humoral) immune response (Th2), and are very poor at inducing cellular immune responses (Th1).
  • Th2 human immune response
  • Th1 for many pathogens, the humoral response contributes little to protection, and can even be detrimental.
  • an immunostimulatory oligonucleotide can be administered prior to, along with or after administration of a chemotherapy or immunotherapy to increase the responsiveness of the malignant cells to subsequent chemotherapy or immunotherapy or to speed the recovery of the bone marrow through induction of restorative cytokines such as GM-CSF.
  • CpG nucleic acids also increase natural killer cell lytic activity and antibody dependent cellular cytotoxicity (ADCC). Induction of NK activity and ADCC may likewise be beneficial in cancer immunotherapy, alone or in conjunction with other treatments.
  • Another use of the described immunostimulatory nucleic acid molecules is in desensitization therapy for allergies, which are generally caused by IgE antibody generation against harmless allergens.
  • the cytokines that are induced by unmethylated CpG nucleic acids are predominantly of a class called “Th1” which is most marked by a cellular immune response and is associated with IL-12 and IFN- ⁇ .
  • Th1 The other major type of immune response is termed a Th2 immune response, which is associated with more of an antibody immune response and with the production of IL-4, IL-5 and IL-10.
  • Th2 immune response which is associated with more of an antibody immune response and with the production of IL-4, IL-5 and IL-10.
  • allergic diseases are mediated by Th2 type immune responses and autoimmune diseases by Th1 immune response.
  • an effective dose of an immunostimulatory nucleic acid (or a vector containing a nucleic acid) alone or in conjunction with an allergen can be administered to a subject to treat or prevent an allergy.
  • Nucleic acids containing unmethylated CpG motifs may also have significant therapeutic utility in the treatment of asthma.
  • Th2 cytokines especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotype switching, eosinophil chemotaxis and activation and mast cell growth.
  • Th1 cytokines especially IFN- ⁇ and IL-12, can suppress the formation of Th2 clones and production of Th2 cytokines.
  • oligonucleotides containing an unmethylated CpG motif i.e. TCCATGA CG TTCCTGA CG TT; SEQ ID NO:10), but not a control oligonucleotide (TCCATGAGCTTCCTGAGTCT; SEQ ID NO:11) prevented the development of an inflammatory cellular infiltrate and eosinophilia in a murine model of asthma. Furthermore, the suppression of eosinophilic inflammation was associated with a suppression of a Th2 response and induction of a Th1 response.
  • an effective amount of an appropriate immunostimulatory nucleic acid molecule alone or formulated as a delivery complex can be administered to a subject by any mode allowing the oligonucleotide to be taken up by the appropriate target cells (e.g., B-cells and monocytic cells).
  • Preferred routes of administration include oral and transdermal (e.g., via a patch).
  • Other routes of administration include injection (subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal, etc.). The injection can be in a bolus or a continuous infusion.
  • a nucleic acid alone or as a nucleic acid delivery complex can be administered in conjunction with a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include substances that can be coadministered with a nucleic acid or a nucleic acid delivery complex and allows the nucleic acid to perform its indicated function. Examples of such carriers include solutions, solvents, dispersion media, delay agents, emulsions and the like. The use of such media for pharmaceutically active substances are well known in the art. Any other conventional carrier suitable for use with the nucleic acids falls within the scope of the instant invention.
  • an effective amount of a nucleic acid molecule refers to the amount necessary or sufficient to realize a desired biologic effect.
  • an effective amount of a nucleic acid containing at least one unmethylated CpG for treating an immune system deficiency could be that amount necessary to eliminate a tumor, cancer, or bacterial, viral or fungal infection.
  • An effective amount for use as a vaccine adjuvant could be that amount useful for boosting a subjects immune response to a vaccine.
  • An “effective amount” for treating asthma can be that amount useful for redirecting a Th2 type of immune response that is associated with asthma to a Th1 type of response.
  • the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular nucleic acid being administered (e.g.
  • B cells were purified from spleens obtained from 6-12 wk old specific pathogen free DBA/2 or BXSB mice (bred in the University of Iowa animal care facility; no substantial strain differences were noted) that were depleted of T cells with anti-Thy-1.2 and complement and centrifugation over lympholyte M (Cedarlane Laboratories, Hornby, Ontario, Canada) (“B cells”). B cells contained fewer than 1% CD4 + or CD8 + cells. 8 ⁇ 10 4 B cells were dispensed in triplicate into 96 well microtiter plates in 100 ⁇ l RPMI containing 10% FBS (heat inactivated to 65° C.
  • DBA/2 B cells were cultured with no DNA or 50 ⁇ g/ml of a) Micrococcus lysodeikticus ; b) NZB/N mouse spleen; and c) NFS/N mouse spleen genomic DNAs for 48 hours, then pulsed with 3 H thymidine for 4 hours prior to cell harvest.
  • Duplicate DNA samples were digested with DNAse I for 30 minutes at 37° C. prior to addition to cell cultures.
  • E. coli DNA also induced an 8.8 fold increase in the number of IgM secreting B cells by 48 hours using the ELISA-spot assay.
  • DBA/2 B cells were cultured with either no additive, 50 ⁇ g/ml LPS or the ODN 1; 1a; 4; or 4a at 20 uM. Cells were cultured and harvested at 4, 8, 24 and 48 hours. BXSB cells were cultured as in Example 1 with 5, 10, 20, 40 or 80 ⁇ M of ODN 1; 1a; 4; or 4a or LPS. In this experiment, wells with no ODN had 3833 cpm. Each experiment was performed at least three times with similar results. Standard deviations of the triplicate wells were ⁇ 5%.
  • Percent specific lysis was determined by calculating the ratio of the 51 Cr released in the presence of effector cells minus the 51 Cr released when the target cells are cultured alone, over the total counts released after cell lysis in 2% acetic acid minus the 51 Cr cpm released when the cells are cultured alone.
  • mice were weighed and injected i.p. with 0.25 ml of sterile PBS or the indicated othioate ODN dissolved in PBS. Twenty four hours later, spleen cells were washed, and stained for flow cytometry using phycoerythrin conjugated 6B2 to cells in conjunction with biotin conjugated anti Ly-6A/E or anti-Ia d (Pharmingen, go, Calif.) or anti-Bla-1 (Hardy, R. R. et al., J. Exp. Med. 159:1169 (1984). Two mice died for each condition and analyzed individually.
  • VEHI-231 cells (5 ⁇ 10 4 /well) were cultured for 1 hr at 37° C. in the presence or of LPS or the control ODN 1 a or the CpG ODN 1 d and 3 Db before addition of anti- /ml). Cells were cultured for a further 20 hr before a 4 hr pulse with 2 ⁇ Ci/well 3 H e. In this experiment, cells with no ODN or anti-IgM gave 90.4 ⁇ 10 3 cpm of 3 H e incorporation by addition of anti-IgM.
  • the phosphodiester ODN shown in Table 1 ilar protection, though with some nonspecific suppression due to ODN degradation. eriment was repeated at least 3 times with similar results.
  • mice BA/2 female mice (2 mos. old) were injected i.p. with 500 ⁇ g CpG or control rothioate ODN. At various time points after injection, the mice were bled. Two re studied for each time point. IL-6 was measured by ELISA, and IL-6 concentration ulated by comparison to a standard curve generated using recombinant IL-6. The ty of the assay was 10 pg/ml. Levels were undetectable after 8 hr.
  • mice at 5-10 wk of age were source of lymphocytes. All mice were obtained from The Jackson Laboratory (Bar Me.), and bred and maintained under specific pathogen-free conditions in the ty of Iowa Animal Care Unit. The mouse B cell line CH12.LX was kindly provided Bishop (University of Iowa, Iowa City).
  • mice were killed by cervical dislocation. Single cell suspensions were prepared aseptically from the spleens from mice. T cell depleted mouse splenocytes were prepared by using anti-Thy-1.2 and complement and centrifugation over lympholyte M (Cedarlane Laboratories, Hornby, Ontario, Canada) as described (Krieg, A. M. et al., (1989) A role for endogenous retroviral sequences in the regulation of lymphocyte activation. J. Immunol. 143:2448).
  • ODN and DNA Phosphodiester oligonucleotides (O-ODN) and the backbone modified phosphorothioate oligonucleotides (S-ODN) were obtained from the DNA Core facility at the University of Iowa or from Operon Technologies (Alameda, Calif.).
  • E. coli DNA (Strain B) and calf thymus DNA were purchased from Sigma (St. Louis, Mo.). All DNA and ODN were purified by extraction with phenol:chloroform:isoamyl alcohol (25:24:1) and/or ethanol precipitation.
  • E. coli and calf thymus DNA were single stranded prior to use by boiling for 10 min. followed by cooling on ice for 5 min. For some experiments, E.
  • E. coli and calf thymus DNA were digested with DNAse I (2U/ ⁇ g of DNA) at 37° C. for 2 hr in 1 ⁇ SSC with 5 mM MgCl 2 .
  • DNAse I (2U/ ⁇ g of DNA)
  • E. coli DNA was treated with CpG methylase (M. SssI; 2U/ ⁇ g of DNA) in NEBuffer 2 supplemented with 160 ⁇ M S-adenosyl methionine and incubated overnight at 37° C.
  • Methylated DNA was purified as above. Efficiency of methylation was confirmed by Hpa II digestion followed by analysis by gel electrophoresis.
  • LPS level in ODN was less than 12.5 ng/mg and E. coli and calf thymus DNA contained less than 2.5 ng of LPS/mg of DNA by Limulus assay.
  • cells were treated with CpG O-ODN along with various concentrations (1-10 ⁇ g/ml) of neutralizing rat IgG1 antibody against murine IL-6 (hybridoma MP5-20F3) or control rat IgG1 mAb to E. coli ⁇ -galactosidase (hybridoma GL113; ATCC, Rockville, Md.) (20) for 5 days.
  • culture supernatant fractions were analyzed by ELISA as below.
  • mice were injected intravenously (i.v.) with PBS, calf thymus DNA (200 ⁇ g/100 ⁇ l PBS/mouse), E. coli DNA (200 ⁇ g/100 ⁇ L PBS/mouse), or CpG or non-CpG S-ODN (200 ⁇ g/100 ⁇ l PBS/mouse).
  • Mice two/group were bled by retroorbital puncture and sacrificed by cervical dislocation at various time points. Liver, spleen, thymus, and bone marrow were removed and RNA was prepared from those organs using RNAzol B (Tel-Test, Friendswood, Tex.) according to the manufacturers protocol.
  • RNAzol B Tel-Test, Friendswood, Tex.
  • TPBS 0.5 mM MgCl 2 .6H 2 O, 2.68 mM KCl, 1.47 mM KH 2 PO 4 , 0.14 M NaCl, 6.6 mM K 2 HPO 4 , 0.5% Tween 20
  • TPBS 0.5 mM MgCl 2 .6H 2 O, 2.68 mM KCl, 1.47 mM KH 2 PO 4 , 0.14 M NaCl, 6.6 mM K 2 HPO 4 , 0.5% Tween 20
  • the plates were washed and 100 ⁇ l/well of biotinylated rat anti-mouse IL-6 monoclonal antibodies (MP5-32C11, Pharmingen, San Diego, Calif.) (1 ⁇ g/ml in 10% FCS) or biotinylated anti-mouse Ig (Sigma, St. Louis, Mo.) were added and incubated for 45 min at room temperature following washes with TPBS. Horseradish peroxidase (HRP) conjugated avidin (Bio-rad Laboratories, Hercules, Calif.) at 1:4000 dilution in 10% FCS (100 ⁇ l/well) was added and incubated at room temperature for 30 min.
  • HRP horseradish peroxidase
  • the plates were washed and developed with o-phenylendiamine dihydrochloride (OPD; Sigma, St. Louis Mo.) 0.05 M phosphate-citrate buffer, pH 5.0, for 30 min.
  • OPD o-phenylendiamine dihydrochloride
  • the reaction was stopped with 0.67 N H 2 SO 4 and plates were read on a microplate reader (Cambridge Technology, Inc., Watertown, Mass.) at 490-600 nm. The results are shown in FIGS. 1 and 2 .
  • RNA synthesis and IL-6 PCR was done essentially as described by Montgomery and Dallman (Montgomery, R. A. and M. S. Dallman (1991), Analysis of cytokine gene expression during fetal thymic ontogeny using the polymerase chain reaction ( J. Immunol .) 147:554).
  • cDNA synthesis and IL-6 PCR was done essentially as described by Montgomery and Dallman (Montgomery, R. A. and M. S. Dallman (1991), Analysis of cytokine gene expression during fetal thymic ontogeny using the polymerase chain reaction ( J.
  • the gel was dried and prehybridized at 47° C. for 2 hr hybridization buffer (5 ⁇ SSPE, 0.1% SDS) containing 10 ⁇ g/ml denatured salmon sperm DNA.
  • the gel was hybridized with 2 ⁇ 10 6 cpm/ml ⁇ -[ 32 P]ATP end-labeled internal oligonucleotide probe for IL-6 (5′CATTTCCACGATTTCCCA 3′, SEQ ID NO:56) overnight at 47° C., washed 4 times (2 ⁇ SSC, 0.2% SDS) at room temperature and autoradiographed. The results are shown in FIG. 3 .
  • DBA/2 mice spleen B cells (5 ⁇ 10 4 cells/100 ⁇ l/well) were treated with media, CpG or non-CpG S—ODN (0.5 ⁇ M) or O—ODN (20 ⁇ M) for 24 hr at 37° C. Cells were pulsed for the last four hr with either [ 3 H] Thymidine or [ 3 H] Uridine (1 ⁇ Ci/well). Amounts of [ 3 H] incorporated were measured using Liquid Scintillation Analyzer (Packard Instrument Co., Downers Grove, Ill.).
  • Chloramphenicol acetyltransferase (CAT) activity was measured by a solution assay (Seed, B. and J. Y. Sheen (1988) A single phase-extraction assay for chloramphenicol acetyl transferase activity. Gene 76:271) 16 hr after transfection. The results are presented in FIG. 5 .
  • ODN were synthesized on an Applied Biosystems Inc. (Foster City, Calif.) model 380A, 380B, or 394 DNA synthesizer using standard procedures (Beacage and Caruthers (1981) Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Letters 22, 1859-1862.).
  • Phosphodiester ODN were synthesized using standard beta-cyanoethyl phosphoramidite chemistry. Phosphorothioate linkages were introduced by oxidizing the phosphite linkage with elemental sulfur instead of the standard iodine oxidation.
  • the four common nucleoside phosphoramidites were purchased from Applied Biosystems. All phosphodiester and thioate containing ODN were deprotected by treatment with concentrated ammonia at 55° C. for 12 hours. The ODN were purified by gel exclusion chromatography and lyophilized to dryness prior to use. Phosphorodithioate linkages were introduced by using deoxynucleoside S-(b-benzoylmercaptoethyl) pyrrolidino thiophosphoramidites (Wiesler, W. T. et al., (1993) In Methods in Molecular Biology: Protocols for Oligonucleotides and Analogs-Synthesis and Properties, Agrawal, S. (ed.), Humana Press, 191-206.). Dithioate containing ODN were deprotected by treatment with concentrated ammonia at 55° C. for 12 hours followed by reverse phase HPLC purification.
  • the methylphosphinodiester is treated with the sulfurizing reagent (5% elemental sulfur, 100 millimolar N,N-diamethylaminopyridine in carbon disulfide/pyridine/triethylamine), four consecutive times for 450 seconds each to produce methylphosphonothioates.
  • the methylphosphinodiester is treated with standard oxidizing reagent (0.1 M iodine in tetrahydrofuran/2,6-lutidine/water).
  • silica gel bound oligomer was treated with distilled pyridine/concentrated ammonia, 1:1, (v/v) for four days at 4 degrees centigrade.
  • the supernatant was dried in vacuo, dissolved in water and chromatographed on a G50/50 Sephadex column.
  • O—ODN refers to ODN which are phosphodiester; S—ODN are completely phosphorothioate modified; S—O—ODN are chimeric ODN in which the central linkages are phosphodiester, but the two 5′ and five 3′ linkages are phosphorothioate modified; S 2 —O—ODN are chimeric ODN in which the central linkages are phosphodiester, but the two 5′ and five 3′ linkages are phosphorodithioate modified; and MP—O—ODN are chimeric ODN in which the central linkages are phosphodiester, but the two 5′ and five 3′ linkages are methylphosphonate modified.
  • the ODN sequences studied include: 3D (5′ GAGAA CG CTGGACCTTCCAT),; (SEQ ID NO:14) 3M (5′ TCCATGT CG GTCCTGATGCT),; (SEQ ID NO:22) 5 (5′ GG CG TTATTCCTGACT CG CC),; (SEQ ID NO:57) and 6 (5′ CCTA CG TTGTATG CG CCCAGCT),. (SEQ ID NO:58) These sequences are representative of literally hundreds of CpG and non-CpG ODN that have been tested in the course of these studies.
  • mice DBA/2, or BXSB mice obtained from The Jackson Laboratory (Bar Harbor, Me.), and maintained under specific pathogen-free conditions were used as a source of lymphocytes at 5-10 wk of age with essentially identical results.
  • mouse spleen cells (5 ⁇ 10 4 cells/100 ⁇ l/well) were cultured at 37° C. in a 5% CO 2 humidified incubator in RPMI-1640 supplemented with 10% (v/v) heat inactivated fetal calf serum (heated to 65° C. for experiments with O—ODN, or 56° C. for experiments using only modified ODN), 1.5 ⁇ M L-glutamine, 50 ⁇ M 2-mercaptoethanol, 100 U/ml penicillin and 100 ⁇ g/ml streptomycin for 24 hr or 48 hr as indicated.
  • Phosphodiester ODN were purchased from Operon Technologies (Alameda, Calif.). Phosphorothioate ODN were purchased from the DNA core facility, University of Iowa, or from The Midland Certified Reagent Company (Midland Tex.). E. coli (strain B) DNA and calf thymus DNA were purchased from Sigma (St. Louis, Mo.). All DNA and ODN were purified by extraction with phenol:chloroform:isoamyl alcohol (25:24:1) and/or ethanol precipitation. The LPS level in ODN was less than 12.5 ng/mg and E. coli and calf thymus DNA contained less than 2.5 ng of LPS/mg of DNA by Limulus assay.
  • Virus-free, 4-6 week old, DBA/2, C57BL/6 (B6) and congenitally athymic BALB/c mice were obtained on contract through the Veterans Affairs from the National Cancer Institute (Bethesda, Md.). C57BL/6 SCID mice were bred in the SPF barrier facility at the University of Iowa Animal Care Unit.
  • PBMC peripheral mononuclear blood leukocytes
  • 1 LU was defined as the number of cells needed to effect 30% specific lysis.
  • neutralizing antibodies against IFN- ⁇ (Lee Biomolecular, San Diego, Calif.) or IL-12 (C15.1, C15.6, C17.8, and C17.15; provided by Dr. Giorgio Trinchieri, The Wistar Institute, Philadelphia, Pa.) or their isotype controls were added at the initiation of cultures to a concentration of 10 ⁇ g/ml.
  • 10 ⁇ g of each of the 4 mAb (or isotype controls) were added simultaneously.
  • Recombinant human IL-2 was used at a concentration of 100 U/ml.
  • Schistosoma mansoni eggs contain an antigen ( Schistosoma mansoni egg antigen (SEA)) that induces a Th2 immune response (e.g. production of IgE antibody).
  • SEA Schistosoma mansoni egg antigen
  • mice were then treated with oligonucleotides (30 ⁇ g in 200 ⁇ l saline by i.p.injection), which either contained an unmethylated CpG motif (i.e. TCCATGA CG TTCCTGA CG TT; SEQ ID NO.10) or did not (i.e. control, TCCATGAGCTTCCTGAGTCT; SEQ ID NO.11).
  • Soluble SEA (10 ⁇ g in 25 ⁇ l of saline) was administered by intranasal instillation on days 14 and 21. Saline was used as a control.
  • mice were sacrificed at various times after airway challenge.
  • Whole lung lavage was performed to harvest airway and alveolar inflammatory cells.
  • Cytokine levels were measured from lavage fluid by ELISA.
  • RNA was isolated from whole lung for Northern analysis and RT-PCR studies using CsCl gradients. Lungs were inflated and perfused with 4% paraformaldehyde for histologic examination.
  • FIG. 9 shows that when the mice are initially injected with the eggs i.p., and then inhale the egg antigen (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given a nucleic acid containing an unmethylated CpG motif along with the eggs, the inflammatory cells in the lung are not increased by subsequent inhalation of the egg antigen (open triangles).
  • FIG. 10 shows that the same results are obtained when only eosinophils present in the lung lavage are measured.
  • Eosinophils are the type of inflammatory cell most closely associated with asthma.
  • FIG. 11 shows that when the mice are treated with a control oligo at the time of the initial exposure to the egg, there is little effect on the subsequent influx of eosinophils into the lungs after inhalation of SEA.
  • mice inhale the eggs on days 14 or 21 they develop an acute inflammatory response in the lungs.
  • giving a CpG oligo along with the eggs at the time of initial antigen exposure on days 0 and 7 almost completely abolishes the increase in eosinophils when the mice inhale the egg antigen on day 14.
  • FIG. 12 shows that very low doses of oligonucleotide ( ⁇ 10 ⁇ g) can give this protection.
  • FIG. 13 shows that the resultant inflammatory response correlates with the levels of the Th2 cytokine IL-4 in the lung.
  • FIG. 14 shows that administration of an oligonucleotide containing an unmethylated CpG motif can actually redirect the cytokine response of the lung to production of II-12, indicating a Th1 type of immune response.
  • FIG. 15 shows that administration of an oligonucleotide containing an unmethylated CpG motif can also redirect the cytokine response of the lung to production of IFN- ⁇ , indicating a Th1 type of immune response.
  • Human PBMC were prepared from whole blood by standard centrifugation over ficoll hypaque.
  • Cells (5 ⁇ 10 5 /ml) were cultured in 10% autologous serum in 96 well microtiter plates with CpG or control oligodeoxynucleotides (24 ⁇ g/ml for phosphodiester oligonucleotides; 6 ⁇ g/ml for nuclease resistant phosphorothioate oligonucleotides) for 4 hr in the case of TNF- ⁇ or 24 hr for the other cytokines before supernatant harvest and assay, measured by ELISA using Quantikine kits or reagents from R&D Systems (pg/ml) or cytokine ELISA kits from Biosource (for IL-12 assay). Assays were performed as per the manufacturer's instructions. Data are presented in Table 6 as the level of cytokine above that in wells with no added oligodeoxynucleotide.

Abstract

Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.

Description

    RELATED APPLICATIONS
  • This application is a continuation of co-pending U.S. patent application Ser. No. 09/818,918, filed Mar. 21, 2001, which is a divisional of U.S. patent application Ser. No. 08/738,652, filed Oct. 30, 1996, now issued as U.S. Pat. No. 6,207,646, which is a continuation-in-part of U.S. patent application Ser. No. 08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No. 6,194,388, which is a continuation-in-part of U.S. patent application Ser. No. 08/276,358, filed Jul. 15, 1994, now abandoned.
  • GOVERNMENT SUPPORT
  • The work resulting in this invention was supported in part by National Institute of Health Grant No. R29-AR42556-01. The U.S. Government may therefore be entitled to certain rights in the invention.
  • BACKGROUND OF THE INVENTION
  • DNA Binds to Cell Membranes and Is Internalized
  • In the 1970's, several investigators reported the binding of high molecular weight DNA to cell membranes (Lerner, R. A., W. Meinke, and D. A. Goldstein. 1971. “Membrane-associated DNA in the cytoplasm of diploid human lymphocytes”. Proc. Natl. Acad. Sci. USA 68.1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975. “Cell-surface-associated nucleic acid in tumorigenic cells made visible with platinum-pyrimidine complexes by electron microscopy”. Proc. Natl. Acad. Sci. USA 72:928). In 1985, Bennett et al. presented the first evidence that DNA binding to lymphocytes is similar to a ligand receptor interaction: binding is saturable, competitive, and leads to DNA endocytosis and degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and M. M. Merritt. 1985. “DNA binding to human leukocytes. Evidence for a receptor-mediated association, internalization, and degradation of DNA”. J. Clin. Invest. 76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen. 1991. “Cellular uptake of antisense oligodeoxynucleotides”. Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R. L. Juliano. 1992. “Pharmaceutical aspects of the biological stability and membrane transport characteristics of antisense oligonucleotides”. In: Gene Regulation: Biology of Antisense RNA and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd. New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J. Herrera, and A. M. Krieg., 1994. “Stage specific oligonucleotide uptake in murine bone marrow B cell precursors”. Blood, 84:3660). No receptor for DNA or ODN uptake has yet been cloned, and it is not yet clear whether ODN binding and cell uptake occurs through the same or a different mechanism from that of high molecular weight DNA.
  • Lymphocyte ODN uptake has been shown to be regulated by cell activation. Spleen cells stimulated with the B cell mitogen LPS had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen Con A showed enhanced ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling, M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg. 1991. “Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible”. Antisense Research and Development 1:161).
  • Immune Effects of Nucleic Acids
  • Several polynucleotides have been extensively evaluated as biological response modifiers. Perhaps the best example is poly (I,C) which is a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity (Talmadge, J. E., J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E. Schlick, R. Ruffinann, R. H. Wiltrout, and M. A. Chirigos. 1985. “Immunomodulatory effects in mice of polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose”. Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley, and J. E. Talmadge. 1985. “Immunomodulation of natural killer activity by polyribonucleotides”. J. Biol. Resp. Mod. 4:512; Krown, S. E. 1986. “Interferons and interferon inducers in cancer treatment”. Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C. Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J. Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt, and S. P. Creekmore. 1992. “Polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose in combination with interleukin-2 in patients with cancer: clinical and immunological effects”. Canc. Res. 52:3005). It appears that this murine NK activation may be due solely to induction of IFN-β secretion (Ishikawa, R., and C. A. Biron. 1993. “IFN induction and associated changes in splenic leukocyte distribution”. J. Immunol. 150:3713). This activation was specific for the ribose sugar since deoxyribose was ineffective. Its potent in vitro antitumor activity led to several clinical trials using poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose (to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985. cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S. E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited supra). Unfortunately, toxic side effects have thus far prevented poly (I,C) from becoming a useful therapeutic agent.
  • Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace “B cell differentiation factors” (Feldbush, T. L., and Z. K. Ballas. 1985. “Lymphokine-like activity of 8-mercaptoguanosine: induction of T and B cell differentiation”. J. Immunol. 134:3204; and Goodman, M. G. 1986. “Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine”. J. Immunol. 136:3335). 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTL (Feldbush, T. L., 1985. cited supra), augment murine NK activity (Koo, G. C., M. E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988. “Activation of murine natural killer cells and macrophages by 8-bromoguanosine”. J. Immunol. 140:3249), and synergize with IL-2 in inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas. 1990. “Lymphokine-activated killer (LAK) cells. V. 8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation”. J. Immunol. 145:3524). The NK and LAK augmenting activities of these C8-substituted guanosines appear to be due to their induction of IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5′ triphosphorylated thymidine produced by a mycobacterium was found to be mitogenic for a subset of human γδ T cells (Constant, P., F. Davodeau, M.-A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, and J.-J. Fournie. 1994. “Stimulation of human γδ T cells by nonpeptidic mycobacterial ligands” Science 264:267). This report indicated the possibility that the immune system may have evolved ways to preferentially respond to microbial nucleic acids.
  • Several observations suggest that certain DNA structures may also have the potential to activate lymphocytes. For example, Bell et al. reported that nucleosomal protein-DNA complexes (but not naked DNA) in spleen cell supernatants caused B cell proliferation and immunoglobulin secretion (Bell, D. A., B. Morrison, and P. VandenBygaart. 1990. “Immunogenic DNA-related factors”. J. Clin. Invest. 85:1487). In other cases, naked DNA has been reported to have immune effects. For example, Messina et al. have recently reported that 260 to 800 bp fragments of poly (dG)•(dC) and poly (dG•dC) were mitogenic for B cells (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1993. “The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens”. Cell. Immunol.147:148). Tokunaga, et al. have reported that dG•dC induces IFN-γ and NK activity (Tokunaga, S. Yamamoto, and K. Namba. 1988. “A synthetic single-stranded DNA, poly(dG,dC), induces interferon-α/β and -γ, augments natural killer activity, and suppresses tumor growth” Jpn. J Cancer Res. 79:682). Aside from such artificial homopolymer sequences, Pisetsky et al. reported that pure mammalian DNA has no detectable immune effects, but that DNA from certain bacteria induces B cell activation and immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1991. “Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA”. J. Immunol. 147:1759). Assuming that these data did not result from some unusual contaminant, these studies suggested that a particular structure or other characteristic of bacterial DNA renders it capable of triggering B cell activation. Investigations of mycobacterial DNA sequences have demonstrated that ODN which contain certain palindrome sequences can activate NK cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992. “Unique palindromic sequences in synthetic oligonucleotides are required to induce INF and augment INF-mediated natural killer activity”. J. Immunol. 148:4072; Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. “Oligonucleotide sequences required for natural killer cell activation”. Jpn. J. Cancer Res. 83:1128).
  • Several phosphorothioate modified ODN have been reported to induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C. Chu, and W. E. Paul. 1992. “An antisense oligonucleotide complementary to a sequence in Iγ2b increases γ2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion”. J. Exp. Med. 175:597; Branda, R. F., A. L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. “Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1”. Biochem. Pharmacol. 45:2037; McIntyre, K. W., K. Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D. Larigan, K. T. Landreth, and R. Narayanan. 1993. “A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NFκB T65 causes sequence-specific immune stimulation”. Antisense Res. Develop. 3:309; and Pisetsky, D. S., and C. F. Reich. 1993. “Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus”. Life Sciences 54:101). These reports do not suggest a common structural motif or sequence element in these ODN that might explain their effects.
  • The CREB/ATF Family of Transcription Factors and Their Role in Replication
  • The cAMP response element binding protein (CREB) and activating transcription factor (ATF) or CREB/ATF family of transcription factors is a ubiquitously expressed class of transcription factors of which 11 members have so far been cloned (reviewed in de Groot, R. P., and P. Sassone-Corsi: “Hormonal control of gene expression: Multiplicity and versatility of cyclic adenosine 3′,5′-monophosphate-responsive nuclear regulators”. Mol. Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson: “Transcriptional regulation by CREB and its relatives”. Biochim. Biophys. Acta 1174:221, 1993.). They all belong to the basic region/leucine zipper (bZip) class of proteins. All cells appear to express one or more CREB/ATF proteins, but the members expressed and the regulation of mRNA splicing appear to be tissue-specific. Differential splicing of activation domains can determine whether a particular CREB/ATF protein will be a transcriptional inhibitor or activator. Many CREB/ATF proteins activate viral transcription, but some splicing variants which lack the activation domain are inhibitory. CREB/ATF proteins can bind DNA as homo- or hetero-dimers through the cAMP response element, the CRE, the consensus form of which is the unmethylated sequence TGACGTC (binding is abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W. Schaffner: “CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation”. Genes & Develop. 3:612, 1989.).
  • The transcriptional activity of the CRE is increased during B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein: “Induction of CREB activity via the surface Ig receptor of B cells”. J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to regulate the expression of multiple genes through the CRE including immunologically important genes such as fos, jun B, Rb-1, IL-6, IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron: “Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1β gene”. Mol. Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel, M. Root, J. M. Pow-Sang, and E. Wickstrom: “Antisense DNA inhibition of tumor growth induced by c-Ha-ras oncogene in nude mice”. Cancer Res. 53:577, 1993), IFN-β (Du, W., and T. Maniatis: “An ATF/CREB binding site protein is required for virus induction of the human interferon B gene”. Proc. Natl. Acad. Sci. USA 89:2150, 1992), TGF-B1 (Asiedu, C. K., L. Scott, R. K. Assoian, M. Ehrlich: “Binding of AP-1/CREB proteins and of MDBP to contiguous sites downstream of the human TGF-B1 gene”. Biochim. Biophys. Acta 1219:55, 1994.), TGF-β2, class II MHC (Cox, P. M., and C. R. Goding: “An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DRa promoter and activation by SV40 T-antigen”. Nucl. Acids Res. 20:4881, 1992.), E-selectin, GM-CSF, CD-8 α, the germline Igα constant region gene, the TCR Vβ gene, and the proliferating cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B. Prystowsky: “Promoter activity of the proliferating-cell nuclear antigen gene is associated with inducible CRE-binding proteins in interleukin 2-stimulated T lymphocytes”. Mol. Cell. Biol. 14:4233, 1994.). In addition to activation through the cAMP pathway, CREB can also mediate transcriptional responses to changes in intracellular Ca++ concentration (Sheng, M., G. McFadden, and M. E. Greenberg: “Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB”. Neuron 4:571, 1990).
  • The role of protein-protein interactions in transcriptional activation by CREB/ATF proteins appears to be extremely important. There are several published studies reporting direct or indirect interactions between NFκB proteins and CREB/ATF proteins (Whitley, et. al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al., (1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189; and Du, et al., (1993) Cell 74:887. Activation of CREB through the cyclic AMP pathway requires protein kinase A (PKA), which phosphorylates CREB341 on ser133 and allows it to bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman: “Nuclear protein CBP is a coactivator for the transcription factor CREB”. Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea, M. Karin, J. Feramisco, and M. Montminy: “Activation of cAMP and mitogen responsive genes relies on a common nuclear factor”. Nature 370:226, 1994.). CBP in turn interacts with the basal transcription factor TFIIB causing increased transcription. CREB also has been reported to interact with dTAFII 110, a TATA binding protein-associated factor whose binding may regulate transcription (Ferreri, K., G. Gill, and M. Montminy: “The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex”. Proc. Natl. Acad. Sci. USA 91:1210, 1994.). In addition to these interactions, CREB/ATF proteins can specifically bind multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbader, and C.-Y. Chen: “Identification of multiple nuclear factors that interact with cyclic adenosine 3′,5′-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions”. Mol. Endocrinol. 5:256, 1991) but the biologic significance of most of these interactions is unknown. CREB is normally thought to bind DNA either as a homodimer or as a heterodimer with several other proteins. Surprisingly, CREB monomers constitutively activate transcription (Krajewski, W., and K. A. W. Lee: “A monomeric derivative of the cellular transcription factor CREB functions as a constitutive activator”. Mol. Cell. Biol. 14:7204, 1994).
  • Aside from their critical role in regulating cellular transcription, it has recently been shown that CREB/ATF proteins are subverted by some infectious viruses and retroviruses, which require them for viral replication. For example, the cytomegalovirus immediate early promoter, one of the strongest known mammalian promoters, contains eleven copies of the CRE which are essential for promoter function (Chang, Y.-N., S. Crawford, J. Stall, D. R. Rawlins, K.-T. Jeang, and G. S. Hayward: “The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements”. J. Virol. 64:264, 1990). At least some of the transcriptional activating effects of the adenovirus E1 A protein, which induces many promoters, are due to its binding to the DNA binding domain of the CREB/ATF protein, ATF-2, which mediates E1 A inducible transcription activation (Liu, F., and M. R. Green: “Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains”. Nature 368:520, 1994). It has also been suggested that E1A binds to the CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M. Livingston, and R. Eckner: “E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators”. Cell 77:799, 1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which causes human T cell leukemia and tropical spastic paresis, also requires CREB/ATF proteins for replication. In this case, the retrovirus produces a protein, Tax, which binds to CREB/ATF proteins and redirects them from their normal cellular binding sites to different DNA sequences (flanked by G- and C-rich sequences) present within the HTLV transcriptional enhancer (Paca-Uccaralertkun, S., L.-J. Zhao, N. Adya, J. V. Cross, B. R. Cullen, I. M. Boros, and C.-Z. Giam: “In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax”. Mol. Cell. Biol. 14:456, 1994; Adya, N., L.-J. Zhao, W. Huang, I. Boros, and C.-Z. Giam: “Expansion of CREB's DNA recognition specificity by Tax results from interaction with Ala-Ala-Arg at positions 282-284 near the conserved DNA-binding domain of CREB”. Proc. Natl. Acad. Sci. USA 91:5642, 1994).
  • SUMMARY OF THE INVENTION
  • The instant invention is based on the finding that certain nucleic acids containing unmethylated cytosine-guanine (CpG) dinucleotides activate lymphocytes in a subject and redirect a subject's immune response from a Th2 to a Th1 (e.g. by inducing monocytic cells and other cells to produce Th1 cytokines, including IL-12, IFN-γ and GM-CSF). Based on this finding, the invention features, in one aspect, novel immunostimulatory nucleic acid compositions.
  • In a preferred embodiment, the immunostimulatory nucleic acid contains a consensus mitogenic CpG motif represented by the formula:
    5′X 1 CGX 23′
    wherein X1 is selected from the group consisting of A,G and T; and X2 is C or T.
  • In a particularly preferred embodiment an immunostimulatory nucleic acid molecule contains a consensus mitogenic CpG motif represented by the formula:
    5′ X 1 X 2 CGX 3 X 43′
    wherein C and G are unmethylated; and X1, X2, X3 and X4 are nucleotides.
  • Enhanced immunostimulatory activity of human cells occurs where X1X2 is selected from the group consisting of GpT, GpG, GpA and ApA and/or X3X4 is selected from the group consisting of TpT, CpT and GpT (Table 5). For facilitating uptake into cells, CpG containing immunostimulatory nucleic acid molecules are preferably in the range of 8 to 40 base pairs in size. However, nucleic acids of any size (even many kb long) are immunostimulatory if sufficient immunostimulatory motifs are present, since such larger nucleic acids are degraded into oligonucleotides inside of cells. Preferred synthetic oligonucleotides do not include a GCG trinucleotide sequence at or near the 5′ and/or 3′ terminals and/or the consensus mitogenic CpG motif is not a palindrome. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides.
  • In a second aspect, the invention features useful therapies, which are based on the immunostimulatory activity of the nucleic acid molecules. For example, the immunostimulatory nucleic acid molecules can be used to treat, prevent or ameliorate an immune system deficiency (e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject). In addition, immunostimulatory nucleic acid molecules can be administered to stimulate a subject's response to a vaccine.
  • Further, by redirecting a subject's immune response from Th2 to Th1, the instant claimed nucleic acid molecules can be administered to treat or prevent the symptoms of asthma. In addition, the instant claimed nucleic acid molecules can be administered in conjunction with a particular allergen to a subject as a type of desensitization therapy to treat or prevent the occurrence of an allergic reaction.
  • Further, the ability of immunostimulatory nucleic acid molecules to induce leukemic cells to enter the cell cycle supports the use of immunostimulatory nucleic acid molecules in treating leukemia by increasing the sensitivity of chronic leukemia cells and then administering conventional ablative chemotherapy, or combining the immunostimulatory nucleic acid molecules with another immunotherapy.
  • Other features and advantages of the invention will become more apparent from the following detailed description and claims.
  • BRIEF DESCRIPTION OF THE FIGURES
  • FIG. 1A-C are graphs plotting dose-dependent IL-6 production in response to various DNA sequences in T cell depleted spleen cell cultures. A. E. coli DNA (●) and calf thymus DNA (▪) sequences and LPS (at 10× the concentration of E. coli and calf thymus DNA) (♦). B. Control phosphodiester oligodeoxynucleotide (ODN) 5′ ATGGAAGGTCCAGTGTTCTC 3′ (SEQ ID NO:1) (▪) and two phosphodiester CpG ODN 5′ ATCGACCTACGTGCGTTCTC 3′ (SEQ ID NO:2) (♦) and 5′ TCCATAACGTTCCTGATGCT 3′ (SEQ ID NO:3) ( ). C. Control phosphorothioate ODN 5′ GCTAGATGTTAGCGT 3′ (SEQ ID NO:4) (▪) and two phosphorothioate CpG ODN 5′ GAGAACGTCGACCTTCGAT 3′ (SEQ ID NO:5) (♦) and 5′ GCATGACGTTGAGCT 3′ (SEQ ID NO:6) (●). Data present the mean±standard deviation of triplicates.
  • FIG. 2 is a graph plotting IL-6 production induced by CpG DNA in vivo as determined 1-8 hrs after injection. Data represent the mean from duplicate analyses of sera from two mice. BALB/c mice (two mice/group) were injected iv. with 100 μl of PBS (□) or 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (▪) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) (♦).
  • FIG. 3 is an autoradiograph showing IL-6 mRNA expression as determined by reverse transcription polymerase chain reaction in liver, spleen, and thymus at various time periods after in vivo stimulation of BALB/c mice (two mice/group) injected iv with 100 μL of PBS, 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8).
  • FIG. 4A is a graph plotting dose-dependent inhibition of CpG-induced IgM production by anti-IL-6. Splenic B-cells from DBA/2 mice were stimulated with CpG ODN 5′ TCCAAGACGTTCCTGATGCT 3′ (SEQ ID NO:9) in the presence of the indicated concentrations of neutralizing anti-IL-6 (♦) or isotype control Ab (●) and IgM levels in culture supernatants determined by ELISA. In the absence of CpG ODN, the anti-IL-6 Ab had no effect on IgM secretion (▪).
  • FIG. 4B is a graph plotting the stimulation index of CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (♦) or anti-IL-6 antibody only (▪). Data present the mean±standard deviation of triplicates.
  • FIG. 5 is a bar graph plotting chloramphenicol acetyltransferase (CAT) activity in WEHI-231 cells transfected with a promoter-less CAT construct (pCAT), positive control plasmid (RSV), or IL-6 promoter-CAT construct alone or cultured with CpG 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) phosphorothioate ODN at the indicated concentrations. Data present the mean of triplicates.
  • FIG. 6 is a schematic overview of the immune effects of the immunostimulatory unmethylated CpG containing nucleic acids, which can directly activate both B cells and monocytic cells (including macrophages and dendritic cells) as shown. The immunostimulatory oligonucleotides do not directly activate purified NK cells, but render them competent to respond to IL-12 with a marked increase in their IFN-γ production. By inducing IL-12 production and the subsequent increased IFN-γ secretion by NK cells, the immunostimulatory nucleic acids promote a Th1 type immune response. No direct activation of proliferation of cytokine secretion by highly purified T cells has been found. However, the induction of Th1 cytokine secretion by the immunostimulatory oligonucleotides promotes the development of a cytotoxic lymphocyte response.
  • FIG. 7 is an autoradiograph showing NFKB mRNA induction in monocytes treated with E. coli (EC) DNA (containing unmethylated CpG motifs), control (CT) DNA (containing no unmethylated CpG motifs) and lipopolysaccharide (LPS) at various measured times, 15 and 30 minutes after contact.
  • FIG. 8A shows the results from a flow cytometry study using mouse B cells with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. The dye only sample in Panel A of the figure shows the background level of cells positive for the dye at 28.6%. This level of reactive oxygen species was greatly increased to 80% in the cells treated for 20 minutes with PMA and ionomycin, a positive control (Panel B). The cells treated with the CpG oligo (TCCATGACGTTCCTGACGTT SEQ ID NO:10) also showed an increase in the level of reactive oxygen species such that more than 50% of the cells became positive (Panel D). However, cells treated with an oligonucleotide with the identical sequence except that the CpGs were switched (TCCATGAGCTTCCTGAGTGCT SEQ ID NO:11) did not show this significant increase in the level of reactive oxygen species (Panel E).
  • FIG. 8B shows the results from a flow cytometry study using mouse B cells in the presence of chloroquine with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. Chloroquine slightly lowers the background level of reactive oxygen species in the cells such that the untreated cells in Panel A have only 4.3% that are positive. Chloroquine completely abolishes the induction of reactive oxygen species in the cells treated with CpG DNA (Panel B) but does not reduce the level of reactive oxygen species in the cells treated with PMA and ionomycin (Panel E).
  • FIG. 9 is a graph plotting lung lavage cell count over time. The graph shows that when the mice are initially injected with Schistosoma mansoni eggs “egg”, which induces a Th2 immune response, and subsequently inhale Schistosoma mansoni egg antigen “SEA” (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given CpG oligo (SEQ ID NO:10) along with egg, the inflammatory cells in the lung are not increased by subsequent inhalation of SEA (open triangles).
  • FIG. 10 is a graph plotting lung lavage eosinophil count over time. Again, the graph shows that when the mice are initially injected with egg and subsequently inhale SEA (open circle), many eosinophils are present in the lungs. However, when the mice are initially given CpG oligo (SEQ ID NO:10) along with egg, the inflammatory cells in the lung are not increased by subsequent inhalation of the SEA (open triangles).
  • FIG. 11 is a bar graph plotting the effect on the percentage of macrophage, lymphocyte, neutrophil and eosinophil cells induced by exposure to saline alone; egg, then SEA; egg and SEQ ID NO:11, then SEA; and egg and control oligo (SEQ ID NO:11), then SEA. When the mice are treated with the control oligo at the time of the initial exposure to the egg, there is little effect on the subsequent influx of eosinophils into the lungs after inhalation of SEA. Thus, when mice inhale the eggs on days 14 or 21, they develop an acute inflammatory response in the lungs. However, giving a CpG oligo along with the eggs at the time of initial antigen exposure on days 0 and 7 almost completely abolishes the increase in eosinophils when the mice inhale the egg antigen on day 14.
  • FIG. 12 is a bar graph plotting eosinophil count in response to injection of various amounts of the protective oligo SEQ ID NO:10.
  • FIG. 13 is a graph plotting interleukin 4 (IL-4) production (pg/ml) in mice over time in response to injection of egg, then SEA (open diamond); egg and SEQ ID NO:10, then SEA (open circle); or saline, then saline (open square). The graph shows that the resultant inflammatory response correlates with the levels of the Th2 cytokine IL-4 in the lung.
  • FIG. 14 is a bar graph plotting interleukin 12 (IL-12) production (pg/ml) in mice over time in response to injection of saline; egg, then SEA; or SEQ ID NO: 0 and egg, then SEA. The graph shows that administration of an oligonucleotide containing an umethylated CpG motif can actually redirect the cytokine response of the lung to production of IL-12, indicating a Th1 type of immune response.
  • FIG. 15 is a bar graph plotting interferon gamma (IFN-γ) production (pg/ml) in mice over time in response to injection of saline; egg, then saline; or SEQ ID NO:10 and egg, then SEA. The graph shows that administration of an oligonucleotide containing an unmethylated CpG motif can also redirect the cytokine response of the lung to production of IFN-γ, indicating a Th1 type of immune response.
  • DETAILED DESCRIPTION OF THE INVENTION
  • Definitions
  • As used herein, the following terms and phrases shall have the meanings set forth below:
  • An “allergen” refers to a substance that can induce an allergic or asthmatic response in a susceptible subject. The list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores and drugs (e.g. penicillin). Examples of natural, animal and plant allergens include proteins specific to the following genera: Canine (Canis familiaris); Dermatophagoides (e.g. Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinosa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana); Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale); Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum (e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum (e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea); Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum halepensis); and Bromus (e.g. Bromus inermis).
  • An “allergy” refers to acquired hypersensitivity to a substance (allergen). Allergic conditions include eczema, allergic rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions.
  • “Asthma” refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms.
  • An “immune system deficiency” shall mean a disease or disorder in which the subject's immune system is not functioning in normal capacity or in which it would be useful to boost a subject's immune response for example to eliminate a tumor or cancer (e.g. tumors of the brain, lung (e.g. small cell and non-small cell), ovary, breast, prostate, colon, as well as other carcinomas and sarcomas) or an infection in a subject.
  • Examples of infectious virus include: Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g., Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes viruses); Poxyiridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g., African swine fever virus); and unclassified viruses (e.g., the etiological agents of Spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class 1=internally transmitted; class 2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related viruses, and astroviruses).
  • Examples of infectious bacteria include: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria spp. (e.g., M tuberculosis, M. avium, M. intracellulare, M. kansasii, gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic spp.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira, and Actinomyces israelli.
  • Examples of infectious fungi include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans. Other infectious organisms (i.e., protists) include: Plasmodium falciparum and Toxoplasma gondii.
  • An “immunostimulatory nucleic acid molecule” refers to a nucleic acid molecule, which contains an unmethylated cytosine, guanine dinucleotide sequence (i.e. “CpG DNA” or DNA containing a cytosine followed by guanosine and linked by a phosphate bond) and stimulates (e.g. has a mitogenic effect on, or induces or increases cytokine expression by) a vertebrate lymphocyte. An immunostimulatory nucleic acid molecule can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules have increased immune activity.
  • In a preferred embodiment, the immunostimulatory nucleic acid contains a consensus mitogenic CpG motif represented by the formula:
    5′ X 1 CGX 23′
    wherein X1 is selected from the group consisting of A,G and T; and X2 is C or T.
  • In a particularly preferred embodiment, immunostimulatory nucleic acid molecules are between 2 to 100 base pairs in size and contain a consensus mitogenic CpG motif represented by the formula:
    5′ X 1 X 2 CGX 3 X 43′
    wherein C and G are unmethylated, X1, X2, X3 and X4 are nucleotides.
  • For economic reasons, preferably the immunostimulatory CpG DNA is in the range of between 8 to 40 base pairs in size if it is synthesized as an oligonucleotide. Alternatively, CpG dinucleotides can be produced on a large scale in plasmids, which after being administered to a subject are degraded into oligonucleotides. Preferred immunostimulatory nucleic acid molecules (e.g. for use in increasing the effectiveness of a vaccine or to treat an immune system deficiency by stimulating an antibody [humoral] response in a subject) have a relatively high stimulation index with regard to B cell, monocyte and/or natural killer cell responses (e.g. cytokine, proliferative, lytic or other responses).
  • The stimulation index of a particular immunostimulatory CpG DNA can be tested in various immune cell assays. Preferably, the stimulation index of the immunostimulatory CpG DNA with regard to B-cell proliferation is at least about 5, preferably at least about 10, more preferably at least about 15 and most preferably at least about 20 as determined by incorporation of 3H uridine in a murine B cell culture, which has been contacted with a 20 μM of ODN for 20 h at 37° C. and has been pulsed with 1 μCi of 3H uridine; and harvested and counted 4 h later as described in detail in Example 1. For use in vivo, for example to treat an immune system deficiency by stimulating a cell-mediated (local) immune response in a subject, it is important that the immunostimulatory CpG DNA be capable of effectively inducing cytokine secretion by monocytic cells and/or Natural Killer (NK) cell lytic activity.
  • Preferred immunostimulatory CpG nucleic acids should effect at least about 500 pg/ml of TNF-α, 15 pg/ml IFN-γ, 70 pg/ml of GM-CSF, 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the therapeutic indication, as determined by the assays described in Example 12. Other preferred immunostimulatory CpG DNAs should effect at least about 10%, more preferably at least about 15% and most preferably at least about 20% YAC-1 cell specific lysis or at least about 30, more preferably at least about 35 and most preferably at least about 40% 2C11 cell specific lysis as determined by the assay described in detail in Example 4.
  • A “nucleic acid” or “DNA” shall mean multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)). As used herein, the term refers to ribonucleotides as well as oligodeoxyribonucleotides. The term shall also include polynucleosides (i.e. a polynucleotide minus the phosphate) and any other organic base containing polymer. Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g. genomic or cDNA), but are preferably synthetic (e.g. produced by oligonucleotide synthesis).
  • A “nucleic acid delivery complex” shall mean a nucleic acid molecule associated with (e.g. ionically or covalently bound to; or encapsulated within) a targeting means (e.g. a molecule that results in higher affinity binding to target cell (e.g. B-cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells). Examples of nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g. cholesterol), a lipid (e.g. a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g. a ligand recognized by target cell specific receptor). Preferred complexes must be sufficiently stable in vivo to prevent significant uncoupling prior to internalization by the target cell. However, the complex should be cleavable under appropriate conditions within the cell so that the nucleic acid is released in a functional form.
  • “Palindromic sequence” shall mean an inverted repeat (i.e. a sequence such as ABCDEE′D′C′B′A′ in which A and A′ are bases capable of forming the usual Watson-Crick base pairs. In vivo, such sequences may form double stranded structures.
  • A “stabilized nucleic acid molecule” shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Stabilization can be a function of length or secondary structure. Unmethylated CpG containing nucleic acid molecules that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter immunostimulatory nucleic acid molecules, secondary structure can stabilize and increase their effect. For example, if the 3′ end of a nucleic acid molecule has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop sturcture, then the nucleic acid molecule becomes stabilized and therefore exhibits more activity.
  • Preferred stabilized nucleic acid molecules of the instant invention have a modified backbone. For use in immune stimulation, especially preferred stabilized nucleic acid molecules are phosphorothioate modified nucleic acid molecules (i.e. at least one of the phosphate oxygens of the nucleic acid molecule is replaced by sulfur). Preferably the phosphate modification occurs at or near the 5′ and/or 3′ end of the nucleic acid molecule. In addition to stabilizing nucleic acid molecules, as reported further herein, phosphorothioate-modified nucleic acid molecules (including phosphorodithioate-modified) can increase the extent of immune stimulation of the nucleic acid molecule, which contains an unmethylated CpG dinucleotide as shown herein. International Patent Application Publication Number: WO 95/26204 entitled “Immune Stimulation By Phosphorothioate Oligonucleotide Analogs” also reports on the non-sequence specific immunostimulatory effect of phosphorothioate modified oligonucleotides. As reported herein, unmethylated CpG containing nucleic acid molecules having a phosphorothioate backbone have been found to preferentially activate B-cell activity, while unmethylated CpG containing nucleic acid molecules having a phosphodiester backbone have been found to preferentially activate monocytic (macrophages, dendritic cells and monocytes) and NK cells. Phosphorothioate CpG oligonucleotides with preferred human motifs are also strong activators of monocytic and NK cells.
  • Other stabilized nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl-phosphonates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acid molecules which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
  • A “subject” shall mean a human or vertebrate animal including a dog, cat, horse, cow, pig, sheep, goat, chicken, monkey, rat, mouse, etc.
  • As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Preferred vectors are those capable of autonomous replication and expression of nucleic acids to which they are linked (e.g., an episome). Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as “expression vectors.” In general, expression vectors of utility in recombinant DNA techniques are often in the form of “plasmids” which refer generally to circular double stranded DNA loops which, in their vector form, are not bound to the chromosome. In the present specification, “plasmid” and “vector” are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • Certain Unmethylated CpG Containing Nucleic Acids Have B Cell Stimulatory Activity As Shown in vitro and in vivo
  • In the course of investigating the lymphocyte stimulatory effects of two antisense oligonucleotides specific for endogenous retroviral sequences, using protocols described in the attached Examples 1 and 2, it was surprisingly found that two out of twenty-four “controls” (including various scrambled, sense, and mismatch controls for a panel of “antisense” ODN) also mediated B cell activation and IgM secretion, while the other “controls” had no effect.
  • Two observations suggested that the mechanism of this B cell activation by the “control” ODN may not involve antisense effects 1) comparison of vertebrate DNA sequences listed in GenBank showed no greater homology than that seen with non-stimulatory ODN and 2) the two controls showed no hybridization to Northern blots with 10 pg of spleen poly A+ RNA. Resynthesis of these ODN on a different synthesizer or extensive purification by polyacrylamide gel electrophoresis or high pressure liquid chromatography gave identical stimulation, eliminating the possibility of an impurity. Similar stimulation was seen using B cells from C3H/HeJ mice, eliminating the possibility that lipopolysaccharide (LPS) contamination could account for the results.
  • The fact that two “control” ODN caused B cell activation similar to that of the two “antisense” ODN raised the possibility that all four ODN were stimulating B cells through some non-antisense mechanism involving a sequence motif that was absent in all of the other nonstimulatory control ODN. In comparing these sequences, it was discovered that all of the four stimulatory ODN contained CpG dinucleotides that were in a different sequence context from the nonstimulatory control.
  • To determine whether the CpG motif present in the stimulatory ODN was responsible for the observed stimulation, over 300 ODN ranging in length from 5 to 42 bases that contained methylated, unmethylated, or no CpG dinucleotides in various sequence contexts were synthesized. These ODNs, including the two original “controls” (ODN 1 and 2) and two originally synthesized as “antisense” (ODN 3D and 3M; Krieg, A. M. J. Immunol. 143:2448 (1989)), were then examined for in vitro effects on spleen cells (representative sequences are listed in Table 1). Several ODN that contained CpG dinucleotides induced B cell activation and IgM secretion; the magnitude of this stimulation typically could be increased by adding more CpG dinucleotides (Table 1; compare ODN 2 to 2a or 3D to 3Da and 3 Db). Stimulation did not appear to result from an antisense mechanism or impurity. ODN caused no detectable proliferation of γδ or other T cell populations.
  • Mitogenic ODN sequences uniformly became nonstimulatory if the CpG dinucleotide was mutated (Table 1; compare ODN 1 to 1a; 3D to 3Dc; 3M to 3Ma; and 4 to 4a) or if the cytosine of the CpG dinucleotide was replaced by 5-methylcytosine (Table 1; ODN 1b,2b,3Dd, and 3 Mb). Partial methylation of CpG motifs caused a partial loss of stimulatory effect (compare 2a to 2c, Table 1). In contrast, methylation of other cytosines did not reduce ODN activity (ODN 1c, 2d, 3De and 3Mc). These data confirmed that a CpG motif is the essential element present in ODN that activate B cells.
  • In the course of these studies, it became clear that the bases flanking the CpG dinucleotide played an important role in determining the murine B cell activation induced by an ODN. The optimal stimulatory motif was determined to consist of a CpG flanked by two 5′ purines (preferably a GpA dinucleotide) and two 3′ pyrimidines (preferably a TpT or TpC dinucleotide). Mutations of ODN to bring the CpG motif closer to this ideal improved stimulation (e.g. Table 1, compare ODN 2 to 2e; 3M to 3Md) while mutations that disturbed the motif reduced stimulation (e.g. Table 1, compare ODN 3D to 3Df; 4 to 4b, 4c and 4d). On the other hand, mutations outside the CpG motif did not reduce stimulation (e.g. Table 1, compare ODN 1 to 1d; 3D to 3Dg; 3M to 3Me). For activation of human cells, the best flanking bases are slightly different (See Table 5).
  • Of those tested, ODNs shorter than 8 bases were non-stimulatory (e.g. Table 1, ODN 4e). Among the forty-eight 8 base ODN tested, the most stimulatory sequence identified was TCAACGTT (ODN 4) which contains the self complementary “palindrome” AACGTT. In further optimizing this motif, it was found that ODN containing Gs at both ends showed increased stimulation, particularly if the ODN were rendered nuclease resistant by phosphorothioate modification of the terminal internucleotide linkages. ODN 1585 (5′ GGGGTCAACGTTGAGGGGGG 3′ (SEQ ID NO:12)), in which the first two and last five internucleotide linkages are phosphorothioate modified caused an average 25.4 fold increase in mouse spleen cell proliferation compared to an average 3.2 fold increase in proliferation induced by ODN 1638, which has the same sequence as ODN 1585 except that the 10 Gs at the two ends are replaced by 10 As. The effect of the G-rich ends is cis; addition of an ODN with poly G ends but no CpG motif to cells along with 1638 gave no increased proliferation. For nucleic acid molecules longer than 8 base pairs, non-palindromic motifs containing an unmethylated CpG were found to be more immunostimulatory.
  • Other octamer ODN containing a 6 base palindrome with a TpC dinucleotide at the 5′ end were also active (e.g. Table 1, ODN 4b,4c). Other dinucleotides at the 5′ end gave reduced stimulation (e.g. ODN 4f; all sixteen possible dinucleotides were tested). The presence of a 3′ dinucleotide was insufficient to compensate for the lack of a 5′ dinucleotide (e.g. Table 1, ODN 4g). Disruption of the palindrome eliminated stimulation in octamer ODN (e.g. Table 1, ODN 4h), but palindromes were not required in longer ODN.
    TABLE 1
    Oligonucleotide Stimulation of Mouse B Cells
    ODN Stimulation Index′
    Production Sequence (5′ to 3′)† 3H Uridine IgM
    1 (SEQ ID NO:13) GCTAGACGTTAGCGT 6.1 ± 0.8 17.9 ± 3.6 
    1a (SEQ. ID NO:4) ......T........ 1.2 ± 0.2 1.7 ± 0.5
    1b (SEQ ID NO:14) ......Z........ 1.2 ± 0.1 1.8 ± 0.0
    1c (SEQ ID NO:15) ............Z.. 10.3 ± 4.4  9.5 ± 1.8
    1d (SEQ ID NO:16) ..AT......GAGC. 13.0 ± 2.3  18.3 ± 7.5 
    2 (SEQ ID NO:17) ATGGAAGGTCCAGCGTTCTC 2.9 ± 0.2 13.6 ± 2.0 
    2a (SEQ ID NO:18) ..C...CTC..G........ 7.7 ± 0.8 24.2 ± 3.2 
    2b (SEQ ID NO:19) ..Z...CTC.ZG..Z..... 1.6 ± 0.5 2.8 ± 2.2
    2c (SEQ ID NO:20) ..Z..CTC..G......... 3.1 ± 0.6 7.3 ± 1.4
    2d (SEQ ID NO:21) ..C..CTC..G......Z.. 7.4 ± 1.4 27.7 ± 5.4 
    2e (SEQ ID NO:22) ............A....... 5.6 ± 2.0 ND
    3D (SEQ ID NO:23) GAGAACGCTGGACCTTCCAT 4.9 ± 0.5 19.9 ± 3.6 
    3Da (SEQ ID NO:24) .........C.......... 6.6 ± 1.5 33.9 ± 6.8 
    3Db (SEQ ID NO:25) .........C.......G.. 10.1 ± 2.8  25.4 ± 0.8 
    3Dc (SEQ ID NO:26) ...C.A.............. 1.0 ± 0.1 1.2 ± 0.5
    3Dd (SEQ ID NO:27) .....Z.............. 1.2 ± 0.2 1.0 ± 0.4
    3De (SEQ ID NO:28) .............Z...... 4.4 ± 1.2 18.8 ± 4.4 
    3Df (SEQ ID NO:29) .......A............ 1.6 ± 0.1 7.7 ± 0.4
    3Dg (SEQ ID NO:30) .........CC.G.ACTG.. 6.1 ± 1.5 18.6 ± 1.5 
    3M (SEQ ID NO:31) TCCATGTCGGTCCTGATGCT 4.1 ± 0.2 23.2 ± 4.9 
    3Ma (SEQ ID NO:32) ......CT............ 0.9 ± 0.1 1.8 ± 0.5
    3Mb (SEQ ID NO:33) .......Z............ 1.3 ± 0.3 1.5 ± 0.6
    3Mc (SEQ ID NO:34) ...........Z........ 5.4 ± 1.5 8.5 ± 2.6
    3Md (SEQ ID NO:35) ......A..T.......... 17.2 ± 9.4  ND
    3Me (SEQ ID NO:36) ...............C..A. 3.6 ± 0.2 14.2 ± 5.2 
     4 TCAACGTT 6.1 ± 1.4 19.2 ± 5.2 
     4a ....GC.. 1.1 ± 0.2 1.5 ± 1.1
     4b ...GCGC. 4.5.± 0.2 9.6 ± 3.4
     4c ...TCGA. 2.7.± 1.0 ND
     4d ..TT..AA 1.3 ± 0.2 ND
     4e -....... 1.3 ± 0.2 1.1 ± 0.5
     4f C....... 3.9 ± 1.4 ND
     4g --......CT 1.4 ± 0.3 ND
     4h ........C 1.2 ± 0.2 ND
     LPS 7.8 ± 2.5 4.8 ± 1.0

    ′Stimulation indexes are the means and std. dev. derived from at least 3 separate experiments, and are compared to wells cultured with no added ODN.

    ND = not done.

    CpG dinucleotides are underlined.

    Dots indicate identity; dashes indicate deletions.

    Z indicates 5 methyl cytosine.
  • TABLE 2
    Identification of the Optimal CpG Motif for Murine IL-6 Production
    and B Cell Activation
    IL-6 (pg/ml)a
    ODN SEQUENCE (5′-3′) CF12.LX SPLENIC B CELL SIb IgM (ng/ml)c
     512 (SEQ ID NO:37) TCCATGTCGGTCCTGATGCT 1300 ± 106 627 ± 43 5.8 ± 0.3  7315 ± 1324
    1637 (SEQ ID NO:38) ......C............. 136 ± 27 46 ± 6 1.7 ± 0.2 770 ± 72
    1615 (SEQ ID NO:39) ......G............. 1201 ± 155  850 ± 202 3.7 ± 0.3 3212 ± 617
    1614 (SEQ ID NO:40) ......A............. 1533 ± 321 1812 ± 103 10.8 ± 0.6  7558 ± 414
    1636 (SEQ ID NO:41) .........A.......... 1181 ± 76   947 ± 132 5.4 ± 0.4 3983 ± 485
    1634 (SEQ ID NO:42) .........C.......... 1049 ± 223 1671 ± 175 9.2 ± 0.9 6256 ± 261
    1619 (SEQ ID NO:43) .........T.......... 1555 ± 304 2908 ± 129 12.5 ± 1.0  8243 ± 698
    1618 (SEQ ID NO:44) ......A..T.......... 2109 ± 291 2596 ± 166 12.9 ± 0.7  10425 ± 674 
    1639 (SEQ ID NO:45) .....AA..T.......... 1827 ± 83  2012 ± 132 11.5 ± 0.4  9489 ± 103
    1707 (SEQ ID NO:46) ......A..TC......... ND 1147 ± 175 4.0 ± 0.2 3534 ± 217
    1708 (SEQ ID NO:47) .....CA..TG......... ND 59 ± 3 1.5 ± 0.1  466 ± 109

    Dots indicate identity; CpG dinucleotides are underlined; ND = not done

    aThe experiment was done at least three times with similar results. The level of IL-6 of unstimulated control cultures of both CH12.LX and splenic B cells was ≦ 10 pg/ml. The IgM level of unstimulated culture was 547 ± 82 ng/ml. CpG dinucleotides are underlined and dots indicate identity.

    b[3H] Uridine uptake was indicated as a fold increase (SI: stimulation index) from unstimulated control (2322.67 ± 213.68 cpm). Cells were stimulated with 20 μM of various CpG O-ODN. Data present the mean ± SD of triplicates

    cMeasured by ELISA.
  • The kinetics of lymphocyte activation were investigated using mouse spleen cells. When the cells were pulsed at the same time as ODN addition and harvested just four hours later, there was already a two-fold increase in 3H uridine incorporation. Stimulation peaked at 12-48 hours and then decreased. After 24 hours, no intact ODN were detected, perhaps accounting for the subsequent fall in stimulation when purified B cells with or without anti-IgM (at a submitogenic dose) were cultured with CpG ODN, proliferation was found to synergistically increase about 10-fold by the two mitogens in combination after 48 hours. The magnitude of stimulation was concentration dependent and consistently exceeded that of LPS under optimal conditions for both. Oligonucleotides containing a nuclease resistant phosphorothioate backbone were approximately two hundred times more potent than unmodified oligonucleotides.
  • Cell cycle analysis was used to determine the proportion of B cells activated by CpG-ODN. CpG-ODN induced cycling in more than 95% of B cells. Splenic B lymphocytes sorted by flow cytometry into CD23− (marginal zone) and CD23+ (follicular) subpopulations were equally responsive to ODN-induced stimulation, as were both resting and activated populations of B cells isolated by fractionation over Percoll gradients. These studies demonstrated that CpG-ODN induce essentially all B cells to enter the cell cycle.
  • Immunostimulatory Nucleic Acid Molecules Block Murine B Cell Apoptosis
  • Certain B cell lines such as WEHI-231 are induced to undergo growth arrest and/or apoptosis in response to crosslinking of their antigen receptor by anti-IgM (Jakway, J. P. et al., “Growth regulation of the B lymphoma cell line WEHI-231 by anti-immunoglobulin, lipopolysaccharide and other bacterial products” J. Immunol. 137: 2225 (1986); Tsubata, T., J. Wu and T. Honjo: B-cell apoptosis induced by antigen receptor crosslinking is blocked by a T-cell signal through CD40.” Nature 364: 645 (1993)). WEHI-231 cells are rescued from this growth arrest by certain stimuli such as LPS and by the CD40 ligand. ODN containing the CpG motif were also found to protect WEHI-231 from anti-IgM induced growth arrest, indicating that accessory cell populations are not required for the effect. Subsequent work indicates that CpG ODN induce Bcl-x and myc expression, which may account for the protection from apoptosis. Also, CpG nucleic acids have been found to block apoptosis in human cells. This inhibition of apoptosis is important, since it should enhance and prolong immune activation by CpG DNA.
  • Induction of Murine Cytokine Secretion by CpG Motifs in Bacterial DNA or Oligonucleotides
  • As described in Example 9, the amount of IL-6 secreted by spleen cells after CpG DNA stimulation was measured by ELISA. T cell depleted spleen cell cultures rather than whole spleen cells were used for in vitro studies following preliminary studies showing that T cells contribute little or nothing to the IL-6 produced by CpG DNA-stimulated spleen cells. As shown in Table 3, IL-6 production was markedly increased in cells cultured with E. coli DNA but not in cells cultured with calf thymus DNA. To confirm that the increased IL-6 production observed with E. coli DNA was not due to contamination by other bacterial products, the DNA was digested with DNAse prior to analysis. DNAse pretreatment abolished IL-6 production induced by E. coli DNA (Table 3). In addition, spleen cells from LPS-nonresponsive C3H/HeJ mouse produced similar levels of IL-6 in response to bacterial DNA. To analyze whether the IL-6 secretion induced by E. coli DNA was mediated by the unmethylated CpG dinucleotides in bacterial DNA, methylated E. coli DNA and a panel of synthetic ODN were examined. As shown in Table 3, CpG ODN significantly induced IL-6 secretion (ODN 5a, 5b, 5c) while CpG methylated E. coli DNA, or ODN containing methylated CpG (ODN 5f) or no CpG (ODN 5d) did not. Changes at sites other than CpG dinucleotides (ODN 5b) or methylation of other cytosines (ODN 5 g) did not reduce the effect of CpG ODN. Methylation of a single CpG in an ODN with three CpGs resulted in a partial reduction in the stimulation (compare ODN 5c to 5e; Table 3).
    TABLE 3
    Induction of Murine IL-6 Secretion by CpG Motifs
    in Bacterial DNA or Oligonucleotides
    Treatment IL-6 (pg/ml)
    calf thymus DNA <10
    calf thymus DNA + DNase <10
    E. coli DNA 1169.5 ± 94.1 
    E. coli DNA + DNase <10
    CpG methylated E. coli DNA <10
    LPS 280.1 ± 17.1
    Media (no DNA) <10
    ODN 5a SEQ ID NO:1 ATGGACTCTCCAGCGTTCTC 1096.4 ± 372.0
        5b SEQ ID NO:2 .....AGG....A....... 1124.5 ± 126.2
        5c SEQ ID NO:3 ..C.......G......... 1783.0 ± 189.5
        5d SEQ ID NO:4 .....AGG..C..T...... <10
        5e SEQ ID NO:5 ..C.......G..Z......  851.1 ± 114.4
        5f SEQ ID NO:6 ..Z......ZG..Z...... <10
        5g SEQ ID NO:7 ..C.......G......Z.. 1862.3 + 87.26

    T cell depleted spleen cells from DBA/2 mice were stimulated with phosphodiester modified oligonucleotides (O-ODN) (20 μM), calf thymus DNA (50 μg/ml) or E. coli DNA (50 μg/ml) with or without enzyme treatment, or LPS (10 μg/ml) for 24 hr. Data represent the mean (pg/ml) ± SD of triplicates. CpG dinucleotides are underlined and dots indicate identity. Z indicates 5-methylcytosine.
  • Identification of the Optimal CpG Motiffor Induction of Murine IL-6 and IgM Secretion and B Cell Proliferation
  • To evaluate whether the optimal B cell stimulatory CpG motif was identical with the optimal CpG motif for IL-6 secretion, a panel of ODN in which the bases flanking the CpG dinucleotide were progressively substituted was studied. This ODN panel was analyzed for effects on B cell proliferation, Ig production, and IL-6 secretion, using both splenic B cells and CH12.LX cells. As shown in Table 2, the optimal stimulatory motif is composed of an unmethylated CpG flanked by two 5′ purines and two 3′ pyrimidines. Generally a mutation of either 5′ purine to pyrimidine or 3′ pymmidine to purine significantly reduced its effects. Changes in 5′ purines to C were especially deleterious, but changes in 5′ purines to T or 3′ pyrimidines to purines had less marked effects. Based on analyses of these and scores of other ODN, it was determined that the optimal CpG motif for induction of IL-6 secretion is TGACGTT, which is identical with the optimal mitogenic and IgM-inducing CpG motif (Table 2). This motif was more stimulatory than any of the palindrome containing sequences studied (1639, 1707 and 1708).
  • Titration of Induction of Murine IL-6 Secretion by CpG Motifs
  • Bacterial DNA and CpG ODN induced IL-6 production in T cell depleted murine spleen cells in a dose-dependent manner, but vertebrate DNA and non-CpG ODN did not (FIG. 1). IL-6 production plateaued at approximately 50 μg/ml of bacterial DNA or 40 μM of CpG O-ODN. The maximum levels of IL-6 induced by bacterial DNA and CpG ODN were 1-1.5 ng/ml and 2-4 ng/ml respectively. These levels were significantly greater than those seen after stimulation by LPS (0.35 ng/ml) (FIG. 1A). To evaluate whether CpG ODN with a nuclease-resistant DNA backbone would also induce IL-6 production, S-ODN were added to T cell depleted murine spleen cells. CpG S-ODN also induced IL-6 production in a dose-dependent manner to approximately the same level as CpG O-ODN while non-CpG S-ODN failed to induce IL-6 (FIG. 1C). CpG S-ODN at a concentration of 0.05 μM could induce maximal IL-6 production in these cells. This result indicated that the nuclease-resistant DNA backbone modification retains the sequence specific ability of CpG DNA to induce IL-6 secretion and that CpG S-ODN are more than 80-fold more potent than CpG O-ODN in this assay system.
  • Induction of Murine IL-6 Secretion by CpG DNA in vivo
  • To evaluate the ability of bacterial DNA and CpG S-ODN to induce IL-6 secretion in vivo, BALB/c mice were injected i.v. with 100 pg of E. coli DNA, calf thymus DNA, or CpG or non-stimulatory S-ODN and bled 2 hr after stimulation. The level of IL-6 in the sera from the E. coli DNA injected group was approximately 13 ng/ml while IL-6 was not detected in the sera from calf thymus DNA or PBS injected groups (Table 4). CpG S-ODN also induced IL-6 secretion in vivo. The IL-6 level in the sera from CpG S-ODN injected groups was approximately 20 ng/ml. In contrast, IL-6 was not detected in the sera from non-stimulatory S-ODN stimulated group (Table 4).
    TABLE 4
    Secretion of Murine IL-6 Induced by CpG
    DNA Stimulation in vivo
    Stimulant IL-6 (pg/ml)
    PBS <50
    E. coli DNA 13858 ± 3143
    Calf Thymus DNA <50
    CpG S-ODN 20715 ± 606 
    non-CpG S-ODN <50

    Mice (2 mice/group) were i.v. injected with 100 μl of PBS, 200 μg of E. coli DNA or calf thymus DNA, or 500 μg of CpG S-ODN or non-CpG control S-ODN. Mice were bled 2 hr
    # after injection and 1:10 dilution of each serum was analyzed by IL-6 ELISA. Sensitivity limit of IL-6 ELISA was 5 pg/ml. Sequences of the CpG S-ODN is 5′GCATGACGTTGAGCT3′ (SEQ ID NO: 48)
    # and of the non-stimulatory S-ODN is 5′GCTAGATGTTAGCGT3′ (SEQ ID NO: 49). Note that although there is a CpG in SEQ ID NO: 49, it is too close to the 3′ end to
    # effect stimulation, as explained herein. Data represent mean ± SD of duplicates. The experiment was done at least twice with similar results.
  • Kinetics of Murine IL-6 Secretion After Stimulation by CpG Motifs in vivo
  • To evaluate the kinetics of induction of IL-6 secretion by CpG DNA in vivo, BALB/c mice were injected i.v. with CpG or control non-CpG S-ODN. Serum IL-6 levels were significantly increased within 1 hr and peaked at 2 hr to a level of approximately 9 ng/ml in the CpG S-ODN injected group (FIG. 2). IL-6 protein in sera rapidly decreased after 4 hr and returned to basal level by 12 hr after stimulation. In contrast to CpG DNA stimulated groups, no significant increase of IL-6 was observed in the sera from the non-stimulatory S-ODN or PBS injected groups (FIG. 2).
  • Tissue Distribution and Kinetics of IL-6 mRNA Expression Induced by CpG Motifs in vivo
  • As shown in FIG. 2, the level of serum IL-6 increased rapidly after CpG DNA stimulation. To investigate the possible tissue origin of this serum IL-6, and the kinetics of IL-6 gene expression in vivo after CpG DNA stimulation, BALB/c mice were injected i.v. with CpG or non-CpG S-ODN and RNA was extracted from liver, spleen, thymus, and bone marrow at various time points after stimulation. As shown in FIG. 3A, the level of 1-6 mRNA in liver, spleen, and thymus was increased within 30 min. after injection of CpG S-ODN. The liver IL-6 mRNA peaked at 2 hr post-injection and rapidly decreased and reached basal level 8 hr after stimulation (FIG. 3A). Splenic IL-6 mRNA peaked at 2 hr after stimulation and then gradually decreased (FIG. 3A). Thymus IL-6 mRNA peaked at 1 hr post-injection and then gradually decreased (FIG. 3A). IL-6 mRNA was significantly increased in bone marrow within 1 hr after CpG S-ODN injection but then returned to basal level. In response to CpG S-ODN, liver, spleen and thymus showed more substantial increases in IL-6 mRNA expression than the bone marrow.
  • Patterns of Murine Cytokine Expression Induced by CpG DNA
  • In vivo or in whole spleen cells, no significant increase in the protein levels of the following interleukins: IL-2, IL-3, IL-4, IL-5, or IL-10 was detected within the first six hours (Klinman, D. M. et al., (1996) Proc. Natl. Acad. Sci. USA 93:2879-2883). However, the level of TNF-α is increased within 30 minutes and the level of IL-6 increased strikingly within 2 hours in the serum of mice injected with CpG ODN. Increased expression of IL-12 and interferon gamma (IFN-γ) mRNA by spleen cells was also detected within the first two hours.
    TABLE 5
    Induction of Human PBMC Cytokine Secrtetion by CpG Oligos
    ODN Sequence (5′-3′) IL-61 TNF-α1 IFN-γ1 GM-CSF IL-12
    512 TCCATGTCGGTCCTGATGCT 500 140 15.6 70 250
    SEQ ID
    NO:37
    1637 ......C............. 550 16 7.8 15.6 35
    SEQ ID
    NO:38
    1615 ......G............. 600 145 7.8 45 250
    SEQ ID
    NO:39
    1614 ......A............. 550 31 0 50 250
    SEQ ID
    NO:40
    1636 .........A.......... 325 250 35 40 0
    SEQ ID
    NO:41
    1634 .........C.......... 300 400 40 85 200
    SEQ ID
    NO:42
    1619 .........T.......... 275 450 200 80 >500
    SEQ ID
    NO:43
    1618 ......A..T.......... 300 60 15.6 15.6 62
    SEQ ID
    NO:44
    1639 .....AA..T.......... 625 220 15.6 40 60
    SEQ ID
    NO:45
    1707 ......A..TC......... 300 70 17 0 0
    SEQ ID
    NO:46
    1708 .....CA..TG......... 270 10 17 0 0
    SEQ ID
    NO:47

    dots indicate identity; CpG dinucleotides are underlined

    1measured by ELISA using Quantikine kits from R&D Systems (pg/ml) Cells were cultured in 10% autologous serum with the indicated oligodeoxynucleotides (12 μg/ml) for 4 hr in the case of TNF-α or 24 hr for the other cytokines before supernatant harvest and assay. Data are presented as the level of cytokine above that in wells with no added oligodeoxynucleotide.
  • CpG DNA Induces Cytokine Secretion by Human PBMC, Specifically Monocytes
  • The same panels of ODN used for studying mouse cytokine expression were used to determine whether human cells also are induced by CpG motifs to express cytokine (or proliferate), and to identify the CpG motif(s) responsible. Oligonucleotide 1619 (GTCGTT) was the best inducer of TNF-α and IFN-γ secretion, and was closely followed by a nearly identical motif in oligonucleotide 1634 (GTCGCT) (Table 5). The motifs in oligodeoxynucleotides 1637 and 1614 (GCCGGT and GACGGT) led to strong IL-6 secretion with relatively little induction of other cytokines. Thus, it appears that human lymphocytes, like murine lymphocytes, secrete cytokines differentially in response to CpG dinucleotides, depending on the surrounding bases. Moreover, the motifs that stimulate murine cells best differ from those that are most effective with human cells. Certain CpG oligodeoxynucleotides are poor at activating human cells (oligodeoxynucleotides 1707, 1708, which contain the palindrome forming sequences GACGTC and CACGTG respectively).
  • The cells responding to the DNA appear to be monocytes, since the cytokine secretion is abolished by treatment of the cells with L-leucyl-L-leucine methyl ester (L-LME), which is selectively toxic to monocytes (but also to cytotoxic T lymphocytes and NK cells), and does not affect B cell Ig secretion (Table 6, and data not shown). The cells surviving L-LME treatment had >95% viability by trypan blue exclusion, indicating that the lack of a cytokine response among these cells did not simply reflect a nonspecific death all all cell types. Cytokine secretion in response to E. Coli (EC) DNA requires unmethylated CpG motifs, since it is abolished by methylation of the EC DNA (next to the bottom row, Table 6). LPS contamination of the DNA cannot explain the results since the level of contamination was identical in the native and methylated DNA, and since addition of twice the highest amount of contaminating LPS had no effect (not shown).
    TABLE 6
    CpG DNA Induces Cytokine Secretion by Human PBMC
    TNF-α IL-6 IFN-γ RANTES
    DNA (pg/ml)1 (pg/ml) (pg/ml) (pg/ml)
    EC DNA (50 μg/ml) 900 12,000 700 1560
    EC DNA (5 μg/ml) 850 11,000 400 750
    EC DNA (0.5 μg/ml) 500 ND 200 0
    EC DNA (0.05 μg/ml) 62.5 10,000 15.6 0
    EC DNA (50 μg/ml) + L-LME 2 0 ND ND ND
    EC DNA (10 μg/ml) Methyl.3 0 5 ND ND
    CT DNA (50 μg/ml) 0 600 0 0

    1Levels of all cytokines were determined by ELISA using Quantikine kits from R&D Systems as described in the previous table. Results are representative using PBMC from different donors.

    2Cells were pretreated for 15 min. with L-leucyl-L-leucine methyl ester (L-LME) to determine whether the cytokine production under these conditions was from monocytes (or other L-LME-sensitive cells).

    3EC DNA was methylated using 2U/μg DNA of CpG methylase (New England Biolabs) according to the manufacturer's directions, and methylation confirmed by digestion with Hpa-II
    # and Msp-I. As a negative control, samples were included containing twice the maximal amount of LPS contained in the highest concentration of EC DNA which failed to induce
    # detectable cytokine production under these experimental conditions.

    ND = not done
  • The loss of cytokine production in the PBMC treated with L-LME suggested that monocytes may be responsible for cytokine production in response to CpG DNA. To test this hypothesis more directly, the effects of CpG DNA on highly purified human monocytes and macrophages was tested. As hypothesized, CpG DNA directly activated production of the cytokines IL-6, GM-CSF, and TNF-α by human macrophages, whereas non-CpG DNA did not (Table 7).
    TABLE 7
    CpG DNA Induces Cytokine Expression in
    Purified Human Macrophages
    IL-6 (pg/ml) GM-CSF (pg/ml) TNF-α (pg/ml)
    Cells alone 0 0 0
    CT DNA (50 μg/ml) 0 0 0
    EC DNA (50 μg/ml) 2000 15.6 1000
  • Biological Role of IL-6 in Inducing Murine IgM Production in Response to CpG Motifs
  • The kinetic studies described above revealed that induction of IL-6 secretion, which occurs within 1 hr post CpG stimulation, precedes IgM secretion. Since the optimal CpG motif for ODN inducing secretion of IL-6 is the same as that for IgM (Table 2), whether the CpG motifs independently induce IgM and IL-6 production or whether the IgM production is dependent on prior IL-6 secretion was examined. The addition of neutralizing anti-IL-6 antibodies inhibited in vitro IgM production mediated by CpG ODN in a dose-dependent manner but a control antibody did not (FIG. 4A). In contrast, anti-IL-6 addition did not affect either the basal level or the CpG-induced B cell proliferation (FIG. 4B).
  • Increased Transcriptional Activity of the IL-6 Promoter in Response to CpG DNA
  • The increased level of IL-6 mRNA and protein after CpG DNA stimulation could result from transcriptional or post-transcriptional regulation. To determine if the transcriptional activity of the IL-6 promoter was upregulated in B cells cultured with CpG ODN, a murine B cell line, WEHI-231, which produces IL-6 in response to CpG DNA, was transfected with an IL-6 promoter-CAT construct (pIL-6/CAT) (Pottratz, S. T. et al., 17B-estradiol) inhibits expression of human interleukin-6-promoter-reporter constructs by a receptor-dependent mechanism. J. Clin. Invest. 93:944). CAT assays were performed after stimulation with various concentrations of CpG or non-CpG ODN. As shown in FIG. 5, CpG ODN induced increased CAT activity in dose-dependent manner while non-CpG ODN failed to induce CAT activity. This confirms that CpG induces the transcriptional activity of the IL-6 promoter.
  • Dependence of B Cell Activation by CpG ODN on the Number of 5′ and 3′ Phosphorothioate Internucleotide Linkages
  • To determine whether partial sulfur modification of the ODN backbone would be sufficient to enhance B cell activation, the effects of a series of ODN with the same sequence, but with differing numbers of S internucleotide linkages at the 5′ and 3′ ends were tested. Based on previous studies of nuclease degradation of ODN, it was determined that at least two phosphorothioate linkages at the 5′ end of ODN were required to provide optimal protection of the ODN from degradation by intracellular exo- and endo-nucleases. Only chimeric ODN containing two 5′ phosphorothioate-modified linkages, and a variable number of 3′ modified linkages were therefore examined.
  • The lymphocyte stimulating effects of these ODN were tested at three concentrations (3.3, 10, and 30 μM) by measuring the total levels of RNA synthesis (by 3H uridine incorporation) or DNA synthesis (by 3H thymidine incorporation) in treated spleen cell cultures (Example 10). O—ODN (0/0 phosphorothioate modifications) bearing a CpG motif caused no spleen cell stimulation unless added to the cultures at concentrations of at least 10 μM (Example 10). However, when this sequence was modified with two S linkages at the 5′ end and at least three S linkages at the 3′ end, significant stimulation was seen at a dose of 3.3 μM. At this low dose, the level of stimulation showed a progressive increase as the number of 3′ modified bases was increased, until this reached or exceeded six, at which point the stimulation index began to decline. In general, the optimal number of 3′ S linkages for spleen cell stimulation was five. At all three concentrations tested in these experiments, the S-ODN was less stimulatory than the optimal chimeric compounds.
  • Dependence of CpG-Mediated Lymphocyte Activation on the Type of Backbone Modification
  • Phosphorothioate modified ODN (S—ODN) are far more nuclease resistant than phosphodiester modified ODN (O—ODN). Thus, the increased immune stimulation caused by S—ODN and S—O—ODN (i.e. chimeric phosphorothioate ODN in which the central linkages are phosphodiester, but the two 5′ and five 3′ linkages are phosphorothioate modified) compared to O-ODN may result from the nuclease resistance of the former. To determine the role of ODN nuclease resistance in immune stimulation by CpG ODN, the stimulatory effects of chimeric ODN in which the 5′ and 3′ ends were rendered nuclease resistant with either methylphosphonate (MP—), methylphosphorothioate (MPS—), phosphorothioate (S—), or phosphorodithioate (S2—) internucleotide linkages were tested (Example 10). These studies showed that despite their nuclease resistance, MP—O—ODN were actually less immune stimulatory than O—ODN. However, combining the MP and S modifications by replacing both nonbridging O molecules with 5′ and 3′ MPS internucleotide linkages restored immune stimulation to a slightly higher level than that triggered by O-ODN.
  • S-O-ODN were far more stimulatory than O-ODN, and were even more stimulatory than S-ODN, at least at concentrations above 3.3 μM. At concentrations below 3 μM, the S-ODN with the 3M sequence was more potent than the corresponding S—O-ODN, while the S-ODN with the 3D sequence was less potent than the corresponding S-O-ODN (Example 10). In comparing the stimulatory CpG motifs of these two sequences, it was noted that the 3D sequence is a perfect match for the stimulatory motif in that the CpG is flanked by two 5′ purines and two 3′ pyrimidines. However, the bases immediately flanking the CpG in ODN 3D are not optimal; it has a 5′ pyrimidine and a 3′ purine. Based on further testing, it was found that the sequence requirement for immune stimulation is more stringent for S-ODN than for S—O— or O—ODN. S—ODN with poor matches to the optimal CpG motif cause little or no lymphocyte activation (e.g. Sequence 3D). However, S-ODN with good matches to the motif, most critically at the positions immediately flanking the CpG, are more potent than the corresponding S—O—ODN (e.g. Sequence 3M, Sequences 4 and 6), even though at higher concentrations (greater than 3 μM) the peak effect from the S—O—ODN is greater (Example 10).
  • S2—O—ODN were remarkably stimulatory, and caused substantially greater lymphocyte activation than the corresponding S—ODN or S—O—ODN at every tested concentration.
  • The increased B cell stimulation seen with CpG ODN bearing S or S2 substitutions could result from any or all of the following effects: nuclease resistance, increased cellular uptake, increased protein binding, and altered intracellular localization. However, nuclease resistance can not be the only explanation, since the MP—O—ODN were actually less stimulatory than the O—ODN with CpG motifs. Prior studies have shown that ODN uptake by lymphocytes is markedly affected by the backbone chemistry (Zhao et al., (1993) Comparison of cellular binding and uptake of antisense phosphodiester, phosphorothioate, and mixed phosphorothioate and methylphosphonate oligonucleotides. (Antisense Research and Development 3, 53-66; Zhao et al., (1994) Stage specific oligonucleotide uptake in murine bone marrow B cell precursors. Blood 84, 3660-3666.) The highest cell membrane binding and uptake was seen with S—ODN, followed by S—O—ODN, O—ODN, and MP—ODN. This differential uptake correlates well with the degree of immune stimulation.
  • Unmethylated CpG Containing Oligos Have NK Cell Stimulatory Activity
  • Experiments were conducted to determine whether CpG containing oligonucleotides stimulated the activity of natural killer (NK) cells in addition to B cells. As shown in Table 8, a marked induction of NK activity among spleen cells cultured with CpG ODN 1 and 3Dd was observed. In contrast, there was relatively no induction in effectors that had been treated with non-CpG control ODN.
    TABLE 8
    Induction Of NK Activity By CpG Oligodeoxynucleotides (ODN)
    % YAC-1 % 2C11
    Specific Lysis* Specific Lysis
    Effector: Target Effector: Target
    ODN 50:1 100:1 50:1 100:1
    None −1.1 −1.4 15.3 16.6
    1 16.1 24.5 38.7 47.2
    3Dd 17.1 27.0 37.0 40.0
    non-CpG ODN −1.6 −1.7 14.8 15.4
  • Induction of NK Activity by DNA Containing CpG Motifs, but not by Non-CpG DNA.
  • Bacterial DNA cultured for 18 hr at 37° C. and then assayed for killing of K562 (human) or YAC-1 (mouse) target cells induced NK lytic activity in both mouse spleen cells depleted of B cells and human PBMC, but vertebrate DNA did not (Table 9). To determine whether the stimulatory activity of bacterial DNA may be a consequence of its increased level of unmethylated CpG dinucleotides, the activating properties of more than 50 synthetic ODN containing unmethylated, methylated, or no CpG dinucleotides was tested. The results, summarized in Table 9, demonstrate that synthetic ODN can stimulate significant NK activity, as long as they contain at least one unmethylated CpG dinucleotide. No difference was observed in the stimulatory effects of ODN in which the CpG was within a palindrome (such as ODN 1585, which contains the palindrome AACGTT) from those ODN without palindromes (such as 1613 or 1619), with the caveat that optimal stimulation was generally seen with ODN in which the CpG was flanked by two 5′ purines or a 5′ GpT dinucleotide and two 3′ pyrimidines. Kinetic experiments demonstrated that NK activity peaked around 18 hrs. after addition of the ODN. The data indicates that the murine NK response is dependent on the prior activation of monocytes by CpG DNA, leading to the production of IL-12, TNF-α, and IFN-α/β (Example 11).
    TABLE 9
    Induction of NK Activity by DNA Containing CpG Motifs
    but not by Non-CpG DNA
    LU/106
    DNA or Cytokine Added Mouse Cells Human Cells
    Expt. 1 None 0.00 0.00
    IL-2 16.68 15.82
    E. coli DNA 7.23 5.05
    Calf thymus DNA 0.00 0.00
    Expt. 2 None 0.00 3.28
    1585 gggGTCAACGTTGAgggggG (SEQ ID NO:12) 7.38 17.98
    1629 .......gtc.......... (SEQ ID NO:50) 0.00 4.4
    Expt. 3 None 0.00
    1613 GCTAGACGTTAGTGT (SEQ ID NO:51) 5.22
    1769 .......Z....... (SEQ ID NO:52) 0.02 ND
    1619 TCCATGTCGTTCCTGATGCT (SEQ ID NO:43) 3.35
    1765 .......Z............ (SEQ ID NO:53) 0.11

    CpG dinucleotides in ODN sequences are indicated by underlining; Z indicates methylcytosine. Lower case letters indicate nuclease resistant phosphorothioate modified intemucleotide linkages which, in titration experiments, were more than 20 times as potent as non-modified ODN, depending on the flanking bases. Poly G ends (g) were used in some ODN, because they significantly increase the level of ODN uptake.
  • From all of these studies, a more complete understanding of the immune effects of CpG DNA has been developed, which is summarized in FIG. 6.
  • Identification of B Cell and MonocyteINK Cell-Specific Oligonucleotides
  • As shown in FIG. 6, CpG DNA can directly activate highly purified B cells and monocytic cells. There are many similarities in the mechanism through which CpG DNA activates these cell types. For example, both require NFKB activation as explained further below.
  • In further studies of different immune effects of CpG DNA, it was found that there is more than one type of CpG motif. Specifically, oligo 1668, with the best mouse B cell motif, is a strong inducer of both B cell and natural killer (NK) cell activation, while oligo 1758 is a weak B cell activator, but still induces excellent NK responses (Table 10).
    TABLE 10
    Different CpG Motifs Stimulate Optimal Murine
    B Cell and NK Activation
    B cell NK
    ODN Sequence activation1 activation2
    1668 TCCATGACGTTCCTGATGCT 42,849 2.52
    (SEQ ID NO:54)
    1758 TCTCCCAGCGTGCGCCAT 1,747 6.66
    (SEQ ID NO:55)
    NONE 367 0.00

    CpG dinucleotides are underlined; oligonucleotides were synthesized with phosphorothioate modified backbones to improve their nuclease resistance.

    1Measured by 3H thymidine incorporation after 48 hr culture with oligodeoxynucleotides at a 200 nM concentration as described in Example 1.

    2Measured in lytic units.
  • Teleological Basis of Immunostimulatory, Nucleic Acids
  • Vertebrate DNA is highly methylated and CpG dinucleotides are underrepresented. However, the stimulatory CpG motif is common in microbial genomic DNA, but quite rare in vertebrate DNA. In addition, bacterial DNA has been reported to induce B cell proliferation and immunoglobulin (Ig) production, while mammalian DNA does not (Messina, J. P. et al., J. Immunol. 147:1759 (1991)). Experiments further described in Example 3, in which methylation of bacterial DNA with CpG methylase was found to abolish mitogenicity, demonstrates that the difference in CpG status is the cause of B cell stimulation by bacterial DNA. This data supports the following conclusion: that unmethylated CpG dinucleotides present within bacterial DNA are responsible for the stimulatory effects of bacterial DNA.
  • Teleologically, it appears likely that lymphocyte activation by the CpG motif represents an immune defense mechanism that can thereby distinguish bacterial from host DNA. Host DNA, which would commonly be present in many anatomic regions and areas of inflammation due to apoptosis (cell death), would generally induce little or no lymphocyte activation due to CpG suppression and methylation. However, the presence of bacterial DNA containing unmethylated CpG motifs can cause lymphocyte activation precisely in infected anatomic regions, where it is beneficial. This novel activation pathway provides a rapid alternative to T cell dependent antigen specific B cell activation. Since the CpG pathway synergizes with B cell activation through the antigen receptor, B cells bearing antigen receptor specific for bacterial antigens would receive one activation signal through cell membrane Ig and a second signal from bacterial DNA, and would therefore tend to be preferentially activated. The interrelationship of this pathway with other pathways of B cell activation provide a physiologic mechanism employing a polyclonal antigen to induce antigen-specific responses.
  • However, it is likely that B cell activation would not be totally nonspecific. B cells bearing antigen receptors specific for bacterial products could receive one activation signal through cell membrane Ig, and a second from bacterial DNA, thereby more vigorously triggering antigen specific immune responses. As with other immune defense mechanisms, the response to bacterial DNA could have undesirable consequences in some settings. For example, autoimmune responses to self antigens would also tend to be preferentially triggered by bacterial infections, since autoantigens could also provide a second activation signal to autoreactive B cells triggered by bacterial DNA. Indeed the induction of autoimmunity by bacterial infections is a common clinical observance. For example, the autoimmune disease systemic lupus erythematosus, which is: i) characterized by the production of anti-DNA antibodies; ii) induced by drugs which inhibit DNA methyltransferase (Cornacchia, E. J. et al., J. Clin. Invest. 92:38 (1993)); and iii) associated with reduced DNA methylation (Richardson, B. L. et al., Arth. Rheum 35:647 (1992)), is likely triggered at least in part by activation of DNA-specific B cells through stimulatory signals provided by CpG motifs, as well as by binding of bacterial DNA to antigen receptors.
  • Further, sepsis, which is characterized by high morbidity and mortality due to massive and nonspecific activation of the immune system, may be initiated by bacterial DNA and other products released from dying bacteria that reach concentrations sufficient to directly activate many lymphocytes. Further evidence of the role of CpG DNA in the sepsis syndrome is described in Cowdery, J., et. al., (1996) J. Immunol. 156:4570-4575.
  • Proposed Mechanisms of Action
  • Unlike antigens that trigger B cells through their surface Ig receptor, CpG-ODN did not induce any detectable Ca2+ flux, changes in protein tyrosine phosphorylation, or IP 3 generation. Flow cytometry with FITC-conjugated ODN with or without a CpG motif was performed as described in Zhao, Q et al., (Antisense Research and Development 3:53-66 (1993)), and showed equivalent membrane binding, cellular uptake, efflux, and intracellular localization. This suggests that there may not be cell membrane proteins specific for CpG ODN. Rather than acting through the cell membrane, that data suggests that unmethylated CpG containing oligonucleotides require cell uptake for activity: ODN covalently linked to a solid Teflon support were nonstimulatory, as were biotinylated ODN immobilized on either avidin beads or avidin coated petri dishes. CpG ODN conjugated to either FITC or biotin retained full mitogenic properties, indicating no steric hindrance.
  • Recent data indicate the involvement of the transcription factor NFKB as a direct or indirect mediator of the CpG effect. For example, within 15 minutes of treating B cells or monocytes with CpG DNA, the level of NFκB binding activity is increased (FIG. 7). However, it is not increased by DNA that does not contain CpG motifs. In addition, it was found that two different inhibitors of NFKB activation, PDTC and gliotoxin, completely block the lymphocyte stimulation by CpG DNA as measured by B cell proliferation or monocytic cell cytokine secretion, suggesting that NFκB activation is required for both cell types.
  • There are several possible mechanisms through which NFKB can be activated. These include through activation of various protein kinases, or through the generation of reactive oxygen species. No evidence for protein kinase activation induced immediately after CpG DNA treatment of B cells or monocytic cells have been found, and inhibitors of protein kinase A, protein kinase C, and protein tyrosine kinases had no effects on the CpG induced activation. However, CpG DNA causes a rapid induction of the production of reactive oxygen species in both B cells and monocytic cells, as detected by the sensitive fluorescent dye dihydrorhodamine 123 as described in Royall, J. A., and Ischiropoulos, H. (Archives of Biochemistry and Biophysics 302:348-355 (1993)). Moreover, inhibitors of the generation of these reactive oxygen species completely block the induction of NFKB and the later induction of cell proliferation and cytokine secretion by CpG DNA.
  • Working backwards, the next question was how CpG DNA leads to the generation of reactive oxygen species so quickly. Previous studies by the inventors demonstrated that oligonucleotides and plasmid or bacterial DNA are taken up by cells into endosomes. These endosomes rapidly become acidified inside the cell. To determine whether this acidification step may be important in the mechanism through which CpG DNA activates reactive oxygen species, the acidification step was blocked with specific inhibitors of endosome acidification including chloroquine, monensin, and bafilomycin, which work through different mechanisms. FIG. 8A shows the results from a flow cytometry study using mouse B cells with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. The dye only sample in Panel A of the figure shows the background level of cells positive for the dye at 28.6%. As expected, this level of reactive oxygen species was greatly increased to 80% in the cells treated for 20 minutes with PMA and ionomycin, a positive control (Panel B). The cells treated with the CpG oligo also showed an increase in the level of reactive oxygen species such that more than 50% of the cells became positive (Panel D). However, cells treated with an oligonucleotide with the identical sequence except that the CpG was switched did not show this significant increase in the level of reactive oxygen species (Panel E).
  • In the presence of chloroquine, the results are very different (FIG. 8B). Chloroquine slightly lowers the background level of reactive oxygen species in the cells such that the untreated cells in Panel A have only 4.3% that are positive. Chloroquine completely abolishes the induction of reactive oxygen species in the cells treated with CpG DNA (Panel B) but does not reduce the level of reactive oxygen species in the cells treated with PMA and ionomycin (Panel E). This demonstrates that unlike the PMA plus ionomycin, the generation of reactive oxygen species following treatment of B cells with CpG DNA requires that the DNA undergo an acidification step in the endosomes. This is a completely novel mechanism of leukocyte activation. Chloroquine, monensin, and bafilomycin also appear to block the activation of NFKB by CpG DNA as well as the subsequent proliferation and induction of cytokine secretion.
  • Presumably, there is a protein in or near the endosomes that specifically recognizes DNA containing CpG motifs and leads to the generation of reactive oxygen species. To detect any protein in the cell cytoplasm that may specifically bind CpG DNA, we used electrophoretic mobility shift assays (EMSA) with 5′ radioactively labeled oligonucleotides with or without CpG motifs. A band was found that appears to represent a protein binding specifically to single stranded oligonucleotides that have CpG motifs, but not to oligonucleotides that lack CpG motifs or to oligonucleotides in which the CpG motif has been methylated. This binding activity is blocked if excess of oligonucleotides that contain the NFκB binding site was added. This suggests that an NFKB or related protein is a component of a protein or protein complex that binds the stimulatory CpG oligonucleotides.
  • No activation of CREB/ATF proteins was found at time points where NFKB was strongly activated. These data therefore do not provide proof that NFKB proteins actually bind to the CpG nucleic acids, but rather that the proteins are required in some way for the CpG activity. It is possible that a CREB/ATF or related protein may interact in some way with NFκB proteins or other proteins thus explaining the remarkable similarity in the binding motifs for CREB proteins and the optimal CpG motif. It remains possible that the oligos bind to a CREB/ATF or related protein, and that this leads to NFκB activation.
  • Alternatively, it is very possible that the CpG nucleic acids may bind to one of the TRAF proteins that bind to the cytoplasmic region of CD40 and mediate NFκB activation when CD40 is cross-linked. Examples of such TRAF proteins include TRAF-2 and TRAF-5.
  • Method for Making Immunostimulatory Nucleic Acids
  • For use in the instant invention, nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the β-cyanoethyl phosphoramidite method (S. L. Beaucage and M. H. Caruthers, (1981) Tet. Let. 22:1859); nucleoside H-phosphonate method (Garegg et al., (1986) Tet. Let. 27: 4051-4054; Froehler et al., (1986) Nucl. Acid. Res. 14: 5399-5407; Garegg et al., (1986) Tet. Let. 27: 4055-4058, Gaffney et al., (1988) Tet. Let. 29:2619-2622). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market. Alternatively, oligonucleotides can be prepared from existing nucleic acid sequences (e.g. genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
  • For use in vivo, nucleic acids are preferably relatively resistant to degradation (e.g. via endo- and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made e.g. as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A. (1990) Chem. Rev. 90:544; Goodchild, J. (1990) Bioconjugate Chem. 1:165). 2′-O-methyl nucleic acids with CpG motifs also cause immune activation, as do ethoxy-modified CpG nucleic acids. In fact, no backbone modifications have been found that completely abolish the CpG effect, although it is greatly reduced by replacing the C with a 5-methyl C.
  • For administration in vivo, nucleic acids may be associated with a molecule that results in higher affinity binding to target cell (e.g. B-cell, monocytic cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells to form a “nucleic acid delivery complex”. Nucleic acids can be ionically, or covalently associated with appropriate molecules using techniques which are well known in the art. A variety of coupling or crosslinking agents can be used e.g. protein A, carbodiimide, and N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP). Nucleic acids can alternatively be encapsulated in liposomes or virosomes using well-known techniques.
  • Therapeutic Uses of Immunostimulatory Nucleic Acid Molecules
  • Based on their immunostimulatory properties, nucleic acid molecules containing at least one unmethylated CpG dinucleotide can be administered to a subject in vivo to treat an “immune system deficiency”. Alternatively, nucleic acid molecules containing at least one unmethylated CpG dinucleotide can be contacted with lymphocytes (e.g. B cells, monocytic cells or NK cells) obtained from a subject having an immune system deficiency ex vivo and activated lymphocytes can then be reimplanted in the subject.
  • As reported herein, in response to unmethylated CpG containing nucleic acid molecules, an increased number of spleen cells secrete IL-6, IL-12, IFN-γ, IFN-α, IFN-β, IL-1, IL-3, IL-10, TNF-α, TNF-β, GM-CSF, RANTES, and probably others. The increased IL-6 expression was found to occur in B cells, CD4+ T cells and monocytic cells.
  • Immunostimulatory nucleic acid molecules can also be administered to a subject in conjunction with a vaccine to boost a subject's immune system and thereby effect a better response from the vaccine. Preferably the immunostimulatory nucleic acid molecule is administered slightly before or at the same time as the vaccine. A conventional adjuvant may optionally be administered in conjunction with the vaccine, which is minimally comprised of an antigen, as the conventional adjuvant may further improve the vaccination by enhancing antigen absorption.
  • When the vaccine is a DNA vaccine at least two components determine its efficacy. First, the antigen encoded by the vaccine determines the specificity of the immune response. Second, if the backbone of the plasmid contains CpG motifs, it functions as an adjuvant for the vaccine. Thus, CpG DNA acts as an effective “danger signal” and causes the immune system to respond vigorously to new antigens in the area. This mode of action presumably results primarily from the stimulatory local effects of CpG DNA on dendritic cells and other “professional” antigen presenting cells, as well as from the costimulatory effects on B cells.
  • Immunostimulatory oligonucleotides and unmethylated CpG containing vaccines, which directly activate lymphocytes and co-stimulate an antigen-specific response, are fundamentally different from conventional adjuvants (e.g. aluminum precipitates), which are inert when injected alone and are thought to work through absorbing the antigen and thereby presenting it more effectively to immune cells. Further, conventional adjuvants only work for certain antigens, only induce an antibody (humoral) immune response (Th2), and are very poor at inducing cellular immune responses (Th1). For many pathogens, the humoral response contributes little to protection, and can even be detrimental.
  • In addition, an immunostimulatory oligonucleotide can be administered prior to, along with or after administration of a chemotherapy or immunotherapy to increase the responsiveness of the malignant cells to subsequent chemotherapy or immunotherapy or to speed the recovery of the bone marrow through induction of restorative cytokines such as GM-CSF. CpG nucleic acids also increase natural killer cell lytic activity and antibody dependent cellular cytotoxicity (ADCC). Induction of NK activity and ADCC may likewise be beneficial in cancer immunotherapy, alone or in conjunction with other treatments.
  • Another use of the described immunostimulatory nucleic acid molecules is in desensitization therapy for allergies, which are generally caused by IgE antibody generation against harmless allergens. The cytokines that are induced by unmethylated CpG nucleic acids are predominantly of a class called “Th1” which is most marked by a cellular immune response and is associated with IL-12 and IFN-γ. The other major type of immune response is termed a Th2 immune response, which is associated with more of an antibody immune response and with the production of IL-4, IL-5 and IL-10. In general, it appears that allergic diseases are mediated by Th2 type immune responses and autoimmune diseases by Th1 immune response. Based on the ability of the immunostimulatory nucleic acid molecules to shift the immune response in a subject from a Th2 (which is associated with production of IgE antibodies and allergy) to a Th1 response (which is protective against allergic reactions), an effective dose of an immunostimulatory nucleic acid (or a vector containing a nucleic acid) alone or in conjunction with an allergen can be administered to a subject to treat or prevent an allergy.
  • Nucleic acids containing unmethylated CpG motifs may also have significant therapeutic utility in the treatment of asthma. Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotype switching, eosinophil chemotaxis and activation and mast cell growth. Th1 cytokines, especially IFN-γ and IL-12, can suppress the formation of Th2 clones and production of Th2 cytokines.
  • As described in detail in the following Example 12, oligonucleotides containing an unmethylated CpG motif (i.e. TCCATGACGTTCCTGACGTT; SEQ ID NO:10), but not a control oligonucleotide (TCCATGAGCTTCCTGAGTCT; SEQ ID NO:11) prevented the development of an inflammatory cellular infiltrate and eosinophilia in a murine model of asthma. Furthermore, the suppression of eosinophilic inflammation was associated with a suppression of a Th2 response and induction of a Th1 response.
  • For use in therapy, an effective amount of an appropriate immunostimulatory nucleic acid molecule alone or formulated as a delivery complex can be administered to a subject by any mode allowing the oligonucleotide to be taken up by the appropriate target cells (e.g., B-cells and monocytic cells). Preferred routes of administration include oral and transdermal (e.g., via a patch). Examples of other routes of administration include injection (subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal, etc.). The injection can be in a bolus or a continuous infusion.
  • A nucleic acid alone or as a nucleic acid delivery complex can be administered in conjunction with a pharmaceutically acceptable carrier. As used herein, the phrase “pharmaceutically acceptable carrier” is intended to include substances that can be coadministered with a nucleic acid or a nucleic acid delivery complex and allows the nucleic acid to perform its indicated function. Examples of such carriers include solutions, solvents, dispersion media, delay agents, emulsions and the like. The use of such media for pharmaceutically active substances are well known in the art. Any other conventional carrier suitable for use with the nucleic acids falls within the scope of the instant invention.
  • The language “effective amount” of a nucleic acid molecule refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a nucleic acid containing at least one unmethylated CpG for treating an immune system deficiency could be that amount necessary to eliminate a tumor, cancer, or bacterial, viral or fungal infection. An effective amount for use as a vaccine adjuvant could be that amount useful for boosting a subjects immune response to a vaccine. An “effective amount” for treating asthma can be that amount useful for redirecting a Th2 type of immune response that is associated with asthma to a Th1 type of response. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular nucleic acid being administered (e.g. the number of unmethylated CpG motifs or their location in the nucleic acid), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular oligonucleotide without necessitating undue experimentation.
  • The present invention is further illustrated by the following Examples which in no way should be construed as further limiting. The entire contents of all of the references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference.
  • EXAMPLES Example 1 Effects of ODNs on B Cell Total RNA Synthesis and Cell Cycle
  • B cells were purified from spleens obtained from 6-12 wk old specific pathogen free DBA/2 or BXSB mice (bred in the University of Iowa animal care facility; no substantial strain differences were noted) that were depleted of T cells with anti-Thy-1.2 and complement and centrifugation over lympholyte M (Cedarlane Laboratories, Hornby, Ontario, Canada) (“B cells”). B cells contained fewer than 1% CD4+ or CD8+ cells. 8×104 B cells were dispensed in triplicate into 96 well microtiter plates in 100 μl RPMI containing 10% FBS (heat inactivated to 65° C. for 30 min.), 50 μM 2-mercaptoethanol, 100 U/ml penicillin, 100 ug/ml streptomycin, and 2 mM L-glutamate. 20 μM ODN were added at the start of culture for 20 h at 37° C., cells pulsed with 1 μCi of 3H uridine, and harvested and counted 4 hr later. Ig secreting B cells were enumerated using the ELISA spot assay after culture of whole spleen cells with ODN at 20 μM for 48 hr. Data, reported in Table 1, represent the stimulation index compared to cells cultured without ODN. 3H thymidine incorporation assays showed similar results, but with some nonspecific inhibition by thymidine released from degraded ODN (Matson. S and A. M. Krieg (1992) Nonspecific suppression of 3H-thymidine incorporation by control oligonucleotides. Antisense Research and Development 2:325).
  • Example 2 Effects of ODN on Production of IgM from B Cells
  • Single cell suspensions from the spleens of freshly killed mice were treated with anti-Thyl, anti-CD4, and anti-CD8 and complement by the method of Leibson et al., J. Exp. Med. 154:1681 (1981)). Resting B cells (<O2% T cell contamination) were isolated from the 63-70% band of a discontinuous Percoll gradient by the procedure of DeFranco et al, J. Exp. Med. 155:1523 (1982). These were cultured as described above in 30 μM ODN or 20 μg/ml LPS for 48 hr. The number of B cells actively secreting IgM was maximal at this time point, as determined by ELIspot assay (Klinman, D. M. et al. J. Immunol. 144:506 (1990)). In that assay, B cells were incubated for 6 hrs on anti-Ig coated microtiter plates. The Ig they produced (>99% IgM) was detected using phosphatase-labelled anti-Ig (Southern Biotechnology Associated, Birmingham, Ala.). The antibodies produced by individual B cells were visualized by addition of BCIP (Sigma Chemical Co., St. Louis Mo.) which forms an insoluble blue precipitate in the presence of phosphatase. The dilution of cells producing 20-40 spots/well was used to determine the total number of antibody-secreting B cells/sample. All assays were performed in triplicate (data reported in Table 1). In some experiments, culture supernatants were assayed for IgM by ELISA, and showed similar increases in response to CpG-ODN.
  • Example 3 B cell Stimulation by Bacterial DNA
  • DBA/2 B cells were cultured with no DNA or 50 μg/ml of a) Micrococcus lysodeikticus; b) NZB/N mouse spleen; and c) NFS/N mouse spleen genomic DNAs for 48 hours, then pulsed with 3H thymidine for 4 hours prior to cell harvest. Duplicate DNA samples were digested with DNAse I for 30 minutes at 37° C. prior to addition to cell cultures. E. coli DNA also induced an 8.8 fold increase in the number of IgM secreting B cells by 48 hours using the ELISA-spot assay.
  • DBA/2 B cells were cultured with either no additive, 50 μg/ml LPS or the ODN 1; 1a; 4; or 4a at 20 uM. Cells were cultured and harvested at 4, 8, 24 and 48 hours. BXSB cells were cultured as in Example 1 with 5, 10, 20, 40 or 80 μM of ODN 1; 1a; 4; or 4a or LPS. In this experiment, wells with no ODN had 3833 cpm. Each experiment was performed at least three times with similar results. Standard deviations of the triplicate wells were <5%.
  • Example 4 Effects of ODN on Natural Killer (NK) Activity
  • 10×106 C57BL/6 spleen cells were cultured in two ml RPMI (supplemented as described for Example 1) with or without 40 μM CpG or non-CpG ODN for forty-eight hours. Cells were washed, and then used as effector cells in a short term 51Cr release assay with YAC-1 and 2C11, two NK sensitive target cell lines (Ballas, Z. K. et al. (1993) J. Immunol. 150:17). Effector cells were added at various concentrations to 104 51Cr-labeled target cells in V-bottom microtiter plates in 0.2 ml, and incubated in 5% CO2 for 4 hr at 37° C. Plates were then centrifuged, and an aliquot of the supernatant counted for radioactivity. Percent specific lysis was determined by calculating the ratio of the 51Cr released in the presence of effector cells minus the 51Cr released when the target cells are cultured alone, over the total counts released after cell lysis in 2% acetic acid minus the 51Cr cpm released when the cells are cultured alone.
  • Example 5 In Vivo Studies with CpG Phosphorothioate ODN
  • Mice were weighed and injected i.p. with 0.25 ml of sterile PBS or the indicated
    Figure US20050070491A1-20050331-P00999
    othioate ODN dissolved in PBS. Twenty four hours later, spleen cells were
    Figure US20050070491A1-20050331-P00999
    washed, and stained for flow cytometry using phycoerythrin conjugated 6B2 to
    Figure US20050070491A1-20050331-P00999
    cells in conjunction with biotin conjugated anti Ly-6A/E or anti-Iad (Pharmingen,
    Figure US20050070491A1-20050331-P00999
    go, Calif.) or anti-Bla-1 (Hardy, R. R. et al., J. Exp. Med. 159:1169 (1984). Two mice
    Figure US20050070491A1-20050331-P00999
    died for each condition and analyzed individually.
  • Example 6 Titration of Phosphorothioate ODN for B Cell Stimulation
  • Figure US20050070491A1-20050331-P00999
    cells were cultured with phosphorothioate ODN with the sequence of control ODN
    Figure US20050070491A1-20050331-P00999
    CpG ODN 1d and 3 Db and then either pulsed after 20 hr with 3H uridine or after 44
    Figure US20050070491A1-20050331-P00999
    H thymidine before harvesting and determining cpm.
  • Example 7 Rescue of B Cells From Apoptosis
  • Figure US20050070491A1-20050331-P00999
    VEHI-231 cells (5×104/well) were cultured for 1 hr at 37° C. in the presence or
    Figure US20050070491A1-20050331-P00999
    of LPS or the control ODN 1 a or the CpG ODN 1 d and 3 Db before addition of anti-
    Figure US20050070491A1-20050331-P00999
    /ml). Cells were cultured for a further 20 hr before a 4 hr pulse with 2 μCi/well 3H
    Figure US20050070491A1-20050331-P00999
    e. In this experiment, cells with no ODN or anti-IgM gave 90.4×103 cpm of 3H
    Figure US20050070491A1-20050331-P00999
    e incorporation by addition of anti-IgM. The phosphodiester ODN shown in Table 1
    Figure US20050070491A1-20050331-P00999
    ilar protection, though with some nonspecific suppression due to ODN degradation.
    Figure US20050070491A1-20050331-P00999
    eriment was repeated at least 3 times with similar results.
  • Example 8 In Vivo Induction of Murine IL-6
  • Figure US20050070491A1-20050331-P00999
    BA/2 female mice (2 mos. old) were injected i.p. with 500 μg CpG or control
    Figure US20050070491A1-20050331-P00999
    rothioate ODN. At various time points after injection, the mice were bled. Two
    Figure US20050070491A1-20050331-P00999
    re studied for each time point. IL-6 was measured by ELISA, and IL-6 concentration
    Figure US20050070491A1-20050331-P00999
    ulated by comparison to a standard curve generated using recombinant IL-6. The
    Figure US20050070491A1-20050331-P00999
    ty of the assay was 10 pg/ml. Levels were undetectable after 8 hr.
  • Example 9 Systemic Induction of Murine IL-6 Transcription Mice and Cell Lines
  • DBA/2, BALB/c, and C3H/HeJ mice at 5-10 wk of age were
    Figure US20050070491A1-20050331-P00999
    source of lymphocytes. All mice were obtained from The Jackson Laboratory (Bar
    Figure US20050070491A1-20050331-P00999
    Me.), and bred and maintained under specific pathogen-free conditions in the
    Figure US20050070491A1-20050331-P00999
    ty of Iowa Animal Care Unit. The mouse B cell line CH12.LX was kindly provided
    Figure US20050070491A1-20050331-P00999
    Bishop (University of Iowa, Iowa City).
  • Cell preparation. Mice were killed by cervical dislocation. Single cell suspensions were prepared aseptically from the spleens from mice. T cell depleted mouse splenocytes were prepared by using anti-Thy-1.2 and complement and centrifugation over lympholyte M (Cedarlane Laboratories, Hornby, Ontario, Canada) as described (Krieg, A. M. et al., (1989) A role for endogenous retroviral sequences in the regulation of lymphocyte activation. J. Immunol. 143:2448).
  • ODN and DNA. Phosphodiester oligonucleotides (O-ODN) and the backbone modified phosphorothioate oligonucleotides (S-ODN) were obtained from the DNA Core facility at the University of Iowa or from Operon Technologies (Alameda, Calif.). E. coli DNA (Strain B) and calf thymus DNA were purchased from Sigma (St. Louis, Mo.). All DNA and ODN were purified by extraction with phenol:chloroform:isoamyl alcohol (25:24:1) and/or ethanol precipitation. E. coli and calf thymus DNA were single stranded prior to use by boiling for 10 min. followed by cooling on ice for 5 min. For some experiments, E. coli and calf thymus DNA were digested with DNAse I (2U/μg of DNA) at 37° C. for 2 hr in 1×SSC with 5 mM MgCl2. To methylate the cytosine in CpG dinucleotides in E. coli DNA, E. coli DNA was treated with CpG methylase (M. SssI; 2U/μg of DNA) in NEBuffer 2 supplemented with 160 μM S-adenosyl methionine and incubated overnight at 37° C. Methylated DNA was purified as above. Efficiency of methylation was confirmed by Hpa II digestion followed by analysis by gel electrophoresis. All enzymes were purchased from New England Biolabs (Beverly, Mass.). LPS level in ODN was less than 12.5 ng/mg and E. coli and calf thymus DNA contained less than 2.5 ng of LPS/mg of DNA by Limulus assay.
  • Cell culture. All cells were cultured at 37° C. in a 5% CO2 humidified incubator maintained in RPMI-1640 supplemented with 10% (v/v) heat inactivated fetal calf serum (FCS), 1.5 mM L-glutamine, 50 μg/ml), CpG or non-CpG phosphodiester ODN (O—ODN) (20 μM), phosphorothioate ODN (S-ODN) (0.5 μM), or E. coli or calf thymus DNA (50 μg/ml) at 37° C. for 24 hr. (for IL-6 production) or 5 days (for IgM production). Concentrations of stimulants were chosen based on preliminary studies with titrations. In some cases, cells were treated with CpG O-ODN along with various concentrations (1-10 μg/ml) of neutralizing rat IgG1 antibody against murine IL-6 (hybridoma MP5-20F3) or control rat IgG1 mAb to E. coli β-galactosidase (hybridoma GL113; ATCC, Rockville, Md.) (20) for 5 days. At the end of incubation, culture supernatant fractions were analyzed by ELISA as below.
  • In vivo induction of IL-6 and IgM. BALB/c mice were injected intravenously (i.v.) with PBS, calf thymus DNA (200 μg/100 μl PBS/mouse), E. coli DNA (200 μg/100 μL PBS/mouse), or CpG or non-CpG S-ODN (200 μg/100 μl PBS/mouse). Mice (two/group) were bled by retroorbital puncture and sacrificed by cervical dislocation at various time points. Liver, spleen, thymus, and bone marrow were removed and RNA was prepared from those organs using RNAzol B (Tel-Test, Friendswood, Tex.) according to the manufacturers protocol.
  • ELISA. Flat-bottomed Immun 1 plates (Dynatech Laboratories, Inc., Chantilly, Va.) were coated with 100 μl/well of anti-mouse IL-6 mAb (MP5-20F3) (2 μg/ml) or anti-mouse IgM μ-chain specific (5 μg/ml; Sigma, St. Louis, Mo.) in carbonate-bicarbonate, pH 9.6 buffer (15 nM Na2CO3, 35 mM NaHCO3) overnight at 4° C. The plates were then washed with TPBS (0.5 mM MgCl2.6H2O, 2.68 mM KCl, 1.47 mM KH2PO4, 0.14 M NaCl, 6.6 mM K2HPO4, 0.5% Tween 20) and blocked with 10% FCS in TPBS for 2 hr at room temperature and then washed again. Culture supernatants, mouse sera, recombinant mouse IL-6 (Pharmingen, San Diego, Calif.) or purified mouse IgM (Calbiochem, San Diego, Calif.) were appropriately diluted in 10% FCS and incubated in triplicate wells for 6 hr at room temperature. The plates were washed and 100 μl/well of biotinylated rat anti-mouse IL-6 monoclonal antibodies (MP5-32C11, Pharmingen, San Diego, Calif.) (1 μg/ml in 10% FCS) or biotinylated anti-mouse Ig (Sigma, St. Louis, Mo.) were added and incubated for 45 min at room temperature following washes with TPBS. Horseradish peroxidase (HRP) conjugated avidin (Bio-rad Laboratories, Hercules, Calif.) at 1:4000 dilution in 10% FCS (100 μl/well) was added and incubated at room temperature for 30 min. The plates were washed and developed with o-phenylendiamine dihydrochloride (OPD; Sigma, St. Louis Mo.) 0.05 M phosphate-citrate buffer, pH 5.0, for 30 min. The reaction was stopped with 0.67 N H2SO4 and plates were read on a microplate reader (Cambridge Technology, Inc., Watertown, Mass.) at 490-600 nm. The results are shown in FIGS. 1 and 2.
  • RT-PCR. A sense primer, an antisense primer, and an internal oligonucleotide probe for IL-6 were synthesized using published sequences (Montgomery, R. A. and M. S. Dallman (1991), Analysis of cytokine gene expression during fetal thymic ontogeny using the polymerase chain reaction (J. Immunol.) 147:554). cDNA synthesis and IL-6 PCR was done essentially as described by Montgomery and Dallman (Montgomery, R. A. and M. S. Dallman (1991), Analysis of cytokine gene expression during fetal thymic ontogeny using the polymerase chain reaction (J. Immunol.) 147:554) using RT-PCR reagents from Perkin-Elmer Corp. (Hayward, Calif.). Samples were analyzed after 30 cycles of amplification by gel electrophoresis followed by unblot analysis (Stoye, J. P. et al., (1991) DNA hybridization in dried gels with fragmented probes: an improvement over blotting techniques, Techniques 3:123). Briefly, the gel was hybridized at room temperature for 30 min in denaturation buffer (0.05 M NaOH, 1.5 M NaCl) followed by incubation for 30 min in renaturation buffer (1.5 M NaCl, 1 M Tris, pH 8) and a 30 min wash in double distilled water. The gel was dried and prehybridized at 47° C. for 2 hr hybridization buffer (5×SSPE, 0.1% SDS) containing 10 μg/ml denatured salmon sperm DNA. The gel was hybridized with 2×106 cpm/ml γ-[32P]ATP end-labeled internal oligonucleotide probe for IL-6 (5′CATTTCCACGATTTCCCA 3′, SEQ ID NO:56) overnight at 47° C., washed 4 times (2× SSC, 0.2% SDS) at room temperature and autoradiographed. The results are shown in FIG. 3.
  • Cell proliferation assay. DBA/2 mice spleen B cells (5×104 cells/100 μl/well) were treated with media, CpG or non-CpG S—ODN (0.5 μM) or O—ODN (20 μM) for 24 hr at 37° C. Cells were pulsed for the last four hr with either [3H] Thymidine or [3H] Uridine (1 μCi/well). Amounts of [3H] incorporated were measured using Liquid Scintillation Analyzer (Packard Instrument Co., Downers Grove, Ill.).
  • Transfections and CAT assays. WEHI-231 cells (107 cells) were electroporated with 20 μg of control or human IL-6 promoter-CAT construct (kindly provided by S. Manolagas, Univ. of Arkansas) (Pottratz, S. T. et al., (1994) 17B-estradiol inhibits expression of human interleukin-6 promoter-reporter constructs by a receptor-dependent mechanism. J. Clin. Invest. 93:944) at 250 mV and 960 μF. Cells were stimulated with various concentrations or CpG or non-CpG ODN after electroporation. Chloramphenicol acetyltransferase (CAT) activity was measured by a solution assay (Seed, B. and J. Y. Sheen (1988) A single phase-extraction assay for chloramphenicol acetyl transferase activity. Gene 76:271) 16 hr after transfection. The results are presented in FIG. 5.
  • Example 10 Oligodeoxynucleotide Modifications Determine the Magnitude of B Cell Stimulation by CpG Motifs
  • ODN were synthesized on an Applied Biosystems Inc. (Foster City, Calif.) model 380A, 380B, or 394 DNA synthesizer using standard procedures (Beacage and Caruthers (1981) Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Letters 22, 1859-1862.). Phosphodiester ODN were synthesized using standard beta-cyanoethyl phosphoramidite chemistry. Phosphorothioate linkages were introduced by oxidizing the phosphite linkage with elemental sulfur instead of the standard iodine oxidation. The four common nucleoside phosphoramidites were purchased from Applied Biosystems. All phosphodiester and thioate containing ODN were deprotected by treatment with concentrated ammonia at 55° C. for 12 hours. The ODN were purified by gel exclusion chromatography and lyophilized to dryness prior to use. Phosphorodithioate linkages were introduced by using deoxynucleoside S-(b-benzoylmercaptoethyl) pyrrolidino thiophosphoramidites (Wiesler, W. T. et al., (1993) In Methods in Molecular Biology: Protocols for Oligonucleotides and Analogs-Synthesis and Properties, Agrawal, S. (ed.), Humana Press, 191-206.). Dithioate containing ODN were deprotected by treatment with concentrated ammonia at 55° C. for 12 hours followed by reverse phase HPLC purification.
  • In order to synthesize oligomers containing methylphosphonothioates or methylphosphonates as well as phosphodiesters at any desired internucleotide linkage, two different synthetic cycles were used. The major synthetic differences in the two cycles are the coupling reagent where dialkylaminomethylnucleoside phosphines are used and the oxidation reagents in the case of methylphosphonothioates. In order to synthesize either derivative, the condensation time has been increased for the dialkylaminomethylnucleoside phosphines due to the slower kinetics of coupling (Jager and Engels, (1984) Synthesis of deoxynucleoside methylphosphonates via a phosphonamidite approach. Tetrahedron Letters 24, 1437-1440). After the coupling step has been completed, the methylphosphinodiester is treated with the sulfurizing reagent (5% elemental sulfur, 100 millimolar N,N-diamethylaminopyridine in carbon disulfide/pyridine/triethylamine), four consecutive times for 450 seconds each to produce methylphosphonothioates. To produce methylphosphonate linkages, the methylphosphinodiester is treated with standard oxidizing reagent (0.1 M iodine in tetrahydrofuran/2,6-lutidine/water).
  • The silica gel bound oligomer was treated with distilled pyridine/concentrated ammonia, 1:1, (v/v) for four days at 4 degrees centigrade. The supernatant was dried in vacuo, dissolved in water and chromatographed on a G50/50 Sephadex column.
  • As used herein, O—ODN refers to ODN which are phosphodiester; S—ODN are completely phosphorothioate modified; S—O—ODN are chimeric ODN in which the central linkages are phosphodiester, but the two 5′ and five 3′ linkages are phosphorothioate modified; S2—O—ODN are chimeric ODN in which the central linkages are phosphodiester, but the two 5′ and five 3′ linkages are phosphorodithioate modified; and MP—O—ODN are chimeric ODN in which the central linkages are phosphodiester, but the two 5′ and five 3′ linkages are methylphosphonate modified. The ODN sequences studied (with CpG dinucleotides indicated by underlining) include:
    3D (5′ GAGAACGCTGGACCTTCCAT),; (SEQ ID NO:14)
    3M (5′ TCCATGTCGGTCCTGATGCT),; (SEQ ID NO:22)
    5 (5′ GGCGTTATTCCTGACTCGCC),; (SEQ ID NO:57)
    and
    6 (5′ CCTACGTTGTATGCGCCCAGCT),. (SEQ ID NO:58)

    These sequences are representative of literally hundreds of CpG and non-CpG ODN that have been tested in the course of these studies.
  • Mice. DBA/2, or BXSB mice obtained from The Jackson Laboratory (Bar Harbor, Me.), and maintained under specific pathogen-free conditions were used as a source of lymphocytes at 5-10 wk of age with essentially identical results.
  • Cell proliferation assay. For cell proliferation assays, mouse spleen cells (5×104 cells/100 μl/well) were cultured at 37° C. in a 5% CO2 humidified incubator in RPMI-1640 supplemented with 10% (v/v) heat inactivated fetal calf serum (heated to 65° C. for experiments with O—ODN, or 56° C. for experiments using only modified ODN), 1.5 μM L-glutamine, 50 μM 2-mercaptoethanol, 100 U/ml penicillin and 100 μg/ml streptomycin for 24 hr or 48 hr as indicated. 1 μCi of 3H uridine or thymidine (as indicated) was added to each well, and the cells harvested after an additional 4 hours of culture. Filters were counted by scintillation counting. Standard deviations of the triplicate wells were <5%. The results are presented in FIGS. 6-8.
  • Example 11 Induction of NK Activity
  • Phosphodiester ODN were purchased from Operon Technologies (Alameda, Calif.). Phosphorothioate ODN were purchased from the DNA core facility, University of Iowa, or from The Midland Certified Reagent Company (Midland Tex.). E. coli (strain B) DNA and calf thymus DNA were purchased from Sigma (St. Louis, Mo.). All DNA and ODN were purified by extraction with phenol:chloroform:isoamyl alcohol (25:24:1) and/or ethanol precipitation. The LPS level in ODN was less than 12.5 ng/mg and E. coli and calf thymus DNA contained less than 2.5 ng of LPS/mg of DNA by Limulus assay.
  • Virus-free, 4-6 week old, DBA/2, C57BL/6 (B6) and congenitally athymic BALB/c mice were obtained on contract through the Veterans Affairs from the National Cancer Institute (Bethesda, Md.). C57BL/6 SCID mice were bred in the SPF barrier facility at the University of Iowa Animal Care Unit.
  • Human peripheral mononuclear blood leukocytes (PBMC) were obtained as previously described (Ballas, Z. K. et al., (1990) J. Allergy Clin. Immunol. 85:453; Ballas, Z. K. and W. Rasmussen (1990) J. Immunol. 145:1039; Ballas, Z. K. and W. Rasmussen (1993) J. Immunol. 150;17). Human or murine cells were cultured at 5×106/well, at 37° C. in a 5% CO2 humidified atmosphere in 24-well plates (Ballas, Z. K. et al., (1990) J. Allergy Clin. Immunol. 85:453; Ballas, Z. K. and W. Rasmussen (1990) J. Immunol 145:1039; and Ballas, Z. K. and W. Rasmussen (1993) J. Immunol, 150:17), with medium alone or with CpG or non-CpG ODN at the indicated concentrations, or with E. coli or calf thymus (50 μg/ml) at 37° C. for 24 hr. All cultures were harvested at 18 hr and the cells were used as effectors in a standard 4 hr 51Cr-release assay against K562 (human) or YAC-1 (mouse) target cells as previously described. For calculation of lytic units (LU), 1 LU was defined as the number of cells needed to effect 30% specific lysis. Where indicated, neutralizing antibodies against IFN-β (Lee Biomolecular, San Diego, Calif.) or IL-12 (C15.1, C15.6, C17.8, and C17.15; provided by Dr. Giorgio Trinchieri, The Wistar Institute, Philadelphia, Pa.) or their isotype controls were added at the initiation of cultures to a concentration of 10 μg/ml. For anti-IL-12 addition, 10 μg of each of the 4 mAb (or isotype controls) were added simultaneously. Recombinant human IL-2 was used at a concentration of 100 U/ml.
  • Example 12 Prevention of the Development of an Inflammatory Cellular Infiltrate and Eosinophilia in a Murine Model of Asthma
  • 6-8 week old C56BL/6 mice (from The Jackson Laboratory, Bar Harbor, Me.) were immunized with 5,000 Schistosoma mansoni eggs by intraperitoneal (i.p.) injection on days 0 and 7. Schistosoma mansoni eggs contain an antigen (Schistosoma mansoni egg antigen (SEA)) that induces a Th2 immune response (e.g. production of IgE antibody). IgE antibody production is known to be an important cause of asthma.
  • The immunized mice were then treated with oligonucleotides (30 μg in 200 μl saline by i.p.injection), which either contained an unmethylated CpG motif (i.e. TCCATGACGTTCCTGACGTT; SEQ ID NO.10) or did not (i.e. control, TCCATGAGCTTCCTGAGTCT; SEQ ID NO.11). Soluble SEA (10 μg in 25 μl of saline) was administered by intranasal instillation on days 14 and 21. Saline was used as a control.
  • Mice were sacrificed at various times after airway challenge. Whole lung lavage was performed to harvest airway and alveolar inflammatory cells. Cytokine levels were measured from lavage fluid by ELISA. RNA was isolated from whole lung for Northern analysis and RT-PCR studies using CsCl gradients. Lungs were inflated and perfused with 4% paraformaldehyde for histologic examination.
  • FIG. 9 shows that when the mice are initially injected with the eggs i.p., and then inhale the egg antigen (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given a nucleic acid containing an unmethylated CpG motif along with the eggs, the inflammatory cells in the lung are not increased by subsequent inhalation of the egg antigen (open triangles).
  • FIG. 10 shows that the same results are obtained when only eosinophils present in the lung lavage are measured. Eosinophils are the type of inflammatory cell most closely associated with asthma.
  • FIG. 11 shows that when the mice are treated with a control oligo at the time of the initial exposure to the egg, there is little effect on the subsequent influx of eosinophils into the lungs after inhalation of SEA. Thus, when mice inhale the eggs on days 14 or 21, they develop an acute inflammatory response in the lungs. However, giving a CpG oligo along with the eggs at the time of initial antigen exposure on days 0 and 7 almost completely abolishes the increase in eosinophils when the mice inhale the egg antigen on day 14.
  • FIG. 12 shows that very low doses of oligonucleotide (<10 μg) can give this protection.
  • FIG. 13 shows that the resultant inflammatory response correlates with the levels of the Th2 cytokine IL-4 in the lung.
  • FIG. 14 shows that administration of an oligonucleotide containing an unmethylated CpG motif can actually redirect the cytokine response of the lung to production of II-12, indicating a Th1 type of immune response.
  • FIG. 15 shows that administration of an oligonucleotide containing an unmethylated CpG motif can also redirect the cytokine response of the lung to production of IFN-γ, indicating a Th1 type of immune response.
  • Example 13 CpG Oligonucleotides Induce Human PBMC to Secrete Cytokines
  • Human PBMC were prepared from whole blood by standard centrifugation over ficoll hypaque. Cells (5×105/ml) were cultured in 10% autologous serum in 96 well microtiter plates with CpG or control oligodeoxynucleotides (24 μg/ml for phosphodiester oligonucleotides; 6 μg/ml for nuclease resistant phosphorothioate oligonucleotides) for 4 hr in the case of TNF-α or 24 hr for the other cytokines before supernatant harvest and assay, measured by ELISA using Quantikine kits or reagents from R&D Systems (pg/ml) or cytokine ELISA kits from Biosource (for IL-12 assay). Assays were performed as per the manufacturer's instructions. Data are presented in Table 6 as the level of cytokine above that in wells with no added oligodeoxynucleotide.
  • Equivalents
  • Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims (112)

1. A method for treating an atopic condition, comprising
administering to a subject in need of treatment of an atopic condition an immunostimulatory nucleic acid, comprising:

5′ X 1 CGX 23′
wherein the immunostimulatory nucleic acid includes at least 8 nucleotides and wherein c is unmethylated and wherein X1 and X2 are nucleotides, in an effective amount to treat the atopic condition.
2. The method of claim 1, wherein the atopic condition is atopic dermatitis.
3. The method of claim 1, wherein X1 is selected from the group consisting of A, G, and T, and wherein X2 is selected from the group consisting of C and T.
4. The method of claim 1, further comprising administering to the subject an allergen in conjunction with the administering of the immunostimulatory nucleic acid.
5. The method of claim 1, wherein the immunostimulatory nucleic acid comprises

5′ X 1 X 2 CGX 3 X 43′
wherein C is unmethylated and wherein X1, X2, X3, and X4 are nucleotides.
6. The method of claim 5, wherein X1X2 is selected from the group consisting of GpT, GpG, GpA and ApA.
7. The method of claim 5, wherein X3X4 is selected from the group consisting of TpT and CpT.
8. The method of claim 5, wherein X1X2 is selected from the group consisting of GpT, GpG, GpA and ApA and wherein X3X4 is selected from the group consisting of TpT and CpT.
9. The method of claim 5, wherein 5′ X1X2CGX3X4 3′ is not a palindrome.
10. The method of claim 5, wherein the immunostimulatory nucleic acid comprises a sequence selected from the group consisting of
TCCATGTCGGTCCTGATGCT, (SEQ ID NO:37) TCCATGCCGGTCCTGATGCT, (SEQ ID NO:38) TCCATGGCGGTCCTGATGCT, (SEQ ID NO:39) TCCATGACGGTCCTGATGCT, (SEQ ID NO:40) TCCATGTCGCTCCTGATGCT, (SEQ ID NO:42) TCCATGTCGTTCCTGATGCT, (SEQ ID NO:43) TCCATGACGTTCCTGATGCT, (SEQ ID NO:44) and TCCATAACGTTCCTGATGCT. (SEQ ID NO:45)
11. The method of claim 1, wherein the immunostimulatory nucleic acid is a synthetic nucleic acid molecule.
12. The method of claim 1, wherein the immunostimulatory nucleic acid is 8 to 100 nucleotides in length.
13. The method of claim 1, wherein the immunostimulatory nucleic acid is 8 to 40 nucleotides in length.
14. The method of claim 1, wherein the immunostimulatory nucleic acid is a stabilized nucleic acid molecule.
15. The method of claim 14, wherein the immunostimulatory nucleic acid includes a phosphate backbone modification which is a phosphorothioate or phosphorodithioate modification.
16. The method of claim 1, wherein the immunostimulatory nucleic acid is administered to the subject orally.
17. The method of claim 1, wherein the immunostimulatory nucleic acid is administered to the subject transdermally.
18. The method of claim 1, wherein the immunostimulatory nucleic acid is administered to the subject by injection.
19. A method for treating a mycobacterial infection in a subject, the method comprising: administering to a subject an immunostimulatory nucleic acid molecule in an amount effective to treat or ameliorate an infection with a Mycobacterium bacterium, thereby treating the infection in the subject.
20. The method of claim 19, wherein the immunostimulatory nucleic acid molecule is an immunostimulatory oligodeoxyribonucleotide.
21. The method of claim 19, wherein the immunostimulatory nucleic acid molecule is purified bacterial DNA.
22. The method of claim 19, wherein the immunostimulatory nucleic acid molecule is a plasmid DNA including sufficient immunostimulatory motifs to be immunostimulatory.
23. The method of claim 19, wherein the immunostimulatory nucleic acid molecule is a plasmid DNA which after being administered to the subject is degraded into oligonucleotides.
24. The method of claim 19, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif composed of an unmethylated CpG flanked by two 5′ purines and two 3′pyrimidines.
25. The method of claim 19, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif in which the CpG is flanked by a 5′ GpT dinucleotide and two 3′ pyrimidines.
26. The method of claim 19, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, and X1, X2, X3 and X4 are nucleotides.
27. The method of claim 19, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1X2 is selected from GpT, GpG, and GpA, and X3 and X4 are nucleotides.
28. The method of claim 19, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1 and X2 are nucleotides, and X3X4 is selected from TpT, CpT, and GpT.
29. The method of claim 19, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1X2 is selected from GpT, GpG, and GpA, and X3X4 is selected from TpT, CpT, and GpT.
30. The method of claim 19, wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
31. The method of claim 84, wherein the immunostimulatory nucleic acid molecule comprises the sequence AACGTT.
32. The method of claim 19, wherein said administering boosts the subject's immune response to eliminate an infection with a species of Mycobacteria.
33. The method of claim 19, wherein the bacterium is Mycobacterium tuberculosis.
34. The method of claim 19, wherein the bacterium is Mycobacterium avium.
35. The method of claim 19, wherein the subject has an immune system deficiency.
36. The method of claim 35, wherein the subject's immune system is not functioning in a normal capacity.
37. A method for stimulating in a subject an immune response against a Mycobacterium bacterium, the method comprising: administering to a subject an immunostimulatory nucleic acid molecule in an amount effective to stimulate an immune response in the subject, wherein said administering results in an immune response effective to treat, prevent or ameliorate an infection in the subject, wherein the infection is a bacterial infection with a Mycobacterium bacterium.
38. The method of claim 90, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif composed of an unmethylated CpG flanked by two 5′ purines and two 3′ pyrimidines.
39. The method of claim 90, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif in which the CpG is flanked by a 5′ GpT dinucleotide and two 3′ pyrimidines.
40. The method of claim 90, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, and X1, X2, X3 and X4 are nucleotides.
41. The method of claim 90, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1X2 is selected from GpT, GpG, and GpA, and X3 and X4 are nucleotides.
42. The method of claim 90, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1 and X2 are nucleotides, and X3X4 is selected from TpT, CpT, and GpT.
43. The method of claim 90, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1X2 is selected from GpT, GpG, and GpA, and X3X4 is selected from TpT, CpT, and GpT.
44. The method of claim 90, wherein the immunostimulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
45. The method of claim 44, wherein the immunostimulatory nucleic acid molecule comprises the sequence AACGTT.
46. The method of claim 90, wherein the bacterium is Mycobacterium tuberculosis.
47. The method of claim 90, wherein the bacterium is Mycobacterium avium.
48. The method of claim 90, wherein the subject has an immune system deficiency.
49. The method of claim 48, wherein the subject's immune system is not functioning in a normal capacity.
50. A method for treating a mycobacterial infection in a subject, the method comprising: administering to a subject an immunostimulatory nucleic acid molecule in an amount effective to treat, prevent or ameliorate an infection in the subject, wherein the infection is a bacterial infection with a Mycobacterium bacterium, thereby treating the infection in the subject, wherein the immunostimulatory nucleic acid comprises an immunostimulatory sequence comprising an unmethylated cytosine, guanine dinucleotide sequence.
51. The method of claim 50, wherein the immunostimulatory nucleic acid molecule is an immunostimulatory oligodeoxyribonucleotide.
52. The method of claim 50, wherein the immunostimulatory nucleic acid molecule is purified bacterial DNA.
53. The method of claim 50, wherein the immunostimulatory nucleic acid molecule is a plasmid DNA including sufficient immunostimulatory motifs to be immunostimulatory.
54. The method of claim 50, wherein the immunostimulatory nucleic acid molecule is a plasmid DNA which after administration to the subject is degraded into oligonucleotides.
55. The method of claim 50, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif composed of an unmethylated CpG flanked by two 5′ purines and two 3′ pyrimidines.
56. The method of claim 50, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif in which the CpG is flanked by a 5′ GpT dinucleotide and two 3′ pyrimidines.
57. The method of claim 50, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, and X1, X2, X3 and X4 are nucleotides.
58. The method of claim 50, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1X2 is selected from GpT, GpG, and GpA, and X3 and X4 are nucleotides.
59. The method of claim 50, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1 and X2 are nucleotides, and X3X4 is selected from TpT, CpT, and GpT.
60. The method of claim 50, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1X2 is selected from GpT, GpG, and GpA, and X3X4 is selected from TpT, CpT, and GpT.
61. The method of claim 50, wherein the immunostimulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
62. The method of claim 61, wherein the immunostimulatory nucleic acid molecule comprises the sequence AACGTT.
63. The method of claim 50, wherein said administering boosts the subject's immune response to eliminate an infection with a species of Mycobacteria.
64. The method of claim 50, wherein the bacterium is Mycobacterium tuberculosis.
65. The method of claim 50, wherein the bacterium is Mycobacterium avium.
66. The method of claim 50, wherein the subject has an immune system deficiency.
67. The method of claim 66, wherein the subject's immune system is not functioning in a normal capacity.
68. A method for stimulating in a subject an immune response against a Mycobacterium bacterium, the method comprising: administering to a subject an immunostimulatory nucleic acid molecule in an amount effective to stimulate an immune response in the subject, wherein the immunostimulatory nucleic acid comprises an immunostimulatory sequence comprising an unmethylated cytosine, guanine dinucleotide sequence, wherein said administering results in an immune response effective to treat, prevent or ameliorate an infection in the subject, wherein the infection is a bacterial infection with a Mycobacterium bacterium.
69. The method of claim 68, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif composed of an unmethylated CpG flanked by two 5′ purines and two 3′ pyrimidines.
70. The method of claim 68, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif in which the CpG is flanked by a 5′GpT dinucleotide and two 3′pyrimidines.
71. The method of claim 68, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, and X1, X2, X3 and X4 are nucleotides.
72. The method of claim 68, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1X2 is selected from GpT, GpG, and GpA, and X3 and X4 are nucleotides.
73. The method of claim 68, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1 and X2 are nucleotides, and X3X4 is selected from TpT, CpT, and GpT.
74. The method of claim 68, wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:

5′X 1 X 2 CGX 3 X 43′
wherein C and G are unmethylated, X1X2 is selected from GpT, GpG, and GpA, and X3X4 is selected from TpT, CpT, and GpT.
75. The method of claim 68, wherein the immunostimulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
76. The method of claim 75, wherein the immunostimulatory nucleic acid molecule comprises the sequence AACGTT.
77. The method of claim 68, wherein the bacterium is Mycobacterium tuberculosis.
78. The method of claim 68, wherein the bacterium is Mycobacterium avium.
79. The method of claim 68, wherein the subject has an immune system deficiency.
80. The method of claim 79, wherein the subject's immune system is not functioning in a normal capacity.
81. A method for treating a mycobacterial infection in a subject, the method comprising: administering to a subject an immunomodulatory nucleic acid molecule in an amount effective to inhibit replication of a Mycobacterium bacterium, thereby treating mycobacterial infection in the subject.
82. The method of claim 81, wherein the immunomodulatory nucleic acid molecule is selected from the group consisting of an immunostimulatory oligodeoxyribonucleotide (ISS—ODN); an isolated, detoxified bacterial polynucleotide; and an ISS-enriched plasmid DNA.
83. The method of claim 81, wherein the immunomodulatory nucleic acid molecule comprises a CpG motif selected from the group consisting of:
a) 5′-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3′;
b) 5′-Purine-TCG-Pyrimidine-Pyrimidine-3′;
c) 5′-[TCG]n-3′, where n is any integer that is at least 1; and
d) 5′-Purine-Purine-CG-Pyrimidine-Pyrimidine-CG-3′.
84. The method of claim 81, wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
85. The method of claim 84, wherein the immunomodulatory nucleic acid molecule comprises the sequence AACGTT.
86. The method of claim 81, wherein said administering results in induction of an immune response effective against infection by a mycobacterial pathogen.
87. The method of claim 81, wherein the bacterium is Mycobacterium tuberculosis.
88. The method of claim 81, wherein the bacterium is Mycobacterium avium.
89. The method of claim 81, wherein the subject is immunocompromised.
90. A method for inducing in a subject an immune response against a Mycobacterium bacterium, the method comprising: administering to a subject an amount of an immunomodulatory nucleic acid molecule in an amount effective to elicit an immune response against a Mycobacterium bacterium; wherein said administering results in induction of an immune response effective to protect the subject against onset of disease or to decrease severity of symptoms of disease caused by infection by the Mycobacterium bacterium.
91. The method of claim 90, wherein the immunomodulatory nucleic acid molecule comprises a CpG motif selected from the group consisting of:
a) 5′-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3′;
b) 5′-Purine-TCG-Pyrimidine-Pyrimidine-3′;
c) 5′-[TCG]n-3′, where n is any integer that is at least 1; and
d) 5′-Purine-Purine-CG-Pyrimidine-Pyrimidine-CG-3′.
92. The method of claim 90, wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
93. The method of claim 92, wherein the immunomodulatory nucleic acid molecule comprises the sequence AACGTT.
94. The method of claim 90, wherein the bacterium is Mycobacterium tuberculosis.
95. The method of claim 90, wherein the bacterium is Mycobacterium avium.
96. The method of claim 90, wherein the subject is immunocompromised.
97. A method for treating a mycobacterial infection in a subject, the method comprising: administering to a subject multiple doses of an immunomodulatory nucleic acid molecule in an amount effective to inhibit replication of a Mycobacterium bacterium, thereby treating the mycobacterial infection in the subject, wherein the immunomodulatory nucleic acid comprises an immunostimulatory sequence comprising 5′CpG3′.
98. The method of claim 97, wherein the immunomodulatory nucleic acid molecule is selected from the group consisting of an immunostimulatory oligodeoxyribonucleotide (ISS—ODN); an isolated, detoxified bacterial polynucleotide; and an ISS-enriched plasmid DNA.
99. The method of claim 97, wherein the immunomodulatory nucleic acid molecule comprises a CpG motif selected from the group consisting of:
5′-Purine-Purine-C-G-Pyrimidine-Pyrimidine-3′;
5′-Purine-TCG-Pyrimidine-Pyrimidine-3′;
5′-(TCG)n-3′, where n is any integer that is at least 1; and
5′-Purine-Purine-CG-Pyrimidine-Pyrimidine-CG-3′.
100. The method of claim 97, wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
101. The method of claim 100, wherein the immunomodulatory nucleic acid molecule comprises the sequence AACGTT.
102. The method of claim 97, wherein said administering results in induction of an immune response effective against infection by a mycobacterial pathogen.
103. The method of claim 97, wherein the bacterium is Mycobacterium tuberculosis.
104. The method of claim 97, wherein the bacterium is Mycobacterium avium.
105. The method of claim 97, wherein the subject is immunocompromised.
106. A method for inducing in a subject an immune response against a Mycobacterium bacterium, the method comprising: administering to a subject multiple doses of an immunomodulatory nucleic acid molecule in an amount effective to elicit an immune response against a Mycobacterium bacterium, wherein the immunomodulatory nucleic acid comprises an immunostimulatory sequence comprising 5′CpG 3′;
wherein said administering results in induction of an immune response effective to protect the subject against onset of disease or to decrease severity of symptoms of disease caused by infection by the Mycobacterium bacterium.
107. The method of claim 106, wherein the immunomodulatory nucleic acid molecule comprises a CpG motif selected from the group consisting of:
5′-Purine-Purine-C-G-Pyrimidine-Pyrimidine-3′;
5′-Purine-TCG-Pyrimidine-Pyrimidine-3′;
5′-(TCG)n-3′, where n is any integer that is at least 1; and
5′-Purine-Purine-CG-Pyrimidine-Pyrimidine-CG-3′.
108. The method of claim 106, wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
109. The method of claim 108, wherein the immunomodulatory nucleic acid molecule comprises the sequence AACGTT.
110. The method of claim 106, wherein the bacterium is Mycobacterium tuberculosis.
111. The method of claim 106, wherein the bacterium is Mycobacterium avium.
112. The method of claim 106, wherein the subject is immunocompromised.
US10/613,916 1994-07-15 2003-07-03 Immunostimulatory nucleic acid molecules Abandoned US20050070491A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/613,916 US20050070491A1 (en) 1994-07-15 2003-07-03 Immunostimulatory nucleic acid molecules

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US27635894A 1994-07-15 1994-07-15
US08/386,063 US6194388B1 (en) 1994-07-15 1995-02-07 Immunomodulatory oligonucleotides
US08/738,652 US6207646B1 (en) 1994-07-15 1996-10-30 Immunostimulatory nucleic acid molecules
US09/818,918 US20030050261A1 (en) 1994-07-15 2001-03-27 Immunostimulatory nucleic acid molecules
US10/613,916 US20050070491A1 (en) 1994-07-15 2003-07-03 Immunostimulatory nucleic acid molecules

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/818,918 Continuation US20030050261A1 (en) 1994-07-15 2001-03-27 Immunostimulatory nucleic acid molecules

Publications (1)

Publication Number Publication Date
US20050070491A1 true US20050070491A1 (en) 2005-03-31

Family

ID=24968901

Family Applications (32)

Application Number Title Priority Date Filing Date
US08/738,652 Expired - Lifetime US6207646B1 (en) 1994-07-15 1996-10-30 Immunostimulatory nucleic acid molecules
US09/818,918 Abandoned US20030050261A1 (en) 1994-07-15 2001-03-27 Immunostimulatory nucleic acid molecules
US10/435,656 Abandoned US20050277604A1 (en) 1994-07-15 2003-05-09 Immunostimulatory nucleic acid molecules
US10/613,916 Abandoned US20050070491A1 (en) 1994-07-15 2003-07-03 Immunostimulatory nucleic acid molecules
US10/679,710 Abandoned US20040147468A1 (en) 1994-07-15 2003-10-03 Immunostimulatory nucleic acid molecules
US10/743,625 Abandoned US20040132685A1 (en) 1994-07-15 2003-12-22 Immunostimulatory nucleic acid
US10/769,282 Expired - Fee Related US7674777B2 (en) 1994-07-15 2004-01-30 Immunostimulatory nucleic acid molecules
US10/817,165 Abandoned US20040198688A1 (en) 1994-07-15 2004-04-02 Immunostimulatory nucleic acid molecules
US10/831,647 Expired - Fee Related US7402572B2 (en) 1994-07-15 2004-04-23 Immunostimulatory nucleic acid molecules
US10/847,642 Abandoned US20050004061A1 (en) 1994-07-15 2004-05-17 Immunostimulatory nucleic acid molecules
US10/877,407 Abandoned US20040229835A1 (en) 1994-07-15 2004-06-24 Immunostimulatory nucleic acid molecules
US10/884,852 Abandoned US20050059625A1 (en) 1994-07-15 2004-07-02 Immunostimulatory nucleic acid molecules
US10/888,449 Abandoned US20050049215A1 (en) 1994-07-15 2004-07-09 Immunostimulatory nucleic acid molecules
US10/888,785 Expired - Fee Related US7517861B2 (en) 1994-07-15 2004-07-09 Immunostimulatory nucleic acid molecules
US10/894,657 Abandoned US20050054602A1 (en) 1994-07-15 2004-07-16 Immunostimulatory nucleic acid molecules
US10/894,862 Expired - Fee Related US8058249B2 (en) 1994-07-15 2004-07-16 Immunostimulatory nucleic acid molecules
US10/928,762 Abandoned US20050123523A1 (en) 1994-07-15 2004-08-26 Immunostimulatory nucleic acid molecules
US10/956,494 Expired - Fee Related US7879810B2 (en) 1994-07-15 2004-10-01 Immunostimulatory nucleic acid molecules
US10/956,745 Abandoned US20050239732A1 (en) 1994-07-15 2004-10-01 Immunostimulatory nucleic acid molecules
US10/972,301 Abandoned US20050215500A1 (en) 1994-07-15 2004-10-22 Immunostimulatory nucleic acid molecules
US10/987,146 Abandoned US20050148537A1 (en) 1994-07-15 2004-11-12 Immunostimulatory nucleic acid molecules
US11/031,460 Expired - Fee Related US8158592B2 (en) 1994-07-15 2005-01-07 Immunostimulatory nucleic acid molecules
US11/036,527 Expired - Fee Related US7723022B2 (en) 1994-07-15 2005-01-14 Immunostimulatory nucleic acid molecules
US11/067,587 Expired - Fee Related US8129351B2 (en) 1994-07-15 2005-02-25 Immunostimulatory nucleic acid molecules
US11/134,918 Abandoned US20050267064A1 (en) 1994-07-15 2005-05-23 Immunostimulatory nucleic acid molecules
US11/296,572 Abandoned US20060089326A1 (en) 1994-07-15 2005-12-07 Immunostimulatory nucleic acid molecules
US11/503,483 Expired - Fee Related US7723500B2 (en) 1994-07-15 2006-08-11 Immunostimulatory nucleic acid molecules
US11/526,197 Abandoned US20070078104A1 (en) 1994-07-15 2006-09-22 Immunostimulatory nucleic acid molecules
US11/598,207 Expired - Fee Related US8258106B2 (en) 1994-07-15 2006-11-10 Immunostimulatory nucleic acid molecules
US11/810,353 Abandoned US20080026011A1 (en) 1994-07-15 2007-06-05 Immunostimulatory nucleic acid molecules
US12/248,493 Abandoned US20090202575A1 (en) 1994-07-15 2008-10-09 Immunostimulatory nucleic acid molecules
US12/383,824 Expired - Fee Related US7888327B2 (en) 1994-07-15 2009-03-25 Methods of using immunostimulatory nucleic acid molecules to treat allergic conditions

Family Applications Before (3)

Application Number Title Priority Date Filing Date
US08/738,652 Expired - Lifetime US6207646B1 (en) 1994-07-15 1996-10-30 Immunostimulatory nucleic acid molecules
US09/818,918 Abandoned US20030050261A1 (en) 1994-07-15 2001-03-27 Immunostimulatory nucleic acid molecules
US10/435,656 Abandoned US20050277604A1 (en) 1994-07-15 2003-05-09 Immunostimulatory nucleic acid molecules

Family Applications After (28)

Application Number Title Priority Date Filing Date
US10/679,710 Abandoned US20040147468A1 (en) 1994-07-15 2003-10-03 Immunostimulatory nucleic acid molecules
US10/743,625 Abandoned US20040132685A1 (en) 1994-07-15 2003-12-22 Immunostimulatory nucleic acid
US10/769,282 Expired - Fee Related US7674777B2 (en) 1994-07-15 2004-01-30 Immunostimulatory nucleic acid molecules
US10/817,165 Abandoned US20040198688A1 (en) 1994-07-15 2004-04-02 Immunostimulatory nucleic acid molecules
US10/831,647 Expired - Fee Related US7402572B2 (en) 1994-07-15 2004-04-23 Immunostimulatory nucleic acid molecules
US10/847,642 Abandoned US20050004061A1 (en) 1994-07-15 2004-05-17 Immunostimulatory nucleic acid molecules
US10/877,407 Abandoned US20040229835A1 (en) 1994-07-15 2004-06-24 Immunostimulatory nucleic acid molecules
US10/884,852 Abandoned US20050059625A1 (en) 1994-07-15 2004-07-02 Immunostimulatory nucleic acid molecules
US10/888,449 Abandoned US20050049215A1 (en) 1994-07-15 2004-07-09 Immunostimulatory nucleic acid molecules
US10/888,785 Expired - Fee Related US7517861B2 (en) 1994-07-15 2004-07-09 Immunostimulatory nucleic acid molecules
US10/894,657 Abandoned US20050054602A1 (en) 1994-07-15 2004-07-16 Immunostimulatory nucleic acid molecules
US10/894,862 Expired - Fee Related US8058249B2 (en) 1994-07-15 2004-07-16 Immunostimulatory nucleic acid molecules
US10/928,762 Abandoned US20050123523A1 (en) 1994-07-15 2004-08-26 Immunostimulatory nucleic acid molecules
US10/956,494 Expired - Fee Related US7879810B2 (en) 1994-07-15 2004-10-01 Immunostimulatory nucleic acid molecules
US10/956,745 Abandoned US20050239732A1 (en) 1994-07-15 2004-10-01 Immunostimulatory nucleic acid molecules
US10/972,301 Abandoned US20050215500A1 (en) 1994-07-15 2004-10-22 Immunostimulatory nucleic acid molecules
US10/987,146 Abandoned US20050148537A1 (en) 1994-07-15 2004-11-12 Immunostimulatory nucleic acid molecules
US11/031,460 Expired - Fee Related US8158592B2 (en) 1994-07-15 2005-01-07 Immunostimulatory nucleic acid molecules
US11/036,527 Expired - Fee Related US7723022B2 (en) 1994-07-15 2005-01-14 Immunostimulatory nucleic acid molecules
US11/067,587 Expired - Fee Related US8129351B2 (en) 1994-07-15 2005-02-25 Immunostimulatory nucleic acid molecules
US11/134,918 Abandoned US20050267064A1 (en) 1994-07-15 2005-05-23 Immunostimulatory nucleic acid molecules
US11/296,572 Abandoned US20060089326A1 (en) 1994-07-15 2005-12-07 Immunostimulatory nucleic acid molecules
US11/503,483 Expired - Fee Related US7723500B2 (en) 1994-07-15 2006-08-11 Immunostimulatory nucleic acid molecules
US11/526,197 Abandoned US20070078104A1 (en) 1994-07-15 2006-09-22 Immunostimulatory nucleic acid molecules
US11/598,207 Expired - Fee Related US8258106B2 (en) 1994-07-15 2006-11-10 Immunostimulatory nucleic acid molecules
US11/810,353 Abandoned US20080026011A1 (en) 1994-07-15 2007-06-05 Immunostimulatory nucleic acid molecules
US12/248,493 Abandoned US20090202575A1 (en) 1994-07-15 2008-10-09 Immunostimulatory nucleic acid molecules
US12/383,824 Expired - Fee Related US7888327B2 (en) 1994-07-15 2009-03-25 Methods of using immunostimulatory nucleic acid molecules to treat allergic conditions

Country Status (14)

Country Link
US (32) US6207646B1 (en)
EP (5) EP2360252B8 (en)
JP (5) JP2001503267A (en)
KR (1) KR100689942B1 (en)
CN (2) CN101265285A (en)
AT (1) ATE332966T1 (en)
AU (3) AU5242498A (en)
CA (1) CA2270345C (en)
DE (1) DE69736331T2 (en)
DK (1) DK0948510T3 (en)
ES (2) ES2624859T3 (en)
NZ (1) NZ335397A (en)
PT (1) PT948510E (en)
WO (1) WO1998018810A1 (en)

Cited By (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020164341A1 (en) * 1997-03-10 2002-11-07 Loeb Health Research Institute At The Ottawa Hospital Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US20030148976A1 (en) * 2001-08-17 2003-08-07 Krieg Arthur M. Combination motif immune stimulatory oligonucleotides with improved activity
US20030191079A1 (en) * 1994-07-15 2003-10-09 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20030212026A1 (en) * 1999-09-25 2003-11-13 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US20030232074A1 (en) * 2002-04-04 2003-12-18 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US20040067905A1 (en) * 2002-07-03 2004-04-08 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040087534A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040092472A1 (en) * 2002-07-03 2004-05-13 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20040147468A1 (en) * 1994-07-15 2004-07-29 Krieg Arthur M Immunostimulatory nucleic acid molecules
US20040152649A1 (en) * 2002-07-03 2004-08-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040157791A1 (en) * 1998-06-25 2004-08-12 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
US20040171571A1 (en) * 2002-12-11 2004-09-02 Coley Pharmaceutical Group, Inc. 5' CpG nucleic acids and methods of use
US20040198680A1 (en) * 2002-07-03 2004-10-07 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040235778A1 (en) * 1998-05-14 2004-11-25 Coley Pharmaceutical Gmbh Methods for regulating hematopoiesis using CpG-oligonucleotides
US20040235774A1 (en) * 2000-02-03 2004-11-25 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20050013812A1 (en) * 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050059619A1 (en) * 2002-08-19 2005-03-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20050075302A1 (en) * 1994-03-25 2005-04-07 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050101557A1 (en) * 1994-07-15 2005-05-12 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050119273A1 (en) * 2003-06-20 2005-06-02 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (TLR) antagonists
US20050130911A1 (en) * 2003-09-25 2005-06-16 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20050181422A1 (en) * 2000-09-15 2005-08-18 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050239734A1 (en) * 2003-10-30 2005-10-27 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050256073A1 (en) * 2004-02-19 2005-11-17 Coley Pharmaceutical Group, Inc. Immunostimulatory viral RNA oligonucleotides
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US20060140875A1 (en) * 2004-10-20 2006-06-29 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US20060211644A1 (en) * 2005-02-24 2006-09-21 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US20060229271A1 (en) * 2005-04-08 2006-10-12 Coley Pharmaceutical Group, Inc. Methods for treating infectious disease exacerbated asthma
US20060241076A1 (en) * 2005-04-26 2006-10-26 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20060286070A1 (en) * 1999-09-27 2006-12-21 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US20070009710A1 (en) * 2000-08-04 2007-01-11 Toyo Boseki Kabushiki Kaisha Flexible metal-clad laminate and method for producing the same
US20070065467A1 (en) * 1994-07-15 2007-03-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20080026986A1 (en) * 2006-06-05 2008-01-31 Rong-Fu Wang Reversal of the suppressive function of specific t cells via toll-like receptor 8 signaling
US20080045473A1 (en) * 2006-02-15 2008-02-21 Coley Pharmaceutical Gmbh Compositions and methods for oligonucleotide formulations
US20080226649A1 (en) * 2000-12-08 2008-09-18 Coley Pharmaceutical Gmbh CPG-like nucleic acids and methods of use thereof
US20090117132A1 (en) * 2005-07-07 2009-05-07 Pfizer, Inc. Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment
US20090142362A1 (en) * 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
US20090214578A1 (en) * 2005-09-16 2009-08-27 Coley Pharmaceutical Gmbh Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
US20090306177A1 (en) * 2005-09-16 2009-12-10 Coley Pharmaceutical Gmbh Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification
US20090311277A1 (en) * 2002-07-03 2009-12-17 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20100010193A1 (en) * 1999-02-17 2010-01-14 Csl Limited Immunogenic complexes and methods relating thereto
US7662949B2 (en) 2005-11-25 2010-02-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US7741300B2 (en) 1998-06-25 2010-06-22 National Jewish Medical And Research Center Methods of using nucleic acid vector-lipid complexes
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US9957969B2 (en) 2012-06-19 2018-05-01 Volvo Lastvagnar Ab Device for controlling a gas flow, an exhaust aftertreatment system and a system for propelling a vehicle

Families Citing this family (780)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL105325A (en) * 1992-04-16 1996-11-14 Minnesota Mining & Mfg Immunogen/vaccine adjuvant composition
US6498147B2 (en) * 1992-05-22 2002-12-24 The Scripps Research Institute Suppression of nuclear factor-κb dependent processes using oligonucleotides
CA2110946A1 (en) * 1992-12-09 1994-06-10 Elazar Rabbani Induction of immunocompatibility by nucleic acid
US20030109469A1 (en) * 1993-08-26 2003-06-12 Carson Dennis A. Recombinant gene expression vectors and methods for use of same to enhance the immune response of a host to an antigen
US5849719A (en) * 1993-08-26 1998-12-15 The Regents Of The University Of California Method for treating allergic lung disease
US5981501A (en) * 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US7422902B1 (en) * 1995-06-07 2008-09-09 The University Of British Columbia Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US7034007B1 (en) * 1995-06-07 2006-04-25 East Carolina University Low adenosine anti-sense oligonucleotide, compositions, kit & method for treatment of airway disorders associated with bronchoconstriction, lung inflammation, allergy(ies) & surfactant depletion
US6825174B2 (en) * 1995-06-07 2004-11-30 East Carolina University Composition, formulations & method for prevention & treatment of diseases and conditions associated with bronchoconstriction, allergy(ies) & inflammation
AU1463097A (en) 1996-01-04 1997-08-01 Rican Limited Helicobacter pylori bacterioferritin
US20030078223A1 (en) * 1996-01-30 2003-04-24 Eyal Raz Compositions and methods for modulating an immune response
WO1997028259A1 (en) * 1996-01-30 1997-08-07 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
US5898031A (en) * 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US20050119470A1 (en) * 1996-06-06 2005-06-02 Muthiah Manoharan Conjugated oligomeric compounds and their use in gene modulation
WO2005121371A2 (en) * 2004-06-03 2005-12-22 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
US7812149B2 (en) 1996-06-06 2010-10-12 Isis Pharmaceuticals, Inc. 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US20040147022A1 (en) * 1996-06-06 2004-07-29 Baker Brenda F. 2'-methoxy substituted oligomeric compounds and compositions for use in gene modulations
US20040171031A1 (en) * 1996-06-06 2004-09-02 Baker Brenda F. Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
ES2241042T3 (en) 1996-10-11 2005-10-16 The Regents Of The University Of California IMMUNO STIMULATOR POLINUCLEOTIDE CONJUGATES / IMMUNOMODULATOR MOLECULA.
ATE367159T1 (en) 1996-10-25 2007-08-15 Minnesota Mining & Mfg COMPOUNDS THAT ALTER THE IMMUNE RESPONSE FOR THE TREATMENT OF TH2-MEDIATED AND RELATED DISEASES
ATE235890T1 (en) * 1997-01-30 2003-04-15 Chiron Corp USE OF MICROPARTICLES WITH ADSORBED ANTIGEN TO STIMULATE IMMUNE DEFENSE
US6884435B1 (en) * 1997-01-30 2005-04-26 Chiron Corporation Microparticles with adsorbent surfaces, methods of making same, and uses thereof
US6214806B1 (en) * 1997-02-28 2001-04-10 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders
CA2283557A1 (en) * 1997-03-10 1998-09-17 Heather L. Davis Use of nucleic acids containing unmethylated cpg dinucleotide as an adjuvant
US6426334B1 (en) 1997-04-30 2002-07-30 Hybridon, Inc. Oligonucleotide mediated specific cytokine induction and reduction of tumor growth in a mammal
US20030104044A1 (en) * 1997-05-14 2003-06-05 Semple Sean C. Compositions for stimulating cytokine secretion and inducing an immune response
DE69841002D1 (en) 1997-05-14 2009-09-03 Univ British Columbia Highly effective encapsulation of nucleic acids in lipid vesicles
WO1998052581A1 (en) 1997-05-20 1998-11-26 Ottawa Civic Hospital Loeb Research Institute Vectors and methods for immunization or therapeutic protocols
US6589940B1 (en) 1997-06-06 2003-07-08 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
EP1374894A3 (en) * 1997-06-06 2004-09-22 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
DE69840850D1 (en) * 1997-06-06 2009-07-09 Dynavax Tech Corp INHIBITORS OF IMMUNSTIMULATORY DNA SEQUENCE ACTIVITY
US20040006034A1 (en) * 1998-06-05 2004-01-08 Eyal Raz Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
EP1009440B1 (en) * 1997-07-03 2008-09-17 MacFarlane, Donald E. Method for inhibiting immunostimulatory dna associated responses
AU2003203948B2 (en) * 1997-09-05 2005-12-22 The Regents Of The University Of California Use of immunostimulatory oligonucleotides for preventing or reducing antigen-stimulated, granulocyte-mediated inflammation
AU757175B2 (en) * 1997-09-05 2003-02-06 Regents Of The University Of California, The Use of immunostimulatory oligonucleotides for preventing or reducing antigen-stimulated, granulocyte-mediated inflammation
JP2002513763A (en) * 1998-05-06 2002-05-14 ユニバーシティ オブ アイオワ リサーチ ファウンデーション Methods for preventing and treating parasitic infections and related diseases using CPG oligonucleotides
CN102274272A (en) 1998-05-19 2011-12-14 研究发展基金会 Triterpene compositions and methods for use thereof
KR19990086271A (en) * 1998-05-27 1999-12-15 손경식 Novel endonucleases of immune cells and immunoadjuvant using the same
US6562798B1 (en) * 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US20040247662A1 (en) * 1998-06-25 2004-12-09 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
EP1100807A1 (en) * 1998-07-27 2001-05-23 University Of Iowa Research Foundation STEREOISOMERS OF CpG OLIGONUCLEOTIDES AND RELATED METHODS
ATE315405T1 (en) * 1998-08-10 2006-02-15 Antigenics Inc CPG COMPOSITIONS, SAPONIN ADJUVANTS AND METHODS OF USE THEREOF
ATE326239T1 (en) * 1998-09-18 2006-06-15 Dynavax Tech Corp METHODS FOR TREATING IG-E ASSOCIATED DISEASES AND COMPOSITIONS FOR USE IN SUCH METHODS
AU6425999A (en) * 1998-10-09 2000-05-01 Dynavax Technologies Corporation Anti hiv compositions comprising immunostimulatory polynucleotides and hiv antigens
US6423493B1 (en) * 1998-10-26 2002-07-23 Board Of Regents The University Of Texas System Combinatorial selection of oligonucleotide aptamers
CA2357413A1 (en) * 1998-12-22 2000-06-29 Panacea Pharmaceuticals, Llc Sensitizing agents for the treatment of skin lesions
US6558951B1 (en) * 1999-02-11 2003-05-06 3M Innovative Properties Company Maturation of dendritic cells with immune response modifying compounds
ES2242604T3 (en) 1999-02-26 2005-11-16 Chiron Corporation MICROEMULSIONS WITH MACROPARTICLES AND ADSORBID MICROPARTICLES.
EP1154790B1 (en) * 1999-02-26 2004-10-20 Chiron S.r.l. Enhancement of bactericidal activity of neisseria antigens with oligonucleotides containing cg motifs
GB2348132B (en) * 1999-03-02 2004-08-04 Nedaa Abdul-Ghani Nasif Asthma/allergy therapy that targets t-lymphocytes and/or eosinophils
FR2790955B1 (en) * 1999-03-19 2003-01-17 Assist Publ Hopitaux De Paris USE OF STABILIZED OLIGONUCLEOTIDES AS ANTI-TUMOR ACTIVE INGREDIENT
US6977245B2 (en) 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
WO2000061151A2 (en) 1999-04-12 2000-10-19 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US6562801B1 (en) 1999-04-15 2003-05-13 Board Of Regents, The University Of Texas System PpGpp and pppGpp as immunomodulatory agents
US6558670B1 (en) 1999-04-19 2003-05-06 Smithkline Beechman Biologicals S.A. Vaccine adjuvants
GB9908885D0 (en) * 1999-04-19 1999-06-16 Smithkline Beecham Biolog Vccine
HU229255B1 (en) 1999-04-19 2013-10-28 Smithkline Beecham Biolog Vaccines
AU762857B2 (en) * 1999-04-20 2003-07-10 Smithkline Beecham Biologicals (Sa) Vaccine
WO2001000232A2 (en) * 1999-06-29 2001-01-04 Smithkline Beecham Biologicals S.A. Use of cpg as an adjuvant for hiv vaccine
US20050002958A1 (en) * 1999-06-29 2005-01-06 Smithkline Beecham Biologicals Sa Vaccines
US6514948B1 (en) 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
FR2795963A1 (en) * 1999-07-08 2001-01-12 Pasteur Merieux Serums Vacc New polynucleotides are useful as vaccines for humans
DE19935756A1 (en) 1999-07-27 2001-02-08 Mologen Forschungs Entwicklung Covalently closed nucleic acid molecule for immune stimulation
US20050226890A1 (en) * 1999-08-12 2005-10-13 Cohen David I Tat-based vaccine compositions and methods of making and using same
PT1200580E (en) * 1999-08-13 2005-03-31 Hybridon Inc MODULATION OF IMMUNITARY STIMULATION MEASURED BY OLIGONUCLEOTIDES CPG THROUGH POSITIONAL MODIFICATION OF NUCLEOSIDOS
ATE419869T1 (en) * 1999-08-19 2009-01-15 Dynavax Tech Corp METHOD FOR MODULATING AN IMMUNE RESPONSE USING IMMUNSTIMULATIVE SEQUENCES AND COMPOSITIONS THEREOF
US20050249794A1 (en) * 1999-08-27 2005-11-10 Semple Sean C Compositions for stimulating cytokine secretion and inducing an immune response
CA2382611A1 (en) * 1999-08-27 2001-03-08 Inex Pharmaceuticals Corp. Compositions for stimulating cytokine secretion and inducing an immune response
EP1688147A1 (en) * 1999-09-27 2006-08-09 Coley Pharmaceutical Group, Inc. Methods Related to Immunostimulatory Nucleic Acid-Induced Interferon
IL148844A0 (en) * 1999-09-27 2002-09-12 Coley Pharm Group Inc Methods related to immunostimulatory nucleic acid-induced interferon
ES2559317T3 (en) 1999-10-29 2016-02-11 Glaxosmithkline Biologicals Sa Neisseria antigenic peptides
US7223398B1 (en) 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
ATE378348T1 (en) * 2000-01-14 2007-11-15 Us Health OLIGODEOXYNUCLEOTIDES AND THEIR USE FOR INDUCING AN IMMUNE RESPONSE
AU3108001A (en) * 2000-01-20 2001-12-24 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for inducing a th2 immune response
WO2001055341A2 (en) * 2000-01-31 2001-08-02 The Regents Of The University Of California Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
US20030130217A1 (en) * 2000-02-23 2003-07-10 Eyal Raz Method for treating inflammatory bowel disease and other forms of gastrointestinal inflammation
CA2399550A1 (en) * 2000-02-23 2001-08-30 The Regents Of The University Of California Method for treating inflammatory bowel disease and other forms of gastrointestinal inflammation
WO2001062092A1 (en) * 2000-02-25 2001-08-30 Thomas Jefferson University Formulations and methods for using the same to elicit an immune response
US7157437B2 (en) 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US20020098199A1 (en) 2000-03-10 2002-07-25 Gary Van Nest Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
US20030129251A1 (en) 2000-03-10 2003-07-10 Gary Van Nest Biodegradable immunomodulatory formulations and methods for use thereof
US7129222B2 (en) * 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US20010046967A1 (en) 2000-03-10 2001-11-29 Gary Van Nest Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide
US20020142978A1 (en) * 2000-04-07 2002-10-03 Eyal Raz Synergistic improvements to polynucleotide vaccines
EP1278761B1 (en) * 2000-05-01 2005-04-06 Hybridon, Inc. MODULATION OF OLIGONUCLEOTIDE CpG-MEDIATED IMMUNE STIMULATION BY POSITIONAL MODIFICATION OF NUCLEOSIDES
US6696064B2 (en) * 2000-06-20 2004-02-24 The United States Of America As Represented By The Department Of Health And Human Services Methods of protecting vasculature from damage by diphtheria toxin-and pseudomonas toxin-based immunotoxins during therapy
WO2001098206A1 (en) 2000-06-22 2001-12-27 Rxkinetix, Inc. Delivery vehicle composition and methods for delivering antigens and other drugs
JP5008244B2 (en) * 2000-06-23 2012-08-22 ワイス・ホールディングズ・コーポレイション Assembly of wild-type and chimeric influenza virus-like particles (VLPs)
WO2002002172A1 (en) * 2000-06-30 2002-01-10 Univ Jefferson Dna palindrome - oligoguanylic acid compositions and uses thereof
US20080044435A1 (en) * 2004-03-16 2008-02-21 Cohen David I Tat-Based Tolerogen Compositions and Methods of Making and Using Same
JP2005503320A (en) * 2000-08-25 2005-02-03 イエダ・リサーチ・アンド・デベロツプメント・カンパニー・リミテツド Methods for treating or preventing autoimmune diseases with CpG-containing polynucleotides
AU9475001A (en) * 2000-09-26 2002-04-08 Hybridon Inc Modulation of immunostimulatory activity of immunostimulatory oligonucleotide analogs by positional chemical changes
CA2881568C (en) 2000-10-27 2019-09-24 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups a & b
US6677347B2 (en) * 2000-12-08 2004-01-13 3M Innovative Properties Company Sulfonamido ether substituted imidazoquinolines
WO2006091720A2 (en) * 2000-12-08 2006-08-31 3M Innovative Properties Company Compositions and methods for targeted delivery of immune response modifiers
WO2002052002A2 (en) * 2000-12-27 2002-07-04 Dynavax Technologies Corporation Immunomodulatory polynucleotides and methods of using the same
CA2434573A1 (en) * 2001-01-12 2002-07-18 Amato Pharmaceutical Products, Ltd. Agent for protection against microorganism infection
US7264810B2 (en) * 2001-01-19 2007-09-04 Cytos Biotechnology Ag Molecular antigen array
DE10290185D2 (en) * 2001-01-31 2004-04-15 Mologen Forschungs Entwicklung tumor vaccine
US20030050268A1 (en) * 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
WO2002083859A2 (en) * 2001-04-13 2002-10-24 Wyeth Surface proteins of streptococcus pyogenes
US20070128229A1 (en) * 2002-04-12 2007-06-07 Wyeth Surface proteins of Streptococcus pyogenes
KR20080081201A (en) 2001-04-16 2008-09-08 와이어쓰 홀딩스 코포레이션 Novel streptococcus pneumoniae open reading frames encoding polypeptide antigens and a composition comprising the same
US7034140B2 (en) * 2001-04-24 2006-04-25 E.I. Du Pont De Nemours And Company Genes involved in isoprenoid compound production
WO2002094845A2 (en) 2001-05-21 2002-11-28 Intercell Ag Method for stabilising of nucleic acids
US6818787B2 (en) * 2001-06-11 2004-11-16 Xenoport, Inc. Prodrugs of GABA analogs, compositions and uses thereof
GB0115176D0 (en) 2001-06-20 2001-08-15 Chiron Spa Capular polysaccharide solubilisation and combination vaccines
ES2487645T3 (en) * 2001-06-21 2014-08-22 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of use thereof
US7785610B2 (en) * 2001-06-21 2010-08-31 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—III
US20030138458A1 (en) * 2001-06-29 2003-07-24 Michael Houghton HCV E1E2 vaccine compositions
GB0118249D0 (en) 2001-07-26 2001-09-19 Chiron Spa Histidine vaccines
GB0121591D0 (en) 2001-09-06 2001-10-24 Chiron Spa Hybrid and tandem expression of neisserial proteins
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
US20030148316A1 (en) * 2001-08-01 2003-08-07 Lipford Grayson B. Methods and compositions relating to plasmacytoid dendritic cells
WO2003025119A2 (en) * 2001-08-03 2003-03-27 Medarex, Inc. Compositions comprising immunostimulatory oligonucleotides and uses thereof to enhance fc receptor-mediated immunotherapies
EP1420829A4 (en) * 2001-08-07 2006-05-17 Dynavax Tech Corp Immunomodulatory compositions, formulations, and methods for use thereof
WO2003020884A2 (en) * 2001-08-14 2003-03-13 The Government Of The United States Of America As Represented By The Secretary Of Health And Human Services Method for rapid generation of mature dendritic cells
JP4319908B2 (en) 2001-08-24 2009-08-26 ユニバーシティ オブ ビクトリア イノベーション アンド ディベロップメント コーポレーション Proaerolysin containing a protease activating sequence and methods of use for the treatment of prostate cancer
WO2003020889A2 (en) * 2001-08-30 2003-03-13 3M Innovative Properties Company Methods of maturing plasmacytoid dendritic cells using immune response modifier molecules
JP2005501917A (en) * 2001-09-07 2005-01-20 ザ トラスティーズ オブ ボストン ユニバーシティ Methods and compositions for treating immune complex related diseases
EP1425040A2 (en) * 2001-09-14 2004-06-09 Cytos Biotechnology AG In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles
AU2002339224B2 (en) * 2001-09-14 2008-10-09 Kuros Us Llc Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
WO2003027313A2 (en) 2001-09-24 2003-04-03 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services SUPPRESSORS OF CpG OLIGONUCLEOTIDES AND METHODS OF USE
US20030119774A1 (en) * 2001-09-25 2003-06-26 Marianna Foldvari Compositions and methods for stimulating an immune response
AR045702A1 (en) 2001-10-03 2005-11-09 Chiron Corp COMPOSITIONS OF ASSISTANTS.
EP1451581A4 (en) * 2001-10-05 2006-01-11 Coley Pharm Gmbh Toll-like receptor 3 signaling agonists and antagonists
WO2003030656A2 (en) 2001-10-06 2003-04-17 Merial Limited Methods and compositions for promoting growth and innate immunity in young animals
US20050238660A1 (en) * 2001-10-06 2005-10-27 Babiuk Lorne A Cpg formulations and related methods
MX339524B (en) 2001-10-11 2016-05-30 Wyeth Corp Novel immunogenic compositions for the prevention and treatment of meningococcal disease.
US7276489B2 (en) * 2002-10-24 2007-10-02 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
WO2003039595A2 (en) * 2001-11-07 2003-05-15 Inex Pharmaceuticals Corporation Mucosal adjuvants comprising an oligonucleotide and a cationic lipid
US20050085433A1 (en) * 2001-11-09 2005-04-21 Claudia Breidenstein Cellular vaccines comprising adjuvants
US7179798B2 (en) * 2001-11-16 2007-02-20 Russell R. Roby Methods and compositions for the treatment of pain and other hormone-allergy-related symptoms using dilute hormone solutions
US20040014779A1 (en) * 2001-11-16 2004-01-22 3M Innovative Properties Company Methods and compositions related to IRM compounds and toll-like recptor pathways
US20050250716A1 (en) * 2001-12-07 2005-11-10 Intercell Ag Immunostimulatory oligodeoxynucleotides
US7615227B2 (en) * 2001-12-20 2009-11-10 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce angiogenesis
CA2365732A1 (en) * 2001-12-20 2003-06-20 Ibm Canada Limited-Ibm Canada Limitee Testing measurements
US8466116B2 (en) 2001-12-20 2013-06-18 The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce epithelial cell growth
CA2471092A1 (en) * 2001-12-21 2003-07-10 Antigenics Inc. Compositions comprising immunoreactive reagents and saponins, and methods of use thereof
JP2005526497A (en) * 2002-02-04 2005-09-08 ビオミラ,インコーポレーテッド Immunostimulatory, covalently lipidated oligonucleotide
US8088388B2 (en) * 2002-02-14 2012-01-03 United Biomedical, Inc. Stabilized synthetic immunogen delivery system
JP4646516B2 (en) 2002-02-20 2011-03-09 ノバルティス バクシンズ アンド ダイアグノスティックス,インコーポレーテッド Fine particles with adsorbed polypeptide-containing molecules
PT1478327E (en) * 2002-02-22 2015-08-04 Meda Ab Method of reducing and treating uvb-induced immunosuppression
US6923958B2 (en) * 2002-03-02 2005-08-02 The Scripps Research Institute DNA vaccines encoding CEA and a CD40 ligand and methods of use thereof
CA2479187A1 (en) * 2002-03-15 2003-09-25 Astral, Inc. Immunostimulatory double stranded rna and methods of inducing, enhancing or modulating the immune response
EP2258712A3 (en) 2002-03-15 2011-05-04 Multicell Immunotherapeutics, Inc. Compositions and Methods to Initiate or Enhance Antibody and Major-histocompatibility Class I or Class II-restricted T Cell Responses by Using Immunomodulatory, Non-coding RNA Motifs
NZ535754A (en) * 2002-03-15 2007-01-26 Wyeth Corp Mutants of the P4 protein of nontypable haemophilus influenzae with reduced enzymatic activity
US20030224013A1 (en) * 2002-04-19 2003-12-04 Cole Garry T. Methods for protection against Coccidioides spp. infection using Coccidioides spp. urea amidohydrolase (Ure) protein
US20040009943A1 (en) * 2002-05-10 2004-01-15 Inex Pharmaceuticals Corporation Pathogen vaccines and methods for using the same
US20040009944A1 (en) * 2002-05-10 2004-01-15 Inex Pharmaceuticals Corporation Methylated immunostimulatory oligonucleotides and methods of using the same
US20040013649A1 (en) * 2002-05-10 2004-01-22 Inex Pharmaceuticals Corporation Cancer vaccines and methods of using the same
US9045727B2 (en) 2002-05-17 2015-06-02 Emory University Virus-like particles, methods of preparation, and immunogenic compositions
US20060088909A1 (en) * 2002-05-17 2006-04-27 Compans Richard W Virus-like particles, methods of preparation, and immunogenic compositions
KR100456681B1 (en) * 2002-05-22 2004-11-10 주식회사 대웅 Immnune-stimulating and controlling Composition comprising bacterial chromosomal DNA fragments and detoxified lipopolysaccharides
CA2388049A1 (en) 2002-05-30 2003-11-30 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
BR0311995A (en) * 2002-06-20 2005-04-05 Cytos Biotechnology Ag Virus-like particles packaged for use as adjuvants: Method of preparation and use
CN1678188B (en) * 2002-07-03 2012-10-10 科勒制药集团有限公司 Nucleic acid compositions for stimulating immune responses
AU2003255969A1 (en) * 2002-07-17 2004-02-02 Coley Pharmaceutical Gmbh Use of cpg nucleic acids in prion-disease
US20060270620A1 (en) * 2002-07-23 2006-11-30 University Of South Florida Method of Enhancing Therapeutic Effect of Nucleic Acids
EP1523557A2 (en) 2002-07-24 2005-04-20 Intercell AG Antigens encoded by alternative reading frame from pathogenic viruses
EP1575504A4 (en) 2002-08-01 2009-11-04 Us Gov Health & Human Serv Method of treating inflammatory arthropathies with suppressors of cpg oligonucleotides
DK1545597T3 (en) 2002-08-15 2011-01-31 3M Innovative Properties Co Immune Stimulating Compositions and Methods for Stimulating an Immune Response
US7785608B2 (en) * 2002-08-30 2010-08-31 Wyeth Holdings Corporation Immunogenic compositions for the prevention and treatment of meningococcal disease
GB0220194D0 (en) 2002-08-30 2002-10-09 Chiron Spa Improved vesicles
US7595303B1 (en) * 2002-09-05 2009-09-29 University Of South Florida Genetic adjuvants for immunotherapy
US20050196382A1 (en) * 2002-09-13 2005-09-08 Replicor, Inc. Antiviral oligonucleotides targeting viral families
EP1537418A2 (en) 2002-09-13 2005-06-08 Intercell AG Method for isolating hepatitis c virus peptides
EP1537208A1 (en) * 2002-09-13 2005-06-08 Replicor, Inc. Non-sequence complementary antiviral oligonucleotides
US8263091B2 (en) * 2002-09-18 2012-09-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
US7301554B2 (en) * 2002-09-20 2007-11-27 Ricoh Company, Ltd. Light scanning device, scanning line adjusting method, scanning line adjusting control method, image forming apparatus, and image forming method
AU2003268737A1 (en) * 2002-10-02 2004-04-23 Mochida Pharmaceutical Co., Ltd. Novel method of constructing monoclonal antibody
US8043622B2 (en) 2002-10-08 2011-10-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides
BRPI0315228A8 (en) 2002-10-11 2018-04-03 Chiron Srl Polypeptide vaccines for broad protection against hypervirulent meningococcal strains
CA2503457A1 (en) * 2002-10-25 2004-05-06 University Of Connecticut Health Center Apparatus and method for immunotherapy of a cancer through controlled cell lysis
AU2003304107B2 (en) * 2002-11-01 2008-05-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of preventing infections from bioterrorism agents with immunostimulatory CpG oligonucleotides
WO2004044139A2 (en) * 2002-11-05 2004-05-27 Isis Parmaceuticals, Inc. Modified oligonucleotides for use in rna interference
WO2004046177A2 (en) 2002-11-15 2004-06-03 Chiron Srl Unexpected surface proteins in neisseria meningitidis
US8039443B2 (en) * 2002-11-21 2011-10-18 Archemix Corporation Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US10100316B2 (en) * 2002-11-21 2018-10-16 Archemix Llc Aptamers comprising CPG motifs
EP2298360A3 (en) * 2002-11-21 2011-07-13 Bayhill Therapeutics, Inc. Methods and immune modulatory nucleic acid compositions for preventing and treating disease
US8853376B2 (en) 2002-11-21 2014-10-07 Archemix Llc Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US20050124565A1 (en) * 2002-11-21 2005-06-09 Diener John L. Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
GB0227346D0 (en) 2002-11-22 2002-12-31 Chiron Spa 741
AU2003287316A1 (en) * 2002-12-11 2004-06-30 3M Innovative Properties Company Assays relating to toll-like receptor activity
WO2004052293A2 (en) * 2002-12-11 2004-06-24 Hawaii Biotech, Inc. Recombinant vaccine against flavivirus infection
WO2004053057A2 (en) * 2002-12-11 2004-06-24 3M Innovative Properties Company Gene expression systems and recombinant cell lines
US8158768B2 (en) 2002-12-23 2012-04-17 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
AU2003302743B2 (en) * 2002-12-23 2008-09-04 Dynavax Technologies Corporation Branched immunomodulatory compounds and methods of using the same
ATE544772T1 (en) 2002-12-23 2012-02-15 Dynavax Tech Corp IMMUNO-STIMULATING SEQUENCE OLIGONUCLEOTIDES AND METHOD OF USE THEREOF
CA2511512C (en) 2002-12-27 2013-10-29 Chiron Corporation Immunogenic compositions containing phospholipid
EP2572714A1 (en) 2002-12-30 2013-03-27 3M Innovative Properties Company Immunostimulatory Combinations
PT1587537E (en) 2003-01-30 2012-05-30 Novartis Ag Injectable vaccines against multiple meningococcal serogroups
US7354907B2 (en) * 2003-02-07 2008-04-08 Idera Pharmaceuticals, Inc. Short immunomodulatory oligonucleotides
EP1592302A4 (en) * 2003-02-13 2007-04-25 3M Innovative Properties Co Methods and compositions related to irm compounds and toll-like receptor 8
ATE491463T1 (en) 2003-02-20 2011-01-15 Univ Connecticut Health Ct METHOD FOR PRODUCING ALPHA (2) MACROGLOBULIN-ANTIGEN MOLECULE COMPLEXES
GB2398783A (en) 2003-02-26 2004-09-01 Antonio Lanzavecchia A method for producing immortalised human B memory lymphocytes
WO2004075865A2 (en) * 2003-02-27 2004-09-10 3M Innovative Properties Company Selective modulation of tlr-mediated biological activity
EP1601365A4 (en) 2003-03-04 2009-11-11 3M Innovative Properties Co Prophylactic treatment of uv-induced epidermal neoplasia
CN100439386C (en) * 2003-03-05 2008-12-03 长春华普生物技术有限公司 Deoxyoligonucleotide containing CpG single strand for strengthening immunological effect of Protein vaccine
ATE556711T1 (en) * 2003-03-13 2012-05-15 3M Innovative Properties Co METHOD FOR IMPROVING SKIN QUALITY
WO2004080292A2 (en) 2003-03-13 2004-09-23 3M Innovative Properties Company Method of tattoo removal
ES2562456T3 (en) 2003-03-24 2016-03-04 Valneva Austria Gmbh Use of an adjuvant that induces a Th1 immune response to improve immune responses
US20040192585A1 (en) 2003-03-25 2004-09-30 3M Innovative Properties Company Treatment for basal cell carcinoma
CA2520181A1 (en) * 2003-03-26 2004-10-14 Astral Inc. Selected rna motifs to include cell death and/or apoptosis
US20060210588A1 (en) * 2003-03-26 2006-09-21 Cytos Biotechnology Ag Hiv-peptide-carrier-conjugates
AU2004224761A1 (en) 2003-03-26 2004-10-07 Cytos Biotechnology Ag HIV-peptide-carrier-conjugates
US7537767B2 (en) 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
AU2004226605A1 (en) * 2003-04-02 2004-10-14 Coley Pharmaceutical Group, Ltd. Immunostimulatory nucleic acid oil-in-water formulations for topical application
US20040265351A1 (en) * 2003-04-10 2004-12-30 Miller Richard L. Methods and compositions for enhancing immune response
EP1617871A4 (en) * 2003-04-10 2010-10-06 3M Innovative Properties Co Delivery of immune response modifier compounds using metal-containing particulate support materials
US20060257852A1 (en) 2003-04-10 2006-11-16 Chiron Corporation Severe acute respiratory syndrome coronavirus
EP2623601B1 (en) 2003-04-21 2015-02-18 Archemix LLC Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
JP4673217B2 (en) * 2003-04-23 2011-04-20 由紀夫 佐藤 Methylated CpG polynucleotide
US20050250106A1 (en) * 2003-04-24 2005-11-10 David Epstein Gene knock-down by intracellular expression of aptamers
AU2004233851B2 (en) * 2003-04-25 2009-07-30 Novartis Vaccines And Diagnostics, Inc. Compositions comprising cationic microparticles and HCV E1E2 DNA and methods of use thereof
EP1617845A4 (en) * 2003-04-28 2006-09-20 3M Innovative Properties Co Compositions and methods for induction of opioid receptors
WO2004100965A1 (en) * 2003-05-15 2004-11-25 Japan Science And Technology Agency Immunostimulant
US8080642B2 (en) * 2003-05-16 2011-12-20 Vical Incorporated Severe acute respiratory syndrome DNA compositions and methods of use
ES2328697T5 (en) 2003-06-02 2017-07-25 Novartis Vaccines And Diagnostics, Inc. Immunogenic compositions based on microparticles comprising adsorbed toxoid and an antigen containing a polysaccharide
US7803386B2 (en) 2003-06-05 2010-09-28 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Poly-gamma-glutamic conjugates for eliciting immune responses directed against bacilli
ES2569927T3 (en) * 2003-06-11 2016-05-13 Idera Pharmaceuticals, Inc. Stabilized immunomodulatory oligonucleotides
KR20060031607A (en) * 2003-07-10 2006-04-12 사이토스 바이오테크놀로지 아게 Packaged virus-like particles
US20080039533A1 (en) * 2003-07-31 2008-02-14 3M Innovative Properties Company Bioactive Compositions Comprising Triazines
CA2534313C (en) * 2003-08-05 2013-03-19 3M Innovative Properties Company Formulations containing an immune response modifier
JP2007502288A (en) * 2003-08-12 2007-02-08 スリーエム イノベイティブ プロパティズ カンパニー Oxime-substituted imidazo-containing compounds
US20050065136A1 (en) * 2003-08-13 2005-03-24 Roby Russell R. Methods and compositions for the treatment of infertility using dilute hormone solutions
US20060035242A1 (en) 2004-08-13 2006-02-16 Michelitsch Melissa D Prion-specific peptide reagents
WO2005020902A2 (en) * 2003-08-21 2005-03-10 Cytokine Pharmasciences, Inc. Compositions and methods for treating and diagnosing irritable bowel syndrome
WO2005020912A2 (en) * 2003-08-25 2005-03-10 3M Innovative Properties Company Delivery of immune response modifier compounds
WO2005018574A2 (en) * 2003-08-25 2005-03-03 3M Innovative Properties Company Immunostimulatory combinations and treatments
AU2004268625B2 (en) * 2003-08-27 2011-03-31 3M Innovative Properties Company Aryloxy and arylalkyleneoxy substituted imidazoquinolines
EP1663222A4 (en) * 2003-09-02 2008-05-21 3M Innovative Properties Co Methods related to the treatment of mucosal associated conditions
JP2007504269A (en) * 2003-09-05 2007-03-01 スリーエム イノベイティブ プロパティズ カンパニー Method for treating CD5 + B cell lymphoma
US8541002B2 (en) 2003-09-12 2013-09-24 Agenus Inc. Vaccine for treatment and prevention of herpes simplex virus infection
GB0323103D0 (en) 2003-10-02 2003-11-05 Chiron Srl De-acetylated saccharides
ES2397923T3 (en) 2003-10-02 2013-03-12 Novartis Ag Liquid vaccines for multiple meningococcal serogroups
US20090075980A1 (en) * 2003-10-03 2009-03-19 Coley Pharmaceutical Group, Inc. Pyrazolopyridines and Analogs Thereof
US7544697B2 (en) * 2003-10-03 2009-06-09 Coley Pharmaceutical Group, Inc. Pyrazolopyridines and analogs thereof
ES2544477T3 (en) * 2003-10-03 2015-08-31 3M Innovative Properties Company Alkoxy substituted imidazoquinolines
WO2005034979A2 (en) * 2003-10-11 2005-04-21 Inex Pharmaceuticals Corporation Methods and compositions for enhancing innate immunity and antibody dependent cellular cytotoxicity
GB0323965D0 (en) * 2003-10-13 2003-11-19 Glaxosmithkline Biolog Sa Immunogenic compositions
WO2005041891A2 (en) * 2003-10-31 2005-05-12 3M Innovative Properties Company Neutrophil activation by immune response modifier compounds
CA2545774A1 (en) 2003-11-14 2005-06-02 3M Innovative Properties Company Oxime substituted imidazo ring compounds
EP1682544A4 (en) * 2003-11-14 2009-05-06 3M Innovative Properties Co Hydroxylamine substituted imidazo ring compounds
NZ547467A (en) * 2003-11-25 2010-06-25 3M Innovative Properties Co Substituted imidazo ring system and methods
US20050287118A1 (en) * 2003-11-26 2005-12-29 Epitomics, Inc. Bacterial plasmid with immunological adjuvant function and uses thereof
US20050277127A1 (en) * 2003-11-26 2005-12-15 Epitomics, Inc. High-throughput method of DNA immunogen preparation and immunization
US20050226878A1 (en) * 2003-12-02 2005-10-13 3M Innovative Properties Company Therapeutic combinations and methods including IRM compounds
WO2005055932A2 (en) * 2003-12-02 2005-06-23 3M Innovative Properties Company Therapeutic combinations and methods including irm compounds
US9090673B2 (en) 2003-12-12 2015-07-28 City Of Hope Synthetic conjugate of CpG DNA and T-help/CTL peptide
HUE026000T2 (en) 2003-12-17 2016-04-28 Wyeth Llc Immunogenic peptide carrier conjugates and methods of producing same
EP2336147B1 (en) 2003-12-17 2014-04-30 Janssen Alzheimer Immunotherapy A beta immunogenic peptide carrier conjugates and methods of producing same
JP4817599B2 (en) * 2003-12-25 2011-11-16 独立行政法人科学技術振興機構 Immune activity enhancer and method for enhancing immune activity using the same
JP2007517035A (en) * 2003-12-29 2007-06-28 スリーエム イノベイティブ プロパティズ カンパニー Arylalkenyl and arylalkynyl substituted imidazoquinolines
EP1699788A2 (en) * 2003-12-30 2006-09-13 3M Innovative Properties Company Imidazoquinolinyl, imidazopyridinyl and imidazonaphthyridinyl sulfonamides
EP1699398A4 (en) * 2003-12-30 2007-10-17 3M Innovative Properties Co Enhancement of immune responses
KR100558851B1 (en) * 2004-01-08 2006-03-10 학교법인연세대학교 Modified CpG oligodeoxynucleotide with improved immunoregulatory function
US7973016B2 (en) * 2004-01-23 2011-07-05 Joslin Diebetes Center Methods of treating, reducing, or preventing autoimmune conditions
US20050181035A1 (en) * 2004-02-17 2005-08-18 Dow Steven W. Systemic immune activation method using non CpG nucleic acids
WO2005080567A1 (en) * 2004-02-20 2005-09-01 Mologen Ag Substituted, non-coding nucleic acid molecule used for the therapeutic and prophylactic immune stimulation in humans and higher animals
US20060193821A1 (en) * 2004-03-05 2006-08-31 Diener John L Aptamers to the human IL-12 cytokine family and their use as autoimmune disease therapeutics
US8569474B2 (en) 2004-03-09 2013-10-29 Isis Pharmaceuticals, Inc. Double stranded constructs comprising one or more short strands hybridized to a longer strand
JP5600375B2 (en) 2004-03-09 2014-10-01 ノバルティス バクシンズ アンド ダイアグノスティックス,インコーポレーテッド Influenza virus vaccine
WO2005090968A1 (en) * 2004-03-16 2005-09-29 Inist Inc. Tat-based immunomodulatory compositions and methods of their discovery and use
US7820175B2 (en) 2004-03-19 2010-10-26 Herbal Spring, Llc Herbal therapy for the treatment of food allergy
US8697873B2 (en) * 2004-03-24 2014-04-15 3M Innovative Properties Company Amide substituted imidazopyridines, imidazoquinolines, and imidazonaphthyridines
TWI235440B (en) * 2004-03-31 2005-07-01 Advanced Semiconductor Eng Method for making leadless semiconductor package
JP2007531746A (en) * 2004-04-02 2007-11-08 コーリー ファーマシューティカル グループ,インコーポレイテッド Immunostimulatory nucleic acid for inducing an IL-10 response
US20050260755A1 (en) * 2004-04-06 2005-11-24 Isis Pharmaceuticals, Inc. Sequential delivery of oligomeric compounds
WO2005105106A2 (en) * 2004-04-21 2005-11-10 Roby Russell R Hormone treatment of macular degeneration
US20050239758A1 (en) * 2004-04-21 2005-10-27 Roby Russell R Hormone treatment of multiple sclerosis
US7579450B2 (en) * 2004-04-26 2009-08-25 Archemix Corp. Nucleic acid ligands specific to immunoglobulin E and their use as atopic disease therapeutics
CN101426524A (en) * 2004-04-28 2009-05-06 3M创新有限公司 Compositions and methods for mucosal vaccination
GB0409745D0 (en) 2004-04-30 2004-06-09 Chiron Srl Compositions including unconjugated carrier proteins
PT1740217E (en) 2004-04-30 2011-08-02 Novartis Ag Meningococcal conjugate vaccination
GB0500787D0 (en) 2005-01-14 2005-02-23 Chiron Srl Integration of meningococcal conjugate vaccination
EP1751612B1 (en) * 2004-05-06 2009-02-25 The Government of the United States of America, as represented by the Secretary of the Department of Health and Human Services Methods and compositions for the treatment of uveitis
GB0410220D0 (en) 2004-05-07 2004-06-09 Kirkham Lea Ann Mutant pneumolysin proteins
GB0410866D0 (en) 2004-05-14 2004-06-16 Chiron Srl Haemophilius influenzae
CN1296378C (en) * 2004-05-17 2007-01-24 中国人民解放军第三军医大学 CpG-N ODN gene sequence with high immunological activity CpG-S ODN and antagonism CpG-N ODN and use thereof
EP1766094A4 (en) * 2004-05-18 2009-11-25 Vical Inc Influenza virus vaccine composition and method of use
WO2006078294A2 (en) 2004-05-21 2006-07-27 Novartis Vaccines And Diagnostics Inc. Alphavirus vectors for respiratory pathogen vaccines
MXPA06013448A (en) 2004-05-21 2007-01-23 Wyeth Corp Altered fibronectin-binding protein of staphylococcus aureus.
US20050267145A1 (en) * 2004-05-28 2005-12-01 Merrill Bryon A Treatment for lung cancer
DK1765310T3 (en) 2004-05-28 2016-01-11 Oryxe MIXING for transdermal delivery of LAV AND HØJMOLEKYLVÆGTFORBINDELSER
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
AU2005326144A1 (en) * 2004-06-08 2006-08-03 Coley Pharmaceutical Gmbh Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
WO2005123080A2 (en) * 2004-06-15 2005-12-29 3M Innovative Properties Company Nitrogen-containing heterocyclyl substituted imidazoquinolines and imidazonaphthyridines
TW200613554A (en) 2004-06-17 2006-05-01 Wyeth Corp Plasmid having three complete transcriptional units and immunogenic compositions for inducing an immune response to HIV
WO2006009832A1 (en) * 2004-06-18 2006-01-26 3M Innovative Properties Company Substituted imidazo ring systems and methods
WO2006065280A2 (en) * 2004-06-18 2006-06-22 3M Innovative Properties Company Isoxazole, dihydroisoxazole, and oxadiazole substituted imidazo ring compounds and methods
US8026366B2 (en) * 2004-06-18 2011-09-27 3M Innovative Properties Company Aryloxy and arylalkyleneoxy substituted thiazoloquinolines and thiazolonaphthyridines
WO2006038923A2 (en) * 2004-06-18 2006-04-13 3M Innovative Properties Company Aryl substituted imidazonaphthyridines
US7482158B2 (en) * 2004-07-01 2009-01-27 Mathison Brian H Composite polynucleic acid therapeutics
JP2008506789A (en) * 2004-07-18 2008-03-06 シーエスエル、リミテッド Immunostimulatory complex and oligonucleotide formulation for inducing enhanced interferon-gamma response
US20060025390A1 (en) * 2004-07-28 2006-02-02 Roby Russell R Treatment of hormone allergy and related symptoms and disorders
EP2612679A1 (en) 2004-07-29 2013-07-10 Novartis Vaccines and Diagnostics, Inc. Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
ES2534288T3 (en) 2004-08-03 2015-04-21 Innate Pharma Therapeutic compositions against cancer that target 4Ig-B7-H3
US20060045886A1 (en) * 2004-08-27 2006-03-02 Kedl Ross M HIV immunostimulatory compositions
WO2006026760A2 (en) * 2004-09-02 2006-03-09 3M Innovative Properties Company 1-amino imidazo-containing compounds and methods
US7884086B2 (en) * 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays
PT1791858E (en) 2004-09-24 2010-07-26 Intercell Ag Modified vp1-capsid protein of parvovirus b19
JP2008000001A (en) * 2004-09-30 2008-01-10 Osaka Univ Immune stimulating oligonucleotide and use in pharmaceutical
KR101376889B1 (en) 2004-10-06 2014-03-25 메디뮨 엘엘씨 Refrigerator-temperature stable influenza vaccine compositions
AU2005294129B2 (en) 2004-10-08 2010-12-23 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention Modulation of replicative fitness by using less frequently used synonymous codons
US20070243215A1 (en) * 2004-10-08 2007-10-18 Miller Richard L Adjuvant for Dna Vaccines
WO2007001423A2 (en) 2004-10-21 2007-01-04 Wyeth Immunogenic compositions of staphylococcus epidermidis polypeptide and polynucleotide antigens
GB0424092D0 (en) 2004-10-29 2004-12-01 Chiron Srl Immunogenic bacterial vesicles with outer membrane proteins
EP2436391A3 (en) 2004-11-02 2012-07-04 Archemix LLC Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US7332324B2 (en) 2004-12-03 2008-02-19 University Of Toledo Attenuated vaccine useful for immunizations against Coccidioides spp. infections
WO2006063072A2 (en) * 2004-12-08 2006-06-15 3M Innovative Properties Company Immunomodulatory compositions, combinations and methods
WO2006065751A2 (en) * 2004-12-13 2006-06-22 Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Cpg oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
WO2006073760A2 (en) 2004-12-17 2006-07-13 Dana-Farber Cancer Institute, Inc. Regulation of mink in thymocytes and t lymphocytes
CA2592922A1 (en) * 2004-12-29 2006-07-06 Mannkind Corporation Methods to trigger, maintain and manipulate immune responses by targeted administration of biological response modifiers into lymphoid organs
US8034938B2 (en) 2004-12-30 2011-10-11 3M Innovative Properties Company Substituted chiral fused [1,2]imidazo[4,5-c] ring compounds
WO2006071997A2 (en) 2004-12-30 2006-07-06 3M Innovative Properties Company Treatment for cutaneous metastases
ES2392647T3 (en) * 2004-12-30 2012-12-12 3M Innovative Properties Company Chiral tetracyclic compounds that induce interferon biosynthesis
LT2682126T (en) 2005-01-27 2017-02-27 Children`s Hospital & Research Center at Oakland GNA1870-based vesicle vaccines for broad spectrum protection against diseases caused by Neisseria meningitidis
JP4836145B2 (en) * 2005-01-28 2011-12-14 クウォン,ヒュン−ジョ Oligonucleotide derived from mycobacteria for immune function stimulation, immune disease treatment, atopic dermatitis treatment and / or normal immune cell protection
GB0502095D0 (en) 2005-02-01 2005-03-09 Chiron Srl Conjugation of streptococcal capsular saccharides
WO2006084251A2 (en) 2005-02-04 2006-08-10 Coley Pharmaceutical Group, Inc. Aqueous gel formulations containing immune reponse modifiers
US7968563B2 (en) 2005-02-11 2011-06-28 3M Innovative Properties Company Oxime and hydroxylamine substituted imidazo[4,5-c] ring compounds and methods
US8062644B2 (en) 2005-02-18 2011-11-22 Novartis Vaccines & Diagnostics Srl. Immunogens from uropathogenic Escherichia coli
PL2351772T3 (en) 2005-02-18 2017-01-31 Glaxosmithkline Biologicals Sa Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli
JP2008531722A (en) 2005-03-04 2008-08-14 ダイナバックス テクノロジーズ コーポレイション Composition comprising a structurally stable conjugate molecule
US8101345B1 (en) 2005-03-25 2012-01-24 Isis Pharmaceuticals, Inc. Proinflammatory nucleic acids
AU2006232375A1 (en) 2005-04-01 2006-10-12 Coley Pharmaceutical Group, Inc. 1-substituted pyrazolo (3,4-c) ring compounds as modulators of cytokine biosynthesis for the treatment of viral infections and neoplastic diseases
EP1869043A2 (en) 2005-04-01 2007-12-26 Coley Pharmaceutical Group, Inc. Pyrazolopyridine-1,4-diamines and analogs thereof
CN113198013B (en) 2005-04-08 2024-02-20 惠氏有限责任公司 Multivalent pneumococcal polysaccharide-protein conjugate composition
JP2008535862A (en) * 2005-04-08 2008-09-04 キメリクス,インコーポレイテッド Compounds, compositions and methods for the treatment of poxvirus infections
WO2006110656A2 (en) * 2005-04-08 2006-10-19 Chimerix, Inc. Compounds, compositions and methods for the treatment of viral infections and other medical disorders
US7709001B2 (en) 2005-04-08 2010-05-04 Wyeth Llc Multivalent pneumococcal polysaccharide-protein conjugate composition
CA2604683C (en) 2005-04-12 2019-04-30 Duke University Method of inducing neutralizing antibodies to human immunodeficiency virus
EP2329843A3 (en) 2005-04-18 2011-09-14 Novartis Vaccines and Diagnostics, Inc. Expressing Hepatitis B Virus surface antigen for vaccine preparation
US20080193474A1 (en) * 2005-04-25 2008-08-14 Griesgraber George W Immunostimulatory Compositions
US20090075342A1 (en) * 2005-04-26 2009-03-19 Sharon Cload Metabolic profile directed aptamer medicinal chemistry
CN101238145B (en) 2005-06-14 2013-04-24 普罗陶克斯有限公司 Use of modified pore-forming proteins in preparing medicine for treating or preventing benign prostatic hyperplasia
MX2007016561A (en) 2005-06-30 2008-03-10 Archemix Corp Materials and methods for the generation of fully 2'-modified nucleic acid transcripts.
US8101385B2 (en) 2005-06-30 2012-01-24 Archemix Corp. Materials and methods for the generation of transcripts comprising modified nucleotides
ES2450593T3 (en) 2005-07-01 2014-03-25 Index Pharmaceuticals Ab Immunostimulant method
PL2179737T3 (en) 2005-07-01 2014-01-31 Index Pharmaceuticals Ab Modulating responsiveness to steroids
WO2007008904A2 (en) * 2005-07-08 2007-01-18 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Targeting poly-gamma-glutamic acid to treat staphylococcus epidermidis and related infections
EP2614709A1 (en) 2005-07-18 2013-07-17 Novartis AG Small animal model for HCV replication
WO2007012285A1 (en) * 2005-07-28 2007-02-01 Changchun Huapu Biotechnology Co., Ltd. Viral infection resistent single strand deoxynucleosides
WO2007041190A2 (en) * 2005-09-30 2007-04-12 The University Of Iowa Research Foundation Polymer-based delivery system for immunotherapy of cancer
WO2007047749A1 (en) 2005-10-18 2007-04-26 Novartis Vaccines And Diagnostics Inc. Mucosal and systemic immunizations with alphavirus replicon particles
CA2625969A1 (en) 2005-10-28 2007-05-03 Index Pharmaceuticals Ab Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease
PT2368572T (en) 2005-11-04 2020-06-16 Seqirus Uk Ltd Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture
AU2006310339B2 (en) 2005-11-04 2013-01-10 Novartis Ag Influenza vaccines including combinations of particulate adjuvants and immunopotentiators
EP1951302A2 (en) 2005-11-04 2008-08-06 Novartis Vaccines and Diagnostics S.r.l. Influenza vaccine with reduced amount of oil-in-water emulsion as adjuvant
CN102755645A (en) 2005-11-04 2012-10-31 诺华疫苗和诊断有限公司 Influenza vaccines with reduced amount of emulsion adjuvant
CN102864152B (en) * 2005-11-07 2015-11-18 艾德拉药物股份有限公司 Comprise the immunostimulatory properties of the compound based on oligonucleotide of modified immunostimulating dinucleotides
JP5215865B2 (en) 2005-11-22 2013-06-19 ノバルティス ヴァクシンズ アンド ダイアグノスティクス インコーポレイテッド Norovirus and sapovirus antigens
GB0524066D0 (en) 2005-11-25 2006-01-04 Chiron Srl 741 ii
US20070184068A1 (en) 2005-12-14 2007-08-09 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
WO2007085969A2 (en) 2006-01-27 2007-08-02 Novartis Vaccines And Diagnostics Gmbh & Co Kg Influenza vaccines containing hemagglutinin and matrix proteins
EP1988896A4 (en) * 2006-02-22 2011-07-27 3M Innovative Properties Co Immune response modifier conjugates
BRPI0708912B8 (en) 2006-03-14 2021-07-27 Univ Oregon Health & Science in vitro methods for detecting mycobacterium tuberculosis and cd8 expressing t cells that specifically recognize seq id no: 11 in an individual
ES2388556T3 (en) * 2006-03-23 2012-10-16 Novartis Ag Immunopotentiating compounds
EP2357184B1 (en) 2006-03-23 2015-02-25 Novartis AG Imidazoquinoxaline compounds as immunomodulators
CA2646349A1 (en) 2006-03-24 2007-10-04 Novartis Vaccines And Diagnostics Gmbh & Co Kg Storage of influenza vaccines without refrigeration
WO2007126825A2 (en) 2006-03-31 2007-11-08 Novartis Ag Combined mucosal and parenteral immunization against hiv
WO2007119815A1 (en) 2006-04-14 2007-10-25 Kyowa Hakko Kirin Co., Ltd. Toll-like receptor 9 agonists
TW200806315A (en) 2006-04-26 2008-02-01 Wyeth Corp Novel formulations which stabilize and inhibit precipitation of immunogenic compositions
CN101460620B (en) 2006-05-31 2012-02-15 东丽株式会社 Immunostimulatory oligonucleotide and pharmaceutical application thereof
ATE522541T1 (en) 2006-06-09 2011-09-15 Novartis Ag BACTERIAL ADHESIN CONFORMERS
SG172696A1 (en) 2006-06-12 2011-07-28 Cytos Biotechnology Ag Processes for packaging oligonucleotides into virus-like particles of rna bacteriophages
BRPI0713711A2 (en) 2006-06-20 2012-10-30 Transgene Sa recombinant viral vaccine, vaccination kit, and method for using at least one compound
US8153116B2 (en) 2006-07-11 2012-04-10 University Of Connecticut Use of conditional plasmodium strains lacking an essential gene in malaria vaccination
WO2008094183A2 (en) * 2006-07-11 2008-08-07 University Of Connecticut Use of conditional plasmodium strains lacking nutrient transporters in malaria vaccination
WO2008008432A2 (en) * 2006-07-12 2008-01-17 Coley Pharmaceutical Group, Inc. Substituted chiral fused( 1,2) imidazo (4,5-c) ring compounds and methods
GB0614460D0 (en) 2006-07-20 2006-08-30 Novartis Ag Vaccines
EP2586790A3 (en) 2006-08-16 2013-08-14 Novartis AG Immunogens from uropathogenic Escherichia coli
ES2536401T3 (en) 2006-09-11 2015-05-25 Novartis Ag Making vaccines against influenza viruses without using eggs
DE102006050655A1 (en) * 2006-10-24 2008-04-30 Halmon Beheer B.V. Pharmaceutical composition useful for treating allergic diseases comprises RNA and an allergen
US20100144846A1 (en) * 2006-10-26 2010-06-10 Coley Pharmaceutical Gmbh Oligoribonucleotides and uses thereof
EP3564674B1 (en) 2006-11-01 2021-08-25 Ventana Medical Systems, Inc. Haptens, hapten conjugates, compositions thereof and method for their preparation and use
US8252757B2 (en) * 2006-11-09 2012-08-28 Dynavax Technologies Corporation Long term disease modification using immunostimulatory oligonucleotides
WO2008140571A2 (en) * 2006-11-15 2008-11-20 Functional Genetics, Inc. Methods and compositions for treating influenza
EP2679240A1 (en) 2006-12-06 2014-01-01 Novartis AG Vaccines including antigen from four strains of influenza virus
AR064642A1 (en) 2006-12-22 2009-04-15 Wyeth Corp POLINUCLEOTIDE VECTOR THAT INCLUDES IT RECOMBINATING CELL THAT UNDERSTANDS THE VECTOR POLYPEPTIDE, ANTIBODY, COMPOSITION THAT UNDERSTANDS THE POLINUCLEOTIDE, VECTOR, RECOMBINATING CELL POLYPEPTIDE OR ANTIBODY, USE OF THE COMPOSITION AND A COMPOSITION AND A METHOD
US20080149123A1 (en) 2006-12-22 2008-06-26 Mckay William D Particulate material dispensing hairbrush with combination bristles
GB0700562D0 (en) 2007-01-11 2007-02-21 Novartis Vaccines & Diagnostic Modified Saccharides
JP5596980B2 (en) 2007-02-28 2014-10-01 アメリカ合衆国 Brachyury polypeptides and methods of use
CA2683752A1 (en) * 2007-04-13 2008-10-23 Duke University Method of inducing neutralizing antibodies to human immunodeficiency virus
US8518903B2 (en) 2007-04-19 2013-08-27 University of Pittsburgh—of the Commonwealth System of Higher Education Use of toll-like receptor-9 agonists
EP2377952A1 (en) 2007-04-26 2011-10-19 Ludwig Institute For Cancer Research Methods for diagnosing and treating astrocytomas
MX2009012482A (en) * 2007-05-17 2009-12-02 Coley Pharm Group Inc Class a oligonucleotides with immunostimulatory potency.
DK2170353T3 (en) * 2007-05-18 2015-07-27 Adiutide Pharmaceuticals Gmbh The phosphate-modified oligonucleotide analogs with immunostimulatory activity
CA2687178C (en) * 2007-05-23 2014-02-04 Ventana Medical Systems, Inc. Polymeric carriers for immunohistochemistry and in situ hybridization
TW200911304A (en) * 2007-05-24 2009-03-16 Glaxosmithkline Biolog Sa Lyophillised antigen composition
WO2009001217A2 (en) 2007-06-27 2008-12-31 Novartis Ag Low-additive influenza vaccines
GB0713880D0 (en) * 2007-07-17 2007-08-29 Novartis Ag Conjugate purification
GB0714963D0 (en) 2007-08-01 2007-09-12 Novartis Ag Compositions comprising antigens
US7879812B2 (en) 2007-08-06 2011-02-01 University Of Iowa Research Foundation Immunomodulatory oligonucleotides and methods of use therefor
CN101835487A (en) * 2007-08-21 2010-09-15 戴纳瓦克斯技术公司 Composition and methods of making and using influenza proteins
WO2009034473A2 (en) 2007-09-12 2009-03-19 Novartis Ag Gas57 mutant antigens and gas57 antibodies
CN101820908A (en) * 2007-10-09 2010-09-01 科利制药公司 The immune stimulatory oligonucleotide analogs that comprises modified sugar moieties
US20110014231A1 (en) * 2007-11-05 2011-01-20 Mor Research Applications Ltd Anti-measles cancer immunotherapy
WO2010008411A1 (en) 2007-11-09 2010-01-21 The Salk Institute For Biological Studies Use of tam receptor inhibitors as immunoenhancers and tam activators as immunosuppressors
GB0810305D0 (en) 2008-06-05 2008-07-09 Novartis Ag Influenza vaccination
WO2009076158A1 (en) 2007-12-07 2009-06-18 Novartis Ag Compositions for inducing immune responses
GB0818453D0 (en) 2008-10-08 2008-11-12 Novartis Ag Fermentation processes for cultivating streptococci and purification processes for obtaining cps therefrom
EP2235046B1 (en) 2007-12-21 2012-08-01 Novartis AG Mutant forms of streptolysin o
PE20091104A1 (en) * 2007-12-21 2009-07-18 Wyeth Corp GENETICALLY MODIFIED ATTENUATED VESICULAR STOMATITIS VIRUS, COMPOSITIONS AND METHODS OF USE OF THE SAME
CN102670628B (en) * 2008-01-25 2015-11-25 奇默里克斯公司 The method for the treatment of viral infection
DK2176408T5 (en) * 2008-01-31 2015-12-14 Curevac Gmbh Nucleic acids comprising FORMULA (NuGiXmGnNv) a AND DERIVATIVES AS IMMUNE STIMULATING AGENTS / ADJUVANTS.
ES2532946T3 (en) 2008-02-21 2015-04-06 Novartis Ag Meningococcal PUfH polypeptides
US9511131B2 (en) 2008-03-10 2016-12-06 Children's Hospital & Research Center Oakland Chimeric factor H binding proteins (fHBP) containing a heterologous B domain and methods of use
EP3459563A1 (en) 2008-03-18 2019-03-27 Seqirus UK Limited Improvements in preparation of influenza virus vaccine antigens
US8815817B2 (en) * 2008-05-15 2014-08-26 Dynavax Technologies Corporation Long term disease modification using immunostimulatory oligonucleotides
US8222225B2 (en) 2008-05-21 2012-07-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating pneumoconiosis with oligodeoxynucleotides
US8703490B2 (en) 2008-06-05 2014-04-22 Ventana Medical Systems, Inc. Compositions comprising nanomaterials and method for using such compositions for histochemical processes
MX2010014358A (en) 2008-06-20 2011-07-04 Wyeth Llc Compositions and methods of use of orf1358 from beta-hemolytic streptococcal strains.
CA2960734C (en) 2008-06-27 2021-08-24 Zoetis Services Llc Adjuvants containing saponins, sterols and quaternary amines
TWI351288B (en) * 2008-07-04 2011-11-01 Univ Nat Pingtung Sci & Tech Cpg dna adjuvant in avian vaccines
US20110136897A1 (en) * 2008-08-14 2011-06-09 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Toll-like receptor 9 agonists for the treatment of anxiety-related disorders and inflammatory disorders
EP3301116A1 (en) 2008-08-25 2018-04-04 Dana Farber Cancer Institute, Inc. Conserved influenza hemagglutinin epitope and antibodies thereto
EP2331127A2 (en) 2008-09-18 2011-06-15 Novartis AG Vaccine adjuvant combinations
EP2385371B1 (en) 2008-09-22 2014-10-22 Oregon Health and Science University Methods for detecting a mycobacterium tuberculosis infection
HUE028497T2 (en) * 2008-10-16 2016-12-28 The Univ Of Saskatchewan Combination adjuvant formulation
US8691502B2 (en) 2008-10-31 2014-04-08 Tremrx, Inc. T-cell vaccination with viral vectors via mechanical epidermal disruption
JP2012508174A (en) * 2008-11-05 2012-04-05 ワイス・エルエルシー Multi-component immunogenic composition for preventing β-hemolytic streptococci (BHS) disease
EP2346529B1 (en) 2008-11-12 2016-02-10 Theraclone Sciences, Inc. Human m2e peptide immunogens
RU2015151857A (en) 2008-12-02 2019-01-15 Уэйв Лайф Сайенсес Джапан, Инк. METHOD FOR SYNTHESIS OF NUCLEIC ACIDS MODIFIED BY PHOSPHOR ATOMIC
PE20142330A1 (en) 2008-12-09 2015-01-14 Pfizer Vaccines Llc IGE CH3 PEPTIDE VACCINE
CN102333538B (en) 2008-12-09 2014-01-15 科勒制药集团有限公司 Immunostimulatory oligonucleotides
US8552165B2 (en) * 2008-12-09 2013-10-08 Heather Davis Immunostimulatory oligonucleotides
BRPI1005670A8 (en) 2009-01-05 2017-12-26 Epitogenesis Inc adjuvant compositions and processes of use.
US20100233270A1 (en) 2009-01-08 2010-09-16 Northwestern University Delivery of Oligonucleotide-Functionalized Nanoparticles
CN103897045A (en) 2009-01-12 2014-07-02 诺华股份有限公司 Cna_b domain antigens in vaccines against gram positive bacteria
WO2010099472A2 (en) 2009-02-27 2010-09-02 The U.S.A. Of America, As Represented By The Secretary, Department Of Health And Human Services Spanx-b polypeptides and their use
EP2403526B1 (en) 2009-03-06 2019-05-15 GlaxoSmithKline Biologicals SA Chlamydia antigens
WO2010111292A1 (en) 2009-03-23 2010-09-30 Nanirx, Inc. Treatment of cancer with immunostimulatory hiv tat derivative polypeptides
SI2411048T1 (en) 2009-03-24 2020-08-31 Glaxosmithkline Biologicals Sa Adjuvanting meningococcal factor h binding protein
CN102439153B (en) 2009-03-25 2015-07-22 德克萨斯大学系统董事会 Compositions for stimulation of mammalian innate immune resistance to pathogens
US9402917B2 (en) 2009-04-03 2016-08-02 Duke University Methods for the induction of broadly anti-HIV-1 neutralizing antibody responses employing liposome-MPER peptide compositions
WO2010115118A2 (en) 2009-04-03 2010-10-07 Antigenics, Inc. Methods for preparing and using multichaperone-antigen complexes
MX363222B (en) 2009-04-14 2019-03-15 Novartis Ag Compositions for immunising against staphylococcus aerus.
KR20120022984A (en) * 2009-04-21 2012-03-12 셀렉타 바이오사이언시즈, 인크. Immunonanotherapeutics providing a th1-biased response
CA2757620C (en) 2009-04-30 2016-04-26 Coley Pharmaceutical Group, Inc. Pneumococcal vaccine and uses thereof
EA201791383A1 (en) 2009-05-27 2018-06-29 Селекта Байосайенсиз, Инк. NANOSEELS HAVE COMPONENTS WITH DIFFERENT RELEASE RATES
CN102802665B (en) 2009-06-15 2015-11-25 新加坡国立大学 Influenza vaccines, compositions and using method
TW201544119A (en) 2009-06-22 2015-12-01 Wyeth Llc Compositions and methods for preparing staphylococcus aureus serotype 5 and 8 capsular polysaccharide conjugate immunogenic compositions
PE20110023A1 (en) 2009-06-22 2011-01-31 Wyeth Llc IMMUNOGENIC COMPOSITIONS OF STAPHYLOCOCCUS AUREUS ANTIGENS
RU2612521C2 (en) 2009-07-06 2017-03-09 Онтории, Инк. Novel prodrugs of nucleic acids and their application methods
TW201116294A (en) 2009-07-15 2011-05-16 Novartis Ag RSV F protein compositions and methods for making same
PT2464658E (en) 2009-07-16 2015-01-14 Novartis Ag Detoxified escherichia coli immunogens
KR101346197B1 (en) 2009-07-17 2014-02-06 한림대학교 산학협력단 Immunostimulatory Compositions Comprising Liposome―Encapsulated Oligonucleotides and Epitopes
US8614200B2 (en) 2009-07-21 2013-12-24 Chimerix, Inc. Compounds, compositions and methods for treating ocular conditions
MX2012001194A (en) 2009-07-30 2012-03-07 Pfizer Vaccines Llc Antigenic tau peptides and uses thereof.
US20110033515A1 (en) * 2009-08-04 2011-02-10 Rst Implanted Cell Technology Tissue contacting material
IN2012DN01984A (en) * 2009-08-18 2015-07-24 Baxter Int
US8598327B2 (en) 2009-08-18 2013-12-03 Baxter International Inc. Aptamers to tissue factor pathway inhibitor and their use as bleeding disorder therapeutics
CN107617110A (en) 2009-08-26 2018-01-23 西莱克塔生物科技公司 The composition of inducing T cell auxiliary
US8858958B2 (en) 2009-08-27 2014-10-14 Novartis Ag Adjuvant comprising aluminum, oligonucleotide and polycation
CN102596240B (en) 2009-08-27 2015-02-04 诺华股份有限公司 Hybrid polypeptides including meningococcal fHBP sequences
WO2011026111A1 (en) 2009-08-31 2011-03-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Oral delivery of a vaccine to the large intestine to induce mucosal immunity
NO2473605T3 (en) 2009-09-03 2018-09-08
JP2013504556A (en) 2009-09-10 2013-02-07 ノバルティス アーゲー Combination vaccine for respiratory tract disease
GB0917002D0 (en) 2009-09-28 2009-11-11 Novartis Vaccines Inst For Global Health Srl Improved shigella blebs
GB0917003D0 (en) 2009-09-28 2009-11-11 Novartis Vaccines Inst For Global Health Srl Purification of bacterial vesicles
CN102596254B (en) 2009-09-30 2016-10-19 诺华股份有限公司 Staphylococcus aureus 5 type and the coupling of CP8
CA2776004A1 (en) 2009-09-30 2011-04-07 Novartis Ag Expression of meningococcal fhbp polypeptides
CN102782138A (en) 2009-10-07 2012-11-14 Uvic工业合伙公司 Vaccines comprising heat-sensitive transgenes
WO2011047340A1 (en) 2009-10-16 2011-04-21 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Insertion of foreign genes in rubella virus and their stable expression in a live, attenuated viral vaccine
GB0918392D0 (en) 2009-10-20 2009-12-02 Novartis Ag Diagnostic and therapeutic methods
WO2011051893A1 (en) 2009-10-27 2011-05-05 Novartis Ag Modified meningococcal fhbp polypeptides
GB0919690D0 (en) 2009-11-10 2009-12-23 Guy S And St Thomas S Nhs Foun compositions for immunising against staphylococcus aureus
EP3360566B1 (en) 2009-11-20 2019-12-25 Oregon Health&Science University Methods for detecting a mycobacterium tuberculosis infection
SG10201408505SA (en) 2009-12-22 2015-02-27 Celldex Therapeutics Inc Vaccine compositions
AU2011216243B2 (en) 2010-02-12 2015-07-09 Chimerix, Inc. Nucleoside phosphonate salts
GB201003333D0 (en) 2010-02-26 2010-04-14 Novartis Ag Immunogenic proteins and compositions
US8685416B2 (en) 2010-03-02 2014-04-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for the treatment of cancer
EP2542670A2 (en) 2010-03-05 2013-01-09 President and Fellows of Harvard College Induced dendritic cell compositions and uses thereof
WO2011112599A2 (en) 2010-03-12 2011-09-15 The United States Of America, As Represented By The Secretary. Department Of Health & Human Services Immunogenic pote peptides and methods of use
WO2012020326A1 (en) 2010-03-18 2012-02-16 Novartis Ag Adjuvanted vaccines for serogroup b meningococcus
AU2011238670B2 (en) 2010-03-30 2015-04-23 Children's Hospital & Research Center Oakland Factor H binding proteins (FHBP) with altered properties and methods of use thereof
GB201005625D0 (en) 2010-04-01 2010-05-19 Novartis Ag Immunogenic proteins and compositions
EP2556151A1 (en) 2010-04-07 2013-02-13 Novartis AG Method for generating a parvovirus b19 virus-like particle
CA2796314A1 (en) 2010-04-13 2011-10-20 Novartis Ag Benzonapthyridine compositions and uses thereof
AU2011248620B2 (en) 2010-04-26 2015-11-26 Chimerix, Inc. Methods of treating retroviral infections and related dosage regimes
PT2772265T (en) 2010-05-14 2018-04-20 Univ Oregon Health & Science Recombinant hcmv and rhcmv vectors and uses thereof
NO2575876T3 (en) 2010-05-26 2018-05-05
WO2011149564A1 (en) 2010-05-28 2011-12-01 Tetris Online, Inc. Interactive hybrid asynchronous computer game infrastructure
DK2575878T3 (en) 2010-05-28 2018-08-13 Zoetis Belgium S A VACCINES INCLUDING CHOLESTEROL AND CPG AS THE ONLY ADJUVENT CARRIER MOLECULES
AU2011261185A1 (en) 2010-06-03 2013-01-10 Pharmacyclics, Inc. The use of inhibitors of Bruton's tyrosine kinase (Btk)
CA2799747C (en) 2010-06-04 2016-10-18 Wyeth Llc Vaccine formulations comprising 2-phenoxyethanol
WO2011154878A1 (en) 2010-06-07 2011-12-15 Pfizer Vaccines Llc Ige ch3 peptide vaccine
GB201009861D0 (en) 2010-06-11 2010-07-21 Novartis Ag OMV vaccines
US10478483B2 (en) 2010-06-25 2019-11-19 Glaxosmithkline Biologicals Sa Combinations of meningococcal factor H binding proteins
JP2013533745A (en) 2010-07-06 2013-08-29 ノバルティス アーゲー Immunogenic compositions and methods derived from norovirus
US9192661B2 (en) 2010-07-06 2015-11-24 Novartis Ag Delivery of self-replicating RNA using biodegradable polymer particles
EP2608805B1 (en) 2010-08-23 2017-07-05 Wyeth LLC STABLE FORMULATIONS OF NEISSERIA MENINGITIDIS rLP2086 ANTIGENS
EP2613806B2 (en) 2010-09-10 2022-10-26 Wyeth LLC Non-lipidated variants of neisseria meningitidis orf2086 antigens
EP3431100B1 (en) 2010-09-14 2021-09-08 University of Pittsburgh- Of the Commonwealth System of Higher Education Computationally optimized broadly reactive antigens for influenza
GB201101665D0 (en) 2011-01-31 2011-03-16 Novartis Ag Immunogenic compositions
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US9072760B2 (en) 2010-09-24 2015-07-07 University of Pittsburgh—of the Commonwealth System of Higher Education TLR4 inhibitors for the treatment of human infectious and inflammatory disorders
US10668092B2 (en) 2010-09-24 2020-06-02 The John Hopkins University Compositions and methods for treatment of inflammatory disorders
GB201017519D0 (en) 2010-10-15 2010-12-01 Novartis Vaccines Inst For Global Health S R L Vaccines
EP2640190A4 (en) 2010-11-05 2016-05-11 Selecta Biosciences Inc Modified nicotinic compounds and related methods
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
EP2468866A1 (en) * 2010-12-21 2012-06-27 Index Pharmaceuticals AB Biologically active oligonucleotides capable of modulating the immune system
WO2012088425A2 (en) 2010-12-22 2012-06-28 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Gap junction-enhancing agents for treatment of necrotizing enterocolitis and inflammatory bowel disease
PL2654785T3 (en) 2010-12-22 2019-09-30 Bayer Intellectual Property Gmbh Enhanced immune response in bovine species
AU2011346535B2 (en) 2010-12-22 2015-09-24 Wyeth Llc Stable immunogenic compositions of Staphylococcus aureus antigens
GB201021867D0 (en) 2010-12-23 2011-02-02 Mologen Ag Non-coding immunomodulatory DNA construct
US20130315959A1 (en) 2010-12-24 2013-11-28 Novartis Ag Compounds
EP2471926A3 (en) 2010-12-30 2012-07-11 Intervet International BV Immunostimulatory oligodeoxynucleotides
US10342862B2 (en) 2011-01-26 2019-07-09 Glaxosmithkline Biologicals, Sa RSV immunization regimen
WO2012109675A1 (en) 2011-02-11 2012-08-16 Baxter International Inc. Aptamers to tissue factor pathway inhibitor and their use as bleeding disorder therapeutics
US20140004142A1 (en) 2011-03-02 2014-01-02 Pfizer Inc. Pcsk9 vaccine
EA027236B1 (en) 2011-04-08 2017-07-31 Иммьюн Дизайн Корп. Immunogenic compositions and methods of using the compositions for inducing humoral and cellular immune responses
US9452212B2 (en) 2011-04-14 2016-09-27 Dynavax Technologies Corporation Methods and compositions for eliciting an immune response against hepatitis B virus
WO2012149307A2 (en) 2011-04-27 2012-11-01 Immune Design Corp. Synthetic long peptide (slp)-based vaccines
LT3275892T (en) 2011-05-13 2020-04-10 Glaxosmithkline Biologicals S.A. Pre-fusion rsv f antigens
FR2975600B1 (en) 2011-05-24 2013-07-05 Assist Publ Hopitaux De Paris AGENTS FOR THE TREATMENT OF TUMORS
EP2714908B1 (en) * 2011-05-26 2018-04-18 Intervet International B.V. Immunostimulatory oligodeoxynucleotides
KR102052215B1 (en) 2011-06-01 2019-12-04 야누스 바이오테라퓨틱스, 인크. Novel immune system modulators
EP2713737B1 (en) 2011-06-01 2016-04-20 Janus Biotherapeutics, Inc. Novel immune system modulators
MX355623B (en) 2011-06-03 2018-04-25 3M Innovative Properties Co Hydrazino 1h-imidazoquinolin-4-amines and conjugates made therefrom.
US9475804B2 (en) 2011-06-03 2016-10-25 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
KR102033185B1 (en) 2011-06-17 2019-10-16 유니버시티 오브 테네시 리서치 파운데이션 Group a streptococcus multivalent vaccine
US9580475B2 (en) 2011-06-20 2017-02-28 University of Pittsburgh—of the Commonwealth System of Higher Education Computationally optimized broadly reactive antigens for H1N1 influenza
ITMI20111182A1 (en) 2011-06-28 2012-12-29 Canio Buonavoglia VACCINE FOR CORONAVIRUS CANINO
JP2014522842A (en) 2011-07-06 2014-09-08 ノバルティス アーゲー Immunogenic combination compositions and uses thereof
EP2729168A2 (en) 2011-07-06 2014-05-14 Novartis AG Immunogenic compositions and uses thereof
WO2013007703A1 (en) * 2011-07-08 2013-01-17 Universität Zürich CLASS A CpG OLIGONUCLEOTIDES FOR PREVENTION OF VIRAL INFECTION IN CATS
WO2013009564A1 (en) 2011-07-08 2013-01-17 Novartis Ag Tyrosine ligation process
MX347361B (en) 2011-07-19 2017-04-12 Wave Life Sciences Ltd Methods for the synthesis of functionalized nucleic acids.
US20130023736A1 (en) 2011-07-21 2013-01-24 Stanley Dale Harpstead Systems for drug delivery and monitoring
ES2687129T3 (en) 2011-07-25 2018-10-23 Glaxosmithkline Biologicals Sa Compositions and methods to evaluate the functional immunogenicity of parvovirus vaccines
EP2736537A4 (en) 2011-07-29 2015-04-15 Selecta Biosciences Inc Synthetic nanocarriers that generate humoral and cytotoxic t lymphocyte (ctl) immune responses
GB201114923D0 (en) 2011-08-30 2011-10-12 Novartis Ag Immunogenic proteins and compositions
US20140348865A1 (en) 2011-09-12 2014-11-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Ser. Immunogens based on an hiv-1 v1v2 site-of-vulnerability
WO2013038385A2 (en) 2011-09-14 2013-03-21 Novartis Ag Escherichia coli vaccine combination
TR201909110T4 (en) 2011-09-14 2019-07-22 Glaxosmithkline Biologicals Sa Methods for making saccharide-protein glycoconjugates.
WO2013049535A2 (en) 2011-09-30 2013-04-04 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Influenza vaccine
US9873694B2 (en) 2011-10-04 2018-01-23 Janus Biotherapeutics, Inc. Imidazole quinoline-based immune system modulators
US20140286983A1 (en) 2011-10-20 2014-09-25 The Government of the USA as represented by the Secretaryof the Dept. of Health and Human Services Dengue virus e-glycoprotein polypeptides containing mutations that eliminate immunodominant cross-reactive epitopes
WO2013068949A1 (en) 2011-11-07 2013-05-16 Novartis Ag Carrier molecule comprising a spr0096 and a spr2021 antigen
BR112014013876A2 (en) 2011-12-08 2019-09-24 Novartis Ag clostridium difficile toxin-based vaccine
EA201491081A1 (en) 2012-01-16 2016-11-30 Элизабет Маккенна COMPOSITIONS AND METHODS FOR THE TREATMENT OF DISEASES AND LIVER DISORDERS
US20140086849A1 (en) 2012-09-21 2014-03-27 Elizabeth McKenna Naturally-Occurring CpG Oligonucleotide Compositions and Therapeutic Applications Thereof
WO2013108272A2 (en) 2012-01-20 2013-07-25 International Centre For Genetic Engineering And Biotechnology Blood stage malaria vaccine
CN104136456A (en) 2012-02-07 2014-11-05 高等教育联邦系统-匹兹堡大学 Computationally optimized broadly reactive antigens for h3n2, h2n2, and b influenza viruses
IN2014DN05695A (en) 2012-02-13 2015-05-15 Univ Pittsburgh
JP2015509713A (en) 2012-02-24 2015-04-02 ノバルティス アーゲー Pili protein and composition
SA115360586B1 (en) 2012-03-09 2017-04-12 فايزر انك Neisseria meningitidis compositions and methods thereof
US8986710B2 (en) 2012-03-09 2015-03-24 Pfizer Inc. Neisseria meningitidis compositions and methods thereof
WO2013142808A1 (en) 2012-03-23 2013-09-26 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pathogenic phlebovirus isolates and compositions and methods of use
EP2841098A4 (en) 2012-04-23 2016-03-02 Allertein Therapeutics Llc Nanoparticles for treatment of allergy
US10279026B2 (en) 2012-04-26 2019-05-07 Glaxosmithkline Biologicals Sa Antigens and antigen combinations
RU2727476C2 (en) 2012-04-26 2020-07-21 Новартис Аг Antigens and antigen compositions
WO2013162828A1 (en) 2012-04-27 2013-10-31 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Use of cpg oligonucleotides co-formulated with an antibiotic to accelarate wound healing
NZ701324A (en) 2012-05-04 2016-09-30 Pfizer Prostate-associated antigens and vaccine-based immunotherapy regimens
AU2013265336A1 (en) 2012-05-22 2014-12-04 Novartis Ag Meningococcus serogroup X conjugate
US9409956B2 (en) 2012-05-23 2016-08-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Salmonella typhi Ty21a expressing Yersinia pestis F1-V fusion protein and uses thereof
CN104428008B (en) 2012-05-24 2020-10-09 美国政府(由卫生和人类服务部的部长所代表) Multivalent meningococcal conjugates and methods of making conjugates
US9687542B2 (en) 2012-06-19 2017-06-27 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Rift valley fever virus replicon particles and use thereof
KR102057217B1 (en) 2012-06-20 2020-01-22 에스케이바이오사이언스 주식회사 Multivalent pneumococcal polysaccharide-protein conjugate composition
JP2015522580A (en) 2012-07-06 2015-08-06 ノバルティス アーゲー Immunological compositions and uses thereof
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
JP6246121B2 (en) * 2012-07-13 2017-12-13 株式会社新日本科学 Chiral nucleic acid adjuvant
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
WO2014015091A2 (en) 2012-07-19 2014-01-23 Zoetis Llc Bovine influenza virus compositions
CN104704129A (en) 2012-07-24 2015-06-10 药品循环公司 Mutations associated with resistance to inhibitors of bruton's tyrosine kinase (BTK)
AU2013295770A1 (en) 2012-07-27 2015-01-29 Zoetis Services Llc Tick toxin compositions
SI2885007T1 (en) 2012-08-16 2018-12-31 Pfizer Inc. Glycoconjugation processes and compositions
US10973892B2 (en) 2012-09-04 2021-04-13 Bavarian Nordic A/S Methods and compositions for enhancing vaccine immune responses
WO2014043518A1 (en) 2012-09-14 2014-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Brachyury protein, non-poxvirus non-yeast vectors encoding brachyury protein, and their use
WO2014043535A1 (en) 2012-09-14 2014-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions for the treatment of cancer
RU2662970C2 (en) 2012-09-18 2018-07-31 Новартис Аг Outer membrane vesicles
US9562066B2 (en) * 2012-09-25 2017-02-07 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Oral therapy of necrotizing enterocolitis
US9855325B2 (en) 2012-10-03 2018-01-02 Glaxosmithkline Biologicals Sa Immunogenic composition
KR20150080592A (en) 2012-11-02 2015-07-09 파마시클릭스, 인코포레이티드 Tec family kinase inhibitor adjuvant therapy
WO2014074785A1 (en) 2012-11-08 2014-05-15 Ludwig Institute For Cancer Research Ltd. Methods of predicting outcome and treating breast cancer
KR20140075201A (en) 2012-12-11 2014-06-19 에스케이케미칼주식회사 Multivalent pneumococcal polysaccharide-protein conjugate composition
KR20140075196A (en) 2012-12-11 2014-06-19 에스케이케미칼주식회사 Multivalent pneumococcal polysaccharide-protein conjugate composition
TWI465241B (en) 2012-12-19 2014-12-21 Ind Tech Res Inst Use of an extract of juniperus chinensis or lignan for manufacturing a medicament for inhibiting angiogenesis
CN104870463B (en) 2012-12-20 2018-09-28 辉瑞公司 Sugared conjugation methods
EP2948469A4 (en) 2013-01-23 2016-11-02 Univ Leland Stanford Junior Stabilized hepatitis b core polypeptide
US11576958B2 (en) 2013-02-07 2023-02-14 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
EP2964665B1 (en) 2013-03-08 2018-08-01 Pfizer Inc Immunogenic fusion polypeptides
KR20150127206A (en) 2013-03-14 2015-11-16 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 Nanoparticle-based compositions
CA2907098A1 (en) 2013-03-15 2014-09-25 Zoetis Services Llc Cross-protection of bovines against b. trehalosi infection by a multi-valent vaccine
DE102013004595A1 (en) 2013-03-15 2014-09-18 Emergent Product Development Germany Gmbh RSV vaccines
WO2014165679A1 (en) 2013-04-03 2014-10-09 Allertein Therapeutics, Llc Novel nanoparticle compositions
EP2986717A1 (en) 2013-04-19 2016-02-24 The Regents of The University of California Lone star virus
AR095882A1 (en) 2013-04-22 2015-11-18 Hoffmann La Roche ANTIBODY COMBINATION THERAPY AGAINST HUMAN CSF-1R WITH A TLR9 AGONIST
CN103550783A (en) * 2013-04-27 2014-02-05 中国人民解放军军事医学科学院放射与辐射医学研究所 Nucleic acid drug targeting delivery system and preparation method thereof
WO2015132619A1 (en) 2013-05-15 2015-09-11 The Governors Of The University Of Alberta E1e2 hcv vaccines and methods of use
WO2014201245A1 (en) 2013-06-12 2014-12-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Tlr-9 agonist with tlr-7 and/or tlr-8 agonist for treating tumors
TWI535451B (en) * 2013-07-19 2016-06-01 財團法人國家衛生研究院 Cpg-oligodeoxynucleotide, immunogenic composition comprising the same, and use of preparation of medicament for treatment in stimulating immune response
CA2919268C (en) 2013-07-25 2023-09-05 Exicure, Inc. Spherical nucleic acid-based constructs as immunostimulatory agents for prophylactic and therapeutic use
EP3632458A1 (en) 2013-07-26 2020-04-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of bacterial infections
EP3041502A2 (en) 2013-09-08 2016-07-13 Pfizer Inc. Neisseria meningitidis compositions and methods thereof
AR097584A1 (en) 2013-09-12 2016-03-23 Hoffmann La Roche ANTIBODY COMBINATION THERAPY AGAINST HUMAN CSF-1R AND ANTIBODIES AGAINST HUMAN PD-L1
CA3005608C (en) 2013-09-19 2020-06-30 Zoetis Services Llc Water-in-oil emulsions comprising immunostimulatory oligonucleotides
US10076567B2 (en) 2013-09-27 2018-09-18 Duke University MPER-liposome conjugates and uses thereof
US10010606B2 (en) 2013-09-30 2018-07-03 Los Alamos National Security, Llc Mosaic conserved region HIV immunogenic polypeptides
EP3052127A1 (en) 2013-10-04 2016-08-10 PIN Pharma, Inc. Immunostimulatory hiv tat derivative polypeptides for use in cancer treatment
JP2016535989A (en) 2013-11-01 2016-11-24 ファイザー・インク Vector for expressing prostate-related antigen
EP2870974A1 (en) 2013-11-08 2015-05-13 Novartis AG Salmonella conjugate vaccines
HUE056105T2 (en) 2013-11-28 2022-01-28 Bavarian Nordic As Compositions and methods for inducing an enhanced immune response using poxvirus vectors
CN112107693B (en) * 2013-12-03 2023-05-26 西北大学 Liposome particles, method for preparing said liposome particles and use thereof
JP6758185B2 (en) 2013-12-13 2020-09-23 ザ ユナイテッド ステイツ オブ アメリカ, アズ リプレゼンテッド バイ ザ セクレタリー, デパートメント オブ ヘルス アンド ヒューマン サービシーズ Multiepitope TARP peptide vaccine and its use
US11708411B2 (en) 2013-12-20 2023-07-25 Wake Forest University Health Sciences Methods and compositions for increasing protective antibody levels induced by pneumococcal polysaccharide vaccines
EP3095460A4 (en) * 2014-01-15 2017-08-23 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
JPWO2015108048A1 (en) * 2014-01-15 2017-03-23 株式会社新日本科学 Chiral nucleic acid adjuvant and antitumor agent having antitumor activity
JPWO2015108047A1 (en) * 2014-01-15 2017-03-23 株式会社新日本科学 Chiral nucleic acid adjuvant having immunity induction activity and immunity induction activator
CA2936712A1 (en) 2014-01-16 2015-07-23 Meena Chiral design
DK3096783T3 (en) 2014-01-21 2021-08-02 Pfizer Streptococcus pneumoniae capsule polysaccharides and conjugates thereof
US11160855B2 (en) 2014-01-21 2021-11-02 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
IL296681A (en) 2014-01-21 2022-11-01 Pfizer Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
SG11201605883UA (en) 2014-01-21 2016-08-30 Immune Design Corp Compositions for use in the treatment of allergic conditions
DK3583947T3 (en) 2014-01-21 2023-11-06 Pfizer Streptococcus pneumoniae capsular polysaccharides and conjugates thereof
WO2016130569A1 (en) 2015-02-09 2016-08-18 Mj Biologics, Inc. A composition comprising pedv antigens and methods for making and using the composition
WO2015123291A1 (en) 2014-02-11 2015-08-20 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Pcsk9 vaccine and methods of using the same
US10668164B2 (en) 2014-02-14 2020-06-02 Pfizer Inc. Immunogenic glycoprotein conjugates
GB2523187A (en) 2014-02-18 2015-08-19 Mologen Ag Covalently closed non-coding immunomodulatory DNA construct
WO2015130584A2 (en) 2014-02-25 2015-09-03 Merck Sharp & Dohme Corp. Lipid nanoparticle vaccine adjuvants and antigen delivery systems
PE20170404A1 (en) 2014-02-28 2017-05-14 Bayer Animal Health Gmbh IMMUNOSTIMULATORY PLASMIDS
CN106535930A (en) 2014-03-11 2017-03-22 明尼苏达大学董事会 Porcine epidemic diarrhea virus vaccines and methods of use thereof
EP3119910A4 (en) 2014-03-20 2018-02-21 Pharmacyclics LLC Phospholipase c gamma 2 and resistance associated mutations
SI3122378T1 (en) 2014-03-26 2020-03-31 Glaxosmithkline Biologicals S.A. Mutant staphylococcal antigens
US9549914B2 (en) 2014-04-03 2017-01-24 The Johns Hopkins University Treatment of human cytomegalovirus by modulating Wnt
EP3134104B1 (en) 2014-04-25 2018-12-26 Tria Bioscience Corp. Synthetic hapten carrier compositions and methods
RU2016150941A (en) * 2014-05-23 2018-06-26 Грегори КОЧОН COATING METHOD AND MATERIALS
CA2986096A1 (en) 2014-05-30 2015-12-03 Sanofi Pasteur Inc. Expression and conformational analysis of engineered influenza hemagglutinin
PL3164113T3 (en) 2014-06-04 2019-09-30 Exicure, Inc. Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
WO2015200728A1 (en) 2014-06-25 2015-12-30 Selecta Biosciences, Inc. Methods and compositions for treatment with synthetic nanocarriers and immune checkpoint inhibitors
EP3169352A1 (en) 2014-07-15 2017-05-24 Immune Design Corp. Prime-boost regimens with a tlr4 agonist adjuvant and a lentiviral vector
EP3398948A3 (en) 2014-08-22 2018-12-05 Janus Biotherapeutics, Inc. 2,4,6,7-tetrasubstituted pteridine compounds and methods of synthesis and use thereof
WO2016044839A2 (en) 2014-09-19 2016-03-24 The Board Of Regents Of The University Of Texas System Compositions and methods for treating viral infections through stimulated innate immunity in combination with antiviral compounds
MX2017004448A (en) 2014-10-06 2017-10-23 Exicure Inc Anti-tnf compounds.
US20160129097A1 (en) * 2014-11-06 2016-05-12 Jeremy Delk Method of processing a veterinary tumor vaccine and a veterinary tumor vaccine processing kit
CA2968531A1 (en) 2014-11-21 2016-05-26 Northwestern University The sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
US20180256630A1 (en) * 2014-12-26 2018-09-13 National Institutes Of Biomedical Innovation, Health And Nutrition Use of nucleic acid-polysaccharide complexes having immunopotentiating activity as anti-tumor drug
WO2016109310A1 (en) 2014-12-31 2016-07-07 Checkmate Pharmaceuticals, Llc Combination tumor immunotherapy
SI3244917T1 (en) 2015-01-15 2023-07-31 Pfizer Inc. Immunogenic compositions for use in pneumococcal vaccines
KR102382773B1 (en) 2015-01-16 2022-04-04 조에티스 서비시즈 엘엘씨 Foot-and-mouth disease vaccine
CA3014427A1 (en) 2015-02-13 2016-08-18 Icahn School Of Medicine At Mount Sinai Rna containing compositions and methods of their use
BR112017017460A2 (en) 2015-02-19 2018-04-10 Pfizer Inc. neisseria meningitidis compositions and methods thereof
DK3268380T3 (en) 2015-03-12 2019-02-18 Zoetis Services Llc PYOLYSIS METHODS AND COMPOSITIONS
WO2016178123A1 (en) 2015-05-04 2016-11-10 Pfizer Inc. Group b streptococcus polysaccharide-protein conjugates, methods for producing conjugates, immunogenic compositions comprising conjugates, and uses thereof
WO2016180852A1 (en) 2015-05-12 2016-11-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for preparing antigen-specific t cells from an umbilical cord blood sample
EP3294324A1 (en) 2015-05-13 2018-03-21 Agenus Inc. Vaccines for treatment and prevention of cancer
WO2016183371A1 (en) 2015-05-13 2016-11-17 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Methods for the treatment or prevention of ischemic tissue damage
AU2016270979B2 (en) 2015-06-02 2020-11-12 Sanofi Pasteur Inc. Engineered influenza antigenic polypeptides and immunogenic compositions thereof
WO2016200787A2 (en) 2015-06-09 2016-12-15 The Board Of Regents Of The University Of Oklahoma Compositions and treatments for haemophilus influenzae
JP6886410B2 (en) 2015-06-10 2021-06-16 ザ ユナイテッド ステイツ オブ アメリカ, アズ リプレゼンテッド バイ ザ セクレタリー, デパートメント オブ ヘルス アンド ヒューマン サービシーズ Process for preparation and purification of nucleic acid-containing compositions
JP2018524323A (en) 2015-06-26 2018-08-30 セキラス ユーケー リミテッド Antigen matched influenza vaccine
US10449212B2 (en) 2015-07-09 2019-10-22 National Institute For Materials Science Immunostimulating oligonucleotide complex
RU2721128C2 (en) 2015-07-21 2020-05-18 Пфайзер Инк. Immunogenic compositions containing conjugated antigens of the capsular saccharide, kits containing these compositions and use thereof
TW201718001A (en) 2015-07-31 2017-06-01 拜耳動物保健有限公司 Enhanced immune response in porcine species
HUE060545T2 (en) 2015-08-14 2023-03-28 Zoetis Services Llc Mycoplasma bovis compositions
WO2017040885A1 (en) 2015-09-03 2017-03-09 The Board Of Regents Of The University Of Oklahoma Peptide inhibitors of clostridium difficile tcdb toxin
LU92821B1 (en) 2015-09-09 2017-03-20 Mologen Ag Combination comprising immunostimulatory oligonucleotides
CN108024914A (en) 2015-09-17 2018-05-11 Jrx生物技术有限公司 Improve the method for the aquation or wetting action of skin
GB2542425A (en) 2015-09-21 2017-03-22 Mologen Ag Means for the treatment of HIV
WO2017059280A1 (en) 2015-10-02 2017-04-06 The University Of North Carolina At Chapel Hill Novel pan-tam inhibitors and mer/axl dual inhibitors
US10548970B2 (en) 2015-10-05 2020-02-04 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Human rotavirus G9P[6] strain and use as a vaccine
WO2017075570A1 (en) 2015-10-30 2017-05-04 The United States Of America, As Represented By Secretary, Department Of Health And Human Sevices Compositions and methods for the treatment of her2-expressing solid tumors
WO2017085586A1 (en) 2015-11-20 2017-05-26 Pfizer Inc. Immunogenic compositions for use in pneumococcal vaccines
CA3006779A1 (en) 2015-12-09 2017-06-15 Admedus Vaccines Pty Ltd Immunomodulating composition for treatment
EP3402878A1 (en) 2016-01-11 2018-11-21 Zoetis Services LLC Novel cross protective vaccine compositions for porcine epidemic diarrhea virus
PL3407910T3 (en) 2016-01-29 2022-08-16 Bavarian Nordic A/S Recombinant modified vaccinia virus ankara (mva) equine encephalitis virus vaccine
WO2017189448A1 (en) 2016-04-25 2017-11-02 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Bivalent immunogenic conjugate for malaria and typhoid
WO2017192874A1 (en) 2016-05-04 2017-11-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Albumin-binding immunomodulatory compositions and methods of use thereof
WO2017201390A1 (en) 2016-05-19 2017-11-23 The Regents Of The University Of Michigan Novel adjuvant compositions
WO2017210215A1 (en) 2016-05-31 2017-12-07 The Government Of The United States Of America As Represented By The Secretary Of The Army Zika virus vaccine and methods of production
CA3026096A1 (en) 2016-06-02 2017-12-07 Sanofi Pasteur Inc. Engineered influenza antigenic polypeptides and immunogenic compositions thereof
MA45159A (en) 2016-06-03 2019-04-10 Sanofi Pasteur Inc MODIFIED INFLUENZA HEMAGGLUTININ POLYPEPTIDES
US10947277B2 (en) 2016-06-13 2021-03-16 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Nucleic acids encoding zika virus-like particles and their use in zika virus vaccines and diagnostic assays
WO2017220753A1 (en) 2016-06-22 2017-12-28 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Pneumococcal polysaccharide-protein conjugate composition
EP3269385A1 (en) 2016-07-12 2018-01-17 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Pneumococcal polysaccharide-protein conjugate composition
WO2018009604A1 (en) 2016-07-08 2018-01-11 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Chimeric dengue/zika viruses live-attenuated zika virus vaccines
WO2018009603A1 (en) 2016-07-08 2018-01-11 The United State of America, as represented by the Secretary, Department of Health and Human Service Chimeric west nile/zika viruses and methods of use
WO2018027123A1 (en) 2016-08-05 2018-02-08 Sanofi Pasteur, Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US11241489B2 (en) 2016-08-05 2022-02-08 Sanofi Pasteur Inc. Multivalent pneumococcal polysaccharide-protein conjugate composition
US10182146B2 (en) * 2016-08-22 2019-01-15 Nice Ltd. System and method for dynamic redundant call recording
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids
EP3504239A1 (en) 2016-08-25 2019-07-03 H. Hoffnabb-La Roche Ag Intermittent dosing of an anti-csf-1r antibody in combination with macrophage activating agent
US10172933B2 (en) 2016-10-31 2019-01-08 The United States Of America, As Represented By The Secretary Of Agriculture Mosaic vaccines for serotype a foot-and-mouth disease virus
US10751402B2 (en) 2016-11-09 2020-08-25 Pfizer Inc. Immunogenic compositions and uses thereof
WO2018115051A1 (en) 2016-12-22 2018-06-28 F. Hoffmann-La Roche Ag Treatment of tumors with an anti-csf-1r antibody in combination with an anti-pd-l1 antibody after failure of anti-pd-l1/pd1 treatment
HRP20220573T1 (en) 2017-01-20 2022-06-10 Pfizer Inc. Immunogenic compositions for use in pneumococcal vaccines
CN110225757A (en) 2017-01-31 2019-09-10 默沙东公司 By the method for S. pneumoniae serotypes 19F production capsular polysaccharide protein conjugate
SG11201906519RA (en) 2017-01-31 2019-08-27 Pfizer Neisseria meningitidis compositions and methods thereof
AU2018214451B2 (en) 2017-02-06 2022-02-03 Meat & Livestock Australia Limited Immunostimulating compositions and uses therefore
GB201703529D0 (en) 2017-03-06 2017-04-19 Cambridge Entpr Ltd Vaccine composition
WO2018183666A1 (en) 2017-03-31 2018-10-04 Boston Medical Center Corporation Methods and compositions using highly converved pneumococcal surface proteins
WO2018201090A1 (en) 2017-04-28 2018-11-01 Exicure, Inc. Synthesis of spherical nucleic acids using lipophilic moieties
CA3066915A1 (en) 2017-06-11 2018-12-20 Molecular Express, Inc. Methods and compositions for substance use disorder vaccine formulations and uses thereof
WO2018237221A1 (en) 2017-06-23 2018-12-27 Nosocomial Vaccine Corporation Immunogenic compositions
BR112020001255A2 (en) 2017-07-21 2020-07-28 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services immunogenic compositions of neisseria meningitidis
JP7438102B2 (en) 2017-09-07 2024-02-26 メルク・シャープ・アンド・ドーム・エルエルシー Pneumococcal polysaccharide and its use in immunogenic polysaccharide-carrier protein conjugates
AU2018330494A1 (en) 2017-09-08 2020-03-26 Mina Therapeutics Limited HNF4a saRNA compositions and methods of use
WO2019066571A2 (en) 2017-09-28 2019-04-04 연세대학교 산학협력단 Method for producing myeloid-derived suppressor cells, myeloid-derived suppressor cells produced thereby, and uses thereof
US11235046B2 (en) 2017-11-04 2022-02-01 Nevada Research & Innovation Corporation Immunogenic conjugates and methods of use thereof
CA3084436A1 (en) 2017-12-06 2019-07-18 Merck Sharp & Dohme Corp. Compositions comprising streptococcus pneumoniae polysaccharide-protein conjugates and methods of use thereof
WO2019126197A1 (en) 2017-12-18 2019-06-27 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Bacterial polysaccharide-conjugated carrier proteins and use thereof
CN111741767A (en) 2017-12-19 2020-10-02 麻省理工学院 Antigen-adjuvant coupling agents and methods of use
CN111629751A (en) 2018-01-22 2020-09-04 美国政府(由卫生和人类服务部的部长所代表) Broad spectrum protective inactivated influenza virus vaccines
CA3034912A1 (en) 2018-02-28 2019-08-28 Pfizer Inc. Il-15 variants and uses thereof
WO2019169332A1 (en) * 2018-03-02 2019-09-06 Elicio Therapeutics Inc. Compounds including a mutant kras sequence and a lipid and uses thereof
US11633471B2 (en) 2018-03-06 2023-04-25 Unm Rainforest Innovations Compositions and methods for reducing serum triglycerides
JP7329529B2 (en) 2018-03-28 2023-08-18 サノフィ パスツール インコーポレイテッド Methods of Producing Broadly Protective Vaccine Compositions Containing Hemagglutinin
CN112512565A (en) 2018-04-03 2021-03-16 赛诺菲 Antigenic influenza-ferritin polypeptides
MX2020010199A (en) 2018-04-03 2021-01-08 Sanofi Sa Antigenic respiratory syncytial virus polypeptides.
EP3773698A1 (en) 2018-04-03 2021-02-17 Sanofi Ferritin proteins
CN112584858A (en) 2018-04-03 2021-03-30 赛诺菲 Antigenic OSPA polypeptides
CN112512566A (en) 2018-04-03 2021-03-16 赛诺菲 Antigenic epstein-barr virus polypeptides
US11434292B2 (en) 2018-05-23 2022-09-06 Pfizer Inc. Antibodies specific for CD3 and uses thereof
MX2020012607A (en) 2018-05-23 2021-01-29 Pfizer Antibodies specific for gucy2c and uses thereof.
EP3574915A1 (en) 2018-05-29 2019-12-04 Neovacs Immunogenic product comprising il-4 and/or il-13 for treating disorders associated with aberrant il-4 and/or il 13 expression or activity
CN110004150B (en) * 2018-08-01 2023-03-10 中国农业科学院兰州兽医研究所 CpG oligonucleotide sequence with immune enhancement activity and application thereof
US11260119B2 (en) 2018-08-24 2022-03-01 Pfizer Inc. Escherichia coli compositions and methods thereof
KR20210124205A (en) 2018-12-04 2021-10-14 더 락커펠러 유니버시티 HIV Vaccine Immunogen
EP3894547A1 (en) 2018-12-12 2021-10-20 The United States of America, as represented by The Secretary, Department of Health and Human Services Recombinant mumps virus vaccine expressing genotype g fusion and hemagglutinin-neuraminidase proteins
WO2020121159A1 (en) 2018-12-12 2020-06-18 Pfizer Inc. Immunogenic multiple hetero-antigen polysaccharide-protein conjugates and uses thereof
US20220023410A1 (en) 2018-12-14 2022-01-27 University Of Georgia Research Foundation, Inc. Crimean-congo hemorrhagic fever virus replicon particles and use thereof
CN113453708A (en) 2018-12-19 2021-09-28 默沙东公司 Compositions comprising streptococcus pneumoniae polysaccharide-protein conjugates and methods of use thereof
US20220370606A1 (en) 2018-12-21 2022-11-24 Pfizer Inc. Combination Treatments Of Cancer Comprising A TLR Agonist
EP3946446A1 (en) 2019-04-02 2022-02-09 Sanofi Antigenic multimeric respiratory syncytial virus polypeptides
WO2020208502A1 (en) 2019-04-10 2020-10-15 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof
US20220241321A1 (en) * 2019-05-10 2022-08-04 Microbio (Shanghai) Co., Ltd. Dimeric cpg oligonucleotides for use in modulating immune responses
CA3143198A1 (en) * 2019-06-14 2020-12-17 G Tech Bio Llc Activated lymphocytic cells and methods of using the same to treat cancer and infectious conditions
US20220280636A1 (en) 2019-07-19 2022-09-08 Merck Sharp & Dohme Corp. Antigenic glycoprotein e polypeptides, compositions, and methods of use thereof
EP4003411A1 (en) 2019-07-30 2022-06-01 Phibro Animal Health Corporation A composition for mucosal administration to avians
MX2022001241A (en) 2019-07-31 2022-04-20 Sanofi Pasteur Inc Multivalent pneumococcal polysaccharide-protein conjugate compositions and methods of using the same.
JP2022545181A (en) 2019-08-30 2022-10-26 ユニバーシティ オブ ロチェスター Septin inhibitors for cancer therapy
CN110646557A (en) * 2019-10-12 2020-01-03 北京航空航天大学 Urine metabolic marker of glioblastoma patient carrying IDH gene mutation and application thereof
JP2021087420A (en) 2019-11-01 2021-06-10 ファイザー・インク Escherichia coli compositions and methods thereof
BR112022010228A2 (en) 2019-12-17 2022-09-06 Us Health ATTENUATED LIVE LEISHMANIA PARASITE VACCINES WITH INCREASED SAFETY CHARACTERISTICS
BR112022009723A2 (en) 2019-12-17 2022-08-09 Pfizer SPECIFIC ANTIBODIES TO CD47, PD-L1, AND USES THEREOF
WO2021154745A1 (en) 2020-01-27 2021-08-05 Oregon State University Gonorrhea subunit vaccine
WO2021163448A2 (en) 2020-02-13 2021-08-19 The Board Of Trustees Of The University Of Illinois Vaccine and methods for detecting and preventing filariasis
IL295632A (en) 2020-02-23 2022-10-01 Pfizer Escherichia coli compositions and methods thereof
JP2023515829A (en) 2020-02-28 2023-04-14 サノフィ パスツール インコーポレイテッド High-dose influenza vaccine for pediatric subjects
US11213482B1 (en) 2020-03-05 2022-01-04 University of Pittsburgh—Of the Commonwealth System of Higher Educat SARS-CoV-2 subunit vaccine and microneedle array delivery system
WO2021211279A1 (en) 2020-04-17 2021-10-21 Regents Of The University Of Minnesota SARS-CoV-2 SPIKE RECEPTOR BINDING DOMAIN AND COMPOSITIONS AND METHODS THEREOF
EP3900739A1 (en) 2020-04-21 2021-10-27 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Synthetic streptococcus pneumoniae saccharide conjugates to conserved membrane protein
CA3178252A1 (en) 2020-05-11 2021-11-18 Erytech Pharma Red cell extracellular vesicles (rcevs) containing cargoes and methods of use and production thereof
CN116323668A (en) 2020-07-17 2023-06-23 辉瑞公司 Therapeutic antibodies and uses thereof
JP2023538736A (en) 2020-08-26 2023-09-11 ファイザー・インク Group B streptococcal polysaccharide-protein conjugates, methods for producing the conjugates, immunogenic compositions comprising the conjugates, and uses thereof
AU2021343290A1 (en) 2020-09-17 2023-04-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Immunogenic product comprising an IgE fragment for treating IgE-mediated inflammatory disorders
JP2023542528A (en) 2020-09-24 2023-10-10 フレッド ハッチンソン キャンサー センター Immunotherapy targeting SOX2 antigen
WO2022066973A1 (en) 2020-09-24 2022-03-31 Fred Hutchinson Cancer Research Center Immunotherapy targeting pbk or oip5 antigens
TW202227467A (en) 2020-10-27 2022-07-16 美商輝瑞大藥廠 Escherichia coli compositions and methods thereof
CA3200602A1 (en) 2020-11-04 2022-05-12 Pfizer Inc. Immunogenic compositions for use in pneumococcal vaccines
WO2022101745A2 (en) 2020-11-10 2022-05-19 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
US20220202923A1 (en) 2020-12-23 2022-06-30 Pfizer Inc. E. coli fimh mutants and uses thereof
WO2022147373A1 (en) 2020-12-31 2022-07-07 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Antibody-guided pcsk9-mimicking immunogens lacking 9-residue sequence overlap with human proteins
WO2022169835A1 (en) 2021-02-03 2022-08-11 The Board Of Trustees Of The University Of Illinois Vaccine and methods for preventing filariasis and dirofilariasis
TW202306969A (en) 2021-05-28 2023-02-16 美商輝瑞大藥廠 Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
BR112023023671A2 (en) 2021-05-28 2024-02-06 Pfizer IMMUNOGENIC COMPOSITIONS COMPRISING CONJUGATED CAPSULAR SACHARIDE ANTIGENS AND USES THEREOF
WO2022261251A1 (en) 2021-06-08 2022-12-15 Glyde Bio Inc. Immunogenic compositions comprising tumour-associated antigen
EP4104830A1 (en) 2021-06-16 2022-12-21 Burghardt Wittig Sequential innate and adaptive immune modulation for cancer treatment
WO2023288263A1 (en) 2021-07-16 2023-01-19 The Board Of Trustees Of The University Of Illinois Universal vaccine for influenza virus based on tetrameric m2 protein incorporated into nanodiscs
WO2023018817A1 (en) 2021-08-11 2023-02-16 Sanofi Pasteur Inc. Truncated influenza neuraminidase and methods of using the same
WO2023059857A1 (en) 2021-10-08 2023-04-13 Sanofi Pasteur Inc. Multivalent influenza vaccines
WO2023079507A1 (en) 2021-11-05 2023-05-11 Sanofi Respiratory syncytial virus rna vaccine
WO2023081798A1 (en) 2021-11-05 2023-05-11 Sanofi Pasteur Inc. Multivalent influenza vaccines comprising recombinant hemagglutinin and neuraminidase and methods of using the same
WO2023079113A1 (en) 2021-11-05 2023-05-11 Sanofi Hybrid multivalent influenza vaccines comprising hemagglutinin and neuraminidase and methods of using the same
US20230310571A1 (en) 2021-11-30 2023-10-05 Sanofi Pasteur Inc. Human metapneumovirus vaccines
WO2023102388A1 (en) 2021-11-30 2023-06-08 Sanofi Pasteur Inc. Human metapneumovirus viral vector-based vaccines
WO2023111262A1 (en) 2021-12-17 2023-06-22 Sanofi Lyme disease rna vaccine
WO2023135515A1 (en) 2022-01-13 2023-07-20 Pfizer Inc. Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
WO2023144206A1 (en) 2022-01-27 2023-08-03 Sanofi Pasteur Modified vero cells and methods of using the same for virus production
WO2023161817A1 (en) 2022-02-25 2023-08-31 Pfizer Inc. Methods for incorporating azido groups in bacterial capsular polysaccharides
WO2023177579A1 (en) 2022-03-14 2023-09-21 Sanofi Pasteur Inc. Machine-learning techniques in protein design for vaccine generation
WO2023201109A1 (en) 2022-04-15 2023-10-19 Yale University Exatecan formulation
WO2023214082A2 (en) 2022-05-06 2023-11-09 Sanofi Signal sequences for nucleic acid vaccines
WO2023218322A1 (en) 2022-05-11 2023-11-16 Pfizer Inc. Process for producing of vaccine formulations with preservatives
WO2024003239A1 (en) 2022-06-29 2024-01-04 Bavarian Nordic A/S RECOMBINANT MODIFIED saRNA (VRP) AND VACCINIA VIRUS ANKARA (MVA) PRIME-BOOST REGIMEN

Citations (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3521637A (en) * 1967-11-28 1970-07-28 Nelson J Waterbury Tampon or similar sanitary napkin containing vitamin a
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5780448A (en) * 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
US5858987A (en) * 1995-05-05 1999-01-12 Mitotix, Inc. E6AP antisense constructs and methods of use
US6030955A (en) * 1996-03-21 2000-02-29 The Trustees Of Columbia University In The City Of New York And Imclone Systems, Inc. Methods of affecting intracellular phosphorylation of tyrosine using phosphorothioate oligonucleotides, and antiangiogenic and antiproliferative uses thereof
US6107062A (en) * 1992-07-30 2000-08-22 Inpax, Inc. Antisense viruses and antisense-ribozyme viruses
US6221882B1 (en) * 1997-07-03 2001-04-24 University Of Iowa Research Foundation Methods for inhibiting immunostimulatory DNA associated responses
US20020064515A1 (en) * 1998-04-03 2002-05-30 Krieg Arthur M. Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US6406705B1 (en) * 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20020091097A1 (en) * 2000-09-07 2002-07-11 Bratzler Robert L. Nucleic acids for the prevention and treatment of sexually transmitted diseases
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US6503533B1 (en) * 1994-07-28 2003-01-07 Georgetown University Antisense ogligonucleotides against Hepatitis B viral replication
US20030026782A1 (en) * 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US20030050263A1 (en) * 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US20030050261A1 (en) * 1994-07-15 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid molecules
US20030055014A1 (en) * 2000-12-14 2003-03-20 Bratzler Robert L. Inhibition of angiogenesis by nucleic acids
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US20030148316A1 (en) * 2001-08-01 2003-08-07 Lipford Grayson B. Methods and compositions relating to plasmacytoid dendritic cells
US20030166001A1 (en) * 2001-10-05 2003-09-04 Lipford Grayson B. Toll-like receptor 3 signaling agonists and antagonists
US20030181406A1 (en) * 2000-12-08 2003-09-25 Christian Schetter CpG-like nucleic acids and methods of use thereof
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040067905A1 (en) * 2002-07-03 2004-04-08 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040067902A9 (en) * 2000-02-03 2004-04-08 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US20040092472A1 (en) * 2002-07-03 2004-05-13 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040106568A1 (en) * 1994-07-15 2004-06-03 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20040152649A1 (en) * 2002-07-03 2004-08-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040171571A1 (en) * 2002-12-11 2004-09-02 Coley Pharmaceutical Group, Inc. 5' CpG nucleic acids and methods of use
US20050032734A1 (en) * 1997-05-20 2005-02-10 Krieg Arthur M. Vectors and methods for immunization or therapeutic protocols
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050059619A1 (en) * 2002-08-19 2005-03-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20050087538A1 (en) * 2003-10-23 2005-04-28 Wolfe Darrell R. Iceless multiple can cooler
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050101577A1 (en) * 2003-09-19 2005-05-12 Pfizer Inc. 2-alkylidene-19-nor-vitamin D derivatives for the treatment of rickets or vitamin D deficiency
US20050119273A1 (en) * 2003-06-20 2005-06-02 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (TLR) antagonists
US20050130911A1 (en) * 2003-09-25 2005-06-16 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20050169888A1 (en) * 1999-09-27 2005-08-04 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US20050181422A1 (en) * 2000-09-15 2005-08-18 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US20050182017A1 (en) * 1997-10-30 2005-08-18 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US20060019923A1 (en) * 2004-07-18 2006-01-26 Coley Pharmaceutical Group, Ltd. Methods and compositions for inducing innate immune responses
US20060019916A1 (en) * 2004-04-02 2006-01-26 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for inducing IL-10 responses
US7038029B2 (en) * 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US20060140875A1 (en) * 2004-10-20 2006-06-29 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US20060172966A1 (en) * 2002-04-04 2006-08-03 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US20070066554A1 (en) * 1999-09-25 2007-03-22 Coley Pharmaceutical Gmbh Immunostimulatory nucleic acids
US20070142315A1 (en) * 2005-11-25 2007-06-21 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US20070184465A1 (en) * 1998-05-14 2007-08-09 Coley Pharmaceutical Gmbh Methods for regulating hematopoiesis using CpG-oligonucleotides

Family Cites Families (473)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2003A (en) * 1841-03-12 Improvement in horizontal windivhlls
US2005A (en) * 1841-03-16 Improvement in the manner of constructing molds for casting butt-hinges
US2002A (en) * 1841-03-12 Tor and planter for plowing
US2010A (en) * 1841-03-18 Machine foe
US2004A (en) * 1841-03-12 Improvement in the manner of constructing and propelling steam-vessels
US3627874A (en) 1969-07-16 1971-12-14 Merck & Co Inc Vaccine preparation
US3761585A (en) 1971-04-05 1973-09-25 Beecham Group Ltd Vaccines containing modified allergenic material
US3906092A (en) 1971-11-26 1975-09-16 Merck & Co Inc Stimulation of antibody response
DE2643213C2 (en) * 1976-09-25 1985-02-21 Bayer Ag, 5090 Leverkusen Process for attenuating or inactivating microorganisms
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
EP0092574B1 (en) 1981-10-23 1992-04-29 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and methods of making same
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
ES8301593A1 (en) 1981-11-16 1983-01-01 Union Ind Y Agro Ganader S A U Nucleotide enriched humanized milk and process for its preparation
US5766920A (en) * 1982-08-11 1998-06-16 Cellcor, Inc. Ex vivo activation of immune cells
SE8205892D0 (en) 1982-10-18 1982-10-18 Bror Morein IMMUNOGENT MEMBRANE PROTEIN COMPLEX, SET FOR PREPARATION AND USE THEREOF
US4452775A (en) * 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
SE8405493D0 (en) 1984-11-01 1984-11-01 Bror Morein IMMUNOGENT COMPLEX AND KITCHEN FOR PREPARING IT AND USING IT AS IMMUNOSTIMENTING AGENTS
US5308626A (en) * 1985-06-28 1994-05-03 Toni N. Mariani Lymphokine activated effector cells for antibody-dependent cellular cytotoxicity (ADCC) treatment of cancer and other diseases
ES2039229T3 (en) 1986-01-14 1993-09-16 De Staat Der Nederlanden Vertegenwoordigd Door De Minister Van Welzijn, Volksgezondheid En Cultuur PROCEDURE FOR THE PREPARATION OF IMMUNOGENIC COMPLEXES AND PHARMACEUTICAL COMPOSITIONS CONTAINING THESE COMPLEXES.
US5194428A (en) 1986-05-23 1993-03-16 Worcester Foundation For Experimental Biology Inhibition of influenza virus replication by oligonucleotide phosphorothioates
US4806463A (en) 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US5059519A (en) 1986-07-01 1991-10-22 University Of Massachusetts Medical School Oligonucleotide probes for the determination of the proclivity for development of autoimmune diseases
US5075109A (en) * 1986-10-24 1991-12-24 Southern Research Institute Method of potentiating an immune response
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
ES2007350A6 (en) 1987-05-29 1989-06-16 Ganadera Union Ind Agro Food products enriched with nucleosides and/or nucleotides and preparation thereof.
CA1339596C (en) 1987-08-07 1997-12-23 New England Medical Center Hospitals, Inc. Viral expression inhibitors
US5004810A (en) 1988-09-30 1991-04-02 Schering Corporation Antiviral oligomers
NZ230747A (en) 1988-09-30 1992-05-26 Bror Morein Immunomodulating matrix comprising a complex of at least one lipid and at least one saponin; certain glycosylated triterpenoid saponins derived from quillaja saponaria molina
US5087617A (en) * 1989-02-15 1992-02-11 Board Of Regents, The University Of Texas System Methods and compositions for treatment of cancer using oligonucleotides
US5112605A (en) * 1989-03-17 1992-05-12 Genentech, Inc. Temporal gamma-interferon administration for allergies
US5693622A (en) 1989-03-21 1997-12-02 Vical Incorporated Expression of exogenous polynucleotide sequences cardiac muscle of a mammal
US5703055A (en) 1989-03-21 1997-12-30 Wisconsin Alumni Research Foundation Generation of antibodies through lipid mediated DNA delivery
US5629158A (en) * 1989-03-22 1997-05-13 Cemu Bitecknik Ab Solid phase diagnosis of medical conditions
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5399346A (en) * 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
US4981684A (en) * 1989-10-24 1991-01-01 Coopers Animal Health Limited Formation of adjuvant complexes
US5178860A (en) * 1989-09-01 1993-01-12 Coopers Animal Health Limited Adjuvant complexes and vaccine made therefrom
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5676954A (en) 1989-11-03 1997-10-14 Vanderbilt University Method of in vivo delivery of functioning foreign genes
US5786189A (en) 1989-11-29 1998-07-28 Smithkline Beecham Biologicals (S.A.) Vaccine
US5457189A (en) 1989-12-04 1995-10-10 Isis Pharmaceuticals Antisense oligonucleotide inhibition of papillomavirus
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5514788A (en) * 1993-05-17 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
US5248670A (en) 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
US5166195A (en) 1990-05-11 1992-11-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides
EP1493825A3 (en) 1990-06-11 2005-02-09 Gilead Sciences, Inc. Method for producing nucleic acid ligands
EP0468520A3 (en) 1990-07-27 1992-07-01 Mitsui Toatsu Chemicals, Inc. Immunostimulatory remedies containing palindromic dna sequences
US5245022A (en) * 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
ATE154947T1 (en) 1990-08-16 1997-07-15 Isis Pharmaceuticals Inc OLIGONUCLEOTIDES FOR MODULATING THE EFFECTS OF CYTOMEGALOVIRUS INFECTIONS
US6042838A (en) 1991-02-15 2000-03-28 Uab Research Foundation immunogenic compositions for mucosal administration of pneumococcal surface protein A (PspA)
JP3507486B2 (en) * 1991-03-15 2004-03-15 アムジエン・インコーポレーテツド Intrapulmonary administration of granulocyte colony-stimulating factor
US5683985A (en) 1991-04-18 1997-11-04 The Salk Institute For Biological Studies Oligonucleotide decoys and methods relating thereto
US5498410A (en) * 1991-04-22 1996-03-12 Gleich; Gerald J. Method for the treatment of eosinophil-associated conditions with anionic polymers
US5681555A (en) 1991-04-22 1997-10-28 Gleich; Gerald J. Method for the treatment of bronchial asthma by parenteral administration of anionic polymers
WO1994008003A1 (en) 1991-06-14 1994-04-14 Isis Pharmaceuticals, Inc. ANTISENSE OLIGONUCLEOTIDE INHIBITION OF THE ras GENE
CA2110040A1 (en) 1991-05-31 1992-12-10 Lyle J. Arnold, Jr. Compositions and delivery systems for transdermal administration of neutral oligomers
US5582986A (en) 1991-06-14 1996-12-10 Isis Pharmaceuticals, Inc. Antisense oligonucleotide inhibition of the ras gene
US6030954A (en) * 1991-09-05 2000-02-29 University Of Connecticut Targeted delivery of poly- or oligonucleotides to cells
US5576302A (en) 1991-10-15 1996-11-19 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating hepatitis C virus having phosphorothioate linkages of high chiral purity
CA2123611A1 (en) 1991-11-15 1993-05-27 Alan M. Gewirtz Treatment of melanoma with antisense oligonucleotides to c-myb proto-oncogene
WO1993010138A1 (en) 1991-11-18 1993-05-27 Tanox Biosystems, Inc. Anti-sense oligonucleotides for isotype-specific suppression of immunoglobulin production
US5858784A (en) * 1991-12-17 1999-01-12 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol- and liposome-based delivery
WO1993015207A2 (en) 1992-02-04 1993-08-05 Viagene, Inc. Hepatitis therapeutics
US5643578A (en) * 1992-03-23 1997-07-01 University Of Massachusetts Medical Center Immunization by inoculation of DNA transcription unit
US6498147B2 (en) 1992-05-22 2002-12-24 The Scripps Research Institute Suppression of nuclear factor-κb dependent processes using oligonucleotides
IL105914A0 (en) 1992-06-04 1993-10-20 Univ California Methods and compositions for in vivo gene therapy
US5726518A (en) * 1992-07-22 1998-03-10 Nikon Corporation Supporting device of relative moving element of vibration actuator or vibration motor
US5585479A (en) 1992-07-24 1996-12-17 The United States Of America As Represented By The Secretary Of The Navy Antisense oligonucleotides directed against human ELAM-I RNA
DE69316369D1 (en) 1992-07-27 1998-02-19 Hybridon Inc Oligonukleotid alkylphosphonothiate
WO1994004196A1 (en) 1992-08-14 1994-03-03 Imperial Cancer Research Technology Limited Tumour therapy
US5429199A (en) * 1992-08-26 1995-07-04 Kennametal Inc. Cutting bit and cutting insert
HUT72400A (en) 1992-10-05 1996-04-29 Hybridon Inc Therapeutic anti-hiv oligonucleotide, pharmaceutical compositions containing them and methods for use of compositions
US5593972A (en) * 1993-01-26 1997-01-14 The Wistar Institute Genetic immunization
EP0692972B2 (en) * 1993-04-02 2012-03-21 AntiCancer, Inc. Method for delivering beneficial compositions to hair follicles
US5567604A (en) * 1993-04-23 1996-10-22 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich oligonucleotides
SG54115A1 (en) * 1993-04-27 1998-11-16 Gerber Scient Products Inc Thermal printing apparatus with improved power supply
WO1994029461A1 (en) 1993-06-11 1994-12-22 Commonwealth Scientific And Industrial Research Organisation Method for specific silencing of genes by dna methylation
WO1995000638A2 (en) * 1993-06-23 1995-01-05 Genesys Pharma Inc. Antisense oligonucleotides and therapeutic use thereof in human immunodeficiency virus infection
CA2166889C (en) 1993-07-19 2001-09-11 Todd C. Peterson Oligonucleotides with activity against human immunodeficiency virus
US6004534A (en) 1993-07-23 1999-12-21 Massachusetts Institute Of Technology Targeted polymerized liposomes for improved drug delivery
US6605708B1 (en) 1993-07-28 2003-08-12 Hybridon, Inc. Building blocks with carbamate internucleoside linkages and oligonucleotides derived therefrom
US5849719A (en) 1993-08-26 1998-12-15 The Regents Of The University Of California Method for treating allergic lung disease
US5830877A (en) 1993-08-26 1998-11-03 The Regents Of The University Of California Method, compositions and devices for administration of naked polynucleotides which encode antigens and immunostimulatory
US5679647A (en) 1993-08-26 1997-10-21 The Regents Of The University Of California Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides
US20030109469A1 (en) 1993-08-26 2003-06-12 Carson Dennis A. Recombinant gene expression vectors and methods for use of same to enhance the immune response of a host to an antigen
AU705889B2 (en) 1993-08-26 1999-06-03 Regents Of The University Of California, The Method, compositions and devices for administration of naked polynucleotides which encode antigens and immunostimulatory peptides
US5804566A (en) 1993-08-26 1998-09-08 The Regents Of The University Of California Methods and devices for immunizing a host through administration of naked polynucleotides with encode allergenic peptides
US5985847A (en) 1993-08-26 1999-11-16 The Regents Of The University Of California Devices for administration of naked polynucleotides which encode biologically active peptides
FR2711670B1 (en) * 1993-10-22 1996-01-12 Pasteur Institut Nucleotide vector, composition containing it and vaccine for immunization against hepatitis.
DE4338704A1 (en) * 1993-11-12 1995-05-18 Hoechst Ag Stabilized oligonucleotides and their use
US5595756A (en) * 1993-12-22 1997-01-21 Inex Pharmaceuticals Corporation Liposomal compositions for enhanced retention of bioactive agents
EP0736093B1 (en) 1993-12-23 2003-03-19 BIOGNOSTIK GESELLSCHAFT FÜR BIOMOLEKULARE DIAGNOSTIK mbH ANTISENSE NUCLEIC ACIDS FOR THE PREVENTION AND TREATMENT OF DISORDERS IN WHICH EXPRESSION OF c-erbB-2 PLAYS A ROLL
US5712384A (en) 1994-01-05 1998-01-27 Gene Shears Pty Ltd. Ribozymes targeting retroviral packaging sequence expression constructs and recombinant retroviruses containing such constructs
US5728518A (en) * 1994-01-12 1998-03-17 The Immune Response Corporation Antiviral poly-and oligonucleotides
US5646126A (en) 1994-02-28 1997-07-08 Epoch Pharmaceuticals Sterol modified oligonucleotide duplexes having anticancer activity
CA2190121A1 (en) 1994-03-15 1995-09-21 Edith Mathiowitz Polymeric gene delivery system
US5596091A (en) * 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
WO1995026204A1 (en) 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US5451569A (en) 1994-04-19 1995-09-19 Hong Kong University Of Science And Technology R & D Corporation Limited Pulmonary drug delivery system
US5696248A (en) 1994-06-15 1997-12-09 Hoechst Aktiengesellschaft 3'-modified oligonucleotide derivatives
US5741516A (en) 1994-06-20 1998-04-21 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
EP1167378B1 (en) * 1994-07-15 2011-05-11 University of Iowa Research Foundation Immunomodulatory oligonucleotides
JPH10502820A (en) 1994-07-18 1998-03-17 ユニバーシティ・オブ・ノース・カロライナ・アット・チャペル・ヒル Oligonucleoside compounds and methods for inhibiting tumor growth, invasion and metastasis
ATE219660T1 (en) * 1994-09-30 2002-07-15 Inex Pharmaceuticals Corp AGENT FOR INTRODUCING POLYANIONIC MATERIALS INTO CELLS
US5753613A (en) * 1994-09-30 1998-05-19 Inex Pharmaceuticals Corporation Compositions for the introduction of polyanionic materials into cells
US6027726A (en) * 1994-09-30 2000-02-22 Inex Phamaceuticals Corp. Glycosylated protein-liposome conjugates and methods for their preparation
WO1996012008A1 (en) 1994-10-13 1996-04-25 Merck & Co., Inc. Synthesis of methylase-resistant genes
US6630455B1 (en) 1995-01-13 2003-10-07 Vanderbilt University Methods for inducing mucosal immune responses
US5795587A (en) * 1995-01-23 1998-08-18 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
US6008202A (en) * 1995-01-23 1999-12-28 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
US5674483A (en) * 1995-01-31 1997-10-07 National Jewish Medical And Research Center Treatment for diseases involving inflammation
DE19502912A1 (en) 1995-01-31 1996-08-01 Hoechst Ag G-Cap Stabilized Oligonucleotides
WO1996024380A1 (en) 1995-02-09 1996-08-15 Icn Pharmaceuticals, Inc. Methods and compositions for regulation of cd28 expression
US5932556A (en) 1995-09-17 1999-08-03 Tam; Robert C Methods and compositions for regulation of CD28 expression
GB9505438D0 (en) 1995-03-17 1995-05-03 Sod Conseils Rech Applic Antisense oligonucleotides
US5703057A (en) 1995-04-07 1997-12-30 Board Of Regents The University Of Texas System Expression library immunization
CA2192674C (en) 1995-04-13 2001-02-13 John Mcmichael Methods for treating respiratory disease
US6096721A (en) * 1995-04-13 2000-08-01 Milkhaus Laboratory, Inc. Method for treating mucositis by sublingual administration of DNA
UA56132C2 (en) 1995-04-25 2003-05-15 Смітклайн Бічем Байолоджікалс С.А. Vaccine composition (variants), method for stabilizing qs21 providing resistance against hydrolysis (variants), method for manufacturing vaccine
CA2220433C (en) 1995-05-11 2010-02-16 Applied Research Systems Ars Holding N.V. Il-6 activity inhibitor
US5955059A (en) * 1995-06-06 1999-09-21 Trustees Of Boston University Use of locally applied DNA fragments
US6025339A (en) * 1995-06-07 2000-02-15 East Carolina University Composition, kit and method for treatment of disorders associated with bronchoconstriction and lung inflammation
US5830878A (en) 1995-06-07 1998-11-03 Megabios Corporation Cationic lipid: DNA complexes for gene targeting
US7034007B1 (en) * 1995-06-07 2006-04-25 East Carolina University Low adenosine anti-sense oligonucleotide, compositions, kit & method for treatment of airway disorders associated with bronchoconstriction, lung inflammation, allergy(ies) & surfactant depletion
US6040296A (en) * 1995-06-07 2000-03-21 East Carolina University Specific antisense oligonucleotide composition & method for treatment of disorders associated with bronchoconstriction and lung inflammation
US5705385A (en) * 1995-06-07 1998-01-06 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5981501A (en) 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
EP1489184A1 (en) 1995-06-07 2004-12-22 Inex Pharmaceutical Corp. Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5994315A (en) 1995-06-07 1999-11-30 East Carolina University Low adenosine agent, composition, kit and method for treatment of airway disease
WO1997000957A1 (en) 1995-06-23 1997-01-09 President And Fellows Of Harvard College Transcriptional regulation of genes encoding vascular endothelial growth factor receptors
US5985662A (en) 1995-07-13 1999-11-16 Isis Pharmaceuticals Inc. Antisense inhibition of hepatitis B virus replication
CA2227287A1 (en) 1995-07-21 1997-02-06 Brown University Research Foundation A method for gene therapy using nucleic acid loaded polymeric microparticles
US6248720B1 (en) * 1996-07-03 2001-06-19 Brown University Research Foundation Method for gene therapy using nucleic acid loaded polymeric microparticles
US5968909A (en) 1995-08-04 1999-10-19 Hybridon, Inc. Method of modulating gene expression with reduced immunostimulatory response
US6667293B1 (en) * 1995-09-12 2003-12-23 Hybridon, Inc. Use of cyclodextrins to modulate gene expression with reduced immunostimulatory response
CZ97798A3 (en) 1995-10-04 1999-02-17 Immunex Corporation Use of flt3 ligand, vaccine adjuvans, expansion media, preparation and cell population and method
US5736152A (en) * 1995-10-27 1998-04-07 Atrix Laboratories, Inc. Non-polymeric sustained release delivery system
WO1997028259A1 (en) 1996-01-30 1997-08-07 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
US20030078223A1 (en) * 1996-01-30 2003-04-24 Eyal Raz Compositions and methods for modulating an immune response
SE9600647D0 (en) 1996-02-21 1996-02-21 Bror Morein New use
US5994316A (en) 1996-02-21 1999-11-30 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
SE9600648D0 (en) * 1996-02-21 1996-02-21 Bror Morein Receptor binding unit
US5843770A (en) 1996-03-11 1998-12-01 The Immune Response Corporation Antisense constructs directed against viral post-transcriptional regulatory sequences
US6620805B1 (en) 1996-03-14 2003-09-16 Yale University Delivery of nucleic acids by porphyrins
US6121247A (en) 1996-03-29 2000-09-19 The Johns Hopkins University Therapy for allergic diseases
US6184037B1 (en) 1996-05-17 2001-02-06 Genemedicine, Inc. Chitosan related compositions and methods for delivery of nucleic acids and oligonucleotides into a cell
JP2002514047A (en) 1996-07-10 2002-05-14 イミュネックス・コーポレーション How to activate dendritic cells
DE69736692T2 (en) 1996-07-16 2007-06-14 Archibald James Mixson Cationic vehicle: DNA complexes and their use in gene therapy
US5854418A (en) 1996-07-25 1998-12-29 The Trustees Of Columbia University In The City Of New York Kaposi's sarcoma-associated herpesvirus (KSHV) viral macrophage inflammatory protein-1α II (vMIP-1α II) and uses thereof
US5856462A (en) 1996-09-10 1999-01-05 Hybridon Incorporated Oligonucleotides having modified CpG dinucleosides
DE19637223A1 (en) * 1996-09-13 1998-04-09 Beiersdorf Ag Removable, self-adhesive device
ES2241042T3 (en) * 1996-10-11 2005-10-16 The Regents Of The University Of California IMMUNO STIMULATOR POLINUCLEOTIDE CONJUGATES / IMMUNOMODULATOR MOLECULA.
US6562345B1 (en) * 1996-11-12 2003-05-13 City Of Hope Immuno-reactive peptide CTL epitopes of human cytomegalovirus
US6797276B1 (en) * 1996-11-14 2004-09-28 The United States Of America As Represented By The Secretary Of The Army Use of penetration enhancers and barrier disruption agents to enhance the transcutaneous immune response
US20060002949A1 (en) * 1996-11-14 2006-01-05 Army Govt. Of The Usa, As Rep. By Secretary Of The Office Of The Command Judge Advocate, Hq Usamrmc. Transcutaneous immunization without heterologous adjuvant
US20060002959A1 (en) * 1996-11-14 2006-01-05 Government Of The United States Skin-sctive adjuvants for transcutaneous immuization
SE9604296D0 (en) 1996-11-22 1996-11-22 Astra Ab New pharmaceutical formulation of polypeptides
HU0000769A (en) 1996-12-27 2000-07-28 G-rich oligo aptamers and methods of modulating an immune response
FR2757876B1 (en) 1996-12-27 1999-04-09 Biovector Therapeutics Sa CONJUGATES OF A PARTICULATE VECTOR AND OLIGONUCLEOTIDES, THEIR PREPARATION METHOD AND THE PHARMACEUTICAL COMPOSITIONS CONTAINING THEM
US20030064945A1 (en) * 1997-01-31 2003-04-03 Saghir Akhtar Enzymatic nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors
GB9702021D0 (en) 1997-01-31 1997-03-19 Imperial College Medicaments
US7517952B1 (en) * 1997-02-25 2009-04-14 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US6214806B1 (en) * 1997-02-28 2001-04-10 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders
CA2283557A1 (en) * 1997-03-10 1998-09-17 Heather L. Davis Use of nucleic acids containing unmethylated cpg dinucleotide as an adjuvant
US5965542A (en) 1997-03-18 1999-10-12 Inex Pharmaceuticals Corp. Use of temperature to control the size of cationic liposome/plasmid DNA complexes
US6426334B1 (en) 1997-04-30 2002-07-30 Hybridon, Inc. Oligonucleotide mediated specific cytokine induction and reduction of tumor growth in a mammal
US6835395B1 (en) 1997-05-14 2004-12-28 The University Of British Columbia Composition containing small multilamellar oligodeoxynucleotide-containing lipid vesicles
US20030104044A1 (en) * 1997-05-14 2003-06-05 Semple Sean C. Compositions for stimulating cytokine secretion and inducing an immune response
DE69841002D1 (en) * 1997-05-14 2009-09-03 Univ British Columbia Highly effective encapsulation of nucleic acids in lipid vesicles
JP2001526688A (en) 1997-05-19 2001-12-18 メルク エンド カンパニー インコーポレーテッド Oligonucleotide adjuvant
US20040006034A1 (en) * 1998-06-05 2004-01-08 Eyal Raz Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US6589940B1 (en) 1997-06-06 2003-07-08 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
DE69840850D1 (en) * 1997-06-06 2009-07-09 Dynavax Tech Corp INHIBITORS OF IMMUNSTIMULATORY DNA SEQUENCE ACTIVITY
AU8428998A (en) 1997-07-24 1999-02-16 Inex Pharmaceuticals Corporation Preparation of lipid-nucleic acid particles using a solvent extraction and direct hydration method
US5877309A (en) * 1997-08-13 1999-03-02 Isis Pharmaceuticals, Inc. Antisense oligonucleotides against JNK
WO1999009154A2 (en) 1997-08-19 1999-02-25 Hybridon, Inc. Novel hiv-specific synthetic oligonucleotides and methods of their use
AU757175B2 (en) 1997-09-05 2003-02-06 Regents Of The University Of California, The Use of immunostimulatory oligonucleotides for preventing or reducing antigen-stimulated, granulocyte-mediated inflammation
US6749856B1 (en) 1997-09-11 2004-06-15 The United States Of America, As Represented By The Department Of Health And Human Services Mucosal cytotoxic T lymphocyte responses
NZ504894A (en) * 1997-12-02 2002-12-20 Powderject Vaccines Inc Crystalline vaccine and adjuvant compositions jointly and separately administered to animals using a transdermal or transmucosally delivery technique
AU1656799A (en) 1997-12-12 1999-07-05 Inex Pharmaceuticals Corp. Cationic drugs encapsulated in anionic liposomes
US7393630B2 (en) * 1997-12-16 2008-07-01 Novartis Vaccines And Diagnostics, Inc. Use of microparticles combined with submicron oil-in-water emulsions
DE69834133D1 (en) 1997-12-23 2006-05-18 Inex Pharmaceuticals Corp NYLON Oligomers
US20050031638A1 (en) * 1997-12-24 2005-02-10 Smithkline Beecham Biologicals S.A. Vaccine
GB9727262D0 (en) 1997-12-24 1998-02-25 Smithkline Beecham Biolog Vaccine
JPH11209289A (en) * 1998-01-22 1999-08-03 Taisho Pharmaceut Co Ltd Mucosal immunity inducer
BR9908278A (en) 1998-02-25 2002-01-02 Iomai Corp Use of agents to improve penetration and break through skin barriers, improve the immune transcutaneous response induced by the adp ribosylation ethoxine
CN1159348C (en) * 1998-03-12 2004-07-28 卢西特国际英国有限公司 Polymer composition
NZ506603A (en) 1998-04-09 2002-10-25 Smithkline Beecham Biolog S Adjuvant compositions comprising polyoxyethylene ether or polyoxyethylene ester
DE69932164D1 (en) 1998-04-28 2006-08-10 Inex Pharmaceuticals Corp POLYANIONIC POLYMERS WITH IMPROVED FUSOGENICITY
JP2002513763A (en) 1998-05-06 2002-05-14 ユニバーシティ オブ アイオワ リサーチ ファウンデーション Methods for preventing and treating parasitic infections and related diseases using CPG oligonucleotides
DK1077722T3 (en) 1998-05-22 2006-11-27 Ottawa Health Research Inst Methods and products for the induction of mucosa immunity
US6881561B1 (en) 1998-05-27 2005-04-19 Cheil Jedang Corporation Endonuclease of immune cell, process for producing the same and immune adjuvant using the same
US6248329B1 (en) * 1998-06-01 2001-06-19 Ramaswamy Chandrashekar Parasitic helminth cuticlin nucleic acid molecules and uses thereof
US6562798B1 (en) * 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
JP4627369B2 (en) 1998-06-10 2011-02-09 バイオグノスティック ゲゼルシャフト フュア バイオモレキュラー ダイアグノスティック ミット ベシュレンクテル ハフツング How to stimulate the immune system
WO1999066947A1 (en) * 1998-06-23 1999-12-29 The Board Of Trustees Of The Leland Stanford Junior University Adjuvant therapy
US6693086B1 (en) * 1998-06-25 2004-02-17 National Jewish Medical And Research Center Systemic immune activation method using nucleic acid-lipid complexes
US20030022854A1 (en) * 1998-06-25 2003-01-30 Dow Steven W. Vaccines using nucleic acid-lipid complexes
US20040247662A1 (en) 1998-06-25 2004-12-09 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
ATE237312T1 (en) 1998-07-20 2003-05-15 Protiva Biotherapeutics Inc NUCLEIC ACID COMPLEXES ENCAPSULATED IN LIPOSOMES
EP1100807A1 (en) 1998-07-27 2001-05-23 University Of Iowa Research Foundation STEREOISOMERS OF CpG OLIGONUCLEOTIDES AND RELATED METHODS
GB9817052D0 (en) 1998-08-05 1998-09-30 Smithkline Beecham Biolog Vaccine
EP0979869A1 (en) 1998-08-07 2000-02-16 Hoechst Marion Roussel Deutschland GmbH Short oligonucleotides for the inhibition of VEGF expression
US20010034330A1 (en) 1998-08-10 2001-10-25 Charlotte Kensil Innate immunity-stimulating compositions of CpG and saponin and methods thereof
ATE315405T1 (en) 1998-08-10 2006-02-15 Antigenics Inc CPG COMPOSITIONS, SAPONIN ADJUVANTS AND METHODS OF USE THEREOF
DE69943392D1 (en) * 1998-08-20 2011-06-09 Du Pont GENES FOR FATTY ACID MODIFYING ENZYMES OF PLANTS AND ASSOCIATED EDUCATION OF CONJUGATED DOUBLE BINDINGS
EP1108017A2 (en) 1998-09-03 2001-06-20 Coley Pharmaceutical GmbH G-motif oligonucleotides and uses thereof
US20020065236A1 (en) 1998-09-09 2002-05-30 Yew Nelson S. CpG reduced plasmids and viral vectors
FR2783170B1 (en) * 1998-09-11 2004-07-16 Pasteur Merieux Serums Vacc IMMUNOSTIMULATING EMULSION
ATE326239T1 (en) 1998-09-18 2006-06-15 Dynavax Tech Corp METHODS FOR TREATING IG-E ASSOCIATED DISEASES AND COMPOSITIONS FOR USE IN SUCH METHODS
EP1671646A3 (en) 1998-09-18 2007-08-29 Dynavax Technologies Corporation Methods of treating IgE-associated disorders and compositions for use therein
WO2000020039A1 (en) 1998-10-05 2000-04-13 The Regents Of The University Of California Methods and adjuvants for stimulating mucosal immunity
AU6425999A (en) 1998-10-09 2000-05-01 Dynavax Technologies Corporation Anti hiv compositions comprising immunostimulatory polynucleotides and hiv antigens
DE69935606T9 (en) 1998-10-16 2021-03-11 Glaxosmithkline Biologicals S.A. ADJUVANCE SYSTEMS AND VACCINE
AUPP807399A0 (en) 1999-01-08 1999-02-04 Csl Limited Improved immunogenic lhrh composition and methods relating thereto
EP1165773A4 (en) 1999-02-02 2005-01-05 Biocache Pharmaceuticals Inc Advanced antigen presentation platform
US6887464B1 (en) 1999-02-02 2005-05-03 Biocache Pharmaceuticals, Inc. Advanced antigen presentation platform
WO2000045849A2 (en) 1999-02-05 2000-08-10 Genzyme Corporation Use of cationic lipids to generate anti-tumor immunity
US6207819B1 (en) 1999-02-12 2001-03-27 Isis Pharmaceuticals, Inc. Compounds, processes and intermediates for synthesis of mixed backbone oligomeric compounds
AU3760100A (en) * 1999-03-16 2000-10-04 Panacea Pharmaceuticals, Llc Immunostimulatory nucleic acids and antigens
FR2790955B1 (en) 1999-03-19 2003-01-17 Assist Publ Hopitaux De Paris USE OF STABILIZED OLIGONUCLEOTIDES AS ANTI-TUMOR ACTIVE INGREDIENT
NZ513841A (en) 1999-03-19 2001-09-28 Smithkline Beecham Biolog S Vaccine against Streptococcus pneumoniae
US6625426B2 (en) * 1999-03-22 2003-09-23 Ronald Baratono Combined rear view mirror and telephone
US6977245B2 (en) * 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
WO2000061151A2 (en) 1999-04-12 2000-10-19 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
AU4642600A (en) 1999-04-15 2000-11-02 Regents Of The University Of California, The Methods and compositions for use in potentiating antigen presentation by antigenpresenting cells
US6558670B1 (en) * 1999-04-19 2003-05-06 Smithkline Beechman Biologicals S.A. Vaccine adjuvants
HU229255B1 (en) 1999-04-19 2013-10-28 Smithkline Beecham Biolog Vaccines
WO2000067023A1 (en) 1999-04-29 2000-11-09 Coley Pharmaceutical Gmbh Screening for immunostimulatory dna functional modifyers
US6737066B1 (en) * 1999-05-06 2004-05-18 The Immune Response Corporation HIV immunogenic compositions and methods
CA2372960C (en) 1999-05-06 2006-03-28 The Immune Response Corporation Hiv immunogenic compositions and methods
CA2376634A1 (en) 1999-06-08 2000-12-14 Aventis Pasteur Immunostimulant oligonucleotide
CA2412345A1 (en) 1999-06-16 2000-12-21 University Of Iowa Research Foundation Antagonism of immunostimulatory cpg-oligonucleotides by 4-aminoquinolines and other weak bases
GB9915204D0 (en) 1999-06-29 1999-09-01 Smithkline Beecham Biolog Vaccine
US20050002958A1 (en) * 1999-06-29 2005-01-06 Smithkline Beecham Biologicals Sa Vaccines
WO2001000232A2 (en) 1999-06-29 2001-01-04 Smithkline Beecham Biologicals S.A. Use of cpg as an adjuvant for hiv vaccine
US6514948B1 (en) * 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
FR2795963A1 (en) * 1999-07-08 2001-01-12 Pasteur Merieux Serums Vacc New polynucleotides are useful as vaccines for humans
DE19935756A1 (en) * 1999-07-27 2001-02-08 Mologen Forschungs Entwicklung Covalently closed nucleic acid molecule for immune stimulation
PT1200580E (en) 1999-08-13 2005-03-31 Hybridon Inc MODULATION OF IMMUNITARY STIMULATION MEASURED BY OLIGONUCLEOTIDES CPG THROUGH POSITIONAL MODIFICATION OF NUCLEOSIDOS
ATE419869T1 (en) 1999-08-19 2009-01-15 Dynavax Tech Corp METHOD FOR MODULATING AN IMMUNE RESPONSE USING IMMUNSTIMULATIVE SEQUENCES AND COMPOSITIONS THEREOF
US20050249794A1 (en) 1999-08-27 2005-11-10 Semple Sean C Compositions for stimulating cytokine secretion and inducing an immune response
US6395678B1 (en) * 1999-09-01 2002-05-28 Aero-Terra-Aqua Technologies Corporation Bead and process for removing dissolved metal contaminants
GB9921147D0 (en) 1999-09-07 1999-11-10 Smithkline Beecham Biolog Novel composition
GB9921146D0 (en) 1999-09-07 1999-11-10 Smithkline Beecham Biolog Novel composition
IL148844A0 (en) * 1999-09-27 2002-09-12 Coley Pharm Group Inc Methods related to immunostimulatory nucleic acid-induced interferon
JP2003512826A (en) * 1999-10-27 2003-04-08 カイロン コーポレイション Activation of HCV-specific T cells
US7223398B1 (en) 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
WO2001037869A1 (en) 1999-11-19 2001-05-31 Csl Limited Vaccine compositions
AU4139801A (en) * 1999-12-06 2001-06-12 Board Of Trustees Of The University Of Arkansas, The Controlled delivery of antigens
AU2593701A (en) 1999-12-21 2001-07-03 Regents Of The University Of California, The Method for preventing an anaphylactic reaction
WO2001051083A2 (en) 2000-01-13 2001-07-19 Antigenics Inc. Innate immunity-stimulating compositions of cpg and saponin and methods thereof
ATE378348T1 (en) * 2000-01-14 2007-11-15 Us Health OLIGODEOXYNUCLEOTIDES AND THEIR USE FOR INDUCING AN IMMUNE RESPONSE
AU3108001A (en) * 2000-01-20 2001-12-24 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for inducing a th2 immune response
US6852705B2 (en) * 2000-01-21 2005-02-08 Merial DNA vaccines for farm animals, in particular bovines and porcines
WO2001055370A2 (en) 2000-01-26 2001-08-02 Hybridon, Inc. MODULATION OF OLIGONUCLEOTIDE CpG-MEDIATED IMMUNE STIMULATION BY POSITIONAL MODIFICATION OF NUCLEOSIDES
AT409085B (en) 2000-01-28 2002-05-27 Cistem Biotechnologies Gmbh PHARMACEUTICAL COMPOSITION FOR IMMUNULATING AND PRODUCING VACCINES
WO2001055341A2 (en) 2000-01-31 2001-08-02 The Regents Of The University Of California Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
KR100808348B1 (en) 2000-01-31 2008-02-27 글락소스미스클라인 바이오로지칼즈 에스.에이. Vaccine for the prophylactic or therapeutic immunization against hiv
FR2805265B1 (en) 2000-02-18 2002-04-12 Aventis Pasteur IMMUNOSTIMULATING OLIGONUCLEOTIDES
US20030130217A1 (en) * 2000-02-23 2003-07-10 Eyal Raz Method for treating inflammatory bowel disease and other forms of gastrointestinal inflammation
CA2399550A1 (en) 2000-02-23 2001-08-30 The Regents Of The University Of California Method for treating inflammatory bowel disease and other forms of gastrointestinal inflammation
WO2001062275A1 (en) 2000-02-24 2001-08-30 The Board Of Trustees Of The Leland Stanford Junior University Adjuvant treatment by in vivo activation of dendritic cells
US20020156033A1 (en) * 2000-03-03 2002-10-24 Bratzler Robert L. Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer
US20020098199A1 (en) 2000-03-10 2002-07-25 Gary Van Nest Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
US20020028784A1 (en) * 2000-03-10 2002-03-07 Nest Gary Van Methods of preventing and treating viral infections using immunomodulatory polynucleotide sequences
US6851845B2 (en) * 2000-03-10 2005-02-08 The Maitland Company, Inc. Method and apparatus for processing waste material
US7157437B2 (en) * 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US20030129251A1 (en) * 2000-03-10 2003-07-10 Gary Van Nest Biodegradable immunomodulatory formulations and methods for use thereof
US20010046967A1 (en) 2000-03-10 2001-11-29 Gary Van Nest Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide
US7129222B2 (en) * 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US20020107212A1 (en) 2000-03-10 2002-08-08 Nest Gary Van Methods of reducing papillomavirus infection using immunomodulatory polynucleotide sequences
CA2404041A1 (en) 2000-03-28 2001-10-04 The Regents Of The University Of California Methods for increasing a cytotoxic t lymphocyte response in vivo
US8246945B2 (en) * 2000-04-06 2012-08-21 University Of Arkansas Methods and reagents for decreasing clinical reaction to allergy
US20020142978A1 (en) 2000-04-07 2002-10-03 Eyal Raz Synergistic improvements to polynucleotide vaccines
US7524826B2 (en) 2000-04-14 2009-04-28 Mcmaster University And Hamilton Health Sciences Corporation Method of inhibiting the generation of active thrombin on the surface of a cell within an atherosclerotic plaque
US6321873B1 (en) * 2000-04-21 2001-11-27 Tra-Lor-Mate, Inc. Ladder mounting system
EP1278761B1 (en) 2000-05-01 2005-04-06 Hybridon, Inc. MODULATION OF OLIGONUCLEOTIDE CpG-MEDIATED IMMUNE STIMULATION BY POSITIONAL MODIFICATION OF NUCLEOSIDES
US6893821B2 (en) * 2000-05-05 2005-05-17 The Regents Of The University Of California Agents that modulate DNA-PK activity and methods of use thereof
WO2001085751A1 (en) 2000-05-09 2001-11-15 Reliable Biopharmaceutical, Inc. Polymeric compounds useful as prodrugs
EP1280521B1 (en) 2000-05-12 2005-07-20 Pharmacia & Upjohn Company LLC Vaccine composition, method of preparing the same, and method of vaccinating vertebrates
US6339630B1 (en) * 2000-05-18 2002-01-15 The United States Of America As Represented By The United States Department Of Energy Sealed drive screw operator
GB0011903D0 (en) * 2000-05-18 2000-07-05 Astrazeneca Ab Combination chemotherapy
EP1292331A2 (en) 2000-06-07 2003-03-19 Biosynexus Incorporated Immunostimulatory rna/dna hybrid molecules
US20020165178A1 (en) * 2000-06-28 2002-11-07 Christian Schetter Immunostimulatory nucleic acids for the treatment of anemia, thrombocytopenia, and neutropenia
JP5511117B2 (en) 2000-07-27 2014-06-04 チルドレンズ ホスピタル アンド リサーチ センター アット オークランド Vaccine for broad protection against diseases caused by Neisseria meningitidis
WO2002009748A1 (en) 2000-07-31 2002-02-07 Yale University Innate immune system-directed vaccines
US20020198165A1 (en) * 2000-08-01 2002-12-26 Bratzler Robert L. Nucleic acids for the prevention and treatment of gastric ulcers
ES2299520T3 (en) 2000-09-01 2008-06-01 Epigenomics Ag PROCEDURE FOR THE DETERMINATION OF THE DEGREE OF METHYLATION OF CERTAIN CITOSINES IN GENOMIC DNA IN THE SEQUENTIAL CONTEXT 5'-CPG-3 '.
WO2002018631A2 (en) * 2000-09-01 2002-03-07 Epigenomics Ag Diagnosis of illnesses or predisposition to certain illnesses
GB0023008D0 (en) 2000-09-20 2000-11-01 Glaxo Group Ltd Improvements in vaccination
US6787524B2 (en) * 2000-09-22 2004-09-07 Tanox, Inc. CpG oligonucleotides and related compounds for enhancing ADCC induced by anti-IgE antibodies
AU9475001A (en) 2000-09-26 2002-04-08 Hybridon Inc Modulation of immunostimulatory activity of immunostimulatory oligonucleotide analogs by positional chemical changes
SE0003538D0 (en) * 2000-09-29 2000-09-29 Isconova Ab New immunogenic complex
US7537772B1 (en) * 2000-10-02 2009-05-26 Emergent Product Development Gaithersburg Inc. Chlamydia protein, gene sequence and the uses thereof
FR2814958B1 (en) 2000-10-06 2003-03-07 Aventis Pasteur VACCINE COMPOSITION
GB0025577D0 (en) * 2000-10-18 2000-12-06 Smithkline Beecham Biolog Vaccine
ES2377077T3 (en) * 2000-10-18 2012-03-22 Glaxosmithkline Biologicals S.A. Vaccines comprising the MAGE antigen bound to a protein D fragment
JP2004512383A (en) 2000-11-02 2004-04-22 アイネックス ファーマシューティカルズ コーポレイション Therapeutic oligonucleotides with reduced toxicity
US20020110840A1 (en) * 2000-12-08 2002-08-15 3M Innovative Properties Company Screening method for identifying compounds that selectively induce interferon alpha
WO2002052002A2 (en) * 2000-12-27 2002-07-04 Dynavax Technologies Corporation Immunomodulatory polynucleotides and methods of using the same
US7337306B2 (en) * 2000-12-29 2008-02-26 Stmicroelectronics, Inc. Executing conditional branch instructions in a data processor having a clustered architecture
US20030050268A1 (en) * 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
US7713942B2 (en) 2001-04-04 2010-05-11 Nordic Vaccine Technology A/S Cage-like microparticle complexes comprising sterols and saponins for delivery of polynucleotides
US7176296B2 (en) 2001-04-30 2007-02-13 Idera Pharmaceuticals, Inc. Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
US7105495B2 (en) 2001-04-30 2006-09-12 Idera Pharmaceuticals, Inc. Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
US20030129605A1 (en) 2001-05-04 2003-07-10 Dong Yu Immunostimulatory activity of CpG oligonucleotides containing non-ionic methylphosophonate linkages
WO2004030608A2 (en) * 2001-06-05 2004-04-15 The Regents Of The University Of Michigan Nanoemulsion vaccines
JP2005509591A (en) 2001-06-15 2005-04-14 リバファーム・インコーポレイテッド Nucleoside vaccine adjuvant
ES2487645T3 (en) 2001-06-21 2014-08-22 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of use thereof
US7785610B2 (en) 2001-06-21 2010-08-31 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—III
US20040132677A1 (en) 2001-06-21 2004-07-08 Fearon Karen L. Chimeric immunomodulatory compounds and methods of using the same-IV
WO2003000232A2 (en) 2001-06-25 2003-01-03 Yissum Research Development Company Of The Hebrew University Of Jerusalem Method for preparation of vesicles loaded with immunostimulator y oligodeoxynucleotides
US20030003970A1 (en) 2001-06-28 2003-01-02 Alan Johnson Portable communications device
US20030138458A1 (en) 2001-06-29 2003-07-24 Michael Houghton HCV E1E2 vaccine compositions
US6982033B2 (en) * 2001-07-13 2006-01-03 Donald Hubbard H Aerobic treatment plant with filter pipe
WO2003040308A2 (en) 2001-07-27 2003-05-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver cpg oligonucleotides in vivo
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
EP1420829A4 (en) * 2001-08-07 2006-05-17 Dynavax Tech Corp Immunomodulatory compositions, formulations, and methods for use thereof
JP2005510462A (en) 2001-08-10 2005-04-21 ダイナバックス テクノロジーズ コーポレイション Production of immunomodulating oligonucleotides and methods of use thereof
WO2003020884A2 (en) * 2001-08-14 2003-03-13 The Government Of The United States Of America As Represented By The Secretary Of Health And Human Services Method for rapid generation of mature dendritic cells
DE60229422D1 (en) * 2001-08-17 2008-11-27 Coley Pharm Gmbh COMBINATION MOTIF IMMUNOSTIMULATING OLIGONUCLEOTIDES WITH IMPROVED EFFECT
WO2003020889A2 (en) 2001-08-30 2003-03-13 3M Innovative Properties Company Methods of maturing plasmacytoid dendritic cells using immune response modifier molecules
WO2003027313A2 (en) * 2001-09-24 2003-04-03 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services SUPPRESSORS OF CpG OLIGONUCLEOTIDES AND METHODS OF USE
US20030119774A1 (en) * 2001-09-25 2003-06-26 Marianna Foldvari Compositions and methods for stimulating an immune response
DE60234782D1 (en) 2001-09-28 2010-01-28 Purdue Research Foundation TREATMENT PROCEDURE WITH LIGAND IMMUNOGENIC CONJUGATES
WO2003030656A2 (en) 2001-10-06 2003-04-17 Merial Limited Methods and compositions for promoting growth and innate immunity in young animals
US20050238660A1 (en) 2001-10-06 2005-10-27 Babiuk Lorne A Cpg formulations and related methods
US7276489B2 (en) 2002-10-24 2007-10-02 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
WO2003035836A2 (en) 2001-10-24 2003-05-01 Hybridon Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5' ends
WO2003039595A2 (en) 2001-11-07 2003-05-15 Inex Pharmaceuticals Corporation Mucosal adjuvants comprising an oligonucleotide and a cationic lipid
US20040014779A1 (en) 2001-11-16 2004-01-22 3M Innovative Properties Company Methods and compositions related to IRM compounds and toll-like recptor pathways
TW200303759A (en) * 2001-11-27 2003-09-16 Schering Corp Methods for treating cancer
EP1455833A1 (en) * 2001-12-04 2004-09-15 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, represented by THE DEPARTMENT OF HEALTH &amp; HUMAN SERVICES Chimeric molecule for the treatment of th2-like cytokine mediated disorders
DE10161755B4 (en) * 2001-12-15 2005-12-15 Infineon Technologies Ag Contact pin for testing microelectronic components with spherical contacts
US7615227B2 (en) * 2001-12-20 2009-11-10 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce angiogenesis
US8466116B2 (en) * 2001-12-20 2013-06-18 The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce epithelial cell growth
CA2471092A1 (en) 2001-12-21 2003-07-10 Antigenics Inc. Compositions comprising immunoreactive reagents and saponins, and methods of use thereof
JP2005526497A (en) 2002-02-04 2005-09-08 ビオミラ,インコーポレーテッド Immunostimulatory, covalently lipidated oligonucleotide
US8088388B2 (en) 2002-02-14 2012-01-03 United Biomedical, Inc. Stabilized synthetic immunogen delivery system
US20030232443A1 (en) 2002-06-18 2003-12-18 Isis Pharmaceuticals Inc. Antisense modulation of centromere protein B expression
EP1496925A4 (en) * 2002-04-11 2007-05-30 Zymogenetics Inc Use of interleukin-24 to treat ovarian cancer
JP2006515266A (en) * 2002-04-22 2006-05-25 バイオニケ ライフ サイエンシーズ インコーポレイテッド Oligonucleotide compositions and their use for modulating immune responses
US6948271B2 (en) * 2002-05-06 2005-09-27 Innovative Supply, Inc. Identification and tracking system for deceased bodies
EP1502012A4 (en) * 2002-05-08 2009-07-01 Btu Int Plasma-assisted engine exhaust treatment
JP2005525414A (en) 2002-05-10 2005-08-25 イネックス ファーマシューティカルズ コーポレイション Pathogen vaccine and method of use
WO2003094963A2 (en) 2002-05-10 2003-11-20 Inex Pharmaceuticals Corporation Methylated immunostimulatory oligonucleotides and methods of using the same
US20040009944A1 (en) 2002-05-10 2004-01-15 Inex Pharmaceuticals Corporation Methylated immunostimulatory oligonucleotides and methods of using the same
EP1507850A1 (en) 2002-05-28 2005-02-23 MERCK PATENT GmbH A method for generating antigen-presenting cells
AU2003267986A1 (en) * 2002-07-03 2004-01-23 Depuy Mitek, Inc. Vaccines to induce mucosal immunity
US7605138B2 (en) 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
AU2003255969A1 (en) 2002-07-17 2004-02-02 Coley Pharmaceutical Gmbh Use of cpg nucleic acids in prion-disease
CN1468957A (en) 2002-07-19 2004-01-21 中国人民解放军第二军医大学 Plasmid used as human therapeutic vaccine adjuvant
US20050209183A1 (en) 2002-07-25 2005-09-22 Phenion Gmbh & Co. Kg Cosmetic or pharmaceutical preparations comprising nucleic acids based on non-methylated CPG motifs
EP1393745A1 (en) 2002-07-29 2004-03-03 Hybridon, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5'ends
EP1575504A4 (en) * 2002-08-01 2009-11-04 Us Gov Health & Human Serv Method of treating inflammatory arthropathies with suppressors of cpg oligonucleotides
EP1551376A4 (en) 2002-08-12 2010-10-06 Dynavax Tech Corp Immunomodulatory compositions, methods of making, and methods of use thereof
US6928476B2 (en) * 2002-08-23 2005-08-09 Mirra, Inc. Peer to peer remote data storage and collaboration
US6744084B2 (en) * 2002-08-29 2004-06-01 Micro Technology, Inc. Two-transistor pixel with buried reset channel and method of formation
CN100536853C (en) * 2002-09-13 2009-09-09 艾登尼科斯(开曼)有限公司 Ss-l-2'-deoxynucleosides for the treatment of resistant HBV strains and combination therapies
US6994870B2 (en) * 2002-09-18 2006-02-07 Jaw-Ji Tsai Local nasal immunotherapy with allergen strip for allergic rhinitis
US8263091B2 (en) * 2002-09-18 2012-09-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
WO2004026888A2 (en) 2002-09-19 2004-04-01 Coley Pharmaceutical Gmbh Toll-like receptor 9 (tlr9) from various mammalian species
US6988995B2 (en) * 2002-09-30 2006-01-24 Carl Zeiss Meditec, Inc. Method and system for detecting the effects of Alzheimer's disease in the human retina
US8043622B2 (en) * 2002-10-08 2011-10-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides
WO2004041183A2 (en) 2002-11-01 2004-05-21 The Regents Of The University Of California Methods of treating pulmonary fibrotic disorders
AU2003304107B2 (en) * 2002-11-01 2008-05-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of preventing infections from bioterrorism agents with immunostimulatory CpG oligonucleotides
KR100525321B1 (en) 2002-12-13 2005-11-02 안웅식 Pharmaceutical composition for prophylaxis and treatment of papillomavirus-derived diseases comprising papillomavirus antigen protein and CpG-oligodeoxynucleotide
AU2003302743B2 (en) 2002-12-23 2008-09-04 Dynavax Technologies Corporation Branched immunomodulatory compounds and methods of using the same
ATE544772T1 (en) * 2002-12-23 2012-02-15 Dynavax Tech Corp IMMUNO-STIMULATING SEQUENCE OLIGONUCLEOTIDES AND METHOD OF USE THEREOF
EP1601789A4 (en) 2003-01-16 2007-10-31 Idera Pharmaceuticals Inc Modulation of immunostimulatory properties of oligonucleotide-based compounds by utilizing modified immunostimulatory dinucleotides
US7189781B2 (en) * 2003-03-13 2007-03-13 H.B. Fuller Licensing & Finance Inc. Moisture curable, radiation curable sealant composition
US20070041998A1 (en) 2003-03-24 2007-02-22 Intercell Ag Use of alum and a th1 immune response inducing adjuvant for enhancing immune responses
AU2004224761A1 (en) 2003-03-26 2004-10-07 Cytos Biotechnology Ag HIV-peptide-carrier-conjugates
AU2004226605A1 (en) 2003-04-02 2004-10-14 Coley Pharmaceutical Group, Ltd. Immunostimulatory nucleic acid oil-in-water formulations for topical application
WO2005016235A2 (en) * 2003-04-14 2005-02-24 The Regents Of The University Of California Combined use of impdh inhibitors with toll-like receptor agonists
WO2004094671A2 (en) 2003-04-22 2004-11-04 Coley Pharmaceutical Gmbh Methods and products for identification and assessment of tlr ligands
JP3887346B2 (en) * 2003-04-28 2007-02-28 株式会社東芝 Video signal processing apparatus, video signal processing method, and video display apparatus
MXPA05012421A (en) 2003-05-16 2006-02-22 Hybridon Inc Synergistic treatment of cancer using immunomers in conjunction with chemotherapeutic agents.
EP1484336A1 (en) * 2003-06-02 2004-12-08 Pevion Biotech Ltd. Methods for synthesizing conformationally constrained peptides, peptidometics and the use thereof as synthetic vaccines
ES2569927T3 (en) 2003-06-11 2016-05-13 Idera Pharmaceuticals, Inc. Stabilized immunomodulatory oligonucleotides
WO2004110489A1 (en) * 2003-06-13 2004-12-23 Daiichi Asubio Pharma Co., Ltd. MEDICINAL COMPOSITION FOR PREVENTING OR TREATING Th1 TYPE IMMUNOLOGICAL DISEASE
EP2356999A1 (en) * 2003-06-17 2011-08-17 Mannkind Corporation Compositions to elicit, enhance and sustain immune responses against MHC class I-restricted epitopes, for prophylactic or therapeutic purposes
US20040265833A1 (en) 2003-06-23 2004-12-30 Cathy Lofton-Day Methods and nucleic acids for the analysis of colorectal cell proliferative disorders
KR20060031607A (en) 2003-07-10 2006-04-12 사이토스 바이오테크놀로지 아게 Packaged virus-like particles
JP4734241B2 (en) 2003-07-11 2011-07-27 インターツェル・アクチェンゲゼルシャフト HCV vaccine
US20050013812A1 (en) 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
WO2005009355A2 (en) 2003-07-15 2005-02-03 Hybridon, Inc. Synergistic stimulation of the immune system using immunostimulatory oligonucleotides and/or immunomer compounds in conjunction with cytokines and/or chemotherapeutic agents or radiation therapy
EP1646427A1 (en) * 2003-07-22 2006-04-19 Cytos Biotechnology AG Cpg-packaged liposomes
AU2004269379A1 (en) 2003-08-28 2005-03-10 The Immune Response Corporation Immunogenic HIV compositions and related methods
DE602004026891D1 (en) * 2003-09-05 2010-06-10 Anadys Pharmaceuticals Inc TLR7 LIGANDS FOR THE TREATMENT OF HEPATITIS C
US20070110714A1 (en) 2003-09-08 2007-05-17 Norio Hayashi Medicinal composition for treatment of chronic hepatitis c
GB0321615D0 (en) * 2003-09-15 2003-10-15 Glaxo Group Ltd Improvements in vaccination
WO2005034979A2 (en) 2003-10-11 2005-04-21 Inex Pharmaceuticals Corporation Methods and compositions for enhancing innate immunity and antibody dependent cellular cytotoxicity
US20050215501A1 (en) 2003-10-24 2005-09-29 Coley Pharmaceutical Group, Inc. Methods and products for enhancing epitope spreading
UA88457C2 (en) 2003-10-30 2009-10-26 Коли Фармасьютикал Гмбх Immunostimulatory nucleic acid with enhanced immunostimulatory potency
US20050239733A1 (en) 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
JP4088246B2 (en) * 2003-12-05 2008-05-21 富士通株式会社 Ring network master setting method and apparatus
CN101094594B (en) 2003-12-08 2012-08-15 海布里顿公司 Modulation of immunostimulatory properties by small oligonucleotide-based compounds
US9090673B2 (en) 2003-12-12 2015-07-28 City Of Hope Synthetic conjugate of CpG DNA and T-help/CTL peptide
US20070172315A1 (en) * 2003-12-18 2007-07-26 Barrett Robert K Method and Apparatus for Creating Soil or Rock Subsurface Support
EP1550458A1 (en) 2003-12-23 2005-07-06 Vectron Therapeutics AG Synergistic liposomal adjuvants
KR100558851B1 (en) 2004-01-08 2006-03-10 학교법인연세대학교 Modified CpG oligodeoxynucleotide with improved immunoregulatory function
AU2005213460A1 (en) * 2004-02-06 2005-08-25 Mayo Foundation For Medical Education And Research Complexed polypeptide and adjuvant for improved vaccines
US20050181035A1 (en) 2004-02-17 2005-08-18 Dow Steven W. Systemic immune activation method using non CpG nucleic acids
TW200533750A (en) 2004-02-19 2005-10-16 Coley Pharm Group Inc Immunostimulatory viral RNA oligonucleotides
WO2005080567A1 (en) 2004-02-20 2005-09-01 Mologen Ag Substituted, non-coding nucleic acid molecule used for the therapeutic and prophylactic immune stimulation in humans and higher animals
US20050266015A1 (en) 2004-03-12 2005-12-01 Hybridon, Inc. Enhanced activity of HIV vaccine using a second generation immunomodulatory oligonucleotide
US7303881B2 (en) * 2004-04-30 2007-12-04 Pds Biotechnology Corporation Antigen delivery compositions and methods of use
WO2005115449A1 (en) * 2004-05-28 2005-12-08 Alk-Abelló A/S Method of treating allergy and infection by eliciting an iga antibody response
US8399025B2 (en) * 2004-06-04 2013-03-19 Board Of Regents, The University Of Texas System Polyamine modified particles
AU2005326144A1 (en) 2004-06-08 2006-08-03 Coley Pharmaceutical Gmbh Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
US7756043B1 (en) * 2004-06-09 2010-07-13 Sprint Communications Company L.P. Method for identifying high traffic origin-destination node pairs in a packet based network
US7498425B2 (en) 2004-06-15 2009-03-03 Idera Pharmaceuticals, Inc. Immunostimulatory oligonucleotide multimers
CA2570786C (en) 2004-06-15 2013-05-28 Idera Pharmaceuticals, Inc. Modified cpg-containing oligonucleotide multimers in immune stimulation
EP1766610A1 (en) * 2004-06-25 2007-03-28 TC Electronic A/S Method of evaluating perception intensity of an audio signal and a method of controlling an input audio signal on the basis of the evaluation
US7534449B2 (en) * 2004-07-01 2009-05-19 Yale University Targeted and high density drug loaded polymeric materials
JP2008506789A (en) 2004-07-18 2008-03-06 シーエスエル、リミテッド Immunostimulatory complex and oligonucleotide formulation for inducing enhanced interferon-gamma response
WO2006015560A1 (en) 2004-08-09 2006-02-16 Mologen Ag Immunomodulating agent used in conjunction with chemotherapy
US20060058261A1 (en) * 2004-09-15 2006-03-16 Andre Aube Chitin derivatives for hyperlipidemia
KR100721928B1 (en) * 2004-11-05 2007-05-28 주식회사 바이오씨에스 Pharmaceutical composition for treating or preventing dermatitis comprising CpG oligodeoxynucleotide
US20060105979A1 (en) 2004-11-08 2006-05-18 Hybridon, Inc. Synergistic inhibition of VEGF and modulation of the immune response
CA2594382A1 (en) 2005-01-07 2006-07-13 Alk-Abello A/S Method of preventive treatment of allergy by oromucosal administration of an allergy vaccine
BRPI0617254A2 (en) * 2005-01-12 2011-07-19 Cancer Rec Tech Ltd Single-stranded oligonucleotide, pharmaceutical composition, methods for stimulating tlr7 activity in a tlr7-expressing cell, for stimulating tlr8 activity in a tlr8-expressing cell, and for stimulating an immune response in a patient
JP2008531018A (en) * 2005-02-24 2008-08-14 コーリー ファーマシューティカル グループ,インコーポレイテッド Immunostimulatory oligonucleotide
SG161260A1 (en) 2005-04-08 2010-05-27 Coley Pharm Group Inc Methods for treating infectious disease exacerbated asthma
US20060241076A1 (en) 2005-04-26 2006-10-26 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
US7325152B2 (en) * 2005-06-30 2008-01-29 Infineon Technologies Ag Synchronous signal generator
US20090117132A1 (en) * 2005-07-07 2009-05-07 Pfizer, Inc. Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment
WO2007027718A1 (en) * 2005-08-31 2007-03-08 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods of altering an immune response induced by cpg oligodeoxynucleotides
BRPI0616235A2 (en) 2005-09-16 2011-06-14 Coley Pharm Gmbh phosphodiester main chain immunostimulatory monofilamentated ribonucleic acid
KR20080047463A (en) 2005-09-16 2008-05-28 콜리 파마슈티칼 게엠베하 Modulation of immunostimulatory properties of short interfering ribonucleic acid (sirna) by nucleotide modification
WO2007038720A2 (en) 2005-09-27 2007-04-05 Coley Pharmaceutical Gmbh Modulation of tlr-mediated immune responses using adaptor oligonucleotides
US20070093439A1 (en) 2005-10-25 2007-04-26 Idera Pharmaceuticals, Inc. Short immunomodulatory oligonucleotides
CA2625969A1 (en) * 2005-10-28 2007-05-03 Index Pharmaceuticals Ab Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease
US20070243209A1 (en) * 2005-10-28 2007-10-18 Health Research, Inc. Compositions and methods for prevention and treatment of fungal diseases
AU2006310339B2 (en) 2005-11-04 2013-01-10 Novartis Ag Influenza vaccines including combinations of particulate adjuvants and immunopotentiators
CN102755645A (en) 2005-11-04 2012-10-31 诺华疫苗和诊断有限公司 Influenza vaccines with reduced amount of emulsion adjuvant
US7470674B2 (en) 2005-11-07 2008-12-30 Idera Pharmaceuticals, Inc. Immunostimulatory properties of oligonucleotide-based compounds comprising modified immunostimulatory dinucleotides
US7776834B2 (en) 2005-11-07 2010-08-17 Idera Pharmaceuticals, Inc. Immunostimulatory properties of oligonucleotide-based compounds comprising modified immunostimulatory dinucleotides
MX2008006004A (en) 2005-11-07 2008-10-01 Idera Pharmaceuticals Inc Immunostimulatory properties of oligonucleotide-based compounds comprising modified immunostimulatory dinucleotides.
CA2628306C (en) 2005-11-07 2014-06-17 Sudhir Agrawal Immunostimulatory oligonucleotide-based compounds with glycerol-linked dinucleotides and modified guanosines at cpg and uses thereof
JP2009521218A (en) 2005-12-20 2009-06-04 イデラ ファーマシューティカルズ インコーポレイテッド Immunostimulatory action of palindromic immune modulatory oligonucleotides (IMO (TM)) containing palindromic segments of different lengths
EP2405002B1 (en) * 2006-02-15 2014-09-24 AdiuTide Pharmaceuticals GmbH Compositions and methods for oligonucleotide formulations
DE102006007433A1 (en) 2006-02-17 2007-08-23 Curevac Gmbh Immunostimulant adjuvant useful in vaccines against cancer or infectious diseases comprises a lipid-modified nucleic acid
WO2008019018A2 (en) * 2006-08-03 2008-02-14 William Soo Hoo Bioactive molecular matrix and methods of use in the treatment of disease
US20080124366A1 (en) * 2006-08-06 2008-05-29 Ohlfest John R Methods and Compositions for Treating Tumors
WO2008019486A1 (en) * 2006-08-16 2008-02-21 Protiva Biotherapeutics, Inc. Nucleic acid modulation of toll-like receptor-mediated immune stimulation
US8027888B2 (en) 2006-08-31 2011-09-27 Experian Interactive Innovation Center, Llc Online credit card prescreen systems and methods
WO2008033432A2 (en) 2006-09-12 2008-03-20 Coley Pharmaceutical Group, Inc. Immune modulation by chemically modified ribonucleosides and oligoribonucleotides
CN101516396B (en) * 2006-09-26 2013-10-09 传染性疾病研究院 Vaccine composition containing synthetic adjuvant
US20090181078A1 (en) * 2006-09-26 2009-07-16 Infectious Disease Research Institute Vaccine composition containing synthetic adjuvant
PT2078080E (en) 2006-09-27 2015-09-18 Coley Pharm Gmbh Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity
EP2068912A2 (en) 2006-09-27 2009-06-17 Coley Pharmaceutical Group, Inc. Compositions of tlr ligands and antivirals
US20100144846A1 (en) * 2006-10-26 2010-06-10 Coley Pharmaceutical Gmbh Oligoribonucleotides and uses thereof
WO2008057529A2 (en) * 2006-11-06 2008-05-15 Coley Pharmaceutical Group, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (cetp)
KR20090095626A (en) * 2006-12-04 2009-09-09 더 보드 오브 트러스티즈 오브 더 유니버시티 오브 일리노이 COMPOSITIONS AND METHODS TO TREAT CANCER WITH CpG RICH DNA AND CUPREDOXINS
US8057804B2 (en) * 2006-12-28 2011-11-15 The Trustees Of The University Of Pennsylvania Herpes simplex virus combined subunit vaccines and methods of use thereof
EP2591800A1 (en) * 2006-12-28 2013-05-15 The Trustees of The University of Pennsylvania Herpes simplex virus combined subunit vaccines and methods of use thereof
AR066405A1 (en) * 2007-04-20 2009-08-19 Glaxosmithkline Biolog Sa VACCINE
MX2009012482A (en) 2007-05-17 2009-12-02 Coley Pharm Group Inc Class a oligonucleotides with immunostimulatory potency.
JP2010536335A (en) * 2007-08-13 2010-12-02 ファイザー・インク Combinatorial motif immunostimulatory oligonucleotides with improved activity
CN101835487A (en) * 2007-08-21 2010-09-15 戴纳瓦克斯技术公司 Composition and methods of making and using influenza proteins
EP2185160B1 (en) * 2007-08-31 2019-02-13 Neurimmune Holding AG Method of providing patient specific immune response in amyloidoses and protein aggregation disorders
US7892567B2 (en) * 2007-10-01 2011-02-22 Board Of Regents, The University Of Texas System Methods and compositions for immunization against chlamydial infection and disease
CN101820908A (en) 2007-10-09 2010-09-01 科利制药公司 The immune stimulatory oligonucleotide analogs that comprises modified sugar moieties
TW200932274A (en) * 2007-12-18 2009-08-01 Alcon Res Ltd Interfering RNA delivery system and uses thereof
US7720322B2 (en) * 2008-06-30 2010-05-18 Intuitive Surgical, Inc. Fiber optic shape sensor
TWI351288B (en) * 2008-07-04 2011-11-01 Univ Nat Pingtung Sci & Tech Cpg dna adjuvant in avian vaccines
US20100166782A1 (en) * 2008-07-25 2010-07-01 Martha Karen Newell Clip inhibitors and methods of modulating immune function
US8053422B2 (en) * 2008-12-04 2011-11-08 The United States Of America As Represented By The Department Of Health And Human Services Anti-cancer oligodeoxynucleotides

Patent Citations (98)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3521637A (en) * 1967-11-28 1970-07-28 Nelson J Waterbury Tampon or similar sanitary napkin containing vitamin a
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US6107062A (en) * 1992-07-30 2000-08-22 Inpax, Inc. Antisense viruses and antisense-ribozyme viruses
US20050075302A1 (en) * 1994-03-25 2005-04-07 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US20070065467A1 (en) * 1994-07-15 2007-03-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20080026011A1 (en) * 1994-07-15 2008-01-31 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20060094683A1 (en) * 1994-07-15 2006-05-04 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040181045A1 (en) * 1994-07-15 2004-09-16 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20060058251A1 (en) * 1994-07-15 2006-03-16 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20070010470A9 (en) * 1994-07-15 2007-01-11 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20050049216A1 (en) * 1994-07-15 2005-03-03 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050037403A1 (en) * 1994-07-15 2005-02-17 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20070009482A9 (en) * 1994-07-15 2007-01-11 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20030050263A1 (en) * 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US20030050261A1 (en) * 1994-07-15 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid molecules
US20060003955A1 (en) * 1994-07-15 2006-01-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050004061A1 (en) * 1994-07-15 2005-01-06 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050171047A1 (en) * 1994-07-15 2005-08-04 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050148537A1 (en) * 1994-07-15 2005-07-07 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050123523A1 (en) * 1994-07-15 2005-06-09 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050101554A1 (en) * 1994-07-15 2005-05-12 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20070066553A1 (en) * 1994-07-15 2007-03-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20080031936A1 (en) * 1994-07-15 2008-02-07 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20070078104A1 (en) * 1994-07-15 2007-04-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050037985A1 (en) * 1994-07-15 2005-02-17 Krieg Arthur M. Methods and products for treating HIV infection
US20040087534A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050049215A1 (en) * 1994-07-15 2005-03-03 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040106568A1 (en) * 1994-07-15 2004-06-03 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20050032736A1 (en) * 1994-07-15 2005-02-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040132685A1 (en) * 1994-07-15 2004-07-08 The University Of Iowa Research Foundation Immunostimulatory nucleic acid
US20040142469A1 (en) * 1994-07-15 2004-07-22 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040143112A1 (en) * 1994-07-15 2004-07-22 Krieg Arthur M. Immunomodulatory oligonucleotides
US20040147468A1 (en) * 1994-07-15 2004-07-29 Krieg Arthur M Immunostimulatory nucleic acid molecules
US20040152657A1 (en) * 1994-07-15 2004-08-05 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20070202128A1 (en) * 1994-07-15 2007-08-30 Coley Pharmaceutical Group, Inc Immunomodulatory oligonucleotides
US20040152656A1 (en) * 1994-07-15 2004-08-05 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040162258A1 (en) * 1994-07-15 2004-08-19 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040162262A1 (en) * 1994-07-15 2004-08-19 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US7223741B2 (en) * 1994-07-15 2007-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050059625A1 (en) * 1994-07-15 2005-03-17 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20060089326A1 (en) * 1994-07-15 2006-04-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050054602A1 (en) * 1994-07-15 2005-03-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050004062A1 (en) * 1994-07-15 2005-01-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050009774A1 (en) * 1994-07-15 2005-01-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040171150A1 (en) * 1994-07-15 2004-09-02 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US6503533B1 (en) * 1994-07-28 2003-01-07 Georgetown University Antisense ogligonucleotides against Hepatitis B viral replication
US20030026782A1 (en) * 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
US5858987A (en) * 1995-05-05 1999-01-12 Mitotix, Inc. E6AP antisense constructs and methods of use
US5780448A (en) * 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
US6030955A (en) * 1996-03-21 2000-02-29 The Trustees Of Columbia University In The City Of New York And Imclone Systems, Inc. Methods of affecting intracellular phosphorylation of tyrosine using phosphorothioate oligonucleotides, and antiangiogenic and antiproliferative uses thereof
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US7001890B1 (en) * 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US20050043529A1 (en) * 1997-03-10 2005-02-24 Coley Pharmaceutical Gmbh Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6406705B1 (en) * 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050032734A1 (en) * 1997-05-20 2005-02-10 Krieg Arthur M. Vectors and methods for immunization or therapeutic protocols
US6399630B1 (en) * 1997-07-03 2002-06-04 University Of Iowa Research Foundation Methods for inhibiting immunostimulatory DNA associated responses
US6221882B1 (en) * 1997-07-03 2001-04-24 University Of Iowa Research Foundation Methods for inhibiting immunostimulatory DNA associated responses
US20050182017A1 (en) * 1997-10-30 2005-08-18 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20020064515A1 (en) * 1998-04-03 2002-05-30 Krieg Arthur M. Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20070184465A1 (en) * 1998-05-14 2007-08-09 Coley Pharmaceutical Gmbh Methods for regulating hematopoiesis using CpG-oligonucleotides
US20070066554A1 (en) * 1999-09-25 2007-03-22 Coley Pharmaceutical Gmbh Immunostimulatory nucleic acids
US20050169888A1 (en) * 1999-09-27 2005-08-04 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US20070037767A1 (en) * 2000-02-03 2007-02-15 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040067902A9 (en) * 2000-02-03 2004-04-08 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20060154890A1 (en) * 2000-02-03 2006-07-13 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US20020091097A1 (en) * 2000-09-07 2002-07-11 Bratzler Robert L. Nucleic acids for the prevention and treatment of sexually transmitted diseases
US20050181422A1 (en) * 2000-09-15 2005-08-18 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US20030181406A1 (en) * 2000-12-08 2003-09-25 Christian Schetter CpG-like nucleic acids and methods of use thereof
US20030055014A1 (en) * 2000-12-14 2003-03-20 Bratzler Robert L. Inhibition of angiogenesis by nucleic acids
US20030148316A1 (en) * 2001-08-01 2003-08-07 Lipford Grayson B. Methods and compositions relating to plasmacytoid dendritic cells
US20030166001A1 (en) * 2001-10-05 2003-09-04 Lipford Grayson B. Toll-like receptor 3 signaling agonists and antagonists
US20060188913A1 (en) * 2001-10-12 2006-08-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US20060172966A1 (en) * 2002-04-04 2006-08-03 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US7038029B2 (en) * 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040067905A1 (en) * 2002-07-03 2004-04-08 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040092472A1 (en) * 2002-07-03 2004-05-13 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040152649A1 (en) * 2002-07-03 2004-08-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20050059619A1 (en) * 2002-08-19 2005-03-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US20040171571A1 (en) * 2002-12-11 2004-09-02 Coley Pharmaceutical Group, Inc. 5' CpG nucleic acids and methods of use
US20050119273A1 (en) * 2003-06-20 2005-06-02 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (TLR) antagonists
US20050101577A1 (en) * 2003-09-19 2005-05-12 Pfizer Inc. 2-alkylidene-19-nor-vitamin D derivatives for the treatment of rickets or vitamin D deficiency
US20050130911A1 (en) * 2003-09-25 2005-06-16 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20050087538A1 (en) * 2003-10-23 2005-04-28 Wolfe Darrell R. Iceless multiple can cooler
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20060019916A1 (en) * 2004-04-02 2006-01-26 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for inducing IL-10 responses
US20070129320A9 (en) * 2004-07-18 2007-06-07 Coley Pharmaceutical Group, Ltd. Methods and compositions for inducing innate immune responses
US20060019923A1 (en) * 2004-07-18 2006-01-26 Coley Pharmaceutical Group, Ltd. Methods and compositions for inducing innate immune responses
US20060140875A1 (en) * 2004-10-20 2006-06-29 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US20070142315A1 (en) * 2005-11-25 2007-06-21 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides

Cited By (140)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050075302A1 (en) * 1994-03-25 2005-04-07 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US8158592B2 (en) 1994-07-15 2012-04-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acid molecules
US20040167089A1 (en) * 1994-07-15 2004-08-26 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7713529B2 (en) 1994-07-15 2010-05-11 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20100125101A1 (en) * 1994-07-15 2010-05-20 Krieg Arthur M Immunostimulatory nucleic acid molecules
US20030191079A1 (en) * 1994-07-15 2003-10-09 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US7723022B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050123523A1 (en) * 1994-07-15 2005-06-09 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20080031936A1 (en) * 1994-07-15 2008-02-07 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20080026011A1 (en) * 1994-07-15 2008-01-31 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040087534A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040087538A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US7879810B2 (en) 1994-07-15 2011-02-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040106568A1 (en) * 1994-07-15 2004-06-03 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20070202128A1 (en) * 1994-07-15 2007-08-30 Coley Pharmaceutical Group, Inc Immunomodulatory oligonucleotides
US20040142469A1 (en) * 1994-07-15 2004-07-22 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040147468A1 (en) * 1994-07-15 2004-07-29 Krieg Arthur M Immunostimulatory nucleic acid molecules
US20070078104A1 (en) * 1994-07-15 2007-04-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040152657A1 (en) * 1994-07-15 2004-08-05 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20070065467A1 (en) * 1994-07-15 2007-03-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20070010470A9 (en) * 1994-07-15 2007-01-11 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US7888327B2 (en) 1994-07-15 2011-02-15 University Of Iowa Research Foundation Methods of using immunostimulatory nucleic acid molecules to treat allergic conditions
US20040171150A1 (en) * 1994-07-15 2004-09-02 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040181045A1 (en) * 1994-07-15 2004-09-16 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040198688A1 (en) * 1994-07-15 2004-10-07 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8309527B2 (en) 1994-07-15 2012-11-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040229835A1 (en) * 1994-07-15 2004-11-18 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050148537A1 (en) * 1994-07-15 2005-07-07 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8008266B2 (en) 1994-07-15 2011-08-30 University Of Iowa Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US20060094683A1 (en) * 1994-07-15 2006-05-04 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050004061A1 (en) * 1994-07-15 2005-01-06 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050004062A1 (en) * 1994-07-15 2005-01-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050009774A1 (en) * 1994-07-15 2005-01-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US8258106B2 (en) 1994-07-15 2012-09-04 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050032736A1 (en) * 1994-07-15 2005-02-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8058249B2 (en) 1994-07-15 2011-11-15 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050049216A1 (en) * 1994-07-15 2005-03-03 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050049215A1 (en) * 1994-07-15 2005-03-03 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20060003955A1 (en) * 1994-07-15 2006-01-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050054602A1 (en) * 1994-07-15 2005-03-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050277609A1 (en) * 1994-07-15 2005-12-15 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050267057A1 (en) * 1994-07-15 2005-12-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8114848B2 (en) 1994-07-15 2012-02-14 The United States Of America As Represented By The Department Of Health And Human Services Immunomodulatory oligonucleotides
US20050101554A1 (en) * 1994-07-15 2005-05-12 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20050101557A1 (en) * 1994-07-15 2005-05-12 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7674777B2 (en) 1994-07-15 2010-03-09 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7723500B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050244379A1 (en) * 1994-07-15 2005-11-03 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050245477A1 (en) * 1994-07-15 2005-11-03 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050171047A1 (en) * 1994-07-15 2005-08-04 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050239732A1 (en) * 1994-07-15 2005-10-27 Krieg Arthur M Immunostimulatory nucleic acid molecules
US8129351B2 (en) 1994-07-15 2012-03-06 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050233999A1 (en) * 1994-07-15 2005-10-20 Krieg Arthur M Immunostimulatory nucleic acid molecules
US8148340B2 (en) 1994-07-15 2012-04-03 The United States Of America As Represented By The Department Of Health And Human Services Immunomodulatory oligonucleotides
US20090060927A1 (en) * 1997-01-23 2009-03-05 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20030224010A1 (en) * 1997-03-10 2003-12-04 Coley Pharmaceutical Gmbh Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030091599A1 (en) * 1997-03-10 2003-05-15 Coley Pharmaceutical Gmbh Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20020164341A1 (en) * 1997-03-10 2002-11-07 Loeb Health Research Institute At The Ottawa Hospital Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US8202688B2 (en) 1997-03-10 2012-06-19 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050043529A1 (en) * 1997-03-10 2005-02-24 Coley Pharmaceutical Gmbh Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20110081366A1 (en) * 1997-10-30 2011-04-07 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20040235777A1 (en) * 1998-05-14 2004-11-25 Coley Pharmaceutical Gmbh Methods for regulating hematopoiesis using CpG-oligonucleotides
US20040235778A1 (en) * 1998-05-14 2004-11-25 Coley Pharmaceutical Gmbh Methods for regulating hematopoiesis using CpG-oligonucleotides
US20040234512A1 (en) * 1998-05-14 2004-11-25 Coley Pharmaceutical Gmbh Methods for regualting hematopoiesis using CpG-oligonucleotides
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US7741300B2 (en) 1998-06-25 2010-06-22 National Jewish Medical And Research Center Methods of using nucleic acid vector-lipid complexes
US20040157791A1 (en) * 1998-06-25 2004-08-12 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
US8173141B2 (en) 1999-02-17 2012-05-08 Csl Limited Immunogenic complexes and methods relating thereto
US20100010193A1 (en) * 1999-02-17 2010-01-14 Csl Limited Immunogenic complexes and methods relating thereto
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US20030212026A1 (en) * 1999-09-25 2003-11-13 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US20060286070A1 (en) * 1999-09-27 2006-12-21 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US20110033421A1 (en) * 1999-09-27 2011-02-10 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US7776344B2 (en) 1999-09-27 2010-08-17 University Of Iowa Research Foundation Methods related to immunostimulatory nucleic acid-induced interferon
US20040235774A1 (en) * 2000-02-03 2004-11-25 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20060154890A1 (en) * 2000-02-03 2006-07-13 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20070037767A1 (en) * 2000-02-03 2007-02-15 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US20070009710A1 (en) * 2000-08-04 2007-01-11 Toyo Boseki Kabushiki Kaisha Flexible metal-clad laminate and method for producing the same
US20050181422A1 (en) * 2000-09-15 2005-08-18 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US7820379B2 (en) 2000-09-15 2010-10-26 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US20080226649A1 (en) * 2000-12-08 2008-09-18 Coley Pharmaceutical Gmbh CPG-like nucleic acids and methods of use thereof
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US20030148976A1 (en) * 2001-08-17 2003-08-07 Krieg Arthur M. Combination motif immune stimulatory oligonucleotides with improved activity
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US20060172966A1 (en) * 2002-04-04 2006-08-03 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US8658607B2 (en) 2002-04-04 2014-02-25 Zoetis Belgium Immunostimulatory G, U-containing oligoribonucleotides
US20030232074A1 (en) * 2002-04-04 2003-12-18 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US9428536B2 (en) 2002-04-04 2016-08-30 Zoetis Belgium Sa Immunostimulatory G, U-containing oligoribonucleotides
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US8114419B2 (en) 2002-07-03 2012-02-14 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20090311277A1 (en) * 2002-07-03 2009-12-17 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040067905A1 (en) * 2002-07-03 2004-04-08 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040092472A1 (en) * 2002-07-03 2004-05-13 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040152649A1 (en) * 2002-07-03 2004-08-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040198680A1 (en) * 2002-07-03 2004-10-07 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US8304396B2 (en) 2002-08-19 2012-11-06 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US8283328B2 (en) 2002-08-19 2012-10-09 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20050059619A1 (en) * 2002-08-19 2005-03-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20060246035A1 (en) * 2002-10-29 2006-11-02 Coley Pharmaceutical Gmbh Methods and products related to treatment and prevention of hepatitis c virus infection
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US20040171571A1 (en) * 2002-12-11 2004-09-02 Coley Pharmaceutical Group, Inc. 5' CpG nucleic acids and methods of use
US7410975B2 (en) 2003-06-20 2008-08-12 Coley Pharmaceutical Group, Inc. Small molecule toll-like receptor (TLR) antagonists
US20050119273A1 (en) * 2003-06-20 2005-06-02 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (TLR) antagonists
US20050013812A1 (en) * 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
US20050130911A1 (en) * 2003-09-25 2005-06-16 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20100183639A1 (en) * 2003-09-25 2010-07-22 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20050239734A1 (en) * 2003-10-30 2005-10-27 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US8188254B2 (en) 2003-10-30 2012-05-29 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050256073A1 (en) * 2004-02-19 2005-11-17 Coley Pharmaceutical Group, Inc. Immunostimulatory viral RNA oligonucleotides
US20090137519A1 (en) * 2004-10-20 2009-05-28 Coley Pharmaceutical Group, Inc. Semi-soft c-class immunostimulatory oligonucleotides
US7795235B2 (en) 2004-10-20 2010-09-14 Coley Pharmaceutical Gmbh Semi-soft c-class immunostimulatory oligonucleotides
US20110201672A1 (en) * 2004-10-20 2011-08-18 Krieg Arthur M Semi-soft c-class immunostimulatory oligonucleotides
US20060140875A1 (en) * 2004-10-20 2006-06-29 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US20060211644A1 (en) * 2005-02-24 2006-09-21 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US20080009455A9 (en) * 2005-02-24 2008-01-10 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US20060229271A1 (en) * 2005-04-08 2006-10-12 Coley Pharmaceutical Group, Inc. Methods for treating infectious disease exacerbated asthma
US20060241076A1 (en) * 2005-04-26 2006-10-26 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20090117132A1 (en) * 2005-07-07 2009-05-07 Pfizer, Inc. Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment
US20090306177A1 (en) * 2005-09-16 2009-12-10 Coley Pharmaceutical Gmbh Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification
US20090214578A1 (en) * 2005-09-16 2009-08-27 Coley Pharmaceutical Gmbh Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
US7662949B2 (en) 2005-11-25 2010-02-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US8354522B2 (en) 2005-11-25 2013-01-15 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US20080045473A1 (en) * 2006-02-15 2008-02-21 Coley Pharmaceutical Gmbh Compositions and methods for oligonucleotide formulations
US20080026986A1 (en) * 2006-06-05 2008-01-31 Rong-Fu Wang Reversal of the suppressive function of specific t cells via toll-like receptor 8 signaling
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US9382545B2 (en) 2006-09-27 2016-07-05 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US10260071B2 (en) 2006-09-27 2019-04-16 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US20090142362A1 (en) * 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
US9957969B2 (en) 2012-06-19 2018-05-01 Volvo Lastvagnar Ab Device for controlling a gas flow, an exhaust aftertreatment system and a system for propelling a vehicle

Also Published As

Publication number Publication date
US8129351B2 (en) 2012-03-06
EP0948510A1 (en) 1999-10-13
US20080026011A1 (en) 2008-01-31
US20040147468A1 (en) 2004-07-29
ES2624859T3 (en) 2017-07-17
CN101265285A (en) 2008-09-17
US20040229835A1 (en) 2004-11-18
US20040132685A1 (en) 2004-07-08
JP2010150280A (en) 2010-07-08
DE69736331T2 (en) 2007-08-09
US20050059625A1 (en) 2005-03-17
AU2004218696B2 (en) 2008-11-06
US20040198688A1 (en) 2004-10-07
US20050049215A1 (en) 2005-03-03
EP1714969A2 (en) 2006-10-25
US20050277604A1 (en) 2005-12-15
US20050277609A1 (en) 2005-12-15
EP2360252A1 (en) 2011-08-24
EP1746159A2 (en) 2007-01-24
US7723500B2 (en) 2010-05-25
US20050148537A1 (en) 2005-07-07
CA2270345C (en) 2014-05-13
US20050233999A1 (en) 2005-10-20
US20050004061A1 (en) 2005-01-06
KR20000052994A (en) 2000-08-25
US20050049216A1 (en) 2005-03-03
WO1998018810A1 (en) 1998-05-07
ES2268736T3 (en) 2007-03-16
US20080031936A1 (en) 2008-02-07
US7674777B2 (en) 2010-03-09
US7888327B2 (en) 2011-02-15
AU775185B2 (en) 2004-07-22
US20030050261A1 (en) 2003-03-13
US8158592B2 (en) 2012-04-17
US20050239732A1 (en) 2005-10-27
EP1746159A3 (en) 2009-11-25
US6207646B1 (en) 2001-03-27
US7879810B2 (en) 2011-02-01
AU2004218696A1 (en) 2004-11-04
CA2270345A1 (en) 1998-05-07
US20050054602A1 (en) 2005-03-10
AU5242498A (en) 1998-05-22
US7517861B2 (en) 2009-04-14
US8058249B2 (en) 2011-11-15
US20050032736A1 (en) 2005-02-10
US20070066553A1 (en) 2007-03-22
EP0948510A4 (en) 2000-08-02
US20060089326A1 (en) 2006-04-27
EP1714969A3 (en) 2010-03-03
ATE332966T1 (en) 2006-08-15
JP5082063B2 (en) 2012-11-28
US20050267064A1 (en) 2005-12-01
US20090202575A1 (en) 2009-08-13
KR100689942B1 (en) 2007-03-09
JP2003286174A (en) 2003-10-07
US7723022B2 (en) 2010-05-25
US20050123523A1 (en) 2005-06-09
EP2322615A1 (en) 2011-05-18
US8258106B2 (en) 2012-09-04
PT948510E (en) 2006-12-29
CN1235609A (en) 1999-11-17
CN100338086C (en) 2007-09-19
DK0948510T3 (en) 2006-10-30
JP2001503267A (en) 2001-03-13
EP2360252B1 (en) 2017-02-08
EP0948510B1 (en) 2006-07-12
JP2008289495A (en) 2008-12-04
US20070078104A1 (en) 2007-04-05
US20060003955A1 (en) 2006-01-05
US20050215500A1 (en) 2005-09-29
US7402572B2 (en) 2008-07-22
AU9724901A (en) 2002-02-07
NZ335397A (en) 2000-11-24
EP2360252B8 (en) 2017-04-12
US20040167089A1 (en) 2004-08-26
DE69736331D1 (en) 2006-08-24
US20050171047A1 (en) 2005-08-04
US20050233995A1 (en) 2005-10-20
US20100125101A1 (en) 2010-05-20
JP2004041224A (en) 2004-02-12

Similar Documents

Publication Publication Date Title
US8058249B2 (en) Immunostimulatory nucleic acid molecules
US7524828B2 (en) Immunostimulatory nucleic acid molecules
US8008266B2 (en) Methods of treating cancer using immunostimulatory oligonucleotides

Legal Events

Date Code Title Description
AS Assignment

Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION, IOWA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KRIEG, ARTHUR M.;REEL/FRAME:015389/0462

Effective date: 20041104

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF IOWA;REEL/FRAME:021670/0819

Effective date: 20031223

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION