US20040219545A1 - Methods for identifying small molecules that bind specific rna structural motifs - Google Patents
Methods for identifying small molecules that bind specific rna structural motifs Download PDFInfo
- Publication number
- US20040219545A1 US20040219545A1 US10/475,024 US47502404A US2004219545A1 US 20040219545 A1 US20040219545 A1 US 20040219545A1 US 47502404 A US47502404 A US 47502404A US 2004219545 A1 US2004219545 A1 US 2004219545A1
- Authority
- US
- United States
- Prior art keywords
- rna
- target rna
- test compound
- compounds
- test compounds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
- C08K3/00—Use of inorganic substances as compounding ingredients
- C08K3/02—Elements
- C08K3/04—Carbon
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08K—Use of inorganic or non-macromolecular organic substances as compounding ingredients
- C08K3/00—Use of inorganic substances as compounding ingredients
- C08K3/30—Sulfur-, selenium- or tellurium-containing compounds
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M103/00—Lubricating compositions characterised by the base-material being an inorganic material
- C10M103/02—Carbon; Graphite
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M103/00—Lubricating compositions characterised by the base-material being an inorganic material
- C10M103/06—Metal compounds
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M107/00—Lubricating compositions characterised by the base-material being a macromolecular compound
- C10M107/02—Hydrocarbon polymers; Hydrocarbon polymers modified by oxidation
- C10M107/04—Polyethene
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M107/00—Lubricating compositions characterised by the base-material being a macromolecular compound
- C10M107/02—Hydrocarbon polymers; Hydrocarbon polymers modified by oxidation
- C10M107/06—Hydrocarbon polymers; Hydrocarbon polymers modified by oxidation containing propene
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M111/00—Lubrication compositions characterised by the base-material being a mixture of two or more compounds covered by more than one of the main groups C10M101/00 - C10M109/00, each of these compounds being essential
- C10M111/04—Lubrication compositions characterised by the base-material being a mixture of two or more compounds covered by more than one of the main groups C10M101/00 - C10M109/00, each of these compounds being essential at least one of them being a macromolecular organic compound
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/04—Elements
- C10M2201/041—Carbon; Graphite; Carbon black
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/04—Elements
- C10M2201/041—Carbon; Graphite; Carbon black
- C10M2201/0413—Carbon; Graphite; Carbon black used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/04—Elements
- C10M2201/041—Carbon; Graphite; Carbon black
- C10M2201/042—Carbon; Graphite; Carbon black halogenated, i.e. graphite fluoride
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/04—Elements
- C10M2201/041—Carbon; Graphite; Carbon black
- C10M2201/042—Carbon; Graphite; Carbon black halogenated, i.e. graphite fluoride
- C10M2201/0423—Carbon; Graphite; Carbon black halogenated, i.e. graphite fluoride used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/06—Metal compounds
- C10M2201/0603—Metal compounds used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/06—Metal compounds
- C10M2201/061—Carbides; Hydrides; Nitrides
- C10M2201/0613—Carbides; Hydrides; Nitrides used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/06—Metal compounds
- C10M2201/062—Oxides; Hydroxides; Carbonates or bicarbonates
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/06—Metal compounds
- C10M2201/062—Oxides; Hydroxides; Carbonates or bicarbonates
- C10M2201/0623—Oxides; Hydroxides; Carbonates or bicarbonates used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/06—Metal compounds
- C10M2201/065—Sulfides; Selenides; Tellurides
- C10M2201/0653—Sulfides; Selenides; Tellurides used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/06—Metal compounds
- C10M2201/065—Sulfides; Selenides; Tellurides
- C10M2201/066—Molybdenum sulfide
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/06—Metal compounds
- C10M2201/065—Sulfides; Selenides; Tellurides
- C10M2201/066—Molybdenum sulfide
- C10M2201/0663—Molybdenum sulfide used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/08—Inorganic acids or salts thereof
- C10M2201/0803—Inorganic acids or salts thereof used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/085—Phosphorus oxides, acids or salts
- C10M2201/0853—Phosphorus oxides, acids or salts used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/086—Chromium oxides, acids or salts
- C10M2201/0863—Chromium oxides, acids or salts used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/087—Boron oxides, acids or salts
- C10M2201/0873—Boron oxides, acids or salts used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/10—Compounds containing silicon
- C10M2201/1006—Compounds containing silicon used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/10—Compounds containing silicon
- C10M2201/102—Silicates
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/10—Compounds containing silicon
- C10M2201/102—Silicates
- C10M2201/1023—Silicates used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/10—Compounds containing silicon
- C10M2201/102—Silicates
- C10M2201/103—Clays; Mica; Zeolites
- C10M2201/1033—Clays; Mica; Zeolites used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/10—Compounds containing silicon
- C10M2201/105—Silica
- C10M2201/1053—Silica used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2201/00—Inorganic compounds or elements as ingredients in lubricant compositions
- C10M2201/12—Glass
- C10M2201/123—Glass used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2205/00—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions
- C10M2205/02—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions containing acyclic monomers
- C10M2205/022—Ethene
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2205/00—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions
- C10M2205/02—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions containing acyclic monomers
- C10M2205/022—Ethene
- C10M2205/0225—Ethene used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2205/00—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions
- C10M2205/02—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions containing acyclic monomers
- C10M2205/024—Propene
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2205/00—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions
- C10M2205/02—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions containing acyclic monomers
- C10M2205/024—Propene
- C10M2205/0245—Propene used as base material
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10M—LUBRICATING COMPOSITIONS; USE OF CHEMICAL SUBSTANCES EITHER ALONE OR AS LUBRICATING INGREDIENTS IN A LUBRICATING COMPOSITION
- C10M2205/00—Organic macromolecular hydrocarbon compounds or fractions, whether or not modified by oxidation as ingredients in lubricant compositions
- C10M2205/14—Synthetic waxes, e.g. polythene waxes
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2010/00—Metal present as such or in compounds
- C10N2010/04—Groups 2 or 12
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/30—Refrigerators lubricants or compressors lubricants
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/32—Wires, ropes or cables lubricants
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/34—Lubricating-sealants
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/36—Release agents or mold release agents
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/38—Conveyors or chain belts
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/40—Generators or electric motors in oil or gas winning field
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/42—Flashing oils or marking oils
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/44—Super vacuum or supercritical use
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10N—INDEXING SCHEME ASSOCIATED WITH SUBCLASS C10M RELATING TO LUBRICATING COMPOSITIONS
- C10N2040/00—Specified use or application for which the lubricating composition is intended
- C10N2040/50—Medical uses
Definitions
- the present invention relates to a method for screening and identifying test compounds that bind to a preselected target ribonucleic acid (“RNA”).
- RNA ribonucleic acid
- Direct, non-competitive binding assays are advantageously used to screen libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular test compound is detected using any physical method that measures the altered physical property of the target RNA bound to a test compound.
- the methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.
- Protein-nucleic acid interactions are involved in many cellular functions, including transcription, RNA splicing, mRNA decay, and mRNA translation.
- Readily accessible synthetic molecules that can bind with high affinity to specific sequences of single- or double-stranded nucleic acids have the potential to interfere with these interactions in a controllable way, making them attractive tools for molecular biology and medicine.
- Successful approaches for blocking function of target nucleic acids include using duplex-forming antisense oligonucleotides (Miller, 1996, Progress in Nucl. Acid Res. & Mol. Biol.
- nucleic acids i.e., antisense, ribozymes, and triplex-forming molecules
- DNA deoxyribonucleic acid
- RNA processes such as transcription or translation.
- carbohydrate-based host cell factors calicheamicin oligosaccharides, interfere with the sequence-specific binding of transcription factors to DNA and inhibit transcription in vivo (Ho et al., 1994, Proc. Natl. Acad. Sci. USA 91:9203-9207; Liu et al., 1996, Proc. Natl. Acad. Sci. USA 93:940-944).
- Certain classes of known antibiotics have been characterized and were found to interact with RNA.
- the antibiotic thiostreptone binds tightly to a 60-mer from ribosomal RNA (Cundliffe et al., 1990, in The Ribosome: Structure, Function & Evolution (Schlessinger et al, eds.) American Society for Microbiology, Washington, D.C. pp. 479-490). Bacterial resistance to various antibiotics often involves methylation at specific rRNA sites (Cundliffe, 1989, Ann. Rev. Microbiol. 43:207-233).
- Aminoglycosidic aminocyclitol (aminoglycoside) antibiotics and peptide antibiotics are known to inhibit group I intron splicing by binding to specific regions of the RNA (von Ahsen et al., 1991, Nature (London) 353:368-370). Some of these same aminoglycosides have also been found to inhibit hammerhead ribozyme finction (Stage et al., 1995, RNA 1:95-101). In addition, certain aminoglycosides and other protein synthesis inhibitors have been found to interact with specific bases in 16S rRNA (Woodcock et al., 1991, EMBO J. 10:3099-3103).
- oligonucleotide analog of the 16S rRNA has also been shown to interact with certain aminoglycosides (Purohit et al., 1994, Nature 370:659-662).
- a molecular basis for hypersensitivity to aminoglycosides has been found to be located in a single base change in mitochondrial rRNA (Hutchin et al., 1993, Nucleic Acids Res. 21:4174-4179).
- Aninoglycosides have also been shown to inhibit the interaction between specific structural RNA motifs and the corresponding RNA binding protein. Zapp et al.
- RNA Single stranded sections of RNA can fold into complex tertiary structures consisting of local motifs such as loops, bulges, pseudoknots, guanosine quartets and turns (Chastain & Tinoco, 1991, Progress in Nucleic Acid Res. & Mol. Biol. 41:131-177; Chow & Bogdan, 1997, Chemical Reviews 97:1489-1514; Rando & Hogan, 1998, Biologic activity of guanosine quartet forming oligonucleotides in “Applied Antisense Oligonucleotide Technology” Stein. & Krieg (eds) John Wiley and Sons, New York, pages 335-352).
- Such structures can be critical to the activity of the nucleic acid and affect functions such as regulation of mRNA transcription, stability, or translation (Weeks & Crothers, 1993, Science 261:1574-1577).
- the dependence of these functions on the native three-dimensional structural motifs of single-stranded stretches of nucleic acids makes it difficult to identify or design synthetic agents that bind to these motifs using general, simple-to-use sequence-specific recognition rules for the formation of double- and triple-helical nucleic acids used in the design of antisense and ribozyme type molecules.
- Approaches to screening generally involve competitive assays designed to identify compounds that disrupt the interaction between a target RNA and a physiological, host cell factor(s) that had been previously identified to specifically interact with that particular target RNA.
- such assays require the identification and characterization of the host cell factor(s) deemed to be required for the function of the target RNA. Both the target RNA and its preselected host cell binding partner are used in a competitive format to identify compounds that disrupt or interfere with the two components in the assay.
- the present invention relates to methods for identifying compounds that bind to preselected target elements of nucleic acids including, but not limited to, specific RNA sequences, RNA structural motifs, and/or RNA structural elements.
- the specific target RNA sequences, RNA structural motifs, and/or RNA structural elements are used as targets for screening small molecules and identifying those that directly bind these specific sequences, motifs, and/or structural elements.
- methods are described in which a preselected target RNA having a detectable label is used to screen a library of test compounds, preferably under physiologic conditions. Any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the altered physical property of the target RNA bound to a test compound.
- the present invention relates to methods for using a target RNA having a detectable label to screen a library of test compounds free in solution, in labeled tubes or microtiter plate, or in a microarray.
- Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex.
- the detectably labeled complex can then be identified and removed from the uncomplexed, unlabeled test compounds in the library, and from uncomplexed, labeled target RNA, by a variety of methods, including but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA.
- Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
- SAR structure-activity relationships
- the structure of the test compound attached to the labeled RNA is then determined.
- the methods used will depend, in part, on the nature of the library screened. For example, assays or microarrays of test compounds, each having an address or identifier, may be deconvoluted, e.g., by cross-referencing the positive sample to original compound list that was applied to the individual test assays.
- test compounds identified includes de novo structure determination of the test compounds using mass spectrometry or nuclear magnetic resonance (“NMR”).
- NMR nuclear magnetic resonance
- the test compounds identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and the like.
- small organic molecules which interact specifically with target RNA molecules may be useful as lead compounds for the development of therapeutic agents.
- the methods described herein for the identification of compounds that directly bind to a particular preselected target RNA are well suited for high-throughput screening.
- the direct binding method of the invention offers advantages over drug screening systems for competitors that inhibit the formation of naturally-occurring RNA binding protein:target RNA complexes; i.e., competitive assays.
- the direct binding method of the invention is rapid and can be set up to be readily performed, e.g., by a technician, making it amenable to high throughput screening.
- the method of the invention also eliminates the bias inherent in the competitive drug screening systems, which require the use of a preselected host cell factor that may not have physiological relevance to the activity of the target RNA.
- the methods of the invention are used to identify any compound that can directly bind to specific target RNA sequences, RNA structural motifs, and/or RNA structural elements, preferably under physiologic conditions.
- the compounds so identified can inhibit the interaction of the target RNA with any one or more of the native host cell factors (whether known or unknown) required for activity of the RNA in vivo.
- a “target nucleic acid” refers to RNA, DNA, or a chemically modified variant thereof.
- the target nucleic acid is RNA.
- a target nucleic acid also refers to tertiary structures of the nucleic acids, such as, but not limited to loops, bulges, pseudoknots, guanosine quartets and turns.
- a target nucleic acid also refers to RNA elements such as, but not limited to, the HIV TAR element, internal ribosome entry site, “slippery site”, instability elements, and adenylate uridylate-rich elements, which are described in Section 5.1. Non-limiting examples of target nucleic acids are presented in Section 5.1 and Section 6.
- a “library” refers to a plurality of test compounds with which a target nucleic acid molecule is contacted.
- a library can be a combinatorial library, e.g., a collection of test compounds synthesized using combinatorial chemistry techniques, or a collection of unique chemicals of low molecular weight (less than 1000 daltons) that each occupy a unique three-dimensional space.
- a “label” or “detectable label” is a composition that is detectable, either directly or indirectly, by spectroscopic, photochemical, biochem cal, immunochemical, or chemical means.
- useful labels include radioactive isotopes (e.g., 32 P, 35 S, and 3 H), dyes, fluorescent dyes, electron-dense reagents, enzymes and their substrates (e.g., as commonly used in enzyme-linked immunoassays, e.g., lkaline phosphatase and horse radish peroxidase), biotin-streptavidin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available.
- radioactive isotopes e.g., 32 P, 35 S, and 3 H
- dyes e.g., 32 P, 35 S, and 3 H
- dyes e.g., fluorescent dyes
- electron-dense reagents e.g., enzyme-
- a label or detectable moiety can include a “affinity tag” that, when coupled with the target nucleic acid and incubated with a test compound or compound library, allows for the affinity capture of the target nucleic acid along with molecules bound to the target nucleic acid.
- affinity tag bound to the target nucleic acids has, by definition, a complimentary ligand coupled to a solid support that allows for its capture.
- useful affinity tags and complimentary partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptaners, or haptens and proteins for which antisera or monoclonal antibodies are available.
- the label or detectable moiety is typically bound, either covalently, through a linker or chemical bound, or through ionic, van der Waals or hydrogen bonds to the molecule to be detected.
- a “dye” refers to a molecule that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional spectroscopic means.
- a “visible dye” refers to a molecule having a chromophore that absorbs radiation in the visible region of the spectrum (i.e., having a wavelength of between about 400 nm and about 700 nm) such that the transmitted radiation is in the visible region and can be detected either visually or by conventional spectroscopic means.
- an “ultraviolet dye” refers to a molecule having a chromophore that absorbs radiation in the ultraviolet region of the spectrum (i.e., having a wavelength of between about 30 nm and about 400 nm).
- an “infrared dye” refers to a molecule having a chromophore that absorbs radiation in the infrared region of the spectrum (i.e., having a wavelength between about 700 nm and about 3,000 nm).
- a “chromophore” is the network of atoms of the dye that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional spectroscopic means.
- a dye absorbs radiation in one region of the spectrum, it may emit radiation in another region of the spectrum.
- an ultraviolet dye may emit radiation in the visible region of the spectrum.
- a dye can transmit radiation or can emit radiation via fluorescence or phosphorescence.
- phrases “pharmaceutically acceptable salt(s),” as used herein includes but is not limited to salts of acidic or basic groups that may be present in test compounds identified using the methods of the present invention. Test compounds that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids.
- the acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to sulfuric, citric, maleic, acetic, oxalic, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pam
- Test compounds that include an amino moiety may form pharmaceutically or cosmetically acceptable s :ts with various amino acids, in addition to the acids mentioned above.
- Test compounds that are acidic in nature are capable of forming base salts with various pharmacologically or cosmetically acceptable cations.
- Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium lithium, zinc, potassium, and iron salts.
- test compound substantially one type of test compound, as used herein, is meant that the assay can be performed in such a fashion that at some point, only one compound need be used in each reaction so that, if the result is indicative of a binding event occurring between the target RNA molecule and the test compound, the test compound can be easily identified.
- FIG. 1 Gel retardation analysis to detect peptide-RNA interactions.
- 20 ⁇ l reactions containing increasing concentrations of Tat 47-58 peptide (0.1 ⁇ M, 0.2 ⁇ M, 0.4 ⁇ M, 0.8 ⁇ M, 1.6 ⁇ M) 50 pmole TAR RNA oligonucleotide was added in TK buffer.
- the reaction mixture was then heated at 90° C. for 2 min and allowed to cool slowly to 24° C.
- 10 ml of 30% glycerol was added to each sample and applied to a 12% non-denaturing polyacrylamide gel.
- the gel was electrophoresed using 1200 volt-hours at 4° C. in TBE Buffer. Following electrophoresis, the gel was dried and the radioactivity was quantitated with a phosphorimager.
- the concentration of peptide added is indicated above each lane.
- FIG. 2 Gentamicin interacts with an oligonucleotide corresponding to the 16S rRNA.
- 20 ⁇ l reactions containing increasing concentrations of gentamicin (1 ng/ml, 10 ng/ml, 100 ng/ml, 1 ⁇ g/ml, 10 ⁇ g/ml, 50 ⁇ g/ml, 500 ⁇ g/ml) were added to 50 pmole RNA oligonucleotide in TKM buffer, heated at 90° C. for 2 min and allowed to cool slowly to 24° C. Then 10 ⁇ l of 30% glycerol was added to each sample and the samples were applied to a 13.5% non-denaturing polyacrylamide gel.
- the gel was electrophoresed using 1200 volt-hours at 4° C. in TBE Buffer Following electrophoresis, the gel was dried and the radioactivity was quantitated using a phosphorimager. The concentration of gentamicin added is indicated above each lane.
- FIG. 3 The presence of 10 pg/ml gentamicin produces a gel mobility shift in the presence of the 16S rRNA oligonucleotide.
- 20 ⁇ l reactions containing 30 increasing concentrations of gentamicin 100 ng/ml, 10 ng/ml, 1 ng/ml, 100 pg/ml, and 10 pg/ml were added to 50 pmole RNA oligonucleotide in TKM buffer were treated as described for FIG. 2.
- FIG. 4 Gentamicin binding to the 16S rRNA oligonucleotide is weak in the absence of MgCl 2 .
- Reaction mixtures containing gentamicin (1 mg/ml, 100 ⁇ g/ml, 10 ⁇ g/ml, 1 ⁇ g/ml, 0.1 ⁇ g/ml, and 10 ng/ml) were treated as described in FIG. 2 except that the TKM buffer does not contain MgCl 2 .
- FIG. 5 Gel retardation analysis to detect peptide-RNA interactions.
- Tat 47-58 peptide 0.1 ⁇ M, 0.2 ⁇ M, 0.4 ⁇ M, 0.8 ⁇ M, 1.6 ⁇ M
- 50 pmole TAR RNA oligonucleotide was added in TK buffer.
- the reaction mixture was then heated at 90° C. for 2 min and allowed to cool slowly to 24° C.
- the reactions were loaded onto a SCE9610 automated capillary electrophoresis apparatus (SpectruMedix; State College, Pa.).
- the peaks correspond to the amount of free TAR RNA (“TAR”) or the Tat-TAR complex (“Tat-TAR”).
- the concentration of peptide added is indicated below each lane.
- the present invention relates to methods for identifying compounds that bind to preselected target elements of nucleic acids, in particular, RNAs, including but not limited to preselected target RNA sequencing structural motifs, or structural elements.
- Methods are described in which a preselected target RNA having a detectable label is used to screen a library of test compounds. Any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the altered physical property of the target RNA bound to a test compound.
- Changes in the physical property of the RNA-test compound complex relative to the target RNA or test compound can be measured by methods such as, but not limited to, methods that detect a change in mobility due to a change in mass, change in charge, or a change in thermostability.
- methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
- the present invention relates to methods for using a target RNA having a detectable label to screen a library of test compounds free in solution, in labeled tubes or microtiter plate, or in a microarray.
- Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex.
- the detectably labeled complex can then be identified and removed from the unlabeled, uncomplexed test compounds in the library by a variety of methods capable of differentiating changes in the physical properties of the complexed target RNA.
- the structure of the test compound attached to the labeled RNA is also determined. The methods used will depend, in part, on the nature of the library screened.
- test compounds each having an address or identifier
- Another method for identifying test compounds includes de novo structure determination of the test compounds using mass spectrometry or nuclear magnetic resonance (“NMR”).
- the methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of test compounds, in which the test compounds of the library that specifically bind a preselected target nucleic acid are easily distinguished from non-binding members of the library.
- the structures of the binding molecules are deciphered from the input library by methods depending on the type of library that is used.
- the test compounds so identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and lead compounds for development of therapeutics, and the like.
- Small organic compounds that are identified to interact specifically with the target RNA molecules are particularly attractive candidates as lead compounds for the development of therapeutic agents.
- the assay of the invention reduces bias introduced by competitive binding assays which require the identification and use of a host cell factor (presumably essential for modulating RNA function) as a binding partner for the target RNA.
- the assays of the present invention are designed to detect any compound or agent that binds to the target RNA, preferably under physiologic conditions. Such agents can then be tested for biological activity, without establishing or guessing which host cell factor or factors is required for modulating the function and/or activity of the target RNA.
- Section 5.1 describes examples of protein-RNA interactions that are important in a variety of cellular functions and several target RNA elements that can be used to identify test compounds. Compounds that inhibit these interactions by binding to the RNA and successfully competing with the natural protein or host cell factor that endogenously binds to the RNA may be important, e.g., in treating or preventing a disease or abnormal condition, such as an infection or unchecked growth.
- Section 5.2 describes detectable labels for target nucleic acids that are useful in the methods of the invention.
- Section 5.3 describes libraries of test compounds. Section 5.4 provides conditions for binding a labeled target RNA to a test compound of a library and detecting RNA binding to a test compound using the methods of the invention.
- Section 5.5 provides methods for separating complexes of target RNAs bound to a test compound from an unbound RNA.
- Section 5.6 describes methods for identifying test compounds that are bound to the target RNA.
- Section 5.7 describes a secondary, biological screen of test compounds identified by the methods of the invention to test the effect of the test compounds in vivo.
- Section 5.8 describes the use of test compounds identified by the methods of the invention for treating or preventing a disease or abnormal condition in mammals.
- Nucleic acids are capable of folding into complex tertiary structures that include bulges, loops, triple helices and pseudoknots, which can provide binding sites for host cell factors, such as proteins and other RNAs.
- RNA-protein and RNA-RNA interactions are important in a variety cellular functions, including transcription, RNA splicing, RNA stability and translation.
- the binding of such host cell factors to RNAs may alter the stability and translational efficiency of such RNAs, and according affect subsequent translation. For example, some diseases are associated with protein overproduction or.decreased protein function. In this case, the identification of compounds to modulate RNA stability and translational efficiency will be useful to treat and prevent such diseases.
- the methods of the present invention are useful for identifying test compounds that bind to target RNA elements in a high throughput screening assay of libraries of test compounds in solution.
- the methods of the present invention are useful for identifying a test compound that binds to a target RNA elements and inhibits the interaction of that RNA with one or more host cell factors in vivo.
- the molecules identified using the methods of the invention are useful for inhibiting the formation of a specific bound RNA:host cell factor complexes in vivo.
- test compounds identified by the methods of the invention are useful for increasing or decreasing the translation of messenger RNAs (“mRNAs”), e.g., protein production, by binding to one or more regulatory elements in the 5′ untranslated region, the 3′ untranslated region, or the coding region of the mRNA.
- mRNAs messenger RNAs
- Compounds that bind to mRNA can, inter alia, increase or decrease the rate of mRNA processing, alter its transport through the cell, prevent or enhance binding of the mRNA to ribosomes, suppressor proteins or enhancer proteins, or alter mRNA stability. Accordingly, compounds that increase or decrease mRNA translation can be used to treat or prever disease.
- diseases associated with protein overproduction such as amyloidosis, or with the production of mutant proteins, such as Ras
- diseases associated with protein overproduction can be treated or prevented by decreasing translation of the mRNA that codes for the overproduced protein, thus inhibiting production of the protein.
- the symptoms of diseases associated with decreased protein function such as hemophelia, may be treated by increasing translation of mRNA coding for the protein whose function is decreased, e.g., factor IX in some forms of hemophilia.
- the methods of the invention can be used to identify compounds that bind to mRNAs coding for a variety of proteins with which the progression of diseases in mammals is associated.
- mRNAs include, but are not limited to, those coding for amyloid protein and amyloid precursor protein; anti-angiogenic proteins such as angiostatin, endostatin, METH-1 and METH-2; apoptosis inhibitor proteins such as survivin, clotting factors such as Factor IX, Factor VIII, and others in the clotting cascade; collagens; cyclins and cyclin inhibitors, such as cyclin dependent kinases, cyclin D1, cyclin E, WAF1, cdk4 inhibitor, and MTS1; cystic fibrosis transmembrane conductance regulator gene (CFTR); cytokines such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11,
- the invention in addition to the eukaryotic genes listed above, the invention, as described, can be used to define molecules that interrupt viral, bacterial or fungal transcription or translation efficiencies and therefore form the basis for a novel anti-infectious disease therapeutic.
- Other target genes include, but are not limited to, those disclosed in Section 5.1 and Section 6.
- the methods of the invention can be used to identify mRNA-binding test compounds for increasing or decreasing the production of a protein, thus treating or preventing a disease associated with decreasing or increasing the production of said protein, respectively.
- the methods of the invention may be useful for identifying test compounds for treating or preventing a disease in mammals, including cats, dogs, swine, horses, goats, sheep, cattle, primates and humans.
- diseases include, but are not limited to, amyloidosis, hemophilia, Alzheimer's disease, atherosclerosis, cancer, giantism, dwarfism, hypothyroidism, hyperthyroidism, inflammation, cystic fibrosis, autoimmune disorders, diabetes, aging, obesity, neurodegenerative disorders, and Parkinson's disease.
- Other diseases include, but are not limited to, those described in Section 5.1 and diseases caused by aberrant expression of the genes disclosed in Example 6.
- the invention as described, can be used to define molecules that interrupt viral, bacterial or fungal transcription or translation efficiencies and therefore form the basis for a novel anti-infectious disease therapeutic.
- test compounds identified by the methods of the invention are useful for preventing the interaction of an RNA, such as a transfer RNA (“tRNA”), an enzymatic RNA or a ribosomal RNA (“rRNA”), with a protein or with another RNA, thus preventing, e.g., assembly of an in vivo protein-RNA or RNA-RNA complex that is essential for the viability of a cell.
- RNA transfer RNA
- rRNA ribosomal RNA
- inhibition of an interaction between rRNA and one or more ribosomal proteins may inhibit the assembly of ribosomes, rendering a cell incapable of synthesizing proteins.
- inhibition of the interaction of precursor rRNA with ribonucleases or ribonucleoprotein complexes (such as RNase P) that process the precursor rRNA prevent maturation of the rRNA and its assembly into ribosomes.
- a tRNA:tRNA synthetase complex may be inhibited by test compounds identified by the methods of the invention such that tRNA molecules do not become charged with amino acids.
- Such interactions include, but are not limited to, rRNA interactions with ribosomal proteins, tRNA interactions with tRNA synthetase, RNase P protein interactions with RNase P RNA, and telomerase protein interactions with telomerase RNA.
- test compounds identified by the methods of the invention are useful for treating or preventing a viral, bacterial, protozoan or fungal infection.
- transcriptional up-regulation of the genes of human immunodeficiency virus type 1 (“HIV-1”) requires binding of the HIV Tat protein to the HIV trans-activation response region RNA (“TAR RNA”).
- HIV TAR RNA is a 59-base stem-loop structure located at the 5′-end of all nascent HIV-1 transcripts (Jones & Peterlin, 1994, Annu. Rev. Biochem. 63:717-43). Tat protein is known to interact with uracil 23 in the bulge region of the stem of TAR RNA.
- TAR RNA is a potential binding target for test compounds, such as small peptides and peptide analogs that bind to the bulge region of TAR RNA and inhibit formation of a Tat-TAR RNA complex involved in HIV-1 upregulation (see Hwang et al.,1999 Proc. Natl. Acad. Sci. USA 96:12997-13002).
- test compounds that bind to TAR RNA are useful as anti-HIV therapeutics (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and therefore, are useful for treating or preventing AIDS.
- the methods of the invention can be used to identify test compounds to treat or prevent viral, bacterial, protozoan or fungal infections in a patient.
- the methods of the invention are useful for identifying compounds that decrease translation of microbial genes by interacting with mRNA, as described above, or for identifying compounds that inhibit the interactions of microbial RNAs with proteins or other ligands that are essential for viability of the virus or microbe.
- microbial target RNAs useful in the present invention for identifying antiviral, antibacterial, anti-protozoan and anti-fungal compounds include, but are not limited to, general antiviral and anti-inflammatory targets such as mRNAs of INF ⁇ , INF ⁇ , RNAse L, RNAse L inhibitor protein, PKR, tumor necrosis factor, interleukins 1-15, and IMP dehydrogenase; internal ribosome entry sites; HIV-1 CT rich domain and RNase H MRNA; HCV internal ribosome entry site (required to direct translation of HCV mRNA), and the 3′-untranslated tail of HCV genomes; rotavirus NSP3 binding site, which binds the protein NSP3 that is required for rotavirus mRNA translation; HBV epsilon domain; Dengue virus 5′ and 3′ untranslated regions, including IRES; INF ⁇ , INF ⁇ and INF ⁇ ; plasmodium falciparum mRNAs; the 16S
- RNAs are functionally conserved in various species (e.g., from yeast to humans), they exhibit nucleotide sequence and structural diversity. Therefore, inhibition of, for example, yeast telomerase by an anti-fungal compound identified by the methods of the invention might not interfere with human telomerase and normal human cell proliferation.
- test compounds that interfere with one or more target RNA interactions with host cell factors that are important for cell growth or viability, or essential in the life cycle of a virus, a bacterium, a protozoa or a fungus.
- test compounds and/or congeners that demonstrate desirable biologic and pharmacologic activity can be administered to a patient in need thereof in order to treat or prevent a disease caused by viral, bacterial, protozoan, or fungal infections.
- Such diseases include, but are not limited to, HIV infection, AIDS, human T-cell leukemia, SIV infection, FIV infection, fel.ne leukemia, hepatitis A, hepatitis B, hepatitis C, Dengue fever, malaria, rotavirus infection, severe acute gastroenteritis, diarrhea, encephalitis, hemorrhagic fever, syphilis, legionella, whooping cough, gonorrhea, sepsis, influenza, pneumonia, tinea infection, candida infection, and meningitis.
- Non-limiting examples of RNA elements involved in the regulation of gene expression include the HIV TAR element, internal ribosome entry site, “slippery site”, instability elements, and adenylate uridylate-rich elements, as discussed below.
- HIV-1 human immunodeficiency virus type 1
- TAR RNA HIV trans-activation response region RNA
- Tat protein is known to interact with uracil 23 in the bulge region of the stem of TAR RNA.
- TAR RNA is a useful binding target for test compounds, such as small peptides and peptide analogs that bind to the bulge region of TAR RNA and inhibit formation of a Tat-TAR RNA complex involved in HIV-1 up-regulation (see Hwang et al., 1999 Proc. Natl. Acad. Sci. USA 96:12997-13002).
- test compounds that bind to TAR RNA can be useful as anti-HIV therapeutics (Harny et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and therefore, are useful for treating or preventing AIDS.
- IRES Internal ribosome entry sites
- 5′ UTR 5′ untranslated regions
- IRES element When the IRES element is present on an mRNA downstream of a translational stop codon, it directs ribosomal re-entry (Ghattas et al., 1991, Mol. Cell. Biol. 11:5848-5959), which permits initiation of translation at the start of a second open reading frame.
- a large segment of the 5′ nontranslated region approximately 400 nucleotides in length, promotes internal entry of ribosomes independent of the non-capped 5′ end of picornavirus mRNAs (mammalian plus-strand RNA viruses whose genomes serve as mRNA).
- This 400 nucleotide segment maps approximately 200 nt down-stream from the 5′ end and is highly structured. IRES elements of different picornaviruses, although functionally similar in vitro and in vivo, are not identical in sequence or structure.
- the IRES elements of cardio-, entero- and aphthoviruses bind a cellular protein, p57. In the case of cardioviruses, the interaction between a specific stem-loop of the IREs is essential for translation in vitro.
- IRES elements of entero- and cardioviruses also bind the cellular protein, p52, but the significance of this interaction remains to be shown.
- the function of p57 or p52 in cellular metabolism is unknown. Since picomaviral IRES elements function in vivo in the absence of any viral gene products, is speculated that IRES-like elements may also occur in specific cellular mRNAs releasing them from cap-dependent translation (Jang et al., 1990, Enzyme 44(1-4):292-309).
- ribosomal frameshifting when ribosomes shift from one translation reading frame to another and synthesize two viral proteins from a single viral mRNA, is directed by a unique site in viral mRNAs called the “slippery site.”
- the slippery site directs ribosomal frameshifting in the ⁇ 1 or +1 direction that causes the ribosome to slip by one base in the 5′ direction thereby placing the ribosome in the new reading frame to produce a new protein.
- Programmed, or directed, ribosomal frameshifting is of particular value to viruses that package their plus strands, as it eliminates the need to splice their mRNAs and reduces the risk of packaging defective genomes and regulates the ratio of viral proteins synthesized.
- Examples of programmed translational frameshifting (both +1 and ⁇ 1 shifts) have been identified in ScV systems (Lopinski et al., 2000, Mol. Cell. Biol. 20(4):1095-103, retroviruses (Falk et al., 1993, J. Virol.
- Drugs targeted to ribosomal frameshifting minimize the problem of virus drug resistance because this strategy targets a host cellular process rather than one introduced into the cell by the virus, which minimizes the ability of viruses to evolve drug-resistant mutants.
- Compounds that target the RNA elements involved in regulating programmed frameshifting should have several advantages, including (a) any selective pressure on the host cellular translational machinery to adapt to the drugs would have to occur at the host evolutionary time scale, which is on the order of millions of years, (b) ribosomal frameshifting is not used to express any host proteins, and (c) altering viral frameshifting efficiencies by modulating the activity of a host protein minimizing the likelihood that the virus will acquire resistance to such inhibition by mutations in its own genome.
- Instability elements may be defined as specific sequence elements that promote the recognition of unstable mRNAs by cellular turnover machinery. Instability elements have been found within mRNA protein coding regions as well as untranslated regions.
- altering the control of stability of normal mRNAs may lead to disease.
- the alteration of mRNA stability has been implicated in diseases such as, but not limited to, cancer, immune disorders, heart disease, and fibrotic disorders.
- the highly oncogenic v-fos mRNA lacks the 3′ UTR adenylate uridylate rich element (“ARE”) that is found in the more labile and weakly oncogenic c-fos mRNA (see, e.g., Schiavi et al., 1992, Biochim Biophys Acta. 1114(2-3):95-106). Differences between the benign cervical lesions brought about by nonintegrated circular human papillomavirus type 16 and its integrated form, that lacks the 3′ UTR ARE and correlates with cervical carcinomas, may be a consequence of stabilizing the E6/E7 transcripts encoding oncogenic proteins.
- ARE 3′ UTR adenylate uridylate rich element
- ARE instability element results in deletion of the ARE instability element, resulting in stabilizion of the transcripts and over-expression of the proteins (see, e.g., Jeon & Lambert, 1995, Proc. Natl. Acad. Sci. USA 92(5):1654-8).
- Deletion of AREs from the 3′ UTR of the IL-2 and IL-3 genes promotes increased stabilization of these mRNAs, high expression of these proteins, and leads to the formation of cancerous cells (see, e.g., Stoecklin et al., 2000, Mol. Cell. Biol. 20(11):3753-63).
- Mutations in trans-acting factors involved in mRNA turnover may also promote cancer.
- the lymphokine GM-CSF mRNA is specifically stabilized as a consequence of an oncogenic lesion in a trans-acting factor that controls mRNA turnover rates.
- the normally unstable IL-3 transcript is inappropriately long-lived in mast tumor cells.
- the labile GM-CSF mRNA is greatly stabilized in bladder carcinoma cells. See, e.g., Bickel et al., 1990, J. Immunol. 145(3):840-5.
- the immune system is regulated by a large number of regulatory molecules that either activate or inhibit the immune response. It has now been clearly demonstrated that stability of the transcripts encoding these proteins are highly regulated. Altered regulation of these molecules leads to mis-regulation of this process and can result in drastic medical consequences. For example, recent results using transgenic mice have shown that mis-regulation of the stability of the important modulator TNF ⁇ mRNA leads to diseases such as, but not limited to, rheumatoid arthritis and a Crohn's-like liver disease. See, e.g., Clark, 2000, Arthritis Res. 2(3):172-4.
- a large number of diseases result from over-expression of collagen. For example, cirrhosis results from damage to the liver as a consequence of carcer, viral infection, or alcohol abuse. Such damage causes mis-regulation of collagen expression, leading to the formation of large collagen deposits. Recent results indicate that the sizeable increase in collagen expression is largely attributable to stabilization of its mRNA. See, e.g., Lindquist et al., 2000, Am. J. Physiol. Gastrointest. Liver Physiol. 279(3):G471-6.
- Adenylate uridylate-rich elements are found in the 3′ untranslated regions (“3′ UTR”) of several mRNAs, and involved in the turnover of mrRNAs, such as but not limited to transcription factors, cytokines, and lymphokines. AREs may function both as stabilizing and destabilizing elements. ARE mRNAs are classified into five groups, depending on sequence (Bakheet et al., 2001, Nucl. Acids Res. 29(1):246-254). An ongoing database at the web site http://rc.kfshrc.edu.sa/ared contains ARE-containing mRNAs and their cluster groups, which is incorporated by reference in its entirety.
- the ARE motifs are classified as follows: Group I Cluster (AUUUAUUUAUUUAUUUAUUUA) SEQ ID NO: 1 Group II Cluster (AUUUAUUUAUUUAUUUA) stretch SEQ ID NO: 2 Group III Cluster (WAUUUAUUUAUUUAW) stretch SEQ ID NO: 3 Group IV Cluster (WWAUUUAUUUAWW) stretch SEQ ID NO: 4 Group V Cluster (WWWWAUUUAWWWW) stretch SEQ ID NO: 5
- ARE-mRNAs were clustered into five groups containing five, four, three and two pentameric repeats, while the last group contains only one pentamer within the 13-bp ARE pattern.
- Functional categories were assigned whenever possible according to NCBI-COG functional annotation (Tatusov et al., 2001, Nucleic Acids Research, 29(1): 22-28), in addition to the categories: inflammation, immune response, development/differentiation, using an extensive literature search.
- Group I contains many secreted proteins including GM-CSF, IL-1, IL-11, IL-12 and Gro- ⁇ that affect the growth of hematopoietic and immune cells (Witsell & Schook, 1992, Proc. Natl Acad. Sci. USA, 89:4754-4758).
- TNF ⁇ is both a pro-inflammatory and anti-tumor protein, there is experimental evidence that it can act as a growth factor in certain leukemias and lymphomas (Liu et al., 2000, J. Biol. Chem. 275:21086-21093).
- Groups II-V contain functionally diverse gene families comprising immune response, cell cycle and proliferation, inflammation and coagulation, angiogenesis, metabolism, energy, DNA binding and transcription, nutrient transportation and ionic homeostasis, protein synthesis, cellular biogenesis, signal transduction, and apoptosis (Bakheet et al., 2001, Nucl. Acids Res. 29(1):246-254).
- ARE-binding proteins that influence the ARE-mRNA stability.
- mammalian homologs of ELAV (embryonic lethal abnormal vision) proteins including AUF1, HuR and He1-N2 (Zhang et al., 1993, Mol. Cell. Biol. 13:7652-7665; Levine et al., 1993, Mol. Cell. Biol. 13:3494-3504: Ma et al., 1996, J. Biol. Chem. 271 :8144-8151).
- the zinc-finger protein tristetraprolin has been identified as another ARE-binding protein with destabilizing activity on TNF- ⁇ , IL-3 and GM-CSF mRNAs (Stoecklin et al., 2000, Mol. Cell. Biol. 20:3753-3763; Carballo et al., 2000, Blood 95:1891-1899).
- ARE-containing genes are clearly important in biological systems, including but not limited to a number of the early response genes that regulate cell proliferation and responses to exogenous agents, the identification of compounds that bind to one or more of the ARE clusters and potentially modulate the stability of the target RNA can potentially be of value as a therapeutic.
- Target nucleic acids including but not limited to RNA and DNA, useful in the methods of the present invention have a label that is detectable via conventional spectroscopic means or radiographic means.
- target nucleic acids are labeled with a covalently attached dye molecule.
- Useful dye-molecule labels include, but are not limited to, fluorescent dyes, phosphorescent dyes, ultraviolet dyes, infrared dyes, and visible dyes.
- the dye is a visible dye.
- Useful labels in the present invention can include, but are not limited to, spectroscopic labels such as fluorescent dyes (e.g., fluorescein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon GreenTM, rhodamine and derivatives (e.g., Texas red, tetramethylrhodimine isothiocynate (TRITC), bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDyeTM, and the like), radiolabels (e.g., 3 H, 125 I, 35 S, 14 C, 32 P, 33 P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), spectroscopic calorimetric labels such as colloidal gold or colored glass or plastic (e.g.
- affinity tags and complimentary partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptamer-streptavidin, or haptens and proteins for which antisera or monoclonal antibodies are available.
- the label may be coupled directly or indirectly to a component of the detection assay (e.g., the detection reagent) according to methods well known in the art.
- a component of the detection assay e.g., the detection reagent
- a wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.
- nucleic acids that are labeled at one or more specific locations are chemically synthesized using phosphoramidite or other solution or solid-phase methods.
- phosphoramidite or other solution or solid-phase methods.
- Detailed descriptions of the chemistry used to form polynucleotides by the phosphoramidite method are well known (see, e.g., Caruthers et al., U.S. Pat. Nos. 4,458,066 and 4,415,732; Caruthers et al., 1982, Genetic Engineering 4:1-17; Users Manual Model 392 and 394 Polynucleotide Synthesizers, 1990, pages 6-1 through 6-22, Applied Biosystems, Part No.
- the phosphoramidite method of polynucleotide synthesis is the preferred method because of its efficient and rapid coupling and the stability of the starting materials.
- the synthesis is performed with the growing polynucleotide chain attached to a solid support, such that excess reagents, which are generally in the liquid phase, can be easily removed by washing, decanting, and/or filtration, thereby eliminating the need for purification steps between synthesis cycles.
- a solid support to which is attached a protected nucleoside monomer at its 3′ terminus is treated with acid, e.g., trichloroacetic acid, to remove the 5′-hydroxyl protecting group, freeing the hydroxyl group for a subsequent coupling reaction.
- acid e.g., trichloroacetic acid
- an activated intermediate is formed by contacting the support-bound nucleoside with a protected nucleoside phosphoramidite monomer and a weak acid, e.g., tetrazole.
- the weak acid protonates the nitrogen atom of the phosphoramidite forming a reactive intermediate.
- Nucleoside addition is generally complete within 30 seconds.
- a capping step is performed, which terminates any polynucleotide chains that did not undergo nucleoside addition.
- Capping is preferably performed using acetic anhydride and 1-methylimidazole.
- the phosphite group of the internucleotide linkage is then converted to the more stable phosphotriester by oxidation using iodine as the preferred oxidizing agent and water as the oxygen donor.
- the hydroxyl protecting group of the newly added nucleoside is removed with a protic acid, e.g., trichloroacetic acid or dichloroacetic acid, and the cycle is repeated one or more times until chain elongation is complete.
- a protic acid e.g., trichloroacetic acid or dichloroacetic acid
- the polynucleotide chain is cleaved from the support using a base, e.g., ammonium hydroxide or t-butyl amine.
- a base e.g., ammonium hydroxide or t-butyl amine.
- the cleavage reaction also removes any phosphate protecting groups, e.g., cyanoethyl.
- the protecting groups on the exocyclic amines of the bases and any protecting groups on the dyes are removed by treating the polynucleotide solution in base at an elevated temperature, e.g., at about 55° C.
- the various protecting groups are removed using ammonium hydroxide or t-butyl amine.
- nucleoside phosphoramidite monomers can be labeled using standard phosphoramidite chemistry methods (Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002; Ojwang et aL, 1997, Biochemistry. 36:6033-6045 and references cited therein).
- Dye molecules useful for covalently coupling to phosphoramidites preferably comprise a primary hydroxyl group that is not part of the dye's chromophore.
- Illustrative dye molecules include, but are not limited to, disperse dye CAS 4439-31-0, disperse dye CAS 6054-58-6, disperse dye CAS 4392-69-2 (Sigma-Aldrich, St. Louis, Mo.), disperse red, and 1-pyrenebutanol (Molecular Probes, Eugene, Oreg.).
- Other dyes useful for coupling to phosphoramidites will be apparent to those of skill in the art, such as fluoroscein, cy3, and cyS fluorescent dyes, and may be purchased from, e.g., Sigma-Aldrich, St. Louis, Mo. or Molecular Probes, Inc., Eugene, Oreg.
- dye-labeled target RNA molecules are synthesized enzymatically using in vitro transcription (Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and references cited therein).
- a template DNA is denatured by heating to about 90° C. and an oligonucleotide primer is annealed to the template DNA, for example by slow-cooling the mixture of the denatured template and the primer from about 90° C. to room temperature.
- a mixture of ribonucleoside-5′-triphosphates capable of supporting template-directed enzymatic extension of the primed template e.g., a mixture including GTP, ATP, CTP, and UTP
- a polymerase enzyme is added to the mixture under conditions where the polymerase enzyme is active, which are well-known to those skilled in the art.
- a labeled polynucleotide is formed by the incorporation of the labeled ribonucleotides during polymerase-mediated strand synthesis.
- nucleic acid molecules are end-labeled after their synthesis.
- Methods for labeling the 5′-end of an oligonucleotide include but are by no means limited to: (i) periodate oxidation of a 5′-to-5′-coupled ribonucleotide, followed by reaction with an arnine-reactive label (Heller & Morisson, 1985, in Rapid Detection and Identification ofInfectious Agents , D. T. Kingsbury and S. Falkow, eds., pp.
- a detectable label should not be incorporated into a target nucleic acid at the specific binding site at which test compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the test compounds at this site. Accordingly, if the region of the target nucleic acid that binds to a host cell factor is known, a detectable label is preferably incorporated into the nucleic acid molecule at one or more positions that are spatially or sequentially remote from the binding region.
- the labeled target nucleic acid can be purified using standard techniques known to those skilled in the art (see Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and references cited therein). Depending on the length of the target nucleic acid and the method of its synthesis, such purification techniques include, but are not limited to, reverse-phase high-performance liquid chromatography (“reverse-phase HPLC”), fast performance liquid chromatography (“FPLC”), and gel purification.
- reverse-phase HPLC reverse-phase high-performance liquid chromatography
- FPLC fast performance liquid chromatography
- gel purification After purification, the target RNA is refolded into its native conformation, preferably by heating to approximately 85-95° C. and slowly cooling to room temperature in a buffer, e.g., a buffer comprising about 50 mM Tris-HCl, pH 8 and 100 mM NaCl.
- the target nucleic acid can also be radiolabeled.
- a radiolabel such as, but not limited to, an isotope of phosphorus, sulfur, or hydrogen, may be incorporated into a nucleotide, which is added either after or during the synthesis of the target nucleic acid.
- Methods for the synthesis and purification of radiolabeled nucleic acids are well known to one of skill in the art. See, e.g., Sambrook et al., 1989, in Molecular Cloning: A Laboratory Manual , pp 10.2-10.70, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incorporated by reference in their entireties.
- the target nucleic acid can be attached to an inorganic nanoparticle.
- a nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag 2 S, ZnS, CdS, CdTe, Au, or TiO 2 . Nanoparticles have unique optical, electronic and catalytic properties relative to bulk materials which can be adjusted according to the size of the particle. Methods for the attachment of nucleic acids are well know to one of skill in the art (see, e.g., Niemeyer, 2001, Angew. Chem. Int. Ed. 40: 4129-4158, International Patent Publication WO/0218643, and the references cited therein, the disclosures of which are hereby incorporated by reference in their entireties).
- Libraries screened using the methods of the present invention can comprise a variety of types of test compounds.
- the test compounds are nucleic acid or peptide molecules.
- peptide molecules can exist in a phage display library.
- types of test compounds include, but are not limited to, peptide analogs including peptides comprising non-naturally occurring amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as ⁇ -amino phosphoric acids and ⁇ -amino phosphoric acids, or amino acids having non-peptide linkages, nucleic acid analogs such as phosphorothioates and PNAs, hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose. Libraries of polypeptides or proteins can also be used.
- the combinatorial libraries are small organic molecule libraries, such as, but not limited to, benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, and diazepindiones.
- the combinatorial libraries comprise peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; or carbohydrate libraries.
- Combinatorial libraries are themselves commercially available (see, e.g., Advanced ChemTech Europe Ltd., Cambridgeshire, UK; ASINEX, Moscow Russia; BioFocus plc, Sittingbourne, UK; Bionet Research (A division of Key Organics Limited), Camelford, UK; ChemBridge Corporation, San Diego, Calif.; ChemDiv Inc, San Diego, Calif.; ChemRx Advanced Technologies, South San Francisco, Calif.; ComGenex Inc., Budapest, Hungary; Evotec OAI Ltd, Abingdon, UK; IF LAB Ltd., Kiev, Ukraine; Maybridge plc, Cornwall, UK; PharmaCore, Inc., North Carolina; SIDDCO Inc, Arlington, Delaware; Tripos Receptor Research Ltd, Bude, UK; Toslab, Ekaterinburg, Russia).
- the combinatorial compound library for the methods of the present invention may be synthesized.
- synthetic methods directed toward the creation of large collections of small organic compounds, or libraries, which could be screened for pharmacological, biological or other activity (Dolle, 2001, J. Comb. Chem. 3:477-517; Hall etal., 2001, J. Comb. Chem. 3:125-150; Dolle, 2000, J. Comb. Chem. 2:383-433; Dolle, 1999, J. Comb. Chem. 1:235-282).
- the synthetic methods applied to create vast combinatorial libraries are performed in solution or in the solid phase, i.e., on a solid support.
- Solid-phase synthesis makes it easier to conduct multi-step reactions and to drive reactions to completion with high yields because excess reagents can be easily added and washed away after each reaction step.
- Solid-phase combinatorial synthesis also tends to improve isolation, purification and screening.
- Methods and strategies for the synthesis of combinatorial libraries can be found in A Practical Guide to Combinatorial Chemistry , A. W. Czarnik and S. H. Dewitt, eds., American Chemical Society, 1997; The Combinatorial Index , B. A. Bunin, Academic Press, 1998; Organic Synthesis on Solid Phase , F. Z. Dörwald, Wiley-VCH, 2000; and Solid - Phase Organic Syntheses , Vol. 1, A. W. Czarnik, ed., Wiley Interscience, 2001.
- Combinatorial compound libraries of the present invention may be synthesized using apparatuses described in U.S. Pat. No. 6,358,479 to Frisina et al., U.S. Pat. No. 6,190,619 to Kilcoin et al., U.S. Pat. No. 6,132,686 to Gallup et al., U.S. Pat. No. 6,126,904 to Zuellig et al., U.S. Pat. No. 6,074,613 to Harness et al., U.S. Pat. No. 6,054,100 to Stanchfield et al., and U.S. Pat. No. 5,746,982 to Saneii et al. which are hereby incorporated by reference in their entirety. These patents describe synthesis apparatuses capable of holding a plurality of reaction vessels for parallel synthesis of multiple discrete compounds or for combinatorial libraries of compounds.
- the combinatorial compound library can be synthesized in solution.
- the method disclosed in U.S. Pat. No. 6,194,612 to Boger et al., which is hereby incorporated by reference in its entirety, features compounds useful as templates for solution phase synthesis of combinatorial libraries.
- the template is designed to permit reaction products to be easily purified from unreacted reactants using liquid/liquid or solid/liquid extractions.
- the compounds produced by combinatorial synthesis using the template will preferably be small organic molecules. Some compounds in the library may mimic the effects of non-peptides or peptides.
- liquid phase synthesis does not require the use of specialized protocols for monitoring the individual steps of a multistep solid phase synthesis (Egner et al., 1995, J. Org. Chem. 60:2652; Anderson et al., 1995, J. Org. Chem. 60:2650; Fitch et al., 1994, J. Org. Chem. 59:7955; Look et al., 1994, J. Org. Chem. 49:7588; Metzger et al., 1993, Angew. Chem., Int. Ed. Engl. 32:894; Youngquist et al., 1994, Rapid Commun. Mass Spect.
- Combinatorial compound libraries useful for the methods of the present invention can be synthesized on solid supports.
- a split synthesis method a protocol of separating and mixing solid supports during the synthesis, is used to synthesize a library of compounds on solid supports (see Lam et al., 1997, Chem. Rev. 97:41-448; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA 90:10922-10926 and references cited therein).
- Each solid support in the final library has substantially one type of test compound attached to its surface.
- solid support is not limited to a specific type of solid support. Rather a large number of supports are available and are known to one skilled in the art. Solid supports include silica gels, resins, derivatized plastic films, glass beads, cotton, plastic beads, polystyrene beads, alumina gels, and polysaccharides. A suitable solid support may be selected on the basis of desired end use and suitability for various synthetic protocols.
- a solid support can be a resin such as p-methylbenzhydrylamine (PMBHA) resin (Peptides International, Louisville, Ky.), polystyrenes (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), including chloromethylpolystyrene, hydroxymethylpolystyrene and aminomethylpolystyrene, poly (dimethylacrylamide)-grafted styrene co-divinyl-benzene (e.g, POLYHIPE resin, obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (e.g., TENTAGEL or ARGOGEL, Bayer, Tubingen, Germany) polydimethylacrylamide resin (obtained from Milligen/Biosearch, California), or Sepharose (Pharmacia, Sweden).
- PMBHA p-methylbenzhydrylamine
- the solid phase support is suitable for in vivo use, i.e., it can serve as a carrier or support for administration of the test compound to a patient (e.g., TENTAGEL, Bayer, Tubingen, Germany).
- the solid support is palatable and/or orally ingestable.
- compounds can be attached to solid supports via linkers.
- Linkers can be integral and part of the solid support, or they may be nonintegral that are either synthesized on the solid support or attached thereto after synthesis.
- Linkers are useful not only for providing points of test compound attachment to the solid support, but also for allowing different groups of molecules to be cleaved from the solid support under different conditions, depending on the nature of the linker.
- linkers can be, inter alia, electrophilically cleaved, nucleophilically cleaved, photocleavable, enzymatically cleaved, cleaved by metals, cleaved under reductive conditions or cleaved under oxidative conditions.
- the combinatorial compound libraries can be assembled in situ using dynamic combinatorial chemistry as described in European Patent Application 1,118,359 Al to Lehn; Huc & Nguyen, 2001, Comb. Chem. High Throughput. Screen. 4:53-74; Lehn and Eliseev, 2001, Science 291:2331-2332; Cousins et al. 2000, Curr. Opin. Chem. Biol. 4: 270-279; and Karan & Miller, 2000, Drug. Disc. Today 5:67-75 which are incorporated by reference in their entirety.
- Dynamic combinatorial chemistry uses non-covalent interaction with a target biomolecule, including but not limited to a protein, RNA, or DNA, to favor assembly of the most tightly binding molecule that is a combination of constituent subunits present as a mixture in the presence of the biomolecule.
- a target biomolecule including but not limited to a protein, RNA, or DNA
- molecules, preferably one molecule, that bind most tightly to a templating biomolecule will be present in greater amount than all other possible combinations.
- the reversible chemical reactions include, but are not limited to, imine, acyl-hydrazone, amide, acetal, or ester formation between carbonyl-containing compounds and amines, hydrazines, or alcohols; thiol exchange between disulfides; alcohol exchange in borate esters; Diels-Alder reactions; thermal- or photoinduced sigmatropic or electrocyclic rearrangements; or Michael reactions.
- the constituent components of the dynamic combinatorial compound library are allowed to combine and reach equilibrium in the absence of the target RNA and then incubated in the presence of the target RNA, preferably at physiological conditions, until a second equilibrium is reached.
- the second, perturbed, equilibrium (the so-called “templated mixture”) can, but need not necessarily, be fixed by a further chemical transformation, including but not limited to reduction, oxidation, hydrolysis, acidification, or basification, to prevent restoration of the original equilibrium when the dynamical combinatorial compound library is separated from the target RNA.
- the predominant product or products of the templated dynamic combinatorial library can separated from the minor products and directly identified.
- the identity of the predominant product or products can be identified by a deconvolution strategy involving preparation of derivative dynamic combinatorial libraries, as described in European Patent Application 1,118,359 A1, which is incorporated by reference in their entirety, whereby each component of the mixture is, preferably one-by-one but possibly group-wise, left out of the mixture and the ability of the derivative library mixture at chemical equilibrium to bind the target RNA is measured.
- the components whose removal most greatly reduces the ability of the derivative dynamic combinatorial library to bind the target RNA are likely the components of the predominant product or products in the original dynamic combinatorial library.
- a target nucleic acid such as but not limited to RNA or DNA
- a test compound library is synthesized or purchased or both
- the labeled target nucleic acid is used to screen the library to identify test compounds that bind to the nucleic acid.
- Screening comprises contacting a labeled target nucleic acid with an individual, or small group, of the components of the compound library.
- the contacting occurs in an aqueous solution, and most preferably, under physiologic conditions.
- the aqueous solution preferably stabilizes the labeled target nucleic acid and prevents denaturation or degradation of the nucleic acid without interfering with binding of the test compounds.
- the aqueous solution can be similar to the solution in which a complex between the target RNA and its corresponding host cell factor (if known) is formed in vitro.
- TK buffer which is commonly used to form Tat protein-TAR RNA complexes in vitro, can be used in the methods of the invention as an aqueous solution to screen a library of test compounds for TAR RNA binding compounds.
- the methods of the present invention for screening a library of test compounds preferably comprise contacting a test compound with a target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions.
- the aqueous solution optionally further comprises non-specific nucleic acids, such as, but not limited to, DNA; yeast tRNA; salmon sperm DNA; homoribopolymers such as, but not limited to, poly IC, polyA, polyU, and polyC; and non-specific RNA.
- the non-specific RNA may be an unlabeled target nucleic acid having a mutation at the binding site, which renders the unlabeled nucleic acid incapable of interacting with a test compound at that site.
- unlabeled TAR RNA having a mutation in the uracil 23/cytosine 24 bulge region may also be present in the aqueous solution.
- the addition of unlabeled RNA that is essentially identical to the dye-labeled target RNA except for a mutation at the binding site might minimize interactions of other regions of the dye-labeled target RNA with test compounds or with the solid support and prevent false positive results.
- the solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant.
- the pH of the solution typically ranges from about 5 to about 8, preferably from about 6 to about 8, most preferably from about 6.5 to about 8.
- a variety of buffers may be used to achieve the desired pH. Suitable buffers include, but are not limited to, Tris, Mes, Bis-Tris, Ada, Aces, Pipes, Mopso, Bis-Tris propane, Bes, Mops, Tes, Hepes, Dipso, Mobs, Tapso, Trizma, Heppso, Popso, TEA, Epps, Tricine, Gly-Gly, Bicine, and sodium-potassium phosphate.
- the buffering agent comprises from about 10 mM to about 100 mM, preferably from about 25 mM to about 75 mM, most preferably from about 40 mM to about 60 mM buffering agent.
- the pH of the aqeuous solution can be optimized for different screening reactions, depending on the target RNA used and the types of test compounds in the library, and therefore, the type and amount of the buffer used in the solution can vary from screen to screen.
- the aqueous solution has a pH of about 7.4, which can be achieved using about 50 mM Tris buffer.
- the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 mM MgCl 2 .
- the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl 2 .
- Applicant has found that a combination of KCl, NaCl, and MgCl 2 stabilizes the target RNA such that most of the RNA is not denatured or digested over the course of the screening reaction.
- the optional concentration of each salt used in the aqueous solution is dependent on the particular target RNA used and can be determined using routine experimentation.
- the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.
- a small amount of detergent or surfactant in the solution might reduce non-specific binding of the target RNA to the solid support and control aggregation and increase stability of target RNA molecules.
- Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N-laurylsarcosine, lauryl sulfate, 1-octane sulfonic acid and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alkyl amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as n-decyl a-D-glucopyranoside, n-decyl ⁇ -D-maltopyranoside, n-d
- the detergent if present, is a nonionic detergent.
- Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol. More preferably, the detergent, if present, is Triton X-100 and present in an amount of about 0.1% (w/v).
- Non-specific binding of a labeled target nucleic acid to test compounds can be further minimized by treating the binding reaction with one or more blocking agents.
- the binding reactions are treated with a blocking agent, e.g., bovine serum albumin (“BSA”), before contacting with to.the labeled target nucleic acid.
- BSA bovine serum albumin
- the binding reactions are treated sequentially with at least two different blocking agents. This blocking step is preferably performed at room temperature for from about 0.5 to about 3 hours.
- the reaction mixture is further treated with unlabeled RNA having a mutation at the binding site.
- This blocking step is preferably performed at about 4° C. for from about 12 hours to about 36 hours before addition of the dye-labeled target RNA.
- the solution used in the one or more blocking steps is substantially similar to the aqueous solution used to screen the library with the dye-labeled target RNA, e.g., in pH and salt concentration.
- the mixture of labeled target nucleic acid and the test compound is preferably maintained at 4° C. for from about 1 day to about 5 days, preferably from about 2 days to about 3 days with constant agitation.
- bound from free compounds are determined using an electrophoretic technique (see Section 5.5.1), or any of the methods disclosed in Section 5.5 infra.
- the complexed target nucleic acid does not need to be separated from the free target nucleic acid if a technique (i.e., spectrometry) that diferentiates between bound and unbound target nucleic acids is used.
- the methods for identifying small molecules bound to labeled nucleic acid will vary with the type of label on the target nucleic acid.
- the target RNA complexes are preferably identified using a chromatographic technique that separates bound from free target by an electrophoretic or size differential technique using individual reactions.
- the reactions corresponding to changes in the migration of the complexed RNA can be cross-referenced to the small molecule compound(s) added to said reaction.
- complexed target RNA can be screened en masse and then separated from free target RNA using an electrophoretic or size differential technique, the resultant complexed target is then analyzed using a mass spectrometric technique.
- test compounds bound to the target nucleic acid may not require separation from the unbound target nucleic acid if a technique such as, but not limited to, spectrometry is used.
- Any method that detects an altered physical property of a target nucleic acid complexed to a test compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids.
- Methods that can be utilized for the physical separation of complexed target RNA from unbound target RNA include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
- Methods for separation of the complex of a target RNA bound to a test compound from the unbound RNA comprises any method of electrophoretic separation, including but not limited to, denaturing and non-denaturing polyacrylamide gel electrophoresis, urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, agarose gel electrophoresis, and capillary electrophoresis.
- an automated electrophoretic system comprising a capillary cartridge having a plurality of capillary tubes is used for high-throughput screening of test compounds bound to target RNA.
- Such an apparatus for performing automated capillary gel electrophoresis is disclosed in U.S. Pat. Nos. 5,885,430; 5,916,428; 6,027,627; and 6,063,251, the disclosures of which are incorporated by reference in their entireties.
- U.S. Pat. No. 5,885,430 which is incorporated by reference in its entirety, allows one to simultaneously introduce samples into a plurality of capillary tubes directly from microtiter trays having a standard size.
- U.S. Pat. No. 5,885,430 discloses a disposable capillary cartridge which can be cleaned between electrophoresis runs, the cartridge having a plurality of capillary tubes. A first end of each capillary tube is retained in a mounting plate, the first ends collectively forming an array in the mounting plate. The spacing between the first ends corresponds to the spacing between the centers of the wells of a microtiter tray having a standard size.
- the cartridge is provided with a second mounting plate in which the second ends of the capillary tubes are retained.
- the second ends of the capillary tubes are arranged in an array which corresponds to the wells in the microtiter tray, which allows for each capillary tube to be isolated from its neighbors and therefore free from cross-contamination, as each end is dipped into an individual well.
- Plate holes may be provided in each mounting plate and the capillary tubes inserted through these plate holes.
- the plate holes are sealed airtight so that the side of the mounting plate having the exposed capillary ends can be pressurized.
- Application of a positive pressure in the vicinity of the capillary openings in this mounting plate allows for the introduction of air and fluids during electrophoretic operations and also can be used to force out gel and other materials from the capillary tubes during reconditioning.
- the capillary tubes may be protected from damage using a needle comprising a cannula and/or plastic tubes, and the like when they are placed in these plate holes. When metallic cannula or the like are used, they can serve as electrical contacts for current flow during electrophoresis.
- the second mounting plate In the presence of a second mounting plate, the second mounting plate is provided with plate holes through which the second ends of the capillary tubes project.
- the second mounting plate serves as a pressure containment member of a pressure cell and the second ends of the capillary tubes communicate with an internal cavity of the pressure cell.
- the pressure cell is also formed with an inlet and an outlet. Gels, buffer solutions, cleaning agents, and the like may be introduced into the internal cavity through the inlet, and each of these can simultaneously enter the second ends of the capillaries.
- the automated electrophoretic system can comprise a chip system consisting of complex designs of interconnected channels that perform and analyze enzyme reactions using part of a channel design as a tiny, continuously operating electrophoresis material, where reactions with one sample are going on in one area of the chip while electrophoretic separation of the products of another sample is taking place in a different part of the chip.
- a chip system consisting of complex designs of interconnected channels that perform and analyze enzyme reactions using part of a channel design as a tiny, continuously operating electrophoresis material, where reactions with one sample are going on in one area of the chip while electrophoretic separation of the products of another sample is taking place in a different part of the chip.
- the system disclosed in U.S. Pat. No. 5,699,157 which is hereby incorporated by reference in its entirety, provides for a microfluidic system for high-speed electrophoretic analysis of subject materials for applications in the fields of chemistry, biochemistry, biotechnology, molecular biology and numerous other areas.
- the system has a channel in a substrate, a light source and a photoreceptor.
- the channel holds subject materials in solution in an electric field so that the materials move through the channel and separate into bands according to species.
- the light source excites fluorescent light in the species bands and the photoreceptor is arranged to receive the fluorescent light from the bands.
- the system further has a means for masking the channel so that the photoreceptor can receive the fluorescent light only at periodically spaced regions along the channel.
- the system also has an unit connected to analyze the modulation frequencies of light intensity received by the photoreceptor so that velocities of the bands along the channel are determined, which allows the materials to be analyzed.
- the system disclosed in U.S. Pat. No. 5,699,157 also provides for a method of performing high-speed electrophoretic analysis of subject materials, which comprises the steps of holding the subject materials in solution in a channel of a microfluidic system; subjecting the materials to an electric field so that the subject materials move through the channel and separate into species bands; directing light toward the channel; receiving light from periodically spaced regions along the channel simultaneously; and analyzing the frequencies of light intensity of the received light so that velocities of the bands along the channel can be determined for analysis of said materials.
- the determination of the velocity of a species band determines the electrophoretic mobility of the species and its identification.
- U.S. Pat. No. 5,842,787 which is hereby incorporated by reference in its entirety, is generally directed to devices and systems employ channels having, at least in part, depths that are varied over those which have been previously described (such as the device disclosed in U.S. Pat. No. 5,699,157), wherein said channel depths provide numerous beneficial and unexpected results such as but not limited to, a reduction in sample perturbation, reduced non-specific sample mixture by diffusion, and increased resolution.
- the electrophoretic method of separation comprises polyacrylamide gel electrophoresis.
- the polyacrylamide gel electrophoresis is non-denaturing, so as to differentiate the mobilities of the target RNA bound to a test compound from free target RNA. If the polyacrylamide gel electrophoresis is denaturing, then the target RNA:test compound complex must be cross-linked prior to electrophoresis to prevent the disassociation of the target RNA from the test compound during electrophoresis.
- Such techniques are well known to one of skill in the art.
- the binding of test compounds to target nucleic acid can be detected, preferably in an automated fashion, by gel electrophoretic analysis of interference footprinting.
- RNA can be degraded at specific base sites by enzymatic methods such as ribonucleases A, U 2 , CL 3 , T 1 , Phy M, and B.
- cleavage sites are determined by the accessibility of particular bases to the reagent employed to initiate cleavage and, as such, is therefore is determined by the three-dimensional structure of the RNA.
- the interaction of small molecules with a target nucleic acid can change the accessibility of bases to these cleavage reagents both by causing conformational changes in the target nucleic acid or by covering a base at the binding interface.
- a test compound binds to the nucleic acid and changes the accessibility of bases to cleavage reagents, the observed cleavage pattern will change.
- This method can be used to identify and characterize the binding of small molecules to RNA as described, for example, by Prudent et al., 1995, J. Am. Chem. Soc. 117:10145-10146 and Mei et al., 1998, Biochem. 37:14204-14212.
- the detectably labeled target nucleic acid is incubated with an individual test compound and then subjected to treatment with a cleavage reagent, either enzymatic or chemical.
- the reaction mixture can be preferably be examined directly, or treated further to isolate and concentrate the nucleic acid.
- the fragments produced are separated by electrophoresis and the pattern of cleavage can be compared to a cleavage reaction performed in the absence of test compound. A change in the cleavage pattern directly indicates that the test compound binds to the target nucleic acid.
- Multiple test compounds can be examined both in parallel and serially.
- electrophoretic separation include, but are not limited to urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, and agarose gel electrophoresis.
- fluorescence polarization spectroscopy an optical detection method that can differentiate the proportion of a fluorescent molecule that is either bound or unbound in solution (e.g., the labeled target nucleic acid of the present invention), can be used to read reaction results without electrophoretic separation of the samples.
- Fluorescence polarization spectroscopy can be used to read the reaction results in the chip system disclosed in U.S. Pat. Nos.
- a compound that has an affinity for the target nucleic acid of interest can be labeled with a fluorophore to screen for test compounds that bind to the target nucleic acid.
- a fluorophore for example, a pyrene-containing aminoglycoside analog was used to accurately monitor antagonist binding to a prokaryotic 16S rRNA A site (which comprises the natural target for arninoglycoside antibiotics) in a screen using a fluorescence quenching technique in a 96-well plate format (Hamasaki & Rando, 1998, Anal. Biochem. 261(2):183-90).
- fluorescence resonance energy transfer can be used to screen for test compounds that bind to the target nucleic acid.
- FRET fluorescence resonance energy transfer
- the fluorophore on the target nucleic acid and the fluorophore on the test compounds will have overlapping excitation and emission spectra such that one fluorophore (the donor) transfers its emission energy to excite the other fluorophore (the acceptor).
- the acceptor preferably emits light of a different wavelength upon relaxing to the ground state, or relaxes non-radiatively to quench fluorescence.
- FRET is very sensitive to the distance between the two fluorophores, and allows measurement of molecular distances less than 10 nm.
- U.S, Pat. No. 6,337,183 to Arenas et al. which is incorporated by reference in its entirety, describes a screen for compounds that bind RNA that uses FRET to measure the effect of test compounds on the stability of a target RNA molecule where the target RNA is labeled with both fluorescent acceptor and donor molecules and the distance between the two fluorophores as determined by FRET provides a measure of the folded structure of the RNA.
- Matsumoto et al. 2000, Bioorg. Med. Chem. Lett.
- both the target nucleic acid and a compound that has an affinity for the target nucleic acid of interest are labeled with fluorophores with overlapping emission and excitation spectra (donor and acceptor), including but not limited to fluorescein and derivatives, rhodamine and derivatives, cyanine dyes and derivatives, bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, pyrene, nanoparticles, or non-fluorescent quenching molecules.
- fluorophores with overlapping emission and excitation spectra including but not limited to fluorescein and derivatives, rhodamine and derivatives, cyanine dyes and derivatives, bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, pyrene, nanoparticles, or non-fluorescent quenching molecules.
- fluorophores with overlapping emission and excitation spectra including but not limited
- the test compounds is labeled with the acceptor fluorophore. Conversely, if the target nucleic acid is labeled with the acceptor fluorophore, then the test compounds is labeled with the donor fluorophore.
- a wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.
- the fluorophore on the target nucleic acid must be in close proximity to the binding site of the test compounds, but should not be incorporated into a target nucleic acid at the specific binding site at which test compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the test compounds at this site.
- HTPF time-resolved fluorescence
- Fluorescence spectroscopy has traditionally been used to characterize DNA-protein and protein-protein interactions, but fluorescence spectroscopy has not been widely used to characterize RNA-protein interactions because of an interfering absorption of RNA nucleotides with the intrinsic tryptophan fluorescence of proteins (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356.). However, fluorescence spectroscopy has been used in studying the: single tryptophan residue within the arginine-rich RNA-binding domain of Rev protein and its interaction with the RRE in a time-resolved fluorescence study (Kwon & Carson, 1998, Anal. Biochem. 264:133-140). Thus, in this invention, fluorescence spectroscopy is less preferred if the test compounds or peptides or proteins possess intrinsic tryptophan fluorescence. However, fluorescence spectroscopy can be used for test compounds that do not possess intrinsic fluorescence.
- SPR Surface plasmon resonance
- the evanescent wave profile depends astonishingly on the refractive index of the medium it probes.
- the angle at which absorption occurs is very sensitive to the refractive changes in the external medium.
- All proteins and nucleic acids are known to change the refractive index of water by a similar amount per unit mass, irrespective of their amino acid or nucleotide composition (the refractive index change is different for proteins and nucleic acids).
- the refractive index change is different for proteins and nucleic acids.
- one member of a complex is immobilized in a dextran layer and then the other member is introduced into the solution, either in a flow cell (Biacore AB, Uppsala, Sweden) or a stirred cuvette (Affinity Sensors, Santa Fe, N. Mex.). It has been determined that there is a linear correlation between the surface concentration of protein or nucleic acid and the shift in resonance angle, which can be used to quantitate kinetic rate constants and/or the equilibrium constants.
- the target RNA may be immobilized to the sensor surface through a streptavidin-biotin linkage, the linkage of which is disclosed by Crouch et al. (Methods Mol. Biol., 1999, 118:143-160).
- the RNA is biotinylated either during synthesis or post-synthetically via the conversion of the 3′ terminal ribonucleoside of the RNA into a reactive free amino group or using a T7 polymerase incorporated guanosine monophosphorothioate at the 5′ end.
- the target nucleic acid can be immobilized to a sensor surface (e.g., by a streptavidin-biotin linkage) and SPR can be used to (a) determine whether the target RNA binds a test compound and (b) further characterize the binding of the target nucleic acids of the present invention to a test compound.
- a sensor surface e.g., by a streptavidin-biotin linkage
- SPR can be used to (a) determine whether the target RNA binds a test compound and (b) further characterize the binding of the target nucleic acids of the present invention to a test compound.
- the mass spectrometer operation on the material to be analyzed is repeated a fixed number of times and the stored control sample values at each m/z ratio level at each time increment are subtracted from each corresponding one from the operational runs thus producing a difference value at each mass ratio for each of the multiple runs at each time increment. If the MS value minus the background noise does not exceed a preset value, the m/z ratio data point is not recorded, thus eliminating background noise, chemical noise and false positive peaks from the mass spectrometer data.
- the stored data for each of the multiple runs is then compared to a predetermined value at each m/z ratio and the resultant series of peaks, which are now determined to be above the background, is stored in the m/z points in which the peaks are of significance.
- the target nucleic acid complexed to a test compound can be determined by any of the mass spectrometry processed described supra. Furthermore, mass spectrometry can also be used to elucidate the structure of the test compound.
- SPA Scintillation Proximity Assay
- SPA can be adapted to high throughput screening by the availability of microplates, wherein the scintillant is directly incorporated into the plastic of the microtiter wells (Nakayama et al., 1998, J. Biomol. Screening 3:43-48).
- one embodiment of the present invention comprises (a) labeling of the target nucleic acid with a radioactive or fluorescent label; (b) contacted the labeled nucleic acid with test compounds, wherein each test compound is in a microtiter well coated with scintillant and is tethered to the microtiter well; and (c) identifying and quantifying the test compounds bound to the target nucleic acid with SPA, wherein the test compound is identified by virtue of its location in the microplate.
- NMR spectroscopy is a valuable technique for identifying complexed target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects, and NMR-based approaches have been used in the identification of small molecule binders of protein drug targets (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356).
- SAR structure-activity relationships
- the signal from the bound molecule is monitored by employing line broadening, transferred NOEs and pulsed field gradient diffusion measurements (Moore, 1999, Curr. Opin. Biotechnol. 10:54-58).
- a strategy for lead generation by NMR using a library of small molecules has been recently described (Fejzo et al., 1999, Chem. Biol. 6:755-769).
- the target nucleic acid complexed to a test compound can be determined by SAR by NMR. Furthermore, SAR by NMR can also be used to elucidate the structure of the test compound.
- size-exclusion chromatography is used to purify test compounds that are bound to a target nucleic from a complex mixture of compounds.
- Size-exclusion chromatography separates molecules based on their size and uses gel-based media comprised of beads with specific size distributions. When applied to a column, this media settles into a tightly packed matrix and forms a complex array of pores. Separation is accomplished by the inclusion or exclusion of molecules by these pores based on molecular size. Small molecules are included into the pores and, consequently, their migration through the matrix is retarded due to the added distance they must travel before elution. Large molecules are excluded from the pores and migrate with the void volume when applied to the matrix.
- a target nucleic acid is incubated with a mixture of test compounds while free in solution and allowed to reach equilibrium.
- test compounds free in solution are retained by the column, and test compounds bound to the target nucleic acid are passed through the column.
- spin columns commonly used for “desalting” of nucleic acids will be employed to separate bound from unbound test compounds (e.g., Bio-Spin columns manufactured by BIO-RAD).
- the size exclusion matrix is packed into multiwell plates to allow high throughput separation of mixtures (e.g., PLASMID 96-well SEC plates manufactured by Millipore).
- affinity capture is used to purify test compounds that are bound to a target nucleic acid labeled with an affinity tag from a complex mixture of compounds.
- a target nucleic acid labeled with an affinity tag is incubated with a mixture of test compounds while free in solution and then captured to a solid support once equilibrium has been established; alternatively, target nucleic acids labeled with an affinity tag can be captured to a solid support first and then allowed to reach equilibrium with a mixture of test compounds.
- the solid support is typically comprised of, but not limited to, cross-linked agarose beads that are coupled with a ligand for the affinity tag.
- the solid support may be a glass, silicon, metal, or carbon, plastic (polystyrene, polypropylene) surface with or without a self-assembled monolayer (SAM) either with a covalently attached ligand for the affinity tag, or with inherent affinity for the tag on the target nucleic acid.
- SAM self-assembled monolayer
- retention of bound compounds and removal of unbound compounds is facilitated by washing the solid support with large excesses of binding reaction buffer.
- retention of high affinity compounds and removal of low affinity compounds can be accomplished by a number of means that increase the stringency of washing; these means include, but are not limited to, increasing the number and duration of washes, raising the salt concentration of the wash buffer, addition of detergent or surfactant to the wash buffer, and addition of non-specific competitor to the wash buffer.
- the test compounds themselves are detectably labeled with fluorescent dyes, radioactive isotopes, or nanoparticles.
- fluorescent dyes e.g., fluorescent dyes, radioactive isotopes, or nanoparticles.
- binding between the test compounds and the target nucleic acid can be determined by the presence of the detectable label on the test compound using fluorescence.
- bound compounds with high affinity for the target nucleic acid can be eluted from the immobilized target nucleic acids and analyzed.
- the elution of test compounds can be accomplished by any means that break the non-covalent interactions between the target nucleic acid and compound.
- Means for elution include, but are not limited to, hanging the pH, changing the salt concentration, the application of organic solvents, and the application of molecules that compete with the bound ligand.
- the means employed for elution will release the compound from the target RNA, but will not effect the interaction between the affinity tag and the solid support, thereby achieving selective elution of test compound.
- a preferred embodiment will employ an elution buffer that is volatile to allow for subsequent concentration by lyophilization of the eluted compound (e.g., 0 M to 5 M ammonium acetate).
- both the target nucleic acid and the test compounds are labeled with nanoparticles.
- a nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag 2 S, ZnS, CdS, CdTe, Au, or TiO 2 .
- Methods for the attachment of nucleic acids and small molecules to nanoparticles are well know to one of skill in the art (reviewed in Niemeyer, 2001, Angew. Chem. Int. Ed. 40:4129-4158. The references cited therein are hereby incorporated by reference in their entireties).
- test compound can be deconvoluted, e.g., by cross-referencing the positive sample to original compound list that was applied to the individual test assays.
- the sequence of the test compound can be determined by direct sequencing of the peptide or nucleic acid. Such methods are well known to one of skill in the art.
- a number of physico-chemical techniques can be used for the de novo characterization of test compounds bound to the target.
- Mass spectrometry e.g., electrospray ionization (“ESI”) and matrix-assisted laser desorption-ionization (“MALDI”), Fourier-transform ion cyclotron resonance (“FT-ICR”)
- ESI electrospray ionization
- MALDI matrix-assisted laser desorption-ionization
- FT-ICR Fourier-transform ion cyclotron resonance
- mass spectroscopy is that separation of a bound and unbound complex and test compound structure elucidation can be carried out in a single step.
- MALDI uses a pulsed laser for desorption of the ions and a time-of-flight analyzer, and has been used for the detection of noncovalent tRNA:amino-acyl-tRNA synthetase complexes (Gruic-Sovulj et al., 1997, J. Biol. Chem. 272:32084-32091).
- covalent cross-linking between the target nucleic acid and the test compound is required for detection, since a non-covalently bound complex may dissociate during the MALDI process.
- ESI mass spectrometry (“ESI-MS”) has been of greater utility for studying non-covalent molecular interactions because, unlike the MALDI process, ESI-MS generates molecular ions with little to no fragmentation (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). ESI-MS has been used to study the complexes formed by HIV Tat peptide and protein with the TAR RNA (Sannes-Lowery et al., 1997, Anal. Chem. 69:5130-5135).
- FT-ICR Fourier-transform ion cyclotron resonance
- An advantage of mass spectroscopy is not only the elucidation of the structure of the test compound, but also the determination of the structure of the test compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a test compound that specifically binds to a preselected target RNA.
- NMR spectroscopy is a technique for identifying binding sites in target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects.
- Examples of NMR that can be used for the invention include, but are not limited to, one-dimentional NMR, two-dimentional NMR, correlation spectroscopy (“COSY”), and nuclear Overhauser effect (“NOE”) spectroscopy.
- COSY correlation spectroscopy
- NOE nuclear Overhauser effect
- an advantage of NMR is the not only the elucidation of the structure of the test compound, but also the determination of the structure of the test compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a test compound that specifically binds to a preselected target RNA.
- Vibrational spectroscopy e.g. infrared (IR) spectroscopy or Raman spectroscopy
- IR infrared
- Raman spectroscopy can be used for elucidating the structure of the test compound on the isolated bead.
- Infrared spectroscopy measures the frequencies of infrared light (wavelengths from 100 to 10,000 nm) absorbed by the test compound as a result of excitation of vibrational modes according to quantum mechanical selection rules which require that absorption of light cause a change in the electric dipole moment of the molecule.
- the infrared spectrum of any molecule is a unique pattern of absorption wavelengths of varying intensity that can be considered as a molecular fingerprint to identify any compound.
- Infrared spectra can be measured in a scanning mode by measuring the absorption of individual frequencies of light, produced by a grating which separates frequencies from a mixed-frequency infrared light source, by the test compound relative to a standard intensity (double-beam instrument) or pre-measured (‘blank’) intensity (single-beam instrument).
- infrared spectra are measured in a pulsed mode (FT-IR) where a mixed beam, produced by an interferometer, of all infrared light frequencies is passed through or reflected off the test compound.
- FT-IR pulsed mode
- the resulting interferogram which may or may not be added with the resulting interferograms from subsequent pulses to increase the signal strength while averaging random noise in the electronic signal, is mathematically transformed into a spectrum using Fourier Transform or Fast Fourier Transform algorithms.
- Raman spectroscopy measures the difference in frequency due to absorption of infrared frequencies of scattered visible or ultraviolet light relative to the incident beam.
- the incident monochromatic light beam usually a single laser frequency, is not truly absorbed by the test compound but interacts with the electric field transiently. Most of the light scattered off the sample with be unchanged (Rayleigh scattering) but a portion of the scatter light will have frequencies that are the sum or difference of the incident and molecular vibrational frequencies.
- the selection rules for Raman (inelastic) scattering require a change in polarizability of the molecule. While some vibrational transitions are observable in both infrared and Raman spectrometry, must are observable only with one or the other technique.
- the Raman spectrum of any molecule is a unique pattern of absorption wavelengths of varying intensity that can be considered as a molecular fingerprint to identify any compound.
- Raman spectra are measured by submitting monochromatic light to the sample, either passed through or preferably reflected off, filtering the Rayleigh scattered light, and detecting the frequency of the Raman scattered light.
- An improved Raman spectrometer is described in U.S. Pat. No. 5,786,893 to Fink et al., which is hereby incorporated by reference.
- Vibrational microscopy can be measured in a spatially resolved fashion to address single beads by integration of a visible microscope and spectrometer.
- a microscopic infrared spectrometer is described in U.S. Pat. No. 5,581,085 to Reffner et al., which is hereby incorporated by reference in its entirety.
- An instrument that simultaneously performs a microscopic infrared and microscopic Raman analysis on a sample is described in U.S. Pat. No. 5,841,139 to Sostek et al., which is hereby incorporated by reference in its entirety.
- test compounds can be identified by matching the IR or Raman spectra of a test compound to a dataset of vibrational (IR or Raman) spectra previously acquired for each compound in the combinatorial library.
- IR or Raman vibrational
- test compounds identified in the binding assay can be tested for biological activity using host cells containing or engineered to contain the target RNA element coupled to a functional readout system.
- the lead compound can be tested in a host cell engineered to contain the target RNA element controlling the expression of a reporter gene.
- the lead compounds are assayed in the presence or absence of the target RNA.
- a phenotypic or physiological readout can be used to assess activity of the target RNA in the presence and absence of the lead compound.
- the lead compound can be tested in a host cell engineered to contain the target RNA element controlling the expression of a reporter gene, such as, but not limited to, ⁇ -galactosidase, green fluorescent protein, red fluorescent protein, luciferase, chloramphenicol acetyltransferase, alkaline phosphatase, and ⁇ -lactamase.
- a reporter gene such as, but not limited to, ⁇ -galactosidase, green fluorescent protein, red fluorescent protein, luciferase, chloramphenicol acetyltransferase, alkaline phosphatase, and ⁇ -lactamase.
- a cDNA encoding the target element is fused upstream to a reporter gene wherein translation of the reporter gene is repressed upon binding of the lead compound to the target RNA. In other words, the steric hindrance caused by the binding of the lead compound to the target RNA repressed the translation of the reporter gene.
- a phenotypic or physiological readout can be used to assess activity of the target RNA in the presence and absence of the lead compound.
- the target RNA may be overexpressed in a cell in which the target RNA is endogenously expressed.
- the in vivo effect of the lead compound can be assayed by measuring the cell growth or viability of the target cell.
- a reporter gene can also be fused downstream of the target PNA sequence and the effect of the lead compound on reporter gene expression can be assayed.
- the lead compounds identified in the binding assay can be tested for biological activity using animal models for a disease, condition, or syndrome of interest. These include animals engineered to contain the target RNA element coupled to a functional readout system, such as a transgenic mouse. Animal model systems can also be used to demonstrate safety and efficacy.
- Compounds displaying the desired biological activity can be considered to be lead compounds, and will be used in the design of congeners or analogs possessing useful pharmacological activity and physiological profiles.
- molecular modeling techniques can be employed, which have proven to be useful in conjunction with synthetic efforts, to design variants of the lead that can be more effective. These applications may include, but are lot limited to, Pharmacophore Modeling (cf. Lamothe, et al. 1997, J. Med. Chem. 40: 3542; Housing et al. 1996, J. Med. Chem. 39: 285; Beusen et al. 1995, Biopolymers 36: 181; P. Fossa et al. 1998, Comput.
- RNA structural programs including, but not limited to mFold (as described by Zuker et al. Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide in RNA Biochemistry and Biotechnology pp. 11-43, J. Barciszewski & B. F. C. Clark, eds. (NATO ASI Series, Kluwer Academic Publishers, 1999) and Mathews et al. 1999 J. Mol. Biol. 288: 911-940); RNAmotif (Macke et al. 2001, Nucleic Acids Res. 29: 4724-4735; and the Vienna RNA package (Hofacker et al. 1994, Monatsh. Chem. 125: 167-188).
- Molecular modeling tools employed may include those from Tripos, Inc., St. Louis, Mo. (e.g., Sybyl/UNITY, CONCORD, DiverseSolutions), Accelerys, San Diego, Calif. (e.g., Catalyst, Wisconsin Package ⁇ BLAST, etc. ⁇ ), Schrodinger, Portland, Oreg. (e.g., QikProp QikFit, Jaguar) or other such vendors as BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc. (Mississauga, Ontario, Canada), and Hypercube, Inc. (Cambridge, Ontario, Canada), and may include privately designed and/or “academic” software (e.g. RNAMotif, MFOLD).
- QSARs Quantitative Structural Activity Relationships
- Biologically active compounds identified using the methods of the invention or a pharmaceutically acceptable salt thereof can be administered to a patient, preferably a mammal, more preferably a human, suffering from a disease whose progression is associated with a target RNA:host cell factor interaction in vivo.
- such compounds or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a mammal, more preferably a human, as a preventative measure against a disease associated with an RNA:host cell factor interaction in vivo.
- treatment refers to an amelioration of a disease, or at least one discernible symptom thereof.
- treatment or “treating” refers to an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient.
- treatment or “treating” refers to inhibiting the progression of a disease, either physically, e.g., stabilization of a discernible symptom, physiologically, e.g., stabilization of a physical parameter, or both.
- treatment or “treating” refers to delaying the onset of a disease.
- the compound or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a manmial, more preferably a human, as a preventative measure against a disease associated with an RNA:host cell factor interaction in vivo.
- prevention or “preventing” refers to a reduction of the risk of acquiring a disease.
- the compound or a pharmaceutically acceptable salt thereof is administered as a preventative measure to a patient.
- the patient can have a genetic predisposition to a disease, such as a family history of the disease, or a non-genetic predisposition to the disease. Accordingly, the compound and pharmaceutically acceptable salts thereof can be used for the treatment of one manifestation of a disease and prevention of another.
- the compound or a pharmaceutically acceptable salt thereof is preferably administered as component of a composition that optionally comprises a pharmaceutically acceptable vehicle.
- the composition can be administered orally, or by any other convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal, and intestinal mucosa, etc.) and may be administered together with another biologically active agent. Administration can be systemic or local.
- Various delivery systems are known, e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the compound and pharmaceutically acceptable salts thereof.
- Methods of administration include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin.
- the mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of the compound or a pharmaceutically acceptable salt thereof into the bloodstream.
- This may be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
- intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.
- Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant.
- the compound and pharmaceutically acceptable salts thereof can be formulated as a suppository, with traditional binders and vehicles such as triglycerides.
- the compound and pharmaceutically acceptable salts thereof can be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).
- a liposome see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).
- the compound and pharmaceutically acceptable salts thereof can be delivered in a controlled release system (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
- a controlled release system see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
- Other controlled-release systems discussed in the review by Langer, 1990, Science 249:1527-1533
- a pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507 Saudek et al, 1989, N. Engl. J. Med. 321:574).
- polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard etal., 1989, J. Neurosurg. 71:105).
- a controlled-release system can be placed in proximity of a target RNA of the compound or a pharmaceutically acceptable salt thereof, thus requiring only a fraction of the systemic dose.
- compositions comprising the compound or a pharmaceutically acceptable salt thereof (“compound compositions”) can additionally comprise a suitable amount of a pharmaceutically acceptable vehicle so as to provide the form for proper administration to the patient.
- the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, mammals, and more particularly in humans.
- vehicle refers to a diluent, adjuvant, excipient, or carrier with which a compound of the invention is administered.
- Such pharmaceutical vehicles can be liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
- the pharmaceutical vehicles can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like.
- auxiliary, stabilizing, thickening, lubricating and coloring agents may be used.
- the pharmaceutically acceptable vehicles are preferably sterile. Water is a preferred vehicle when the compound of the invention is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid vehicles, particularly for injectable solutions.
- Suitable pharmaceutical vehicles also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
- excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
- Compound compositions if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
- Compound compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use.
- the pharmaceutically acceptable vehicle is a capsule (see e.g., U.S. Pat. No. 5,698,155).
- suitable pharmaceutical vehicles are described in Remington's Pharmaceutical Sciences, Alfonso R. Gennaro, ed., Mack Publishing Co. Easton, Pa., 19th ed., 1995, pp. 1447 to 1676, incorporated herein by reference.
- compositions for oral delivery may be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example.
- Orally administered compositions may contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation.
- compositions can be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over an extended period of time.
- Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions.
- fluid from the environment surrounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture.
- delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations.
- a time delay material such as glycerol monostearate or glycerol stearate may also be used.
- compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. Such vehicles are preferably of pharmaceutical grade.
- compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions may also include a solubilizing agent.
- the compound or a pharmaceutically acceptable salt thereof can be formulated for intravenous administration.
- Compositions for intravenous administration may optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection.
- the ingredients are supplied either separately or mix ed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
- the compound or a pharmaceutically acceptable salt thereof is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline.
- an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
- the amount of a compound or a pharmaceutically acceptable salt thereof that will be effective in the treatment of a particular disease will depend on the nature of the disease, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances. However, suitable dosage ranges for oral administration are generally about 0.001 milligram to about 200 milligrams of a compound or a pharmaceutically acceptable salt thereof per kilogram body weight per day.
- the oral dose is about 0.01 milligram to about 100 milligrams per kilogram body weight per day, more preferably about 0.1 milligram to about 75 milligrams per kilogram body weight per day, more preferably about 0.5 milligram to 5 milligrams per kilogram body weight per day.
- the dosage amounts described herein refer to total amounts administered; that is, if more than one compound is administered, or if a compound is administered with a therapeutic agent, then the preferred dosages correspond to the total amount administered.
- Oral compositions preferably contain about 10% to about 95% active ingredient by weight.
- Suitable dosage ranges for intravenous (i.v.) administration are about 0.01 milligram to about 100 milligrams per kilogram body weight per day, about 0.1 milligram to about 35 milligrams per kilogram body weight per day, and about 1 milligram to about 10 milligrams per kilogram body weight per day.
- Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight per day to about 1 mg/kg body weight per day.
- Suppositories generally contain about 0.01 milligram to about 50 milligrams of a compound of the invention per kilogram body weight per day and comprise active ingredient in the range of about 0.5% to about 10% by weight.
- the compound and pharmaceutically acceptable salts thereof are preferably assayed in vitro and in vivo, for the desired therapeutic or prophylactic activity, prior to use in humans.
- in vitro assays can be used to determine whether it is preferable to administer the compound, a pharmaceutically acceptable salt thereof, and/or another therapeutic agent.
- Animal model systems can be used to demonstrate safety and efficacy.
- a variety of compounds can be used for treating or preventing diseases in mammals.
- Types of compounds include, but are not limited to, peptides, peptide analogs including peptides comprising non-natural amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as a-amino phosphonic acids and a-amino phosphinic acids, or amino acids having non-peptide linkages, nucleic acids, nucleic acid analogs such as phosphorothioates or peptide nucleic acids (“PNAs”), hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose.
- PNAs phosphorothioates or peptide nucleic acids
- the therapeutic targets presented herein are by way of example, and the present invention is not to be limited by the targets described herein.
- the therapeutic targets presented herein as DNA sequences are understood by one of skill in the art that the sequences can be converted to RNA sequences.
- TNF- ⁇ Tumor Necrosis Factor Alpha
- GenBank Accession # X01394 1 gcagaggacc agctaagagg gagagaagca actacagacc ccccctgaaa acaaccctca (SEQ ID NO: 6) 61 gacgccacat cccctgacaa gctgccaggc aggttctctt cctctcacat actgacccac 121 ggctccaccc tctcccct ggaaaggaca ccatgagcac tgaaagcatg atccgggacg 181 tggagctggc cgaggaggcg ctccccaaga agacaggggg gccccagggcggt 241 gcttgtcct cagcctcttc ttcctga tcgtggggtggt 241 gcttgtct
- GM-CSF Granulocyte-macrophage Colony Stimulating Factor
- Group I AU-Rich Element Cluster in 3′ untranslated region 5′ AUUUAUUUAUUUAUUUAUUUA 3′ (SEQ ID NO: 1)
- IL-2 Interleukin 2
- GenBank Accession #U25676 1 atcactctct ttaatcacta ctcacattaa cctcaactccc tgccacaatg tacaggatgc (SEQ ID NO: 9) 61 aactcctgtc ttgcattgca ctaattcttg cacttgtcac aaacagtgca cctacttcaa 121 gttcgacaaa gaaaacaag aaacacagc tacaactgga gcatttactg ctggatttac 181 agatgatttt gaatggaatt aataattaca agaatcccaa actcaccagg atgctcacat 241 ttaagtttta catgcccaag aaggccacag aactgaaaca gcttcagtgt ctagaagaaga
- IL-6 Interleukin 6
- VEGF Vascular Endothelial Growth Factor
- GenBank Accession #AF022375 1 aagagctcca gagagaagtc gaggaagaga gagacggggt cagagagagc gcgcgggcgt (SEQ ID NO: 12) 61 gcgagcagcg aaagcgacag gggcaaagtg agtgacctgc ttttgggggt gaccgccgga 121 gcgcggcgtg agccctcccccccttgggatcc cgcagctgac cagtcgcgct gacggacaga 181 cagacagaca ccgcccccag ccccagttac cacctcctcc ccggcg gcggacagtg 241 gacgcggcgg cgagcgg gcagggggg
- HIV-1 Human Immunodeficiency Virus I
- Gag/Pol Frameshifting Site “Minimal” frameshifting element 5′ UUUUUUAGGGAAGAUCUGGCCUUCCUACAA (SEQ ID NO: 16) GGGAAGGCCAGGGAAUUUUCUU 3′
- HCV Hepatitis C Virus
- RNaseP Ribonuclease P RNA
- RNA 1 ccaccggtta cgatcttgcc gaccatggcc ccacaatagg gccggggaga cccggcgtca (SEQ ID NO: 24) 61 gtggtgggcg gcacggtcag taacgtctgc gcaacacggg gttgactgac gggcaatatc 121 ggctccatag cgtcggccgc ggatacagta aaggagcatt ctgtgacgga aaagacgccc 181 gacgacgtct tcaaacttgc caaggacgag aaggtcgaat atgtcgacgt cggtctgt 241 gacctgcct
- XIAP X-Linked Inhibitor of Apoptosis Protein
- GenBank Accession #U45880 1 gaaaaggtgg acaagtccta ttttcaagag aagatgactt ttaacagttt tgaaggatct (SEQ ID NO: 25) 61 aaaacttgtg tacctgcaga catcaataag gaagaagaat ttgtagaaga gtttaataga 121 ttaaaaactt ttgctaatttt tccaagtggt agtcctgttt cagcatcaac actggcacga 181 gcagggtttc tttatactgg tgaaggagat accgtgcggt gctttagttg tcatgcagct 241 gtagatagat ggcaatatgg agactcagca gttggaagac acagga
- Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100, and 0.5 mM MgCl 2 .
- Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA.
- Tris-Potassium chloride-magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KCl, 0.1 % Triton X-100 and 5 mM MgCl 2 .
- RNA oligonucleotides were purchased from Dharmacon, Inc, Lafayette, Colo.). 500 pmole of either a 5′ fluorescein labeled oligonucleotide corresponding to the 16S rRNA A site (5′-GGCGUCACACCUUCGGGUGAAGUCGCC-3′ (SEQ ID NO: 29); Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al., 1991, EMBO J. 10:3099-3103; Yoshizawa et al., 1998, EMBO J.
- the labeled oligonucleotides were purified using G-25 Sephadex columns (Boehringer Mannheim).
- Tat-TAR gel retardation reactions the method of Huq et al. (Nucleic Acids Research, 1999, 27:1084-1093) was utilized with TK buffer containing 0.5 mM MgCl 2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 31); single letter amino acid code).
- TK buffer containing 0.5 mM MgCl 2
- YGRKKRRQRRRP SEQ ID NO: 31
- single letter amino acid code the method of Huq et al. was used with TKM buffer.
- reaction volumes 50 pmoles of 32 P cytidine-labeled oligonucleotide and either gentamicin sulfate (Sigma) or the short Tat peptide (Tat 47-58 ) in TK or TKM buffer were heated at 90° C. for 2 minutes and allow to cool to room temperature (approximately 24° C.) over 2 hours. Then 10 ⁇ l of 30% glycerol was added to each reaction tube and the entire sample was loaded onto a TBE non-denaturing polyacrylamide gel and electrophoresed at 1200-1600 volt-hours at 4° C. The gel was exposed to an intensifying screen and radioactivity was quantitated using a Typhoon phosporimager (Molecular Dynamics).
- Typhoon phosporimager Molecular Dynamics
- RNA structures such as ribosomes
- chemical footprinting or toe printing Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al., 1991, EMBO J. 10:3099-3103; Yoshizawaetal., 1998, EMBO J. 17:6437-6448.
- gel mobility shift assays to monitor RNA-small molecule interactions are described. This approach allows for rapid visualization of small molecule-RNA interactions based on the difference between mobility of RNA alone versus RNA in a complex with a small molecule.
- RNA oligonucleotide corresponding to the well-characterized gentamicin binding site on the 16S rRNA (Moazed & Noller, 1987, Nature 327:389-394) and the equally well-characterized HIV-1 TAT protein binding site on the HIV-1 TAR element (Huq et al., 1999, Nucleic Acids Res. 27: 1084-1093) were chosen.
- the purpose of these experiments is to lay the groundwork for the use of chromatographic techniques in a high throughput fashion, such as microcapillary electrophoresis, for drug discovery.
- a gel retardation assay was performed using the Tat 47-58 peptide and the TAR RNA oligonucleotide. As shown in FIG. 1, in the presence of the Tat peptide, a clear shift is visible when the products are separated on a 12% non-denaturing polyacrylamide gel. In the reaction that lacks peptide, only the free RNA is visible.
- the temperature of the reaction when gentamicin is added is also important.
- gentamicin is present in the reaction during the entire denaturation/renaturation cycle, that is, when gentamicin is added at 90C° C. or 85 ° C., a gel shift is visualized (data not shown).
- gentamicin is added after the renaturation step has proceeded to 75° C., a mobility shift is not produced.
- Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100, and 0.5 mM MgCl 2 .
- Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA.
- Tris-Potassium chloride-magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100 and 5 mM MgCl 2 .
- RNA oligonucleotides were purchased from Dharmacon, Inc. Lafayette, Colo.). 500 pmole of a 5′ fluorescein labeled oligonucleotide corresponding to the HIV-1 TAR element TAR RNA (5′-GGCGUCACACCUUCGGGUGAAGUCGCC-3′ (SEQ ID NO: 30); Huq et al., 1999, Nucleic Acids Research. 27:1084-1093; Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was used. For Tat-TAR gel retardation reactions the method of Huq et al.
- TK buffer containing 0.5 mM MgCl 2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 31); single letter amino acid code).
- YGRKKRRQRRRP SEQ ID NO: 31
- Tat 47-58 short Tat peptide
- TKM buffer 20 ⁇ l reaction volumes 50 pmoles of labeled oligonucleotide and the short Tat peptide (Tat 47-58 ) in TK or TKM buffer were heated at 90° C. for 2 minutes and allow to cool to room temperature (approximately 24° C.) over 2 hours.
- the reactions were loaded onto a SCE9610 automated capillary electrophoresis apparatus (SpectruMedix; State College, Pa.).
- a method for identifying a test compound that binds to a target RNA molecule comprising the steps of (a) contacting a detectably labeled target RNA molecule with a library of test compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of test compounds so that a detectably labeled target RNA:test compound complex is formed; (b) separating the detectably labeled target RNA:test compound complex formed in step(a) from uncomplexed target RNA molecules and test compounds; and (c) determining a structure of the test compound bound to the RNA in the RNA:test compound complex.
- RNA molecule is an element derived from the mRNA for tumor necrosis factor alpha (“TNF- ⁇ ”), granulocyte-macrophage colony stimulating factor (“GM-CSF”), interleukin 2 (“IL-2”), interleukin 6 (“IL-6”), vascular endothelial growth factor (“VEGF”), human immunodeficiency virus I (“HIV-1”), hepatitis C virus (“HCV”—genotypes 1a & 1b), ribonuclease P RNA (“RNaseP”), X-linked inhibitor of apoptosis protein (“XIAP”), or survivin.
- TNF- ⁇ tumor necrosis factor alpha
- GM-CSF granulocyte-macrophage colony stimulating factor
- IL-2 interleukin 2
- IL-6 interleukin 6
- VEGF vascular endothelial growth factor
- HCV-1 human immunodeficiency virus I
- HCV hepatitis C virus
- test compound is selected from a combinatorial library comprising peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; and small organic molecule libraries, including but not limited to, libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, or diazepindiones.
- screening a library of test compounds comprises contacting the test compound with the target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions.
- aqueous solution optionally further comprises non-specific nucleic acids comprising DNA, yeast tRNA, salmon sperm DNA, homoribopolymers, and nonspecific RNAs.
- the aqueous solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant.
- the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 mM MgCl 2 .
- the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl 2 .
- the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.
- Any method that detects an altered physical property of a target nucleic acid complexed to a test compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids in the method of paragraph 1.
- elecfrophoresis is used for separation of the complexed and non-complexed target nucleic acids.
- the electrophoresis is capillary electrophoresis.
- fluorescence spectroscopy surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation are used for the separation of the complexed and non-complexed target nucleic acids.
- SAR structure-activity relationships
- test compound of the RNA:test compound complex of paragraph 1 is determined, in part, by the type of library of test compounds.
- the combinatorial libraries are small organic molecule libraries, mass spectroscopy, NMR, or vibration spectroscopy are used to determine the structure of the test compounds.
Abstract
The present invention relates to a method for screening and identifying test compounds that bind to a preselected target ribonucleic acid (“RNA”). Direct, non-competitive binding assays are advantageously used to screen libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular test compound is detected using any physical method that measures the altered physical property of the target RNA bound to a test compound. The structure of the test compound attached to the labeled RNA is also determined. The methods used will depend, in part, on the nature of the library screened. The methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.
Description
- This application claims the benefit of U.S. Provisional Application No. 60/282,965, filed Apr. 11, 2001, which is incorporated herein by reference in its entirety.
- The present invention relates to a method for screening and identifying test compounds that bind to a preselected target ribonucleic acid (“RNA”). Direct, non-competitive binding assays are advantageously used to screen libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular test compound is detected using any physical method that measures the altered physical property of the target RNA bound to a test compound. The methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.
- Protein-nucleic acid interactions are involved in many cellular functions, including transcription, RNA splicing, mRNA decay, and mRNA translation. Readily accessible synthetic molecules that can bind with high affinity to specific sequences of single- or double-stranded nucleic acids have the potential to interfere with these interactions in a controllable way, making them attractive tools for molecular biology and medicine. Successful approaches for blocking function of target nucleic acids include using duplex-forming antisense oligonucleotides (Miller, 1996, Progress in Nucl. Acid Res. & Mol. Biol. 52:261-291; Ojwang & Rando, 1999, Achieving antisense inhibition by oligodeoxynucleotides containing N7 modified 2′-deoxyguanosine using tumor necrosis
factor receptor type 1, METHODS: A Companion to Methods in Enzymology 18:244-251) and peptide nucleic acids (“PNA”) (Nielsen, 1999, Current Opinion in Biotechnology 10:71-75), which bind to nucleic acids via Watson-Crick base-pairing. Triplex-forming anti-gene oligonucleotides can also be designed (Ping et al., 1997, RNA 3:850-860; Aggarwal et al., 1996, Cancer Res. 56:5156-5164; U.S. Pat. No. 5,650,316), as well as pyrrole-imidazole polyamide oligomers (Gottesfeld et al., 1997, Nature 387:202-205; White et al., 1998, Nature 391:468-471), which are specific for the major and minor grooves of a double helix, respectively. - In addition to synthetic nucleic acids (i.e., antisense, ribozymes, and triplex-forming molecules), there are examples of natural products that interfere with deoxyribonucleic acid (“DNA”) or RNA processes such as transcription or translation. For example, certain carbohydrate-based host cell factors, calicheamicin oligosaccharides, interfere with the sequence-specific binding of transcription factors to DNA and inhibit transcription in vivo (Ho et al., 1994, Proc. Natl. Acad. Sci. USA 91:9203-9207; Liu et al., 1996, Proc. Natl. Acad. Sci. USA 93:940-944). Certain classes of known antibiotics have been characterized and were found to interact with RNA. For example, the antibiotic thiostreptone binds tightly to a 60-mer from ribosomal RNA (Cundliffe et al., 1990, in The Ribosome: Structure, Function & Evolution (Schlessinger et al, eds.) American Society for Microbiology, Washington, D.C. pp. 479-490). Bacterial resistance to various antibiotics often involves methylation at specific rRNA sites (Cundliffe, 1989, Ann. Rev. Microbiol. 43:207-233). Aminoglycosidic aminocyclitol (aminoglycoside) antibiotics and peptide antibiotics are known to inhibit group I intron splicing by binding to specific regions of the RNA (von Ahsen et al., 1991, Nature (London) 353:368-370). Some of these same aminoglycosides have also been found to inhibit hammerhead ribozyme finction (Stage et al., 1995, RNA 1:95-101). In addition, certain aminoglycosides and other protein synthesis inhibitors have been found to interact with specific bases in 16S rRNA (Woodcock et al., 1991, EMBO J. 10:3099-3103). An oligonucleotide analog of the 16S rRNA has also been shown to interact with certain aminoglycosides (Purohit et al., 1994, Nature 370:659-662). A molecular basis for hypersensitivity to aminoglycosides has been found to be located in a single base change in mitochondrial rRNA (Hutchin et al., 1993, Nucleic Acids Res. 21:4174-4179). Aninoglycosides have also been shown to inhibit the interaction between specific structural RNA motifs and the corresponding RNA binding protein. Zapp et al. (Cell, 1993, 74:969-978) has demonstrated that the aminoglycosides neomycin B, lividomycin A, and tobramycin can block the binding of Rev, a viral regulatory protein required for viral gene expression, to its viral recognition element in the IIB (or RRE) region of HIV RNA. This blockage appears to be the result of competitive binding of the antibiotics directly to the RRE RNA structural motif.
- Single stranded sections of RNA can fold into complex tertiary structures consisting of local motifs such as loops, bulges, pseudoknots, guanosine quartets and turns (Chastain & Tinoco, 1991, Progress in Nucleic Acid Res. & Mol. Biol. 41:131-177; Chow & Bogdan, 1997, Chemical Reviews 97:1489-1514; Rando & Hogan, 1998, Biologic activity of guanosine quartet forming oligonucleotides in “Applied Antisense Oligonucleotide Technology” Stein. & Krieg (eds) John Wiley and Sons, New York, pages 335-352). Such structures can be critical to the activity of the nucleic acid and affect functions such as regulation of mRNA transcription, stability, or translation (Weeks & Crothers, 1993, Science 261:1574-1577). The dependence of these functions on the native three-dimensional structural motifs of single-stranded stretches of nucleic acids makes it difficult to identify or design synthetic agents that bind to these motifs using general, simple-to-use sequence-specific recognition rules for the formation of double- and triple-helical nucleic acids used in the design of antisense and ribozyme type molecules. Approaches to screening generally involve competitive assays designed to identify compounds that disrupt the interaction between a target RNA and a physiological, host cell factor(s) that had been previously identified to specifically interact with that particular target RNA. In general, such assays require the identification and characterization of the host cell factor(s) deemed to be required for the function of the target RNA. Both the target RNA and its preselected host cell binding partner are used in a competitive format to identify compounds that disrupt or interfere with the two components in the assay.
- Citation or identification of any reference in Section 2 of this application is not an admission that such reference is available as prior art to the present invention.
- The present invention relates to methods for identifying compounds that bind to preselected target elements of nucleic acids including, but not limited to, specific RNA sequences, RNA structural motifs, and/or RNA structural elements. The specific target RNA sequences, RNA structural motifs, and/or RNA structural elements are used as targets for screening small molecules and identifying those that directly bind these specific sequences, motifs, and/or structural elements. For example, methods are described in which a preselected target RNA having a detectable label is used to screen a library of test compounds, preferably under physiologic conditions. Any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the altered physical property of the target RNA bound to a test compound. In particular, the present invention relates to methods for using a target RNA having a detectable label to screen a library of test compounds free in solution, in labeled tubes or microtiter plate, or in a microarray. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. The detectably labeled complex can then be identified and removed from the uncomplexed, unlabeled test compounds in the library, and from uncomplexed, labeled target RNA, by a variety of methods, including but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA. Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation. The structure of the test compound attached to the labeled RNA is then determined. The methods used will depend, in part, on the nature of the library screened. For example, assays or microarrays of test compounds, each having an address or identifier, may be deconvoluted, e.g., by cross-referencing the positive sample to original compound list that was applied to the individual test assays. Another method for identifying test compounds includes de novo structure determination of the test compounds using mass spectrometry or nuclear magnetic resonance (“NMR”). The test compounds identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and the like. In addition, small organic molecules which interact specifically with target RNA molecules may be useful as lead compounds for the development of therapeutic agents.
- The methods described herein for the identification of compounds that directly bind to a particular preselected target RNA are well suited for high-throughput screening. The direct binding method of the invention offers advantages over drug screening systems for competitors that inhibit the formation of naturally-occurring RNA binding protein:target RNA complexes; i.e., competitive assays. The direct binding method of the invention is rapid and can be set up to be readily performed, e.g., by a technician, making it amenable to high throughput screening. The method of the invention also eliminates the bias inherent in the competitive drug screening systems, which require the use of a preselected host cell factor that may not have physiological relevance to the activity of the target RNA. Instead, the methods of the invention are used to identify any compound that can directly bind to specific target RNA sequences, RNA structural motifs, and/or RNA structural elements, preferably under physiologic conditions. As a result, the compounds so identified can inhibit the interaction of the target RNA with any one or more of the native host cell factors (whether known or unknown) required for activity of the RNA in vivo.
- The present invention may be understood more fully by reference to the detailed description and examples, which are intended to illustrate non-limiting embodiments of the invention.
- As used herein, a “target nucleic acid” refers to RNA, DNA, or a chemically modified variant thereof. In a preferred embodiment, the target nucleic acid is RNA. A target nucleic acid also refers to tertiary structures of the nucleic acids, such as, but not limited to loops, bulges, pseudoknots, guanosine quartets and turns. A target nucleic acid also refers to RNA elements such as, but not limited to, the HIV TAR element, internal ribosome entry site, “slippery site”, instability elements, and adenylate uridylate-rich elements, which are described in Section 5.1. Non-limiting examples of target nucleic acids are presented in Section 5.1 and Section 6.
- As used herein, a “library” refers to a plurality of test compounds with which a target nucleic acid molecule is contacted. A library can be a combinatorial library, e.g., a collection of test compounds synthesized using combinatorial chemistry techniques, or a collection of unique chemicals of low molecular weight (less than 1000 daltons) that each occupy a unique three-dimensional space.
- As used herein, a “label” or “detectable label” is a composition that is detectable, either directly or indirectly, by spectroscopic, photochemical, biochem cal, immunochemical, or chemical means. For example, useful labels include radioactive isotopes (e.g.,32P, 35S, and 3H), dyes, fluorescent dyes, electron-dense reagents, enzymes and their substrates (e.g., as commonly used in enzyme-linked immunoassays, e.g., lkaline phosphatase and horse radish peroxidase), biotin-streptavidin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available. Moreover, a label or detectable moiety can include a “affinity tag” that, when coupled with the target nucleic acid and incubated with a test compound or compound library, allows for the affinity capture of the target nucleic acid along with molecules bound to the target nucleic acid. One skilled in the art will appreciate that a affinity tag bound to the target nucleic acids has, by definition, a complimentary ligand coupled to a solid support that allows for its capture. For example, useful affinity tags and complimentary partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptaners, or haptens and proteins for which antisera or monoclonal antibodies are available. The label or detectable moiety is typically bound, either covalently, through a linker or chemical bound, or through ionic, van der Waals or hydrogen bonds to the molecule to be detected.
- As used herein, a “dye” refers to a molecule that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional spectroscopic means. As used herein, a “visible dye” refers to a molecule having a chromophore that absorbs radiation in the visible region of the spectrum (i.e., having a wavelength of between about 400 nm and about 700 nm) such that the transmitted radiation is in the visible region and can be detected either visually or by conventional spectroscopic means. As used herein, an “ultraviolet dye” refers to a molecule having a chromophore that absorbs radiation in the ultraviolet region of the spectrum (i.e., having a wavelength of between about 30 nm and about 400 nm). As used herein, an “infrared dye” refers to a molecule having a chromophore that absorbs radiation in the infrared region of the spectrum (i.e., having a wavelength between about 700 nm and about 3,000 nm). A “chromophore” is the network of atoms of the dye that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional spectroscopic means. One of skill in the art will readily appreciate that although a dye absorbs radiation in one region of the spectrum, it may emit radiation in another region of the spectrum. For example, an ultraviolet dye may emit radiation in the visible region of the spectrum. One of skill in the art will also readily appreciate that a dye can transmit radiation or can emit radiation via fluorescence or phosphorescence.
- The phrase “pharmaceutically acceptable salt(s),” as used herein includes but is not limited to salts of acidic or basic groups that may be present in test compounds identified using the methods of the present invention. Test compounds that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to sulfuric, citric, maleic, acetic, oxalic, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., 1,1′-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Test compounds that include an amino moiety may form pharmaceutically or cosmetically acceptable s :ts with various amino acids, in addition to the acids mentioned above. Test compounds that are acidic in nature are capable of forming base salts with various pharmacologically or cosmetically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium lithium, zinc, potassium, and iron salts.
- By “substantially one type of test compound,” as used herein, is meant that the assay can be performed in such a fashion that at some point, only one compound need be used in each reaction so that, if the result is indicative of a binding event occurring between the target RNA molecule and the test compound, the test compound can be easily identified.
- FIG. 1. Gel retardation analysis to detect peptide-RNA interactions. In 20 μl reactions containing increasing concentrations of Tat47-58 peptide (0.1 μM, 0.2 μM, 0.4 μM, 0.8 μM, 1.6 μM) 50 pmole TAR RNA oligonucleotide was added in TK buffer. The reaction mixture was then heated at 90° C. for 2 min and allowed to cool slowly to 24° C. 10 ml of 30% glycerol was added to each sample and applied to a 12% non-denaturing polyacrylamide gel. The gel was electrophoresed using 1200 volt-hours at 4° C. in TBE Buffer. Following electrophoresis, the gel was dried and the radioactivity was quantitated with a phosphorimager. The concentration of peptide added is indicated above each lane.
- FIG. 2. Gentamicin interacts with an oligonucleotide corresponding to the 16S rRNA. 20 μl reactions containing increasing concentrations of gentamicin (1 ng/ml, 10 ng/ml, 100 ng/ml, 1 μg/ml, 10 μg/ml, 50 μg/ml, 500 μg/ml) were added to 50 pmole RNA oligonucleotide in TKM buffer, heated at 90° C. for 2 min and allowed to cool slowly to 24° C. Then 10 μl of 30% glycerol was added to each sample and the samples were applied to a 13.5% non-denaturing polyacrylamide gel. The gel was electrophoresed using 1200 volt-hours at 4° C. in TBE Buffer Following electrophoresis, the gel was dried and the radioactivity was quantitated using a phosphorimager. The concentration of gentamicin added is indicated above each lane.
- FIG. 3. The presence of 10 pg/ml gentamicin produces a gel mobility shift in the presence of the 16S rRNA oligonucleotide. 20 μl reactions containing 30 increasing concentrations of gentamicin (100 ng/ml, 10 ng/ml, 1 ng/ml, 100 pg/ml, and 10 pg/ml) were added to 50 pmole RNA oligonucleotide in TKM buffer were treated as described for FIG. 2.
- FIG. 4. Gentamicin binding to the 16S rRNA oligonucleotide is weak in the absence of MgCl2. Reaction mixtures containing gentamicin (1 mg/ml, 100 μg/ml, 10 μg/ml, 1 μg/ml, 0.1 μg/ml, and 10 ng/ml) were treated as described in FIG. 2 except that the TKM buffer does not contain MgCl2.
- FIG. 5. Gel retardation analysis to detect peptide-RNA interactions. In reactions containing increasing concentrations of Tat47-58 peptide (0.1 μM, 0.2 μM, 0.4 μM, 0.8 μM, 1.6 μM) 50 pmole TAR RNA oligonucleotide was added in TK buffer. The reaction mixture was then heated at 90° C. for 2 min and allowed to cool slowly to 24° C. The reactions were loaded onto a SCE9610 automated capillary electrophoresis apparatus (SpectruMedix; State College, Pa.). The peaks correspond to the amount of free TAR RNA (“TAR”) or the Tat-TAR complex (“Tat-TAR”). The concentration of peptide added is indicated below each lane.
- The present invention relates to methods for identifying compounds that bind to preselected target elements of nucleic acids, in particular, RNAs, including but not limited to preselected target RNA sequencing structural motifs, or structural elements. Methods are described in which a preselected target RNA having a detectable label is used to screen a library of test compounds. Any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the altered physical property of the target RNA bound to a test compound. Changes in the physical property of the RNA-test compound complex relative to the target RNA or test compound can be measured by methods such as, but not limited to, methods that detect a change in mobility due to a change in mass, change in charge, or a change in thermostability. Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation. In particular, the present invention relates to methods for using a target RNA having a detectable label to screen a library of test compounds free in solution, in labeled tubes or microtiter plate, or in a microarray. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. The detectably labeled complex can then be identified and removed from the unlabeled, uncomplexed test compounds in the library by a variety of methods capable of differentiating changes in the physical properties of the complexed target RNA. The structure of the test compound attached to the labeled RNA is also determined. The methods used will depend, in part, on the nature of the library screened. For example, assays or microarrays of test compounds, each having an address or identifier, may be deconvoluted, e.g., by cross-referencing the positive sample to an original compound list that was applied to the individual test assays. Another method for identifying test compounds includes de novo structure determination of the test compounds using mass spectrometry or nuclear magnetic resonance (“NMR”).
- Thus, the methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of test compounds, in which the test compounds of the library that specifically bind a preselected target nucleic acid are easily distinguished from non-binding members of the library. The structures of the binding molecules are deciphered from the input library by methods depending on the type of library that is used. The test compounds so identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and lead compounds for development of therapeutics, and the like. Small organic compounds that are identified to interact specifically with the target RNA molecules are particularly attractive candidates as lead compounds for the development of therapeutic agents.
- The assay of the invention reduces bias introduced by competitive binding assays which require the identification and use of a host cell factor (presumably essential for modulating RNA function) as a binding partner for the target RNA. The assays of the present invention are designed to detect any compound or agent that binds to the target RNA, preferably under physiologic conditions. Such agents can then be tested for biological activity, without establishing or guessing which host cell factor or factors is required for modulating the function and/or activity of the target RNA.
- Section 5.1 describes examples of protein-RNA interactions that are important in a variety of cellular functions and several target RNA elements that can be used to identify test compounds. Compounds that inhibit these interactions by binding to the RNA and successfully competing with the natural protein or host cell factor that endogenously binds to the RNA may be important, e.g., in treating or preventing a disease or abnormal condition, such as an infection or unchecked growth. Section 5.2 describes detectable labels for target nucleic acids that are useful in the methods of the invention. Section 5.3 describes libraries of test compounds. Section 5.4 provides conditions for binding a labeled target RNA to a test compound of a library and detecting RNA binding to a test compound using the methods of the invention. Section 5.5 provides methods for separating complexes of target RNAs bound to a test compound from an unbound RNA. Section 5.6 describes methods for identifying test compounds that are bound to the target RNA. Section 5.7 describes a secondary, biological screen of test compounds identified by the methods of the invention to test the effect of the test compounds in vivo. Section 5.8 describes the use of test compounds identified by the methods of the invention for treating or preventing a disease or abnormal condition in mammals.
- Nucleic acids, and in particular RNAs, are capable of folding into complex tertiary structures that include bulges, loops, triple helices and pseudoknots, which can provide binding sites for host cell factors, such as proteins and other RNAs. RNA-protein and RNA-RNA interactions are important in a variety cellular functions, including transcription, RNA splicing, RNA stability and translation. Furthermore, the binding of such host cell factors to RNAs may alter the stability and translational efficiency of such RNAs, and according affect subsequent translation. For example, some diseases are associated with protein overproduction or.decreased protein function. In this case, the identification of compounds to modulate RNA stability and translational efficiency will be useful to treat and prevent such diseases.
- The methods of the present invention are useful for identifying test compounds that bind to target RNA elements in a high throughput screening assay of libraries of test compounds in solution. In particular, the methods of the present invention are useful for identifying a test compound that binds to a target RNA elements and inhibits the interaction of that RNA with one or more host cell factors in vivo. The molecules identified using the methods of the invention are useful for inhibiting the formation of a specific bound RNA:host cell factor complexes in vivo.
- In some embodiments, test compounds identified by the methods of the invention are useful for increasing or decreasing the translation of messenger RNAs (“mRNAs”), e.g., protein production, by binding to one or more regulatory elements in the 5′ untranslated region, the 3′ untranslated region, or the coding region of the mRNA. Compounds that bind to mRNA can, inter alia, increase or decrease the rate of mRNA processing, alter its transport through the cell, prevent or enhance binding of the mRNA to ribosomes, suppressor proteins or enhancer proteins, or alter mRNA stability. Accordingly, compounds that increase or decrease mRNA translation can be used to treat or prever disease. For example, diseases associated with protein overproduction, such as amyloidosis, or with the production of mutant proteins, such as Ras, can be treated or prevented by decreasing translation of the mRNA that codes for the overproduced protein, thus inhibiting production of the protein. Conversely, the symptoms of diseases associated with decreased protein function, such as hemophelia, may be treated by increasing translation of mRNA coding for the protein whose function is decreased, e.g., factor IX in some forms of hemophilia.
- The methods of the invention can be used to identify compounds that bind to mRNAs coding for a variety of proteins with which the progression of diseases in mammals is associated. These mRNAs include, but are not limited to, those coding for amyloid protein and amyloid precursor protein; anti-angiogenic proteins such as angiostatin, endostatin, METH-1 and METH-2; apoptosis inhibitor proteins such as survivin, clotting factors such as Factor IX, Factor VIII, and others in the clotting cascade; collagens; cyclins and cyclin inhibitors, such as cyclin dependent kinases, cyclin D1, cyclin E, WAF1, cdk4 inhibitor, and MTS1; cystic fibrosis transmembrane conductance regulator gene (CFTR); cytokines such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17 and other interleukins; hematopoetic growth factors such as erythropoietin (Epo); colony stimulating factors such as G-CSF, GM-CSF, M-CSF, SCF and thrombopoietin; growth factors such as BNDF, BMP, GGRP, EGF, FGF, GDNF, GGF, HGF, IGF-1, IGF-2, KGF, myotrophin, NGF, OSM, PDGF, somatotrophin, TGF-β, TGF-α anc VEGF; antiviral cytokines such as interferons, antiviral proteins induced by interferons, TNF-α, and TNF-β; enzymes such as cathepsin K, cytochrome P-450 and other cytochromes, farnesyl transferase, glutathione-S transferases, heparanase, HMG CoA synthctase, N-acetyltransferase, phenylalanine hydroxylase, phosphodiesterase, ras carboxyl-terminal protease, telomerase and TNF converting enzyme; glycoproteins such as cadherins, e.g., N-cadherin and E-cadherin; cell adhesion molecules; selectins; transmembrane glycoproteins such as CD40; heat shock proteins; hormones such as 5-α reductase, atrial natriuretic factor, calcitonin, corticotrophin releasing factor, diuretic hormones, glucagon, gonadotropin, gonadotropin releasing hormone, growth hormone, growth hormone releasing factor, somatotropin, insulin, leptin, luteinizing hormone, luteinizing hormone releasing hormone, parathyroid hormone, thyroid hormone, and thyroid stimulating hormone; proteins involved in immune responses, including antibodies, CTLA4, hemagglutinin, MHC proteins, VLA-4, and kallikrein-kininogen-kinin system; ligands such as CD4; oncogene products such as sis, hst, protein tyrosine kinase receptors, ras, abl, mos, myc, fos, jun, H-ras, ki-ras, c-fms, bcl-2, L-myc, c-myc, gip, gsp, and HER-2; receptors such as bombesin receptor, estrogen receptor, GABA receptors, growth factor receptors including EGFR, PDGFR, FGFR, and NGFR, GTP-binding regulatory proteins, interleukin receptors, ion channel receptors, leukotriene receptor antagonists, lipoprotein receptors, opioid pain receptors, substance P receptors, retinoic acid and retinoid receptors, steroid receptors, T-cell receptors, thyroid hormone receptors, TNF receptors; tissue plasminogen activator; transmembrane receptors; transmembrane transporting systems, such as calcium pump, proton pump, Na/Ca exchanger, MRP1, MRP2, P170, LRP, and cMOAT; transferrin; and tumor suppressor gene products such as APC, brca1, brca2, DCC, MCC, MTS1, NF1, NF2, nm23, p53 and Rb. In addition to the eukaryotic genes listed above, the invention, as described, can be used to define molecules that interrupt viral, bacterial or fungal transcription or translation efficiencies and therefore form the basis for a novel anti-infectious disease therapeutic. Other target genes include, but are not limited to, those disclosed in Section 5.1 and Section 6.
- The methods of the invention can be used to identify mRNA-binding test compounds for increasing or decreasing the production of a protein, thus treating or preventing a disease associated with decreasing or increasing the production of said protein, respectively. The methods of the invention may be useful for identifying test compounds for treating or preventing a disease in mammals, including cats, dogs, swine, horses, goats, sheep, cattle, primates and humans. Such diseases include, but are not limited to, amyloidosis, hemophilia, Alzheimer's disease, atherosclerosis, cancer, giantism, dwarfism, hypothyroidism, hyperthyroidism, inflammation, cystic fibrosis, autoimmune disorders, diabetes, aging, obesity, neurodegenerative disorders, and Parkinson's disease. Other diseases include, but are not limited to, those described in Section 5.1 and diseases caused by aberrant expression of the genes disclosed in Example 6. In addition to the eukaryotic genes listed above, the invention, as described, can be used to define molecules that interrupt viral, bacterial or fungal transcription or translation efficiencies and therefore form the basis for a novel anti-infectious disease therapeutic.
- In other embodiments, test compounds identified by the methods of the invention are useful for preventing the interaction of an RNA, such as a transfer RNA (“tRNA”), an enzymatic RNA or a ribosomal RNA (“rRNA”), with a protein or with another RNA, thus preventing, e.g., assembly of an in vivo protein-RNA or RNA-RNA complex that is essential for the viability of a cell. The term “enzymatic RNA,” as used herein, refers to RNA molecules that are either self-splicing, or that form an enzyme by virtue of their association with one or more proteins, e.g., as in RNase P, telomerase or small nuclear ribonuclear protein particles. For example, inhibition of an interaction between rRNA and one or more ribosomal proteins may inhibit the assembly of ribosomes, rendering a cell incapable of synthesizing proteins. In addition, inhibition of the interaction of precursor rRNA with ribonucleases or ribonucleoprotein complexes (such as RNase P) that process the precursor rRNA prevent maturation of the rRNA and its assembly into ribosomes. Similarly, a tRNA:tRNA synthetase complex may be inhibited by test compounds identified by the methods of the invention such that tRNA molecules do not become charged with amino acids. Such interactions include, but are not limited to, rRNA interactions with ribosomal proteins, tRNA interactions with tRNA synthetase, RNase P protein interactions with RNase P RNA, and telomerase protein interactions with telomerase RNA.
- In other embodiments, test compounds identified by the methods of the invention are useful for treating or preventing a viral, bacterial, protozoan or fungal infection. For example, transcriptional up-regulation of the genes of human immunodeficiency virus type 1 (“HIV-1”) requires binding of the HIV Tat protein to the HIV trans-activation response region RNA (“TAR RNA”). HIV TAR RNA is a 59-base stem-loop structure located at the 5′-end of all nascent HIV-1 transcripts (Jones & Peterlin, 1994, Annu. Rev. Biochem. 63:717-43). Tat protein is known to interact with uracil 23 in the bulge region of the stem of TAR RNA. Thus, TAR RNA is a potential binding target for test compounds, such as small peptides and peptide analogs that bind to the bulge region of TAR RNA and inhibit formation of a Tat-TAR RNA complex involved in HIV-1 upregulation (see Hwang et al.,1999 Proc. Natl. Acad. Sci. USA 96:12997-13002). Accordingly, test compounds that bind to TAR RNA are useful as anti-HIV therapeutics (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and therefore, are useful for treating or preventing AIDS.
- The methods of the invention can be used to identify test compounds to treat or prevent viral, bacterial, protozoan or fungal infections in a patient. In some embodiments, the methods of the invention are useful for identifying compounds that decrease translation of microbial genes by interacting with mRNA, as described above, or for identifying compounds that inhibit the interactions of microbial RNAs with proteins or other ligands that are essential for viability of the virus or microbe. Examples of microbial target RNAs useful in the present invention for identifying antiviral, antibacterial, anti-protozoan and anti-fungal compounds include, but are not limited to, general antiviral and anti-inflammatory targets such as mRNAs of INFα, INFγ, RNAse L, RNAse L inhibitor protein, PKR, tumor necrosis factor, interleukins 1-15, and IMP dehydrogenase; internal ribosome entry sites; HIV-1 CT rich domain and RNase H MRNA; HCV internal ribosome entry site (required to direct translation of HCV mRNA), and the 3′-untranslated tail of HCV genomes; rotavirus NSP3 binding site, which binds the protein NSP3 that is required for rotavirus mRNA translation; HBV epsilon domain; Dengue virus 5′ and 3′ untranslated regions, including IRES; INFα, INFβ and INFγ; plasmodium falciparum mRNAs; the 16S ribosomal subunit ribosomal RNA and the RNA component of RNase P of bacteria; and the RNA component of telomerase in fungi and cancer cells. Other target viral and bacterial mRNAs include, but are not limited to, those disclosed in Section 6.
- One of skill in the art will appreciate that, although such target RNAs are functionally conserved in various species (e.g., from yeast to humans), they exhibit nucleotide sequence and structural diversity. Therefore, inhibition of, for example, yeast telomerase by an anti-fungal compound identified by the methods of the invention might not interfere with human telomerase and normal human cell proliferation.
- Thus, the methods of the invention can be used to identify test compounds that interfere with one or more target RNA interactions with host cell factors that are important for cell growth or viability, or essential in the life cycle of a virus, a bacterium, a protozoa or a fungus. Such test compounds and/or congeners that demonstrate desirable biologic and pharmacologic activity can be administered to a patient in need thereof in order to treat or prevent a disease caused by viral, bacterial, protozoan, or fungal infections. Such diseases include, but are not limited to, HIV infection, AIDS, human T-cell leukemia, SIV infection, FIV infection, fel.ne leukemia, hepatitis A, hepatitis B, hepatitis C, Dengue fever, malaria, rotavirus infection, severe acute gastroenteritis, diarrhea, encephalitis, hemorrhagic fever, syphilis, legionella, whooping cough, gonorrhea, sepsis, influenza, pneumonia, tinea infection, candida infection, and meningitis.
- Non-limiting examples of RNA elements involved in the regulation of gene expression, i.e., mRNA stability, translational efficiency via translational initiation and ribosome assembly, etc., include the HIV TAR element, internal ribosome entry site, “slippery site”, instability elements, and adenylate uridylate-rich elements, as discussed below.
- Transcriptional up-regulation of the genes of human immunodeficiency virus type 1 (“HIV-1”) requires binding of the HIV Tat protein to the HIV trans-activation response region RNA (“TAR RNA”), a 59-base stem-loop structure located at the 5′ end of all nascent HIV-1 transcripts (Jones & Peterlin, 1994, Annu. Rev. Biochem. 63:717-43). Tat protein is known to interact with uracil 23 in the bulge region of the stem of TAR RNA. Thus, TAR RNA is a useful binding target for test compounds, such as small peptides and peptide analogs that bind to the bulge region of TAR RNA and inhibit formation of a Tat-TAR RNA complex involved in HIV-1 up-regulation (see Hwang et al., 1999 Proc. Natl. Acad. Sci. USA 96:12997-13002). Accordingly, test compounds that bind to TAR RNA can be useful as anti-HIV therapeutics (Harny et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and therefore, are useful for treating or preventing AIDS.
- Internal ribosome entry sites (“IRES”) are found in the 5′ untranslated regions (“5′ UTR”) of several mRNAs, and are thought to be involved in the regulation of translational efficiency. When the IRES element is present on an mRNA downstream of a translational stop codon, it directs ribosomal re-entry (Ghattas et al., 1991, Mol. Cell. Biol. 11:5848-5959), which permits initiation of translation at the start of a second open reading frame.
- As reviewed by Jang et al., a large segment of the 5′ nontranslated region, approximately 400 nucleotides in length, promotes internal entry of ribosomes independent of the non-capped 5′ end of picornavirus mRNAs (mammalian plus-strand RNA viruses whose genomes serve as mRNA). This 400 nucleotide segment (IRES), maps approximately 200 nt down-stream from the 5′ end and is highly structured. IRES elements of different picornaviruses, although functionally similar in vitro and in vivo, are not identical in sequence or structure. However, IRES elements of the genera entero- and rhinoviruses, on the one hand, and cardio- and aphthoviruses, on the other hand, reveal similarities corresponding to phylogenetic kinship. All IRES elements contain a conserved Yn-Xm-AUG unit (Y, pyrimidine; X, nucleotide) which appears essential for IRES function. The IRES elements of cardio-, entero- and aphthoviruses bind a cellular protein, p57. In the case of cardioviruses, the interaction between a specific stem-loop of the IREs is essential for translation in vitro. The IRES elements of entero- and cardioviruses also bind the cellular protein, p52, but the significance of this interaction remains to be shown. The function of p57 or p52 in cellular metabolism is unknown. Since picomaviral IRES elements function in vivo in the absence of any viral gene products, is speculated that IRES-like elements may also occur in specific cellular mRNAs releasing them from cap-dependent translation (Jang et al., 1990, Enzyme 44(1-4):292-309).
- Programmed, or directed, ribosomal frameshifting, when ribosomes shift from one translation reading frame to another and synthesize two viral proteins from a single viral mRNA, is directed by a unique site in viral mRNAs called the “slippery site.” The slippery site directs ribosomal frameshifting in the −1 or +1 direction that causes the ribosome to slip by one base in the 5′ direction thereby placing the ribosome in the new reading frame to produce a new protein.
- Programmed, or directed, ribosomal frameshifting is of particular value to viruses that package their plus strands, as it eliminates the need to splice their mRNAs and reduces the risk of packaging defective genomes and regulates the ratio of viral proteins synthesized. Examples of programmed translational frameshifting (both +1 and −1 shifts) have been identified in ScV systems (Lopinski et al., 2000, Mol. Cell. Biol. 20(4):1095-103, retroviruses (Falk et al., 1993, J. Virol. 67:273-6277; Jacks & Varmus, 1985, Science 230:1237-1242; Morikawa & Bishop, 1992, Virology 186:389-397; Nam et al., 1993, J. Virol. 67:196-203); coronaviruses (Brierley et al., 1987, EMBO J. 6:3779-3785; Herold & Siddell, 1993, Nucleic Acids Res. 21:5838-5842); giardiaviruses, which are also members of the Totiviridae (Wang et al., 1993, Proc. Natl. Acad. Sci. USA 90:8595-8599); two bacterial genes (Blinkowa & Walker, 1990, Nucleic Acids Res., 18: i725-1729; Craigen & Caskey, 1986, Nature 322:273); bacteriophage genes (Condron et al., 1991, Nucleic Acids Res. 19:5607-5612); astroviruses (Marczinke et al., 1994, J. Virol. 68:5588-5595); the yeast EST3 gene (Lundblad & Morris, 1997, Curr. Biol. 7:969-976); and the rat, mouse, Xenopus, and Drosophila ornithine decarboxylase antizymes (Matsufuji et al., 1995, Cell 80:51-60); and a significant number of cellular genes (Herold & Siddell, 1993, Nucleic Acids Res. 21:5838-5842).
- Drugs targeted to ribosomal frameshifting minimize the problem of virus drug resistance because this strategy targets a host cellular process rather than one introduced into the cell by the virus, which minimizes the ability of viruses to evolve drug-resistant mutants. Compounds that target the RNA elements involved in regulating programmed frameshifting should have several advantages, including (a) any selective pressure on the host cellular translational machinery to adapt to the drugs would have to occur at the host evolutionary time scale, which is on the order of millions of years, (b) ribosomal frameshifting is not used to express any host proteins, and (c) altering viral frameshifting efficiencies by modulating the activity of a host protein minimizing the likelihood that the virus will acquire resistance to such inhibition by mutations in its own genome.
- “Instability elements” may be defined as specific sequence elements that promote the recognition of unstable mRNAs by cellular turnover machinery. Instability elements have been found within mRNA protein coding regions as well as untranslated regions.
- Altering the control of stability of normal mRNAs may lead to disease. The alteration of mRNA stability has been implicated in diseases such as, but not limited to, cancer, immune disorders, heart disease, and fibrotic disorders.
- There are several examples of mutations that delete instability elements which then result in stabilization of mRNAs that may be involved in the onset of cancer. In Burkitt's lymphoma, a portion of the c-myc proto-oncogene is translocated to an Ig locus, producing a form of the c-myc mRNA that is five times more stable (see, e.g., Kapstein et al., 1996, J. Biol. Chem. 271(31):18875-84). The highly oncogenic v-fos mRNA lacks the 3′ UTR adenylate uridylate rich element (“ARE”) that is found in the more labile and weakly oncogenic c-fos mRNA (see, e.g., Schiavi et al., 1992, Biochim Biophys Acta. 1114(2-3):95-106). Differences between the benign cervical lesions brought about by nonintegrated circular human papillomavirus type 16 and its integrated form, that lacks the 3′ UTR ARE and correlates with cervical carcinomas, may be a consequence of stabilizing the E6/E7 transcripts encoding oncogenic proteins. Integration of the virus results in deletion of the ARE instability element, resulting in stabilizion of the transcripts and over-expression of the proteins (see, e.g., Jeon & Lambert, 1995, Proc. Natl. Acad. Sci. USA 92(5):1654-8). Deletion of AREs from the 3′ UTR of the IL-2 and IL-3 genes promotes increased stabilization of these mRNAs, high expression of these proteins, and leads to the formation of cancerous cells (see, e.g., Stoecklin et al., 2000, Mol. Cell. Biol. 20(11):3753-63).
- Mutations in trans-acting factors involved in mRNA turnover may also promote cancer. In monocytic tumors, the lymphokine GM-CSF mRNA is specifically stabilized as a consequence of an oncogenic lesion in a trans-acting factor that controls mRNA turnover rates. Furthermore, the normally unstable IL-3 transcript is inappropriately long-lived in mast tumor cells. Similarly, the labile GM-CSF mRNA is greatly stabilized in bladder carcinoma cells. See, e.g., Bickel et al., 1990, J. Immunol. 145(3):840-5.
- The immune system is regulated by a large number of regulatory molecules that either activate or inhibit the immune response. It has now been clearly demonstrated that stability of the transcripts encoding these proteins are highly regulated. Altered regulation of these molecules leads to mis-regulation of this process and can result in drastic medical consequences. For example, recent results using transgenic mice have shown that mis-regulation of the stability of the important modulator TNFα mRNA leads to diseases such as, but not limited to, rheumatoid arthritis and a Crohn's-like liver disease. See, e.g., Clark, 2000, Arthritis Res. 2(3):172-4.
- Smooth muscle in the heart is modulated by the β-adrenergic receptor, which in turn responds to the sympathetic neurotransmitter norepinephrine and the adrenal hormone epinephrine. Chronic heart failure is characterized by impairment of smooth muscle cells, which results, in part, from the more rapid decay of the β-adrenergic receptor mRNA. See, e.g., Ellis & Frielle, 1999, Biochem. Biophys. Res. Commun. 258(3):552-8.
- A large number of diseases result from over-expression of collagen. For example, cirrhosis results from damage to the liver as a consequence of carcer, viral infection, or alcohol abuse. Such damage causes mis-regulation of collagen expression, leading to the formation of large collagen deposits. Recent results indicate that the sizeable increase in collagen expression is largely attributable to stabilization of its mRNA. See, e.g., Lindquist et al., 2000, Am. J. Physiol. Gastrointest. Liver Physiol. 279(3):G471-6.
- Adenylate uridylate-rich elements (“ARE”) are found in the 3′ untranslated regions (“3′ UTR”) of several mRNAs, and involved in the turnover of mrRNAs, such as but not limited to transcription factors, cytokines, and lymphokines. AREs may function both as stabilizing and destabilizing elements. ARE mRNAs are classified into five groups, depending on sequence (Bakheet et al., 2001, Nucl. Acids Res. 29(1):246-254). An ongoing database at the web site http://rc.kfshrc.edu.sa/ared contains ARE-containing mRNAs and their cluster groups, which is incorporated by reference in its entirety. The ARE motifs are classified as follows:
Group I Cluster (AUUUAUUUAUUUAUUUAUUUA) SEQ ID NO: 1 Group II Cluster (AUUUAUUUAUUUAUUUA) stretch SEQ ID NO: 2 Group III Cluster (WAUUUAUUUAUUUAW) stretch SEQ ID NO: 3 Group IV Cluster (WWAUUUAUUUAWW) stretch SEQ ID NO: 4 Group V Cluster (WWWWAUUUAWWWW) stretch SEQ ID NO: 5 - The ARE-mRNAs were clustered into five groups containing five, four, three and two pentameric repeats, while the last group contains only one pentamer within the 13-bp ARE pattern. Functional categories were assigned whenever possible according to NCBI-COG functional annotation (Tatusov et al., 2001, Nucleic Acids Research, 29(1): 22-28), in addition to the categories: inflammation, immune response, development/differentiation, using an extensive literature search.
- Group I contains many secreted proteins including GM-CSF, IL-1, IL-11, IL-12 and Gro-β that affect the growth of hematopoietic and immune cells (Witsell & Schook, 1992, Proc. Natl Acad. Sci. USA, 89:4754-4758). Although TNFα is both a pro-inflammatory and anti-tumor protein, there is experimental evidence that it can act as a growth factor in certain leukemias and lymphomas (Liu et al., 2000, J. Biol. Chem. 275:21086-21093).
- Unlike Group I, Groups II-V contain functionally diverse gene families comprising immune response, cell cycle and proliferation, inflammation and coagulation, angiogenesis, metabolism, energy, DNA binding and transcription, nutrient transportation and ionic homeostasis, protein synthesis, cellular biogenesis, signal transduction, and apoptosis (Bakheet et al., 2001, Nucl. Acids Res. 29(1):246-254).
- Several groups have described ARE-binding proteins that influence the ARE-mRNA stability. Among the well-characterized proteins are the mammalian homologs of ELAV (embryonic lethal abnormal vision) proteins including AUF1, HuR and He1-N2 (Zhang et al., 1993, Mol. Cell. Biol. 13:7652-7665; Levine et al., 1993, Mol. Cell. Biol. 13:3494-3504: Ma et al., 1996, J. Biol. Chem. 271 :8144-8151). The zinc-finger protein tristetraprolin has been identified as another ARE-binding protein with destabilizing activity on TNF-α, IL-3 and GM-CSF mRNAs (Stoecklin et al., 2000, Mol. Cell. Biol. 20:3753-3763; Carballo et al., 2000, Blood 95:1891-1899).
- Since ARE-containing genes are clearly important in biological systems, including but not limited to a number of the early response genes that regulate cell proliferation and responses to exogenous agents, the identification of compounds that bind to one or more of the ARE clusters and potentially modulate the stability of the target RNA can potentially be of value as a therapeutic.
- Target nucleic acids, including but not limited to RNA and DNA, useful in the methods of the present invention have a label that is detectable via conventional spectroscopic means or radiographic means. Preferably, target nucleic acids are labeled with a covalently attached dye molecule. Useful dye-molecule labels include, but are not limited to, fluorescent dyes, phosphorescent dyes, ultraviolet dyes, infrared dyes, and visible dyes. Preferably, the dye is a visible dye.
- Useful labels in the present invention can include, but are not limited to, spectroscopic labels such as fluorescent dyes (e.g., fluorescein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon Green™, rhodamine and derivatives (e.g., Texas red, tetramethylrhodimine isothiocynate (TRITC), bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDye™, and the like), radiolabels (e.g.,3H, 125I, 35S, 14C, 32P,33P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), spectroscopic calorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads, or nanoparticles—nanoclusters of inorganic ions with defined dimension from 0.1 to 1000 nm. Useful affinity tags and complimentary partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptamer-streptavidin, or haptens and proteins for which antisera or monoclonal antibodies are available. The label may be coupled directly or indirectly to a component of the detection assay (e.g., the detection reagent) according to methods well known in the art. A wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.
- In one embodiment, nucleic acids that are labeled at one or more specific locations are chemically synthesized using phosphoramidite or other solution or solid-phase methods. Detailed descriptions of the chemistry used to form polynucleotides by the phosphoramidite method are well known (see, e.g., Caruthers et al., U.S. Pat. Nos. 4,458,066 and 4,415,732; Caruthers et al., 1982, Genetic Engineering 4:1-17;Users Manual Model 392 and 394 Polynucleotide Synthesizers, 1990, pages 6-1 through 6-22, Applied Biosystems, Part No. 901237; Ojwang, et al., 1997, Biochemistry, 36:6033-6045). The phosphoramidite method of polynucleotide synthesis is the preferred method because of its efficient and rapid coupling and the stability of the starting materials. The synthesis is performed with the growing polynucleotide chain attached to a solid support, such that excess reagents, which are generally in the liquid phase, can be easily removed by washing, decanting, and/or filtration, thereby eliminating the need for purification steps between synthesis cycles.
- The following briefly describes illustrative steps of a typical polynucleotide synthesis cycle using the phosphoramidite method. First, a solid support to which is attached a protected nucleoside monomer at its 3′ terminus is treated with acid, e.g., trichloroacetic acid, to remove the 5′-hydroxyl protecting group, freeing the hydroxyl group for a subsequent coupling reaction. After the coupling reaction is completed an activated intermediate is formed by contacting the support-bound nucleoside with a protected nucleoside phosphoramidite monomer and a weak acid, e.g., tetrazole. The weak acid protonates the nitrogen atom of the phosphoramidite forming a reactive intermediate. Nucleoside addition is generally complete within 30 seconds. Next, a capping step is performed, which terminates any polynucleotide chains that did not undergo nucleoside addition. Capping is preferably performed using acetic anhydride and 1-methylimidazole. The phosphite group of the internucleotide linkage is then converted to the more stable phosphotriester by oxidation using iodine as the preferred oxidizing agent and water as the oxygen donor. After oxidation, the hydroxyl protecting group of the newly added nucleoside is removed with a protic acid, e.g., trichloroacetic acid or dichloroacetic acid, and the cycle is repeated one or more times until chain elongation is complete. After synthesis, the polynucleotide chain is cleaved from the support using a base, e.g., ammonium hydroxide or t-butyl amine. The cleavage reaction also removes any phosphate protecting groups, e.g., cyanoethyl. Finally, the protecting groups on the exocyclic amines of the bases and any protecting groups on the dyes are removed by treating the polynucleotide solution in base at an elevated temperature, e.g., at about 55° C. Preferably the various protecting groups are removed using ammonium hydroxide or t-butyl amine.
- Any of the nucleoside phosphoramidite monomers can be labeled using standard phosphoramidite chemistry methods (Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002; Ojwang et aL, 1997, Biochemistry. 36:6033-6045 and references cited therein). Dye molecules useful for covalently coupling to phosphoramidites preferably comprise a primary hydroxyl group that is not part of the dye's chromophore. Illustrative dye molecules include, but are not limited to, disperse dye CAS 4439-31-0, disperse dye CAS 6054-58-6, disperse dye CAS 4392-69-2 (Sigma-Aldrich, St. Louis, Mo.), disperse red, and 1-pyrenebutanol (Molecular Probes, Eugene, Oreg.). Other dyes useful for coupling to phosphoramidites will be apparent to those of skill in the art, such as fluoroscein, cy3, and cyS fluorescent dyes, and may be purchased from, e.g., Sigma-Aldrich, St. Louis, Mo. or Molecular Probes, Inc., Eugene, Oreg.
- In another embodiment, dye-labeled target RNA molecules are synthesized enzymatically using in vitro transcription (Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and references cited therein). In this embodiment, a template DNA is denatured by heating to about 90° C. and an oligonucleotide primer is annealed to the template DNA, for example by slow-cooling the mixture of the denatured template and the primer from about 90° C. to room temperature. A mixture of ribonucleoside-5′-triphosphates capable of supporting template-directed enzymatic extension of the primed template (e.g., a mixture including GTP, ATP, CTP, and UTP), including one or more dye-labeled ribonucleotides (Sigma-Aldrich, St. Louis, Mo.), is added to the primed template. Next, a polymerase enzyme is added to the mixture under conditions where the polymerase enzyme is active, which are well-known to those skilled in the art. A labeled polynucleotide is formed by the incorporation of the labeled ribonucleotides during polymerase-mediated strand synthesis.
- In yet another embodiment of the invention, nucleic acid molecules are end-labeled after their synthesis. Methods for labeling the 5′-end of an oligonucleotide include but are by no means limited to: (i) periodate oxidation of a 5′-to-5′-coupled ribonucleotide, followed by reaction with an arnine-reactive label (Heller & Morisson, 1985, inRapid Detection and Identification ofInfectious Agents, D. T. Kingsbury and S. Falkow, eds., pp. 245-256, Academic Press); (ii) condensation of ethylenediamine with 5′-phosphorylated polynucleotide, followed by reaction with an amine reactive label (Morrison, European Patent Application 232 967); (iii) introduction of an aliphatic amine substituent using an aminohexyl phosphite reagent in solid-phase DNA synthesis, followed by reaction with an amine reactive label (Cardullo et al., 1988, Proc. Natl. Acad. Sci. USA 85:8790-8794); and (iv) introduction of a thiophosphate group on the 5′-end of the nucleic acid, using phosphatase treatment followed by end-labeling with ATP-?S and kinase, which reacts specifically and efficiently with maleimide-labeled fluorescent dyes (Czworkowski et al., 1991, Biochem. 30:4821-4830).
- A detectable label should not be incorporated into a target nucleic acid at the specific binding site at which test compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the test compounds at this site. Accordingly, if the region of the target nucleic acid that binds to a host cell factor is known, a detectable label is preferably incorporated into the nucleic acid molecule at one or more positions that are spatially or sequentially remote from the binding region.
- After synthesis, the labeled target nucleic acid can be purified using standard techniques known to those skilled in the art (see Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and references cited therein). Depending on the length of the target nucleic acid and the method of its synthesis, such purification techniques include, but are not limited to, reverse-phase high-performance liquid chromatography (“reverse-phase HPLC”), fast performance liquid chromatography (“FPLC”), and gel purification. After purification, the target RNA is refolded into its native conformation, preferably by heating to approximately 85-95° C. and slowly cooling to room temperature in a buffer, e.g., a buffer comprising about 50 mM Tris-HCl,
pH 8 and 100 mM NaCl. - In another embodiment, the target nucleic acid can also be radiolabeled. A radiolabel, such as, but not limited to, an isotope of phosphorus, sulfur, or hydrogen, may be incorporated into a nucleotide, which is added either after or during the synthesis of the target nucleic acid. Methods for the synthesis and purification of radiolabeled nucleic acids are well known to one of skill in the art. See, e.g., Sambrook et al., 1989, inMolecular Cloning: A Laboratory Manual, pp 10.2-10.70, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incorporated by reference in their entireties.
- In another embodiment, the target nucleic acid can be attached to an inorganic nanoparticle. A nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag2S, ZnS, CdS, CdTe, Au, or TiO2. Nanoparticles have unique optical, electronic and catalytic properties relative to bulk materials which can be adjusted according to the size of the particle. Methods for the attachment of nucleic acids are well know to one of skill in the art (see, e.g., Niemeyer, 2001, Angew. Chem. Int. Ed. 40: 4129-4158, International Patent Publication WO/0218643, and the references cited therein, the disclosures of which are hereby incorporated by reference in their entireties).
- Libraries screened using the methods of the present invention can comprise a variety of types of test compounds. In some embodiments, the test compounds are nucleic acid or peptide molecules. In a non-limiting example, peptide molecules can exist in a phage display library. In other embodiments, types of test compounds include, but are not limited to, peptide analogs including peptides comprising non-naturally occurring amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as α-amino phosphoric acids and α-amino phosphoric acids, or amino acids having non-peptide linkages, nucleic acid analogs such as phosphorothioates and PNAs, hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose. Libraries of polypeptides or proteins can also be used.
- In a preferred embodiment, the combinatorial libraries are small organic molecule libraries, such as, but not limited to, benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, and diazepindiones. In another embodiment, the combinatorial libraries comprise peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; or carbohydrate libraries. Combinatorial libraries are themselves commercially available (see, e.g., Advanced ChemTech Europe Ltd., Cambridgeshire, UK; ASINEX, Moscow Russia; BioFocus plc, Sittingbourne, UK; Bionet Research (A division of Key Organics Limited), Camelford, UK; ChemBridge Corporation, San Diego, Calif.; ChemDiv Inc, San Diego, Calif.; ChemRx Advanced Technologies, South San Francisco, Calif.; ComGenex Inc., Budapest, Hungary; Evotec OAI Ltd, Abingdon, UK; IF LAB Ltd., Kiev, Ukraine; Maybridge plc, Cornwall, UK; PharmaCore, Inc., North Carolina; SIDDCO Inc, Tucson, Ariz.; TimTec Inc, Newark, Delaware; Tripos Receptor Research Ltd, Bude, UK; Toslab, Ekaterinburg, Russia).
- In one embodiment, the combinatorial compound library for the methods of the present invention may be synthesized. There is a great interest in synthetic methods directed toward the creation of large collections of small organic compounds, or libraries, which could be screened for pharmacological, biological or other activity (Dolle, 2001, J. Comb. Chem. 3:477-517; Hall etal., 2001, J. Comb. Chem. 3:125-150; Dolle, 2000, J. Comb. Chem. 2:383-433; Dolle, 1999, J. Comb. Chem. 1:235-282). The synthetic methods applied to create vast combinatorial libraries are performed in solution or in the solid phase, i.e., on a solid support. Solid-phase synthesis makes it easier to conduct multi-step reactions and to drive reactions to completion with high yields because excess reagents can be easily added and washed away after each reaction step. Solid-phase combinatorial synthesis also tends to improve isolation, purification and screening. However, the more traditional solution phase chemistry supports a wider variety of organic reactions than solid-phase chemistry. Methods and strategies for the synthesis of combinatorial libraries can be found inA Practical Guide to Combinatorial Chemistry, A. W. Czarnik and S. H. Dewitt, eds., American Chemical Society, 1997; The Combinatorial Index, B. A. Bunin, Academic Press, 1998; Organic Synthesis on Solid Phase, F. Z. Dörwald, Wiley-VCH, 2000; and Solid-Phase Organic Syntheses, Vol. 1, A. W. Czarnik, ed., Wiley Interscience, 2001.
- Combinatorial compound libraries of the present invention may be synthesized using apparatuses described in U.S. Pat. No. 6,358,479 to Frisina et al., U.S. Pat. No. 6,190,619 to Kilcoin et al., U.S. Pat. No. 6,132,686 to Gallup et al., U.S. Pat. No. 6,126,904 to Zuellig et al., U.S. Pat. No. 6,074,613 to Harness et al., U.S. Pat. No. 6,054,100 to Stanchfield et al., and U.S. Pat. No. 5,746,982 to Saneii et al. which are hereby incorporated by reference in their entirety. These patents describe synthesis apparatuses capable of holding a plurality of reaction vessels for parallel synthesis of multiple discrete compounds or for combinatorial libraries of compounds.
- In one embodiment, the combinatorial compound library can be synthesized in solution. The method disclosed in U.S. Pat. No. 6,194,612 to Boger et al., which is hereby incorporated by reference in its entirety, features compounds useful as templates for solution phase synthesis of combinatorial libraries. The template is designed to permit reaction products to be easily purified from unreacted reactants using liquid/liquid or solid/liquid extractions. The compounds produced by combinatorial synthesis using the template will preferably be small organic molecules. Some compounds in the library may mimic the effects of non-peptides or peptides. In contrast to solid phase synthesize of combinatorial compound libraries, liquid phase synthesis does not require the use of specialized protocols for monitoring the individual steps of a multistep solid phase synthesis (Egner et al., 1995, J. Org. Chem. 60:2652; Anderson et al., 1995, J. Org. Chem. 60:2650; Fitch et al., 1994, J. Org. Chem. 59:7955; Look et al., 1994, J. Org. Chem. 49:7588; Metzger et al., 1993, Angew. Chem., Int. Ed. Engl. 32:894; Youngquist et al., 1994, Rapid Commun. Mass Spect. 8:77; Chu et al., 1995, J. Am. Chem. Soc. 117:5419; Brummel et al., 1994, Science 264:399; Stevanovic et al., 1993, Bioorg. Med. Chem. Lett. 3:431).
- Combinatorial compound libraries useful for the methods of the present invention can be synthesized on solid supports. In one embodiment, a split synthesis method, a protocol of separating and mixing solid supports during the synthesis, is used to synthesize a library of compounds on solid supports (see Lam et al., 1997, Chem. Rev. 97:41-448; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA 90:10922-10926 and references cited therein). Each solid support in the final library has substantially one type of test compound attached to its surface. Other methods for synthesizing combinatorial libraries on solid supports, wherein one product is attached to each support, will be known to those of skill in the art (see, e.g., Nefzi et al., 1997, Chem. Rev. 97:449-472 and U.S. Pat. No. 6,087,186 to Cargill et al. which are hereby incorporated by reference in their entirety).
- As used herein, the term “solid support” is not limited to a specific type of solid support. Rather a large number of supports are available and are known to one skilled in the art. Solid supports include silica gels, resins, derivatized plastic films, glass beads, cotton, plastic beads, polystyrene beads, alumina gels, and polysaccharides. A suitable solid support may be selected on the basis of desired end use and suitability for various synthetic protocols. For example, for peptide synthesis, a solid support can be a resin such as p-methylbenzhydrylamine (PMBHA) resin (Peptides International, Louisville, Ky.), polystyrenes (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), including chloromethylpolystyrene, hydroxymethylpolystyrene and aminomethylpolystyrene, poly (dimethylacrylamide)-grafted styrene co-divinyl-benzene (e.g, POLYHIPE resin, obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (e.g., TENTAGEL or ARGOGEL, Bayer, Tubingen, Germany) polydimethylacrylamide resin (obtained from Milligen/Biosearch, California), or Sepharose (Pharmacia, Sweden).
- In one embodiment, the solid phase support is suitable for in vivo use, i.e., it can serve as a carrier or support for administration of the test compound to a patient (e.g., TENTAGEL, Bayer, Tubingen, Germany). In a particular embodiment, the solid support is palatable and/or orally ingestable.
- In some embodiments of the present invention, compounds can be attached to solid supports via linkers. Linkers can be integral and part of the solid support, or they may be nonintegral that are either synthesized on the solid support or attached thereto after synthesis. Linkers are useful not only for providing points of test compound attachment to the solid support, but also for allowing different groups of molecules to be cleaved from the solid support under different conditions, depending on the nature of the linker. For example, linkers can be, inter alia, electrophilically cleaved, nucleophilically cleaved, photocleavable, enzymatically cleaved, cleaved by metals, cleaved under reductive conditions or cleaved under oxidative conditions.
- In another embodiment, the combinatorial compound libraries can be assembled in situ using dynamic combinatorial chemistry as described in European Patent Application 1,118,359 Al to Lehn; Huc & Nguyen, 2001, Comb. Chem. High Throughput. Screen. 4:53-74; Lehn and Eliseev, 2001, Science 291:2331-2332; Cousins et al. 2000, Curr. Opin. Chem. Biol. 4: 270-279; and Karan & Miller, 2000, Drug. Disc. Today 5:67-75 which are incorporated by reference in their entirety.
- Dynamic combinatorial chemistry uses non-covalent interaction with a target biomolecule, including but not limited to a protein, RNA, or DNA, to favor assembly of the most tightly binding molecule that is a combination of constituent subunits present as a mixture in the presence of the biomolecule. According to the laws of thermodynamics, when a collection of molecules is able to combine and recombine at equilibrium through reversible chemical reactions in solution, molecules, preferably one molecule, that bind most tightly to a templating biomolecule will be present in greater amount than all other possible combinations. The reversible chemical reactions include, but are not limited to, imine, acyl-hydrazone, amide, acetal, or ester formation between carbonyl-containing compounds and amines, hydrazines, or alcohols; thiol exchange between disulfides; alcohol exchange in borate esters; Diels-Alder reactions; thermal- or photoinduced sigmatropic or electrocyclic rearrangements; or Michael reactions.
- In the preferred embodiment of this technique, the constituent components of the dynamic combinatorial compound library are allowed to combine and reach equilibrium in the absence of the target RNA and then incubated in the presence of the target RNA, preferably at physiological conditions, until a second equilibrium is reached. The second, perturbed, equilibrium (the so-called “templated mixture”) can, but need not necessarily, be fixed by a further chemical transformation, including but not limited to reduction, oxidation, hydrolysis, acidification, or basification, to prevent restoration of the original equilibrium when the dynamical combinatorial compound library is separated from the target RNA.
- In the preferred embodiment of this technique, the predominant product or products of the templated dynamic combinatorial library can separated from the minor products and directly identified. In another embodiment, the identity of the predominant product or products can be identified by a deconvolution strategy involving preparation of derivative dynamic combinatorial libraries, as described in European Patent Application 1,118,359 A1, which is incorporated by reference in their entirety, whereby each component of the mixture is, preferably one-by-one but possibly group-wise, left out of the mixture and the ability of the derivative library mixture at chemical equilibrium to bind the target RNA is measured. The components whose removal most greatly reduces the ability of the derivative dynamic combinatorial library to bind the target RNA are likely the components of the predominant product or products in the original dynamic combinatorial library.
- After a target nucleic acid, such as but not limited to RNA or DNA, is labeled and a test compound library is synthesized or purchased or both, the labeled target nucleic acid is used to screen the library to identify test compounds that bind to the nucleic acid. Screening comprises contacting a labeled target nucleic acid with an individual, or small group, of the components of the compound library. Preferably, the contacting occurs in an aqueous solution, and most preferably, under physiologic conditions. The aqueous solution preferably stabilizes the labeled target nucleic acid and prevents denaturation or degradation of the nucleic acid without interfering with binding of the test compounds. The aqueous solution can be similar to the solution in which a complex between the target RNA and its corresponding host cell factor (if known) is formed in vitro. For example, TK buffer, which is commonly used to form Tat protein-TAR RNA complexes in vitro, can be used in the methods of the invention as an aqueous solution to screen a library of test compounds for TAR RNA binding compounds.
- The methods of the present invention for screening a library of test compounds preferably comprise contacting a test compound with a target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions. The aqueous solution optionally further comprises non-specific nucleic acids, such as, but not limited to, DNA; yeast tRNA; salmon sperm DNA; homoribopolymers such as, but not limited to, poly IC, polyA, polyU, and polyC; and non-specific RNA. The non-specific RNA may be an unlabeled target nucleic acid having a mutation at the binding site, which renders the unlabeled nucleic acid incapable of interacting with a test compound at that site. For example, if dye-labeled TAR RNA is used to screen a library, unlabeled TAR RNA having a mutation in the uracil 23/cytosine 24 bulge region may also be present in the aqueous solution. Without being bound by any theory, the addition of unlabeled RNA that is essentially identical to the dye-labeled target RNA except for a mutation at the binding site might minimize interactions of other regions of the dye-labeled target RNA with test compounds or with the solid support and prevent false positive results.
- The solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant. The pH of the solution typically ranges from about 5 to about 8, preferably from about 6 to about 8, most preferably from about 6.5 to about 8. A variety of buffers may be used to achieve the desired pH. Suitable buffers include, but are not limited to, Tris, Mes, Bis-Tris, Ada, Aces, Pipes, Mopso, Bis-Tris propane, Bes, Mops, Tes, Hepes, Dipso, Mobs, Tapso, Trizma, Heppso, Popso, TEA, Epps, Tricine, Gly-Gly, Bicine, and sodium-potassium phosphate. The buffering agent comprises from about 10 mM to about 100 mM, preferably from about 25 mM to about 75 mM, most preferably from about 40 mM to about 60 mM buffering agent. The pH of the aqeuous solution can be optimized for different screening reactions, depending on the target RNA used and the types of test compounds in the library, and therefore, the type and amount of the buffer used in the solution can vary from screen to screen. In a preferred embodiment, the aqueous solution has a pH of about 7.4, which can be achieved using about 50 mM Tris buffer.
- In addition to an appropriate buffer, the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 mM MgCl2. In a preferred embodiment, the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl2. Without being bound by any theory, Applicant has found that a combination of KCl, NaCl, and MgCl2 stabilizes the target RNA such that most of the RNA is not denatured or digested over the course of the screening reaction. The optional concentration of each salt used in the aqueous solution is dependent on the particular target RNA used and can be determined using routine experimentation.
- The solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant. Without being bound by any theory, a small amount of detergent or surfactant in the solution might reduce non-specific binding of the target RNA to the solid support and control aggregation and increase stability of target RNA molecules. Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N-laurylsarcosine, lauryl sulfate, 1-octane sulfonic acid and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alkyl amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as n-decyl a-D-glucopyranoside, n-decyl β-D-maltopyranoside, n-dodecyl β-D-maltoside, n-octyl β-D-glucopyranoside, sorbitan esters, n-tetradecyl β-D-maltoside, octylphenoxy polyethoxyethanol (Nonidet P-40), nonylphenoxypolyethoxyethanol (NP-40), and tritonis. Preferably, the detergent, if present, is a nonionic detergent. Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol. More preferably, the detergent, if present, is Triton X-100 and present in an amount of about 0.1% (w/v).
- Non-specific binding of a labeled target nucleic acid to test compounds can be further minimized by treating the binding reaction with one or more blocking agents. In one embodiment, the binding reactions are treated with a blocking agent, e.g., bovine serum albumin (“BSA”), before contacting with to.the labeled target nucleic acid. In another embodiment, the binding reactions are treated sequentially with at least two different blocking agents. This blocking step is preferably performed at room temperature for from about 0.5 to about 3 hours. In a subsequent step, the reaction mixture is further treated with unlabeled RNA having a mutation at the binding site. This blocking step is preferably performed at about 4° C. for from about 12 hours to about 36 hours before addition of the dye-labeled target RNA. Preferably, the solution used in the one or more blocking steps is substantially similar to the aqueous solution used to screen the library with the dye-labeled target RNA, e.g., in pH and salt concentration.
- Once contacted, the mixture of labeled target nucleic acid and the test compound is preferably maintained at 4° C. for from about 1 day to about 5 days, preferably from about 2 days to about 3 days with constant agitation. To identify the reactions in which binding to the labeled target nucleic acid occurred, after the incubation period, bound from free compounds are determined using an electrophoretic technique (see Section 5.5.1), or any of the methods disclosed in Section 5.5 infra. In another embodiment, the complexed target nucleic acid does not need to be separated from the free target nucleic acid if a technique (i.e., spectrometry) that diferentiates between bound and unbound target nucleic acids is used.
- The methods for identifying small molecules bound to labeled nucleic acid will vary with the type of label on the target nucleic acid. For example, if a target RNA is labeled with a visible of fluorescent dye, the target RNA complexes are preferably identified using a chromatographic technique that separates bound from free target by an electrophoretic or size differential technique using individual reactions. The reactions corresponding to changes in the migration of the complexed RNA can be cross-referenced to the small molecule compound(s) added to said reaction. Alternatively, complexed target RNA can be screened en masse and then separated from free target RNA using an electrophoretic or size differential technique, the resultant complexed target is then analyzed using a mass spectrometric technique. In this fashion the bound small molecule can be identified on the basis of its molecular weight. In this reaction a priori knowledge of the exact molecular weights of all compounds within the library is known. In another embodiment, the test compounds bound to the target nucleic acid may not require separation from the unbound target nucleic acid if a technique such as, but not limited to, spectrometry is used.
- Any method that detects an altered physical property of a target nucleic acid complexed to a test compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids. Methods that can be utilized for the physical separation of complexed target RNA from unbound target RNA include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
- Methods for separation of the complex of a target RNA bound to a test compound from the unbound RNA comprises any method of electrophoretic separation, including but not limited to, denaturing and non-denaturing polyacrylamide gel electrophoresis, urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, agarose gel electrophoresis, and capillary electrophoresis.
- In a preferred embodiment, an automated electrophoretic system comprising a capillary cartridge having a plurality of capillary tubes is used for high-throughput screening of test compounds bound to target RNA. Such an apparatus for performing automated capillary gel electrophoresis is disclosed in U.S. Pat. Nos. 5,885,430; 5,916,428; 6,027,627; and 6,063,251, the disclosures of which are incorporated by reference in their entireties.
- The device disclosed in U.S. Pat. No. 5,885,430, which is incorporated by reference in its entirety, allows one to simultaneously introduce samples into a plurality of capillary tubes directly from microtiter trays having a standard size. U.S. Pat. No. 5,885,430 discloses a disposable capillary cartridge which can be cleaned between electrophoresis runs, the cartridge having a plurality of capillary tubes. A first end of each capillary tube is retained in a mounting plate, the first ends collectively forming an array in the mounting plate. The spacing between the first ends corresponds to the spacing between the centers of the wells of a microtiter tray having a standard size. Thus, the first ends of the capillary tubes can simultaneously be dipped into the samples present in the tray's wells. The cartridge is provided with a second mounting plate in which the second ends of the capillary tubes are retained. The second ends of the capillary tubes are arranged in an array which corresponds to the wells in the microtiter tray, which allows for each capillary tube to be isolated from its neighbors and therefore free from cross-contamination, as each end is dipped into an individual well.
- Plate holes may be provided in each mounting plate and the capillary tubes inserted through these plate holes. In such a case, the plate holes are sealed airtight so that the side of the mounting plate having the exposed capillary ends can be pressurized. Application of a positive pressure in the vicinity of the capillary openings in this mounting plate allows for the introduction of air and fluids during electrophoretic operations and also can be used to force out gel and other materials from the capillary tubes during reconditioning. The capillary tubes may be protected from damage using a needle comprising a cannula and/or plastic tubes, and the like when they are placed in these plate holes. When metallic cannula or the like are used, they can serve as electrical contacts for current flow during electrophoresis. In the presence of a second mounting plate, the second mounting plate is provided with plate holes through which the second ends of the capillary tubes project. In this instance, the second mounting plate serves as a pressure containment member of a pressure cell and the second ends of the capillary tubes communicate with an internal cavity of the pressure cell. The pressure cell is also formed with an inlet and an outlet. Gels, buffer solutions, cleaning agents, and the like may be introduced into the internal cavity through the inlet, and each of these can simultaneously enter the second ends of the capillaries.
- In another preferred embodiment, the automated electrophoretic system can comprise a chip system consisting of complex designs of interconnected channels that perform and analyze enzyme reactions using part of a channel design as a tiny, continuously operating electrophoresis material, where reactions with one sample are going on in one area of the chip while electrophoretic separation of the products of another sample is taking place in a different part of the chip. Such a system is disclosed in U.S. Pat. Nos. 5,699,157; 5,842,787; 5,869,004; 5,876,675; 5,942,443; 5,948,227; 6,042,709; 6,042,710; 6,046,056; 6,048,498; 6,086,740; 6,132,685; 6,150,119; 6,150,180; 6,153,073; 6,167,910; 6,171,850; and 6,186,660, the disclosures of which are incorporated by reference in their entireties.
- The system disclosed in U.S. Pat. No. 5,699,157, which is hereby incorporated by reference in its entirety, provides for a microfluidic system for high-speed electrophoretic analysis of subject materials for applications in the fields of chemistry, biochemistry, biotechnology, molecular biology and numerous other areas. The system has a channel in a substrate, a light source and a photoreceptor. The channel holds subject materials in solution in an electric field so that the materials move through the channel and separate into bands according to species. The light source excites fluorescent light in the species bands and the photoreceptor is arranged to receive the fluorescent light from the bands. The system further has a means for masking the channel so that the photoreceptor can receive the fluorescent light only at periodically spaced regions along the channel. The system also has an unit connected to analyze the modulation frequencies of light intensity received by the photoreceptor so that velocities of the bands along the channel are determined, which allows the materials to be analyzed.
- The system disclosed in U.S. Pat. No. 5,699,157 also provides for a method of performing high-speed electrophoretic analysis of subject materials, which comprises the steps of holding the subject materials in solution in a channel of a microfluidic system; subjecting the materials to an electric field so that the subject materials move through the channel and separate into species bands; directing light toward the channel; receiving light from periodically spaced regions along the channel simultaneously; and analyzing the frequencies of light intensity of the received light so that velocities of the bands along the channel can be determined for analysis of said materials. The determination of the velocity of a species band determines the electrophoretic mobility of the species and its identification.
- U.S. Pat. No. 5,842,787, which is hereby incorporated by reference in its entirety, is generally directed to devices and systems employ channels having, at least in part, depths that are varied over those which have been previously described (such as the device disclosed in U.S. Pat. No. 5,699,157), wherein said channel depths provide numerous beneficial and unexpected results such as but not limited to, a reduction in sample perturbation, reduced non-specific sample mixture by diffusion, and increased resolution.
- In another embodiment, the electrophoretic method of separation comprises polyacrylamide gel electrophoresis. In a preferred embodiment, the polyacrylamide gel electrophoresis is non-denaturing, so as to differentiate the mobilities of the target RNA bound to a test compound from free target RNA. If the polyacrylamide gel electrophoresis is denaturing, then the target RNA:test compound complex must be cross-linked prior to electrophoresis to prevent the disassociation of the target RNA from the test compound during electrophoresis. Such techniques are well known to one of skill in the art.
- In one embodiment of the method, the binding of test compounds to target nucleic acid can be detected, preferably in an automated fashion, by gel electrophoretic analysis of interference footprinting. RNA can be degraded at specific base sites by enzymatic methods such as ribonucleases A, U2, CL3, T1, Phy M, and B. cereus or chemical methods such as diethylpyrocarbonate, sodium hydroxide, hydrazine, piperidine formate, dimethyl sulfate, [2,12-dimethyl-3,7,11,17-tetraazacyclo[11.3.1]heptadeca-1(17),2,11,13,15-pentaenato] nickel(II) (NiCR), cobalt(II)chloride, or iron(II) ethylenediaminetetraacetate (Fe-EDTA) as described for example in Zheng et al., 1999, Biochem. 37:2207-2214; Latham & Cech, 1989, Science 245:276-282; and Sambrook et al., 2001, in Molecular Cloning: A Laboratory Manual, pp 12.61-12.73, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incorporated by reference in their entireties. The specific pattern of cleavage sites is determined by the accessibility of particular bases to the reagent employed to initiate cleavage and, as such, is therefore is determined by the three-dimensional structure of the RNA.
- The interaction of small molecules with a target nucleic acid can change the accessibility of bases to these cleavage reagents both by causing conformational changes in the target nucleic acid or by covering a base at the binding interface. When a test compound binds to the nucleic acid and changes the accessibility of bases to cleavage reagents, the observed cleavage pattern will change. This method can be used to identify and characterize the binding of small molecules to RNA as described, for example, by Prudent et al., 1995, J. Am. Chem. Soc. 117:10145-10146 and Mei et al., 1998, Biochem. 37:14204-14212.
- In the preferred embodiment of this technique, the detectably labeled target nucleic acid is incubated with an individual test compound and then subjected to treatment with a cleavage reagent, either enzymatic or chemical. The reaction mixture can be preferably be examined directly, or treated further to isolate and concentrate the nucleic acid. The fragments produced are separated by electrophoresis and the pattern of cleavage can be compared to a cleavage reaction performed in the absence of test compound. A change in the cleavage pattern directly indicates that the test compound binds to the target nucleic acid. Multiple test compounds can be examined both in parallel and serially.
- Other embodiments of electrophoretic separation include, but are not limited to urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, and agarose gel electrophoresis.
- In a preferred embodiment, fluorescence polarization spectroscopy, an optical detection method that can differentiate the proportion of a fluorescent molecule that is either bound or unbound in solution (e.g., the labeled target nucleic acid of the present invention), can be used to read reaction results without electrophoretic separation of the samples. Fluorescence polarization spectroscopy can be used to read the reaction results in the chip system disclosed in U.S. Pat. Nos. 5,699,157; 5,842,787; 5,869,004; 5,876,675; 5,942,443; 5,948,227; 6,042,709; 6,042,710; 6,046,056; 6,048,498; 6,086,740; 6,132,685; 6,150,119; 6,150,180; 6,153,073; 6,167,910; 6,171,850; and 6,186,660, the disclosures of which are incorporated by reference in their entireties. The application of fluorescence polarization spectroscopy to the chip system disclosed in the U.S. Patents listed supra is fast, efficient, and well-adapted for high-throughput screening.
- In another embodiment, a compound that has an affinity for the target nucleic acid of interest can be labeled with a fluorophore to screen for test compounds that bind to the target nucleic acid. For example, a pyrene-containing aminoglycoside analog was used to accurately monitor antagonist binding to a prokaryotic 16S rRNA A site (which comprises the natural target for arninoglycoside antibiotics) in a screen using a fluorescence quenching technique in a 96-well plate format (Hamasaki & Rando, 1998, Anal. Biochem. 261(2):183-90).
- In another embodiment, fluorescence resonance energy transfer (FRET) can be used to screen for test compounds that bind to the target nucleic acid. FRET, a characteristic change in fluorescence, occurs when two fluorophores with overlapping emission and excitation wavelength bands are held together in close proximity, such as by a binding event. In the preferred embodiment, the fluorophore on the target nucleic acid and the fluorophore on the test compounds will have overlapping excitation and emission spectra such that one fluorophore (the donor) transfers its emission energy to excite the other fluorophore (the acceptor). The acceptor preferably emits light of a different wavelength upon relaxing to the ground state, or relaxes non-radiatively to quench fluorescence. FRET is very sensitive to the distance between the two fluorophores, and allows measurement of molecular distances less than 10 nm. For example, U.S, Pat. No. 6,337,183 to Arenas et al., which is incorporated by reference in its entirety, describes a screen for compounds that bind RNA that uses FRET to measure the effect of test compounds on the stability of a target RNA molecule where the target RNA is labeled with both fluorescent acceptor and donor molecules and the distance between the two fluorophores as determined by FRET provides a measure of the folded structure of the RNA. Matsumoto et al. (2000, Bioorg. Med. Chem. Lett. 10:1857-1861) describe a system where a peptide that binds to HIV-1 TAR RNA is labeled on one end with a fluorescein fluorophore and a tetramethylrhodamine on the other end. The conformational change of the peptide upon binding to the RNA provided a FRET signal to screen for compounds that bound to the TAR RNA.
- In the preferred embodiment, both the target nucleic acid and a compound that has an affinity for the target nucleic acid of interest are labeled with fluorophores with overlapping emission and excitation spectra (donor and acceptor), including but not limited to fluorescein and derivatives, rhodamine and derivatives, cyanine dyes and derivatives, bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, pyrene, nanoparticles, or non-fluorescent quenching molecules. Binding of a labeled test compound to the target nucleic acid can be identified by the change in observable fluorescence as a result of FRET.
- If the target nucleic acid is labeled with the donor fluorophore, then the test compounds is labeled with the acceptor fluorophore. Conversely, if the target nucleic acid is labeled with the acceptor fluorophore, then the test compounds is labeled with the donor fluorophore. A wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions. The fluorophore on the target nucleic acid must be in close proximity to the binding site of the test compounds, but should not be incorporated into a target nucleic acid at the specific binding site at which test compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the test compounds at this site.
- In yet another embodiment, homogeneous time-resolved fluorescence (“HTPF”) techniques based on time-resolved energy transfer from lanthanide ion complexes to a suitable acceptor species can be adapted for high-throughput screening for inhibitors of RNA-protein complexes (Hemmilä, 1999, J. Biomol. Screening 4:303-107; Mathis, 1999, J. Biomol. Screening 4:309-313). HTRF is similar to fluorescence resonance energy transfer using conventional organic dye pairs, but has several advantages, such as increased sensitivity and efficiency, and background elimination (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356).
- Fluorescence spectroscopy has traditionally been used to characterize DNA-protein and protein-protein interactions, but fluorescence spectroscopy has not been widely used to characterize RNA-protein interactions because of an interfering absorption of RNA nucleotides with the intrinsic tryptophan fluorescence of proteins (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356.). However, fluorescence spectroscopy has been used in studying the: single tryptophan residue within the arginine-rich RNA-binding domain of Rev protein and its interaction with the RRE in a time-resolved fluorescence study (Kwon & Carson, 1998, Anal. Biochem. 264:133-140). Thus, in this invention, fluorescence spectroscopy is less preferred if the test compounds or peptides or proteins possess intrinsic tryptophan fluorescence. However, fluorescence spectroscopy can be used for test compounds that do not possess intrinsic fluorescence.
- Surface plasmon resonance (SPR) can be used for determining kinetic rate constants and equilibrium constants for macromolecular interactions by following the association project in “real time” (Schuck, 1997, Annu. Rev. Biophys. Biomol. Struct. 26:541-566).
- The principle of SPR is summarized by Xavier et al. (Trends Biotechnol., 2000, 18(8):349-356) as follows. Total internal reflection occurs at the boundary between two substances of different refractive index. The incident light's electromagnetic field penetrates beyond the interface as an evanescent wave, which extends a few hundred nanometers beyond the surface into the medium. Insertion of a thin gold foil at the interace produced SPR owing to the absorption of the energy from the evanescent wave by free electron clouds of the metal (plasmons). As a result of this absorbance, there is a drop in the intensity of the reflected light at a particular angle of incidence. The evanescent wave profile depends exquisitely on the refractive index of the medium it probes. Thus, the angle at which absorption occurs is very sensitive to the refractive changes in the external medium. All proteins and nucleic acids are known to change the refractive index of water by a similar amount per unit mass, irrespective of their amino acid or nucleotide composition (the refractive index change is different for proteins and nucleic acids). When the protein or nucleic acid content of the layer at the sensor changes, the refractive index also changes. Typically, one member of a complex is immobilized in a dextran layer and then the other member is introduced into the solution, either in a flow cell (Biacore AB, Uppsala, Sweden) or a stirred cuvette (Affinity Sensors, Santa Fe, N. Mex.). It has been determined that there is a linear correlation between the surface concentration of protein or nucleic acid and the shift in resonance angle, which can be used to quantitate kinetic rate constants and/or the equilibrium constants.
- In the present invention, the target RNA may be immobilized to the sensor surface through a streptavidin-biotin linkage, the linkage of which is disclosed by Crouch et al. (Methods Mol. Biol., 1999, 118:143-160). The RNA is biotinylated either during synthesis or post-synthetically via the conversion of the 3′ terminal ribonucleoside of the RNA into a reactive free amino group or using a T7 polymerase incorporated guanosine monophosphorothioate at the 5′ end. SPR has been used to determine the stoichiometry and affinity of the interaction between the HIV Rev protein and the RRE (Van Ryk & Venkatesan, 1999, J. Biol. Chem. 274:17452-17463) and the aminoglycoside antibiotics with RRE and a model RNA derived from the 16S ribosomal A site, respectively (Hendrix et al., 1997, J. Am. Chem. Soc. 119:3641-3648; Wong et al., 1998, Chem. Biol. 5:397-406).
- In one embodiment of the present invention, the target nucleic acid can be immobilized to a sensor surface (e.g., by a streptavidin-biotin linkage) and SPR can be used to (a) determine whether the target RNA binds a test compound and (b) further characterize the binding of the target nucleic acids of the present invention to a test compound.
- An automated method for analyzing mass spectrometer data which can analyze complex mixtures containing many thousands of components and can correct for background noise, multiply charged peaks and atomic isotope peaks is described in U.S. Pat. No. 6,147,344, which is hereby incorporated by reference in its entirety. The system disclosed in U.S. Pat. No. 6,147,344 is a method for analyzing mass spectrometer data in which a control sample measurement is performed providing a background noise check. The peak height and width values at each m/z ratio as a finction of time are stored in a memory. A mass spectrometer operation on a material to be analyzed is performed and the peak height and width values at each m/z ratio versus time are stored in a second memory location. The mass spectrometer operation on the material to be analyzed is repeated a fixed number of times and the stored control sample values at each m/z ratio level at each time increment are subtracted from each corresponding one from the operational runs thus producing a difference value at each mass ratio for each of the multiple runs at each time increment. If the MS value minus the background noise does not exceed a preset value, the m/z ratio data point is not recorded, thus eliminating background noise, chemical noise and false positive peaks from the mass spectrometer data. The stored data for each of the multiple runs is then compared to a predetermined value at each m/z ratio and the resultant series of peaks, which are now determined to be above the background, is stored in the m/z points in which the peaks are of significance.
- One possibility for the utilization of mass spectrometry in high throughput screening is the integration of SPR with mass spectrometry. Approaches that have been tried are direct analysis of the analyte retained on the sensor chip and mass spectrometry with the eluted analyte (Sonksen et al., 1998, Anal. Chem. 70:2731-2736; Nelson & Krone, 1999, J. Mol. Recog. 12:77-93). Further developments, especially in the interfacing of the sensor chip with the mass spectrometer and in reusing the sensor chip, are required to make SPR combined with mass spectroscopy a high-throughput method for biomolecular interaction analysis and the screening of targets for small molecule inhibitors (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356).
- In one embodiment of the present invention, the target nucleic acid complexed to a test compound can be determined by any of the mass spectrometry processed described supra. Furthermore, mass spectrometry can also be used to elucidate the structure of the test compound.
- Scintillation Proximity Assay (“SPA”) is a method that can be used for screening small molecules that bind to the target RNAs. SPA would involve radiolabeling either the target RNA or the test compound and then quantitating its binding to the other member to a bead or a surface impregnated with a scintillant (Cook, 1996, Drug Discov. Today 1:287-294). Currently, fluorescence-based techniques are preferred for high-throughput screening (Pope et al., 1999, Drug Discov. Today 4:350-362).
- Screening for small molecules that inhibit Tat peptide:TAR RNA interaction has been performed with SPA, and inhibitors of the interaction were isolated and characterized (Mei et al., 1997, Bioorg. Med. Chem. 5:1173-1184; Mei et al., 1998, Biochemistry 37:14204-14212). A similar approach can be used to identify small molecules that directly bind to a preselected target RNA element in accordance with the invention can be utilized.
- SPA can be adapted to high throughput screening by the availability of microplates, wherein the scintillant is directly incorporated into the plastic of the microtiter wells (Nakayama et al., 1998, J. Biomol. Screening 3:43-48). Thus, one embodiment of the present invention comprises (a) labeling of the target nucleic acid with a radioactive or fluorescent label; (b) contacted the labeled nucleic acid with test compounds, wherein each test compound is in a microtiter well coated with scintillant and is tethered to the microtiter well; and (c) identifying and quantifying the test compounds bound to the target nucleic acid with SPA, wherein the test compound is identified by virtue of its location in the microplate.
- NMR spectroscopy is a valuable technique for identifying complexed target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects, and NMR-based approaches have been used in the identification of small molecule binders of protein drug targets (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). The determination of structure-activity relationships (“SAR”) by NMR is the first method for NMR described in which small molecules that bind adjacent subsites are identified by two-dimentional1H-15N spectra of the target protein (Shuker et al., 1996, Science 274:1531-1534). The signal from the bound molecule is monitored by employing line broadening, transferred NOEs and pulsed field gradient diffusion measurements (Moore, 1999, Curr. Opin. Biotechnol. 10:54-58). A strategy for lead generation by NMR using a library of small molecules has been recently described (Fejzo et al., 1999, Chem. Biol. 6:755-769).
- In one embodiment of the present invention, the target nucleic acid complexed to a test compound can be determined by SAR by NMR. Furthermore, SAR by NMR can also be used to elucidate the structure of the test compound.
- In another embodiment of the present invention, size-exclusion chromatography is used to purify test compounds that are bound to a target nucleic from a complex mixture of compounds. Size-exclusion chromatography separates molecules based on their size and uses gel-based media comprised of beads with specific size distributions. When applied to a column, this media settles into a tightly packed matrix and forms a complex array of pores. Separation is accomplished by the inclusion or exclusion of molecules by these pores based on molecular size. Small molecules are included into the pores and, consequently, their migration through the matrix is retarded due to the added distance they must travel before elution. Large molecules are excluded from the pores and migrate with the void volume when applied to the matrix. In the present invention, a target nucleic acid is incubated with a mixture of test compounds while free in solution and allowed to reach equilibrium. When applied to a size exclusion column, test compounds free in solution are retained by the column, and test compounds bound to the target nucleic acid are passed through the column. In a preferred embodiment, spin columns commonly used for “desalting” of nucleic acids will be employed to separate bound from unbound test compounds (e.g., Bio-Spin columns manufactured by BIO-RAD). In another embodiment, the size exclusion matrix is packed into multiwell plates to allow high throughput separation of mixtures (e.g., PLASMID 96-well SEC plates manufactured by Millipore).
- In one embodiment of the present invention, affinity capture is used to purify test compounds that are bound to a target nucleic acid labeled with an affinity tag from a complex mixture of compounds. To accomplish this, a target nucleic acid labeled with an affinity tag is incubated with a mixture of test compounds while free in solution and then captured to a solid support once equilibrium has been established; alternatively, target nucleic acids labeled with an affinity tag can be captured to a solid support first and then allowed to reach equilibrium with a mixture of test compounds.
- The solid support is typically comprised of, but not limited to, cross-linked agarose beads that are coupled with a ligand for the affinity tag. Alternatively, the solid support may be a glass, silicon, metal, or carbon, plastic (polystyrene, polypropylene) surface with or without a self-assembled monolayer (SAM) either with a covalently attached ligand for the affinity tag, or with inherent affinity for the tag on the target nucleic acid.
- Once the complex between the target nucleic acid and test compound has reached equilibrium and has been captured, one skilled in the art will appreciate that the retention of bound compounds and removal of unbound compounds is facilitated by washing the solid support with large excesses of binding reaction buffer. Furthermore, retention of high affinity compounds and removal of low affinity compounds can be accomplished by a number of means that increase the stringency of washing; these means include, but are not limited to, increasing the number and duration of washes, raising the salt concentration of the wash buffer, addition of detergent or surfactant to the wash buffer, and addition of non-specific competitor to the wash buffer.
- In one embodiment, the test compounds themselves are detectably labeled with fluorescent dyes, radioactive isotopes, or nanoparticles. When the test compounds are applied to the captured target nucleic acid in a spatially addressed fashion (e.g., in separate wells of a 96-well microplate), binding between the test compounds and the target nucleic acid can be determined by the presence of the detectable label on the test compound using fluorescence.
- Following the removal of unbound compounds, bound compounds with high affinity for the target nucleic acid can be eluted from the immobilized target nucleic acids and analyzed. The elution of test compounds can be accomplished by any means that break the non-covalent interactions between the target nucleic acid and compound. Means for elution include, but are not limited to, hanging the pH, changing the salt concentration, the application of organic solvents, and the application of molecules that compete with the bound ligand. In a preferred embodiment, the means employed for elution will release the compound from the target RNA, but will not effect the interaction between the affinity tag and the solid support, thereby achieving selective elution of test compound. Moreover, a preferred embodiment will employ an elution buffer that is volatile to allow for subsequent concentration by lyophilization of the eluted compound (e.g., 0 M to 5 M ammonium acetate).
- In one embodiment of the present invention, both the target nucleic acid and the test compounds are labeled with nanoparticles. A nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag2S, ZnS, CdS, CdTe, Au, or TiO2. Methods for the attachment of nucleic acids and small molecules to nanoparticles are well know to one of skill in the art (reviewed in Niemeyer, 2001, Angew. Chem. Int. Ed. 40:4129-4158. The references cited therein are hereby incorporated by reference in their entireties). In particular, if multiple copies of the target nucleic acid are attached to a single nanoparticle and multiple copies of a test compound are attached to another nanoparticle, then interaction between the test compound and target nucleic acid will induce aggregation of nanoparticles as described, for example, by Mitchel et al. 1999, J. Am. Chem. Soc. 121:8122-8123. The aggregate can be detected by changes in absorbance or fluorescence spectra and physically separated from the unbound components through filtration or centrifugation.
- If the library comprises arrays or microarrays of test compounds, wherein each test compound has an address or identifier, the test compound can be deconvoluted, e.g., by cross-referencing the positive sample to original compound list that was applied to the individual test assays.
- If the library is a peptide or nucleic acid library, the sequence of the test compound can be determined by direct sequencing of the peptide or nucleic acid. Such methods are well known to one of skill in the art.
- A number of physico-chemical techniques can be used for the de novo characterization of test compounds bound to the target.
- Mass spectrometry (e.g., electrospray ionization (“ESI”) and matrix-assisted laser desorption-ionization (“MALDI”), Fourier-transform ion cyclotron resonance (“FT-ICR”)) can be used both for high-throughput screening of test compounds that bind to a target RNA and elucidating the structure of the test compound. Thus, one example of mass spectroscopy is that separation of a bound and unbound complex and test compound structure elucidation can be carried out in a single step.
- MALDI uses a pulsed laser for desorption of the ions and a time-of-flight analyzer, and has been used for the detection of noncovalent tRNA:amino-acyl-tRNA synthetase complexes (Gruic-Sovulj et al., 1997, J. Biol. Chem. 272:32084-32091). However, covalent cross-linking between the target nucleic acid and the test compound is required for detection, since a non-covalently bound complex may dissociate during the MALDI process.
- ESI mass spectrometry (“ESI-MS”) has been of greater utility for studying non-covalent molecular interactions because, unlike the MALDI process, ESI-MS generates molecular ions with little to no fragmentation (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). ESI-MS has been used to study the complexes formed by HIV Tat peptide and protein with the TAR RNA (Sannes-Lowery et al., 1997, Anal. Chem. 69:5130-5135).
- Fourier-transform ion cyclotron resonance (“FT-ICR”) mass spectrometry provides high-resolution spectra, isotope-resolved precursor ion selection, and accurate mass assignments (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). FT-ICR has been used to study the interaction of aminoglycoside antibiotics with cognate and non-cognate RNAs (Hofstadler et al., 1999, Anal. Chem. 71:3436-3440; Griffey et al., 1999, Proc. Natl. Acad. Sci. USA 96:10129-10133). As true for all of the mass spectrometry methods discussed herein, FT-ICR does not require labeling of the target RNA or a test compound.
- An advantage of mass spectroscopy is not only the elucidation of the structure of the test compound, but also the determination of the structure of the test compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a test compound that specifically binds to a preselected target RNA.
- As described above, NMR spectroscopy is a technique for identifying binding sites in target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects. Examples of NMR that can be used for the invention include, but are not limited to, one-dimentional NMR, two-dimentional NMR, correlation spectroscopy (“COSY”), and nuclear Overhauser effect (“NOE”) spectroscopy. Such methods of structure determination of test compounds are well known to one of skill in the art.
- Similar to mass spectroscopy, an advantage of NMR is the not only the elucidation of the structure of the test compound, but also the determination of the structure of the test compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a test compound that specifically binds to a preselected target RNA.
- Vibrational spectroscopy (e.g. infrared (IR) spectroscopy or Raman spectroscopy) can be used for elucidating the structure of the test compound on the isolated bead.
- Infrared spectroscopy measures the frequencies of infrared light (wavelengths from 100 to 10,000 nm) absorbed by the test compound as a result of excitation of vibrational modes according to quantum mechanical selection rules which require that absorption of light cause a change in the electric dipole moment of the molecule. The infrared spectrum of any molecule is a unique pattern of absorption wavelengths of varying intensity that can be considered as a molecular fingerprint to identify any compound.
- Infrared spectra can be measured in a scanning mode by measuring the absorption of individual frequencies of light, produced by a grating which separates frequencies from a mixed-frequency infrared light source, by the test compound relative to a standard intensity (double-beam instrument) or pre-measured (‘blank’) intensity (single-beam instrument). In a preferred embodiment, infrared spectra are measured in a pulsed mode (FT-IR) where a mixed beam, produced by an interferometer, of all infrared light frequencies is passed through or reflected off the test compound. The resulting interferogram, which may or may not be added with the resulting interferograms from subsequent pulses to increase the signal strength while averaging random noise in the electronic signal, is mathematically transformed into a spectrum using Fourier Transform or Fast Fourier Transform algorithms.
- Raman spectroscopy measures the difference in frequency due to absorption of infrared frequencies of scattered visible or ultraviolet light relative to the incident beam. The incident monochromatic light beam, usually a single laser frequency, is not truly absorbed by the test compound but interacts with the electric field transiently. Most of the light scattered off the sample with be unchanged (Rayleigh scattering) but a portion of the scatter light will have frequencies that are the sum or difference of the incident and molecular vibrational frequencies. The selection rules for Raman (inelastic) scattering require a change in polarizability of the molecule. While some vibrational transitions are observable in both infrared and Raman spectrometry, must are observable only with one or the other technique. The Raman spectrum of any molecule is a unique pattern of absorption wavelengths of varying intensity that can be considered as a molecular fingerprint to identify any compound.
- Raman spectra are measured by submitting monochromatic light to the sample, either passed through or preferably reflected off, filtering the Rayleigh scattered light, and detecting the frequency of the Raman scattered light. An improved Raman spectrometer is described in U.S. Pat. No. 5,786,893 to Fink et al., which is hereby incorporated by reference.
- Vibrational microscopy can be measured in a spatially resolved fashion to address single beads by integration of a visible microscope and spectrometer. A microscopic infrared spectrometer is described in U.S. Pat. No. 5,581,085 to Reffner et al., which is hereby incorporated by reference in its entirety. An instrument that simultaneously performs a microscopic infrared and microscopic Raman analysis on a sample is described in U.S. Pat. No. 5,841,139 to Sostek et al., which is hereby incorporated by reference in its entirety.
- In the preferred embodiment, test compounds can be identified by matching the IR or Raman spectra of a test compound to a dataset of vibrational (IR or Raman) spectra previously acquired for each compound in the combinatorial library. By this method, the spectra of compounds with known structure are recorded so that comparison with these spectra can identify compounds again when isolated from RNA binding experiments.
- The test compounds identified in the binding assay (for convenience referred to herein as a “lead” compound) can be tested for biological activity using host cells containing or engineered to contain the target RNA element coupled to a functional readout system. For example, the lead compound can be tested in a host cell engineered to contain the target RNA element controlling the expression of a reporter gene. In this example, the lead compounds are assayed in the presence or absence of the target RNA. Alternatively, a phenotypic or physiological readout can be used to assess activity of the target RNA in the presence and absence of the lead compound.
- In one embodiment, the lead compound can be tested in a host cell engineered to contain the target RNA element controlling the expression of a reporter gene, such as, but not limited to, β-galactosidase, green fluorescent protein, red fluorescent protein, luciferase, chloramphenicol acetyltransferase, alkaline phosphatase, and β-lactamase. In a preferred embodiment, a cDNA encoding the target element is fused upstream to a reporter gene wherein translation of the reporter gene is repressed upon binding of the lead compound to the target RNA. In other words, the steric hindrance caused by the binding of the lead compound to the target RNA repressed the translation of the reporter gene. This method, termed the translational repression assay procedure (“TRAP”) has been demonstrated inE. coli and S. cerevisiae (Jain & Belasco, 1996, Cell 87(1):115-25; Huang & Schreiber, 1997, Proc. Natl. Acad. Sci. USA 94:13396-13401).
- In another embodiment, a phenotypic or physiological readout can be used to assess activity of the target RNA in the presence and absence of the lead compound. For example, the target RNA may be overexpressed in a cell in which the target RNA is endogenously expressed. Where the target RNA controls expression of a gene product involved in cell growth or viability, the in vivo effect of the lead compound can be assayed by measuring the cell growth or viability of the target cell. Alternatively, a reporter gene can also be fused downstream of the target PNA sequence and the effect of the lead compound on reporter gene expression can be assayed.
- Alternatively, the lead compounds identified in the binding assay can be tested for biological activity using animal models for a disease, condition, or syndrome of interest. These include animals engineered to contain the target RNA element coupled to a functional readout system, such as a transgenic mouse. Animal model systems can also be used to demonstrate safety and efficacy.
- Compounds displaying the desired biological activity can be considered to be lead compounds, and will be used in the design of congeners or analogs possessing useful pharmacological activity and physiological profiles. Following the identification of a lead compound, molecular modeling techniques can be employed, which have proven to be useful in conjunction with synthetic efforts, to design variants of the lead that can be more effective. These applications may include, but are lot limited to, Pharmacophore Modeling (cf. Lamothe, et al. 1997, J. Med. Chem. 40: 3542; Mottola et al. 1996, J. Med. Chem. 39: 285; Beusen et al. 1995, Biopolymers 36: 181; P. Fossa et al. 1998, Comput. Aided Mol. Des. 12: 361), QSAR development (cf Siddiqui et al. 1999, J. Med. Chem. 42: 4122; Barreca et al. 1999 Bioorg. Med. Chem. 7: 2283; Kroemer et al. 1995, J. Med. Chem. 4917; Schaal et al. 2001, J. Med. Chem. 44: 155; Buolamwini & Assefa 2002, J. Mol. Chem. 45: 84), Virtual docking and screening/scoring (cf Anzini et al. 2001, J. Med. Chem. 44: 1134; Faaland et al. 2000, Biochem. Cell. Biol. 78: 415; Silvestri et al 2000, Bioorg. Med. Chem. 8: 2305; J. Lee et al 2001, Bioorg. Med. Chem. 9: 19), and Structure Prediction using RNA structural programs including, but not limited to mFold (as described by Zuker et al. Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide in RNA Biochemistry and Biotechnology pp. 11-43, J. Barciszewski & B. F. C. Clark, eds. (NATO ASI Series, Kluwer Academic Publishers, 1999) and Mathews et al. 1999 J. Mol. Biol. 288: 911-940); RNAmotif (Macke et al. 2001, Nucleic Acids Res. 29: 4724-4735; and the Vienna RNA package (Hofacker et al. 1994, Monatsh. Chem. 125: 167-188).
- Further examples of the application of such techniques can be found in several review articles, such as Rotivinen et al., 1988, Acta Pharmaceutical Fennica 97:159-166; Ripka, 1998, New Scientist 54-57; McKinaly & Rossmann, 1989, Annu. Rev. Pharmacol. Toxiciol. 29:111-122; Perry & Davies, QSAR: Quantitative Structure-Activity Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis & Dean, 1989, Proc. R. Soc. Lond. 236:125-140 and 141-162; Askew et al., 1989, J. Am. Chem. Soc. 111: 1082-1090. Molecular modeling tools employed may include those from Tripos, Inc., St. Louis, Mo. (e.g., Sybyl/UNITY, CONCORD, DiverseSolutions), Accelerys, San Diego, Calif. (e.g., Catalyst, Wisconsin Package {BLAST, etc.}), Schrodinger, Portland, Oreg. (e.g., QikProp QikFit, Jaguar) or other such vendors as BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc. (Mississauga, Ontario, Canada), and Hypercube, Inc. (Cambridge, Ontario, Canada), and may include privately designed and/or “academic” software (e.g. RNAMotif, MFOLD). These application suites and programs include tools for the atomistic construction and analysis of structural models for drug-like molecules, proteins, and DNA or RNA and their potential interactions. They also provide for the calculation of important physical properties, such as solubility estimates, permeability metrics, and empirical measures of molecular “druggability” (e.g., Lipinski “Rule of 5” as described by Lipinski et al. 1997, Adv. Drug Delivery Rev. 23: 3-25). Most importantly, they provide appropriate metrics and statistical modeling power (such as the patented CoMFA technology in Sybyl as described in U.S. Pat. Nos. 6,240,374 and 6,185,506) to develop Quantitative Structural Activity Relationships (QSARs) which are used to guide the synthesis of more efficacious clinical development candidates while improving desirable physical properties, as determined by results from the aforementioned secondary screening protocols.
- Biologically active compounds identified using the methods of the invention or a pharmaceutically acceptable salt thereof can be administered to a patient, preferably a mammal, more preferably a human, suffering from a disease whose progression is associated with a target RNA:host cell factor interaction in vivo. In certain embodiments, such compounds or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a mammal, more preferably a human, as a preventative measure against a disease associated with an RNA:host cell factor interaction in vivo.
- In one embodiment, “treatment” or “treating” refers to an amelioration of a disease, or at least one discernible symptom thereof. In another embodiment, “treatment” or “treating” refers to an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient. In yet another embodiment, “treatment” or “treating” refers to inhibiting the progression of a disease, either physically, e.g., stabilization of a discernible symptom, physiologically, e.g., stabilization of a physical parameter, or both. In yet another embodiment, “treatment” or “treating” refers to delaying the onset of a disease.
- In certain embodiments, the compound or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a manmial, more preferably a human, as a preventative measure against a disease associated with an RNA:host cell factor interaction in vivo. As used herein, “prevention” or “preventing” refers to a reduction of the risk of acquiring a disease. In one embodiment, the compound or a pharmaceutically acceptable salt thereof is administered as a preventative measure to a patient. According to this embodiment, the patient can have a genetic predisposition to a disease, such as a family history of the disease, or a non-genetic predisposition to the disease. Accordingly, the compound and pharmaceutically acceptable salts thereof can be used for the treatment of one manifestation of a disease and prevention of another.
- When administered to a patient, the compound or a pharmaceutically acceptable salt thereof is preferably administered as component of a composition that optionally comprises a pharmaceutically acceptable vehicle. The composition can be administered orally, or by any other convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal, and intestinal mucosa, etc.) and may be administered together with another biologically active agent. Administration can be systemic or local. Various delivery systems are known, e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the compound and pharmaceutically acceptable salts thereof.
- Methods of administration include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of the compound or a pharmaceutically acceptable salt thereof into the bloodstream.
- In specific embodiments, it may be desirable to administer the compound or a pharmaceutically acceptable salt thereof locally. This may be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
- In certain embodiments, it may be desirable to introduce the compound or a pharmaceutically acceptable salt thereof into the central nervous system by any suitable route, including intraventricular, intrathecal and epidural injection. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.
- Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant. In certain embodiments, the compound and pharmaceutically acceptable salts thereof can be formulated as a suppository, with traditional binders and vehicles such as triglycerides.
- In another embodiment, the compound and pharmaceutically acceptable salts thereof can be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).
- In yet another embodiment, the compound and pharmaceutically acceptable salts thereof can be delivered in a controlled release system (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled-release systems discussed in the review by Langer, 1990, Science 249:1527-1533) may be used. In one embodiment, a pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507 Saudek et al, 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard etal., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled-release system can be placed in proximity of a target RNA of the compound or a pharmaceutically acceptable salt thereof, thus requiring only a fraction of the systemic dose.
- Compositions comprising the compound or a pharmaceutically acceptable salt thereof (“compound compositions”) can additionally comprise a suitable amount of a pharmaceutically acceptable vehicle so as to provide the form for proper administration to the patient.
- In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, mammals, and more particularly in humans. The term “vehicle” refers to a diluent, adjuvant, excipient, or carrier with which a compound of the invention is administered. Such pharmaceutical vehicles can be liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The pharmaceutical vehicles can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary, stabilizing, thickening, lubricating and coloring agents may be used. When administered to a patient, the pharmaceutically acceptable vehicles are preferably sterile. Water is a preferred vehicle when the compound of the invention is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid vehicles, particularly for injectable solutions. Suitable pharmaceutical vehicles also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Compound compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
- Compound compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the pharmaceutically acceptable vehicle is a capsule (see e.g., U.S. Pat. No. 5,698,155). Other examples of suitable pharmaceutical vehicles are described in Remington's Pharmaceutical Sciences, Alfonso R. Gennaro, ed., Mack Publishing Co. Easton, Pa., 19th ed., 1995, pp. 1447 to 1676, incorporated herein by reference.
- In a preferred embodiment, the compound or a pharmaceutically acceptable salt thereof is formulated in accordance with routine procedures as a pharmaceutical composition adapted for oral administration to human beings. Compositions for oral delivery may be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions may contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions. In these later platforms, fluid from the environment surrounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. These delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations. A time delay material such as glycerol monostearate or glycerol stearate may also be used. Oral compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. Such vehicles are preferably of pharmaceutical grade. Typically, compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions may also include a solubilizing agent.
- In another embodiment, the compound or a pharmaceutically acceptable salt thereof can be formulated for intravenous administration. Compositions for intravenous administration may optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mix ed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the compound or a pharmaceutically acceptable salt thereof is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the compound or a pharmaceutically acceptable salt thereof is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
- The amount of a compound or a pharmaceutically acceptable salt thereof that will be effective in the treatment of a particular disease will depend on the nature of the disease, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances. However, suitable dosage ranges for oral administration are generally about 0.001 milligram to about 200 milligrams of a compound or a pharmaceutically acceptable salt thereof per kilogram body weight per day. In specific preferred embodiments of the invention, the oral dose is about 0.01 milligram to about 100 milligrams per kilogram body weight per day, more preferably about 0.1 milligram to about 75 milligrams per kilogram body weight per day, more preferably about 0.5 milligram to 5 milligrams per kilogram body weight per day. The dosage amounts described herein refer to total amounts administered; that is, if more than one compound is administered, or if a compound is administered with a therapeutic agent, then the preferred dosages correspond to the total amount administered. Oral compositions preferably contain about 10% to about 95% active ingredient by weight.
- Suitable dosage ranges for intravenous (i.v.) administration are about 0.01 milligram to about 100 milligrams per kilogram body weight per day, about 0.1 milligram to about 35 milligrams per kilogram body weight per day, and about 1 milligram to about 10 milligrams per kilogram body weight per day. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight per day to about 1 mg/kg body weight per day. Suppositories generally contain about 0.01 milligram to about 50 milligrams of a compound of the invention per kilogram body weight per day and comprise active ingredient in the range of about 0.5% to about 10% by weight.
- Recommended dosages for intradermal, intramuscular, intraperitoneal, subcutaneous, epidural, sublingual, intracerebral, intravaginal, transdermal administration or administration by inhalation are in the range of about 0.001 milligram to about 200 milligrams per kilogram of body weight per day. Suitable doses for topical administration are in the range of about 0.001 milligram to about 1 milligram, depending on the area of administration. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Such animal models and systems are well known in the art.
- The compound and pharmaceutically acceptable salts thereof are preferably assayed in vitro and in vivo, for the desired therapeutic or prophylactic activity, prior to use in humans. For example, in vitro assays can be used to determine whether it is preferable to administer the compound, a pharmaceutically acceptable salt thereof, and/or another therapeutic agent. Animal model systems can be used to demonstrate safety and efficacy.
- A variety of compounds can be used for treating or preventing diseases in mammals. Types of compounds include, but are not limited to, peptides, peptide analogs including peptides comprising non-natural amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as a-amino phosphonic acids and a-amino phosphinic acids, or amino acids having non-peptide linkages, nucleic acids, nucleic acid analogs such as phosphorothioates or peptide nucleic acids (“PNAs”), hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose.
- The therapeutic targets presented herein are by way of example, and the present invention is not to be limited by the targets described herein. The therapeutic targets presented herein as DNA sequences are understood by one of skill in the art that the sequences can be converted to RNA sequences.
- GenBank Accession # X01394:
1 gcagaggacc agctaagagg gagagaagca actacagacc ccccctgaaa acaaccctca (SEQ ID NO: 6) 61 gacgccacat cccctgacaa gctgccaggc aggttctctt cctctcacat actgacccac 121 ggctccaccc tctctcccct ggaaaggaca ccatgagcac tgaaagcatg atccgggacg 181 tggagctggc cgaggaggcg ctccccaaga agacaggggg gccccagggc tccaggcggt 241 gcttgttcct cagcctcttc tccttcctga tcgtggcagg cgccaccacg ctcttctgcc 301 tgctgcactt tggagtgatc ggcccccaga gggaagagtt ccccagggac ctctctctaa 361 tcagccctct ggcccaggca gtcagatcat cttctcgaac cccgagtgac aagcctgtag 421 cccatgttgt agcaaaccct caagctgagg ggcagctcca gtggctgaac cgccgggcca 481 atgccctcct ggccaatggc gtggagctga gagataacca gctggtggtg ccatcagagg 541 gcctgtacct catctactcc caggtcctct tcaagggcca aggctgcccc tccacccatg 601 tgctcctcac ccacaccatc agccgcatcg ccgtctccta ccagaccaag gtcaacctcc 661 tctctgccat caagagcccc tgccagaggg agaccccaga gggggctgag gccaagccct 721 ggtatgagcc catctatctg ggaggggtct tccagctgga gaagggtgac cgactcagcg 781 ctgagatcaa tcggcccgac tatctcgact ttgccgagtc tgggcaggtc tactttggga 841 tcattgccct gtgaggagga cgaacatcca accttcccaa acgcctcccc tgccccaatc 901 cctttattac cccctccttc agacaccctc aacctcttct ggctcaaaaa gagaattggg 961 ggcttagggt cggaacccaa gcttagaact ttaagcaaca agaccaccac ttcgaaacct 1021 gggattcagg aatgtgtggc ctgcacagtg aattgctggc aaccactaag aattcaaact 1081 ggggcctcca gaactcactg gggcctacag ctttgatccc tgacatctgg aatctggaga 1141 ccagggagcc tttggttctg gccagaatgc tgcaggactt gagaagacct cacctagaaa 1201 ttgacacaag tggaccttag gccttcctct ctccagatgt ttccagactt ccttgagaca 1261 cggagcccag ccctccccat ggagccagct ccctctattt atgtttgcac ttgtgattat 1321 ttattattta tttattattt atttatttac agatgaatgt atttatttgg gagaccgggg 1381 tatcctgggg gacccaatgt aggagctgcc ttggctcaga catgttttcc gtgaaaacgg 1441 agctgaacaa taggctgttc ccatgtagcc ccctggcctc tgtgccttct tttgattatg 1501 ttttttaaaa tatttatctg attaagttgt ctaaacaatg ctgatttggt gaccaactgt 1561 cactcattgc tgagcctctg ctccccaggg gagttgtgtc tgtaatcgcc ctactattca 1621 gtggcgagaa ataaagtttg ctt - General Target Regions:
- (1) 5′ Untranslated Region—nts 1-152
- (2) 3′ Untranslated Region—nts 852-1643
- Initial Specific Target Motif:
Group I AU-Rich Element (ARE) Cluster in 3′ untranslated region 5′ AUUUAUUUAUUUAUUUAUUUA 3′ (SEQ ID NO: 1) - GenBank Accession #NM—000758:
1 gctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc agcatctctg (SEQ ID NO: 7) 61 cacccgcccg ctcgcccagc cccagcacgc agccctggga gcatgtgaat gccatccagg 121 aggcccggcg tctcctgaac ctgagtagag acactgctgc tgagatgaat gaaacagtag 181 aagtcatctc agaaatgttt gacctccagg agccgacctg cctacagacc cgcctggagc 241 tgtacaagca gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg 301 ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca acccagacta 361 tcacctttga aagtttcaaa gagaacctga aggactttct gcttgtcatc ccctttgact 421 gctgggagcc agtccaggag tgagaccggc cagatgaggc tggccaagcc ggggagctgc 481 tctctcatga aacaagagct agaaactcag gatggtcatc ttggagggac caaggggtgg 541 gccacagcca tggtgggagt ggcctggacc tgccctgggc cacactgacc ctgatacagg 601 catggcagaa gaatgggaat attttatact gacagaaatc agtaatattt atatatttat 661 atttttaaaa tatttattta tttatttatt taagttcata ttccatattt attcaagatg 721 ttttaccgta ataattatta ttaaaaatat gcttct - GenBank Accession #XM—003751:
1 tctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc agcatctctg (SEQ ID NO: 8) 61 cacccgcccg ctcgcccagc cccagcacgc agccctggga gcatgtgaat gccatccagg 121 aggcccggcg tctcctgaac ctgagtagag acactgctgc tgagatgaat gaaacagtag 181 aagtcatctc agaaatgttt gacctccagg agccgacctg cctacagacc cgcctggagc 241 tgtacaagca gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg 301 ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca acccagacta 361 tcacctttga aagtttcaaa gagaacctga aggactttct gcttgtcatc ccctttgact 421 gctgggagcc agtccaggag tgagaccggc cagatgaggc tggccaagcc ggggagctgc 481 tctctcatga aacaagagct agaaactcag gatggtcatc ttggagggac caaggggtgg 541 gccacagcca tggtgggagt ggcctggacc tgccctgggc cacactgacc ctgatacagg 601 catggcagaa gaatgggaat attttatact gacagaaatc agtaatattt atatatttat 661 atttttaaaa tatttattta tttatttatt taagttcata ttccatattt attcaagatg 721 ttttaccgta ataattatta ttaaaaatat gcttct - General Target Regions:
- (1) 5′ Untranslated Region—nts 1-32
- (2) 3′ Untranslated Region—nts 468-789
- Initial Specific Target Motif:
- Group I AU-Rich Element (ARE) Cluster in 3′ untranslated region 5′ AUUUAUUUAUUUAUUUAUUUA 3′ (SEQ ID NO: 1)
- GenBank Accession #U25676:
1 atcactctct ttaatcacta ctcacattaa cctcaactcc tgccacaatg tacaggatgc (SEQ ID NO: 9) 61 aactcctgtc ttgcattgca ctaattcttg cacttgtcac aaacagtgca cctacttcaa 121 gttcgacaaa gaaaacaaag aaaacacagc tacaactgga gcatttactg ctggatttac 181 agatgatttt gaatggaatt aataattaca agaatcccaa actcaccagg atgctcacat 241 ttaagtttta catgcccaag aaggccacag aactgaaaca gcttcagtgt ctagaagaag 301 aactcaaacc tctggaggaa gtgctgaatt tagctcaaag caaaaacttt cacttaagac 361 ccagggactt aatcagcaat atcaacgtaa tagttctgga actaaaggga tctgaaacaa 421 cattcatgtg tgaatatgca gatgagacag caaccattgt agaatttctg aacagatgga 481 ttaccttttg tcaaagcatc atctcaacac taacttgata attaagtgct tcccacttaa 541 aacatatcag gccttctatt tatttattta aatatttaaa ttttatattt attgttgaat 601 gtatggttgc tacctattgt aactattatt cttaatctta aaactataaa tatggatctt 661 ttatgattct ttttgtaagc cctaggggct ctaaaatggt ttaccttatt tatcccaaaa 721 atatttatta ttatgttgaa tgttaaatat agtatctatg tagattggtt agtaaaacta 781 tttaataaat ttgataaata taaaaaaaaa aaacaaaaaa aaaaa - General Target Regions:
- (1) 5′ Untranslated Region—nts 1-47
- (2) 3′ Untranslated Region—nts 519-825
- Initial Specific Target Motifs:
Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region 5′NAUUUAUUUAUUUAN 3′ (SEQ ID NO: 10) - GenBank Accession #NM—000600:
1 ttctgccctc gagcccaccg ggaacgaaag agaagctcta tctcgcctcc aggagcccag (SEQ ID NO: 11) 61 ctatgaactc cttctccaca agcgccttcg gtccagttgc cttctccctg gggctgctcc 121 tggtgttgcc tgctgccttc cctgccccag tacccccagg agaagattcc aaagatgtag 181 ccgccccaca cagacagcca ctcacctctt cagaacgaat tgacaaacaa attcggtaca 241 tcctcgacgg catctcagcc ctgagaaagg agacatgtaa caagagtaac atgtgtgaaa 301 gcagcaaaga ggcactggca gaaaacaacc tgaaccttcc aaagatggct gaaaaagatg 361 gatgcttcca atctggattc aatgaggaga cttgcctggt gaaaatcatc actggtcttt 421 tggagtttga ggtataccta gagtacctcc agaacagatt tgagagtagt gaggaacaag 481 ccagagctgt gcagatgagt acaaaagtcc tgatccagtt cctgcagaaa aaggcaaaga 541 atctagatgc aataaccacc cctgacccaa ccacaaatgc cagcctgctg acgaagctgc 601 aggcacagaa ccagtggctg caggacatga caactcatct cattctgcgc agctttaagg 661 agttcctgca gtccagcctg agggctcttc ggcaaatgta gcatgggcac ctcagattgt 721 tgttgttaat gggcattcct tcttctggtc agaaacctgt ccactgggca cagaacttat 781 gttgttctct atggagaact aaaagtatga gcgttaggac actattttaa ttatttttaa 841 tttattaata tttaaatatg tgaagctgag ttaatttatg taagtcatat ttatattttt 901 aagaagtacc acttgaaaca ttttatgtat tagttttgaa ataataatgg aaagtggcta 961 tgcagtttga atatcctttg tttcagagcc agatcatttc ttggaaagtg taggcttacc 1021 tcaaataaat ggctaactta tacatatttt taaagaaata tttatattgt atttatataa 1081 tgtataaatg gtttttatac caataaatgg cattttaaaa aattc - General Target Regions:
- (1) 5′ Untranslated Region—nts 1-62
- (2) 3′ Untranslated Region—nts 699-1125
- Initial Specific Target Motifs:
Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region 5′ NAUUUAUUUAUUUAN 3′ (SEQ ID NO: 10) - GenBank Accession #AF022375:
1 aagagctcca gagagaagtc gaggaagaga gagacggggt cagagagagc gcgcgggcgt (SEQ ID NO: 12) 61 gcgagcagcg aaagcgacag gggcaaagtg agtgacctgc ttttgggggt gaccgccgga 121 gcgcggcgtg agccctcccc cttgggatcc cgcagctgac cagtcgcgct gacggacaga 181 cagacagaca ccgcccccag ccccagttac cacctcctcc ccggccggcg gcggacagtg 241 gacgcggcgg cgagccgcgg gcaggggccg gagcccgccc ccggaggcgg ggtggagggg 301 gtcggagctc gcggcgtcgc actgaaactt ttcgtccaac ttctgggctg ttctcgcttc 361 ggaggagccg tggtccgcgc gggggaagcc gagccgagcg gagccgcgag aagtgctagc 421 tcgggccggg aggagccgca gccggaggag ggggaggagg aagaagagaa ggaagaggag 481 agggggccgc agtggcgact cggcgctcgg aagccgggct catggacggg tgaggcggcg 541 gtgtgcgcag acagtgctcc agcgcgcgcg ctccccagcc ctggcccggc ctcgggccgg 601 gaggaagagt agctcgccga ggcgccgagg agagcgggcc gccccacagc ccgagccgga 661 gagggacgcg agccgcgcgc cccggtcggg cctccgaaac catgaacttt ctgctgtctt 721 gggtgcattg gagccttgcc ttgctgctct acctccacca tgccaagtgg tcccaggctg 781 cacccatggc agaaggagga gggcagaatc atcacgaagt ggtgaagttc atggatgtct 841 atcagcgcag ctactgccat ccaatcgaga ccctggtgga catcttccag gagtaccctg 901 atgagatcga gtacatcttc aagccatcct gtgtgcccct gatgcgatgc gggggctgct 961 ccaatgacga gggcctggag tgtgtgccca ctgaggagtc caacatcacc atgcagatta 1021 tgcggatcaa acctcaccaa ggccagcaca taggagagat gagcttccta cagcacaaca 1081 aatgtgaatg cagaccaaag aaagatagag caagacaaga aaatccctgt gggccttgct 1141 cagagcggag aaagcatttg tttgtacaag atccgcagac gtgtaaatgt tcctgcaaaa 1201 acacacactc gcgttgcaag gcgaggcagc ttgagttaaa cgaacgtact tgcagatgtg 1261 acaagccgag gcggtgagcc gggcaggagg aaggagcctc cctcagggtt tcgggaacca 1321 gatctctctc caggaaagac tgatacagaa cgatcgatac agaaaccacg ctgccgccac 1381 cacaccatca ccatcgacag aacagtcctt aatccagaaa cctgaaatga aggaagagga 1441 gactctgcgc agagcacttt gggtccggag ggcgagactc cggcggaagc attcccgggc 1501 gggtgaccca gcacggtccc tcttggaatt ggattcgcca ttttattttt cttgctgcta 1561 aatcaccgag cccggaagat tagagagttt tatttctggg attcctgtag acacacccac 1621 ccacatacat acatttatat atatatatat tatatatata taaaaataaa tatctctatt 1681 ttatatatat aaaatatata tattcttttt ttaaattaac agtgctaatg ttattggtgt 1741 cttcactgga tgtatttgac tgctgtggac ttgagttggg aggggaatgt tcccactcag 1801 atcctgacag ggaagaggag gagatgagag actctggcat gatctttttt ttgtcccact 1861 tggtggggcc agggtcctct cccctgccca agaatgtgca aggccagggc atgggggcaa 1921 atatgaccca gttttgggaa caccgacaaa cccagccctg gcgctgagcc tctctacccc 1981 aggtcagacg gacagaaaga caaatcacag gttccgggat gaggacaccg gctctgacca 2041 ggagtttggg gagcttcagg acattgctgt gctttgggga ttccctccac atgctgcacg 2101 cgcatctcgc ccccaggggc actgcctgga agattcagga gcctgggcgg ccttcgctta 2161 ctctcacctg cttctgagtt gcccaggagg ccactggcag atgtcccggc gaagagaaga 2221 gacacattgt tggaagaagc agcccatgac agcgcccctt cctgggactc gccctcatcc 2281 tcttcctgct ccccttcctg gggtgcagcc taaaaggacc tatgtcctca caccattgaa 2341 accactagtt ctgtcccccc aggaaacctg gttgtgtgtg tgtgagtggt tgaccttcct 2401 ccatcccctg gtccttccct tcccttcccg aggcacagag agacagggca ggatccacgt 2461 gcccattgtg gaggcagaga aaagagaaag tgttttatat acggtactta tttaatatcc 2521 ctttttaatt agaaattaga acagttaatt taattaaaga gtagggtttt ttttcagtat 2581 tcttggttaa tatttaattt caactattta tgagatgtat cttttgctct ctcttgctct 2641 cttatttgta ccggtttttg tatataaaat tcatgtttcc aatctctctc tccctgatcg 2701 gtgacagtca ctagcttatc ttgaacagat atttaatttt gctaacactc agctctgccc 2761 tccccgatcc cctggctccc cagcacacat tcctttgaaa gagggtttca atatacatct 2821 acatactata tatatattgg gcaacttgta tttgtgtgta tatatatata tatatgttta 2881 tgtatatatg tgatcctgaa aaaataaaca tcgctattct gttttttata tgttcaaacc 2941 aaacaagaaa aaatagagaa ttctacatac taaatctctc tcctttttta attttaatat 3001 ttgttatcat ttatttattg gtgctactgt ttatccgtaa taattgtggg gaaaagatat 3061 taacatcacg tctttgtctc tagtgcagtt tttcgagata ttccgtagta catatttatt 3121 tttaaacaac gacaaagaaa tacagatata tcttaaaaaa aaaaaa - General Target Regions:
- (1) 5′ Untranslated Region—nts 1-701
- (2) 3′ Untranslated Region—nts 1275-3166
- Initial Specific Target Motifs:
(1) Internal Ribosome Entry Site (IRES) in 5′ untranslated region nts 513-704 5′CCGGGCUCAUGGACGGGUGAGGCGGCGGUGUGCGCAGACAGU (SEQ ID NO: 13) GCUCCAGCGCGCGCGCUCCCCAGCCCUGGCCCGGCCUCGGGCCG GGAGGAAGAGUAGCUCGCCGAGGCGCCGAGGAGAGCGGGCCGC CCCACAGCCCGAGCCGGAGAGGGACGCGAGCCGCGCGCCCCGGU CGGGCCUCCGAAACCAUGAACUUUCUGCUGUCUUGGGUGCAUU GGAGCCUUGCCUUGCUGCUCUACCUCCACCAUG 3′ (2) Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region 5′ NAUUUAUUUAUUUAN 3′ (SEQ ID NO: 10) - GenBank Accession #NC—001802:
1 ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac (SEQ ID NO: 14) 61 tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 121 gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 181 gtggcgcccg aacagggacc tgaaagcgaa agggaaacca gaggagctct ctcgacgcag 241 gactcggctt gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc 301 aaaaattttg actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa 361 gcgggggaga attagatcga tgggaaaaaa ttcggttaag gccaggggga aagaaaaaat 421 ataaattaaa acatatagta tgggcaagca gggagctaga acgattcgca gttaatcctg 481 gcctgttaga aacatcagaa ggctgtagac aaatactggg acagctacaa ccatcccttc 541 agacaggatc agaagaactt agatcattat ataatacagt agcaaccctc tattgtgtgc 601 atcaaaggat agagataaaa gacaccaagg aagctttaga caagatagag gaagagcaaa 661 acaaaagtaa gaaaaaagca cagcaagcag cagctgacac aggacacagc aatcaggtca 721 gccaaaatta ccctatagtg cagaacatcc aggggcaaat ggtacatcag gccatatcac 781 ctagaacttt aaatgcatgg gtaaaagtag tagaagagaa ggctttaagc ccagaagtga 841 tacccatgtt ttcagcatta tcagaaggag ccaccccaca agatttaaac accatgctaa 901 acacagtggg gggacatcaa gcagccatgc aaatgttaaa agagaccatc aatgaggaag 961 ctgcagaatg ggatagagtg catccagtgc atgcagggcc tattgcacca ggccagatga 1021 gagaaccaag gggaagtgac atagcaggaa ctactagtac ccttcaggaa caaataggat 1081 ggatgacaaa taatccacct atcccagtag gagaaattta taaaagatgg ataatcctgg 1141 gattaaataa aatagtaaga atgtatagcc ctaccagcat tctggacata agacaaggac 1201 caaaggaacc ctttagagac tatgtagacc ggttctataa aactctaaga gccgagcaag 1261 cttcacagga ggtaaaaaat tggatgacag aaaccttgtt ggtccaaaat gcgaacccag 1321 attgtaagac tattttaaaa gcattgggac cagcggctac actagaagaa atgatgacag 1381 catgtcaggg agtaggagga cccggccata aggcaagagt tttggctgaa gcaatgagcc 1441 aagtaacaaa ttcagctacc ataatgatgc agagaggcaa ttttaggaac caaagaaaga 1501 ttgttaagtg tttcaattgt ggcaaagaag ggcacacagc cagaaattgc agggccccta 1561 ggaaaaaggg ctgttggaaa tgtggaaagg aaggacacca aatgaaagat tgtactgaga 1621 gacaggctaa ttttttaggg aagatctggc cttcctacaa gggaaggcca gggaattttc 1681 ttcagagcag accagagcca acagccccac cagaagagag cttcaggtct ggggtagaga 1741 caacaactcc ccctcagaag caggagccga tagacaagga actgtatcct ttaacttccc 1801 tcaggtcact ctttggcaac gacccctcgt cacaataaag ataggggggc aactaaagga 1861 agctctatta gatacaggag cagatgatac agtattagaa gaaatgagtt tgccaggaag 1921 atggaaacca aaaatgatag ggggaattgg aggttttatc aaagtaagac agtatgatca 1981 gatactcata gaaatctgtg gacataaagc tataggtaca gtattagtag gacctacacc 2041 tgtcaacata attggaagaa atctgttgac tcagattggt tgcactttaa attttcccat 2101 tagccctatt gagactgtac cagtaaaatt aaagccagga atggatggcc caaaagttaa 2161 acaatggcca ttgacagaag aaaaaataaa agcattagta gaaatttgta cagagatgga 2221 aaaggaaggg aaaatttcaa aaattgggcc tgaaaatcca tacaatactc cagtatttgc 2281 cataaagaaa aaagacagta ctaaatggag aaaattagta gatttcagag aacttaataa 2341 gagaactcaa gacttctggg aagttcaatt aggaatacca catcccgcag ggttaaaaaa 2401 gaaaaaatca gtaacagtac tggatgtggg tgatgcatat ttttcagttc ccttagatga 2461 agacttcagg aagtatactg catttaccat acctagtata aacaatgaga caccagggat 2521 tagatatcag tacaatgtgc ttccacaggg atggaaagga tcaccagcaa tattccaaag 2581 tagcatgaca aaaatcttag agccttttag aaaacaaaat ccagacatag ttatctatca 2641 atacatggat gatttgtatg taggatctga cttagaaata gggcagcata gaacaaaaat 2701 agaggagctg agacaacatc tgttgaggtg gggacttacc acaccagaca aaaaacatca 2761 gaaagaacct ccattccttt ggatgggtta tgaactccat cctgataaat ggacagtaca 2821 gcctatagtg ctgccagaaa aagacagctg gactgtcaat gacatacaga agttagtggg 2881 gaaattgaat tgggcaagtc agatttaccc agggattaaa gtaaggcaat tatgtaaact 2941 ccttagagga accaaagcac taacagaagt aataccacta acagaagaag cagagctaga 3001 actggcagaa aacagagaga ttctaaaaga accagtacat ggagtgtatt atgacccatc 3061 aaaagactta atagcagaaa tacagaagca ggggcaaggc caatggacat atcaaattta 3121 tcaagagcca tttaaaaatc tgaaaacagg aaaatatgca agaatgaggg gtgcccacac 3181 taatgatgta aaacaattaa cagaggcagt gcaaaaaata accacagaaa gcatagtaat 3241 atggggaaag actcctaaat ttaaactgcc catacaaaag gaaacatggg aaacatggtg 3301 gacagagtat tggcaagcca cctggattcc tgagtgggag tttgttaata cccctccctt 3361 agtgaaatta tggtaccagt tagagaaaga acccatagta ggagcagaaa ccttctatgt 3421 agatggggca gctaacaggg agactaaatt aggaaaagca ggatatgtta ctaatagagg 3481 aagacaaaaa gttgtcaccc taactgacac aacaaatcag aagactgagt tacaagcaat 3541 ttatctagct ttgcaggatt cgggattaga agtaaacata gtaacagact cacaatatgc 3601 attaggaatc attcaagcac aaccagatca aagtgaatca gagttagtca atcaaataat 3661 agagcagtta ataaaaaagg aaaaggtcta tctggcatgg gtaccagcac acaaaggaat 3721 tggaggaaat gaacaagtag ataaattagt cagtgctgga atcaggaaag tactattttt 3781 agatggaata gataaggccc aagatgaaca tgagaaatat cacagtaatt ggagagcaat 3841 ggctagtgat tttaacctgc cacctgtagt agcaaaagaa atagtagcca gctgtgataa 3901 atgtcagcta aaaggagaag ccatgcatgg acaagtagac tgtagtccag gaatatggca 3961 actagattgt acacatttag aaggaaaagt tatcctggta gcagttcatg tagccagtgg 4021 atatatagaa gcagaagtta ttccagcaga aacagggcag gaaacagcat attttctttt 4081 aaaattagca ggaagatggc cagtaaaaac aatacatact gacaatggca gcaatttcac 4141 cggtgctacg gttagggccg cctgttggtg ggcgggaatc aagcaggaat ttggaattcc 4201 ctacaatccc caaagtcaag gagtagtaga atctatgaat aaagaattaa agaaaattat 4261 aggacaggta agagatcagg ctgaacatct taagacagca gtacaaatgg cagtattcat 4321 ccacaatttt aaaagaaaag gggggattgg ggggtacagt gcaggggaaa gaatagtaga 4381 cataatagca acagacatac aaactaaaga attacaaaaa caaattacaa aaattcaaaa 4441 ttttcgggtt tattacaggg acagcagaaa tccactttgg aaaggaccag caaagctcct 4501 ctggaaaggt gaaggggcag tagtaataca agataatagt gacataaaag tagtgccaag 4561 aagaaaagca aagatcatta gggattatgg aaaacagatg gcaggtgatg attgtgtggc 4621 aagtagacag gatgaggatt agaacatgga aaagtttagt aaaacaccat atgtatgttt 4681 cagggaaagc taggggatgg ttttatagac atcactatga aagccctcat ccaagaataa 4741 gttcagaagt acacatccca ctaggggatg ctagattggt aataacaaca tattggggtc 4801 tgcatacagg agaaagagac tggcatttgg gtcagggagt ctccatagaa tggaggaaaa 4861 agagatatag cacacaagta gaccctgaac tagcagacca actaattcat ctgtattact 4921 ttgactgttt ttcagactct gctataagaa aggccttatt aggacacata gttagcccta 4981 ggtgtgaata tcaagcagga cataacaagg taggatctct acaatacttg gcactagcag 5041 cattaataac accaaaaaag ataaagccac ctttgcctag tgttacgaaa ctgacagagg 5101 atagatggaa caagccccag aagaccaagg gccacagagg gagccacaca atgaatggac 5161 actagagctt ttagaggagc ttaagaatga agctgttaga cattttccta ggatttggct 5221 ccatggctta gggcaacata tctatgaaac ttatggggat acttgggcag gagtggaagc 5281 cataataaga attctgcaac aactgctgtt tatccatttt cagaattggg tgtcgacata 5341 gcagaatagg cgttactcga cagaggagag caagaaatgg agccagtaga tcctagacta 5401 gagccctgga agcatccagg aagtcagcct aaaactgctt gtaccaattg ctattgtaaa 5461 aagtgttgct ttcattgcca agtttgtttc ataacaaaag ccttaggcat ctcctatggc 5521 aggaagaagc ggagacagcg acgaagagct catcagaaca gtcagactca tcaagcttct 5581 ctatcaaagc agtaagtagt acatgtaatg caacctatac caatagtagc aatagtagca 5641 ttagtagtag caataataat agcaatagtt gtgtggtcca tagtaatcat agaatatagg 5701 aaaatattaa gacaaagaaa aatagacagg ttaattgata gactaataga aagagcagaa 5761 gacagtggca atgagagtga aggagaaata tcagcacttg tggagatggg ggtggagatg 5821 gggcaccatg ctccttggga tgttgatgat ctgtagtgct acagaaaaat tgtgggtcac 5881 agtctattat ggggtacctg tgtggaagga agcaaccacc actctatttt gtgcatcaga 5941 tgctaaagca tatgatacag aggtacataa tgtttgggcc acacatgcct gtgtacccac 6001 agaccccaac ccacaagaag tagtattggt aaatgtgaca gaaaatttta acatgtggaa 6061 aaatgacatg gtagaacaga tgcatgagga tataatcagt ttatgggatc aaagcctaaa 6121 gccatgtgta aaattaaccc cactctgtgt tagtttaaag tgcactgatt tgaagaatga 6181 tactaatacc aatagtagta gcgggagaat gataatggag aaaggagaga taaaaaactg 6241 ctctttcaat atcagcacaa gcataagagg taaggtgcag aaagaatatg cattttttta 6301 taaacttgat ataataccaa tagataatga tactaccagc tataagttga caagttgtaa 6361 cacctcagtc attacacagg cctgtccaaa ggtatccttt gagccaattc ccatacatta 6421 ttgtgccccg gctggttttg cgattctaaa atgtaataat aagacgttca atggaacagg 6481 accatgtaca aatgtcagca cagtacaatg tacacatgga attaggccag tagtatcaac 6541 tcaactgctg ttaaatggca gtctagcaga agaagaggta gtaattagat ctgtcaattt 6601 cacggacaat gctaaaacca taatagtaca gctgaacaca tctgtagaaa ttaattgtac 6661 aagacccaac aacaatacaa gaaaaagaat ccgtatccag agaggaccag ggagagcatt 6721 tgttacaata ggaaaaatag gaaatatgag acaagcacat tgtaacatta gtagagcaaa 6781 atggaataac actttaaaac agatagctag caaattaaga gaacaatttg gaaataataa 6841 aacaataatc tttaagcaat cctcaggagg ggacccagaa attgtaacgc acagttttaa 6901 ttgtggaggg gaatttttct actgtaattc aacacaactg tttaatagta cttggtttaa 6961 tagtacttgg agtactgaag ggtcaaataa cactgaagga agtgacacaa tcaccctccc 7021 atgcagaata aaacaaatta taaacatgtg gcagaaagta ggaaaagcaa tgtatgcccc 7081 tcccatcagt ggacaaatta gatgttcatc aaatattaca gggctgctat taacaagaga 7141 tggtggtaat agcaacaatg agtccgagat cttcagacct ggaggaggag atatgaggga 7201 caattggaga agtgaattat ataaatataa agtagtaaaa attgaaccat taggagtagc 7261 acccaccaag gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc 7321 tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcct caatgacgct 7381 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 7441 ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca 7501 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg 7561 ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 7621 atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa 7681 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 7741 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 7801 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 7861 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 7921 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 7981 tggagagaga gacagagaca gatccattcg attagtgaac ggatccttgg cacttatctg 8041 ggacgatctg cggagcctgt gcctcttcag ctaccaccgc ttgagagact tactcttgat 8101 tgtaacgagg attgtggaac ttctgggacg cagggggtgg gaagccctca aatattggtg 8161 gaatctccta cagtattgga gtcaggaact aaagaatagt gctgttagct tgctcaatgc 8221 cacagccata gcagtagctg aggggacaga tagggttata gaagtagtac aaggagcttg 8281 tagagctatt cgccacatac ctagaagaat aagacagggc ttggaaagga ttttgctata 8341 agatgggtgg caagtggtca aaaagtagtg tgattggatg gcctactgta agggaaagaa 8401 tgagacgagc tgagccagca gcagataggg tgggagcagc atctcgagac ctggaaaaac 8461 atggagcaat cacaagtagc aatacagcag ctaccaatgc tgcttgtgcc tggctagaag 8521 cacaagagga ggaggaggtg ggttttccag tcacacctca ggtaccttta agaccaatga 8581 cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga ctggaagggc 8641 taattcactc ccaaagaaga caagatatcc ttgatctgtg gatctaccac acacaaggct 8701 acttccctga ttagcagaac tacacaccag ggccaggggt cagatatcca ctgacctttg 8761 gatggtgcta caagctagta ccagttgagc cagataagat agaagaggcc aataaaggag 8821 agaacaccag cttgttacac cctgtgagcc tgcatgggat ggatgacccg gagagagaag 8881 tgttagagtg gaggtttgac agccgcctag catttcatca cgtggcccga gagctgcatc 8941 cggagtactt caagaactgc tgacatcgag cttgctacaa gggactttcc gctggggact 9001 ttccagggag gcgtggcctg ggcgggactg gggagtggcg agccctcaga tcctgcatat 9061 aagcagctgc tttttgcctg tactgggtct ctctggttag accagatctg agcctgggag 9121 ctctctggct aactagggaa cccactgctt aagcctcaat aaagcttgcc ttgagtgctt 9181 c - Initial Specific Target Motifs:
- (1) Trans-activation response region/Tat protein binding site—TAR RNA—nts 1-60
- “Minimal” TAR RNA element
5′ GGCAGAUCUGAGCCUGGGAGCUCUCU (SEQ ID NO: 15) GCC 3′ - (2) Gag/Pol Frameshifting Site—“Minimal” frameshifting element
5′ UUUUUUAGGGAAGAUCUGGCCUUCCUACAA (SEQ ID NO: 16) GGGAAGGCCAGGGAAUUUUCUU 3′ - GenBank Accession #NC—001433:
1 ttgggggcga cactccacca tagatcactc ccctgtgagg aactactgtc ttcacgcaga (SEQ ID NO: 17) 61 aagcgtctag ccatggcgtt agtatgagtg ttgtgcagcc tccaggaccc cccctcccgg 121 gagagccata gtggtctgcg gaaccggtga gtacaccgga attgccagga cgaccgggtc 181 ctttcttgga tcaacccgct caatgcctgg agatttgggc gtgcccccgc gagactgcta 241 gccgagtagt gttgggtcgc gaaaggcctt gtggtactgc ctgatagggt gcttgcgagt 301 gccccgggag gtctcgtaga ccgtgcatca tgagcacaaa tcctaaacct caaagaaaaa 361 ccaaacgtaa caccaaccgc cgcccacagg acgttaagtt cccgggcggt ggtcagatcg 421 ttggtggagt ttacctgttg ccgcgcaggg gccccaggtt gggtgtgcgc gcgactagga 481 agacttccga gcggtcgcaa cctcgtggaa ggcgacaacc tatccccaag gctcgccggc 541 ccgagggtag gacctgggct cagcccgggt acccttggcc cctctatggc aacgagggta 601 tggggtgggc aggatggctc ctgtcacccc gtggctctcg gcctagttgg ggccccacag 661 acccccggcg taggtcgcgt aatttgggta aggtcatcga tacccttaca tgcggcttcg 721 ccgacctcat ggggtacatt ccgcttgtcg gcgcccccct agggggcgct gccagggccc 781 tggcacatgg tgtccgggtt ctggaggacg gcgtgaacta tgcaacaggg aatctgcccg 841 gttgctcttt ctctatcttc ctcttagctt tgctgtcttg tttgaccatc ccagcttccg 901 cttacgaggt gcgcaacgtg tccgggatat accatgtcac gaacgactgc tccaactcaa 961 gtattgtgta tgaggcagcg gacatgatca tgcacacccc cgggtgcgtg ccctgcgtcc 1021 gggagagtaa tttctcccgt tgctgggtag cgctcactcc cacgctcgcg gccaggaaca 1081 gcagcatccc caccacgaca atacgacgcc acgtcgattt gctcgttggg gcggctgctc 1141 tctgttccgc tatgtacgtt ggggatctct gcggatccgt ttttctcgtc tcccagctgt 1201 tcaccttctc acctcgccgg tatgagacgg tacaagattg caattgctca atctatcccg 1261 gccacgtatc aggtcaccgc atggcttggg atatgatgat gaactggtca cctacaacgg 1321 ccctagtggt atcgcagcta ctccggatcc cacaagccgt cgtggacatg gtggcggggg 1381 cccactgggg tgtcctagcg ggccttgcct actattccat ggtggggaac tgggctaagg 1441 tcttgattgt gatgctactc tttgctggcg ttgacgggca cacccacgtg acagggggaa 1501 gggtagcctc cagcacccag agcctcgtgt cctggctctc acaaggccca tctcagaaaa 1561 tccaactcgt gaacaccaac ggcagctggc acatcaacag gaccgctctg aattgcaatg 1621 actccctcca aactgggttc attgctgcgc tgttctacgc acacaggttc aacgcgtccg 1681 ggtgcccaga gcgcatggct agctgccgcc ccatcgatga gttcgctcag gggtggggtc 1741 ccatcactca tgatatgcct gagagctcgg accagaggcc atattgctgg cactacgcgc 1801 ctcgaccgtg cgggatcgtg cctgcgtcgc aggtgtgtgg tccagtgtat tgcttcactc 1861 cgagccctgt tgtagtgggg acgaccgatc gtttcggcgc tcctacgtat agctgggggg 1921 agaatgagac agacgtgctg ctacttagca acacgcggcc gcctcaaggc aactggtttg 1981 ggtgcacgtg gatgaacagc actgggttca ccaagacgtg cgggggccct ccgtgcaaca 2041 tcgggggggt cggcaacaac accttggtct gccccacgga ttgcttccgg aagcaccccg 2101 aggccactta cacaaagtgt ggctcggggc cctggttgac acccaggtgc atggttgact 2161 acccatacag gctctggcac tacccctgca ctgttaactt taccgtcttt aaggtcagga 2221 tgtatgtggg gggcgtggag cacaggctca atgctgcatg caattggact cgaggagagc 2281 gctgtgactt ggaggacagg gataggtcag aactcagccc gctgctgctg tctacaacag 2341 agtggcagat actgccctgt tccttcacca ccctaccggc cctgtccact ggcttgatcc 2401 atcttcaccg gaacatcgtg gacgtgcaat acctgtacgg tatagggtcg gcagttgtct 2461 cctttgcaat caaatgggag tatatcctgt tgcttttcct tcttctggcg gacgcgcgcg 2521 tctgtgcctg cttgtggatg atgctgctga tagcccaggc tgaggccacc ttagagaacc 2581 tggtggtcct caatgcggcg tctgtggccg gagcgcatgg ccttctctcc ttcctcgtgt 2641 tcttctgcgc cgcctggtac atcaaaggca ggctggtccc tggggcggca tatgctctct 2701 atggcgtatg gccgttgctc ctgctcttgc tggccttacc accacgagct tatgccatgg 2761 accgagagat ggctgcatcg tgcggaggcg cggtttttgt aggtctggta ctcttgacct 2821 tgtcaccata ctataaggtg ttcctcgcta ggctcatatg gtggttacaa tattttatca 2881 ccagagccga ggcgcacttg caagtgtggg tcccccctct caatgttcgg ggaggccgcg 2941 atgccatcat cctccttaca tgcgcggtcc atccagagct aatctttgac atcaccaaac 3001 tcctgctcgc catactcggt ccgctcatgg tgctccaggc tggcataact agagtgccgt 3061 actttgtacg cgctcagggg ctcatccgtg catgcatgtt agtgcggaag gtcgctggag 3121 gccactatgt ccaaatggcc ttcatgaagc tggccgcgct gacaggtacg tacgtatatg 3181 accatcttac tccactgcgg gattgggccc acgcgggcct acgagacctt gcggtggcag 3241 tagagcccgt cgtcttctct gacatggaga ctaaactcat cacctggggg gcagacaccg 3301 cggcgtgtgg ggacatcatc tcgggtctac cagtctccgc ccgaaggggg aaggagatac 3361 ttctaggacc ggccgatagt tttggagagc aggggtggcg gctccttgcg cctatcacgg 3421 cctattccca acaaacgcgg ggcctgcttg gctgtatcat cactagcctc acaggtcggg 3481 acaagaacca ggtcgatggg gaggttcagg tgctctccac cgcaacgcaa tctttcctgg 3541 cgacctgcgt caatggcgtg tgttggaccg tctaccatgg tgccggctcg aagaccctgg 3601 ccggcccgaa gggtccaatc acccaaatgt acaccaatgt agaccaggac ctcgtcggct 3661 ggccggcgcc ccccggggcg cgctccatga caccgtgcac ctgcggcagc tcggaccttt 3721 acttggtcac gaggcatgct gatgtcgttc cggtgcgccg gcggggcgac agcaggggga 3781 gcctgctttc ccccaggccc atctcctacc tgaagggctc ctcgggtgga ccactgcttt 3841 gcccttcggg gcacgttgta ggcatcttcc gggctgctgt gtgcacccgg ggggttgcga 3901 aggcggtgga cttcataccc gttgagtcta tggaaactac catgcggtct ccggtcttca 3961 cagacaactc atcccctccg gccgtaccgc aaacattcca agtggcacat ttacacgctc 4021 ccactggcag cggcaagagc accaaagtgc cggctgcata tgcagcccaa gggtacaagg 4081 tgctcgtcct aaacccgtcc gttgccgcca cattgggctt tggagcgtat atgtccaagg 4141 cacatggcat cgagcctaac atcagaactg gggtaaggac catcaccacg ggcggcccca 4201 tcacgtactc cacctattgc aagttccttg ccgacggtgg atgctccggg ggcgcctatg 4261 acatcataat atgtgatgaa tgccactcaa ctgactcgac taccatcttg ggcatcggca 4321 cagtcctgga tcaggcagag acggctggag cgcggctcgt cgtgctcgcc accgccacgc 4381 ctccgggatc gatcaccgtg ccacacccca acatcgagga agtggccctg tccaacactg 4441 gagagattcc cttctatggc aaagccatcc ccattgaggc catcaagggg ggaaggcatc 4501 tcatcttctg ccattccaag aagaagtgtg acgagctcgc cgcaaagctg acaggcctcg 4561 gactcaatgc tgtagcgtat taccggggtc tcgatgtgtc cgtcataccg actagcggag 4621 acgtcgttgt cgtggcaaca gacgctctaa tgacgggttt taccggcgac tttgactcag 4681 tgatcgactg caacacatgt gtcacccaga cagtcgattt cagcttggat cccaccttca 4741 ccattgagac gacaacgctg ccccaagacg cggtgtcgcg tgcgcagcgg cgaggtagga 4801 ctggcagggg caggagtggc atctacaggt ttgtgactcc aggagaacgg ccctcaggca 4861 tgttcgactc ctcggtcctg tgtgagtgct atgacgcagg ctgcgcttgg tatgagctca 4921 cgcccgctga gacctcggtt aggttgcggg cttacctaaa tacaccaggg ttgcccgtct 4981 gccaggacca cctagagttc tgggagagcg tcttcacagg cctcacccac atagatgccc 5041 acttcttgtc ccagaccaaa caggcaggag acaacctccc ctacctggta gcataccaag 5101 ccacagtgtg cgccagggct caggctccac ctccatcgtg ggaccaaatg tggaagtgtc 5161 tcatacggct aaagcccaca ctgcatgggc caacgcccct gctgtacagg ctaggagccg 5221 ttcaaaatga ggtcactctc acacacccca taaccaaata catcatggca tgcatgtcgg 5281 ctgacctgga ggtcgtcact agcacctggg tgctagtagg cggagtcctt gcggctctgg 5341 ccgcgtactg cctgacgaca ggcagcgtgg tcattgtggg caggatcatc ttgtccggga 5401 ggccagctgt tattcccgac agggaagtcc tctaccagga gttcgatgag atggaagagt 5461 gtgcttcaca cctcccttac atcgagcaag gaatgcagct cgccgagcaa ttcaaacaga 5521 aggcgctcgg attgctgcaa acagccacca agcaagcgga ggctgctgct cccgtggtgg 5581 agtccaagtg gcgagccctt gaggtcttct gggcgaaaca catgtggaac ttcatcagcg 5641 ggatacagta cttggcaggc ctatccactc tgcctggaaa ccccgcgata gcatcattga 5701 tggcttttac agcctctatc accagcccgc tcaccaccca aaataccctc ctgtttaaca 5761 tcttgggggg atgggtggct gcccaactcg ctccccccag cgctgcttcg gctttcgtgg 5821 gcgccggcat tgccggtgcg gccgttggca gcataggtct cgggaaggta cttgtggaca 5881 ttctggcggg ctatggggcg ggggtggctg gcgcactcgt ggcctttaag gtcatgagcg 5941 gcgagatgcc ctccactgag gatctggtta atttactccc tgccatcctt tctcctggcg 6001 ccctggttgt cggggtcgtg tgcgcagcaa tactgcgtcg gcacgtgggc ccgggagagg 6061 gggctgtgca gtggatgaac cggctgatag cgttcgcttc gcggggtaac cacgtctccc 6121 ccacgcacta tgtgcccgag agcgacgccg cggcgcgtgt tactcagatc ctctccagcc 6181 ttaccatcac tcagttgctg aagaggcttc atcagtggat taatgaggac tgctccacgc 6241 cttgttccgg ctcgtggcta aaggatgttt gggactggat atgcacggtg ttgagtgact 6301 tcaagacttg gctccagtcc aagctcctgc cgcggttacc gggactccct ttcctgtcat 6361 gccaacgcgg gtacaaggga gtctggcggg gggatggcat catgcaaacc acctgcccat 6421 gtggagcaca gatcaccgga catgtcaaaa atggctccat gaggattgtt gggccaaaaa 6481 cctgcagcaa cacgtggcat ggaacattcc ccatcaacgc atacaccacg ggcccctgca 6541 cgccctcccc agcgccgaac tattccaggg cgctgtggcg ggtggctgct gaggagtacg 6601 tggaggttac gcgggtgggg gatttccact acgtgacggg catgaccact gacaacgtga 6661 aatgcccatg ccaggttcca gcccctgaat ttttcacgga ggtggatgga gtacggttgc 6721 acaggtatgc tccagtgtgc aaacctctcc tacgagagga ggtcgtattc caggtcgggc 6781 tcaaccagta cctggtcggg tcacagctcc catgtgagcc cgaaccggat gtggcagtgc 6841 tcacttccat gctcaccgac ccctctcata ttacagcaga gacggccaag cgtaggctgg 6901 ccagggggtc tcccccctcc ttggccagct cttcagctag ccagttgtct gcgccttctt 6961 tgaaggcgac atgtactacc catcatgact ccccggacgc tgacctcatc gaggccaacc 7021 tcctgtggcg gcaggagatg ggcgggaaca tcacccgtgt ggagtcagaa aataaggtgg 7081 taatcctgga ctctttcgat ccgattcggg cggtggagga tgagagggaa atatccgtcc 7141 cggcggagat cctgcgaaaa cccaggaagt tccccccagc gttgcccata tgggcacgcc 7201 cggattacaa ccctccactg ctagagtcct ggaaggaccc ggactacgtc cccccggtgg 7261 tacacgggtg ccctttgcca tctaccaagg cccccccaat accacctcca cggaggaaga 7321 ggacggttgt cctgacagag tccaccgtgt cttctgcctt ggcggagctc gctactaaga 7381 cctttggcag ctccgggtcg tcggccgttg acagcggcac ggcgactggc cctcccgatc 7441 aggcctccga cgacggcgac aaaggatccg acgttgagtc gtactcctcc atgccccccc 7501 tcgagggaga gccaggggac cccgacctca gcgacgggtc ttggtctacc gtgagcgggg 7561 aagctggtga ggacgtcgtc tgctgctcaa tgtcctatac atggacaggt gccttgatca 7621 cgccatgcgc tgcggaggag agcaagttgc ccatcaatcc gttgagcaac tctttgctgc 7681 gtcaccacag tatggtctac tccacaacat ctcgcagcgc aagtctgcgg cagaagaagg 7741 tcacctttga cagactgcaa gtcctggacg accactaccg ggacgtgctc aaggagatga 7801 aggcgaaggc gtccacagtt aaggctaggc ttctatctat agaggaggcc tgcaaactga 7861 cgcccccaca ttcggccaaa tccaaatttg gctacggggc gaaggacgtc cggagcctat 7921 ccagcagggc cgtcaaccac atccgctccg tgtgggagga cttgctggaa gacactgaaa 7981 caccaattga taccaccatc atggcaaaaa atgaggtttt ctgcgtccaa ccagagaaag 8041 gaggccgcaa gccagctcgc cttatcgtat tcccagacct gggggtacgt gtatgcgaga 8101 agatggccct ttacgacgtg gtctccaccc ttcctcaggc cgtgatgggc ccctcatacg 8161 gattccagta ctctcctggg cagcgggtcg agttcctggt gaatacctgg aaatcaaaga 8221 aatgccctat gggcttctca tatgacaccc gctgctttga ctcaacggtc actgagaatg 8281 acatccgtac tgaggaatca atttaccaat gttgtgactt ggcccccgaa gccaggcagg 8341 ccataaggtc gctcacagag cggctttatg tcgggggtcc cctgactaat tcgaaggggc 8401 agaactgcgg ttatcgccgg tgccgcgcaa gtggcgtgct gacgactagc tgcggcaaca 8461 ccctcacatg ttacttgaag gccactgcgg cctgtcgagc tgcaaagctc caggactgca 8521 cgatgctcgt gaacggagac gaccttgtcg ttatctgtga gagtgcggga acccaggagg 8581 atgcggcggc cctacgagcc ttcacggagg ctatgactag gtattccgcc ccccccgggg 8641 acccgcccca accagaatac gacttggagc tgataacgtc atgctcctcc aatgtgtcgg 8701 tcgcgcacga tgcatccggc aaaagggtgt actacctcac ccgtgacccc accacccccc 8761 tcgcacgggc tgcgtgggag acagttagac acactccagt caactcctgg ctaggcaata 8821 tcatcatgta tgcgcccacc ctatgggcga ggatgattct gatgactcat ttcttctcta 8881 tccttctagc tcaggagcaa cttgaaaaag ccctggattg tcagatctac ggggcctgtt 8941 actccattga gccacttgac ctacctcaga tcattgaacg actccatggt cttagcgcat 9001 tttcactcca cagttactct ccaggtgaga tcaatagggt ggcttcatgc ctcaggaaac 9061 ttggggtacc gcctttgcga gtctggagac atcgggccag aagtgtccgc gctaagctac 9121 tgtcccaggg ggggagggct gccacttgcg gcaagtacct cttcaactgg gcagtaaaga 9181 ccaagcttaa actcactcca atcccggctg cgtcccagct agacttgtcc ggctggttcg 9241 ttgctggtta caacggggga gacatatatc acagcctgtc tcgtgcccga ccccgttggt 9301 tcatgttgtg cctactccta ctttctgtag gggtaggcat ctacctgctc cccaaccggt 9361 gaacggggag ctaaccactc caggccaata ggccattccc tttttttttt ttc - General Target Region:
- 5′ Untranslated Region—nts 1-328 - Internal Ribosome Entry Site (IRES):
5′UUGGGGGCGACACUCCACCAUAGAUCACUCCCCUGUGAGGAACUACUGUCU (SEQ ID NO: 18) UCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGUGUUGUGCAGCCUC CAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUAC ACCGGAAUUGCCAGGACGACCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGC CUGGAGAUUUGGGCGUGCCCCCGCGAGACUGCUAGCCGAGUAGUGUUGGGU CGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGG AGGUCUCGUAGACCGUGCAU3′ - Initial Specific Target Motifs:
- (1) Subdomain IIIc within HCV IRES—nts 213-226
5′AUUUGGGCGUGCCC3′ (SEQ ID NO: 19) - (2) Subdomain IIId within HCV IRES—nts 241-267
5′GCCGAGUAGUGUUGGGUCGCGAAAGGC3′ (SEQ ID NO: 20) - GenBank Accession #s
- X15624 Homo sapiens RNaseP H1 RNA:
1 atgggcggag ggaagctcat cagtggggcc acgagctgag tgcgtcctgt cactccactc (SEQ ID NO: 21) 61 ccatgtccct tgggaaggtc tgagactagg gccagaggcg gccctaacag ggctctccct 121 gagcttcagg gaggtgagtt cccagagaac ggggctccgc gcgaggtcag actgggcagg 181 agatgccgtg gaccccgccc ttcggggagg ggcccggcgg atgcctcctt tgccggagct 241 tggaacagac tcacggccag cgaagtgagt tcaatggctg aggtgaggta ccccgcaggg 301 gacctcataa cccaattcag accactctcc tccgcccatt - U64885Staphylococcus aureus RNaseP (rrnB) RNA:
1 gaggaaagtc cgggctcaca cagtctgaga tgattgtagt gttcgtgctt gatgaaacaa (SEQ ID NO: 22) 61 taaatcaagg cattaatttg acggcaatga aatatcctaa gtctttcgat atggatagag 121 taatttgaaa gtgccacagt gacgtagctt ttatagaaat ataaaaggtg gaacgcggta 181 aacccctcga gtgagcaatc caaatttggt aggagcactt gtttaacgga attcaacgta 241 taaacgagac acacttcgcg aaatgaagtg gtgtagacag atggttatca cctgagtacc 301 agtgtgacta gtgcacgtga tgagtacgat ggaacagaac gcggcttat - M17569Escherichia coli RNA component (M1 RNA) of ribonuclease P (mpB) gene:
1 gaagctgacc agacagtcgc cgcttcgtcg tcgtcctctt cgggggagac gggcggaggg (SEQ ID NO: 23) 61 gaggaaagtc cgggctccat agggcagggt gccaggtaac gcctgggggg gaaacccacg 121 accagtgcaa cagagagcaa accgccgatg gcccgcgcaa gcgggatcag gtaagggtga 181 aagggtgcgg taagagcgca ccgcgcggct ggtaacagtc cgtggcacgg taaactccac 241 ccggagcaag gccaaatagg ggttcataag gtacggcccg tactgaaccc gggtaggctg 301 cttgagccag tgagcgattg ctggcctaga tgaatgactg tccacgacag aacccggctt 361 atcggtcagt ttcacct - Z70692Mycobacterium tuberculosis RNaseP (mpB) RNA:
1 ccaccggtta cgatcttgcc gaccatggcc ccacaatagg gccggggaga cccggcgtca (SEQ ID NO: 24) 61 gtggtgggcg gcacggtcag taacgtctgc gcaacacggg gttgactgac gggcaatatc 121 ggctccatag cgtcggccgc ggatacagta aaggagcatt ctgtgacgga aaagacgccc 181 gacgacgtct tcaaacttgc caaggacgag aaggtcgaat atgtcgacgt ccggttctgt 241 gacctgcctg gcatcatgca gcacttcacg attccggctt cggcctttga caagagcgtg 301 tttgacgacg gcttggcctt tgacggctcg tcgattcgcg ggttccagtc gatccacgaa 361 tccgacatgt tgcttcttcc cgatcccgag acggcgcgca tcgacccgtt ccgcgcggcc 421 aagacgctga atatcaactt ctttgtgcac gacccgttca ccctggagcc gtactcccgc 481 gacccgcgca acatcgcccg caaggccgag aactacctga tcagcactgg catcgccgac 541 accgcatact tcggcgccga ggccgagttc tacattttcg attcggtgag cttcgactcg 601 cgcgccaacg gctccttcta cgaggtggac gccatctcgg ggtggtggaa caccggcgcg 661 gcgaccgagg ccgacggcag tcccaaccgg ggctacaagg tccgccacaa gggcgggtat 721 ttcccagtgg cccccaacga ccaatacgtc gacctgcgcg acaagatgct gaccaacctg 781 atcaactccg gcttcatcct ggagaagggc caccacgagg tgggcagcgg cggacaggcc 841 gagatcaact accagttcaa ttcgctgctg cacgccgccg acgacatgca gttgtacaag 901 tacatcatca agaacaccgc ctggcagaac ggcaaaacgg tcacgttcat gcccaagccg 961 ctgttcggcg acaacgggtc cggcatgcac tgtcatcagt cgctgtggaa ggacggggcc 1021 ccgctgatgt acgacgagac gggttatgcc ggtctgtcgg acacggcccg tcattacatc 1081 ggcggcctgt tacaccacgc gccgtcgctg ctggccttca ccaacccgac ggtgaactcc 1141 tacaagcggc tggttcccgg ttacgaggcc ccgatcaacc tggtctatag ccagcgcaac 1201 cggtcggcat gcgtgcgcat cccgatcacc ggcagcaacc cgaaggccaa gcggctggag 1261 ttccgaagcc ccgactcgtc gggcaacccg tatctggcgt tctcggccat gctgatggca 1321 ggcctggacg gtatcaagaa caagatcgag ccgcaggcgc ccgtcgacaa ggatctctac 1381 gagctgccgc cggaagaggc cgcgagtatc ccgcagactc cgacccagct gtcagatgtg 1441 atcgaccgtc tcgaggccga ccacgaatac ctcaccgaag gaggggtgtt cacaaacgac 1501 ctgatcgaga cgtggatcag tttcaagcgc gaaaacgaga tcgagccggt caacatccgg 1561 ccgcatccct acgaattcgc gctgtactac gacgtttaag gactcttcgc agtccgggtg 1621 tagagggagc ggcgtgtcgt tgccagggcg ggcgtcgagg tttttcgatg ggtgacggtg 1681 gccggcaacg gcgcgccgac caccgctgcg aagagcccgt ttaagaacgt tcaaggacgt 1741 ttcagccggg tgccacaacc cgcttggcaa tcatctcccg accgccgagc gggttgtctt 1801 tcacatgcgc cgaaactcaa gccacgtcgt cgcccaggcg tgtcgtcgcg gccggttcag 1861 gttaagtgtc ggggattcgt cgtgcgggcg ggcgtccacg ctgaccaacg gggcagtcaa 1921 ctcccgaaca ctttgcgcac taccgccttt gcccgccgcg tcacccgtag gtagttgtcc 1981 aggaattccc caccgtcgtc gtttcgccag ccggccgcga ccgcgaccgc attgagctgg 2041 cgcccgggtc ccggcagctg gtcggtgggc ttgccgcgca ccaacaccag cgcgttgcgg 2101 gcccgggtgg cggtcagcca ggcctgacgg agcagctcca cgtcggctgc gggaaccaga 2161 tcggcggccg cgatgacatc cagggattgc agcgtcgagg tgttgtgcag ggcgggaacc 2221 tggtgcgcat gctgtagctg cagcaactgc acggtccatt cgatgtcggc cagtccgccg 2281 cggcccagtt tggtgtgtgt gttggggtcg gcaccgcgcg gcaaccgctc ggactcgata 2341 cgggccttga tgcggcgaat ctcgcgcacc gagtcagcgg acacaccgtc gggcggatac 2401 cgcgttttgt cgaccatccg taggaatcgc tgacccaact cggcatcgcc ggcaaccgcg 2461 tgtgcgcgta gcagggcctg gatctcccat ggctgtgccc actgctcgta gtatgcggcg 2521 taggacccca gggtgcggac cagcggaccg ttgcggccct cgggtcgcaa attggcgtcg 2581 agctccagcg gcggatcgac gctgggtgtc cccagcagcg cccgaacccg ctcggcgatc 2641 gatgtcgacc atttcaccgc ccgtgcatcg tcgacgccgg tggccggctc acagacgaac 2701 atcacgtcgg catccgaccc gtagcccaac tcggcaccac ccagccgacc catgccgatg 2761 accgcgatgg ccgccggggc gcgatcgtcg tcgggaaggc tggcccggat catgacgtcc 2821 agcgcggcct gcagcaccgc cacccacacc gacgtcaacg cccggcacac ctcggtgacc 2881 tcgagcaggc cgagcaggtc cgccgaaccg atgcgggcca gctctcgacg acgcagcgtg 2941 cgcgcgccgg cgatggcccg ctccgggtcg gggtagcggc tcgccgaggc gatcagcgcc 3001 cgagccacgg cggcgggctc ggtctcgagc agcttcgggc ccgcaggccc gtcctcgtac 3061 tgctggatga cccgcggcgc gcgcatcaac agatccggca catacgccga ggtacccaag 3121 acatgcatga gccgcttggc caccgcgggc ttgtcccgca gcgtggccag gtaccagctt 3181 tcggtggcca gcgcctcact gagccgccgg taggccagca gtccgccgtc gggatcgggg 3241 gcatacgaca tccagtccag cagcctgggc agcagcaccg actgcacccg tccgcgccgg 3301 ccgctttgat tgaccaacgc cgacatgtgt ttcaacgcgg tctgcggtcc ctcgtagccc 3361 agcgcggcca gccggcgccc cgcggcctcc aacgtcatgc cgtgggcgat ctccaacccg 3421 gtcgggccga tcgattccag cagcggttga tagaagagtt tggtgtgtaa cttcgacacc 3481 cgcacgttct gcttcttgag ttcctcccgc agcaccccgg ccgcatcgtt tcggccatcg 3541 ggccggatgt gggccgcgcg cgccagccag cgcactgcct cctcgtcttc gggatcggga 3601 agcaggtggg tgcgcttgag ccgctgcaac tgcagtcggt gctcgagcag cctgaggaac 3661 tcatacgacg cggtcatgtt cgccgcgtcc tcacgcccga tgtagccgcc ttcgcccaac 3721 gccgccaatg cgtccaccgt ggacgccacc cgtaacgact cgtcgctacg ggcatgaacc 3781 agctgcagta gctgtacggc gaactccacg tcgcgcaatc cgccgctgcc gagtttgagc 3841 tcgcggccgc ggacatcggc gggcaccagc tgctccaccc gccgccgcat ggcctgcacc 3901 tcgaccacaa agtcttcgcg ctcgcaggct cgccacacca tcggcatcaa ggcggtcagg 3961 taacgctcgc caagttccgc gtcgccaacg actggccgtg ctttcagcaa cgcctgaaac 4021 tcccaggtct tggcccagcg ctggtagtag gcgatgtgcg actcgagcgt acggaccagc 4081 tccccgttgc gcccctccgg acgcagggcg gcgtccacct cgaaaaaggc cgccgaggcc 4141 acccgcatca tctcgctggc cacgcgcgcg ttgcgcgggt cggagcgctc ggcaacgaat 4201 atgacatcga cgtcgctgac gtagttcagt tcgcgcgcac cgcacttgcc catcgcgatg 4261 accgccaggc gcggtggcgg gtgctcgccg cacacgctcg cctcggccac gcgcagcgcc 4321 gccgccagag cggcgtccgc ggcgtccgcc aggcgtgcgg ccaccacggt gaatggcagc 4381 accggttcgt cctcgaccgt cgcggccagg tcgagagcgg ccagcattag cacgtagtcg 4441 cggtactggg ttcgcaatcg gtgcacgagc gagcccggca taccctccga ttcctcgacg 4501 cactcgacga acgaccgctg cagctggtca tgggacggca gtgtgacctt gccccgcagc 4561 aatttccagg actgcggatg ggcgaccagg tgatcgccca acgccagcga cgagcccagc 4621 accgagaaca gccgcccgcg cagactgcgt tcgcgcagca gagccgcgtt gagctcgtcc 4681 catccggtgt ctggattctc cgacagccgg atcaaggcgc gcagcgcggc atcggcgtcc 4741 ggagcgcgtg acagcgacca cagcaggtcg acgtgcgcct gatcctcgtg ccgatcccac 4801 cccagctgag ccagacgctc accagcaggg gggtcaacta atccgagccg gccaacgctg 4861 ggcaacttcg gccgctgcgt ggcgagtttg gtcacgacca cgacggtagc gcaaagcgcg 4921 tcggcgtcgg atcaaccggt agatctgggc tacagcgaca ggtaggtgcg cagctcgtat 4981 ggcgtgacgt ggctgcggta gttcgcccac tccgtgcgct tgttgcgcaa gaaaaagtca 5041 aaaacgtgct cccccaaggc ctccgcgacg agttcggagg cctccatggc gcgcagcgca 5101 ctatccaaac tggacggcaa ttctcggtac cccatcgctc ggcgttcctc gggtgtgagg 5161 tcccatacgt tgtcctcggc ctgcgggccc agcacgtaac ccttctctac accccgcaat 5221 cccgcggcca gcagcacggc gaatgtcaga tagggattgc acgccgaatc agggctgcgt 5281 acttcgaccc gccgcgacga ggtcttgtgc ggcgtgtaca tcggcacccg cactagggcg 5341 gatcggttgg cggcccccca cgacgcggcc gtgggcgctt cgccgccctg caccagccgc 5401 ttgtaagagt tgacccactg atttgtgacc gcgctgatct cgcaagcgtg ctccaggatc 5461 ccggcgatga acgatttacc cacttccgac agctgcagcg gatcatcagc gctgtggaac 5521 gcgttgacat caccctcgaa caggctcatg tgggtgtgca tcgccgagcc cgggtgctgg 5581 ccgaatggct tgggcatgaa cgacgcccgg gcgccctctt ccagcgcgac ttctttgatg 5641 acgtagcgga aggtcatcac gttgtcagcc atcgacagag cgtcggcaaa ccgcaggtcg 5701 atctcctgct ggccgggtgc gccttcgtga tggctgaact ccaccgagat gcccatgaat 5761 tccagggcat cgatcgcgtg gcggcgaaag ttcaaggcgg agtcgtgcac cgcttggtcg 5821 aaatagccgg cgttgtcgac cgggacgggc accgacccgt cctcgggtcc gggcttgagc 5881 aggaagaact cgatttcggg atgcacgtag caggagaagc cgagttcgcc ggccttcgtc 5941 agctgccgcc gcaacacgtg ccgcgggtcc gcccacgacg gcgagccgtc cggcatggtg 6001 atgtcgcaaa acatccgcgc tgagtggtgg tggccggaac tggtggccca gggcagcacc 6061 tggaaggtcg acgggtccgg gtgcgccacc gtatcggatt ccgagacccg cgcaaagccc 6121 tcgatcgagg atccgtcgaa gccgatgcct tcctcgaagg cgccctcgag ttcggctggg 6181 gcgatggcga ccgacttgag gaaaccgagc acgtctgtga accacagccg gacgaagcgg 6241 atgtcgcgtt cttccagggt acgaagaacg aattccttct gtcggtccat acctcgaaca 6301 gtatgcactg tctgttaaaa ccgtgttacc gatgcccggc cagaagcgtt gcggggcggc 6361 ccgcaagggg agtgcgcggt gagttcaggg cgcgcaccgc agactcgtcg gcggcaaggt 6421 cccgtcgaga aaatagtgca tcaccgcaga gtccacacac tggttgccat cgaacaccgc 6481 agtgtgttgg gtgccgtcga aggtgatcag cggtgcgccc agctggcggg ccaggtctac 6541 cccggactga tacggagtgg ccgggtcgtg ggtggtggac accacgacga ccttgccagc 6601 cccggccggc gccgcggggt gcggcgtcga cgttgccggc accggccaca gcgcgcacag 6661 atcgcggggg gcggatccgg tgaactgccc gtagctaagg aacggggcga cctgacggat 6721 ccgttggtcg gcggccaccc aggccgctgg atcggccggt gtgggcgcat cgacgcaccg 6781 gaccgcgttg aacgcgtcct ggtcgttgct gtagtgcccg tctgcatccc ggccgtcata 6841 gtcgtcggca agcaccagca agtcgccggc gtcgctgccg cgctgcagcc ccagcagacc 6901 actggtcagg tacttccagc gctgagggct gtacagcgcg ttgatggtgc ccgtcgtcgc 6961 gtcggcgtag ctcaggccac gtggatccga cgtcttaccc ggcttctgca ccagcgggtc 7021 aaccagggcg tggtagcggt tgacccactg ggccgagtcg gtgcccagag ggcaggccgg 7081 cgagcgggcg cagtcggcgg cgtagtcatt gaaagcggtc tgaaatcccg ccatttggct 7141 gatgctttcc tcgattgggc taacggctgg atcgatagcg ccgtcgagga ccatcgcccg 7201 cacatgagta ccgaaccgtt ccaggtaagc ggtgcccaac tcggtgccgt agctgtatcc 7261 gaggtagttg atctgatcgt cacctaacgc ttggcgaacc atgtccatgt cccgtgcgac 7321 ggacgcggta ccgatattgg ccaagaagct gaagcccatc cggtcaacac agtcctgggc 7381 caactgccgg tagacctgtt cgacgtgggt gacaccggcc ggactgtagt cggccatcgg 7441 atcgcgccgg tacgcgtcga actcggcgtc ggtgcgacac cgcaacgcag gggtcgagtg 7501 gccgacccct ctcgggtcga agcccaccag gtcgaagtgg cggagaatgt cggtgtcggc 7561 gatcgcgggt gccatagcgg cgaccatgtc gaccgccgac gccccgggtc ccccaggatt 7621 gaccagcagt gctccgaatc gctgtcccgt cgcggggacg cggatcaccg ccaacttcgc 7681 ttgtgtccca ccgggttggt cgtagtcgac ggggacggac accgtcgcgc agcgtgcagt 7741 gcgaatttcg ctggtgtcgg cgatgaactc gcggcagctg ttccaactct gttgcggcgc 7801 cacgaccggc gcacccgggg tttggccggc gccgggttct tcagtcgcgc cggccaacgg 7861 gggcgctgct aggggcagtc cgccgagcag caacccgaag gacagcagcg ccgagctcaa 7921 cggtctgcgg cgccacatgg ccgccatcgt ctcaccggcg aatacctgtg acggcgcgaa 7981 atgatcacac cttcgtttct tcgccccgct agcacttggc gccgctgggc ggcgtggtgc 8041 cgccgattaa atacgccgtc acgtactcgt caatgcagct gtcgccctgg aataccaccg 8101 tgtgctgggt tccgtcgaag gtcagcaacg aaccgcgaag ctggttcgcc aggtcgaccc 8161 cggccttgta cggcgtcgcc gggtcatggg tggtggatac caccaccgtc ggcactaggc 8221 cgggcgccga gacggcatgg ggctgacttg tgggtggcac cggccagaac gcgcaggtgc 8281 ccagcggcgc atcaccggtg aacttcccgt agctcatgaa cggtgcgatc tcccgggcgc 8341 ggcggtcttc gtcgatgacc ttgtcgcgat cggtaaccgg gggctgatcg acgcaattga 8401 tcgccacccg cgcgtcaccg gaattgttgt agcggccgtg cgagtcccga cgcatgtaca 8461 tgtcggccag agccagcagg gtgtctccgc gattgtcgac cagctccgac agcccgtcgg 8521 tcaagtgttg ccacagattc ggtgagtaca gcgccataat ggtgcccacg atggcgtcgc 8581 tataactcag cccgcgcgga tccttcgtgc gcgccggcct gctgatcctc gggttgtccg 8641 ggtcgaccaa cggatcgacc aggctgtggt agacctcgac ggctttggcc gggtcggcgc 8701 ccagcgggca gcccgcgttc ttggcgcagt cggcggcata gttgttgaac gcgtcctgga 8761 agcccttggc ctggcgcagc tccgcctcga tgggatcggc attggggtcg acggcaccgt 8821 cgagaatcat tgcccgcacc cgctgcggaa attcctcggc atacgcggag ccgatccggg 8881 tgccgtacga gtagcccagg taggtcagct tgtcgtcgcc caacgccgcg cgaatggcat 8941 ccaggtcctt ggcgacgttg accgtcccga catgggccag aaagttcttg cccatcttgt 9001 ccacacagcg accgacgaat tgcttggtct cgttctcgat gtgcgccaca ccctcccggc 9061 tgtagtcaac ctgcggctcg gcccgcagcc ggtcgttgtc ggcatcggag ttgcaccaga 9121 tcgccggccg ggacgacgcc accccgcggg ggtcgaaccc aaccaggtcg aacctttcgt 9181 gcacccgctt cggcaatgtc tggaagacgc ccaaggcggc ctcgataccg gattcgccgg 9241 gtccaccggg atttatgacc agcgaaccga tcttgtctcc cgtcgccgga aagcgaatca 9301 gcgccagcgc cgccacgtca ccatcggggc ggtcgtagtc gaccggtaca gcgagcttgc 9361 cgcataacgc gccgccgggg atctttactt gcgggtttga cgaccggcac ggtgtccact 9421 ccaccggctg gcccagcttc ggctccgcca tacgagcgcg tcccccgacc acgcggatgc 9481 agcccacaag aaccaacgcc acggcggcga gcgcggccca gatcaacagc atgcgcgcga 9541 tcttgtcgcg gcgagacagc ctcatgccca caatgctgcc agagcagacc cgagatcctg 9601 gccagcggcc accgtcggcc gactaaccgg ccgctgccag cagtcctgcc atcgccgatg 9661 gcgaactcgt cggccatccc ccatacgtcc ggtaacagat ccgggcaaga caccgacccg 9721 tcgaccggat ccggcacggg cgcgtcggcc tcggcggtgc acaactgcga catcaggttg 9781 gcgctggcac cccgtccacg ccggcatggt gcaccttggc catcgcccga gggcgatccc 9841 cgatgccgtc caccccttcg acgaacccat ctcccacggc ggtcgccggc agcgacgcga 9901 tgtggccgca gatctccgag agttcggccc gcccgcccgg cgacggcaac ccgatgccgt 9961 gcaagtgacg atcgatgtga ggttcaaggt tcagcgcact gctggcaagc tttttccgaa 10021 accgcggcct cgccttgatc tggagtcaga acgcgtcacg cagccggtca aaggcgtaac 10031 ccatgctcga gcaaacatgc atgggctgag tggacgtttc cagacacagc aactggcgtc 10141 caggccactg agccgctgca tgcgcgatgg tatgccgatg ggggccccgg gcgcgtctga 10201 ggggaagaag tggcagactg tcagggtccg acgaacccgg ggaccctaac gggccacgag 10261 gatcgacccg accaccatta gggacagtga tgtctgagca gactatctat ggggccaata 10321 cccccggagg ctccgggccg cggaccaaga tccgcaccca ccacctacag agatggaagg 10381 ccgacggcca caagtgggcc atgctgacgg cctacgacta ttcgacggcc cggatcttcg 10441 acgaggccgg catcccggtg ctgctggtcg gtgattcggc ggccaacgtc gtgtacggct 10501 acgacaccac cgtgccgatc tccatcgacg agctgatccc gctggtccgt ggcgtggtgc 10561 ggggtgcccc gcacgcactg gtcgtcgccg acctgccgtt cggcagctac gaggcggggc 10621 ccaccgccgc gttggccgcc gccacccggt tcctcaagga cggcggcgca catgcggtca 10681 agctcgaggg cggtgagcgg gtggccgagc aaatcgcctg tctgaccgcg gcgggcatcc 10741 cggtgatggc acacatcggc ttcaccccgc aaagcgtcaa caccttgggc ggcttccggg 10801 tgcagggccg cggcgacgcc gccgaacaaa ccatcgccga cgcgatcgcc gtcgccgaag 10861 ccggagcgtt tgccgtcgtg atggagatgg tgcccgccga gttggccacc cagatcaccg 10921 gcaagcttac cattccgacg gtcgggatcg gcgctgggcc caactgcgac ggccaggtcc 10981 tggtatggca ggacatggcc gggttcagcg gcgccaagac cgcccgcttc gtcaaacggt 11041 atgccgatgt cggtggtgaa ctacgccgtg ctgcaatgca atacgcccaa gaggtggccg 11101 gcggggtatt ccccgctgac gaacacagtt tctgaccaag ccgaatcagc ccgatgcgcg 11161 ggcattgcgg tggcgccctg gatgccgtcg acgccggatt gccggcgcgg acgcgccagc 11221 gggacccatc ggcgtcgcgt tcgccggttg agcccggggt gagcccagac attcgatgtg 11281 cccaacacca tccgccacag cccaattgat gtggcactct atgcatgcct atccccgacc 11341 aaccaccacc gcggcgacgc atcatgaccg gaggcgaaga tgccagtaga ggcgcccaga 11401 ccagcgcgcc atctggaggt cgagcgcaag ttcgacgtga tcgagtcgac ggtgtcgccg 11461 tcgttcgagg gcatcgccgc ggtggttcgc gtcgagcagt cgccgaccca gcagctcgac 11521 gcggtgtact tcgacacacc gtcgcacgac ctggcgcgca accagatcac cttgcggcgc 11581 cgcaccggcg gcgccgacgc cggctggcat ctgaagctgc cggccggacc cgacaagcgc 11641 accgagatgc gagcaccgct gtccgcatca ggcgacgctg tgccggccga gttgttggat 11701 gtggtgctgg cgatcgtccg cgaccagccg gttcagccgg tcgcgcggat cagcactcac 11761 cgcgaaagcc agatcctgta cggcgccggg ggcgacgcgc tggcggaatt ctgcaacgac 11821 gacgtcaccg catggtcggc cggggcattc cacgccgctg gtgcagcgga caacggccct 11881 gccgaacagc agtggcgcga atgggaactg gaactggtca ccacggatgg gaccgccgat 11941 accaagctac tggaccggct agccaaccgg ctgctcgatg ccggtgccgc acctgccggc 12001 cacggctcca aactggcgcg ggtgctcggt gcgacctctc ccggtgagct gcccaacggc 12061 ccgcagccgc cggcggatcc agtacaccgc gcggtgtccg agcaagtcga gcagctgctg 12121 ctgtgggatc gggccgtgcg ggccgacgcc tatgacgccg tgcaccagat gcgagtgacg 12181 acccgcaaga tccgcagctt gctgacggat tcccaggagt cgtttggcct gaaggaaagt 12241 gcgtgggtca tcgatgaact gcgtgagctg gccgatgtcc tgggcgtagc ccgggacgcc 12301 gaggtactcg gtgaccgcta ccagcgcgaa ctggacgcgc tggcgccgga gctggtacgc 12361 ggccgggtgc gcgagcgcct ggtagacggg gcgcggcggc gataccagac cgggctgcgg 12421 cgatcactga tcgcattgcg gtcgcagcgg tacttccgtc tgctcgacgc tctagacgcg 12481 cttgtgtccg aacgcgccca tgccacttct ggggaggaat cggcaccggt aaccatcgat 12541 gcggcctacc ggcgagtccg caaagccgca aaagccgcaa agaccgccgg cgaccaggcg 12601 ggcgaccacc accgcgacga ggcattgcac ctgatccgca agcgcgcgaa gcgattacgc 12661 tacaccgcgg cggctactgg ggcggacaat gtgtcacaag aagccaaggt catccagacg 12721 ttgctaggcg atcatcaaga cagcgtggtc agccgggaac atctgatcca gcaggccata 12781 gccgcgaaca ccgccggcga ggacaccttc acctacggtc tgctctacca acaggaagcc 12841 gacttggccg agcgctgccg ggagcagctt gaagccgcgc tgcgcaaact cgacaaggcg 12901 gtccgcaaag cacgggattg agcccgccag gggcggacga gttggcctgt aagccggatt 12961 ctgttccgcg ccgccacagc caagctaacg gcggcacggc ggcgaccatc catctggaca 13021 caccgttacc gggtgcctcg agcggcctac ccgcaggctc gggcgagcaa ccctcaagcg 13081 cctgcgcggc cgcactttcg gtgcggcctt cttggccttg cttcgggtgg ggtttgccta 13141 gccaccccgg tcacccggaa tgctggtgcg ctcttaccgc accgtttcac ccttgccacc 13201 acgaggatgg cggtctgttt tctgtggcac tttcccgcga gtcacctcgg attgccgtta 13261 gcaatcaccc tgctctgtga agtccggact ttcctcgact cgacgctgaa cctcgtgaat 13321 ccacacaagc cctacgcgag ccgcggccgc ccagccaact catccgcgac gaccacgcta 13381 ccccgctggg cggtgtcgcg gccagtgtga ccgctggacg acacggctag tcggacagcc 13441 gatccggcgg gcagtcctta tcgtggactg gtgacacggt gggacaaacg cgtcgactcc 13501 ggcgactggg acgccatcgc tgccgaggtc agcgagtacg gtggcgcact gctacctcgg 13561 ctgatcaccc ccggcgaggc cgcccggctg cgcaagctgt acgccgacga cggcctgttt 13621 cgctcgacgg tcgatatggc atccaagcgg tacggcgccg ggcagtatcg atatttccat 13681 gccccctatc ccgagtgatc gagcgtctca agcaggcgct gtatcccaaa ctgctgccga 13741 tagcgcgcaa ctggtgggcc aaactgggcc gggaggcgcc ctggccagac agccttgatg 13801 actggttggc gagctgtcat gccgccggcc aaacccgatc cacagcgctg atgttgaagt 13861 acggcaccaa cgactggaac gccctacacc aggatctcta cggcgagttg gtgtttccgc 13921 tgcaggtggt gatcaacctg agcgatccgg aaaccgacta caccggcggc gagttcctgc 13981 ttgtcgaaca gcggcctcgc gcccaatccc ggggtaccgc aatgcaactt ccgcagggac 14041 atggttatgt gttcacgacc cgtgatcggc cggtgcggac tagccgtggc tggtcggcat 14101 ctccagtgcg ccatgggctt tcgactattc gttccggcga acgctatgcc atggggctga 14161 tctttcacga cgcagcctga ttgcacgcca tctatagata gcctgtctga ttcaccaatc 14221 gcaccgacga tgccccatcg gcgtagaact cggcgatgct cagcgatgcc agatcaagat 14281 gcaaccgata taggacgccc gacccggcat ccaacgccag ccgcaacaac attttgatcg 14341 gcgtgacatg tgacaccacc agcaccgtcg cgccttcgta gccaacgatg atccgatcac 14401 gtccccgccg aacccgccgc agcacgtcgt cgaagctttc cccacccggg ggcgtgatgc 14461 tggtgtcctg cagccagcga cggtgcagct cgggatcgcg ttctgcggcc tccgcgaacg 14521 tcagcccctc ccaggcgccg aagtcggtct cgaccaggtc gtcatcgacg accacgtcca 14581 gggccagggc tctggcggcg gtcaccgcgg tgtcgtaagc ccgctgtagc ggcgaggaga 14641 ccaccgcagc gatcccgccg cgccgcgcca gatacccggc cgccgcacca acctggcgcc 14701 accccacctc gttcaacccc gggttgccgc gccccgaata gcggcgttgc tccgacagct 14761 ccgtctgccc gtggcgcaac aaaagtagtc gggtgggtgt accgcgggcg ccggtccagc 14821 cgggagatgt cggtgactcg gtcgcaacga ttttggcagg atccgcatcc gccgcagccg 14881 attgcgcggc ggcgtccatc gcgtcattgg ccaaccggtc tgcatacgtg ttccgggcac 14941 gcggaaccca ctcgtagttg atcctgcgaa actgggacgc caacgcctga gcctggacat 15001 agagcttcag cagatccggg tgcttgacct tccaccgccc ggacatctgc tccaccacca 15061 gcttggagtc catcagcacc gcggcctcgg tggcacctag tttcacggcg tcgtccaaac 15121 cggctatcag gccgcggtat tcggcgacgt tgttcgtcgc ccggccgatc gcctgcttgg 15181 actcggccag cacggtggag tgatcggcgg tccacaccac cgcgccgtat ccggccggtc 15241 cgggattgcc ccgcgatccg ccgtcggctt cgatgacaac tttcactcct caaatccttc 15301 gagccgcaac aagatcgctc cgcattccgg gcagcgcacc acttcatcct cggcggccgc 15361 cgagatctgg gccagctcgc cgcggccgat ctcgatccgg caggcaccac atcgatgacc 15421 ttgcaaccgc ccggcccctg gcccgcctcc ggcccgctgt ctttcgtaga gccccgcaag 15481 ctcgggatca agtgtcgccg tcagcatgtc gcgttgcgat gaatgttggt gccgggcttg 15541 gtcgatttcg gcaagtgcct cgtccaaagc ctgctgggcg gcggccaggt cggcccgcaa 15601 cgcttggagc gcccgcgact cggcggtctg ttgagcctgc agctcctcgc ggcgttccag 15661 cacctccagc agggcatctt ccaaactggc ttgacggcgt tgcaagctgt cgagctcgtg 15721 ctgcagatca gccaattgct tggcgtccgt tgcacccgaa gtgagcaacg accggtcccg 15781 gtcgccacgc ttacgcaccg catcgatctc cgactcaaaa cgcgacacct ggccgtccaa 15841 gtcctccgcc gcgattcgca gggccgccat cctgtcgttg gcggcgttgt gctcggcctg 15901 cacctgctgg taagccgccc gctgcggcag atgggtagcc cgatgcgcga tccgggtcag 15961 ctcagcatcc agcttcgcca attccagtag cgaccgttgc tgtgccactc cggctttcat 16021 gcctgatctc tcccagtttc gtgatcgagg ttccacgggt cggtgcagat ggtgcacaca 16081 cgcaccggca gcgacgcgcc gaaatgagac cgcaacactt cggcggcctg gccgcaccac 16141 gggaattcgc ttgcccaatg cgcgacgtcg atcagggcca cttgcgaagc tcggcaatgc 16201 tcgtcggctg gatgatgtcg cagatcggcc gtaacgtacg cttgcacgtc cgcggcggcc 16261 acggtggcaa gcaacgagtc cccggcgccg ccgcagaccg cgacccgcga caccagcagg 16321 tcgggatccc cggcggcgcg cacaccggtc gcagtcggcg gcaacgcggc ctccagacgg 16381 gcaacaaagg tgcgcagcgg ttcgggtttt ggcagtctgc caatccggcc taacccgctg 16441 ccgaccggcg gtggtaccag cgcgaagatg tcgaatgccg gctcctcgta agggtgcgcg 16501 gcgcgcatcg ccgccaacac ctcggcgcgc gctcgtgcgg gtgcgacgac ctcgacccgg 16561 tcctcggcca cccgttcgac ggtaccgacg ctgcctatgg cgggcgacgc cccgtcgtgc 16621 gccaggaact gcccggtacc cgcgacactc cagctgcagt gcgagtagtc gccgatatgg 16681 ccggcaccgg cctcaaagac cgctgcccgc accgcctctg agttctcgcg cggcacatag 16741 atgacccact tgtcgagatc ggccgctccg ggcaccgggt cgagaacggc gtcgacggtc 16801 agaccaacag cgtgtgccag cgcgtcggac acacccggcg acgccgagtc ggcgttggtg 16861 tgcgcggtaa acaacgagcg accggtccgg atcaggcggt gcaccagcac accctttggc 16921 gtgttggccg cgaccgtatc gaccccacgc agtaacaacg ggtggtgcac caatagcagt 16981 ccggcctggg gaacctggtc caccaccgcc ggcgtcgcgt ccaccgcaac ggtcaccgaa 17041 tccaccacgt cgtcggggtc gccgcacacc agacccaccg aatcccacga ctgggcaagc 17101 cgcggcgggt aggcctggtc cagcacgtcg atgacatcgg ccagccgcac actcatcggc 17161 gtcctccacg ctttgcccac tcggcgatcg ccgccaccag cacgggccac tccgggcgca 17221 ccgccgcccg caggtaccgc gcgtccaggc cgacgaaggt gtcaccgcgg cgcaccgcaa 17281 ttcctttgct ctgcaaatag tttcgtaatc cgtcagcatc ggcgatgttg aacagtacga 17341 aaggggccgc accatcgacc acctcggcac ccaccgatct cagtccggcc accatctccg 17401 cgcgcagcgc cgtcaaccgc accgcatcgg ctgcggcagc ggcgaccgcc cggggggcgc 17461 agcaagcagc gatggccgtc agttgcaatg ttcccaacgg ccagtgcgct cgctgcacgg 17521 tcaaccgagc cagcacgtct ggcgagccga gcgcgtagcc cacccgcaat ccggccagcg 17581 accacgtttt cgtcaagcta cggagcacca gcacatcggg cagcgagtca tcggccaacg 17641 attgcggctc gccgggaacc caatcagcga acgcctcgtc gaccaccagg atgcgtcccg 17701 gccggcgtaa ctcgagcagc tgctcgcgga ggtgcagcac cgaggtgggg ttggtcggat 17761 tacccacgac gacaaggtcg gcgtcgtcag gcacgtgcgc ggtgtccagc acgaacggcg 17821 gctttaggac aacatggtgc gccgtgattc cggcagcgct caaggctatg gccggctcgg 17881 tgaacgcggg cacgacgatt gctgcccgca ccggacttag gttgtgcagc aatgcgaatc 17941 cctccgccgc cccgacgagc gggagcactt cgtcacgggt tctgccatga cgttcagcga 18001 ccgcgtcttg cgcccggtgc acatcgtcgg tgctcggata gcgggccagc tccggcagca 18061 gcgcggcgag ctgccggacc aaccattccg ggggccggtc atggcggacg ttgacggcga 18121 agtccagcac gccgggcgcg acatcctgat caccgtggta gcgcgccgcg gcaagcgggc 18181 tagtgtctag actcgccaca gcgtcaaaca gtagtgggcc ggtgtgcggg ccaagaatcc 18241 agagcaccgc cgacgcgttg tctacgcggc gacaaccgcg acatcacagg cagctaacag 18301 ggcgtcggcg gtgatgatcg tcaggccaag cagctgtgcc tgggcgatga gcacacggtc 18361 gaatggatgt cgatggtgat ccggaagctc tgcggtgcgc agtgtgtgcg tggtcaactg 18421 acagcggcga cgtgccgcag cggcgcattc gatcgggcac gtaagaagcc gatggctcgg 18481 gcggcgggag cttgccgagg cggtagttga tcgcgatctc ccaggcactg gcggccgaca 18541 agagaatgct gttgcggacg tcctgaacaa tcgcccgtgt ttcgttgacg gcatccgcag 18601 ccaaacgtgg gtgtcgatga ggtagcgctt caccggtgaa agcgttcgag cacgtcgtct 18661 gacaacggag cgtccaaatc gtcgggcacg cggtacacgc catggtcaat gcctaaccgc 18721 cgagtctcat gaggatgcag cggcacaagc tttgctaccg gctcgccgcg gcgggcaatc 18781 tcaacctctg cccgccgtag acgagccgca gcagctcgga caggcgtgtc ttcgcctcgt 18841 gaacgccgac ccgcttcgca ggcgcccaga ctttcgcgtc gaccacctgc tcaccaaact 18901 tcgcgatcat cgcctgatac cacagcgcca acgggtagcg gtttgtccaa ccgcttcgtc 18961 aacgacaatg ggatcgtgac cgacacgacc gcgagcggga ccaattgccc gcctcctcca 19021 cgcgccgccg cacggcgcgc atcgtcgccg ggtgaatcgc cgcagctggt gatcttcgat 19081 ctggacggca cgctgaccga ctcggcgcgc ggaatcgtat ccagcttccg acacgcgctc 19141 aaccacatcg gtgccccagt acccgaaggc gacctggcca ctcacatcgt cggcccgccc 19201 atgcatgaga cgctgcgcgc catggggctc ggcgaatccg ccgaggaggc gatcgtagcc 19261 taccgggccg actacagcgc ccgcggttgg gcgatgaaca gcttgttcga cgggatcggg 19321 ccgctgctgg ccgacctgcg caccgccggt gtccggctgg ccgtcgccac ctccaaggca 19381 gagccgaccg cacggcgaat cctgcgccac ttcggaattg agcagcactt cgaggtcatc 19441 gcgggcgcga gcaccgatgg ctcgcgaggc agcaaggtcg acgtgctggc ccacgcgctc 19501 gcgcagctgc ggccgctacc cgagcggttg gtgatggtcg gcgaccgcag ccacgacgtc 19561 gacggggcgg ccgcgcacgg catcgacacg gtggtggtcg gctggggcta cgggcgcgcc 19621 gactttatcg acaagacctc caccaccgtc gtgacgcatg ccgccacgat tgacgagctg 19681 agggaggcgc taggtgtctg atccgctgca cgtcacattc gtttgtacgg gcaacatctg 19741 ccggtcgcca atggccgaga agatgttcgc ccaacagctt cgccaccgtg gcctgggtga 19801 cgcggtgcga gtgaccagtg cgggcaccgg gaactggcat gtaggcagtt gcgccgacga 19861 gcgggcggcc ggggtgttgc gagcccacgg ctaccctacc gaccaccggg ccgcacaagt 19921 cggcaccgaa cacctggcgg cagacctgtt ggtggccttg gaccgcaacc acgctcggct 19981 gttgcggcag ctcggcgtcg aagccgcccg ggtacggatg ctgcggtcat tcgacccacg 20041 ctcgggaacc catgcgctcg atgtcgagga tccctactat ggcgatcact ccgacttcga 20101 ggaggtcttc gccgtcatcg aatccgccct gcccggcctg cacgactggg tcgacgaacg 20161 tctcgcgcgg aacggaccga gttgatgccc cgcctagcgt tcctgctgcg gcccggctgg 20221 ctggcgttgg ccctggtcgt ggtcgcgttc acctacctgt gctttacggt gctcgcgccg 20281 tggcagctgg gcaagaatgc caaaacgtca cgagagaacc agcagatcag gtattccctc 20341 gacaccccgc cggttccgct gaaaaccctt ctaccacagc aggattcgtc ggcgccggac 20401 gcgcagtggc gccgggtgac ggcaaccgga cagtaccttc cggacgtgca ggtgctggcc 20461 cgactgcgcg tggtggaggg ggaccaggcg tttgaggtgt tggccccatt cgtggtcgac 20521 ggcggaccaa ccgtcctggt cgaccgtgga tacgtgcggc cccaggtggg ctcgcacgta 20581 ccaccgatcc cccgcctgcc ggtgcagacg gtgaccatca ccgcgcggct gcgtgactcc 20641 gaaccgagcg tggcgggcaa agacccattc gtcagagacg gcttccagca ggtgtattcg 20701 atcaataccg gacaggtcgc cgcgctgacc ggagtccagc tggctgggtc ctatctgcag 20761 ttgatcgaag accaacccgg cgggctcggc gtgctcggcg ttccgcatct agatcccggg 20821 ccgttcctgt cctatggcat ccaatggatc tcgttcggca ttctggcacc gatcggcttg 20881 ggctatttcg cctacgccga gatccgggcg cgccgccggg aaaaagcggg gtcgccacca 20941 ccggacaagc caatgacggt cgagcagaaa ctcgctgacc gctacggccg ccggcggtaa 21001 accaacatca cggccaatac cgcagccccc gcctggacca cccgcgacag caccacggcg 21061 cggcgcagat cggccacctt gggcgaccgg ccgtcgccca aggtgggccg gatctgcaac 21121 tcatggtggt accgggtggg cccacccagc cgcacgtcaa gcgccccagc aaacgccgcc 21181 tcgacgacac cggcgttggg gctgggatgg cgggcggcgt cgcgccgcca ggcccgtacc 21241 gcaccgcggg gcgacccacc gaccaccggc gcgcagatca ccaccagcac cgccgtcgcc 21301 cgtgcgccaa catagttggc ccagtcatcc aatcgtgctg cagcccaacc gaatcggaga 21361 taacgcggcg agcggtagcc gatcatcgag tccagggtgt tgatggcacg atatcccagc 21421 accgcaggca cgccgctcga agccgcccac agcagcggca ccacctgggc gtcggcggtg 21481 ttttcggcca ccgactccag cgcggcacgc gtcaggcccg ggccgcccag ctgggccggg 21541 tcacgcccgc acagcgacgg cagcagccgt cgcgccgcct cgacatcgtc gcgctccaac 21601 aggtccgata tctggcggcc ggtgcgcgcc agcgaagttc cgcccagcgc tgcccaggtg 21661 gccgtcgcgg tggccgccac gggccaggac ctgccgggta gccgctgcag tgccgcgccg 21721 agcaagccca ccgcgccgac cagcaggccg acgtgtaccg caccggcgac ccggccgtca 21781 cggtaggtga tctgctccag cttggcggcc gcccgaccga acagggccac cggatgacct 21841 cgtttggggt cgccgaacac gacgtcgagc aggcagccga tcagcacgcc gacggccctg 21901 gtctgccagg tcgatgcaaa cactccggca gcgtcgcaca cgtggtctac gctcagctat 21961 ttatgacctc atacggcagc tatccacgat gaagcggcca gctacccggg ttgccgacct 22021 gttgaacccg gcggcaatgt tgttgccggc agcgaatgtc atcatgcagc tggcagtgcc 22081 gggtgtcggg tatggcgtgc tggaaagccc ggtggacagc ggcaacgtct acaagcatcc 22141 gttcaagcgg gcccggacca ccggcaccta cctggcggtg gcgaccatcg ggacggaatc 22201 cgaccgagcg ctgatccggg gtgccgtgga cgtcgcgcac cggcaggttc ggtcgacggc 22261 ctcgagccca gtgtcctata acgccttcga cccgaagttg cagctgtggg tggcggcgtg 22321 tctgtaccgc tacttcgtgg accagcacga gtttctgtac ggcccactcg aagatgccac 22381 cgccgacgcc gtctaccaag acgccaaacg gttagggacc acgctgcagg tgccggaggg 22441 gatgtggccg ccggaccggg tcgcgttcga cgagtactgg aagcgctcgc ttgatgggct 22501 gcagatcgac gcgccggtgc gcgagcatct tcgcggggtg gcctcggtag cgtttctccc 22561 gtggccgttg cgcgcggtgg ccgggccgtt caacctgttt gcgacgacgg gattcttggc 22621 accggagttc cgcgcgatga tgcagctgga gtggtcacag gcccagcagc gtcgcttcga 22681 gtggttactt tccgtgctac ggttagccga ccggctgatt ccgcatcggg cctggatctt 22741 cgtttaccag ctttacttgt gggacatgcg gtttcgcgcc cgacacggcc gccgaatcgt 22801 ctgatagagc ccggccgagt gtgagcctga cagcccgaca ccggcggcgt gtgtcgcgtc 22861 gccaggttca cgctcggcga tctagagccg ccgaaaacct acttctgggt tgcctcccga 22921 atcaacgtgc tgatctgctc gagcagctca cgcatatcgg cgcgcatcgc atccaccgcg 22981 gcatacaggt cggccttggt cgccggcagc tggtccgacg tcattggccg caccggcggt 23041 gctgtctgtc gcgccgcgct gtcgctttga aacccaggtc gctcacccac gaccacgaca 23101 ctgccatatc cggcgccccg ccgacaacga agcacagcta gccggtgggc gcggacggga 23161 tcgaaccgcc gaccgctggt gtgtaaaacc agagctctac cgctgagcta cgcgcccatg 23221 accgccgcag gctacacgcc ttgcggccaa gcacccaaaa ccttaggccg taagcgccgc 23281 cagagcgtcg gtccacagcc gctgatcgcg aacttcaccc ggctgcttca tctcggcgaa 23341 ccgaatgatc cctgaccgat cgaccacaaa ggtgccccgg ttagcgatgc cggcctgctc 23401 gttgaagacg ccgtaggcct gactgaccgc gccgtgtggc cagaagtccg acaacagcgg 23461 aaacgtgaat ccgctctgcg tcgcccagat cttgtgagtg ggtggcgggc ccaccgaaat 23521 cgctagcgcg gcgctgtcgt cgttctcaaa ctcgggcagg tgatcacgca actggtccag 23581 ctcgccctgg cagatgcccg tgaacgccaa cggaaagaac accaacagca cgttctttgc 23641 accccggtag ccgcgcaggg tgacaagctg ctgattctgg tcgcgcaacg tgaagtcagg 23701 ggcggtggct ccgacgttca gcatcagcgc ttgccagccc gcgatttcgg ctgtaccaat 23761 ctgctggcgc tccagttgcc cagattgacc gacgaggtcg gcatcagccc agctgtgggc 23821 gccgcctcgg caatctcggc gggcaataca tggccgggct ggccggtctt gggcgtcacc 23881 acccaaatca caccgtcctc ggcgagcggg ccgatcgcat ccatcagggt gtccaccaaa 23941 tcgccgtcgc catcacgcca ccacaacagg acgacatcga tgacctcgtc ggtgtcttca 24001 tcgagcaact ctcccccgca cgcttcttcg atggccgcgc ggatgtcgtc gtcggtgtct 24061 tcgtcccagc cccattcctg gataagttgg tctcgttgga tgcccaattt gcgggcgtag 24121 ttcgaggcgt gatccgccgc gaccaccgtg gaacctcctt cagtctccgc gggccatgtg 24181 cacaccgtcg cgatgggcat tatcgtcgca cagccagaac cggtccaccc gcccgcctca 24241 gaaggcggcc acgcacattg tcaatgcctt tgtcttggtg tcgttgagcc gatcaacccg 24301 ccggttgaat tccgctgtcg acgcgtgcgc accgatggca tttgccaccg cgcgggccgc 24361 gtcgacatat gcgttgagcg catcccccag ttgcgcggac agcgcggcgc tcagactgcc 24421 tgagaccgtc gaggcactgt tgttgagcgc gtcgatggcc ggaccttcgg tcggcccggt 24481 gttgcggccc tgattgaacg cggccacgta ggcgttcacc ttgtcgatgg cgtccttgct 24541 ggtggccgcc agcgcgtcac acgaggtgcg aatcgccttg gtcgtcagcg attgttggcg 24601 ctgcgactcc cggatgctcg acgtcgccgc cgaagccgac accgacgcgg acaccgacga 24661 gcggtaggcc ggtgcgacgt tggtgtcggg catggccgta ccgtcggtga cagtggtaca 24721 tccgacgatc cccatcagca gcagcgcgat gcagccgagc gccagggcgc ctcgcctggg 24781 gagctccccc ccgtgcctgc gaggcacggc gcgccatccg atgagcacgg catgtgaggt 24841 tacctggtcg cagcgcgacc gcgctggccg tggtgtgtcg cgcatccgca gaaccgagcg 24901 gagtgcggct atccgccgcc gacgccggtg cggcacgata gggggacgac catctaaaca 24961 gcacgcaagc ggaagcccgc cacctacagg agtagtgcgt tgaccaccga tttcgcccgc 25021 cacgatctgg cccaaaactc aaacagcgca agcgaacccg accgagttcg ggtgatccgc 25081 gagggtgtgg cgtcgtattt gcccgacatt gatcccgagg agacctcgga gtggctggag 25141 tcctttgaca cgctgctgca acgctgcggc ccgtcgcggg cccgctacct gatgttgcgg 25201 ctgctagagc gggccggcga gcagcgggtg gccatcccgg cattgacgtc taccgactat 25261 gtcaacacca tcccgaccga gctggagccg tggttccccg gcgacgaaga cgtcgaacgt 25321 cgttatcgag cgtggatcag atggaatgcg gccatcatgg tgcaccgtgc gcaacgaccg 25381 ggtgtgggcg tgggtggcca tatctcgacc tacgcgtcgt ccgcggcgct ctatgaggtc 25441 ggtttcaacc acttcttccg cggcaagtcg cacccgggcg gcggcgatca ggtgttcatc 25501 cagggccacg cttccccggg aatctacgcg cgcgccttcc tcgaagggcg gttgaccgcc 25561 gagcaactcg acggattccg ccaggaacac agccatgtcg gcggcgggtt gccgtcctat 25621 ccgcacccgc ggctcatgcc cgacttctgg gaattcccca ccgtgtcgat gggtttgggc 25681 ccgctcaacg ccatctacca ggcacggttc aaccactatc tgcatgaccg cggtatcaaa 25741 gacacctccg atcaacacgt gtggtgtttt ttgggcgacg gcgagatgga cgaacccgag 25801 agccgtgggc tggcccacgt cggcgcgctg gaaggcttgg acaacttgac cttcgtgatc 25861 aactgcaatc tgcagcgact cgacggcccg gtgcgcggca acggcaagat catccaggag 25921 ctggagtcgt tcttccgcgg tgccggctgg aacgtcatca aggtggtgtg gggccgcgaa 25981 tgggatgccc tgctgcacgc cgaccgcgac ggtgcgctgg tgaatttaat gaatacaaca 26041 cccgatggcg attaccagac ctataaggcc aacgacggcg gctacgtgcg tgaccacttc 26101 ttcggccgcg acccacgcac caaggcgctg gtggagaaca tgagcgacca ggatatctgg 26161 aacctcaaac ggggcggcca cgattaccgc aaggtttacg ccgcctaccg cgccgccgtc 26221 gaccacaagg gacagccgac ggtgatcctg gccaagacca tcaaaggcta cgcgctgggc 26281 aagcatttcg aaggacgcaa tgccacccac cagatgaaaa aactgaccct ggaagacctt 26341 aaggagtttc gtgacacgca gcggattccg gtcagcgacg cccagcttga agagaatccg 26401 tacctgccgc cctactacca ccccggcctc aacgccccgg agattcgtta catgctcgac 26461 cggcgccggg ccctcggggg ctttgttccc gagcgcagga ccaagtccaa agcgctgacc 26521 ctgccgggtc gcgacatcta cgcgccgctg aaaaagggct ctgggcacca ggaggtggcc 26581 accaccatgg cgacggtgcg cacgttcaaa gaagtgttgc gcgacaagca gatcgggccg 26641 aggatagtcc cgatcattcc cgacgaggcc cgcaccttcg ggatggactc ctggttcccg 26701 tcgctaaaga tctataaccg caatggccag ctgtataccg cggttgacgc cgacctgatg 26761 ctggcctaca aggagagcga agtcgggcag atcctgcacg agggcatcaa cgaagccggg 26821 tcggtgggct cgttcatcgc ggccggcacc tcgtatgcga cgcacaacga accgatgatc 26881 cccatttaca tcttctactc gatgttcggc ttccagcgca ccggcgatag cttctgggcc 26941 gcggccgacc agatggctcg agggttcgtg ctcggggcca ccgccgggcg caccaccctg 27001 accggtgagg gcctgcaaca cgccgacggt cactcgttgc tgctggccgc caccaacccg 27061 gcggtggttg cctacgaccc ggccttcgcc tacgaaatcg cctacatcgt ggaaagcgga 27121 ctggccagga tgtgcgggga gaacccggag aacatcttct tctacatcac cgtctacaac 27181 gagccgtacg tgcagccgcc ggagccggag aacttcgatc ccgagggcgt gctgcggggt 27241 atctaccgct atcacgcggc caccgagcaa cgcaccaaca aggcgcagat cctggcctcc 27301 ggggtagcga tgcccgcggc gctgcgggca gcacagatgc tggccgccga gtgggatgtc 27361 gccgccgacg tgtggtcggt gaccagttgg ggcgagctaa accgcgacgg ggtggccatc 27421 gagaccgaga agctccgcca ccccgatcgg ccggcgggcg tgccctacgt gacgagagcg 27481 ctggagaatg ctcggggccc ggtgatcgcg gtgtcggact ggatgcgcgc ggtccccgag 27541 cagatccgac cgtgggtgcc gggcacatac ctcacgttgg gcaccgacgg gttcggcttt 27601 tccgacactc ggcccgccgc tcgccgctac ttcaacaccg acgccgaatc ccaggtggtc 27661 gcggttttgg aggcgttggc gggcgacggc gagatcgacc catcggtgcc ggtcgcggcc 27721 gcccgccagt accggatcga cgacgtggcg gctgcgcccg agcagaccac ggatcccggt 27781 cccggggcct aacgccggcg agccgaccgc ctttggccga atcttccaga aatctggcgt 27841 agcttttagg agtgaacgac aatcagttgg ctccagttgc ccgcccgagg tcgccgctcg 27901 aactgctgga cactgtgccc gattcgctgc tgcggcggtt gaagcagtac tcgggccggc 27961 tggccaccga ggcagtttcg gccatgcaag aacggttgcc gttcttcgcc gacctagaag 28021 cgtcccagcg cgccagcgtg gcgctggtgg tgcagacggc cgtggtcaac ttcgtcgaat 28081 ggatgcacga cccgcacagt gacgtcggct ataccgcgca ggcattcgag ctggtgcccc 28141 aggatctgac gcgacggatc gcgctgcgcc agaccgtgga catggtgcgg gtcaccatgg 28201 agttcttcga agaagtcgtg cccctgctcg cccgttccga agagcagttg accgccctca 28261 cggtgggcat tttgaaatac agccgcgacc tggcattcac cgccgccacg gcctacgccg 28321 atgcggccga ggcacgaggc acctgggaca gccggatgga ggccagcgtg gtggacgcgg 28381 tggtacgcgg cgacaccggt cccgagctgc tgtcccgggc ggccgcgctg aattgggaca 28441 ccaccgcgcc ggcgaccgta ctggtgggaa ctccggcgcc cggtccaaat ggctccaaca 28501 gcgacggcga cagcgagcgg gccagccagg atgtccgcga caccgcggct cgccacggcc 28561 gcgctgcgct gaccgacgtg cacggcacct ggctggtggc gatcgtctcc ggccagctgt 28621 cgccaaccga gaagttcctc aaagacctgc tggcagcatt cgccgacgcc ccggtggtca 28681 tcggccccac ggcgcccatg ctgaccgcgg cgcaccgcag cgctagcgag gcgatctccg 28741 ggatgaacgc cgtcgccggc tggcgcggag cgccgcggcc cgtgctggct agggaacttt 28801 tgcccgaacg cgccctgatg ggcgacgcct cggcgatcgt ggccctgcat accgacgtga 28861 tgcggcccct agccgatgcc ggaccgacgc tcatcgagac gctagacgca tatctggatt 28921 gtggcggcgc gattgaagct tgtgccagaa agttgttcgt tcatccaaac acagtgcggt 28981 accggctcaa gcggatcacc gacttcaccg ggcgcgatcc cacccagcca cgcgatgcct 29041 atgtccttcg ggtggcggcc accgtgggtc aactcaacta tccgacgccg cactgaagca 29101 tcgacagcaa tgccgtgtca tagattccct cgccggtcag agggggtcca gcaggggccc 29161 cggaaagata ccaggggcgc cgtcggacgg aaagtgatcc agacaacagg tcgcgggacg 29221 atctcaaaaa catagcttac aggcccgttt tgttggttat atacaaaaac ctaagacgag 29281 gttcataatc tgttacaccg cgcaaaaccg tcttcacagt gttctcttag acacgtgatt 29341 gcgttgctcg cacccggaca gggttcgcaa accgagggaa tgttgtcgcc gtggcttcag 29401 ctgcccggcg cagcggacca gatcgcggcg tggtcgaaag ccgctgatct agatcttgcc 29461 cggctgggca ccaccgcctc gaccgaggag atcaccgaca ccgcggtcgc ccagccattg 29521 atcgtcgccg cgactctgct ggcccaccag gaactggcgc gccgatgcgt gctcgccggc 29581 aaggacgtca tcgtggccgg ccactccgtc ggcgaaatcg cggcctacgc aatcgccggt 29641 gtgatagccg ccgacgacgc cgtcgcgctg gccgccaccc gcggcgccga gatggccaag 29701 gcctgcgcca ccgagccgac cggcatgtct gcggtgctcg gcggcgacga gaccgaggtg 29761 ctgagtcgcc tcgagcagct cgacttggtc ccggcaaacc gcaacgccgc cggccagatc 29821 gtcgctgccg gccggctgac cgcgttggag aagctcgccg aagacccgcc ggccaaggcg 29881 cgggtgcgtg cactgggtgt cgccggagcg ttccacaccg agttcatggc gcccgcactt 29941 gacggctttg cggcggccgc ggccaacatc gcaaccgccg accccaccgc cacgctgctg 30001 tccaaccgcg acgggaagcc ggtgacatcc gcggccgcgg cgatggacac cctggtctcc 30061 cagctcaccc aaccggtgcg atgggacctg tgcaccgcga cgctgcgcga acacacagtc 30121 acggcgatcg tggagttccc ccccgcgggc acgcttagcg gtatcgccaa acgcgaactt 30181 cggggggttc cggcacgcgc cgtcaagtca cccgcagacc tggacgagct ggcaaaccta 30241 taaccgcgga ctcggccaga acaaccacat acccgtcagt tcgatttgta cacaacatat 30301 tacgaaggga agcatgctgt gcctgtcact caggaagaaa tcattgccgg tatcgccgag 30361 atcatcgaag aggtaaccgg tatcgagccg tccgagatca ccccggagaa gtcgttcgtc 30421 gacgacctgg acatcgactc gctgtcgatg gtcgagatcg ccgtgcagac cgaggacaag 30481 tacggcgtca agatccccga cgaggacctc gccggtctgc gtaccgtcgg tgacgttgtc 30541 gcctacatcc agaagctcga ggaagaaaac ccggaggcgg ctcaggcgtt gcgcgcgaag 30601 attgagtcgg agaaccccga tgccgttgcc aacgttcagg cgaggcttga ggccgagtcc 30661 aagtgagtca gccttccacc gctaatggcg gtttccccag cgttgtggtg accgccgtca 30721 cagcgacgac gtcgatctcg ccggacatcg agagcacgtg gaagggtctg ttggccggcg 30781 agagcggcat ccacgcactc gaagacgagt tcgtcaccaa gtgggatcta gcggtcaaga 30841 tcggcggtca cctcaaggat ccggtcgaca gccacatggg ccgactcgac atgcgacgca 30901 tgtcgtacgt ccagcggatg ggcaagttgc tgggcggaca gctatgggag tccgccggca 30961 gcccggaggt cgatccagac cggttcgccg ttgttgtcgg caccggtcta ggtggagccg 31021 agaggattgt cgagagctac gacctgatga atgcgggcgg cccccggaag gtgtccccgc 31081 tggccgttca gatgatcatg cccaacggtg ccgcggcggt gatcggtctg cagcttgggg 31141 cccgcgccgg ggtgatgacc ccggtgtcgg cctgttcgtc gggctcggaa gcgatcgccc 31201 acgcgtggcg tcagatcgtg atgggcgacg ccgacgtcgc cgtctgcggc ggtgtcgaag 31261 gacccatcga ggcgctgccc atcgcggcgt tctccatgat gcgggccatg tcgacccgca 31321 acgacgagcc tgagcgggcc tcccggccgt tcgacaagga ccgcgacggc tttgtgttcg 31381 gcgaggccgg tgcgctgatg ctcatcgaga cggaggagca cgccaaagcc cgtggcgcca 31441 agccgttggc ccgattgctg ggtgccggta tcacctcgga cgcctttcat atggtggcgc 31501 ccgcggccga tggtgttcgt gccggtaggg cgatgactcg ctcgctggag ctggccgggt 31561 tgtcgccggc ggacatcgac cacgtcaacg cgcacggcac ggcgacgcct atcggcgacg 31621 ccgcggaggc caacgccatc cgcgtcgccg gttgtgatca ggccgcggtg tacgcgccga 31681 agtctgcgct gggccactcg atcggcgcgg tcggtgcgct cgagtcggtg ctcacggtgc 31741 tgacgctgcg cgacggcgtc atcccgccga ccctgaacta cgagacaccc gatcccgaga 31801 tcgaccttga cgtcgtcgcc ggcgaaccgc gctatggcga ttaccgctac gcagtcaaca 31861 actcgttcgg gttcggcggc cacaatgtgg cgcttgcctt cgggcgttac tgaagcacga 31921 catcgcgggt cgcgaggccc gaggtggggg tccccccgct tgcgggggcg agtcggaccg 31981 atatggaagg aacgttcgca agaccaatga cggagctggt taccgggaaa gcctttccct 32041 acgtagtcgt caccggcatc gccatgacga ccgcgctcgc gaccgacgcg gagactacgt 32101 ggaagttgtt gctggaccgc caaagcggga tccgtacgct cgatgaccca ttcgtcgagg 32161 agttcgacct gccagttcgc atcggcggac atctgcttga ggaattcgac caccagctga 32221 cgcggatcga actgcgccgg atgggatacc tgcagcggat gtccaccgtg ctgagccggc 32281 gcctgtggga aaatgccggc tcacccgagg tggacaccaa tcgattgatg gtgtccatcg 32341 gcaccggcct gggttcggcc gaggaactgg tcttcagtta cgacgatatg cgcgctcgcg 32401 gaatgaaggc ggtctcgccg ctgaccgtgc agaagtacat gcccaacggg gccgccgcgg 32461 cggtcgggtt ggaacggcac gccaaggccg gggtgatgac gccggtatcg gcgtgcgcat 32521 ccggcgccga ggccatcgcc cgtgcgtggc agcagattgt gctgggagag gccgatgccg 32581 ccatctgcgg cggcgtggag accaggatcg aagcggtgcc catcgccggg ttcgctcaga 32641 tgcgcatcgt gatgtccacc aacaacgacg accccgccgg tgcatgccgc ccattcgaca 32701 gggaccgcga cggctttgtg ttcggcgagg gcggcgccct tctgttgatc gagaccgagg 32761 agcacgccaa ggcacgtggc gccaacatcc tggcccggat catgggcgcc agcatcacct 32821 ccgatggctt ccacatggtg gccccggacc ccaacgggga acgcgccggg catgcgatta 32881 cgcgggcgat tcagctggcg ggcctcgccc ccggcgacat cgaccacgtc aatgcgcacg 32941 ccaccggcac ccaggtcggc gacctggccg aaggcagggc catcaacaac gccttgggcg 33001 gcaaccgacc ggcggtgtac gcccccaagt ctgccctcgg ccactcggtg ggcgcggtcg 33061 gcgcggtcga atcgatcttg acggtgctcg cgttgcgcga tcaggtgatc ccgccgacac 33121 tgaatctggt aaacctcgat cccgagatcg atttggacgt ggtggcgggt gaaccgcgac 33181 cgggcaatta ccggtatgcg atcaataact cgttcggatt cggcggccac aacgtggcaa 33241 tcgccttcgg acggtactaa accccagcgt tacgcgacag gagacctgcg atgacaatca 33301 tggcccccga ggcggttggc gagtcgctcg acccccgcga tccgctgttg cggctgagca 33361 acttcttcga cgacggcagc gtggaattgc tgcacgagcg tgaccgctcc ggagtgctgg 33421 ccgcggcggg caccgtcaac ggtgtgcgca ccatcgcgtt ctgcaccgac ggcaccgtga 33481 tgggcggcgc catgggcgtc gaggggtgca cgcacatcgt caacgcctac gacactgcca 33541 tcgaagacca gagtcccatc gtgggcatct ggcattcggg tggtgcccgg ctggctgaag 33601 gtgtgcgggc gctgcacgcg gtaggccagg tgttcgaagc catgatccgc gcgtccggct 33661 acatcccgca gatctcggtg gtcgtcggtt tcgccgccgg cggcgccgcc tacggaccgg 33721 cgttgaccga cgtcgtcgtc atggcgccgg aaagccgggt gttcgtcacc gggcccgacg 33781 tggtgcgcag cgtcaccggc gaggacgtcg acatggcctc gctcggtggg ccggagaccc 33841 accacaagaa gtccggggtg tgccacatcg tcgccgacga cgaactcgat gcctacgacc 33901 gtgggcgccg gttggtcgga ttgttctgcc agcaggggca tttcgatcgc agcaaggccg 33961 aggccggtga caccgacatc cacgcgctgc tgccggaatc ctcgcgacgt gcctacgacg 34021 tgcgtccgat cgtgacggcg atcctcgatg cggacacacc gttcgacgag ttccaggcca 34081 attgggcgcc gtcgatggtg gtcgggctgg gtcggctgtc gggtcgcacg gtgggtgtac 34141 tggccaacaa cccgctacgc ctgggcggct gcctgaactc cgaaagcgca gagaaggcag 34201 cgcgtttcgt gcggctgtgc gacgcgttcg ggattccgct ggtggtggtg gtcgatgtgc 34261 cgggctatct gcccggtgtc gaccaggagt ggggtggcgt ggtgcgccgt ggcgccaagt 34321 tgctgcacgc gttcggcgag tgcaccgttc cgcgggtcac gctggtcacc cgaaagacct 34381 acggcggggc atacattgcg atgaactccc ggtcgttgaa cgcgaccaag gtgttcgcct 34441 ggccggacgc cgaggtcgcg gtgatgggcg ctaaggcggc cgtcggcatc ctgcacaaga 34501 agaagttggc cgccgctccg gagcacgaac gcgaagcgct gcacgaccag ttggccgccg 34561 agcatgagcg catcgccggc ggggtcgaca gtgcgctgga catcggtgtg gtcgacgaga 34621 agatcgaccc ggcgcatact cgcagcaagc tcaccgaggc gctggcgcag gctccggcac 34681 ggcgcggccg ccacaagaac atcccgctgt agttctgacc gcgagcagac gcagaatcgc 34741 acgcgcgagg tccgcgccgt gcgattctgc gtctgctcgc cagttatccc cagcggtggc 34801 tggtcaacgc gaggcgctcc tcgcatgctc ggacggtgcc taccgacgcg ctaacaattc 34861 tcgagaaggc cggcgggttc gccaccaccg cgcaattgct cacggtcatg acccgccaac 34921 agctcgacgt ccaagtgaaa aacggcggcc tcgttcgcgt ttggtacggg gtctacgcgg 34981 cacaagagcc ggacctgttg ggccgcttgg cggctctcga tgtgttcatg ggggggcacg 35041 ccgtcgcgtg tctgggcacc gccgccgcgt tgtatggatt cgacacggaa aacaccgtcg 35101 ctatccatat gctcgatccc ggagtaagga tgcggcccac ggtcggtctg atggtccacc 35161 aacgcgtcgg tgcccggctc caacgggtgt caggtcgtct cgcgaccgcg cccgcatgga 35221 ctgccgtgga ggtcgcacga cagttgcgcc gcccgcgggc gctggccacc ctcgacgccg 35281 cactacggtc aatgcgctgc gctcgcagtg aaattgaaaa cgccgttgct gagcagcgag 35341 gccgccgagg catcgtcgcg gcgcgcgaac tcttaccctt cgccgacgga cgcgcggaat 35401 cggccatgga gagcgaggct cggctcgtca tgatcgacca cgggctgccg ttgcccgaac 35461 ttcaataccc gatacacggc cacggtggtg aaatgtggcg agtcgacttc gcctggcccg 35521 acatgcgtct cgcggccgaa tacgaaagca tcgagtggca cgcgggaccg gcggagatgc 35581 tgcgcgacaa gacacgctgg gccaagctcc aagagctcgg gtggacgatt gtcccgattg 35641 tcgtcgacga tgtcagacgc gaacccggcc gcctggcggc ccgcatcgcc cgccacctcg 35701 accgcgcgcg tatggccggc tgaccgctgg tgagcagacg cagagtcgca ctgcggccgg 35761 cgcagtgcga ctctgcgtct gctcgcgctc aacggctgag gaactcctta gccacggcga 35821 ctacgcgctc gcgatcccgt ggcaccagac cgatccgggt ccggcggtcg aggatatcgt 35881 ccacatccag cgccccctca tgggtcaccg cgtattcgaa ctccgcccgg gtcacgtcga 35941 tgccgtcggc gaccggctcg gtgggccgct cacatgtggc ggcggcagcg acgttggccg 36001 cctcggcccc gtaccgcgcc accagcgact cgggcaatcc ggcgcccgat ccgggggccg 36061 gcccagggtt cgccggtgcg ccgatcagcg gcaggttgcg agtgcggcac ttcgcggctc 36121 gcaggtgtcg cagcgtgatg gcgcgattca gcacatcctc tgccatgtag cggtattccg 36181 tcagcttgcc gccgaccaca ctgatcacgc ccgacggcga ttcaaaaaca gcgtggtcac 36241 gcgaaacgtc ggcggtgcgg ccctggacac cagcaccgcc ggtgtcgatt agcggccgca 36301 atcccgcata ggcaccgatg acatccttgg tgccgaccgc cgtccccaat gcggtgttca 36361 ccgtatccag caggaacgtg atctcttccg aagacggttg tggcacatcg ggaatcgggc 36421 cgggtgcgtc ttcgtcggtc agcccgagat agatccggcc cagctgctcg ggcatggcga 36481 acacgaagcg gttcagctca ccggggatcg gaatggtcag cgcggcagtc ggattggcaa 36541 acgacttcgc gtcgaagacc agatgtgtgc cgcggctggg gcgtagcctc agggacgggt 36601 cgatctcacc cgcccacacg cccgccgcgt tgatgacggc acgcgccgac agcgcgaacg 36661 actgccgggt gcgccggtcg gtcaactcca ccgaagtgcc ggtgacattc gacgcgccca 36721 cgtaagtgag gatgcgggcg ccgtgctggg ccgcggtgcg cgcgacggcc atgaccagcc 36781 gggcgtcgtc gatcaattgc ccgtcgtacg cgagcagacc accgtcgagg ccgtcccgcc 36841 gaacggtggg agcaatctcc accacccgtg acgccgggat tcggcgcgat cggggcaacg 36901 tcgccgccgg cgtacccgct agcacccgca aagcgtcgcc ggccaggaaa ccggcacgca 36961 ccaacgcccg cttggtgtga cccatcgacg gcaacaacgg gaccagttgc ggcatggcat 37021 gcacgagatg aggagcgttg cgtgtcatca ggattccgcg ttcgacggcg ctgcgccggg 37081 cgatgcccac gttgccgctg gccagatagc gcagaccgcc gtgcaccaac ttcgagctcc 37141 agcggctggt gccgaacgcc agatcatgct tttccaccaa ggccaccgtc agaccgcggg 37201 tggcagcatc taaggcaatg ccaacaccgg taatgccgcc gcctatcacg atgacgtcga 37261 gtgcgccacc gtcggccagt gcggtcaggt cggcggagcg acgcgccgcg ttgagtgcag 37321 ccgagtgggg catcagcaca aatatccgtt cagtgcgtgg gtaagttcgg tggccagcgc 37381 ggcggaatcg aggatcgaat cgacgatgtc cgcggactgg atggtcgact gggcgatcag 37441 caacaccatg gtcgccagtc gacgagcgtc gccggagcgc acactgcccg accgctgcgc 37501 cactgtcagc cgggcggcca acccctcgat caggacctgc tggctggtgc cgaggcgctc 37561 ggtgatgtac accctggcca gctccgagtg catgaccgac atgatcagat cgtcaccccg 37621 caaccggtcg gccaccgcga caatctgctt taccaacgct tcccggtcgt ccccgtcgag 37681 gggcacctcc cgcagcacgt cggcgatatg gctggtcagc atggacgcca tgatcgaccg 37741 ggtgtccggc cagcgacggt atacggtcgg gcggctcacg cccgcgcgcc gggcgatctc 37801 ggcaagtgtc acccggtcca cgccgtaatc gacgacgcag ctcgccgctg cccgcaggat 37861 acgaccaccg gtatccgcgc ggtcattact cattgacagc atgtgtaata ctgtaacgcg 37921 tgactcaccg cgaggaactc cttccaccga tgaaatggga cgcgtgggga gatcccgccg 37981 cggccaagcc actttctgat ggcgtccggt cgttgctgaa gcaggttgtg ggcctagcgg 38041 actcggagca gcccgaactc gaccccgcgc aggtgcagct gcgcccgtcc gccctgtcgg 38101 gggcagacca - GenBank Accession #U45880:
1 gaaaaggtgg acaagtccta ttttcaagag aagatgactt ttaacagttt tgaaggatct (SEQ ID NO: 25) 61 aaaacttgtg tacctgcaga catcaataag gaagaagaat ttgtagaaga gtttaataga 121 ttaaaaactt ttgctaattt tccaagtggt agtcctgttt cagcatcaac actggcacga 181 gcagggtttc tttatactgg tgaaggagat accgtgcggt gctttagttg tcatgcagct 241 gtagatagat ggcaatatgg agactcagca gttggaagac acaggaaagt atccccaaat 301 tgcagattta tcaacggctt ttatcttgaa aatagtgcca cgcagtctac aaattctggt 361 atccagaatg gtcagtacaa agttgaaaac tatctgggaa gcagagatca ttttgcctta 421 gacaggccat ctgagacaca tgcagactat cttttgagaa ctgggcaggt tgtagatata 481 tcagacacca tatacccgag gaaccctgcc atgtattgtg aagaagctag attaaagtcc 541 tttcagaact ggccagacta tgctcaccta accccaagag agttagcaag tgctggactc 601 tactacacag gtattggtga ccaagtgcag tgcttttgtt gtggtggaaa actgaaaaat 661 tgggaacctt gtgatcgtgc ctggtcagaa cacaggcgac actttcctaa ttgcttcttt 721 gttttgggcc ggaatcttaa tattcgaagt gaatctgatg ctgtgagttc tgataggaat 781 ttcccaaatt caacaaatct tccaagaaat ccatccatgg cagattatga agcacggatc 841 tttacttttg ggacatggat atactcagtt aacaaggagc agcttgcaag agctggattt 901 tatgctttag gtgaaggtga taaagtaaag tgctttcact gtggaggagg gctaactgat 961 tggaagccca gtgaagaccc ttgggaacaa catgctaaat ggtatccagg gtgcaaatat 1021 ctgttagaac agaagggaca agaatatata aacaatattc atttaactca ttcacttgag 1081 gagtgtctgg taagaactac tgagaaaaca ccatcactaa ctagaagaat tgatgatacc 1141 atcttccaaa atcctatggt acaagaagct atacgaatgg ggttcagttt caaggacatt 1201 aagaaaataa tggaggaaaa aattcagata tctgggagca actataaatc acttgaggtt 1261 ctggttgcag atctagtgaa tgctcagaaa gacagtatgc aagatgagtc aagtcagact 1321 tcattacaga aagagattag tactgaagag cagctaaggc gcctgcaaga ggagaagctt 1381 tgcaaaatct gtatggatag aaatattgct atcgtttttg ttccttgtgg acatctagtc 1441 acttgtaaac aatgtgctga agcagttgac aagtgtccca tgtgctacac agtcattact 1501 ttcaagcaaa aaatttttat gtcttaatct aactctatag taggcatgtt atgttgttct 1561 tattaccctg attgaatgtg tgatgtgaac tgactttaag taatcaggat tgaattccat 1621 tagcatttgc taccaagtag gaaaaaaaat gtacatggca gtgttttagt tggcaatata 1681 atctttgaat ttcttgattt ttcagggtat tagctgtatt atccattttt tttactgtta 1741 tttaattgaa accatagact aagaataaga agcatcatac tataactgaa cacaatgtgt 1801 attcatagta tactgattta atttctaagt gtaagtgaat taatcatctg gattttttat 1861 tcttttcaga taggcttaac aaatggagct ttctgtatat aaatgtggag attagagtta 1921 atctccccaa tcacataatt tgttttgtgt gaaaaaggaa taaattgttc catgctggtg 1981 gaaagataga gattgttttt agaggttggt tgttgtgttt taggattctg tccattttct 2041 tgtaaaggga taaacacgga cgtgtgcgaa atatgtttgt aaagtgattt gccattgttg 2101 aaagcgtatt taatgataga atactatcga gccaacatgt actgacatgg aaagatgtca 2161 gagatatgtt aagtgtaaaa tgcaagtggc gggacactat gtatagtctg agccagatca 2221 aagtatgtat gttgttaata tgcatagaac gagagatttg gaaagatata caccaaactg 2281 ttaaatgtgg tttctcttcg gggagggggg gattggggga ggggccccag aggggtttta 2341 gaggggcctt ttcactttcg acttttttca ttttgttctg ttcggatttt ttataagtat 2401 gtagaccccg aagggtttta tgggaactaa catcagtaac ctaacccccg tgactatcct 2461 gtgctcttcc tagggagctg tgttgtttcc cacccaccac ccttccctct gaacaaatgc 2521 ctgagtgctg gggcactttg - General Target Region:
- Internal Ribosome Entry Site (IRES) in 5′ untranslated region:
5′AGCUCCUAUAACAAAAGUCUGUUGCUUGUGUUUCACAUUUUGGAUU (SEQ ID NO: 26) UCCUAAUAUAAUGUUCUCUUUUUAGAAAAGGUGGACAAGUCCUAUUU UCAAGAGAAG3′ - Initial Specific Target Matif:
- RNP core binding site within XIAP IRES
5′GGAUUUCCUAAUAUAAUGUUCUCUUUUU3′ (SEQ ID NO: 27) - GenBank Accession #NM—001168:
1 ccgccagatt tgaatcgcgg gacccgttgg cagaggtggc ggcggcggca tgggtgcccc (SEQ ID NO: 28) 61 gacgttgccc cctgcctggc agccctttct caaggaccac cgcatctcta cattcaagaa 121 ctggcccttc ttggagggct gcgcctgcac cccggagcgg atggccgagg ctggcttcat 181 ccactgcccc actgagaacg agccagactt ggcccagtgt ttcttctgct tcaaggagct 241 ggaaggctgg gagccagatg acgaccccat agaggaacat aaaaagcatt cgtccggttg 301 cgctttcctt tctgtcaaga agcagtttga agaattaacc cttggtgaat ttttgaaact 361 ggacagagaa agagccaaga acaaaattgc aaaggaaacc aacaataaga agaaagaatt 421 tgaggaaact gcgaagaaag tgcgccgtgc catcgagcag ctggctgcca tggattgagg 481 cctctggccg gagctgcctg gtcccagagt ggctgcacca cttccagggt ttattccctg 541 gtgccaccag ccttcctgtg ggccccttag caatgtctta ggaaaggaga tcaacatttt 601 caaattagat gtttcaactg tgctcctgtt ttgtcttgaa agtggcacca gaggtgcttc 661 tgcctgtgca gcgggtgctg ctggtaacag tggctgcttc tctctctctc tctctttttt 721 gggggctcat ttttgctgtt ttgattcccg ggcttaccag gtgagaagtg agggaggaag 781 aaggcagtgt cccttttgct agagctgaca gctttgttcg cgtgggcaga gccttccaca 841 gtgaatgtgt ctggacctca tgttgttgag gctgtcacag tcctgagtgt ggacttggca 901 ggtgcctgtt gaatctgagc tgcaggttcc ttatctgtca cacctgtgcc tcctcagagg 961 acagtttttt tgttgttgtg tttttttgtt tttttttttt ggtagatgca tgacttgtgt 1021 gtgatgagag aatggagaca gagtccctgg ctcctctact gtttaacaac atggctttct 1081 tattttgttt gaattgttaa ttcacagaat agcacaaact acaattaaaa ctaagcacaa 1141 agccattcta agtcattggg gaaacggggt gaacttcagg tggatgagga gacagaatag 1201 agtgatagga agcgtctggc agatactcct tttgccactg ctgtgtgatt agacaggccc 1261 agtgagccgc ggggcacatg ctggccgctc ctccctcaga aaaaggcagt ggcctaaatc 1321 ctttttaaat gacttggctc gatgctgtgg gggactggct gggctgctgc aggccgtgtg 1381 tctgtcagcc caaccttcac atctgtcacg ttctccacac gggggagaga cgcagtccgc 1441 ccaggtcccc gctttctttg gaggcagcag ctcccgcagg gctgaagtct ggcgtaagat 1501 gatggatttg attcgccctc ctccctgtca tagagctgca gggtggattg ttacagcttc 1561 gctggaaacc tctggaggtc atctcggctg ttcctgagaa ataaaaagcc tgtcatttc - The results presented in this Example indicate that gel mobility shift assays can be used to detect the binding of small molecules, such as the Tat peptide and gentamicin, to their respective target RNAs.
- Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100, and 0.5 mM MgCl2. Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA. Tris-Potassium chloride-magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KCl, 0.1 % Triton X-100 and 5 mM MgCl2.
- RNA oligonucleotides were purchased from Dharmacon, Inc, Lafayette, Colo.). 500 pmole of either a 5′ fluorescein labeled oligonucleotide corresponding to the 16S rRNA A site (5′-GGCGUCACACCUUCGGGUGAAGUCGCC-3′ (SEQ ID NO: 29); Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al., 1991, EMBO J. 10:3099-3103; Yoshizawa et al., 1998, EMBO J. 17:6437-6448) or a 5′ fluorescein labeled oligonucleotide correspording to the HIV-1 TAR element TAR RNA (5′-GGCGUCACACCUUCGGGUGAAGUCGCC-3′ (SEQ ID NO: 30); Huq et al., 1999, Nucleic Acids Research. 27:1084-1093; Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was 3′ labeled with 5′-32p cytidine 3′, 5′-bis(phosphate) (NEN) and T4 RNA ligase (NEBiolabs) in 10% DMSO as per manufacturer's instructions. The labeled oligonucleotides were purified using G-25 Sephadex columns (Boehringer Mannheim). For Tat-TAR gel retardation reactions the method of Huq et al. (Nucleic Acids Research, 1999, 27:1084-1093) was utilized with TK buffer containing 0.5 mM MgCl2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 31); single letter amino acid code). For 16S rRNA-gentamicin reactions, the method of Huq et al. was used with TKM buffer. In 20
μl reaction volumes 50 pmoles of 32P cytidine-labeled oligonucleotide and either gentamicin sulfate (Sigma) or the short Tat peptide (Tat47-58) in TK or TKM buffer were heated at 90° C. for 2 minutes and allow to cool to room temperature (approximately 24° C.) over 2 hours. Then 10 μl of 30% glycerol was added to each reaction tube and the entire sample was loaded onto a TBE non-denaturing polyacrylamide gel and electrophoresed at 1200-1600 volt-hours at 4° C. The gel was exposed to an intensifying screen and radioactivity was quantitated using a Typhoon phosporimager (Molecular Dynamics). - One method used to demonstrate small molecule interactions with natural occurring RNA structures such as ribosomes is by a method called chemical footprinting or toe printing (Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al., 1991, EMBO J. 10:3099-3103; Yoshizawaetal., 1998, EMBO J. 17:6437-6448). Here the use of gel mobility shift assays to monitor RNA-small molecule interactions are described. This approach allows for rapid visualization of small molecule-RNA interactions based on the difference between mobility of RNA alone versus RNA in a complex with a small molecule. To validate this approach, an RNA oligonucleotide corresponding to the well-characterized gentamicin binding site on the 16S rRNA (Moazed & Noller, 1987, Nature 327:389-394) and the equally well-characterized HIV-1 TAT protein binding site on the HIV-1 TAR element (Huq et al., 1999, Nucleic Acids Res. 27: 1084-1093) were chosen. The purpose of these experiments is to lay the groundwork for the use of chromatographic techniques in a high throughput fashion, such as microcapillary electrophoresis, for drug discovery.
- A gel retardation assay was performed using the Tat47-58 peptide and the TAR RNA oligonucleotide. As shown in FIG. 1, in the presence of the Tat peptide, a clear shift is visible when the products are separated on a 12% non-denaturing polyacrylamide gel. In the reaction that lacks peptide, only the free RNA is visible. These observations confirm previous reports made using other Tat peptides (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Huq et al., 1999, Nucleic Acids Res. 27: 1084-1093).
- Based on the results of FIG. 1, it was hypothesized that RNA interactions with small organic molecules could also be visualized using this method. As shown in FIG. 2, the addition of varying concentrations of gentamicin to an RNA oligonucleotide corresponding to the 16S rRNA A site produces a mobility shift. These results demonstrate that the binding of the small molecule gentamicin to an RNA oligonucleotide having a defined structure in solution can be monitored using this approach. In addition, as shown in FIG. 2, a concentration as low as 10 ng/ml gentamicin produces the mobility shift.
- To determine whether lower concentrations of gentamicin would be sufficient to produce a gel shift, similar experiment was performed, as shown in FIG. 2, except that the concentrations of gentamicin ranged from 100 ng/ml to 10 pg/ml. As shown in FIG. 3, gel mobility shifts are produced when the gentamicin concentration is as low as 10 pg/ml. Further, the results shown in FIG. 3 demonstrate that the shift is specific to the 16S rRNA oligonucleotide as the use of an unrelated oligonucleotide, corresponding to the HIV TAR RNA element, does not result in a gel mobility shift when incubated with 10 μg/ml gentamicin. In addition, if a concentration as low as 10 pg/ml gentamicin produces a gel mobility shift then it should be possible to detect changes to RNA structural motifs when small amounts of compound from a library of diverse compounds is screened in this fashion.
- Further analysis of the gentamicin-RNA interaction indicates that the interaction is Mg− and temperature dependent. As shown in FIG. 4, when MgCl2 is not present (TK buffer), 1 mg/ml of gentamicin must be added to the reaction to produce a gel shift.
- Similarly, the temperature of the reaction when gentamicin is added is also important. When gentamicin is present in the reaction during the entire denaturation/renaturation cycle, that is, when gentamicin is added at 90C° C. or 85 ° C., a gel shift is visualized (data not shown). In contrast, when gentamicin is added after the renaturation step has proceeded to 75° C., a mobility shift is not produced. These results are consistent with the notion that gentamicin may recognize and interact with an RNA structure formed early in the renaturation process.
- The results presented in this Example indicate that interactions between a peptide and its target RNA, such as the Tat peptide and TAR RNA, can be monitored by gel retardation assays in an automated capillary electrophoresis system.
- Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100, and 0.5 mM MgCl2. Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA. Tris-Potassium chloride-magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100 and 5 mM MgCl2.
- RNA oligonucleotides were purchased from Dharmacon, Inc. Lafayette, Colo.). 500 pmole of a 5′ fluorescein labeled oligonucleotide corresponding to the HIV-1 TAR element TAR RNA (5′-GGCGUCACACCUUCGGGUGAAGUCGCC-3′ (SEQ ID NO: 30); Huq et al., 1999, Nucleic Acids Research. 27:1084-1093; Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was used. For Tat-TAR gel retardation reactions the method of Huq et al. (Nucleic Acids Research, 1999, 27:1084-1093) was utilized with TK buffer containing 0.5 mM MgCl2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 31); single letter amino acid code). In 20
μl reaction volumes 50 pmoles of labeled oligonucleotide and the short Tat peptide (Tat47-58) in TK or TKM buffer were heated at 90° C. for 2 minutes and allow to cool to room temperature (approximately 24° C.) over 2 hours. The reactions were loaded onto a SCE9610 automated capillary electrophoresis apparatus (SpectruMedix; State College, Pa.). - As presented in the previous Example in Section 7, interactions between a peptide and RNA can be monitored by gel retardation assays. It was hypothesized that interactions between a peptide and RNA could be monitored by gel retardation assays by an automated capillary electrophoresis system. To test this hypothesis, a gel retardation assay by an automated capillary electrophoresis system was performed using the Tat47-58 peptide and the TAR RNA oligonucleotide. As shown in FIG. 5 using the capillary electrophoresis system, in the presence of the Tat peptide, a clear shift is visible upon the addition of increasing concentrations of Tat peptide. In the reaction that lacks peptide, only a peak corresponding to the free RNA is observed. These observations confirm previous reports made using other Tat peptides (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Huq et al., 1999, Nucleic Acids Res. 27: 1084-1093).
- The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
- Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.
- The invention can be ilustrated by the following embodiments enumerated in the numbered paragraphs that follow:
- 1. A method for identifying a test compound that binds to a target RNA molecule, comprising the steps of (a) contacting a detectably labeled target RNA molecule with a library of test compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of test compounds so that a detectably labeled target RNA:test compound complex is formed; (b) separating the detectably labeled target RNA:test compound complex formed in step(a) from uncomplexed target RNA molecules and test compounds; and (c) determining a structure of the test compound bound to the RNA in the RNA:test compound complex.
- 2. The method of
paragraph 1 in which the target RNA molecule contains an HIV TAR element, internal ribosome entry site, “slippery site”, instability element, or adenylate uridylate-rich element. - 3. The method of
paragraph 1 in which the RNA molecule is an element derived from the mRNA for tumor necrosis factor alpha (“TNF-α”), granulocyte-macrophage colony stimulating factor (“GM-CSF”), interleukin 2 (“IL-2”), interleukin 6 (“IL-6”), vascular endothelial growth factor (“VEGF”), human immunodeficiency virus I (“HIV-1”), hepatitis C virus (“HCV”—genotypes 1a & 1b), ribonuclease P RNA (“RNaseP”), X-linked inhibitor of apoptosis protein (“XIAP”), or survivin. - 4. The method of
paragraph 1 in which the detectably labeled RNA is labeled with a fluorescent dye, phosphorescent dye, ultraviolet dye, infrared dye, visible dye, radiolabel, enzyme, spectroscopic colorimetric label, affinity tag, or nanoparticle. - 5. The method of
paragraph 1 in which the test compound is selected from a combinatorial library comprising peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; and small organic molecule libraries, including but not limited to, libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, or diazepindiones. - 6. The method of
paragraph 1 in which screening a library of test compounds comprises contacting the test compound with the target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions. - 7. The method of paragraph 6 in which the aqueous solution optionally further comprises non-specific nucleic acids comprising DNA, yeast tRNA, salmon sperm DNA, homoribopolymers, and nonspecific RNAs.
- 8. The method of paragraph 6 in which the aqueous solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant. In another embodiment, the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 mM MgCl2. In a preferred embodiment, the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl2. In another embodiment, the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.
- 9. Any method that detects an altered physical property of a target nucleic acid complexed to a test compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids in the method of
paragraph 1. In a preferred embodiment, elecfrophoresis is used for separation of the complexed and non-complexed target nucleic acids. In a preferred embodiment, the electrophoresis is capillary electrophoresis. In other embodiments, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation are used for the separation of the complexed and non-complexed target nucleic acids. - 10. The structure of the test compound of the RNA:test compound complex of
paragraph 1 is determined, in part, by the type of library of test compounds. In a preferred embodiment wherein the combinatorial libraries are small organic molecule libraries, mass spectroscopy, NMR, or vibration spectroscopy are used to determine the structure of the test compounds. -
1 31 1 21 RNA Homo sapiens 1 auuuauuuau uuauuuauuu a 21 2 17 RNA Homo sapiens 2 auuuauuuau uuauuua 17 3 15 RNA Homo sapiens 3 wauuuauuua uuuaw 15 4 13 RNA Homo sapiens 4 wwauuuauuu aww 13 5 13 RNA Homo sapiens 5 wwwwauuuaw www 13 6 1643 DNA Homo sapiens 6 gcagaggacc agctaagagg gagagaagca actacagacc ccccctgaaa acaaccctca 60 gacgccacat cccctgacaa gctgccaggc aggttctctt cctctcacat actgacccac 120 ggctccaccc tctctcccct ggaaaggaca ccatgagcac tgaaagcatg atccgggacg 180 tggagctggc cgaggaggcg ctccccaaga agacaggggg gccccagggc tccaggcggt 240 gcttgttcct cagcctcttc tccttcctga tcgtggcagg cgccaccacg ctcttctgcc 300 tgctgcactt tggagtgatc ggcccccaga gggaagagtt ccccagggac ctctctctaa 360 tcagccctct ggcccaggca gtcagatcat cttctcgaac cccgagtgac aagcctgtag 420 cccatgttgt agcaaaccct caagctgagg ggcagctcca gtggctgaac cgccgggcca 480 atgccctcct ggccaatggc gtggagctga gagataacca gctggtggtg ccatcagagg 540 gcctgtacct catctactcc caggtcctct tcaagggcca aggctgcccc tccacccatg 600 tgctcctcac ccacaccatc agccgcatcg ccgtctccta ccagaccaag gtcaacctcc 660 tctctgccat caagagcccc tgccagaggg agaccccaga gggggctgag gccaagccct 720 ggtatgagcc catctatctg ggaggggtct tccagctgga gaagggtgac cgactcagcg 780 ctgagatcaa tcggcccgac tatctcgact ttgccgagtc tgggcaggtc tactttggga 840 tcattgccct gtgaggagga cgaacatcca accttcccaa acgcctcccc tgccccaatc 900 cctttattac cccctccttc agacaccctc aacctcttct ggctcaaaaa gagaattggg 960 ggcttagggt cggaacccaa gcttagaact ttaagcaaca agaccaccac ttcgaaacct 1020 gggattcagg aatgtgtggc ctgcacagtg aattgctggc aaccactaag aattcaaact 1080 ggggcctcca gaactcactg gggcctacag ctttgatccc tgacatctgg aatctggaga 1140 ccagggagcc tttggttctg gccagaatgc tgcaggactt gagaagacct cacctagaaa 1200 ttgacacaag tggaccttag gccttcctct ctccagatgt ttccagactt ccttgagaca 1260 cggagcccag ccctccccat ggagccagct ccctctattt atgtttgcac ttgtgattat 1320 ttattattta tttattattt atttatttac agatgaatgt atttatttgg gagaccgggg 1380 tatcctgggg gacccaatgt aggagctgcc ttggctcaga catgttttcc gtgaaaacgg 1440 agctgaacaa taggctgttc ccatgtagcc ccctggcctc tgtgccttct tttgattatg 1500 ttttttaaaa tatttatctg attaagttgt ctaaacaatg ctgatttggt gaccaactgt 1560 cactcattgc tgagcctctg ctccccaggg gagttgtgtc tgtaatcgcc ctactattca 1620 gtggcgagaa ataaagtttg ctt 1643 7 756 DNA Homo sapiens 7 gctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc agcatctctg 60 cacccgcccg ctcgcccagc cccagcacgc agccctggga gcatgtgaat gccatccagg 120 aggcccggcg tctcctgaac ctgagtagag acactgctgc tgagatgaat gaaacagtag 180 aagtcatctc agaaatgttt gacctccagg agccgacctg cctacagacc cgcctggagc 240 tgtacaagca gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg 300 ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca acccagacta 360 tcacctttga aagtttcaaa gagaacctga aggactttct gcttgtcatc ccctttgact 420 gctgggagcc agtccaggag tgagaccggc cagatgaggc tggccaagcc ggggagctgc 480 tctctcatga aacaagagct agaaactcag gatggtcatc ttggagggac caaggggtgg 540 gccacagcca tggtgggagt ggcctggacc tgccctgggc cacactgacc ctgatacagg 600 catggcagaa gaatgggaat attttatact gacagaaatc agtaatattt atatatttat 660 atttttaaaa tatttattta tttatttatt taagttcata ttccatattt attcaagatg 720 ttttaccgta ataattatta ttaaaaatat gcttct 756 8 756 DNA Homo sapiens 8 tctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc agcatctctg 60 cacccgcccg ctcgcccagc cccagcacgc agccctggga gcatgtgaat gccatccagg 120 aggcccggcg tctcctgaac ctgagtagag acactgctgc tgagatgaat gaaacagtag 180 aagtcatctc agaaatgttt gacctccagg agccgacctg cctacagacc cgcctggagc 240 tgtacaagca gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg 300 ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca acccagacta 360 tcacctttga aagtttcaaa gagaacctga aggactttct gcttgtcatc ccctttgact 420 gctgggagcc agtccaggag tgagaccggc cagatgaggc tggccaagcc ggggagctgc 480 tctctcatga aacaagagct agaaactcag gatggtcatc ttggagggac caaggggtgg 540 gccacagcca tggtgggagt ggcctggacc tgccctgggc cacactgacc ctgatacagg 600 catggcagaa gaatgggaat attttatact gacagaaatc agtaatattt atatatttat 660 atttttaaaa tatttattta tttatttatt taagttcata ttccatattt attcaagatg 720 ttttaccgta ataattatta ttaaaaatat gcttct 756 9 825 DNA Homo sapiens 9 atcactctct ttaatcacta ctcacattaa cctcaactcc tgccacaatg tacaggatgc 60 aactcctgtc ttgcattgca ctaattcttg cacttgtcac aaacagtgca cctacttcaa 120 gttcgacaaa gaaaacaaag aaaacacagc tacaactgga gcatttactg ctggatttac 180 agatgatttt gaatggaatt aataattaca agaatcccaa actcaccagg atgctcacat 240 ttaagtttta catgcccaag aaggccacag aactgaaaca gcttcagtgt ctagaagaag 300 aactcaaacc tctggaggaa gtgctgaatt tagctcaaag caaaaacttt cacttaagac 360 ccagggactt aatcagcaat atcaacgtaa tagttctgga actaaaggga tctgaaacaa 420 cattcatgtg tgaatatgca gatgagacag caaccattgt agaatttctg aacagatgga 480 ttaccttttg tcaaagcatc atctcaacac taacttgata attaagtgct tcccacttaa 540 aacatatcag gccttctatt tatttattta aatatttaaa ttttatattt attgttgaat 600 gtatggttgc tacctattgt aactattatt cttaatctta aaactataaa tatggatctt 660 ttatgattct ttttgtaagc cctaggggct ctaaaatggt ttaccttatt tatcccaaaa 720 atatttatta ttatgttgaa tgttaaatat agtatctatg tagattggtt agtaaaacta 780 tttaataaat ttgataaata taaaaaaaaa aaacaaaaaa aaaaa 825 10 15 RNA Homo sapiens misc_feature (1)..(1) N = A, U, G, OR C 10 nauuuauuua uuuan 15 11 1125 DNA Homo sapiens 11 ttctgccctc gagcccaccg ggaacgaaag agaagctcta tctcgcctcc aggagcccag 60 ctatgaactc cttctccaca agcgccttcg gtccagttgc cttctccctg gggctgctcc 120 tggtgttgcc tgctgccttc cctgccccag tacccccagg agaagattcc aaagatgtag 180 ccgccccaca cagacagcca ctcacctctt cagaacgaat tgacaaacaa attcggtaca 240 tcctcgacgg catctcagcc ctgagaaagg agacatgtaa caagagtaac atgtgtgaaa 300 gcagcaaaga ggcactggca gaaaacaacc tgaaccttcc aaagatggct gaaaaagatg 360 gatgcttcca atctggattc aatgaggaga cttgcctggt gaaaatcatc actggtcttt 420 tggagtttga ggtataccta gagtacctcc agaacagatt tgagagtagt gaggaacaag 480 ccagagctgt gcagatgagt acaaaagtcc tgatccagtt cctgcagaaa aaggcaaaga 540 atctagatgc aataaccacc cctgacccaa ccacaaatgc cagcctgctg acgaagctgc 600 aggcacagaa ccagtggctg caggacatga caactcatct cattctgcgc agctttaagg 660 agttcctgca gtccagcctg agggctcttc ggcaaatgta gcatgggcac ctcagattgt 720 tgttgttaat gggcattcct tcttctggtc agaaacctgt ccactgggca cagaacttat 780 gttgttctct atggagaact aaaagtatga gcgttaggac actattttaa ttatttttaa 840 tttattaata tttaaatatg tgaagctgag ttaatttatg taagtcatat ttatattttt 900 aagaagtacc acttgaaaca ttttatgtat tagttttgaa ataataatgg aaagtggcta 960 tgcagtttga atatcctttg tttcagagcc agatcatttc ttggaaagtg taggcttacc 1020 tcaaataaat ggctaactta tacatatttt taaagaaata tttatattgt atttatataa 1080 tgtataaatg gtttttatac caataaatgg cattttaaaa aattc 1125 12 3166 DNA Homo sapiens 12 aagagctcca gagagaagtc gaggaagaga gagacggggt cagagagagc gcgcgggcgt 60 gcgagcagcg aaagcgacag gggcaaagtg agtgacctgc ttttgggggt gaccgccgga 120 gcgcggcgtg agccctcccc cttgggatcc cgcagctgac cagtcgcgct gacggacaga 180 cagacagaca ccgcccccag ccccagttac cacctcctcc ccggccggcg gcggacagtg 240 gacgcggcgg cgagccgcgg gcaggggccg gagcccgccc ccggaggcgg ggtggagggg 300 gtcggagctc gcggcgtcgc actgaaactt ttcgtccaac ttctgggctg ttctcgcttc 360 ggaggagccg tggtccgcgc gggggaagcc gagccgagcg gagccgcgag aagtgctagc 420 tcgggccggg aggagccgca gccggaggag ggggaggagg aagaagagaa ggaagaggag 480 agggggccgc agtggcgact cggcgctcgg aagccgggct catggacggg tgaggcggcg 540 gtgtgcgcag acagtgctcc agcgcgcgcg ctccccagcc ctggcccggc ctcgggccgg 600 gaggaagagt agctcgccga ggcgccgagg agagcgggcc gccccacagc ccgagccgga 660 gagggacgcg agccgcgcgc cccggtcggg cctccgaaac catgaacttt ctgctgtctt 720 gggtgcattg gagccttgcc ttgctgctct acctccacca tgccaagtgg tcccaggctg 780 cacccatggc agaaggagga gggcagaatc atcacgaagt ggtgaagttc atggatgtct 840 atcagcgcag ctactgccat ccaatcgaga ccctggtgga catcttccag gagtaccctg 900 atgagatcga gtacatcttc aagccatcct gtgtgcccct gatgcgatgc gggggctgct 960 ccaatgacga gggcctggag tgtgtgccca ctgaggagtc caacatcacc atgcagatta 1020 tgcggatcaa acctcaccaa ggccagcaca taggagagat gagcttccta cagcacaaca 1080 aatgtgaatg cagaccaaag aaagatagag caagacaaga aaatccctgt gggccttgct 1140 cagagcggag aaagcatttg tttgtacaag atccgcagac gtgtaaatgt tcctgcaaaa 1200 acacacactc gcgttgcaag gcgaggcagc ttgagttaaa cgaacgtact tgcagatgtg 1260 acaagccgag gcggtgagcc gggcaggagg aaggagcctc cctcagggtt tcgggaacca 1320 gatctctctc caggaaagac tgatacagaa cgatcgatac agaaaccacg ctgccgccac 1380 cacaccatca ccatcgacag aacagtcctt aatccagaaa cctgaaatga aggaagagga 1440 gactctgcgc agagcacttt gggtccggag ggcgagactc cggcggaagc attcccgggc 1500 gggtgaccca gcacggtccc tcttggaatt ggattcgcca ttttattttt cttgctgcta 1560 aatcaccgag cccggaagat tagagagttt tatttctggg attcctgtag acacacccac 1620 ccacatacat acatttatat atatatatat tatatatata taaaaataaa tatctctatt 1680 ttatatatat aaaatatata tattcttttt ttaaattaac agtgctaatg ttattggtgt 1740 cttcactgga tgtatttgac tgctgtggac ttgagttggg aggggaatgt tcccactcag 1800 atcctgacag ggaagaggag gagatgagag actctggcat gatctttttt ttgtcccact 1860 tggtggggcc agggtcctct cccctgccca agaatgtgca aggccagggc atgggggcaa 1920 atatgaccca gttttgggaa caccgacaaa cccagccctg gcgctgagcc tctctacccc 1980 aggtcagacg gacagaaaga caaatcacag gttccgggat gaggacaccg gctctgacca 2040 ggagtttggg gagcttcagg acattgctgt gctttgggga ttccctccac atgctgcacg 2100 cgcatctcgc ccccaggggc actgcctgga agattcagga gcctgggcgg ccttcgctta 2160 ctctcacctg cttctgagtt gcccaggagg ccactggcag atgtcccggc gaagagaaga 2220 gacacattgt tggaagaagc agcccatgac agcgcccctt cctgggactc gccctcatcc 2280 tcttcctgct ccccttcctg gggtgcagcc taaaaggacc tatgtcctca caccattgaa 2340 accactagtt ctgtcccccc aggaaacctg gttgtgtgtg tgtgagtggt tgaccttcct 2400 ccatcccctg gtccttccct tcccttcccg aggcacagag agacagggca ggatccacgt 2460 gcccattgtg gaggcagaga aaagagaaag tgttttatat acggtactta tttaatatcc 2520 ctttttaatt agaaattaga acagttaatt taattaaaga gtagggtttt ttttcagtat 2580 tcttggttaa tatttaattt caactattta tgagatgtat cttttgctct ctcttgctct 2640 cttatttgta ccggtttttg tatataaaat tcatgtttcc aatctctctc tccctgatcg 2700 gtgacagtca ctagcttatc ttgaacagat atttaatttt gctaacactc agctctgccc 2760 tccccgatcc cctggctccc cagcacacat tcctttgaaa gagggtttca atatacatct 2820 acatactata tatatattgg gcaacttgta tttgtgtgta tatatatata tatatgttta 2880 tgtatatatg tgatcctgaa aaaataaaca tcgctattct gttttttata tgttcaaacc 2940 aaacaagaaa aaatagagaa ttctacatac taaatctctc tcctttttta attttaatat 3000 ttgttatcat ttatttattg gtgctactgt ttatccgtaa taattgtggg gaaaagatat 3060 taacatcacg tctttgtctc tagtgcagtt tttcgagata ttccgtagta catatttatt 3120 tttaaacaac gacaaagaaa tacagatata tcttaaaaaa aaaaaa 3166 13 249 RNA Homo sapiens 13 ccgggcucau ggacggguga ggcggcggug ugcgcagaca gugcuccagc gcgcgcgcuc 60 cccagcccug gcccggccuc gggccgggag gaagaguagc ucgccgaggc gccgaggaga 120 gcgggccgcc ccacagcccg agccggagag ggacgcgagc cgcgcgcccc ggucgggccu 180 ccgaaaccau gaacuuucug cugucuuggg ugcauuggag ccuugccuug cugcucuacc 240 uccaccaug 249 14 9181 DNA Homo sapiens 14 ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac 60 tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 120 gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 180 gtggcgcccg aacagggacc tgaaagcgaa agggaaacca gaggagctct ctcgacgcag 240 gactcggctt gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc 300 aaaaattttg actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa 360 gcgggggaga attagatcga tgggaaaaaa ttcggttaag gccaggggga aagaaaaaat 420 ataaattaaa acatatagta tgggcaagca gggagctaga acgattcgca gttaatcctg 480 gcctgttaga aacatcagaa ggctgtagac aaatactggg acagctacaa ccatcccttc 540 agacaggatc agaagaactt agatcattat ataatacagt agcaaccctc tattgtgtgc 600 atcaaaggat agagataaaa gacaccaagg aagctttaga caagatagag gaagagcaaa 660 acaaaagtaa gaaaaaagca cagcaagcag cagctgacac aggacacagc aatcaggtca 720 gccaaaatta ccctatagtg cagaacatcc aggggcaaat ggtacatcag gccatatcac 780 ctagaacttt aaatgcatgg gtaaaagtag tagaagagaa ggctttcagc ccagaagtga 840 tacccatgtt ttcagcatta tcagaaggag ccaccccaca agatttaaac accatgctaa 900 acacagtggg gggacatcaa gcagccatgc aaatgttaaa agagaccatc aatgaggaag 960 ctgcagaatg ggatagagtg catccagtgc atgcagggcc tattgcacca ggccagatga 1020 gagaaccaag gggaagtgac atagcaggaa ctactagtac ccttcaggaa caaataggat 1080 ggatgacaaa taatccacct atcccagtag gagaaattta taaaagatgg ataatcctgg 1140 gattaaataa aatagtaaga atgtatagcc ctaccagcat tctggacata agacaaggac 1200 caaaggaacc ctttagagac tatgtagacc ggttctataa aactctaaga gccgagcaag 1260 cttcacagga ggtaaaaaat tggatgacag aaaccttgtt ggtccaaaat gcgaacccag 1320 attgtaagac tattttaaaa gcattgggac cagcggctac actagaagaa atgatgacag 1380 catgtcaggg agtaggagga cccggccata aggcaagagt tttggctgaa gcaatgagcc 1440 aagtaacaaa ttcagctacc ataatgatgc agagaggcaa ttttaggaac caaagaaaga 1500 ttgttaagtg tttcaattgt ggcaaagaag ggcacacagc cagaaattgc agggccccta 1560 ggaaaaaggg ctgttggaaa tgtggaaagg aaggacacca aatgaaagat tgtactgaga 1620 gacaggctaa ttttttaggg aagatctggc cttcctacaa gggaaggcca gggaattttc 1680 ttcagagcag accagagcca acagccccac cagaagagag cttcaggtct ggggtagaga 1740 caacaactcc ccctcagaag caggagccga tagacaagga actgtatcct ttaacttccc 1800 tcaggtcact ctttggcaac gacccctcgt cacaataaag ataggggggc aactaaagga 1860 agctctatta gatacaggag cagatgatac agtattagaa gaaatgagtt tgccaggaag 1920 atggaaacca aaaatgatag ggggaattgg aggttttatc aaagtaagac agtatgatca 1980 gatactcata gaaatctgtg gacataaagc tataggtaca gtattagtag gacctacacc 2040 tgtcaacata attggaagaa atctgttgac tcagattggt tgcactttaa attttcccat 2100 tagccctatt gagactgtac cagtaaaatt aaagccagga atggatggcc caaaagttaa 2160 acaatggcca ttgacagaag aaaaaataaa agcattagta gaaatttgta cagagatgga 2220 aaaggaaggg aaaatttcaa aaattgggcc tgaaaatcca tacaatactc cagtatttgc 2280 cataaagaaa aaagacagta ctaaatggag aaaattagta gatttcagag aacttaataa 2340 gagaactcaa gacttctggg aagttcaatt aggaatacca catcccgcag ggttaaaaaa 2400 gaaaaaatca gtaacagtac tggatgtggg tgatgcatat ttttcagttc ccttagatga 2460 agacttcagg aagtatactg catttaccat acctagtata aacaatgaga caccagggat 2520 tagatatcag tacaatgtgc ttccacaggg atggaaagga tcaccagcaa tattccaaag 2580 tagcatgaca aaaatcttag agccttttag aaaacaaaat ccagacatag ttatctatca 2640 atacatggat gatttgtatg taggatctga cttagaaata gggcagcata gaacaaaaat 2700 agaggagctg agacaacatc tgttgaggtg gggacttacc acaccagaca aaaaacatca 2760 gaaagaacct ccattccttt ggatgggtta tgaactccat cctgataaat ggacagtaca 2820 gcctatagtg ctgccagaaa aagacagctg gactgtcaat gacatacaga agttagtggg 2880 gaaattgaat tgggcaagtc agatttaccc agggattaaa gtaaggcaat tatgtaaact 2940 ccttagagga accaaagcac taacagaagt aataccacta acagaagaag cagagctaga 3000 actggcagaa aacagagaga ttctaaaaga accagtacat ggagtgtatt atgacccatc 3060 aaaagactta atagcagaaa tacagaagca ggggcaaggc caatggacat atcaaattta 3120 tcaagagcca tttaaaaatc tgaaaacagg aaaatatgca agaatgaggg gtgcccacac 3180 taatgatgta aaacaattaa cagaggcagt gcaaaaaata accacagaaa gcatagtaat 3240 atggggaaag actcctaaat ttaaactgcc catacaaaag gaaacatggg aaacatggtg 3300 gacagagtat tggcaagcca cctggattcc tgagtgggag tttgttaata cccctccctt 3360 agtgaaatta tggtaccagt tagagaaaga acccatagta ggagcagaaa ccttctatgt 3420 agatggggca gctaacaggg agactaaatt aggaaaagca ggatatgtta ctaatagagg 3480 aagacaaaaa gttgtcaccc taactgacac aacaaatcag aagactgagt tacaagcaat 3540 ttatctagct ttgcaggatt cgggattaga agtaaacata gtaacagact cacaatatgc 3600 attaggaatc attcaagcac aaccagatca aagtgaatca gagttagtca atcaaataat 3660 agagcagtta ataaaaaagg aaaaggtcta tctggcatgg gtaccagcac acaaaggaat 3720 tggaggaaat gaacaagtag ataaattagt cagtgctgga atcaggaaag tactattttt 3780 agatggaata gataaggccc aagatgaaca tgagaaatat cacagtaatt ggagagcaat 3840 ggctagtgat tttaacctgc cacctgtagt agcaaaagaa atagtagcca gctgtgataa 3900 atgtcagcta aaaggagaag ccatgcatgg acaagtagac tgtagtccag gaatatggca 3960 actagattgt acacatttag aaggaaaagt tatcctggta gcagttcatg tagccagtgg 4020 atatatagaa gcagaagtta ttccagcaga aacagggcag gaaacagcat attttctttt 4080 aaaattagca ggaagatggc cagtaaaaac aatacatact gacaatggca gcaatttcac 4140 cggtgctacg gttagggccg cctgttggtg ggcgggaatc aagcaggaat ttggaattcc 4200 ctacaatccc caaagtcaag gagtagtaga atctatgaat aaagaattaa agaaaattat 4260 aggacaggta agagatcagg ctgaacatct taagacagca gtacaaatgg cagtattcat 4320 ccacaatttt aaaagaaaag gggggattgg ggggtacagt gcaggggaaa gaatagtaga 4380 cataatagca acagacatac aaactaaaga attacaaaaa caaattacaa aaattcaaaa 4440 ttttcgggtt tattacaggg acagcagaaa tccactttgg aaaggaccag caaagctcct 4500 ctggaaaggt gaaggggcag tagtaataca agataatagt gacataaaag tagtgccaag 4560 aagaaaagca aagatcatta gggattatgg aaaacagatg gcaggtgatg attgtgtggc 4620 aagtagacag gatgaggatt agaacatgga aaagtttagt aaaacaccat atgtatgttt 4680 cagggaaagc taggggatgg ttttatagac atcactatga aagccctcat ccaagaataa 4740 gttcagaagt acacatccca ctaggggatg ctagattggt aataacaaca tattggggtc 4800 tgcatacagg agaaagagac tggcatttgg gtcagggagt ctccatagaa tggaggaaaa 4860 agagatatag cacacaagta gaccctgaac tagcagacca actaattcat ctgtattact 4920 ttgactgttt ttcagactct gctataagaa aggccttatt aggacacata gttagcccta 4980 ggtgtgaata tcaagcagga cataacaagg taggatctct acaatacttg gcactagcag 5040 cattaataac accaaaaaag ataaagccac ctttgcctag tgttacgaaa ctgacagagg 5100 atagatggaa caagccccag aagaccaagg gccacagagg gagccacaca atgaatggac 5160 actagagctt ttagaggagc ttaagaatga agctgttaga cattttccta ggatttggct 5220 ccatggctta gggcaacata tctatgaaac ttatggggat acttgggcag gagtggaagc 5280 cataataaga attctgcaac aactgctgtt tatccatttt cagaattggg tgtcgacata 5340 gcagaatagg cgttactcga cagaggagag caagaaatgg agccagtaga tcctagacta 5400 gagccctgga agcatccagg aagtcagcct aaaactgctt gtaccaattg ctattgtaaa 5460 aagtgttgct ttcattgcca agtttgtttc ataacaaaag ccttaggcat ctcctatggc 5520 aggaagaagc ggagacagcg acgaagagct catcagaaca gtcagactca tcaagcttct 5580 ctatcaaagc agtaagtagt acatgtaatg caacctatac caatagtagc aatagtagca 5640 ttagtagtag caataataat agcaatagtt gtgtggtcca tagtaatcat agaatatagg 5700 aaaatattaa gacaaagaaa aatagacagg ttaattgata gactaataga aagagcagaa 5760 gacagtggca atgagagtga aggagaaata tcagcacttg tggagatggg ggtggagatg 5820 gggcaccatg ctccttggga tgttgatgat ctgtagtgct acagaaaaat tgtgggtcac 5880 agtctattat ggggtacctg tgtggaagga agcaaccacc actctatttt gtgcatcaga 5940 tgctaaagca tatgatacag aggtacataa tgtttgggcc acacatgcct gtgtacccac 6000 agaccccaac ccacaagaag tagtattggt aaatgtgaca gaaaatttta acatgtggaa 6060 aaatgacatg gtagaacaga tgcatgagga tataatcagt ttatgggatc aaagcctaaa 6120 gccatgtgta aaattaaccc cactctgtgt tagtttaaag tgcactgatt tgaagaatga 6180 tactaatacc aatagtagta gcgggagaat gataatggag aaaggagaga taaaaaactg 6240 ctctttcaat atcagcacaa gcataagagg taaggtgcag aaagaatatg cattttttta 6300 taaacttgat ataataccaa tagataatga tactaccagc tataagttga caagttgtaa 6360 cacctcagtc attacacagg cctgtccaaa ggtatccttt gagccaattc ccatacatta 6420 ttgtgccccg gctggttttg cgattctaaa atgtaataat aagacgttca atggaacagg 6480 accatgtaca aatgtcagca cagtacaatg tacacatgga attaggccag tagtatcaac 6540 tcaactgctg ttaaatggca gtctagcaga agaagaggta gtaattagat ctgtcaattt 6600 cacggacaat gctaaaacca taatagtaca gctgaacaca tctgtagaaa ttaattgtac 6660 aagacccaac aacaatacaa gaaaaagaat ccgtatccag agaggaccag ggagagcatt 6720 tgttacaata ggaaaaatag gaaatatgag acaagcacat tgtaacatta gtagagcaaa 6780 atggaataac actttaaaac agatagctag caaattaaga gaacaatttg gaaataataa 6840 aacaataatc tttaagcaat cctcaggagg ggacccagaa attgtaacgc acagttttaa 6900 ttgtggaggg gaatttttct actgtaattc aacacaactg tttaatagta cttggtttaa 6960 tagtacttgg agtactgaag ggtcaaataa cactgaagga agtgacacaa tcaccctccc 7020 atgcagaata aaacaaatta taaacatgtg gcagaaagta ggaaaagcaa tgtatgcccc 7080 tcccatcagt ggacaaatta gatgttcatc aaatattaca gggctgctat taacaagaga 7140 tggtggtaat agcaacaatg agtccgagat cttcagacct ggaggaggag atatgaggga 7200 caattggaga agtgaattat ataaatataa agtagtaaaa attgaaccat taggagtagc 7260 acccaccaag gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc 7320 tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcct caatgacgct 7380 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 7440 ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca 7500 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg 7560 ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 7620 atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa 7680 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 7740 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 7800 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 7860 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 7920 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 7980 tggagagaga gacagagaca gatccattcg attagtgaac ggatccttgg cacttatctg 8040 ggacgatctg cggagcctgt gcctcttcag ctaccaccgc ttgagagact tactcttgat 8100 tgtaacgagg attgtggaac ttctgggacg cagggggtgg gaagccctca aatattggtg 8160 gaatctccta cagtattgga gtcaggaact aaagaatagt gctgttagct tgctcaatgc 8220 cacagccata gcagtagctg aggggacaga tagggttata gaagtagtac aaggagcttg 8280 tagagctatt cgccacatac ctagaagaat aagacagggc ttggaaagga ttttgctata 8340 agatgggtgg caagtggtca aaaagtagtg tgattggatg gcctactgta agggaaagaa 8400 tgagacgagc tgagccagca gcagataggg tgggagcagc atctcgagac ctggaaaaac 8460 atggagcaat cacaagtagc aatacagcag ctaccaatgc tgcttgtgcc tggctagaag 8520 cacaagagga ggaggaggtg ggttttccag tcacacctca ggtaccttta agaccaatga 8580 cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga ctggaagggc 8640 taattcactc ccaaagaaga caagatatcc ttgatctgtg gatctaccac acacaaggct 8700 acttccctga ttagcagaac tacacaccag ggccaggggt cagatatcca ctgacctttg 8760 gatggtgcta caagctagta ccagttgagc cagataagat agaagaggcc aataaaggag 8820 agaacaccag cttgttacac cctgtgagcc tgcatgggat ggatgacccg gagagagaag 8880 tgttagagtg gaggtttgac agccgcctag catttcatca cgtggcccga gagctgcatc 8940 cggagtactt caagaactgc tgacatcgag cttgctacaa gggactttcc gctggggact 9000 ttccagggag gcgtggcctg ggcgggactg gggagtggcg agccctcaga tcctgcatat 9060 aagcagctgc tttttgcctg tactgggtct ctctggttag accagatctg agcctgggag 9120 ctctctggct aactagggaa cccactgctt aagcctcaat aaagcttgcc ttgagtgctt 9180 c 9181 15 29 RNA Homo sapiens 15 ggcagaucug agccugggag cucucugcc 29 16 52 RNA Homo sapiens 16 uuuuuuaggg aagaucuggc cuuccuacaa gggaaggcca gggaauuuuc uu 52 17 9353 DNA Homo sapiens 17 ttgggggcga cactccacca tagatcactc ccctgtgagg aactactgtc ttcacgcaga 60 aagcgtctag ccatggcgtt agtatgagtg ttgtgcagcc tccaggaccc cccctcccgg 120 gagagccata gtggtctgcg gaaccggtga gtacaccgga attgccagga cgaccgggtc 180 ctttcttgga tcaacccgct caatgcctgg agatttgggc gtgcccccgc gagactgcta 240 gccgagtagt gttgggtcgc gaaaggcctt gtggtactgc ctgatagggt gcttgcgagt 300 gccccgggag gtctcgtaga ccgtgcatca tgagcacaaa tcctaaacct caaagaaaaa 360 ccaaacgtaa caccaaccgc cgcccacagg acgttaagtt cccgggcggt ggtcagatcg 420 ttggtggagt ttacctgttg ccgcgcaggg gccccaggtt gggtgtgcgc gcgactagga 480 agacttccga gcggtcgcaa cctcgtggaa ggcgacaacc tatccccaag gctcgccggc 540 ccgagggtag gacctgggct cagcccgggt acccttggcc cctctatggc aacgagggta 600 tggggtgggc aggatggctc ctgtcacccc gtggctctcg gcctagttgg ggccccacag 660 acccccggcg taggtcgcgt aatttgggta aggtcatcga tacccttaca tgcggcttcg 720 ccgacctcat ggggtacatt ccgcttgtcg gcgcccccct agggggcgct gccagggccc 780 tggcacatgg tgtccgggtt ctggaggacg gcgtgaacta tgcaacaggg aatctgcccg 840 gttgctcttt ctctatcttc ctcttagctt tgctgtcttg tttgaccatc ccagcttccg 900 cttacgaggt gcgcaacgtg tccgggatat accatgtcac gaacgactgc tccaactcaa 960 gtattgtgta tgaggcagcg gacatgatca tgcacacccc cgggtgcgtg ccctgcgtcc 1020 gggagagtaa tttctcccgt tgctgggtag cgctcactcc cacgctcgcg gccaggaaca 1080 gcagcatccc caccacgaca atacgacgcc acgtcgattt gctcgttggg gcggctgctc 1140 tctgttccgc tatgtacgtt ggggatctct gcggatccgt ttttctcgtc tcccagctgt 1200 tcaccttctc acctcgccgg tatgagacgg tacaagattg caattgctca atctatcccg 1260 gccacgtatc aggtcaccgc atggcttggg atatgatgat gaactggtca cctacaacgg 1320 ccctagtggt atcgcagcta ctccggatcc cacaagccgt cgtggacatg gtggcggggg 1380 cccactgggg tgtcctagcg ggccttgcct actattccat ggtggggaac tgggctaagg 1440 tcttgattgt gatgctactc tttgctggcg ttgacgggca cacccacgtg acagggggaa 1500 gggtagcctc cagcacccag agcctcgtgt cctggctctc acaaggccca tctcagaaaa 1560 tccaactcgt gaacaccaac ggcagctggc acatcaacag gaccgctctg aattgcaatg 1620 actccctcca aactgggttc attgctgcgc tgttctacgc acacaggttc aacgcgtccg 1680 ggtgcccaga gcgcatggct agctgccgcc ccatcgatga gttcgctcag gggtggggtc 1740 ccatcactca tgatatgcct gagagctcgg accagaggcc atattgctgg cactacgcgc 1800 ctcgaccgtg cgggatcgtg cctgcgtcgc aggtgtgtgg tccagtgtat tgcttcactc 1860 cgagccctgt tgtagtgggg acgaccgatc gtttcggcgc tcctacgtat agctgggggg 1920 agaatgagac agacgtgctg ctacttagca acacgcggcc gcctcaaggc aactggtttg 1980 ggtgcacgtg gatgaacagc actgggttca ccaagacgtg cgggggccct ccgtgcaaca 2040 tcgggggggt cggcaacaac accttggtct gccccacgga ttgcttccgg aagcaccccg 2100 aggccactta cacaaagtgt ggctcggggc cctggttgac acccaggtgc atggttgact 2160 acccatacag gctctggcac tacccctgca ctgttaactt taccgtcttt aaggtcagga 2220 tgtatgtggg gggcgtggag cacaggctca atgctgcatg caattggact cgaggagagc 2280 gctgtgactt ggaggacagg gataggtcag aactcagccc gctgctgctg tctacaacag 2340 agtggcagat actgccctgt tccttcacca ccctaccggc cctgtccact ggcttgatcc 2400 atcttcaccg gaacatcgtg gacgtgcaat acctgtacgg tatagggtcg gcagttgtct 2460 cctttgcaat caaatgggag tatatcctgt tgcttttcct tcttctggcg gacgcgcgcg 2520 tctgtgcctg cttgtggatg atgctgctga tagcccaggc tgaggccacc ttagagaacc 2580 tggtggtcct caatgcggcg tctgtggccg gagcgcatgg ccttctctcc ttcctcgtgt 2640 tcttctgcgc cgcctggtac atcaaaggca ggctggtccc tggggcggca tatgctctct 2700 atggcgtatg gccgttgctc ctgctcttgc tggccttacc accacgagct tatgccatgg 2760 accgagagat ggctgcatcg tgcggaggcg cggtttttgt aggtctggta ctcttgacct 2820 tgtcaccata ctataaggtg ttcctcgcta ggctcatatg gtggttacaa tattttatca 2880 ccagagccga ggcgcacttg caagtgtggg tcccccctct caatgttcgg ggaggccgcg 2940 atgccatcat cctccttaca tgcgcggtcc atccagagct aatctttgac atcaccaaac 3000 tcctgctcgc catactcggt ccgctcatgg tgctccaggc tggcataact agagtgccgt 3060 actttgtacg cgctcagggg ctcatccgtg catgcatgtt agtgcggaag gtcgctggag 3120 gccactatgt ccaaatggcc ttcatgaagc tggccgcgct gacaggtacg tacgtatatg 3180 accatcttac tccactgcgg gattgggccc acgcgggcct acgagacctt gcggtggcag 3240 tagagcccgt cgtcttctct gacatggaga ctaaactcat cacctggggg gcagacaccg 3300 cggcgtgtgg ggacatcatc tcgggtctac cagtctccgc ccgaaggggg aaggagatac 3360 ttctaggacc ggccgatagt tttggagagc aggggtggcg gctccttgcg cctatcacgg 3420 cctattccca acaaacgcgg ggcctgcttg gctgtatcat cactagcctc acaggtcggg 3480 acaagaacca ggtcgatggg gaggttcagg tgctctccac cgcaacgcaa tctttcctgg 3540 cgacctgcgt caatggcgtg tgttggaccg tctaccatgg tgccggctcg aagaccctgg 3600 ccggcccgaa gggtccaatc acccaaatgt acaccaatgt agaccaggac ctcgtcggct 3660 ggccggcgcc ccccggggcg cgctccatga caccgtgcac ctgcggcagc tcggaccttt 3720 acttggtcac gaggcatgct gatgtcgttc cggtgcgccg gcggggcgac agcaggggga 3780 gcctgctttc ccccaggccc atctcctacc tgaagggctc ctcgggtgga ccactgcttt 3840 gcccttcggg gcacgttgta ggcatcttcc gggctgctgt gtgcacccgg ggggttgcga 3900 aggcggtgga cttcataccc gttgagtcta tggaaactac catgcggtct ccggtcttca 3960 cagacaactc atcccctccg gccgtaccgc aaacattcca agtggcacat ttacacgctc 4020 ccactggcag cggcaagagc accaaagtgc cggctgcata tgcagcccaa gggtacaagg 4080 tgctcgtcct aaacccgtcc gttgccgcca cattgggctt tggagcgtat atgtccaagg 4140 cacatggcat cgagcctaac atcagaactg gggtaaggac catcaccacg ggcggcccca 4200 tcacgtactc cacctattgc aagttccttg ccgacggtgg atgctccggg ggcgcctatg 4260 acatcataat atgtgatgaa tgccactcaa ctgactcgac taccatcttg ggcatcggca 4320 cagtcctgga tcaggcagag acggctggag cgcggctcgt cgtgctcgcc accgccacgc 4380 ctccgggatc gatcaccgtg ccacacccca acatcgagga agtggccctg tccaacactg 4440 gagagattcc cttctatggc aaagccatcc ccattgaggc catcaagggg ggaaggcatc 4500 tcatcttctg ccattccaag aagaagtgtg acgagctcgc cgcaaagctg acaggcctcg 4560 gactcaatgc tgtagcgtat taccggggtc tcgatgtgtc cgtcataccg actagcggag 4620 acgtcgttgt cgtggcaaca gacgctctaa tgacgggttt taccggcgac tttgactcag 4680 tgatcgactg caacacatgt gtcacccaga cagtcgattt cagcttggat cccaccttca 4740 ccattgagac gacaacgctg ccccaagacg cggtgtcgcg tgcgcagcgg cgaggtagga 4800 ctggcagggg caggagtggc atctacaggt ttgtgactcc aggagaacgg ccctcaggca 4860 tgttcgactc ctcggtcctg tgtgagtgct atgacgcagg ctgcgcttgg tatgagctca 4920 cgcccgctga gacctcggtt aggttgcggg cttacctaaa tacaccaggg ttgcccgtct 4980 gccaggacca cctagagttc tgggagagcg tcttcacagg cctcacccac atagatgccc 5040 acttcttgtc ccagaccaaa caggcaggag acaacctccc ctacctggta gcataccaag 5100 ccacagtgtg cgccagggct caggctccac ctccatcgtg ggaccaaatg tggaagtgtc 5160 tcatacggct aaagcccaca ctgcatgggc caacgcccct gctgtacagg ctaggagccg 5220 ttcaaaatga ggtcactctc acacacccca taaccaaata catcatggca tgcatgtcgg 5280 ctgacctgga ggtcgtcact agcacctggg tgctagtagg cggagtcctt gcggctctgg 5340 ccgcgtactg cctgacgaca ggcagcgtgg tcattgtggg caggatcatc ttgtccggga 5400 ggccagctgt tattcccgac agggaagtcc tctaccagga gttcgatgag atggaagagt 5460 gtgcttcaca cctcccttac atcgagcaag gaatgcagct cgccgagcaa ttcaaacaga 5520 aggcgctcgg attgctgcaa acagccacca agcaagcgga ggctgctgct cccgtggtgg 5580 agtccaagtg gcgagccctt gaggtcttct gggcgaaaca catgtggaac ttcatcagcg 5640 ggatacagta cttggcaggc ctatccactc tgcctggaaa ccccgcgata gcatcattga 5700 tggcttttac agcctctatc accagcccgc tcaccaccca aaataccctc ctgtttaaca 5760 tcttgggggg atgggtggct gcccaactcg ctccccccag cgctgcttcg gctttcgtgg 5820 gcgccggcat tgccggtgcg gccgttggca gcataggtct cgggaaggta cttgtggaca 5880 ttctggcggg ctatggggcg ggggtggctg gcgcactcgt ggcctttaag gtcatgagcg 5940 gcgagatgcc ctccactgag gatctggtta atttactccc tgccatcctt tctcctggcg 6000 ccctggttgt cggggtcgtg tgcgcagcaa tactgcgtcg gcacgtgggc ccgggagagg 6060 gggctgtgca gtggatgaac cggctgatag cgttcgcttc gcggggtaac cacgtctccc 6120 ccacgcacta tgtgcccgag agcgacgccg cggcgcgtgt tactcagatc ctctccagcc 6180 ttaccatcac tcagttgctg aagaggcttc atcagtggat taatgaggac tgctccacgc 6240 cttgttccgg ctcgtggcta aaggatgttt gggactggat atgcacggtg ttgagtgact 6300 tcaagacttg gctccagtcc aagctcctgc cgcggttacc gggactccct ttcctgtcat 6360 gccaacgcgg gtacaaggga gtctggcggg gggatggcat catgcaaacc acctgcccat 6420 gtggagcaca gatcaccgga catgtcaaaa atggctccat gaggattgtt gggccaaaaa 6480 cctgcagcaa cacgtggcat ggaacattcc ccatcaacgc atacaccacg ggcccctgca 6540 cgccctcccc agcgccgaac tattccaggg cgctgtggcg ggtggctgct gaggagtacg 6600 tggaggttac gcgggtgggg gatttccact acgtgacggg catgaccact gacaacgtga 6660 aatgcccatg ccaggttcca gcccctgaat ttttcacgga ggtggatgga gtacggttgc 6720 acaggtatgc tccagtgtgc aaacctctcc tacgagagga ggtcgtattc caggtcgggc 6780 tcaaccagta cctggtcggg tcacagctcc catgtgagcc cgaaccggat gtggcagtgc 6840 tcacttccat gctcaccgac ccctctcata ttacagcaga gacggccaag cgtaggctgg 6900 ccagggggtc tcccccctcc ttggccagct cttcagctag ccagttgtct gcgccttctt 6960 tgaaggcgac atgtactacc catcatgact ccccggacgc tgacctcatc gaggccaacc 7020 tcctgtggcg gcaggagatg ggcgggaaca tcacccgtgt ggagtcagaa aataaggtgg 7080 taatcctgga ctctttcgat ccgattcggg cggtggagga tgagagggaa atatccgtcc 7140 cggcggagat cctgcgaaaa cccaggaagt tccccccagc gttgcccata tgggcacgcc 7200 cggattacaa ccctccactg ctagagtcct ggaaggaccc ggactacgtc cccccggtgg 7260 tacacgggtg ccctttgcca tctaccaagg cccccccaat accacctcca cggaggaaga 7320 ggacggttgt cctgacagag tccaccgtgt cttctgcctt ggcggagctc gctactaaga 7380 cctttggcag ctccgggtcg tcggccgttg acagcggcac ggcgactggc cctcccgatc 7440 aggcctccga cgacggcgac aaaggatccg acgttgagtc gtactcctcc atgccccccc 7500 tcgagggaga gccaggggac cccgacctca gcgacgggtc ttggtctacc gtgagcgggg 7560 aagctggtga ggacgtcgtc tgctgctcaa tgtcctatac atggacaggt gccttgatca 7620 cgccatgcgc tgcggaggag agcaagttgc ccatcaatcc gttgagcaac tctttgctgc 7680 gtcaccacag tatggtctac tccacaacat ctcgcagcgc aagtctgcgg cagaagaagg 7740 tcacctttga cagactgcaa gtcctggacg accactaccg ggacgtgctc aaggagatga 7800 aggcgaaggc gtccacagtt aaggctaggc ttctatctat agaggaggcc tgcaaactga 7860 cgcccccaca ttcggccaaa tccaaatttg gctacggggc gaaggacgtc cggagcctat 7920 ccagcagggc cgtcaaccac atccgctccg tgtgggagga cttgctggaa gacactgaaa 7980 caccaattga taccaccatc atggcaaaaa atgaggtttt ctgcgtccaa ccagagaaag 8040 gaggccgcaa gccagctcgc cttatcgtat tcccagacct gggggtacgt gtatgcgaga 8100 agatggccct ttacgacgtg gtctccaccc ttcctcaggc cgtgatgggc ccctcatacg 8160 gattccagta ctctcctggg cagcgggtcg agttcctggt gaatacctgg aaatcaaaga 8220 aatgccctat gggcttctca tatgacaccc gctgctttga ctcaacggtc actgagaatg 8280 acatccgtac tgaggaatca atttaccaat gttgtgactt ggcccccgaa gccaggcagg 8340 ccataaggtc gctcacagag cggctttatg tcgggggtcc cctgactaat tcgaaggggc 8400 agaactgcgg ttatcgccgg tgccgcgcaa gtggcgtgct gacgactagc tgcggcaaca 8460 cgatgctcgt gaacggagac gaccttgtcg ttatctgtga gagtgcggga acccaggagg 8520 atgcggcggc cctacgagcc ttcacggagg ctatgactag gtattccgcc ccccccgggg 8580 acccgcccca accagaatac gacttggagc tgataacgtc atgctcctcc aatgtgtcgg 8640 tcgcgcacga tgcatccggc aaaagggtgt actacctcac ccgtgacccc accacccccc 8700 tcgcacgggc tgcgtgggag acagttagac acactccagt caactcctgg ctaggcaata 8760 tcatcatgta tgcgcccacc ctatgggcga ggatgattct gatgactcat ttcttctcta 8820 tccttctagc tcaggagcaa cttgaaaaag ccctggattg tcagatctac ggggcctgtt 8880 actccattga gccacttgac ctacctcaga tcattgaacg actccatggt cttagcgcat 8940 tttcactcca cagttactct ccaggtgaga tcaatagggt ggcttcatgc ctcaggaaac 9000 ttggggtacc gcctttgcga gtctggagac atcgggccag aagtgtccgc gctaagctac 9060 tgtcccaggg ggggagggct gccacttgcg gcaagtacct cttcaactgg gcagtaaaga 9120 ccaagcttaa actcactcca atcccggctg cgtcccagct agacttgtcc ggctggttcg 9180 ttgctggtta caacggggga gacatatatc acagcctgtc tcgtgcccga ccccgttggt 9240 tcatgttgtg cctactccta ctttctgtag gggtaggcat ctacctgctc cccaaccggt 9300 gaacggggag ctaaccactc caggccaata ggccattccc tttttttttt ttc 9353 18 328 RNA Homo sapiens 18 uugggggcga cacuccacca uagaucacuc cccugugagg aacuacuguc uucacgcaga 60 aagcgucuag ccauggcguu aguaugagug uugugcagcc uccaggaccc ccccucccgg 120 gagagccaua guggucugcg gaaccgguga guacaccgga auugccagga cgaccggguc 180 cuuucuugga ucaacccgcu caaugccugg agauuugggc gugcccccgc gagacugcua 240 gccgaguagu guugggucgc gaaaggccuu gugguacugc cugauagggu gcuugcgagu 300 gccccgggag gucucguaga ccgugcau 328 19 14 RNA Homo sapiens 19 auuugggcgu gccc 14 20 27 RNA Homo sapiens 20 gccgaguagu guugggucgc gaaaggc 27 21 340 DNA Homo sapiens 21 atgggcggag ggaagctcat cagtggggcc acgagctgag tgcgtcctgt cactccactc 60 ccatgtccct tgggaaggtc tgagactagg gccagaggcg gccctaacag ggctctccct 120 gagcttcagg gaggtgagtt cccagagaac ggggctccgc gcgaggtcag actgggcagg 180 agatgccgtg gaccccgccc ttcggggagg ggcccggcgg atgcctcctt tgccggagct 240 tggaacagac tcacggccag cgaagtgagt tcaatggctg aggtgaggta ccccgcaggg 300 gacctcataa cccaattcag accactctcc tccgcccatt 340 22 349 DNA Homo sapiens 22 gaggaaagtc cgggctcaca cagtctgaga tgattgtagt gttcgtgctt gatgaaacaa 60 taaatcaagg cattaatttg acggcaatga aatatcctaa gtctttcgat atggatagag 120 taatttgaaa gtgccacagt gacgtagctt ttatagaaat ataaaaggtg gaacgcggta 180 aacccctcga gtgagcaatc caaatttggt aggagcactt gtttaacgga attcaacgta 240 taaacgagac acacttcgcg aaatgaagtg gtgtagacag atggttatca cctgagtacc 300 agtgtgacta gtgcacgtga tgagtacgat ggaacagaac gcggcttat 349 23 377 DNA Homo sapiens 23 gaagctgacc agacagtcgc cgcttcgtcg tcgtcctctt cgggggagac gggcggaggg 60 gaggaaagtc cgggctccat agggcagggt gccaggtaac gcctgggggg gaaacccacg 120 accagtgcaa cagagagcaa accgccgatg gcccgcgcaa gcgggatcag gtaagggtga 180 aagggtgcgg taagagcgca ccgcgcggct ggtaacagtc cgtggcacgg taaactccac 240 ccggagcaag gccaaatagg ggttcataag gtacggcccg tactgaaccc gggtaggctg 300 cttgagccag tgagcgattg ctggcctaga tgaatgactg tccacgacag aacccggctt 360 atcggtcagt ttcacct 377 24 38110 DNA Homo sapiens 24 ccaccggtta cgatcttgcc gaccatggcc ccacaatagg gccggggaga cccggcgtca 60 gtggtgggcg gcacggtcag taacgtctgc gcaacacggg gttgactgac gggcaatatc 120 ggctccatag cgtcggccgc ggatacagta aaggagcatt ctgtgacgga aaagacgccc 180 gacgacgtct tcaaacttgc caaggacgag aaggtcgaat atgtcgacgt ccggttctgt 240 gacctgcctg gcatcatgca gcacttcacg attccggctt cggcctttga caagagcgtg 300 tttgacgacg gcttggcctt tgacggctcg tcgattcgcg ggttccagtc gatccacgaa 360 tccgacatgt tgcttcttcc cgatcccgag acggcgcgca tcgacccgtt ccgcgcggcc 420 aagacgctga atatcaactt ctttgtgcac gacccgttca ccctggagcc gtactcccgc 480 gacccgcgca acatcgcccg caaggccgag aactacctga tcagcactgg catcgccgac 540 accgcatact tcggcgccga ggccgagttc tacattttcg attcggtgag cttcgactcg 600 cgcgccaacg gctccttcta cgaggtggac gccatctcgg ggtggtggaa caccggcgcg 660 gcgaccgagg ccgacggcag tcccaaccgg ggctacaagg tccgccacaa gggcgggtat 720 ttcccagtgg cccccaacga ccaatacgtc gacctgcgcg acaagatgct gaccaacctg 780 atcaactccg gcttcatcct ggagaagggc caccacgagg tgggcagcgg cggacaggcc 840 gagatcaact accagttcaa ttcgctgctg cacgccgccg acgacatgca gttgtacaag 900 tacatcatca agaacaccgc ctggcagaac ggcaaaacgg tcacgttcat gcccaagccg 960 ctgttcggcg acaacgggtc cggcatgcac tgtcatcagt cgctgtggaa ggacggggcc 1020 ccgctgatgt acgacgagac gggttatgcc ggtctgtcgg acacggcccg tcattacatc 1080 ggcggcctgt tacaccacgc gccgtcgctg ctggccttca ccaacccgac ggtgaactcc 1140 tacaagcggc tggttcccgg ttacgaggcc ccgatcaacc tggtctatag ccagcgcaac 1200 cggtcggcat gcgtgcgcat cccgatcacc ggcagcaacc cgaaggccaa gcggctggag 1260 ttccgaagcc ccgactcgtc gggcaacccg tatctggcgt tctcggccat gctgatggca 1320 ggcctggacg gtatcaagaa caagatcgag ccgcaggcgc ccgtcgacaa ggatctctac 1380 gagctgccgc cggaagaggc cgcgagtatc ccgcagactc cgacccagct gtcagatgtg 1440 atcgaccgtc tcgaggccga ccacgaatac ctcaccgaag gaggggtgtt cacaaacgac 1500 ctgatcgaga cgtggatcag tttcaagcgc gaaaacgaga tcgagccggt caacatccgg 1560 ccgcatccct acgaattcgc gctgtactac gacgtttaag gactcttcgc agtccgggtg 1620 tagagggagc ggcgtgtcgt tgccagggcg ggcgtcgagg tttttcgatg ggtgacggtg 1680 gccggcaacg gcgcgccgac caccgctgcg aagagcccgt ttaagaacgt tcaaggacgt 1740 ttcagccggg tgccacaacc cgcttggcaa tcatctcccg accgccgagc gggttgtctt 1800 tcacatgcgc cgaaactcaa gccacgtcgt cgcccaggcg tgtcgtcgcg gccggttcag 1860 gttaagtgtc ggggattcgt cgtgcgggcg ggcgtccacg ctgaccaacg gggcagtcaa 1920 ctcccgaaca ctttgcgcac taccgccttt gcccgccgcg tcacccgtag gtagttgtcc 1980 aggaattccc caccgtcgtc gtttcgccag ccggccgcga ccgcgaccgc attgagctgg 2040 cgcccgggtc ccggcagctg gtcggtgggc ttgccgcgca ccaacaccag cgcgttgcgg 2100 gcccgggtgg cggtcagcca ggcctgacgg agcagctcca cgtcggctgc gggaaccaga 2160 tcggcggccg cgatgacatc cagggattgc agcgtcgagg tgttgtgcag ggcgggaacc 2220 tggtgcgcat gctgtagctg cagcaactgc acggtccatt cgatgtcggc cagtccgccg 2280 cggcccagtt tggtgtgtgt gttggggtcg gcaccgcgcg gcaaccgctc ggactcgata 2340 cgggccttga tgcggcgaat ctcgcgcacc gagtcagcgg acacaccgtc gggcggatac 2400 cgcgttttgt cgaccatccg taggaatcgc tgacccaact cggcatcgcc ggcaaccgcg 2460 tgtgcgcgta gcagggcctg gatctcccat ggctgtgccc actgctcgta gtatgcggcg 2520 taggacccca gggtgcggac cagcggaccg ttgcggccct cgggtcgcaa attggcgtcg 2580 agctccagcg gcggatcgac gctgggtgtc cccagcagcg cccgaacccg ctcggcgatc 2640 gatgtcgacc atttcaccgc ccgtgcatcg tcgacgccgg tggccggctc acagacgaac 2700 atcacgtcgg catccgaccc gtagcccaac tcggcaccac ccagccgacc catgccgatg 2760 accgcgatgg ccgccggggc gcgatcgtcg tcgggaaggc tggcccggat catgacgtcc 2820 agcgcggcct gcagcaccgc cacccacacc gacgtcaacg cccggcacac ctcggtgacc 2880 tcgagcaggc cgagcaggtc cgccgaaccg atgcgggcca gctctcgacg acgcagcgtg 2940 cgcgcgccgg cgatggcccg ctccgggtcg gggtagcggc tcgccgaggc gatcagcgcc 3000 cgagccacgg cggcgggctc ggtctcgagc agcttcgggc ccgcaggccc gtcctcgtac 3060 tgctggatga cccgcggcgc gcgcatcaac agatccggca catacgccga ggtacccaag 3120 acatgcatga gccgcttggc caccgcgggc ttgtcccgca gcgtggccag gtaccagctt 3180 tcggtggcca gcgcctcact gagccgccgg taggccagca gtccgccgtc gggatcgggg 3240 gcatacgaca tccagtccag cagcctgggc agcagcaccg actgcacccg tccgcgccgg 3300 ccgctttgat tgaccaacgc cgacatgtgt ttcaacgcgg tctgcggtcc ctcgtagccc 3360 agcgcggcca gccggcgccc cgcggcctcc aacgtcatgc cgtgggcgat ctccaacccg 3420 gtcgggccga tcgattccag cagcggttga tagaagagtt tggtgtgtaa cttcgacacc 3480 cgcacgttct gcttcttgag ttcctcccgc agcaccccgg ccgcatcgtt tcggccatcg 3540 ggccggatgt gggccgcgcg cgccagccag cgcactgcct cctcgtcttc gggatcggga 3600 agcaggtggg tgcgcttgag ccgctgcaac tgcagtcggt gctcgagcag cctgaggaac 3660 tcatacgacg cggtcatgtt cgccgcgtcc tcacgcccga tgtagccgcc ttcgcccaac 3720 gccgccaatg cgtccaccgt ggacgccacc cgtaacgact cgtcgctacg ggcatgaacc 3780 agctgcagta gctgtacggc gaactccacg tcgcgcaatc cgccgctgcc gagtttgagc 3840 tcgcggccgc ggacatcggc gggcaccagc tgctccaccc gccgccgcat ggcctgcacc 3900 tcgaccacaa agtcttcgcg ctcgcaggct cgccacacca tcggcatcaa ggcggtcagg 3960 taacgctcgc caagttccgc gtcgccaacg actggccgtg ctttcagcaa cgcctgaaac 4020 tcccaggtct tggcccagcg ctggtagtag gcgatgtgcg actcgagcgt acggaccagc 4080 tccccgttgc gcccctccgg acgcagggcg gcgtccacct cgaaaaaggc cgccgaggcc 4140 acccgcatca tctcgctggc cacgcgcgcg ttgcgcgggt cggagcgctc ggcaacgaat 4200 atgacatcga cgtcgctgac gtagttcagt tcgcgcgcac cgcacttgcc catcgcgatg 4260 accgccaggc gcggtggcgg gtgctcgccg cacacgctcg cctcggccac gcgcagcgcc 4320 gccgccagag cggcgtccgc ggcgtccgcc aggcgtgcgg ccaccacggt gaatggcagc 4380 accggttcgt cctcgaccgt cgcggccagg tcgagagcgg ccagcattag cacgtagtcg 4440 cggtactggg ttcgcaatcg gtgcacgagc gagcccggca taccctccga ttcctcgacg 4500 cactcgacga acgaccgctg cagctggtca tgggacggca gtgtgacctt gccccgcagc 4560 aatttccagg actgcggatg ggcgaccagg tgatcgccca acgccagcga cgagcccagc 4620 accgagaaca gccgcccgcg cagactgcgt tcgcgcagca gagccgcgtt gagctcgtcc 4680 catccggtgt ctggattctc cgacagccgg atcaaggcgc gcagcgcggc atcggcgtcc 4740 ggagcgcgtg acagcgacca cagcaggtcg acgtgcgcct gatcctcgtg ccgatcccac 4800 cccagctgag ccagacgctc accagcaggg gggtcaacta atccgagccg gccaacgctg 4860 ggcaacttcg gccgctgcgt ggcgagtttg gtcacgacca cgacggtagc gcaaagcgcg 4920 tcggcgtcgg atcaaccggt agatctgggc tacagcgaca ggtaggtgcg cagctcgtat 4980 ggcgtgacgt ggctgcggta gttcgcccac tccgtgcgct tgttgcgcaa gaaaaagtca 5040 aaaacgtgct cccccaaggc ctccgcgacg agttcggagg cctccatggc gcgcagcgca 5100 ctatccaaac tggacggcaa ttctcggtac cccatcgctc ggcgttcctc gggtgtgagg 5160 tcccatacgt tgtcctcggc ctgcgggccc agcacgtaac ccttctctac accccgcaat 5220 cccgcggcca gcagcacggc gaatgtcaga tagggattgc acgccgaatc agggctgcgt 5280 acttcgaccc gccgcgacga ggtcttgtgc ggcgtgtaca tcggcacccg cactagggcg 5340 gatcggttgg cggcccccca cgacgcggcc gtgggcgctt cgccgccctg caccagccgc 5400 ttgtaagagt tgacccactg atttgtgacc gcgctgatct cgcaagcgtg ctccaggatc 5460 ccggcgatga acgatttacc cacttccgac agctgcagcg gatcatcagc gctgtggaac 5520 gcgttgacat caccctcgaa caggctcatg tgggtgtgca tcgccgagcc cgggtgctgg 5580 ccgaatggct tgggcatgaa cgacgcccgg gcgccctctt ccagcgcgac ttctttgatg 5640 acgtagcgga aggtcatcac gttgtcagcc atcgacagag cgtcggcaaa ccgcaggtcg 5700 atctcctgct ggccgggtgc gccttcgtga tggctgaact ccaccgagat gcccatgaat 5760 tccagggcat cgatcgcgtg gcggcgaaag ttcaaggcgg agtcgtgcac cgcttggtcg 5820 aaatagccgg cgttgtcgac cgggacgggc accgacccgt cctcgggtcc gggcttgagc 5880 aggaagaact cgatttcggg atgcacgtag caggagaagc cgagttcgcc ggccttcgtc 5940 agctgccgcc gcaacacgtg ccgcgggtcc gcccacgacg gcgagccgtc cggcatggtg 6000 atgtcgcaaa acatccgcgc tgagtggtgg tggccggaac tggtggccca gggcagcacc 6060 tggaaggtcg acgggtccgg gtgcgccacc gtatcggatt ccgagacccg cgcaaagccc 6120 tcgatcgagg atccgtcgaa gccgatgcct tcctcgaagg cgccctcgag ttcggctggg 6180 gcgatggcga ccgacttgag gaaaccgagc acgtctgtga accacagccg gacgaagcgg 6240 atgtcgcgtt cttccagggt acgaagaacg aattccttct gtcggtccat acctcgaaca 6300 gtatgcactg tctgttaaaa ccgtgttacc gatgcccggc cagaagcgtt gcggggcggc 6360 ccgcaagggg agtgcgcggt gagttcaggg cgcgcaccgc agactcgtcg gcggcaaggt 6420 cccgtcgaga aaatagtgca tcaccgcaga gtccacacac tggttgccat cgaacaccgc 6480 agtgtgttgg gtgccgtcga aggtgatcag cggtgcgccc agctggcggg ccaggtctac 6540 cccggactga tacggagtgg ccgggtcgtg ggtggtggac accacgacga ccttgccagc 6600 cccggccggc gccgcggggt gcggcgtcga cgttgccggc accggccaca gcgcgcacag 6660 atcgcggggg gcggatccgg tgaactgccc gtagctaagg aacggggcga cctgacggat 6720 ccgttggtcg gcggccaccc aggccgctgg atcggccggt gtgggcgcat cgacgcaccg 6780 gaccgcgttg aacgcgtcct ggtcgttgct gtagtgcccg tctgcatccc ggccgtcata 6840 gtcgtcggca agcaccagca agtcgccggc gtcgctgccg cgctgcagcc ccagcagacc 6900 actggtcagg tacttccagc gctgagggct gtacagcgcg ttgatggtgc ccgtcgtcgc 6960 gtcggcgtag ctcaggccac gtggatccga cgtcttaccc ggcttctgca ccagcgggtc 7020 aaccagggcg tggtagcggt tgacccactg ggccgagtcg gtgcccagag ggcaggccgg 7080 cgagcgggcg cagtcggcgg cgtagtcatt gaaagcggtc tgaaatcccg ccatttggct 7140 gatgctttcc tcgattgggc taacggctgg atcgatagcg ccgtcgagga ccatcgcccg 7200 cacatgagta ccgaaccgtt ccaggtaagc ggtgcccaac tcggtgccgt agctgtatcc 7260 gaggtagttg atctgatcgt cacctaacgc ttggcgaacc atgtccatgt cccgtgcgac 7320 ggacgcggta ccgatattgg ccaagaagct gaagcccatc cggtcaacac agtcctgggc 7380 caactgccgg tagacctgtt cgacgtgggt gacaccggcc ggactgtagt cggccatcgg 7440 atcgcgccgg tacgcgtcga actcggcgtc ggtgcgacac cgcaacgcag gggtcgagtg 7500 gccgacccct ctcgggtcga agcccaccag gtcgaagtgg cggagaatgt cggtgtcggc 7560 gatcgcgggt gccatagcgg cgaccatgtc gaccgccgac gccccgggtc ccccaggatt 7620 gaccagcagt gctccgaatc gctgtcccgt cgcggggacg cggatcaccg ccaacttcgc 7680 ttgtgtccca ccgggttggt cgtagtcgac ggggacggac accgtcgcgc agcgtgcagt 7740 gcgaatttcg ctggtgtcgg cgatgaactc gcggcagctg ttccaactct gttgcggcgc 7800 cacgaccggc gcacccgggg tttggccggc gccgggttct tcagtcgcgc cggccaacgg 7860 gggcgctgct aggggcagtc cgccgagcag caacccgaag gacagcagcg ccgagctcaa 7920 cggtctgcgg cgccacatgg ccgccatcgt ctcaccggcg aatacctgtg acggcgcgaa 7980 atgatcacac cttcgtttct tcgccccgct agcacttggc gccgctgggc ggcgtggtgc 8040 cgccgattaa atacgccgtc acgtactcgt caatgcagct gtcgccctgg aataccaccg 8100 tgtgctgggt tccgtcgaag gtcagcaacg aaccgcgaag ctggttcgcc aggtcgaccc 8160 cggccttgta cggcgtcgcc gggtcatggg tggtggatac caccaccgtc ggcactaggc 8220 cgggcgccga gacggcatgg ggctgacttg tgggtggcac cggccagaac gcgcaggtgc 8280 ccagcggcgc atcaccggtg aacttcccgt agctcatgaa cggtgcgatc tcccgggcgc 8340 ggcggtcttc gtcgatgacc ttgtcgcgat cggtaaccgg gggctgatcg acgcaattga 8400 tcgccacccg cgcgtcaccg gaattgttgt agcggccgtg cgagtcccga cgcatgtaca 8460 tgtcggccag agccagcagg gtgtctccgc gattgtcgac cagctccgac agcccgtcgg 8520 tcaagtgttg ccacagattc ggtgagtaca gcgccataat ggtgcccacg atggcgtcgc 8580 tataactcag cccgcgcgga tccttcgtgc gcgccggcct gctgatcctc gggttgtccg 8640 ggtcgaccaa cggatcgacc aggctgtggt agacctcgac ggctttggcc gggtcggcgc 8700 ccagcgggca gcccgcgttc ttggcgcagt cggcggcata gttgttgaac gcgtcctgga 8760 agcccttggc ctggcgcagc tccgcctcga tgggatcggc attggggtcg acggcaccgt 8820 cgagaatcat tgcccgcacc cgctgcggaa attcctcggc atacgcggag ccgatccggg 8880 tgccgtacga gtagcccagg taggtcagct tgtcgtcgcc caacgccgcg cgaatggcat 8940 ccaggtcctt ggcgacgttg accgtcccga catgggccag aaagttcttg cccatcttgt 9000 ccacacagcg accgacgaat tgcttggtct cgttctcgat gtgcgccaca ccctcccggc 9060 tgtagtcaac ctgcggctcg gcccgcagcc ggtcgttgtc ggcatcggag ttgcaccaga 9120 tcgccggccg ggacgacgcc accccgcggg ggtcgaaccc aaccaggtcg aacctttcgt 9180 gcacccgctt cggcaatgtc tggaagacgc ccaaggcggc ctcgataccg gattcgccgg 9240 gtccaccggg atttatgacc agcgaaccga tcttgtctcc cgtcgccgga aagcgaatca 9300 gcgccagcgc cgccacgtca ccatcggggc ggtcgtagtc gaccggtaca gcgagcttgc 9360 cgcataacgc gccgccgggg atctttactt gcgggtttga cgaccggcac ggtgtccact 9420 ccaccggctg gcccagcttc ggctccgcca tacgagcgcg tcccccgacc acgcggatgc 9480 agcccacaag aaccaacgcc acggcggcga gcgcggccca gatcaacagc atgcgcgcga 9540 tcttgtcgcg gcgagacagc ctcatgccca caatgctgcc agagcagacc cgagatcctg 9600 gccagcggcc accgtcggcc gactaaccgg ccgctgccag cagtcctgcc atcgccgatg 9660 gcgaactcgt cggccatccc ccatacgtcc ggtaacagat ccgggcaaga caccgacccg 9720 tcgaccggat ccggcacggg cgcgtcggcc tcggcggtgc acaactgcga catcaggttg 9780 gcgctggcac cccgtccacg ccggcatggt gcaccttggc catcgcccga gggcgatccc 9840 cgatgccgtc caccccttcg acgaacccat ctcccacggc ggtcgccggc agcgacgcga 9900 tgtggccgca gatctccgag agttcggccc gcccgcccgg cgacggcaac ccgatgccgt 9960 gcaagtgacg atcgatgtga ggttcaaggt tcagcgcact gctggcaagc tttttccgaa 10020 accgcggcct cgccttgatc tggagtcaga acgcgtcacg cagccggtca aaggcgtaac 10080 ccatgctcga gcaaacatgc atgggctgag tggacgtttc cagacacagc aactggcgtc 10140 caggccactg agccgctgca tgcgcgatgg tatgccgatg ggggccccgg gcgcgtctga 10200 ggggaagaag tggcagactg tcagggtccg acgaacccgg ggaccctaac gggccacgag 10260 gatcgacccg accaccatta gggacagtga tgtctgagca gactatctat ggggccaata 10320 cccccggagg ctccgggccg cggaccaaga tccgcaccca ccacctacag agatggaagg 10380 ccgacggcca caagtgggcc atgctgacgg cctacgacta ttcgacggcc cggatcttcg 10440 acgaggccgg catcccggtg ctgctggtcg gtgattcggc ggccaacgtc gtgtacggct 10500 acgacaccac cgtgccgatc tccatcgacg agctgatccc gctggtccgt ggcgtggtgc 10560 ggggtgcccc gcacgcactg gtcgtcgccg acctgccgtt cggcagctac gaggcggggc 10620 ccaccgccgc gttggccgcc gccacccggt tcctcaagga cggcggcgca catgcggtca 10680 agctcgaggg cggtgagcgg gtggccgagc aaatcgcctg tctgaccgcg gcgggcatcc 10740 cggtgatggc acacatcggc ttcaccccgc aaagcgtcaa caccttgggc ggcttccggg 10800 tgcagggccg cggcgacgcc gccgaacaaa ccatcgccga cgcgatcgcc gtcgccgaag 10860 ccggagcgtt tgccgtcgtg atggagatgg tgcccgccga gttggccacc cagatcaccg 10920 gcaagcttac cattccgacg gtcgggatcg gcgctgggcc caactgcgac ggccaggtcc 10980 tggtatggca ggacatggcc gggttcagcg gcgccaagac cgcccgcttc gtcaaacggt 11040 atgccgatgt cggtggtgaa ctacgccgtg ctgcaatgca atacgcccaa gaggtggccg 11100 gcggggtatt ccccgctgac gaacacagtt tctgaccaag ccgaatcagc ccgatgcgcg 11160 ggcattgcgg tggcgccctg gatgccgtcg acgccggatt gccggcgcgg acgcgccagc 11220 gggacccatc ggcgtcgcgt tcgccggttg agcccggggt gagcccagac attcgatgtg 11280 cccaacacca tccgccacag cccaattgat gtggcactct atgcatgcct atccccgacc 11340 aaccaccacc gcggcgacgc atcatgaccg gaggcgaaga tgccagtaga ggcgcccaga 11400 ccagcgcgcc atctggaggt cgagcgcaag ttcgacgtga tcgagtcgac ggtgtcgccg 11460 tcgttcgagg gcatcgccgc ggtggttcgc gtcgagcagt cgccgaccca gcagctcgac 11520 gcggtgtact tcgacacacc gtcgcacgac ctggcgcgca accagatcac cttgcggcgc 11580 cgcaccggcg gcgccgacgc cggctggcat ctgaagctgc cggccggacc cgacaagcgc 11640 accgagatgc gagcaccgct gtccgcatca ggcgacgctg tgccggccga gttgttggat 11700 gtggtgctgg cgatcgtccg cgaccagccg gttcagccgg tcgcgcggat cagcactcac 11760 cgcgaaagcc agatcctgta cggcgccggg ggcgacgcgc tggcggaatt ctgcaacgac 11820 gacgtcaccg catggtcggc cggggcattc cacgccgctg gtgcagcgga caacggccct 11880 gccgaacagc agtggcgcga atgggaactg gaactggtca ccacggatgg gaccgccgat 11940 accaagctac tggaccggct agccaaccgg ctgctcgatg ccggtgccgc acctgccggc 12000 cacggctcca aactggcgcg ggtgctcggt gcgacctctc ccggtgagct gcccaacggc 12060 ccgcagccgc cggcggatcc agtacaccgc gcggtgtccg agcaagtcga gcagctgctg 12120 ctgtgggatc gggccgtgcg ggccgacgcc tatgacgccg tgcaccagat gcgagtgacg 12180 acccgcaaga tccgcagctt gctgacggat tcccaggagt cgtttggcct gaaggaaagt 12240 gcgtgggtca tcgatgaact gcgtgagctg gccgatgtcc tgggcgtagc ccgggacgcc 12300 gaggtactcg gtgaccgcta ccagcgcgaa ctggacgcgc tggcgccgga gctggtacgc 12360 ggccgggtgc gcgagcgcct ggtagacggg gcgcggcggc gataccagac cgggctgcgg 12420 cgatcactga tcgcattgcg gtcgcagcgg tacttccgtc tgctcgacgc tctagacgcg 12480 cttgtgtccg aacgcgccca tgccacttct ggggaggaat cggcaccggt aaccatcgat 12540 gcggcctacc ggcgagtccg caaagccgca aaagccgcaa agaccgccgg cgaccaggcg 12600 ggcgaccacc accgcgacga ggcattgcac ctgatccgca agcgcgcgaa gcgattacgc 12660 tacaccgcgg cggctactgg ggcggacaat gtgtcacaag aagccaaggt catccagacg 12720 ttgctaggcg atcatcaaga cagcgtggtc agccgggaac atctgatcca gcaggccata 12780 gccgcgaaca ccgccggcga ggacaccttc acctacggtc tgctctacca acaggaagcc 12840 gacttggccg agcgctgccg ggagcagctt gaagccgcgc tgcgcaaact cgacaaggcg 12900 gtccgcaaag cacgggattg agcccgccag gggcggacga gttggcctgt aagccggatt 12960 ctgttccgcg ccgccacagc caagctaacg gcggcacggc ggcgaccatc catctggaca 13020 caccgttacc gggtgcctcg agcggcctac ccgcaggctc gggcgagcaa ccctcaagcg 13080 cctgcgcggc cgcactttcg gtgcggcctt cttggccttg cttcgggtgg ggtttgccta 13140 gccaccccgg tcacccggaa tgctggtgcg ctcttaccgc accgtttcac ccttgccacc 13200 acgaggatgg cggtctgttt tctgtggcac tttcccgcga gtcacctcgg attgccgtta 13260 gcaatcaccc tgctctgtga agtccggact ttcctcgact cgacgctgaa cctcgtgaat 13320 ccacacaagc cctacgcgag ccgcggccgc ccagccaact catccgcgac gaccacgcta 13380 ccccgctggg cggtgtcgcg gccagtgtga ccgctggacg acacggctag tcggacagcc 13440 gatccggcgg gcagtcctta tcgtggactg gtgacacggt gggacaaacg cgtcgactcc 13500 ggcgactggg acgccatcgc tgccgaggtc agcgagtacg gtggcgcact gctacctcgg 13560 ctgatcaccc ccggcgaggc cgcccggctg cgcaagctgt acgccgacga cggcctgttt 13620 cgctcgacgg tcgatatggc atccaagcgg tacggcgccg ggcagtatcg atatttccat 13680 gccccctatc ccgagtgatc gagcgtctca agcaggcgct gtatcccaaa ctgctgccga 13740 tagcgcgcaa ctggtgggcc aaactgggcc gggaggcgcc ctggccagac agccttgatg 13800 actggttggc gagctgtcat gccgccggcc aaacccgatc cacagcgctg atgttgaagt 13860 acggcaccaa cgactggaac gccctacacc aggatctcta cggcgagttg gtgtttccgc 13920 tgcaggtggt gatcaacctg agcgatccgg aaaccgacta caccggcggc gagttcctgc 13980 ttgtcgaaca gcggcctcgc gcccaatccc ggggtaccgc aatgcaactt ccgcagggac 14040 atggttatgt gttcacgacc cgtgatcggc cggtgcggac tagccgtggc tggtcggcat 14100 ctccagtgcg ccatgggctt tcgactattc gttccggcga acgctatgcc atggggctga 14160 tctttcacga cgcagcctga ttgcacgcca tctatagata gcctgtctga ttcaccaatc 14220 gcaccgacga tgccccatcg gcgtagaact cggcgatgct cagcgatgcc agatcaagat 14280 gcaaccgata taggacgccc gacccggcat ccaacgccag ccgcaacaac attttgatcg 14340 gcgtgacatg tgacaccacc agcaccgtcg cgccttcgta gccaacgatg atccgatcac 14400 gtccccgccg aacccgccgc agcacgtcgt cgaagctttc cccacccggg ggcgtgatgc 14460 tggtgtcctg cagccagcga cggtgcagct cgggatcgcg ttctgcggcc tccgcgaacg 14520 tcagcccctc ccaggcgccg aagtcggtct cgaccaggtc gtcatcgacg accacgtcca 14580 gggccagggc tctggcggcg gtcaccgcgg tgtcgtaagc ccgctgtagc ggcgaggaga 14640 ccaccgcagc gatcccgccg cgccgcgcca gatacccggc cgccgcacca acctggcgcc 14700 accccacctc gttcaacccc gggttgccgc gccccgaata gcggcgttgc tccgacagct 14760 ccgtctgccc gtggcgcaac aaaagtagtc gggtgggtgt accgcgggcg ccggtccagc 14820 cgggagatgt cggtgactcg gtcgcaacga ttttggcagg atccgcatcc gccgcagccg 14880 attgcgcggc ggcgtccatc gcgtcattgg ccaaccggtc tgcatacgtg ttccgggcac 14940 gcggaaccca ctcgtagttg atcctgcgaa actgggacgc caacgcctga gcctggacat 15000 agagcttcag cagatccggg tgcttgacct tccaccgccc ggacatctgc tccaccacca 15060 gcttggagtc catcagcacc gcggcctcgg tggcacctag tttcacggcg tcgtccaaac 15120 cggctatcag gccgcggtat tcggcgacgt tgttcgtcgc ccggccgatc gcctgcttgg 15180 actcggccag cacggtggag tgatcggcgg tccacaccac cgcgccgtat ccggccggtc 15240 cgggattgcc ccgcgatccg ccgtcggctt cgatgacaac tttcactcct caaatccttc 15300 gagccgcaac aagatcgctc cgcattccgg gcagcgcacc acttcatcct cggcggccgc 15360 cgagatctgg gccagctcgc cgcggccgat ctcgatccgg caggcaccac atcgatgacc 15420 ttgcaaccgc ccggcccctg gcccgcctcc ggcccgctgt ctttcgtaga gccccgcaag 15480 ctcgggatca agtgtcgccg tcagcatgtc gcgttgcgat gaatgttggt gccgggcttg 15540 gtcgatttcg gcaagtgcct cgtccaaagc ctgctgggcg gcggccaggt cggcccgcaa 15600 cgcttggagc gcccgcgact cggcggtctg ttgagcctgc agctcctcgc ggcgttccag 15660 cacctccagc agggcatctt ccaaactggc ttgacggcgt tgcaagctgt cgagctcgtg 15720 ctgcagatca gccaattgct tggcgtccgt tgcacccgaa gtgagcaacg accggtcccg 15780 gtcgccacgc ttacgcaccg catcgatctc cgactcaaaa cgcgacacct ggccgtccaa 15840 gtcctccgcc gcgattcgca gggccgccat cctgtcgttg gcggcgttgt gctcggcctg 15900 cacctgctgg taagccgccc gctgcggcag atgggtagcc cgatgcgcga tccgggtcag 15960 ctcagcatcc agcttcgcca attccagtag cgaccgttgc tgtgccactc cggctttcat 16020 gcctgatctc tcccagtttc gtgatcgagg ttccacgggt cggtgcagat ggtgcacaca 16080 cgcaccggca gcgacgcgcc gaaatgagac cgcaacactt cggcggcctg gccgcaccac 16140 gggaattcgc ttgcccaatg cgcgacgtcg atcagggcca cttgcgaagc tcggcaatgc 16200 tcgtcggctg gatgatgtcg cagatcggcc gtaacgtacg cttgcacgtc cgcggcggcc 16260 acggtggcaa gcaacgagtc cccggcgccg ccgcagaccg cgacccgcga caccagcagg 16320 tcgggatccc cggcggcgcg cacaccggtc gcagtcggcg gcaacgcggc ctccagacgg 16380 gcaacaaagg tgcgcagcgg ttcgggtttt ggcagtctgc caatccggcc taacccgctg 16440 ccgaccggcg gtggtaccag cgcgaagatg tcgaatgccg gctcctcgta agggtgcgcg 16500 gcgcgcatcg ccgccaacac ctcggcgcgc gctcgtgcgg gtgcgacgac ctcgacccgg 16560 tcctcggcca cccgttcgac ggtaccgacg ctgcctatgg cgggcgacgc cccgtcgtgc 16620 gccaggaact gcccggtacc cgcgacactc cagctgcagt gcgagtagtc gccgatatgg 16680 ccggcaccgg cctcaaagac cgctgcccgc accgcctctg agttctcgcg cggcacatag 16740 atgacccact tgtcgagatc ggccgctccg ggcaccgggt cgagaacggc gtcgacggtc 16800 agaccaacag cgtgtgccag cgcgtcggac acacccggcg acgccgagtc ggcgttggtg 16860 tgcgcggtaa acaacgagcg accggtccgg atcaggcggt gcaccagcac accctttggc 16920 gtgttggccg cgaccgtatc gaccccacgc agtaacaacg ggtggtgcac caatagcagt 16980 ccggcctggg gaacctggtc caccaccgcc ggcgtcgcgt ccaccgcaac ggtcaccgaa 17040 tccaccacgt cgtcggggtc gccgcacacc agacccaccg aatcccacga ctgggcaagc 17100 cgcggcgggt aggcctggtc cagcacgtcg atgacatcgg ccagccgcac actcatcggc 17160 gtcctccacg ctttgcccac tcggcgatcg ccgccaccag cacgggccac tccgggcgca 17220 ccgccgcccg caggtaccgc gcgtccaggc cgacgaaggt gtcaccgcgg cgcaccgcaa 17280 ttcctttgct ctgcaaatag tttcgtaatc cgtcagcatc ggcgatgttg aacagtacga 17340 aaggggccgc accatcgacc acctcggcac ccaccgatct cagtccggcc accatctccg 17400 cgcgcagcgc cgtcaaccgc accgcatcgg ctgcggcagc ggcgaccgcc cggggggcgc 17460 agcaagcagc gatggccgtc agttgcaatg ttcccaacgg ccagtgcgct cgctgcacgg 17520 tcaaccgagc cagcacgtct ggcgagccga gcgcgtagcc cacccgcaat ccggccagcg 17580 accacgtttt cgtcaagcta cggagcacca gcacatcggg cagcgagtca tcggccaacg 17640 attgcggctc gccgggaacc caatcagcga acgcctcgtc gaccaccagg atgcgtcccg 17700 gccggcgtaa ctcgagcagc tgctcgcgga ggtgcagcac cgaggtgggg ttggtcggat 17760 tacccacgac gacaaggtcg gcgtcgtcag gcacgtgcgc ggtgtccagc acgaacggcg 17820 gctttaggac aacatggtgc gccgtgattc cggcagcgct caaggctatg gccggctcgg 17880 tgaacgcggg cacgacgatt gctgcccgca ccggacttag gttgtgcagc aatgcgaatc 17940 cctccgccgc cccgacgagc gggagcactt cgtcacgggt tctgccatga cgttcagcga 18000 ccgcgtcttg cgcccggtgc acatcgtcgg tgctcggata gcgggccagc tccggcagca 18060 gcgcggcgag ctgccggacc aaccattccg ggggccggtc atggcggacg ttgacggcga 18120 agtccagcac gccgggcgcg acatcctgat caccgtggta gcgcgccgcg gcaagcgggc 18180 tagtgtctag actcgccaca gcgtcaaaca gtagtgggcc ggtgtgcggg ccaagaatcc 18240 agagcaccgc cgacgcgttg tctacgcggc gacaaccgcg acatcacagg cagctaacag 18300 ggcgtcggcg gtgatgatcg tcaggccaag cagctgtgcc tgggcgatga gcacacggtc 18360 gaatggatgt cgatggtgat ccggaagctc tgcggtgcgc agtgtgtgcg tggtcaactg 18420 acagcggcga cgtgccgcag cggcgcattc gatcgggcac gtaagaagcc gatggctcgg 18480 gcggcgggag cttgccgagg cggtagttga tcgcgatctc ccaggcactg gcggccgaca 18540 agagaatgct gttgcggacg tcctgaacaa tcgcccgtgt ttcgttgacg gcatccgcag 18600 ccaaacgtgg gtgtcgatga ggtagcgctt caccggtgaa agcgttcgag cacgtcgtct 18660 gacaacggag cgtccaaatc gtcgggcacg cggtacacgc catggtcaat gcctaaccgc 18720 cgagtctcat gaggatgcag cggcacaagc tttgctaccg gctcgccgcg gcgggcaatc 18780 tcaacctctg cccgccgtag acgagccgca gcagctcgga caggcgtgtc ttcgcctcgt 18840 gaacgccgac ccgcttcgca ggcgcccaga ctttcgcgtc gaccacctgc tcaccaaact 18900 tcgcgatcat cgcctgatac cacagcgcca acgggtagcg gtttgtccaa ccgcttcgtc 18960 aacgacaatg ggatcgtgac cgacacgacc gcgagcggga ccaattgccc gcctcctcca 19020 cgcgccgccg cacggcgcgc atcgtcgccg ggtgaatcgc cgcagctggt gatcttcgat 19080 ctggacggca cgctgaccga ctcggcgcgc ggaatcgtat ccagcttccg acacgcgctc 19140 aaccacatcg gtgccccagt acccgaaggc gacctggcca ctcacatcgt cggcccgccc 19200 atgcatgaga cgctgcgcgc catggggctc ggcgaatccg ccgaggaggc gatcgtagcc 19260 taccgggccg actacagcgc ccgcggttgg gcgatgaaca gcttgttcga cgggatcggg 19320 ccgctgctgg ccgacctgcg caccgccggt gtccggctgg ccgtcgccac ctccaaggca 19380 gagccgaccg cacggcgaat cctgcgccac ttcggaattg agcagcactt cgaggtcatc 19440 gcgggcgcga gcaccgatgg ctcgcgaggc agcaaggtcg acgtgctggc ccacgcgctc 19500 gcgcagctgc ggccgctacc cgagcggttg gtgatggtcg gcgaccgcag ccacgacgtc 19560 gacggggcgg ccgcgcacgg catcgacacg gtggtggtcg gctggggcta cgggcgcgcc 19620 gactttatcg acaagacctc caccaccgtc gtgacgcatg ccgccacgat tgacgagctg 19680 agggaggcgc taggtgtctg atccgctgca cgtcacattc gtttgtacgg gcaacatctg 19740 ccggtcgcca atggccgaga agatgttcgc ccaacagctt cgccaccgtg gcctgggtga 19800 cgcggtgcga gtgaccagtg cgggcaccgg gaactggcat gtaggcagtt gcgccgacga 19860 gcgggcggcc ggggtgttgc gagcccacgg ctaccctacc gaccaccggg ccgcacaagt 19920 cggcaccgaa cacctggcgg cagacctgtt ggtggccttg gaccgcaacc acgctcggct 19980 gttgcggcag ctcggcgtcg aagccgcccg ggtacggatg ctgcggtcat tcgacccacg 20040 ctcgggaacc catgcgctcg atgtcgagga tccctactat ggcgatcact ccgacttcga 20100 ggaggtcttc gccgtcatcg aatccgccct gcccggcctg cacgactggg tcgacgaacg 20160 tctcgcgcgg aacggaccga gttgatgccc cgcctagcgt tcctgctgcg gcccggctgg 20220 ctggcgttgg ccctggtcgt ggtcgcgttc acctacctgt gctttacggt gctcgcgccg 20280 tggcagctgg gcaagaatgc caaaacgtca cgagagaacc agcagatcag gtattccctc 20340 gacaccccgc cggttccgct gaaaaccctt ctaccacagc aggattcgtc ggcgccggac 20400 gcgcagtggc gccgggtgac ggcaaccgga cagtaccttc cggacgtgca ggtgctggcc 20460 cgactgcgcg tggtggaggg ggaccaggcg tttgaggtgt tggccccatt cgtggtcgac 20520 ggcggaccaa ccgtcctggt cgaccgtgga tacgtgcggc cccaggtggg ctcgcacgta 20580 ccaccgatcc cccgcctgcc ggtgcagacg gtgaccatca ccgcgcggct gcgtgactcc 20640 gaaccgagcg tggcgggcaa agacccattc gtcagagacg gcttccagca ggtgtattcg 20700 atcaataccg gacaggtcgc cgcgctgacc ggagtccagc tggctgggtc ctatctgcag 20760 ttgatcgaag accaacccgg cgggctcggc gtgctcggcg ttccgcatct agatcccggg 20820 ccgttcctgt cctatggcat ccaatggatc tcgttcggca ttctggcacc gatcggcttg 20880 ggctatttcg cctacgccga gatccgggcg cgccgccggg aaaaagcggg gtcgccacca 20940 ccggacaagc caatgacggt cgagcagaaa ctcgctgacc gctacggccg ccggcggtaa 21000 accaacatca cggccaatac cgcagccccc gcctggacca cccgcgacag caccacggcg 21060 cggcgcagat cggccacctt gggcgaccgg ccgtcgccca aggtgggccg gatctgcaac 21120 tcatggtggt accgggtggg cccacccagc cgcacgtcaa gcgccccagc aaacgccgcc 21180 tcgacgacac cggcgttggg gctgggatgg cgggcggcgt cgcgccgcca ggcccgtacc 21240 gcaccgcggg gcgacccacc gaccaccggc gcgcagatca ccaccagcac cgccgtcgcc 21300 cgtgcgccaa catagttggc ccagtcatcc aatcgtgctg cagcccaacc gaatcggaga 21360 taacgcggcg agcggtagcc gatcatcgag tccagggtgt tgatggcacg atatcccagc 21420 accgcaggca cgccgctcga agccgcccac agcagcggca ccacctgggc gtcggcggtg 21480 ttttcggcca ccgactccag cgcggcacgc gtcaggcccg ggccgcccag ctgggccggg 21540 tcacgcccgc acagcgacgg cagcagccgt cgcgccgcct cgacatcgtc gcgctccaac 21600 aggtccgata tctggcggcc ggtgcgcgcc agcgaagttc cgcccagcgc tgcccaggtg 21660 gccgtcgcgg tggccgccac gggccaggac ctgccgggta gccgctgcag tgccgcgccg 21720 agcaagccca ccgcgccgac cagcaggccg acgtgtaccg caccggcgac ccggccgtca 21780 cggtaggtga tctgctccag cttggcggcc gcccgaccga acagggccac cggatgacct 21840 cgtttggggt cgccgaacac gacgtcgagc aggcagccga tcagcacgcc gacggccctg 21900 gtctgccagg tcgatgcaaa cactccggca gcgtcgcaca cgtggtctac gctcagctat 21960 ttatgacctc atacggcagc tatccacgat gaagcggcca gctacccggg ttgccgacct 22020 gttgaacccg gcggcaatgt tgttgccggc agcgaatgtc atcatgcagc tggcagtgcc 22080 gggtgtcggg tatggcgtgc tggaaagccc ggtggacagc ggcaacgtct acaagcatcc 22140 gttcaagcgg gcccggacca ccggcaccta cctggcggtg gcgaccatcg ggacggaatc 22200 cgaccgagcg ctgatccggg gtgccgtgga cgtcgcgcac cggcaggttc ggtcgacggc 22260 ctcgagccca gtgtcctata acgccttcga cccgaagttg cagctgtggg tggcggcgtg 22320 tctgtaccgc tacttcgtgg accagcacga gtttctgtac ggcccactcg aagatgccac 22380 cgccgacgcc gtctaccaag acgccaaacg gttagggacc acgctgcagg tgccggaggg 22440 gatgtggccg ccggaccggg tcgcgttcga cgagtactgg aagcgctcgc ttgatgggct 22500 gcagatcgac gcgccggtgc gcgagcatct tcgcggggtg gcctcggtag cgtttctccc 22560 gtggccgttg cgcgcggtgg ccgggccgtt caacctgttt gcgacgacgg gattcttggc 22620 accggagttc cgcgcgatga tgcagctgga gtggtcacag gcccagcagc gtcgcttcga 22680 gtggttactt tccgtgctac ggttagccga ccggctgatt ccgcatcggg cctggatctt 22740 cgtttaccag ctttacttgt gggacatgcg gtttcgcgcc cgacacggcc gccgaatcgt 22800 ctgatagagc ccggccgagt gtgagcctga cagcccgaca ccggcggcgt gtgtcgcgtc 22860 gccaggttca cgctcggcga tctagagccg ccgaaaacct acttctgggt tgcctcccga 22920 atcaacgtgc tgatctgctc gagcagctca cgcatatcgg cgcgcatcgc atccaccgcg 22980 gcatacaggt cggccttggt cgccggcagc tggtccgacg tcattggccg caccggcggt 23040 gctgtctgtc gcgccgcgct gtcgctttga aacccaggtc gctcacccac gaccacgaca 23100 ctgccatatc cggcgccccg ccgacaacga agcacagcta gccggtgggc gcggacggga 23160 tcgaaccgcc gaccgctggt gtgtaaaacc agagctctac cgctgagcta cgcgcccatg 23220 accgccgcag gctacacgcc ttgcggccaa gcacccaaaa ccttaggccg taagcgccgc 23280 cagagcgtcg gtccacagcc gctgatcgcg aacttcaccc ggctgcttca tctcggcgaa 23340 ccgaatgatc cctgaccgat cgaccacaaa ggtgccccgg ttagcgatgc cggcctgctc 23400 gttgaagacg ccgtaggcct gactgaccgc gccgtgtggc cagaagtccg acaacagcgg 23460 aaacgtgaat ccgctctgcg tcgcccagat cttgtgagtg ggtggcgggc ccaccgaaat 23520 cgctagcgcg gcgctgtcgt cgttctcaaa ctcgggcagg tgatcacgca actggtccag 23580 ctcgccctgg cagatgcccg tgaacgccaa cggaaagaac accaacagca cgttctttgc 23640 accccggtag ccgcgcaggg tgacaagctg ctgattctgg tcgcgcaacg tgaagtcagg 23700 ggcggtggct ccgacgttca gcatcagcgc ttgccagccc gcgatttcgg ctgtaccaat 23760 ctgctggcgc tccagttgcc cagattgacc gacgaggtcg gcatcagccc agctgtgggc 23820 gccgcctcgg caatctcggc gggcaataca tggccgggct ggccggtctt gggcgtcacc 23880 acccaaatca caccgtcctc ggcgagcggg ccgatcgcat ccatcagggt gtccaccaaa 23940 tcgccgtcgc catcacgcca ccacaacagg acgacatcga tgacctcgtc ggtgtcttca 24000 tcgagcaact ctcccccgca cgcttcttcg atggccgcgc ggatgtcgtc gtcggtgtct 24060 tcgtcccagc cccattcctg gataagttgg tctcgttgga tgcccaattt gcgggcgtag 24120 ttcgaggcgt gatccgccgc gaccaccgtg gaacctcctt cagtctccgc gggccatgtg 24180 cacaccgtcg cgatgggcat tatcgtcgca cagccagaac cggtccaccc gcccgcctca 24240 gaaggcggcc acgcacattg tcaatgcctt tgtcttggtg tcgttgagcc gatcaacccg 24300 ccggttgaat tccgctgtcg acgcgtgcgc accgatggca tttgccaccg cgcgggccgc 24360 gtcgacatat gcgttgagcg catcccccag ttgcgcggac agcgcggcgc tcagactgcc 24420 tgagaccgtc gaggcactgt tgttgagcgc gtcgatggcc ggaccttcgg tcggcccggt 24480 gttgcggccc tgattgaacg cggccacgta ggcgttcacc ttgtcgatgg cgtccttgct 24540 ggtggccgcc agcgcgtcac acgaggtgcg aatcgccttg gtcgtcagcg attgttggcg 24600 ctgcgactcc cggatgctcg acgtcgccgc cgaagccgac accgacgcgg acaccgacga 24660 gcggtaggcc ggtgcgacgt tggtgtcggg catggccgta ccgtcggtga cagtggtaca 24720 tccgacgatc cccatcagca gcagcgcgat gcagccgagc gccagggcgc ctcgcctggg 24780 gagctccccc ccgtgcctgc gaggcacggc gcgccatccg atgagcacgg catgtgaggt 24840 tacctggtcg cagcgcgacc gcgctggccg tggtgtgtcg cgcatccgca gaaccgagcg 24900 gagtgcggct atccgccgcc gacgccggtg cggcacgata gggggacgac catctaaaca 24960 gcacgcaagc ggaagcccgc cacctacagg agtagtgcgt tgaccaccga tttcgcccgc 25020 cacgatctgg cccaaaactc aaacagcgca agcgaacccg accgagttcg ggtgatccgc 25080 gagggtgtgg cgtcgtattt gcccgacatt gatcccgagg agacctcgga gtggctggag 25140 tcctttgaca cgctgctgca acgctgcggc ccgtcgcggg cccgctacct gatgttgcgg 25200 ctgctagagc gggccggcga gcagcgggtg gccatcccgg cattgacgtc taccgactat 25260 gtcaacacca tcccgaccga gctggagccg tggttccccg gcgacgaaga cgtcgaacgt 25320 cgttatcgag cgtggatcag atggaatgcg gccatcatgg tgcaccgtgc gcaacgaccg 25380 ggtgtgggcg tgggtggcca tatctcgacc tacgcgtcgt ccgcggcgct ctatgaggtc 25440 ggtttcaacc acttcttccg cggcaagtcg cacccgggcg gcggcgatca ggtgttcatc 25500 cagggccacg cttccccggg aatctacgcg cgcgccttcc tcgaagggcg gttgaccgcc 25560 gagcaactcg acggattccg ccaggaacac agccatgtcg gcggcgggtt gccgtcctat 25620 ccgcacccgc ggctcatgcc cgacttctgg gaattcccca ccgtgtcgat gggtttgggc 25680 ccgctcaacg ccatctacca ggcacggttc aaccactatc tgcatgaccg cggtatcaaa 25740 gacacctccg atcaacacgt gtggtgtttt ttgggcgacg gcgagatgga cgaacccgag 25800 agccgtgggc tggcccacgt cggcgcgctg gaaggcttgg acaacttgac cttcgtgatc 25860 aactgcaatc tgcagcgact cgacggcccg gtgcgcggca acggcaagat catccaggag 25920 ctggagtcgt tcttccgcgg tgccggctgg aacgtcatca aggtggtgtg gggccgcgaa 25980 tgggatgccc tgctgcacgc cgaccgcgac ggtgcgctgg tgaatttaat gaatacaaca 26040 cccgatggcg attaccagac ctataaggcc aacgacggcg gctacgtgcg tgaccacttc 26100 ttcggccgcg acccacgcac caaggcgctg gtggagaaca tgagcgacca ggatatctgg 26160 aacctcaaac ggggcggcca cgattaccgc aaggtttacg ccgcctaccg cgccgccgtc 26220 gaccacaagg gacagccgac ggtgatcctg gccaagacca tcaaaggcta cgcgctgggc 26280 aagcatttcg aaggacgcaa tgccacccac cagatgaaaa aactgaccct ggaagacctt 26340 aaggagtttc gtgacacgca gcggattccg gtcagcgacg cccagcttga agagaatccg 26400 tacctgccgc cctactacca ccccggcctc aacgccccgg agattcgtta catgctcgac 26460 cggcgccggg ccctcggggg ctttgttccc gagcgcagga ccaagtccaa agcgctgacc 26520 ctgccgggtc gcgacatcta cgcgccgctg aaaaagggct ctgggcacca ggaggtggcc 26580 accaccatgg cgacggtgcg cacgttcaaa gaagtgttgc gcgacaagca gatcgggccg 26640 cggatagtcc cgatcattcc cgacgaggcc cgcaccttcg ggatggactc ctggttcccg 26700 tcgctaaaga tctataaccg caatggccag ctgtataccg cggttgacgc cgacctgatg 26760 ctggcctaca aggagagcga agtcgggcag atcctgcacg agggcatcaa cgaagccggg 26820 tcggtgggct cgttcatcgc ggccggcacc tcgtatgcga cgcacaacga accgatgatc 26880 cccatttaca tcttctactc gatgttcggc ttccagcgca ccggcgatag cttctgggcc 26940 gcggccgacc agatggctcg agggttcgtg ctcggggcca ccgccgggcg caccaccctg 27000 accggtgagg gcctgcaaca cgccgacggt cactcgttgc tgctggccgc caccaacccg 27060 gcggtggttg cctacgaccc ggccttcgcc tacgaaatcg cctacatcgt ggaaagcgga 27120 ctggccagga tgtgcgggga gaacccggag aacatcttct tctacatcac cgtctacaac 27180 gagccgtacg tgcagccgcc ggagccggag aacttcgatc ccgagggcgt gctgcggggt 27240 atctaccgct atcacgcggc caccgagcaa cgcaccaaca aggcgcagat cctggcctcc 27300 ggggtagcga tgcccgcggc gctgcgggca gcacagatgc tggccgccga gtgggatgtc 27360 gccgccgacg tgtggtcggt gaccagttgg ggcgagctaa accgcgacgg ggtggccatc 27420 gagaccgaga agctccgcca ccccgatcgg ccggcgggcg tgccctacgt gacgagagcg 27480 ctggagaatg ctcggggccc ggtgatcgcg gtgtcggact ggatgcgcgc ggtccccgag 27540 cagatccgac cgtgggtgcc gggcacatac ctcacgttgg gcaccgacgg gttcggcttt 27600 tccgacactc ggcccgccgc tcgccgctac ttcaacaccg acgccgaatc ccaggtggtc 27660 gcggttttgg aggcgttggc gggcgacggc gagatcgacc catcggtgcc ggtcgcggcc 27720 gcccgccagt accggatcga cgacgtggcg gctgcgcccg agcagaccac ggatcccggt 27780 cccggggcct aacgccggcg agccgaccgc ctttggccga atcttccaga aatctggcgt 27840 agcttttagg agtgaacgac aatcagttgg ctccagttgc ccgcccgagg tcgccgctcg 27900 aactgctgga cactgtgccc gattcgctgc tgcggcggtt gaagcagtac tcgggccggc 27960 tggccaccga ggcagtttcg gccatgcaag aacggttgcc gttcttcgcc gacctagaag 28020 cgtcccagcg cgccagcgtg gcgctggtgg tgcagacggc cgtggtcaac ttcgtcgaat 28080 ggatgcacga cccgcacagt gacgtcggct ataccgcgca ggcattcgag ctggtgcccc 28140 aggatctgac gcgacggatc gcgctgcgcc agaccgtgga catggtgcgg gtcaccatgg 28200 agttcttcga agaagtcgtg cccctgctcg cccgttccga agagcagttg accgccctca 28260 cggtgggcat tttgaaatac agccgcgacc tggcattcac cgccgccacg gcctacgccg 28320 atgcggccga ggcacgaggc acctgggaca gccggatgga ggccagcgtg gtggacgcgg 28380 tggtacgcgg cgacaccggt cccgagctgc tgtcccgggc ggccgcgctg aattgggaca 28440 ccaccgcgcc ggcgaccgta ctggtgggaa ctccggcgcc cggtccaaat ggctccaaca 28500 gcgacggcga cagcgagcgg gccagccagg atgtccgcga caccgcggct cgccacggcc 28560 gcgctgcgct gaccgacgtg cacggcacct ggctggtggc gatcgtctcc ggccagctgt 28620 cgccaaccga gaagttcctc aaagacctgc tggcagcatt cgccgacgcc ccggtggtca 28680 tcggccccac ggcgcccatg ctgaccgcgg cgcaccgcag cgctagcgag gcgatctccg 28740 ggatgaacgc cgtcgccggc tggcgcggag cgccgcggcc cgtgctggct agggaacttt 28800 tgcccgaacg cgccctgatg ggcgacgcct cggcgatcgt ggccctgcat accgacgtga 28860 tgcggcccct agccgatgcc ggaccgacgc tcatcgagac gctagacgca tatctggatt 28920 gtggcggcgc gattgaagct tgtgccagaa agttgttcgt tcatccaaac acagtgcggt 28980 accggctcaa gcggatcacc gacttcaccg ggcgcgatcc cacccagcca cgcgatgcct 29040 atgtccttcg ggtggcggcc accgtgggtc aactcaacta tccgacgccg cactgaagca 29100 tcgacagcaa tgccgtgtca tagattccct cgccggtcag agggggtcca gcaggggccc 29160 cggaaagata ccaggggcgc cgtcggacgg aaagtgatcc agacaacagg tcgcgggacg 29220 atctcaaaaa catagcttac aggcccgttt tgttggttat atacaaaaac ctaagacgag 29280 gttcataatc tgttacaccg cgcaaaaccg tcttcacagt gttctcttag acacgtgatt 29340 gcgttgctcg cacccggaca gggttcgcaa accgagggaa tgttgtcgcc gtggcttcag 29400 ctgcccggcg cagcggacca gatcgcggcg tggtcgaaag ccgctgatct agatcttgcc 29460 cggctgggca ccaccgcctc gaccgaggag atcaccgaca ccgcggtcgc ccagccattg 29520 atcgtcgccg cgactctgct ggcccaccag gaactggcgc gccgatgcgt gctcgccggc 29580 aaggacgtca tcgtggccgg ccactccgtc ggcgaaatcg cggcctacgc aatcgccggt 29640 gtgatagccg ccgacgacgc cgtcgcgctg gccgccaccc gcggcgccga gatggccaag 29700 gcctgcgcca ccgagccgac cggcatgtct gcggtgctcg gcggcgacga gaccgaggtg 29760 ctgagtcgcc tcgagcagct cgacttggtc ccggcaaacc gcaacgccgc cggccagatc 29820 gtcgctgccg gccggctgac cgcgttggag aagctcgccg aagacccgcc ggccaaggcg 29880 cgggtgcgtg cactgggtgt cgccggagcg ttccacaccg agttcatggc gcccgcactt 29940 gacggctttg cggcggccgc ggccaacatc gcaaccgccg accccaccgc cacgctgctg 30000 tccaaccgcg acgggaagcc ggtgacatcc gcggccgcgg cgatggacac cctggtctcc 30060 cagctcaccc aaccggtgcg atgggacctg tgcaccgcga cgctgcgcga acacacagtc 30120 acggcgatcg tggagttccc ccccgcgggc acgcttagcg gtatcgccaa acgcgaactt 30180 cggggggttc cggcacgcgc cgtcaagtca cccgcagacc tggacgagct ggcaaaccta 30240 taaccgcgga ctcggccaga acaaccacat acccgtcagt tcgatttgta cacaacatat 30300 tacgaaggga agcatgctgt gcctgtcact caggaagaaa tcattgccgg tatcgccgag 30360 atcatcgaag aggtaaccgg tatcgagccg tccgagatca ccccggagaa gtcgttcgtc 30420 gacgacctgg acatcgactc gctgtcgatg gtcgagatcg ccgtgcagac cgaggacaag 30480 tacggcgtca agatccccga cgaggacctc gccggtctgc gtaccgtcgg tgacgttgtc 30540 gcctacatcc agaagctcga ggaagaaaac ccggaggcgg ctcaggcgtt gcgcgcgaag 30600 attgagtcgg agaaccccga tgccgttgcc aacgttcagg cgaggcttga ggccgagtcc 30660 aagtgagtca gccttccacc gctaatggcg gtttccccag cgttgtggtg accgccgtca 30720 cagcgacgac gtcgatctcg ccggacatcg agagcacgtg gaagggtctg ttggccggcg 30780 agagcggcat ccacgcactc gaagacgagt tcgtcaccaa gtgggatcta gcggtcaaga 30840 tcggcggtca cctcaaggat ccggtcgaca gccacatggg ccgactcgac atgcgacgca 30900 tgtcgtacgt ccagcggatg ggcaagttgc tgggcggaca gctatgggag tccgccggca 30960 gcccggaggt cgatccagac cggttcgccg ttgttgtcgg caccggtcta ggtggagccg 31020 agaggattgt cgagagctac gacctgatga atgcgggcgg cccccggaag gtgtccccgc 31080 tggccgttca gatgatcatg cccaacggtg ccgcggcggt gatcggtctg cagcttgggg 31140 cccgcgccgg ggtgatgacc ccggtgtcgg cctgttcgtc gggctcggaa gcgatcgccc 31200 acgcgtggcg tcagatcgtg atgggcgacg ccgacgtcgc cgtctgcggc ggtgtcgaag 31260 gacccatcga ggcgctgccc atcgcggcgt tctccatgat gcgggccatg tcgacccgca 31320 acgacgagcc tgagcgggcc tcccggccgt tcgacaagga ccgcgacggc tttgtgttcg 31380 gcgaggccgg tgcgctgatg ctcatcgaga cggaggagca cgccaaagcc cgtggcgcca 31440 agccgttggc ccgattgctg ggtgccggta tcacctcgga cgcctttcat atggtggcgc 31500 ccgcggccga tggtgttcgt gccggtaggg cgatgactcg ctcgctggag ctggccgggt 31560 tgtcgccggc ggacatcgac cacgtcaacg cgcacggcac ggcgacgcct atcggcgacg 31620 ccgcggaggc caacgccatc cgcgtcgccg gttgtgatca ggccgcggtg tacgcgccga 31680 agtctgcgct gggccactcg atcggcgcgg tcggtgcgct cgagtcggtg ctcacggtgc 31740 tgacgctgcg cgacggcgtc atcccgccga ccctgaacta cgagacaccc gatcccgaga 31800 tcgaccttga cgtcgtcgcc ggcgaaccgc gctatggcga ttaccgctac gcagtcaaca 31860 actcgttcgg gttcggcggc cacaatgtgg cgcttgcctt cgggcgttac tgaagcacga 31920 catcgcgggt cgcgaggccc gaggtggggg tccccccgct tgcgggggcg agtcggaccg 31980 atatggaagg aacgttcgca agaccaatga cggagctggt taccgggaaa gcctttccct 32040 acgtagtcgt caccggcatc gccatgacga ccgcgctcgc gaccgacgcg gagactacgt 32100 ggaagttgtt gctggaccgc caaagcggga tccgtacgct cgatgaccca ttcgtcgagg 32160 agttcgacct gccagttcgc atcggcggac atctgcttga ggaattcgac caccagctga 32220 cgcggatcga actgcgccgg atgggatacc tgcagcggat gtccaccgtg ctgagccggc 32280 gcctgtggga aaatgccggc tcacccgagg tggacaccaa tcgattgatg gtgtccatcg 32340 gcaccggcct gggttcggcc gaggaactgg tcttcagtta cgacgatatg cgcgctcgcg 32400 gaatgaaggc ggtctcgccg ctgaccgtgc agaagtacat gcccaacggg gccgccgcgg 32460 cggtcgggtt ggaacggcac gccaaggccg gggtgatgac gccggtatcg gcgtgcgcat 32520 ccggcgccga ggccatcgcc cgtgcgtggc agcagattgt gctgggagag gccgatgccg 32580 ccatctgcgg cggcgtggag accaggatcg aagcggtgcc catcgccggg ttcgctcaga 32640 tgcgcatcgt gatgtccacc aacaacgacg accccgccgg tgcatgccgc ccattcgaca 32700 gggaccgcga cggctttgtg ttcggcgagg gcggcgccct tctgttgatc gagaccgagg 32760 agcacgccaa ggcacgtggc gccaacatcc tggcccggat catgggcgcc agcatcacct 32820 ccgatggctt ccacatggtg gccccggacc ccaacgggga acgcgccggg catgcgatta 32880 cgcgggcgat tcagctggcg ggcctcgccc ccggcgacat cgaccacgtc aatgcgcacg 32940 ccaccggcac ccaggtcggc gacctggccg aaggcagggc catcaacaac gccttgggcg 33000 gcaaccgacc ggcggtgtac gcccccaagt ctgccctcgg ccactcggtg ggcgcggtcg 33060 gcgcggtcga atcgatcttg acggtgctcg cgttgcgcga tcaggtgatc ccgccgacac 33120 tgaatctggt aaacctcgat cccgagatcg atttggacgt ggtggcgggt gaaccgcgac 33180 cgggcaatta ccggtatgcg atcaataact cgttcggatt cggcggccac aacgtggcaa 33240 tcgccttcgg acggtactaa accccagcgt tacgcgacag gagacctgcg atgacaatca 33300 tggcccccga ggcggttggc gagtcgctcg acccccgcga tccgctgttg cggctgagca 33360 acttcttcga cgacggcagc gtggaattgc tgcacgagcg tgaccgctcc ggagtgctgg 33420 ccgcggcggg caccgtcaac ggtgtgcgca ccatcgcgtt ctgcaccgac ggcaccgtga 33480 tgggcggcgc catgggcgtc gaggggtgca cgcacatcgt caacgcctac gacactgcca 33540 tcgaagacca gagtcccatc gtgggcatct ggcattcggg tggtgcccgg ctggctgaag 33600 gtgtgcgggc gctgcacgcg gtaggccagg tgttcgaagc catgatccgc gcgtccggct 33660 acatcccgca gatctcggtg gtcgtcggtt tcgccgccgg cggcgccgcc tacggaccgg 33720 cgttgaccga cgtcgtcgtc atggcgccgg aaagccgggt gttcgtcacc gggcccgacg 33780 tggtgcgcag cgtcaccggc gaggacgtcg acatggcctc gctcggtggg ccggagaccc 33840 accacaagaa gtccggggtg tgccacatcg tcgccgacga cgaactcgat gcctacgacc 33900 gtgggcgccg gttggtcgga ttgttctgcc agcaggggca tttcgatcgc agcaaggccg 33960 aggccggtga caccgacatc cacgcgctgc tgccggaatc ctcgcgacgt gcctacgacg 34020 tgcgtccgat cgtgacggcg atcctcgatg cggacacacc gttcgacgag ttccaggcca 34080 attgggcgcc gtcgatggtg gtcgggctgg gtcggctgtc gggtcgcacg gtgggtgtac 34140 tggccaacaa cccgctacgc ctgggcggct gcctgaactc cgaaagcgca gagaaggcag 34200 cgcgtttcgt gcggctgtgc gacgcgttcg ggattccgct ggtggtggtg gtcgatgtgc 34260 cgggctatct gcccggtgtc gaccaggagt ggggtggcgt ggtgcgccgt ggcgccaagt 34320 tgctgcacgc gttcggcgag tgcaccgttc cgcgggtcac gctggtcacc cgaaagacct 34380 acggcggggc atacattgcg atgaactccc ggtcgttgaa cgcgaccaag gtgttcgcct 34440 ggccggacgc cgaggtcgcg gtgatgggcg ctaaggcggc cgtcggcatc ctgcacaaga 34500 agaagttggc cgccgctccg gagcacgaac gcgaagcgct gcacgaccag ttggccgccg 34560 agcatgagcg catcgccggc ggggtcgaca gtgcgctgga catcggtgtg gtcgacgaga 34620 agatcgaccc ggcgcatact cgcagcaagc tcaccgaggc gctggcgcag gctccggcac 34680 ggcgcggccg ccacaagaac atcccgctgt agttctgacc gcgagcagac gcagaatcgc 34740 acgcgcgagg tccgcgccgt gcgattctgc gtctgctcgc cagttatccc cagcggtggc 34800 tggtcaacgc gaggcgctcc tcgcatgctc ggacggtgcc taccgacgcg ctaacaattc 34860 tcgagaaggc cggcgggttc gccaccaccg cgcaattgct cacggtcatg acccgccaac 34920 agctcgacgt ccaagtgaaa aacggcggcc tcgttcgcgt ttggtacggg gtctacgcgg 34980 cacaagagcc ggacctgttg ggccgcttgg cggctctcga tgtgttcatg ggggggcacg 35040 ccgtcgcgtg tctgggcacc gccgccgcgt tgtatggatt cgacacggaa aacaccgtcg 35100 ctatccatat gctcgatccc ggagtaagga tgcggcccac ggtcggtctg atggtccacc 35160 aacgcgtcgg tgcccggctc caacgggtgt caggtcgtct cgcgaccgcg cccgcatgga 35220 ctgccgtgga ggtcgcacga cagttgcgcc gcccgcgggc gctggccacc ctcgacgccg 35280 cactacggtc aatgcgctgc gctcgcagtg aaattgaaaa cgccgttgct gagcagcgag 35340 gccgccgagg catcgtcgcg gcgcgcgaac tcttaccctt cgccgacgga cgcgcggaat 35400 cggccatgga gagcgaggct cggctcgtca tgatcgacca cgggctgccg ttgcccgaac 35460 ttcaataccc gatacacggc cacggtggtg aaatgtggcg agtcgacttc gcctggcccg 35520 acatgcgtct cgcggccgaa tacgaaagca tcgagtggca cgcgggaccg gcggagatgc 35580 tgcgcgacaa gacacgctgg gccaagctcc aagagctcgg gtggacgatt gtcccgattg 35640 tcgtcgacga tgtcagacgc gaacccggcc gcctggcggc ccgcatcgcc cgccacctcg 35700 accgcgcgcg tatggccggc tgaccgctgg tgagcagacg cagagtcgca ctgcggccgg 35760 cgcagtgcga ctctgcgtct gctcgcgctc aacggctgag gaactcctta gccacggcga 35820 ctacgcgctc gcgatcccgt ggcaccagac cgatccgggt ccggcggtcg aggatatcgt 35880 ccacatccag cgccccctca tgggtcaccg cgtattcgaa ctccgcccgg gtcacgtcga 35940 tgccgtcggc gaccggctcg gtgggccgct cacatgtggc ggcggcagcg acgttggccg 36000 cctcggcccc gtaccgcgcc accagcgact cgggcaatcc ggcgcccgat ccgggggccg 36060 gcccagggtt cgccggtgcg ccgatcagcg gcaggttgcg agtgcggcac ttcgcggctc 36120 gcaggtgtcg cagcgtgatg gcgcgattca gcacatcctc tgccatgtag cggtattccg 36180 tcagcttgcc gccgaccaca ctgatcacgc ccgacggcga ttcaaaaaca gcgtggtcac 36240 gcgaaacgtc ggcggtgcgg ccctggacac cagcaccgcc ggtgtcgatt agcggccgca 36300 atcccgcata ggcaccgatg acatccttgg tgccgaccgc cgtccccaat gcggtgttca 36360 ccgtatccag caggaacgtg atctcttccg aagacggttg tggcacatcg ggaatcgggc 36420 cgggtgcgtc ttcgtcggtc agcccgagat agatccggcc cagctgctcg ggcatggcga 36480 acacgaagcg gttcagctca ccggggatcg gaatggtcag cgcggcagtc ggattggcaa 36540 acgacttcgc gtcgaagacc agatgtgtgc cgcggctggg gcgtagcctc agggacgggt 36600 cgatctcacc cgcccacacg cccgccgcgt tgatgacggc acgcgccgac agcgcgaacg 36660 actgccgggt gcgccggtcg gtcaactcca ccgaagtgcc ggtgacattc gacgcgccca 36720 cgtaagtgag gatgcgggcg ccgtgctggg ccgcggtgcg cgcgacggcc atgaccagcc 36780 gggcgtcgtc gatcaattgc ccgtcgtacg cgagcagacc accgtcgagg ccgtcccgcc 36840 gaacggtggg agcaatctcc accacccgtg acgccgggat tcggcgcgat cggggcaacg 36900 tcgccgccgg cgtacccgct agcacccgca aagcgtcgcc ggccaggaaa ccggcacgca 36960 ccaacgcccg cttggtgtga cccatcgacg gcaacaacgg gaccagttgc ggcatggcat 37020 gcacgagatg aggagcgttg cgtgtcatca ggattccgcg ttcgacggcg ctgcgccggg 37080 cgatgcccac gttgccgctg gccagatagc gcagaccgcc gtgcaccaac ttcgagctcc 37140 agcggctggt gccgaacgcc agatcatgct tttccaccaa ggccaccgtc agaccgcggg 37200 tggcagcatc taaggcaatg ccaacaccgg taatgccgcc gcctatcacg atgacgtcga 37260 gtgcgccacc gtcggccagt gcggtcaggt cggcggagcg acgcgccgcg ttgagtgcag 37320 ccgagtgggg catcagcaca aatatccgtt cagtgcgtgg gtaagttcgg tggccagcgc 37380 ggcggaatcg aggatcgaat cgacgatgtc cgcggactgg atggtcgact gggcgatcag 37440 caacaccatg gtcgccagtc gacgagcgtc gccggagcgc acactgcccg accgctgcgc 37500 cactgtcagc cgggcggcca acccctcgat caggacctgc tggctggtgc cgaggcgctc 37560 ggtgatgtac accctggcca gctccgagtg catgaccgac atgatcagat cgtcaccccg 37620 caaccggtcg gccaccgcga caatctgctt taccaacgct tcccggtcgt ccccgtcgag 37680 gggcacctcc cgcagcacgt cggcgatatg gctggtcagc atggacgcca tgatcgaccg 37740 ggtgtccggc cagcgacggt atacggtcgg gcggctcacg cccgcgcgcc gggcgatctc 37800 ggcaagtgtc acccggtcca cgccgtaatc gacgacgcag ctcgccgctg cccgcaggat 37860 acgaccaccg gtatccgcgc ggtcattact cattgacagc atgtgtaata ctgtaacgcg 37920 tgactcaccg cgaggaactc cttccaccga tgaaatggga cgcgtgggga gatcccgccg 37980 cggccaagcc actttctgat ggcgtccggt cgttgctgaa gcaggttgtg ggcctagcgg 38040 actcggagca gcccgaactc gaccccgcgc aggtgcagct gcgcccgtcc gccctgtcgg 38100 gggcagacca 38110 25 2540 DNA Homo sapiens 25 gaaaaggtgg acaagtccta ttttcaagag aagatgactt ttaacagttt tgaaggatct 60 aaaacttgtg tacctgcaga catcaataag gaagaagaat ttgtagaaga gtttaataga 120 ttaaaaactt ttgctaattt tccaagtggt agtcctgttt cagcatcaac actggcacga 180 gcagggtttc tttatactgg tgaaggagat accgtgcggt gctttagttg tcatgcagct 240 gtagatagat ggcaatatgg agactcagca gttggaagac acaggaaagt atccccaaat 300 tgcagattta tcaacggctt ttatcttgaa aatagtgcca cgcagtctac aaattctggt 360 atccagaatg gtcagtacaa agttgaaaac tatctgggaa gcagagatca ttttgcctta 420 gacaggccat ctgagacaca tgcagactat cttttgagaa ctgggcaggt tgtagatata 480 tcagacacca tatacccgag gaaccctgcc atgtattgtg aagaagctag attaaagtcc 540 tttcagaact ggccagacta tgctcaccta accccaagag agttagcaag tgctggactc 600 tactacacag gtattggtga ccaagtgcag tgcttttgtt gtggtggaaa actgaaaaat 660 tgggaacctt gtgatcgtgc ctggtcagaa cacaggcgac actttcctaa ttgcttcttt 720 gttttgggcc ggaatcttaa tattcgaagt gaatctgatg ctgtgagttc tgataggaat 780 ttcccaaatt caacaaatct tccaagaaat ccatccatgg cagattatga agcacggatc 840 tttacttttg ggacatggat atactcagtt aacaaggagc agcttgcaag agctggattt 900 tatgctttag gtgaaggtga taaagtaaag tgctttcact gtggaggagg gctaactgat 960 tggaagccca gtgaagaccc ttgggaacaa catgctaaat ggtatccagg gtgcaaatat 1020 ctgttagaac agaagggaca agaatatata aacaatattc atttaactca ttcacttgag 1080 gagtgtctgg taagaactac tgagaaaaca ccatcactaa ctagaagaat tgatgatacc 1140 atcttccaaa atcctatggt acaagaagct atacgaatgg ggttcagttt caaggacatt 1200 aagaaaataa tggaggaaaa aattcagata tctgggagca actataaatc acttgaggtt 1260 ctggttgcag atctagtgaa tgctcagaaa gacagtatgc aagatgagtc aagtcagact 1320 tcattacaga aagagattag tactgaagag cagctaaggc gcctgcaaga ggagaagctt 1380 tgcaaaatct gtatggatag aaatattgct atcgtttttg ttccttgtgg acatctagtc 1440 acttgtaaac aatgtgctga agcagttgac aagtgtccca tgtgctacac agtcattact 1500 ttcaagcaaa aaatttttat gtcttaatct aactctatag taggcatgtt atgttgttct 1560 tattaccctg attgaatgtg tgatgtgaac tgactttaag taatcaggat tgaattccat 1620 tagcatttgc taccaagtag gaaaaaaaat gtacatggca gtgttttagt tggcaatata 1680 atctttgaat ttcttgattt ttcagggtat tagctgtatt atccattttt tttactgtta 1740 tttaattgaa accatagact aagaataaga agcatcatac tataactgaa cacaatgtgt 1800 attcatagta tactgattta atttctaagt gtaagtgaat taatcatctg gattttttat 1860 tcttttcaga taggcttaac aaatggagct ttctgtatat aaatgtggag attagagtta 1920 atctccccaa tcacataatt tgttttgtgt gaaaaaggaa taaattgttc catgctggtg 1980 gaaagataga gattgttttt agaggttggt tgttgtgttt taggattctg tccattttct 2040 tgtaaaggga taaacacgga cgtgtgcgaa atatgtttgt aaagtgattt gccattgttg 2100 aaagcgtatt taatgataga atactatcga gccaacatgt actgacatgg aaagatgtca 2160 gagatatgtt aagtgtaaaa tgcaagtggc gggacactat gtatagtctg agccagatca 2220 aagtatgtat gttgttaata tgcatagaac gagagatttg gaaagatata caccaaactg 2280 ttaaatgtgg tttctcttcg gggagggggg gattggggga ggggccccag aggggtttta 2340 gaggggcctt ttcactttcg acttttttca ttttgttctg ttcggatttt ttataagtat 2400 gtagaccccg aagggtttta tgggaactaa catcagtaac ctaacccccg tgactatcct 2460 gtgctcttcc tagggagctg tgttgtttcc cacccaccac ccttccctct gaacaaatgc 2520 ctgagtgctg gggcactttg 2540 26 103 RNA Homo sapiens 26 agcuccuaua acaaaagucu guugcuugug uuucacauuu uggauuuccu aauauaaugu 60 ucucuuuuua gaaaaggugg acaaguccua uuuucaagag aag 103 27 28 RNA Homo sapiens 27 ggauuuccua auauaauguu cucuuuuu 28 28 1619 DNA Homo sapiens 28 ccgccagatt tgaatcgcgg gacccgttgg cagaggtggc ggcggcggca tgggtgcccc 60 gacgttgccc cctgcctggc agccctttct caaggaccac cgcatctcta cattcaagaa 120 ctggcccttc ttggagggct gcgcctgcac cccggagcgg atggccgagg ctggcttcat 180 ccactgcccc actgagaacg agccagactt ggcccagtgt ttcttctgct tcaaggagct 240 ggaaggctgg gagccagatg acgaccccat agaggaacat aaaaagcatt cgtccggttg 300 cgctttcctt tctgtcaaga agcagtttga agaattaacc cttggtgaat ttttgaaact 360 ggacagagaa agagccaaga acaaaattgc aaaggaaacc aacaataaga agaaagaatt 420 tgaggaaact gcgaagaaag tgcgccgtgc catcgagcag ctggctgcca tggattgagg 480 cctctggccg gagctgcctg gtcccagagt ggctgcacca cttccagggt ttattccctg 540 gtgccaccag ccttcctgtg ggccccttag caatgtctta ggaaaggaga tcaacatttt 600 caaattagat gtttcaactg tgctcctgtt ttgtcttgaa agtggcacca gaggtgcttc 660 tgcctgtgca gcgggtgctg ctggtaacag tggctgcttc tctctctctc tctctttttt 720 gggggctcat ttttgctgtt ttgattcccg ggcttaccag gtgagaagtg agggaggaag 780 aaggcagtgt cccttttgct agagctgaca gctttgttcg cgtgggcaga gccttccaca 840 gtgaatgtgt ctggacctca tgttgttgag gctgtcacag tcctgagtgt ggacttggca 900 ggtgcctgtt gaatctgagc tgcaggttcc ttatctgtca cacctgtgcc tcctcagagg 960 acagtttttt tgttgttgtg tttttttgtt tttttttttt ggtagatgca tgacttgtgt 1020 gtgatgagag aatggagaca gagtccctgg ctcctctact gtttaacaac atggctttct 1080 tattttgttt gaattgttaa ttcacagaat agcacaaact acaattaaaa ctaagcacaa 1140 agccattcta agtcattggg gaaacggggt gaacttcagg tggatgagga gacagaatag 1200 agtgatagga agcgtctggc agatactcct tttgccactg ctgtgtgatt agacaggccc 1260 agtgagccgc ggggcacatg ctggccgctc ctccctcaga aaaaggcagt ggcctaaatc 1320 ctttttaaat gacttggctc gatgctgtgg gggactggct gggctgctgc aggccgtgtg 1380 tctgtcagcc caaccttcac atctgtcacg ttctccacac gggggagaga cgcagtccgc 1440 ccaggtcccc gctttctttg gaggcagcag ctcccgcagg gctgaagtct ggcgtaagat 1500 gatggatttg attcgccctc ctccctgtca tagagctgca gggtggattg ttacagcttc 1560 gctggaaacc tctggaggtc atctcggctg ttcctgagaa ataaaaagcc tgtcatttc 1619 29 27 RNA Homo sapiens 29 ggcgucacac cuucggguga agucgcc 27 30 27 RNA Homo sapiens 30 ggcgucacac cuucggguga agucgcc 27 31 12 PRT Homo sapiens 31 Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro 1 5 10
Claims (18)
1. A method for identifying a test compound that binds to a target RNA molecule, comprising the steps of:
(a) contacting a detectably labeled target RNA molecule with a library of test compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of test compounds so that a detectably labeled target RNA:test compound complex is formed;
(b) separating the detectably labeled target RNA:test compound complex formed in step (a) from uncomplexed target RNA molecules and test compounds; and
(c) determining a structure of the test compound bound to the RNA in the RNA:test compound complex.
2. The method of claim 1 in which the target RNA molecule contains an HIV TAR element, internal ribosome entry site, “slippery site”, instability element, or adenylate uridylate-rich element.
3. The method of claim 1 in which the RNA molecule is an element derived from the mRNA for tumor necrosis factor alpha (“TNF-α”), granulocyte-macrophage colony stimulating factor (“GM-CSF”), interleukin 2 (“IL-2”), interleukin 6 (“IL-6”), vascular endothelial growth factor (“VEGF”), human immunodeficiency virus I (“HIV-1”), hepatitis C virus (“HCV”—genotypes 1a & 1b), ribonuclease P RNA (“RNaseP”), X-linked inhibitor of apoptosis protein (“XIAP”), or survivin.
4. The method of claim 1 in which the detectably labeled RNA is labeled with a fluorescent dye, phosphorescent dye, ultraviolet dye, infrared dye, visible dye, radiolabel, enzyme, spectroscopic colorimetric label, affinity tag, or nanoparticle.
5. The method of claim 1 in which the test compound is selected from a combinatorial library comprising peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; or small organic molecule libraries.
6. The method of claim 5 in which the small organic molecule libraries are libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, or diazepindiones.
7. The method of claim 1 in which screening a library of test compounds comprises contacting the test compound with the target nucleic acid in the presence of an aqueous solution wherein the aqueous solution comprises a buffer and a combination of salts.
8. The method of claim 7 wherein the aqueous solution approximates or mimics physiologic conditions.
9. The method of claim 7 in which the aqueous solution optionally further comprises non-specific nucleic acids comprising DNA, yeast tRNA, salmon sperm DNA, homoribopolymers, and nonspecific RNAs.
10. The method of claim 7 in which the aqueous solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant.
11. The method of claim 10 in which the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 MM MgCl2.
13. The method of claim 11 wherein the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl2.
14. The method of claim 10 wherein the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.
15. The method of claim 1 in which separating the detectably labeled target RNA:test compound complex formed in step (a) from uncomplexed target RNA and test compounds is by electrophoresis.
16. The method of claim 15 in which the electrophoresis is capillary electrophoresis.
17. The method of claim 1 in which separating the detectably labeled target RNA:test compound. complex formed in step (a) from uncomplexed target RNA and test compounds is by fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, or nanoparticle aggregation.
18. The method of claim 1 in which the library of test compounds are small organic molecule libraries.
19. The method of claim 18 in which the structure of the test compound is determined by mass spectroscopy, NMR, or vibration spectroscopy.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/475,024 US20040219545A1 (en) | 2001-04-13 | 2002-04-11 | Methods for identifying small molecules that bind specific rna structural motifs |
US11/347,748 US20060228730A1 (en) | 2001-04-11 | 2006-02-03 | Methods for identifying small molecules that bind specific RNA structural motifs |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US28386901P | 2001-04-13 | 2001-04-13 | |
PCT/US2002/011757 WO2002083953A1 (en) | 2001-04-11 | 2002-04-11 | Methods for identifying small molecules that bind specific rna structural motifs |
US10/475,024 US20040219545A1 (en) | 2001-04-13 | 2002-04-11 | Methods for identifying small molecules that bind specific rna structural motifs |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US11/347,748 Continuation US20060228730A1 (en) | 2001-04-11 | 2006-02-03 | Methods for identifying small molecules that bind specific RNA structural motifs |
Publications (1)
Publication Number | Publication Date |
---|---|
US20040219545A1 true US20040219545A1 (en) | 2004-11-04 |
Family
ID=23087914
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/475,024 Abandoned US20040219545A1 (en) | 2001-04-11 | 2002-04-11 | Methods for identifying small molecules that bind specific rna structural motifs |
US10/123,001 Expired - Lifetime US6649573B2 (en) | 2001-04-13 | 2002-04-11 | Solid lubricant and composition |
US10/655,082 Abandoned US20040043908A1 (en) | 2001-04-13 | 2003-09-03 | Solid lubricant and composition |
Family Applications After (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/123,001 Expired - Lifetime US6649573B2 (en) | 2001-04-13 | 2002-04-11 | Solid lubricant and composition |
US10/655,082 Abandoned US20040043908A1 (en) | 2001-04-13 | 2003-09-03 | Solid lubricant and composition |
Country Status (4)
Country | Link |
---|---|
US (3) | US20040219545A1 (en) |
AU (1) | AU2002314745A1 (en) |
CA (1) | CA2381627C (en) |
WO (1) | WO2002083822A2 (en) |
Cited By (17)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060128031A1 (en) * | 2004-12-15 | 2006-06-15 | Robotti Karla M | Addressable recovery of bound analytes from an evanescent wave sensor |
US20060257866A1 (en) * | 2002-07-24 | 2006-11-16 | Welch Ellen M | Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mrna decay |
US20060269923A1 (en) * | 2003-03-27 | 2006-11-30 | Trotta Christopher R | Methods of identifying compounds that target trna splicing endonuclease and uses of said compounds as anti-fungal agents |
US20070020630A1 (en) * | 2003-03-27 | 2007-01-25 | Trotta Christopher R | Methods of identifying compounds that target trna splicing endonuclease and uses of said compounds as anti-proliferative agents |
US20070099200A1 (en) * | 2002-04-24 | 2007-05-03 | Caliper Life Sciences, Inc. | High throughput mobility shift |
US20070178456A1 (en) * | 2003-03-27 | 2007-08-02 | Trotta Christopher R | Targeting enzymes of the trna splicing pathway for identification of anti-fungal and/or anti-proliferative molecules |
US20100069260A1 (en) * | 2006-11-22 | 2010-03-18 | Guenther Richard H | Compositions and methods for the identification of inhibitors of protein synthesis |
US20100136710A1 (en) * | 2003-07-02 | 2010-06-03 | Ptc Therapeutics, Inc. | RNA processing protein complexes and uses thereof |
US20100291032A1 (en) * | 2007-09-14 | 2010-11-18 | Trana Discovery | Compositions and methods for the identification of inhibitors of retroviral infection |
US20110229920A1 (en) * | 2008-09-29 | 2011-09-22 | Trana Discovery, Inc. | Screening methods for identifying specific staphylococcus aureus inhibitors |
US20120152743A1 (en) * | 2010-12-17 | 2012-06-21 | General Electric Company | Method for electroeluting genetic material from dried samples |
US9230185B1 (en) * | 2012-03-30 | 2016-01-05 | Pierce Biotechnology, Inc. | Analysis of electrophoretic bands in a substrate |
US20160326227A1 (en) * | 2013-10-17 | 2016-11-10 | Institut D'investigaciones Biomediques August Pi I Sunyer | Diagnostic method for detecting a gaba(a) related autoimmune disease and related subject-matter |
WO2016204983A1 (en) * | 2015-06-19 | 2016-12-22 | Seracare Life Sciences, Inc. | Sindbis control virus |
WO2018057070A1 (en) * | 2016-09-21 | 2018-03-29 | Florida State University Research Foundation, Inc. | Determining molecular and molecular assembly structures from a momentum transfer cross section distribution |
US20220291121A1 (en) * | 2016-09-17 | 2022-09-15 | C Technologies Inc. | Monitoring of Compounds |
US20230103705A1 (en) * | 2019-09-05 | 2023-04-06 | Korea Research Institute Of Standards And Science | Raman-active particle for surface-enhanced raman scattering and method of producing the same |
Families Citing this family (21)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7244695B2 (en) * | 2000-09-29 | 2007-07-17 | Kelsan Technologies Corp. | Method for reducing wear of steel elements in sliding-rolling contact |
US7820598B2 (en) * | 2001-04-13 | 2010-10-26 | Mitrovich Michael J | Solid lubricant sticks having a two part formulation |
US7943556B2 (en) * | 2001-04-13 | 2011-05-17 | Mitrovich Michael J | Environmentally friendly solid lubricant sticks |
WO2002083822A2 (en) * | 2001-04-13 | 2002-10-24 | Mitrovich Michael J | Solid lubricant and composition |
US8304373B2 (en) * | 2002-11-21 | 2012-11-06 | Oiles Corporation | Solid lubricant and sliding member |
CA2597830C (en) * | 2005-02-14 | 2015-06-02 | Kelsan Technologies Corp. | Solid stick compositions comprising thermosetting plastic |
US20060264336A1 (en) * | 2005-05-04 | 2006-11-23 | Kelsan Technologies Corp. | Modified interlocking solid stick |
US7449433B1 (en) | 2005-05-24 | 2008-11-11 | Environmental Lubricants Mfg., Inc. | Rigid structure lubricant |
US7709426B2 (en) * | 2005-07-08 | 2010-05-04 | Kelsan Technologies Corp. | Solid stick grease compositions |
US7910527B2 (en) * | 2006-03-21 | 2011-03-22 | University Of Florida Research Foundation | Wear resistant lubricious composite |
WO2007135722A1 (en) * | 2006-05-19 | 2007-11-29 | Oiles Corporation | Spherical belt-like seal body, exhaust pipe joint device making use of the same and process for manufacturing spherical belt-like seal body |
US8445416B2 (en) * | 2007-01-26 | 2013-05-21 | L.B. Foster Rail Technologies, Corp. | Solid stick compositions comprising vinyl ester |
US8304066B2 (en) * | 2008-01-11 | 2012-11-06 | Lexmark International, Inc. | Toner release coating |
US20090325829A1 (en) * | 2008-06-27 | 2009-12-31 | Cowan Sandra S | Reduced Molybdenum Grease Formulation |
CH699751A1 (en) * | 2008-10-30 | 2010-04-30 | Brugg Drahtseil Ag | Rope lubricant. |
US20140087980A1 (en) | 2012-09-21 | 2014-03-27 | Mpl Technology, Inc. | Lubricant compositions |
CN106281619B (en) * | 2016-08-16 | 2022-08-23 | 浙江宝晟铁路新材料科技有限公司 | Rail distance surface sweat gland type solid lubricating rod, preparation method thereof and clamping device thereof |
USD872151S1 (en) * | 2017-11-30 | 2020-01-07 | Mpl Innovations, Inc. | Lubricant stick |
USD873319S1 (en) * | 2017-11-30 | 2020-01-21 | Mpl Innovations, Inc. | Lubricant stick |
USD864269S1 (en) * | 2017-11-30 | 2019-10-22 | Mpl Innovations, Inc. | Lubricant stick |
CN111073745B (en) * | 2019-12-31 | 2022-12-13 | 中山绿材新材料科技有限公司 | Solid lubricating material for photosensitive drum and preparation method thereof |
Citations (23)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5510240A (en) * | 1990-07-02 | 1996-04-23 | The Arizona Board Of Regents | Method of screening a peptide library |
US5593835A (en) * | 1995-05-12 | 1997-01-14 | President And Fellows Of Harvard College | Methods and kits for RNA binding compounds |
US5650316A (en) * | 1994-06-06 | 1997-07-22 | Research Development Foundation | Uses of triplex forming oligonucleotides for the treatment of human diseases |
US5667975A (en) * | 1994-05-06 | 1997-09-16 | The University Of North Carolina | Method of fluorescent detection of nucleic acids and cytoskeleton elements using bis-dicationic aryl furans |
US5712096A (en) * | 1994-08-23 | 1998-01-27 | University Of Massachusetts Medical Center | Oligoribonucleotide assays for novel antibiotics |
US5716825A (en) * | 1995-11-01 | 1998-02-10 | Hewlett Packard Company | Integrated nucleic acid analysis system for MALDI-TOF MS |
US5807682A (en) * | 1992-04-03 | 1998-09-15 | The Perkin-Elmer Corporation | Probe composition containing a binding domain and polymer chain and method of use |
US5840702A (en) * | 1996-03-22 | 1998-11-24 | Uab Research Foundation | Cystic fibrosis treatment |
US5866341A (en) * | 1996-04-03 | 1999-02-02 | Chugai Pharmaceutical Co., Ltd. | Compositions and methods for screening drug libraries |
US6004749A (en) * | 1996-07-31 | 1999-12-21 | Message Pharmaceuticals | Method for identifying compounds affecting RNA/RNA binding protein interactions |
US6060240A (en) * | 1996-12-13 | 2000-05-09 | Arcaris, Inc. | Methods for measuring relative amounts of nucleic acids in a complex mixture and retrieval of specific sequences therefrom |
US6071700A (en) * | 1995-01-20 | 2000-06-06 | University Of Massachusetts | Heterologous polypeptide production in the absence of nonsense-mediated MRNA decay functions |
US6090912A (en) * | 1993-05-27 | 2000-07-18 | Selectide Corporation | Topologically segregated, encoded solid phase libraries comprising linkers having an enzymatically susceptible bond |
US6107029A (en) * | 1996-07-31 | 2000-08-22 | Message Pharmaceticals, Inc. | Universal method for detecting interactions between RNA molecules and RNA binding proteins |
US6147344A (en) * | 1998-10-15 | 2000-11-14 | Neogenesis, Inc | Method for identifying compounds in a chemical mixture |
US6207391B1 (en) * | 1998-03-31 | 2001-03-27 | Tularik Inc. | High-throughput screening assays for modulators of STAT4 and STAT6 activity |
US6211477B1 (en) * | 1998-02-26 | 2001-04-03 | Becton Dickinson And Company | Electrostatic deceleration system for flow cytometer |
US6320040B1 (en) * | 1990-07-27 | 2001-11-20 | Isis Pharmaceuticals, Inc. | 4-desmethyl nucleoside analogs and oligomers thereof |
US6329146B1 (en) * | 1998-03-02 | 2001-12-11 | Isis Pharmaceuticals, Inc. | Mass spectrometric methods for biomolecular screening |
US6355428B1 (en) * | 1998-09-11 | 2002-03-12 | Genelabs Technologies, Inc. | Nucleic acid ligand interaction assays |
US6391542B1 (en) * | 1992-09-10 | 2002-05-21 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of Hepatitis C virus-associated diseases |
US6503713B1 (en) * | 1999-10-04 | 2003-01-07 | University Of Medicine And Dentistry Of New Jersey | Methods for identifying RNA binding compounds |
US6503721B2 (en) * | 1995-09-08 | 2003-01-07 | Anadys Pharmaceuticals, Inc. | Screen for compounds with affinity for nucleic acids |
Family Cites Families (39)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR774488A (en) | 1934-06-12 | 1934-12-07 | Improvements to reverse-loading mechanical fireplaces | |
US2589582A (en) * | 1949-08-12 | 1952-03-18 | Strughold Peter | Lubricant stick |
US3729415A (en) | 1964-04-28 | 1973-04-24 | Ferri J | Lubricating composition |
US3541011A (en) | 1964-04-28 | 1970-11-17 | Joseph E Ferri | Lubricating composition |
US3537819A (en) | 1966-07-19 | 1970-11-03 | United States Steel Corp | Manufacture of phosphoryl fluoride and difluorophosphoric acid |
US3433742A (en) * | 1967-10-26 | 1969-03-18 | Petro Tex Chem Corp | Polybutene-1 bearing compositions and method |
US3607746A (en) * | 1968-11-29 | 1971-09-21 | Shell Oil Co | Surface coated wax-polymer lubricant compositions |
US3944025A (en) | 1973-10-09 | 1976-03-16 | Electronic Flange Lubricators, Inc. | Flanged wheel lubricating apparatus |
GB1438215A (en) * | 1974-05-08 | 1976-06-03 | Lonz Ltd | High temperature lubricant |
US3946682A (en) | 1974-10-25 | 1976-03-30 | The Singer Company - Patent Department | Swingaway convertible bed cabinets |
ZA84247B (en) * | 1983-02-18 | 1984-09-26 | Lonza Ag | Parting and lubricating agent in solid form |
US4647386A (en) | 1983-10-03 | 1987-03-03 | Jamison Warren E | Intercalated transition metal based solid lubricating composition and method of so forming |
US4711320A (en) | 1985-10-08 | 1987-12-08 | Madison-Kipp Corporation | Wheel flange and rail lubricator apparatus |
US4715972A (en) * | 1986-04-16 | 1987-12-29 | Pacholke Paula J | Solid lubricant additive for gear oils |
US4659762A (en) * | 1986-07-25 | 1987-04-21 | Ciba-Geigy Corporation | Tris (substituted hydroxyphenylthio) trithioorthoester stabilizers for polymers |
CH669207A5 (en) * | 1986-07-29 | 1989-02-28 | Lonza Ag | Compsn. for reducing friction noise on contacting metal surfaces - contg. thermoplastic (co)polymer lubricant for synthetics and solid lubricant |
US4763759A (en) | 1987-05-04 | 1988-08-16 | Eximport Industria E Comercio Ltda. | Apparatus for lubricating wheel flanges of a railroad vehicle |
US4915856A (en) | 1987-07-10 | 1990-04-10 | Durafilm Corporation | Solid lubricant composition |
GB2207146B (en) | 1987-07-10 | 1991-07-24 | Durafilm Materials Corp | Solid lubricant composition |
US4811818A (en) | 1987-08-19 | 1989-03-14 | Durafilm Corporation | Transit rail lubricant applicator |
US5173204A (en) * | 1989-06-08 | 1992-12-22 | Century Oils (Canada), Inc. | Solid lubricant with high and positive friction characteristic |
US5308516A (en) * | 1989-06-08 | 1994-05-03 | Century Oils, Inc. | Friction modifiers |
AU639465B2 (en) * | 1989-06-08 | 1993-07-29 | Kelsan Technologies Corp. | Lubricant composition |
US5076339B1 (en) * | 1990-02-08 | 1998-06-09 | J & S Chemical Corp | Solid lubricant for die-casting process |
JP2866457B2 (en) * | 1990-08-02 | 1999-03-08 | オイレス工業株式会社 | Solid lubricant and sliding member embedded with the solid lubricant |
CA2106036C (en) * | 1992-09-30 | 2001-07-31 | Andrew F. Lum | Carrier-free metalworking lubricant and method of making and using same |
US5337860A (en) | 1993-04-07 | 1994-08-16 | Burke Robert J | Railroad wheel flange lubricator mounting |
CA2095996C (en) * | 1993-05-11 | 2002-11-19 | Terry Grinham | Lubricant for lubricating the id surface of a tyre for a rotary trunnion supported equipment |
US5363821A (en) * | 1993-07-06 | 1994-11-15 | Ford Motor Company | Thermoset polymer/solid lubricant coating system |
US5435925A (en) | 1993-08-13 | 1995-07-25 | E/M Corporation | Polyethylene lubricant-dispensing compositions |
US5385683A (en) * | 1993-10-05 | 1995-01-31 | Ransom; Louis J. | Anti-friction composition |
CN1031204C (en) * | 1993-11-05 | 1996-03-06 | 张念 | Wheel-rail lubricating composite |
EP0774488A1 (en) * | 1995-11-11 | 1997-05-21 | Alcatel | Fire propagation inhibiting composition |
DE29719861U1 (en) * | 1997-11-11 | 1998-01-02 | Roechling Haren Kg | Flame retardant plastic material |
US6142258A (en) * | 1999-02-18 | 2000-11-07 | Gsti Surface Technologies Ltd. | Solid lubrication tools and methods for their production and use |
US6182793B1 (en) | 1999-04-13 | 2001-02-06 | Warren Jamison | Lubricant delivery system for lubricating rail wheel flanges |
AU2001291574A1 (en) * | 2000-09-29 | 2002-04-08 | Kelsan Technologies Corp. | Friction control compositions |
WO2002083822A2 (en) * | 2001-04-13 | 2002-10-24 | Mitrovich Michael J | Solid lubricant and composition |
US6749772B2 (en) * | 2002-04-24 | 2004-06-15 | Illinois Tool Works, Inc. | Fluorescent lubricant |
-
2002
- 2002-04-11 WO PCT/US2002/011751 patent/WO2002083822A2/en not_active Application Discontinuation
- 2002-04-11 US US10/475,024 patent/US20040219545A1/en not_active Abandoned
- 2002-04-11 CA CA2381627A patent/CA2381627C/en not_active Expired - Fee Related
- 2002-04-11 US US10/123,001 patent/US6649573B2/en not_active Expired - Lifetime
- 2002-04-11 AU AU2002314745A patent/AU2002314745A1/en not_active Abandoned
-
2003
- 2003-09-03 US US10/655,082 patent/US20040043908A1/en not_active Abandoned
Patent Citations (23)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5510240A (en) * | 1990-07-02 | 1996-04-23 | The Arizona Board Of Regents | Method of screening a peptide library |
US6320040B1 (en) * | 1990-07-27 | 2001-11-20 | Isis Pharmaceuticals, Inc. | 4-desmethyl nucleoside analogs and oligomers thereof |
US5807682A (en) * | 1992-04-03 | 1998-09-15 | The Perkin-Elmer Corporation | Probe composition containing a binding domain and polymer chain and method of use |
US6391542B1 (en) * | 1992-09-10 | 2002-05-21 | Isis Pharmaceuticals, Inc. | Compositions and methods for treatment of Hepatitis C virus-associated diseases |
US6090912A (en) * | 1993-05-27 | 2000-07-18 | Selectide Corporation | Topologically segregated, encoded solid phase libraries comprising linkers having an enzymatically susceptible bond |
US5667975A (en) * | 1994-05-06 | 1997-09-16 | The University Of North Carolina | Method of fluorescent detection of nucleic acids and cytoskeleton elements using bis-dicationic aryl furans |
US5650316A (en) * | 1994-06-06 | 1997-07-22 | Research Development Foundation | Uses of triplex forming oligonucleotides for the treatment of human diseases |
US5712096A (en) * | 1994-08-23 | 1998-01-27 | University Of Massachusetts Medical Center | Oligoribonucleotide assays for novel antibiotics |
US6071700A (en) * | 1995-01-20 | 2000-06-06 | University Of Massachusetts | Heterologous polypeptide production in the absence of nonsense-mediated MRNA decay functions |
US5593835A (en) * | 1995-05-12 | 1997-01-14 | President And Fellows Of Harvard College | Methods and kits for RNA binding compounds |
US6503721B2 (en) * | 1995-09-08 | 2003-01-07 | Anadys Pharmaceuticals, Inc. | Screen for compounds with affinity for nucleic acids |
US5716825A (en) * | 1995-11-01 | 1998-02-10 | Hewlett Packard Company | Integrated nucleic acid analysis system for MALDI-TOF MS |
US5840702A (en) * | 1996-03-22 | 1998-11-24 | Uab Research Foundation | Cystic fibrosis treatment |
US5866341A (en) * | 1996-04-03 | 1999-02-02 | Chugai Pharmaceutical Co., Ltd. | Compositions and methods for screening drug libraries |
US6004749A (en) * | 1996-07-31 | 1999-12-21 | Message Pharmaceuticals | Method for identifying compounds affecting RNA/RNA binding protein interactions |
US6107029A (en) * | 1996-07-31 | 2000-08-22 | Message Pharmaceticals, Inc. | Universal method for detecting interactions between RNA molecules and RNA binding proteins |
US6060240A (en) * | 1996-12-13 | 2000-05-09 | Arcaris, Inc. | Methods for measuring relative amounts of nucleic acids in a complex mixture and retrieval of specific sequences therefrom |
US6211477B1 (en) * | 1998-02-26 | 2001-04-03 | Becton Dickinson And Company | Electrostatic deceleration system for flow cytometer |
US6329146B1 (en) * | 1998-03-02 | 2001-12-11 | Isis Pharmaceuticals, Inc. | Mass spectrometric methods for biomolecular screening |
US6207391B1 (en) * | 1998-03-31 | 2001-03-27 | Tularik Inc. | High-throughput screening assays for modulators of STAT4 and STAT6 activity |
US6355428B1 (en) * | 1998-09-11 | 2002-03-12 | Genelabs Technologies, Inc. | Nucleic acid ligand interaction assays |
US6147344A (en) * | 1998-10-15 | 2000-11-14 | Neogenesis, Inc | Method for identifying compounds in a chemical mixture |
US6503713B1 (en) * | 1999-10-04 | 2003-01-07 | University Of Medicine And Dentistry Of New Jersey | Methods for identifying RNA binding compounds |
Cited By (33)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9683994B2 (en) * | 2002-04-24 | 2017-06-20 | Caliper Life Sciences, Inc. | High throughput mobility shift |
US8241883B2 (en) * | 2002-04-24 | 2012-08-14 | Caliper Life Sciences, Inc. | High throughput mobility shift |
US20070099200A1 (en) * | 2002-04-24 | 2007-05-03 | Caliper Life Sciences, Inc. | High throughput mobility shift |
US20120273353A1 (en) * | 2002-04-24 | 2012-11-01 | Caliper Life Sciences, Inc. | High throughput mobility shift |
US20060257866A1 (en) * | 2002-07-24 | 2006-11-16 | Welch Ellen M | Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mrna decay |
US7927791B2 (en) | 2002-07-24 | 2011-04-19 | Ptc Therapeutics, Inc. | Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mRNA decay |
US20070020630A1 (en) * | 2003-03-27 | 2007-01-25 | Trotta Christopher R | Methods of identifying compounds that target trna splicing endonuclease and uses of said compounds as anti-proliferative agents |
US20100267035A1 (en) * | 2003-03-27 | 2010-10-21 | Ptc Therapeutics, Inc. | METHODS OF IDENTIFYING COMPOUNDS THAT TARGET tRNA SPLICING ENDONUCLEASE AND USES OF SAID COMPOUNDS AS ANTI-PROLIFERATIVE AGENTS |
US7829503B2 (en) | 2003-03-27 | 2010-11-09 | Ptc Therapeutics, Inc. | Methods of identifying compounds that target tRNA splicing endonuclease and uses of said compounds as anti-fungal agents |
US20070178456A1 (en) * | 2003-03-27 | 2007-08-02 | Trotta Christopher R | Targeting enzymes of the trna splicing pathway for identification of anti-fungal and/or anti-proliferative molecules |
US7939468B2 (en) | 2003-03-27 | 2011-05-10 | Ptc Therapeutics, Inc. | Methods of identifying compounds that target tRNA splicing endonuclease and uses of said compounds as anti-proliferative agents |
US20060269923A1 (en) * | 2003-03-27 | 2006-11-30 | Trotta Christopher R | Methods of identifying compounds that target trna splicing endonuclease and uses of said compounds as anti-fungal agents |
US20100136710A1 (en) * | 2003-07-02 | 2010-06-03 | Ptc Therapeutics, Inc. | RNA processing protein complexes and uses thereof |
US8278085B2 (en) | 2003-07-02 | 2012-10-02 | Ptc Therapeutics, Inc. | RNA processing protein complexes and uses thereof |
US20060128031A1 (en) * | 2004-12-15 | 2006-06-15 | Robotti Karla M | Addressable recovery of bound analytes from an evanescent wave sensor |
US8232378B2 (en) | 2006-11-22 | 2012-07-31 | Trana Discovery, Inc. | Compositions and methods for the identification of inhibitors of protein synthesis |
US8431341B2 (en) | 2006-11-22 | 2013-04-30 | Trana Discovery, Inc. | Compositions and methods for the identification of inhibitors of protein synthesis |
US20100069260A1 (en) * | 2006-11-22 | 2010-03-18 | Guenther Richard H | Compositions and methods for the identification of inhibitors of protein synthesis |
US20110033850A1 (en) * | 2007-09-14 | 2011-02-10 | Agris Paul F | Compositions and methods for the identification of inhibitors of retroviral infection |
US20100291032A1 (en) * | 2007-09-14 | 2010-11-18 | Trana Discovery | Compositions and methods for the identification of inhibitors of retroviral infection |
US20110229920A1 (en) * | 2008-09-29 | 2011-09-22 | Trana Discovery, Inc. | Screening methods for identifying specific staphylococcus aureus inhibitors |
US20120152743A1 (en) * | 2010-12-17 | 2012-06-21 | General Electric Company | Method for electroeluting genetic material from dried samples |
US9552529B2 (en) * | 2012-03-30 | 2017-01-24 | Pierce Biotechnology, Inc. | Analysis of electrophoretic bands in a substrate |
US9230185B1 (en) * | 2012-03-30 | 2016-01-05 | Pierce Biotechnology, Inc. | Analysis of electrophoretic bands in a substrate |
US20160326227A1 (en) * | 2013-10-17 | 2016-11-10 | Institut D'investigaciones Biomediques August Pi I Sunyer | Diagnostic method for detecting a gaba(a) related autoimmune disease and related subject-matter |
US11041005B2 (en) * | 2013-10-17 | 2021-06-22 | Institut D'investigaciones Biomediques August Pi I Sunyer | Methods for detecting autoantibodies against a GABA(A) receptor alpha 1 subunit and/or beta 3 subunit in autoimmune seizure and/or encephalitis |
WO2016204983A1 (en) * | 2015-06-19 | 2016-12-22 | Seracare Life Sciences, Inc. | Sindbis control virus |
US20220291121A1 (en) * | 2016-09-17 | 2022-09-15 | C Technologies Inc. | Monitoring of Compounds |
WO2018057070A1 (en) * | 2016-09-21 | 2018-03-29 | Florida State University Research Foundation, Inc. | Determining molecular and molecular assembly structures from a momentum transfer cross section distribution |
GB2568442A (en) * | 2016-09-21 | 2019-05-15 | Univ Florida State Res Found Inc | Determining molecular and molecular assembly structures from a momentum transfer cross section distribution |
US10605773B2 (en) | 2016-09-21 | 2020-03-31 | The Florida State University Research Foundation, Inc. | Determining molecular and molecular assembly structures from a momentum transfer cross section distribution |
GB2568442B (en) * | 2016-09-21 | 2023-01-18 | Univ Florida State Res Found Inc | Determining molecular and molecular assembly structures from a momentum transfer cross section distribution |
US20230103705A1 (en) * | 2019-09-05 | 2023-04-06 | Korea Research Institute Of Standards And Science | Raman-active particle for surface-enhanced raman scattering and method of producing the same |
Also Published As
Publication number | Publication date |
---|---|
US20040043908A1 (en) | 2004-03-04 |
WO2002083822A2 (en) | 2002-10-24 |
AU2002314745A1 (en) | 2002-10-28 |
US6649573B2 (en) | 2003-11-18 |
US20020151440A1 (en) | 2002-10-17 |
WO2002083822A3 (en) | 2003-04-03 |
CA2381627A1 (en) | 2002-10-13 |
CA2381627C (en) | 2010-06-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20040219545A1 (en) | Methods for identifying small molecules that bind specific rna structural motifs | |
US20060194234A1 (en) | Methods for identifying small molecules that bind specific RNA structural motifs | |
US20060228730A1 (en) | Methods for identifying small molecules that bind specific RNA structural motifs | |
EP1377684A1 (en) | Methods for identifying small molecules that bind specific rna structural motifs | |
Halperin et al. | CRISPR-guided DNA polymerases enable diversification of all nucleotides in a tunable window | |
Adams | The biochemistry of the nucleic acids | |
CN111868255A (en) | Methods and reagents for enriching nucleic acid material for sequencing applications and other nucleic acid material interrogation | |
Matsuura et al. | Real-time observation of a single DNA digestion by λ exonuclease under a fluorescence microscope field | |
KR20210135626A (en) | The method and the composition for analyzing the cellular constituent | |
Tsukamoto et al. | Hdf1, a yeast Ku-protein homologue, is involved in illegitimate recombination, but not in homologous recombination | |
ATE295540T1 (en) | PERFECT MAGNETIC PARTICLES, METHOD FOR THEIR PRODUCTION AND THEIR APPLICATIONS FOR SEPARATING MOLECULES | |
CA2410072A1 (en) | Polymerase cleavage agents and detection of rna | |
ES539560A0 (en) | IMPROVEMENTS IN THE PROVISIONS FOR THE DETECTION OF DETERMINED NUCLEOTIDE DISEQUENCES, DETECTION AND CHARACTERIZATION PROCEDURE OF A SEQUENCE OR OF A DETERMINED NUCLEIC ACID FRAGMENT AND CLONED PROBE | |
CN112147185B (en) | Method for controlling speed of polypeptide passing through nanopore and application of method | |
Koski et al. | Identification of a ribonuclease P-like activity from human KB cells | |
Barik | Mutagenesis and gene fusion by megaprimer PCR | |
Fotedar et al. | Multistep pathway for replication-dependent nucleosome assembly. | |
WO2021252867A2 (en) | Methods of enriching for target nucelic acid molecules and uses thereof | |
Stuart et al. | Kinetoplastid RNA editing: complexes and catalysts | |
US20090203003A1 (en) | Inhibition of metallo-beta-lactamase | |
Wu et al. | Recent advances in DNA sequence analysi | |
Whitehead et al. | AhaIII: a restriction endonuclease with a recognition sequence containing only A: T basepairs | |
Roche et al. | Capillary electrophoresis in biotechnology | |
Boulikas | Studies on protein poly (ADP-ribosylation) using high resolution gel electrophoresis. | |
De Peña et al. | A microfluidic electrophoretic dual dynamic staining method for the identification and relative quantitation of dsRNA contaminants in mRNA vaccines |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |