US20040091488A1 - Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof - Google Patents

Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof Download PDF

Info

Publication number
US20040091488A1
US20040091488A1 US10/412,672 US41267203A US2004091488A1 US 20040091488 A1 US20040091488 A1 US 20040091488A1 US 41267203 A US41267203 A US 41267203A US 2004091488 A1 US2004091488 A1 US 2004091488A1
Authority
US
United States
Prior art keywords
antigenic constructs
specific carrier
class
antigens
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/412,672
Inventor
Gerhard Seeman
Klaus Bosslet
Hans Sedlacek
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer Pharma AG
Original Assignee
Dr. Klaus Bosslet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dr. Klaus Bosslet filed Critical Dr. Klaus Bosslet
Priority to US10/412,672 priority Critical patent/US20040091488A1/en
Publication of US20040091488A1 publication Critical patent/US20040091488A1/en
Assigned to SCHERING AG reassignment SCHERING AG ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BOSSLET, KLAUS
Assigned to BAYER SCHERING PHARMA AKTIENGESELLSCHAFT reassignment BAYER SCHERING PHARMA AKTIENGESELLSCHAFT CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: SCHERING AKTIENGESELLSCHAFT
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6891—Pre-targeting systems involving an antibody for targeting specific cells
    • A61K47/6897—Pre-targeting systems with two or three steps using antibody conjugates; Ligand-antiligand therapies
    • A61K47/6898—Pre-targeting systems with two or three steps using antibody conjugates; Ligand-antiligand therapies using avidin- or biotin-conjugated antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70539—MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
    • C07K17/02—Peptides being immobilised on, or in, an organic carrier
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the invention relates to antigenic constructs resulting from the linkage of major histocompatibility complex (MHC) class I antigens with specific carrier molecules.
  • MHC major histocompatibility complex
  • Tissue-rejection reactions are the strongest-known immune responses mediated by T cells.
  • individuals of the same species they are caused by allogenic differences in class I and class II MHC antigens.
  • any allogenic determinants of the MHC antigens present in the donor tissue are recognized as foreign by allospecific T cells of the recipient, a T cell immune response is induced, and the rejection reaction takes place unless an immunosuppressive therapy has been initiated or such a therapy proves insufficient.
  • MHC class I antigens are glycoproteins which are expressed on the surface of all nucleated cells. They are composed of a heavy chain, which is encoded by MHC class I genes, and of a light chain, the ⁇ 2 -microglobulin which is non-covalently associated with the heavy chain.
  • the extracellular part of the heavy chain is folded in three domains, the first two of these domains (alpha 1 and alpha 2 ) exhibiting a pronounced polymorphism when the amino acid sequences of hitherto known class I MHC antigens from various individuals are compared. They assist with antigen presentation and carry the allogenic determinants.
  • the third extracellular domain has a more conserved sequence.
  • the association with ⁇ 2 -microglobulin is essential for correct folding of the heavy chain and for the transport of the molecule to the cell surface.
  • target-cell-specific carriers for example preferably monoclonal antibodies (mAb), but also polyclonal antibodies or molecules which bind to receptors on cells, can be coupled to the N- or C-terminal end of an allogenic MHC class I molecule without this altering the allogenic determinants in a disadvantageous manner.
  • the MHC class I molecule is brought, with the aid of this target-cell-specific carrier, specifically to the target cells, which leads to activation of allospecific T cells and thus to destruction of the target cells by allospecific cytotoxic T cells.
  • N-terminal end of the MHC class I molecule is located on the side of the alpha 1 and alpha 2 domains which points towards the cell, whereas the allogenic determinants are located on the side of the alpha 1 and alpha 2 domains which faces away from the cell (FIG. 1, FIG. 34).
  • HLA B27w and HLA B27k are two subtypes of the serologically defined HLA B27 specificity which are defined by cytotoxic T lymphocytes.
  • HLA B27w and HLA B27k are two subtypes of the serologically defined HLA B27 specificity which are defined by cytotoxic T lymphocytes.
  • HLA B27w and HLA B27k are two subtypes of the serologically defined HLA B27 specificity which are defined by cytotoxic T lymphocytes.
  • HLA B27w and HLA B27k are two subtypes of the serologically defined HLA B27 specificity which are defined by cytotoxic T lymphocytes.
  • HLA B27w and HLA B27k are two subtypes of the serologically defined HLA B27 specificity which are defined by cytotoxic T lymphocytes.
  • HLA B27w and HLA B27k are two subtypes of the serologically defined HLA B27 specificity which are defined by cytotoxic T lymphocytes.
  • any desired MHC class I antigen to the relevant specific carriers if the above-mentioned antigens do not lead in the relevant recipient to activation of allospecific T cells and subsequent damage to or destruction of the target cells.
  • Target cells may be regarded as cells which are undesired and/or pathogenic in the body, such as, for example, tumor cells.
  • the antigenic constructs according to the invention are accordingly suitable for tumor therapy.
  • the MHC class I antigenic constructs according to the invention to treat other diseases which are caused by cells or the products thereof and are favorably affected by elimination of these cells.
  • the mode of action of the hybrid molecules described in example groups I and II derives from the fact that they are able, because of the specifity of the antibody portion, to bind to an antigen on the cell.
  • the HLA B27 portion of the fused molecule results in masking of the surface of the target cell with an allogenic MHC class I molecule.
  • These allogenic class I molecules can then be recognized by syngeneic, allospecific, cytotoxic T cells, which leads to destruction of the target cells by the allospecific cytotoxic T cells. Accordingly, the invention relates to
  • MHC class I antigens which are linked N- or C-terminally to specific carriers, the linkage preferably being brought about covalently but also possibly being non-covalent, for example by a biotin-avidin bridge, and the specific carriers binding selectively to target cells and denoting preferably monoclonal, but also polyclonal, antibodies, but being very generally receptor-binding molecules which bind to the particular cell receptors,
  • Examples 1-17 detailed hereinafter describe a construct according to the invention composed of the nitrophenol (NP)-specific mouse mAb B/1-8 V H gene (1), of a human IgG C F(ab′) 2 gene (2) and of an HLA B27w gene (3).
  • (1) and (2) are to be regarded in this context as examples of the specific carrier portion—in this case an mAb against NP—whereas (3) represents an HLA class I antigen.
  • the abovementioned construct is, after appropriate transformation, expressed and secreted by those myeloma cells which contain a human ⁇ 2 -microglobulin and a light chain of an immunoglobulin and whose V gene forms with V H B/1-8 a NP binding-site, such as, for example, the mice myeloma cell J 558 L (Oi, V. T., Morrison, S. L., Touchberg, L. A., Berg, P.: Immunoglobulin gene expression in transformed lymphoid cells. Proc. Natl. Acad. Sci. USA 80, 825, 1983). It is possible, by exchanging the V H gene of the heavy chain and using an appropriate light chain, to provide the mAb/HLA B27w fusion product with any desired specificity for which a specific or selective mAb exists.
  • a human IgG 3 C gene was isolated from a human gene bank in EMBL3 phages (Frischholz, A.-M., Lehrach, H., Proustka, A., Murray, N.: Lambda replacement vectors carrying polylinker sequences. J. Mol. Biol. 170, 827-842 (1983) and Seemann, G. H. A., Rein, R. S., Brown, C. S., Ploegh, H. L.: Gene conversion-like mechanisms may generate polymorphism in human class I genes.
  • HLA B27w gene was isolated from a genomic gene bank cloned in EMBL3 bacteriophages (Frischholz, A.-M., loc. cit., and Seemann, G. H. A., loc. cit.) and characterized by restriction mapping and nucleotide sequence analysis (Maxam, A., Gilbert, W.: Sequencing end-labeled DNA with base specific chemical cleavage. Meth. Enzymol. 65, 499560 (1980) and Sanger, F., Nicklen, S., Coulson, A. R.: DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5471i (1977)) (FIG. 5).
  • HLA B27w gene was then digested with the restriction enzymes SstI and BglII and subcloned into the SstI and BamHI cleavage sites of pUC 19. Plasmid clones with the subfragments A, B and C (FIG. 5) were isolated.
  • the plasmid with subfragment A was cleaved completely with SstI and partially with SmaI and, after fractionation on an agarose gel, the fragment A′ (FIG. 6) was cloned in a pUC 19 plasmid cleaved with HincII and SstI.
  • the plasmid with the subfragment B was digested with XbaI, and the resulting XbaI insert (B′) was cloned in a XbaI-cleaved pUC 19 plasmid (FIG. 7).
  • the plasmid with the subfragment C was cleaved completely with HindIII and partially with SstI, and the fragment which, in the HLA B27w gene, is attached to fragment A (C′) was, after fractionation on an agarose gel, isolated and cloned into the Bluescript KS+ phasmid vector (Stratagene, LaJolla, Calif., USA) cleaved with HindIII and SstI (FIG. 8).
  • Single-stranded phages were prepared from the KS+ phasmid vector C′ by infection with VCS-M13 helper phages (Stratagene, Cat # 200251) and were purified (Stratagene: Bluescript Exo/Mung DNA sequencing system: Instruction Manual).
  • the double-stranded phasmids generated in this way were transformed into XL Blue bacteria and then single-stranded phages were again generated from the resulting plasmid clones by infection with helper phages, and the nucleotide sequence was determined with the aid of an oligonucleotide primer II (5′TGAGGGCTCCTGCTT3′) (Sanger, F. et al., loc. cit.).
  • a clone in which the codon TGG (amino acid 274) at the 3′ end of the alpha3 exon had been mutated to a stop codon (TGA) was identified (C′′) (FIG. 9).
  • the plasmid with the fragment A′ was cleaved with SstI and ligated with the C′′ fragment which had been generated by a complete HindIII and partial SstI cleavage of the phasmid clone C′′ and had been isolated after fractionation on an agarose gel. After ligation at 14° C. for 30 minutes, the unligated ends were filled in with T 4 polymerase and subsequently ligated once again. Restriction mapping was used to identify the plasmid D (FIG. 10) in which the fragment A′ is connected to the fragment C′′ via the SstI cleavage site in the alpha2 exon.
  • the plasmid with the fragment D was cleaved with XbaI and ligated with the fragment B′ which had been cut out of the plasmid B′ with XbaI and had been purified after fractionation on an agarose gel (FIG. 11). Nucleotide sequence analyses (17) were used to identify a plasmid (E) in which the B′ fragment is ligated in the correct 5′-3′ orientation to the fragment D.
  • the fragment E was cut out of the plasmid E by cleavage with EcoRI and HindIII, the ends were filled in with T 4 polymerase and purified after fractionation on an agarose gel. This purified fragment E was then ligated with the plasmid which contains the IgG3 F(ab′) 2 3H fragment after the latter had been cleaved and the XbaI ends had been filled in with T 4 polymerase (FIG. 12). Restriction mapping was used to identify the clone which contained the plasmid F, in which the modified HLA B27w gene is fused in the correct 5′-3′orientation to the F(ab′) 2 3H gene.
  • the fragment F was cut out with HindIII and EcoRI in order to place a polylinker in front of the 5′ end of the fragment F.
  • the HindIII and XbaI ends were filled in with T 4 polymerase and cloned into a pUC 19 which had been cleaved with SstI and whose SstI ends had been filled in with T 4 polymerase. Restriction analyses were used to identify the clone with the plasmid G which has the pUC 19 polylinker 5′ from the fragment F (FIG. 13).
  • the plasmid G was cleaved with HindIII and EcoRI, and the insert with the IgG F(ab′) 2 HLA B27w fusion gene was isolated and cloned into a Bluescript KS+ phasmid vector (Stratagene: Bluescript Exo/Mung DNA sequencing system: Instruction Manual) cleaved with HindIII and EcoRI (FIG. 14).
  • the plasmid H resulting from this cloning was then cleaved with BamHI, and the insert was cloned into the eukaryotic expression vector pEV H (Simon, T., Rajewsky, K., Nucl. Acids Res. 16, 354, (1988), which contains the IgG H promoter/enhancer sequences and the V H gene originating from the NP-specific mouse mAb B/1-8 which had been cleaved with BamHI (FIG. 15) (Neuberger, M. N.: EMBO Journal 2, 1375-1378 (1983)). Restriction analysis was used to identify the plasmid I in which the IgG 3 F(ab′) 2 HLA B27w fusion gene is cloned in the correct 5′-3′ orientation behind the V H gene.
  • pEV H eukaryotic expression vector
  • the mAb/HLA B27w fusion gene now possesses intact 5′ and 3′ ends having all the signals required for expression in eukaryotic cells.
  • the construct is, as stated in the introduction, expressed and secreted in every myeloma cell which contains a human ⁇ 2 -microglobulin and a light chain of an immunoglobulin and whose V gene forms with V H B/1-8 a NP binding site, such as, for example, the mouse myeloma cell J 558L (Oi, V. T., Morrison, S. L., Herzenberg, L. A., Berg, P., Proc. Natl. Acad. Sci. USA 80, 825 (1983)).
  • HLA B27w gene was isolated from a genomic gene bank cloned in EMBL3 bacteriophages (Frischholz et al., loc. cit. and Seemann, G. H. A., loc. cit.) and characterized by restriction mapping and nucleotide sequence analysis (Maxam et al., loc. cit. and Sanger et al., loc. cit.) (FIG. 5).
  • HLA B27w gene was then digested with the restriction enzymes SstI and BglII and subcloned into the SstI and BamHI cleavage sites of pUC 19. Plasmid clones with the subfragments A, B and C (FIG. 5) were isolated.
  • the plasmid with the HLA B27 subclone C was partially cleaved with PstI.
  • the protruding 3′ ends of the PstI cleavage sites were removed with T 4 polymerase, with addition of dGTP, and religated with T 4 ligase. Restriction analysis was used to identify the plasmid clone Cl which contains no PstI cleavage site in the intron between the alpha2 and alpha3 exon (FIG. 16).
  • the plasmid clone Cl was cleaved partially with SstI and completely with HindIII, and the Cl′ fragment was isolated and cloned into a double-stranded M13 mp18 vector cleaved with SstI and HindIII.
  • the M13 clone Cl′ with the Cl′ fragment was identified by determining the nucleic acid sequence of the insert (FIG. 17).
  • the mutated clone C2 was identified by restriction analysis of the M13 mp18 double-stranded DNAs and confirmed by nucleic acid sequence analysis (FIG. 18). The mutagenesis resulted in destruction of the PstI restriction cleavage site in the alpha2 exon without altering the reading frame or the encoded amino acid sequence.
  • the plasmid clone with the subfragment B was digested with XbaI, and the resulting XbaI insert (B′) was cloned in an XbaI-cleaved pUC 19 plasmid (FIG. 7).
  • the plasmid clone with the fragment A was cleaved completely with HindII and partially with SmaI, and religated. Restriction analysis was used to identify the clone A′ in which part of the pUC 19 polylinker is deleted (FIG. 21).
  • the plasmid clone A′ was cleaved partially with SstI and ligated with the C2 fragment generated by an SstI cleavage of the plasmid clone C2 and isolated after fractionation on an agarose gel. Restriction mapping was used to identify the plasmid D 1 (FIG. 22) in which the fragment A is connected to the fragment C2 via the SstI cleavage site in the alpha2 exon. The 5′ end of the HLA B27w gene is thus complete.
  • oligonucleotide Va 5′ TCGAATTCCG GCGAGGCAGC TCCCCCAGCT GCACCCGCAG CAGCCGCAGC AGGCCGGCAG GTCCAACTGC AGGA 3′ oligonucleotide Vb: 5′ TCCTGCAGTT GGACCTGCCC GCCTGCTGCG GCTGCTGCGG GTGCAGCTGC GGGAGCTGCC TCGCCGGAAT TCGA 3′
  • the immunoglobulin V gene was synthesized by P. T. Jones et al. (Jones, P. T., Dear, P. H., Foote, J., Neuberger, M. S. Winter, G., Nature 321: 522, (1986)) using oligonucleotides. It contains a PstI restriction cleavage site in the 5′ region of the clone and is cloned as HindIII/BamHI fragment in an M13 mp8 vector whose PstI cleavage site had been destroyed by cleavage, removal of the protruding ends and religation (FIG. 24).
  • a human IgG3 C gene was isolated from a human gene bank in EMBL3 phages (Frischholz et al., loc. cit. and Seeman et al., loc. cit.) and subcloned into the plasmid vector pUC 19 as a HindIII/SphI fragment 3.1 kb in size (clone 54.1.24) (FIG. 2).
  • the plasmid clone 54.1.24 was cleaved with HindII and Asp718, the protruding ends of the Asp718 cleavage site were removed with T 4 polymerase and religated with T 4 ligase. Restriction analysis and nucleic acid sequence determination were used to identify the clone 54.1.24 Delta Pol which, apart from SphI, PstI, SstI and EcoRI, no longer contains any restriction cleavage sites 3′ of the human IgG3 C gene (FIG. 25).
  • the plasmid clone 54.1.24 Delta Pol was digested with BglII and SphI. The protruding ends were removed with T 4 polymerase and religated with T 4 ligase. Restriction analysis and nucleic acid sequence determination were used to identify the clone I which now contains only the CH 1 exon of the human IgG3 C gene (FIG. 26).
  • the plasmid clone I was cleaved with PstI, and the protruding ends were removed with T 4 polymerase.
  • the plasmid clone K was cleaved with HindIII and EcoRI, the protruding ends were removed, and the insert was ligated in an SstI-cleaved pUC 19 plasmid whose ends had likewise been made blunt.
  • the plasmid clone L was cleaved with EcoRI and HindIII, and the insert was purified and ligated into a HindIII- and EcoRI-cleaved KS + vector (Stratagene; Bluescript Exo/Mung DNA Sequencing System) whose PstI cleavage site had previously been destroyed by cleavage with PstI, T 4 polymerase treatment and religation.
  • the clone M from which it is possible to cut out the human C H 1 exon with the HLA class 13′ end by a Bam HI cleavage, was identified (FIG. 29).
  • Double-stranded DNA was prepared from the M13 mp8 clone V and cleaved with BamHI.
  • the KS + clone M was cleaved with BamHI, and the insert M was purified.
  • the M fragment was ligated into the BamHI-cleaved clone V, and nucleic acid sequence determination was used to identify the M13 clone N which contains an intact IgG3 gene (FIG. 30).
  • Double-stranded DNA was prepared from the M13 clone N and was cleaved with EcoRI, and the insert was purified.
  • the plasmid clone D 1 was cleaved with EcoRI and ligated with the fragment N.
  • the phage clone 0 in which the fragment N is cloned in the correct orientation into the clone D 1 was isolated (FIG. 31).
  • the plasmid clone O was subjected to a complete PstI cleavage and partial EcoRI cleavage and ligated with the linker fragment cut out of the plasmid vector L with EcoRI and PstI.
  • the plasmid clone P contains the complete HLA B27w mAb fusion gene (FIG. 32, FIG. 33). This fusion gene can be expressed and secreted in human cells alone or in mouse cells together with the human beta 2 microglobulin gene if the expressing cells also contain an immunoglobulin light chain.
  • alpha 1, alpha 2 and alpha 3 denote the domains of the class I MHC antigen chain.
  • the arrows point to the alpha helices which carry the allodeterminants.
  • CM is meant to represent the cell membrane, and C the cell.
  • EcoRI etc. represents the cleavage with the particular restriction end nuclease or represents the corresponding cleavage site denotes a restriction cleavage site destroyed by religation after filling-in.
  • TM denotes the transmembrane region.
  • 3′NT denotes 3′ non-translated IgH p/E denotes the immunoglobulin heavy chain promoter/enhancer
  • DS-DNA denotes: double-stranded DNA
  • SS-DNA denotes: single-stranded DNA
  • s.CTL denotes: syngeneic cytotoxic T lymphocyte
  • TcR denotes: T-cell receptor
  • a.MHC class I denotes: allogenic MHC class I antigen
  • t.a.a denotes: tumor-associated antigen
  • s.t.c. denotes: syngeneic tumor cell

Abstract

Antigenic constructs which result from linkage of major histocompatibility complex (MHC) class I antigens with specific carrier molecules are described. The linkage is effected N- or C-terminally by covalent bonding or, in the case of non-covalent bonding, for example by an avidin/biotin bridge.
The specific carrier molecules bind selectively to target cells and are preferably monoclonal antibodies. Processes of genetic manipulation for the preparation of such constructs are indicated. Antigenic constructs according to the invention are used to damage or eliminate target cells.

Description

  • The invention relates to antigenic constructs resulting from the linkage of major histocompatibility complex (MHC) class I antigens with specific carrier molecules. [0001]
  • Tissue-rejection reactions are the strongest-known immune responses mediated by T cells. In individuals of the same species they are caused by allogenic differences in class I and class II MHC antigens. In organ transplants, for example, any allogenic determinants of the MHC antigens present in the donor tissue are recognized as foreign by allospecific T cells of the recipient, a T cell immune response is induced, and the rejection reaction takes place unless an immunosuppressive therapy has been initiated or such a therapy proves insufficient. [0002]
  • It is furthermore known that MHC class I antigens are glycoproteins which are expressed on the surface of all nucleated cells. They are composed of a heavy chain, which is encoded by MHC class I genes, and of a light chain, the β[0003] 2-microglobulin which is non-covalently associated with the heavy chain. The extracellular part of the heavy chain is folded in three domains, the first two of these domains (alpha1 and alpha2) exhibiting a pronounced polymorphism when the amino acid sequences of hitherto known class I MHC antigens from various individuals are compared. They assist with antigen presentation and carry the allogenic determinants. The third extracellular domain has a more conserved sequence. The association with β2-microglobulin is essential for correct folding of the heavy chain and for the transport of the molecule to the cell surface.
  • Isolation and characterization of mutated MHC class I antigens in mice showed that merely a few differences in amino acids on the alpha[0004] 1 and alpha2 domains between donor and recipient suffice to induce a rejection reaction (Nathenson et al., Ann. Rev. Immunol., 1986, 4, 471-502). It has also been shown in humans that slight differences between donor and recipient lead to rejection of a transplant (Dausset, J., Rapaport, F. T., Legrand, L., Colombani, J., Marcelli-Barge, A.: Skin allograft survival in 238 human subjects: Role of specific relationships at the four gene sites of the first and the second HL-A loci., Histocompatibility Testing (1970) pages 381-397, Terasaki P. I. (Ed.)). The task which presented itself from that said above was to utilize the specific inducibility and strength of the cellular immune response in the tissue-rejection reaction to damage or destroy selected target cells.
  • It has been found that target-cell-specific carriers, for example preferably monoclonal antibodies (mAb), but also polyclonal antibodies or molecules which bind to receptors on cells, can be coupled to the N- or C-terminal end of an allogenic MHC class I molecule without this altering the allogenic determinants in a disadvantageous manner. The MHC class I molecule is brought, with the aid of this target-cell-specific carrier, specifically to the target cells, which leads to activation of allospecific T cells and thus to destruction of the target cells by allospecific cytotoxic T cells. One explanation for the success of the coupling of a target-cell-specific carrier to the N- or C-terminal end of a MHC class I molecule while retaining the allogenic determinants is that the N-terminal end of the MHC class I molecule is located on the side of the alpha[0005] 1 and alpha2 domains which points towards the cell, whereas the allogenic determinants are located on the side of the alpha1 and alpha2 domains which faces away from the cell (FIG. 1, FIG. 34).
  • Because of the great polymorphism of the MHC class I antigens in the human population, it is possible to induce a rejection reaction in almost 100% of the population with the aid of only two different MHC class I molecules selected, for example HLA B27w and HLA B27k. HLA B27w and HLA B27k are two subtypes of the serologically defined HLA B27 specificity which are defined by cytotoxic T lymphocytes. In the caucasoid population about 7% of individuals express HLA B27w and about 1% express HLA B27k. The use of, for example, both HLA B27 subtypes for the allogenization in accordance with this invention makes it possible to treat almost 100% of the caucasoid population. However, it is possible according to the invention to couple any desired MHC class I antigen to the relevant specific carriers if the above-mentioned antigens do not lead in the relevant recipient to activation of allospecific T cells and subsequent damage to or destruction of the target cells. Target cells may be regarded as cells which are undesired and/or pathogenic in the body, such as, for example, tumor cells. The antigenic constructs according to the invention are accordingly suitable for tumor therapy. However, it is also possible with the MHC class I antigenic constructs according to the invention to treat other diseases which are caused by cells or the products thereof and are favorably affected by elimination of these cells. The mode of action of the hybrid molecules described in example groups I and II derives from the fact that they are able, because of the specifity of the antibody portion, to bind to an antigen on the cell. The HLA B27 portion of the fused molecule results in masking of the surface of the target cell with an allogenic MHC class I molecule. These allogenic class I molecules can then be recognized by syngeneic, allospecific, cytotoxic T cells, which leads to destruction of the target cells by the allospecific cytotoxic T cells. Accordingly, the invention relates to [0006]
  • a) MHC class I antigens which are linked N- or C-terminally to specific carriers, the linkage preferably being brought about covalently but also possibly being non-covalent, for example by a biotin-avidin bridge, and the specific carriers binding selectively to target cells and denoting preferably monoclonal, but also polyclonal, antibodies, but being very generally receptor-binding molecules which bind to the particular cell receptors, [0007]
  • b) a process for the preparation of the MHC class I antigenic constructs, and [0008]
  • c) the use of the MHC class I antigenic constructs mentioned in a) and b) for damaging or eliminating target cells. [0009]
  • The invention is furthermore described in the examples which follow and in the patent claims, but it is not to be regarded as restricted thereto. [0010]
  • Examples 1-17 detailed hereinafter describe a construct according to the invention composed of the nitrophenol (NP)-specific mouse mAb B/1-8 V[0011] H gene (1), of a human IgG C F(ab′)2 gene (2) and of an HLA B27w gene (3). (1) and (2) are to be regarded in this context as examples of the specific carrier portion—in this case an mAb against NP—whereas (3) represents an HLA class I antigen.
  • The abovementioned construct is, after appropriate transformation, expressed and secreted by those myeloma cells which contain a human β[0012] 2-microglobulin and a light chain of an immunoglobulin and whose V gene forms with VH B/1-8 a NP binding-site, such as, for example, the mice myeloma cell J 558 L (Oi, V. T., Morrison, S. L., Herzenberg, L. A., Berg, P.: Immunoglobulin gene expression in transformed lymphoid cells. Proc. Natl. Acad. Sci. USA 80, 825, 1983). It is possible, by exchanging the VH gene of the heavy chain and using an appropriate light chain, to provide the mAb/HLA B27w fusion product with any desired specificity for which a specific or selective mAb exists.
    •  EXAMPLES
  • I Examples 1 to 13 Show the Construction of an HLA B27/mAb Fusion Gene with the HLA B27 Portion at the 3′ End of the Monoclonal Antibody [0013]
  • A) Preparation of the mAb C Gene Portion (IgG[0014] 3 C Gene)
    • Example 1
  • A human IgG[0015] 3 C gene was isolated from a human gene bank in EMBL3 phages (Frischauf, A.-M., Lehrach, H., Proustka, A., Murray, N.: Lambda replacement vectors carrying polylinker sequences. J. Mol. Biol. 170, 827-842 (1983) and Seemann, G. H. A., Rein, R. S., Brown, C. S., Ploegh, H. L.: Gene conversion-like mechanisms may generate polymorphism in human class I genes. The EMBO Journal 5, 547-552 (1986)) and subcloned as a HindIII/Sph I fragment 3.1 kb in size into the plasmid vector pUC 19 (clone 54.1.24) (FIG. 2).
  • All the techniques used in these and in the following examples were taken, unless otherwise indicated, from Lehrach, H. and Frischauf, A.-M. Laboratory Manual EMBL (1982), Heidelberg; Maniatis, T., Fritsch, E. F., Sambrook, J.: Molecular Cloning: A laboratory manual (1982), Cold Spring Harbor Laboratory. [0016]
    • Example 2
  • The 54.1.24 clone was subjected to complete HindIII and partial PstI restriction digestion. This results, inter alia, in restriction fragments which contain the C[0017] H1 exon and one, two or three hinge exons. These fragments were cut out of an agarose gel and cloned into a pUC 19 vector cut with HindIII and PstI (FIG. 3).
  • The plasmid clone with the C[0018] H1 and three hinge exons (F(ab′)2 3H) was then cleaved with BamHI and Asp 718, the cleavage sites were filled in and religated with T4 ligase (FIG. 4). This deletes the pUC 19 polylinker between the Xba I and the SstI cleavage site.
  • I B) Preparation of the HLA B27 Gene [0019]
    • Example 3
  • An HLA B27w gene was isolated from a genomic gene bank cloned in EMBL3 bacteriophages (Frischauf, A.-M., loc. cit., and Seemann, G. H. A., loc. cit.) and characterized by restriction mapping and nucleotide sequence analysis (Maxam, A., Gilbert, W.: Sequencing end-labeled DNA with base specific chemical cleavage. Meth. Enzymol. 65, 499560 (1980) and Sanger, F., Nicklen, S., Coulson, A. R.: DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5471i (1977)) (FIG. 5). [0020]
  • The HLA B27w gene was then digested with the restriction enzymes SstI and BglII and subcloned into the SstI and BamHI cleavage sites of [0021] pUC 19. Plasmid clones with the subfragments A, B and C (FIG. 5) were isolated.
    • Example 4
  • The plasmid with subfragment A was cleaved completely with SstI and partially with SmaI and, after fractionation on an agarose gel, the fragment A′ (FIG. 6) was cloned in a [0022] pUC 19 plasmid cleaved with HincII and SstI.
    • Example 5
  • The plasmid with the subfragment B was digested with XbaI, and the resulting XbaI insert (B′) was cloned in a XbaI-cleaved [0023] pUC 19 plasmid (FIG. 7).
    • Example 6
  • The plasmid with the subfragment C was cleaved completely with HindIII and partially with SstI, and the fragment which, in the HLA B27w gene, is attached to fragment A (C′) was, after fractionation on an agarose gel, isolated and cloned into the Bluescript KS+ phasmid vector (Stratagene, LaJolla, Calif., USA) cleaved with HindIII and SstI (FIG. 8). [0024]
    • Example 7
  • Single-stranded phages were prepared from the KS+ phasmid vector C′ by infection with VCS-M13 helper phages (Stratagene, Cat # 200251) and were purified (Stratagene: Bluescript Exo/Mung DNA sequencing system: Instruction Manual). A synthetic oligonucleotide (I=5′CCTTACCTCATCTCAGG3′) was hybridized onto these single strands, and the remainder of the second strand was synthesized using Klenow polymerase. The double-stranded phasmids generated in this way were transformed into XL Blue bacteria and then single-stranded phages were again generated from the resulting plasmid clones by infection with helper phages, and the nucleotide sequence was determined with the aid of an oligonucleotide primer II (5′TGAGGGCTCCTGCTT3′) (Sanger, F. et al., loc. cit.). A clone in which the codon TGG (amino acid 274) at the 3′ end of the alpha3 exon had been mutated to a stop codon (TGA) was identified (C″) (FIG. 9). [0025]
    • Example 8
  • The plasmid with the fragment A′ was cleaved with SstI and ligated with the C″ fragment which had been generated by a complete HindIII and partial SstI cleavage of the phasmid clone C″ and had been isolated after fractionation on an agarose gel. After ligation at 14° C. for 30 minutes, the unligated ends were filled in with T[0026] 4 polymerase and subsequently ligated once again. Restriction mapping was used to identify the plasmid D (FIG. 10) in which the fragment A′ is connected to the fragment C″ via the SstI cleavage site in the alpha2 exon.
    • Example 9
  • The plasmid with the fragment D was cleaved with XbaI and ligated with the fragment B′ which had been cut out of the plasmid B′ with XbaI and had been purified after fractionation on an agarose gel (FIG. 11). Nucleotide sequence analyses (17) were used to identify a plasmid (E) in which the B′ fragment is ligated in the correct 5′-3′ orientation to the fragment D. [0027]
  • C) Fusion of the Modified HLA B27w Gene with the IgG3 C F(ab′)[0028] 2 3H Gene Fragment
    • Example 10
  • The fragment E was cut out of the plasmid E by cleavage with EcoRI and HindIII, the ends were filled in with T[0029] 4 polymerase and purified after fractionation on an agarose gel. This purified fragment E was then ligated with the plasmid which contains the IgG3 F(ab′)2 3H fragment after the latter had been cleaved and the XbaI ends had been filled in with T4 polymerase (FIG. 12). Restriction mapping was used to identify the clone which contained the plasmid F, in which the modified HLA B27w gene is fused in the correct 5′-3′orientation to the F(ab′)2 3H gene.
    • Example 11
  • The fragment F was cut out with HindIII and EcoRI in order to place a polylinker in front of the 5′ end of the fragment F. The HindIII and XbaI ends were filled in with T[0030] 4 polymerase and cloned into a pUC 19 which had been cleaved with SstI and whose SstI ends had been filled in with T4 polymerase. Restriction analyses were used to identify the clone with the plasmid G which has the pUC 19 polylinker 5′ from the fragment F (FIG. 13).
    • Example 12
  • The plasmid G was cleaved with HindIII and EcoRI, and the insert with the IgG F(ab′)[0031] 2 HLA B27w fusion gene was isolated and cloned into a Bluescript KS+ phasmid vector (Stratagene: Bluescript Exo/Mung DNA sequencing system: Instruction Manual) cleaved with HindIII and EcoRI (FIG. 14).
    • Example 13
  • The plasmid H resulting from this cloning was then cleaved with BamHI, and the insert was cloned into the eukaryotic expression vector pEV[0032] H (Simon, T., Rajewsky, K., Nucl. Acids Res. 16, 354, (1988), which contains the IgG H promoter/enhancer sequences and the VH gene originating from the NP-specific mouse mAb B/1-8 which had been cleaved with BamHI (FIG. 15) (Neuberger, M. N.: EMBO Journal 2, 1375-1378 (1983)). Restriction analysis was used to identify the plasmid I in which the IgG 3 F(ab′)2 HLA B27w fusion gene is cloned in the correct 5′-3′ orientation behind the VH gene.
  • The mAb/HLA B27w fusion gene now possesses intact 5′ and 3′ ends having all the signals required for expression in eukaryotic cells. The construct is, as stated in the introduction, expressed and secreted in every myeloma cell which contains a human β[0033] 2-microglobulin and a light chain of an immunoglobulin and whose V gene forms with VH B/1-8 a NP binding site, such as, for example, the mouse myeloma cell J 558L (Oi, V. T., Morrison, S. L., Herzenberg, L. A., Berg, P., Proc. Natl. Acad. Sci. USA 80, 825 (1983)).
  • II Examples 14 to 17 Show the Construction of an HLA B27/mAb Fusion Gene with the HLA B27 Portion at the 5′ End of the Monoclonal Antibody [0034]
  • A) Preparation of the HLA B27 Gene [0035]
    • Example 14
  • An HLA B27w gene was isolated from a genomic gene bank cloned in EMBL3 bacteriophages (Frischauf et al., loc. cit. and Seemann, G. H. A., loc. cit.) and characterized by restriction mapping and nucleotide sequence analysis (Maxam et al., loc. cit. and Sanger et al., loc. cit.) (FIG. 5). [0036]
  • The HLA B27w gene was then digested with the restriction enzymes SstI and BglII and subcloned into the SstI and BamHI cleavage sites of [0037] pUC 19. Plasmid clones with the subfragments A, B and C (FIG. 5) were isolated.
  • The plasmid with the HLA B27 subclone C was partially cleaved with PstI. The protruding 3′ ends of the PstI cleavage sites were removed with T[0038] 4 polymerase, with addition of dGTP, and religated with T4 ligase. Restriction analysis was used to identify the plasmid clone Cl which contains no PstI cleavage site in the intron between the alpha2 and alpha3 exon (FIG. 16).
  • The plasmid clone Cl was cleaved partially with SstI and completely with HindIII, and the Cl′ fragment was isolated and cloned into a double-stranded M13 mp18 vector cleaved with SstI and HindIII. The M13 clone Cl′ with the Cl′ fragment was identified by determining the nucleic acid sequence of the insert (FIG. 17). [0039]
  • Using the protocol of the Bio-Rad Muta-Gene M13 mutagenesis kit there were isolated from the Cl′ M13 mp18 phages in the bacterial strain CJ236 single-stranded phages which contained uracils. An oligonucleotide (oligonucleotide III) with the sequence [0040] 5′ GCGCGCTGGAGCGTCTC3′ was hybridized onto these single-stranded phages and the second strand was synthesized with addition of T4 polymerase, DNTP and T4 ligase.
  • After infection of the bacterial strain MV 1190 the mutated clone C2 was identified by restriction analysis of the M13 mp18 double-stranded DNAs and confirmed by nucleic acid sequence analysis (FIG. 18). The mutagenesis resulted in destruction of the PstI restriction cleavage site in the alpha2 exon without altering the reading frame or the encoded amino acid sequence. [0041]
  • Single-stranded phages were in turn produced from the M13 clone C2 in the bacterial strain CJ236 and were hybridized with the oligonucleotide IV (oligonucleotide IV=[0042] 5′GGGGACGGTGGAATTCGAAGACGGCTC3′). The second strand was then synthesized with T4 polymerase, T4 ligase and dNTP. After transformation into MV 1190 bacteria, the M13 mp18 clone C2′ was identified by restriction analysis, and the mutation was verified as correct by nucleotide sequence analysis (FIG. 19). This mutagenesis resulted in an EcoRI and an AsuII cleavage site being introduced into the TM exon of the HLA B27 gene, and in amino acid 279 being converted from glutamine into asparagine (FIG. 20).
    • Example 15
  • The plasmid clone with the subfragment B was digested with XbaI, and the resulting XbaI insert (B′) was cloned in an XbaI-cleaved [0043] pUC 19 plasmid (FIG. 7).
  • The plasmid clone with the fragment A was cleaved completely with HindII and partially with SmaI, and religated. Restriction analysis was used to identify the clone A′ in which part of the [0044] pUC 19 polylinker is deleted (FIG. 21).
  • The plasmid clone A′ was cleaved partially with SstI and ligated with the C2 fragment generated by an SstI cleavage of the plasmid clone C2 and isolated after fractionation on an agarose gel. Restriction mapping was used to identify the plasmid D[0045] 1 (FIG. 22) in which the fragment A is connected to the fragment C2 via the SstI cleavage site in the alpha2 exon. The 5′ end of the HLA B27w gene is thus complete.
  • Construction of the Linker: [0046]
  • Two oligonucleotides were synthesized: [0047]
    oligonucleotide Va:
    5′TCGAATTCCG GCGAGGCAGC TCCCCCAGCT GCACCCGCAG CAGCCGCAGC AGGCCGGCAG GTCCAACTGC AGGA 3′
    oligonucleotide Vb:
    5′TCCTGCAGTT GGACCTGCCC GCCTGCTGCG GCTGCTGCGG GTGCAGCTGC GGGAGCTGCC TCGCCGGAAT TCGA 3′
  • The two oligonucleotides were hybridized together. This resulted in double-stranded DNA fragments with an EcoRI restriction cleavage site at one end and a PstI restriction cleavage site at the other end. These fragments were cleaved with EcoRI and PstI and cloned into an EcoRI- and PstI-cleaved [0048] pUC 19 plasmid vector (FIG. 23). The plasmid clone L was identified by restriction analysis and verified by nucleotide sequence analysis.
  • The immunoglobulin V gene was synthesized by P. T. Jones et al. (Jones, P. T., Dear, P. H., Foote, J., Neuberger, M. S. Winter, G., Nature 321: 522, (1986)) using oligonucleotides. It contains a PstI restriction cleavage site in the 5′ region of the clone and is cloned as HindIII/BamHI fragment in an M13 mp8 vector whose PstI cleavage site had been destroyed by cleavage, removal of the protruding ends and religation (FIG. 24). [0049]
  • II B) Preparation of the mAb C Gene Portion: [0050]
    • Example 16
  • A human IgG3 C gene was isolated from a human gene bank in EMBL3 phages (Frischauf et al., loc. cit. and Seeman et al., loc. cit.) and subcloned into the [0051] plasmid vector pUC 19 as a HindIII/SphI fragment 3.1 kb in size (clone 54.1.24) (FIG. 2).
  • The plasmid clone 54.1.24 was cleaved with HindII and Asp718, the protruding ends of the Asp718 cleavage site were removed with T[0052] 4 polymerase and religated with T4 ligase. Restriction analysis and nucleic acid sequence determination were used to identify the clone 54.1.24 Delta Pol which, apart from SphI, PstI, SstI and EcoRI, no longer contains any restriction cleavage sites 3′ of the human IgG3 C gene (FIG. 25).
  • The plasmid clone 54.1.24 Delta Pol was digested with BglII and SphI. The protruding ends were removed with T[0053] 4 polymerase and religated with T4 ligase. Restriction analysis and nucleic acid sequence determination were used to identify the clone I which now contains only the CH1 exon of the human IgG3 C gene (FIG. 26).
  • The plasmid clone I was cleaved with PstI, and the protruding ends were removed with T[0054] 4 polymerase. The B′ insert which had been cut with XbaI and filled in with T4 polymerase to give blunt ends was ligated into the resulting blunt ends. Restriction analysis and nucleic acid sequence determination were used to identify the clone K (FIG. 27) which contains a human IgG3CH1 exon and a 3′ end of a HLA class I gene.
  • The plasmid clone K was cleaved with HindIII and EcoRI, the protruding ends were removed, and the insert was ligated in an SstI-cleaved [0055] pUC 19 plasmid whose ends had likewise been made blunt. The clone L which harbors the polylinker of the pUC 19 vector 51 from the C H1 exon was identified (FIG. 28).
  • The plasmid clone L was cleaved with EcoRI and HindIII, and the insert was purified and ligated into a HindIII- and EcoRI-cleaved KS[0056] + vector (Stratagene; Bluescript Exo/Mung DNA Sequencing System) whose PstI cleavage site had previously been destroyed by cleavage with PstI, T4 polymerase treatment and religation. The clone M, from which it is possible to cut out the human C H1 exon with the HLA class 13′ end by a Bam HI cleavage, was identified (FIG. 29).
    • Example 17
  • Double-stranded DNA was prepared from the M13 mp8 clone V and cleaved with BamHI. The KS[0057] + clone M was cleaved with BamHI, and the insert M was purified. The M fragment was ligated into the BamHI-cleaved clone V, and nucleic acid sequence determination was used to identify the M13 clone N which contains an intact IgG3 gene (FIG. 30).
  • Double-stranded DNA was prepared from the M13 clone N and was cleaved with EcoRI, and the insert was purified. The plasmid clone D[0058] 1 was cleaved with EcoRI and ligated with the fragment N. The phage clone 0 in which the fragment N is cloned in the correct orientation into the clone D1 was isolated (FIG. 31).
  • The plasmid clone O was subjected to a complete PstI cleavage and partial EcoRI cleavage and ligated with the linker fragment cut out of the plasmid vector L with EcoRI and PstI. The plasmid clone P contains the complete HLA B27w mAb fusion gene (FIG. 32, FIG. 33). This fusion gene can be expressed and secreted in human cells alone or in mouse cells together with the human beta[0059] 2 microglobulin gene if the expressing cells also contain an immunoglobulin light chain.
  • Key to FIG. 1 [0060]
  • [0061] alpha 1, alpha 2 and alpha 3 denote the domains of the class I MHC antigen chain. The arrows point to the alpha helices which carry the allodeterminants. CM is meant to represent the cell membrane, and C the cell.
  • Key to FIG. 2 et Seq. [0062]
  • EcoRI etc. represents the cleavage with the particular restriction end nuclease or represents the corresponding cleavage site denotes a restriction cleavage site destroyed by religation after filling-in. [0063]
  • TM denotes the transmembrane region. [0064]
  • 3′NT denotes 3′ non-translated IgH p/E denotes the immunoglobulin heavy chain promoter/enhancer [0065]
  • * denotes: incomplete digestion [0066]
  • DS-DNA denotes: double-stranded DNA [0067]
  • SS-DNA denotes: single-stranded DNA [0068]
  • Key to FIG. 34: [0069]
  • s.CTL denotes: syngeneic cytotoxic T lymphocyte [0070]
  • TcR denotes: T-cell receptor [0071]
  • a.MHC class I denotes: allogenic MHC class I antigen [0072]
  • t.a.a. denotes: tumor-associated antigen [0073]
  • s.t.c. denotes: syngeneic tumor cell [0074]
  • 1 13 1 17 DNA Artificial Sequence Description of Artificial Sequence Synthetic oligonucleotide 1 ccttacctca tctcagg 17 2 15 DNA Artificial Sequence Description of Artificial Sequence Synthetic oligonucleotide 2 tgagggctcc tgctt 15 3 17 DNA Artificial Sequence Description of Artificial Sequence Synthetic oligonucleotide 3 gcgcgctgga gcgtctc 17 4 27 DNA Artificial Sequence Description of Artificial Sequence Synthetic oligonucleotide 4 ggggacggtg gaattcgaag acggctc 27 5 74 DNA Artificial Sequence Description of Artificial Sequence Synthetic oligonucleotide 5 tcgaattccg gcgaggcagc tcccgcagct gcacccgcag cagccgcagc aggcgggcag 60 gtccaactgc agga 74 6 74 DNA Artificial Sequence Description of Artificial Sequence Synthetic oligonucleotide 6 tcctgcagtt ggacctgccc gcctgctgcg gctgctgcgg gtgcagctgc gggagctgcc 60 tcgccggaat tcga 74 7 28 DNA Artificial Sequence CDS (2)..(28) Description of Artificial Sequence Synthetic oligonucleotide 7 a gag ccg tct tcs mak tcc acc gtc ccc 28 Glu Pro Ser Ser Xaa Ser Thr Val Pro 1 5 8 9 PRT Artificial Sequence Description of Artificial Sequence Synthetic peptide 8 Glu Pro Ser Ser Xaa Ser Thr Val Pro 1 5 9 28 DNA Artificial Sequence CDS (2)..(28) Description of Artificial Sequence Synthetic oligonucleotide 9 a gag ccg tct tcg aat tcc acc gtc ccc 28 Glu Pro Ser Ser Asn Ser Thr Val Pro 1 5 10 9 PRT Artificial Sequence Description of Artificial Sequence Synthetic peptide 10 Glu Pro Ser Ser Asn Ser Thr Val Pro 1 5 11 27 PRT Artificial Sequence Description of Artificial Sequence Synthetic peptide 11 Glu Pro Ser Ser Asn Ser Gly Glu Ala Ala Pro Ala Ala Ala Pro Ala 1 5 10 15 Ala Ala Ala Ala Gly Gly Gln Val Gln Leu Gln 20 25 12 12 PRT Artificial Sequence Description of Artificial Sequence Synthetic peptide 12 Gly Val His Asp Gln Val Gln Leu Gln Glu Ser Gly 1 5 10 13 30 PRT Artificial Sequence Description of Artificial Sequence Synthetic peptide 13 Glu Pro Ser Ser Asn Ser Gly Glu Ala Ala Pro Ala Ala Ala Pro Ala 1 5 10 15 Ala Ala Ala Ala Gly Gly Gln Val Gln Leu Gln Glu Ser Gly 20 25 30

Claims (14)

1. Antigenic constructs in which major histocompatibility complex (MHC) class I antigens are linked at the C- or N-terminal end to specific carrier molecules.
2. Antigenic constructs in which major histocompatibility complex (MHC) class I antigens are linked at the amino-terminal end to specific carrier molecules.
3. Antigenic constructs in which major histocompatibility complex (MHC) class I antigens are linked at the C-terminal end to specific carrier molecules.
4. Antigenic constructs as claimed in claim 1, in which one MHC class I antigen is linked to one specific carrier molecule respectively.
5. Antigenic constructs as claimed in claim 1, in which the specific carrier molecules are CD4 domains.
6. Antigenic constructs as claimed in claim 1, in which the specific carrier molecules are monoclonal antibodies.
7. Antigenic constructs as claimed in claim 6, in which the monoclonal antibodies are shortened in the constant part of the heavy chain.
8. Antigenic constructs as claimed in claim 1, in which the MHC class I antigen is HLA B27w or HLA B27k.
9. Antigenic constructs as claimed in claim 1, in which the MHC class I antigen is covalently bonded to the carrier molecule.
10. Antigenic constructs as claimed in claim 1, in which the MHC class I antigen is bonded via avidin/biotin to the carrier molecule.
11. Antigenic constructs as claimed in claim 1, which are prepared by genetic manipulation by fusion of the DNAs coding for them.
12. A process for the preparation of antigenic constructs as claimed in claim 1, which comprises the required parts of genes being fused in the form of their DNA, being provided with suitable regulation sequences and being expressed in suitable expression systems.
13. The use of the antigenic constructs as claimed in claim 1 for the allogenization of target cells.
14. A pharmaceutical which contains antigenic constructs as claimed in claim 1.
US10/412,672 1988-07-28 2003-04-14 Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof Abandoned US20040091488A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/412,672 US20040091488A1 (en) 1988-07-28 2003-04-14 Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
DEP3825615.0 1988-07-28
DE3825615A DE3825615A1 (en) 1988-07-28 1988-07-28 ANTIGENT CONSTRUCTS OF "MAJOR HISTOCOMPATIBILITY COMPLEX" CLASS I ANTIGENS WITH SPECIFIC CARRIER MOLECULES, THEIR PRODUCTION AND USE
US38553289A 1989-07-26 1989-07-26
US91267792A 1992-07-14 1992-07-14
US08/460,569 US6548067B1 (en) 1988-07-28 1995-06-02 Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof
US10/412,672 US20040091488A1 (en) 1988-07-28 2003-04-14 Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/460,569 Division US6548067B1 (en) 1988-07-28 1995-06-02 Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof

Publications (1)

Publication Number Publication Date
US20040091488A1 true US20040091488A1 (en) 2004-05-13

Family

ID=6359731

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/460,569 Expired - Fee Related US6548067B1 (en) 1988-07-28 1995-06-02 Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof
US10/412,672 Abandoned US20040091488A1 (en) 1988-07-28 2003-04-14 Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/460,569 Expired - Fee Related US6548067B1 (en) 1988-07-28 1995-06-02 Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof

Country Status (12)

Country Link
US (2) US6548067B1 (en)
EP (1) EP0352761B1 (en)
JP (1) JP2812726B2 (en)
KR (1) KR970010760B1 (en)
AT (1) ATE128732T1 (en)
AU (1) AU625065B2 (en)
DE (2) DE3825615A1 (en)
DK (1) DK371089A (en)
ES (1) ES2080055T3 (en)
FI (1) FI100973B (en)
GR (1) GR3017915T3 (en)
PT (1) PT91294B (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050042218A1 (en) * 2003-07-10 2005-02-24 Vaccinex, Inc. MHC class I - peptide-antibody conjugates with modified beta2-microglobulin
US20060269540A1 (en) * 2002-09-27 2006-11-30 Vaccinex, Inc. Targeted cd1d molecules
US20080254045A1 (en) * 2007-02-21 2008-10-16 Alena Donda Modulation of NKT Cell Activity with Antigen-Loaded CD1d Molecules
US20100008920A1 (en) * 2002-07-12 2010-01-14 The Johns Hopkins University Reagents and Methods for Engaging Unique Clonotypic Lymphocyte Receptors
WO2012175508A1 (en) 2011-06-22 2012-12-27 F. Hoffmann-La Roche Ag Removal of target cells by circulating virus-specific cytotoxic t-cells using mhc class i comprising complexes
WO2014083004A1 (en) * 2012-11-30 2014-06-05 Roche Glycart Ag Removal of cancer cells by circulating virus-specific cytotoxic t-cells using cancer cell targeted mhc class i comprising multi-function proteins
US9139809B2 (en) 2009-01-08 2015-09-22 Albert Einstein College Of Medicine Of Yeshiva University Bacterial vaccines with cell wall-associated ceramide-like glycolipids and uses thereof
US9371352B2 (en) 2013-02-08 2016-06-21 Vaccinex, Inc. Modified glycolipids and methods of making and using the same
US10294454B2 (en) 2016-08-24 2019-05-21 General Electric Company Methods and kits for cell activation
US10501521B2 (en) 2012-12-21 2019-12-10 Hoffmann-La Roche Inc. Disulfide-linked multivalent MHC class I comprising multi-function proteins

Families Citing this family (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5525338A (en) * 1992-08-21 1996-06-11 Immunomedics, Inc. Detection and therapy of lesions with biotin/avidin conjugates
DE3825615A1 (en) * 1988-07-28 1990-02-01 Behringwerke Ag ANTIGENT CONSTRUCTS OF "MAJOR HISTOCOMPATIBILITY COMPLEX" CLASS I ANTIGENS WITH SPECIFIC CARRIER MOLECULES, THEIR PRODUCTION AND USE
DE3920358A1 (en) 1989-06-22 1991-01-17 Behringwerke Ag BISPECIFIC AND OLIGO-SPECIFIC, MONO- AND OLIGOVALENT ANTI-BODY CONSTRUCTS, THEIR PRODUCTION AND USE
DE4106389A1 (en) * 1991-02-28 1992-09-03 Behringwerke Ag FUSION PROTEINS FOR PRODRUG ACTIVATION, THEIR PRODUCTION AND USE
US7241595B2 (en) 1989-10-20 2007-07-10 Sanofi-Aventis Pharma Deutschland Gmbh Glycosyl-etoposide prodrugs, a process for preparation thereof and the use thereof in combination with functionalized tumor-specific enzyme conjugates
SE9002484L (en) 1990-07-20 1992-01-21 Kabi Pharmacia Ab NEW SUBSTITUTED POLYETERS
US5885570A (en) * 1991-01-23 1999-03-23 The General Hospital Corporation Induction of tolerance with modified immunogens
JP3105629B2 (en) † 1991-04-23 2000-11-06 サングスタット メディカル コーポレイション Cell activity regulating conjugates of members of specific binding pairs
DE4133791A1 (en) * 1991-10-11 1993-04-15 Behringwerke Ag MONOCLONAL ANTIBODIES AGAINST TUMOR ASSOCIATED ANTIGENS, METHOD FOR THEIR PRODUCTION AND THEIR USE
JPH05246889A (en) * 1992-03-05 1993-09-24 Seitai Chiyousetsu Kenkyusho:Kk Carcinostatic method and carcinostatic agent
US6030797A (en) * 1992-10-08 2000-02-29 Dade Behring Marburg Gmbh Monoclonal antibodies against tumor-associated antigens, processes for the preparation thereof and the use thereof
WO1997024446A2 (en) * 1995-12-29 1997-07-10 Chiron Corporation Gene delivery vehicle-targeting ligands
CA2250166A1 (en) 1996-03-28 1997-10-02 The Johns Hopkins University Soluble divalent and multivalent heterodimeric analogs of proteins
US6458354B1 (en) 1996-03-28 2002-10-01 The Johns Hopkins University Molecular complexes which modify immune responses
US6211342B1 (en) * 1996-07-18 2001-04-03 Children's Hospital Medical Center Multivalent MHC complex peptide fusion protein complex for stimulating specific T cell function
JP2001500479A (en) * 1996-08-23 2001-01-16 マサチューセッツ インスティチュート オブ テクノロジー Allogeneic histocompatibility complex as mediator of cell destruction
US6268411B1 (en) 1997-09-11 2001-07-31 The Johns Hopkins University Use of multivalent chimeric peptide-loaded, MHC/ig molecules to detect, activate or suppress antigen-specific T cell-dependent immune responses
US6248564B1 (en) 1997-08-29 2001-06-19 Harvard University Mutant MHC class I molecules
US20020051783A1 (en) * 1998-06-05 2002-05-02 Savage Philip Michael Method for producing or enhancing a T-cell response against a target cell using a complex comprising an HLA class I molecule and an attaching means
AU2002301994B2 (en) * 1998-06-05 2008-05-15 Alexis Biotech Limited Method for producing cytotoxic T-cells
GB2339782A (en) * 1998-06-05 2000-02-09 Philip Michael Savage Chimeric protein complexes comprising HLA class I antigens
US7521197B2 (en) 1998-06-05 2009-04-21 Alexis Biotech Limited Method for producing cytotoxic T-cells
US7264965B2 (en) 1998-06-05 2007-09-04 Alexis Biotech Limited Method for producing or enhancing a T-cell response against a target cell using a complex comprising an HLA class I molecule and an attaching means
US6197591B1 (en) * 1998-09-14 2001-03-06 Pfizer Inc. Streptomyces avermitilis regulatory genes for increased avermectin production
IL151860A0 (en) * 2000-03-27 2003-04-10 Technion Res & Dev Foundation Single chain class i major histocompatibility complexes, constructs encoding same and methods of generating same
US20040191260A1 (en) 2003-03-26 2004-09-30 Technion Research & Development Foundation Ltd. Compositions capable of specifically binding particular human antigen presenting molecule/pathogen-derived antigen complexes and uses thereof
WO2001074382A1 (en) 2000-03-31 2001-10-11 Purdue Research Foundation Method of treatment using ligand-immunogen conjugates
AU2001255326B2 (en) * 2000-04-12 2005-12-15 University Of Rochester Targeted vaccine delivery systems
DK2336167T3 (en) * 2001-03-14 2019-09-02 Dako Denmark As MHC molecular constructs and their use in diagnosis and therapy
US8022190B2 (en) 2001-06-19 2011-09-20 Technion Research & Development Foundation Ltd. Immuno-molecules containing viral proteins, compositions thereof and methods of using
US20030017134A1 (en) * 2001-06-19 2003-01-23 Technion Research And Development Foundation Ltd. Methods and pharmaceutical compositions for immune deception, particularly useful in the treatment of cancer
US20040210037A1 (en) * 2003-03-28 2004-10-21 Vaccinex, Inc. Targeted MHC class I alpha3 vaccine delivery systems
GB2408507B (en) * 2003-10-06 2005-12-14 Proimmune Ltd Chimeric MHC protein and oligomer thereof for specific targeting
GB2409456B (en) * 2003-10-30 2006-01-04 Proimmune Ltd Oligomeric receptor ligand pair member complexes
US20050287611A1 (en) * 2004-05-07 2005-12-29 Nugent C T Iv MHC bridging system for detecting CTL-mediated lysis of antigen presenting cells
WO2007085266A1 (en) * 2006-01-30 2007-08-02 Dako Denmark A/S High-speed quantification of antigen specific t-cells in whole blood by flow cytometry
CN101448951B (en) * 2006-05-19 2013-04-10 泰华制药工业有限公司 Fusion proteins, uses thereof and processes for producing same
GB2442048B (en) * 2006-07-25 2009-09-30 Proimmune Ltd Biotinylated MHC complexes and their uses
EP2361930A3 (en) 2007-03-26 2011-10-26 Dako Denmark A/S Multimers of MHC-peptide complexes and uses thereof in Borrelia infectious diseases
EP3023436A1 (en) * 2007-07-03 2016-05-25 Dako Denmark A/S Improved methods for generation, labeling and use of mhc multimers
WO2009039854A2 (en) 2007-09-27 2009-04-02 Dako Denmark A/S Mhc multimers in tuberculosis diagnostics, vaccine and therapeutics
US10968269B1 (en) 2008-02-28 2021-04-06 Agilent Technologies, Inc. MHC multimers in borrelia diagnostics and disease
US10722562B2 (en) 2008-07-23 2020-07-28 Immudex Aps Combinatorial analysis and repair
GB0817244D0 (en) 2008-09-20 2008-10-29 Univ Cardiff Use of a protein kinase inhibitor to detect immune cells, such as T cells
US10369204B2 (en) 2008-10-02 2019-08-06 Dako Denmark A/S Molecular vaccines for infectious disease

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4478823A (en) * 1977-09-28 1984-10-23 National Research Development Corporation Immunological preparations containing purified MHC antigens bonded to other antigens
US5225538A (en) * 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
US5734023A (en) * 1991-11-19 1998-03-31 Anergen Inc. MHC class II β chain/peptide complexes useful in ameliorating deleterious immune responses
US6548067B1 (en) * 1988-07-28 2003-04-15 Gerhard Seeman Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0031812B1 (en) * 1979-03-27 1983-06-15 National Research Development Corporation Improvements in or relating to immunological preparations
DE3329184A1 (en) * 1983-08-12 1985-02-21 Behringwerke Ag, 3550 Marburg MONOCLONAL ANTIBODIES WITH SPECIFICITY FOR MEMBRANE-ASSOCIATED ANTIGENS
DE3531301A1 (en) * 1985-09-02 1987-03-05 Behringwerke Ag MONOCLONAL ANTIBODIES AGAINST TUMOR ASSOCIATED GLYCOPROTEINS, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE
US4894443A (en) * 1984-02-08 1990-01-16 Cetus Corporation Toxin conjugates
DE3545576A1 (en) * 1985-11-28 1987-07-02 Behringwerke Ag HLA-B 27, DAFUER CODING GENOMIC DNA AND THEIR USE
US5258498A (en) * 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
EP0334300A1 (en) 1988-03-21 1989-09-27 Neorx Corporation The use of monoclonal antibodies and conjugates thereof as signals to direct sensitized effector cells to tumor sites
US5130297A (en) * 1988-06-23 1992-07-14 Anergen, Inc. Conjugates useful in ameliorating autoimmunity MHC-II-peptide
US5194425A (en) * 1988-06-23 1993-03-16 Anergen, Inc. Mhc-mediated toxic conjugates useful in ameliorating autoimmunity

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4478823A (en) * 1977-09-28 1984-10-23 National Research Development Corporation Immunological preparations containing purified MHC antigens bonded to other antigens
US6548067B1 (en) * 1988-07-28 2003-04-15 Gerhard Seeman Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof
US5225538A (en) * 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
US5734023A (en) * 1991-11-19 1998-03-31 Anergen Inc. MHC class II β chain/peptide complexes useful in ameliorating deleterious immune responses

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100008920A1 (en) * 2002-07-12 2010-01-14 The Johns Hopkins University Reagents and Methods for Engaging Unique Clonotypic Lymphocyte Receptors
US20060269540A1 (en) * 2002-09-27 2006-11-30 Vaccinex, Inc. Targeted cd1d molecules
US9809654B2 (en) 2002-09-27 2017-11-07 Vaccinex, Inc. Targeted CD1d molecules
US20050042218A1 (en) * 2003-07-10 2005-02-24 Vaccinex, Inc. MHC class I - peptide-antibody conjugates with modified beta2-microglobulin
WO2005099361A2 (en) * 2003-07-10 2005-10-27 Vaccinex, Inc. MHC CLASS I - PEPTIDE-ANTIBODY CONJUGATES WITH MODIFIED β2-MICROGLOBULIN
WO2005099361A3 (en) * 2003-07-10 2005-12-15 Vaccinex Inc MHC CLASS I - PEPTIDE-ANTIBODY CONJUGATES WITH MODIFIED β2-MICROGLOBULIN
US20080254045A1 (en) * 2007-02-21 2008-10-16 Alena Donda Modulation of NKT Cell Activity with Antigen-Loaded CD1d Molecules
US9603922B2 (en) 2007-02-21 2017-03-28 Vaccinex, Inc. Modulation of NKT cell activity with antigen-loaded CD1d molecules
US9139809B2 (en) 2009-01-08 2015-09-22 Albert Einstein College Of Medicine Of Yeshiva University Bacterial vaccines with cell wall-associated ceramide-like glycolipids and uses thereof
KR20140036251A (en) * 2011-06-22 2014-03-25 에프. 호프만-라 로슈 아게 Removal of target cells by circulating virus-specific cytotoxic t-cells using mhc class i comprising complexes
CN103649125A (en) * 2011-06-22 2014-03-19 霍夫曼-拉罗奇有限公司 Removal of target cells by circulating virus-specific cytotoxic t-cells using MHC class I comprising complexes
AU2012274127B2 (en) * 2011-06-22 2017-06-22 F. Hoffmann-La Roche Ag Removal of target cells by circulating virus-specific cytotoxic T-cells using MHC class I comprising complexes
WO2012175508A1 (en) 2011-06-22 2012-12-27 F. Hoffmann-La Roche Ag Removal of target cells by circulating virus-specific cytotoxic t-cells using mhc class i comprising complexes
KR102038155B1 (en) 2011-06-22 2019-10-29 에프. 호프만-라 로슈 아게 Removal of target cells by circulating virus-specific cytotoxic t-cells using mhc class i comprising complexes
WO2014083004A1 (en) * 2012-11-30 2014-06-05 Roche Glycart Ag Removal of cancer cells by circulating virus-specific cytotoxic t-cells using cancer cell targeted mhc class i comprising multi-function proteins
US10501521B2 (en) 2012-12-21 2019-12-10 Hoffmann-La Roche Inc. Disulfide-linked multivalent MHC class I comprising multi-function proteins
US9371352B2 (en) 2013-02-08 2016-06-21 Vaccinex, Inc. Modified glycolipids and methods of making and using the same
US10111950B2 (en) 2013-02-08 2018-10-30 Vaccinex, Inc. Modified glycolipids and methods of making and using the same
US10294454B2 (en) 2016-08-24 2019-05-21 General Electric Company Methods and kits for cell activation
US11512288B2 (en) 2016-08-24 2022-11-29 Global Life Sciences Solutions Usa Llc Methods and kits for cell activation

Also Published As

Publication number Publication date
KR970010760B1 (en) 1997-06-30
AU625065B2 (en) 1992-07-02
ES2080055T3 (en) 1996-02-01
FI100973B (en) 1998-03-31
US6548067B1 (en) 2003-04-15
EP0352761A3 (en) 1991-09-04
DE3825615A1 (en) 1990-02-01
ATE128732T1 (en) 1995-10-15
EP0352761B1 (en) 1995-10-04
DK371089A (en) 1990-01-29
PT91294A (en) 1990-02-08
JPH02104599A (en) 1990-04-17
FI893575A0 (en) 1989-07-26
KR910003098A (en) 1991-02-26
DK371089D0 (en) 1989-07-27
FI893575A (en) 1990-01-29
DE58909458D1 (en) 1995-11-09
GR3017915T3 (en) 1996-01-31
EP0352761A2 (en) 1990-01-31
PT91294B (en) 1995-03-01
AU3900589A (en) 1990-02-01
JP2812726B2 (en) 1998-10-22

Similar Documents

Publication Publication Date Title
US6548067B1 (en) Antigenic constructs of major histocompatibility complex class I antigens with specific carrier molecules, the preparation and use thereof
CN109689097B (en) Extracellular vesicles comprising fusion proteins with FC binding capacity
US20240024359A1 (en) BISPECIFIC OR-GATE CHIMERIC ANTIGEN RECEPTOR RESPONSIVE TO CD19 and CD20
de la Hera et al. Structure of the T cell antigen receptor (TCR): two CD3 epsilon subunits in a functional TCR/CD3 complex.
Vance et al. Cloning of a mouse homolog of CD94 extends the family of C‐type lectins on murine natural killer cells
JP3520272B2 (en) CD2 binding domain of lymphocyte function related antigen 3
Robinson et al. A glycophospholipid anchor is required for Qa-2-mediated T cell activation
Idzerda et al. Isolation and DNA sequence of a cDNA clone encoding a lymphocyte adhesion receptor for high endothelium.
JP3696232B2 (en) Re-establishing cellular immunity with receptor chimeras
JP4170390B2 (en) Redirection of cellular immunity by receptor chimeras
US7049136B2 (en) Redirection of cellular immunity by receptor chimeras
US5843728A (en) Redirection of cellular immunity by receptor chimeras
Fell et al. Homologous recombination in hybridoma cells: heavy chain chimeric antibody produced by gene targeting.
KR20180095719A (en) Chimeric proteins and methods of immunotherapy
CA2008259A1 (en) Expression system for production of chimeric monoclonal antibodie
JPH04502850A (en) adheson mutant
Bhakdi et al. Fluid-phase SC5b-8 complex of human complement: generation and isolation from serum.
Costa et al. Functional reconstitution of an immunoglobulin antigen receptor in T cells.
Stroynowski et al. Expression and T cell recognition of hybrid antigens with amino-terminal domains encoded by Qa-2 region of major histocompatibility complex and carboxyl termini of transplantation antigens.
Choi et al. A method for production of antibodies to human T-cell receptor beta-chain variable regions.
JP2023521410A (en) Incorporation of large adenoviral payloads
Boursier et al. Evidence for an extended structure of the T-cell co-receptor CD8 alpha as deduced from the hydrodynamic properties of soluble forms of the extracellular region.
JP2562541B2 (en) Chimeric polypeptide
FR2810047A1 (en) New DNA for human leukocyte antigen-G7 isoform, useful as immunomodulator for e.g. treating graft rejection, tumor and viral infections
Vu et al. Molecular basis for the defective expression of the mouse Ew17 beta gene.

Legal Events

Date Code Title Description
AS Assignment

Owner name: SCHERING AG, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BOSSLET, KLAUS;REEL/FRAME:014873/0414

Effective date: 20040713

AS Assignment

Owner name: BAYER SCHERING PHARMA AKTIENGESELLSCHAFT, GERMANY

Free format text: CHANGE OF NAME;ASSIGNOR:SCHERING AKTIENGESELLSCHAFT;REEL/FRAME:020110/0334

Effective date: 20061229

Owner name: BAYER SCHERING PHARMA AKTIENGESELLSCHAFT,GERMANY

Free format text: CHANGE OF NAME;ASSIGNOR:SCHERING AKTIENGESELLSCHAFT;REEL/FRAME:020110/0334

Effective date: 20061229

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION