US20040071673A1 - Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease - Google Patents
Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease Download PDFInfo
- Publication number
- US20040071673A1 US20040071673A1 US10/359,397 US35939703A US2004071673A1 US 20040071673 A1 US20040071673 A1 US 20040071673A1 US 35939703 A US35939703 A US 35939703A US 2004071673 A1 US2004071673 A1 US 2004071673A1
- Authority
- US
- United States
- Prior art keywords
- cell
- plp
- amino acid
- disease
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4713—Autoimmune diseases, e.g. Insulin-dependent diabetes mellitus, multiple sclerosis, rheumathoid arthritis, systemic lupus erythematosus; Autoantigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- This invention relates generally to the field of immunotherapy and to the preparation and use of engineered cells having the ability to restore tolerance to self antigens in patients suffering from autoimmune disease. More particularly, this invention relates to the design and construction of a gene encoding an encephalitogenic epitope of proteolipid protein (PLP), to methods of in vitro and in vivo expression of a PLP epitope, to methods of in vivo secretion of a PLP epitope, and to methods of transferring the partial PLP gene to a host to ameliorate the progression of an immune response to self antigens derived from myelin proteins.
- PLP proteolipid protein
- the immune system can respond in two ways when exposed to an antigen.
- a positive response leads to differentiation of T and B cells, antibody production and to immunologic memory.
- a negative response leads to suppression or inactivation of specific lymphocytes and to tolerance.
- Tolerance can be defined as the failure of an organism to mount an immune response against a specific antigen. Normally, an organism is tolerant of its own antigens.
- MS multiple sclerosis
- myelin proteins thought to be the target of an immune response in MS include myelin basic protein (MBP), proteolipid protein (PLP), and myelin-oligodendrocyte glycoprotein (MOG).
- MBP myelin basic protein
- PBP proteolipid protein
- MOG myelin-oligodendrocyte glycoprotein
- EAE can be induced in SJL mice by injection of mouse spinal cord homogenate (MSCH), MBP, PLP, by the injection of synthetic peptides whose sequences correspond to the major encephalitogenic epitopes of myelin basic protein, MBP 84-104, proteolipid protein, PLP 139-151, or by adoptive transfer of activated CD4 + T H1, but not T H2 cells specific for encephalitogenic epitopes.
- MBP mouse spinal cord homogenate
- the major encephalitogenic epitopes of myelin-derived sequences in EAE, such as MBP can also activate human T cells of several different haplotypes including HLA-DR2.
- the experimental disease is characterized by a relapsing-remitting course (R-EAE) of neurological dysfunction, perivascular mononuclear infiltration and demyelination.
- CNS damage is probably mediated by inflammatory cytokines which can activate additional monocytes and macrophages non-specifically. J. E. Blalock, The Immune System, Our Sixth Sense , The Immunologist, 2:8-15 (1994).
- the goal of immunologic therapy is to restore tolerance without suppressing the entire immune system which can lead to complications such as infection, hemorrhage, and cancer.
- Drugs currently used to treat autoimmune diseases are non-specific immunosuppressive agents, such as anti-inflammatory agents or drugs which can block cell proliferation or depress proinflammatory cytokines. In general, these agents are effective for limited duration and subject to devastating complications.
- the present invention addresses the disadvantages present in the prior art.
- the invention is based on the discovery that recombinant DNA technology and cell transfer may be employed to restore tolerance to one's own tissues.
- the present invention provides a means of preparing and constructing a gene, that when expressed and secreted in vivo, can provide a means of halting the progression of an autoimmune disease.
- the invention provides a method to construct a gene encoding a portion of a CNS protein, insert the gene sequence into a vector and transfect a cell line.
- the invention provides a method to construct a gene encoding a portion of a CNS protein, insert the sequence into a retroviral vector, and transduce a producer fibroblast cell line to generate supernatant containing the recombinant retrovirus. Histocompatible fibroblasts are transduced with the recombinant retrovirus encoding a portion of the CNS protein and are delivered to animals. These fibroblasts continuously secrete a CNS antigen in vivo but do not themselves produce viral particles.
- the producer line PA317 is transduced with the PLP retroviral vector to generate supernatant containing the recombinant retrovirus.
- the producer cell line PA317 was developed by Dr. A. Dusty Miller and has been extensively characterized and approved for human use by the FDA for other clinical trials, such as for genetic diseases and cancer. Miller and Baltimore, Mol. Cell Biol. 6:2895-2902 (1986), W. F. Anderson, Science 256:808-813.
- FIG. 1 is a map of the partial PLP gene showing the sequence of the gene product and restriction sites.
- FIG. 2 is a map of the GlXSvNa vector illustrating restriction sites and functional features.
- FIG. 2 b illustrates, the entire DNA sequence of GlXSvNa.
- FIG. 3 outlines the method of constructing a GlXSvNa vector containing the PLP gene insert.
- FIG. 4 shows the level of mRNA expressed in transfected and transduced SJL fibroblast cells as detected by reverse transcriptase PCR.
- Lane 1 is molecular weight standards
- Lane 2 is Negative control from mock transfection
- Lane 3 is positive control-PLP-gene plasmid
- Lane 4 is cDNA from PLP-transfected SJL fibroblasts
- Lane 5 is cDNA from PLP transduced SJL fibroblasts.
- FIG. 5 demonstrates the level of PLP protein in the supernatants of transduced fibroblasts as detected by ELISA.
- FIG. 6 demonstrates the level of B-Gal expression in transduced fibroblasts.
- FIG. 7 illustrates the clinical scoring system for chronic EAE.
- FIG. 8 illustrates the histological scoring system for EAE.
- FIG. 9 illustrates the clinical assessment of EAE mice treated with retrovirus transduced fibroblasts.
- FIG. 10 a shows the pathologic assessment of brain and spinal cord of SJL mice treated with retrovirus transduced fibroblasts
- 10 b is a summary of the pathologic assessment of brain and spinal cord from Days 55-60 through days 90-95.
- FIG. 11 shows the histology of SJL mice with chronic EAE treated with retrovirus transduced fibroblasts.
- FIG. 12 illustrates the results of proliferation assays using FAE mice treated with PLP-expressing fibroblasts.
- FIG. 13 illustrates the results of proliferation assays with and without IL-2 using EAE mice treated with PLP-expressing fibroblasts.
- the present invention relates to the use of engineered cells to restore tolerance to self antigens in patients suffering from autoimmune disease.
- the engineered cells can be any mammalian cell.
- the term “engineered” is intended to refer to a cell into which one or more recombinant genes, such as a gene encoding an epitope of a self antigen, has been introduced.
- a gene is a deoxyribonucleotide sequence coding for an amino acid sequence.
- Recombinantly introduced genes will either be in the form of a synthetic oligonucleotide, a cDNA gene (i.e. they will not contain introns), a copy of a genomic gene sequence, or a hybrid, gene which is a fusion of two or more gene sequences.
- the gene may be linked to one or more nucleotide sequence capable of directing expression of the gene product.
- Sequence elements capable of effecting expression of a gene or gene product include but are not limited to promoters, enhancer elements, transcription termination signals, polyadenylation sites, a Kozak box sequence to ensure efficient translation, and leader sequences.
- the gene sequence can include restriction sites to enable the insertion of additional gene sequences.
- the gene will contain a leader sequence to ensure the gene product is synthesized in the endoplasmic reticulum for later constitutive secretion.
- Recombinantly introduced genes carried by the engineered cells can encode one or more epitope, fragment, domain or mini-protein portion of a protein antigen.
- suitable proteins from which an epitope, fragment, domain, or mini-protein may be derived include but are not limited to myelin proteins, acetylcholine receptor, TSH receptor, and collagen.
- T cell mediated autoimmune diseases that may be treated using the invention include but are not limited to multiple sclerosis, myasthenia gravis, systemic lupus erythematosus, psoriasis, juvenile onset diabetes, rheumatoid arthritis, thyroid disease and chronic inflammatory demyelinating polyneuropathy (CIDP).
- CIDP chronic inflammatory demyelinating polyneuropathy
- Expression vectors are generally deoxyribonucleotide molecules engineered for controlled expression of one or more desired genes.
- the vectors may comprise one or more nucleotide sequences operably linked to a gene to control expression of the desired gene or genes.
- standard laboratory manuals on genetic engineering provide recombinant DNA methods and methods for making and using expression vectors.
- the vector may encode a selectable marker, for example, antibiotic resistance.
- the gene can be inserted into the mammalian cell using any gene transfer procedure.
- RNA viral mediated gene transfer such as retroviral transduction, DNA viral mediated gene transfer, electroporation, calcium phosphate mediated transfection, microinjection or liposome mediated gene transfer.
- the type of procedure required to achieve an engineered cell that secretes the desired gene product will depend on the nature and properties of the cell. The specific technology for introducing such genes into such cells is generally known and well within the skill of the art.
- the encephalitogenic epitope of PLP comprises amino acids 139-151. N Takahashi et al., Cell 42:139-148 (1985), K Sakai et al., J. Neuroimmunol. 19:21-32 (1988), D. H. Kono et al., J. Exp. Med. 168:213-227.
- the vector in the present invention is designed in order that the gene product encoded by it be constitutively secreted from fibroblasts. Since the complete PLP protein is a hydrophobic transmembrane protein (H-J. Diehl, M. Schaich, R-M. Buszinski and W. Stoffel, PNAS U.S.A. 83:9807-9811 (1986)), with the encephalitogenic epitope being extracellular, a plasmid encoding amino acids 101-157 and additional amino acids required for secretion was constructed. This sequence is hydrophilic in character.
- Oligonucleotides can be synthesized manually, e.g., by the phospho-tri-ester method, as disclosed, for example in R. L. Letsinger, et. al., J. Am. Chem. Soc. 98:3655 (1967), the disclosure of which is incorporated by reference. Other methods are well known in the art. See also Matteucci and Caruthers, J. Am. Chem. Soc. 103:3185 (1981), the disclosure of which is incorporated by reference.
- the desired gene sequence can be made by automated synthesis of individual oligonucleotides at 0.2 ⁇ M concentrations.
- DNA syntheses were performed on a Perkin Elmer/Applied Biosystems Division Model 394 DNA synthesizer using cyanoethyl-protected phosphoramidites.
- the dimethoxytrityl (DMT) group was not removed from the 5′hydroxyl group to allow for purification. After normal cleavage from the resin using concentrated ammonium hydroxide and deprotection at 55° C.
- oligonucleotides were purified using oligonucleotide purification cartridges (CPC) according to the manufacturer's instructions (Applied Biosystems Inc.)
- CPC oligonucleotide purification cartridges
- Five oligonucleotides of the following sequences were synthesized: OLG1 5′-CGGCGACTACAAGACCACCATCTGCGGCAAGGGCCTGAGCGCAACGGTAACAG GGGGCCAGAAGGGGAGGGGTTCCAGAGGCCAACATCAaGCTCATTCTCTCGAGC-3′, OLG2 5′-GAGCTTGATGTTGGCCTCTGGAACCCCTCCCCTTCTGGCCCCCTGTTACCGTT GCGCTCAGGCCCTTGCCGCAGATGGTGGTCTTGTAGTCGCCGGGCC-3′, OLG3 5′-GGGTGTGTCATTGTTTGGGAAAATGGCTAGGACATCCCGACAAGTTTGTGGGC ATCACCTATGCTACCCTTAAGTAGGATCCTTCAATAGGTA-3′
- Each purified oligonucleotide was dried under vacuum, washed with 1 ml of sterile double distilled water and then concentrated to dryness under vacuum (Speed vac evaporator; Savant Inc.). 80 pm of each oligomer was kinased at 37° C. for 1 hour by resuspending in 56.6 ⁇ l of 1 ⁇ kinase buffer (Polynucleotide Kinase Buffer; Boehringer Mannheim, Indianapolis, Ind.) containing 10 units, of polynucleotide kinase (Boehringer Mannheim) and 100 ⁇ M of ATP.
- 1 ⁇ kinase buffer Polynucleotide Kinase Buffer; Boehringer Mannheim, Indianapolis, Ind.
- the individual oligonucleotides were combined in the presence of 2 ⁇ SSC (0.03M Sodium Citratei pH 7.0, and 0.3M NaCl) in a PCR tube with their respective complementary oligomer partners for annealing. Each annealed set measured 20011 in volume. Oligomer OLG1 was annealed with OLG2, and oligomers OLG4 and OLG5 were annealed with OLG3. Annealing was performed in a Perkin-Elmer 9600 Thermocycler, programmed as follows: 1)99.9° for 2 minutes, and 2) 99.9° to 40 in 15 minutes.
- the ligated DNA was precipitated with 2 volumes of 100% ethanol and incubated at ⁇ 70° C. for 1 hour. The precipitate was centrifuged for 30 minutes at 17000 ⁇ g at 4° C. The supernatant was discarded and pellet was washed with 1 ml of 70° ethanol and centrifuged for 10 minutes at 17000 ⁇ g at 4° C. The DNA pellet was dried under vacuum (Speed vac evaporator; Savant Inc.) and resuspended in 45 ⁇ l sterile double distilled water.
- DNA of the correct molecular weight was isolated by electrophoresis. 5 ⁇ l of 10 ⁇ loading buffer (6.25 g Ficoll and 0.93 g Disodium EDTA/25 ml 10% SDS, Orange G, Xylene Cyanole, and Bromophenol Blue) was added to the sample and loaded onto a 14.5 cm ⁇ 16 cm ⁇ 0.15 mm urea/acrylamide gel (7M urea/8% acrylamide with 1.1% Bis). TBE (89 mM Tris, 89 mM Boric acid, and 2 mM EDTA pH8.0) was used as both gel and electrophoresis buffer.
- 10 ⁇ loading buffer (6.25 g Ficoll and 0.93 g Disodium EDTA/25 ml 10% SDS, Orange G, Xylene Cyanole, and Bromophenol Blue) was added to the sample and loaded onto a 14.5 cm ⁇ 16 cm ⁇ 0.15 mm urea/acrylamide gel (7M urea/8% acrylamide with 1.1% Bis
- the sample was electrophoresed at 35 mA until the Orange G dye line had migrated within 1 cm of the bottom of the gel.
- the acrylamide gel was washed twice with water for 5 minutes. After the last wash, the gel was incubated for 3 minutes in a 500 ml solution containing 10 ul of 10 mg/ml of ethidium bromide, and visualized under a UV-light source.
- the band corresponding to the ligated DNA was excised and cut into small pieces for electroelution in an IBI electroelutor apparatus (Model UEA: International Biotechnologies Inc., New Haven, Conn.).
- the salt trap of the apparatus was filled with 125 ⁇ l of 7M sodium acetate/bromophenol blue dye solution.
- the buffer chamber was filled with ⁇ fraction (1/2) ⁇ TBE.
- the sample was electroeluted for 1 hour at 85V. After removing the eluted DNA, the sample well was washed with ⁇ fraction (1/2) ⁇ TBE and combined with the initial eluate. The eluted DNA was then precipitated overnight at ⁇ 70° C. with 2 volumes of 100% ethanol. The precipitate was pelleted, washed as previously described, and resuspended in 15 ul of sterile double distilled water.
- the pRc/CMV vector construct was cut with the restriction endonucleases Apa I and Hind III according to the Manufacturer's instructions (Boehringer Mannheim, Indianapolis, Ind.).
- the resuspended PLP gene construct was then added to a 5 ⁇ l mixture containing 0.3 kg of pRc/CMV cut vector (2 ⁇ l), 1 unit T4 ligase (1 ⁇ l) (Boehringer Mannheim, Indianapolis, Ind.), and 2 ⁇ l of Manufacturer's 10 ⁇ T4 DNA ligation buffer (Boehringer Mannheim, Indianapolis, Ind.).
- the ligated vector was then transformed into the competent cell line AG1.
- Transformation proceeded by combining the ligation mixture with the AG1 cells and incubating it on ice for 20 minutes. The cell/vector mixture was then incubated at 42 for 2 minutes and plated overnight onto a Luria Broth agar (LB; Bio101, Vista, Calif.) plate, supplemented with 80 mg/ml of ampicillin (Sigma, St. Louis Mo.) Colonies were screened for the correct sequence vector by first isolating the plasmid DNA and then sequencing the DNA.
- LB Luria Broth agar
- ampicillin Sigma, St. Louis Mo.
- plasmid purification kit Wizard Minipreps (Promega, Madison, Wis.) was used. Colonies were picked from the LB/Amp plates and grown for 3.5 hours in 5 ml of LB medium (BIO 101, Vista, Calif.) supplemented with 80 mg/ml of ampicillin (Sigma, St. Louis, Mo.). 3 ml of the medium was centrifuged at 17000 ⁇ g at room temperature, for 1 minute to pellet the cells. Isolation of the plasmid proceeded according to the Manufacturer's instructions. 1 ⁇ g of the isolated DNA was used, for sequencing.
- LB medium BIO 101, Vista, Calif.
- ampicillin Sigma, St. Louis, Mo.
- the oligonucleotide sequence can be checked by methods well known in the art, such as that described by Sanger et al., PNAS U.S.A. 70:1209 (1973) or by the Maxam-Gilbert method, Meth. Enzymology, 65:499 (1977), the disclosures of both of which are incorporated herein by reference.
- the plasmid can be sequenced using an automated DNA sequencer.
- the plasmid was sequenced using automated fluorescent DNA sequencing procedures (Perkin Elmer/Applied Biosystems Inc, Foster City, Calif.) using the following primers: GATTTAGGTGACACTATAG and TAATACGACTCACTATAGGG.
- FIG. 1 shows a map of the partial PLP gene showing the sequence of the gene product and restriction sites.
- a hydrophobic leader sequence from the MHC class I L d gene to enable the gene product to be synthesized in the endoplasmic reticulum IER) for later constitutive secretion. Linsk et al. J. Exp. Med. 164:794-813 (1996).
- a lysine codon at the 3′ end was added to ensure that the protein could not be retained in membrane.
- a Kozak box was included in the construct to ensure efficient translation. Restriction sites Afl II and BamHI were included in the construct to allow for insertion of further epitopes.
- the PLP vector encodes a protein which is constitutively secreted. Specifically, the mRNA levels of PLP were evaluated in SJL fibroblast cells transfected with the pRc/CMV-PLP vector, and mRNA and protein levels of PLP were evaluated in SJL fibroblast cells transfected with the pGlPLPSvNa vector.
- Syngeneic fibroblasts (derived from SJL mice) were obtained from Dr. G. Dveskler (Uniformed Services University, Bethesda, Md.) and expanded at 37° incubation using DMEM growth medium, supplemented with 5% glutamine and 10% FCS. The cells were harvested and frozen at 1 ⁇ 10 7 cells per vial, and aliquots were quality control tested for mycoplasma, sterility and viability.
- a recombinant retroviral vector in which exogenous genes are inserted into a retroviral vector was constructed.
- the cloning strategy was to construct a pGlXSvNa vector (W. French Anderson, University of Southern California) containing the PLP insert from pRc/CMV-PLP.
- the pGlXSvNa vector like most retroviral vectors used in preclinical and clinical trials, is derived from the Moloney murine leukemia retrovirus (Mo-MLV). Rosenberg et al., N. Eng. J. Med. 323:570-578. (1990), Culver et al., Science 256:1550-1552 (1992).
- the GlXSvNa vector is a 5865 bp vector whose map, functional features and complete DNA sequence are shown in FIGS. 2 a and 2 b .
- FIG. 3 illustrates the procedure for constructing the pGlPLPSvNa vector.
- the pRc/CMV-PLP vector was digested with BstEII/HindIII and PLP encoding fragment was isolated by gel electrophoresis. After electroelution, HindIII/NotI adapters (Stratagene, La Jolla, Calif.) were ligated into the HindIII site of the eluted fragment. A NotI digestion was performed to generate NotI ends.
- a NotI digest was performed on pGlXSvNa and the 5865 bp fragment was isolated, electroeluted, and a CIAP (Calf intestine alkaline phosphatase treatment) was performed on the fragment ends.
- the NotI site of the insert was ligated into the NotI site of the vector.
- BstEII ends of the insert and NotI site of the vector were Klenowed.
- a blunt end ligation is performed to close the vector.
- HB101 cells were transformed with ligation mix and restriction analysis was performed to determine which vectors contain insert and the insert orientation. The recombinant retroviruses are non-replicating and incapable of producing infectious virus.
- the PLP-transduced retroviral packaging cell line PA317 was grown in 4 ml of appropriate culture medium in a T25 flask (Corning, Cambridge, Mass.). Retroviral vector supernatant is produced by harvesting the cell culture medium when cells were 80-90% confluent, and stored in 1 ml aliquots at ⁇ 70C°.
- the viral titer is determined using 3T3 cells. Viral preparations with titers greater than 5 ⁇ 10 4 colons forming units/ml are used.
- the PLP-vector preparations from PA317 can be extensively tested to assure that no detectable replication competent virus is present. This is particularly relevant to the embodiment of the invention wherein the invention is used to treat humans. Tests on both the viral supernatant and on the transduced fibroblasts can be performed to determine if there is replication competent virus present. The following tests can be performed on the producer cell line and/or the viral supernatant:
- the viral titer is determined using 3T3 cells. Viral preparations with titers greater than 5 ⁇ 10 4 colony forming units/ml are used.
- Viral testing is performed including: MAP test, LCM virus, thymic agent, S+L-assay for ecotropic virus, S+L assay for xenotropic virus, S+L-assay for amphotropic virus and 3T3 amplification.
- Electron microscopy is performed to assure the absence of adventitious agents.
- the pellet was washed with cold 70% ethanol, recentrifuged at 10000 ⁇ g for 10 minutes at 4° C., and dried under vacuum (Speed vac evaporator; Savant Inc.).
- the purified DNA was resuspended with double-distilled sterile water and utilized in the transfection process.
- Test SJL fibroblasts were transfected using LipofectAMINE Reagent (Life Technologies Inc./Gibco BRL) according to the manufacturer's instructions. Control SJL fibroblasts underwent the same procedure without the presence of a DNA construct. 3 ⁇ g of CsCl purified PLP-pRc/CMV plasmid and 25 ⁇ l of Lipofectamine were used for transfection.
- Retroviral constructs containing a neo-selectable marker together with either the PLP gene or the Lac-z gene were used to transduce fibroblasts. Transduction with the retrovirus was performed on healthy cells (90% viable, as determined by trypan blue staining). 2 ⁇ 10 6 cells were plated in 0.5 ml DMEM-10 media (DMEM media supplemented with 109′ fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin G, 50 mg/ml streptomycin in one well of a 24-well plate (Falcon, Franklin Lakes, N.J.) Cells were placed in the incubator and allowed to settle (37°, 5% CO 2 ).
- DMEM-10 media DMEM media supplemented with 109′ fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin G, 50 mg/ml streptomycin
- mRNA isolation was performed using aseptic techniques, RNAse free supplies, and DEPC (Diethylpyrocarbonate) treated solutions.
- 4 ⁇ 10 6 experimental and control SJL cells were washed twice with cold Phosphate-buffered saline, resuspended in 200 ⁇ l cell lysis mix (10 mM TRIS pH 7.5, 0.15M NaCl, 1.5 mM MgCl 2 , 0.65% NP 40), vortexed, and centrifuged at 17000 ⁇ g at 40 for 5 minutes.
- the supernatant was transferred to a tube containing 200 ⁇ l of urea mix (7M urea, 1% SDS, 0.35M NaCl, 10 mM EDTA, and 10 mM Tris-HCL, pH 7.5) and 400 ⁇ l of phenol:chloroform;isoamyl alcohol (25:24:1).
- the solution was vortexed and centrifuged for 1 minute at 17000 ⁇ g. This procedure was repeated twice using the aqueous layer and then transferred to a tube containing 400 ⁇ l of phenol and washed as before.
- the aqueous layer was transferred again to another tube, and precipitated with 1 ml of 100% ethanol overnight at ⁇ 20° C.
- the precipitated RNA was washed with 1 ml 70% ethanol. After the ethanol was discarded, the pellet was dried under vacuum lag of the RNA was used for RT-PCR analysis.
- RT-PCR was performed using a commercially available kit, GeneAmp RNA PCR Kit (Perkin Elmer/ABI) according to the Manufacturer's instructions. The following primers were used to amplify the cDNA: 5′-GCGACTACAAGACCACCATCT-3′ and 5′-TAAGGCTAGCATAGGTGATG-3′.
- the PCR products were electrophoresed on a 1.5% agarose (SeaKem GTG; FMC)/s, gel with 1 ⁇ l of 10 mg/ml of ethidium bromide/ml of agarose solution. The gel was electrophoresed using TAE buffer at a constant 40 mA.
- FIG. 4 is an agarose gel showing PLP-specific RT-PCR products. The data illustrates that mRNA is present in both PLP-transduced and PLP-transfected cells. The correlation between mRNA and secreted protein remains to be determined since peptide concentration does not necessarily correspond to the level of mRNA.
- Samples 1 and 2 were PLP (amino acids 139-151) and HIV gp120 peptides used at a concentration of 5 ug/ml. This experiment illustrates that the transduced PLP-transduced fibroblasts do produce and secrete the partial PLP protein.
- Critical to the success of this invention in the embodiment of this example is the ability to deliver genetically manipulated fibroblasts to patients so that the cells survive in sufficient numbers and for long periods of time, in order that continuous secreted antigen may be provided to the patient.
- SJL fibroblasts transduced with retrovirus encoding B-galactosidase were injected subcutaneously between the shoulders of SJL mice. All mice were female mice of the SJL strain between 6-8 weeks old and were obtained from Jackson Labs. Animals were housed and maintained according to NIH guidelines (National Research Council, 1986). These fibroblasts survived in large numbers after 60 days. Fibroblasts injected into the footpad or intramuscularly could not be detected at eight days.
- the activity of the B-Galactosidase marker was evaluated using two groups of eight normal mice. Two mice were injected subcutaneously on the back, two mice were injected intramuscularly and two mice were injected in the footpad with Lac-Z transduced cells. One animal was injected with fibroblasts transduced with neo-marker only, and the last mouse was injected with untransduced fibroblasts. After harvesting and washing, the different cell lineages were suspended in a concentration of 10 7 cells in 0.2 ml of Hank's PBS and slowly injected using a 25 gauge needle at different sites Animals were sacrificed at 10 and 15 days post treatment and injection sites were submitted to histochemical study.
- FIG. 6 illustrates B-Gal expression in transduced fibroblasts 60 days in vivo. There was no evidence of an inflammatory response, suggesting that the retrovirus used to transduce syngeneic fibroblasts, does not evoke an immune response or rejection process.
- Another important aspect of this invention in the embodiment of this example is determining whether transduced fibroblasts secreting PLP actually produce EAE in normal animals.
- 10′ P12-secreting SJL fibroblasts were injected into 12 normal SJL mice.
- Six animals had fibroblasts placed subcutaneously and six animals had fibroblasts injected intraperitoneally. Animals were sacrificed at day 16 and showed no evidence of inflammatory disease or EAE.
- FIG. 7 illustrates the clinical scoring system for chronic EAE. Y-A Lu et al., Mol. Immunol. 28:623-630 (1991), J. Williamson et al., J. Neuroimmunol. 32:199-207 (1991).
- FIG. 8 illustrates the histological scoring system for EAE. J. Governman et al., Cell 72:551-560 (1993).,
- FIG. 9 illustrates the clinical assessment of EAE mice treated with retrovirus transduced fibroblasts. Animals receiving the PLP secreting fibroblasts had a marked reduction of clinical signs and had dramatic reduction in inflammatory cells, particularly in the brain.
- FIG. 10 a illustrates the pathologic assessment of brain and spinal cord of SJL mice treated with retrovirus transduced fibroblasts.
- FIG. 10 b is a summary of the pathologic assessment of brain and spinal cord from days 55-60 and 90-95. Histological assessment of EAE Grades in Brain and Spinal Cord were performed following the preparation of hematoxylin and eosin stained sections.
- mice were inoculated with MSCH in CFA. A second immunization was given 7 days later.
- 113 animals developed clinical disease lasting 3-4 days. These positive animals were separated for subsequent experiments and had their first relapse on day +55 to 60, with 100 animals becoming sick. These were again separated and on day +137, 67 had a relapse.
- Eight days after relapse animals were each transplanted with 10 7 fibroblasts and then sacrificed 18 to 23 days later.
- FIG. 11 shows the histology of SJL mice with chronic EAE treated with retrovirus transduced fibroblasts. There were no animals receiving PLP secreting fibroblasts with 2+ to 3+ inflammation.
- Spleen cells from our EAE control mice and from four EAE mice which had been treated with fibroblasts expressing the PLP protein were used in proliferation assays, in which they were incubated with 40 ⁇ M PLP peptide 139-151 or 40 ⁇ M HIV gp120 peptide 308-322 for 4 days and then pulsed with 3 H-thymidine for 24 hours.
- PLP peptide 140-151 and MBP peptide 89-101 were used for antigen-specific proliferation while HIV gp120 peptide 308-322 was used as negative control.
- some wells also contained 10 U/ml of recombinant mouse IL-2 (Boehringer Mannheim, Indianapolis, Ind.) During the last 18-24 h of culture, each well was pulsed with 1 ⁇ Ci of 3 H-thymidine (ICN, Irvine, Calif.), harvested onto ‘Xtal Scint’ glass fiber filters (Beckman, Fullerton, Calif.) and counted using a Beckman LSGOOO Scintillation counter. Thymidine incorporation values (experimental counts per minute-background counts per minute) were calculated and represent means of triplicate cultures ⁇ standard deviation.
- FIG. 13 illustrates the same experiment as in FIG. 12 but with the addition of mouse IL-2 (10 U/ml) for 5 days.
- the present invention acts to restore tolerance in individuals suffering from T-cell mediated autoimmune disease
- the method is a genetic approach to immunospecifically silence pathogenic T-cell responses and does not down-regulate the entire immune system.
- the invention may easily be adapted to target those specificities. For example, DNA encoding multiple self-antigenic epitopes may be introduced into the patient's cells.
- the invention is also advantageous in that the reagents can easily be made or obtained in sufficient quantity to carry out the invention.
Abstract
The present invention relates to the application of genetic engineering to provide a treatment of autoimmune disease. This is achieved preferably through the introduction of one or more recombinant genes encoding self antigens which are the target of an autoimmune response. In particular the invention provides a method of designing and constructing a gene encoding an encephalitogenic epitope of proteolipid protein, and to the in vivo expression of the gene product by a recombinant retroviral vector. The expression and secretion of the encephalitogenic epitope ameliorates the histopathological and clinical characteristics of experimental autoimmune encephalomyelitis (EAE) in the mouse model for multiple sclerosis (MS).
Description
- This invention relates generally to the field of immunotherapy and to the preparation and use of engineered cells having the ability to restore tolerance to self antigens in patients suffering from autoimmune disease. More particularly, this invention relates to the design and construction of a gene encoding an encephalitogenic epitope of proteolipid protein (PLP), to methods of in vitro and in vivo expression of a PLP epitope, to methods of in vivo secretion of a PLP epitope, and to methods of transferring the partial PLP gene to a host to ameliorate the progression of an immune response to self antigens derived from myelin proteins.
- The immune system can respond in two ways when exposed to an antigen. A positive response leads to differentiation of T and B cells, antibody production and to immunologic memory. A negative response leads to suppression or inactivation of specific lymphocytes and to tolerance. Tolerance can be defined as the failure of an organism to mount an immune response against a specific antigen. Normally, an organism is tolerant of its own antigens.
- Autoimmune diseases are thought to result from an uncontrolled immune response directed against self antigens. In patients with multiple sclerosis (MS), for example, there is evidence that this attack is against the white matter of the central nervous system and more particularly to white matter proteins. Ultimately, the myelin sheath surrounding the axons is destroyed. This can result in paralysis, sensory deficits and visual problems. MS is characterized by a T cell and macrophage infiltrate in the brain. Autoreactive myelin-specific T cells have been isolated from MS patients, although T cells of the same specificity have been detected in normal individuals. J. M. LaSalle et al.,J. Immunol. 147:774-780 (1991), J. M. LaSalle et al., J. Exp. Med. 176:177-186 (1992), J. Correale et al., Neurology 45:1370-1378 (1995). Presently, the myelin proteins thought to be the target of an immune response in MS include myelin basic protein (MBP), proteolipid protein (PLP), and myelin-oligodendrocyte glycoprotein (MOG). Individuals who do not mount an autoimmune response to self proteins are thought to have control over these responses and are believed to be “tolerant” of self antigens. The evidence, therefore, that MS is caused by pathogenic T cells is necessarily indirect, but the close resemblance which the characteristics of this disease bear to those of the murine model, experimental autoimmune encephalomyelitis (EAE), suggest that MS is indeed caused by an aberrant immune response mediated by T cells.
- The RAE mouse model for MS, the subject of intense and fruitful study for several years, displays many of the same histopathological and clinical characteristics as the relapsing remitting forms of MS.The T Lymphocyte in Experimental Allergic Encephalomyelitis, Ann. Rev. Immunol. 8:579-621 (1990). EAE can be induced in SJL mice by injection of mouse spinal cord homogenate (MSCH), MBP, PLP, by the injection of synthetic peptides whose sequences correspond to the major encephalitogenic epitopes of myelin basic protein, MBP 84-104, proteolipid protein, PLP 139-151, or by adoptive transfer of activated CD4+ TH1, but not TH2 cells specific for encephalitogenic epitopes. The major encephalitogenic epitopes of myelin-derived sequences in EAE, such as MBP, can also activate human T cells of several different haplotypes including HLA-DR2. R. Martin, et al., J. Exp. Med. 173:19-24 (1992). The experimental disease is characterized by a relapsing-remitting course (R-EAE) of neurological dysfunction, perivascular mononuclear infiltration and demyelination. CNS damage is probably mediated by inflammatory cytokines which can activate additional monocytes and macrophages non-specifically. J. E. Blalock, The Immune System, Our Sixth Sense, The Immunologist, 2:8-15 (1994).
- Although the initial attack in EAE can be induced by the administration of either T cells specific for MBP or for PLP, close examination of reactivities of T cells in the primary and subsequent relapses demonstrates the presence of T cells which interact with specificities other than the inducing epitopes. This expansion of encephalitogenic epitopes is termed “determinant spreading”. S. D. Miller and W. J. Karpus,Immunology Today 15:356-361 (1994), P. V. Lehman, T. Forsthuber, A. Miller, and E. E. Sercarz, Nature 358-155-157 (1992), H. Jiang, S. I. Zhang and B. Pernis, Science 256:1213-1215 (1992). Antigen specific treatment would therefore, be expected to be more effective when administered early in the course of the disease, before the onset of increasing epitope complexity and eventual non-specific inflammation.
- The goal of immunologic therapy is to restore tolerance without suppressing the entire immune system which can lead to complications such as infection, hemorrhage, and cancer. Drugs currently used to treat autoimmune diseases are non-specific immunosuppressive agents, such as anti-inflammatory agents or drugs which can block cell proliferation or depress proinflammatory cytokines. In general, these agents are effective for limited duration and subject to devastating complications.
- It is desirable to suppress the immune system in a more specific way to control the response to self-antigens and theoretically “cure” the disease without down-regulating the entire immune system. Several specific immunotherapies have been hypothesized and tested in recent years, many of which are impractical or do not work in humans. For example, high affinity peptides can be synthesized which interact with MHC class II molecules and prevent the binding of encephalitogenic peptides, thereby preventing the activation of pathogenic T cells. A. Franco et al.,The Immunologist 2:97-102 (1994). This approach is disadvantageous in that it is difficult to obtain effective concentrations of inhibitor peptides in vivo. G. Y. Ishioka et al., J. Immunol. 152:4310-4319. In an alternate strategy, peptides which are analogs of encephalitogenic sequences have been shown to antagonize the T cell receptors of antigen-specific T cells, rendering them unreactive, although the exact mechanism is at present unknown. S. C. Jameson et al., J. Exp. Med 177:1541-1550 (1993), N. Karin et al, J. Exp. Med. 180:2227-2237 (1994), V. K. Kuchroo et al, J. Immunol. 153:3326-3336 (1994). Oral administration of myelin has been tested and found to induce a state of immunological unresponsiveness thought to be mediated by the induction of suppressor T cell or of anergy H. L. Weiner et al., Annu. Rev. Immunol. 12:809-837 (1994), C. C. Whitacre et al., J. Immunol. 147:2155-2163 (1991), S. J. Khoury et al., J. Exp. Med. 0.176:1355-1364 (1992). This treatment has been found to be efficacious for some but not all individuals. H. L. Weiner et al., Science 259:1321-1324 (1993). Thus, it is evident that improvements are needed to treat MS and other autoimmune disorders with an effective, immunospecific approach.
- The present invention addresses the disadvantages present in the prior art. In general, the invention is based on the discovery that recombinant DNA technology and cell transfer may be employed to restore tolerance to one's own tissues. The present invention provides a means of preparing and constructing a gene, that when expressed and secreted in vivo, can provide a means of halting the progression of an autoimmune disease. In further aspects the invention provides a method to construct a gene encoding a portion of a CNS protein, insert the gene sequence into a vector and transfect a cell line. In further aspects, the invention provides a method to construct a gene encoding a portion of a CNS protein, insert the sequence into a retroviral vector, and transduce a producer fibroblast cell line to generate supernatant containing the recombinant retrovirus. Histocompatible fibroblasts are transduced with the recombinant retrovirus encoding a portion of the CNS protein and are delivered to animals. These fibroblasts continuously secrete a CNS antigen in vivo but do not themselves produce viral particles.
- In accordance with the present invention, we have used synthetic oligonucleotides to construct a gene encoding a portion of the PLP protein, performed expression of the DNA in combination with various expression vectors, and thereby evaluated expression levels of the gene product in vitro and in vivo. After transduced histocompatible fibroblasts that secrete the partial PLP protein are transplanted into EAE mice, the disease disappears. The effect is the amelioration of both clinical symptoms and signs and pathological findings.
- In a preferred embodiment of the invention, the producer line PA317 is transduced with the PLP retroviral vector to generate supernatant containing the recombinant retrovirus. The producer cell line PA317 was developed by Dr. A. Dusty Miller and has been extensively characterized and approved for human use by the FDA for other clinical trials, such as for genetic diseases and cancer. Miller and Baltimore,Mol. Cell Biol. 6:2895-2902 (1986), W. F. Anderson, Science 256:808-813.
- FIG. 1 is a map of the partial PLP gene showing the sequence of the gene product and restriction sites.
- FIG. 2 is a map of the GlXSvNa vector illustrating restriction sites and functional features. FIG. 2b illustrates, the entire DNA sequence of GlXSvNa.
- FIG. 3 outlines the method of constructing a GlXSvNa vector containing the PLP gene insert.
- FIG. 4 shows the level of mRNA expressed in transfected and transduced SJL fibroblast cells as detected by reverse transcriptase PCR.
Lane 1 is molecular weight standards,Lane 2 is Negative control from mock transfection,Lane 3 is positive control-PLP-gene plasmid,Lane 4 is cDNA from PLP-transfected SJL fibroblasts,Lane 5 is cDNA from PLP transduced SJL fibroblasts. - FIG. 5 demonstrates the level of PLP protein in the supernatants of transduced fibroblasts as detected by ELISA.
- FIG. 6 demonstrates the level of B-Gal expression in transduced fibroblasts.
- FIG. 7 illustrates the clinical scoring system for chronic EAE.
- FIG. 8 illustrates the histological scoring system for EAE.
- FIG. 9 illustrates the clinical assessment of EAE mice treated with retrovirus transduced fibroblasts.
- FIG. 10a shows the pathologic assessment of brain and spinal cord of SJL mice treated with retrovirus transduced fibroblasts, and 10 b is a summary of the pathologic assessment of brain and spinal cord from Days 55-60 through days 90-95.,
- FIG. 11 shows the histology of SJL mice with chronic EAE treated with retrovirus transduced fibroblasts.
- FIG. 12 illustrates the results of proliferation assays using FAE mice treated with PLP-expressing fibroblasts.
- FIG. 13 illustrates the results of proliferation assays with and without IL-2 using EAE mice treated with PLP-expressing fibroblasts.
- As indicated above, the present invention relates to the use of engineered cells to restore tolerance to self antigens in patients suffering from autoimmune disease. The engineered cells can be any mammalian cell. As used herein, the term “engineered” is intended to refer to a cell into which one or more recombinant genes, such as a gene encoding an epitope of a self antigen, has been introduced.
- A gene is a deoxyribonucleotide sequence coding for an amino acid sequence. Recombinantly introduced genes will either be in the form of a synthetic oligonucleotide, a cDNA gene (i.e. they will not contain introns), a copy of a genomic gene sequence, or a hybrid, gene which is a fusion of two or more gene sequences. Optionally the gene may be linked to one or more nucleotide sequence capable of directing expression of the gene product. Sequence elements capable of effecting expression of a gene or gene product include but are not limited to promoters, enhancer elements, transcription termination signals, polyadenylation sites, a Kozak box sequence to ensure efficient translation, and leader sequences. Optionally, the gene sequence can include restriction sites to enable the insertion of additional gene sequences. Preferably, the gene will contain a leader sequence to ensure the gene product is synthesized in the endoplasmic reticulum for later constitutive secretion.
- Recombinantly introduced genes carried by the engineered cells can encode one or more epitope, fragment, domain or mini-protein portion of a protein antigen. Examples of suitable proteins from which an epitope, fragment, domain, or mini-protein may be derived include but are not limited to myelin proteins, acetylcholine receptor, TSH receptor, and collagen.
- It is believed that protein self-antigens which are the target of an autoimmune response are highly conserved both among and between species. Thus, although the invention will primarily be used to treat humans it can also be used to treat animals. Examples of T cell mediated autoimmune diseases that may be treated using the invention include but are not limited to multiple sclerosis, myasthenia gravis, systemic lupus erythematosus, psoriasis, juvenile onset diabetes, rheumatoid arthritis, thyroid disease and chronic inflammatory demyelinating polyneuropathy (CIDP).
- Expression vectors are generally deoxyribonucleotide molecules engineered for controlled expression of one or more desired genes. The vectors may comprise one or more nucleotide sequences operably linked to a gene to control expression of the desired gene or genes. There are an abundance of expression vectors available and one skilled in the art could easily select an appropriate vector. In addition, standard laboratory manuals on genetic engineering provide recombinant DNA methods and methods for making and using expression vectors. Optionally, the vector may encode a selectable marker, for example, antibiotic resistance.
- The gene can be inserted into the mammalian cell using any gene transfer procedure. Examples of such procedures include but are not limited to, RNA viral mediated gene transfer such as retroviral transduction, DNA viral mediated gene transfer, electroporation, calcium phosphate mediated transfection, microinjection or liposome mediated gene transfer. The type of procedure required to achieve an engineered cell that secretes the desired gene product will depend on the nature and properties of the cell. The specific technology for introducing such genes into such cells is generally known and well within the skill of the art.
- The examples which follow illustrate the design and construction of a portion of the PLP gene, in vitro and in vivo expression of the PLP gene product, and the in vivo effects of the PLP gene product. The following examples are presented to illustrate the invention, and are not intended to limit the scope thereof.
- Design and Construction of the PLP Gene
- In SJL/J mice, the encephalitogenic epitope of PLP comprises amino acids 139-151. N Takahashi et al.,Cell 42:139-148 (1985), K Sakai et al., J. Neuroimmunol. 19:21-32 (1988), D. H. Kono et al., J. Exp. Med. 168:213-227. The vector in the present invention is designed in order that the gene product encoded by it be constitutively secreted from fibroblasts. Since the complete PLP protein is a hydrophobic transmembrane protein (H-J. Diehl, M. Schaich, R-M. Buszinski and W. Stoffel, PNAS U.S.A. 83:9807-9811 (1986)), with the encephalitogenic epitope being extracellular, a plasmid encoding amino acids 101-157 and additional amino acids required for secretion was constructed. This sequence is hydrophilic in character.
- 1. Oligonucleotide Synthesis and Construction of the PLP pRc/CMV Vector
- Oligonucleotides can be synthesized manually, e.g., by the phospho-tri-ester method, as disclosed, for example in R. L. Letsinger, et. al.,J. Am. Chem. Soc. 98:3655 (1967), the disclosure of which is incorporated by reference. Other methods are well known in the art. See also Matteucci and Caruthers, J. Am. Chem. Soc. 103:3185 (1981), the disclosure of which is incorporated by reference.
- Preferably, however, the desired gene sequence can be made by automated synthesis of individual oligonucleotides at 0.2 μM concentrations. For PLP amino acids 101-157, DNA syntheses were performed on a Perkin Elmer/Applied Biosystems Division Model 394 DNA synthesizer using cyanoethyl-protected phosphoramidites. The dimethoxytrityl (DMT) group was not removed from the 5′hydroxyl group to allow for purification. After normal cleavage from the resin using concentrated ammonium hydroxide and deprotection at 55° C. for 16 hours, the oligonucleotides were purified using oligonucleotide purification cartridges (CPC) according to the manufacturer's instructions (Applied Biosystems Inc.) Five oligonucleotides of the following sequences were synthesized:
OLG1 5′-CGGCGACTACAAGACCACCATCTGCGGCAAGGGCCTGAGCGCAACGGTAACAG GGGGCCAGAAGGGGAGGGGTTCCAGAGGCCAACATCAaGCTCATTCTCTCGAGC-3′, OLG2 5′-GAGCTTGATGTTGGCCTCTGGAACCCCTCCCCTTCTGGCCCCCTGTTACCGTT GCGCTCAGGCCCTTGCCGCAGATGGTGGTCTTGTAGTCGCCGGGCC-3′, OLG3 5′-GGGTGTGTCATTGTTTGGGAAAATGGCTAGGACATCCCGACAAGTTTGTGGGC ATCACCTATGCTACCCTTAAGTAGGATCCTTCAATAGGTA-3′, OLG4 5′-AGCTTACCTATTCAAGGATCCTACTTAAGGCTAGCATAGGTGATGCCCA-3′, and OLG5 5′-CAAACTTGTCGGGATGTCCTAGCCATTTTCCCAAACAATGACACACCCGCTCGAGAGAAT-3′. - Each purified oligonucleotide was dried under vacuum, washed with 1 ml of sterile double distilled water and then concentrated to dryness under vacuum (Speed vac evaporator; Savant Inc.). 80 pm of each oligomer was kinased at 37° C. for 1 hour by resuspending in 56.6 μl of 1× kinase buffer (Polynucleotide Kinase Buffer; Boehringer Mannheim, Indianapolis, Ind.) containing 10 units, of polynucleotide kinase (Boehringer Mannheim) and 100 μM of ATP. The individual oligonucleotides were combined in the presence of 2×SSC (0.03M Sodium Citratei pH 7.0, and 0.3M NaCl) in a PCR tube with their respective complementary oligomer partners for annealing. Each annealed set measured 20011 in volume. Oligomer OLG1 was annealed with OLG2, and oligomers OLG4 and OLG5 were annealed with OLG3. Annealing was performed in a Perkin-Elmer 9600 Thermocycler, programmed as follows: 1)99.9° for 2 minutes, and 2) 99.9° to 40 in 15 minutes. During the temperature descent to 4° C., when the thermocycler temperature reached 37° C., the solution containing the oligomer duplex OLG1 and OLG2 was combined with the solution containing the oligomers OLG3, OLG4, and OLG5. The descent cycle was then continued until it reached 22° C. Subsequently, 5 units (5 μl) of T4 ligase (Boehringer Mannheim, Indianapolis, Ind.) and 45 μl of manufacturer's 10×T4 DNA ligation buffer (Boehinger Mannheim, Indianapolis, Ind.) was added, and ligation proceeded overnight at 10° C.
- The ligated DNA was precipitated with 2 volumes of 100% ethanol and incubated at −70° C. for 1 hour. The precipitate was centrifuged for 30 minutes at 17000×g at 4° C. The supernatant was discarded and pellet was washed with 1 ml of 70° ethanol and centrifuged for 10 minutes at 17000×g at 4° C. The DNA pellet was dried under vacuum (Speed vac evaporator; Savant Inc.) and resuspended in 45 μl sterile double distilled water.
- DNA of the correct molecular weight was isolated by electrophoresis. 5 μl of 10× loading buffer (6.25 g Ficoll and 0.93 g Disodium EDTA/25
ml 10% SDS, Orange G, Xylene Cyanole, and Bromophenol Blue) was added to the sample and loaded onto a 14.5 cm×16 cm×0.15 mm urea/acrylamide gel (7M urea/8% acrylamide with 1.1% Bis). TBE (89 mM Tris, 89 mM Boric acid, and 2 mM EDTA pH8.0) was used as both gel and electrophoresis buffer. The sample was electrophoresed at 35 mA until the Orange G dye line had migrated within 1 cm of the bottom of the gel. The acrylamide gel was washed twice with water for 5 minutes. After the last wash, the gel was incubated for 3 minutes in a 500 ml solution containing 10 ul of 10 mg/ml of ethidium bromide, and visualized under a UV-light source. The band corresponding to the ligated DNA was excised and cut into small pieces for electroelution in an IBI electroelutor apparatus (Model UEA: International Biotechnologies Inc., New Haven, Conn.). - For electroelution, the salt trap of the apparatus was filled with 125 μl of 7M sodium acetate/bromophenol blue dye solution. The buffer chamber was filled with {fraction (1/2)}×TBE. The sample was electroeluted for 1 hour at 85V. After removing the eluted DNA, the sample well was washed with {fraction (1/2)}×TBE and combined with the initial eluate. The eluted DNA was then precipitated overnight at −70° C. with 2 volumes of 100% ethanol. The precipitate was pelleted, washed as previously described, and resuspended in 15 ul of sterile double distilled water.
- Preceding the ligation of the eluted partial PLP gene to the pRc/CMV vector (Invitrogen, San Diego, Calif.), the pRc/CMV vector construct was cut with the restriction endonucleases Apa I and Hind III according to the Manufacturer's instructions (Boehringer Mannheim, Indianapolis, Ind.). The resuspended PLP gene construct was then added to a 5 μl mixture containing 0.3 kg of pRc/CMV cut vector (2 μl), 1 unit T4 ligase (1 μl) (Boehringer Mannheim, Indianapolis, Ind.), and 2 μl of Manufacturer's 10×T4 DNA ligation buffer (Boehringer Mannheim, Indianapolis, Ind.). The ligated vector was then transformed into the competent cell line AG1.
- Transformation proceeded by combining the ligation mixture with the AG1 cells and incubating it on ice for 20 minutes. The cell/vector mixture was then incubated at 42 for 2 minutes and plated overnight onto a Luria Broth agar (LB; Bio101, Vista, Calif.) plate, supplemented with 80 mg/ml of ampicillin (Sigma, St. Louis Mo.) Colonies were screened for the correct sequence vector by first isolating the plasmid DNA and then sequencing the DNA.
- To isolate the plasmid, a commercially available plasmid purification kit, Wizard Minipreps (Promega, Madison, Wis.) was used. Colonies were picked from the LB/Amp plates and grown for 3.5 hours in 5 ml of LB medium (
BIO 101, Vista, Calif.) supplemented with 80 mg/ml of ampicillin (Sigma, St. Louis, Mo.). 3 ml of the medium was centrifuged at 17000×g at room temperature, for 1 minute to pellet the cells. Isolation of the plasmid proceeded according to the Manufacturer's instructions. 1 μg of the isolated DNA was used, for sequencing. - The oligonucleotide sequence can be checked by methods well known in the art, such as that described by Sanger et al.,PNAS U.S.A. 70:1209 (1973) or by the Maxam-Gilbert method, Meth. Enzymology, 65:499 (1977), the disclosures of both of which are incorporated herein by reference. Preferably, the plasmid can be sequenced using an automated DNA sequencer. For the PLP pRc/CMV construct, the plasmid was sequenced using automated fluorescent DNA sequencing procedures (Perkin Elmer/Applied Biosystems Inc, Foster City, Calif.) using the following primers: GATTTAGGTGACACTATAG and TAATACGACTCACTATAGGG. These primers primed off the vector, which flanked the Kozak and “stop” site of the total construct. FIG. 1 shows a map of the partial PLP gene showing the sequence of the gene product and restriction sites. At the 5′ end of the construct we had previously inserted a hydrophobic leader sequence from the MHC class I Ld gene to enable the gene product to be synthesized in the endoplasmic reticulum IER) for later constitutive secretion. Linsk et al. J. Exp. Med. 164:794-813 (1996). In addition, a lysine codon at the 3′ end was added to ensure that the protein could not be retained in membrane. A Kozak box was included in the construct to ensure efficient translation. Restriction sites Afl II and BamHI were included in the construct to allow for insertion of further epitopes.
- In Vitro Expression of the PLP Protein
- The following experiments were performed in order to demonstrate that the PLP vector encodes a protein which is constitutively secreted. Specifically, the mRNA levels of PLP were evaluated in SJL fibroblast cells transfected with the pRc/CMV-PLP vector, and mRNA and protein levels of PLP were evaluated in SJL fibroblast cells transfected with the pGlPLPSvNa vector.
- 1. Establishment of Fibroblast Cultures
- Syngeneic fibroblasts (derived from SJL mice) were obtained from Dr. G. Dveskler (Uniformed Services University, Bethesda, Md.) and expanded at 37° incubation using DMEM growth medium, supplemented with 5% glutamine and 10% FCS. The cells were harvested and frozen at 1×107 cells per vial, and aliquots were quality control tested for mycoplasma, sterility and viability.
- 2. Retroviral Constructs
- A recombinant retroviral vector in which exogenous genes are inserted into a retroviral vector was constructed. The cloning strategy was to construct a pGlXSvNa vector (W. French Anderson, University of Southern California) containing the PLP insert from pRc/CMV-PLP. The pGlXSvNa vector, like most retroviral vectors used in preclinical and clinical trials, is derived from the Moloney murine leukemia retrovirus (Mo-MLV). Rosenberg et al.,N. Eng. J. Med. 323:570-578. (1990), Culver et al., Science 256:1550-1552 (1992). The GlXSvNa vector is a 5865 bp vector whose map, functional features and complete DNA sequence are shown in FIGS. 2a and 2 b. FIG. 3 illustrates the procedure for constructing the pGlPLPSvNa vector. Essentially, the pRc/CMV-PLP vector was digested with BstEII/HindIII and PLP encoding fragment was isolated by gel electrophoresis. After electroelution, HindIII/NotI adapters (Stratagene, La Jolla, Calif.) were ligated into the HindIII site of the eluted fragment. A NotI digestion was performed to generate NotI ends. A NotI digest was performed on pGlXSvNa and the 5865 bp fragment was isolated, electroeluted, and a CIAP (Calf intestine alkaline phosphatase treatment) was performed on the fragment ends. The NotI site of the insert was ligated into the NotI site of the vector. BstEII ends of the insert and NotI site of the vector were Klenowed. A blunt end ligation is performed to close the vector. HB101 cells were transformed with ligation mix and restriction analysis was performed to determine which vectors contain insert and the insert orientation. The recombinant retroviruses are non-replicating and incapable of producing infectious virus.
- 3. Retroviral Vector Supernatant
- To prepare supernatant containing PLP-recombinant retrovirus, the PLP-transduced retroviral packaging cell line PA317 was grown in 4 ml of appropriate culture medium in a T25 flask (Corning, Cambridge, Mass.). Retroviral vector supernatant is produced by harvesting the cell culture medium when cells were 80-90% confluent, and stored in 1 ml aliquots at −70C°.
- The following tests were performed on the PLP cell line and/or the vector supernatants:
- (1) The viral titer is determined using 3T3 cells. Viral preparations with titers greater than 5×104 colons forming units/ml are used.
- (2) Sterility of the producer cell line and the supernatant is assured by testing for aerobic and anaerobic bacteria, fungus and mycoplasma.
- The PLP-vector preparations from PA317 can be extensively tested to assure that no detectable replication competent virus is present. This is particularly relevant to the embodiment of the invention wherein the invention is used to treat humans. Tests on both the viral supernatant and on the transduced fibroblasts can be performed to determine if there is replication competent virus present. The following tests can be performed on the producer cell line and/or the viral supernatant:
- (1) The viral titer is determined using 3T3 cells. Viral preparations with titers greater than 5×104 colony forming units/ml are used.
- (2) Southern blots are run on the producer cell line to detect the partial PLP gene.
- (3) PLP production by the producer cell line is measured and should be significantly above baseline control values, as determined by ELISA assay.
- (4) Sterility of the producer cell line and the supernatant is assured by testing for aerobic and anaerobic bacteria, fungus and mycoplasma.
- (5) Viral testing is performed including: MAP test, LCM virus, thymic agent, S+L-assay for ecotropic virus, S+L assay for xenotropic virus, S+L-assay for amphotropic virus and 3T3 amplification.
- (6) Electron microscopy is performed to assure the absence of adventitious agents.
- Following the introduction of the gene into fibroblasts, the following tests are performed on the fibroblasts prior to administration to patients.
- (1) Cell viability is greater than 70′ as tested by trypan blue dye exclusion.
- (2) Cytologic analysis is performed on over 200 cells prior to infusion to assure that tumor cells are absent.
- (3) Sterility is assured by testing for aerobic and anaerobic bacteria, fungus and mycoplasma.
- (4) S+L-assay including 3T3 amplification must be negative.
- (5) PCR assay for the absence of 4070A envelope gene must be negative.
- (6) Reverse transcriptase assay must be negative.
- (7) Southern blots run on the transduced fibroblasts to assure that intact provirus is present.
- (8) PLP protein assay to assure the production of PLP protein.
- 4. Transfection of Fibroblasts
- Prior to the transfection of the SJL fibroblasts, highly purified PLP-pRc/CMV vector was isolated from the transformed AG1 cells. Large scale purification was performed by using a commercially available kit and CsCl gradient banding. Initial purification was accomplished using a Wizard Megaprep Kit (Promega, Madison, Wis.). A 1000 ml culture of transformed AG1 cells, grown overnight in LB/Amp at 37° C., was pelleted and the plasmid DNA isolated according to the Manufacturer's instructions. The isolated DNA, which was suspended in 3 ml of TE buffer (10 mM Tris-HCl, pH 7.4, and 1 mM disodium EDTA, pH, 8.0) was further processed by CsCl gradient banding. A modified CsCl banding of the DNA was performed based on procedures found in “Current Protocols in Molecular Biology,
Vol 1” (Greene Publishing Associates and Wiley-Interscience). - After the DNA band was extracted from the ultracentrifuge tubes, ethidium bromide was removed from the sample by washing it with 3 volumes of SSC saturated isopropanol. The wash was repeated until the aqueous layer appeared clear. CsCl was removed by precipitation. 2 volumes of 0.2M NaCl/TE and 2 volumes of 100% ethanol (relative to the combined total volume of DNA solution and 0.2M NaCl/TE) were added to the sample, mixed and placed on ice for 10 minutes. The precipitated DNA was pelleted by centrifugation at 10000×g for 10 minutes at 4° C. The pellet was washed with cold 70% ethanol, recentrifuged at 10000×g for 10 minutes at 4° C., and dried under vacuum (Speed vac evaporator; Savant Inc.). The purified DNA was resuspended with double-distilled sterile water and utilized in the transfection process.
- Test SJL fibroblasts were transfected using LipofectAMINE Reagent (Life Technologies Inc./Gibco BRL) according to the manufacturer's instructions. Control SJL fibroblasts underwent the same procedure without the presence of a DNA construct. 3 μg of CsCl purified PLP-pRc/CMV plasmid and 25 μl of Lipofectamine were used for transfection. Approximately 3×105 SJL cells, seeded overnight into 25 cm2 culture flasks (Corning Costar Corp., Cambridge, Mass.) and grown at 37° with 5% CO2 in 5 ml of DMEM culture medium (Dulbecco's Modified Eagle's Medium (Irvine Scientific, Santa Ana, Calif.), supplemented with 5% glutamine, 10% Fetal Calf Serum, 25 Units/ml of penicillin G sodium, and 25 μg/ml of streptomycin sulfate, were washed with 3 ml serum free HL-1 medium (Hycor Biomedical Inc., Irvine, Calif.). After the DNA/lipofectamine complexes were incubated with cells for 6 hours at 37° with 5% CO2, 1 ml of DMEM was added to the flasks. The flasks were incubated overnight at 370 with 5% CO2. The medium was replaced with 5 ml of fresh DMEM the next morning. 36 hours after the end of the transfection period, the medium was replaced with 5 ml of DMEM containing 900 kg of G418 (Life Technologies Inc./Gibco BRL)/ml of medium. The test cells were grown in the presence of 900 kg of G418 of medium until all the control cells had died; and no more cell death could be observed in the test sample flask. The G418 concentration was then reduced to 600 μg/ml of culture medium for duration of cell culturing procedures.
- 5. Transduction of Fibroblasts
- Retroviral constructs containing a neo-selectable marker together with either the PLP gene or the Lac-z gene were used to transduce fibroblasts. Transduction with the retrovirus was performed on healthy cells (90% viable, as determined by trypan blue staining). 2×106 cells were plated in 0.5 ml DMEM-10 media (DMEM media supplemented with 109′ fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin G, 50 mg/ml streptomycin in one well of a 24-well plate (Falcon, Franklin Lakes, N.J.) Cells were placed in the incubator and allowed to settle (37°, 5% CO2). After cells had settled, 1 ml of retroviral supernatant and polybrene (Sigma, St. Louis, Mo.) (
final concentration 10 μg/ml) was added to the well. Cells were incubated as above for 2.5 hours without shaking. After 2.5 hours, cells were transferred to a T25 flask and DMEM-10 media was added to a total volume of 8 ml. Selection media (culture media comprising DMEM-10 supplemented with 900 μg/ml G418 (Gibco, Grand Island, N.Y.) was added on the third day after transduction. The G418 concentration was then reduced to 600 μg/ml of culture medium for the duration of cell culturing procedures. - 6. mRNA Expression Analysis
- mRNA isolation was performed using aseptic techniques, RNAse free supplies, and DEPC (Diethylpyrocarbonate) treated solutions. 4×106 experimental and control SJL cells were washed twice with cold Phosphate-buffered saline, resuspended in 200 μl cell lysis mix (10 mM TRIS pH 7.5, 0.15M NaCl, 1.5 mM MgCl2, 0.65% NP 40), vortexed, and centrifuged at 17000×g at 40 for 5 minutes. The supernatant was transferred to a tube containing 200 μl of urea mix (7M urea, 1% SDS, 0.35M NaCl, 10 mM EDTA, and 10 mM Tris-HCL, pH 7.5) and 400 μl of phenol:chloroform;isoamyl alcohol (25:24:1). The solution was vortexed and centrifuged for 1 minute at 17000×g. This procedure was repeated twice using the aqueous layer and then transferred to a tube containing 400 μl of phenol and washed as before. The aqueous layer was transferred again to another tube, and precipitated with 1 ml of 100% ethanol overnight at −20° C. The precipitated RNA was washed with 1 ml 70% ethanol. After the ethanol was discarded, the pellet was dried under vacuum lag of the RNA was used for RT-PCR analysis.
- RT-PCR was performed using a commercially available kit, GeneAmp RNA PCR Kit (Perkin Elmer/ABI) according to the Manufacturer's instructions. The following primers were used to amplify the cDNA: 5′-GCGACTACAAGACCACCATCT-3′ and 5′-TAAGGCTAGCATAGGTGATG-3′. The PCR products were electrophoresed on a 1.5% agarose (SeaKem GTG; FMC)/s, gel with 1 μl of 10 mg/ml of ethidium bromide/ml of agarose solution. The gel was electrophoresed using TAE buffer at a constant 40 mA. Electrophoresis was continued until the molecular weight marker bands had separated adequately enough, to verify the PCR products' approximate molecular size. The DNA band of interest was then excised and gel purified, using the commercially available MERmaid Kit (
Bio 101, Vista, Calif.), according to the Manufacturer's instructions. The purified DNA was then sequenced by automated Fluorescent DNA sequencing procedures (Perkin Elmer/ABI, Foster City, Calif.). - FIG. 4 is an agarose gel showing PLP-specific RT-PCR products. The data illustrates that mRNA is present in both PLP-transduced and PLP-transfected cells. The correlation between mRNA and secreted protein remains to be determined since peptide concentration does not necessarily correspond to the level of mRNA.
- 7. Protein Expression Analysis
- The in vitro qualitative expression of the proteins encoded by the PLP gene was detected immunologically by ELISA. Undiluted supernatants from cultures of fibroblasts transduced with the PLP gene were tested. Wells of 96 microtiter plate were coated with the supernatants. Primary anti-PLP-antibody 4E10 139-151, from Dr M. Lees (Harvard), is specific for PLP 139-151 and was added to wells as undiluted hybridoma supernatant followed by horseradish peroxidase (HRP)-conjugated goat anti-mouse secondary antibody in a concentration of 1:500. The plate was developed and analyzed at 490 nm on a microplate reader. FIG. 5 illustrates the results of ELISA assays on transduced fibroblast supernatants.
Samples - In Vivo Effects of the PLP Protein
- Critical to the success of this invention in the embodiment of this example is the ability to deliver genetically manipulated fibroblasts to patients so that the cells survive in sufficient numbers and for long periods of time, in order that continuous secreted antigen may be provided to the patient.
- To assess the fate of transplanted transduced fibroblasts, SJL fibroblasts transduced with retrovirus encoding B-galactosidase were injected subcutaneously between the shoulders of SJL mice. All mice were female mice of the SJL strain between 6-8 weeks old and were obtained from Jackson Labs. Animals were housed and maintained according to NIH guidelines (National Research Council, 1986). These fibroblasts survived in large numbers after 60 days. Fibroblasts injected into the footpad or intramuscularly could not be detected at eight days.
- 1. In Vivo Fate B-Gal Transduced Cells
- The activity of the B-Galactosidase marker was evaluated using two groups of eight normal mice. Two mice were injected subcutaneously on the back, two mice were injected intramuscularly and two mice were injected in the footpad with Lac-Z transduced cells. One animal was injected with fibroblasts transduced with neo-marker only, and the last mouse was injected with untransduced fibroblasts. After harvesting and washing, the different cell lineages were suspended in a concentration of 107 cells in 0.2 ml of Hank's PBS and slowly injected using a 25 gauge needle at different sites Animals were sacrificed at 10 and 15 days post treatment and injection sites were submitted to histochemical study. Pieces of tissue were fixed in 4% paraformaldehyde for one hour, washed in PBS three times and then kept in 8.4% acrylamide solution overnight. The next morning tissues were embedded in acrylamide which after hardening were cut and frozen. The frozen sections were done in 10 um by cryostat and stained with 1 ml of 5-Bromo-4-chloro-3-indolyl-B-d-galactopyranoside (X-Gal) in PBS. The X-Gal was dissolved in DMSO at 40 mg/ml and then added to the reaction mixture. Incubation was for 14-18 h at 37°. FIG. 6 illustrates B-Gal expression in transduced fibroblasts 60 days in vivo. There was no evidence of an inflammatory response, suggesting that the retrovirus used to transduce syngeneic fibroblasts, does not evoke an immune response or rejection process.,
- 2. Effect of PLP in Normal SJL Mice
- Another important aspect of this invention in the embodiment of this example is determining whether transduced fibroblasts secreting PLP actually produce EAE in normal animals. To test this, 10′ P12-secreting SJL fibroblasts were injected into 12 normal SJL mice. Six animals had fibroblasts placed subcutaneously and six animals had fibroblasts injected intraperitoneally. Animals were sacrificed at day 16 and showed no evidence of inflammatory disease or EAE. FIG. 7 illustrates the clinical scoring system for chronic EAE. Y-A Lu et al.,Mol. Immunol. 28:623-630 (1991), J. Williamson et al., J. Neuroimmunol. 32:199-207 (1991). In the EAE model for multiple sclerosis, using spinal cord homogenates plus adjuvant, inflammation in the CNS can be seen by
day 14. In this study, normal animals injected with PLP-secreting SJL fibroblasts did not show any signs of clinical disease even at day 60. In addition, the animals did not show any histologic evidence of inflammation in the CNS at day 60. FIG. 8 illustrates the histological scoring system for EAE. J. Governman et al., Cell 72:551-560 (1993)., - 3. Clinical and Histological Assessment of Acute EAE Mice Treated With Retrovirus Transduced Fibroblasts.
- Six week SJL mice were infected with mouse spinal cord homogenate (MSCH) in complete Freund's Adjuvant (CFA) and with MSCH in incomplete Freund's Adjuvant IFA, seven days later.J. Immunol. 144:909-915 (1990). The initial EAE attack was observed on days 14-18, with full recovery by 21. Ninety-five percent of animals showed clinical evidence of an acute attack and these were given either 107 PLP secreting SJL fibroblasts or control fibroblasts on
day 21. Animals not showing clinical disease were eliminated from the experiment. FIG. 9 illustrates the clinical assessment of EAE mice treated with retrovirus transduced fibroblasts. Animals receiving the PLP secreting fibroblasts had a marked reduction of clinical signs and had dramatic reduction in inflammatory cells, particularly in the brain. - FIG. 10a illustrates the pathologic assessment of brain and spinal cord of SJL mice treated with retrovirus transduced fibroblasts. FIG. 10b is a summary of the pathologic assessment of brain and spinal cord from days 55-60 and 90-95. Histological assessment of EAE Grades in Brain and Spinal Cord were performed following the preparation of hematoxylin and eosin stained sections.
- 4. Clinical and Histological Assessment of Chronic EAE Mice Treated With Retrovirus Transduced Fibroblasts.
- 150 mice were inoculated with MSCH in CFA. A second immunization was given 7 days later. A. M. Brown and D. E. McFarlin,Laboratory Invest. 45:278-284 (1981). On day +14 to 16, 113 animals developed clinical disease lasting 3-4 days. These positive animals were separated for subsequent experiments and had their first relapse on day +55 to 60, with 100 animals becoming sick. These were again separated and on day +137, 67 had a relapse. Eight days after relapse, animals were each transplanted with 107 fibroblasts and then sacrificed 18 to 23 days later. Four different types of fibroblasts were used, those transduced with retrovirus encoding PLP, encoding B-galactosidase and encoding neo-selectable marker as well as untransduced cells. FIG. 11 shows the histology of SJL mice with chronic EAE treated with retrovirus transduced fibroblasts. There were no animals receiving PLP secreting fibroblasts with 2+ to 3+ inflammation.
- 5. Peripheral Immune Status of Treated Mice v. Control EAE Mice.
- Spleen cells from our EAE control mice and from four EAE mice which had been treated with fibroblasts expressing the PLP protein were used in proliferation assays, in which they were incubated with 40 μM PLP peptide 139-151 or 40 μM HIV gp120 peptide 308-322 for 4 days and then pulsed with3H-thymidine for 24 hours.
- Briefly, animals were sacrificed by CO2 asphyxiation. Spleen cells were dispersed to single cell suspensions in RPMI 1640 by passing through a size 60 mesh, and washed once before being cultured (8×105 per well) in 0.2 ml of HL-1 medium (Hycor Biomedical, Irvine, Calif.), supplemented with 2 mM glutamine, 100 U/ml penicillin, 100 μg streptomycin either alone or with 40 μM of peptide in 96-well tissue culture plates for 4 days at 37° C. with 5* CO2. PLP peptide 140-151 and MBP peptide 89-101 were used for antigen-specific proliferation while HIV gp120 peptide 308-322 was used as negative control. Where indicated, some wells also contained 10 U/ml of recombinant mouse IL-2 (Boehringer Mannheim, Indianapolis, Ind.) During the last 18-24 h of culture, each well was pulsed with 1 μCi of 3H-thymidine (ICN, Irvine, Calif.), harvested onto ‘Xtal Scint’ glass fiber filters (Beckman, Fullerton, Calif.) and counted using a Beckman LSGOOO Scintillation counter. Thymidine incorporation values (experimental counts per minute-background counts per minute) were calculated and represent means of triplicate cultures±standard deviation.
- The results are shown in FIG. 12 and suggest that PLP specific proliferative responses are reduced significantly in EAE mice which have received PLP expressing fibroblasts.
- FIG. 13 illustrates the same experiment as in FIG. 12 but with the addition of mouse IL-2 (10 U/ml) for 5 days. These results illustrate that the mechanism by which the PLP specific proliferative responses are reduced significantly may suggest the possibility of deletion of T cells rather than anergy because these lymphocytes do not respond to IL-2.
- Although the mechanism by which the present invention acts to restore tolerance in individuals suffering from T-cell mediated autoimmune disease is not entirely understood, the benefits of the treatment are clearly advantageous over alternative treatments. The method is a genetic approach to immunospecifically silence pathogenic T-cell responses and does not down-regulate the entire immune system. In the case where an individual with a T-cell mediated autoimmune disease exhibits pathogenic T-cells of multiple specificities, the invention may easily be adapted to target those specificities. For example, DNA encoding multiple self-antigenic epitopes may be introduced into the patient's cells. The invention is also advantageous in that the reagents can easily be made or obtained in sufficient quantity to carry out the invention.
- The present invention is not to be limited in scope by the exemplified embodiments disclosed herein which are intended as illustrations of single aspects of the invention, and clones, DNA or amino acid sequences which are functionally equivalent are within the scope of the invention. Various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.
- Various publications are cited herein that are hereby incorporated by reference in their entireties.
-
1 1 1 5856 DNA Artificial Sal/hind drag of pSVNA into Sal/Hind cut G1 1 tttgaaagac cccacccgta ggtggcaagc tagcttaagt aacgccactt tgcaaggcat 60 ggaaaaatac ataactgaga ataggaaagt tcagatcaag gtcaggaaca aagaaacagc 120 tgaataccaa acaggatatc tgtggtaagc ggttcctgcc ccggctcagg gccaagaaca 180 gatgagacag ctgagtgatg ggccaaacag gatatctgtg gtaagcagtt cctgccccgg 240 ctcggggcca agaacagatg gtccccagat gcggtccagc cctcagcagt ttctagtgaa 300 tcatcagatg tttccagggt gccccaagga cctgaaaatg accctgtacc ttatttgaac 360 taaccaatca gttcgcttct cgcttctgtt cgcgcgcttc cgctctccga gctcaataaa 420 agagcccaca acccctcact cggcgcgcca gtcttccgat agactgcgtc gcccgggtac 480 ccgtattccc aataaagcct cttgctgttt gcatccgaat cgtggtctcg ctgttccttg 540 ggagggtctc ctctgagtga ttgactaccc acgacggggg tctttcattt gggggctcgt 600 ccgggatttg gagacccctg cccagggacc accgacccac caccgggagg taagctggcc 660 agcaacctat ctgtgtctgt ccgattgtct agtgtctatg tttgatgtta tgcgcctgcg 720 tctgtactag ttagctaact agctctgtat ctggcggacc cgtggtggaa ctgacgagtt 780 ctgaacaccc ggccgcaacc cagggagacg tcccagggac tttgggggcc gtttttgtgg 840 cccgacctga ggaagggagt cgatgtggaa tccgaccccg tcaggatatg tggttctggt 900 aggagacgag aacctaaaac agttcccgcc tccgtctgaa tttttgcttt cggtttggaa 960 ccgaagccgc gcgtcttgtc tgctgcagca tcgttctgtg ttgtctctgt ctgactgtgt 1020 ttctgtattt gtctgaaaat tagggccaga ctgttaccac tcccttaagt ttgaccttag 1080 gtcactggaa agatgtcgag cggatcgctc acaaccagtc ggtagatgtc aagaagagac 1140 gttgggttac cttctgctct gcagaatggc caacctttaa cgtcggatgg ccgcgagacg 1200 gcacctttaa ccgagacctc atcacccagg ttaagatcaa ggtcttttca cctggcccgc 1260 atggacaccc agaccaggtc ccctacatcg tgacctggga agccttggct tttgaccccc 1320 ctccctgggt caagcccttt gtacacccta agcctccgcc tcctcttcct ccatccgccc 1380 cgtctctccc ccttgaacct cctcgttcga ccccgcctcg atcctccctt tatccagccc 1440 tcactccttc tctaggcgcc ggaattcgcg gccgctacgt agtcgactcg ctgtggaatg 1500 tgtgtcagtt agggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca 1560 tgcatctcaa ttagtcagca accaggtgtg gaaagtcccc aggctcccca gcaggcagaa 1620 gtatgcaaag catgcatctc aattagtcag caaccatagt cccgccccta actccgccca 1680 tcccgcccct aactccgccc agttccgccc attctccgcc ccatggctga ctaatttttt 1740 ttatttatgc agaggccgag gccgcctcgg cctctgagct attccagaag tagtgaggag 1800 gcttttttgg aggcctaggc ttttgcaaaa agctcgaaga tcaattccga tctgatcaag 1860 agacaggatg aggatcgttt cgcatgattg aacaagatgg attgcacgca ggttctccgg 1920 ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc ggctgctctg 1980 atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc 2040 tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg gctatcgtgg ctggccacga 2100 cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg gactggctgc 2160 tattgggcga agtgccgggg caggatctcc tgtcatctca ccttgctcct gccgagaaag 2220 tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct acctgcccat 2280 tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa gccggtcttg 2340 tcgatcagga tgatctggac gaagagcatc aggggctcgc gccagccgaa ctgttcgcca 2400 ggctcaaggc gcgcatgccc gacggcgagg atctcgtcgt gacccatggc gatgcctgct 2460 tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt ggccggctgg 2520 gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct gaagagcttg 2580 gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc gattcgcagc 2640 gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc gggactctgg ggttcgtcga 2700 gaagcttggg cccatcgata aaataaaaga ttttatttag tctccagaaa aaggggggaa 2760 tgaaagaccc cacctgtagg tttggcaagc tagcttaagt aacgccattt tgcaaggcat 2820 ggaaaaatac ataactgaga atagagaagt tcagatcaag gtcaggaaca gatggaacag 2880 ctgaatatgg gccaaacagg atatctgtgg taagcagttc ctgccccggc tcagggccaa 2940 gaacagatgg aacagctgaa tatgggccaa acaggatatc tgtggtaagc agttcctgcc 3000 ccggctcagg gccaagaaca gatggtcccc agatgcggtc cagccctcag cagtttctag 3060 agaaccatca gatgtttcca gggtgcccca aggacctgaa atgaccctgt gccttatttg 3120 aactaaccaa tcagttcgct tctcgcttct gttcgcgcgc ttctgctccc cgagctcaat 3180 aaaagagccc acaacccctc actcggggcg ccagtcctcc gattgactga gtcgcccggg 3240 tacccgtgta tccaataaac cctcttgcag ttgcatccga cttgtggtct cgctgttcct 3300 tgggagggtc tcctctgagt gattgactac ccgtcagcgg gggtctttca tttgggggct 3360 cgtccgggat cgggagaccc ctgcccaggg accaccgacc caccaccggg aggtaagctg 3420 gctgcctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga 3480 cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag 3540 cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat agcggagtgt 3600 atactggctt aactatgcgg catcagagca gattgtactg agagtgcacc atatgcggtg 3660 tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcgctctt ccgcttcctc 3720 gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 3780 ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa 3840 aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct 3900 ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac 3960 aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc 4020 gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc 4080 tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg 4140 tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga 4200 gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag 4260 cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta 4320 cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag 4380 agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg 4440 caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac 4500 ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc 4560 aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag 4620 tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc 4680 agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac 4740 gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc 4800 accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg 4860 tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag 4920 tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctgcaggca tcgtggtgtc 4980 acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac 5040 atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag 5100 aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac 5160 tctcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg 5220 agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaacacggg ataataccgc 5280 gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact 5340 ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg 5400 atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa 5460 tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt 5520 tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg 5580 tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga 5640 cgtctaagaa accattatta tcatgacatt aacctataaa aataggcgta tcacgaggcc 5700 ctttcgtctt caagaattca taccagatca ccgaaaactg tcctccaaat gtgtccccct 5760 cacactccca aattcgcggg cttctgctct tagaccactc taccctattc cccacactca 5820 ccggagccaa agccgcggcc cttccgtttc tttgct 5856
Claims (19)
1. A method of treating a patient for a T-cell mediated autoimmune disease comprising: introducing a cell comprising a polynucleotide encoding an antigenic amino acid sequence into a patient, the cell expressing in the patient a therapeutically effective amount of the antigenic amino acid sequence to induce T-cell tolerance to the expressed antigenic amino acid sequence.
2. The method of claim 1 wherein the patient is human.
3. The method of claim 2 wherein the cell is a fibroblast.
4. The method of claim 3 wherein the fibroblast is histocompatible with the patient.
5. The method of claim 1 wherein the cell is autologous.
6. The method of claim 1 wherein the cell is heterologous.
7. The method of claim 1 wherein the antigenic amino acid sequence is from a nervous system protein.
8. The method of claim 2 wherein the disease is selected from the group consisting of multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, psoriasis, juvenile onset diabetes, Sjogren's disease, thyroid disease, myasthenia gravis, and chronic inflammatory demyelinating polyneuropathy (CIDP).
9. The method of claim 8 wherein the disease is multiple sclerosis.
10. The method of claim 1 , wherein the expressed antigenic amino acid further comprises a hydrophobic leader sequence, the hydrophobic leader sequence enabling the antigenic amino acid to be synthesized in an endoplasmic reticulum for later constitutive secretion.
11. The method of claim 1 , wherein the polynucleotide farther comprises a Kozak box, the Kozak box permitting efficient translation of an mRNA transcribed from the polynucleotide.
12. The method of claim 1 , wherein the antigenic amino acid sequence comprises an encephalogenic amino acid epitope.
13. The method of claim 12 , wherein the encephalogenic amino acid epitope is selected from the group consisting of the encephalogenic epitopes of myelin basic protein, myelin-oligodendrocyte glycoprotein, and proteolipid protein.
14. The method of claim 13 wherein the disease is multiple sclerosis.
15. The method of claim 1 , wherein a recombinant vector is used to transfect the polynucleotide into the cell.
16. The method of claim 15 , wherein the vector is a viral vector.
17. The method of claim 16 , wherein the viral vector is a retroviral vector.
18. The method of claim 15 , wherein the transfection is in vitro.
19. The method of claim 15 , wherein the transfection is in vivo.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/359,397 US20040071673A1 (en) | 1996-05-29 | 2003-02-05 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
US11/488,524 US8323963B2 (en) | 1996-05-29 | 2006-07-17 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/654,737 US6274136B1 (en) | 1996-05-29 | 1996-05-29 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
US71553500A | 2000-11-17 | 2000-11-17 | |
US10/098,035 US20020141983A1 (en) | 1996-05-29 | 2002-03-14 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
US10/359,397 US20040071673A1 (en) | 1996-05-29 | 2003-02-05 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/098,035 Continuation US20020141983A1 (en) | 1996-05-29 | 2002-03-14 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US11/488,524 Continuation-In-Part US8323963B2 (en) | 1996-05-29 | 2006-07-17 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
Publications (1)
Publication Number | Publication Date |
---|---|
US20040071673A1 true US20040071673A1 (en) | 2004-04-15 |
Family
ID=24626060
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/654,737 Expired - Lifetime US6274136B1 (en) | 1996-05-29 | 1996-05-29 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
US10/098,035 Abandoned US20020141983A1 (en) | 1996-05-29 | 2002-03-14 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
US10/359,397 Abandoned US20040071673A1 (en) | 1996-05-29 | 2003-02-05 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
Family Applications Before (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/654,737 Expired - Lifetime US6274136B1 (en) | 1996-05-29 | 1996-05-29 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
US10/098,035 Abandoned US20020141983A1 (en) | 1996-05-29 | 2002-03-14 | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
Country Status (7)
Country | Link |
---|---|
US (3) | US6274136B1 (en) |
EP (1) | EP1015034A4 (en) |
AU (1) | AU734633B2 (en) |
CA (1) | CA2256577A1 (en) |
NO (1) | NO985576L (en) |
RU (1) | RU2248807C2 (en) |
WO (1) | WO1997045144A1 (en) |
Families Citing this family (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6274136B1 (en) * | 1996-05-29 | 2001-08-14 | University Of Southern California | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
US8323963B2 (en) * | 1996-05-29 | 2012-12-04 | University Of Southern California | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
US7030098B2 (en) | 1999-03-12 | 2006-04-18 | The Board Of Trustees Of The Leland Stanford Junior University | DNA vaccination for treatment of autoimmune disease |
EP1168923B1 (en) * | 1999-03-12 | 2005-11-02 | The Board Of Trustees Of The Leland Stanford Junior University | Dna vaccination for treatment of autoimmune disease |
US6884785B2 (en) * | 1999-06-17 | 2005-04-26 | The Scripps Research Institute | Compositions and methods for the treatment or prevention of autoimmune diabetes |
IL132611A0 (en) | 1999-10-27 | 2001-03-19 | Yeda Res & Dev | Synthetic genes and polypeptides and pharmaceutical compositions comprising them |
US20020147158A1 (en) * | 2001-02-27 | 2002-10-10 | University Of Southern California | Composition and method for preventing and treating sinusoidal obstruction syndrome and radiation-induced liver disease |
WO2003028441A1 (en) * | 2001-10-02 | 2003-04-10 | The Board Of Trustees Of The Leland Stanford Junior University | Gene therapy for the prevention of autoimmune disease |
EP1446129A4 (en) | 2001-11-21 | 2006-05-10 | Univ Leland Stanford Junior | Polynucleotide therapy |
US20040156826A1 (en) * | 2002-09-27 | 2004-08-12 | Fernando Dangond | Treatment of patients with multiple sclerosis based on gene expression changes in central nervous system tissues |
EP1931390B1 (en) * | 2005-10-05 | 2012-07-25 | Bayhill Therapeutics, Inc. | Compositions and methods for treatment of autoimmune disease |
CN101489382A (en) * | 2006-06-13 | 2009-07-22 | 贝希尔治疗学股份有限公司 | Polynucleotide therapy |
WO2013152291A1 (en) * | 2012-04-05 | 2013-10-10 | University Of Southern California | Cell therapy technology to deliver radio-protective peptides |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5264618A (en) * | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
US5399346A (en) * | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
US5580859A (en) * | 1989-03-21 | 1996-12-03 | Vical Incorporated | Delivery of exogenous DNA sequences in a mammal |
US5716826A (en) * | 1988-03-21 | 1998-02-10 | Chiron Viagene, Inc. | Recombinant retroviruses |
US6274136B1 (en) * | 1996-05-29 | 2001-08-14 | University Of Southern California | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
IL105347A0 (en) * | 1992-04-09 | 1993-08-18 | Autoimmune Corp | Multiple sclerosis t-cell receptor |
CA2148835A1 (en) * | 1992-11-09 | 1994-05-26 | Scott Chappel | Treatment of autoimmune diseases by inducing tolerance to cells, tissues and organs |
CA2168202A1 (en) * | 1993-07-30 | 1995-03-16 | Joseph Dougherty | Efficient gene transfer into primary lymphocytes |
WO1997035997A2 (en) * | 1996-03-25 | 1997-10-02 | Therion Biologics Corporation | Recombinant pox virus encoding myelin protein for therapy |
-
1996
- 1996-05-29 US US08/654,737 patent/US6274136B1/en not_active Expired - Lifetime
-
1997
- 1997-05-29 RU RU98123561/15A patent/RU2248807C2/en not_active IP Right Cessation
- 1997-05-29 AU AU32342/97A patent/AU734633B2/en not_active Ceased
- 1997-05-29 WO PCT/US1997/010214 patent/WO1997045144A1/en not_active Application Discontinuation
- 1997-05-29 CA CA002256577A patent/CA2256577A1/en not_active Abandoned
- 1997-05-29 EP EP97928025A patent/EP1015034A4/en not_active Withdrawn
-
1998
- 1998-11-27 NO NO985576A patent/NO985576L/en not_active Application Discontinuation
-
2002
- 2002-03-14 US US10/098,035 patent/US20020141983A1/en not_active Abandoned
-
2003
- 2003-02-05 US US10/359,397 patent/US20040071673A1/en not_active Abandoned
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5716826A (en) * | 1988-03-21 | 1998-02-10 | Chiron Viagene, Inc. | Recombinant retroviruses |
US5580859A (en) * | 1989-03-21 | 1996-12-03 | Vical Incorporated | Delivery of exogenous DNA sequences in a mammal |
US5589466A (en) * | 1989-03-21 | 1996-12-31 | Vical Incorporated | Induction of a protective immune response in a mammal by injecting a DNA sequence |
US5399346A (en) * | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
US5264618A (en) * | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
US5459127A (en) * | 1990-04-19 | 1995-10-17 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
US6274136B1 (en) * | 1996-05-29 | 2001-08-14 | University Of Southern California | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease |
Also Published As
Publication number | Publication date |
---|---|
US20020141983A1 (en) | 2002-10-03 |
NO985576L (en) | 1999-01-19 |
AU3234297A (en) | 1998-01-05 |
US6274136B1 (en) | 2001-08-14 |
RU2248807C2 (en) | 2005-03-27 |
EP1015034A1 (en) | 2000-07-05 |
CA2256577A1 (en) | 1997-12-04 |
NO985576D0 (en) | 1998-11-27 |
AU734633B2 (en) | 2001-06-21 |
WO1997045144A1 (en) | 1997-12-04 |
EP1015034A4 (en) | 2004-12-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6403088B1 (en) | Antibodies reactive with VEGF-C, a ligand for the Flt4 receptor tyrosine kinase (VEGFR-3) | |
AU2014211454B2 (en) | High avidity binding molecules recognizing MAGE-A1 | |
US6730658B1 (en) | Stimulation of lymphatic growth with an FLT4 ligand | |
KR101522217B1 (en) | Fsh producing cell clone | |
US20040071673A1 (en) | Construction and use of genes encoding pathogenic epitopes for treatment of autoimmune disease | |
KR102035357B1 (en) | Compositions for regulating iron homeostasis and methods of using same | |
CN109706185A (en) | The method and application of gene knockout are realized based on base editing system mutation initiation codon | |
CN108949693A (en) | A kind of pair of T cell immune detection point access carries out the method and application of gene knockout | |
CA2404100A1 (en) | Therapeutic peptides having a motif that binds specifically to non-acetylated h3 and h4 histones for cancer therapy | |
US6379927B1 (en) | Retinoblastoma fusion proteins | |
CA2361396A1 (en) | Compositions, kits, and methods relating to the human fez1 gene, a novel tumor suppressor gene | |
US20040209800A1 (en) | Use of mx gtpases in the prognosis and treatment of cancer | |
CN115044585B (en) | Eukaryotic cell promoter CF1 and application thereof in cell gene expression | |
EP1165812A2 (en) | Protozoan expression system | |
CN114736308B (en) | Preparation and application of coccidian antigen peptide/IL 5 fusion protein gene engineering bacteria | |
EP0607247A1 (en) | Production of gpa neurotrophic factor | |
CN106701806B (en) | Assess serial transcription factor Reporter System and its application of Chinese medicine and/or natural drug efficiency | |
US20030182668A1 (en) | Transgenic non-human mammals expressing constitutively activated tyrosine kinase receptors | |
CN116672442B (en) | Preparation of medicine for treating osteosarcoma by combining ligustilide and HER2-CAR-T cells | |
CN109929847B (en) | PEX26 gene, protein and application thereof | |
CN108588100B (en) | Inhibin B double-gene fragment combined expression vector and application thereof | |
US6074850A (en) | Retinoblastoma fusion polypeptides | |
CN112626029B (en) | Transgenic modified Daudi cell and preparation method and application thereof | |
KR101876486B1 (en) | A recombinant vector comprising MYH4 gene and use thereof | |
CN106868044A (en) | A kind of transgenic animals hair color reporter gene expression box, expression vector and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STCB | Information on status: application discontinuation |
Free format text: EXPRESSLY ABANDONED -- DURING EXAMINATION |