US20040171566A1

US20040171566A1 - Antisense modulation of p38 mitogen activated protein kinase expression

Info

Publication number: US20040171566A1
Application number: US10/641,455
Authority: US
Inventors: Brett Monia; William Gaarde; Pamela Nero; Robert McKay; Wai Wong
Original assignee: National University of Singapore; Isis Pharmaceuticals Inc
Current assignee: National University of Singapore; Ionis Pharmaceuticals Inc
Priority date: 1999-04-06
Filing date: 2003-08-15
Publication date: 2004-09-02
Also published as: US20080194503A1; WO2005016947A3; WO2005016947A2; EP1660682A2; ATE527378T1; EP1660682A4; US7981868B2; EP1660682B1

Abstract

Compositions and methods for the treatment and diagnosis of diseases or conditions amenable to treatment through modulation of expression of a gene encoding a p38 mitogen-activated protein kinase (p38 MAPK) are provided. Methods for the treatment and diagnosis of diseases or conditions associated with aberrant expression of one or more p38 MAPKs are also provided.

Description

This application is a continuation-in-part of U.S. patent application Ser. No. 10/238,442, filed Sep. 9, 2002, which is a continuation of U.S. patent application Ser. No. 09/640,101 filed Aug. 15, 2000, now issued as U.S. Pat. No. 6,448,079, which is a continuation-in-part of U.S. patent application Ser. No. 09/286,904, filed Apr. 6, 1999, now issued as U.S. Pat. No. 6,140,124.[0001]

FIELD OF THE INVENTION

This invention relates to compositions and methods for modulating expression of p38 mitogen activated protein kinase genes, a family of naturally present cellular genes involved in signal transduction, and inflammatory and apoptotic responses. This invention is also directed to methods for inhibiting inflammation or apoptosis; these methods can be used diagnostically or therapeutically. Furthermore, this invention is directed to treatment of diseases or conditions associated with expression of p38 mitogen activated protein kinase genes.

BACKGROUND OF THE INVENTION

Cellular responses to external factors, such as growth factors, cytokines, and stress conditions, result in altered gene expression. These signals are transmitted from the cell surface to the nucleus by signal transduction pathways. Beginning with an external factor binding to an appropriate receptor, a cascade of signal transduction events is initiated. These responses are mediated through activation of various enzymes and the subsequent activation of specific transcription factors. These activated transcription factors then modulate the expression of specific genes.

The phosphorylation of enzymes plays a key role in the transduction of extracellular signals into the cell. Mitogen activated protein kinases (MAPKs), enzymes which effect such phosphorylations are targets for the action of growth factors, hormones, and other agents involved in cellular metabolism, proliferation and differentiation (Cobb et al., J. Biol. Chem., 1995, 270, 14843). Mitogen activated protein kinases were initially discovered due to their ability to be tyrosine phosphorylated in response to exposure to bacterial lipopolysaccharides or hyperosmotic conditons (Han et al, Science, 1994, 265, 808). These conditions activate inflammatory and apoptotic responses mediated by MAPK. In general, MAP kinases are involved in a variety of signal transduction pathways (sometimes overlapping and sometimes parallel) that function to convey extracellular stimuli to protooncogene products to modulate cellular proliferation and/or differentiation (Seger et al., FASEB J., 1995, 9, 726; Cano et al., Trends Biochem. Sci., 1995, 20, 117).

One of the MAPK signal transduction pathways involves the MAP kinases p38α and p38β (also known as CSaids Binding Proteins, CSBP). These MAP kinases are responsible for the phosphorylation of ATF-2, MEFC2 and a variety of other cellular effectors that may serve as substrates for p38 MAPK proteins (Kummer et al, J. Biol. Chem., 1997, 272, 20490). Phosphorylation of p38 MAPKs potentiates the ability of these factors to activate transcription (Raingeaud et al, Mol. Cell Bio., 1996, 16, 1247; Han et al, Nature, 1997, 386, 296). Among the genes activated by the p38 MAPK signaling pathway is IL-6 (De Cesaris, P., et al., J. Biol. Chem., 1998, 273, 7566-7571).

Besides p38α and p38β, other p38 MAPK family members have been described, including p38γ (Li et al, Biochem. Biophys. Res. Commun., 1996, 228, 334), and p38δ (Jiang et al, J. Biol. Chem., 1997, 272, 30122). The term “p38” as used herein shall mean a member of the p38 MAPK family, including but not limited to p38α, p38β, p38γ and p38δ, their isoforms (Kumar et al, Biochem. Biophys. Res. Commun., 1997, 235, 533) and other members of the p38 MAPK family of proteins whether they function as p38 MAP kinases per se or not.

Modulation of the expression of one or more p38 MAPKs is desirable in order to interfere with inflammatory or apoptotic responses associated with disease states and to modulate the transcription of genes stimulated by ATF-2, MEFC2 and other p38 MAPK phosphorylation substrates.

Inhibitors of p38 MAPKs have been shown to have efficacy in animal models of arthritis (Badger, A. M., et al., J. Pharmacol. Exp. Ther., 1996, 279, 1453-1461) and angiogenesis (Jackson, J. R., et al., J. Pharmacol. Exp. Ther., 1998, 284, 687-692). MacKay, K. and Mochy-Rosen, D. (J. Biol. Chem., 1999, 274, 6272-6279) demonstrate that an inhibitor of p38 MAPKs prevents apoptosis during ischemia in cardiac myocytes, suggesting that p38 MAPK inhibitors can be used for treating ischemic heart disease. p38 MAPK also is required for T-cell HIV-1 replication (Cohen et al, Mol. Med., 1997, 3, 339) and may be a useful target for AIDS therapy. Other diseases believed to be amenable to treatment by inhibitors of p38 MAPKs are disclosed in U.S. Pat. No. 5,559,137, herein incorporated by reference.

Therapeutic agents designed to target p38 MAPKs include small molecule inhibitors and antisense oligonucleotides. Small molecule inhibitors based on pyridinyl imidazole are described in U.S. Pat. Nos. 5,670,527; 5,658,903; 5,656,644; 5,559,137; 5,593,992; and 5,593,991. WO 98/27098 and WO 99/00357 describe additional small molecule inhibitors, one of which has entered clinical trials. Other small molecule inhibitors are also known.

Antisense therapy represents a potentially more specific therapy for targeting p38 MAPKs and, in particular, specific p38 MAPK isoforms. Nagata, Y., et al. ( Blood, 1998, 6, 1859-1869) disclose an antisense phosphothioester oligonucleotide targeted to the translational start site of mouse p38b (p38β). Aoshiba, K., et al. (J. Immunol., 1999, 162, 1692-1700) and Cohen, P. S., et al. (Mol. Med., 1997, 3, 339-346) disclose a phosphorothioate antisense oligonucleotide targeted to the coding regions of human p38α, human p38β and rat p38.

There remains a long-felt need for improved compositions and methods for modulating the expression of p38 MAP kinases.

SUMMARY OF THE INVENTION

The present invention provides antisense compounds which are targeted to nucleic acids encoding a p38 MAPK and are capable of modulating p38 MAPK expression. The present invention also provides oligonucleotides targeted to nucleic acids encoding a p38 MAPK. The present invention also comprises methods of modulating the expression of a p38 MAPK, in cells and tissues, using the oligonucleotides of the invention. Methods of inhibiting p38 MAPK expression are provided; these methods are believed to be useful both therapeutically and diagnostically. These methods are also useful as tools, for example, for detecting and determining the role of p38 MAPKs in various cell functions and physiological processes and conditions and for diagnosing conditions associated with expression of p38 MAPKs.

The present invention also comprises methods for diagnosing and treating inflammatory diseases, particularly rheumatoid arthritis and asthma. These methods are believed to be useful, for example, in diagnosing p38 MAPK-associated disease progression. These methods employ the oligonucleotides of the invention. These methods are believed to be useful both therapeutically, including prophylactically, and as clinical research and diagnostic tools.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A-1B are graphs showing the effect of inhaled p38α MAP kinase antisense oligonucleotide ISIS 101757 (ASO, FIG. 1A) and mismatched control oligonucleotide ISIS 101758 (MM ASO, FIG. 1B) on ovalbumin (OVA)-induced airway hyperresponsiveness in a murine asthma model. [0014]
FIG. 2 is a graph showing that inhaled ISIS 101757 increases the provocation concentration of methacholine required to achieve doubling of airway reactivity (PC200) in OVA-challenged mice. [0015]
FIGS. 3A-3B are graphs showing the effect of inhaled ISIS 101757 (FIG. 3A) and 101758 (FIG. 3B) on immune cells in broncheolar lavage (BAL) fluid of OVA-challenged mice. EOS=eosinpophils, NEU=neutrophils, MAC=macrophages, LYM=lymphocyes. [0016]
FIG. 4 is a graph showing aerosolized ISIS 101757 concentration in mouse lung vs. dose. [0017]
FIG. 5 is a graph showing dose-dependent inhibition of the penh response to methacholine (50 mg/ml) challenge by ISIS 101757. ISIS 101757 doses are in mg/kg α-axis). [0018]
FIG. 6 is a graph showing ISIS 101757 concentration (μg/g) in the lungs vs. dose (intratracheal administration).[0019]

DETAILED DESCRIPTION OF THE INVENTION

p38 MAPKs play an important role in signal transduction in response to cytokines, growth factors and other cellular stimuli. Specific responses elicited by p38 include inflammatory and apoptotic responses. Modulation of p38 may be useful in the treatment of inflammatory diseases, such as rheumatoid arthritis. [0020]
The present invention employs antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding a p38 MAPK, ultimately modulating the amount of a p38 MAPK produced. This is accomplished by providing oligonucleotides which specifically hybridize with nucleic acids, preferably mRNA, encoding a p38 MAPK. [0021]
The antisense compounds may be used to modulate the function of a particular p38 MAPK isoform, e.g. for research purposes to determine the role of a particular isoform in a normal or disease process, or to treat a disease or condition that may be associated with a particular isoform. It may also be desirable to target multiple p38 MAPK isoforms. In each case, antisense compounds can be designed by taking advantage of sequence homology between the various isoforms. If an antisense compound to a particular isoform is desired, then the antisense compound is designed to a unique region in the desired isoform's gene sequence. With such a compound, it is desirable that this compound does not inhibit the expression of other isoforms. Less desirable, but acceptable, are compounds that do not “substantially” inhibit other isoforms. By “substantially”, it is intended that these compounds do not inhibit the expression of other isoforms greater than 25%; more preferred are compounds that do not inhibit other isoforms greater than 10%. If an antisense compound is desired to target multiple p38 isoforms, then regions of significant homology between the isoforms can be used. [0022]
This relationship between an antisense compound such as an oligonucleotide and its complementary nucleic acid target, to which it hybridizes, is commonly referred to as “antisense”. “Targeting” an oligonucleotide to a chosen nucleic acid target, in the context of this invention, is a multistep process. The process usually begins with identifying a nucleic acid sequence whose function is to be modulated. This may be, as examples, a cellular gene (or mRNA made from the gene) whose expression is associated with a particular disease state, or a foreign nucleic acid from an infectious agent. In the present invention, the target is a nucleic acid encoding a p38 MAPK; in other words, a p38 MAPK gene or RNA expressed from a p38 MAPK gene. p38 MAPK mRNA is presently the preferred target. The targeting process also includes determination of a site or sites within the nucleic acid sequence for the antisense interaction to occur such that modulation of gene expression will result. [0023]
In accordance with this invention, persons of ordinary skill in the art will understand that messenger RNA includes not only the information to encode a protein using the three letter genetic code, but also associated ribonucleotides which form a region known to such persons as the 5′-untranslated region, the 3′-untranslated region, the 5′ cap region and intron/exon junction ribonucleotides. Thus, oligonucleotides may be formulated in accordance with this invention which are targeted wholly or in part to these associated ribonucleotides as well as to the informational ribonucleotides. The oligonucleotide may therefore be specifically hybridizable with a transcription initiation site region, a translation initiation codon region, a 5′ cap region, an intron/exon junction, coding sequences, a translation termination codon region or sequences in the 5′- or 3′-untranslated region. Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon.” A minority of genes have a translation initiation codon having the [0024] RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding p38, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively). The terms “start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. This region is a preferred target region. Similarly, the terms “stop codon region” and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. This region is a preferred target region. The open reading frame (ORF) or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other preferred target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene) and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA or corresponding nucleotides on the gene). mRNA splice sites may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions may also be preferred targets.
Once the target site or sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired modulation. [0025]
“Hybridization”, in the context of this invention, means hydrogen bonding, also known as Watson-Crick base pairing, between complementary bases, usually on opposite nucleic acid strands or two regions of a nucleic acid strand. Guanine and cytosine are examples of complementary bases which are known to form three hydrogen bonds between them. Adenine and thymine are examples of complementary bases which form two hydrogen bonds between them. [0026]
“Specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the oligonucleotide. [0027]
It is understood that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target interferes with the normal function of the target molecule to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment and, in the case of in vitro assays, under conditions in which the assays are conducted. [0028]
Hybridization of antisense oligonucleotides with mRNA interferes with one or more of the normal functions of mRNA. The functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA. [0029]
The overall effect of interference with mRNA function is modulation of p38 MAPK expression. In the context of this invention “modulation” means either inhibition or stimulation; i.e., either a decrease or increase in expression. This modulation can be measured in ways which are routine in the art, for example by Northern blot assay of mRNA expression as taught in the examples of the instant application or by Western blot or ELISA assay of protein expression, or by an immunoprecipitation assay of protein expression, as taught in the examples of the instant application. Effects on cell proliferation or tumor cell growth can also be measured, as taught in the examples of the instant application. [0030]
The oligonucleotides of this invention can be used in diagnostics, therapeutics, prophylaxis, and as research reagents and in kits. Since the oligonucleotides of this invention hybridize to nucleic acids encoding a p38 MAPK, sandwich, calorimetric and other assays can easily be constructed to exploit this fact. Furthermore, since the oligonucleotides of this invention hybridize specifically to nucleic acids encoding particular isoforms of p38 MAPK, such assays can be devised for screening of cells and tissues for particular p38 MAPK isoforms. Such assays can be utilized for diagnosis of diseases associated with various p38 MAPK isoforms. Provision of means for detecting hybridization of oligonucleotide with a p38 MAPK gene or mRNA can routinely be accomplished. Such provision may include enzyme conjugation, radiolabelling or any other suitable detection systems. Kits for detecting the presence or absence of p38 MAPK may also be prepared. [0031]
The present invention is also suitable for diagnosing abnormal inflammatory states in tissue or other samples from patients suspected of having an inflammatory disease such as rheumatoid arthritis. The ability of the oligonucleotides of the present invention to inhibit inflammation may be employed to diagnose such states. A number of assays may be formulated employing the present invention, which assays will commonly comprise contacting a tissue sample with an oligonucleotide of the invention under conditions selected to permit detection and, usually, quantitation of such inhibition. In the context of this invention, to “contact” tissues or cells with an oligonucleotide or oligonucleotides means to add the oligonucleotide(s), usually in a liquid carrier, to a cell suspension or tissue sample, either in vitro or ex vivo, or to administer the oligonucleotide(s) to cells or tissues within an animal. Similarly, the present invention can be used to distinguish p38 MAPK-associated diseases, from diseases having other etiologies, in order that an efficacious treatment regime can be designed. [0032]
The oligonucleotides of this invention may also be used for research purposes. Thus, the specific hybridization exhibited by the oligonucleotides may be used for assays, purifications, cellular product preparations and in other methodologies which may be appreciated by persons of ordinary skill in the art. [0033]
In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid or deoxyribonucleic acid. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent intersugar (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced binding to target and increased stability in the presence of nucleases. [0034]
The antisense compounds in accordance with this invention preferably comprise from about 5 to about 50 nucleobases. Particularly preferred are antisense oligonucleotides comprising from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleosides). Preferred embodiments comprise at least an 8-nucleobase portion of a sequence of an antisense compound which inhibits the expression of a p38 mitogen activated kinase. As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2=, 3=or [0035] 5=hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3=to 5=phosphodiester linkage.
While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing. [0036]
The first evidence that dsRNA could lead to gene silencing in animals came in 1995 from work in the nematode, [0037] Caenorhabditis elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). Montgomery et al. have shown that the primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811). Recently, it has been shown that it is, in fact, the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., Science, 2002, 295, 694-697). Single stranded and double stranded RNA (RNAi) inhibition of human p38 MAP kinase is also within the scope of the present invention.
Oligomer and Monomer Modifications [0038]
As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside linkage or in conjunction with the sugar ring the backbone of the oligonucleotide. The normal internucleoside linkage that makes up the backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage. [0039]
Modified Internucleoside Linkages [0040]
Specific examples of preferred antisense oligomeric compounds useful in this invention include oligonucleotides containing modified e.g. non-naturally occurring internucleoside linkages. As defined in this specification, oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. [0041]
In the [0042] C. elegans system, modification of the internucleotide linkage (phosphorothioate) did not significantly interfere with RNAi activity. Based on this observation, it is suggested that certain preferred oligomeric compounds of the invention can also have one or more modified internucleoside linkages. A preferred phosphorus containing modified internucleoside linkage is the phosphorothioate internucleoside linkage.
Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphoro-dithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and borano-phosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included. [0043]
Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference. [0044]
In more preferred embodiments of the invention, oligomeric compounds have one or more phosphorothioate and/or heteroatom internucleoside linkages, in particular —CH[0045] ₂—NH—O—CH₂—, —CH₂—N(CH₃)—O—CH₂— [known as a methylene (methylimino) or MMI backbone], —CH₂—O—N(CH₃)—CH₂—, —CH₂—N(CH₃)—N(CH₃)—CH₂— and —O—N(CH₃)—CH₂—CH₂— [wherein the native phosphodiester internucleotide linkage is represented as —O—P(═O)(OH)—O—CH₂—]. The MMI type internucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,489,677. Preferred amide internucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,602,240.
Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH[0046] ₂component parts.
Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference. [0047]
Oligomer Mimetics [0048]
Another preferred group of oligomeric compounds amenable to the present invention includes oligonucleotide mimetics. The term mimetic as it is applied to oligonucleotides is intended to include oligomeric compounds wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with novel groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA oligomeric compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA oligomeric compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA oligomeric compounds can be found in Nielsen et al., [0049] Science, 1991, 254, 1497-1500.
One oligonucleotide mimetic that has been reported to have excellent hybridization properties is peptide nucleic acids (PNA). The backbone in PNA compounds is two or more linked aminoethylglycine units which gives PNA an amide containing backbone. The heterocyclic base moieties are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500. [0050]
PNA has been modified to incorporate numerous modifications since the basic PNA structure was first prepared. The basic structure is shown below: [0051]
wherein [0052]
Bx is a heterocyclic base moiety; [0053]
T[0054] ₄is hydrogen, an amino protecting group, —C(O)R₅, substituted or unsubstituted C₁-C₁₀alkyl, substituted or unsubstituted C₂-C₁₀alkenyl, substituted or unsubstituted C₂-C₁₀alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group, a reporter group, a conjugate group, a D or L α-amino acid linked via the α-carboxyl group or optionally through the ω-carboxyl group when the amino acid is aspartic acid or glutamic acid or a peptide derived from D, L or mixed D and L amino acids linked through a carboxyl group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl;
T[0055] ₅is —OH, —N(Z₁) Z₂, R₅, D or L α-amino acid linked via the α-amino group or optionally through the ω-amino group when the amino acid is lysine or ornithine or a peptide derived from D, L or mixed D and L amino acids linked through an amino group, a chemical functional group, a reporter group or a conjugate group;
Z[0056] ₁is hydrogen, C₁-C₆alkyl, or an amino protecting group;
Z[0057] ₂is hydrogen, C₁-C₆alkyl, an amino protecting group, —C(═O)_n—(CH₂)_n-J-Z₃, a D or L α-amino acid linked via the α-carboxyl group or optionally through the ω-carboxyl group when the amino acid is aspartic acid or glutamic acid or a peptide derived from D, L or mixed D and L amino acids linked through a carboxyl group;
Z[0058] ₃is hydrogen, an amino protecting group, —C₁-C₆alkyl, —C(═O)—CH₃, benzyl, benzoyl, or —(CH₂)_n—N(H)Z₁;
each J is O, S or NH; [0059]
R[0060] ₅is a carbonyl protecting group; and
n is from 2 to about 50. [0061]
Another class of oligonucleotide mimetic that has been studied is based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. A number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid. A preferred class of linking groups have been selected to give a non-ionic oligomeric compound. The non-ionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins. Morpholino-based oligomeric compounds are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, [0062] Biochemistry, 2002, 41 (14), 4503-4510). Morpholino-based oligomeric compounds are disclosed in U.S. Pat. No. 5,034,506, issued Jul. 23, 1991. The morpholino class of oligomeric compounds have been prepared having a variety of different linking groups joining the monomeric subunits.
Morpholino nucleic acids have been prepared having a variety of different linking groups (L[0063] ₂) joining the monomeric subunits. The basic formula is shown below:
wherein [0064]
T[0065] ₁is hydroxyl or a protected hydroxyl;
T[0066] ₅is hydrogen or a phosphate or phosphate derivative;
L[0067] ₂is a linking group; and
n is from 2 to about 50. [0068]
A further class of oligonucleotide mimetic is referred to as cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in an DNA/RNA molecule is replaced with a cyclohenyl ring. CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see Wang et al., [0069] J. Am. Chem. Soc., 2000, 122, 8595-8602). In general the incorporation of CeNA monomers into a DNA chain increases its stability of a DNA/RNA hybrid. CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the native complexes. The study of incorporating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichrdism to proceed with easy conformational adaptation. Furthermore the incorporation of CeNA into a sequence targeting RNA was stable to serum and able to activate E. Coli RNase resulting in cleavage of the target RNA strand.
The general formula of CeNA is shown below: [0070]
wherein [0071]
each Bx is a heterocyclic base moiety; [0072]
T[0073] ₁is hydroxyl or a protected hydroxyl; and
T2 is hydroxyl or a protected hydroxyl. [0074]
Another class of oligonucleotide mimetic (anhydrohexitol nucleic acid) can be prepared from one or more anhydrohexitol nucleosides (see, Wouters and Herdewijn, [0075] Bioorg. Med. Chem. Lett., 1999, 9, 1563-1566) and would have the general formula:
A further preferred modification includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 4′ carbon atom of the sugar ring thereby forming a 2′-C,4′-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (—CH[0076] ₂—)_ngroup bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456). LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm=+3 to +10 C), stability towards 3′-exonucleolytic degradation and good solubility properties. The basic structure of LNA showing the bicyclic ring system is shown below:
The conformations of LNAs determined by 2D NMR spectroscopy have shown that the locked orientation of the LNA nucleotides, both in single-stranded LNA and in duplexes, constrains the phosphate backbone in such a way as to introduce a higher population of the N-type conformation (Petersen et al., J. Mol. Recognit., 2000, 13, 44-53). These conformations are associated with improved stacking of the nucleobases (Wengel et al., Nucleosides Nucleotides, 1999, 18, 1365-1370). [0077]
LNA has been shown to form exceedingly stable LNA:LNA duplexes (Koshkin et al., J. Am. Chem. Soc., 1998, 120, 13252-13253). LNA:LNA hybridization was shown to be the most thermally stable nucleic acid type duplex system, and the RNA-mimicking character of LNA was established at the duplex level. Introduction of 3 LNA monomers (T or A) significantly increased melting points (Tm=+15/+11) toward DNA complements. The universality of LNA-mediated hybridization has been stressed by the formation of exceedingly stable LNA:LNA duplexes. The RNA-mimicking of LNA was reflected with regard to the N-type conformational restriction of the monomers and to the secondary structure of the LNA:RNA duplex. [0078]
LNAs also form duplexes with complementary DNA, RNA or LNA with high thermal affinities. Circular dichroism (CD) spectra show that duplexes involving fully modified LNA (esp. LNA:RNA) structurally resemble an A-form RNA:RNA duplex. Nuclear magnetic resonance (NMR) examination of an LNA:DNA duplex confirmed the 3′-endo conformation of an LNA monomer. Recognition of double-stranded DNA has also been demonstrated suggesting strand invasion by LNA. Studies of mismatched sequences show that LNAs obey the Watson-Crick base pairing rules with generally improved selectivity compared to the corresponding unmodified reference strands. [0079]
Novel types of LNA-oligomeric compounds, as well as the LNAs, are useful in a wide range of diagnostic and therapeutic applications. Among these are antisense applications, PCR applications, strand-displacement oligomers, substrates for nucleic acid polymerases and generally as nucleotide based drugs. Potent and nontoxic antisense oligonucleotides containing LNAs have been described (Wahlestedt et al., Proc. Natl. Acad. Sci. U.S. A., 2000, 97, 5633-5638.) The authors have demonstrated that LNAs confer several desired properties to antisense agents. LNA/DNA copolymers were not degraded readily in blood serum and cell extracts. LNA/DNA copolymers exhibited potent antisense activity in assay systems as disparate as G-protein-coupled receptor signaling in living rat brain and detection of reporter genes in [0080] Escherichia coli. Lipofectin-mediated efficient delivery of LNA into living human breast cancer cells has also been accomplished.
The synthesis and preparation of the LNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). LNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226. [0081]
The first analogs of LNA, phosphorothioate-LNA and 2′-thio-LNAs, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs containing oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., PCT International Application WO 98-DK393 19980914). Furthermore, synthesis of 2′-amino-LNA, a novel conformationally restricted high-affinity oligonucleotide analog with a handle has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2′-Amino- and 2‘-methylamino-LNA’s have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported. [0082]
Further oligonucleotide mimetics have been prepared to include bicyclic and tricyclic nucleoside analogs having the formulas (amidite monomers shown): [0083]
(see Steffens et al., [0084] Helv. Chim. Acta, 1997, 80, 2426-2439; Steffens et al., J. Am. Chem. Soc., 1999, 121, 3249-3255; and Renneberg et al., J. Am. Chem. Soc., 2002, 124, 5993-6002). These modified nucleoside analogs have been oligomerized using the phosphoramidite approach and the resulting oligomeric compounds containing tricyclic nucleoside analogs have shown increased thermal stabilities (Tm's) when hybridized to DNA, RNA and itself. Oligomeric compounds containing bicyclic nucleoside analogs have shown thermal stabilities approaching that of DNA duplexes.
Another class of oligonucleotide mimetic is referred to as phosphonomonoester nucleic acids incorporate a phosphorus group in a backbone the backbone. This class of olignucleotide mimetic is reported to have useful physical and biological and pharmacological properties in the areas of inhibiting gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides), as probes for the detection of nucleic acids and as auxiliaries for use in molecular biology. [0085]
The general formula (for definitions of Markush variables see: U.S. Pat. Nos. 5,874,553 and 6,127,346 herein incorporated by reference in their entirety) is shown below. [0086]
Another oligonucleotide mimetic has been reported wherein the furanosyl ring has been replaced by a cyclobutyl moiety. [0087]
Modified Sugars [0088]
Oligomeric compounds of the invention may also contain one or more substituted sugar moieties. Preferred oligomeric compounds comprise a sugar substituent group selected from: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C[0089] ₁to C₁₀alkyl or C₂to C₁₀alkenyl and alkynyl. Particularly preferred are O[(CH₂)_nO]_mCH₃, O(CH₂)_nOCH₃, O(CH₂)_nNH₂, O(CH₂)_nCH₃, O(CH₂)_nONH₂, and O(CH₂)_nON[(CH₂)_nCH₃]₂, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise a sugar substituent group selected from: C₁to C₁₀lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH₃, OCN, Cl, Br, CN, CF₃, OCF₃, SOCH₃, SO₂CH₃, ONO₂, NO₂, N₃, NH₂, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy (2′-C—CH₂CH₂OCH₃, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH₂)₂ON(CH₃)₂group, also known as 2′-DMAOE, as described in examples hereinbelow, and 2′-dimethylamino-ethoxyethoxy (also known in the art as 2′-O-dimethyl-amino-ethoxy-ethyl or 2′-DMAEOE), i.e., 2′-O—CH₂—O—CH₂—N(CH₃)₂.
Other preferred sugar substituent groups include methoxy (—O—CH[0090] ₃), aminopropoxy (—OCH₂CH₂CH₂NH₂), allyl (—CH₂—CH═CH₂), —O-allyl (—O—CH₂—CH═CH₂) and fluoro (F). 2′-Sugar substituent groups may be in the arabino (up) position or ribo (down) position. A preferred 2′-arabino modification is 2′-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3′ position of the sugar on the 3′ terminal nucleoside or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
Further representative sugar substituent groups include groups of formula I[0091] _aor II_a:
wherein: [0092]
R[0093] _bis O, S or NH;
R[0094] _dis a single bond, O, S or C(═O);
R[0095] _eis C₁-C₁₀alkyl, N(R_k) (R_m), N(R_k) (R_n), N═C(R_p) (R_q), N═C(R_p) (R_r) or has formula III_a;
R[0096] _pand R_qare each independently hydrogen or C₁-C₁₀alkyl;
R[0097] _ris —R_x—R_y;
each R[0098] _s, R_t, R_uand R_vis, independently, hydrogen, C(O)R_w, substituted or unsubstituted C₁-C₁₀alkyl, substituted or unsubstituted C₂-C₁₀alkenyl, substituted or unsubstituted C₂-C₁₀alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or a conjugate group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl;
or optionally, R[0099] _uand R_v, together form a phthalimido moiety with the nitrogen atom to which they are attached;
each R[0100] _wis, independently, substituted or unsubstituted C₁-C₁₀alkyl, trifluoromethyl, cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy, 2-(trimethylsilyl)-ethoxy, 2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or aryl;
R[0101] _kis hydrogen, a nitrogen protecting group or —R_x—R_y;
R[0102] _pis hydrogen, a nitrogen protecting group or —R_x—R_y;
R[0103] _xis a bond or a linking moiety;
R[0104] _yis a chemical functional group, a conjugate group or a solid support medium;
each R[0105] _mand R_nis, independently, H, a nitrogen protecting group, substituted or unsubstituted C₁-C₁₀alkyl, substituted or unsubstituted C₂-C₁₀alkenyl, substituted or unsubstituted C₂-C₁₀alkynyl, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, alkynyl; NH₃ ⁺, N(R_u) (R_v), guanidino and acyl where said acyl is an acid amide or an ester;
or R[0106] _mand R_n, together, are a nitrogen protecting group, are joined in a ring structure that optionally includes an additional heteroatom selected from N and O or are a chemical functional group;
R[0107] _iis OR_z, SR_z, or N(R_z)₂;
each R[0108] _zis, independently, H, C₁-C₈alkyl, C₁-C₈haloalkyl, C(═NH)N(H)R_u, C(═O)N(H)R_uor OC(═O)N(H)R_u;
R[0109] _f, R_gand R_hcomprise a ring system having from about 4 to about 7 carbon atoms or having from about 3 to about 6 carbon atoms and 1 or 2 heteroatoms wherein said heteroatoms are selected from oxygen, nitrogen and sulfur and wherein said ring system is aliphatic, unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic;
R[0110] _jis alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms, N(R_k) (R_m) OR_k, halo, SR_kor CN;
m[0111] _ais 1 to about 10;
each mb is, independently, 0 or 1; [0112]
mc is 0 or an integer from 1 to 10; [0113]
md is an integer from 1 to 10; [0114]
me is from 0, 1 or 2; and [0115]
provided that when mc is 0, md is greater than 1. [0116]
Representative substituents groups of Formula I are disclosed in United States patent application Ser. No. 09/130,973, filed Aug. 7, 1998, entitled “[0117] Capped 2′-Oxyethoxy Oligonucleotides,” hereby incorporated by reference in its entirety.
Representative cyclic substituent groups of Formula II are disclosed in U.S. patent application Ser. No. 09/123,108, filed Jul. 27, 1998, entitled “RNA Targeted 2′-Oligomeric compounds that are Conformationally Preorganized,” hereby incorporated by reference in its entirety. [0118]
Particularly preferred sugar substituent groups include O[(CH[0119] ₂)_nO]_mCH₃, O(CH₂)_nOCH₃, O(CH₂)_nNH₂, O(CH₂)_nCH₃, O(CH₂)_nONH₂, and O(CH₂)_nON[(CH₂)_nCH₃)]₂, where n and m are from 1 to about 10.
Representative guanidino substituent groups that are shown in formula III and IV are disclosed in co-owned U.S. patent application Ser. No. 09/349,040, entitled “Functionalized Oligomers”, filed Jul. 7, 1999, hereby incorporated by reference in its entirety. [0120]
Representative acetamido substituent groups are disclosed in U.S. Pat. No. 6,147,200 which is hereby incorporated by reference in its entirety. [0121]
Representative dimethylaminoethyloxyethyl substituent groups are disclosed in International Patent Application PCT/US99/17895, entitled “2′-O-Dimethylaminoethyloxyethyl-Oligomeric compounds”, filed Aug. 6, 1999, hereby incorporated by reference in its entirety. [0122]
Modified Nucleobases/Naturally Occurring Nucleobases [0123]
Oligomeric compounds may also include nucleobase (often referred to in the art simply as “base” or “heterocyclic base moiety”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases also referred herein as heterocyclic base moieties include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH[0124] ₃) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in [0125] The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
In one aspect of the present invention oligomeric compounds are prepared having polycyclic heterocyclic compounds in place of one or more heterocyclic base moieties. A number of tricyclic heterocyclic compounds have been previously reported. These compounds are routinely used in antisense applications to increase the binding properties of the modified strand to a target strand. The most studied modifications are targeted to guanosines hence they have been termed G-clamps or cytidine analogs. Many of these polycyclic heterocyclic compounds have the general formula: [0126]
Representative cytosine analogs that make 3 hydrogen bonds with a guanosine in a second strand include 1,3-diazaphenoxazine-2-one (R[0127] ₁₀═O, R₁₁—R₁₄═H) [Kurchavov, et al., Nucleosides and Nucleotides, 1997, 16, 1837-1846], 1,3-diazaphenothiazine-2-one (R₁₀═S, R₁₁—R₁₄═H), [Lin, K.-Y.; Jones, R. J.; Matteucci, M. J. Am. Chem. Soc. 1995, 117, 3873-3874] and 6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (R₁₀═O, R₁₁—R₁₄═F) [Wang, J.; Lin, K.-Y., Matteucci, M. Tetrahedron Lett. 1998, 39, 8385-8388]. Incorporated into oligonucleotides these base modifications were shown to hybridize with complementary guanine and the latter was also shown to hybridize with adenine and to enhance helical thermal stability by extended stacking interactions (also see U.S. Patent Application entitled “Modified Peptide Nucleic Acids” filed May 24, 2002, Ser. No. 10/155,920; and U.S. Patent Application entitled “Nuclease Resistant Chimeric Oligonucleotides” filed May 24, 2002, Ser. No. 10/013,295, both of which are commonly owned with this application and are herein incorporated by reference in their entirety).
Further helix-stabilizing properties have been observed when a cytosine analog/substitute has an aminoethoxy moiety attached to the rigid 1,3-diazaphenoxazine-2-one scaffold (R[0128] ₁₀═O, R₁₁═—O—(CH₂)₂—NH₂, R_12-14═H) [Lin, K.-Y.; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532]. Binding studies demonstrated that a single incorporation could enhance the binding affinity of a model oligonucleotide to its complementary target DNA or RNA with a ΔT_mof up to 18° relative to 5-methyl cytosine (dC5^me), which is the highest known affinity enhancement for a single modification, yet. On the other hand, the gain in helical stability does not compromise the specificity of the oligonucleotides. The T_mdata indicate an even greater discrimination between the perfect match and mismatched sequences compared to dC5^me. It was suggested that the tethered amino group serves as an additional hydrogen bond donor to interact with the Hoogsteen face, namely the O6, of a complementary guanine thereby forming 4 hydrogen bonds. This means that the increased affinity of G-clamp is mediated by the combination of extended base stacking and additional specific hydrogen bonding.
Further tricyclic heterocyclic compounds and methods of using them that are amenable to the present invention are disclosed in U.S. Pat. Ser. No. 6,028,183, which issued on May 22, 2000, and U.S. Pat. Ser. No. 6,007,992, which issued on Dec. 28, 1999, the contents of both are commonly assigned with this application and are incorporated herein in their entirety. [0129]
The enhanced binding affinity of the phenoxazine derivatives together with their uncompromised sequence specificity makes them valuable nucleobase analogs for the development of more potent antisense-based drugs. In fact, promising data have been derived from in vitro experiments demonstrating that heptanucleotides containing phenoxazine substitutions are capable to activate RNaseH, enhance cellular uptake and exhibit an increased antisense activity [Lin, K-Y; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532]. The activity enhancement was even more pronounced in case of G-clamp, as a single substitution was shown to significantly improve the in vitro potency of a [0130] 20mer 2′-deoxyphosphorothioate oligonucleotides [Flanagan, W. M.; Wolf, J. J.; Olson, P.; Grant, D.; Lin, K.-Y.; Wagner, R. W.; Matteucci, M. Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518]. Nevertheless, to optimize oligonucleotide design and to better understand the impact of these heterocyclic modifications on the biological activity, it is important to evaluate their effect on the nuclease stability of the oligomers.
Further modified polycyclic heterocyclic compounds useful as heterocyclcic bases are disclosed in but not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269; 5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S. patent application Ser. No. 09/996,292 filed Nov. 28, 2001, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference. [0131]
The oligonucleotides of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the oligonucleotide. For example, if the first nucleotide is an adenosine, variants may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the oligonucleotide. Thus, a 20-mer may comprise 60 variations (20 positions×3 alternates at each position) in which the original nucleotide is substituted with any of the three alternate nucleotides. These oligonucleotides are then tested using the methods described herein to determine their ability to inhibit expression of HCV mRNA and/or HCV replication. [0132]
Conjugates [0133]
A further preferred substitution that can be appended to the oligomeric compounds of the invention involves the linkage of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting oligomeric compounds. In one embodiment such modified oligomeric compounds are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which is incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., [0134] Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-o-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937.
The oligomeric compounds of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in United States patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety. [0135]
Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference. [0136]
Chimeric Oligomeric Compounds [0137]
It is not necessary for all positions in an oligomeric compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligomeric compound or even at a single monomeric subunit such as a nucleoside within a oligomeric compound. The present invention also includes oligomeric compounds which are chimeric oligomeric compounds. “Chimeric” oligomeric compounds or “chimeras,” in the context of this invention, are oligomeric compounds that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a nucleic acid based oligomer. [0138]
Chimeric oligomeric compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligomeric compounds when chimeras are used, compared to for example phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art. [0139]
Chimeric oligomeric compounds of the invention may be formed as composite structures of two or more oligonucleotides, oligonucleotide analogs, oligonucleosides and/or oligonucleotide mimetics as described above. Such oligomeric compounds have also been referred to in the art as hybrids hemimers, gapmers or inverted gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety. [0140]
3′-Endo Modifications [0141]
In one aspect of the present invention oligomeric compounds include nucleosides synthetically modified to induce a 3′-endo sugar conformation. A nucleoside can incorporate synthetic modifications of the heterocyclic base, the sugar moiety or both to induce a desired 3′-endo sugar conformation. These modified nucleosides are used to mimic RNA like nucleosides so that particular properties of an oligomeric compound can be enhanced while maintaining the desirable 3′-endo conformational geometry. There is an apparent preference for an RNA type duplex (A form helix, predominantly 3′-endo) as a requirement (e.g. trigger) of RNA interference which is supported in part by the fact that duplexes composed of 2′-deoxy-2′-F-nucleosides appears efficient in triggering RNAi response in the [0142] C. elegans system. Properties that are enhanced by using more stable 3′-endo nucleosides include but aren't limited to modulation of pharmacokinetic properties through modification of protein binding, protein off-rate, absorption and clearance; modulation of nuclease stability as well as chemical stability; modulation of the binding affinity and specificity of the oligomer (affinity and specificity for enzymes as well as for complementary sequences); and increasing efficacy of RNA cleavage. The present invention provides oligomeric triggers of RNAi having one or more nucleosides modified in such a way as to favor a C3′-endo type conformation.

Nucleoside conformation is influenced by various factors including substitution at the 2′, 3′ or 4′-positions of the pentofuranosyl sugar. Electronegative substituents generally prefer the axial positions, while sterically demanding substituents generally prefer the equatorial positions (Principles of Nucleic Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.) Modification of the 2′ position to favor the 3′-endo conformation can be achieved while maintaining the 2′-OH as a recognition element, as illustrated in FIG. 2, below (Gallo et al., Tetrahedronl (2001), 57, 5707-5713. Harry- O'kuru et al., J. Org. Chem., (1997), 62(6), 1754-1759 and Tang et al., J. Org. Chem (1999), 64, 747-754.) Alternatively, preference for the 3′-endo conformation can be achieved by deletion of the 2′-OH as exemplified by 2′deoxy-2′ F-nucleosides (Kawasaki et al., J. Med. Chel . (1993), 36, 831-841), which adopts the 3′-endo conformation positioning the electronegative fluorine atom in the axial position. Other modifications of the ribose ring, for example substitution at the 4′-position to give 4′-F modified nucleosides (Guillerm et al., Bioorganic and Medicinal Chemistry Lettersl (1995), 5, 1455-1460 and Owen et al., J. Org. Chem . (1976), 41, 3010-3017), or for example modification to yield methanocarba nucleoside analogs (Jacobson et al., J. Med. Chem. Lett . (2000), 43, 2196-2203 and Lee et al., Bioorganic and Medicinal Chemistry Letters (2001), 11, 1333-1337) also induce preference for the 3′-endo conformation. Along similar lines, oligomeric triggers of RNAi response might be composed of one or more nucleosides modified in such a way that conformation is locked into a C3′-endo type conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem. Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids (ENA, Morita et al, Bioorganic & Medicinal Chemistry Letters (2002), 12, 73-76.) Examples of modified nucleosides amenable to the present invention are shown below in Table I. These examples are meant to be representative and not exhaustive.

TABLE I

The preferred conformation of modified nucleosides and their oligomers can be estimated by various methods such as molecular dynamics calculations, nuclear magnetic resonance spectroscopy and CD measurements. Hence, modifications predicted to induce RNA like conformations, A-form duplex geometry in an oligomeric context, are selected for use in the modified oligoncleotides of the present invention. The synthesis of numerous modified nucleosides amenable to the present invention are known in the art (see for example, Chemistry of Nucleosides and Nucleotides Vol 1-3, ed. Leroy B. Townsend, 1988, Plenum press., and the examples section below.) [0144]
In one aspect, the present invention is directed to oligonucleotides that are prepared having enhanced properties compared to native RNA against nucleic acid targets. A target is identified and an oligonucleotide is selected having an effective length and sequence that is complementary to a portion of the target sequence. Each nucleoside of the selected sequence is scrutinized for possible enhancing modifications. A preferred modification would be the replacement of one or more RNA nucleosides with nucleosides that have the same 3′-endo conformational geometry. Such modifications can enhance chemical and nuclease stability relative to native RNA while at the same time being much cheaper and easier to synthesize and/or incorporate into an oligonulceotide. The selected sequence can be further divided into regions and the nucleosides of each region evaluated for enhancing modifications that can be the result of a chimeric configuration. Consideration is also given to the 5′ and 3′-termini as there are often advantageous modifications that can be made to one or more of the terminal nucleosides. The oligomeric compounds of the present invention include at least one 5′-modified phosphate group on a single strand or on at least one 5′-position of a double stranded sequence or sequences. Further modifications are also considered such as internucleoside linkages, conjugate groups, substitute sugars or bases, substitution of one or more nucleosides with nucleoside mimetics and any other modification that can enhance the selected sequence for its intended target. The terms used to describe the conformational geometry of homoduplex nucleic acids are “A Form” for RNA and “B Form” for DNA. The respective conformational geometry for RNA and DNA duplexes was determined from X-ray diffraction analysis of nucleic acid fibers (Arnott and Hukins, [0145] Biochem. Biophys. Res. Comm., 1970, 47, 1504.) In general, RNA:RNA duplexes are more stable and have higher melting temperatures (Tm's) than DNA:DNA duplexes (Sanger et al., Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New York, N.Y.; Lesnik et al., Biochemistry, 1995, 34, 10807-10815; Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634). The increased stability of RNA has been attributed to several structural features, most notably the improved base stacking interactions that result from an A-form geometry (Searle et al., Nucleic Acids Res., 1993, 21, 2051-2056). The presence of the 2′ hydroxyl in RNA biases the sugar toward a C3′ endo pucker, i.e., also designated as Northern pucker, which causes the duplex to favor the A-form geometry. In addition, the 2′ hydroxyl groups of RNA can form a network of water mediated hydrogen bonds that help stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35, 8489-8494). On the other hand, deoxy nucleic acids prefer a C2′ endo sugar pucker, i.e., also known as Southern pucker, which is thought to impart a less stable B-form geometry (Sanger, W. (1984) Principles of Nucleic Acid Structure, Springer-Verlag, New York, N.Y.). As used herein, B-form geometry is inclusive of both C2′-endo pucker and O4′-endo pucker. This is consistent with Berger, et. al., Nucleic Acids Research, 1998, 26, 2473-2480, who pointed out that in considering the furanose conformations which give rise to B-form duplexes consideration should also be given to a O4′-endo pucker contribution.
DNA:RNA hybrid duplexes, however, are usually less stable than pure RNA:RNA duplexes, and depending on their sequence may be either more or less stable than DNA:DNA duplexes (Searle et al., [0146] Nucleic Acids Res., 1993, 21, 2051-2056). The structure of a hybrid duplex is intermediate between A- and B-form geometries, which may result in poor stacking interactions (Lane et al., Eur. J. Biochem., 1993, 215, 297-306; Fedoroff et al., J. Mol. Biol., 1993, 233, 509-523; Gonzalez et al., Biochemistry, 1995, 34, 4969-4982; Horton et al., J. Mol. Biol., 1996, 264, 521-533). The stability of the duplex formed between a target RNA and a synthetic sequence is central to therapies such as but not limited to antisense and RNA interference as these mechanisms require the binding of a synthetic oligonucleotide strand to an RNA target strand. In the case of antisense, effective inhibition of the mRNA requires that the antisense DNA have a very high binding affinity with the mRNA. Otherwise the desired interaction between the synthetic oligonucleotide strand and target mRNA strand will occur infrequently, resulting in decreased efficacy.
One routinely used method of modifying the sugar puckering is the substitution of the sugar at the 2′-position with a substituent group that influences the sugar geometry. The influence on ring conformation is dependant on the nature of the substituent at the 2′-position. A number of different substituents have been studied to determine their sugar puckering effect. For example, 2′-halogens have been studied showing that the 2′-fluoro derivative exhibits the largest population (65%) of the C3′-endo form, and the 2′-iodo exhibits the lowest population (7%). The populations of adenosine (2′-OH) versus deoxyadenosine (2′-H) are 36% and 19%, respectively. Furthermore, the effect of the 2′-fluoro group of adenosine dimers (2′-deoxy-2′-fluoroadenosine-2′-deoxy-2′-fluoro-adenosine) is further correlated to the stabilization of the stacked conformation. [0147]
As expected, the relative duplex stability can be enhanced by replacement of 2′-OH groups with 2′-F groups thereby increasing the C3′-endo population. It is assumed that the highly polar nature of the 2′-F bond and the extreme preference for C3′-endo puckering may stabilize the stacked conformation in an A-form duplex. Data from UV hypochromicity, circular dichroism, and [0148] ¹H NMR also indicate that the degree of stacking decreases as the electronegativity of the halo substituent decreases. Furthermore, steric bulk at the 2′-position of the sugar moiety is better accommodated in an A-form duplex than a B-form duplex. Thus, a 2′-substituent on the 3′-terminus of a dinucleoside monophosphate is thought to exert a number of effects on the stacking conformation: steric repulsion, furanose puckering preference, electrostatic repulsion, hydrophobic attraction, and hydrogen bonding capabilities. These substituent effects are thought to be determined by the molecular size, electronegativity, and hydrophobicity of the substituent. Melting temperatures of complementary strands is also increased with the 2′-substituted adenosine diphosphates. It is not clear whether the 3′-endo preference of the conformation or the presence of the substituent is responsible for the increased binding. However, greater overlap of adjacent bases (stacking) can be achieved with the 3′-endo conformation.
One synthetic 2′-modification that imparts increased nuclease resistance and a very high binding affinity to nucleotides is the 2-methoxyethoxy (2′-MOE, 2′-OCH[0149] ₂CH₂OCH₃) side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). One of the immediate advantages of the 2′-MOE substitution is the improvement in binding affinity, which is greater than many similar 2′ modifications such as O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2′-O-methoxyethyl substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926). Relative to DNA, the oligonucleotides having the 2′-MOE modification displayed improved RNA affinity and higher nuclease resistance. Chimeric oligonucleotides having 2′-MOE substituents in the wing nucleosides and an internal region of deoxy-phosphorothioate nucleotides (also termed a gapped oligonucleotide or gapmer) have shown effective reduction in the growth of tumors in animal models at low doses. 2′-MOE substituted oligonucleotides have also shown outstanding promise as antisense agents in several disease states. One such MOE substituted oligonucleotide is presently being investigated in clinical trials for the treatment of CMV retinitis.
Chemistries Defined [0150]
Unless otherwise defined herein, alkyl means C[0151] ₁-C₁₂, preferably C₁-C₈, and more preferably C₁-C₆, straight or (where possible) branched chain aliphatic hydrocarbyl.
Unless otherwise defined herein, heteroalkyl means C[0152] ₁-C₁₂, preferably C₁-C₈, and more preferably C₁-C₆, straight or (where possible) branched chain aliphatic hydrocarbyl containing at least one, and preferably about 1 to about 3, hetero atoms in the chain, including the terminal portion of the chain. Preferred heteroatoms include N, O and S. Unless otherwise defined herein, cycloalkyl means C₃-C₁₂, preferably C₃-C₈, and more preferably C₃-C₆, aliphatic hydrocarbyl ring.
Unless otherwise defined herein, alkenyl means C[0153] ₂-C₁₂, preferably C₂-C₈, and more preferably C₂-C₆alkenyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon double bond.
Unless otherwise defined herein, alkynyl means C[0154] ₂-C₁₂, preferably C₂-C₈, and more preferably C₂-C₆alkynyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon triple bond.
Unless otherwise defined herein, heterocycloalkyl means a ring moiety containing at least three ring members, at least one of which is carbon, and of which 1, 2 or three ring members are other than carbon. Preferably the number of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8. Preferred ring heteroatoms are N, O and S. Preferred heterocycloalkyl groups include morpholino, thiomorpholino, piperidinyl, piperazinyl, homopiperidinyl, homopiperazinyl, homomorpholino, homothiomorpholino, pyrrolodinyl, tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl, and tetrahydroisothiazolyl. [0155]
Unless otherwise defined herein, aryl means any hydrocarbon ring structure containing at least one aryl ring. Preferred aryl rings have about 6 to about 20 ring carbons. Especially preferred aryl rings include phenyl, napthyl, anthracenyl, and phenanthrenyl. [0156]
Unless otherwise defined herein, hetaryl means a ring moiety containing at least one fully unsaturated ring, the ring consisting of carbon and non-carbon atoms. Preferably the ring system contains about 1 to about 4 rings. Preferably the number of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8. Preferred ring heteroatoms are N, O and S. Preferred hetaryl moieties include pyrazolyl, thiophenyl, pyridyl, imidazolyl, tetrazolyl, pyridyl, pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl, benzimidazolyl, benzothiophenyl, etc. [0157]
Unless otherwise defined herein, where a moiety is defined as a compound moiety, such as hetarylalkyl (hetaryl and alkyl), aralkyl (aryl and alkyl), etc., each of the sub-moieties is as defined herein. [0158]
Unless otherwise defined herein, an electron withdrawing group is a group, such as the cyano or isocyanato group that draws electronic charge away from the carbon to which it is attached. Other electron withdrawing groups of note include those whose electronegativities exceed that of carbon, for example halogen, nitro, or phenyl substituted in the ortho- or para-position with one or more cyano, isothiocyanato, nitro or halo groups. [0159]
Unless otherwise defined herein, the terms halogen and halo have their ordinary meanings. Preferred halo (halogen) substituents are Cl, Br, and I. [0160]
The aforementioned optional substituents are, unless otherwise herein defined, suitable substituents depending upon desired properties. Included are halogens (Cl, Br, I), alkyl, alkenyl, and alkynyl moieties, NO[0161] ₂, NH₃(substituted and unsubstituted), acid moieties (e.g. —CO₂H, —OSO₃H₂, etc.), heterocycloalkyl moieties, hetaryl moieties, aryl moieties, etc. In all the preceding formulae, the squiggle (˜) indicates a bond to an oxygen or sulfur of the 5′-phosphate.
Phosphate protecting groups include those described in U.S. Pat. Nos. 5,760,209, U.S. Pat. No. 5,614,621, U.S. Pat. No. 6,051,699, U.S. Pat. No. 6,020,475, U.S. Pat. No. 6,326,478, U.S. Pat. No. 6,169,177, U.S. Pat. No. 6,121,437, U.S. Pat. No. 6,465,628 each of which is expressly incorporated herein by reference in its entirety. [0162]
The oligonucleotides in accordance with this invention (single stranded or double stranded) preferably comprise from about 8 to about 80 nucleotides, more preferably from about 12-50 nucleotides and most preferably from about 15 to 30 nucleotides. As is known in the art, a nucleotide is a base-sugar combination suitably bound to an adjacent nucleotide through a phosphodiester, phosphorothioate or other covalent linkage. [0163]
The oligonucleotides of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the oligonucleotide. For example, if the first nucleotide is an adenosine, variants may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the oligonucleotide. Thus, a 20-mer may comprise 60 variations (20 positions×3 alternates at each position) in which the original nucleotide is substituted with any of the three alternate nucleotides. These oligonucleotides are then tested using the methods described herein to determine their ability to inhibit expression of p38α MAP kinase mRNA. [0164]
The oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the talents of the routineer. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and 2′-alkoxy or 2′-alkoxyalkoxy derivatives, including 2′-O-methoxyethyl oligonucleotides [Martin, P., [0165] Helv. Chim. Acta, 78, 486 (1995)]. It is also well known to use similar techniques and commercially available modified amidites and controlled-pore glass (CPG) products such as biotin, fluorescein, acridine or psoralen-modified amidites and/or CPG (available from Glen Research, Sterling Va.) to synthesize fluorescently labeled, biotinylated or other conjugated oligonucleotides.
The antisense compounds of the present invention include bioequivalent compounds, including pharmaceutically acceptable salts and prodrugs. This is intended to encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of the nucleic acids of the invention and prodrugs of such nucleic acids. [0166]
Pharmaceutically acceptable “salts” are physiologically and pharmaceutically acceptable salts of the nucleic acids of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto [see, for example, Berge et al., “Pharmaceutical Salts,” [0167] J. of Pharma Sci., 66:1 (1977)].
For oligonucleotides, examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. [0168]
The oligonucleotides of the invention may additionally or alternatively be prepared to be delivered in a “prodrug” form. The term “prodrug” indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published Dec. 9, 1993. [0169]
For therapeutic or prophylactic treatment, oligonucleotides are administered in accordance with this invention. Oligonucleotide compounds of the invention may be formulated in a pharmaceutical composition, which may include pharmaceutically acceptable carriers, thickeners, diluents, buffers, preservatives, surface active agents, neutral or cationic lipids, lipid complexes, liposomes, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients and the like in addition to the oligonucleotide. Such compositions and formulations are comprehended by the present invention. [0170]
Pharmaceutical compositions comprising the oligonucleotides of the present invention may include penetration enhancers in order to enhance the alimentary delivery of the oligonucleotides. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., fatty acids, bile salts, chelating agents, surfactants and non-surfactants (Lee et al., [0171] Critical Reviews in Therapeutic Drug Carrier Systems, 1991, 8:91-192; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7:1). One or more penetration enhancers from one or more of these broad categories may be included.
The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional compatible pharmaceutically-active materials such as, e.g., antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the composition of present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the invention. [0172]
Regardless of the method by which the oligonucleotides of the invention are introduced into a patient, colloidal dispersion systems may be used as delivery vehicles to enhance the in vivo stability of the oligonucleotides and/or to target the oligonucleotides to a particular organ, tissue or cell type. Colloidal dispersion systems include, but are not limited to, macromolecule complexes, nanocapsules, microspheres, beads and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, liposomes and lipid:oligonucleotide complexes of uncharacterized structure. A preferred colloidal dispersion system is a plurality of liposomes. Liposomes are microscopic spheres having an aqueous core surrounded by one or more outer layers made up of lipids arranged in a bilayer configuration [see, generally, Chonn et al., [0173] Current Op. Biotech., 6, 698 (1995)].
The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer, metered dose inhaler or dry powder inhaler; intratracheal, intranasal, or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration. [0174]
Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. [0175]
Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. [0176]
Compositions for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. In some cases it may be more effective to treat a patient with an oligonucleotide of the invention in conjunction with other traditional therapeutic modalities in order to increase the efficacy of a treatment regimen. In the context of the invention, the term “treatment regimen” is meant to encompass therapeutic, palliative and prophylactic modalities. For example, a patient may be treated with conventional chemotherapeutic agents, particularly those used for tumor and cancer treatment. Examples of such chemotherapeutic agents include but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,taxol, vincristine, vinblastine, etoposide, trimetrexate, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, [0177] The Merck Manual of Diagnosis and Therapy, 15th Ed., pp. 1206-1228, Berkow et al., eds., Rahay, N.J., 1987). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide).
The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC[0178] ₅₀s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years.
Thus, in the context of this invention, by “therapeutically effective amount” is meant the amount of the compound which is required to have a therapeutic effect on the treated mammal. This amount, which will be apparent to the skilled artisan, will depend upon the type of mammal, the age and weight of the mammal, the type of disease to be treated, perhaps even the gender of the mammal, and other factors which are routinely taken into consideration when treating a mammal with a disease. A therapeutic effect is assessed in the mammal by measuring the effect of the compound on the disease state in the animal. For example, if the disease to be treated is cancer, therapeutic effects are assessed by measuring the rate of growth or the size of the tumor, or by measuring the production of compounds such as cytokines, production of which is an indication of the progress or regression of the tumor. [0179]
The following examples illustrate the present invention and are not intended to limit the same. [0180]

EXAMPLES

[0181] Eample 1

Synthesis of Oligonucleotides

Unmodified oligodeoxynucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine. β-cyanoethyldiisopropyl-phosphoramidites were purchased from Applied Biosystems (Foster City, Calif.). For phosphorothioate oligonucleotides, the standard oxidation bottle was replaced by a 0.2 M solution of [0182] ³H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the stepwise thiation of the phosphite linkages. The thiation cycle wait step was increased to 68 seconds and was followed by the capping step.
2′-methoxy oligonucleotides are synthesized using 2′-methoxy β-cyanoethyldiisopropyl-phosphoramidites (Chemgenes, Needham, Mass.) and the standard cycle for unmodified oligonucleotides, except the wait step after pulse delivery of tetrazole and base was increased to 360 seconds. Other 2′-alkoxy oligonucleotides were synthesized by a modification of this method, using appropriate 2′-modified amidites such as those available from Glen Research, Inc., Sterling, Va. [0183]
2′-fluoro oligonucleotides are synthesized as described in Kawasaki et al., [0184] J. Med. Chem., 36, 831 (1993). Briefly, the protected nucleoside N⁶-benzoyl-2′-deoxy-2′-fluoroadenosine is synthesized utilizing commercially available 9-β-D-arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2′-α-fluoro atom is introduced by a S_N2-displacement of a 2′-β-O-trifyl group. Thus N⁶-benzoyl-9-β-D-arabinofuranosyladenine is selectively protected in moderate yield as the 3′,5′-ditetrahydropyranyl (THP) intermediate. Deprotection of the THP and N⁶-benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5′-dimethoxytrityl-(DMT) and 5′-DMT-3′-phosphoramidite intermediates.
The synthesis of 2′-deoxy-2′-fluoroguanosine is accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-β-D-arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS group is followed by protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabinofuranosylguanine. Selective O-deacylation and triflation is followed by treatment of the crude product with fluoride, then deprotection of the THP groups. Standard methodologies are used to obtain the 5′-DMT- and 5′-DMT-3′-phosphoramidites. [0185]
Synthesis of 2′-deoxy-2′-fluorouridine is accomplished by the modification of a known procedure in which 2,2′-anhydro-1-B-D-arabinofuranosyluracil is treated with 70% hydrogen fluoride-pyridine. Standard procedures are used to obtain the 5′-DMT and 5′-DMT-3′phosphoramidites. [0186]
2′-deoxy-2′-fluorocytidine is synthesized via amination of 2′-deoxy-2′-fluorouridine, followed by selective protection to give N[0187] ⁴-benzoyl-2′-deoxy-2′-fluorocytidine. Standard procedures are used to obtain the 5′-DMT and 5′-DMT-3′phosphoramidites.
2′-(2-methoxyethyl)-modified amidites were synthesized according to Martin, P., [0188] Helv. Chim. Acta, 78,486 (1995). For ease of synthesis, the last nucleotide was a deoxynucleotide. 2′-O—CH₂CH₂OCH₃-cytosines may be 5-methyl cytosines. Synthesis of 5-Methyl Cytosine Monomers:
2,2′-Anhydro[1-(β-D-arabinofuranosyl)-5-methyluridine]: [0189]
5-Methyluridine (ribosylthymine, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenyl-carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were added to DMF (300 mL). The mixture was heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was poured into diethylether (2.5 L), with stirring. The product formed a gum. The ether was decanted and the residue was dissolved in a minimum amount of methanol (ca. 400 mL). The solution was poured into fresh ether (2.5 L) to yield a stiff gum. The ether was decanted and the gum was dried in a vacuum oven (60° C. at 1 mm Hg for 24 hours) to give a solid which was crushed to a light tan powder (57 g, 85% crude yield). The material was used as is for further reactions. [0190]
2′-O-Methoxyethyl-5-methyluridine: [0191]
2,2′-Anhydro-5-methyluridine (195 g, 0.81 M), tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 L) were added to a 2 L stainless steel pressure vessel and placed in a pre-heated oil bath at 160° C. After heating for 48 hours at 155-160° C., the vessel was opened and the solution evaporated to dryness and triturated with MeOH (200 mL). The residue was suspended in hot acetone (1 L). The insoluble salts were filtered, washed with acetone (150 mL) and the filtrate evaporated. The residue (280 g) was dissolved in CH[0192] ₃CN (600 mL) and evaporated. A silica gel column (3 kg) was packed in CH₂Cl₂/acetone/MeOH (20:5:3) containing 0.5% Et₃NH. The residue was dissolved in CH₂Cl₂(250 mL) and adsorbed onto silica (150 g) prior to loading onto the column. The product was eluted with the packing solvent to give 160 g (63%) of product.
2′-O-Methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine: [0193]
2′-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was co-evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the reaction stirred for an additional one hour. Methanol (170 mL) was then added to stop the reaction. HPLC showed the presence of approximately 70% product. The solvent was evaporated and triturated with CH[0194] ₃CN (200 mL). The residue was dissolved in CHCl₃(1.5 L) and extracted with 2×500 mL of saturated NaHCO₃and 2×500 mL of saturated NaCl. The organic phase was dried over Na₂SO₄, filtered and evaporated. 275 g of residue was obtained. The residue was purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5% Et₃NH. The pure fractions were evaporated to give 164 g of product. Approximately 20 g additional was obtained from the impure fractions to give a total yield of 183 g (57%).
3′-O-Acetyl-2′-O-methoxyethyl-51-O-dimethoxytrityl-5-methyluridine: [0195]
2′-O-Methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine (106 g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from 562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38 mL, 0.258 M) were combined and stirred at room temperature for 24 hours. The reaction was monitored by tic by first quenching the tic sample with the addition of MeOH. Upon completion of the reaction, as judged by tic, MeOH (50 mL) was added and the mixture evaporated at 35° C. The residue was dissolved in CHCl[0196] ₃(800 mL) and extracted with 2×200 mL of saturated sodium bicarbonate and 2×200 mL of saturated NaCl. The water layers were back extracted with 200 mL of CHCl₃. The combined organics were dried with sodium sulfate and evaporated to give 122 g of residue (approx. 90% product). The residue was purified on a 3.5 kg silica gel column and eluted using EtOAc/Hexane(4:1). Pure product fractions were evaporated to yield 96 g (84%).
3′-O-Acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyl-4-triazoleuridine: [0197]
A first solution was prepared by dissolving 3′-O-acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH[0198] ₃CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH₃CN (1 L), cooled to −5° C. and stirred for 0.5 h using an overhead stirrer. POCl₃was added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10EC, and the resulting mixture stirred for an additional 2 hours. The first solution was added dropwise, over a 45 minute period, to the later solution. The resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solids were removed by filtration. The filtrate was washed with 1×300 mL of NaHCO₃and 2×300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.
2′-O-Methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine: [0199]
A solution of 3′-O-acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and NH[0200] ₄OH (30 mL) was stirred at room temperature for 2 hours. The dioxane solution was evaporated and the residue azeotroped with MeOH (2×200 mL). The residue was dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH₃gas was added and the vessel heated to 100° C. for 2 hours (tlc showed complete conversion). The vessel contents were evaporated to dryness and the residue was dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL). The organics were dried over sodium sulfate and the solvent was evaporated to give 85 g (95%) of the title compound.
N[0201] ⁴-Benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine:
2′-O-Methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) was added with stirring. After stirring for 3 hours, tlc showed the reaction to be approximately 95% complete. The solvent was evaporated and the residue azeotroped with MeOH (200 mL). The residue was dissolved in CHCl[0202] ₃(700 mL) and extracted with saturated NaHCO₃(2×300 mL) and saturated NaCl (2×300 mL), dried over MgSO₄and evaporated to give a residue (96 g). The residue was chromatographed on a 1.5 kg silica column using EtOAc/-Hexane (1:1) containing 0.5% Et₃NH as the eluting solvent. The pure product fractions were evaporated to give 90 g (90%) of the title compound.
N[0203] ⁴-Benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine-3′-amidite:
N[0204] ⁴-Benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine (74 g, 0.10 M) was dissolved in CH₂Cl₂(1 L) Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123 M) were added with stirring, under a nitrogen atmosphere. The resulting mixture was stirred for 20 hours at room temperature (tlc showed the reaction to be 95% complete). The reaction mixture was extracted with saturated NaHCO₃(1×300 mL) and saturated NaCl (3×300 mL). The aqueous washes were back-extracted with CH₂Cl₂(300 mL), and the extracts were combined, dried over MgSO₄and concentrated. The residue obtained was chromatographed on a 1.5 kg silica column using EtOAc\Hexane (3:1) as the eluting solvent. The pure fractions were combined to give 90.6 g (87%) of the title compound.
5-methyl-2′-deoxycytidine (5-me-C) containing oligonucleotides were synthesized according to published methods [Sanghvi et al., [0205] Nucl. Acids Res., 21, 3197 (1993)] using commercially available phosphoramidites (Glen Research, Sterling Va. or ChemGenes, Needham Mass.).
2=-O-(dimethylaminooxyethyl) Nucleoside Amidites [0206]
2′-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2′-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine. [0207]
5′-O-tert-Butyldiphenylsilyl-O[0208] ²-2′-anhydro-5-methyluridine
O[0209] ²-2′-anhydro-5-methyluridine (Pro. Bio. Sint., Varese, Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013eq, 0.0054 mmol) are dissolved in dry pyridine (500 ml) at ambient temperature under an argon atmosphere and with mechanical stirring. tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1eq, 0.458 mmol) is added in one portion. The reaction is stirred for 16 h at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicates a complete reaction. The solution is concentrated under reduced pressure to a thick oil. This is partitioned between dichloromethane (1 L) and saturated sodium bicarbonate (2×1 L) and brine (1 L). The organic layer is dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil is dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600 mL) and the solution is cooled to −10° C. The resulting crystalline product is collected by filtration, washed with ethyl ether (3×200 mL) and dried (40° C., 1 mm Hg, 24 h) to 149 g (74.8%) of white solid. TLC and NMR are used to check consistency with pure product.
5′-O-tert-Butyldiphenylsilyl-2′-O-(2-hydroxyethyl)-5-methyluridine [0210]
In a 2 L stainless steel, unstirred pressure reactor is added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the fume hood and with manual stirring, ethylene glycol (350 mL, excess) is added cautiously at first until the evolution of hydrogen gas subsided. 5′-O-tert-Butyldiphenylsilyl-O[0211] ²-2′-anhydro-5-methyluridine (149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) are added with manual stirring. The reactor is sealed and heated in an oil bath until an internal temperature of 160° C. is reached and then maintained for 16 h (pressure<100 psig). The reaction vessel is cooled to ambient and opened. TLC (Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate) indicates % conversion to the product. In order to avoid additional side product formation, the reaction is stopped, concentrated under reduced pressure (10 to 1 mm Hg) in a warm water bath (40-100° C.) with the more extreme conditions used to remove the ethylene glycol. [Alternatively, once the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase.] The residue is purified by column chromatography (2 kg silica gel, ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate fractions are combined, stripped and dried to product as a white crisp foam (84 g, 50%), contaminated starting material (17.4 g) and pure reusable starting material 20 g. TLC and NMR are used to determine consistency with pure product.
2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine [0212]
5′-O-tert-Butyldiphenylsilyl-2′-O-(2-hydroxyethyl)-5-methyluridine (20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g, 44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was then dried over P[0213] ₂O₅under high vacuum for two days at 40° C. The reaction mixture was flushed with argon and dry THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop. After the addition was complete, the reaction was stirred for 4 hrs. By that time TLC showed the completion of the reaction (ethylacetate:hexane, 60:40). The solvent was evaporated in vacuum. Residue obtained was placed on a flash column and eluted with ethyl acetate:hexane (60:40), to get 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine as white foam (21.819, 86%).
5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine [0214]
2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine (3.1 g, 4.5 mmol) is dissolved in dry CH[0215] ₂Cl₂(4.5 mL) and methylhydrazine (300 mL, 4.64 mmol) is added dropwise at −10° C. to 0° C. After 1 hr the mixture is filtered, the filtrate is washed with ice cold CH₂Cl₂and the combined organic phase is washed with water, brine and dried over anhydrous Na₂SO₄. The solution is concentrated to get 2′-O-(aminooxyethyl) thymidine, which is then dissolved in MeOH (67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1eg.) is added and the mixture for 1 hr. Solvent is removed under vacuum; residue chromatographed to get 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine as white foam.
5′-O-tert-Butyldiphenylsilyl-2′-O-[N,N-dimethylaminooxyethyl]-5-methyluridine [0216]
5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine (1.77 g, 3.12 mmol) is dissolved in a solution of 1M pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium cyanoborohydride (0.39 g, 6.13 mmol) is added to this solution at 10° C. under inert atmosphere. The reaction mixture is stirred for 10 minutes at 10° C. After that the reaction vessel is removed from the ice bath and stirred at room temperature for 2 hr, the reaction monitored by TLC (5% MeOH in CH[0217] ₂Cl₂). Aqueous NaHCO₃solution (5%, 10 mL) is added and extracted with ethyl acetate (2×20 mL). Ethyl acetate phase is dried over anhydrous Na₂SO₄, evaporated to dryness. Residue is dissolved in a solution of 1M PPTS in MeOH (30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes. Reaction mixture cooled to 10° C. in an ice bath, sodium cyanoborohydride (0.39 g, 6.13 mmol) is added and reaction mixture stirred at 10° C. for 10 minutes. After 10 minutes, the reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs. To the reaction mixture 5% NaHCO₃(25 mL) solution is added and extracted with ethyl acetate (2×25 mL). Ethyl acetate layer is dried over anhydrous Na₂SO₄and evaporated to dryness. The residue obtained is purified by flash column chromatography and eluted with 5% MeOH in CH₂Cl₂to get 5′-O-tert-butyldiphenylsilyl-2′-O-[N,N-dimethylaminooxyethyl]-5-methyluridine as a white foam (14.6 g).
2′-O-(dimethylaminooxyethyl)-5-methyluridine [0218]
Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) is dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept over KOH). This mixture of triethylamine-2HF is then added to 5′-O-tert-butyldiphenylsilyl-2′-O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40 g, 2.4 mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH[0219] ₂Cl₂). Solvent is removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH₂Cl₂to get 2′-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg).
5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine [0220]
2′-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17 mmol) is dried over P[0221] ₂O₅under high vacuum overnight at 40° C. It is then co-evaporated with anhydrous pyridine (20 mL). The residue obtained is dissolved in pyridine (11 mL) under argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol), 4,4′-dimethoxytrityl chloride (880 mg, 2.60 mmol) is added to the mixture and the reaction mixture is stirred at room temperature until all of the starting material disappeared. Pyridine is removed under vacuum and the residue chromatographed and eluted with 10% MeOH in CH₂Cl₂(containing a few drops of pyridine) to get 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine (1.13 g).
5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite][0222]
5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine (1.08 g, 1.67 mmol) is co-evaporated with toluene (20 mL). To the residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) is added and dried over P[0223] ₂O₅under high vacuum overnight at 40° C. Then the reaction mixture is dissolved in anhydrous acetonitrile (8.4 mL) and 2-cyanoethyl-N,N,N¹,N¹′-tetraisopropylphosphoramidite (2.12 mL, 6.08 mmol) is added. The reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction was monitored by TLC (hexane:ethyl acetate 1:1). The solvent is evaporated, then the residue is dissolved in ethyl acetate (70 mL) and washed with 5% aqueous NaHCO₃(40 mL). Ethyl acetate layer is dried over anhydrous Na₂SO₄and concentrated. Residue obtained is chromatographed (ethyl acetate as eluent) to get 5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite] as a foam (1.04 g).
2′-(Aminooxyethoxy) Nucleoside Amidites [0224]
2′-(Aminooxyethoxy) nucleoside amidites [also known in the art as 2′-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly. [0225]
N2-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite][0226]
The 2′-O-aminooxyethyl guanosine analog may be obtained by selective 2′-O-alkylation of diaminopurine riboside. Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2′-O-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3′-O-isomer. 2′-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2′-O-(2-ethylacetyl)guanosine by treatment with adenosine deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C. J., WO 94/02501 A1 940203.) Standard protection procedures should afford 2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine which may be reduced to provide 2-N-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine. As before the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite]. [0227]
Oligonucleotides having methylene (methylimino) (MMI) backbones are synthesized according to U.S. Pat. No. 5,378,825, which is coassigned to the assignee of the present invention and is incorporated herein in its entirety. For ease of synthesis, various nucleoside dimers containing MMI linkages were synthesized and incorporated into oligonucleotides. Other nitrogen-containing backbones are synthesized according to WO 92/20823 which is also coassigned to the assignee of the present invention and incorporated herein in its entirety. [0228]
Oligonucleotides having amide backbones are synthesized according to De Mesmaeker et al., [0229] Acc. Chem. Res., 28, 366 (1995). The amide moiety is readily accessible by simple and well-known synthetic methods and is compatible with the conditions required for solid phase synthesis of oligonucleotides.
Oligonucleotides with morpholino backbones are synthesized according to U.S. Pat. No. 5,034,506 (Summerton and Weller). [0230]
Peptide-nucleic acid (PNA) oligomers are synthesized according to P. E. Nielsen et al., [0231] Science, 254, 1497 (1991).
After cleavage from the controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55° C. for 18 hours, the oligonucleotides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis were periodically checked by [0232] ³¹P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem., 266, 18162 (1991). Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.

Example 2

Human p38α Oligonucleotide Sequences

Antisense oligonucleotides were designed to target human p38α. Target sequence data are from the p38 MAPK cDNA sequence; Genbank accession number L35253, provided herein as SEQ ID NO: 1. Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of eight 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by six-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All 2′-MOE cytosines were 5-methylcytosines. These oligonucleotide sequences are shown in Table 1. [0233]
The human Jurkat T-cell line (American Type Culture Collection, Manassas, Va.) was maintained in RPMI 1640 growth media supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, Utah). HUVEC cells (Clonetics, San Diego, Calif.) were cultivated in endothelial basal media supplemented with 10% FBS (Hyclone, Logan, Utah). [0234]
Jurkat cells were grown to approximately 75% confluency and resuspended in culture media at a density of 1×10[0235] ⁷cells/ml. A total of 3.6×10⁶cells were employed for each treatment by combining 360 μl of cell suspension with oligonucleotide at the indicated concentrations to reach a final volume of 400 μl. Cells were then transferred to an electroporation cuvette and electroporated using an Electrocell Manipulator 600 instrument (Biotechnologies and Experimental Research, Inc.) employing 150 V, 1000 μF, at 13 Ω. Electroporated cells were then transferred to conical tubes containing 5 ml of culture media, mixed by inversion, and plated onto 10 cm culture dishes.
HUVEC cells were allowed to reach 75% confluency prior to use. The cells were washed twice with warm (37° C.) OPTI-MEM™ (Life Technologies). The cells were incubated in the presence of the appropriate culture medium, without the growth factors added, and the oligonucleotide formulated in LIPOFECTIN7 (Life Technologies), a 1:1 (w/w) liposome formulation of the cationic lipid N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA), and dioleoyl phosphotidylethanolamine (DOPE) in membrane filtered water. HUVEC cells were treated with 100 nM oligonucleotide in 10 μg/ml LIPOFECTIN7. Treatment was for four hours. [0236]

Total mRNA was isolated using the RNEASY7 Mini Kit (Qiagen, Valencia, Calif.; similar kits from other manufacturers may also be used), separated on a 1% agarose gel, transferred to HYBOND™-N+ membrane (Amersham Pharmacia Biotech, Piscataway, N.J.), a positively charged nylon membrane, and probed. p38 MAPK probes were made using the Prime-A-Gene7 kit (Promega Corporation, Madison, Wis.), a random primer labeling kit, using mouse p38α or p38β cDNA as a template. A glyceraldehyde 3-phosphate dehydrogenase (G3PDH) probe was purchased from Clontech (Palo Alto, Calif.), Catalog Number 9805-1. The fragments were purified from low-melting temperature agarose, as described in Maniatis, T., et al., Molecular Cloning: A Laboratory Manual, 1989. The G3PDH probe was labeled with REDIVUE™ ³²P-dCTP (Amersham Pharmacia Biotech, Piscataway, N.J.) and Strip-EZ labelling kit (Ambion, Austin, Tex.). mRNA was quantitated by a PhosphoImager (Molecular Dynamics, Sunnyvale, Calif.).

TABLE 1


Nucleotide Sequences of Human p38α Chimeric
(deoxy gapped) Phosphorothioate
Oligonucleotides

		SEQ	TARGET GENE	GENE
ISIS	NUCLEOTIDE SEQUENCE¹	ID	NUCLEOTIDE	TARGET
NO.	(5′ → 3′)	NO:	CO-ORDINATES²	REGION

16486	AAGACC GGGCCCGGAATTCC	3	0001-0020	5′-UTR

16487	GTGGAG GCCAGTCCCCGGGA	4	0044-0063	5′-UTR

16488	TGGCAG CAAAGTGCTGCTGG	5	0087-0106	5′-UTR

16489	CAGAGAGCCTCCTGGGAGGG	6	0136-0155	5′-UTR

16490	TGTGCCGAATCTCGGCCTCT	7	0160-0179	5′-UTR

16491	GGTCTC GGGCGACCTCTCCT	8	0201-0220	5′-UTR

16492	CAGCCGCGGGACCAGCGGCG	9	0250-0269	5′-UTR

16493	CATTTTCCAGCGGCAGCCGC	10	0278-0297	AUG

16494	TCCTGAGACATTTTCCAGCG	11	0286-0305	AUG

16495	CTGCCG GTAGAACGTGGGCC	12	0308-0327	coding

16496	GTAAGCTTCTGACATTTCAC	13	0643-0662	coding

16497	TTTAGGTCCCTGTGAATTAT	14	0798-0817	coding

16498	ATGTTCTTCCAGTCAACAGC	15	0939-0958	coding

16499	TAAGGAGGTCCCTGCTTTCA	16	1189-1208	coding

16500	AACCAGGTGCTCAGGACTCC	17	1368-1387	stop

16501	GAAGTGGGATCAACAGAACA	18	1390-1409	3′-UTR

16502	TGAAAAGGCCTTCCCCTCAC	19	1413-1432	3′-UTR

16503	AGGCACTTGAATAATATTTG	20	1444-1463	3′-UTR

16504	CTTCCACCATGGAGGAAATC	21	1475-1494	3′-UTR

16505	ACACATGCACACACACTAAC	22	1520-1539	3′-UTR

For an initial screen of human p38α antisense oligonucleotides, Jurkat cells were electroporated with 10 μM oligonucleotide. mRNA was measured by Northern blot. Results are shown in Table 2. Oligonucleotides 16496 (SEQ ID NO. 13), 16500 (SEQ ID NO. 17) and 16503 (SEQ ID NO. 20) gave 35% or greater inhibition of p38α mRNA.

TABLE 2


Inhibition of Human p38α mRNA expression in Jurkat Cells by
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides

	SEQ	GENE
ISIS	ID	TARGET	% mRNA	% mRNA
No:	NO:	REGION	EXPRESSION	INHIBITION

control	—	—	100%	0%
16486	3	5′-UTR	212%	—
16487	4	5′-UTR	171%	—
16488	5	5′-UTR	157%	—
16489	6	5′-UTR	149%	—
16490	7	5′-UTR	152%	—
16491	8	5′-UTR	148%	—
16492	9	5′-UTR	125%	—
16493	10	AUG	101%	—
16494	11	AUG	72%	28%
16495	12	coding	72%	28%
16496	13	coding	61%	39%
16497	14	coding	104%	—
16498	15	coding	88%	12%
16499	16	coding	74%	26%
16500	17	stop	63%	37%
16501	18	3′-UTR	77%	23%
16502	19	3′-UTR	79%	21%
16503	20	3′-UTR	65%	35%
16504	21	3′-UTR	72%	28%
16505	22	3′-UTR	93%	7%

The most active human p38α oligonucleotides were chosen for dose response studies. Oligonucleotide 16490 (SEQ ID NO. 7) which showed no inhibition in the initial screen was included as a negative control. Jurkat cells were grown and treated as described above except the concentration of oligonucleotide was varied as indicated in Table 3. Results are shown in Table 3. Each of the active oligonucleotides showed a dose response effect with IC ₅₀s around 10 nM. Maximum inhibition was approximately 70% with 16500 (SEQ ID NO 17). The most active oligonucleotides were also tested for their ability to inhibit p38β. None of these oligonucleotides significantly reduced p38β mRNA expression.

TABLE 3


Dose Response of p38α mRNA in Jurkat cells to human p38α
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides

	SEQ ID	ASO Gene		% mRNA	% mRNA
ISIS #	NO:	Target	Dose	Expression	Inhibition

control	—	—	—	100%	0%
16496	13	coding	2.5 nM	94%	6%
″	″	″	5 nM	74%	26%
″	″	″	10 nM	47%	53%
″	″	″	20 nM	41%	59%
16500	17	stop	2.5 nM	82%	18%
″	″	″	5 nM	71%	29%
″	″	″	10 nM	49%	51%
″	″	″	20 nM	31%	69%
16503	20	3′-UTR	2.5 nM	74%	26%
″	″	″	5 nM	61%	39%
″	″	″	10 nM	53%	47%
″	″	″	20 nM	41%	59%
16490	7	5′-UTR	2.5 nM	112%	—
″	″	″	5 nM	109%	—
″	″	″	10 nM	104%	—
″	″	″	20 nM	97%	3%

Example 3

Human p38β Oligonucleotide Sequences

Antisense oligonucleotides were designed to target human p38β. Target sequence data are from the p38β MAPK cDNA sequence; Genbank accession number U53442, provided herein as SEQ ID NO: 23. Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All 2′-MOE cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 4.

TABLE 4


Nucleotide Sequences of Human p38β
Phosphorothioate Oligonucleotides

		SEQ	TARGET GENE	GENE
ISIS	NUCLEOTIDE SEQUENCE¹	ID	NUCLEOTIDE	TARGET
NO.	(5′ → 3′)	NO:	CO-ORDINATES²	REGION

17891	CGACATGTCCGGAGCAGAAT	25	0006-0025	AUG

17892	TTCAGCTCCTGCCGGTAGAA	26	0041-0060	coding

17893	TGCGGCACCTCCCACACGGT	27	0065-0084	coding

17894	CCGAACAGACGGAGCCGTAT	28	0121-0140	coding

17895	GTGCTTCAGGTGCTTGAGCA	29	0240-0259	coding

17896	GCGTG AAGACGTCCAGAAGC	30	0274-0293	coding

17897	ACTTGACGATGTTGTTCAGG	31	0355-0374	coding

17898	AACGTGCTCGTCAAGTGCCA	32	0405-0424	coding

17899	ATCCTGAGCTCACAGTCCTC	33	0521-0540	coding

17900	ACTGTTTGGTTGTAATGCAT	34	0635-0654	coding

17901	ATGATGCGCTTCAGCTGGTC	35	0731-0750	coding

17902	GCCAGTGCCTCAGGTGCACT	36	0935-0954	coding

17903	AACGCTCTCATCATATGGCT	37	1005-1024	coding

17904	CAGCACCTCACTGCTCAATC	38	1126-1145	stop

17905	TCTGTGACCATAGGAGTGTG	39	1228-1247	3′-UTR

17906	ACACATGTTTGTGCATGCAT	40	1294-1313	3′-UTR

17907	CCTACACATGGCAAGCACAT	41	1318-1337	3′-UTR

17908	TCCAGGCTGAGCAGCTCTAA	42	1581-1600	3′-UTR

17909	AGTGCACGCTCATCCACACG	43	1753-1772	3′-UTR

17910	CTTGCCAGATATGGCTGCTG	44	1836-1855	3′-UTR

For an initial screen of human p38β antisense oligonucleotides, HUVEC cells were cultured and treated as described in Example 2. mRNA was measured by Northern blot as described in Example 2. Results are shown in Table 5. Every oligonucleotide tested gave at least 50% inhibition. Oligonucleotides 17892 (SEQ ID NO. 26), 17893 (SEQ ID NO. 27), 17894 (SEQ ID NO. 28), 17899 (SEQ ID NO. 33), 17901 (SEQ ID NO. 35), 17903 (SEQ ID NO. 37), 17904 (SEQ ID NO. 38), 17905 (SEQ ID NO. 39), 17907 (SEQ ID NO. 41), 17908 (SEQ ID NO. 42), and 17909 (SEQ ID NO. 43) gave greater than approximately 85% inhibition and are preferred.

TABLE 5


Inhibition of Human p38β mRNA expression in Huvec Cells by
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides

	SEQ	GENE
ISIS	ID	TARGET	% mRNA	% mRNA
No:	NO:	REGION	EXPRESSION	INHIBITION

control	—	—	100%	0%
17891	25	AUG	22%	78%
17892	26	coding	10%	90%
17893	27	coding	4%	96%
17894	28	coding	13%	87%
17895	29	coding	25%	75%
17896	30	coding	24%	76%
17897	31	coding	25%	75%
17898	32	coding	49%	51%
17899	33	coding	5%	95%
17900	34	coding	40%	60%
17901	35	coding	15%	85%
17902	36	coding	49%	51%
17903	37	coding	11%	89%
17904	38	stop	9%	91%
17905	39	3′-UTR	14%	86%
17906	40	3′-UTR	22%	78%
17907	41	3′-UTR	8%	92%
17908	42	3′-UTR	17%	83%
17909	43	3′-UTR	13%	87%
17910	44	3′-UTR	26%	74%

Oligonucleotides 17893 (SEQ ID NO. 27), 17899 (SEQ ID NO:33), 17904 (SEQ ID NO. 38), and 17907 (SEQ ID NO. 41) were chosen for dose response studies. HUVEC cells were cultured and treated as described in Example 2 except that the oligonucleotide concentration was varied as shown in Table 6. The Lipofectin7/Oligo ratio was maintained at 3 μg Lipofectin7/100 nM oligo, per ml. mRNA was measured by Northern blot as described in Example 2. [0242]

Results are shown in Table 6. Each oligonucleotide tested had an IC ₅₀of less than 10 nM. The effect of these oligonucleotides on human p38α was also determined. Only oligonucleotide 17893 (SEQ ID NO. 27) showed an effect on p38α mRNA expression. The IC₅₀of this oligonucleotide was approximately 4 fold higher for p38α compared to p38β.

TABLE 6


Dose Response of p38β in Huvec cells to human p38β
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides

	SEQ ID	ASO Gene		% mRNA	% mRNA
ISIS #	NO:	Target	Dose	Expression	Inhibition

control	—	—	—	100%	0%
17893	27	coding	10 nM	37%	63%
″	″	″	25 nM	18%	82%
″	″	″	50 nM	16%	84%
″	″	″	100 nM	19%	81%
17899	33	coding	10 nM	37%	63%
″	″	″	25 nM	23%	77%
″	″	″	50 nM	18%	82%
″	″	″	100 nM	21%	79%
17904	38	stop	10 nM	31%	69%
″	″	″	25 nM	21%	79%
″	″	″	50 nM	17%	83%
″	″	″	100 nM	19%	81%
17907	41	3′-UTR	10 nM	37%	63%
″	″	″	25 nM	22%	78%
″	″	″	50 nM	18%	72%
″	″	″	100 nM	18%	72%

Example 4

Rat p38α Oligonucleotide Sequences

Antisense oligonucleotides were designed to target rat p38α. Target sequence data are from the p38 MAPK cDNA sequence; Genbank accession number U73142, provided herein as SEQ ID NO: 45. Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages in the wings are phosphodiester (P═O). Internucleoside linkages in the central gap are phosphorothioate (P═S). All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 7. [0244]
bEND.3, a mouse endothelial cell line (gift of Dr. Werner Risau; see Montesano et al., [0245] Cell, 1990, 62, 435, and Stepkowski et al., J. Immunol., 1994, 153, 5336) were grown in high-glucose DMEM (Life Technologies, Gaithersburg, Md.) medium containing 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycinin. Cells were plated at approximately 2×10⁵cells per 100 mm dish. Within 48 hours of plating, the cells were washed with phosphate-buffered saline (Life Technologies). Then, Opti-MEM7 medium containing 3 μg/mL LIPOFECTIN⁷and an appropriate amount of oligonucleotide were added to the cells. As a control, cells were treated with LIPOFECTIN⁷without oligonucleotide under the same conditions and for the same times as the oligonucleotide-treated samples.

After 4 hours at 37° C., the medium was replaced with high glucose DMEM medium containing 10% FBS and 1% Penicillin/Streptomycinin. The cells were typically allowed to recover overnight (about 18 to 24 hours) before RNA and/or protein assays were performed as described in Example 2. The p38α, p38β and G3PDH probes used were identical to those described in Example 2.

TABLE 7


Nucleotide Sequences of Rat p38α Phosphorothioate
Oligonucleotides

		SEQ	TARGET GENE	GENE
ISIS	NUCLEOTIDE SEQUENCE¹	ID	NUCLEOTIDE	TARGET
NO.	(5′ → 3′)	NO	CO-ORDINATES²	REGION

21844	CoToGoCoGsAsCsAsTsTsTsTsCsCsAsGoCoGoGoC	47	0001-0020	AUG

21845	GoGoToAoAsGsCsTsTsCsTsGsAsCsAsCoToToCoA	48	0361-0380	coding

21846	GoGoCoCoAsGsAsGsAsCsTsGsAsAsTsGoToAoGoT	49	0781-0800	coding

21871	CoAoToCoAsTsCsAsGsGsGsTsCsGsTsGoGoToAoC	50	0941-0960	coding

21872	GoGoCoAoCsAsAsAsGsCsTsAsAsTsGsAoCoToToC	51	1041-1060	coding

21873	AoGoGoToGsCsTsCsAsGsGsAsCsTsCsCoAoToToT	52	1081-1100	stop

21874	GoGoAoToGsGsAsCsAsGsAsAsCsAsGsAoAoGoCoA	53	1101-1120	3′-UTR

21875	GoAoGoCoAsGsGsCsAsGsAsCsTsGsCsCoAoAoGoG	54	1321-1340	3′-UTR

21876	AoGoGoCoTsAsGsAsGsCsCsCsAsGsGsAoGoCoCoA	55	1561-1580	3′-UTR

21877	GoAoGoCoCsTsGsTsGsCsCsTsGsGsCsAoCoToGoG	56	1861-1880	3′-UTR

21878	ToGoCoAoCsCsAsCsAsAsGsCsAsCsCsToGoGoAoG	57	2081-2100	3′-UTR

21879	GoGoCoToAsCsCsAsTsGsAsGsTsGsAsGoAoAoGoA	58	2221-2240	3′-UTR

21880	GoToCoCoCsTsGsCsAsCsTsGsAsTsAsGoAoGoAoA	59	2701-2720	3′-UTR

21881	T oCoToToCsCsAsAsTsGsGsAsGsAsAsAoCoToGoG	60	3001-3020	3′-UTR

[0247] ¹Emboldened residues, 2′-methoxyethoxy-residues (others are 2′-deoxy-); 2′-MOE cytosines and 2′-deoxy cytosine residues are 5-methyl-cytosines; “s” linkages are phosphorothioate linkages; “o” linkages are phosphodiester linkages. ²Co-ordinates from Genbank Accession No. U73142, locus name “RNU73142”, SEQ ID NO. 45.
Rat p38α antisense oligonucleotides were screened in bEND.3 cells for inhibition of p38α and p38β mRNA expression. The concentration of oligonucleotide used was 100 nM. Results are shown in Table 8. Oligonucleotides 21844 (SEQ ID NO. 47), 21845 (SEQ ID NO. 48), 21872 (SEQ ID NO. 51), 21873 (SEQ ID NO. 52), 21875 (SEQ ID NO. 54), and 21876 (SEQ ID NO. [0248]

55) showed greater than approximately 70% inhibition of p38α mRNA with minimal effects on p38β mRNA levels. Oligonucleotide 21871 (SEQ ID NO. 50) inhibited both p38α and p38β levels greater than 70%.

TABLE 8


Inhibition of Mouse p38 mRNA expression in bEND.3 Cells by
Chimeric (deoxy gapped) Mixed Backbone p38α Antisense
Oligonucleotides

	SEQ	GENE
ISIS	ID	TARGET	% p38α mRNA	% p38β mRNA
No:	NO:	REGION	INHIBITION	INHIBITION

control	—	—	0%	0%
21844	47	AUG	81%	20%
21845	48	coding	75%	25%
21871	50	coding	90%	71%
21872	51	coding	87%	23%
21873	52	stop	90%	3%
21874	53	3′-UTR	38%	21%
21875	54	3′-UTR	77%	—
21876	55	3′-UTR	69%	—
21877	56	3′-UTR	55%	13%
21878	57	3′-UTR	25%	10%
21879	58	3′-UTR	—	—
21881	60	3′-UTR	—	—

Several of the most active oligonucleotides were selected for dose response studies. bEND.3 cells were cultured and treated as described above, except that the concentration of oligonucleotide was varied as noted in Table 9. Results are shown in Table 9.

TABLE 9


Dose Response of bEND.3 cells to rat p38β
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides

	SEQ
	ID	ASO Gene		% p38α mRNA	% p38β mRNA
ISIS #	NO:	Target	Dose	Inhibition	Inhibition

control	—	—	—	100%	0%
21844	47	AUG	1 nM	—	—
″	″	″	5 nM	—	—
″	″	″	25 nM	36%	8%
″	″	″	100 nM	80%	5%
21871	50	coding	1 nM	1%	—
″	″	″	5 nM	23%	4%
″	″	″	25 nM	34%	24%
″	″	″	100 nM	89%	56%
21872	51	stop	1 nM	—	—
″	″	″	5 nM	—	—
″	″	″	25 nM	35%	—
″	″	″	100 nM	76%	1%
21873	52	stop	1 nM	—	53%
″	″	″	5 nM	—	31%
″	″	″	25 nM	54%	28%
″	″	″	100 nM	92%	25%
21875	54	3′-UTR	1 nM	—	11%
″	″	″	5 nM	—	16%
″	″	″	25 nM	33%	2%
″	″	″	100 nM	72%	4%

Example 5

Mouse p38β Oligonucleotide Sequences

Antisense oligonucleotides were designed to target mouse p38β. Target sequence data are from a mouse EST sequence; Genbank accession number AI119044, provided herein as SEQ ID NO 61. Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages in the wings are phosphodiester (P═O). Internucleoside linkages in the central gap are phosphorothioate (P═S). All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 10.

TABLE 10


Nucleotide Sequences of Mouse p38β
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides

			TARGET
		SEQ	GENE
ISIS	NUCLEOTIDE SEQUENCE′	ID	NUCLEOTIDE
NO.	(5′ → 3′)	NO:	CO-ORDINATES²

100800	CoAoCoAoGsAsAsGsCsAsGsCsTsGsGsAoGoCoGoA	63	0051-0070

100801	ToGoCoGoGsCsAsCsCsTsCsCsCsAsTsAoCoToGoT	64	0119-0138

100802	CoCoCoToGsCsAsGsCsCsGsCsTsGsCsGoGoCoAoC	65	0131-0150

100803	GoCoAoGoAsCsTsGsAsGsCsCsGsTsAsGoGoCoGoC	66	0171-0190

100804	ToToAoCoAsGsCsCsAsCsCsTsTsCsTsGoGoCoGoC	67	0211-0230

100805	GoToAoToGsTsCsCsTsCsCsTsCsGsCsGoToGoGoA	68	0261-0280

100806	AoToGoGoAsTsGsTsGsGsCsCsGsGsCsGoToGoAoA	69	0341-0360

100807	GoAoAoToTsGsAsAsCsAsTsGsCsTsCsAoToCoGoC	70	0441-0460

100808	AoCoAoToTsGsCsTsGsGsGsCsTsTsCsAoGoGoToC	71	0521-0540

100809	AoToCoCoTsCsAsGsCsTsCsGsCsAsGsToCoCoToC	72	0551-0570

100810	ToAoCoCoAsCsCsGsTsGsTsGsGsCsCsAoCoAoToA	73	0617-0636

100811	CoAoGoToTsTsAsGsCsAsTsGsAsTsCsToCoToGoG	74	0644-0663

100812	CoAoGoGoCsCsAsCsAsGsAsCsCsAsGsAoToGoToC	75	0686-0705

100813	CoCoToToCsCsAsGsCsAsGsTsTsCsAsAoGoCoCoA	76	0711-0730

101123	CoAoGoCoAsCsCsAsTsGsGsAsCsGsCsGoGoAoAoC	77	21871
			mismatch

Mouse p38β antisense sequences were screened in bEND.3 cells as described in Example 4. Results are shown in Table 11. [0252]

Oligonucleotides 100800 (SEQ ID NO. 63), 100801 (SEQ ID NO. 64), 100803 (SEQ ID NO. 66), 100804 (SEQ ID NO. 67), 100805 (SEQ ID NO. 68), 100807 (SEQ ID NO. 70), 100808 (SEQ ID NO. 71), 100809 (SEQ ID NO. 72), 100810 (SEQ ID NO. 73), 100811 (SEQ ID NO.74), and 100813 (SEQ ID NO. 76) resulted in at least 50% inhibition of p38β mRNA expression. Oligonucleotides 100801 (SEQ ID NO.64), 100803 (SEQ ID NO. 66), 100804 (SEQ ID NO. 67), 100805 (SEQ ID NO. 68), 100809 (SEQ ID NO. 72), and 100810 (SEQ ID NO. 73) resulted in at least 70% inhibition and are preferred. Oligonucleotides 100801 (SEQ ID NO. 64), 100805 (SEQ ID NO. 68), and 100811 (SEQ ID NO. 74) resulted in significant inhibition of p38α mRNA expression in addition to their effects on p38β.

TABLE 11


Inhibition of Mouse p38 mRNA expression in bEND.3 Cells by
Chimeric (deoxy gapped) Mixed Backbone p38β Antisense
Oligonucleotides

ISIS	SEQ ID	% p38β mRNA	% p38α mRNA
No:	NO:	INHIBITION	INHIBITION

control	—	0%	0%
100800	63	51%	—
100801	64	74%	31%
100802	65	35%	—
100803	66	74%	18%
100804	67	85%	18%
100805	68	78%	58%
100806	69	22%	3%
100807	70	64%	—
100808	71	53%	13%
100809	72	84%	14%
100810	73	72%	1%
100811	74	60%	43%
100812	75	36%	17%
100813	76	54%	—

Example 6

Effect of p38 MAPK Antisense Oligonucleotides on IL-6 Secretion

p38 MAPK antisense oligonucleotides were tested for their ability to reduce IL-6 secretion. bEND.3 cells were cultured and treated as described in Example 4 except that 48 hours after oligonucleotide treatment, cells were stimulated for 6 hours with 1 ng/mL recombinant mouse IL-1 (R&D Systems, Minneapolis, Minn.). IL-6 was measured in the medium using an IL-6 ELISA kit (Endogen Inc., Woburn, Mass.). [0254]
Results are shown in Table 12. Oligonucleotides targeting a specific p38 MAPK isoform were effective in reducing IL-6 secretion greater than approximately 50%. [0255]

TABLE 12

Effect of p38 Antisense Oligonucleotides on IL-6 secretion

ISIS SEQ ID DOSE % IL-6

No: NO: GENE TARGET (μM) INHIBITION

control — — 0%

21873 52 p38α 100 49%

100804 67 p38β 100 57%

21871 50 p38α and p38β 200 23%

Example 7

Activity of p38α Antisense Oligonucleotides in Rat Cardiomyocytes

Rat p38α antisense oligonucleotides were screened in Rat A-10 cells. A-10 cells (American Type Culture Collection, Manassas, Va.) were grown in high-glucose DMEM (Life Technologies, Gaithersburg, Md.) medium containing 10% fetal calf serum (FCS). Cells were treated with oligonucleotide as described in Example 2. Oligonucleotide concentration was 200 nM. mRNA was isolated 24 hours after time zero and quantitated by Northern blot as described in Example 2. [0256]

Results are shown in Table 13. Oligonucleotides 21845 (SEQ ID NO. 48), 21846 (SEQ ID NO. 49), 21871 (SEQ ID NO. 50), 21872 (SEQ ID NO. 51), 21873 (SEQ ID NO. 52), 21874 (SEQ ID NO. 53), 21875 (SEQ ID NO. 54), 21877 (SEQ ID NO. 56), 21878 (SEQ ID NO. 57), 21879 (SEQ ID NO. 58), and 21881 (SEQ ID NO. 60) inhibited p38α mRNA expression by 65% or greater in this assay. Oligonucleotides 21846 (SEQ ID NO. 49), 21871 (SEQ ID NO. 50), 21872 (SEQ ID NO. 51), 21877 (SEQ ID NO. 56), and 21879 (SEQ ID NO. 58) inhibited p38α mRNA expression by greater than 85% and are preferred.

TABLE 13


Inhibition of Rat p38α mRNA expression in A-10 Cells by
Chimeric (deoxy gapped) Mixed Backbone p38α Antisense
Oligonucleotides

	SEQ	GENE
ISIS	ID	TARGET	% p38α mRNA	% p38α mRNA
No:	NO:	REGION	EXPRESSION	INHIBITION

control	—	—	100%	0%
21844	47	AUG	75%	25%
21845	48	coding	25%	75%
21846	49	coding	8%	92%
21871	50	coding	12%	88%
21872	51	coding	13%	87%
21873	52	stop	19%	81%
21874	53	3′-UTR	22%	78%
21875	54	3′-UTR	26%	74%
21876	55	3′-UTR	61%	39%
21877	56	3′-UTR	12%	88%
21878	57	3′-UTR	35%	65%
21879	58	3′-UTR	11%	89%
21881	60	3′-UTR	31%	69%

The most active oligonucleotide in this screen (SEQ ID NO. 49) was used in rat cardiac myocytes prepared from neonatal rats (Zechner, D., et. al., [0258] J. Cell Biol., 1997, 139, 115-127). Cells were grown as described in Zechner et al. and transfected with oligonucleotide as described in Example 2. Oligonucleotide concentration was 1 μM. mRNA was isolated 24 hrs after time zero and quantitated using Northern blotting as described in Example 2. An antisense oligonucleotide targeted to JNK-2 was used as a non-specific target control.
Results are shown in Table 14. Oligonucleotide 21846 (SEQ ID NO. 49) was able to reduce p38α expression in rat cardiac myocytes by nearly 60%. The JNK-2 antisense oligonucleotide had little effect on p38α expression. [0259]

TABLE 14

Inhibition of Rat p38α mRNA expression in Rat Cardiac

Myocytes by A Chimeric (deoxy gapped) Mixed Backbone p38α

Antisense Oligonucleotide

SEQ GENE

ISIS ID TARGET % p38α mRNA % p38α mRNA

No: NO: REGION EXPRESSION INHIBITION

control — — 100% 0%

21846 49 coding 41% 59%
[0260] Eample 8

Additional Human p38α Oligonucleotide Sequences

Additional antisense oligonucleotides were designed to target human p38α based on active rat sequences. Target sequence data are from the p38 MAPK cDNA sequence; Genbank accession number L35253, provided herein as SEQ ID NO: 1. Oligonucleotides were synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 15.

TABLE 15


Additional Nucleotide Sequences of Human p38α
Chimeric (deoxy gapped) Phosphorothioate
Oligonucleotides

		SEQ	TARGET GENE	GENE
ISIS	NUCLEOTIDE SEQUENCE¹	ID	NUCLEOTIDE	TARGET
NO.	(5′ → 3′)	NO:	CO-ORDINATES²	REGION

100860	CTGAGACATTTTCCAGCGGC	78	0284-0303	Start

100861	ACGCTCGGGCACCTCCCAGA	79	0344-0363	coding

100862	AGCTT CTTCACTGCCACACG	80	0439-0458	coding

100863	AATGATGGACTGAAATGGTC	81	0464-0483	coding

100864	TCCAACAGACCAATCACATT	82	0538-0557	coding

100865	TGTAAGCTTCTGACATTTCA	83	0644-0663	coding

100866	TGAATGTATATACTTTAGAC	84	0704-0723	coding

100867	CTCACAGTCTTCATTCACAG	85	0764-0783	coding

100868	CACGTAGCCTGTCATTTCAT	86	0824-0843	coding

100869	CATCCCACTGACCAAATATC	87	0907-0926	coding

100870	TATGGTCTGTACCAGGAAAC	88	0960-0979	coding

100871	AGTCAAAGACTGAATATAGT	89	1064-1083	coding

100872	TTCTCTTATCTGAGTCCAAT	90	1164-1183	coding

100873	CATCATCAGGATCGTGGTAC	91	1224-1243	coding

100874	TCAAAGGACTGATCATAAGG	92	1258-1277	coding

100875	GGCACAAAGCTGATGACTTC	93	1324-1343	coding

100876	AGGTGCTCAGGACTCCATCT	94	1364-1383	stop

100877	GCAACAAGAGGCACTTGAAT	95	1452-1471	3′-UTR

For an initial screen of human p38α antisense oligonucleotides, T-24 cells, a human transitional cell bladder carcinoma cell line, were obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), [0262] penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. A control oligonucleotide ISIS 118965 (TTATCCTAGCTTAGACCTAT, herein incorporated as SEQ ID NO: 96) was synthesized as chimeric oligonucleotide (“gapmer”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All 2′-MOE cytosines and 2′OH cytosines were 5-methyl-cytosines.

For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. mRNA was measured by Northern blot. Results are shown in Table 16. Oligonucleotides 100861 (SEQ ID NO. 79) 100862 (SEQ ID NO. 80), 100863 (SEQ ID NO. 81), 100866 (SEQ ID NO. 84), 100867 (SEQ ID NO. 85), 100868 (SEQ ID NO. 86) 100870 (SEQ ID NO. 88), 100871 (SEQ ID NO. 89), 100872 (SEQ NO. 90), 100873 (SEQ ID NO. 91), and 100874 (SEQ ID NO. 92) 100875 (SEQ ID NO. 93) and 100877 (SEQ ID NO. 95) gave greater than approximately 40% inhibition and are preferred.

TABLE 16


Inhibition of Human p38α mRNA expression in T-24 Cells by
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides

	SEQ
ISIS	ID	GENE TARGET	% P38α mRNA	% P38β mRNA
No:	NO:	REGION	EXPRESSION	EXPRESSION

100860	78	0284-0303	73%	71%
100861	79	0344-0363	60%	47%
100862	80	0439-0458	56%	45%
100863	81	0464-0483	49%	67%
100864	82	0538-0557	66%	70%
100865	83	0644-0663	64%	63%
100866	84	0704-0723	55%	65%
100867	85	0764-0783	58%	33%
100868	86	0824-0843	47%	60%
100869	87	0907-0926	61%	100%
100870	88	0960-0979	51%	No data
100871	89	1064-1083	57%	96%
100872	90	1164-1183	37%	77%
100873	91	1224-1243	34%	70%
100874	92	1258-1277	42%	76%
100875	93	1324-1343	39%	90%
100876	94	1364-1383	77%	93%
100877	95	1452-1471	47%	95%

Oligonucleotides 100872 (SEQ ID NO. 90), 100873 (SEQ ID NO. 91), 100874 (SEQ ID NO. 92), and 100875 (SEQ ID NO. 93) were chosen for dose response studies. [0264]

Results are shown in Table 17. The effect of these oligonucleotides on human p38β was also determined.

TABLE 17


Dose Response of p38α in T-24 cells to human p38α
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides

	SEQ
	ID	ASO Gene		% p38α mRNA	% p38β mRNA
ISIS #	NO:	Target	Dose	Expression	Inhibition

Control	96	—	—	94%	80%
118965
100872	90	coding	50 nM	45%	108%
″	″	″	100 nM	18%	91%
″	″	″	200 nM	17%	92%
100873	91	coding	50 nM	19%	90%
″	″	″	100 nM	12%	78%
″	″	″	200 nM	8%	44%
100874	92	coding	50 nM	47%	107%
″	″	″	100 nM	27%	101%
″	″	″	200 nM	13%	51%
100875	93	coding	50 nM	30%	105%
″	″	″	100 nM	13%	92%
″	″	″	200 nM	8%	69%

Example 9

Additional Human p38β Oligonucleotide Sequences

Additional antisense oligonucleotides were designed to target human p38β based on active rat sequences. Target sequence data are from the p38 MAPK cDNA sequence; Genbank accession number U53442, provided herein as SEQ ID NO: 23. [0266]

Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages in the wings are phosphodiester (P═O). Internucleoside linkages in the central gap are phosphorothioate (P═S). All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 18. A control oligonucleotide ISIS 118966 (GTTCGATCGGCTCGTGTCGA), herein incorporated as SEQ ID NO: 107) was synthesized as chimeric oligonucleotide (“gapmer”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) in the gap and phosphodiester in the wings. All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines.

TABLE 18


Additional Nucleotide Sequences of Human p38β
Chimeric (deoxy gapped) Mixed-Backbone
Phosphorothioate Oligonucleotides

107869	ACAGACGGAGCCGTAGGCGC	97	117-136	coding

107870	CACCGCCACCTTCTGGCGCA	98	156-175	coding

107871	GTACGTTCTGCGCGCGTGGA	99	207-226	coding

107872	ATGGA CGTGGCCGGCGTGAA	100	287-306	coding

107873	CAGGAATTGAACGTGCTCGT	101	414-433	coding

107874	ACGTTGCTGGGCTTCAGGTC	102	491-510	coding

107875	TACCAGCGCGTGGCCACATA	103	587-606	coding

107876	CAGTTGAGCATGATCTCAGG	104	614-633	coding

107877	CGGACCAGATATCCACTGTT	105	649-668	coding

107878	TGCCCTGGAGCAGCTCAGCC	106	682-701	coding

For an initial screen of human p38β antisense oligonuleotides, T-24 cells, a human transitional cell bladder carcinoma cell line, were obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), [0268] penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. A control oligonucleotide ISIS 118966 (TTATCCTAGCTTAGACCTAT, herein incorporated as SEQ ID NO: 106) was synthesized as chimeric oligonucleotide (“gapmer”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) in the gap and phosphodiester in the wings. All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines.
For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. mRNA was measured by Northern blot. Results are shown in Table 19. For comparison, ISIS 17893 and ISIS 17899, both targeting human p38β (SEQ ID NO: 27) and ISIS 100802 targeting mouse p38β (SEQ ID NO: 65) described in Examples 3 and 5 above, respectively, were included in the screen. [0269]

Oligonucleotides 107869 (SEQ ID NO. 97), 107871 (SEQ ID NO. 99), 107872 (SEQ ID NO. 100), 107873 (SEQ ID NO. 101), 107878 (SEQ ID NO.106), 17893 (SEQ ID NO. 27), 17899 (SEQ ID NO. 33) and 100802 (SEQ ID NO.65, targeted to mouse p38β) gave greater than approximately 40% inhibition and are preferred.

TABLE 19


Inhibition of Human p38β mRNA expression in T-24 Cells by
Chimeric (deoxy gapped) Mixed-Backbone Phosphorothioate
Oligonucleotides

	SEQ
ISIS	ID	GENE TARGET	% p38β mRNA	% p38α mRNA
No:	NO:	REGION	EXPRESSION	EXPRESSION

107869	97	Coding	60%	93%
107870	98	Coding	74%	97%
107871	99	Coding	60%	111%
107872	100	Coding	57%	123%
107873	101	Coding	58%	120%
107874	102	Coding	61%	100%
107875	103	Coding	92%	112%
107876	104	Coding	127%	137%
107877	105	Coding	No data	No data
107878	106	Coding	54%	112%
17893	27	Coding	31%	61%
17899	33	Coding	56%	117%
100802	65	Coding	47%	78%

Oligonucleotides 107871, 107872, 107873, 107874, 107875, 107877, 107878, 17893 and 17899 were chosen for dose response studies. [0271]

Results are shown in Table 20. The effect of these oligonucleotides on human p38α was also determined.

TABLE 20


Dose Response of p38β in T-24 cells to human p38β
Chimeric (deoxy gapped) Mixed-backbone Phosphorothioate
Oligonucleotides

	SEQ
	ID	ASO Gene		% p38β mRNA	% p38α mRNA
ISIS #	NO:	Target	Dose	Expression	Inhibition

Control	107	—	—	100%	100%
118966
107871	99	coding	50 nM	41%	105%
″	″	″	100 nM	42%	132%
″	″	″	200 nM	10%	123%
107872	100	coding	50 nM	71%	124%
″	″	″	100 nM	13%	84%
″	″	″	200 nM	22%	102%
107873	101	coding	50 nM	69%	132%
″	″	″	100 nM	41%	119%
″	″	″	200 nM	23%	131%
107874	102	coding	50 nM	75%	109%
″	″	″	100 nM	34%	99%
″	″	″	200 nM	23%	87%
107875	103	coding	50 nM	82%	93%
″	″	″	100 nM	38%	101%
″	″	″	200 nM	40%	91%
107877	105	coding	50 nM	50%	127%
″	″	″	100 nM	34%	125%
″	″	″	200 nM	22%	106%
107878	106	coding	50 nM	70%	110%
″	″	″	100 nM	43%	109%
″	″	″	200 nM	27%	116%
17893	27	coding	50 nM	28%	88%
″	″	″	100 nM	27%	115%
″	″	″	200 nM	16%	108%
17899	33	coding	50 nM	89%	87%
″	″	″	100 nM	36%	104%
″	″	″	200 nM	15%	80%

These data show that the oligonucleotides designed to target human p38β, do so in a target-specific and dose-dependent manner. [0273]

Eample 10

Real-Time Quantitative PCR Analysis of p38β mRNA Levels

Quantitation of p38α mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5′ end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3′ end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3′ quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM™ Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples. [0274]
Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be “multiplexed” with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only (“single-plexing”), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art. [0275]
PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, Calif.). RT-PCR reactions were carried out by adding 20 μL PCR cocktail (2.5×PCR buffer minus MgCl[0276] ₂, 6.6 mM MgCl₂, 375 μM each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5×ROX dye) to 96-well plates containing 30 μL total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48° C. Following a 10 minute incubation at 95° C. to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95° C. for 15 seconds (denaturation) followed by 60° C. for 1.5 minutes (annealing/extension).
Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen™ (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RiboGreen™ are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). [0277]
In this assay, 170 μL of RiboGreen™ working reagent (RiboGreen™ reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 μL purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm. [0278]
Probes and primers to human p38α were designed to hybridize to a human p38α sequence, using published sequence information (GenBank accession number L35253, incorporated herein as SEQ ID NO:1). For human p38α the PCR primers were: [0279]
forward primer: GATGAGTGGAAAAGCCTGAC (SEQ ID NO: 108) [0280]
reverse primer: CTGCAACAAGAGGCACTTGA (SEQ ID NO: 109) and the PCR probe was: FAM-GATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGA-TAMRA (SEQ ID NO: 110) where FAM is the fluorescent dye and TAMRA is the quencher dye. For human GAPDH the PCR primers were: [0281]
forward primer: GAAGGTGAAGGTCGGAGTC(SEQ ID NO: 111) [0282]
reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 112) and the PCR probe was: 5′ JOE-CAAGCTTCCCGTTCTCAGCC-[0283] TAMRA 3′ (SEQ ID NO: 113) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
Probes and primers to mouse p38α were designed to hybridize to a mouse p38α sequence, using published sequence information (GenBank accession number U10871.1, incorporated herein as SEQ ID NO: 114). For mouse p38α the PCR primers were: [0284]
forward primer: AAGGGAACGAGAAAACTGCTGTT (SEQ ID NO: 115) [0285]
reverse primer: TATTTTAACCAGTGGTATTATCTGACATCCT (SEQ ID NO: 116) and the PCR probe was: FAM-TTGTATTTGTGAACTTGGCTGTAATCTGGTATGCC -TAMRA [0286]
(SEQ ID NO: 117) where FAM is the fluorescent reporter dye and TAMRA is the quencher dye. For mouse GAPDH the PCR primers were: [0287]
forward primer: GGCAAATTCAACGGCACAGT(SEQ ID NO: 118) [0288]
reverse primer: GGGTCTCGCTCCTGGAAGAT(SEQ ID NO: 119) and the PCR probe was: 5′ JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-[0289] TAMRA 3′ (SEQ ID NO: 120) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
Probes and primers to rat p38α were designed to hybridize to a rat p38α sequence, using published sequence information (GenBank accession number U73142, incorporated herein as SEQ ID NO: 45). For rat p38α the PCR primers were: [0290]
forward primer: ATCATTTGGAGCCCAGAAGGA (SEQ ID NO: 121) [0291]
reverse primer: TGGAGCTGGACTGCATACTGA (SEQ ID NO: 122) and the PCR probe was: FAM-CTGGCCAGGCCTCACCGC-TAMRA [0292]
(SEQ ID NO: 123) where FAM is the fluorescent reporter dye and TAMRA is the quencher dye. For rat GAPDH the PCR primers were: [0293]
forward primer: TGTTCTAGAGACAGCCGCATCTT(SEQ ID NO: 124) [0294]
reverse primer: CACCGACCTTCACCATCTTGT(SEQ ID NO: 125) and the PCR probe was: 5′ JOE-TTGTGCAGTGCCAGCCTCGTCTCA-[0295] TAMRA 3′ (SEQ ID NO: 126) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.

Example 11

Additional Human p38α Oligonucleotide Sequences

Additional antisense oligonucleotides were designed to target human p38α using published sequence (Genbank accession number NM _—001315.1, provided herein as SEQ ID NO: 127). Oligonucleotides were synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings. ” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. Internucleoside linkages are phosphorothioate (P═S). These oligonucleotide sequences are shown in Table 21. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds. The compounds can be analyzed for their effect on human p38α mRNA levels by quantitative real-time PCR as described in other examples herein.

TABLE 21


Additional chimeric phosphorothioate antisense
oligonucleotides targeted to human p38α

		Target
		Sequence	Target		SEQ
ISIS #	Region	Accession #	Site	SEQUENCE	ID NO:

186877	coding	NM_001315.1	1271	GAGCAAAGTAGGCATGTGCA	128

186878	3′ UTR	NM_001315.1	2703	GTTTCCGAAGTTTGGGATAT	129

186879	3′ UTR	NM_001315.1	2735	GCATTAGTTATTGGGAGTGA	130

186880	3′ UTR	NM_001315.1	1671	CCCTGGAGCATCCACAACCT	131

186881	coding	NM_001315.1	1021	TGTACCAGGAAACAATGTTC	132

186882	5′ UTR	NM_001315.1	326	CGGGCAAGAAGGTGGCCCTG	133

186883	3′ UTR	NM_001315.1	3296	ATCGCCATCAGTCTGCCTCC	134

186884	3′ UTR	NM_001315.1	2312	TGACATCAAGAACCTGCTTC	135

186885	3′ UTR	NM_001315.1	2134	GGCCCACAAGCAGCTGTCCA	136

186886	3′ UTR	NM_001315.1	3063	TGAAAACGACACTTCTCCAC	137

186887	3′ UTR	NM_001315.1	3307	GGTGAGAGGGAATCGCCATC	138

186888	3′ UTR	NM_001315.1	2007	ATACTGTCAAGATCTGAGAA	139

186889	3′ UTR	NM_001315.1	2702	TTTCCGAAGTTTGGGATATT	140

186890	3′ UTR	NM_001315.1	2205	AGAGAGACGCACATATACGC	141

186891	3′ UTR	NM_001315.1	1516	CAACAGGCACTTGAATAATA	142

186892	coding	NM_001315.1	638	ATTCCTCCAGAGACCTTGCA	143

186893	3′ UTR	NM_001315.1	2848	AAGACACCTTGTTACTTTTT	144

186894	3′ UTR	NM_001315.1	2989	TGCCCTTTCTCCCCATCAAA	145

186895	coding	NM_001315.1	1096	TGGCATCCTGTTAATGAGAT	146

186896	3′ UTR	NM_001315.1	1477	AAGGCCTTCCCCTCACAGTG	147

186897	3′ UTR	NM_001315.1	3728	AATAGGCTTTATTTTAACCA	148

186898	3′ UTR	NM_001315.1	2455	ACCCAAGAAGTCTTCACTGG	149

186899	3′ UTR	NM_001315.1	3135	TTTCTTATTACACAAAAGGC	150

186900	3′ UTR	NM_001315.1	3445	GGAAATCACACGAGCATTTA	151

186901	coding	NM_001315.1	794	GGTCCCTGTGAATTATGTCA	152

186902	3′ UTR	NM_001315.1	3112	AATATATGAGTCCTCATGTA	153

186903	3′ UTR	NM_001315.1	3511	CTAACACGTATGTGGTCACA	154

186904	3′ UTR	NM_001315.1	2984	TTTCTCCCCATCAAAAGGAA	155

186905	coding	NM_001315.1	727	CTGAACATGGTCATCTGTAA	156

186906	3′ UTR	NM_001315.1	3681	ATAACTGATTACAGCCAAGT	157

186907	3′ UTR	NM_001315.1	2959	TTCTCAAAGGGATTCCTACA	158

186908	coding	NM_001315.1	678	TCTGCCCCCATGAGATGGGT	159

186909	coding	NM_001315.1	540	TTCGCATGAATGATGGACTG	160

186910	coding	NM_001315.1	1275	TACTGAGCAAAGTAGGCATG	161

186911	coding	NM_001315.1	1336	GTCCCTGCTTTCAAAGGACT	162

186912	coding	NM_001315.1	577	CATATGTTTAAGTAACCGCA	163

186913	3′ UTR	NM_001315.1	2963	CACATTCTCAAAGGGATTCC	164

Additional antisense oligonucleotides were designed to target human p38α using published sequence (Genbank accession number NM[0297] _—001315.1, provided herein as SEQ ID NO: 127. Oligonucleotides were synthesized as oligonucleotides comprised of 2′-deoxynucleotides and phosphodiester internucleoside linkages (P═O). These oligonucleotide sequences are shown in Table 22. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

TABLE 22

Additional phosphodiester oligonucleotides

targeted to p38α

Target SEQ

ISIS Sequence Target ID

# Region Accession Site SEQUENCE NO

169107 coding NM_001315.1 1420 GGACTCCATCTCTTCTTGGTCAA 165

336747 3′ UTR NM_001315.1 1454 GAAGTGGGATCAACAGAACAGAAA 166

336750 coding NM_001315.1 436 AGCCCACTGGAGACAGGTTCT 167

Example 12

Mouse and Rat p38α Antisense Oligonucleotides

Antisense oligonucleotides were designed to target mouse p38α using published sequences (Genbank accession number U10871.1, provided herein as SEQ ID NO: 114, GenBank accession number D83073.1, provided herein as SEQ ID NO: 168, GenBank accession number AA002328.1, provided herein as SEQ ID NO: 169, GenBank accession number AF128892.1, provided herein as SEQ ID NO: 170, GenBank accession number BY159314.1, provided herein as SEQ ID NO: 171 and Genbank accession number BY257628.1, provided herein as SEQ ID NO: 172). These compounds are shown in the tables included in this example. [0298]
Antisense oligonucleotides were also designed to target rat p38α using published sequences (GenBank accession number U73142, provided herein as SEQ ID NO: 45, and Genbank accession number U91847.1, provided herein as SEQ ID NO: 173). These compounds are shown in the tables in this example. [0299]
Oligonucleotides were synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. Internucleoside linkages are phosphorothioate (P═S). In Table 23, “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds. [0300]
The compounds in Table 23 were analyzed for their effect on mouse p38α mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from two experiments in which bEND.3 cells were treated with the antisense oligonucleotides of the present invention and are presented in the column labeled “% inhib, mouse p38α”. If present, “N.D.” indicates “no data”. ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 174) was used as a scrambled control oligonucleotide. [0301]
The compounds in Table 23 were also analyzed for their effect on rat p38α mRNA levels in NR-8383 cells by quantitative real-time PCR as described in other examples herein. The rat normal lung alveolar macrophage cell line NR-8383 was obtained from the American Type Culture Collection (Manassas, Va.). NR-8383 cells were routinely cultured in Ham's F12 medium (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal bovine serum (Gibco/Life Technologies, Gaithersburg, Md.), and 1% Penicillin/Streptomycin (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. For transfection with oligonucleotides, NR-8383 cells were plated on 24 well plates at a density of 4×10[0302] ⁴cells/cm2 (8.0×10⁴cells/well) in serum-free F12 Nutrient Medium (Gibco/Life Technologies, Gaithersburg, Md.). After 2 hours, media was removed and replaced with 400 ul of Ham's F12 Nutrient Medium supplemented with 15% fetal bovine serum and 1% Penicillin/Streptomyocin. Cells were then transfected with 300 nM of antisense oligonucleotides mixed with FuGENE 6
Transfection Reagent (Roche Applied Science, Indianapolis, Ind.) for 24 hours, after which mRNA was quantitated as described in other examples herein. Data are averages from two experiments in which NR-8383 cells were treated with the antisense oligonucleotides of the present invention and are presented in the column labeled “% inhib, rat p38α”. If present, “N.D.” indicates “no data”. ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 174) was used as a scrambled control oligonucleotide. [0303]
One additional compound, ISIS 186911 (SEQ ID NO: 143), targeted to human p38α, was also tested for its effect on mouse and rat p38α mRNA expression in bEND.3 cells and NR-8383 cells, respectively. [0304]

An asterisk (*) adjacent to the ISIS oligonucleotide number in Table 23 indicates that the oligonucleotide targets human, mouse and rat p38αsequences. Compounds in Table 23, with the exception of ISIS 101753, ISIS 320119, ISIS 320120 and 320121 target both mouse and rat p38α.

TABLE 23


Inhibition of mouse and rat p38α by chimeric phosphorothioate
oligonucleotides having 2′-MOE wings and a deoxy gap

		Target			% Inhib.	% Inhib.
		Sequence	Target		mouse	rat	Seq
ISIS #	Region	Accession #	Site	Sequence	p38α	p38α	ID NO

100864*	coding	L35253	538	TCCAACAGACCAATCACATT	83	57	82

101753	start	U73142	1	CTGCGACATTTTCCAGCGGC	64	43	175
	codon

101755*	coding	U10871.1	1226	CATCATCAGGGTCGTGGTAC	84	74	176

101757*	coding	U10871.1	1336	AGGTGCTCAGGACTCCATTT	88	53	177

186911*	coding	NM 001315.1	1336	GTCCCTGCTTTCAAAGGACT	81	40	178

306022*	coding	U73142	781	GGCCAGAGACTGAATGTAGT	78	53	179

320103*	coding	U10871.1	315	AGCTCCTGCCGGTAGAACGT	81	55	180

320104*	coding	U10871.1	405	TCAAAAGCAGCACACACCGA	82	42	181

320105*	coding	U10871.1	417	CCCGTCTTTGTATCAAAAGC	89	59	182

320106*	coding	U10871.1	453	AACGGTCTCGACAGCTTCTT	91	67	183

320107*	coding	U10871.1	483	TAGGTCCTTTTGGCGTGAAT	84	60	184

320108*	coding	U10871.1	600	AGATGGGTCACCAGGTACAC	61	57	185

320109*	coding	U10871.1	609	GCCCCCATGAGATGGGTCAC	69	34	186

320110*	coding	U10871.1	807	TCATCAGTGTGCCGAGCCAG	87	54	187

320111*	coding	U10871.1	930	GTCAACAGCTCAGCCATGAT	86	55	188

320112*	coding	U10871.1	940	CGTTCTTCCGGTCAACAGCT	93	58	189

320113*	coding	U10871.1	967	ATCAATATGGTCTGTACCAG	35	9	190

320114*	coding	U10871.1	987	CTTAAAATGAGCTTCAACTG	71	60	191

320115*	coding	U10871.1	1001	GGGTTCCAACGAGTCTTAAA	67	53	192

320116*	coding	U10871.1	1019	TCAGAAGCTCAGCCCCTGGG	95	73	193

320117*	coding	U10871.1	1030	GGAGATTTTCTTCAGAAGCT	72	55	194

320118*	coding	U10871.1	1040	CAGACTCTGAGGAGATTTTC	47	69	195

320119	coding	U10871.1	1050	TAGTTTCTTGCAGACTCTGA	53	32	196

320120	coding	U10871.1	1060	AGACTGAATGTAGTTTCTTG	74	39	197

320121	coding	U10871.1	1083	TTCATCTTCGGCATCTGGGC	83	57	198

320122	coding	U10871.1	1093	ATTTGCGAAGTTCATCTTCG	73	48	199

320123	coding	U10871.1	1103	CAATAAATACATTTGCGAAG	79	32	200

320124	coding	U10871.1	1113	GGATTGGCACCAATAAATAC	29	31	201

320125	coding	U10871.1	1176	GCTGCTGTGATCCTCTTATC	67	63	202

320126	coding	U10871.1	1196	AGGCATGCGCAAGAGCTTGG	90	69	203

320127	coding	U10871.1	1206	TGAGCAAAGTAGGCATGCGC	73	56	204

320128	coding	U10871.1	1260	TCAAAGGACTGGTCATAAGG	79	37	205

320129	coding	U10871.1	1351	CATTTCTTCTTGGTCAAGGG	69	65	206

320130	stop	U10871.1	1358	AGGACTCCATTTCTTCTTGG	81	61	207
	codon

320131	3′ UTR	U10871.1	1406	CTTCCCCTCACAGTGAAGTG	92	39	208

320132	3′ UTR	U10871.1	1432	TATTTGGAGAGTTCCCATGA	85	56	209

320133	3′ UTR	U10871.1	1442	ACTTGAATGGTATTTGGAGA	52	61	210

320134	3′ UTR	U10871.1	1452	AACAAGAGGCACTTGAATGG	85	74	211

320135	3′ UTR	U10871.1	1480	ACCCCCTTCCACCATGAAGG	95	47	212

320136	3′ UTR	U10871.1	1608	AGCAGGCAGACTGCCAAGGA	83	34	213

320137	3′ UTR	U10871.1	1663	CACACACATCCCTAAGGAGA	80	44	214

320138	3′ UTR	U10871.1	1745	TAAAGGCAGGGCCACAGGAG	87	46	215

320139	3′ UTR	U10871.1	1771	GCAGCCTCTCTCTGTCACTG	87	61	216

320140	3′ UTR	U10871.1	1791	GGGATAGCCTCAGACCTGAA	61	37	217

320141	3′ UTR	U10871.1	1801	GCATGGCTGAGGGATAGCCT	83	73	218

320142	3′ UTR	U10871.1	1828	GAGCCAGTTGGTTCTCTTGG	85	53	219

320143	3′ UTR	U10871.1	1910	AGGCACAAACAGACTGACAG	88	54	220

320144	3′ UTR	U10871.1	1917	CCTTTTAAGGCACAAACAGA	83	39	221

320145	3′ UTR	U10871.1	2138	GACCTCTGCACTGAGGTGAA	52	44	222

320146	3′ UTR	U10871.1	2147	GGCACTGGAGACCTCTGCAC	74	57	223

320147	3′ UTR	U10871.1	2228	AGAGCACAGCATGCAAACAC	66	43	224

320148	3′ UTR	U10871.1	2259	CCAGGGCTTCCAGAAGACAG	78	33	225

320149	3′ UTR	U10871.1	2576	AAGGAGCTCCTGGCTTCAGG	74	25	226

320150	3′ UTR	U10871.1	2738	GGATTCCTACAACATACAAA	82	62	227

320151	3′ UTR	U10871.1	2758	GAAGGAACCACACTCTCTAA	90	47	228

320152	3′ UTR	U10871.1	2778	TTTGCCCTTTCTCCCCATCA	93	66	229

320153	3′ UTR	U10871.1	2791	AATATTAAAATAATTTGCCC	0	22	230

320154	3′ UTR	U10871.1	2817	TCATGTTTATAAAGGTGAAA	52	50	231

320155	3′ UTR	U10871.1	2827	CCCTGAGGATTCATGTTTAT	93	73	232

320156	3′ UTR	U10871.1	2930	GGAATTGGCTTTACACTTTC	91	64	233

320157	3′ UTR	U10871.1	2941	CGTCCAACACTGGAATTGGC	96	71	234

320158	3′ UTR	U10871.1	3042	CCTTCTGGGCTCCAAATGAT	91	71	235

320159	3′ UTR	U10871.1	3386	TCTGACATCCTATGGCATAC	94	69	236

320160	coding	D83073.1	900	GTTAATATGGTCTGTACCAG	53	43	237

320161	coding	D83073.1	910	GCTGAAGCTGGTTAATATGG	80	66	238

320162	coding	D83073.1	920	CGCATTATCTGCTGAAGCTG	92	62	239

320163	coding	D83073.1	955	TGTTAATGAGATAAGCAGGG	0	40	240

320164	coding	D83073.1	965	CTTGGCATCCTGTTAATGAG	80	73	241

320165	coding	D83073.1	975	TGCCTCATGGCTTGGCATCC	81	53	242

320166	coding	D83073.1	991	ACTGAATGTAGTTTCTTGCC	53	35	243

320167	5′ UTR	AA002328.1	155	CTTGCCTGTAAAAACACAGA	7	11	244

320168	stop	AF128892.1	1059	TCACCTCATGGCTTGGCATC	83	56	245
	codon

320169	stop	AF128892.1	1066	TTTGTTCTCACCTCATGGCT	92	64	246
	codon

320170	3′ UTR	AF128892.1	1132	TGCTGGCTATACACAGACAC	83	55	247

320171	intron	BY159314.1	58	TGGAAAACTGTTTTGTCAAA	35	2	248

320172	intron	3Y257628.1	39	ACTCTCGCGAGAACAGCTCC	39	0	249

320173	intron	BY257628.1	72	TCCCACAGGCAGCGGCCGGG	160	250

320174	intron	BY257628.1	97	CCCGCTTGGGCTCCAGTGGC	62	29	251

Additional antisense oligonucleotides were designed to target mouse p38α using published sequences (Genbank accession number U10871.1, provided herein as SEQ ID NO: 114). Oligonucleotides are composed of 2′-deoxynucleotides. Internucleoside linkages are phosphorodiester (P═O). These oligonucleotide sequences are shown in Table 24. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

TABLE 24


Antisense oligonucleotides targeted to mouse
p38α having 2′-deoxynucleotides and
phosphodiester linkages

		Target
		Sequence	Start		SEQ
ISIS #	Region	Accession #	Site	SEQUENCE	ID NO

137934	3′ UTR	U10871.1	3331	GCAGTTTTCTCGTTCC	252
				CTTG

264006	coding	U10871.1	1207	CTGAGCAAAGTAGGCA	253
				TGCG

320184	3′ UTR	U10871.1	2306	GGAGGCAATGTGGACA	254
				GGAA

279221	coding	U10871.1	521	CATTTTCGTGTTTCAT	255
				GTGCTTC

326403	3′ UTR	U10871.1	3395	TATTTTAACCAGTGGT	256
				ATTATCTACATCCT

Additional antisense oligonucleotides were designed to target mouse p38α using published sequences (Genbank accession number U10871.1, provided herein as SEQ ID NO: 114). Oligonucleotides were synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. Internucleoside linkages in the central gap region are phosphorothioate (P═S), and internucleoside linkages in the wings are phosphodiester (P═O). These oligonucleotide sequences are shown in Table 25. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

TABLE 25


Chimeric oligonucleotides targeted to mouse
p38a having 2′-MOE wings and a deoxy gap
and mixed phophorothioate and phosphodiester
internucleoside linkages

		Target
		Sequence			SEQ
ISIS		Accession	Start		ID
#	Region	#	Site	SEQUENCE	NO

101369	codon	U10871.1	286	CTGCGACATCTTCCAGCG	257
				GC

101370	coding	U10871.1	646	GGTCAGCTTCTGGCACTT	258
				CA

101372	3′ UTR	U10871.1	1609	AAGCAGGCAGACTGCCAA	259
				GG

Additional antisense oligonucleotides were designed to target rat p38α using published sequences (GenBank accession number U73142, provided herein as SEQ ID NO: 45, and GenBank accession number U91847.1, provided herein as SEQ ID NO: 173). Oligonucleotides are composed of 2′-deoxynucleotides. Internucleoside linkages are phosphorodiester (P═O). These oligonucleotide sequences are shown in Table 26. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

TABLE 26


Antisense oligonucleotides targeted to rat p38α
having 2′-deoxynucleotides and phosphodiester
linkages

		Target
		Sequence			SEQ
ISIS		Accession	Start		ID
#	Region	#	Site	SEQUENCE	NO

336744	coding	U91847.1	902	AGGCATGCGCAAGAGCTT	260

336741	coding	U91847.1	66	GGGACAGGTTCTGGTATC	261
				GC

257014	coding	U91847.1	224	TCTCGTGCTTCATGTGCT	262
				TCA

320187	3′ UTR	U73142	2800	TGGAGCTGGACTGCATAC	263
				TGA

Additional antisense oligonucleotides were designed to target rat p38α using published sequences (GenBank accession number U73142, provided herein as SEQ ID NO: 45). Oligonucleotides were synthesized as chimeric oligonucleotides, composed 2′-deoxynucleotides and 2′-methoxyethyl (2′-MOE) nucleotides (indicated in bold type in Table 27). Internucleoside linkages in the central gap region are phosphorothioate (P═S), and internucleoside linkages in the wings are phosphodiester (P═O). These oligonucleotide sequences are shown in Table 27. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

TABLE 27


Chimeric oligonucleotides targeted to rat p38α
having 2′-MOE wings and a deoxy gap and mixed
phophorothioate and phosphodiester
internucleoside linkages

		Target
		Sequence			SEQ
ISIS		Accession	Start		ID
#	Region	#	Site	SEQUENCE	NO

111831	coding	U73142	941	CATCAGGGTCGTGGTAC	264

111830	coding	U73142	942	CATCATCAGGGTCGT	265

Example 13

Mouse model of allergic inflammation

In the mouse model of allergic inflammation, mice were sensitized and challenged with aerosolized chicken ovalbumin (OVA). Airway responsiveness was assessed by inducing airflow obstruction with a methacholine aerosol using a noninvasive method. This methodology utilized unrestrained conscious mice that are placed into the main chamber of a plthysmograph (Buxco Electronics, Inc., Troy, N.Y.). Pressure differences between this chamber and a reference chamber were used to extrapolate minute volume, breathing frequency and enhanced pause (Penh). Penh is a dimensionless parameter that is a function of total pulmonary airflow in mice (i.e., the sum of the airflow in the upper and lower respiratory tracts) during the respiratory cycle of the animal. The lower the Penh, the greater the airflow. This parameter closely correlates with lung resistance as measured by traditional invasive techniques using ventilated animals (Hamelmann et al., 1997). Dose-response data were plotted as raw Penh values to increasing concentrations of methacholine. This system was used to test the efficacy of an antisense oligonucleotide targeted to mouse p38α (ISIS 101757; SEQ ID NO: 177). Mismatched p38α oligonucleotide (ISIS 101758; SEQ ID NO: 266) was used as a negative control. [0310]
There are several important features common to human asthma and the mouse model of allergic inflammation. One of these is pulmonary inflammation, in which cytokine expression and Th2 profile is dominant. Another is goblet cell hyperplasia with increased mucus production. Lastly, airway hyperresponsiveness (AHR) occurs resulting in increased sensitivity to cholinergic receptor agonists such as acetylcholine or methacholine. The compositions and methods of the present invention may be used to treat AHR and pulmonary inflammation. The combined use of antisense oligonucleotides targeted to human p38 MAP kinase with one or more conventional asthma medications including, but not limited to, montelukast sodium (Singulair™), albuterol, beclomethasone dipropionate, triamcinolone acetonide, ipratropium bromide (Atrovent™), flunisolide, fluticasone propionate (Flovent™) and other steroids is also contemplated. [0311]
Ovalbumin-Induced Allergic Inflammation [0312]
For intratracheal administration of ISIS 101757, female Balb/c mice (Charles Rivers Laboratory, Taconic Farms, N.Y.) were maintained in micro-isolator cages housed in a specific pathogen-free (SPF) facility. The sentinel cages within the animal colony surveyed negative for viral antibodies and the presence of known mouse pathogens. Mice were sensitized and challenged with aerosolized chicken OVA. Briefly, 20 μm alum-precipitated OVA was injected intraperitoneally on [0313] days 0 and 14. On day 24, 25 and 26, the animals were exposed for 20 minutes to 1.0% OVA (in saline) by nebulization. The challenge was conducted using an ultrasonic nebulizer (PulmoSonic, The DeVilbiss Co., Somerset, Pa.). Animals were analyzed about 24 hours following the last nebulization using the Buxco electronics Biosystem. Lung function (Penh), lung histology (cell infiltration and mucus production), target mRNA reduction in the lung, inflammation (BAL cell type & number, cytokine levels), spleen weight and serum AST/ALT were determined.
For the aerosol studies, the protocol described above was slightly modified. Male Balb/c mice were injected IP with OVA (20 μg) in aluminum hydroxide on [0314] days 0 and 14. Aerosol dosing was performed with nebulized sterile saline, antisense oligonucleotide or mismatched control oligonucleotide using 25, 125 and 250 μg/ml solutions (5 mg/kg) for 30 min. on days 14-20 in a closed chamber. Aerosol lung challenge was carried out with nebulized saline or 1% OVA for 20 min. on days 18, 19 and 20. BAL fluid was collected at 24 hr post-last lung challenge (cell differentials) or at 2-12 h post-challenge (cytokine analysis). AHR was measured 24 hours after OVA challenge. Mice were exposed to aerosolized methacholine 24 hr post-last lung challenge from 2-80 mg/ml for 3 min. until a 200% increase in Penh was achieved.
Intratracheal Oligonucleotide Administration [0315]
Antisense oligonucleotides (ASOs) were dissolved in saline and used to intratracheally dose mice every day, four times per day, from days 15-26 of the OVA sensitization and challenge protocol, or used as an aerosol. Specifically, the mice were anesthetized with isofluorane and placed on a board with the front teeth hung from a line. The nose was covered and the animal's tongue was extended with forceps and 25 μl of various doses of ASO, or an equivalent volume of saline (control) was placed at the back of the tongue until inhaled into the lung. [0316]
Mouse antisense oligonucleotides to p38α are phosphorothioates with 2′-MOE modifications on nucleotides 1-5 and 16-20, and 2′-deoxy at positions 6-15. These ASOs were identified by mouse-targeted ASO screening of 10 p38α antisense oligonucleotides by target p38α mRNA reduction in mouse bEND.3 cells, as described in Example 12. Dose-response confirmation led to selection of ISIS 21873 (>70% reduction at 50 nM). ISIS 101757 contains all phosphorothioate linkages, whereas ISIS 21873 is a mixed phosphodiester/phosphorothioate compound. ISIS 101757 had an IC50<50 nM for reducing p38α mRNA in endothelial cells, and an IC50 of about 250 nM in fibroblasts. [0317]
Results of Aerosol Administration [0318]
The p38α knock-down effect of ISIS 101757 was confirmed in a mouse T cell line (EL4) and a mouse macrophage cell line (RAW264.7) using Western blotting. ISIS 101757, but not the mismatched control, dose-dependently suppressed methacholine-induced AHR in sensitized mice measured by whole body plethysmography (FIG. 1A-1B). The PC200 values for methacholine (FIG. 2) significantly (P<0.05) reduced OVA-induced increases in total cell counts and eosinophils recovered in BAL fluid (FIG. 3). In addition, histological studies revealed that ISIS 101757 markedly inhibited OVA-induced inflammatory cell infiltration into the lungs (H&E stain) and mucus hypersecretion in the airway epithelium (PAS stain). ISIS 101757 also significantly (P<0.05);lowered blood levels of total IgE, OVA-specific IgE and OVA-specific IgG[0319] ₁in sensitized mice as compared to the mismatched control. Oligonucleotide levels of up to 1 μg/g of lung tissue were sufficient to achieve the pharmacological effects described above. The aerosolized ISIS 101757 concentration in mouse lung vs. dose is shown in FIG. 4. There was no significant effect of aerosol oligonucleotide administration of spleen weight. These data indicate that p38α antisense oligonucleotides are useful for the treatment of asthma.
Intratracheal Administration Results [0320]
After intratracheal administration of ISIS 101757 as described above, dose-dependent inhibition of the Penh response to methacholine (50 mg/ml) challenge was observed (FIG. 5). The oligonucleotide concentration (μg/g) in lungs vs. dose is shown in FIG. 6. [0321]
RT-PCR Analysis [0322]
RNA was harvested from experimental lungs removed on day 28 of the OVA protocol. P38α levels were measured by quantitative RT-PCR as described in other examples herein. [0323]
Collection of Bronchial Alveolar Lavage (BAL) Fluid and Blood Serum for the Determination of Cytokine and Chemokine Levels [0324]
Animals were injected with a lethal dose of ketamine, the trachea was exposed and a cannula was inserted and secured by sutures. The lungs were lavaged twice with 0.5 ml aliquots of ice cold PBS with 0.2% FCS. The recovered BAL fluid was centrifuged at 1,000 rpm for 10 min at 4° C., frozen on dry ice and stored at −80° C. until used. Luminex was used to measure cytokine levels in BAL fluid and serum. [0325]
BAL Cell Counts and Differentials [0326]
Cytospins of cells recovered from BAL fluid were prepared using a Shandon Cytospin 3 (Shandon Scientific LTD, Cheshire, England). Cell differentials were performed from slides stained with Leukostat (Fisher Scientific, Pittsburgh, Pa.). Total cell counts were quantified by hemocytometer and, together with the percent type by differential, were used to calculate specific cell number. [0327]
Tissue Histology [0328]
Before resection, lungs were inflated with 0.5 ml of 10% phosphate-buffered formalin and fixed overnight at 4° C. The lung samples were washed free of formalin with 1×PBS and subsequently dehydrated through an ethanol series prior to equilibration in xylene and embedded in paraffin. Sections (6μ) were mounted on slides and stained with hematoxylin/eosin, massons trichome and periodic acid-schiff (PAS) reagent. Parasagittal sections were analyzed by bright-field microscopy. Mucus cell content was assessed as the airway epithelium staining with PAS. Relative comparisons of mucus content were made between cohorts of animals by counting the number of PAS-positive airways. [0329]

Example 14

Design and Screening of Duplexed Antisense Compounds Targeting p38α MAP Kinase

In accordance with the present invention, a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target p38α MAP kinase. The nucleobase sequence of the antisense strand of the duplex comprises at least a portion of an oligonucleotide to p38α MAP kinase as described herein. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini. For example, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG and having a two-nucleobase overhang of deoxythymidine(dT) would have the following structure: [0330]

cgagaggcggacgggaccgTT Antisense Strand

|||||||||||||||||||

TTgctctccgcctgccctggc Complement
RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, Colo.). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15 uL of a 5×solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90° C. and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37° C. at which time the dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplex is 20 uM. This solution can be stored frozen (−20° C.) and freeze-thawed up to 5 times. [0331]
Once prepared, the duplexed antisense compounds are evaluated for their ability to modulate p38α MAP kinase expression according to the protocols described herein. [0332]

Example 15

Design of Phenotypic Assays and In Vivo Studies for the Use of p38α MAP Kinase Inhibitors

Phenotypic Assays [0333]
Once p38α MAP kinase inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of p38α MAP kinase in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.). [0334]
In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with p38α MAP kinase inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints. [0335]
Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest. [0336]
Analysis of the genotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the p38α MAP kinase inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells. [0337]

0

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 266

<210> SEQ ID NO 1

<211> LENGTH: 1539

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<220> FEATURE:

<221> NAME/KEY: CDS

<222> LOCATION: (295)..(1377)

<300> PUBLICATION INFORMATION:

<303> JOURNAL: Science

<304> VOLUME: 265

<305> ISSUE: 5173

<306> PAGES: 808-811

<307> DATE: 1994-08-05

<308> DATABASE ACCESSION NUMBER: L35253

<309> DATABASE ENTRY DATE: 1995-08-14

<400> SEQUENCE: 1

ggaattccgg gcccggtctt tcctcccgcc gccgccggcc tggtcccggg gactggcctc 60

cacgtccgac tcgtccgagc tgaagcccag cagcactttg ctgccagccg cgggggcggc 120

ggaggcgccc ccgggccctc ccaggaggct ctctgggcca gaggccgaga ttcggcacag 180

gcccccagga gtccgtaagt aggagaggtc gcccgagacc ggccggaccc ccatccccgc 240

ggccgccgcc gccgctggtc ccgcggctgc gaccgtggcg gctgccgctg gaaa atg 297

Met

1

tct cag gag agg ccc acg ttc tac cgg cag gag ctg aac aag aca atc 345

Ser Gln Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu Asn Lys Thr Ile

5 10 15

tgg gag gtg ccc gag cgt tac cag aac ctg tct cca gtg ggc tct ggc 393

Trp Glu Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro Val Gly Ser Gly

20 25 30

gcc tat ggc tct gtg tgt gct gct ttt gac aca aaa acg ggg tta cgt 441

Ala Tyr Gly Ser Val Cys Ala Ala Phe Asp Thr Lys Thr Gly Leu Arg

35 40 45

gtg gca gtg aag aag ctc tcc aga cca ttt cag tcc atc att cat gcg 489

Val Ala Val Lys Lys Leu Ser Arg Pro Phe Gln Ser Ile Ile His Ala

50 55 60 65

aaa aga acc tac aga gaa ctg cgg tta ctt aaa cat atg aaa cat gaa 537

Lys Arg Thr Tyr Arg Glu Leu Arg Leu Leu Lys His Met Lys His Glu

70 75 80

aat gtg att ggt ctg ttg gac gtt ttt aca cct gca agg tct ctg gag 585

Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Arg Ser Leu Glu

85 90 95

gaa ttc aat gat gtg tat ctg gtg acc cat ctc atg ggg gca gat ctg 633

Glu Phe Asn Asp Val Tyr Leu Val Thr His Leu Met Gly Ala Asp Leu

100 105 110

aac aac att gtg aaa tgt cag aag ctt aca gat gac cat gtt cag ttc 681

Asn Asn Ile Val Lys Cys Gln Lys Leu Thr Asp Asp His Val Gln Phe

115 120 125

ctt atc tac caa att ctc cga ggt cta aag tat ata cat tca gct gac 729

Leu Ile Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile His Ser Ala Asp

130 135 140 145

ata att cac agg gac cta aaa cct agt aat cta gct gtg aat gaa gac 777

Ile Ile His Arg Asp Leu Lys Pro Ser Asn Leu Ala Val Asn Glu Asp

150 155 160

tgt gag ctg aag att ctg gat ttt gga ctg gct cgg cac aca gat gat 825

Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg His Thr Asp Asp

165 170 175

gaa atg aca ggc tac gtg gcc act agg tgg tac agg gct cct gag atc 873

Glu Met Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro Glu Ile

180 185 190

atg ctg aac tgg atg cat tac aac cag aca gtt gat att tgg tca gtg 921

Met Leu Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp Ser Val

195 200 205

gga tgc ata atg gcc gag ctg ttg act gga aga aca ttg ttt cct ggt 969

Gly Cys Ile Met Ala Glu Leu Leu Thr Gly Arg Thr Leu Phe Pro Gly

210 215 220 225

aca gac cat att gat cag ttg aag ctc att tta aga ctc gtt gga acc 1017

Thr Asp His Ile Asp Gln Leu Lys Leu Ile Leu Arg Leu Val Gly Thr

230 235 240

cca ggg gct gag ctt ttg aag aaa atc tcc tca gag tct gca aga aac 1065

Pro Gly Ala Glu Leu Leu Lys Lys Ile Ser Ser Glu Ser Ala Arg Asn

245 250 255

tat att cag tct ttg act cag atg ccg aag atg aac ttt gcg aat gta 1113

Tyr Ile Gln Ser Leu Thr Gln Met Pro Lys Met Asn Phe Ala Asn Val

260 265 270

ttt att ggt gcc aat ccc ctg gct gtc gac ttg ctg gag aag atg ctt 1161

Phe Ile Gly Ala Asn Pro Leu Ala Val Asp Leu Leu Glu Lys Met Leu

275 280 285

gta ttg gac tca gat aag aga att aca gcg gcc caa gcc ctt gca cat 1209

Val Leu Asp Ser Asp Lys Arg Ile Thr Ala Ala Gln Ala Leu Ala His

290 295 300 305

gcc tac ttt gct cag tac cac gat cct gat gat gaa cca gtg gcc gat 1257

Ala Tyr Phe Ala Gln Tyr His Asp Pro Asp Asp Glu Pro Val Ala Asp

310 315 320

cct tat gat cag tcc ttt gaa agc agg gac ctc ctt ata gat gag tgg 1305

Pro Tyr Asp Gln Ser Phe Glu Ser Arg Asp Leu Leu Ile Asp Glu Trp

325 330 335

aaa agc ctg acc tat gat gaa gtc atc agc ttt gtg cca cca ccc ctt 1353

Lys Ser Leu Thr Tyr Asp Glu Val Ile Ser Phe Val Pro Pro Pro Leu

340 345 350

gac caa gaa gag atg gag tcc tga gcacctggtt tctgttctgt tgatcccact 1407

Asp Gln Glu Glu Met Glu Ser

355 360

tcactgtgag gggaaggcct tttcacggga actctccaaa tattattcaa gtgcctcttg 1467

ttgcagagat ttcctccatg gtggaagggg gtgtgcgtgc gtgtgcgtgc gtgttagtgt 1527

gtgtgcatgt gt 1539

<210> SEQ ID NO 2

<211> LENGTH: 360

<212> TYPE: PRT

<213> ORGANISM: Homo sapiens

<400> SEQUENCE: 2

Met Ser Gln Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu Asn Lys Thr

1 5 10 15

Ile Trp Glu Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro Val Gly Ser

20 25 30

Gly Ala Tyr Gly Ser Val Cys Ala Ala Phe Asp Thr Lys Thr Gly Leu

35 40 45

Arg Val Ala Val Lys Lys Leu Ser Arg Pro Phe Gln Ser Ile Ile His

50 55 60

Ala Lys Arg Thr Tyr Arg Glu Leu Arg Leu Leu Lys His Met Lys His

65 70 75 80

Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Arg Ser Leu

85 90 95

Glu Glu Phe Asn Asp Val Tyr Leu Val Thr His Leu Met Gly Ala Asp

100 105 110

Leu Asn Asn Ile Val Lys Cys Gln Lys Leu Thr Asp Asp His Val Gln

115 120 125

Phe Leu Ile Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile His Ser Ala

130 135 140

Asp Ile Ile His Arg Asp Leu Lys Pro Ser Asn Leu Ala Val Asn Glu

145 150 155 160

Asp Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg His Thr Asp

165 170 175

Asp Glu Met Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro Glu

180 185 190

Ile Met Leu Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp Ser

195 200 205

Val Gly Cys Ile Met Ala Glu Leu Leu Thr Gly Arg Thr Leu Phe Pro

210 215 220

Gly Thr Asp His Ile Asp Gln Leu Lys Leu Ile Leu Arg Leu Val Gly

225 230 235 240

Thr Pro Gly Ala Glu Leu Leu Lys Lys Ile Ser Ser Glu Ser Ala Arg

245 250 255

Asn Tyr Ile Gln Ser Leu Thr Gln Met Pro Lys Met Asn Phe Ala Asn

260 265 270

Val Phe Ile Gly Ala Asn Pro Leu Ala Val Asp Leu Leu Glu Lys Met

275 280 285

Leu Val Leu Asp Ser Asp Lys Arg Ile Thr Ala Ala Gln Ala Leu Ala

290 295 300

His Ala Tyr Phe Ala Gln Tyr His Asp Pro Asp Asp Glu Pro Val Ala

305 310 315 320

Asp Pro Tyr Asp Gln Ser Phe Glu Ser Arg Asp Leu Leu Ile Asp Glu

325 330 335

Trp Lys Ser Leu Thr Tyr Asp Glu Val Ile Ser Phe Val Pro Pro Pro

340 345 350

Leu Asp Gln Glu Glu Met Glu Ser

355 360

<210> SEQ ID NO 3

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 3

aagaccgggc ccggaattcc 20

<210> SEQ ID NO 4

<211> LENGTH: 30

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 4

gtggaggcca gtccccggga ccggaattcc 30

<210> SEQ ID NO 5

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 5

tggcagcaaa gtgctgctgg 20

<210> SEQ ID NO 6

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 6

cagagagcct cctgggaggg 20

<210> SEQ ID NO 7

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 7

tgtgccgaat ctcggcctct 20

<210> SEQ ID NO 8

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 8

ggtctcgggc gacctctcct 20

<210> SEQ ID NO 9

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 9

cagccgcggg accagcggcg 20

<210> SEQ ID NO 10

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 10

cattttccag cggcagccgc 20

<210> SEQ ID NO 11

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 11

tcctgagaca ttttccagcg 20

<210> SEQ ID NO 12

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 12

ctgccggtag aacgtgggcc 20

<210> SEQ ID NO 13

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 13

gtaagcttct gacatttcac 20

<210> SEQ ID NO 14

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 14

tttaggtccc tgtgaattat 20

<210> SEQ ID NO 15

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 15

atgttcttcc agtcaacagc 20

<210> SEQ ID NO 16

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 16

taaggaggtc cctgctttca 20

<210> SEQ ID NO 17

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 17

aaccaggtgc tcaggactcc 20

<210> SEQ ID NO 18

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 18

gaagtgggat caacagaaca 20

<210> SEQ ID NO 19

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 19

tgaaaaggcc ttcccctcac 20

<210> SEQ ID NO 20

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 20

aggcacttga ataatatttg 20

<210> SEQ ID NO 21

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 21

cttccaccat ggaggaaatc 20

<210> SEQ ID NO 22

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 22

acacatgcac acacactaac 20

<210> SEQ ID NO 23

<211> LENGTH: 2180

<212> TYPE: DNA

<213> ORGANISM: Homo sapiens

<220> FEATURE:

<221> NAME/KEY: CDS

<222> LOCATION: (20)..(1138)

<300> PUBLICATION INFORMATION:

<308> DATABASE ACCESSION NUMBER: U53442

<309> DATABASE ENTRY DATE: 1996-07-30

<400> SEQUENCE: 23

gtgaaattct gctccggac atg tcg ggc cct cgc gcc ggc ttc tac cgg cag 52

Met Ser Gly Pro Arg Ala Gly Phe Tyr Arg Gln

1 5 10

gag ctg aac aag acc gtg tgg gag gtg ccg cag cgg ctg cag ggg ctg 100

Glu Leu Asn Lys Thr Val Trp Glu Val Pro Gln Arg Leu Gln Gly Leu

15 20 25

cgc ccg gtg ggc tcc ggc gcc tac ggc tcc gtc tgt tcg gcc tac gac 148

Arg Pro Val Gly Ser Gly Ala Tyr Gly Ser Val Cys Ser Ala Tyr Asp

30 35 40

gcc cgg ctg cgc cag aag gtg gcg gtg aag aag ctg tcg cgc ccc ttc 196

Ala Arg Leu Arg Gln Lys Val Ala Val Lys Lys Leu Ser Arg Pro Phe

45 50 55

cag tcg ctg atc cac gcg cgc aga acg tac cgg gag ctg cgg ctg ctc 244

Gln Ser Leu Ile His Ala Arg Arg Thr Tyr Arg Glu Leu Arg Leu Leu

60 65 70 75

aag cac ctg aag cac gag aac gtc atc ggg ctt ctg gac gtc ttc acg 292

Lys His Leu Lys His Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr

80 85 90

ccg gcc acg tcc atc gag gac ttc agc gaa gtg tac ttg gtg acc acc 340

Pro Ala Thr Ser Ile Glu Asp Phe Ser Glu Val Tyr Leu Val Thr Thr

95 100 105

ctg atg ggc gcc gac ctg aac aac atc gtc aag tgc cag gcg ggc gcc 388

Leu Met Gly Ala Asp Leu Asn Asn Ile Val Lys Cys Gln Ala Gly Ala

110 115 120

cat cag ggt gcc cgc ctg gca ctt gac gag cac gtt caa ttc ctg gtt 436

His Gln Gly Ala Arg Leu Ala Leu Asp Glu His Val Gln Phe Leu Val

125 130 135

tac cag ctg ctg cgc ggg ctg aag tac atc cac tcg gcc ggg atc atc 484

Tyr Gln Leu Leu Arg Gly Leu Lys Tyr Ile His Ser Ala Gly Ile Ile

140 145 150 155

cac cgg gac ctg aag ccc agc aac gtg gct gtg aac gag gac tgt gag 532

His Arg Asp Leu Lys Pro Ser Asn Val Ala Val Asn Glu Asp Cys Glu

160 165 170

ctc agg atc ctg gat ttc ggg ctg gcg cgc cag gcg gac gag gag atg 580

Leu Arg Ile Leu Asp Phe Gly Leu Ala Arg Gln Ala Asp Glu Glu Met

175 180 185

acc ggc tat gtg gcc acg cgc tgg tac cgg gca cct gag atc atg ctc 628

Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro Glu Ile Met Leu

190 195 200

aac tgg atg cat tac aac caa aca gtg gat atc tgg tcc gtg ggc tgc 676

Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp Ser Val Gly Cys

205 210 215

atc atg gct gag ctg ctc cag ggc aag gcc ctc ttc ccg gga agc gac 724

Ile Met Ala Glu Leu Leu Gln Gly Lys Ala Leu Phe Pro Gly Ser Asp

220 225 230 235

tac att gac cag ctg aag cgc atc atg gaa gtg gtg ggc aca ccc agc 772

Tyr Ile Asp Gln Leu Lys Arg Ile Met Glu Val Val Gly Thr Pro Ser

240 245 250

cct gag gtt ctg gca aaa atc tcc tcg gaa cac gcc cgg aca tat atc 820

Pro Glu Val Leu Ala Lys Ile Ser Ser Glu His Ala Arg Thr Tyr Ile

255 260 265

cag tcc ctg ccc ccc atg ccc cag aag gac ctg agc agc atc ttc cgt 868

Gln Ser Leu Pro Pro Met Pro Gln Lys Asp Leu Ser Ser Ile Phe Arg

270 275 280

gga gcc aac ccc ctg gcc ata gac ctc ctt gga agg atg ctg gtg ctg 916

Gly Ala Asn Pro Leu Ala Ile Asp Leu Leu Gly Arg Met Leu Val Leu

285 290 295

gac agt gac cag agg gtc agt gca gct gag gca ctg gcc cac gcc tac 964

Asp Ser Asp Gln Arg Val Ser Ala Ala Glu Ala Leu Ala His Ala Tyr

300 305 310 315

ttc agc cag tac cac gac ccc gag gat gag cca gag gcc gag cca tat 1012

Phe Ser Gln Tyr His Asp Pro Glu Asp Glu Pro Glu Ala Glu Pro Tyr

320 325 330

gat gag agc gtt gag gcc aag gag cgc acg ctg gag gag tgg aag gag 1060

Asp Glu Ser Val Glu Ala Lys Glu Arg Thr Leu Glu Glu Trp Lys Glu

335 340 345

ctc act tac cag gaa gtc ctt agc ttc aag ccc cca gag cca ccg aag 1108

Leu Thr Tyr Gln Glu Val Leu Ser Phe Lys Pro Pro Glu Pro Pro Lys

350 355 360

cca cct ggc agc ctg gag att gag cag tga ggtgctgccc agcagcccct 1158

Pro Pro Gly Ser Leu Glu Ile Glu Gln

365 370

gagagcctgt ggaggggctt gggcctgcac ccttccacag ctggcctggt ttcctcgaga 1218

ggcacctccc acactcctat ggtcacagac ttctggccta ggacccctcg ccttcaggag 1278

aatctacacg catgtatgca tgcacaaaca tgtgtgtaca tgtgcttgcc atgtgtagga 1338

gtctgggcac aagtgtccct gggcctacct tggtcctcct gtcctcttct ggctactgca 1398

ctctccactg ggacctgact gtggggtcct agatgccaaa ggggttcccc tgcggagttc 1458

ccctgtctgt cccaggccga cccaagggag tgtcagcctt gggctctctt ctgtcccagg 1518

gctttctgga gggcgcgctg gggccgggac cccgggagac tcaaagggag aggtctcagt 1578

ggttagagct gctcagcctg gaggtagggc gctgtcttgg tcactgctga gacccacagg 1638

tctaagagga gaggcagagc cagtgtgcca ccaggctggg cagggacaac caccaggtgt 1698

caaatgagaa aagctgcctg gagtcttgtg ttcacccgtg ggtgtgtgtg ggcacgtgtg 1758

gatgagcgtg cactccccgt gttcatatgt cagggcacat gtgatgtggt gcgtgtgaat 1818

ctgtgggcgc ccaaggccag cagccatatc tggcaagaag ctggagccgg ggtgggtgtg 1878

ctgttgcctt ccctctcctc ggttcctgat gccttgaggg gtgtttcaga ctggcggcac 1938

cgttgtggcc ctgcagccgg agatctgagg tgctctggtc tgtgggtcag tcctctttcc 1998

ttgtcccagg atggagctga tccagtaacc tcggagacgg gaccctgccc agagctgagt 2058

tgggggtgtg gctctgccct ggaaaggggg tgacctcttg cctcgagggg cccagggaag 2118

cctgggtgtc aagtgcctgc accaggggtg cacaataaag ggggttctct ctcagaaaaa 2178

aa 2180

<210> SEQ ID NO 24

<211> LENGTH: 372

<212> TYPE: PRT

<213> ORGANISM: Homo sapiens

<400> SEQUENCE: 24

Met Ser Gly Pro Arg Ala Gly Phe Tyr Arg Gln Glu Leu Asn Lys Thr

1 5 10 15

Val Trp Glu Val Pro Gln Arg Leu Gln Gly Leu Arg Pro Val Gly Ser

20 25 30

Gly Ala Tyr Gly Ser Val Cys Ser Ala Tyr Asp Ala Arg Leu Arg Gln

35 40 45

Lys Val Ala Val Lys Lys Leu Ser Arg Pro Phe Gln Ser Leu Ile His

50 55 60

Ala Arg Arg Thr Tyr Arg Glu Leu Arg Leu Leu Lys His Leu Lys His

65 70 75 80

Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Thr Ser Ile

85 90 95

Glu Asp Phe Ser Glu Val Tyr Leu Val Thr Thr Leu Met Gly Ala Asp

100 105 110

Leu Asn Asn Ile Val Lys Cys Gln Ala Gly Ala His Gln Gly Ala Arg

115 120 125

Leu Ala Leu Asp Glu His Val Gln Phe Leu Val Tyr Gln Leu Leu Arg

130 135 140

Gly Leu Lys Tyr Ile His Ser Ala Gly Ile Ile His Arg Asp Leu Lys

145 150 155 160

Pro Ser Asn Val Ala Val Asn Glu Asp Cys Glu Leu Arg Ile Leu Asp

165 170 175

Phe Gly Leu Ala Arg Gln Ala Asp Glu Glu Met Thr Gly Tyr Val Ala

180 185 190

Thr Arg Trp Tyr Arg Ala Pro Glu Ile Met Leu Asn Trp Met His Tyr

195 200 205

Asn Gln Thr Val Asp Ile Trp Ser Val Gly Cys Ile Met Ala Glu Leu

210 215 220

Leu Gln Gly Lys Ala Leu Phe Pro Gly Ser Asp Tyr Ile Asp Gln Leu

225 230 235 240

Lys Arg Ile Met Glu Val Val Gly Thr Pro Ser Pro Glu Val Leu Ala

245 250 255

Lys Ile Ser Ser Glu His Ala Arg Thr Tyr Ile Gln Ser Leu Pro Pro

260 265 270

Met Pro Gln Lys Asp Leu Ser Ser Ile Phe Arg Gly Ala Asn Pro Leu

275 280 285

Ala Ile Asp Leu Leu Gly Arg Met Leu Val Leu Asp Ser Asp Gln Arg

290 295 300

Val Ser Ala Ala Glu Ala Leu Ala His Ala Tyr Phe Ser Gln Tyr His

305 310 315 320

Asp Pro Glu Asp Glu Pro Glu Ala Glu Pro Tyr Asp Glu Ser Val Glu

325 330 335

Ala Lys Glu Arg Thr Leu Glu Glu Trp Lys Glu Leu Thr Tyr Gln Glu

340 345 350

Val Leu Ser Phe Lys Pro Pro Glu Pro Pro Lys Pro Pro Gly Ser Leu

355 360 365

Glu Ile Glu Gln

370

<210> SEQ ID NO 25

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 25

cgacatgtcc ggagcagaat 20

<210> SEQ ID NO 26

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 26

ttcagctcct gccggtagaa 20

<210> SEQ ID NO 27

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 27

tgcggcacct cccacacggt 20

<210> SEQ ID NO 28

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 28

ccgaacagac ggagccgtat 20

<210> SEQ ID NO 29

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 29

gtgcttcagg tgcttgagca 20

<210> SEQ ID NO 30

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 30

gcgtgaagac gtccagaagc 20

<210> SEQ ID NO 31

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 31

acttgacgat gttgttcagg 20

<210> SEQ ID NO 32

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 32

aacgtgctcg tcaagtgcca 20

<210> SEQ ID NO 33

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 33

atcctgagct cacagtcctc 20

<210> SEQ ID NO 34

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 34

actgtttggt tgtaatgcat 20

<210> SEQ ID NO 35

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 35

atgatgcgct tcagctggtc 20

<210> SEQ ID NO 36

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 36

gccagtgcct cagctgcact 20

<210> SEQ ID NO 37

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 37

aacgctctca tcatatggct 20

<210> SEQ ID NO 38

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 38

cagcacctca ctgctcaatc 20

<210> SEQ ID NO 39

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 39

tctgtgacca taggagtgtg 20

<210> SEQ ID NO 40

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 40

acacatgttt gtgcatgcat 20

<210> SEQ ID NO 41

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 41

cctacacatg gcaagcacat 20

<210> SEQ ID NO 42

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 42

tccaggctga gcagctctaa 20

<210> SEQ ID NO 43

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 43

agtgcacgct catccacacg 20

<210> SEQ ID NO 44

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 44

cttgccagat atggctgctg 20

<210> SEQ ID NO 45

<211> LENGTH: 3132

<212> TYPE: DNA

<213> ORGANISM: Rattus norvegicus

<220> FEATURE:

<221> NAME/KEY: CDS

<222> LOCATION: (12)..(1094)

<300> PUBLICATION INFORMATION:

<308> DATABASE ACCESSION NUMBER: U73142

<309> DATABASE ENTRY DATE: 1996-10-22

<400> SEQUENCE: 45

gccgctggaa a atg tcg cag gaa agg ccc acg ttc tac cgg cag gag ctg 50

Met Ser Gln Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu

1 5 10

aac aag acc gtc tgg gag gtg ccc gag cga tac cag aac ctg tcc ccg 98

Asn Lys Thr Val Trp Glu Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro

15 20 25

gtg ggc tcg gga gcc tac ggc tcg gtg tgt gct gct ttt gat aca aag 146

Val Gly Ser Gly Ala Tyr Gly Ser Val Cys Ala Ala Phe Asp Thr Lys

30 35 40 45

acg gga cat cgt gtg gca gtg aag aag ctg tcg aga ccg ttt cag tcc 194

Thr Gly His Arg Val Ala Val Lys Lys Leu Ser Arg Pro Phe Gln Ser

50 55 60

atc att cac gcc aaa agg acc tac agg gag ctg cgg ctg ctg aag cac 242

Ile Ile His Ala Lys Arg Thr Tyr Arg Glu Leu Arg Leu Leu Lys His

65 70 75

atg aag cac gag aat gtg att ggt ctg ttg gat gtg ttt aca cct gca 290

Met Lys His Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala

80 85 90

agg tcc ctg gaa gaa ttc aac gat gtg tac ctg gtg acc cat ctc atg 338

Arg Ser Leu Glu Glu Phe Asn Asp Val Tyr Leu Val Thr His Leu Met

95 100 105

ggg gca gac ctg aac aac atc gtg aag tgt cag aag ctt acc gat gac 386

Gly Ala Asp Leu Asn Asn Ile Val Lys Cys Gln Lys Leu Thr Asp Asp

110 115 120 125

cac gtt cag ttt ctt atc tac cag atc ctg cga ggg ctg aag tat ata 434

His Val Gln Phe Leu Ile Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile

130 135 140

cac tcg gct gac ata atc cac agg gac cta aag ccc agc aac ctc gct 482

His Ser Ala Asp Ile Ile His Arg Asp Leu Lys Pro Ser Asn Leu Ala

145 150 155

gtg aat gaa gac tgt gag ctg aag att ctg gat ttt ggg ctg gct cgg 530

Val Asn Glu Asp Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg

160 165 170

cac act gat gac gaa atg acc ggc tac gtg gct acc cgg tgg tac aga 578

His Thr Asp Asp Glu Met Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg

175 180 185

gcc ccc gag att atg ctg aat tgg atg cac tac aac cag aca gtg gat 626

Ala Pro Glu Ile Met Leu Asn Trp Met His Tyr Asn Gln Thr Val Asp

190 195 200 205

att tgg tcc gtg ggc tgc atc atg gct gag ctg ttg acc gga aga acg 674

Ile Trp Ser Val Gly Cys Ile Met Ala Glu Leu Leu Thr Gly Arg Thr

210 215 220

ttg ttt cct ggt aca gac cat att gat cag ttg aag ctc att tta aga 722

Leu Phe Pro Gly Thr Asp His Ile Asp Gln Leu Lys Leu Ile Leu Arg

225 230 235

ctc gtt gga acc cca ggg gct gag ctt ctg aag aaa atc tcc tca gag 770

Leu Val Gly Thr Pro Gly Ala Glu Leu Leu Lys Lys Ile Ser Ser Glu

240 245 250

tct gca aga aac tac att cag tct ctg gcc cag atg ccg aag atg aac 818

Ser Ala Arg Asn Tyr Ile Gln Ser Leu Ala Gln Met Pro Lys Met Asn

255 260 265

ttc gca aat gta ttt att ggt gcc aat ccc ctg gct gtc gac ctg ctg 866

Phe Ala Asn Val Phe Ile Gly Ala Asn Pro Leu Ala Val Asp Leu Leu

270 275 280 285

gaa aag atg ctg gtt ttg gac tcg gat aag agg atc aca gca gcc caa 914

Glu Lys Met Leu Val Leu Asp Ser Asp Lys Arg Ile Thr Ala Ala Gln

290 295 300

gct ctt gcg cat gcc tac ttt gct cag tac cac gac cct gat gat gag 962

Ala Leu Ala His Ala Tyr Phe Ala Gln Tyr His Asp Pro Asp Asp Glu

305 310 315

cca gtg gct gaa cct tat gac cag tcc ttt gaa agc agg gac ttc ctt 1010

Pro Val Ala Glu Pro Tyr Asp Gln Ser Phe Glu Ser Arg Asp Phe Leu

320 325 330

ata gac gaa tgg aag agc ctg acc tac gat gaa gtc att agc ttt gtg 1058

Ile Asp Glu Trp Lys Ser Leu Thr Tyr Asp Glu Val Ile Ser Phe Val

335 340 345

cca ccg ccc ctt gac caa gaa gaa atg gag tcc tga gcaccttgct 1104

Pro Pro Pro Leu Asp Gln Glu Glu Met Glu Ser

350 355 360

tctgttctgt ccatcccact tcactgtgag gggaaggcct gttcatggga actctccaaa 1164

taccattcaa gtgcctcttg ttgaaagatt ccttcatggt ggaagggggt gcatgtatgt 1224

gcgtagtgtt tgtgtgtgtc tgtctgtctg tccgtttgtc catgtatctt tgtggaagtc 1284

attgtgatgg cagtgacttc atgagtggta gatgctcctt ggcagtctgc ctgctctctc 1344

agagtccggg caggccgatg ggaactgccg tctccttagg gatgtgtgtg tgtatgttaa 1404

gtgcaaagta agaatattaa aatatccctg ttcctagtta ccttgccact tcggcttctc 1464

ctgtggccct gcctttacca tatcacagtg acagagagag gctgcttcag gtctgaggct 1524

atccctcagc catgcataaa gcccaagaga accaactggc tcctgggctc tagcctgtga 1584

tcggcttgct catgtcctca gaacctgtca gtctgtttgt gccttaaaag gagagaaggg 1644

cgcgttgtgg tagttacaga atctcagttg ctggcgttct gagccaggca aggcacaggg 1704

ctgttggatg gccagtgggg agctggacaa aacaaggcag ccttcaagga ggccatgggt 1764

gcatgtttgc atgagtgtat gtgcaaccgc cctccctcac ctccaggagc aagctgtttt 1824

ctatgcttac ctaagttcac ctcagtgcag aggtctccag tgccaggcac aggctcctgc 1884

catcagtagc ttcctatgtc atcttcacgt catgcgggtg tttgcatgct gtgctctgga 1944

gcttgtcctg tcttctggaa gccctgggcc gggcgtgtga agacttccca gcagtcctat 2004

ccacgcacct cagctgaggc cacgggcaca ctgctgcttc ctcactccag ctacgttgtg 2064

ttgaacacaa ctgatcctcc aggtgcttgt ggtgcaggaa acgggacgaa cagagcacct 2124

gaacccttgc catctgacat caccgacaca ggagaacagt cctctcctct cctctcctct 2184

cctctcctag gacagtcccc ggctctggaa tcatgttctt ctcactcatg gtagccagct 2244

aagaaagctg caaaccgaac aaagggagaa ccgagctcct gaagccagga gctcctttta 2304

ctgtccttct caaaataggg tcattagaca cagccaagtc gtcaaaggcc cctttccttg 2364

tacggggccc ccccgccccc ggcagcttga cactgatttc agtgtctatt tggggagaaa 2424

gcaattttgt cttggaattt tgtatgttgt aggaatcctt agagagtgtg gttccttctg 2484

atggggagaa agggcaaatt attttaatat tttgtatttc acctttataa acatgaatcc 2544

tcaggggtga agaacagttt gcataatttt ctgaatttca ggcactttgt gctatatgag 2604

gacccatata tttaagcttt ttgtgcagta agaaagtgta aagccaattc cagtgttgga 2664

cgaaacaggt ctcgtattta ggtcaaggtg tctccattct ctatcagtgc agggacatgc 2724

agtttctgtg gggcagggta ggaccctgca tcatttggag cccagaagga ggccgactgg 2784

ccaggcctca ccgcctcagt atgcagtcca gctccacgtc atcccctcac aatggttagt 2844

agcaacgtct gggtttgaac gccaggcgtg gttatattat tgaggatgcc tttgcacatg 2904

tggccatgct gtgttaggac tgtgccccag ggcccggact tgaagctaga gctggcagaa 2964

gagctcctgg catccatggt gcgatgctgc cgccacccag tttctccatt ggaagacaag 3024

ggaatgagaa gactgctgtg tatgtgtatt tgtgaacttg gttgtgatct ggtatgccat 3084

aggatgtcag acaatatcac tggttaaagt aaagcctatt tttcagat 3132

<210> SEQ ID NO 46

<211> LENGTH: 360

<212> TYPE: PRT

<213> ORGANISM: Rattus norvegicus

<400> SEQUENCE: 46

Met Ser Gln Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu Asn Lys Thr

1 5 10 15

Val Trp Glu Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro Val Gly Ser

20 25 30

Gly Ala Tyr Gly Ser Val Cys Ala Ala Phe Asp Thr Lys Thr Gly His

35 40 45

Arg Val Ala Val Lys Lys Leu Ser Arg Pro Phe Gln Ser Ile Ile His

50 55 60

Ala Lys Arg Thr Tyr Arg Glu Leu Arg Leu Leu Lys His Met Lys His

65 70 75 80

Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Arg Ser Leu

85 90 95

Glu Glu Phe Asn Asp Val Tyr Leu Val Thr His Leu Met Gly Ala Asp

100 105 110

Leu Asn Asn Ile Val Lys Cys Gln Lys Leu Thr Asp Asp His Val Gln

115 120 125

Phe Leu Ile Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile His Ser Ala

130 135 140

Asp Ile Ile His Arg Asp Leu Lys Pro Ser Asn Leu Ala Val Asn Glu

145 150 155 160

Asp Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg His Thr Asp

165 170 175

Asp Glu Met Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro Glu

180 185 190

Ile Met Leu Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp Ser

195 200 205

Val Gly Cys Ile Met Ala Glu Leu Leu Thr Gly Arg Thr Leu Phe Pro

210 215 220

Gly Thr Asp His Ile Asp Gln Leu Lys Leu Ile Leu Arg Leu Val Gly

225 230 235 240

Thr Pro Gly Ala Glu Leu Leu Lys Lys Ile Ser Ser Glu Ser Ala Arg

245 250 255

Asn Tyr Ile Gln Ser Leu Ala Gln Met Pro Lys Met Asn Phe Ala Asn

260 265 270

Val Phe Ile Gly Ala Asn Pro Leu Ala Val Asp Leu Leu Glu Lys Met

275 280 285

Leu Val Leu Asp Ser Asp Lys Arg Ile Thr Ala Ala Gln Ala Leu Ala

290 295 300

His Ala Tyr Phe Ala Gln Tyr His Asp Pro Asp Asp Glu Pro Val Ala

305 310 315 320

Glu Pro Tyr Asp Gln Ser Phe Glu Ser Arg Asp Phe Leu Ile Asp Glu

325 330 335

Trp Lys Ser Leu Thr Tyr Asp Glu Val Ile Ser Phe Val Pro Pro Pro

340 345 350

Leu Asp Gln Glu Glu Met Glu Ser

355 360

<210> SEQ ID NO 47

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 47

ctgcgacatt ttccagcggc 20

<210> SEQ ID NO 48

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 48

ggtaagcttc tgacacttca 20

<210> SEQ ID NO 49

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 49

ggccagagac tgaatgtagt 20

<210> SEQ ID NO 50

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 50

catcatcagg gtcgtggtac 20

<210> SEQ ID NO 51

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 51

ggcacaaagc taatgacttc 20

<210> SEQ ID NO 52

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 52

aggtgctcag gactccattt 20

<210> SEQ ID NO 53

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 53

ggatggacag aacagaagca 20

<210> SEQ ID NO 54

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 54

gagcaggcag actgccaagg 20

<210> SEQ ID NO 55

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 55

aggctagagc ccaggagcca 20

<210> SEQ ID NO 56

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 56

gagcctgtgc ctggcactgg 20

<210> SEQ ID NO 57

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 57

tgcaccacaa gcacctggag 20

<210> SEQ ID NO 58

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 58

ggctaccatg agtgagaaga 20

<210> SEQ ID NO 59

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 59

gtccctgcac tgatagagaa 20

<210> SEQ ID NO 60

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 60

tcttccaatg gagaaactgg 20

<210> SEQ ID NO 61

<211> LENGTH: 749

<212> TYPE: DNA

<213> ORGANISM: Mus musculus

<400> SEQUENCE: 61

tgctgggcgt ggggcgcggg ccgggtgctg cgcgcgggga tccggggcgc tcgctccagc 60

tgcttctgtg gatatgtcgg gtccgcgcgc gggattctac cggcaagagc tgaacaaaac 120

agtatgggag gtgccgcagc ggctgcaggg cctacgcccg gtgggctccg gcgcctacgg 180

ctcagtctgc tcggcctacg acgcgcggct gcgccagaag gtggctgtaa agaagctgtc 240

tcgccctttc caatcgctga tccacgcgag gaggacatac cgtgagctgc gcctactcaa 300

gcacctgaag cacgagaacg tcataggact tttggacgtc ttcacgccgg ccacatccat 360

cgaggatttc agcgaagtgt acctcgtgac gaccctgatg ggcgccgacc tgaataacat 420

cgtcaagtgt caggccctga gcgatgagca tgttcaattc cttgtctacc agctgctgcg 480

tgggctgaag tatatccact cggcgggcat cattcaccgg gacctgaagc ccagcaatgt 540

agcggtgaac gaggactgcg agctgaggat cctggacttt gggctagcac gccaggctga 600

tgaggagatg accggatatg tggccacacg gtggtaccgg gcgccagaga tcatgctaaa 660

ctggatgcac tacaaccaga cagtggacat ctggtctgtg gcctgcttca tggcttgaac 720

tgctggaagg gaagggcctt ctttcctgg 749

<210> SEQ ID NO 62

<400> SEQUENCE: 62

000

<210> SEQ ID NO 63

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 63

cacagaagca gctggagcga 20

<210> SEQ ID NO 64

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 64

tgcggcacct cccatactgt 20

<210> SEQ ID NO 65

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 65

ccctgcagcc gctgcggcac 20

<210> SEQ ID NO 66

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 66

gcagactgag ccgtaggcgc 20

<210> SEQ ID NO 67

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 67

ttacagccac cttctggcgc 20

<210> SEQ ID NO 68

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 68

gtatgtcctc ctcgcgtgga 20

<210> SEQ ID NO 69

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 69

atggatgtgg ccggcgtgaa 20

<210> SEQ ID NO 70

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 70

gaattgaaca tgctcatcgc 20

<210> SEQ ID NO 71

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 71

acattgctgg gcttcaggtc 20

<210> SEQ ID NO 72

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 72

atcctcagct cgcagtcctc 20

<210> SEQ ID NO 73

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 73

taccaccgtg tggccacata 20

<210> SEQ ID NO 74

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 74

cagtttagca tgatctctgg 20

<210> SEQ ID NO 75

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 75

caggccacag accagatgtc 20

<210> SEQ ID NO 76

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 76

ccttccagca gttcaagcca 20

<210> SEQ ID NO 77

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: control sequence

<400> SEQUENCE: 77

cagcaccatg gacgcggaac 20

<210> SEQ ID NO 78

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 78

ctgagacatt ttccagcggc 20

<210> SEQ ID NO 79

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 79

acgctcgggc acctcccaga 20

<210> SEQ ID NO 80

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 80

agcttcttca ctgccacacg 20

<210> SEQ ID NO 81

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 81

aatgatggac tgaaatggtc 20

<210> SEQ ID NO 82

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 82

tccaacagac caatcacatt 20

<210> SEQ ID NO 83

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 83

tgtaagcttc tgacatttca 20

<210> SEQ ID NO 84

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 84

tgaatgtata tactttagac 20

<210> SEQ ID NO 85

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 85

ctcacagtct tcattcacag 20

<210> SEQ ID NO 86

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 86

cacgtagcct gtcatttcat 20

<210> SEQ ID NO 87

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 87

catcccactg accaaatatc 20

<210> SEQ ID NO 88

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 88

tatggtctgt accaggaaac 20

<210> SEQ ID NO 89

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 89

agtcaaagac tgaatatagt 20

<210> SEQ ID NO 90

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 90

ttctcttatc tgagtccaat 20

<210> SEQ ID NO 91

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 91

catcatcagg atcgtggtac 20

<210> SEQ ID NO 92

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 92

tcaaaggact gatcataagg 20

<210> SEQ ID NO 93

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 93

ggcacaaagc tgatgacttc 20

<210> SEQ ID NO 94

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 94

aggtgctcag gactccatct 20

<210> SEQ ID NO 95

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 95

gcaacaagag gcacttgaat 20

<210> SEQ ID NO 96

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 96

ttatcctagc ttagacctat 20

<210> SEQ ID NO 97

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 97

acagacggag ccgtaggcgc 20

<210> SEQ ID NO 98

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 98

caccgccacc ttctggcgca 20

<210> SEQ ID NO 99

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 99

gtacgttctg cgcgcgtgga 20

<210> SEQ ID NO 100

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 100

atggacgtgg ccggcgtgaa 20

<210> SEQ ID NO 101

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 101

caggaattga acgtgctcgt 20

<210> SEQ ID NO 102

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 102

acgttgctgg gcttcaggtc 20

<210> SEQ ID NO 103

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 103

taccagcgcg tggccacata 20

<210> SEQ ID NO 104

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 104

cagttgagca tgatctcagg 20

<210> SEQ ID NO 105

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 105

cggaccagat atccactgtt 20

<210> SEQ ID NO 106

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 106

tgccctggag cagctcagcc 20

<210> SEQ ID NO 107

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: antisense sequence

<400> SEQUENCE: 107

gttcgatcgg ctcgtgtcga 20

<210> SEQ ID NO 108

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 108

gatgagtgga aaagcctgac 20

<210> SEQ ID NO 109

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 109

ctgcaacaag aggcacttga 20

<210> SEQ ID NO 110

<211> LENGTH: 50

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Probe

<400> SEQUENCE: 110

gatgaagtca tcagctttgt gccaccaccc cttgaccaag aagagatgga 50

<210> SEQ ID NO 111

<211> LENGTH: 19

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 111

gaaggtgaag gtcggagtc 19

<210> SEQ ID NO 112

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 112

gaagatggtg atgggatttc 20

<210> SEQ ID NO 113

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Probe

<400> SEQUENCE: 113

caagcttccc gttctcagcc 20

<210> SEQ ID NO 114

<211> LENGTH: 3450

<212> TYPE: DNA

<213> ORGANISM: M. musculus

<220> FEATURE:

<221> NAME/KEY: CDS

<222> LOCATION: (297)...(1379)

<400> SEQUENCE: 114

cgggcgctga agcgcgagcg ggtgtcttgc ggcgtcggcg tgcgctccct ccccggggag 60

cggctgcagg aggaccgcgg cgggagcagc ctcgagccgt gcagccggct ccggcacctt 120

gccgacgctc gtaggagccg ccgcggctga caggggcggc gggtcgcagc ctccacacct 180

gcgcgggtgg cgggcgcggg gtccggtctg ccgcgggcgg gcgcagagga gagcgtgcgg 240

ctgcaggcag gagcccccgc tcggccacct cctcgccccg ctgctgccgc tggaag atg 299

Met

1

tcg cag gag agg ccc acg ttc tac cgg cag gag ctg aac aag acc atc 347

Ser Gln Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu Asn Lys Thr Ile

5 10 15

tgg gag gtg ccc gaa cga tac cag aac ctg tcc ccg gtg ggc tcg ggc 395

Trp Glu Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro Val Gly Ser Gly

20 25 30

gcc tat ggc tcg gtg tgt gct gct ttt gat aca aag acg ggg cat cgt 443

Ala Tyr Gly Ser Val Cys Ala Ala Phe Asp Thr Lys Thr Gly His Arg

35 40 45

gtg gca gtt aag aag ctg tcg aga ccg ttt cag tcc atc att cac gcc 491

Val Ala Val Lys Lys Leu Ser Arg Pro Phe Gln Ser Ile Ile His Ala

50 55 60 65

aaa agg acc tac cga gag ttg cgt ctg ctg aag cac atg aaa cac gaa 539

Lys Arg Thr Tyr Arg Glu Leu Arg Leu Leu Lys His Met Lys His Glu

70 75 80

aat gtg att ggt ctg ttg gat gtg ttc aca ccc gca agg tca ctg gag 587

Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Arg Ser Leu Glu

85 90 95

gaa ttc aat gac gtg tac ctg gtg acc cat ctc atg ggg gcg gac ctg 635

Glu Phe Asn Asp Val Tyr Leu Val Thr His Leu Met Gly Ala Asp Leu

100 105 110

aac aac atc gtg aag tgc cag aag ctg acc gac gac cac gtt cag ttt 683

Asn Asn Ile Val Lys Cys Gln Lys Leu Thr Asp Asp His Val Gln Phe

115 120 125

ctc atc tac cag atc ctc cga ggg ctg aag tat ata cat tcg gct gac 731

Leu Ile Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile His Ser Ala Asp

130 135 140 145

ata att cac agg gac cta aag ccc agc aac cta gct gtg aac gaa gac 779

Ile Ile His Arg Asp Leu Lys Pro Ser Asn Leu Ala Val Asn Glu Asp

150 155 160

tgt gag ctc aag att ctg gat ttt ggg ctg gct cgg cac act gat gat 827

Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg His Thr Asp Asp

165 170 175

gag atg aca ggc tac gtg gct acc agg tgg tac cga gcc cca gag atc 875

Glu Met Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro Glu Ile

180 185 190

atg ctg aat tgg atg cac tat aac cag aca gtg gat att tgg tcc gtg 923

Met Leu Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp Ser Val

195 200 205

ggc tgc atc atg gct gag ctg ttg acc gga aga acg ttg ttt cct ggt 971

Gly Cys Ile Met Ala Glu Leu Leu Thr Gly Arg Thr Leu Phe Pro Gly

210 215 220 225

aca gac cat att gat cag ttg aag ctc att tta aga ctc gtt gga acc 1019

Thr Asp His Ile Asp Gln Leu Lys Leu Ile Leu Arg Leu Val Gly Thr

230 235 240

cca ggg gct gag ctt ctg aag aaa atc tcc tca gag tct gca aga aac 1067

Pro Gly Ala Glu Leu Leu Lys Lys Ile Ser Ser Glu Ser Ala Arg Asn

245 250 255

tac att cag tct ctg gcc cag atg ccg aag atg aac ttc gca aat gta 1115

Tyr Ile Gln Ser Leu Ala Gln Met Pro Lys Met Asn Phe Ala Asn Val

260 265 270

ttt att ggt gcc aat ccc ctg gct gtc gac cta ctg gag aag atg ctc 1163

Phe Ile Gly Ala Asn Pro Leu Ala Val Asp Leu Leu Glu Lys Met Leu

275 280 285

gtt ttg gac tca gat aag agg atc aca gca gcc caa gct ctt gcg cat 1211

Val Leu Asp Ser Asp Lys Arg Ile Thr Ala Ala Gln Ala Leu Ala His

290 295 300 305

gcc tac ttt gct cag tac cac gac cct gat gat gag cct gtt gct gac 1259

Ala Tyr Phe Ala Gln Tyr His Asp Pro Asp Asp Glu Pro Val Ala Asp

310 315 320

cct tat gac cag tcc ttt gaa agc agg gac ctt ctc ata gat gag tgg 1307

Pro Tyr Asp Gln Ser Phe Glu Ser Arg Asp Leu Leu Ile Asp Glu Trp

325 330 335

aag agc ctg acc tat gat gaa gtc atc agc ttt gtg cca cca ccc ctt 1355

Lys Ser Leu Thr Tyr Asp Glu Val Ile Ser Phe Val Pro Pro Pro Leu

340 345 350

gac caa gaa gaa atg gag tcc tga gcacctggtt tctgttctgt ctatctcact 1409

Asp Gln Glu Glu Met Glu Ser

355 360

tcactgtgag gggaagacct tctcatggga actctccaaa taccattcaa gtgcctcttg 1469

ttgaaagatt ccttcatggt ggaagggggt gcatgtatgt gttagtgttt gtgtgtgtgt 1529

gtgtgtctgt ctgttcgtct gtccacctat ctttgtggaa gtcactgtga tggtagtgac 1589

tttatgagtt gtgaatggtc cttggcagtc tgcctgcttt ctcagagtct gggcaggccg 1649

atgggaactg tcatctcctt agggatgtgt gtgttcagtg caaagtaaga aatatgaaaa 1709

tatccctgtt cttagttacc ttgccacttt ggcttctcct gtggccctgc ctttaccata 1769

tcagtgacag agagaggctg cttcaggtct gaggctatcc ctcagccatg cataaagtcc 1829

aagagaacca actggctcct ggtctctagc ctgtgaccgg cttgcttaat gtcctcagaa 1889

cctgacaggt atgttcaaaa ctgtcagtct gtttgtgcct taaaagggtg agaagggcgc 1949

gtagatagtt acagagtctc agctgctgac gttctgagcc aggcaagtgc acggggctgt 2009

tggatggcca gtggggagct ggaaaaaaca aggcagcctt taggaaggcc atggtgcatg 2069

tgtgtgcatg cgtgtatgtg cagccgccct ccctcacttc aggagcaagc tgtttgctgt 2129

gcttaccctt cacctcagtg cagaggtctc cagtgccgag cacaggcacc tgccatcagt 2189

agttcctgtg tcatcttcac atctagcaga gcacggatgt gtttgcatgc tgtgctcttg 2249

gagcttgtcc tgtcttctgg aagccctgga caaggcgtgt gaaggcttcc cagaagttcc 2309

tgtccacatt gcctccgccc accgacgcca tgggcacact gctccctcct cctcctccag 2369

ctactttgtg ttgaacacaa ttgattctcc aggtgctcat ggtgcaggaa aacaggacag 2429

acagagagca ctgaaccctt gccatctgat gtcaccaatt caggaaaacg agtcctctcc 2489

taggactatc cccggttctg gaaatcatgt tctcctcact catggtgaca agctaagaaa 2549

gctgaacaaa gggagagacg agagcgcctg aagccaggag ctcctttact atctttctca 2609

aaagggttgt tagacacaaa ccaagtcatc aaggccccgc tcctctcctc ggaagggtcc 2669

cccacccccc ggcagcttga cactgaatcc agtgtcaatt tggggagaaa gcagttttgt 2729

cttggaattt tgtatgttgt aggaatcctt agagagtgtg gttccttctg atggggagaa 2789

agggcaaatt attttaatat tttgtatttt cacctttata aacatgaatc ctcaggggtg 2849

aagaactgtt tgcataattt tctgaatttt gagcactttg tgctatataa ggacccatat 2909

ttaagctttg tgtgcagtaa gaaagtgtaa agccaattcc agtgttggac gtgacaggtc 2969

ttgtgtttag gtcaaggtgt ctcctctcag tgcagggaca tgcctgctct gtggggcagg 3029

cgaggaccct gaatcatttg gagcccagaa ggaggcagac tggccaggtc tcaccacctc 3089

agtgtgcagt tcaactccat gccatcccat caagatgggt tagtagcagt gtctgttttt 3149

gaatgccaag tgtgatttcc aacaattctg ctctggttat ttcattgaag acatctttgc 3209

acatgtgacc atgctgtgtt aggggctgtg ttccagggac tggactcgaa gctagaactg 3269

gcagaagagt tctggcatcc acagcgcaat gctgccacca cccagtttct tcatcagaag 3329

acaagggaac gagaaaactg ctgttcgttt gtatttgtga acttggctgt aatctggtat 3389

gccataggat gtcagataat accactggtt aaaataaagc ctagttttca aattcaaccg 3449

g 3450

<210> SEQ ID NO 115

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 115

aagggaacga gaaaactgct gtt 23

<210> SEQ ID NO 116

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 116

tattttaacc agtggtatta tctgacatcc t 31

<210> SEQ ID NO 117

<211> LENGTH: 35

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Probe

<400> SEQUENCE: 117

ttgtatttgt gaacttggct gtaatctggt atgcc 35

<210> SEQ ID NO 118

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 118

ggcaaattca acggcacagt 20

<210> SEQ ID NO 119

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 119

gggtctcgct cctggaagat 20

<210> SEQ ID NO 120

<211> LENGTH: 27

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Probe

<400> SEQUENCE: 120

aaggccgaga atgggaagct tgtcatc 27

<210> SEQ ID NO 121

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 121

atcatttgga gcccagaagg a 21

<210> SEQ ID NO 122

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 122

tggagctgga ctgcatactg a 21

<210> SEQ ID NO 123

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Probe

<400> SEQUENCE: 123

ctggccaggc ctcaccgc 18

<210> SEQ ID NO 124

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 124

tgttctagag acagccgcat ctt 23

<210> SEQ ID NO 125

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Primer

<400> SEQUENCE: 125

caccgacctt caccatcttg t 21

<210> SEQ ID NO 126

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: PCR Probe

<400> SEQUENCE: 126

ttgtgcagtg ccagcctcgt ctca 24

<210> SEQ ID NO 127

<211> LENGTH: 3757

<212> TYPE: DNA

<213> ORGANISM: H. sapiens

<220> FEATURE:

<221> NAME/KEY: CDS

<222> LOCATION: (363)...(1445)

<400> SEQUENCE: 127

ggaaccgcga ccactggagc cttagcgggc gcagcagctg gaacgggagt actgcgacgc 60

agcccggagt cggccttgta ggggcgaagg tgcagggaga tcgcggcggg cgcagtcttg 120

agcgccggag cgcgtccctg cccttagcgg ggcttgcccc agtcgcaggg gcacatccag 180

ccgctgcggc tgacagcagc cgcgcgcgcg ggagtctgcg gggtcgcggc agccgcacct 240

gcgcgggcga ccagcgcaag gtccccgccc ggctgggcgg gcagcaaggg ccggggagag 300

ggtgcgggtg caggcggggg ccccacaggg ccaccttctt gcccggcggc tgccgctgga 360

aa atg tct cag gag agg ccc acg ttc tac cgg cag gag ctg aac aag 407

Met Ser Gln Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu Asn Lys

1 5 10 15

aca atc tgg gag gtg ccc gag cgt tac cag aac ctg tct cca gtg ggc 455

Thr Ile Trp Glu Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro Val Gly

20 25 30

tct ggc gcc tat ggc tct gtg tgt gct gct ttt gac aca aaa acg ggg 503

Ser Gly Ala Tyr Gly Ser Val Cys Ala Ala Phe Asp Thr Lys Thr Gly

35 40 45

tta cgt gtg gca gtg aag aag ctc tcc aga cca ttt cag tcc atc att 551

Leu Arg Val Ala Val Lys Lys Leu Ser Arg Pro Phe Gln Ser Ile Ile

50 55 60

cat gcg aaa aga acc tac aga gaa ctg cgg tta ctt aaa cat atg aaa 599

His Ala Lys Arg Thr Tyr Arg Glu Leu Arg Leu Leu Lys His Met Lys

65 70 75

cat gaa aat gtg att ggt ctg ttg gac gtt ttt aca cct gca agg tct 647

His Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Arg Ser

80 85 90 95

ctg gag gaa ttc aat gat gtg tat ctg gtg acc cat ctc atg ggg gca 695

Leu Glu Glu Phe Asn Asp Val Tyr Leu Val Thr His Leu Met Gly Ala

100 105 110

gat ctg aac aac att gtg aaa tgt cag aag ctt aca gat gac cat gtt 743

Asp Leu Asn Asn Ile Val Lys Cys Gln Lys Leu Thr Asp Asp His Val

115 120 125

cag ttc ctt atc tac caa att ctc cga ggt cta aag tat ata cat tca 791

Gln Phe Leu Ile Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile His Ser

130 135 140

gct gac ata att cac agg gac cta aaa cct agt aat cta gct gtg aat 839

Ala Asp Ile Ile His Arg Asp Leu Lys Pro Ser Asn Leu Ala Val Asn

145 150 155

gaa gac tgt gag ctg aag att ctg gat ttt gga ctg gct cgg cac aca 887

Glu Asp Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg His Thr

160 165 170 175

gat gat gaa atg aca ggc tac gtg gcc act agg tgg tac agg gct cct 935

Asp Asp Glu Met Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro

180 185 190

gag atc atg ctg aac tgg atg cat tac aac cag aca gtt gat att tgg 983

Glu Ile Met Leu Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp

195 200 205

tca gtg gga tgc ata atg gcc gag ctg ttg act gga aga aca ttg ttt 1031

Ser Val Gly Cys Ile Met Ala Glu Leu Leu Thr Gly Arg Thr Leu Phe

210 215 220

cct ggt aca gac cat att aac cag ctt cag cag att atg cgt ctg aca 1079

Pro Gly Thr Asp His Ile Asn Gln Leu Gln Gln Ile Met Arg Leu Thr

225 230 235

gga aca ccc ccc gct tat ctc att aac agg atg cca agc cat gag gca 1127

Gly Thr Pro Pro Ala Tyr Leu Ile Asn Arg Met Pro Ser His Glu Ala

240 245 250 255

aga aac tat att cag tct ttg act cag atg ccg aag atg aac ttt gcg 1175

Arg Asn Tyr Ile Gln Ser Leu Thr Gln Met Pro Lys Met Asn Phe Ala

260 265 270

aat gta ttt att ggt gcc aat ccc ctg gct gtc gac ttg ctg gag aag 1223

Asn Val Phe Ile Gly Ala Asn Pro Leu Ala Val Asp Leu Leu Glu Lys

275 280 285

atg ctt gta ttg gac tca gat aag aga att aca gcg gcc caa gcc ctt 1271

Met Leu Val Leu Asp Ser Asp Lys Arg Ile Thr Ala Ala Gln Ala Leu

290 295 300

gca cat gcc tac ttt gct cag tac cac gat cct gat gat gaa cca gtg 1319

Ala His Ala Tyr Phe Ala Gln Tyr His Asp Pro Asp Asp Glu Pro Val

305 310 315

gcc gat cct tat gat cag tcc ttt gaa agc agg gac ctc ctt ata gat 1367

Ala Asp Pro Tyr Asp Gln Ser Phe Glu Ser Arg Asp Leu Leu Ile Asp

320 325 330 335

gag tgg aaa agc ctg acc tat gat gaa gtc atc agc ttt gtg cca cca 1415

Glu Trp Lys Ser Leu Thr Tyr Asp Glu Val Ile Ser Phe Val Pro Pro

340 345 350

ccc ctt gac caa gaa gag atg gag tcc tga gcacctggtt tctgttctgt 1465

Pro Leu Asp Gln Glu Glu Met Glu Ser

355 360

tgatcccact tcactgtgag gggaaggcct tttcacggga actctccaaa tattattcaa 1525

gtgcctcttg ttgcagagat ttcctccatg gtggaagggg gtgtgcgtgc gtgtgcgtgc 1585

gtgttagtgt gtgtgcatgt gtgtgtctgt ctttgtggga gggtaagaca atatgaacaa 1645

actatgatca cagtgacttt acaggaggtt gtggatgctc cagggcagcc tccaccttgc 1705

tcttctttct gagagttggc tcaggcagac aagagctgct gtccttttag gaatatgttc 1765

aatgcaaagt aaaaaaatat gaattgtccc caatcccggt catgcttttg ccactttggc 1825

ttctcctgtg accccacctt gacggtgggg cgtagacttg acaacatccc acagtggcac 1885

ggagagaagg cccatacctt ctggttgctt cagacctgac accgtccctc agtgatacgt 1945

acagccaaaa aggaccaact ggcttctgtg cactagcctg tgattaactt gcttagtatg 2005

gttctcagat cttgacagta tatttgaaac tgtaaatatg tttgtgcctt aaaaggagag 2065

aagaaagtgt agatagttaa aagactgcag ctgctgaagt tctgagccgg gcaagtcgag 2125

agggctgttg gacagctgct tgtgggcccg gagtaatcag gcagccttca taggcggtca 2185

tgtgtgcatg tgagcacatg cgtatatgtg cgtctctctt tctccctcac ccccaggtgt 2245

tgccatttct ctgcttaccc ttcacctttg gtgcagaggt ttcttgaata tctgccccag 2305

tagtcagaag caggttcttg atgtcatgta cttcctgtgt actctttatt tctagcagag 2365

tgaggatgtg ttttgcacgt cttgctattt gagcatgcac agctgcttgt cctgctctct 2425

tcaggaggcc ctggtgtcag gcaggtttgc cagtgaagac ttcttgggta gtttagatcc 2485

catgtcacct cagctgatat tatggcaagt gatatcacct ctcttcagcc cctagtgcta 2545

ttctgtgttg aacacaattg atacttcagg tgcttttgat gtgaaaatca tgaaaagagg 2605

aacaggtgga tgtatagcat ttttattcat gccatctgtt ttcaaccaac tatttttgag 2665

gaattatcat gggaaaagac cagggctttt cccaggaata tcccaaactt cggaaacaag 2725

ttattctctt cactcccaat aactaatgct aagaaatgct gaaaatcaaa gtaaaaaatt 2785

aaagcccata aggccagaaa ctccttttgc tgtctttctc taaatatgat tactttaaaa 2845

taaaaaagta acaaggtgtc ttttccactc ctatggaaaa gggtcttctt ggcagcttaa 2905

cattgacttc ttggtttggg gagaaataaa ttttgtttca gaattttgta tattgtagga 2965

atccctttga gaatgtgatt ccttttgatg gggagaaagg gcaaattatt ttaatatttt 3025

gtattttcaa ctttataaag ataaaatatc ctcaggggtg gagaagtgtc gttttcataa 3085

cttgctgaat ttcaggcatt ttgttctaca tgaggactca tatatttaag ccttttgtgt 3145

aataagaaag tataaagtca cttccagtgt tggctgtgtg acagaatctt gtatttgggc 3205

caaggtgttt ccatttctca atcagtgcag tgatacatgt actccagagg gacagggtgg 3265

accccctgag tcaactggag caagaaggaa ggaggcagac tgatggcgat tccctctcac 3325

ccgggactct ccccctttca aggaaagtga acctttaaag taaaggcctc atctccttta 3385

ttgcagttca aatcctcacc atccacagca agatgaattt tatcagccat gtttggttgt 3445

aaatgctcgt gtgatttcct acagaaatac tgctctgaat attttgtaat aaaggtcttt 3505

gcacatgtga ccacatacgt gttaggaggc tgcatgctct ggaagcctgg actctaagct 3565

ggagctcttg gaagagctct tcggtttctg agcataatgc tcccatctcc tgatttctct 3625

gaacagaaaa caaaagagag aatgagggaa attgctattt tatttgtatt catgaacttg 3685

gctgtaatca gttatgccgt ataggatgtc agacaatacc actggttaaa ataaagccta 3745

tttttcaaat tt 3757

<210> SEQ ID NO 128

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 128

gagcaaagta ggcatgtgca 20

<210> SEQ ID NO 129

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 129

gtttccgaag tttgggatat 20

<210> SEQ ID NO 130

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 130

gcattagtta ttgggagtga 20

<210> SEQ ID NO 131

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 131

ccctggagca tccacaacct 20

<210> SEQ ID NO 132

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 132

tgtaccagga aacaatgttc 20

<210> SEQ ID NO 133

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 133

cgggcaagaa ggtggccctg 20

<210> SEQ ID NO 134

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 134

atcgccatca gtctgcctcc 20

<210> SEQ ID NO 135

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 135

tgacatcaag aacctgcttc 20

<210> SEQ ID NO 136

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 136

ggcccacaag cagctgtcca 20

<210> SEQ ID NO 137

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 137

tgaaaacgac acttctccac 20

<210> SEQ ID NO 138

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 138

ggtgagaggg aatcgccatc 20

<210> SEQ ID NO 139

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 139

atactgtcaa gatctgagaa 20

<210> SEQ ID NO 140

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 140

tttccgaagt ttgggatatt 20

<210> SEQ ID NO 141

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 141

agagagacgc acatatacgc 20

<210> SEQ ID NO 142

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 142

caagaggcac ttgaataata 20

<210> SEQ ID NO 143

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 143

attcctccag agaccttgca 20

<210> SEQ ID NO 144

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 144

aagacacctt gttacttttt 20

<210> SEQ ID NO 145

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 145

tgccctttct ccccatcaaa 20

<210> SEQ ID NO 146

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 146

tggcatcctg ttaatgagat 20

<210> SEQ ID NO 147

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 147

aaggccttcc cctcacagtg 20

<210> SEQ ID NO 148

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 148

aataggcttt attttaacca 20

<210> SEQ ID NO 149

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 149

acccaagaag tcttcactgg 20

<210> SEQ ID NO 150

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 150

tttcttatta cacaaaaggc 20

<210> SEQ ID NO 151

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 151

ggaaatcaca cgagcattta 20

<210> SEQ ID NO 152

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 152

ggtccctgtg aattatgtca 20

<210> SEQ ID NO 153

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 153

aatatatgag tcctcatgta 20

<210> SEQ ID NO 154

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 154

ctaacacgta tgtggtcaca 20

<210> SEQ ID NO 155

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 155

tttctcccca tcaaaaggaa 20

<210> SEQ ID NO 156

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 156

ctgaacatgg tcatctgtaa 20

<210> SEQ ID NO 157

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 157

ataactgatt acagccaagt 20

<210> SEQ ID NO 158

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 158

ttctcaaagg gattcctaca 20

<210> SEQ ID NO 159

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 159

tctgccccca tgagatgggt 20

<210> SEQ ID NO 160

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 160

ttcgcatgaa tgatggactg 20

<210> SEQ ID NO 161

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 161

tactgagcaa agtaggcatg 20

<210> SEQ ID NO 162

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 162

gtccctgctt tcaaaggact 20

<210> SEQ ID NO 163

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 163

catatgttta agtaaccgca 20

<210> SEQ ID NO 164

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 164

cacattctca aagggattcc 20

<210> SEQ ID NO 165

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 165

ggactccatc tcttcttggt caa 23

<210> SEQ ID NO 166

<211> LENGTH: 24

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 166

gaagtgggat caacagaaca gaaa 24

<210> SEQ ID NO 167

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 167

agcccactgg agacaggttc t 21

<210> SEQ ID NO 168

<211> LENGTH: 3352

<212> TYPE: DNA

<213> ORGANISM: M. musculus

<220> FEATURE:

<221> NAME/KEY: CDS

<222> LOCATION: (230)...(1312)

<400> SEQUENCE: 168

aggaggaccg cggcgggagc agcctcgagc cgtgcagccg gctccggcac cttgccgacg 60

ctcgtaggag ccgccgcggc tgacaggggc ggcgggtcgc agcctccaca cctgcgcggg 120

tggcgggcgc ggggtccggt ctgccgcggg cgggcgcaga ggagagcgtg cggctgcagg 180

caggagcccc cgctcggcca cctcctcgcc ccgctgctgc cgctggaag atg tcg cag 238

Met Ser Gln

1

gag agg ccc acg ttc tac cgg cag gag ctg aac aag acc atc tgg gag 286

Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu Asn Lys Thr Ile Trp Glu

5 10 15

gtg ccc gaa cga tac cag aac ctg tcc ccg gtg ggc tcg ggc gcc tat 334

Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro Val Gly Ser Gly Ala Tyr

20 25 30 35

ggc tcg gtg tgt gct gct ttt gat aca aag acg ggg cat cgt gtg gca 382

Gly Ser Val Cys Ala Ala Phe Asp Thr Lys Thr Gly His Arg Val Ala

40 45 50

gtt aag aag ctg tcg aga ccg ttt cag tcc atc att cac gcc aaa agg 430

Val Lys Lys Leu Ser Arg Pro Phe Gln Ser Ile Ile His Ala Lys Arg

55 60 65

acc tac cga gag ttg cgt ctg ctg aag cac atg aaa cac gaa aat gtg 478

Thr Tyr Arg Glu Leu Arg Leu Leu Lys His Met Lys His Glu Asn Val

70 75 80

att ggt ctg ttg gat gtg ttc aca ccc gca agg tca ctg gag gaa ttc 526

Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Arg Ser Leu Glu Glu Phe

85 90 95

aat gac gtg tac ctg gtg acc cat ctc atg ggg gcg gac ctg aac aac 574

Asn Asp Val Tyr Leu Val Thr His Leu Met Gly Ala Asp Leu Asn Asn

100 105 110 115

atc gtg aag tgc cag aag ctg acc gac gac cac gtt cag ttt ctc atc 622

Ile Val Lys Cys Gln Lys Leu Thr Asp Asp His Val Gln Phe Leu Ile

120 125 130

tac cag atc ctc cga ggg ctg aag tat ata cat tcg gct gac ata att 670

Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile His Ser Ala Asp Ile Ile

135 140 145

cac agg gac cta aag ccc agc aac cta gct gtg aac gaa gac tgt gag 718

His Arg Asp Leu Lys Pro Ser Asn Leu Ala Val Asn Glu Asp Cys Glu

150 155 160

ctc aag att ctg gat ttt ggg ctg gct cgg cac act gat gat gag atg 766

Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg His Thr Asp Asp Glu Met

165 170 175

aca ggc tac gtg gct acc agg tgg tac cga gcc cca gag atc atg ctg 814

Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro Glu Ile Met Leu

180 185 190 195

aat tgg atg cac tat aac cag aca gtg gat att tgg tcc gtg ggc tgc 862

Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp Ser Val Gly Cys

200 205 210

atc atg gct gag ctg ttg acc gga aga acg ttg ttt cct ggt aca gac 910

Ile Met Ala Glu Leu Leu Thr Gly Arg Thr Leu Phe Pro Gly Thr Asp

215 220 225

cat att aac cag ctt cag cag ata atg cgt atg acg ggg aca ccc cct 958

His Ile Asn Gln Leu Gln Gln Ile Met Arg Met Thr Gly Thr Pro Pro

230 235 240

gct tat ctc att aac agg atg cca agc cat gag gca aga aac tac att 1006

Ala Tyr Leu Ile Asn Arg Met Pro Ser His Glu Ala Arg Asn Tyr Ile

245 250 255

cag tct ctg gcc cag atg ccg aag atg aac ttc gca aat gta ttt att 1054

Gln Ser Leu Ala Gln Met Pro Lys Met Asn Phe Ala Asn Val Phe Ile

260 265 270 275

ggt gcc aat ccc ctg gct gtc gac cta ctg gag aag atg ctc gtt ttg 1102

Gly Ala Asn Pro Leu Ala Val Asp Leu Leu Glu Lys Met Leu Val Leu

280 285 290

gac tca gat aag agg atc aca gca gcc caa gct ctt gcg cat gcc tac 1150

Asp Ser Asp Lys Arg Ile Thr Ala Ala Gln Ala Leu Ala His Ala Tyr

295 300 305

ttt gct cag tac cac gac cct gat gat gag cct gtt gct gac cct tat 1198

Phe Ala Gln Tyr His Asp Pro Asp Asp Glu Pro Val Ala Asp Pro Tyr

310 315 320

gac cag tcc ttt gaa agc agg gac ctt ctc ata gat gag tgg aag agc 1246

Asp Gln Ser Phe Glu Ser Arg Asp Leu Leu Ile Asp Glu Trp Lys Ser

325 330 335

ctg acc tat gat gaa gtc atc agc ttt gtg cca cca ccc ctt gac caa 1294

Leu Thr Tyr Asp Glu Val Ile Ser Phe Val Pro Pro Pro Leu Asp Gln

340 345 350 355

gaa gaa atg gag tcc tga gcacctggtt tctgttctgt ctatctcact 1342

Glu Glu Met Glu Ser

360

tcactgtgag gggaagacct tctcatggga actctccaaa taccattcaa gtgcctcttg 1402

ttgaaagatt ccttcatggt ggaagggggt gcatgtatgt gttagtgttt gtgtgtgtgt 1462

gtgtgtctgt ctgttcgtct gtccacctat ctttgtggaa gtcactgtga tggtagtgac 1522

tttatgagtt gtgaatggtc cttggcagtc tgcctgcttt ctcagagtct gggcaggccg 1582

atgggaactg tcatctcctt agggatgtgt gtgttcagtg caaagtaaga aatatgaaaa 1642

tatccctgtt cttagttacc ttgccacttt ggcttctcct gtggccctgc ctttaccata 1702

tcagtgacag agagaggctg cttcaggtct gaggctatcc ctcagccatg cataaagtcc 1762

aagagaacca actggctcct ggtctctagc ctgtgaccgg cttgcttaat gtcctcagaa 1822

cctgacaggt atgttcaaaa ctgtcagtct gtttgtgcct taaaagggtg agaagggcgc 1882

gtagatagtt acagagtctc agctgctgac gttctgagcc aggcaagtgc acggggctgt 1942

tggatggcca gtggggagct ggaaaaaaca aggcagcctt taggaaggcc atggtgcatg 2002

tgtgtgcatg cgtgtatgtg cagccgccct ccctcacttc aggagcaagc tgtttgctgt 2062

gcttaccctt cacctcagtg cagaggtctc cagtgccgag cacaggcacc tgccatcagt 2122

agttcctgtg tcatcttcac atctagcaga gcacggatgt gtttgcatgc tgtgctcttg 2182

gagcttgtcc tgtcttctgg aagccctgga caaggcgtgt gaaggcttcc cagaagttcc 2242

tgtccacatt gcctccgccc accgacgcca tgggcacact gctccctcct cctcctccag 2302

ctactttgtg ttgaacacaa ttgattctcc aggtgctcat ggtgcaggaa aacaggacag 2362

acagagagca ctgaaccctt gccatctgat gtcaccaatt caggaaaacg agtcctctcc 2422

taggactatc cccggttctg gaaatcatgt tctcctcact catggtgaca agctaagaaa 2482

gctgaacaaa gggagagacg agagcgcctg aagccaggag ctcctttact atctttctca 2542

aaagggttgt tagacacaaa ccaagtcatc aaggccccgc tcctctcctc ggaagggtcc 2602

cccacccccc ggcagcttga cactgaatcc agtgtcaatt tggggagaaa gcagttttgt 2662

cttggaattt tgtatgttgt aggaatcctt agagagtgtg gttccttctg atggggagaa 2722

agggcaaatt attttaatat tttgtatttt cacctttata aacatgaatc ctcaggggtg 2782

aagaactgtt tgcataattt tctgaatttt gagcactttg tgctatataa ggacccatat 2842

ttaagctttg tgtgcagtaa gaaagtgtaa agccaattcc agtgttggac gtgacaggtc 2902

ttgtgtttag gtcaaggtgt ctcctctcag tgcagggaca tgcctgctct gtggggcagg 2962

cgaggaccct gaatcatttg gagcccagaa ggaggcagac tggccaggtc tcaccacctc 3022

agtgtgcagt tcaactccat gccatcccat caagatgggt tagtagcagt gtctgttttt 3082

gaatgccaag tgtgatttcc aacaattctg ctctggttat ttcattgaag acatctttgc 3142

acatgtgacc atgctgtgtt aggggctgtg ttccagggac tggactcgaa gctagaactg 3202

gcagaagagt tctggcatcc acagcgcaat gctgccacca cccagtttct tcatcagaag 3262

acaagggaac gagaaaactg ctgttcgttt gtatttgtga acttggctgt aatctggtat 3322

gccataggat gtcagataat accactggtt 3352

<210> SEQ ID NO 169

<211> LENGTH: 503

<212> TYPE: DNA

<213> ORGANISM: M. musculus

<400> SEQUENCE: 169

cgcaagaata aagtcagtgg tcacaaatag agggggtcag tggctagaag aagagtaagc 60

ctgaattgag catcccagac agtggtccat acgggccgtc agctagctca ttccctgaga 120

tcactaacac tactgaacat agtcattctg aaagtctgtg tttttacagg caagaaacta 180

cattcagtct ctggcccag atg ccg aag atg aac ttc gca aat gta ttt att 232

ggt gcc aat ccc ctg gct gtc gac cta ctg gag aag atg ctc gtt ttg 280

gac tca gat aag agg atc aca gca gcc caa gct ctt gcg cat gct act 328

ttg ctc agt acc acg acc ctg atg atg agc ctg ttg ctg acc ctt atg 376

acc agt cct ttg aaa gca ggg acc ttc tca tag atgagtggaa gagcctgacc 429

tatgatgaag tcatcagctt tgtgccacca ccccttgacc aagaagagat ggagtcctga 489

gcacctggtt tctg 503

<210> SEQ ID NO 170

<211> LENGTH: 1500

<212> TYPE: DNA

<213> ORGANISM: M. musculus

<220> FEATURE:

<221> NAME/KEY: CDS

<222> LOCATION: (297)...(1073)

<400> SEQUENCE: 170

cgggcgctga agcgcgagcg ggtgtcttgc ggcgtcggcg tgcgctccct ccccggggag 60

cggctgcagg aggaccgcgg cgggagcagc ctcgagccgt gcagccggct ccggcacctt 120

gccgacgctc gtaggagccg ccgcggctga caggggcggc gggtcgcagc ctccacacct 180

gcgcgggtgg cgggcgcggg gtccggtctg ccgcgggcgg gcgcagagga gagcgtgcgg 240

ctgcaggcag gagcccccgc tcggccacct cctcgccccg ctgctgccgc tggaag atg 299

Met

1

tcg cag gag agg ccc acg ttc tac cgg cag gag ctg aac aag acc atc 347

Ser Gln Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu Asn Lys Thr Ile

5 10 15

tgg gag gtg ccc gaa cga tac cag aac ctg tcc ccg gtg ggc tcg ggc 395

Trp Glu Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro Val Gly Ser Gly

20 25 30

gcc tat ggc tcg gtg tgt gct gct ttt gat aca aag acg ggg cat cgt 443

Ala Tyr Gly Ser Val Cys Ala Ala Phe Asp Thr Lys Thr Gly His Arg

35 40 45

gtg gca gtt aag aag ctg tcg aga ccg ttt cag tcc atc att cac gcc 491

Val Ala Val Lys Lys Leu Ser Arg Pro Phe Gln Ser Ile Ile His Ala

50 55 60 65

aaa agg acc tac cga gag ttg cgt ctg ctg aag cac atg aaa cac gaa 539

Lys Arg Thr Tyr Arg Glu Leu Arg Leu Leu Lys His Met Lys His Glu

70 75 80

aat gtg att ggt ctg ttg gat gtg ttc aca ccc gca agg tca ctg gag 587

Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Arg Ser Leu Glu

85 90 95

gaa ttc aat gac gtg tac ctg gtg acc cat ctc atg ggg gcg gac ctg 635

Glu Phe Asn Asp Val Tyr Leu Val Thr His Leu Met Gly Ala Asp Leu

100 105 110

aac aac atc gtg aag tgc cag aag ctg acc gac gac cac gtt cag ttt 683

Asn Asn Ile Val Lys Cys Gln Lys Leu Thr Asp Asp His Val Gln Phe

115 120 125

ctc atc tac cag atc ctc cga ggg ctg aag tat ata cat tcg gct gac 731

Leu Ile Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile His Ser Ala Asp

130 135 140 145

ata att cac agg gac cta aag ccc agc aac cta gct gtg aac gaa gac 779

Ile Ile His Arg Asp Leu Lys Pro Ser Asn Leu Ala Val Asn Glu Asp

150 155 160

tgt gag ctc aag att ctg gat ttt ggg ctg gct cgg cac act gat gat 827

Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg His Thr Asp Asp

165 170 175

gag atg aca ggc tac gtg gct acc agg tgg tac cga gcc cca gag atc 875

Glu Met Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro Glu Ile

180 185 190

atg ctg aat tgg atg cac tat aac cag aca gtg gat att tgg tcc gtg 923

Met Leu Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp Ser Val

195 200 205

ggc tgc atc atg gct gag ctg ttg acc gga aga acg ttg ttt cct ggt 971

Gly Cys Ile Met Ala Glu Leu Leu Thr Gly Arg Thr Leu Phe Pro Gly

210 215 220 225

aca gac cat att gat cag ttg aag ctc att tta aga ctc gtt gga acc 1019

Thr Asp His Ile Asp Gln Leu Lys Leu Ile Leu Arg Leu Val Gly Thr

230 235 240

cca ggg gct gag ctt ctg aag aaa atc tcc tca gag tct gat gcc aag 1067

Pro Gly Ala Glu Leu Leu Lys Lys Ile Ser Ser Glu Ser Asp Ala Lys

245 250 255

cca tga ggtgagaaca aacagcatgc acagggaagt ctacctcgga ggccaccttc 1123

Pro

tcgtggtagt gtctgtgtat agccagcagt ttctaatgtc accgaatgct tgcatgtgcc 1183

ccaagaaccg ttaaagcagt actggctgtg tgctagcgga gtgttggcat ttaggatgca 1243

gtctcctgag cctgcgaggc agcgatgcag tgtagggcag tgttccctag tgtttggctt 1303

tctgatcttg tgcttgaggt aacaagtgtc gttgcagttg tatgtagtta gggtgtgcta 1363

cagccgtgtc atgggtgcat ggaacagagt tcattagtgt gctttgctct ccacccattt 1423

tacaaccaag agaagactgc atgcaagcac gcactataaa attccttgtg ctaataaaaa 1483

aaaaaaaaaa aaaaaaa 1500

<210> SEQ ID NO 171

<211> LENGTH: 384

<212> TYPE: DNA

<213> ORGANISM: M. musculus

<400> SEQUENCE: 171

ttgcaaggac gctccagctc gccgcttagt cacataccac tgctcatttc agtattgttt 60

gacaaaacag ttttccatac cgagcagagg ggcgcccctc aagatcaaga agtgctgctt 120

ttgatacaaa gacggggcat cgtgtggcag ttaagaagct gtcgagaccg tttcagtcca 180

tcattcacgc caaaaggacc taccgagagt tgcgtctgct gaagcacatg aaacacgaaa 240

atgtgattgg tctgttggat gtgttcacac ccgcaaggtc actggaggaa ttcaatgacg 300

tgtacctggt gacccatctc atgggggcgg acctgaacaa catcgtgaag tgccagaagc 360

tgaccgacga ccacgttcag tttc 384

<210> SEQ ID NO 172

<211> LENGTH: 463

<212> TYPE: DNA

<213> ORGANISM: M. musculus

<220> FEATURE:

<221> NAME/KEY: misc_feature

<222> LOCATION: 429

<223> OTHER INFORMATION: n = A, T, C, or G

<400> SEQUENCE: 172

atattgggta agatctggat tcagagcggg gcctccttgg agctgttctc gcgagagttc 60

cgcgagaggc tcccggccgc tgcctgtggg atcgccgcca ctggagccca agcggggcgc 120

tgaagcgcga gcgggtgtct tgcggcgtcg gcgtgcgctc cctccccggg gagcggctgc 180

aggaggaccg cggcgggagc agcctcgagc cgtgcagccg gctccggcac cttgccgacg 240

ctcgtaggag ccgccgcggc tgacaggggc ggcgggtcgc accctccaca cctgcgcggg 300

tggcgggcgc ggggtccggt ctgccgcggg cgggcgcaga ggagagcgtg cggctgcagg 360

caggagcccc cgctcggcca cctcctcgcc ccgctgctgc cgctggaaga tgtcgcagga 420

gaggcccang ttctaccggc aggagctgaa caagaccatc tgg 463

<210> SEQ ID NO 173

<211> LENGTH: 1083

<212> TYPE: DNA

<213> ORGANISM: R. norvegicus

<220> FEATURE:

<221> NAME/KEY: CDS

<222> LOCATION: (1)...(1083)

<400> SEQUENCE: 173

atg tct cag gag agg ccc acg ttc tac cgg cag gag ctg aac aag acc 48

Met Ser Gln Glu Arg Pro Thr Phe Tyr Arg Gln Glu Leu Asn Lys Thr

1 5 10 15

gtc tgg gag gtg ccc gag cga tac cag aac ctg tcc ccg gtg ggc tcg 96

Val Trp Glu Val Pro Glu Arg Tyr Gln Asn Leu Ser Pro Val Gly Ser

20 25 30

gga gcc tac ggc tcg gtg tgt gct gct ttt gat aca aag acg gga cat 144

Gly Ala Tyr Gly Ser Val Cys Ala Ala Phe Asp Thr Lys Thr Gly His

35 40 45

cgt gtg gca gtg aag aag ctg tcg aga ccg gtt cag ccc atc att cac 192

Arg Val Ala Val Lys Lys Leu Ser Arg Pro Val Gln Pro Ile Ile His

50 55 60

gcc aaa agg tcc tac agg gag ctg cgg ctg ctg aag cac atg aag cac 240

Ala Lys Arg Ser Tyr Arg Glu Leu Arg Leu Leu Lys His Met Lys His

65 70 75 80

gag aat gtg att ggt ctg ttg gat gtg ttt aca cct gca agg tcc ctg 288

Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Ala Arg Ser Leu

85 90 95

gag gaa ttc aac gat gtg tac ctg gtg acc cat ctc atg ggg gca gac 336

Glu Glu Phe Asn Asp Val Tyr Leu Val Thr His Leu Met Gly Ala Asp

100 105 110

ctg aac aac atc gtg aag tgt cag aag ctt acc gat gac cac gtt cag 384

Leu Asn Asn Ile Val Lys Cys Gln Lys Leu Thr Asp Asp His Val Gln

115 120 125

ttt ctt atc tac cag atc ctg cga ggg ctg aag tat ata cac tcg gct 432

Phe Leu Ile Tyr Gln Ile Leu Arg Gly Leu Lys Tyr Ile His Ser Ala

130 135 140

gac ata atc cac agg gac cta aag ccc agc aac ctc gct gtg aat gaa 480

Asp Ile Ile His Arg Asp Leu Lys Pro Ser Asn Leu Ala Val Asn Glu

145 150 155 160

gac tgt gag ctg aag att ctg gat ttt ggg ctg gct cgg cac act gat 528

Asp Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg His Thr Asp

165 170 175

gac gaa atg acc ggc tac gtg gct acc cgg tgg tac aga gcc ccc gag 576

Asp Glu Met Thr Gly Tyr Val Ala Thr Arg Trp Tyr Arg Ala Pro Glu

180 185 190

att atg ctg aat tgg atg cac tac aac cag aca gtg gat att tgg tcc 624

Ile Met Leu Asn Trp Met His Tyr Asn Gln Thr Val Asp Ile Trp Ser

195 200 205

gtg ggc tgc atc atg gct gag ctg ttg acc gga aga acg ttg ttt cct 672

Val Gly Cys Ile Met Ala Glu Leu Leu Thr Gly Arg Thr Leu Phe Pro

210 215 220

ggt aca gac cat att gat cag ttg aag ctc att tta aga ctc gtt gga 720

Gly Thr Asp His Ile Asp Gln Leu Lys Leu Ile Leu Arg Leu Val Gly

225 230 235 240

acc cca ggg gct gag ctt ctg aag aaa atc tcc tca gag tct gca aga 768

Thr Pro Gly Ala Glu Leu Leu Lys Lys Ile Ser Ser Glu Ser Ala Arg

245 250 255

aac tac att cag tct ctg gcc cag atg ccg aag atg aac ttc gca aat 816

Asn Tyr Ile Gln Ser Leu Ala Gln Met Pro Lys Met Asn Phe Ala Asn

260 265 270

gta ttt att ggt gcc aat ccc ctg gct gtc gac ctg ctg gaa aag atg 864

Val Phe Ile Gly Ala Asn Pro Leu Ala Val Asp Leu Leu Glu Lys Met

275 280 285

ctg gtt ttg gac tca gat aag agg atc aca gca gcc caa gct ctt gcg 912

Leu Val Leu Asp Ser Asp Lys Arg Ile Thr Ala Ala Gln Ala Leu Ala

290 295 300

cat gcc tac ttt gct cag tac cac gac cct gat gat gag cca gtg gct 960

His Ala Tyr Phe Ala Gln Tyr His Asp Pro Asp Asp Glu Pro Val Ala

305 310 315 320

gac cct tat gac cag tcc ttt gaa agc agg gac ctc ctt ata gac gaa 1008

Asp Pro Tyr Asp Gln Ser Phe Glu Ser Arg Asp Leu Leu Ile Asp Glu

325 330 335

tgg aag agc ctg acc tac gat gaa gtc att agc ttt gtg cca ccg ccc 1056

Trp Lys Ser Leu Thr Tyr Asp Glu Val Ile Ser Phe Val Pro Pro Pro

340 345 350

ctt gac caa gaa gaa atg gac tcc tga 1083

Leu Asp Gln Glu Glu Met Asp Ser

355 360

<210> SEQ ID NO 174

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 174

gtgcgcgcga gcccgaaatc 20

<210> SEQ ID NO 175

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 175

ctgcgacatt ttccagcggc 20

<210> SEQ ID NO 176

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 176

catcatcagg gtcgtggtac 20

<210> SEQ ID NO 177

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 177

aggtgctcag gactccattt 20

<210> SEQ ID NO 178

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 178

gtccctgctt tcaaaggact 20

<210> SEQ ID NO 179

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 179

ggccagagac tgaatgtagt 20

<210> SEQ ID NO 180

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 180

agctcctgcc ggtagaacgt 20

<210> SEQ ID NO 181

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 181

tcaaaagcag cacacaccga 20

<210> SEQ ID NO 182

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 182

cccgtctttg tatcaaaagc 20

<210> SEQ ID NO 183

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 183

aacggtctcg acagcttctt 20

<210> SEQ ID NO 184

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 184

taggtccttt tggcgtgaat 20

<210> SEQ ID NO 185

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 185

agatgggtca ccaggtacac 20

<210> SEQ ID NO 186

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 186

gcccccatga gatgggtcac 20

<210> SEQ ID NO 187

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 187

tcatcagtgt gccgagccag 20

<210> SEQ ID NO 188

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 188

gtcaacagct cagccatgat 20

<210> SEQ ID NO 189

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 189

cgttcttccg gtcaacagct 20

<210> SEQ ID NO 190

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 190

atcaatatgg tctgtaccag 20

<210> SEQ ID NO 191

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 191

cttaaaatga gcttcaactg 20

<210> SEQ ID NO 192

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 192

gggttccaac gagtcttaaa 20

<210> SEQ ID NO 193

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 193

tcagaagctc agcccctggg 20

<210> SEQ ID NO 194

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 194

ggagattttc ttcagaagct 20

<210> SEQ ID NO 195

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 195

cagactctga ggagattttc 20

<210> SEQ ID NO 196

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 196

tagtttcttg cagactctga 20

<210> SEQ ID NO 197

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 197

agactgaatg tagtttcttg 20

<210> SEQ ID NO 198

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 198

ttcatcttcg gcatctgggc 20

<210> SEQ ID NO 199

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 199

atttgcgaag ttcatcttcg 20

<210> SEQ ID NO 200

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 200

caataaatac atttgcgaag 20

<210> SEQ ID NO 201

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 201

ggattggcac caataaatac 20

<210> SEQ ID NO 202

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 202

gctgctgtga tcctcttatc 20

<210> SEQ ID NO 203

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 203

aggcatgcgc aagagcttgg 20

<210> SEQ ID NO 204

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 204

tgagcaaagt aggcatgcgc 20

<210> SEQ ID NO 205

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 205

tcaaaggact ggtcataagg 20

<210> SEQ ID NO 206

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 206

catttcttct tggtcaaggg 20

<210> SEQ ID NO 207

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 207

aggactccat ttcttcttgg 20

<210> SEQ ID NO 208

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 208

cttcccctca cagtgaagtg 20

<210> SEQ ID NO 209

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 209

tatttggaga gttcccatga 20

<210> SEQ ID NO 210

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 210

acttgaatgg tatttggaga 20

<210> SEQ ID NO 211

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 211

aacaagaggc acttgaatgg 20

<210> SEQ ID NO 212

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 212

acccccttcc accatgaagg 20

<210> SEQ ID NO 213

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 213

agcaggcaga ctgccaagga 20

<210> SEQ ID NO 214

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 214

cacacacatc cctaaggaga 20

<210> SEQ ID NO 215

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 215

taaaggcagg gccacaggag 20

<210> SEQ ID NO 216

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 216

gcagcctctc tctgtcactg 20

<210> SEQ ID NO 217

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 217

gggatagcct cagacctgaa 20

<210> SEQ ID NO 218

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 218

gcatggctga gggatagcct 20

<210> SEQ ID NO 219

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 219

gagccagttg gttctcttgg 20

<210> SEQ ID NO 220

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 220

aggcacaaac agactgacag 20

<210> SEQ ID NO 221

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 221

ccttttaagg cacaaacaga 20

<210> SEQ ID NO 222

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 222

gacctctgca ctgaggtgaa 20

<210> SEQ ID NO 223

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 223

ggcactggag acctctgcac 20

<210> SEQ ID NO 224

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 224

agagcacagc atgcaaacac 20

<210> SEQ ID NO 225

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 225

ccagggcttc cagaagacag 20

<210> SEQ ID NO 226

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 226

aaggagctcc tggcttcagg 20

<210> SEQ ID NO 227

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 227

ggattcctac aacatacaaa 20

<210> SEQ ID NO 228

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 228

gaaggaacca cactctctaa 20

<210> SEQ ID NO 229

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 229

tttgcccttt ctccccatca 20

<210> SEQ ID NO 230

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 230

aatattaaaa taatttgccc 20

<210> SEQ ID NO 231

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 231

tcatgtttat aaaggtgaaa 20

<210> SEQ ID NO 232

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 232

ccctgaggat tcatgtttat 20

<210> SEQ ID NO 233

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 233

ggaattggct ttacactttc 20

<210> SEQ ID NO 234

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 234

cgtccaacac tggaattggc 20

<210> SEQ ID NO 235

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 235

ccttctgggc tccaaatgat 20

<210> SEQ ID NO 236

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 236

tctgacatcc tatggcatac 20

<210> SEQ ID NO 237

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 237

gttaatatgg tctgtaccag 20

<210> SEQ ID NO 238

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 238

gctgaagctg gttaatatgg 20

<210> SEQ ID NO 239

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 239

cgcattatct gctgaagctg 20

<210> SEQ ID NO 240

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 240

tgttaatgag ataagcaggg 20

<210> SEQ ID NO 241

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 241

cttggcatcc tgttaatgag 20

<210> SEQ ID NO 242

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 242

tgcctcatgg cttggcatcc 20

<210> SEQ ID NO 243

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 243

actgaatgta gtttcttgcc 20

<210> SEQ ID NO 244

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 244

cttgcctgta aaaacacaga 20

<210> SEQ ID NO 245

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 245

tcacctcatg gcttggcatc 20

<210> SEQ ID NO 246

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 246

tttgttctca cctcatggct 20

<210> SEQ ID NO 247

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 247

tgctggctat acacagacac 20

<210> SEQ ID NO 248

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 248

tggaaaactg ttttgtcaaa 20

<210> SEQ ID NO 249

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 249

actctcgcga gaacagctcc 20

<210> SEQ ID NO 250

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 250

tcccacaggc agcggccggg 20

<210> SEQ ID NO 251

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 251

cccgcttggg ctccagtggc 20

<210> SEQ ID NO 252

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 252

gcagttttct cgttcccttg 20

<210> SEQ ID NO 253

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 253

ctgagcaaag taggcatgcg 20

<210> SEQ ID NO 254

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 254

ggaggcaatg tggacaggaa 20

<210> SEQ ID NO 255

<211> LENGTH: 23

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 255

cattttcgtg tttcatgtgc ttc 23

<210> SEQ ID NO 256

<211> LENGTH: 31

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 256

tattttaacc agtggtatta tctgacatcc t 31

<210> SEQ ID NO 257

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 257

ctgcgacatc ttccagcggc 20

<210> SEQ ID NO 258

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 258

ggtcagcttc tggcacttca 20

<210> SEQ ID NO 259

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 259

aagcaggcag actgccaagg 20

<210> SEQ ID NO 260

<211> LENGTH: 18

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 260

aggcatgcgc aagagctt 18

<210> SEQ ID NO 261

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 261

gggacaggtt ctggtatcgc 20

<210> SEQ ID NO 262

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 262

tctcgtgctt catgtgcttc a 21

<210> SEQ ID NO 263

<211> LENGTH: 21

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 263

tggagctgga ctgcatactg a 21

<210> SEQ ID NO 264

<211> LENGTH: 17

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 264

catcagggtc gtggtac 17

<210> SEQ ID NO 265

<211> LENGTH: 15

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 265

catcatcagg gtcgt 15

<210> SEQ ID NO 266

<211> LENGTH: 20

<212> TYPE: DNA

<213> ORGANISM: Artificial Sequence

<220> FEATURE:

<223> OTHER INFORMATION: Antisense Oligonucleotide

<400> SEQUENCE: 266

agctgatctg gcctacagtt 20

Claims

What is claimed is:

1. A method for treating airway hyperresponsiveness or pulmonary inflammation in an individual in need thereof, comprising administering to said individual an antisense compound 8 to 30 nucleobases in length targeted to a nucleic acid molecule encoding a human p38α MAP kinase protein to said individual.

2. The method of claim 1, wherein said antisense compound is an antisense oligonucleotide.

3. The method of claim 2, wherein at least one covalent linkage of said antisense compound is a modified covalent linkage.

4. The method of claim 2, wherein at least one nucleotide of said antisense compound has a modified sugar moiety.

5. The method of claim 2, wherein at least one nucleotide of said antisense compound has a modified nucleobase.

6. The method of claim 1, further comprising administering an anti-asthma medication to said individual.

7. The method of claim 1 wherein said antisense compound comprises at least one lipophilic moiety which enhances the cellular uptake of said antisense compound.

8. The method of claim 1, wherein said antisense compound is aerosolized and inhaled by said individual.

9. The method of claim 1, wherein said antisense compound is administered intranasally, intrapulmonarily or intratracheally.

10. The method of claim 1, wherein said airway hyperresponsiveness or pulmonary inflammation is associated with asthma.

11. A pharmaceutical composition comprising an antisense oligonucleotide targeted to nucleic acid encoding human p38α MAP kinase in a formulation suitable for intranasal, intrapulmonary or intratracheal administration.

12. The pharmaceutical composition of claim 11, wherein said composition is in a metered dose inhaler or nebulizer.