US20040045050A1 - Methods and materials for transformation - Google Patents
Methods and materials for transformation Download PDFInfo
- Publication number
- US20040045050A1 US20040045050A1 US10/609,207 US60920703A US2004045050A1 US 20040045050 A1 US20040045050 A1 US 20040045050A1 US 60920703 A US60920703 A US 60920703A US 2004045050 A1 US2004045050 A1 US 2004045050A1
- Authority
- US
- United States
- Prior art keywords
- dna
- rna
- nnnnnnnnnn nnnnnnnnnn
- launching platform
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8203—Virus mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Disclosed herein are novel methods and materials directed to transforming a host cell and expressing exogenous RNA therein. Specifically disclosed are DNA-launching platforms used to introduce a replicating viral segment attached to an exogenous polynucleotide into a cell, whereby the exogenous polynucleotide is expressed in said cell and confers a detectable trait.
Description
- This application is a continuation of co-pending patent application U.S. Ser. No. 09/316,622, filed May 21, 1999; which claims priority from provisional patent application U.S. Ser. No. 60/086,526, filed May 22, 1998.
- [0002] This invention was made with United States government support awarded by the following agency:
- [0003] NIH Grant No: GM35072
- [0004] The United States has certain rights in this invention.
- RNA viruses have been found to be valuable tools in the phenotypic and genotypic transformation of targeted cells and tissues. See, e.g., U.S. Pat. No. 5,500,360, which teaches novel viral RNA expression vectors. It has been shown that the RNA of the genome of an RNA virus can be modified to include an exogenous RNA segment and that the modified RNA can be introduced into a host cell, replicated therein, and thereby express the exogenous RNA segment.
- Current methods of inoculating a host cell with modified RNA viruses involve the in vitro transcription of a particular strand followed by the introduction of the resulting RNA transcripts into the host cell. One problem with the current inoculation method is that the RNA rapidly degrades which causes a low efficiency of infection. In addition, the preparation of the in vitro RNA transcripts is expensive and time consuming.
- Further, with the advent of transformation and the genetic engineering of plants, much concern has arisen concerning the potential hazard of the dispersal of dangerous traits into the environment. For example, genes increasing the stress tolerance and/or herbicide resistance of an agriculturally important crop could theoretically “leak” to surrounding less desirable and damaging plants, e.g., through pollen, mechanical or insect dispersal. This phenomenon could create a novel species of “super-weed” which could wreak havoc on the agricultural industry. Existing RNA virus-based vectors can spread to non-target plants by mechanical means and/or by insects. Such spread can be prevented by using vectors that can replicate and/or move only in target plants expressing the appropriate trans-acting factors. Accordingly, there remains a need for less expensive and more efficient methods of transformation of target cells and tissues. Moreover, there is a need for a novel method of transformation which alleviates the potential dangers associated with the unwanted spread of engineered traits into the environment.
- The subject invention pertains to improved materials and methods for transforming host cells which involve transfecting said cells with a DNA-launching platform. One aspect of the subject invention pertains to a DNA-launching platform which encodes a modified viral RNA molecule downstream of DNA-dependent RNA polymerase (pol) promoter, whereby the DNA-launching platform is capable of being introduced into a host cell and effectively “launching” said modified viral RNA molecule into the host cell such that it is replicated and expressed therein. The term “modified viral RNA molecule” as used herein refers to a viral RNA which has been changed from its natural state. Examples of changes of viral RNA include, but are not limited to, removal of a part of viral RNA genome, insertion or substitution of an exogenous RNA, etc. The exogenous RNA segment can be located in a region of the viral RNA molecule such that it does not disrupt the RNA replication. Techniques for such manipulations have been well known to those of ordinary skill in the art for many years. Preferably, the modified viral RNA molecule further comprises a ribozyme which is located in the proximity of the 3′ end of the modified viral RNA molecule. The viral segment may have the ability to be replicated with or, alternatively, without the presence of trans-acting viral replicating elements.
- Another aspect of the subject invention pertains to a method of genotypically or phenotypically modifying a host cell, comprising introducing a DNA-launching platform which encodes a viral RNA molecule and an exogenous RNA segment in a location which does not disrupt the replication of said viral RNA segment or said exogenous RNA segment, whereby the exogenous RNA segment confers a detectable trait in the host cell. The subject invention applies to a wide array of plant cells.
- Still a further aspect of the subject invention pertains to cells in which the DNA-launching platform of the subject invention has been introduced.
- Yet another aspect of the subject invention pertains to a plant comprising cells transfected with the DNA-launching platform.
- The novel methods and materials of the subject invention provide a greater inoculation efficiency of RNA viruses because use of DNA-launching platforms of the subject invention are more resistant to degradation than RNA inocula, and because each DNA platform produces multiple RNA transcripts over an extended period of time. As the DNA-launching platform provides a genetically stable in planta archive copy of a desired vector construct, the continuing transcription of said DNA platform will repeatedly reinoculate the host cell with the desired construct. This serves to counteract genetic instability problems that have inhibited the expression of some genes from vectors based on plant and animal RNA viruses. Further, the inoculation methods of the subject invention provide a much simpler means of producing inocula in bulk for large scale use, which is cheaper and more efficient than inoculating with in vitro RNA transcripts.
- FIG. 1 represents the schematic for producing the 1a and 2a proteins in the host cell.
- FIG. 2 illustrates an example of an Agrobacterium transformation vector containing an expression cassette capable of expressing 1a and/or 2a BMV proteins.
- FIG. 3 illustrates several Agrobacterium vectors that were produced to transform host plant cells (black rectangles indicate T-DNA borders).
- FIG. 4 represents the general mechanism of BMV RNA3 launching, and replication.
- FIG. 5 depicts DNA-launching platforms which can be used in accord with the teachings contained herein. The BMV and CCMV designations denote cis-acting elements.
- FIG. 6 depicts DNA-launching platforms which can be used in accord with the teachings contained herein.
- FIG. 7 depicts DNA-launching platforms which can be used in accord with the teachings contained herein.
- FIG. 8 depicts DNA-launching platforms which can be used in accord with the teachings contained herein.
- FIG. 9 depicts Agrobacterium vector for delivery of DNA-launching platforms to plant cells (open triangles represent T-DNA borders).
- FIG. 10 depicts DNA-launching platforms which can be used in accord with the teachings contained herein.
- Legend For FIGS.5-10
- 35S=CaMV35S promoter
- t=termination/polyA+sequences
- Rz=ribozyme
- NOS=NOS promoter
- OOA=origin of assembly
- FG=foreign gene
- FIG. 11 shows that BMV replication factors support efficient RNA3 replication in protoplasts.
- FIG. 12 shows the efficient replication of launched BMV RNA3 in protoplasts.
- FIG. 13 shows transgenic expression of
BMV - FIG. 14 shows the efficient replication of launched BMV RNA3 in (1a+2a)-transgenic plants.
- FIG. 15 shows the successful GUS expression from the launched BMV RNA3 in (1a+2a)-transgenic plants.
- FIG. 16 shows the successful GUS expression from the launched BMV RNA3 in protoplasts.
- FIG. 17 shows the successful GFP expression from the launched BMV RNA3 in (1a+2a)-transgenic plants.
- FIG. 18 shows the successful GFP expression from the launched BMV RNA3 in protoplasts.
- FIG. 19 shows the efficient replication of the launched BMV RNA3 in (1a+2a)-transgenicN. benthamiana using Agrobacterium inoculation.
- FIG. 20 shows the successful GUS expression from the launched BMV RNA3 having the SHMV coat protein in (1a+2a)-transgenic plants.
- FIG. 21 shows that launched BMV replicates, moves cell-to-cell, and spreads long distances in (1a+2a)-transgenic plants.
- FIG. 22 shows transfection of progeny from (1a+2a)-transgenicN. benthamiana with BMV RNA3 DNA-launching platform and localization of the launched RNA3 to the roots.
- SEQ ID NO. 1: pB1LR2—partial nucleotide sequence includes
BMV 1a expression cassette. - SEQ ID NO. 2: pB1LR3—partial nucleotide sequence includes
BMV 1a expression cassette. - SEQ ID NO. 3: pB2LR4—partial nucleotide sequence includes
BMV 2a expression cassette. - SEQ ID NO. 4: pB2LR5—partial nucleotide sequence includes
BMV 2a expression cassette. - SEQ ID NO. 5: pB12LR6—partial nucleotide sequence includes
BMV - SEQ ID NO. 6: pB12LR7—partial nucleotide sequence includes
BMV - SEQ ID NO. 7: pB12LR8—partial nucleotide sequence includes
BMV - SEQ ID NO. 8: pB12LR9—partial nucleotide sequence includes
BMV - To facilitate understanding of the invention, certain terms used throughout are herein defined. The term “RNA virus” as used herein means a virus whose genome is RNA in a double-stranded or single-stranded form, the single strand being a (+) strand or (−) strand.
- The terms “transfection” or “transfected” as used herein means an introduction of a foreign DNA or RNA into a cell by mechanical inoculation, electroporation, agroinfection, particle bombardment, microinjection, or by other known methods.
- The terms “transformation” or “transformed” as used herein means a stable incorporation of a foreign DNA or RNA into the cell which results in a permanent, heritable alteration in the cell. Accordingly, the skilled artisan would understand that transfection of a cell may result in the transformation of that cell.
- The term “launched” as used herein refers to a polynucleotide that has been transcribed from a DNA-launching platform, as described herein and, preferably, replicated.
- The term “cis-acting element” as used herein denotes that portion of the RNA genome of an RNA virus which must be present in cis, that is, present as a part of each viral strand as a necessary condition for replication of that strand. Virus replication may depend upon the existence of one or more trans (diffusible) elements which interact with the cis-acting element to carry out RNA replication. If trans-acting elements are necessary for replication, they need not be present or coded for on the modified viral RNA provided, but may be made available within the infected cell by some other means. For example, the trans-acting replication functions may be provided by other, unmodified or modified, components of the viral genome transfected into the cells simultaneously with the modified RNA. The same approach can be used for other trans-acting functions including movement protein, coat protein, and other functions. The target cell may also be premodified, for example, cells may have been previously transformed to provide constitutive expression of the trans-acting functions from a chromosome. The cis-acting element is composed of one or more segments of viral RNA which must be present on any RNA molecule that is to be replicated within a host cell by RNA replication. The segment will most likely be the 5′ and 3′ terminal portions of the viral RNA molecule, and may include other portions and/or virus open reading frames as well. The cis-acting element is accordingly defined in functional terms: any modification which destroys the ability of the RNA to replicate in a cell known to contain the requisite trans-acting elements, is deemed to be a modification in the cis-acting element. Conversely, any modification, such as deletion or insertion in a sequence region which is able to tolerate such deletion or insertion without disrupting replication, is a modification outside the cis-acting element. As is demonstrated herein, using the example of BMV which is known and accepted by those skilled in the art to be a functional example from which substantial portions of an RNA virus molecule may be modified, by deletion, insertion, or by a combination of deletion and insertion, without disrupting replication.
- “Exogenous RNA” is a term used to describe a segment or component of RNA to be inserted into the virus RNA to be modified, the source of the exogenous RNA segment being different from the RNA virus itself. The source may be another virus, an organism such as a plant, animal, bacteria, virus, or fungus. The exogenous RNA may be a chemically synthesized RNA, derived from a native RNA, or it may be a combination of the foregoing. The exogenous RNA may provide any function which is appropriate and known to be provided by an RNA segment. Such functions include, but are not limited to, a coding function in which the RNA acts as a messenger RNA encoding a sequence which, when translated by the host cell, results in synthesis of a peptide or protein having useful or desired properties; the RNA segment may also be structural, as for example in ribosomal RNA; it may be regulatory, as for example with small nuclear RNAs or anti-sense RNA; or it may be catalytic. One skilled in the art will understand that the exogenous RNA may encode, for example, a protein which is a key enzyme in a biochemical pathway, which upon expression effects a desirable phenotypic characteristic, such as altering cell metabolism. Further, the exogenous RNA may encode a protein involved in transcriptional regulation, such as zinc finger, winged-helix, and leucine-zipper proteins. A particularly interesting function is provided by anti-sense RNA, sometimes termed (−) strand RNA, which is in fact a sequence complementary to another RNA sequence present in the target cell which can, through complementary base pairing, bind to and inhibit the function of the RNA in the target cell.
- The term “non-viral” is used herein in a special sense to include any RNA segment which is not normally contained within the virus whose modification is exploited for replication and expression, and is therefore used synonymously with “exogenous”. Accordingly, a gene derived from a different virus species than that which is modified is included within the meaning of the terms “non-viral” and “exogenous” for the purposes of describing the invention. For example, a non-viral gene as the term is used herein could include a gene derived from a bacterial virus, an animal virus, or a plant virus of a type distinguishable from the virus modified to effect transformation. In addition, a non-viral gene may be a structural gene derived from any prokaryotic or eukaryotic organism.
- In one embodiment, the subject invention concerns a novel method of transfecting a host cell which uses a DNA-launching platform to introduce viral RNA into the cell. The subject invention is directed towards a method of transfection employing a DNA-launching platform which encodes a modified viral RNA molecule comprising an RNA viral component attached to an exogenous RNA component and a DNA-dependent RNA pol promoter. The DNA-dependent RNA pol promoter is preferably but not necessarily fused within up to 10 nucleotides of the 5′ transcriptional start site of the modified viral RNA molecule, and more preferably within up to 5 nucleotides of the 5′ transcriptional start site. Expression of the DNA-launching platform produces transcripts of the modified viral RNA molecule that are then capable of RNA replication in the presence of replication factors, which can be present in the modified viral RNA and/or may be supplied in trans by other means including expression from chromosome or supplied on different launching plasmids. When the modified viral RNA is replicated, the exogenous RNA can be replicated as well. Further, the exogenous RNA can be expressed in the cell, thereby providing a predetermined phenotypic characteristic. In a preferred embodiment, the DNA launching platform further comprises a nucleotide sequence encoding a self-cleavable ribozyme situated proximate to the 3′ end of said RNA molecule. As would be readily apparent to those skilled in the art, known ribozymes may be used in accordance with the subject invention. In a preferred embodiment, the ribozyme cleaves the modified RNA viral molecule at the 3′ region. The 3′ region can consist of up to 30 nucleotides upstream or downstream of the 3′ end; and preferably consists of up to 10 nucleotides upstream or downstream of the 3′ end. In a more preferred embodiment, the ribozyme cleaves the modified RNA viral molecule precisely at the 3′ end. Other known regulatory sequences, e.g., promoters and/or termination sequences, may also be substituted for and/or included on the DNA-launching platform. A suitable restriction site can be introduced proximate to the 3′ end of the modified viral RNA molecule sequence and the DNA molecule can be cleaved by an appropriate restriction enzyme prior to transfection. The term “DNA-launching platform” as used herein is intended to mean a DNA molecule, circular or linear, which has a coding region comprising a segment encoding a modified viral RNA segment, and further, which is capable of being delivered into a cell and subsequently transcribed.
- Possible regulatory sequences can include, but are not limited to, any promoter already shown to be constitutive for expression, such as those of viral origin (
CaMV 19S and 35S) or so-called “housekeeping” genes (ubiquitin, actin, tubulin) with their corresponding termination/polyA+sequences. Also, seed-and/or developmentally-specific promoters, such as those from plant fatty acid/lipid biosynthesis genes (ACPs, acyltransferases, desaturases, lipid transfer protein genes) or from storage protein genes (zein, napin, cruciferin, conglycinin, phaseolin, or lectin genes, for example), with their corresponding termination/polyA+sequences can be used for targeted expression. In addition, the gene can be placed under the regulation of inducible promoters and their termination sequences so that gene expression is induced by light (rbcS-3A, cab-1), heat (hsp gene promoters) or wounding (mannopine, HGPGs). It is clear to one skilled in the art that a promoter may be used either in native or truncated form, and may be paired with its own or a heterologous termination/polyA+sequence. - In a particularly preferred embodiment, the subject invention is directed toward a method of genotypically or phenotypically modifying a cell comprising the following steps: a) forming a cDNA molecule of a virus RNA, or of at least one RNA component if the RNA virus is multipartite, the viral RNA having been modified to contain a DNA segment encoding a non-viral RNA component situated in a region able to tolerate such insertion without disrupting replication of the RNA product encoded thereby; b) cloning modified cDNA into a DNA-launching platform; and c) transfecting a suitable host cell with said DNA-launching platform. In a most preferred embodiment, the method further comprises pretransforming a plant with trans-acting viral replication factors and/or other trans-acting factors. Such trans-acting factors may include viral movement proteins(s), coat protein(s), viral protease(s), and other structural and nonstructural genes. In addition to stable expression of trans-acting factors, trans-acting factors may be introduced on separate expression plasmids or may be expressed from RNA transcripts. In a preferred embodiment such trans-acting factors do not replicate. Suitable host cells may include protoplasts, cells in suspension, or cells in tissues or whole organisms.
- In a specific embodiment intended as an example of the broader teachings herein, the RNA viral segment can be derived from brome mosaic virus (BMV), whereby the DNA-launching platform comprises DNA encoding the RNA3 segment of the virus. Brome mosaic virus (BMV) is a member of the α virus-like super family of positive-strand RNA viruses of animals and plants, and has a genome divided among three RNAs. RNA1 and RNA2 encode the 1a and 2a proteins, respectively, which are necessary for a genomic RNA replication and subgenomic mRNA synthesis (see, e.g., U.S. Pat. No. 5,500,360, which to the extent not inconsistent herewith, is incorporated herein by reference). These proteins contain three domains conserved in all other members of the α virus-like super family. 1a (109 kDa) contains a c-proximal helicase-like domain and an n-proximal domain implicated in RNA capping, and 2a (94 kDa) contains a central polymerase-like domain. See, e.g., French and Ahlquist, (1988). 1a and 2a interact with each other and with cell factors to form a membrane bound viral RNA replication complex associated with the endoplasmic reticulums of infected cells. BMV RNA3, a 2.1-kb RNA, encodes the 3a protein (32 kDa) and coat protein (20 kDa), which are involved in the spread of BMV infection in its natural plant hosts but are dispensable for RNA replication. See U.S. Pat. No.5,500,360. The 3a or coat protein gene of the RNA3 viral segment can be replaced with exogenous RNA, whereby it does not interfere with the replication element. Further, the exogenous RNA segment can be inserted downstream of an additional subgenomic promoter. Still further, cells or tissues can be pretransformed to express 1a, 2a, 3a, and coat protein, or any combination thereof, wherein DNA-launching platforms containing a foreign gene(s) with the necessary cis-acting components is transfected, such that the foreign gene is replicated and/or expressed.
- In one embodiment, the host cell is pretransformed with BMV1 or BMV2 such that it is transgenically engineered to express 1a and 2a proteins. Preferably, the 5′ and 3′ ends of BMV1 and BMV2 are removed such that they are incapable of replication, but can express 1a and 2a to form a viral RNA replication complex associated with the endoplasmic reticulum of the host cell. Subsequent transfection of a DNA-launching platform comprising the RNA3 viral replication segment, as well as the exogenous RNA of interest, can produce the expression of said exogenous RNA while also preventing the undesired and dangerous spread of viral RNA spillage into the environment. That is, because a plant must have all 3 segments to form infectious BMV particle(s), problems associated with the environmentally hazardous escape of foreign genes through mechanical or insect dispersal of RNA virus vectors are avoided. One skilled in the art will readily appreciate that in the example of BMV that DNA-launching platforms could be also derived from either RNA1 or RNA2. For example, the sequence encoding the 1a protein could be replaced with an exogenous RNA; replication would require the expression of 1a (e.g., separate expression plasmid). In a preferred embodiment, the DNA-launching platform also comprises a ribozyme situated proximate to the 3′ end of the modified RNA3, wherein said ribozyme cleaves the RNA3 at the 3′ end. As would be readily apparent to the skilled artisan with the teachings contained herein, viral segments from other known viruses, and/or subviral agents, can be used to formulate DNA-launching platforms of the subject invention. One skilled in the art will appreciate that BMV is merely one representative example of the many viruses suitable for practicing the subject invention. It is widely accepted that principles on which the subject invention is based are broadly applicable to a myriad of viruses. Examples of other such viruses include, but are not limited to, alfalfa mosaic virus (AMV), barley stripe mosaic virus, cowpea mosaic virus, cucumber mosaic virus, reoviruses, polio virus, sindbis virus, vesicular stomatitis virus, influenza virus, retroviruses, and cowpea chlorotic mottle virus (CCMV) and any other viruses that replicate through RNA intermediates and from which a cDNA copy can be obtained. Specifically, as the other viruses are further characterized, those of skill in the art will readily appreciate the applicability of the teachings herein to other suitable viruses as well.
- The skilled artisan would easily appreciate that known methods of introducing foreign DNA into cells can be used in accordance with the teachings of the subject disclosure. Such methods include, but are not limited to, mechanical inoculation, particle bombardment, agroinfection, electroporation, and microinjection, as well as other known methods.
- Various aspects of the invention can be modified as needed, depending upon specific characteristics of the virus selected as the transforming and transfecting agent and of the RNA segment to be inserted. For example, the inserted gene need not be a naturally occurring gene, but may be modified, a composite of more than one coding segment, or it may encode more than one protein. The RNA may also be modified by combining insertions and deletions in order to control the total length or other properties of the modified RNA molecule. The inserted non-viral gene may be either prokaryotic or eukaryotic in origin. The inserted gene may contain its own translation start signals, for example, a ribosomal binding site and start (AUG) codon, or it may be inserted in a manner which takes advantage of one or more of these components preexisting in the viral RNA to be modified. Certain structural constraints must be observed to preserve correct translation of the inserted sequence, according to principles well understood in the art. For example, if it is intended that the exogenous coding segment is to be combined with an endogenous coding segment, the coding sequence to be inserted must be inserted in reading frame phase therewith and in the same translational direction.
- It will be understood by those ordinarily skilled in the art that there may exist certain genes whose transfer does not result in obvious phenotypic modification of the recipient cell. Such may occur, for example, if the translation product of the non-viral gene is toxic to the host cell, is degraded or processed in a manner which renders it non-functional or possesses structural features which render it impossible for the host cell to translate in sufficient quantities to confer a detectable phenotype on the transformed cells. However, the invention does not depend upon any specific property of an RNA segment or gene being transferred. Therefore, the possible existence of RNA segments or genes which fail to confer a readily observable phenotypic trait on recipient cells or plants is irrelevant to the invention, and in any case will be readily recognizable by those of ordinary skill in the art without undue experimentation.
- An exogenous RNA segment may be inserted at any convenient insertion site in any of the cDNA sequences corresponding to a viral RNA, or component RNA of a multipartite RNA virus, provided the insertion does not disrupt a sequence essential for replication of the RNA within the host cell. For example, for a virus whose coat protein is not essential for replication, an exogenous RNA segment may be inserted within or substituted for the region which normally codes for coat protein. As desired, regions which contribute to undesirable host cell responses may be deleted or inactivated, provided such changes do not adversely affect the ability of the RNA to be replicated in the host cell. For many single component and multipartite RNA viruses, a reduction in the rate of normal RNA replication is tolerable and will in some instances be preferred, since the amount of RNA produced in a normal infection is more than enough to saturate the ribosomes of the transformed cell.
- Plant cells which are inoculated in culture will normally remain transfected as the cells grow and divide since the RNA components expressed from the DNA-launching platform are able to replicate and thus become distributed to descendant cells upon cell division. Plants regenerated from phenotypically modified cells, tissues, or protoplasts remain phenotypically modified. Similarly, plants transfected as seedlings remain transfected during growth. Optimal timing of application of the transfecting components will be governed by the result which is intended and by variations in susceptibility to the transfecting components during various stages of plant growth.
- Many plant RNA viruses are seed transmitted from one generation to the next. This property can be exploited to effect genotypic transformation of a plant. That is to say, the modified RNA remains transmissible from one generation to the next, just as seed-borne virus infections are transmitted from one generation to the next.
- Following are examples which illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
- Binary vectors for expressing the
BMV - The 2a expression cassette was inserted into pBI101.2 LR1. First the pBI101.2LR1 was cut with Hind III and dephosphorylated. Next, pB2PA17 (Dinant et al., 1993) was cut with Hind III and the 2a insert was purified using a low melting agarose gel. The restriction fragment ends were ligated forming the pB2LR4 and pB2LR5 (FIGS. 3c and 3 d).
- The 1a expression cassette was inserted into pBI101.2LR1 by first cutting pBI101.2LR1 with SnaBI and dephosphorylated. PB1PA17 (Dinant et al., 1993) was cut with PstI and the extra nucleotides were removed with T4 DNA polymerase. The 1a insert was purified using a low melting agarose gel. The restriction fragment ends were ligated forming the pB1LR2 and pB1LR3 vectors (FIGS. 3a and 3 b).
- The 1a expression cassette was inserted into pB2LR4 and pB2LR5 by cutting pB2LR4 or pB2LR5 with SnaBI and dephosphorylated. PB1PA17 (Dinant et al., 1993) was cut with PstI, and the extra nucleotides were removed with T4 DNA polymerase. The 1a insert was purified using low melting agarose gel and ligated with the cut pB2LR4 or pB2LR5 vectors to form pB12LR6, pB12LR7, pB12LR8, and pB12LR9 vectors (FIGS. 3e-3 h).
- Vector pRT101 (Topfer et al., 1987) was cut with PpuMI and the restriction fragment ends were filled in with Klenow fragment and dNTPs, and cut with BamHI and dephosphorylated. Vector pB3RQ39 (Ishikawa et al., 1997) was cut with SnaBI and BamHI; the B3 fragment was isolated from a low melting agarose gel. This fragment was ligated to the cut pRT101 thereby forming pB3LR10 (FIG. 4). The pB3LR15 (FIG. 4) that is a pB3LR10 derivative has the ClaI-KpnI fragment replaced with the corresponding fragment from pB3TP8 (Janda et al., 1987).
- PCR was performed on pRT101 to amplify an EcoRV and EcoRI fragment. To create a StuI site instead of a PpuMI site, a one nucleotide deletion was performed during the PCR process. The resulting PCR product was cut with EcoRV and EcoRI and inserted into dephosphorylated pRT101 cut with EcoRV and EcoRI to form pRT101LR11. The pRT101LR11 was cut with StuI and BamHI and dephosphorylated. PB3RQ39 was cut with SnaBI and BamHI and a B3 fragment was isolated using a low melting agarose gel. The fragment was then ligated to pRT101LR11 to form pB3LR12 (FIG. 4).
- Another DNA-launching platform was constructed with wtRNA3 of BMV having a partially doubled CaMV35S promoter; thereby forming pB3LR14 and pB3LR16 (FIG. 4).
- A DNA-launching platform wherein the BMV RNA3 coat protein was replaced with GUS was also constructed. The pB3MI22 (Ishikawa et al., 1997) was cut with ClaI and StuI and a B3GUS insert was isolated. The pB3LR10 or pB3LR14 DNA-launching constructs were cut with ClaI and StuI and dephosphorylated. The B3GUS fragment was then ligated to the cut pB3LR10 or pB3LR14 thereby forming the pB3GUSLR17 and pB3GUSLR18 DNA-launching constructs (FIG. 5).
- A DNA-launching platform having a BMV RNA3 with a GUS gene insertion wherein the GUS is downstream of an additional BMV subgenomic promoter was constructed. The pB3LR15 construct was cut with AvaI and the restriction fragment ends were filled in with Klenow fragment and dNTPs. Construct was then cut with ClaI and dephosphorylated. The pB3MI22 was cut with ClaI and StuI and a B3GUS fragment was isolated. The isolated B3GUS fragment was then ligated to the cut pB3LR15 construct to form a new construct of pB3GUSCPLR19 (FIG. 5).
- A BMV RNA3 based DNA-launching platform with a CP gene inserted downstream of an additional cowpea chlorotic mottle virus (CCMV) subgenomic promoter was constructed. The pB3GUSLR17 construct was cut with StuI and KpnI and dephosphorylated. The pBC3AJ14 (Pacha and Ahlquist, 1991) was cut with NdeI, the ends were blunted by known methods in the art, and then cut with KpnI. A coat protein fragment was then isolated. The coat protein fragment was then ligated to the cut pB3GUSLR17 to form a new construct of pB3GUSCPLR22 (FIG. 5).
- A DNA-launching platform was constructed having a subgenomic RNA4. The pB4MK2 (M. Kroll, personal communications) was cut with SnaBI and BamHI and a RNA4 fragment was then isolated. The pRT101LR11 construct was cut with StuI and BamHI and dephosphorylated. The fragment and the cut pRT101LR11 construct were then ligated forming pB4LR20 (FIG. 5a).
- A DNA-launching platform wherein the BMV coat protein was replaced with GFP was constructed. pEGFP (Clontech, Calif.) was cut with NotI, filled in with Klenow fragment and dNTPs, cut with SalI, and GFP insert was isolated using low-melting agarose gel. The pB3LR15 was cut with SalI and StuI and dephosphorylated. The GFP fragment was then ligated to the cut pB3LR15 thereby forming the pB3GFPLR48 (FIG. 6e).
- A DNA-launching platform having a BMV RNA3 with a GFP gene insertion wherein the CP is downstream of an additional CCMV subgenomic promoter was constructed. The pBC3AJ14 (Pacha and Ahlquist, 1991) was cut with NdeI and EcoRI and the ends were blunted by known methods in the art. The coat protein fragment was then isolated and ligated into dephosphorylated and blunted pEGFP cut with NotI and StuI forming pEGFPCPLR49. pEGFPCPLR49 was cut with KpnI and the EGFPCP fragment was isolated using low-melting agarose gel. PB3GFPLR48 was cut with KpnI and dephosphorylated. The EGFPCP fragment was then ligated to the cut pB3GFPLR48 thereby forming the pB3GFPCPLR50 (FIG. 6a).
- An RNA transcription vector wherein the GFP gene is expressed as a translational fusion with
BMV 3a was constructed. The pB3TP10 (Pacha and Ahlquist, 1991) was cut with BamHI and dephosphorylated. The GFP fragment was amplified from pEGFP (Clontech, Calif.) using PCR and the following primers:5′GCAGTCGACGGTACCGCGGGCC3′`and 5′CGCGGCCGCGGATCCTGTACAGCTCG3′. - The amplified product was cut with BamHI and purified using low-melting agarose gel. The GFP fragment was ligated to the cut pB3TP10 forming pB3GFPLR47 (FIG. 6d). The pB3GFPLR47 was cut with EcoRI and transcribed using T7 RNA polymerase.
- An Agrobacterium vector containing BMV RNA3 DNA-launching platform was constructed. The pBI101.2LR1 was cut with SmaI and dephosphorylated. The pB3LR15 was cut with PvuII and the B3 fragment was purified using a low-melting agarose gel. The B3 fragment was then ligated to the cut pBI101.2LR1 thereby forming pB3LR42 (FIG. 9).
- A DNA-launching platform wherein the BMV RNA3 coat protein was replaced with the SHMV (Sunn hemp mosaic virus) coat protein and the GUS gene was inserted downstream of an additional BMV subgenomic promoter was constructed. The pB3RS4 (Sacher et al., 1988) was cut with AvaI, blunted with Klenow fragment and dNTPs, and cut with KpnI. The SHMV coat protein fragment was isolated using a low-melting agarose gel. The pB3GUSLR17 was cut with StuI and KpnI and dephosphorylated. The SHMV coat protein fragment was ligated to the cut pB3GUSLR17 thereby forming pB3GUSCPLR24 (FIG. 7).
- Other permutations of DNA-launching platforms containing one or more foreign genes and the necessary cis-acting replication signals will be readily appreciated in view of the teachings herein. For examples, see FIGS.5-10.
- NT1 Medium (1 liter) was made with Gibco-BRL (MS salt, catalog #11118-031), 3 ml of 6% KH2PO4, and 0.2 μg/
ml 2,4D (final concentration). The pH was adjusted to 5.5-5.7 using KOH, and the resulting mixture was autoclaved. - NT1 Plating Medium (1 liter) was made with NT1 medium and 72.86 g mannitol, the pH was adjusted to 5.5-5.7, and the resulting mixture was autoclaved.
- Wash Solution (1 liter) was made with 72.86 g mannitol, the pH was adjusted to 5.5, and the resulting mixture was autoclaved.
- Electroporation Buffer was made with 0.8% NaCl, 0.02% KCl, 0.02% KH2PO4, 0.11% Na2HPO4, and 0.4M mannitol. The pH was adjusted to 6.5, and the resulting mixture was autoclaved.
- Enzyme Solution was made with 0.4M mannitol, and 20 mM MES. The pH was adjusted to 5.5, and the resulting mixture was autoclaved.
- Growth conditions: Cells (Nicotiana tabacum) were grown at room temperature in NT1 media with constant shaking (about 200 rpm).
- Preparation of cultures for digestion: About 2-3 ml of one-week old suspension culture was subcultured into 50 ml of
fresh NT1 media 3 days before the enzyme digestion. The culture was maintained at 28° C. under constant shaking. - Enzyme digestion: The enzyme digestion solution was prepared containing the following: 1% cellulysin (Calbiochem) and 0.3% macerase (Calbiochem) in the enzyme solution. The pH was adjusted to 5.5 and filter sterilized.
- The cells were centrifuged at 800 rpm for 5 min. The supernatant was discarded. About 40 ml of wash solution was added, cells were resuspended and were centrifuged at 800 rpm for 5 min. The supernatant was discarded. The cells were then resuspended in three volumes of enzyme digestion solution, and incubated for 60 min. at room temperature.
- Washing: The cells were transferred into 50 ml plastic tube and centrifuged at 800 rpm for 5 min. The supernatant was discarded. The cells were resuspended in 40 ml of wash solution and centrifuged at 800 rpm for 5 min. The supernatant was discarded. The cells were resuspended in 40 ml of electroporation buffer and centrifuged at 800 rpm for 5 min. The supernatant was discarded. The cells were resuspended in four volumes of electroporation buffer.
- Electroporation: One ml of cells containing the RNA or DNA inocula was transferred into electroporation cuvettes and placed on ice for 10 min. The cells were then mixed and electroporated at 500 microF, 250V. The cuvettes were placed on ice for 10 min. The cells were transferred into 10 ml of NT1 plating media.
- Incubation and collection of samples: The cells were incubated at room temperature in dark. Samples were collected 24-48 hrs post inoculation.
- RNA Analysis: RNA extraction, denaturing 1% agarose gel electrophoresis and Northern blot hybridization were performed by known methods, such as that performed in Rasochova and Miller (1996). Each lane was loaded with equal amounts (approx. 5 μg) of total RNA as determined by spectrophotometry and confirmed by ethidium bromide staining of ribosomal RNA before Northern blot hybridization. 1×106 cpm/ml of radioactive probe in hybridization buffer was used per hybridization experiment. Replication of RNA3 was confirmed by detection of sgRNA4, thus showing that BMV
RNA replication factors - Once a desired molecule was constructed inE. coli, the molecule was transferred into Agrobacterium tumefaciens by the freeze-thaw method. Vectors pB1LR2, pB2LR4, pB12LR6, and pB12LR7 were all individually used. An Agrobacterium strain LBA 4404 containing an appropriate helper Ti plasmid was grown in 5 ml of YEP medium overnight at 28° C. Two ml of the overnight culture were added to 50 ml YEP medium in a 250-ml flask and shaken vigorously (250 rpm) at 28° C. until the culture grew to an OD500 of 0.5 to 1.0. The culture was chilled on ice. The cell suspension was centrifuged at 3000 g for 5 min. at 4° C. The supernatant solution was discarded. The cells were resuspended in 1 ml of ice-cold 20 mM CaCl2 solution. 0.1-ml aliquots were dispensed into prechilled eppendorf tubes. About 1 μg of plasmid DNA was added to the cells. The cells were frozen in liquid nitrogen. The cells were thawed by incubating the test tube in a 37° C. water bath for 5 min. 1 ml of YEP medium was added to the tube and incubated at 28° C. for 2-4 h with gentle shaking to allow the bacteria to express the antibiotic resistance genes. The tubes were centrifuged for 30 s and the supernatant solution was discarded. The cells were resuspended in 0.1 ml YEP medium, plated on a YEP agar plate containing selection antibiotic(s), and incubated at 28° C. Transformed colonies appeared in 2-3 days.
- In vitro clonal copies of approximately three week oldNicotina tabacum, Wisconsin No. 38, were used as the source of explants. Leaf explants were prepared from the second and third fully expanded leaves of in vitro cultures. The leaf pieces were cut into 1 cm×1 cm squares and placed upon TB1 (plus 2.0 mg/l 6-benzyl-aminopurine, and 0.1 mg/l-naphthalene acetic acid) media for 24 hours at 25° C. with a 16 hour photo period.
-
- TB1 (1 liter) included 4.30 g MS salts, 100 mg myo-inositol, 1.0 ml Nitsch and Nitsch vitamins, 30 g sucrose, 2 mg BAP, 0.10 mg of NAA, and 8 g Noble agar. The media was adjusted to a pH 5.7 and autoclaved.
- TB2 (1 liter) included 4.30 g MS salts, 100 mg myo-inositol, 1.0 ml Nitsch and Nitsch vitamins, 30 g sucrose, 1.0 mg BAP, 0.10 mg NAA, and 8 g Noble agar. The media was adjusted to pH 5.7 and autoclaved.
- MST (1 liter) included 4.30 g MS salts, 1.0 ml Nitsch and Nitsch vitamins, 30 g sucrose, 100 mg myo-inositol, and 8.5 g Difco agar. The media was adjusted to pH 5.7 and autoclaved.
- YEP (100 ml) included 1.0 g Bacto-peptone, 1.0 g Bacto-yeast extract, and 0.5 g NaCl. The media was autoclaved.
- RNA Analysis: Total RNA extraction, denaturing 1% agarose gel electrophoresis and Northern blot hybridization was performed by known methods, such as that performed in Rasochova and Miller (1996). Each lane was loaded with equal amounts (approx. 5 μg) of total RNA as determined by spectrophotometry and confirmed by ethidium bromide staining of ribosomal RNA before Northern blot hybridization. 1×106 cpm/ml of radioactive probe in hybridization buffer was used per hybridization experiment. FIG. 13a shows the successful expression of
BMV - Precipitation of DNA onto Microcarriers for Particle Bombardment: (Kikkert, 1993).
- Sterilization of Microcarriers: 80 mg of gold microcarriers were resuspended in 1 ml of 70% ethanol, soaked for 15 min., and centrifuged at 13,000×g for 5 min. The supernatant was carefully removed and discarded. Particles were resuspended in 1 ml of sterile distilled, deionized water and centrifuged at 13,000×g for 5 min. The supernatant was carefully removed and discarded. Water washing of particles was repeated 2 more times. After final rinse, particles were resuspended in 1 ml of sterile 50% glycerol.
- Coating Microcarriers with DNA: The following was sequentially and quickly added: 5 μl DNA(1 μg/μl), 50 μl of 2.5M CaCl2, and 20 μl of 0.1M Spermidine.
- The mixture was incubated for 10 min. on a vortex shaker at room temperature. Particles were pelleted by centrifugation at 13,000×g for 5 sec. Supernatant was carefully removed and discarded. Particles were resuspended in 140 μl of 70% ethanol and centrifuged at 13,000×g for 5 sec. Supernatant was removed and discarded. Particles were resuspended in 140 μl of 100% ethanol and centrifuged at 13,000×g for 5 sec. Supernatant was removed and discard. Particles were resuspended in 50 μl of 100% ethanol.
- Young leaves from tobacco plants grown in vitro on agar-solidified MS medium containing 30 g/liter sucrose, were bombarded with 5-μl aliquots of resuspended DNA-coated particles using a PDS1000He biolistic gun (DuPont) and 1100 psi rupture disks (Bio-Rad).
- RNA Analysis: Total RNA extraction, denaturing 1% agarose gel electrophoresis and Northern blot hybridization was performed by known methods, such as that performed in Rasochova and Miller (1996). Each lane was loaded with equal amounts (approx. 5 μg) of total RNA as determined by spectrophotometry and confirmed by ethidium bromide staining of ribosomal RNA before Northern blot hybridization. 1×106 cpm/ml of radioactive probe in hybridization buffer was used per hybridization experiment. FIG. 14a shows that the launched BMV RNA3 replicates efficiently in transgenic plants expressing
BMV replication factors BMV 1a and/or 2a. - Once a desired molecule was constructed inE. coli, the molecule was transferred into Agrobacterium tumefaciens. Vectors pB1LR2, pB2LR4, pB12LR6, and pB12LR7 were all individually used. An Agrobacterium strain LBA 4404 containing an appropriate helper Ti plasmid was grown in 5 ml of YEP medium overnight at 28° C. Two ml of the overnight culture were added to 50 ml YEP medium in a 250-ml flask and shaken vigorously (250 rpm) at 28° C. until the culture grew to an OD500 of 0.5 to 1.0. The culture was chilled on ice. The cell suspension was centrifuged at 3000 g for 5 min. at 4° C. The supernatant solution was discarded. The cells were resuspended in 1 ml of ice-cold 20 mM CaCl2 solution. 0.1-ml aliquots were dispensed into prechilled eppendorf tubes. About 1 μg of plasmid DNA was added to the cells. The cells were frozen in liquid nitrogen. The cells were thawed by incubating the test tube in a 37° C. water bath for 5 min. 1 ml of YEP medium was added to the tube and incubated at 28° C. for 2-4 h with gentle shaking to allow the bacteria to express the antibiotic resistance genes. The tubes were centrifuged for 30 s and the supernatant solution was discarded. The cells were resuspended in 0.1 ml YEP medium. The cells were plated on a YEP agar plate containing selection antibiotic(s) and incubated at 28° C. Transformed colonies appeared in 2-3 days.
- In vitro clonal copies of approximately five-seven weeks oldN. benthamiana were used as the source of explants. Leaf explants were prepared from the second and third fully expanded leaves of in vitro cultures. The leaf pieces were cut into 1 cm×1 cm squares and placed upon MS104 media in 100×15 mm plates for 24 hours at 23° C. with a 16 hour photo period.
-
- One liter of MS104 included 4.3 g MS salt mixture, 1.0 ml B5 vitamin solution, 30 g sucrose, 1.0 mg BA, 0.1 mg NAA, and 8.0 g Phytagar. The media was adjusted to pH 5.8 and autoclaved.
- 100 ml of YEP included 1.0 g Bacto-peptone, 1.0 g Bacto-yeast extract, 0.5 g NaCl. The media was autoclaved.
- One liter of MST included 4.3 g MS salt mixture, 1.0 ml Nitsch & Nitsch vitamins, 30 g sucrose, 100 mg myo-inositol, and 8.5 g Phytagar. The media was adjusted to pH 5.7 and autoclaved.
- RNA Analysis: Total RNA extraction, denaturing 1% agarose gel electrophoresis and Northern blot hybridization was performed by known methods, such as that performed in Rasochova and Miller (1996). Each lane was loaded with equal amounts (approx. 5 μg) of total RNA as determined by spectrophotometry and confirmed by ethidium bromide staining of ribosomal RNA before Northern blot hybridization. 1×106 cpm/ml of radioactive probe in hybridization buffer was used per hybridization experiment. FIG. 13b shows the successful expression of
BMV - Precipitation of DNA onto Microcarriers for Particle Bombardment: (Kikkert, 1993).
- Sterilization of Microcarriers: 80 mg of gold microcarriers were resuspended in 1 ml of 70% ethanol, soaked for 15 min., and centrifuged at 13,000×g for 5 min. The supernatant was carefully removed and discarded. Particles were resuspended in 1 ml of sterile distilled, deionized water and centrifuged at 13,000×g for 5 min. The supernatant was carefully removed and discarded. Water washing of particles was repeated 2 more times. After final rinse, particles were resuspended in 1 ml of sterile 50% glycerol.
- Coating Microcarriers with DNA: To the 50 μl of particles the following was sequentially and quickly added: 5 μl DNA(1 μg/μl), 50 μl of 2.5M CaCl2, and 20 μl of 0.1M Spermidine.
- The mixture was incubated for 10 min. on a vortex shaker at room temperature. Particles were pelleted by centrifugation at 13,000×g for 5 sec. Supernatant was carefully removed and discarded. Particles were resuspended in 140 μl of 70% ethanol and centrifuged at 13,000×g for 5 sec. Supernatant was removed and discarded. Particles were resuspended in 140 μl of 100% ethanol and centrifuged at 13,000×g for 5 sec. Supernatant was removed and discarded. Particles were resuspended in 50 μl of 100% ethanol.
- Young leaves fromN. benthamiana plants grown in vitro on agar-solidified MS medium containing 30 g/liter sucrose, were bombarded with 5-μl aliquots of resuspended DNA-coated particles using a PDS1000He biolistic gun (DuPont) and 1100 psi rupture disks (Bio-Rad).
- RNA Analysis: Total RNA extraction, denaturing 1% agarose gel electrophoresis and Northern blot hybridization was performed by known methods, such as that performed in Rasochova and Miller (1996). Each lane was loaded with equal amounts (approx. 5 μg) of total RNA as determined by spectrophotometry and confirmed by ethidium bromide staining of ribosomal RNA before Northern blot hybridization. 1×106 cpm/ml of radioactive probe in hybridization buffer was used per hybridization experiment. The launched BMV and
RNA 3 showed efficient replication (FIG. 14b) in transgenic N. benthamiana plants expressingBMV replication factors BMV 1a and/or 2a. - TransgenicN. tabacum and N. benthaniana plants were produced according to the procedures discussed above. The plants were transfected with a DNA-launching platform containing a GUS gene (FIG. 5a) by particle bombardment as described in Examples 5 and 7. The plants were incubated for 3-5 days and then assayed for β-glucuronidase (GUS) activity using 1 mg/ml X-Gluc (5-bromo-4-chloro-3-indolyl glucucuronide) as substrate in 0.1M potassium phosphate buffer, pH 7.0, 50 μM potassium ferrocyanide, and 2% Triton® X-100. Following an overnight incubation at 37° C., cells replicating launched RNA3 derivatives and expressing the GUS reporter gene from a subgenomic RNA4 gave rise to blue spots (FIG. 15). The launched RNA3 derivative did not replicate and express GUS reporter gene in the absence of BMV
RNA replication factors - A plant is transformed with
BMV - Alternatively, plants can be transformed to express
BMV - Other permutations and combinations of genes pretransformed and those included in the DNA-launching platform will readily be appreciated by the skilled artisan in light of the teachings herein. (See, e.g., FIGS. 8c, 10 b, and 10 c).
- As indicated above, CCMV subgenomic promoter can be substituted for BMV sequences in a desired DNA-launching platform. Because the sequence of CCMV subgenomic promoter differs from the sequence of BMV subgenomic promoter, the probability of recombination that would result in loss of a foreign gene is much lower in a construct having a combination of these two different promoters.
- In the above examples, trans-acting components may include, but are not limited to, replication factors, components responsible for cell to cell movement, or components such as the coat protein which may be required for long distance spread, viral proteases responsible for post translational processing, or other known trans-acting functions.
-
BMV replication factors -
BMV replication factors BMV 3a ORF (FIG. 6d). Protoplasts were incubated for 24 hrs and examined for GFP expression using a fluorescent microscope. FIG. 18 shows the successful expression of GFP in protoplasts. -
-
-
- F1 progeny plants from self-fertilized (1a+2a)-transgenicN. benthamiana BP14 were inoculated with BMV RNA3 DNA launching platform using Agrobacterium tumefaciens. Seedlings were germinated on Smurf media containing Kanamycin. Plants were grown at 23° C. with a 16 hr photoperiod. Once the desired construct (pB3LR42) was obtained in E. coli it was transferred to A. tumefaciens strain LBA4404 using a thaw-freeze method as described above. The Agrobacterium was grown overnight at 28° C. under constant shaking. A single lower leaf of N. benthamiana was punctured with a needle multiple times and submerged in Agrobacterium culture. The inoculated, middle, and upper leaves were harvested 14 days post-inoculation. Total RNA extraction and northern blot hybridization were performed as described above. RNA3 replication was detected in all leaves tested (FIG. 21). It shows that BMV RNA3 is able to replicate, move cell-to-cell and spread long distance in (1a+2a)-transgenic plants.
- Progeny plants from self-fertilized (1a+2a)-transgenicN. benthamiana (designated BP14) were inoculated with BMV RNA3 DNA-launching platform using Agrobacterium as described in Example 13. Control plants (non-transgenic N. benthamiana) were inoculated with the sap from BMV infected barley using inoculation buffer composed of 50 mM NaPO4, pH7.0, and 1% celite. Root samples were harvested 6 weeks post inoculation. RNA extraction and northern blot hybridization were performed as described above. FIG. 22 shows that BMV RNA3 replicated to very high levels in roots. In some (1a+2a)-transgenic plants (FIG. 22,
lanes - Barley stripe mosaic virus (BSMV) has a tripartite genome (RNA alpha, beta, and gamma). These genomic RNAs have an m7Gppp cap at the 5′ end and a t-RNA like structure at the 3′ end (Jackson and Hunter, 1989).
- A DNA-launching plasmid for BSMV RNA alpha, RNA beta, and RNA gamma containing BSMV RNA cDNA is constructed by precisely fusing at its 5′ end to a DNA-dependent RNA polymerase promoter and to a self-cleaving ribozyme at its 3′ end. A polyadenylation signal may be also included. Alternatively, a convenient restriction site may be engineered at the 3′ end of viral cDNAs. Foreign genes or sequences maybe expressed in several ways. For example, DNA-launching plasmids based on BSMV RNA beta may contain a foreign gene or sequence expressed in place of ORF beta a.
- Transgenic plants having one or more trans-acting factors fused to the DNA-dependent RNA polymerase promoter and terminator are obtained. Such trans-acting factors may include parts of the viral RNA replicase (ORFs alpha a and/or gamma a) or other trans-acting factors. The trans-acting factors are stably expressed in the plant cell or their expression may be induced if an inducible promoter is used. Cis-acting sequences necessary for BSMV RNA replication are removed from transgenes. Alternatively, the full-length RNA alpha is expressed from the chromosome. Alternatively, ORF gamma a including the 5′ untranslated region and ORF gamma b from a seed transmitted strain, such as ND18, are also expressed (Edwards, 1995).
- A DNA-launching plasmid is constructed containing the DNA-dependent RNA polymerase promoter precisely fused to the 5′ end of the BSMV RNA beta, cis-acting elements important for BSMV RNA beta life cycle, such as the 5′ and 3′ ends, the intercistronic region between the beta a and beta b ORFs (Zhou and Jackson, 1996) and a foreign gene or sequence in place of ORF beta a (coat protein) which is dispensable for BSMV replication and movement (Petty and Jackson, 1990). Such DNA-launching plasmids may lack the internal poly(A) region as this region is dispensable for replication and contain a ribozyme or a convenient restriction site at the 3′ end of the modified viral RNA. Alternatively, a DNA-launching plasmid is constructed from RNA gamma in which ORFs gamma a and/or gamma b are replaced with foreign genes or sequences which may also include the triple gene block genes (ORFs beta b, beta c, and beta d) or a heterologous movement protein (TMV 30K, RCNMV 35K).
- Tobacco mosaic virus (TMV) has a single-stranded positive sense RNA genome. The 5′ end has an m7Gppp cap and the 3′ end contains a t-RNA like structure.
- A DNA-launching plasmid is constructed based on TMV RNA containing TMV cDNA precisely fused at its 5′ end to a DNA-dependent RNA polymerase promoter and at its 3′ end to a self-cleaving ribozyme. A polyadenylation signal may be also included. Alternatively, a convenient restriction site may be engineered at the 3′ end. Foreign gene may be expressed from an additional subgenomic RNA by including an additional subgenomic RNA promoter on the (−) strand.
- Transgenic plants are obtained having one or more trans-acting factors fused to the DNA-dependent RNA polymerase promoter and terminator. Such factors may include the viral replicase (126K/183K), movement protein (30K), or coat protein (17.6K). At least one cis-acting sequence necessary for TMV RNA replication is removed from transgenes. The trans-acting factors are stably expressed in the plant cell or their expression may be induced if an inducible promoter is used.
- A DNA-launching plasmid is constructed containing the DNA-dependent RNA polymerase promoter precisely fused to the 5′ end of the TMV cDNA, cis-acting elements important for the TMV life cycle, such as the 5′ and 3′ ends, origin of assembly, etc., at least one foreign gene or sequence in place of the trans-acting factor that is expressed from the chromosome, and a ribozyme or a convenient restriction site at the 3′ end. Alternatively, the foreign gene sequence can be expressed from an additional subgenomic RNA promoter and the sequence coding for the trans-acting factor that is expressed from the transgene can be deleted from the DNA-launching plasmid. Preferably, if the viral replicase proteins are expressed in transgenic plants, the DNA-launching plasmid will have a deletion of nucleotides 3420-4902, which appears to be a region that inhibits replication in trans. (Lewandowski et al., 1998).
- Potato virus X (PVX) has a single-stranded positive sense RNA genome. The 5′ end has an m7Gppp cap and the 3′ end is polyadenylated. A full-length cDNA clone of PVX has been constructed and infectious RNA transcripts obtained (Hemenway et al., 1990).
- A DNA-launching plasmid is constructed based on PVX RNA containing PVX cDNA precisely fused at its 5′ end to a DNA-dependent RNA polymerase promoter and having a polyadenylation site at its 3′ end. A convenient restriction site may also be included at the 3′ end. A foreign gene may be expressed from an additional subgenomic RNA.
- Transgenic plants are obtained having one or more trans-acting factors fused to the DNA-dependent RNA polymerase promoter and terminator. Such factors may include the viral RNA polymerase gene (ORF1-147K), coat protein (ORF5-21K), or triple gene block (ORF2-25K, ORF3-12K, ORF4-8K). The triple gene block genes can be expressed individually. Alternatively, they can be expressed as negative sense transcripts from which plus sense subgenomic RNA for
ORFs ORFs - A DNA-launching plasmid is constructed containing the DNA-dependent RNA polymerase promoter precisely fused to the 5′ end of the PVX genome, cis-acting elements important for PVX life cycle, such as the 5′ and 3′ ends, origin of assembly, etc., at least one foreign gene or sequence in place of the trans-acting factor that is expressed from the chromosome and a polyadenylation signal. Alternatively, the foreign gene sequence can be expressed from an additional subgenomic RNA promoter and the sequence coding for the trans-acting factor that is expressed transgenically can be deleted from the DNA-launching plasmid.
- Alternatively, a DNA-launching plasmid is constructed having a DNA-dependent RNA polymerase promoter, polyadenylation site, and the PVX cDNA sequence in which the ORF2 (25K) is replaced with a foreign gene or sequence. Alternatively, the ORF2 is deleted and the foreign gene is expressed from an additional subgenomic RNA promoter. Such a DNA-launching plasmid is inoculated to transgenic plants expressing movement protein from heterologous virus, such as tobacco mosaic virus (TMV 30K), tomato mosaic virus (ToMV 30K), or red clover necrotic mosaic virus (RCNMV 35K).
- Flock house virus (FHV) has a genome consisting of two single stranded RNAs. RNA1 encodes protein A, involved in RNA replication, and protein B that is translated from sg RNA3 and is dispensable for RNA replication. RNA2 encodes virion capsid precursor protein alpha. FHV is infectious to insect, plant, mammalian, and yeast cells (Selling et al., 1990; Price et al., 1996).
- A DNA-launching plasmid is constructed for FHV RNA1 and RNA2 containing FHV RNA cDNA precisely fused at its 5′ end to a DNA-dependent RNA polymerase promoter and at its 3′ end to a self-cleaving ribozyme. A polyadenylation signal may be also included. Alternatively, a convenient restriction site may be engineered at the 3′ end. Foreign genes or sequences may be expressed in several ways. For example, DNA-launching plasmids based on FHV RNA1 may contain a foreign gene or sequence expressed from subgenomic RNA3 as ORF B replacement or as a translational fusion with ORF B. Alternatively, a foreign gene may be expressed from an additional sg RNA. DNA-launching plasmids based on FHV RNA2 may contain a foreign gene(s) or sequence(s) expressed as a part of polyprotein alpha. Foreign gene(s) in such construct may include sequences necessary for polyprotein clevage. DNA-launching plasmids will preferably also express a movement protein of a heterologous plant virus, such as 30K of TMV or 35K of RCNMV. Alternatively, DNA-launching plasmids will be inoculated onto transgenic plants expressing such movement protein.
- Transgenic plants are obtained having one or more trans-acting factors fused to the DNA-dependent RNA polymerase promoter and terminator. Such factors may include protein A or capsid protein precursor alpha, and preferably will also include a movement protein from a plant virus, such as 30K of TMV or 35K of RCNMV. Trans-acting factors are stably expressed in the plant cell or their expression may be induced if an inducible promoter is used. Transgenically expressed trans-acting factors preferably lack at least one cis-acting factor which is necessary for their replication, such as the 5′ and/or 3′ end.
- A DNA-launching plasmid is constructed based on FHV RNA1 or FHV RNA2 containing a DNA-dependent RNA polymerase promoter precisely fused to the 5′ end of RNA1 (or RNA2), cis-acting elements important for FHV RNA1 (or RNA2) replication, such as the 5′ and 3′ ends, at least one foreign gene or sequence and a self-cleaving ribozyme at the 3′ end. Polyadenylation signal may also be included. Alternatively, a convenient restriction site may be engineered at the 3′ end of the modified viral RNA sequence of the DNA-launching plasmid. DNA-launching plasmids based on FHV RNA1 may contain a foreign gene or sequence in place of ORF A. Alternatively, the ORF A may be deleted and the foreign gene may be expressed from subgenomic RNA3, for example as an ORF B replacement or as a translational fusion with ORF B. Alternatively, DNA-launching plasmid may contain two exogenous RNA sequences, one in the place of ORF A and the other expressed from the subgenomic RNA3. DNA-launching plasmids based on FHV RNA2 may contain a foreign gene(s) or sequence(s) in place of ORF alpha or expressed as a part of polyprotein alpha. Foreign gene(s) in such a construct may include sequences necessary for polyprotein clevage.
- Tomato spotted wild virus (TSWV) is a tripartite (RNA L, M, S), negative sense and ambisense, single stranded RNA virus.
- Transgenic plants are obtained having one or more trans-acting factors fused to the DNA-dependent RNA polymerase promoter and terminator. Such factors include the putative TSWV polymerase gene (ORF L), ORF N, and possibly other trans-acting factors (NSm or NSs). At least one cis-acting sequence, such as 5′ and/or 3′ ends, which are necessary for TSWV RNA replication are removed from the transgene. Trans-acting factors are stably expressed in the plant cell or their expression may be induced if an inducible promoter is used.
- A DNA-launching plasmid is constructed based on TSWV RNA M in which the G1 and G2 coding sequences are replaced with at least one foreign gene or sequence. Such DNA-launching plasmid contains a DNA-dependent RNA polymerase promoter and TSWV RNA M cDNA fused to the self-cleaving ribozymes at the 5′ and 3′ ends. Alternatively, a DNA-launching plasmid is constructed based on TSWV RNA S in which the N coding region is replaced with a foreign gene or sequence.
- Genome of barley mild mosaic virus (BaMMV) consists of two positive sense, single-stranded, 3′-polyadenylated RNAs. The RNA1 encodes proteins related to the potyviral P3, 6K1, CI, 6K2, NIa-VPg, NIa-Pro, NIb and capsid protein (Kashiwazaki et al., 1990). The RNA2 encodes P1 and P2 protein (Kashiwazaki et al., 1991). The P1 protein is related to the potyviral HC-Pro and the P2 protein is important for fungal transmission. An isolate was obtained containing a deletion in the P2 protein (Timpe and Kuhne, 1995) thus indicating that P2 is dispensable for viral RNA replication.
- A DNA-launching plasmid is constructed for BaMMV RNA1 and RNA2 containing BaMMV RNA cDNA precisely fused at its 5′ end to a DNA-dependent RNA polymerase promoter and a polyadenylation site at its 3′ end. Foreign genes or sequences may be expressed in several ways. For example, DNA-launching plasmids based on BaMMV RNA2 may contain a foreign gene or sequence expressed as a part of polyprotein which can be cleaved and a foreign protein can be released.
- Transgenic plants are obtained having the BaMMV RNA1 cDNA lacking the 5′ and 3′ ends fused to the DNA-dependent RNA polymerase promoter and terminator.
- A DNA-launching plasmid is constructed based on BaMMV (isolate M) RNA2. Such plasmid contains a DNA-dependent RNA polymerase promoter precisely fused to the 5′ end of RNA2, RNA2 cis-acting replication signals located in the 5′ and 3′ ends, P1 ORF and a foreign gene in place of P2 ORF or expressed as a part of P1/P2 polyprotein which can be cleaved and a foreign protein can be released.
- The contents of all references cited throughout are incorporated herein by this reference to the extent they are not inconsistent with the disclosure, teachings, and principles of the subject invention.
- It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.
- De Jong and Ahlquist (1992) “A hybrid plant RNA virus made by transferring the noncapsid movement protein from a rod-shaped to an icosahedral virus is competent for systemic infection,”PNAS 89:6808-6812.
- Dinant, S., Janda, M., Kroner, P. A., Ahlquist, P. (1993) “Bromovirus RNA replication and transcription requires compatibility between the polymerase- and helicase-like viral RNA synthesis proteins,”J. Virol. 67:7181-7189.
- Edwards, M. C. (1995) “Mapping of the seed transmission determinants of barley stripe mosaic virus,”MPMI 8:906-915.
- French, R. and Ahlquist, P. (1988) “Characterization and engineering of sequences controlling in vivo synthesis of brome mosaic virus RNA3,”J. Virol. 62(7):2411-2421.
- Hemenway, C., Weiss, J., O'Connell, K., and Turner, N. E. (1990) “Characterization of infectious transcripts from a potato virus X cDNA clone,”Virology 175:365-371.
- Ishikawa, M., Diez, J., Restrepo-Hartwig, M., Ahlquist, P. (1997) “Yeast mutations in multiple complementation groups inhibit brome mosaic virus RNA replication and transcription and perturb regulated expression of viral polymerase-like gene,”PNAS 94:13810-13815.
- Jackson, A. O. and Hunter, B. G (1989) “Hordeivirus relationships and genome organization,”Annu. Rev. Phytopathol. 27:95-121.
- Janda, M., French, R., Ahlquist, P. (1987) “High efficiency T7 polymerase synthesis of infectious RNA from cloned brome mosaic virus cDNA and effect of 5′ extensions on transcript infectivity,”Virology 158:259-262.
- Kashiwazaki, S. Minobe, Y., Omura, T., Hibino, H. (1990) “Nucleotide sequence of barley yellow mosaic virus RNA1: a close evolutionary relationship with potyviruses,”Journal of General Virology 71:2781-2790.
- Kashiwazaki, S., Minobe, Y., Hibino, H. (1991) “Nucleotide sequence of barley yellow mosaic virus RNA2,”Journal of General Virology 72:995-999.
- Kikkert (1993) “The biolistic PDS 1000/He device,”Plant Cell Tiss. and Org. Cult. 33:221-226.
- Lewandowski, Dennis J., Dawson, William O. (1998) “Deletion of internal sequences results in tobacco mosaic virus defective RNAs that accumulate to high levels without interfering with replication of the helper virus,”Virology 251(2):427-437.
- Pacha, R. F. and Ahlquist, P. (1991) “Use of Bromovirus RNA3 hybrids to study template specificity in viral RNA amplification,”Journal of Virology 65:3693-3703.
- Petty, I. T. D. and Jackson, A. O. (1990) “Mutational analysis of barley stripe mosaic virus RNA beta,”Virology 179:712-718.
- Price, B. D., Rueckert, R. R., Ahlquist, P. (1996) “Complete replication of an animal virus and maintenance of expression vectors derived from it inSaccharomyces cerevisiae” PNAS 93:9465-9470.
- Rasochova, L. and Miller, W. A. (1996) “Satellite RNA of barley yellow dwarf-RPV virus reduces accumulation of RPV helper virus RNA and attenuates RPV symptoms on oats,”Molecular Plant-Microbe Interact 9:646-650.
- Sacher, R., French, R., Ahlquist, P. (1988) “Hybrid brome mosaic virus RNAs express and are packaged in tobacco mosaic virus coat protein in vivo,”Virology 167:15-24.
- Selling, B. H., Allison, R. F., Kaesberg, P. (1990) “Genomic RNA of an insect virus directs synthesis of infectious virions in plants,”PNAS 87:434-438.
- Timpe, U. and Kuhne, T. (1995) “In vitro transcript of a full-length cDNA of a naturally deleted RNA2 of barley mild mosaic virus (BaMMV) replicate in BaMMV-infected plants,”Journal of General Virology 76:2619-2623.
- Töpfer, R., Matzeit, V., Gronenborn, B., Schell, J., Steinbiss, H. H. (1987) “A set of plant expression vectors for transcriptional and translational fusions,”Nucleic Acids Res. 15:5890.
- U.S. Pat. No. 5,500,360.
- Zhou, H. and Jackson, A. O. (1996) “Analysis of cis-acting elements for replication of barley stripe mosaic virus RNA,”Virology 219:150-160.
-
1 8 1 7074 DNA Brome mosaic virus unsure (307)..(330) 24 nucleotides which are unknown. 1 aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60 agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120 gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180 aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240 tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300 aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840 cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140 nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380 tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440 tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500 ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560 gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620 cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680 ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740 ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800 ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980 cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100 ctgcaggtcg actctagagg atccccggtc actggatttt ggttttagga attagaaatt 2160 ttattgatag aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac 2220 acatgagcga aaccctataa gaaccctaat tcccttatct gggaactact cacacattat 2280 tctggagaaa atagagagag atagatttgt agagagagac tggtgatttg cggactctag 2340 aggatccccg ggtaccgagc tcgaattctc gagcagaggt ctcacacaga gacaagcgca 2400 tcacttaaca caattaaaga tcaaatcacc agcgagctcg ccgttaaagc aatactcaaa 2460 ggacttcttg tgtcgtgtta aggcaaccaa acagtactcc tcatgtttaa acaaatcaca 2520 tttggtcgac ttaagccgaa ccaaagtgac gttgtcaaca gagatccctt gcgcttcgtg 2580 tactgttttt atgtgtccat caatccagtc cttgctcacg ggaaaatcct tagccctcgt 2640 ttgaagggcc gctttatcag cttgagtcat cgtaagatac gttctgttcg gatcaatagt 2700 gacctgcaaa ccagaagtaa tacgacgctt cgtgagactt ctagaaactt tggactcaga 2760 tgtccaggat tgatacttcg tgtccctatt accgcattta cgcttcagca gattaacagc 2820 agcgataaca tcttgcggac accggtaagt cttgtgaaca acgtcacggc gatcatattg 2880 cagattaccg tggagcaatt taaaacccgc gtcacgagac ttgaacgaaa tctgctctgt 2940 gtccccaaag gcaagaactt gtgaacattt agacagagca gccaccacca ggagttgacc 3000 ataatgtagt aaaccagcct catcaacaag cagcctatga caggacggta caccgtgcat 3060 gatcgcagaa tccgcggtgc gcacaacgtc caaagctacc ttggaattat aagtgtcagg 3120 gaataaagcc atcctgacgt cctcggccga tttacgattc gccgtcacaa ttaggtcctc 3180 tcccatacgg aatgcatctt ttatggcagt ggttttaccg catcccgcaa ctccatcaac 3240 catggaaata tcgcatgtag ggacagaaac tttggcgcta gcttctgcaa tgtccctcaa 3300 gttagagcat gcacatgttt tatcaacaat gtacgtttca tctgcgtgct tcggacctaa 3360 accatgctca ttatatccaa cagtgtaatc gtatttttta ggatacaacc agttaccgtt 3420 ggccaaatgg acattcacca tatcgtctat gcgatggtag gtctcaaaga tgctcttatt 3480 tgcgatctca cttccgcgac cgccggaaat gtcccatagg tgacgaagat tagactcgga 3540 gttgttatgt aatctcttac aataacgcac aaattccttc atggctccgt gtctagatat 3600 gccacgaggg tccgttggta cctcaacaga cacctcggca tccgggacca catcagtcac 3660 cggtttaacg tcatcactga cggactcagg gctcgaactc tcaggggcat catgaaactc 3720 ctcctgaggt atctcagcag ctggcgggac tttcgccttc ttcttcgagc gcttggtctt 3780 ggctgtctgc acttcatgct ccagccggtc gaataagtcc tcttcagtcc aaaacgttct 3840 caaacgtgat atcggtacag aatcttgctc aaattcttca acgtttgaga gacgagtcag 3900 aaacttaaaa ctgtccgcat aagaatccag acgtagtagg ggaaatctgc tagccaatgt 3960 tctcagccat cctactttcg ccctggatga atctccaccc caccaaaacc tagttttgaa 4020 gtgatggcac caacctttcc attccatccc atcgcggagg gccgtaagct tttcgtactt 4080 ttgatacaga ttcaaagtca aagcaaaggc cactagatga taatcttcaa tgtctaagcg 4140 ctcaccagcc atgatagcct gaccgttaat aataacagtc gacgacttgg cggataagat 4200 agatgcgaca gctttcatgt tctcagtcca ttctttactt tccttgaaac atctgaaagc 4260 tatctcctct acctctctca ctgtggtttt ggcgacgcgc acacatttcc agcgattgag 4320 actccagtct tcaggtattg agacccctac gtacttagat atgtcttcaa accatacaca 4380 gtgacgtagt gtctcccggg ggcagcgtaa atttgtagcg atgatcttat aggtcatgat 4440 gttacatttc agcatttcgc gctccaacag ataggtggtt ccatcgatgc aatgcaccga 4500 ctcggtgaaa aatgagccca aatcttgcca tccgtggatg taagataatg tgctttcatt 4560 ttcaaaatcg aatttgatca cctcatccgc gcctgacccg tcacgttgcc agtgacattt 4620 aagcaaggga agaaaaccct cgcggtcaaa caacatggcg ccgtcgaaca taacggtacc 4680 acgtagtacg cgtactccat gcgaatgcat ggcgtcacac agaccttgga agcccatatc 4740 ataaccgccg tggatacaga tagcccaatc agcttggaca tcacaatctt gagctcggtt 4800 aagacaaaag ttcgggactt catcgaaatc atcgctttct tgcaaaattt ttcgcatgcg 4860 gcacatcctc tcctcatgtc gggcagcgtc tctaacaccc aacacaggac aacaactgtg 4920 caccctttta tcccttcttg aaaagtgatg ccaccaagac cctccgaaat ctataacggg 4980 gtcttcaggg ggaaaactgt cgagacagtc ataatgctcc gctacacgca gagcaccagc 5040 caggctatgg ggcgcatgat actgctgagt caaatttaag tcaaaggcac caccataacg 5100 gtcacggaag gcgtcagcct cctcaataga gagcttattg cgaacgttga ttttcttaga 5160 ccttttcgcg tattcaatct gcgcagataa ctgttgcgca acctgattgt ctacgatgtc 5220 ttgggcactc tggctgtcag cacccttctc agcaatcaac ttcagcaaat cgatagaact 5280 tgacattttg ttggtgaaaa acaaagaaca agtagcagaa ccgtggtcga ggtcctctcc 5340 aaatgaaatg aacttcctta tatagaggaa gggtcttgcg aaggatagtg ggattgtgcg 5400 tcatccctta cgtcagtgga gatatcacat caatccactt gctttgaaga cgtggttgga 5460 acgtcttctt tttccacgat gttcctcgtg ggtgggggtc catctttggg accactgtcg 5520 gtagaggcat tcttgaacga tagcctttcc tttatcgcaa tgatggcatt tgtagaagcc 5580 atcttccttt tctactgtcc tttcgatgaa gtgacagata gctgggcaat ggaatccgag 5640 gaggtttccc gatattaccc tttgttgaaa agtctcaata gccctctggt cttctgagac 5700 tgtatctttg atattcttgg agtagacgag agtgtcgtgc tccaccatgt tgaccgggtg 5760 gtcagtccct tatgttacgt cctgtagaaa ccccaacccg tgaaatcaaa aaactcgacg 5820 gcctgtgggc attcagtctg gatcgcgaaa actgtggaat tgatcagcgt tggtgggaaa 5880 gcgcgttaca agaaagccgg gcaattgctg tgccaggcag ttttaacgat cagttcgccg 5940 atgcagatat tcgtaattat gcgggcaacg tctggtatca gcgcgaagtc tttataccga 6000 aaggttgggc aggccagcgt atcgtgctgc gtttcgatgc ggtcactcat tacggcaaag 6060 tgtgggtcaa taatcaggaa gtgatggagc atcagggcgg ctatacgcca tttgaagccg 6120 atgtcacgcc gtatgttatt gccgggaaaa gtgtacaatt cactggccgt cgttttacaa 6180 cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct 6240 ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc 6300 agcctgaatg gcgaatgnnn nnnnaattca gtacattaaa aacgtccgca atgtgttatt 6360 aagttgtcta agcgtcaatt tgtttacacc acaatatatc ctgccaccag ccagccaaca 6420 gctccccgac cggcagctcg gcacaaaatc accactcgat acaggcagcc catcagnnnn 6480 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6540 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6600 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6660 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6720 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6780 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6840 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6900 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6960 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 7020 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnn 7074 2 6750 DNA Brome mosaic virus unsure (307)..(330) 24 nucleotides which are unknown. 2 aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60 agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120 gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180 aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240 tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300 aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840 cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140 nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380 tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440 tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500 ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560 gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620 cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680 ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740 ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800 ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980 cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100 ctgcaggtcg actctagagg atccccggtc aacatggtgg agcacgacac tctcgtctac 2160 tccaagaata tcaaagatac agtctcagaa gaccagaggg ctattgagac ttttcaacaa 2220 agggtaatat cgggaaacct cctcggattc cattgcccag ctatctgtca cttcatcgaa 2280 aggacagtag aaaaggaaga tggcttctac aaatgccatc attgcgataa aggaaaggct 2340 atcgttcaag aatgcctcta ccgacagtgg tcccaaagat ggacccccac ccacgaggaa 2400 catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt gatgtgatat 2460 ctccactgac gtaagggatg acgcacaatc ccactatcct tcgcaagacc cttcctctat 2520 ataaggaagt tcatttcatt tggagaggac ctcgaccacg gttctgctac ttgttctttg 2580 tttttcacca acaaaatgtc aagttctatc gatttgctga agttgattgc tgagaagggt 2640 gctgacagcc agagtgccca agacatcgta gacaatcagg ttgcgcaaca gttatctgcg 2700 cagattgaat acgcgaaaag gtctaagaaa atcaacgttc gcaataagct ctctattgag 2760 gaggctgacg ccttccgtga ccgttatggt ggtgcctttg acttaaattt gactcagcag 2820 tatcatgcgc cccatagcct ggctggtgct ctgcgtgtag cggagcatta tgactgtctc 2880 gacagttttc cccctgaaga ccccgttata gatttcggag ggtcttggtg gcatcacttt 2940 tcaagaaggg ataaaagggt gcacagttgt tgtcctgtgt tgggtgttag agacgctgcc 3000 cgacatgagg agaggatgtg ccgcatgcga aaaattttgc aagaaagcga tgatttcgat 3060 gaagtcccga acttttgtct taaccgagct caagattgtg atgtccaagc tgattgggct 3120 atctgtatcc acggcggtta tgatatgggc ttccaaggtc tgtgtgacgc catgcattcg 3180 catggagtac gcgtactacg tggtaccgtt atgttcgacg gcgccatgtt gtttgaccgc 3240 gagggttttc ttcccttgct taaatgtcac tggcaacgtg acgggtcagg cgcggatgag 3300 gtgatcaaat tcgattttga aaatgaaagc acattatctt acatccacgg atggcaagat 3360 ttgggctcat ttttcaccga gtcggtgcat tgcatcgatg gaaccaccta tctgttggag 3420 cgcgaaatgc tgaaatgtaa catcatgacc tataagatca tcgctacaaa tttacgctgc 3480 ccccgggaga cactacgtca ctgtgtatgg tttgaagaca tatctaagta cgtaggggtc 3540 tcaatacctg aagactggag tctcaatcgc tggaaatgtg tgcgcgtcgc caaaaccaca 3600 gtgagagagg tagaggagat agctttcaga tgtttcaagg aaagtaaaga atggactgag 3660 aacatgaaag ctgtcgcatc tatcttatcc gccaagtcgt cgactgttat tattaacggt 3720 caggctatca tggctggtga gcgcttagac attgaagatt atcatctagt ggcctttgct 3780 ttgactttga atctgtatca aaagtacgaa aagcttacgg ccctccgcga tgggatggaa 3840 tggaaaggtt ggtgccatca cttcaaaact aggttttggt ggggtggaga ttcatccagg 3900 gcgaaagtag gatggctgag aacattggct agcagatttc ccctactacg tctggattct 3960 tatgcggaca gttttaagtt tctgactcgt ctctcaaacg ttgaagaatt tgagcaagat 4020 tctgtaccga tatcacgttt gagaacgttt tggactgaag aggacttatt cgaccggctg 4080 gagcatgaag tgcagacagc caagaccaag cgctcgaaga agaaggcgaa agtcccgcca 4140 gctgctgaga tacctcagga ggagtttcat gatgcccctg agagttcgag ccctgagtcc 4200 gtcagtgatg acgttaaacc ggtgactgat gtggtcccgg atgccgaggt gtctgttgag 4260 gtaccaacgg accctcgtgg catatctaga cacggagcca tgaaggaatt tgtgcgttat 4320 tgtaagagat tacataacaa ctccgagtct aatcttcgtc acctatggga catttccggc 4380 ggtcgcggaa gtgagatcgc aaataagagc atctttgaga cctaccatcg catagacgat 4440 atggtgaatg tccatttggc caacggtaac tggttgtatc ctaaaaaata cgattacact 4500 gttggatata atgagcatgg tttaggtccg aagcacgcag atgaaacgta cattgttgat 4560 aaaacatgtg catgctctaa cttgagggac attgcagaag ctagcgccaa agtttctgtc 4620 cctacatgcg atatttccat ggttgatgga gttgcgggat gcggtaaaac cactgccata 4680 aaagatgcat tccgtatggg agaggaccta attgtgacgg cgaatcgtaa atcggccgag 4740 gacgtcagga tggctttatt ccctgacact tataattcca aggtagcttt ggacgttgtg 4800 cgcaccgcgg attctgcgat catgcacggt gtaccgtcct gtcataggct gcttgttgat 4860 gaggctggtt tactacatta tggtcaactc ctggtggtgg ctgctctgtc taaatgttca 4920 caagttcttg cctttgggga cacagagcag atttcgttca agtctcgtga cgcgggtttt 4980 aaattgctcc acggtaatct gcaatatgat cgccgtgacg ttgttcacaa gacttaccgg 5040 tgtccgcaag atgttatcgc tgctgttaat ctgctgaagc gtaaatgcgg taatagggac 5100 acgaagtatc aatcctggac atctgagtcc aaagtttcta gaagtctcac gaagcgtcgt 5160 attacttctg gtttgcaggt cactattgat ccgaacagaa cgtatcttac gatgactcaa 5220 gctgataaag cggcccttca aacgagggct aaggattttc ccgtgagcaa ggactggatt 5280 gatggacaca taaaaacagt acacgaagcg caagggatct ctgttgacaa cgtcactttg 5340 gttcggctta agtcgaccaa atgtgatttg tttaaacatg aggagtactg tttggttgcc 5400 ttaacacgac acaagaagtc ctttgagtat tgctttaacg gcgagctcgc tggtgatttg 5460 atctttaatt gtgttaagtg atgcgcttgt ctctgtgtga gacctctgct cgagaattcg 5520 agctcggtac ccggggatcc tctagagtcc gcaaatcacc agtctctctc tacaaatcta 5580 tctctctcta ttttctccag aataatgtgt gagtagttcc cagataaggg aattagggtt 5640 cttatagggt ttcgctcatg tgttgagcat ataagaaacc cttagtatgt atttgtattt 5700 gtaaaatact tctatcaata aaatttctaa ttcctaaaac caaaatccag tgaccgggtg 5760 gtcagtccct tatgttacgt cctgtagaaa ccccaacccg tgaaatcaaa aaactcgacg 5820 gcctgtgggc attcagtctg gatcgcgaaa actgtggaat tgatcagcgt tggtgggaaa 5880 gcgcgttaca agaaagccgg gcaattgctg tgccaggcag ttttaacgat cagttcgccg 5940 atgcagatat tcgtaattat gcgggcaacg tctggtatca gcgcgaagtc tttataccga 6000 aaggttgggc aggccagcgt atcgtgctgc gtttcgatgc ggtcactcat tacggcaaag 6060 tgtgggtcaa taatcaggaa gtgatggagc atcagggcgg ctatacgcca tttgaagccg 6120 atgtcacgcc gtatgttatt gccgggaaaa gtgtacaatt cactggccgt cgttttacaa 6180 cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct 6240 ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc 6300 agcctgaatg gcgaatgnnn nnnnaattca gtacattaaa aacgtccgca atgtgttatt 6360 aagttgtcta agcgtcaatt tgtttacacc acaatatatc ctgccaccag ccagccaaca 6420 gctccccgac cggcagctcg gcacaaaatc accactcgat acaggcagcc catcagnnnn 6480 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6540 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6600 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6660 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6720 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6750 3 6426 DNA Brome mosaic virus unsure (307)..(330) 24 nucleotides which are unknown. 3 aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60 agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120 gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180 aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240 tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300 aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840 cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140 nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380 tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440 tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500 ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560 gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620 cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680 ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740 ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800 ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980 cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100 ctgcaggtca ctggattttg gttttaggaa ttagaaattt tattgataga agtattttac 2160 aaatacaaat acatactaag ggtttcttat atgctcaaca catgagcgaa accctataag 2220 aaccctaatt cccttatctg ggaactactc acacattatt ctggagaaaa tagagagaga 2280 tagatttgta gagagagact ggtgatttgc ggactctaga ggatccccag cttttaaact 2340 tagccaaagt ggtctgcctg accaggagtt tttaacctta accaaagggc tgttcacagc 2400 ttaggttcat atatcataga accgatcatc tcagatcaga gggcttaaaa gtctcacaat 2460 gggacttcac gagcaaagca tcaactgacg ttaggcctcc tctaccggta gcgtaatcgt 2520 cgaccttctt tttcaagcgt tgtgtggtcc tacgatcatt agctaatttg agtgactcac 2580 gctcaagggc ctcatgtaaa cgtccgatcc gtttgacagg gagctcctta gtactacagt 2640 ccgaggaata aattccaatg gttctgtaga ctttgtctaa cacaccagga aactttggat 2700 tcttccagtt gtgaaaccag tcaccatcag ttttacgctc ttccgtggtg cgtttgaact 2760 tacatacagg atcgctcatc tgataaactc tgatgccttc ggtacagtag caatcagaga 2820 acctcaggaa attctcggag tataaagaaa aagccgcaag agcagctcta acctcctcga 2880 aaatccaagg tttttctttc ccatatttca gataaacaaa atgacagagc gtcgtaatca 2940 tcttctcatc aagttgatta ataaacttca ttcgatcaca gaaggaaacg aaatgtgctc 3000 tgagcatctg ttcatcacgc agaatctttc gcttagctaa gcgctggatc tctctcagag 3060 gatctggtac agacaccaaa ttgcccattt cagtttcgac gagaaactta ctacaaacgt 3120 agggcacact agggtccatg acttttatct ccatattgaa gagagacgta aacatatcgg 3180 tatccaggac tggcttaact ttagagatga ttaaagaatc atctcctgaa aatattgcac 3240 agtcacagtc acttagatca gaggcatatg caatcatagc catagtgaca agagtattac 3300 cgaaatatgt aaacgcgtca ccagttctgc gttggaagga aacggacatt cccaccttgg 3360 catgagggtc tgataaataa gaatcgcgat gaaaatcaga ccaccaattc gtcagcggcg 3420 ctggaaagcc cagcgcaagg agtatctctc tctgaaactc taggtgcagc tcaccctgag 3480 atttatcaaa tttgcttagg tccgcttcaa gaaagtatct gttattcaag cggacattct 3540 taagctccag agaggatatc tttccgatag gcacaatgaa cctggatttc agggccagtg 3600 ataacttctc gaaacaagca gtgaaaaagg gtgaaaaatt actagtcaca cctttactat 3660 gaaatgttat agtagctgct actgctcgtt ccaagtgaag ggtgtcagtt acaacaggtt 3720 ttacgtcaga cttcagcata tgctggtacc gacataaatc agtctctgct gccacattca 3780 caccttgcaa gtccatgtgc ttaccccact tcttatggta ctcaagacat ttagtcatga 3840 catccataga agctctcaga cagtcttcac cgtcaacatt aaggaatgtg ctacgaaagc 3900 gctttgctat agctttcgca gtgtccttca tgttaatcgc gtctcccatt tctggaacgt 3960 ccgcgtttcg ctttttgagt gcggttaaga cttctttctg agtaccaact cttcgctgag 4020 cactcccgat attcattttt ggttgaaaat atttatcggg gtccctatac cagtctacat 4080 cactttgctt aagtctgatc ctatcaaagt ccatggaata atcaccattt tcaacaaggg 4140 cttgatggta cgaatcatcg aaataagcat gggttggcag tatggaatga ctggtcgctt 4200 ctgttctagc aaggctgact ctctccatat aaattggccc agtagagatg tcagggttat 4260 ctggatggca gtgtgtatca ataacacgcg aaaccctatg ttcaataggg ttcatgattt 4320 gaagagtgat gtcgtaatca gtattagtag tctgaaactc ttcatcaatg cccatgtacc 4380 tatctccaag ggtcagctcc ttgggggtat ctccagtaac acgaacttcc tcaatttcac 4440 agttcgagga atcactggcg agttttagat cgctcgcatg atcttcatcg gcggcaaacg 4500 atacaccgta accatcacta gtatcctcgg gataccagtc atcaatttca tcttcgagca 4560 cgaaagagcc cggaatgtca agatataaca tccgtgccat ttcagcttga ggaatcagcg 4620 gtctatcggt gaactgttga accatttgtt ggacggtgtc gcaaatagag ccccagcgca 4680 ctcggtcaaa agggggatcg aatacccctc ctatctccaa gggcgctata gctaatttaa 4740 aactcgcgag agatccgtca atggcaactc cgtctgccgg ctcctgcacc tgaaggctag 4800 cagcctccac ctcgtcttct aaggattgat ctatgatcca ttggaaagac gggacctggc 4860 gaacgaaatc atcatcccag gttttcgaag acatcttggt gatagtagaa agaacaagca 4920 cacaacaaca acaaggtcag atgtgtgttg cgggtaccga gctcgaattc tcgaggtcct 4980 ctccaaatga aatgaacttc cttatataga ggaagggtct tgcgaaggat agtgggattg 5040 tgcgtcatcc cttacgtcag tggagatatc acatcaatcc acttgctttg aagacgtggt 5100 tggaacgtct tctttttcca cgatgttcct cgtgggtggg ggtccatctt tgggaccact 5160 gtcggtagag gcattcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 5220 agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 5280 cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 5340 agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgacct 5400 gcaggcagca agcttgcatg cctgcaggtc gactctagag gatccccggg tggtcagtcc 5460 cttatgttac gtcctgtaga aaccccaacc cgtgaaatca aaaaactcga cggcctgtgg 5520 gcattcagtc tggatcgcga aaactgtgga attgatcagc gttggtggga aagcgcgtta 5580 caagaaagcc gggcaattgc tgtgccaggc agttttaacg atcagttcgc cgatgcagat 5640 attcgtaatt atgcgggcaa cgtctggtat cagcgcgaag tctttatacc gaaaggttgg 5700 gcaggccagc gtatcgtgct gcgtttcgat gcggtcactc attacggcaa agtgtgggtc 5760 aataatcagg aagtgatgga gcatcagggc ggctatacgc catttgaagc cgatgtcacg 5820 ccgtatgtta ttgccgggaa aagtgtacaa ttcactggcc gtcgttttac aacgtcgtga 5880 ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 5940 ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 6000 tggcgaatgn nnnnnnaatt cagtacatta aaaacgtccg caatgtgtta ttaagttgtc 6060 taagcgtcaa tttgtttaca ccacaatata tcctgccacc agccagccaa cagctccccg 6120 accggcagct cggcacaaaa tcaccactcg atacaggcag cccatcagnn nnnnnnnnnn 6180 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6240 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6300 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6360 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6420 nnnnnn 6426 4 6500 DNA Brome mosaic virus unsure (307)..(330) 24 nucleotides which are unknown. 4 aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60 agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120 gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180 aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240 tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300 aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840 cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140 nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380 tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440 tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500 ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560 gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620 cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680 ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740 ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800 ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980 cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgctgcc 2100 tgcaggtcaa catggtggag cacgacactc tcgtctactc caagaatatc aaagatacag 2160 tctcagaaga ccagagggct attgagactt ttcaacaaag ggtaatatcg ggaaacctcc 2220 tcggattcca ttgcccagct atctgtcact tcatcgaaag gacagtagaa aaggaagatg 2280 gcttctacaa atgccatcat tgcgataaag gaaaggctat cgttcaagaa tgcctctacc 2340 gacagtggtc ccaaagatgg acccccaccc acgaggaaca tcgtggaaaa agaagacgtt 2400 ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac 2460 gcacaatccc actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg 2520 gagaggacct cgagaattcg agctcggtac ccgcaacaca catctgacct tgttgttgtt 2580 gtgtgcttgt tctttctact atcaccaaga tgtcttcgaa aacctgggat gatgatttcg 2640 ttcgccaggt cccgtctttc caatggatca tagatcaatc cttagaagac gaggtggagg 2700 ctgctagcct tcaggtgcag gagccggcag acggagttgc cattgacgga tctctcgcga 2760 gttttaaatt agctatagcg cccttggaga taggaggggt attcgatccc ccttttgacc 2820 gagtgcgctg gggctctatt tgcgacaccg tccaacaaat ggttcaacag ttcaccgata 2880 gaccgctgat tcctcaagct gaaatggcac ggatgttata tcttgacatt ccgggctctt 2940 tcgtgctcga agatgaaatt gatgactggt atcccgagga tactagtgat ggttacggtg 3000 tatcgtttgc cgccgatgaa gatcatgcga gcgatctaaa actcgccagt gattcctcga 3060 actgtgaaat tgaggaagtt cgtgttactg gagatacccc caaggagctg acccttggag 3120 ataggtacat gggcattgat gaagagtttc agactactaa tactgattac gacatcactc 3180 ttcaaatcat gaaccctatt gaacataggg tttcgcgtgt tattgataca cactgccatc 3240 cagataaccc tgacatctct actgggccaa tttatatgga gagagtcagc cttgctagaa 3300 cagaagcgac cagtcattcc atactgccaa cccatgctta tttcgatgat tcgtaccatc 3360 aagcccttgt tgaaaatggt gattattcca tggactttga taggatcaga cttaagcaaa 3420 gtgatgtaga ctggtatagg gaccccgata aatattttca accaaaaatg aatatcggga 3480 gtgctcagcg aagagttggt actcagaaag aagtcttaac cgcactcaaa aagcgaaacg 3540 cggacgttcc agaaatggga gacgcgatta acatgaagga cactgcgaaa gctatagcaa 3600 agcgctttcg tagcacattc cttaatgttg acggtgaaga ctgtctgaga gcttctatgg 3660 atgtcatgac taaatgtctt gagtaccata agaagtgggg taagcacatg gacttgcaag 3720 gtgtgaatgt ggcagcagag actgatttat gtcggtacca gcatatgctg aagtctgacg 3780 taaaacctgt tgtaactgac acccttcact tggaacgagc agtagcagct actataacat 3840 ttcatagtaa aggtgtgact agtaattttt cacccttttt cactgcttgt ttcgagaagt 3900 tatcactggc cctgaaatcc aggttcattg tgcctatcgg aaagatatcc tctctggagc 3960 ttaagaatgt ccgcttgaat aacagatact ttcttgaagc ggacctaagc aaatttgata 4020 aatctcaggg tgagctgcac ctagagtttc agagagagat actccttgcg ctgggctttc 4080 cagcgccgct gacgaattgg tggtctgatt ttcatcgcga ttcttattta tcagaccctc 4140 atgccaaggt gggaatgtcc gtttccttcc aacgcagaac tggtgacgcg tttacatatt 4200 tcggtaatac tcttgtcact atggctatga ttgcatatgc ctctgatcta agtgactgtg 4260 actgtgcaat attttcagga gatgattctt taatcatctc taaagttaag ccagtcctgg 4320 ataccgatat gtttacgtct ctcttcaata tggagataaa agtcatggac cctagtgtgc 4380 cctacgtttg tagtaagttt ctcgtcgaaa ctgaaatggg caatttggtg tctgtaccag 4440 atcctctgag agagatccag cgcttagcta agcgaaagat tctgcgtgat gaacagatgc 4500 tcagagcaca tttcgtttcc ttctgtgatc gaatgaagtt tattaatcaa cttgatgaga 4560 agatgattac gacgctctgt cattttgttt atctgaaata tgggaaagaa aaaccttgga 4620 ttttcgagga ggttagagct gctcttgcgg ctttttcttt atactccgag aatttcctga 4680 ggttctctga ttgctactgt accgaaggca tcagagttta tcagatgagc gatcctgtat 4740 gtaagttcaa acgcaccacg gaagagcgta aaactgatgg tgactggttt cacaactgga 4800 agaatccaaa gtttcctggt gtgttagaca aagtctacag aaccattgga atttattcct 4860 cggactgtag tactaaggag ctccctgtca aacggatcgg acgtttacat gaggcccttg 4920 agcgtgagtc actcaaatta gctaatgatc gtaggaccac acaacgcttg aaaaagaagg 4980 tcgacgatta cgctaccggt agaggaggcc taacgtcagt tgatgctttg ctcgtgaagt 5040 cccattgtga gacttttaag ccctctgatc tgagatgatc ggttctatga tatatgaacc 5100 taagctgtga acagcccttt ggttaaggtt aaaaactcct ggtcaggcag accactttgg 5160 ctaagtttaa aagctgggga tcctctagag tccgcaaatc accagtctct ctctacaaat 5220 ctatctctct ctattttctc cagaataatg tgtgagtagt tcccagataa gggaattagg 5280 gttcttatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta 5340 tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtgacctg 5400 caggcatgca agcttgcatg cctgcaggtc gactctagag gatccccggg tggtcagtcc 5460 cttatgttac gtcctgtaga aaccccaacc cgtgaaatca aaaaactcga cggcctgtgg 5520 gcattcagtc tggatcgcga aaactgtgga attgatcagc gttggtggga aagcgcgtta 5580 caagaaagcc gggcaattgc tgtgccaggc agttttaacg atcagttcgc cgatgcagat 5640 attcgtaatt atgcgggcaa cgtctggtat cagcgcgaag tctttatacc gaaaggttgg 5700 gcaggccagc gtatcgtgct gcgtttcgat gcggtcactc attacggcaa agtgtgggtc 5760 aataatcagg aagtgatgga gcatcagggc ggctatacgc catttgaagc cgatgtcacg 5820 ccgtatgtta ttgccgggaa aagtgtacaa ttcactggcc gtcgttttac aacgtcgtga 5880 ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 5940 ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 6000 tggcgaatgn nnnnnnaatt cagtacatta aaaacgtccg caatgtgtta ttaagttgtc 6060 taagcgtcaa tttgtttaca ccacaatata tcctgccacc agccagccaa cagctccccg 6120 accggcagct cggcacaaaa tcaccactcg atacaggcag cccatcagnn nnnnnnnnnn 6180 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6240 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6300 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6360 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6420 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 6480 nnnnnnnnnn nnnnnnnnnn 6500 5 10100 DNA Brome mosaic virus unsure (307)..(330) 24 nucleotides which are unknown. 5 aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60 agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120 gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180 aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240 tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300 aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840 cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140 nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380 tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440 tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500 ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560 gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620 cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680 ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740 ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800 ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980 cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100 ctgcaggtca ctggattttg gttttaggaa ttagaaattt tattgataga agtattttac 2160 aaatacaaat acatactaag ggtttcttat atgctcaaca catgagcgaa accctataag 2220 aaccctaatt cccttatctg ggaactactc acacattatt ctggagaaaa tagagagaga 2280 tagatttgta gagagagact ggtgatttgc ggactctaga ggatccccag cttttaaact 2340 tagccaaagt ggtctgcctg accaggagtt tttaacctta accaaagggc tgttcacagc 2400 ttaggttcat atatcataga accgatcatc tcagatcaga gggcttaaaa gtctcacaat 2460 gggacttcac gagcaaagca tcaactgacg ttaggcctcc tctaccggta gcgtaatcgt 2520 cgaccttctt tttcaagcgt tgtgtggtcc tacgatcatt agctaatttg agtgactcac 2580 gctcaagggc ctcatgtaaa cgtccgatcc gtttgacagg gagctcctta gtactacagt 2640 ccgaggaata aattccaatg gttctgtaga ctttgtctaa cacaccagga aactttggat 2700 tcttccagtt gtgaaaccag tcaccatcag ttttacgctc ttccgtggtg cgtttgaact 2760 tacatacagg atcgctcatc tgataaactc tgatgccttc ggtacagtag caatcagaga 2820 acctcaggaa attctcggag tataaagaaa aagccgcaag agcagctcta acctcctcga 2880 aaatccaagg tttttctttc ccatatttca gataaacaaa atgacagagc gtcgtaatca 2940 tcttctcatc aagttgatta ataaacttca ttcgatcaca gaaggaaacg aaatgtgctc 3000 tgagcatctg ttcatcacgc agaatctttc gcttagctaa gcgctggatc tctctcagag 3060 gatctggtac agacaccaaa ttgcccattt cagtttcgac gagaaactta ctacaaacgt 3120 agggcacact agggtccatg acttttatct ccatattgaa gagagacgta aacatatcgg 3180 tatccaggac tggcttaact ttagagatga ttaaagaatc atctcctgaa aatattgcac 3240 agtcacagtc acttagatca gaggcatatg caatcatagc catagtgaca agagtattac 3300 cgaaatatgt aaacgcgtca ccagttctgc gttggaagga aacggacatt cccaccttgg 3360 catgagggtc tgataaataa gaatcgcgat gaaaatcaga ccaccaattc gtcagcggcg 3420 ctggaaagcc cagcgcaagg agtatctctc tctgaaactc taggtgcagc tcaccctgag 3480 atttatcaaa tttgcttagg tccgcttcaa gaaagtatct gttattcaag cggacattct 3540 taagctccag agaggatatc tttccgatag gcacaatgaa cctggatttc agggccagtg 3600 ataacttctc gaaacaagca gtgaaaaagg gtgaaaaatt actagtcaca cctttactat 3660 gaaatgttat agtagctgct actgctcgtt ccaagtgaag ggtgtcagtt acaacaggtt 3720 ttacgtcaga cttcagcata tgctggtacc gacataaatc agtctctgct gccacattca 3780 caccttgcaa gtccatgtgc ttaccccact tcttatggta ctcaagacat ttagtcatga 3840 catccataga agctctcaga cagtcttcac cgtcaacatt aaggaatgtg ctacgaaagc 3900 gctttgctat agctttcgca gtgtccttca tgttaatcgc gtctcccatt tctggaacgt 3960 ccgcgtttcg ctttttgagt gcggttaaga cttctttctg agtaccaact cttcgctgag 4020 cactcccgat attcattttt ggttgaaaat atttatcggg gtccctatac cagtctacat 4080 cactttgctt aagtctgatc ctatcaaagt ccatggaata atcaccattt tcaacaaggg 4140 cttgatggta cgaatcatcg aaataagcat gggttggcag tatggaatga ctggtcgctt 4200 ctgttctagc aaggctgact ctctccatat aaattggccc agtagagatg tcagggttat 4260 ctggatggca gtgtgtatca ataacacgcg aaaccctatg ttcaataggg ttcatgattt 4320 gaagagtgat gtcgtaatca gtattagtag tctgaaactc ttcatcaatg cccatgtacc 4380 tatctccaag ggtcagctcc ttgggggtat ctccagtaac acgaacttcc tcaatttcac 4440 agttcgagga atcactggcg agttttagat cgctcgcatg atcttcatcg gcggcaaacg 4500 atacaccgta accatcacta gtatcctcgg gataccagtc atcaatttca tcttcgagca 4560 cgaaagagcc cggaatgtca agatataaca tccgtgccat ttcagcttga ggaatcagcg 4620 gtctatcggt gaactgttga accatttgtt ggacggtgtc gcaaatagag ccccagcgca 4680 ctcggtcaaa agggggatcg aatacccctc ctatctccaa gggcgctata gctaatttaa 4740 aactcgcgag agatccgtca atggcaactc cgtctgccgg ctcctgcacc tgaaggctag 4800 cagcctccac ctcgtcttct aaggattgat ctatgatcca ttggaaagac gggacctggc 4860 gaacgaaatc atcatcccag gttttcgaag acatcttggt gatagtagaa agaacaagca 4920 cacaacaaca acaaggtcag atgtgtgttg cgggtaccga gctcgaattc tcgaggtcct 4980 ctccaaatga aatgaacttc cttatataga ggaagggtct tgcgaaggat agtgggattg 5040 tgcgtcatcc cttacgtcag tggagatatc acatcaatcc acttgctttg aagacgtggt 5100 tggaacgtct tctttttcca cgatgttcct cgtgggtggg ggtccatctt tgggaccact 5160 gtcggtagag gcattcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 5220 agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 5280 cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 5340 agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgacct 5400 gcaggcagca agcttgcatg cctgcaggtc gactctagag gatccccggt caacatggtg 5460 gagcacgaca ctctcgtcta ctccaagaat atcaaagata cagtctcaga agaccagagg 5520 gctattgaga cttttcaaca aagggtaata tcgggaaacc tcctcggatt ccattgccca 5580 gctatctgtc acttcatcga aaggacagta gaaaaggaag atggcttcta caaatgccat 5640 cattgcgata aaggaaaggc tatcgttcaa gaatgcctct accgacagtg gtcccaaaga 5700 tggaccccca cccacgagga acatcgtgga aaaagaagac gttccaacca cgtcttcaaa 5760 gcaagtggat tgatgtgata tctccactga cgtaagggat gacgcacaat cccactatcc 5820 ttcgcaagac ccttcctcta tataaggaag ttcatttcat ttggagagga cctcgaccac 5880 ggttctgcta cttgttcttt gtttttcacc aacaaaatgt caagttctat cgatttgctg 5940 aagttgattg ctgagaaggg tgctgacagc cagagtgccc aagacatcgt agacaatcag 6000 gttgcgcaac agttatctgc gcagattgaa tacgcgaaaa ggtctaagaa aatcaacgtt 6060 cgcaataagc tctctattga ggaggctgac gccttccgtg accgttatgg tggtgccttt 6120 gacttaaatt tgactcagca gtatcatgcg ccccatagcc tggctggtgc tctgcgtgta 6180 gcggagcatt atgactgtct cgacagtttt ccccctgaag accccgttat agatttcgga 6240 gggtcttggt ggcatcactt ttcaagaagg gataaaaggg tgcacagttg ttgtcctgtg 6300 ttgggtgtta gagacgctgc ccgacatgag gagaggatgt gccgcatgcg aaaaattttg 6360 caagaaagcg atgatttcga tgaagtcccg aacttttgtc ttaaccgagc tcaagattgt 6420 gatgtccaag ctgattgggc tatctgtatc cacggcggtt atgatatggg cttccaaggt 6480 ctgtgtgacg ccatgcattc gcatggagta cgcgtactac gtggtaccgt tatgttcgac 6540 ggcgccatgt tgtttgaccg cgagggtttt cttcccttgc ttaaatgtca ctggcaacgt 6600 gacgggtcag gcgcggatga ggtgatcaaa ttcgattttg aaaatgaaag cacattatct 6660 tacatccacg gatggcaaga tttgggctca tttttcaccg agtcggtgca ttgcatcgat 6720 ggaaccacct atctgttgga gcgcgaaatg ctgaaatgta acatcatgac ctataagatc 6780 atcgctacaa atttacgctg cccccgggag acactacgtc actgtgtatg gtttgaagac 6840 atatctaagt acgtaggggt ctcaatacct gaagactgga gtctcaatcg ctggaaatgt 6900 gtgcgcgtcg ccaaaaccac agtgagagag gtagaggaga tagctttcag atgtttcaag 6960 gaaagtaaag aatggactga gaacatgaaa gctgtcgcat ctatcttatc cgccaagtcg 7020 tcgactgtta ttattaacgg tcaggctatc atggctggtg agcgcttaga cattgaagat 7080 tatcatctag tggcctttgc tttgactttg aatctgtatc aaaagtacga aaagcttacg 7140 gccctccgcg atgggatgga atggaaaggt tggtgccatc acttcaaaac taggttttgg 7200 tggggtggag attcatccag ggcgaaagta ggatggctga gaacattggc tagcagattt 7260 cccctactac gtctggattc ttatgcggac agttttaagt ttctgactcg tctctcaaac 7320 gttgaagaat ttgagcaaga ttctgtaccg atatcacgtt tgagaacgtt ttggactgaa 7380 gaggacttat tcgaccggct ggagcatgaa gtgcagacag ccaagaccaa gcgctcgaag 7440 aagaaggcga aagtcccgcc agctgctgag atacctcagg aggagtttca tgatgcccct 7500 gagagttcga gccctgagtc cgtcagtgat gacgttaaac cggtgactga tgtggtcccg 7560 gatgccgagg tgtctgttga ggtaccaacg gaccctcgtg gcatatctag acacggagcc 7620 atgaaggaat ttgtgcgtta ttgtaagaga ttacataaca actccgagtc taatcttcgt 7680 cacctatggg acatttccgg cggtcgcgga agtgagatcg caaataagag catctttgag 7740 acctaccatc gcatagacga tatggtgaat gtccatttgg ccaacggtaa ctggttgtat 7800 cctaaaaaat acgattacac tgttggatat aatgagcatg gtttaggtcc gaagcacgca 7860 gatgaaacgt acattgttga taaaacatgt gcatgctcta acttgaggga cattgcagaa 7920 gctagcgcca aagtttctgt ccctacatgc gatatttcca tggttgatgg agttgcggga 7980 tgcggtaaaa ccactgccat aaaagatgca ttccgtatgg gagaggacct aattgtgacg 8040 gcgaatcgta aatcggccga ggacgtcagg atggctttat tccctgacac ttataattcc 8100 aaggtagctt tggacgttgt gcgcaccgcg gattctgcga tcatgcacgg tgtaccgtcc 8160 tgtcataggc tgcttgttga tgaggctggt ttactacatt atggtcaact cctggtggtg 8220 gctgctctgt ctaaatgttc acaagttctt gcctttgggg acacagagca gatttcgttc 8280 aagtctcgtg acgcgggttt taaattgctc cacggtaatc tgcaatatga tcgccgtgac 8340 gttgttcaca agacttaccg gtgtccgcaa gatgttatcg ctgctgttaa tctgctgaag 8400 cgtaaatgcg gtaataggga cacgaagtat caatcctgga catctgagtc caaagtttct 8460 agaagtctca cgaagcgtcg tattacttct ggtttgcagg tcactattga tccgaacaga 8520 acgtatctta cgatgactca agctgataaa gcggcccttc aaacgagggc taaggatttt 8580 cccgtgagca aggactggat tgatggacac ataaaaacag tacacgaagc gcaagggatc 8640 tctgttgaca acgtcacttt ggttcggctt aagtcgacca aatgtgattt gtttaaacat 8700 gaggagtact gtttggttgc cttaacacga cacaagaagt cctttgagta ttgctttaac 8760 ggcgagctcg ctggtgattt gatctttaat tgtgttaagt gatgcgcttg tctctgtgtg 8820 agacctctgc tcgagaattc gagctcggta cccggggatc ctctagagtc cgcaaatcac 8880 cagtctctct ctacaaatct atctctctct attttctcca gaataatgtg tgagtagttc 8940 ccagataagg gaattagggt tcttataggg tttcgctcat gtgttgagca tataagaaac 9000 ccttagtatg tatttgtatt tgtaaaatac ttctatcaat aaaatttcta attcctaaaa 9060 ccaaaatcca gtgaccgggt ggtcagtccc ttatgttacg tcctgtagaa accccaaccc 9120 gtgaaatcaa aaaactcgac ggcctgtggg cattcagtct ggatcgcgaa aactgtggaa 9180 ttgatcagcg ttggtgggaa agcgcgttac aagaaagccg ggcaattgct gtgccaggca 9240 gttttaacga tcagttcgcc gatgcagata ttcgtaatta tgcgggcaac gtctggtatc 9300 agcgcgaagt ctttataccg aaaggttggg caggccagcg tatcgtgctg cgtttcgatg 9360 cggtcactca ttacggcaaa gtgtgggtca ataatcagga agtgatggag catcagggcg 9420 gctatacgcc atttgaagcc gatgtcacgc cgtatgttat tgccgggaaa agtgtacaat 9480 tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 9540 cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 9600 cgcccttccc aacagttgcg cagcctgaat ggcgaatgnn nnnnnaattc agtacattaa 9660 aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat 9720 cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga 9780 tacaggcagc ccatcagnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9840 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9900 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9960 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10020 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10080 nnnnnnnnnn nnnnnnnnnn 10100 6 10240 DNA Brome mosaic virus unsure (307)..(330) 24 nucleotides which are unknown. 6 aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60 agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120 gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180 aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240 tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300 aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840 cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140 nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380 tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440 tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500 ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560 gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620 cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680 ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740 ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800 ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980 cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgcatgc 2100 ctgcaggtca ctggattttg gttttaggaa ttagaaattt tattgataga agtattttac 2160 aaatacaaat acatactaag ggtttcttat atgctcaaca catgagcgaa accctataag 2220 aaccctaatt cccttatctg ggaactactc acacattatt ctggagaaaa tagagagaga 2280 tagatttgta gagagagact ggtgatttgc ggactctaga ggatccccag cttttaaact 2340 tagccaaagt ggtctgcctg accaggagtt tttaacctta accaaagggc tgttcacagc 2400 ttaggttcat atatcataga accgatcatc tcagatcaga gggcttaaaa gtctcacaat 2460 gggacttcac gagcaaagca tcaactgacg ttaggcctcc tctaccggta gcgtaatcgt 2520 cgaccttctt tttcaagcgt tgtgtggtcc tacgatcatt agctaatttg agtgactcac 2580 gctcaagggc ctcatgtaaa cgtccgatcc gtttgacagg gagctcctta gtactacagt 2640 ccgaggaata aattccaatg gttctgtaga ctttgtctaa cacaccagga aactttggat 2700 tcttccagtt gtgaaaccag tcaccatcag ttttacgctc ttccgtggtg cgtttgaact 2760 tacatacagg atcgctcatc tgataaactc tgatgccttc ggtacagtag caatcagaga 2820 acctcaggaa attctcggag tataaagaaa aagccgcaag agcagctcta acctcctcga 2880 aaatccaagg tttttctttc ccatatttca gataaacaaa atgacagagc gtcgtaatca 2940 tcttctcatc aagttgatta ataaacttca ttcgatcaca gaaggaaacg aaatgtgctc 3000 tgagcatctg ttcatcacgc agaatctttc gcttagctaa gcgctggatc tctctcagag 3060 gatctggtac agacaccaaa ttgcccattt cagtttcgac gagaaactta ctacaaacgt 3120 agggcacact agggtccatg acttttatct ccatattgaa gagagacgta aacatatcgg 3180 tatccaggac tggcttaact ttagagatga ttaaagaatc atctcctgaa aatattgcac 3240 agtcacagtc acttagatca gaggcatatg caatcatagc catagtgaca agagtattac 3300 cgaaatatgt aaacgcgtca ccagttctgc gttggaagga aacggacatt cccaccttgg 3360 catgagggtc tgataaataa gaatcgcgat gaaaatcaga ccaccaattc gtcagcggcg 3420 ctggaaagcc cagcgcaagg agtatctctc tctgaaactc taggtgcagc tcaccctgag 3480 atttatcaaa tttgcttagg tccgcttcaa gaaagtatct gttattcaag cggacattct 3540 taagctccag agaggatatc tttccgatag gcacaatgaa cctggatttc agggccagtg 3600 ataacttctc gaaacaagca gtgaaaaagg gtgaaaaatt actagtcaca cctttactat 3660 gaaatgttat agtagctgct actgctcgtt ccaagtgaag ggtgtcagtt acaacaggtt 3720 ttacgtcaga cttcagcata tgctggtacc gacataaatc agtctctgct gccacattca 3780 caccttgcaa gtccatgtgc ttaccccact tcttatggta ctcaagacat ttagtcatga 3840 catccataga agctctcaga cagtcttcac cgtcaacatt aaggaatgtg ctacgaaagc 3900 gctttgctat agctttcgca gtgtccttca tgttaatcgc gtctcccatt tctggaacgt 3960 ccgcgtttcg ctttttgagt gcggttaaga cttctttctg agtaccaact cttcgctgag 4020 cactcccgat attcattttt ggttgaaaat atttatcggg gtccctatac cagtctacat 4080 cactttgctt aagtctgatc ctatcaaagt ccatggaata atcaccattt tcaacaaggg 4140 cttgatggta cgaatcatcg aaataagcat gggttggcag tatggaatga ctggtcgctt 4200 ctgttctagc aaggctgact ctctccatat aaattggccc agtagagatg tcagggttat 4260 ctggatggca gtgtgtatca ataacacgcg aaaccctatg ttcaataggg ttcatgattt 4320 gaagagtgat gtcgtaatca gtattagtag tctgaaactc ttcatcaatg cccatgtacc 4380 tatctccaag ggtcagctcc ttgggggtat ctccagtaac acgaacttcc tcaatttcac 4440 agttcgagga atcactggcg agttttagat cgctcgcatg atcttcatcg gcggcaaacg 4500 atacaccgta accatcacta gtatcctcgg gataccagtc atcaatttca tcttcgagca 4560 cgaaagagcc cggaatgtca agatataaca tccgtgccat ttcagcttga ggaatcagcg 4620 gtctatcggt gaactgttga accatttgtt ggacggtgtc gcaaatagag ccccagcgca 4680 ctcggtcaaa agggggatcg aatacccctc ctatctccaa gggcgctata gctaatttaa 4740 aactcgcgag agatccgtca atggcaactc cgtctgccgg ctcctgcacc tgaaggctag 4800 cagcctccac ctcgtcttct aaggattgat ctatgatcca ttggaaagac gggacctggc 4860 gaacgaaatc atcatcccag gttttcgaag acatcttggt gatagtagaa agaacaagca 4920 cacaacaaca acaaggtcag atgtgtgttg cgggtaccga gctcgaattc tcgaggtcct 4980 ctccaaatga aatgaacttc cttatataga ggaagggtct tgcgaaggat agtgggattg 5040 tgcgtcatcc cttacgtcag tggagatatc acatcaatcc acttgctttg aagacgtggt 5100 tggaacgtct tctttttcca cgatgttcct cgtgggtggg ggtccatctt tgggaccact 5160 gtcggtagag gcattcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 5220 agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 5280 cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 5340 agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgacct 5400 gcaggcagca agcttgcatg cctgcaggtc gactctagag gatccccggt cactggattt 5460 tggttttagg aattagaaat tttattgata gaagtatttt acaaatacaa atacatacta 5520 agggtttctt atatgctcaa cacatgagcg aaaccctata agaaccctaa ttcccttatc 5580 tgggaactac tcacacatta ttctggagaa aatagagaga gatagatttg tagagagaga 5640 ctggtgattt gcggactcta gaggatcccc gggtaccgag ctcgaattct cgagcagagg 5700 tctcacacag agacaagcgc atcacttaac acaattaaag atcaaatcac cagcgagctc 5760 gccgttaaag caatactcaa aggacttctt gtgtcgtgtt aaggcaacca aacagtactc 5820 ctcatgttta aacaaatcac atttggtcga cttaagccga accaaagtga cgttgtcaac 5880 agagatccct tgcgcttcgt gtactgtttt tatgtgtcca tcaatccagt ccttgctcac 5940 gggaaaatcc ttagccctcg tttgaagggc cgctttatca gcttgagtca tcgtaagata 6000 cgttctgttc ggatcaatag tgacctgcaa accagaagta atacgacgct tcgtgagact 6060 tctagaaact ttggactcag atgtccagga ttgatacttc gtgtccctat taccgcattt 6120 acgcttcagc agattaacag cagcgataac atcttgcgga caccggtaag tcttgtgaac 6180 aacgtcacgg cgatcatatt gcagattacc gtggagcaat ttaaaacccg cgtcacgaga 6240 cttgaacgaa atctgctctg tgtccccaaa ggcaagaact tgtgaacatt tagacagagc 6300 agccaccacc aggagttgac cataatgtag taaaccagcc tcatcaacaa gcagcctatg 6360 acaggacggt acaccgtgca tgatcgcaga atccgcggtg cgcacaacgt ccaaagctac 6420 cttggaatta taagtgtcag ggaataaagc catcctgacg tcctcggccg atttacgatt 6480 cgccgtcaca attaggtcct ctcccatacg gaatgcatct tttatggcag tggttttacc 6540 gcatcccgca actccatcaa ccatggaaat atcgcatgta gggacagaaa ctttggcgct 6600 agcttctgca atgtccctca agttagagca tgcacatgtt ttatcaacaa tgtacgtttc 6660 atctgcgtgc ttcggaccta aaccatgctc attatatcca acagtgtaat cgtatttttt 6720 aggatacaac cagttaccgt tggccaaatg gacattcacc atatcgtcta tgcgatggta 6780 ggtctcaaag atgctcttat ttgcgatctc acttccgcga ccgccggaaa tgtcccatag 6840 gtgacgaaga ttagactcgg agttgttatg taatctctta caataacgca caaattcctt 6900 catggctccg tgtctagata tgccacgagg gtccgttggt acctcaacag acacctcggc 6960 atccgggacc acatcagtca ccggtttaac gtcatcactg acggactcag ggctcgaact 7020 ctcaggggca tcatgaaact cctcctgagg tatctcagca gctggcggga ctttcgcctt 7080 cttcttcgag cgcttggtct tggctgtctg cacttcatgc tccagccggt cgaataagtc 7140 ctcttcagtc caaaacgttc tcaaacgtga tatcggtaca gaatcttgct caaattcttc 7200 aacgtttgag agacgagtca gaaacttaaa actgtccgca taagaatcca gacgtagtag 7260 gggaaatctg ctagccaatg ttctcagcca tcctactttc gccctggatg aatctccacc 7320 ccaccaaaac ctagttttga agtgatggca ccaacctttc cattccatcc catcgcggag 7380 ggccgtaagc ttttcgtact tttgatacag attcaaagtc aaagcaaagg ccactagatg 7440 ataatcttca atgtctaagc gctcaccagc catgatagcc tgaccgttaa taataacagt 7500 cgacgacttg gcggataaga tagatgcgac agctttcatg ttctcagtcc attctttact 7560 ttccttgaaa catctgaaag ctatctcctc tacctctctc actgtggttt tggcgacgcg 7620 cacacatttc cagcgattga gactccagtc ttcaggtatt gagaccccta cgtacttaga 7680 tatgtcttca aaccatacac agtgacgtag tgtctcccgg gggcagcgta aatttgtagc 7740 gatgatctta taggtcatga tgttacattt cagcatttcg cgctccaaca gataggtggt 7800 tccatcgatg caatgcaccg actcggtgaa aaatgagccc aaatcttgcc atccgtggat 7860 gtaagataat gtgctttcat tttcaaaatc gaatttgatc acctcatccg cgcctgaccc 7920 gtcacgttgc cagtgacatt taagcaaggg aagaaaaccc tcgcggtcaa acaacatggc 7980 gccgtcgaac ataacggtac cacgtagtac gcgtactcca tgcgaatgca tggcgtcaca 8040 cagaccttgg aagcccatat cataaccgcc gtggatacag atagcccaat cagcttggac 8100 atcacaatct tgagctcggt taagacaaaa gttcgggact tcatcgaaat catcgctttc 8160 ttgcaaaatt tttcgcatgc ggcacatcct ctcctcatgt cgggcagcgt ctctaacacc 8220 caacacagga caacaactgt gcaccctttt atcccttctt gaaaagtgat gccaccaaga 8280 ccctccgaaa tctataacgg ggtcttcagg gggaaaactg tcgagacagt cataatgctc 8340 cgctacacgc agagcaccag ccaggctatg gggcgcatga tactgctgag tcaaatttaa 8400 gtcaaaggca ccaccataac ggtcacggaa ggcgtcagcc tcctcaatag agagcttatt 8460 gcgaacgttg attttcttag accttttcgc gtattcaatc tgcgcagata actgttgcgc 8520 aacctgattg tctacgatgt cttgggcact ctggctgtca gcacccttct cagcaatcaa 8580 cttcagcaaa tcgatagaac ttgacatttt gttggtgaaa aacaaagaac aagtagcaga 8640 accgtggtcg aggtcctctc caaatgaaat gaacttcctt atatagagga agggtcttgc 8700 gaaggatagt gggattgtgc gtcatccctt acgtcagtgg agatatcaca tcaatccact 8760 tgctttgaag acgtggttgg aacgtcttct ttttccacga tgttcctcgt gggtgggggt 8820 ccatctttgg gaccactgtc ggtagaggca ttcttgaacg atagcctttc ctttatcgca 8880 atgatggcat ttgtagaagc catcttcctt ttctactgtc ctttcgatga agtgacagat 8940 agctgggcaa tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat 9000 agccctctgg tcttctgaga ctgtatcttt gatattcttg gagtagacga gagtgtcgtg 9060 ctccaccatg ttgaccgggt ggtcagtccc ttatgttacg tcctgtagaa accccaaccc 9120 gtgaaatcaa aaaactcgac ggcctgtggg cattcagtct ggatcgcgaa aactgtggaa 9180 ttgatcagcg ttggtgggaa agcgcgttac aagaaagccg ggcaattgct gtgccaggca 9240 gttttaacga tcagttcgcc gatgcagata ttcgtaatta tgcgggcaac gtctggtatc 9300 agcgcgaagt ctttataccg aaaggttggg caggccagcg tatcgtgctg cgtttcgatg 9360 cggtcactca ttacggcaaa gtgtgggtca ataatcagga agtgatggag catcagggcg 9420 gctatacgcc atttgaagcc gatgtcacgc cgtatgttat tgccgggaaa agtgtacaat 9480 tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 9540 cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 9600 cgcccttccc aacagttgcg cagcctgaat ggcgaatgnn nnnnnaattc agtacattaa 9660 aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat 9720 cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga 9780 tacaggcagc ccatcagnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9840 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9900 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9960 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10020 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10080 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10140 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10200 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10240 7 10272 DNA Brome mosaic virus unsure (307)..(330) 24 nucleotides which are unknown. 7 aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60 agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120 gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180 aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240 tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300 aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840 cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140 nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380 tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440 tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500 ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560 gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620 cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680 ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740 ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800 ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980 cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgctgcc 2100 tgcaggtcaa catggtggag cacgacactc tcgtctactc caagaatatc aaagatacag 2160 tctcagaaga ccagagggct attgagactt ttcaacaaag ggtaatatcg ggaaacctcc 2220 tcggattcca ttgcccagct atctgtcact tcatcgaaag gacagtagaa aaggaagatg 2280 gcttctacaa atgccatcat tgcgataaag gaaaggctat cgttcaagaa tgcctctacc 2340 gacagtggtc ccaaagatgg acccccaccc acgaggaaca tcgtggaaaa agaagacgtt 2400 ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac 2460 gcacaatccc actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg 2520 gagaggacct cgagaattcg agctcggtac ccgcaacaca catctgacct tgttgttgtt 2580 gtgtgcttgt tctttctact atcaccaaga tgtcttcgaa aacctgggat gatgatttcg 2640 ttcgccaggt cccgtctttc caatggatca tagatcaatc cttagaagac gaggtggagg 2700 ctgctagcct tcaggtgcag gagccggcag acggagttgc cattgacgga tctctcgcga 2760 gttttaaatt agctatagcg cccttggaga taggaggggt attcgatccc ccttttgacc 2820 gagtgcgctg gggctctatt tgcgacaccg tccaacaaat ggttcaacag ttcaccgata 2880 gaccgctgat tcctcaagct gaaatggcac ggatgttata tcttgacatt ccgggctctt 2940 tcgtgctcga agatgaaatt gatgactggt atcccgagga tactagtgat ggttacggtg 3000 tatcgtttgc cgccgatgaa gatcatgcga gcgatctaaa actcgccagt gattcctcga 3060 actgtgaaat tgaggaagtt cgtgttactg gagatacccc caaggagctg acccttggag 3120 ataggtacat gggcattgat gaagagtttc agactactaa tactgattac gacatcactc 3180 ttcaaatcat gaaccctatt gaacataggg tttcgcgtgt tattgataca cactgccatc 3240 cagataaccc tgacatctct actgggccaa tttatatgga gagagtcagc cttgctagaa 3300 cagaagcgac cagtcattcc atactgccaa cccatgctta tttcgatgat tcgtaccatc 3360 aagcccttgt tgaaaatggt gattattcca tggactttga taggatcaga cttaagcaaa 3420 gtgatgtaga ctggtatagg gaccccgata aatattttca accaaaaatg aatatcggga 3480 gtgctcagcg aagagttggt actcagaaag aagtcttaac cgcactcaaa aagcgaaacg 3540 cggacgttcc agaaatggga gacgcgatta acatgaagga cactgcgaaa gctatagcaa 3600 agcgctttcg tagcacattc cttaatgttg acggtgaaga ctgtctgaga gcttctatgg 3660 atgtcatgac taaatgtctt gagtaccata agaagtgggg taagcacatg gacttgcaag 3720 gtgtgaatgt ggcagcagag actgatttat gtcggtacca gcatatgctg aagtctgacg 3780 taaaacctgt tgtaactgac acccttcact tggaacgagc agtagcagct actataacat 3840 ttcatagtaa aggtgtgact agtaattttt cacccttttt cactgcttgt ttcgagaagt 3900 tatcactggc cctgaaatcc aggttcattg tgcctatcgg aaagatatcc tctctggagc 3960 ttaagaatgt ccgcttgaat aacagatact ttcttgaagc ggacctaagc aaatttgata 4020 aatctcaggg tgagctgcac ctagagtttc agagagagat actccttgcg ctgggctttc 4080 cagcgccgct gacgaattgg tggtctgatt ttcatcgcga ttcttattta tcagaccctc 4140 atgccaaggt gggaatgtcc gtttccttcc aacgcagaac tggtgacgcg tttacatatt 4200 tcggtaatac tcttgtcact atggctatga ttgcatatgc ctctgatcta agtgactgtg 4260 actgtgcaat attttcagga gatgattctt taatcatctc taaagttaag ccagtcctgg 4320 ataccgatat gtttacgtct ctcttcaata tggagataaa agtcatggac cctagtgtgc 4380 cctacgtttg tagtaagttt ctcgtcgaaa ctgaaatggg caatttggtg tctgtaccag 4440 atcctctgag agagatccag cgcttagcta agcgaaagat tctgcgtgat gaacagatgc 4500 tcagagcaca tttcgtttcc ttctgtgatc gaatgaagtt tattaatcaa cttgatgaga 4560 agatgattac gacgctctgt cattttgttt atctgaaata tgggaaagaa aaaccttgga 4620 ttttcgagga ggttagagct gctcttgcgg ctttttcttt atactccgag aatttcctga 4680 ggttctctga ttgctactgt accgaaggca tcagagttta tcagatgagc gatcctgtat 4740 gtaagttcaa acgcaccacg gaagagcgta aaactgatgg tgactggttt cacaactgga 4800 agaatccaaa gtttcctggt gtgttagaca aagtctacag aaccattgga atttattcct 4860 cggactgtag tactaaggag ctccctgtca aacggatcgg acgtttacat gaggcccttg 4920 agcgtgagtc actcaaatta gctaatgatc gtaggaccac acaacgcttg aaaaagaagg 4980 tcgacgatta cgctaccggt agaggaggcc taacgtcagt tgatgctttg ctcgtgaagt 5040 cccattgtga gacttttaag ccctctgatc tgagatgatc ggttctatga tatatgaacc 5100 taagctgtga acagcccttt ggttaaggtt aaaaactcct ggtcaggcag accactttgg 5160 ctaagtttaa aagctgggga tcctctagag tccgcaaatc accagtctct ctctacaaat 5220 ctatctctct ctattttctc cagaataatg tgtgagtagt tcccagataa gggaattagg 5280 gttcttatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta 5340 tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtgacctg 5400 caggcatgca agcttgcatg cctgcaggtc gactctagag gatccccggt caacatggtg 5460 gagcacgaca ctctcgtcta ctccaagaat atcaaagata cagtctcaga agaccagagg 5520 gctattgaga cttttcaaca aagggtaata tcgggaaacc tcctcggatt ccattgccca 5580 gctatctgtc acttcatcga aaggacagta gaaaaggaag atggcttcta caaatgccat 5640 cattgcgata aaggaaaggc tatcgttcaa gaatgcctct accgacagtg gtcccaaaga 5700 tggaccccca cccacgagga acatcgtgga aaaagaagac gttccaacca cgtcttcaaa 5760 gcaagtggat tgatgtgata tctccactga cgtaagggat gacgcacaat cccactatcc 5820 ttcgcaagac ccttcctcta tataaggaag ttcatttcat ttggagagga cctcgaccac 5880 ggttctgcta cttgttcttt gtttttcacc aacaaaatgt caagttctat cgatttgctg 5940 aagttgattg ctgagaaggg tgctgacagc cagagtgccc aagacatcgt agacaatcag 6000 gttgcgcaac agttatctgc gcagattgaa tacgcgaaaa ggtctaagaa aatcaacgtt 6060 cgcaataagc tctctattga ggaggctgac gccttccgtg accgttatgg tggtgccttt 6120 gacttaaatt tgactcagca gtatcatgcg ccccatagcc tggctggtgc tctgcgtgta 6180 gcggagcatt atgactgtct cgacagtttt ccccctgaag accccgttat agatttcgga 6240 gggtcttggt ggcatcactt ttcaagaagg gataaaaggg tgcacagttg ttgtcctgtg 6300 ttgggtgtta gagacgctgc ccgacatgag gagaggatgt gccgcatgcg aaaaattttg 6360 caagaaagcg atgatttcga tgaagtcccg aacttttgtc ttaaccgagc tcaagattgt 6420 gatgtccaag ctgattgggc tatctgtatc cacggcggtt atgatatggg cttccaaggt 6480 ctgtgtgacg ccatgcattc gcatggagta cgcgtactac gtggtaccgt tatgttcgac 6540 ggcgccatgt tgtttgaccg cgagggtttt cttcccttgc ttaaatgtca ctggcaacgt 6600 gacgggtcag gcgcggatga ggtgatcaaa ttcgattttg aaaatgaaag cacattatct 6660 tacatccacg gatggcaaga tttgggctca tttttcaccg agtcggtgca ttgcatcgat 6720 ggaaccacct atctgttgga gcgcgaaatg ctgaaatgta acatcatgac ctataagatc 6780 atcgctacaa atttacgctg cccccgggag acactacgtc actgtgtatg gtttgaagac 6840 atatctaagt acgtaggggt ctcaatacct gaagactgga gtctcaatcg ctggaaatgt 6900 gtgcgcgtcg ccaaaaccac agtgagagag gtagaggaga tagctttcag atgtttcaag 6960 gaaagtaaag aatggactga gaacatgaaa gctgtcgcat ctatcttatc cgccaagtcg 7020 tcgactgtta ttattaacgg tcaggctatc atggctggtg agcgcttaga cattgaagat 7080 tatcatctag tggcctttgc tttgactttg aatctgtatc aaaagtacga aaagcttacg 7140 gccctccgcg atgggatgga atggaaaggt tggtgccatc acttcaaaac taggttttgg 7200 tggggtggag attcatccag ggcgaaagta ggatggctga gaacattggc tagcagattt 7260 cccctactac gtctggattc ttatgcggac agttttaagt ttctgactcg tctctcaaac 7320 gttgaagaat ttgagcaaga ttctgtaccg atatcacgtt tgagaacgtt ttggactgaa 7380 gaggacttat tcgaccggct ggagcatgaa gtgcagacag ccaagaccaa gcgctcgaag 7440 aagaaggcga aagtcccgcc agctgctgag atacctcagg aggagtttca tgatgcccct 7500 gagagttcga gccctgagtc cgtcagtgat gacgttaaac cggtgactga tgtggtcccg 7560 gatgccgagg tgtctgttga ggtaccaacg gaccctcgtg gcatatctag acacggagcc 7620 atgaaggaat ttgtgcgtta ttgtaagaga ttacataaca actccgagtc taatcttcgt 7680 cacctatggg acatttccgg cggtcgcgga agtgagatcg caaataagag catctttgag 7740 acctaccatc gcatagacga tatggtgaat gtccatttgg ccaacggtaa ctggttgtat 7800 cctaaaaaat acgattacac tgttggatat aatgagcatg gtttaggtcc gaagcacgca 7860 gatgaaacgt acattgttga taaaacatgt gcatgctcta acttgaggga cattgcagaa 7920 gctagcgcca aagtttctgt ccctacatgc gatatttcca tggttgatgg agttgcggga 7980 tgcggtaaaa ccactgccat aaaagatgca ttccgtatgg gagaggacct aattgtgacg 8040 gcgaatcgta aatcggccga ggacgtcagg atggctttat tccctgacac ttataattcc 8100 aaggtagctt tggacgttgt gcgcaccgcg gattctgcga tcatgcacgg tgtaccgtcc 8160 tgtcataggc tgcttgttga tgaggctggt ttactacatt atggtcaact cctggtggtg 8220 gctgctctgt ctaaatgttc acaagttctt gcctttgggg acacagagca gatttcgttc 8280 aagtctcgtg acgcgggttt taaattgctc cacggtaatc tgcaatatga tcgccgtgac 8340 gttgttcaca agacttaccg gtgtccgcaa gatgttatcg ctgctgttaa tctgctgaag 8400 cgtaaatgcg gtaataggga cacgaagtat caatcctgga catctgagtc caaagtttct 8460 agaagtctca cgaagcgtcg tattacttct ggtttgcagg tcactattga tccgaacaga 8520 acgtatctta cgatgactca agctgataaa gcggcccttc aaacgagggc taaggatttt 8580 cccgtgagca aggactggat tgatggacac ataaaaacag tacacgaagc gcaagggatc 8640 tctgttgaca acgtcacttt ggttcggctt aagtcgacca aatgtgattt gtttaaacat 8700 gaggagtact gtttggttgc cttaacacga cacaagaagt cctttgagta ttgctttaac 8760 ggcgagctcg ctggtgattt gatctttaat tgtgttaagt gatgcgcttg tctctgtgtg 8820 agacctctgc tcgagaattc gagctcggta cccggggatc ctctagagtc cgcaaatcac 8880 cagtctctct ctacaaatct atctctctct attttctcca gaataatgtg tgagtagttc 8940 ccagataagg gaattagggt tcttataggg tttcgctcat gtgttgagca tataagaaac 9000 ccttagtatg tatttgtatt tgtaaaatac ttctatcaat aaaatttcta attcctaaaa 9060 ccaaaatcca gtgaccgggt ggtcagtccc ttatgttacg tcctgtagaa accccaaccc 9120 gtgaaatcaa aaaactcgac ggcctgtggg cattcagtct ggatcgcgaa aactgtggaa 9180 ttgatcagcg ttggtgggaa agcgcgttac aagaaagccg ggcaattgct gtgccaggca 9240 gttttaacga tcagttcgcc gatgcagata ttcgtaatta tgcgggcaac gtctggtatc 9300 agcgcgaagt ctttataccg aaaggttggg caggccagcg tatcgtgctg cgtttcgatg 9360 cggtcactca ttacggcaaa gtgtgggtca ataatcagga agtgatggag catcagggcg 9420 gctatacgcc atttgaagcc gatgtcacgc cgtatgttat tgccgggaaa agtgtacaat 9480 tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 9540 cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 9600 cgcccttccc aacagttgcg cagcctgaat ggcgaatgnn nnnnnaattc agtacattaa 9660 aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat 9720 cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga 9780 tacaggcagc ccatcagnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9840 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9900 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9960 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10020 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10080 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10140 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10200 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10260 nnnnnnnnnn nn 10272 8 10166 DNA Brome mosaic virus unsure (307)..(330) 24 nucleotides which are unknown. 8 aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag cggagaatta 60 agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac gtttggaact 120 gacagaaccg caacgattga aggagccact cagccgcggg tttctggagt ttaatgagct 180 aagcacatac gtcagaaacc attattgcgc gttcaaaagt cgcctaaggt cactatcagc 240 tagcaaatat ttcttgtcaa aaatgctcca ctgacgttcc ataaattccc ctcggtatcc 300 aattagnnnn nnnnnnnnnn nnnnnnnnnn gatcgtttcg catgattgaa caagatggat 360 tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac 420 agacaatcgg ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 480 tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc 540 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag 600 cgggaaggga ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc 660 ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg 720 atccggctac ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc 780 ggatggaagc cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 840 cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga 900 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca 960 tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg 1020 atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg 1080 ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgannnn 1140 nnnnnnnnnn nnnnnnnnnn gatcgttcaa acatttggca ataaagtttc ttaagattga 1200 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg 1260 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc 1320 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat 1380 tatcgcgcgc ggtgtcatct atgttactag atcgggcctc ctgtcaatgc tggcggcggc 1440 tctggtggtg gttctggtgg cggctctgag ggtggtggct ctgagggtgg cggttctgag 1500 ggtggcggct ctgagggagg cggttccggt ggtggctctg gttccggtga ttttgattat 1560 gaaaagatgg caaacgctaa taagggggct atgaccgaaa atgccgatga aaacgcgcta 1620 cagtctgacg ctaaaggcaa acttgattct gtcgctactg attacggtgc tgctatcgat 1680 ggtttcattg gtgacgtttc cggccttgct aatggtaatg gtgctactgg tgattttgct 1740 ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt aatgaataat 1800 ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt tgtctttggc 1860 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 1920 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact 1980 cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg 2040 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcttgctgcc 2100 tgcaggtcaa catggtggag cacgacactc tcgtctactc caagaatatc aaagatacag 2160 tctcagaaga ccagagggct attgagactt ttcaacaaag ggtaatatcg ggaaacctcc 2220 tcggattcca ttgcccagct atctgtcact tcatcgaaag gacagtagaa aaggaagatg 2280 gcttctacaa atgccatcat tgcgataaag gaaaggctat cgttcaagaa tgcctctacc 2340 gacagtggtc ccaaagatgg acccccaccc acgaggaaca tcgtggaaaa agaagacgtt 2400 ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac 2460 gcacaatccc actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg 2520 gagaggacct cgagaattcg agctcggtac ccgcaacaca catctgacct tgttgttgtt 2580 gtgtgcttgt tctttctact atcaccaaga tgtcttcgaa aacctgggat gatgatttcg 2640 ttcgccaggt cccgtctttc caatggatca tagatcaatc cttagaagac gaggtggagg 2700 ctgctagcct tcaggtgcag gagccggcag acggagttgc cattgacgga tctctcgcga 2760 gttttaaatt agctatagcg cccttggaga taggaggggt attcgatccc ccttttgacc 2820 gagtgcgctg gggctctatt tgcgacaccg tccaacaaat ggttcaacag ttcaccgata 2880 gaccgctgat tcctcaagct gaaatggcac ggatgttata tcttgacatt ccgggctctt 2940 tcgtgctcga agatgaaatt gatgactggt atcccgagga tactagtgat ggttacggtg 3000 tatcgtttgc cgccgatgaa gatcatgcga gcgatctaaa actcgccagt gattcctcga 3060 actgtgaaat tgaggaagtt cgtgttactg gagatacccc caaggagctg acccttggag 3120 ataggtacat gggcattgat gaagagtttc agactactaa tactgattac gacatcactc 3180 ttcaaatcat gaaccctatt gaacataggg tttcgcgtgt tattgataca cactgccatc 3240 cagataaccc tgacatctct actgggccaa tttatatgga gagagtcagc cttgctagaa 3300 cagaagcgac cagtcattcc atactgccaa cccatgctta tttcgatgat tcgtaccatc 3360 aagcccttgt tgaaaatggt gattattcca tggactttga taggatcaga cttaagcaaa 3420 gtgatgtaga ctggtatagg gaccccgata aatattttca accaaaaatg aatatcggga 3480 gtgctcagcg aagagttggt actcagaaag aagtcttaac cgcactcaaa aagcgaaacg 3540 cggacgttcc agaaatggga gacgcgatta acatgaagga cactgcgaaa gctatagcaa 3600 agcgctttcg tagcacattc cttaatgttg acggtgaaga ctgtctgaga gcttctatgg 3660 atgtcatgac taaatgtctt gagtaccata agaagtgggg taagcacatg gacttgcaag 3720 gtgtgaatgt ggcagcagag actgatttat gtcggtacca gcatatgctg aagtctgacg 3780 taaaacctgt tgtaactgac acccttcact tggaacgagc agtagcagct actataacat 3840 ttcatagtaa aggtgtgact agtaattttt cacccttttt cactgcttgt ttcgagaagt 3900 tatcactggc cctgaaatcc aggttcattg tgcctatcgg aaagatatcc tctctggagc 3960 ttaagaatgt ccgcttgaat aacagatact ttcttgaagc ggacctaagc aaatttgata 4020 aatctcaggg tgagctgcac ctagagtttc agagagagat actccttgcg ctgggctttc 4080 cagcgccgct gacgaattgg tggtctgatt ttcatcgcga ttcttattta tcagaccctc 4140 atgccaaggt gggaatgtcc gtttccttcc aacgcagaac tggtgacgcg tttacatatt 4200 tcggtaatac tcttgtcact atggctatga ttgcatatgc ctctgatcta agtgactgtg 4260 actgtgcaat attttcagga gatgattctt taatcatctc taaagttaag ccagtcctgg 4320 ataccgatat gtttacgtct ctcttcaata tggagataaa agtcatggac cctagtgtgc 4380 cctacgtttg tagtaagttt ctcgtcgaaa ctgaaatggg caatttggtg tctgtaccag 4440 atcctctgag agagatccag cgcttagcta agcgaaagat tctgcgtgat gaacagatgc 4500 tcagagcaca tttcgtttcc ttctgtgatc gaatgaagtt tattaatcaa cttgatgaga 4560 agatgattac gacgctctgt cattttgttt atctgaaata tgggaaagaa aaaccttgga 4620 ttttcgagga ggttagagct gctcttgcgg ctttttcttt atactccgag aatttcctga 4680 ggttctctga ttgctactgt accgaaggca tcagagttta tcagatgagc gatcctgtat 4740 gtaagttcaa acgcaccacg gaagagcgta aaactgatgg tgactggttt cacaactgga 4800 agaatccaaa gtttcctggt gtgttagaca aagtctacag aaccattgga atttattcct 4860 cggactgtag tactaaggag ctccctgtca aacggatcgg acgtttacat gaggcccttg 4920 agcgtgagtc actcaaatta gctaatgatc gtaggaccac acaacgcttg aaaaagaagg 4980 tcgacgatta cgctaccggt agaggaggcc taacgtcagt tgatgctttg ctcgtgaagt 5040 cccattgtga gacttttaag ccctctgatc tgagatgatc ggttctatga tatatgaacc 5100 taagctgtga acagcccttt ggttaaggtt aaaaactcct ggtcaggcag accactttgg 5160 ctaagtttaa aagctgggga tcctctagag tccgcaaatc accagtctct ctctacaaat 5220 ctatctctct ctattttctc cagaataatg tgtgagtagt tcccagataa gggaattagg 5280 gttcttatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta 5340 tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtgacctg 5400 caggcatgca agcttgcatg cctgcaggtc gactctagag gatccccggt cactggattt 5460 tggttttagg aattagaaat tttattgata gaagtatttt acaaatacaa atacatacta 5520 agggtttctt atatgctcaa cacatgagcg aaaccctata agaaccctaa ttcccttatc 5580 tgggaactac tcacacatta ttctggagaa aatagagaga gatagatttg tagagagaga 5640 ctggtgattt gcggactcta gaggatcccc gggtaccgag ctcgaattct cgagcagagg 5700 tctcacacag agacaagcgc atcacttaac acaattaaag atcaaatcac cagcgagctc 5760 gccgttaaag caatactcaa aggacttctt gtgtcgtgtt aaggcaacca aacagtactc 5820 ctcatgttta aacaaatcac atttggtcga cttaagccga accaaagtga cgttgtcaac 5880 agagatccct tgcgcttcgt gtactgtttt tatgtgtcca tcaatccagt ccttgctcac 5940 gggaaaatcc ttagccctcg tttgaagggc cgctttatca gcttgagtca tcgtaagata 6000 cgttctgttc ggatcaatag tgacctgcaa accagaagta atacgacgct tcgtgagact 6060 tctagaaact ttggactcag atgtccagga ttgatacttc gtgtccctat taccgcattt 6120 acgcttcagc agattaacag cagcgataac atcttgcgga caccggtaag tcttgtgaac 6180 aacgtcacgg cgatcatatt gcagattacc gtggagcaat ttaaaacccg cgtcacgaga 6240 cttgaacgaa atctgctctg tgtccccaaa ggcaagaact tgtgaacatt tagacagagc 6300 agccaccacc aggagttgac cataatgtag taaaccagcc tcatcaacaa gcagcctatg 6360 acaggacggt acaccgtgca tgatcgcaga atccgcggtg cgcacaacgt ccaaagctac 6420 cttggaatta taagtgtcag ggaataaagc catcctgacg tcctcggccg atttacgatt 6480 cgccgtcaca attaggtcct ctcccatacg gaatgcatct tttatggcag tggttttacc 6540 gcatcccgca actccatcaa ccatggaaat atcgcatgta gggacagaaa ctttggcgct 6600 agcttctgca atgtccctca agttagagca tgcacatgtt ttatcaacaa tgtacgtttc 6660 atctgcgtgc ttcggaccta aaccatgctc attatatcca acagtgtaat cgtatttttt 6720 aggatacaac cagttaccgt tggccaaatg gacattcacc atatcgtcta tgcgatggta 6780 ggtctcaaag atgctcttat ttgcgatctc acttccgcga ccgccggaaa tgtcccatag 6840 gtgacgaaga ttagactcgg agttgttatg taatctctta caataacgca caaattcctt 6900 catggctccg tgtctagata tgccacgagg gtccgttggt acctcaacag acacctcggc 6960 atccgggacc acatcagtca ccggtttaac gtcatcactg acggactcag ggctcgaact 7020 ctcaggggca tcatgaaact cctcctgagg tatctcagca gctggcggga ctttcgcctt 7080 cttcttcgag cgcttggtct tggctgtctg cacttcatgc tccagccggt cgaataagtc 7140 ctcttcagtc caaaacgttc tcaaacgtga tatcggtaca gaatcttgct caaattcttc 7200 aacgtttgag agacgagtca gaaacttaaa actgtccgca taagaatcca gacgtagtag 7260 gggaaatctg ctagccaatg ttctcagcca tcctactttc gccctggatg aatctccacc 7320 ccaccaaaac ctagttttga agtgatggca ccaacctttc cattccatcc catcgcggag 7380 ggccgtaagc ttttcgtact tttgatacag attcaaagtc aaagcaaagg ccactagatg 7440 ataatcttca atgtctaagc gctcaccagc catgatagcc tgaccgttaa taataacagt 7500 cgacgacttg gcggataaga tagatgcgac agctttcatg ttctcagtcc attctttact 7560 ttccttgaaa catctgaaag ctatctcctc tacctctctc actgtggttt tggcgacgcg 7620 cacacatttc cagcgattga gactccagtc ttcaggtatt gagaccccta cgtacttaga 7680 tatgtcttca aaccatacac agtgacgtag tgtctcccgg gggcagcgta aatttgtagc 7740 gatgatctta taggtcatga tgttacattt cagcatttcg cgctccaaca gataggtggt 7800 tccatcgatg caatgcaccg actcggtgaa aaatgagccc aaatcttgcc atccgtggat 7860 gtaagataat gtgctttcat tttcaaaatc gaatttgatc acctcatccg cgcctgaccc 7920 gtcacgttgc cagtgacatt taagcaaggg aagaaaaccc tcgcggtcaa acaacatggc 7980 gccgtcgaac ataacggtac cacgtagtac gcgtactcca tgcgaatgca tggcgtcaca 8040 cagaccttgg aagcccatat cataaccgcc gtggatacag atagcccaat cagcttggac 8100 atcacaatct tgagctcggt taagacaaaa gttcgggact tcatcgaaat catcgctttc 8160 ttgcaaaatt tttcgcatgc ggcacatcct ctcctcatgt cgggcagcgt ctctaacacc 8220 caacacagga caacaactgt gcaccctttt atcccttctt gaaaagtgat gccaccaaga 8280 ccctccgaaa tctataacgg ggtcttcagg gggaaaactg tcgagacagt cataatgctc 8340 cgctacacgc agagcaccag ccaggctatg gggcgcatga tactgctgag tcaaatttaa 8400 gtcaaaggca ccaccataac ggtcacggaa ggcgtcagcc tcctcaatag agagcttatt 8460 gcgaacgttg attttcttag accttttcgc gtattcaatc tgcgcagata actgttgcgc 8520 aacctgattg tctacgatgt cttgggcact ctggctgtca gcacccttct cagcaatcaa 8580 cttcagcaaa tcgatagaac ttgacatttt gttggtgaaa aacaaagaac aagtagcaga 8640 accgtggtcg aggtcctctc caaatgaaat gaacttcctt atatagagga agggtcttgc 8700 gaaggatagt gggattgtgc gtcatccctt acgtcagtgg agatatcaca tcaatccact 8760 tgctttgaag acgtggttgg aacgtcttct ttttccacga tgttcctcgt gggtgggggt 8820 ccatctttgg gaccactgtc ggtagaggca ttcttgaacg atagcctttc ctttatcgca 8880 atgatggcat ttgtagaagc catcttcctt ttctactgtc ctttcgatga agtgacagat 8940 agctgggcaa tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat 9000 agccctctgg tcttctgaga ctgtatcttt gatattcttg gagtagacga gagtgtcgtg 9060 ctccaccatg ttgaccgggt ggtcagtccc ttatgttacg tcctgtagaa accccaaccc 9120 gtgaaatcaa aaaactcgac ggcctgtggg cattcagtct ggatcgcgaa aactgtggaa 9180 ttgatcagcg ttggtgggaa agcgcgttac aagaaagccg ggcaattgct gtgccaggca 9240 gttttaacga tcagttcgcc gatgcagata ttcgtaatta tgcgggcaac gtctggtatc 9300 agcgcgaagt ctttataccg aaaggttggg caggccagcg tatcgtgctg cgtttcgatg 9360 cggtcactca ttacggcaaa gtgtgggtca ataatcagga agtgatggag catcagggcg 9420 gctatacgcc atttgaagcc gatgtcacgc cgtatgttat tgccgggaaa agtgtacaat 9480 tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 9540 cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat 9600 cgcccttccc aacagttgcg cagcctgaat ggcgaatgnn nnnnnaattc agtacattaa 9660 aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat 9720 cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga 9780 tacaggcagc ccatcagnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9840 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9900 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 9960 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10020 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10080 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 10140 nnnnnnnnnn nnnnnnnnnn nnnnnn 10166
Claims (30)
1. A DNA-launching platform comprising:
a) a polynucleotide molecule encoding a modified viral RNA molecule; and
b) a DNA dependent RNA polymerase promoter.
2. The DNA-launching platform of claim 1 further comprising a sequence encoding at least one cis-acting element.
3. The DNA-launching platform of claim 1 further comprising a ribozyme sequence.
4. The DNA-launching platform of claim 1 further comprising a termination sequence.
5. The DNA-launching platform of claim 1 further comprising a restriction site.
6. The DNA-launching platform of claim 1 wherein said modified RNA molecule comprises an exogenous RNA segment.
7. The DNA-launching platform of claim 1 wherein said DNA dependent RNA polymerase promoter is capable of functioning in a plant cell.
8. A method of genotypically or phenotypically modifying one or more cells comprising the following steps:
a) obtaining a DNA-launching platform comprising a polynucleotide molecule encoding a modified viral RNA; and
b) transfecting said one or more cells with said DNA-launching platform, wherein said polynucleotide molecule is transcribed thereby forming a replicatable RNA transcript.
9. The method of claim 8 further comprising pre-transforming said cell with at least one polynucleotide molecule encoding at least one trans-acting factor.
10. The method of claim 8 further comprising introducing a trans-acting factor.
11. The method of claim 10 wherein said introducing a trans-acting factor comprises co-transfection of an expression plasmid comprising a nucleotide sequence encoding said trans-acting factor.
12. The method of claim 10 wherein said introducing a trans-acting factor comprises co-transfection of an RNA transcript encoding said trans-acting factor.
13. The method of claim 10 wherein said trans-acting factor is stably expressed.
14. The method of claim 8 wherein said modified viral RNA comprises an exogenous RNA segment.
15. The method of claim 8 wherein said DNA-launching platform comprises a ribozyme sequence.
16. The method of claim 8 wherein said DNA-launching platform comprises a promoter.
17. The method of claim 8 wherein said DNA-launching platform comprises a termination sequence.
18. The method of claim 8 wherein said DNA-launching platform comprises a restriction site.
19. The modified cell produced by the method of claim 8 .
20. A method of producing a plant or plant tissue comprising at least one genotypically or phenotypically modified cell, said method comprising transfecting cells of said plant or plant tissue with a DNA-launching platform, wherein said DNA-launching platform comprises a polynucleotide encoding a modified RNA molecule, such that said polynucleotide molecule is transcribed to form a replicatable RNA transcript.
21. The method of claim 20 wherein said modified RNA molecule comprises an exogenous RNA segment.
22. The method of claim 20 wherein said DNA-launching platform comprises a ribozyme sequence.
23. The method of claim 20 wherein said DNA-launching platform comprises a promoter.
24. The method of claim 20 wherein said DNA-launching platform comprises a termination sequence.
25. The method of claim 20 wherein said DNA-launching platform comprises a restriction site.
26. A method of producing a genotypically or phenotypically modified plant comprising obtaining at least one modified cell produced by the method of claim 8; and subjecting said modified cell to conditions whereby a plant is regenerated therefrom.
27. A plant produced by the method of claim 26 .
28. A plant descended from the plant of claim 27 .
29. The method of claim 20 , wherein said plant or plant tissue comprises one or more cells transformed with a polynucleotide molecule encoding at least one trans-acting factor, wherein said polynucleotide molecule is expressed.
30. The method of claim 29 , wherein said modified viral RNA molecule is capable of replication only in said one or more cells transformed with a polynucleotide molecule encoding at least one trans-acting factor.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/609,207 US20040045050A1 (en) | 1998-05-22 | 2003-06-26 | Methods and materials for transformation |
US11/621,850 US10308946B2 (en) | 1998-05-22 | 2007-01-10 | Expression cassette for transformation comprising a modified viral sequence driven by a suitable promoter |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US8652698P | 1998-05-22 | 1998-05-22 | |
US09/316,622 US20030074677A1 (en) | 1998-05-22 | 1999-05-21 | Improved materials and methods for transformation |
US10/609,207 US20040045050A1 (en) | 1998-05-22 | 2003-06-26 | Methods and materials for transformation |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/316,622 Continuation US20030074677A1 (en) | 1998-05-22 | 1999-05-21 | Improved materials and methods for transformation |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US11/621,850 Continuation US10308946B2 (en) | 1998-05-22 | 2007-01-10 | Expression cassette for transformation comprising a modified viral sequence driven by a suitable promoter |
Publications (1)
Publication Number | Publication Date |
---|---|
US20040045050A1 true US20040045050A1 (en) | 2004-03-04 |
Family
ID=26774844
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/316,622 Abandoned US20030074677A1 (en) | 1998-05-22 | 1999-05-21 | Improved materials and methods for transformation |
US10/609,207 Abandoned US20040045050A1 (en) | 1998-05-22 | 2003-06-26 | Methods and materials for transformation |
US11/621,850 Expired - Fee Related US10308946B2 (en) | 1998-05-22 | 2007-01-10 | Expression cassette for transformation comprising a modified viral sequence driven by a suitable promoter |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/316,622 Abandoned US20030074677A1 (en) | 1998-05-22 | 1999-05-21 | Improved materials and methods for transformation |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US11/621,850 Expired - Fee Related US10308946B2 (en) | 1998-05-22 | 2007-01-10 | Expression cassette for transformation comprising a modified viral sequence driven by a suitable promoter |
Country Status (1)
Country | Link |
---|---|
US (3) | US20030074677A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2004278624B2 (en) * | 2003-10-01 | 2008-03-20 | Japan Science And Technology Agency | DNA fragment, method for producing transformant for protein production and utilization thereof |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5418153A (en) * | 1992-04-28 | 1995-05-23 | Nihon Nohyaku Co., Ltd. | Process for production of exogenous gene or its product in plant cells |
US5500360A (en) * | 1985-03-07 | 1996-03-19 | Mycogen Plant Science, Inc. | RNA transformation vector |
US5817512A (en) * | 1993-07-01 | 1998-10-06 | The Uab Research Foundation | Encapsidated recombinant viral nucleic acid and methods of making and using same |
US5824856A (en) * | 1990-09-07 | 1998-10-20 | Nihon Nohyaku Co., Ltd. | Process for production of exogenous gene or its product in plant cells |
US5851767A (en) * | 1985-03-04 | 1998-12-22 | The Regents Of The University Of California | Detection of prokaryotic organism by DNA hybridization |
US5863716A (en) * | 1994-09-19 | 1999-01-26 | The Leland Stanford Junior University Board Of Trustees | Treatment of plasmodium |
US5877403A (en) * | 1994-12-30 | 1999-03-02 | Seminis Vegetable Seeds, Inc. | Papaya ringspot virus protease gene |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1990012107A1 (en) | 1989-03-31 | 1990-10-18 | The Salk Institute Biotechnology/Industrial Associates, Inc. | Recombinant expression system based on satellite tobacco mosaic virus |
US6093554A (en) * | 1989-10-03 | 2000-07-25 | Aveve N.V. | Genetics manipulations with recombinant DNA virus comprising sequences derived from RNA virus |
ATE234361T1 (en) * | 1992-12-30 | 2003-03-15 | Biosource Genetics Corp | VIRAL AMPLIFICATION OF RECOMBINANT MESSENGER RNA IN TRANSGENIC PLANTS |
CA2523216C (en) | 1993-09-15 | 2010-11-16 | Chiron Corporation | Recombinant alphavirus vectors |
US5591579A (en) * | 1993-12-21 | 1997-01-07 | Washington University | Indicator cell line for detecting RNA viruses and method therefor |
US5500300A (en) * | 1995-05-18 | 1996-03-19 | General Electric Company | Silicone fluids having chloroalkyl and epoxy groups and photocurable silicone coating compositions |
US5853716A (en) * | 1995-07-28 | 1998-12-29 | Yale University | Genetically engineered chimeric viruses for the treatment of diseases associated with viral transactivators |
-
1999
- 1999-05-21 US US09/316,622 patent/US20030074677A1/en not_active Abandoned
-
2003
- 2003-06-26 US US10/609,207 patent/US20040045050A1/en not_active Abandoned
-
2007
- 2007-01-10 US US11/621,850 patent/US10308946B2/en not_active Expired - Fee Related
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5851767A (en) * | 1985-03-04 | 1998-12-22 | The Regents Of The University Of California | Detection of prokaryotic organism by DNA hybridization |
US5500360A (en) * | 1985-03-07 | 1996-03-19 | Mycogen Plant Science, Inc. | RNA transformation vector |
US5824856A (en) * | 1990-09-07 | 1998-10-20 | Nihon Nohyaku Co., Ltd. | Process for production of exogenous gene or its product in plant cells |
US5418153A (en) * | 1992-04-28 | 1995-05-23 | Nihon Nohyaku Co., Ltd. | Process for production of exogenous gene or its product in plant cells |
US5817512A (en) * | 1993-07-01 | 1998-10-06 | The Uab Research Foundation | Encapsidated recombinant viral nucleic acid and methods of making and using same |
US5863716A (en) * | 1994-09-19 | 1999-01-26 | The Leland Stanford Junior University Board Of Trustees | Treatment of plasmodium |
US5877403A (en) * | 1994-12-30 | 1999-03-02 | Seminis Vegetable Seeds, Inc. | Papaya ringspot virus protease gene |
Also Published As
Publication number | Publication date |
---|---|
US20030074677A1 (en) | 2003-04-17 |
US10308946B2 (en) | 2019-06-04 |
US20090106855A1 (en) | 2009-04-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8148608B2 (en) | Systems and methods for clonal expression in plants | |
US8936937B2 (en) | System for expression of genes in plants from a virus-based expression vector | |
MXPA03008667A (en) | Processes and vectors for amplification or expression of nucleic acid sequences of interest in plants. | |
JP6850041B2 (en) | Protein expression system in plant cells and its use | |
EP0179861A1 (en) | Methods and vectors for transformation of plant cells | |
AU759570B2 (en) | Transgenic lemnaceae | |
CN105939599A (en) | Citrus tristeza virus based vectors for foreign gene/s expression | |
AU763096B2 (en) | Improved methods and materials for transformation | |
Hensgens et al. | Translation controls the expression level of a chimaeric reporter gene | |
US20040045050A1 (en) | Methods and materials for transformation | |
US20040121430A1 (en) | Construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and /or developmentally regulated expression of selected genetic sequences | |
US7005559B1 (en) | Expression silencing system and different uses thereof | |
EP3862430A1 (en) | Dna construct to be used in genome editing of plant | |
DE4005684C2 (en) | ||
US20100257632A1 (en) | Methods for generating marker-free transgenic plants | |
EP1630233A1 (en) | Novel vector | |
AU2003200734B2 (en) | Transgenic Lemnaceae | |
JPH0549481A (en) | Multicloning binary vector | |
El Mohtar | Exploring Citrus tristeza virus-based vector limits for heterologous gene/s expression | |
CZ2015764A3 (en) | An expression system and the method of expression of proteins in plants |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |