US20030191084A1 - High affinity nucleic acid ligands of complement system proteins - Google Patents

High affinity nucleic acid ligands of complement system proteins Download PDF

Info

Publication number
US20030191084A1
US20030191084A1 US10/435,750 US43575003A US2003191084A1 US 20030191084 A1 US20030191084 A1 US 20030191084A1 US 43575003 A US43575003 A US 43575003A US 2003191084 A1 US2003191084 A1 US 2003191084A1
Authority
US
United States
Prior art keywords
nucleic acid
artificial sequence
rna
ligands
completely synthesized
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/435,750
Inventor
Gregory Biesecker
Larry Gold
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gilead Sciences Inc
Original Assignee
Gilead Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/409,442 external-priority patent/US5696249A/en
Priority claimed from PCT/US1997/001739 external-priority patent/WO1997028178A1/en
Priority claimed from US09/023,228 external-priority patent/US6140490A/en
Application filed by Gilead Sciences Inc filed Critical Gilead Sciences Inc
Priority to US10/435,750 priority Critical patent/US20030191084A1/en
Assigned to GILEAD SCIENCES, INC. reassignment GILEAD SCIENCES, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: NEXSTAR PHARMACEUTICALS, INC.
Publication of US20030191084A1 publication Critical patent/US20030191084A1/en
Priority to US11/288,622 priority patent/US7964572B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1048SELEX
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/15Nucleic acids forming more than 2 strands, e.g. TFOs
    • C12N2310/151Nucleic acids forming more than 2 strands, e.g. TFOs more than 3 strands, e.g. tetrads, H-DNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures

Definitions

  • U.S. patent application Ser. No. 08/469,609 is also a continuation of U.S. patent application Ser. No. 08/409,442, filed Mar. 24, 1995, now U.S. Pat. No. 5,696,249 and a continuation of U.S. patent application Ser. No. 08/412,110, filed Mar. 27, 1995, now U.S. Pat. No. 5,670,637.
  • Ser. Nos. 08/428,964, 08/409,442, and 08/412,110 are continuations of U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, now U.S. Pat. No. 5,475,096, which is a continuation-in-part application of U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, now abandoned.
  • Described herein are methods for identifying and preparing high-affinity Nucleic Acid Ligands to Complement System Proteins.
  • the method utilized herein for identifying such Nucleic Acid Ligands is called SELEXTM, an acronym for Systematic Evolution of Ligands by EXponential enrichment.
  • Described herein are methods for identifying and preparing high-affinity Nucleic Acid Ligands to the Complement System Proteins C1q, C3 and C5.
  • This invention includes high affinity Nucleic Acid Ligands of C1q, C3 and C5.
  • Nucleic Acid Ligands that inhibit and/or activate the Complement System.
  • the oligonucleotides of the present invention are useful as pharmaceuticals or diagnostic agents.
  • the complement system comprises a set of at least 20 plasma and membrane proteins that act together in a regulated cascade system to attack extracellular forms of pathogens (Janeway et al. (1994) Immunobiology: The Immune System in Health and Disease . Current Biology Ltd, San Francisco, pp. 8:35-8:55; Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3):265-298).
  • pathogens There are two distinct enzymatic activation cascades, the classical and alternative pathways, and a non-enzymatic pathway known as the membrane attack pathway.
  • the classical pathway is usually triggered by an antibody bound to a foreign particle. It comprises several components, C1, C4, C2, C3 and C5 (listed by order in the pathway). Initiation of the classical pathway of the Complement System occurs following binding and activation of the first complement component (C1) by both immune and non-immune activators (Cooper (1985) Adv. Immunol. 37:151).
  • C1 comprises a calcium-dependent complex of components C1q, C1r and C1s, and is activated through binding of the C1q component.
  • C1 q contains six identical subunits and each subunit comprises three chains (the A, B and C chains). Each chain has a globular head region which is connected to a collagen-like tail.
  • Binding and activation of C1q by antigen-antibody complexes occurs through the C1q head group region.
  • Numerous non-antibody C1q activators including proteins, lipids and nucleic acids (Reid et al. (1993) The Natural Immune System: Humoral Factors . E. Sim, ed. IRL Press, Oxford, p. 151) bind and activate through a distinct site on the collagen-like stalk region.
  • Non-antibody C1q protein activators include C-reactive protein (CRP) (Jiang et al. (1991) J. Immunol. 146:2324) and serum amyloid protein (SAP) (Bristow et al. (1986) Mol. Immunol. 23:1045); these will activate C1q when aggregated by binding to phospholipid or carbohydrate, respectively. Monomeric CRP or SAP do not activate C1q. C1q is also activated through binding to aggregated ⁇ -amyloid peptide (Schultz et al. (1994) Neurosci. Lett. 175:99; Snyder et al. (1994) Exp. Neurol.
  • CRP C-reactive protein
  • SAP serum amyloid protein
  • C1q activators bind C1q on its collagen-like region, distant from the head-group region where immunoglobulin activators bind.
  • Other proteins which bind the C1q collagen-like region include collagen (Menzel et al. (1981) Biochim. Biophys. Acta 670:265), fibronectin (Reid et al. (1984) Acta Pathol. Microbiol. Immunol. Scand. Sect. C 92 (Suppl. 284):11), laminin (Bohnsack et al. (1985) Proc. Natl. Acad. Sci. USA 82:3824), fibrinogen and fibrin (Entwistle et al. (1988) Biochem.
  • C1q also binds and can be activated by anionic carbohydrates (Hughes-Jones et al. (1978) Immunology 34:459) including mucopolysaccharides (Almeda et al. (1983) J. Biol. Chem. 258:785), fucans (Blondin et al. (1994) Mol. Immunol. 31 :247), proteoglycans (Silvestri et al. (1981) J. Biol. Chem. 256:7383), and by lipids including lipopolysaccharide (LPS) (Zohair et al. (1989) Biochem. J. 257:865; Stoiber et al.
  • anionic carbohydrates Hughes-Jones et al. (1978) Immunology 34:459
  • mucopolysaccharides Almeda et al. (1983) J. Biol. Chem. 258:785)
  • fucans Blon
  • a binding site for non-antibody activators including CRP (Jiang et al. (1991) J. Immunol. 146:2324), SAP (Ying et al. (1993) J. Immunol. 150:169), ⁇ -amyloid peptide (Newman (1994) Curr. Biol. 4:462) and DNA (Jiang et al. (1992) J. Biol. Chem. 267:25597) has been localized to the amino terminus of C1q A chain at residues 14-26.
  • a synthetic peptide comprising this sequence effectively inhibits both binding and activation.
  • the peptide 14-26 contains several basic residues and matches one of the heparin binding motifs (Yabkowitz et al.
  • the peptide is also highly homologous with peptide 145-156 in collagen-tailed acetylcholinesterase; this site is associated with heparin-sulfate basement membrane binding (Deprez et al. (1995) J. Biol. Chem. 270:11043).
  • a second C1q A chain site at residues 76-92 also might be involved in weaker binding; this site is at the junction of the globular head region and the collagen-like tail.
  • the second enzymatically activated cascade is a rapid, antibody-independent route for the Complement System activation and amplification.
  • the alternative pathway comprises several components, C3, Factor B, and Factor D.
  • Activation of the alternative pathway occurs when C3b, a proteolytic cleavage form of C3, is bound to an activating surface such as a bacterium.
  • Factor B is then bound to C3b, and cleaved by Factor D to yield the active enzyme, Ba.
  • the enzyme Ba then cleaves more C3 to C3b, producing extensive deposition of C3b-Ba complexes on the activating surface.
  • a second C3b is deposited, forming a C3b-C3b-Ba complex, the enzyme can then cleave C5 and trigger activation of the terminal pathway.
  • the non-enzymatic terminal pathway also known as the membrane attack pathway, comprises the components C5, C6, C7, C8 and C9. Activation of this membrane attack pathway results when the C5 component is enzymatically cleaved by either the classical or alternative pathway to yield the small C5a polypeptide (9 kDa) and the large C5b fragment (200 kDa).
  • the C5a polypeptide binds to a 7 transmembrane G-protein coupled receptor which was originally described on leukocytes and is now known to be expressed on a variety of tissues including hepatocytes (Haviland et al. (1995) J. Immunol. 154:1861) and neurons (Gasque et al. (1997) Am. J.
  • the C5a molecule is the primary chemotactic component of the human Complement System and can trigger a variety of biological responses including leukocyte chemotaxis, smooth muscle contraction, activation of intracellular signal transduction pathways, neutrophil-endothelial adhesion (Mulligan et al. (1997) J. Immunol. 158:1857), cytokine and lipid mediator release and oxidant formation.
  • the larger C5b fragment binds sequentially to later components to form the C5b-9 membrane attack complex (MAC).
  • the C5b-9 MAC can directly lyse erythrocytes, and in greater quantities is lytic for leukocytes and is damaging to tissues such as muscle, epithelial and endothelial cells (Stahl et al. (1997) Circ. Res. 76:575). In sublytic amounts the MAC can stimulate upregulation of adhesion molecules, intracellular calcium increase and cytokine release (Ward (1996) Am. J. Pathol. 149:1079). In addition, the C5b-9 MAC can stimulate cells such as endothelial cells and platelets without causing cell lysis. The non-lytic effects of C5a and the C5b-9 MAC are sometimes quite similar.
  • Complement System has an important role in defense against bacterial and viral infection, and possibly in immune surveillance against tumors. This is demonstrated most clearly in humans who are deficient in complement components. Individuals deficient in early components (C1, C4, C2 or C3) suffer from recurrent infections, while individuals deficient in late components (C5 through C9) are susceptible to nisseria infection.
  • Complement classical pathway is activated on bacteria by antibodies, by binding of CRP or SAP, or by direct activation through LPS.
  • Complement alternative pathway is activated through binding of C3 to the cell coat.
  • Complement can be activated by viruses through antibodies, and can also be activated on viral infected cells because these are recognized as foreign. In a similar way, transformed cells can be recognized as foreign and can be lysed by the Complement System or targeted for immune clearance.
  • Activation of the Complement System can and has been used for therapeutic purposes. Antibodies which were produced against tumor cells were then used to activate the Complement System and cause tumor rejection. Also, the Complement System is used together with polyclonal or monoclonal antibodies to eliminate unwanted lymphocytes. For example, anti-lymphocyte globulin or monoclonal anti-T-cell antibodies are used prior to organ transplantation to eliminate lymphocytes which would otherwise mediate rejection.
  • Complement System Although the Complement System has an important role in the maintenance of health, it has the potential to cause or contribute to disease.
  • the Complement System has been implicated in numerous renal, rheumatological, neurological, dermatological, hematological, vascular/pulmonary, allergy, infectious, biocompatibility/shock and other diseases or conditions (Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3 :265-298; Matis and Rollins (1995) Nature Medicine 1(8):839-842).
  • the Complement System is not necessarily the only cause of the disease state, but it may be one of several factors, each of which contributes to pathogenesis.
  • C5 is an attractive target for the development of a Complement System inhibitor, as both the classical and alternative pathways converge at component C5 (Matis and Rollins (1995) Nature Medicine 1(8):839-842).
  • inhibition of C5 cleavage blocks both the C5a and the C5b effects on leukocytes and on tissue such as endothelial cells (Ward (1996) Am. J. Pathol. 149:1079); thus C5 inhibition can have therapeutic benefits in a variety of diseases and situations, including lung inflammation (Mulligan et al. (1998) J. Clin. Invest. 98:503), extracorporeal complement activation (Rinder et al. (1995) J. Clin. Invest.
  • the MAC mediates muscle injury in acute autoimmune myasthenia gravis (Biesecker and Gomez (1989) J. Immunol. 142:2654), organ rejection in transplantation (Baldwin et al. (1995) Transplantation 59:797; Brauer et al. (1995) Transplantation 59:288; Takahashi et al. (1997) Immunol. Res. 16:273) and renal injury in autoimmune glomerulonephritis (Biesecker (1981) J. Exp. Med. 39:1779; Nangaku (1997) Kidney Int.
  • C3 is an attractive target for the development of a Complement System inhibitor, as it is common to both pathways. Inhibition of C3 using recombinant versions of a natural inhibitors (Kalli et al. (1994) Springer Semin. Immunopathol. 15:417) can prevent cell-mediated tissue injury (Mulligan et al. (1992) J. Immunol. 148:1479) and this has been shown to have therapeutic benefit in diseases such as myocardial infarction (Weisman et al. (1990) Science 249:146) and liver ischemia/reperfusion (Chavez-Cartaya et al. (1995) Transplantation 59:1047). Controlling C3 limits most biological activities of the Complement System. Most natural inhibitors, including DAF, MCP, CR1 and Factor H target C3.
  • the SELEX method involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity.
  • the SELEX method includes steps of contacting the mixture with the Target under conditions favorable for binding, partitioning unbound Nucleic Acids from those Nucleic Acids which have bound specifically to Target molecules, dissociating the Nucleic Acid-Target complexes, amplifying the Nucleic Acids dissociated from the Nucleic Acid-Target complexes to yield a ligand-enriched mixture of Nucleic Acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity Nucleic Acid Ligands to the Target molecule.
  • the SELEX method encompasses the identification of high-affinity Nucleic Acid Ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified Nucleic Acid Ligands containing modified nucleotides are described in U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” now abandoned, (see also U.S. Pat. No.
  • the SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. patent application Ser. No. 08/284,063, filed Aug. 2, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” now U.S. Pat. No. 5,637,459 and U.S. patent application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX,” now U.S. Pat. No. 5,683,867, respectively.
  • the present invention includes methods of identifying and producing Nucleic Acid Ligands to Complement System Proteins and homologous proteins and the Nucleic Acid Ligands so identified and produced.
  • homologous proteins it is meant a degree of amino acid sequence identity of 80% or more.
  • Exemplified herein is a method of identifying and producing Nucleic Acid Ligands to C1q, C3 and C5, and the Nucleic Acid Ligands so produced.
  • Nucleic Acid Ligand sequences are provided that are capable of binding specifically to C1q, C3 and C5.
  • RNA sequences are provided that are capable of binding specifically the C1q, C3 and C5.
  • RNA ligand sequences shown in Tables 2-6, 8, 10 and 12-13 and FIGS. 5 A-B SEQ ID NOS: 5-155 and 160-196.
  • Nucleic Acid Ligands that inhibit the function of proteins of the Complement System.
  • Nucleic Acid Ligands that inhibit and/or activate the Complement System.
  • nucleic Acid Ligands and Nucleic Acid Ligand sequences to Complement System Proteins comprising the steps of (a) preparing a Candidate Mixture of Nucleic Acids, (b) contacting the Candidate Mixture of Nucleic Acids with a Complement System Protein, (c) partitioning between members of said Candidate Mixture on the basis of affinity to said Complement System Protein, and (d) amplifying the selected molecules to yield a mixture of Nucleic Acids enriched for Nucleic Acid sequences with a relatively higher affinity for binding to said Complement System Protein.
  • Also included in this invention is a method of identifying Nucleic Acid Ligands and Nucleic Acid Ligand sequences to C1q, C3 and C5, comprising the steps of (a) preparing a Candidate Mixture of Nucleic Acids, (b) contacting the Candidate Mixture of Nucleic Acids with C1q, C3 or C5, (c) partitioning between members of said Candidate Mixture on the basis of affinity to C1q, C3 or C5, and (d) amplifying the selected molecules to yield a mixture of Nucleic Acids enriched for Nucleic Acid sequences with a relatively higher affinity for binding to C1q, C3 or C5.
  • the present invention includes the RNA ligands to C1q, C3 and C5 identified according to the above-described method, including RNA ligands to C1q, including those ligands shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS: 84-155), RNA ligands to C3, including those sequences shown in Table 3 (SEQ ID NOS:21-46), and RNA ligands to C5, including those sequences shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS.
  • RNA ligands to C1q including those ligands shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS: 84-155
  • RNA ligands to C1q, C3 and C5 that are substantially homologous to any of the given ligands and that have substantially the same ability to bind C1q, C3 or C5, and inhibit the function of C1q, C3 or C5.
  • Nucleic Acid Ligands to C1q, C3 and C5 that have substantially the same structural form as the ligands presented herein and that have substantially the same ability to bind C1q, C3 or C5 and inhibit the function of C1q, C3 or C5.
  • the present invention also includes modified nucleotide sequences based on the RNA ligands identified herein and mixtures of the same.
  • FIG. 1 shows the results of an inhibition assay in which 2′-F RNA ligands C 12 (SEQ ID NO:59), A6 (SEQ ID NO:48), K7 (SEQ ID NO:50), C9 (SEQ ID NO:58), E5c (SEQ ID NO:47) and F8 (SEQ ID NO:49) to human C5 were incubated with antibody-coated sheep erythrocytes and whole human serum. The results are presented as optical density (OD) versus concentration of ligand in nM.
  • OD optical density
  • FIG. 2 shows the % C5a generation as a function of concentration of clone C6 (SEQ ID NO:51).
  • FIG. 3A shows a sequencing gel of 5′-kinase-labeled clone C6 (SEQ ID NO:51) after alkaline hydrolysis or digestion with T 1 nuclease.
  • the 3′-sequence (5′-end labeled) is aligned with the alkaline hydrolysis ladder.
  • On the left is the T 1 ladder and on the right are RNA selected with 5 ⁇ and 1 ⁇ concentrations of C5.
  • the boundary where removal of a base eliminates binding is shown by the arrow.
  • the asterisk shows a G which is hypersensitive to T 1 .
  • FIG. 3B shows a sequencing gel of 3′-pCp-ligated clone C6 after alkaline hydrolysis or digestion with T 1 nuclease.
  • the 5′-sequence (3′-end-labled) is aligned with the alkaline hydrolysis ladder.
  • the T 1 and protein lanes, boundary and hypersensitive G nucleotides are as described for FIG. 3A.
  • FIG. 4 shows the results of the 2′-O-methyl interference assay. Positions where 2′-OH purines can be substituted with 2′-O-methyl were determined from binding interference. Plotted is the ratio of (the intensity of bands selected by protein)/(the band intensity for oligonucleotides not selected by protein) with a linear curve fit (open circles). The same ratio for mixed 2′-OH:2′-OMe nucleotides is also plotted (closed circles).
  • FIG. 5A shows the proposed structure of the 38 mer truncate (SEQ ID NO:160) of clone C6 (SEQ ID NO:51) together with alternative bases.
  • FIG. 5B shows the 2′-O-methyl substitution pattern of a 38 mer truncate (SEQ ID NO: 193 of clone C6 (SEQ ID NO:51). Positions where 2′-OMe substitutions can be made are shown in bold. Positions which must be 2′-OH are underlined.
  • FIG. 6 shows the % hemolysis verses concentration of nucleic acid ligand ( ⁇ m) for a 38 mer truncate of clone YL-13 (SEQ ID NO: 175) without 2′-OMe substitution (SEQ ID NO:194; open circles), with a 2′-OMe substitution at position 20 (SEQ ID NO:195; closed triangles) and with 2′-OMe substitutions at positions 2, 7, 8, 13, 14, 15, 20, 21, 22, 26, 27, 28, 36 and 38 (SEQ ID NO:196; closed circles).
  • Nucleic Acid Ligand as used herein is a non-naturally occurring Nucleic Acid having a desirable action on a Target.
  • a desirable action includes, but is not limited to, binding of the Target, catalytically changing the Target, reacting with the Target in a way which modifies/alters the Target or the functional activity of the Target, covalently attaching to the Target as in a suicide inhibitor, and facilitating the reaction between the Target and another molecule.
  • the desirable action is specific binding to a Target molecule, such Target molecule being a three dimensional chemical structure other than a polynucleotide that binds to the Nucleic Acid Ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein the Nucleic Acid Ligand is not a Nucleic Acid having the known physiological function of being bound by the Target molecule.
  • Nucleic Acid Ligands include Nucleic Acids that are identified from a Candidate Mixture of Nucleic Acids, said Nucleic Acid Ligand being a ligand of a given Target by the method comprising: a) contacting the Candidate Mixture with the Target, wherein Nucleic Acids having an increased affinity to the Target relative to the Candidate Mixture may be partitioned from the remainder of the Candidate Mixture; b) partitioning the increased affinity Nucleic Acids from the remainder of the Candidate Mixture; and c) amplifying the increased affinity Nucleic Acids to yield a ligand-enriched mixture of Nucleic Acids.
  • Candidate Mixture is a mixture of Nucleic Acids of differing sequence from which to select a desired ligand.
  • the source of a Candidate Mixture can be from naturally-occurring Nucleic Acids or fragments thereof, chemically synthesized Nucleic Acids, enzymatically synthesized Nucleic Acids or Nucleic Acids made by a combination of the foregoing techniques.
  • each Nucleic Acid has fixed sequences surrounding a randomized region to facilitate the amplification process.
  • Nucleic Acid means both DNA, RNA, single-stranded or double-stranded and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the Nucleic Acid Ligand bases or to the Nucleic Acid Ligand as a whole.
  • modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping.
  • SELEXTM methodology involves the combination of selection of Nucleic Acid Ligands which interact with a Target in a desirable manner, for example binding to a protein, with amplification of those selected Nucleic Acids. Iterative cycling of the selection/amplification steps allows selection of one or a small number of Nucleic Acids which interact most strongly with the Target from a pool which contains a very large number of Nucleic Acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved.
  • the SELEX methodology is employed to obtain Nucleic Acid Ligands to C1q, C3 and C5. The SELEX methodology is described in the SELEX Patent Applications.
  • Target means any compound or molecule of interest for which a ligand is desired.
  • a Target can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc. without limitation.
  • the Target is a Complement System Protein, preferably C1q, C3 and C5.
  • Complement System Protein means any protein or component of the Complement System including, but not limited to, C1, C1q, C1r, C1s, C2, C3, C3a, C3b, C4, C4a, C5, C5a, C5b, C6, C7, C8, C9, Factor B (B), Factor D (D), Factor H (H) and receptors thereof, and other soluble and membrane inhibitors/control proteins.
  • Complement System is a set of plasma and membrane proteins that act together in a regulated cascade system to attack extracellular forms of pathogens or infected or transformed cells, and in clearance of immune reactants or cellular debris.
  • the Complement System can be activated spontaneously on certain pathogens or by antibody binding to the pathogen.
  • the pathogen becomes coated with Complement System Proteins (opsonized) for uptake and destruction.
  • the pathogen can also be directly lysed and killed. Similar mechanisms target infected, transformed or damaged cells.
  • the Complement System also participates in clearance of immune and cellular debris.
  • a Candidate Mixture of Nucleic Acids of differing sequence is prepared.
  • the Candidate Mixture generally includes regions of fixed sequences (i.e., each of the members of the Candidate Mixture contains the same sequences in the same location) and regions of randomized sequences.
  • the fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the Target, or (c) to enhance the concentration of a given structural arrangement of the Nucleic Acids in the Candidate Mixture.
  • the randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent).
  • the Candidate Mixture is contacted with the selected Target under conditions favorable for binding between the Target and members of the Candidate Mixture. Under these circumstances, the interaction between the Target and the Nucleic Acids of the Candidate Mixture can be considered as forming Nucleic Acid-Target pairs between the Target and those Nucleic Acids having the strongest affinity for the Target.
  • the newly formed Candidate Mixture contains fewer and fewer weakly binding sequences, and the average degree of affinity of the Nucleic Acids to the Target will generally increase.
  • the SELEX process will yield a Candidate Mixture containing one or a small number of unique Nucleic Acids representing those Nucleic Acids from the original Candidate Mixture having the highest affinity to the Target molecule.
  • the SELEX Patent Applications describe and elaborate on this process in great detail. Included are Targets that can be used in the process; methods for partitioning Nucleic Acids within a Candidate Mixture; and methods for amplifying partitioned Nucleic Acids to generate enriched Candidate Mixture.
  • the SELEX Patent Applications also describe ligands obtained to a number of target species, including both protein Targets where the protein is and is not a Nucleic Acid binding protein.
  • the SELEX method further encompasses combining selected Nucleic Acid Ligands with lipophilic or Non-Immunogenic, High Molecular Weight compounds in a diagnostic or therapeutic complex as described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes,” now U.S. Pat. No. 6,011,020.
  • VEGF Nucleic Acid Ligands that are associated with a Lipophilic Compound, such as diacyl glycerol or dialkyl glycerol, in a diagnostic or therapeutic complex are described in U.S. patent application Ser. No. 08/739,109, filed Oct.
  • VEGF Vascular Endothelial Growth Factor
  • VEGF Nucleic Acid Ligands that are associated with a Lipophilic Compound, such as a glycerol lipid, or a Non-Immunogenic, High Molecular Weight Compound, such as polyalkylene glycol, are further described in U.S. patent application Ser. No. 08/897,351, filed Jul. 21, 1997, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes,” now U.S. Pat. No. 6,051,698.
  • VEGF Nucleic Acid Ligands that are associated with a Non-Immunogenic, High Molecular Weight compound or a lipophilic compound are also further described in PCT/US97/18944, filed Oct. 17, 1997, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes.”
  • VEGF Vascular Endothelial Growth Factor
  • Certain embodiments of the present invention provide a complex comprising one or more Nucleic Acid Ligands to a Complement System Protein covalently linked with a Non-Immunogenic, High Molecular Weight compound or lipophilic compound.
  • a complex as used herein describes the molecular entity formed by the covalent linking of the Nucleic Acid Ligand of a Complement System Protein to a Non-Immunogenic, High Molecular Weight compound.
  • a Non-Immunogenic, High Molecular Weight compound is a compound between approximately 100 Da to 1,000,000 Da, more preferably approximately 1000 Da to 500,000 Da, and most preferably approximately 1000 Da to 200,000 Da, that typically does not generate an immunogenic response.
  • an immunogenic response is one that causes the organism to make antibody proteins.
  • the Non-Immunogenic, High Molecular Weight compound is a polyalkylene glycol.
  • the polyalkylene glycol is polyethylene glycol (PEG). More preferably, the PEG has a molecular weight of about 10-80K. Most preferably, the PEG has a molecular weight of about 20-45K.
  • the Non-Immunogenic, High Molecular Weight compound can also be a Nucleic Acid Ligand.
  • Lipophilic compounds are compounds that have the propensity to associate with or partition into lipid and/or other materials or phases with low dielectric constants, including structures that are comprised substantially of lipophilic components. Lipophilic compounds include lipids as well as non-lipid containing compounds that have the propensity to associate with lipids (and/or other materials or phases with low dielectric constants). Cholesterol, phospholipid, and glycerol lipids, such as dialkyl glycerol, diacyl glycerol, and glycerol amide lipids are further examples of lipophilic compounds. In a preferred embodiment, the lipophilic compound is a glycerol lipid.
  • the Non-Immunogenic, High Molecular Weight compound or lipophilic compound may be covalently bound to a variety of positions on the Nucleic Acid Ligand to a Complement System Protein, such as to an exocyclic amino group on the base, the 5-position of a pyrimidine nucleotide, the 8-position of a purine nucleotide, the hydroxyl group of the phosphate, or a hydroxyl group or other group at the 5′ or 3′ terminus of the Nucleic Acid Ligand to a Complement System Protein.
  • the lipophilic compound is a glycerol lipid, or the Non-Immunogenic, High Molecular Weight compound is polyalkylene glycol or polyethylene glycol, preferably the Non-Immunogenic, High Molecular Weight compound is bonded to the 5′ or 3′ hydroxyl of the phosphate group thereof. In the most preferred embodiment, the lipophilic compound or Non-Immunogenic, High Molecular Weight compound is bonded to the 5′ hydroxyl of the phosphate group of the Nucleic Acid Ligand. Attachment of the Non-Immunogenic, High Molecular Weight compound or lipophilic compound to the Nucleic Acid Ligand of the Complement System Protein can be done directly or with the utilization of linkers or spacers.
  • a linker is a molecular entity that connects two or more molecular entities through covalent bonds or non-covalent interactions, and can allow spatial separation of the molecular entities in a manner that preserves the functional properties of one or more of the molecular entities.
  • a linker can also be referred to as a spacer.
  • the complex comprising a Nucleic Acid Ligand to a Complement System Protein and a Non-Immunogenic, High Molecular Weight compound or lipophilic compound can be further associated with a lipid construct.
  • Lipid constructs are structures containing lipids, phospholipids, or derivatives thereof comprising a variety of different structural arrangements which lipids are known to adopt in aqueous suspension. These structures include, but are not limited to, lipid bilayer vesicles, micelles, liposomes, emulsions, lipid ribbons or sheets, and may be complexed with a variety of drugs and components which are known to be pharmaceutically acceptable.
  • the lipid construct is a liposome.
  • the preferred liposome is unilamellar and has a relative size less than 200 nm.
  • Common additional components in lipid constructs include cholesterol and alpha-tocopherol, among others.
  • the lipid constructs may be used alone or in any combination which one skilled in the art would appreciate to provide the characteristics desired for a particular application.
  • the technical aspects of lipid constructs and liposome formation are well known in the art and any of the methods commonly practiced in the field may be used for the present invention.
  • nucleic Acid Ligands identified by such methods are useful for both therapeutic and diagnostic purposes.
  • Therapeutic uses include the treatment or prevention of diseases or medical conditions in human patients, specifically diseases or conditions caused by activation of the Complement System.
  • the Complement System does not have to be the only cause of the disease state, but it may be one of several factors, each of which contributes to pathogenesis.
  • Such diseases or conditions include, but are not limited to, renal diseases, such as lupus nephritis and membranoproliferative glomerulonephritis (MPGN), membranous nephritis, IgA nephropathy; rheumatological diseases, such as rheumatoid arthritis, systemic lupus erythematosus (SLE), Behcet's syndrome, juvenile rheumatoid arthritis, Sjögren's syndrome and systemic sclerosis; neurological diseases, such as myasthenia gravis, multiple sclerosis, cerebral lupus, Guillain-Barré syndrome and Alzheimer's disease; dermatological diseases, such as Pemphigus/pemphigoid, phototoxic reactions, vasculitis and thermal bums; hematological diseases, such as paroxysmal nocturnal hemoglobinuria (PNH), hereditary erythroblastic multinuclearity with positive acidified serum
  • the Complement System can be inhibited at several points in the activation cascade by targeting different components. Inhibition of C1q would block the initiation by either antibody or non-antibody mechanisms. Antibodies activate C1q in many diseases including SLE, myasthenia gravis and arthritis. Non-antibody Complement System activation occurs in many diseases including Alzheimer's disease, myocardial infarction and septic shock. Blocking C1q could prevent the complement-mediated tissue injury in these diseases.
  • the Complement can also be activated in the absence of antibodies directly at the C3 stage. Activating surfaces including bacteria, virus particles or damaged cells can trigger Complement System activation that does not require C1q. An inhibitor of C3 could prevent Complement System activation and damage in these situations.
  • C5 In other instances the inhibition of C5 is most useful. Activation of the Complement System by either C1q or C3 mechanisms both lead to activation of C5, so that inhibition of C5 could prevent Complement System-mediated damage by either pathway.
  • both C1q and C3 are important in normal defense against microorganisms and in clearance of immune components and damaged tissue, while C5 is mostly dispensable for this function. Therefore, C5 can be inhibited either for a short term or a long term and the protective role of Complement System would not be compromised, whereas long term inhibition of C1q or C3 is not desirable.
  • the C5 fragments C5a and C5b directly cause the majority of tissue injury and disease associated with unwanted Complement System activation. Therefore, inhibition of C5 is the most direct way of producing therapeutic benefit.
  • the activation of the Complement System is desirable in the treatment or prevention of diseases or medical conditions in human patients.
  • the activation of the Complement System is desirable in treating bacterial or viral infections and malignancies.
  • the activation of the Complement System on T-cells prior to transplantation could prevent rejection of an organ or tissue by eliminating the T-cells that mediate the rejection.
  • Nucleic Acid Ligands that bind to cell surface Targets could be made more efficient by giving them the ability to activate the Complement System. Nucleic Acid binding would then both inhibit a Target function and also eliminate the cell, for example, by membrane attack complex lysis and cell clearance through opsonization. Nucleic Acid Ligands could activate the Complement System through either the classical or the alternative pathways.
  • C1q Nucleic Acid Ligands can be conjugated to other structures that target a cell surface component.
  • C1q Nucleic Acid Ligands can be conjugated to antibodies to cell targets, cytokines, growth factors or a ligand to a cell receptor. This would allow the C1q Nucleic Acid Ligands to multimerize on the targeted cell surface and activate the Complement System, thereby killing the cell.
  • the prototype classical pathway activators are immune aggregates, which activate the Complement System through binding to globular head groups on the C1q component. Generally, binding of two or more Fc domains to C1q is required; pentameric IgM is an especially efficient activator.
  • Nucleic Acid Ligands can activate through binding at a separate site on the C1q collagen-like tail region. This site also binds to a variety of other non-antibody activators including C-reactive protein, serum amyloid protein, endotoxin, ⁇ -amyloid peptide 1-40 and mitochondrial membranes. As with immunoglobulin, these non-antibody activators need to be multimerized to activate.
  • Nucleic Acid Ligands that bind to sites on the collagen-like region of C1q may also become activators when aggregated.
  • Such a Complement System-activating aggregate may be lytic if formed on a cell surface, such as binding to a tumor-specific antigen (TSA) or to a leukocyte antigen.
  • TSA tumor-specific antigen
  • the extent of Nucleic Acid Ligand-mediated activation increases with the extent of Nucleic Acid Ligand aggregation (i.e., multiplicity of Nucleic Acid Ligand-C1q interaction).
  • the Complement System-mediated killing is especially specific if the Nucleic Acid Ligands circulate as monomers which do not activate, but become activators when they are multimerized on the targeted cell surface.
  • C3 As with any Complement System activation, the extent and specificity is determined by the amount of C3 deposited onto the targeted cell. Deposited C3 forms an enzyme convertase that cleaves C5 and initiates membrane attack complex formation. C3 is also the classical serum opsonin for targeting phagocytic ingestion.
  • the prototype alternative pathway activators are repeating carbohydrate units including bacterial and yeast cell walls, fucoidin and Sepharose, or glycolipids such as endotoxin or the glycocalyx. Nucleic Acid Ligands could activate the alternative pathway by aggregating the C3 component on the cell surface. Depositing C3 on a cell promotes Factor B binding and alternative pathway C3 convertase formation.
  • Binding of a Nucleic Acid Ligand to C3 blocks binding of the inhibitor Factor H and prevents C3b decay. This would also increase C3 convertase formation and alternative path activation. Nucleic Acid Ligands to C3 may have this activity since heparin binds activated C3 and can promote alternative pathway activation. Binding of Nucleic Acid Ligands to C3 blocks binding to C3 of the membrane-associated inhibitors CR1, CR2, MCP and DAF, preventing C3b convertase decay and stimulating alternative pathway activation. This alternative pathway mechanism can be as efficient as C1q-dependent activation in cell killing and lysis.
  • Nucleic Acid Ligand-mediated Complement System cell killing could be employed in several ways, for example, by: a) direct killing of tumor cells; b) lysis of targeted microorganisms or infected cells; and c) elimination of lymphocytes or lymphocyte subsets. Nucleic Acid Ligands could replace antibodies currently used for these purposes.
  • Diagnostic utilization may include either in vivo or in vitro diagnostic applications.
  • the SELEX method generally, and the specific adaptations of the SELEX method taught and claimed herein specifically, are particularly suited for diagnostic applications.
  • the SELEX method identifies Nucleic Acid Ligands that are able to bind targets with high affinity and with surprising specificity. These characteristics are, of course, the desired properties one skilled in the art would seek in a diagnostic ligand.
  • the Nucleic Acid Ligands of the present invention may be routinely adapted for diagnostic purposes according to any number of techniques employed by those skilled in the art. Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. Simply the ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes. Those skilled in the art would also be able to adapt any Nucleic Acid Ligand by procedures known in the art to incorporate a labeling tag in order to track the presence of such ligand. Such a tag could be used in a number of diagnostic procedures.
  • the Nucleic Acid Ligands to C1q, C3 and C5 described herein may specifically be used for identification of the C1q, C3 or C5 protein.
  • the SELEX process provides high affinity ligands of a target molecule. This represents a singular achievement that is unprecedented in the field of Nucleic Acids research.
  • the present invention applies the SELEX procedure to the specific target C1q, which is part of the first component (C1) of the classical pathway of Complement System activation, to the specific target C3, which is part of both the classical and alternative pathway, and to the specific target C5, which is part of the terminal pathway.
  • C1q which is part of the first component (C1) of the classical pathway of Complement System activation
  • C3 the specific target C5
  • the specific target C5 which is part of the terminal pathway.
  • the Nucleic Acid Ligand (1) binds to the target in a manner capable of achieving the desired effect on the target; (2) be as small as possible to obtain the desired effect; (3) be as stable as possible; and (4) be a specific ligand to the chosen target. In most situations, it is preferred that the Nucleic Acid Ligand have the highest possible affinity to the Target.
  • Pharmaceutical agents which include, but are not limited to, small molecules, antisense oligonucleotides, nucleosides, and polypeptides can activate the Complement System in an undesirable manner.
  • Nucleic Acid Ligands to Complement System Proteins could be used as a prophylactic by transiently inhibiting the Complement System, so that a pharmaceutical agent could be administered and achieve a therapeutically effective amount without eliciting the undesirable side effect of activating the Complement System.
  • RNA with specific high affinity for C1q, C3 and C5 from a degenerate library containing 30 or 50 random positions (30N or 50N).
  • This invention includes the specific RNA ligands to C1q shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155), identified by the method described in Examples 2 and 6, the specific RNA ligands to C3 shown in Table 3 (SEQ ID NOS:21-46), identified by method described in Example 3, and the specific RNA ligands to C5 shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS.
  • This invention further includes RNA ligands to C1q, C3 and C5 which inhibit the function of C1q, C3 and C5.
  • the scope of the ligands covered by this invention extends to all Nucleic Acid Ligands of C1q, C3 and C5, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes Nucleic Acid sequences that are substantially homologous to the ligands shown in Tables 2-6, 8, 10 and 12-13 and FIGS. 5 A-B (SEQ ID NOS:5-155 and 160-196).
  • substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%, and even more preferably in excess of 90%, 95% or 99%.
  • the percentage of homology as described herein is calculated as the percentage of nucleotides found in the smaller of the two sequences which align with identical nucleotide residues in the sequence being compared when 1 gap in a length of 10 nucleotides may be introduced to assist in that alignment.
  • this invention also includes Nucleic Acid Ligands that have substantially the same structure and ability to bind C1q as the Nucleic Acid Ligands shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155), Nucleic Acid Ligands that have substantially the same structure and ability to bind C3 as the Nucleic Acid Ligands shown in Table 3 (SEQ ID NOS:21-46) and Nucleic Acid Ligands that have substantially the same structure and ability to bind C5 as the Nucleic Acid Ligands shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:
  • Substantially the same ability to bind C1q, C3 or C5 means that the affinity is within one or two orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind C1q, C3 or C5.
  • Nucleic Acid Ligand One potential problem encountered in the therapeutic, prophylactic and in vivo diagnostic use of Nucleic Acids is that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. Certain chemical modifications of the Nucleic Acid Ligand can be made to increase the in vivo stability of the Nucleic Acid Ligand or to enhance or to mediate the delivery of the Nucleic Acid Ligand. See, e.g., U.S. patent application Ser. No. 08/117,991, filed Sep.
  • Nucleic Acid Ligands Containing Modified Nucleotides
  • U.S. Pat. No. 5,660,985 U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes,” which are specifically incorporated herein by reference in their entirety.
  • Modifications of the Nucleic Acid Ligands contemplated in this invention include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the Nucleic Acid Ligand bases or to the Nucleic Acid Ligand as a whole.
  • modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping.
  • the modifications can be pre- or post-SELEX modifications.
  • Pre-SELEX modifications yield Nucleic Acid Ligands with both specificity for their SELEX Target and improved in vivo stability.
  • Post-SELEX modifications made to 2′-OH Nucleic Acid Ligands can result in improved in vivo stability without adversely affecting the binding capacity of the Nucleic Acid Ligand.
  • the preferred modifications of the Nucleic Acid Ligands of the subject invention are 5′ and 3′ phosphorothioate capping and/or 3′-3′ inverted phosphodiester linkage at the 3′ end.
  • the preferred modification of the Nucleic Acid Ligand is a 3′-3′ inverted phosphodiester linkage at the 3′ end. Additional 2′-fluoro (2′-F) and/or 2′-amino (2′-NH 2 ) and/or 2′-O-methyl (2′-OMe) modification of some or all of the nucleotides is preferred. Described herein are Nucleic Acid Ligands that were 2′-NH 2 modified or 2′-F modified and incorporated into the SELEX process. Further described herein are 2′-F modified Nucleic Acid Ligands derived from the SELEX process which were modified to comprise 2′-OMe purines in post-SELEX modifications.
  • Nucleic Acid Ligands to C3 or to C5 could also inhibit Complement System activation in Alzheimer's disease or myocardial infarction, whether the Complement System is activated through C1q by antibody or non-antibody mechanisms, or independent of C1q through the alternative pathway.
  • the Nucleic Acid Ligands of the present invention may be useful in treating Alzheimer's disease or myocardial infarction.
  • compositions of the Nucleic Acid Ligands may be administered parenterally by injection, although other effective administration forms, such as intraarticular injection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories are also envisioned.
  • One preferred carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used.
  • the carrier and the Nucleic Acid Ligand constitute a physiologically-compatible, slow release formulation.
  • the primary solvent in such a carrier may be either aqueous or non-aqueous in nature.
  • the carrier may contain other pharmacologically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation.
  • the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release or absorption of the ligand.
  • excipients are those substances usually and customarily employed to formulate dosages for parental administration in either unit dose or multi-dose form.
  • the therapeutic composition may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in a ready to use form or requiring reconstitution immediately prior to administration.
  • the manner of administering formulations containing Nucleic Acid Ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intranasal or vaginal or rectal suppository.
  • Example 1 describes the various materials and experimental procedures used in Examples 2, 3, 4 and 6.
  • Example 2 describes the generation of 2′-NH 2 RNA ligands to C1q.
  • Example 3 describes the generation of 2′-F Nucleic Acid Ligands of Complement System Protein C3.
  • Example 4 describes the generation of 2′-F Nucleic Acid Ligands of Complement System Protein C5.
  • Example 5 describes the activation of the Complement System through C1q ligands.
  • Example 6 describes the generation of 2′-F RNA ligands to C1q.
  • Example 7 describes an assay for hemolytic inhibition for 2′-F RNA ligands to C5.
  • Example 8 describes an assay for inhibition of C5a release by a Nucleic Acid Ligand (clone C6) to Human C5.
  • Example 9 describes boundary experiments performed to determine the minimum binding sequence for Nucleic Acid Ligands to Human C5.
  • Example 10 describes a Biased SELEX experiment performed to improve Nucleic Acid Ligand affinity, using a 42 mer truncated sequence of clone C6 as the random sequence in the template.
  • Example 11 describes the results of 2′-OMe purine substitutions in a Human C5 Nucleic Acid Ligand in an interference assay.
  • Example 12 describes the structure of a 38 mer truncate of a Nucleic Acid Ligand to human C5.
  • Example 13 describes a hemolytic assay of 2′-OMe purine substituted Nucleic Acid Ligands to human C5.
  • This example provides general procedures followed and incorporated in Examples 2, 3, 4 and 6 for the identification of 2′-NH 2 and 2′-F RNA ligands to C1q, and 2′-F ligands to C3 and C5.
  • C1q, C3, C5 and C4-deficient guinea pig sera were obtained from Quidel (San Diego, Calif.).
  • Bovine serum albumin (BSA), rabbit anti-BSA, CRP, SAP and ⁇ -amyloid peptides 1-40 and 1-42 were obtained from Sigma (St. Louis, Mo.).
  • Nucleotides GTP, ATP and deoxynucleotides were obtained from Pharmacia (Uppsala, Sweden).
  • Taq polymerase was obtained from Perkin-Elmer (Norwalk, Conn.).
  • Modified nucleotides 2′-NH 2 -CTP and 2′-NH 2 -UTP, and 2′-F-CTP and 2′-F-UTP, were prepared as described in Jellinek et al. (1995) Biochem. 34:11363.
  • Avian reverse transcriptase was obtained from Life Sciences (St. Russia, Fla.) and T7 RNA polymerase from USB (Cleveland, Ohio.).
  • Nitrocellulose filters were obtained from Millipore (Bedford, Mass.). All chemicals were the highest grade available.
  • RNA was purified by electrophoresis on 8% acrylamide gels with 7 M urea, 10 mM Tris-Borate, 2 mM EDTA, pH 8.3 running buffer. After autoradiography, the band containing labeled, modified RNA transcript was excised and frozen at ⁇ 70° C., then 400 ⁇ L of 100 mM NaCl, 2 mM EDTA was added, the gel was mashed, and the slurry was spun through 2 cm of glass-wool (Rnase-free—Alltech Associates, Deerfield, Ill.) and two nitrocellulose filters.
  • RNA was precipitated by addition of 1 ⁇ 5 vol of 6.6 M NH 4 OAc, pH 7.7, plus 2 vol of ethanol. The pellet was washed twice with 80% ethanol, and taken to dryness. The dry RNA pellet was dissolved in phosphate buffered saline (Sambrook et al. (1989) Molecular Cloning. A laboratory Manual . Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) containing 1 mM MgCl 2 (MgPBS).
  • RNA Nucleic Acid Ligand plus C1q plus inhibitor e.g., the A-chain residue 14-26 site, SAP, ⁇ -amyloid peptide, CRP
  • CRP ⁇ -amyloid peptide
  • RNA ligand binding to C1q was also measured in the presence of immune-complexes, which would block the binding of ligands to C1q head-groups.
  • Immune complexes were formed by mixing 620 ⁇ g BSA at equivalence with 1 mL of rabbit anti-BSA (Sigma, St. Louis, Mo.) plus PEG 8000 added to 1% final concentration, and then the samples were incubated overnight at 4° C. The IC were pelleted by microfugation at 12,000 rpm for 10 minutes, washed five times with PBS, and suspended in 1 mL of MgPBS.
  • the C1q RNA Nucleic Acid Ligand was included in the initial ⁇ -amyloid peptide-whole human serum incubation mixture, and then C4 amounts assayed as above.
  • Family 1 contained 12 of the 19 total sequences.
  • Family 2 contained three sequences.
  • Both Family 3 and Family 4 contained two sequences.
  • Both Family 1 and Family 2 sequences contain G-rich regions and both have the repeated sequence motifs GGAG and GGUG. The identity and homology of Family 1 members is greatest in the 5′ half, which is G-rich.
  • the C-rich 3′ half has only short stretches of sequence homology, and these are shown only with inclusion of large gap regions.
  • Sequences from all families can be folded to give stem-loop structures with extensive Watson-Crick base-pairing.
  • the binding maximum is not 100% because of variable amounts of nucleic acid alterations taking place during purification. This is known because usually ligands can be bound to protein, extracted, and then re-bound, and give maximum binding approaching 100% (data not shown).
  • ligand #50 is competed by proteins which are known to bind the A-chain residue 14-26 site, including SAP, ⁇ -amyloid peptide and CRP. Finally, ligand #50 is competed by a peptide that has the same amino acid sequence as residues 14-26 on the A-chain. This result is further supported by results for hemolytic inhibition as described below.
  • RNA In order to generate ligands to complement protein C3, a library of about 10 14 RNA was generated that contained 30 nucleotides of contiguous random sequence flanked by defined sequences.
  • 30N random nucleotides of the initial Candidate Mixture were comprised of 2′-F pyrimidine bases.
  • the rounds of selection and amplification were carried out as described in Example 1 using art-known techniques.
  • the 30N7-2′-F-RNA and C3 were both incubated at 3 ⁇ M. There was barely detectable binding at this round. Both the RNA and C3 concentrations were decreased during the SELEX procedure. Sequences derived from the SELEX procedure are shown in Table 3 (SEQ ID NOS:21-46).
  • RNA template was synthesized with a 5′-fixed region containing the T7 promoter, followed by a 30N stretch of random sequence, and then with a 3′-fixed region (Table 1; SEQ ID NO:1). The rounds of selection and amplification were carried out as described in Example 1 using art-known techniques.
  • the initial rounds of the SELEX experiment were set up with high concentrations of 2′-F RNA (7.5 ⁇ M) and protein (3 ⁇ M), as the binding of C5 to unselected RNA was quite low.
  • the SELEX experiment was designed to promote binding of RNA at the C5a-C5b cleavage site. RNA and C5 were incubated together with small amounts of trypsin, with the reasoning that limited trypsin treatment of C5 produces a single site cleavage and generates C5a-like activity (Wetsel and Kolb (1983) J. Exp. Med. 157:2029). This cleavage led to a slight increase in random RNA binding.
  • RNA binding associated structurally with exposure of the C5a-like domain could evolve Nucleic Acid Ligands that bind near the C5 convertase site and could interfere with or inhibit C5 cleavage.
  • the SELEX experiment was performed simultaneously to both the native and to the mildly-trypsinized protein, so that Nucleic Acid Ligand evolution would pick the highest affinity winner. With this procedure the highest affinity winner against the multiple protein species would be evolved, and multiple aptamers and specific aptamers might be obtained out of a single SELEX experiment.
  • Nucleic Acid Ligands from each family were also assayed for inhibition of rat Complement System activity (Table 5; SEQ ID NOS:76-83). Nucleic Acid Ligands from Family I and Family III inhibited rat complement, whereas a Nucleic Acid Ligand from Family II did not.
  • An inhibitory Nucleic Acid Ligand can be used to inhibit Complement System activity in various rat disease models including, but not limited to, myasthenia gravis, myocardial infarction, glomerulonephritis, ARDS, arthritis and transplantation.
  • Complement System activation is also initiated on the erythrocyte membrane and is tested by hemolytic assays.
  • Known activators including 2′-OH poly-G and phosphorothioate oligonucleotides, as well as potential activators such as multimerized C1q Nucleic Acid Ligands and small (e.g., 15-mer) 2′-F poly-G oligonucleotides are coated on sheep erythrocytes and subsequent lysis of the erythrocytes by serum complement is measured.
  • Methods of coating oligonucleotides and Nucleic Acid Ligands on cells include passive adsorption, chemical conjugation, streptavidin-biotin coupling and specific Nucleic Acid binding. Following treatment with fresh rat or human serum, the deposition of complement components on the cell, membrane damage and lysis are measured by standard methods as would be known by one of skill in the art.
  • Nucleic Acid Ligands are dimerized using chemical cross-linkers of various lengths.
  • Nucleic Acid Ligand monomers are biotinylated and then multimerized with streptavidin. Each of these multimers are tested for complement activation and lysis of erythrocytes.
  • poly-G sequence to C1q Nucleic Acid Ligands provides additional binding ability and increases the ability of the oligonucleotide to activate the Complement System.
  • short poly-G sequences on individual C1 q Nucleic Acid Ligands can interact to form higher order structures, which serve to multimerize the C1q Nucleic Acid Ligands and cause activation.
  • Nucleic Acid Ligands that promote erythrocyte lysis are tested on nucleated cells, including lymphocytes and tumor cells.
  • Nucleated cells have mechanisms of complement resistance that erythrocytes lack.
  • nucleated cells can shed antigens, bleb off membrane vesicles containing the complement components and express increased levels of complement inhibitors as compared with erythrocytes and may up-regulate protective mechanisms upon initial complement attack.
  • activators are compared for amount of Complement System component deposition and extent of membrane damage.
  • different types and sources of tumor cells and lymphocytes are tested to determine if susceptibility is cell-type specific.
  • Nucleic Acid Ligands can be generated for virtually any target as described in the SELEX Patent Applications. Nucleic Acid Ligands to L-Selectin have been generated (See U.S. patent application Ser. No. 08/479,724, filed Jun. 7, 1995, entitled “High Affinity Nucleic Acid Ligands to Lectins,” now U.S. Pat. No. 5,780,228, which is incorporated herein by reference in its entirety). The diversity of lectin mediated functions provides a vast array of potential therapeutic targets for lectin antagonists. For example, antagonists to the mammalian selecting, a family of endogenous carbohydrate binding lectins, may have therapeutic applications in a variety of leukocyte-mediated disease states.
  • Inhibition of selectin binding to its receptor blocks cellular adhesion and consequently may be useful in treating inflammation, coagulation, transplant rejection, tumor metastasis, rheumatoid arthritis, reperfusion injury, stroke, myocardial infarction, bums, psoriasis, multiple sclerosis, bacterial sepsis, hypovolaemic and traumatic shock, acute lung injury and ARDS.
  • the coupling of C1q Nucleic Acid Ligands to L-Selectin Nucleic Acid Ligands makes the L-Selectin Nucleic Acid Ligand more efficient by promoting cell killing at the target.
  • C1q Nucleic Acid Ligands are coupled to L-Selectin Nucleic Acid Ligands, and the conjugates are tested for leukocyte lysis as described above.
  • Nucleic Acid Ligands to other cell surface targets, antibodies to all targets that do not themselves activate complement, cytokines, growth factors, or a ligand to a cell receptor could be coupled to a C1q Nucleic Acid Ligand and used for cell killing.
  • Nucleic Acid Ligand-mediated Complement System activation is tested in animals to evaluate in vivo Nucleic Acid Ligand action.
  • Erythrocytes and/or lymphocytes are coated with Nucleic Acid Ligands and injected into rats to test cell killing and lysis in vivo.
  • Activating Nucleic Acid Ligands are also coupled to a Mab that does not activate the Complement System, where the antibody is directed against a rat cell antigen (e.g., lymphocyte antigen). These cells are then coated with the Nucleic Acid Ligand-antibody conjugate and injected into rats. Alternatively, the Nucleic Acid Ligand-antibody conjugate is injected directly into the rat and then in vivo leukocyte killing is measured.
  • C1q Nucleic Acid Ligands cross-react with non-human C1q, and non-human C1q could be used for in vivo assays.
  • C1q Nucleic Acid Ligands are tested against species such as mouse, rat and rabbit C1q.
  • C1q is purified from serum and cross-reactivity with C1q Nucleic Acid Ligands is tested by nitrocellulose binding assay.
  • C1q is bound to immune complexes which are added to serum and then C1q Nucleic Acid Ligand binding to the aggregate is tested.
  • rat serum is depleted of rat C1q by continuous perfusion over a Ig-Sepharose column, and the serum is reconstituted with human C1 q by methods known to one of skill in the art. These reconstituted animals are then used to test C1q Nucleic Acid Ligands for targeted Complement System activation and cell killing.
  • the 2′-F RNA Nucleic Acid Ligands to C5 were assayed for hemolytic inhibition by including dilutions in a standard assay for human serum lysis of antibody-coated sheep erythrocytes. Sheep cells were mixed with a 1:40 dilution of serum containing Nucleic Acid Ligand or buffer, and incubated for 30 minutes at 37° C. After quenching with cold EDTA buffer, the samples were spun and supernatants read at OD 412 nm. Group I Nucleic Acid Ligands inhibited almost to background at 1 ⁇ M, with a K i of 60-100 nM. The results are shown in FIG. 1.
  • Clone C6 (SEQ ID NO:51) (Example 4) was selected for determination of a minimal binding sequence. This was done in the following two ways.
  • RNA sequences (5′ and 3′ boundaries) required for binding of clone C6 to C5 were determined by partially hydrolyzing clone C6 and determining protein binding (Green et al. (1995) Chem. Biol. 2:683). Briefly, clone C6 was synthesized as either 5′-[ 32 p]-kinase labeled (to determine the 3′ boundary) or 3′-[ 32 P]-pCp labeled (to determine the 5′ boundary) and the oligonucleotides were purified. Then the oligonucleotides were subjected to alkaline hydrolysis, which cleaves oligonucleotides from the 3′ end to purine bases.
  • RNA which bound to the C5 protein was partitioned on nitrocellulose and eluted from the protein.
  • the partitioned RNA together with an RNA ladder were run on an 8% acrylamide/7M urea sequencing gel. The boundary where removal of one more base would reduce or eliminate binding was determined by comparison of selected RNA (RNA which bound to C5) versus non-selected RNA (RNA which did not bind to C5).
  • FIG. 3A shows the results of the digestion of the 5′-kinase-labeled RNA.
  • the 3′-sequence (5′-end labeled) is aligned with the alkaline hydrolysis ladder.
  • the T 1 ladder On the left is the T 1 ladder and on the right are RNA selected with 5 ⁇ and 1 ⁇ concentrations of C5. The boundary where removal of a base eliminates binding is shown by the arrow.
  • the asterisk shows a G which is hypersensitive to T 1 .
  • FIG. 3B shows the results of the 3′-pCp-ligated RNA.
  • the 5′-sequence (3′-end-labled) is aligned with the alkaline hydrolysis ladder.
  • the T 1 and protein lanes, boundary and hypersensitive G nucleotides are as described for FIG. 3A.
  • a biased SELEX experiment was performed to improve Nucleic Acid Ligand affinity and to further define the structure.
  • the sequence of the 42 mer truncate (SEQ ID NO:75) from Example 9 (Table 8) was used as a template for the Biased SELEX experiment.
  • a synthetic template comprising a 42N random region flanked by new n8 fixed regions (Table 10; SEQ ID NO:163) was constructed and synthesized (Oligos, Etc., CT), where the random region was biased toward the 42 mer truncate of clone C6 from the first SELEX experiment.
  • a 42 mer random region was chosen rather than the minimal 38 mer sequence, as the four extra bases extended a terminal helix.
  • RNA and protein concentrations were started at 2.6 ⁇ M and 7.1 ⁇ M, respectively, similar to the first SELEX experiment.
  • the binding rapidly improved at round three.
  • RNA and protein concentrations were gradually reduced at each subsequent round to final concentrations by round nine of 62.5 pM and 31 pM, respectively.
  • the binding of the RNA pool to C5 was approximately 5 nM (Table 9), as compared to approximately 100 M for the RNA pool from the first SELEX experiment.
  • RNA pool after eight rounds of the Biased SELEX process was improved by 20-50 fold over the round twelve pool from the first SELEX experiment.
  • the overall improvement in K d from the random pool to pool from eight rounds of the Biased SELEX process is estimated to be greater than 10 5 -fold.
  • the isolated and cloned sequences from the Biased SELEX experiment are shown in Table 10 (SEQ ID NOS:164-189).
  • the two base-pair stem which is dispensable for binding is separated from the minimal 38 mer sequence. These bases show no selective pressure except to maintain the stem. None of the sequences exactly match the original template sequence.
  • the partially substituted 2′-OMe oligonucleotides were 5′-[ 32 P]-kinase-labeled.
  • the oligonucleotides were selected at 100 nM and 10 nM C5 and the binding to protein was greater than 10-fold over background filter binding.
  • the oligonucleotides were eluted from the protein, alkaline hydrolyzed and then run on a 20% acrylamide/7 M urea/TBE sequencing gel. On adjacent tracks were run oligonucleotides not selected with C5. Band intensities were quantitated with on an InstantImager (Packard, Meriden, Conn.).
  • the ratio of (the intensity of the bands selected by protein binding)/(band intensity for oligonucleotide not selected to protein) was calculated. These ratios were plotted versus nucleotide position and a linear fit determined (FIG. 4, open circles). The same calculation was made for mixed 2′-OH/2′-OMe oligonucleotides, and these ratios were compared with previously determined curve (FIG. 4, closed circles). Where 2′-OMe substitution did not interfere with binding the ratio was within one standard deviation of the 2′-OH ratio. However, where 2′-OMe substitution interfered with binding, the binding preference for 2′-OH purine increased the ratio.
  • the stem-loop structure has between 12 and 14 base-pairs: a) the proposed 5′, 3′-terminal base pairs (c1-a3, and U36-G38); b) stem-loop base-pairs (U11-U14 and G24-A27) are supported by covariant changes during the Biased SELEX procedure; and c) the middle stem (g7-C10 and G28-C34), which is generally conserved, U9-A32 which is invariant and g8-C33 conserved during the Biased SELEX procedure.
  • the u4 ⁇ c4 change improves binding, and this change is found in all clones from the Biased SELEX experiment, and G29, A29 variants are found only in clones from the Biased SELEX experiment.
  • the UUU bulge is generally conserved.
  • One original sequence contained two U bases, with no reduction in binding, and two Nucleic Acid Ligands with a single base substitution were found during Biased SELEX experiment.
  • the C10-G28 base-pair following the UUU-bulge is conserved. This region with a conserved bulge and stem is likely involved in protein interaction.
  • the stem-loop G15 to U23 is highly conserved, except for bases 19.
  • the 2′-OMe substitution pattern is consistent with this structure (SEQ ID NO:193; FIG. 5B). Positions where 2′-OMe substitutions can be made are shown in bold. The three positions which must be 2′-OH are shown as underlined. The obligate 2′-OH bases at g5, G17 and A32 are in bulge or loop regions which might form unique three-dimensional structures required for protein binding. Allowed positions for 2′-OMe substitution occur in stem regions where a standard helical structure is more likely.
  • oligonucleotides were synthesized based on clone YL-13 from the Biased SELEX experiment to compare the effect of 2′-OMe substitution on hemolytic inhibition: (1) a 38 mer truncate B2010 (SEQ ID NO:194), in which all of the nucleotides were 2′-OH; (2) a 38 mer in which one nucleotide (position 20) was a 2′-OMe-G (B2070; SEQ ID NO:195); and (3) a 38 mer in which the maximum number of allowable positions (positions 2, 7, 8, 13, 14, 15, 20, 21, 22, 26, 27, 28, 36 and 38) were synthesized as 2′-OMe-G and 2′-OMe-A (M6040; SEQ ID NO:196) as shown in Table 13.
  • N′s at position 33-62 are a or c or g or t 1 taatacgact cactataggg aggacgatgc ggnnnnnnnnnnnnnnnnnnnnnnn 60 nncagacgac tcgcccga 78 2 61 RNA Artificial Sequence unsure (16).
  • N′s at position 16-55 are a or c or g or u.
  • N at position 52 is a or c or g or u 42 ggaggacgau gcggggccua aagucaagug aucauccccu gcgucagacg anucgcccga 60 43 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 43 gggaggacga ugcggguggc gauuccaagu cuuccgugaa cauggucaga cgacucgccc 60 g 61 44 62 RNA Artificial Sequence unsure (57) Description of Artificial Sequence Completely Synthesized Nucleic Acid.
  • N at position 57 is a or c or g or u 44 gggaggacga ugcgggugac ucgauaucuu ccaaucugua cauggucaga cgacucnccc 60 ga 62 45 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 45 gggaggacga ugcgguggcg auuccaaguc uuccgugaac auggucagac gacucgcccg 60 a 61 46 58 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 46 gggaggacga ugcgguggcg auuccaaguc uuccgugaac aucagacgac ucgcccga 58 47 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 47 gggaggacga ugcgguccgg cgg
  • N at position 30 is a or c or g or u 64 gggaggacga ugcgguguuc agcauucagn aucuucacgu gucgucagac gacucgcccg 60 a 61 65 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 65 gggaggacga ugcgguguuc accauucaga ucuucacgug ucgucagacg acucgcccga 60 66 57 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 66 gggaggacga ugcuguucag cauucagauc uucacgugug ucagacgacu cgccga 57 67 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 67 gggaggacga ugcgguuucg
  • N at position 34 is a or c or g or u 128 gggaggacga ugcggcggga aguuugaggu guanuaccug uugucugguc agacgacucg 60 cccga 65 129 67 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 129 gggaggacga ugcggcucaa cucucccaca gacgacucgc ccgggccucc ucagacgacu 60 cgcccga 67 130 58 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 130 gggaggacga ugcgggacuc cucgaccgac ucgaccggcu cgucagacga cucgccga 58 131 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 131
  • N at position 33 is a or c or g or u 154 gggaggacga ugcgguuccg caaaguagau aunucauccg cacgucagac gacucgcccg 60 a 61 155 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 155 gggaggacga ugcgguugag uggacagugc gauucguuuuu ggggucagac gacucgcccg 60 a 61 156 98 DNA Artificial Sequence unsure (33)..(72) Description of Artificial Sequence Completely Synthesized Nucleic Acid.
  • N′s at positions 33-72 are a or c or g or t.
  • N′s at positions 16-65 are
  • N at position 33 is a or c or g or u 187 gggagauaag aauaacgcu caaggacgac gcngucugau gcgcagagug ucaguuuacc 60 uucgacuucg acaggaggcu cacaacaggc 90 188 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 188 gggagauaag aauaaacgcu caaggacgac gcggucugau gcgcagagug ucaguuuacc 60 ucgucuucg acaggaggcu cacaacaggc 90 189 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 189 gggagauaag aauaaacgcu caaggacgac gcggucggaug g uccguuuacc 60

Abstract

Methods are described for the identification and preparation of high-affinity Nucleic Acid Ligands to Complement System Proteins. Methods are described for the identification and preparation of high affinity Nucleic Acid Ligands to Complement System Proteins C1q, C3 and C5. Included in the invention are specific RNA ligands to C1q, C3 and C5 identified by the SELEX method.

Description

    RELATED APPLICATIONS
  • This application is a continuation of U.S. patent application Ser. No. 10/037,282, filed Jan. 3, 2002, which is a continuation of U.S. patent application Ser. No. 09/163,025, filed Sep. 29, 1998, now U.S. Pat. No. 6,395,888, which is a continuation-in-part of U.S. patent application Ser. No. 09/023,228, filed Feb. 12, 1998, now U.S. Pat. No. 6,140,490, which is a continuation-in-part of PCT/US97/01739 (International Publication No. WO 97/28178), filed Jan. 30, 1997, which is a continuation-in-part of U.S. patent. application Ser. No. 08/595,335, filed Feb. 1, 1996, now abandoned. This application is also a continuation-in-part of U.S. patent application Ser. No. 10/037,986, filed Oct. 18, 2001, which is a continuation of U.S. patent application Ser. No. 09/502,344, filed Feb. 10, 2000, now U.S. Pat. No. 6,331,398, which is a continuation of U.S. Patent. application Ser. No. 09/143,190, filed Aug. 27, 1998, now U.S. Pat. No. 6,110,900, which is a continuation of U.S. patent application Ser. No. 08/469,609, filed Jun. 6, 1995, now U.S. Pat. No. 5,843,653, which is a continuation of U.S. patent application Ser. No. 08/428,964, filed Apr. 25, 1995, now abandoned. U.S. patent application Ser. No. 08/469,609 is also a continuation of U.S. patent application Ser. No. 08/409,442, filed Mar. 24, 1995, now U.S. Pat. No. 5,696,249 and a continuation of U.S. patent application Ser. No. 08/412,110, filed Mar. 27, 1995, now U.S. Pat. No. 5,670,637. Ser. Nos. 08/428,964, 08/409,442, and 08/412,110 are continuations of U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, now U.S. Pat. No. 5,475,096, which is a continuation-in-part application of U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, now abandoned.[0001]
  • FIELD OF THE INVENTION
  • Described herein are methods for identifying and preparing high-affinity Nucleic Acid Ligands to Complement System Proteins. The method utilized herein for identifying such Nucleic Acid Ligands is called SELEX™, an acronym for Systematic Evolution of Ligands by EXponential enrichment. Described herein are methods for identifying and preparing high-affinity Nucleic Acid Ligands to the Complement System Proteins C1q, C3 and C5. This invention includes high affinity Nucleic Acid Ligands of C1q, C3 and C5. Also disclosed are RNA ligands of C1q, C3 and C5. Also disclosed are Nucleic Acid Ligands that inhibit and/or activate the Complement System. The oligonucleotides of the present invention are useful as pharmaceuticals or diagnostic agents. [0002]
  • BACKGROUND OF THE INVENTION
  • The complement system comprises a set of at least 20 plasma and membrane proteins that act together in a regulated cascade system to attack extracellular forms of pathogens (Janeway et al. (1994) [0003] Immunobiology: The Immune System in Health and Disease. Current Biology Ltd, San Francisco, pp. 8:35-8:55; Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3):265-298). There are two distinct enzymatic activation cascades, the classical and alternative pathways, and a non-enzymatic pathway known as the membrane attack pathway.
  • The classical pathway is usually triggered by an antibody bound to a foreign particle. It comprises several components, C1, C4, C2, C3 and C5 (listed by order in the pathway). Initiation of the classical pathway of the Complement System occurs following binding and activation of the first complement component (C1) by both immune and non-immune activators (Cooper (1985) Adv. Immunol. 37:151). C1 comprises a calcium-dependent complex of components C1q, C1r and C1s, and is activated through binding of the C1q component. C1 q contains six identical subunits and each subunit comprises three chains (the A, B and C chains). Each chain has a globular head region which is connected to a collagen-like tail. Binding and activation of C1q by antigen-antibody complexes occurs through the C1q head group region. Numerous non-antibody C1q activators, including proteins, lipids and nucleic acids (Reid et al. (1993) [0004] The Natural Immune System: Humoral Factors. E. Sim, ed. IRL Press, Oxford, p. 151) bind and activate through a distinct site on the collagen-like stalk region.
  • Non-antibody C1q protein activators include C-reactive protein (CRP) (Jiang et al. (1991) J. Immunol. 146:2324) and serum amyloid protein (SAP) (Bristow et al. (1986) Mol. Immunol. 23:1045); these will activate C1q when aggregated by binding to phospholipid or carbohydrate, respectively. Monomeric CRP or SAP do not activate C1q. C1q is also activated through binding to aggregated β-amyloid peptide (Schultz et al. (1994) Neurosci. Lett. 175:99; Snyder et al. (1994) Exp. Neurol. 128:136), a component of plaques seen in Alzheimer's disease (Jiang et al. (1994) J. Immunol. 152:5050; Eikelenboom and Stam (1982) Acta Neuropathol (Berl) 57:239; Eikelenboom et al. (1989) Virchows Arch. [B] 56:259; Rogers et al. (1992) Proc. Natl. Acad. Sci. USA 89:10016; Dietzschold et al. (1995) J. Neurol. Sci. 130:11). C1q activation might also exacerbate the tissue damage associated with Alzheimer's disease. These activators bind C1q on its collagen-like region, distant from the head-group region where immunoglobulin activators bind. Other proteins which bind the C1q collagen-like region include collagen (Menzel et al. (1981) Biochim. Biophys. Acta 670:265), fibronectin (Reid et al. (1984) Acta Pathol. Microbiol. Immunol. Scand. Sect. C 92 (Suppl. 284):11), laminin (Bohnsack et al. (1985) Proc. Natl. Acad. Sci. USA 82:3824), fibrinogen and fibrin (Entwistle et al. (1988) Biochem. 27:507), HIV rsgp41 (Stoiber et al. (1995) Mol. Immunol. 32:371), actin (Nishioka et al. (1982) Biochem. Biophys. Res. Commun. 108:1307) and tobacco glycoprotein (Koethe et al. (1995) J. Immunol. 155:826). [0005]
  • C1q also binds and can be activated by anionic carbohydrates (Hughes-Jones et al. (1978) Immunology 34:459) including mucopolysaccharides (Almeda et al. (1983) J. Biol. Chem. 258:785), fucans (Blondin et al. (1994) Mol. Immunol. 31 :247), proteoglycans (Silvestri et al. (1981) J. Biol. Chem. 256:7383), and by lipids including lipopolysaccharide (LPS) (Zohair et al. (1989) Biochem. J. 257:865; Stoiber et al. (1994) Eur. J. Immunol. 24:294). Both DNA (Schravendijk and Dwek (1982) Mol. Immunol. 19:1179; Rosenberg et al. (1988) J. Rheumatol 15:1091; Uwatoko et al. (1990) J. Immunol. 144:3484) and RNA (Acton et al. (1993) J. Biol. Chem. 268:3530) can also bind and potentially activate C1q. Intracellular components which activate C1q include cellular and subcellular membranes (Linder (1981) J. Immunol. 126:648; Pinckard et al. (1973) J. Immunol. 110: 1376; Storrs et al. (1981) J. Biol. Chem. 256:10924; Giclas et al. (1979) J. Immmunol. 122:146; Storrs et al. (1983) J. Immunol. 131:416), intermediate filaments (Linder et al. (1979) Nature 278:176) and actin (Nishioka et al. (1982) Biochem. Biophys. Res. Commun. 108:1307). All of these interactions would recruit the classical pathway for protection against bacterial (or viral) infection, or as a response to tissue injury (Li et al. (1994) J. Immunol. 152:2995) in the absence of antibody. [0006]
  • A binding site for non-antibody activators including CRP (Jiang et al. (1991) J. Immunol. 146:2324), SAP (Ying et al. (1993) J. Immunol. 150:169), β-amyloid peptide (Newman (1994) Curr. Biol. 4:462) and DNA (Jiang et al. (1992) J. Biol. Chem. 267:25597) has been localized to the amino terminus of C1q A chain at residues 14-26. A synthetic peptide comprising this sequence effectively inhibits both binding and activation. The peptide 14-26 contains several basic residues and matches one of the heparin binding motifs (Yabkowitz et al. (1989) J. Biol. Chem. 264:10888; Cardin et al. (1989) Arteriosclerosis 9:21). The peptide is also highly homologous with peptide 145-156 in collagen-tailed acetylcholinesterase; this site is associated with heparin-sulfate basement membrane binding (Deprez et al. (1995) J. Biol. Chem. 270:11043). A second C1q A chain site at residues 76-92 also might be involved in weaker binding; this site is at the junction of the globular head region and the collagen-like tail. [0007]
  • The second enzymatically activated cascade, known as the alternative pathway, is a rapid, antibody-independent route for the Complement System activation and amplification. The alternative pathway comprises several components, C3, Factor B, and Factor D. Activation of the alternative pathway occurs when C3b, a proteolytic cleavage form of C3, is bound to an activating surface such as a bacterium. Factor B is then bound to C3b, and cleaved by Factor D to yield the active enzyme, Ba. The enzyme Ba then cleaves more C3 to C3b, producing extensive deposition of C3b-Ba complexes on the activating surface. When a second C3b is deposited, forming a C3b-C3b-Ba complex, the enzyme can then cleave C5 and trigger activation of the terminal pathway. [0008]
  • The non-enzymatic terminal pathway, also known as the membrane attack pathway, comprises the components C5, C6, C7, C8 and C9. Activation of this membrane attack pathway results when the C5 component is enzymatically cleaved by either the classical or alternative pathway to yield the small C5a polypeptide (9 kDa) and the large C5b fragment (200 kDa). The C5a polypeptide binds to a 7 transmembrane G-protein coupled receptor which was originally described on leukocytes and is now known to be expressed on a variety of tissues including hepatocytes (Haviland et al. (1995) J. Immunol. 154:1861) and neurons (Gasque et al. (1997) Am. J. Pathol. 150:31). The C5a molecule is the primary chemotactic component of the human Complement System and can trigger a variety of biological responses including leukocyte chemotaxis, smooth muscle contraction, activation of intracellular signal transduction pathways, neutrophil-endothelial adhesion (Mulligan et al. (1997) J. Immunol. 158:1857), cytokine and lipid mediator release and oxidant formation. The larger C5b fragment binds sequentially to later components to form the C5b-9 membrane attack complex (MAC). The C5b-9 MAC can directly lyse erythrocytes, and in greater quantities is lytic for leukocytes and is damaging to tissues such as muscle, epithelial and endothelial cells (Stahl et al. (1997) Circ. Res. 76:575). In sublytic amounts the MAC can stimulate upregulation of adhesion molecules, intracellular calcium increase and cytokine release (Ward (1996) Am. J. Pathol. 149:1079). In addition, the C5b-9 MAC can stimulate cells such as endothelial cells and platelets without causing cell lysis. The non-lytic effects of C5a and the C5b-9 MAC are sometimes quite similar. [0009]
  • The Complement System has an important role in defense against bacterial and viral infection, and possibly in immune surveillance against tumors. This is demonstrated most clearly in humans who are deficient in complement components. Individuals deficient in early components (C1, C4, C2 or C3) suffer from recurrent infections, while individuals deficient in late components (C5 through C9) are susceptible to nisseria infection. Complement classical pathway is activated on bacteria by antibodies, by binding of CRP or SAP, or by direct activation through LPS. Complement alternative pathway is activated through binding of C3 to the cell coat. Complement can be activated by viruses through antibodies, and can also be activated on viral infected cells because these are recognized as foreign. In a similar way, transformed cells can be recognized as foreign and can be lysed by the Complement System or targeted for immune clearance. [0010]
  • Activation of the Complement System can and has been used for therapeutic purposes. Antibodies which were produced against tumor cells were then used to activate the Complement System and cause tumor rejection. Also, the Complement System is used together with polyclonal or monoclonal antibodies to eliminate unwanted lymphocytes. For example, anti-lymphocyte globulin or monoclonal anti-T-cell antibodies are used prior to organ transplantation to eliminate lymphocytes which would otherwise mediate rejection. [0011]
  • Although the Complement System has an important role in the maintenance of health, it has the potential to cause or contribute to disease. The Complement System has been implicated in numerous renal, rheumatological, neurological, dermatological, hematological, vascular/pulmonary, allergy, infectious, biocompatibility/shock and other diseases or conditions (Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3 :265-298; Matis and Rollins (1995) Nature Medicine 1(8):839-842). The Complement System is not necessarily the only cause of the disease state, but it may be one of several factors, each of which contributes to pathogenesis. [0012]
  • Several pharmaceuticals have been developed that inhibit the Complement System in vivo, however, many cause toxicity or are poor inhibitors (Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3):265-298). Heparins, K76COOH and nafamstat mesilate have been shown to be effective in animal studies (Morgan (1995) Crit. Rev. in Clin Lab. Sci. 32(3):265-298). Recombinant forms of naturally occurring inhibitors of the Complement System have been developed or are under consideration, and these include the membrane regulatory proteins Complement Receptor 1 (CR1), Decay Accelerating Factor (DAF), Membrane Cofactor Protein (MCP) and CD59. [0013]
  • C5 is an attractive target for the development of a Complement System inhibitor, as both the classical and alternative pathways converge at component C5 (Matis and Rollins (1995) Nature Medicine 1(8):839-842). In addition, inhibition of C5 cleavage blocks both the C5a and the C5b effects on leukocytes and on tissue such as endothelial cells (Ward (1996) Am. J. Pathol. 149:1079); thus C5 inhibition can have therapeutic benefits in a variety of diseases and situations, including lung inflammation (Mulligan et al. (1998) J. Clin. Invest. 98:503), extracorporeal complement activation (Rinder et al. (1995) J. Clin. Invest. 96:1564) or antibody-mediated complement activation (Biesecker et al. (1989) J. Immunol. 142:2654). Matis and Rollins ((1995) Nature Medicine 1(8):839-842) have developed C5-specific monoclonal antibodies as an anti-inflammatory biopharmaceutical. Both C5a and the MAC have been implicated in acute and chronic inflammation associated with human disease, and their role in disease states has been confirmed in animal models. C5a is required for complement- and neutrophil-dependent lung vascular injury (Ward (1997) J. Lab. Clin. Med. 129:400; Mulligan et al. (1998) J. Clin. Invest. 98:503), and is associated with neutrophil and platelet activation in shock and in burn injury (Schmid et al. (1997) Shock 8:119). The MAC mediates muscle injury in acute autoimmune myasthenia gravis (Biesecker and Gomez (1989) J. Immunol. 142:2654), organ rejection in transplantation (Baldwin et al. (1995) Transplantation 59:797; Brauer et al. (1995) Transplantation 59:288; Takahashi et al. (1997) Immunol. Res. 16:273) and renal injury in autoimmune glomerulonephritis (Biesecker (1981) J. Exp. Med. 39:1779; Nangaku (1997) Kidney Int. 52:1570). Both C5a and the MAC are implicated in acute myocardial ischemia (Homeister and Lucchesi (1994) Annu. Rev. Pharmacol. Toxicol. 34:17), acute (Bednar et al. (1997) J. Neurosurg. 86:139) and chronic CNS injury (Morgan (1997) Exp. Clin. Immunogenet. 14:19), leukocyte activation during extracorporeal circulation (Sun et al. (1995) Nucleic Acids Res. 23:2909; Spycher and Nydegger (1995) Infushionsther. Transfusionsmed. 22:36) and in tissue injury associated with autoimmune diseases including arthritis and lupus (Wang et al. (1996) Immunology 93:8563). Thus, inhibiting cleavage of C5 prevents generation of two potentially damaging activities of the Complement System. Inhibiting C5a release eliminates the major Complement System chemotactic and vasoactive activity, and inhibiting C5b formation blocks assembly of the cytolytic C5b-9 MAC. Furthermore, inhibition of C5 prevents injury by the Complement System while leaving intact important Complement System defense and clearance mechanisms, such as C3 and C1q phagocytic activity, clearance of immune complexes and the innate immune response (Carrol (1998) Ann. Rev. Immunol. 16:545). [0014]
  • C3 is an attractive target for the development of a Complement System inhibitor, as it is common to both pathways. Inhibition of C3 using recombinant versions of a natural inhibitors (Kalli et al. (1994) Springer Semin. Immunopathol. 15:417) can prevent cell-mediated tissue injury (Mulligan et al. (1992) J. Immunol. 148:1479) and this has been shown to have therapeutic benefit in diseases such as myocardial infarction (Weisman et al. (1990) Science 249:146) and liver ischemia/reperfusion (Chavez-Cartaya et al. (1995) Transplantation 59:1047). Controlling C3 limits most biological activities of the Complement System. Most natural inhibitors, including DAF, MCP, CR1 and Factor H target C3. [0015]
  • SELEX™[0016]
  • A method for the in vitro evolution of Nucleic Acid molecules with highly specific binding to target molecules has been developed. This method, Systematic Evolution of Ligands by EXponential enrichment, termed the SELEX process, is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by Exponential Enrichment,” now abandoned; U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands,” now U.S. Pat. No. 5,475,096; U.S. patent application Ser. No. 07/931,473, filed Aug. 17, 1992, entitled “Methods for Identifying Nucleic Acid Ligands,” now U.S. Pat. No. 5,270,163 (see also WO 91/19813), each of which is herein specifically incorporated by reference in its entirety. Each of these applications, collectively referred to herein as the SELEX Patent Applications, describes a fundamentally novel method for making a Nucleic Acid Ligand to any desired Target molecule. [0017]
  • The SELEX method involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of Nucleic Acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the Target under conditions favorable for binding, partitioning unbound Nucleic Acids from those Nucleic Acids which have bound specifically to Target molecules, dissociating the Nucleic Acid-Target complexes, amplifying the Nucleic Acids dissociated from the Nucleic Acid-Target complexes to yield a ligand-enriched mixture of Nucleic Acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity Nucleic Acid Ligands to the Target molecule. [0018]
  • The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” now abandoned (see also U.S. Pat. No. 5,707,796), describes the use of the SELEX method in conjunction with gel electrophoresis to select Nucleic Acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands,” now abandoned, (see also U.S. Pat. No. 5,763,177) describes a SELEX-based method for selecting Nucleic Acid Ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a Target molecule. U.S. patent application Ser. No. 08/134,028, filed Oct. 7, 1993, entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” now abandoned (see also U.S. Pat. No. 5,580,737), describes a method for identifying highly specific Nucleic Acid Ligands able to discriminate between closely related molecules, termed Counter-SELEX. U.S. patent application Ser. No. 08/143,564, filed Oct. 25, 1993, entitled “Systematic Evolution of Ligands by EXponential Enrichment: Solution SELEX,” now abandoned, (see also U.S. Pat. No. 5,567,588) and U.S. patent application Ser. No. 08/792,075, filed Jan. 31, 1997, entitled “Flow Cell SELEX,” now U.S. Pat. No. 5,861,254, describe SELEX-based methods which achieve highly efficient partitioning between oligonucleotides having high and low affinity for a Target molecule. U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev,” now U.S. Pat. No. 5,496,938, describes methods for obtaining improved Nucleic Acid Ligands after the SELEX process has been performed. U.S. patent application Ser. No. 08/400,440, filed Mar. 8, 1995, entitled “Systematic Evolution of Ligands by EXponential Enrichment: Chemi-SELEX,” now U.S. Pat. No. 5,705,337, describes methods for covalently linking a ligand to its Target. [0019]
  • The SELEX method encompasses the identification of high-affinity Nucleic Acid Ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified Nucleic Acid Ligands containing modified nucleotides are described in U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” now abandoned, (see also U.S. Pat. No. 5,660,985) that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. patent application Ser. No. 08/134,028, now U.S. Pat. No. 5,580,737, supra, describes highly specific Nucleic Acid Ligands containing one or more nucleotides modified with 2′-amino (2′-NH[0020] 2), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of Known and Novel 2′ Modified Nucleosides by Intramolecular Nucleophilic Displacement,” now abandoned, describes oligonucleotides containing various 2′-modified pyrimidines.
  • The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. patent application Ser. No. 08/284,063, filed Aug. 2, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX,” now U.S. Pat. No. 5,637,459 and U.S. patent application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX,” now U.S. Pat. No. 5,683,867, respectively. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules. Each of the above described patent applications which describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety. [0021]
  • BRIEF SUMMARY OF THE INVENTION
  • The present invention includes methods of identifying and producing Nucleic Acid Ligands to Complement System Proteins and homologous proteins and the Nucleic Acid Ligands so identified and produced. By homologous proteins it is meant a degree of amino acid sequence identity of 80% or more. Exemplified herein is a method of identifying and producing Nucleic Acid Ligands to C1q, C3 and C5, and the Nucleic Acid Ligands so produced. Nucleic Acid Ligand sequences are provided that are capable of binding specifically to C1q, C3 and C5. In particular, RNA sequences are provided that are capable of binding specifically the C1q, C3 and C5. Specifically included in the invention are the RNA ligand sequences shown in Tables 2-6, 8, 10 and 12-13 and FIGS. [0022] 5A-B (SEQ ID NOS: 5-155 and 160-196). Also included in the invention are Nucleic Acid Ligands that inhibit the function of proteins of the Complement System. Specifically included in the invention herein are RNA ligands that inhibit the function of C1 q, C3 and C5. Also included are Nucleic Acid Ligands that inhibit and/or activate the Complement System.
  • Further included in this invention is a method of identifying Nucleic Acid Ligands and Nucleic Acid Ligand sequences to Complement System Proteins comprising the steps of (a) preparing a Candidate Mixture of Nucleic Acids, (b) contacting the Candidate Mixture of Nucleic Acids with a Complement System Protein, (c) partitioning between members of said Candidate Mixture on the basis of affinity to said Complement System Protein, and (d) amplifying the selected molecules to yield a mixture of Nucleic Acids enriched for Nucleic Acid sequences with a relatively higher affinity for binding to said Complement System Protein. [0023]
  • Also included in this invention is a method of identifying Nucleic Acid Ligands and Nucleic Acid Ligand sequences to C1q, C3 and C5, comprising the steps of (a) preparing a Candidate Mixture of Nucleic Acids, (b) contacting the Candidate Mixture of Nucleic Acids with C1q, C3 or C5, (c) partitioning between members of said Candidate Mixture on the basis of affinity to C1q, C3 or C5, and (d) amplifying the selected molecules to yield a mixture of Nucleic Acids enriched for Nucleic Acid sequences with a relatively higher affinity for binding to C1q, C3 or C5. [0024]
  • More specifically, the present invention includes the RNA ligands to C1q, C3 and C5 identified according to the above-described method, including RNA ligands to C1q, including those ligands shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS: 84-155), RNA ligands to C3, including those sequences shown in Table 3 (SEQ ID NOS:21-46), and RNA ligands to C5, including those sequences shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. [0025] 5A-B (SEQ ID NOS:160 and 193). Also included are RNA ligands to C1q, C3 and C5 that are substantially homologous to any of the given ligands and that have substantially the same ability to bind C1q, C3 or C5, and inhibit the function of C1q, C3 or C5. Further included in this invention are Nucleic Acid Ligands to C1q, C3 and C5 that have substantially the same structural form as the ligands presented herein and that have substantially the same ability to bind C1q, C3 or C5 and inhibit the function of C1q, C3 or C5.
  • The present invention also includes modified nucleotide sequences based on the RNA ligands identified herein and mixtures of the same.[0026]
  • BRIEF DESCRIPTION OF THE FIGURES
  • FIG. 1 shows the results of an inhibition assay in which 2′-F RNA ligands C 12 (SEQ ID NO:59), A6 (SEQ ID NO:48), K7 (SEQ ID NO:50), C9 (SEQ ID NO:58), E5c (SEQ ID NO:47) and F8 (SEQ ID NO:49) to human C5 were incubated with antibody-coated sheep erythrocytes and whole human serum. The results are presented as optical density (OD) versus concentration of ligand in nM. [0027]
  • FIG. 2 shows the % C5a generation as a function of concentration of clone C6 (SEQ ID NO:51). [0028]
  • FIG. 3A shows a sequencing gel of 5′-kinase-labeled clone C6 (SEQ ID NO:51) after alkaline hydrolysis or digestion with T[0029] 1 nuclease. The 3′-sequence (5′-end labeled) is aligned with the alkaline hydrolysis ladder. On the left is the T1 ladder and on the right are RNA selected with 5× and 1× concentrations of C5. The boundary where removal of a base eliminates binding is shown by the arrow. The asterisk shows a G which is hypersensitive to T1.
  • FIG. 3B shows a sequencing gel of 3′-pCp-ligated clone C6 after alkaline hydrolysis or digestion with T[0030] 1 nuclease. The 5′-sequence (3′-end-labled) is aligned with the alkaline hydrolysis ladder. The T1 and protein lanes, boundary and hypersensitive G nucleotides are as described for FIG. 3A.
  • FIG. 4 shows the results of the 2′-O-methyl interference assay. Positions where 2′-OH purines can be substituted with 2′-O-methyl were determined from binding interference. Plotted is the ratio of (the intensity of bands selected by protein)/(the band intensity for oligonucleotides not selected by protein) with a linear curve fit (open circles). The same ratio for mixed 2′-OH:2′-OMe nucleotides is also plotted (closed circles). [0031]
  • FIG. 5A shows the proposed structure of the 38 mer truncate (SEQ ID NO:160) of clone C6 (SEQ ID NO:51) together with alternative bases. [0032]
  • FIG. 5B shows the 2′-O-methyl substitution pattern of a 38 mer truncate (SEQ ID NO: 193 of clone C6 (SEQ ID NO:51). Positions where 2′-OMe substitutions can be made are shown in bold. Positions which must be 2′-OH are underlined. [0033]
  • FIG. 6 shows the % hemolysis verses concentration of nucleic acid ligand (μm) for a 38 mer truncate of clone YL-13 (SEQ ID NO: 175) without 2′-OMe substitution (SEQ ID NO:194; open circles), with a 2′-OMe substitution at position 20 (SEQ ID NO:195; closed triangles) and with 2′-OMe substitutions at [0034] positions 2, 7, 8, 13, 14, 15, 20, 21, 22, 26, 27, 28, 36 and 38 (SEQ ID NO:196; closed circles).
  • DETAILED DESCRIPTION OF THE INVENTION
  • This application describes Nucleic Acid Ligands to Complement System Proteins identified generally according to the method known as SELEX. As stated earlier, the SELEX technology is described in detail in the SELEX Patent Applications which are incorporated herein by reference in their entirety. Certain terms used to describe the invention herein are defined as follows: [0035]
  • “Nucleic Acid Ligand” as used herein is a non-naturally occurring Nucleic Acid having a desirable action on a Target. A desirable action includes, but is not limited to, binding of the Target, catalytically changing the Target, reacting with the Target in a way which modifies/alters the Target or the functional activity of the Target, covalently attaching to the Target as in a suicide inhibitor, and facilitating the reaction between the Target and another molecule. In the preferred embodiment, the desirable action is specific binding to a Target molecule, such Target molecule being a three dimensional chemical structure other than a polynucleotide that binds to the Nucleic Acid Ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein the Nucleic Acid Ligand is not a Nucleic Acid having the known physiological function of being bound by the Target molecule. Nucleic Acid Ligands include Nucleic Acids that are identified from a Candidate Mixture of Nucleic Acids, said Nucleic Acid Ligand being a ligand of a given Target by the method comprising: a) contacting the Candidate Mixture with the Target, wherein Nucleic Acids having an increased affinity to the Target relative to the Candidate Mixture may be partitioned from the remainder of the Candidate Mixture; b) partitioning the increased affinity Nucleic Acids from the remainder of the Candidate Mixture; and c) amplifying the increased affinity Nucleic Acids to yield a ligand-enriched mixture of Nucleic Acids. [0036]
  • “Candidate Mixture” is a mixture of Nucleic Acids of differing sequence from which to select a desired ligand. The source of a Candidate Mixture can be from naturally-occurring Nucleic Acids or fragments thereof, chemically synthesized Nucleic Acids, enzymatically synthesized Nucleic Acids or Nucleic Acids made by a combination of the foregoing techniques. In a preferred embodiment, each Nucleic Acid has fixed sequences surrounding a randomized region to facilitate the amplification process. [0037]
  • “Nucleic Acid” means both DNA, RNA, single-stranded or double-stranded and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the Nucleic Acid Ligand bases or to the Nucleic Acid Ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping. [0038]
  • “SELEX™” methodology involves the combination of selection of Nucleic Acid Ligands which interact with a Target in a desirable manner, for example binding to a protein, with amplification of those selected Nucleic Acids. Iterative cycling of the selection/amplification steps allows selection of one or a small number of Nucleic Acids which interact most strongly with the Target from a pool which contains a very large number of Nucleic Acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved. In the present invention, the SELEX methodology is employed to obtain Nucleic Acid Ligands to C1q, C3 and C5. The SELEX methodology is described in the SELEX Patent Applications. [0039]
  • “Target” means any compound or molecule of interest for which a ligand is desired. A Target can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc. without limitation. In this application, the Target is a Complement System Protein, preferably C1q, C3 and C5. [0040]
  • “Complement System Protein” means any protein or component of the Complement System including, but not limited to, C1, C1q, C1r, C1s, C2, C3, C3a, C3b, C4, C4a, C5, C5a, C5b, C6, C7, C8, C9, Factor B (B), Factor D (D), Factor H (H) and receptors thereof, and other soluble and membrane inhibitors/control proteins. [0041]
  • “Complement System” is a set of plasma and membrane proteins that act together in a regulated cascade system to attack extracellular forms of pathogens or infected or transformed cells, and in clearance of immune reactants or cellular debris. The Complement System can be activated spontaneously on certain pathogens or by antibody binding to the pathogen. The pathogen becomes coated with Complement System Proteins (opsonized) for uptake and destruction. The pathogen can also be directly lysed and killed. Similar mechanisms target infected, transformed or damaged cells. The Complement System also participates in clearance of immune and cellular debris. [0042]
  • The SELEX process is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled “Systematic Evolution of Ligands by EXponential Enrichment,” now abandoned; U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands,” now U.S. Pat. No. 5,475,096; U.S. patent application Ser. No. 07/931,473, filed Aug. 17, 1992, entitled “Methods for Identifying Nucleic Acid Ligands,” now U.S. Pat. No. 5,270,163 (see also WO 91/19813). These applications, each specifically incorporated herein by reference, are collectively called the SELEX Patent Applications. [0043]
  • In its most basic form, the SELEX process may be defined by the following series of steps: [0044]
  • 1) A Candidate Mixture of Nucleic Acids of differing sequence is prepared. The Candidate Mixture generally includes regions of fixed sequences (i.e., each of the members of the Candidate Mixture contains the same sequences in the same location) and regions of randomized sequences. The fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the Target, or (c) to enhance the concentration of a given structural arrangement of the Nucleic Acids in the Candidate Mixture. The randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent). [0045]
  • 2) The Candidate Mixture is contacted with the selected Target under conditions favorable for binding between the Target and members of the Candidate Mixture. Under these circumstances, the interaction between the Target and the Nucleic Acids of the Candidate Mixture can be considered as forming Nucleic Acid-Target pairs between the Target and those Nucleic Acids having the strongest affinity for the Target. [0046]
  • 3) The Nucleic Acids with the highest affinity for the Target are partitioned from those Nucleic Acids with lesser affinity to the Target. Because only an extremely small number of sequences (and possibly only one molecule of Nucleic Acid) corresponding to the highest affinity Nucleic Acids exist in the Candidate Mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the Nucleic Acids in the Candidate Mixture (approximately 5-50%) are retained during partitioning. [0047]
  • 4) Those Nucleic Acids selected during partitioning as having the relatively higher affinity to the Target are then amplified to create a new Candidate Mixture that is enriched in Nucleic Acids having a relatively higher affinity for the Target. [0048]
  • 5) By repeating the partitioning and amplifying steps above, the newly formed Candidate Mixture contains fewer and fewer weakly binding sequences, and the average degree of affinity of the Nucleic Acids to the Target will generally increase. Taken to its extreme, the SELEX process will yield a Candidate Mixture containing one or a small number of unique Nucleic Acids representing those Nucleic Acids from the original Candidate Mixture having the highest affinity to the Target molecule. [0049]
  • The SELEX Patent Applications describe and elaborate on this process in great detail. Included are Targets that can be used in the process; methods for partitioning Nucleic Acids within a Candidate Mixture; and methods for amplifying partitioned Nucleic Acids to generate enriched Candidate Mixture. The SELEX Patent Applications also describe ligands obtained to a number of target species, including both protein Targets where the protein is and is not a Nucleic Acid binding protein. [0050]
  • The SELEX method further encompasses combining selected Nucleic Acid Ligands with lipophilic or Non-Immunogenic, High Molecular Weight compounds in a diagnostic or therapeutic complex as described in U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes,” now U.S. Pat. No. 6,011,020. VEGF Nucleic Acid Ligands that are associated with a Lipophilic Compound, such as diacyl glycerol or dialkyl glycerol, in a diagnostic or therapeutic complex are described in U.S. patent application Ser. No. 08/739,109, filed Oct. 25, 1996, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes,” now U.S. Pat. No. 5,859,228. VEGF Nucleic Acid Ligands that are associated with a Lipophilic Compound, such as a glycerol lipid, or a Non-Immunogenic, High Molecular Weight Compound, such as polyalkylene glycol, are further described in U.S. patent application Ser. No. 08/897,351, filed Jul. 21, 1997, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes,” now U.S. Pat. No. 6,051,698. VEGF Nucleic Acid Ligands that are associated with a Non-Immunogenic, High Molecular Weight compound or a lipophilic compound are also further described in PCT/US97/18944, filed Oct. 17, 1997, entitled “Vascular Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes.” Each of the above described patent applications which describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety. [0051]
  • Certain embodiments of the present invention provide a complex comprising one or more Nucleic Acid Ligands to a Complement System Protein covalently linked with a Non-Immunogenic, High Molecular Weight compound or lipophilic compound. A complex as used herein describes the molecular entity formed by the covalent linking of the Nucleic Acid Ligand of a Complement System Protein to a Non-Immunogenic, High Molecular Weight compound. A Non-Immunogenic, High Molecular Weight compound is a compound between approximately 100 Da to 1,000,000 Da, more preferably approximately 1000 Da to 500,000 Da, and most preferably approximately 1000 Da to 200,000 Da, that typically does not generate an immunogenic response. For the purposes of this invention, an immunogenic response is one that causes the organism to make antibody proteins. In one preferred embodiment of the invention, the Non-Immunogenic, High Molecular Weight compound is a polyalkylene glycol. In the most preferred embodiment, the polyalkylene glycol is polyethylene glycol (PEG). More preferably, the PEG has a molecular weight of about 10-80K. Most preferably, the PEG has a molecular weight of about 20-45K. In certain embodiments of the invention, the Non-Immunogenic, High Molecular Weight compound can also be a Nucleic Acid Ligand. [0052]
  • Another embodiment of the invention is directed to complexes comprised of a Nucleic Acid Ligand to a Complement System Protein and a lipophilic compound. Lipophilic compounds are compounds that have the propensity to associate with or partition into lipid and/or other materials or phases with low dielectric constants, including structures that are comprised substantially of lipophilic components. Lipophilic compounds include lipids as well as non-lipid containing compounds that have the propensity to associate with lipids (and/or other materials or phases with low dielectric constants). Cholesterol, phospholipid, and glycerol lipids, such as dialkyl glycerol, diacyl glycerol, and glycerol amide lipids are further examples of lipophilic compounds. In a preferred embodiment, the lipophilic compound is a glycerol lipid. [0053]
  • The Non-Immunogenic, High Molecular Weight compound or lipophilic compound may be covalently bound to a variety of positions on the Nucleic Acid Ligand to a Complement System Protein, such as to an exocyclic amino group on the base, the 5-position of a pyrimidine nucleotide, the 8-position of a purine nucleotide, the hydroxyl group of the phosphate, or a hydroxyl group or other group at the 5′ or 3′ terminus of the Nucleic Acid Ligand to a Complement System Protein. In embodiments where the lipophilic compound is a glycerol lipid, or the Non-Immunogenic, High Molecular Weight compound is polyalkylene glycol or polyethylene glycol, preferably the Non-Immunogenic, High Molecular Weight compound is bonded to the 5′ or 3′ hydroxyl of the phosphate group thereof. In the most preferred embodiment, the lipophilic compound or Non-Immunogenic, High Molecular Weight compound is bonded to the 5′ hydroxyl of the phosphate group of the Nucleic Acid Ligand. Attachment of the Non-Immunogenic, High Molecular Weight compound or lipophilic compound to the Nucleic Acid Ligand of the Complement System Protein can be done directly or with the utilization of linkers or spacers. [0054]
  • A linker is a molecular entity that connects two or more molecular entities through covalent bonds or non-covalent interactions, and can allow spatial separation of the molecular entities in a manner that preserves the functional properties of one or more of the molecular entities. A linker can also be referred to as a spacer. [0055]
  • The complex comprising a Nucleic Acid Ligand to a Complement System Protein and a Non-Immunogenic, High Molecular Weight compound or lipophilic compound can be further associated with a lipid construct. Lipid constructs are structures containing lipids, phospholipids, or derivatives thereof comprising a variety of different structural arrangements which lipids are known to adopt in aqueous suspension. These structures include, but are not limited to, lipid bilayer vesicles, micelles, liposomes, emulsions, lipid ribbons or sheets, and may be complexed with a variety of drugs and components which are known to be pharmaceutically acceptable. In a preferred embodiment, the lipid construct is a liposome. The preferred liposome is unilamellar and has a relative size less than 200 nm. Common additional components in lipid constructs include cholesterol and alpha-tocopherol, among others. The lipid constructs may be used alone or in any combination which one skilled in the art would appreciate to provide the characteristics desired for a particular application. In addition, the technical aspects of lipid constructs and liposome formation are well known in the art and any of the methods commonly practiced in the field may be used for the present invention. [0056]
  • The methods described herein and the Nucleic Acid Ligands identified by such methods are useful for both therapeutic and diagnostic purposes. Therapeutic uses include the treatment or prevention of diseases or medical conditions in human patients, specifically diseases or conditions caused by activation of the Complement System. The Complement System does not have to be the only cause of the disease state, but it may be one of several factors, each of which contributes to pathogenesis. Such diseases or conditions include, but are not limited to, renal diseases, such as lupus nephritis and membranoproliferative glomerulonephritis (MPGN), membranous nephritis, IgA nephropathy; rheumatological diseases, such as rheumatoid arthritis, systemic lupus erythematosus (SLE), Behcet's syndrome, juvenile rheumatoid arthritis, Sjögren's syndrome and systemic sclerosis; neurological diseases, such as myasthenia gravis, multiple sclerosis, cerebral lupus, Guillain-Barré syndrome and Alzheimer's disease; dermatological diseases, such as Pemphigus/pemphigoid, phototoxic reactions, vasculitis and thermal bums; hematological diseases, such as paroxysmal nocturnal hemoglobinuria (PNH), hereditary erythroblastic multinuclearity with positive acidified serum lysis test (HEMPAS) and idiopathic thrombocytopenic purpura (ITP); biocompatibility/shock diseases, such as post-bypass syndrome, adult respiratory distress syndrome (ARDS), catheter reactions, anaphylaxis, transplant rejection, pre-eclampsia, hemodialysis and platelet storage; vascular/pulmonary diseases, such as atherosclerosis, myocardial infarction, stroke and reperfusion injury; allergies, such as anaphylaxis, asthma and skin reactions; infection, such as septic shock, viral infection and bacterial infection; and other conditions, such as atheroma, bowel inflammation, thyroiditis, infertility, paroxysmal nocturnal hemoglobinuria (PNH) and hemolytic anemia. [0057]
  • The Complement System can be inhibited at several points in the activation cascade by targeting different components. Inhibition of C1q would block the initiation by either antibody or non-antibody mechanisms. Antibodies activate C1q in many diseases including SLE, myasthenia gravis and arthritis. Non-antibody Complement System activation occurs in many diseases including Alzheimer's disease, myocardial infarction and septic shock. Blocking C1q could prevent the complement-mediated tissue injury in these diseases. [0058]
  • The Complement can also be activated in the absence of antibodies directly at the C3 stage. Activating surfaces including bacteria, virus particles or damaged cells can trigger Complement System activation that does not require C1q. An inhibitor of C3 could prevent Complement System activation and damage in these situations. [0059]
  • In other instances the inhibition of C5 is most useful. Activation of the Complement System by either C1q or C3 mechanisms both lead to activation of C5, so that inhibition of C5 could prevent Complement System-mediated damage by either pathway. However, both C1q and C3 are important in normal defense against microorganisms and in clearance of immune components and damaged tissue, while C5 is mostly dispensable for this function. Therefore, C5 can be inhibited either for a short term or a long term and the protective role of Complement System would not be compromised, whereas long term inhibition of C1q or C3 is not desirable. Finally, the C5 fragments C5a and C5b directly cause the majority of tissue injury and disease associated with unwanted Complement System activation. Therefore, inhibition of C5 is the most direct way of producing therapeutic benefit. [0060]
  • In other instances, the activation of the Complement System is desirable in the treatment or prevention of diseases or medical conditions in human patients. For example, the activation of the Complement System is desirable in treating bacterial or viral infections and malignancies. In addition, the activation of the Complement System on T-cells prior to transplantation could prevent rejection of an organ or tissue by eliminating the T-cells that mediate the rejection. [0061]
  • Furthermore, Nucleic Acid Ligands that bind to cell surface Targets could be made more efficient by giving them the ability to activate the Complement System. Nucleic Acid binding would then both inhibit a Target function and also eliminate the cell, for example, by membrane attack complex lysis and cell clearance through opsonization. Nucleic Acid Ligands could activate the Complement System through either the classical or the alternative pathways. C1q Nucleic Acid Ligands can be conjugated to other structures that target a cell surface component. For example, C1q Nucleic Acid Ligands can be conjugated to antibodies to cell targets, cytokines, growth factors or a ligand to a cell receptor. This would allow the C1q Nucleic Acid Ligands to multimerize on the targeted cell surface and activate the Complement System, thereby killing the cell. [0062]
  • The prototype classical pathway activators are immune aggregates, which activate the Complement System through binding to globular head groups on the C1q component. Generally, binding of two or more Fc domains to C1q is required; pentameric IgM is an especially efficient activator. In contrast, Nucleic Acid Ligands can activate through binding at a separate site on the C1q collagen-like tail region. This site also binds to a variety of other non-antibody activators including C-reactive protein, serum amyloid protein, endotoxin, β-amyloid peptide 1-40 and mitochondrial membranes. As with immunoglobulin, these non-antibody activators need to be multimerized to activate. [0063]
  • Nucleic Acid Ligands that bind to sites on the collagen-like region of C1q may also become activators when aggregated. Such a Complement System-activating aggregate may be lytic if formed on a cell surface, such as binding to a tumor-specific antigen (TSA) or to a leukocyte antigen. The extent of Nucleic Acid Ligand-mediated activation increases with the extent of Nucleic Acid Ligand aggregation (i.e., multiplicity of Nucleic Acid Ligand-C1q interaction). The Complement System-mediated killing is especially specific if the Nucleic Acid Ligands circulate as monomers which do not activate, but become activators when they are multimerized on the targeted cell surface. [0064]
  • As with any Complement System activation, the extent and specificity is determined by the amount of C3 deposited onto the targeted cell. Deposited C3 forms an enzyme convertase that cleaves C5 and initiates membrane attack complex formation. C3 is also the classical serum opsonin for targeting phagocytic ingestion. The prototype alternative pathway activators are repeating carbohydrate units including bacterial and yeast cell walls, fucoidin and Sepharose, or glycolipids such as endotoxin or the glycocalyx. Nucleic Acid Ligands could activate the alternative pathway by aggregating the C3 component on the cell surface. Depositing C3 on a cell promotes Factor B binding and alternative pathway C3 convertase formation. Binding of a Nucleic Acid Ligand to C3 blocks binding of the inhibitor Factor H and prevents C3b decay. This would also increase C3 convertase formation and alternative path activation. Nucleic Acid Ligands to C3 may have this activity since heparin binds activated C3 and can promote alternative pathway activation. Binding of Nucleic Acid Ligands to C3 blocks binding to C3 of the membrane-associated inhibitors CR1, CR2, MCP and DAF, preventing C3b convertase decay and stimulating alternative pathway activation. This alternative pathway mechanism can be as efficient as C1q-dependent activation in cell killing and lysis. [0065]
  • Nucleic Acid Ligand-mediated Complement System cell killing could be employed in several ways, for example, by: a) direct killing of tumor cells; b) lysis of targeted microorganisms or infected cells; and c) elimination of lymphocytes or lymphocyte subsets. Nucleic Acid Ligands could replace antibodies currently used for these purposes. [0066]
  • Diagnostic utilization may include either in vivo or in vitro diagnostic applications. The SELEX method generally, and the specific adaptations of the SELEX method taught and claimed herein specifically, are particularly suited for diagnostic applications. The SELEX method identifies Nucleic Acid Ligands that are able to bind targets with high affinity and with surprising specificity. These characteristics are, of course, the desired properties one skilled in the art would seek in a diagnostic ligand. [0067]
  • The Nucleic Acid Ligands of the present invention may be routinely adapted for diagnostic purposes according to any number of techniques employed by those skilled in the art. Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. Simply the ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes. Those skilled in the art would also be able to adapt any Nucleic Acid Ligand by procedures known in the art to incorporate a labeling tag in order to track the presence of such ligand. Such a tag could be used in a number of diagnostic procedures. The Nucleic Acid Ligands to C1q, C3 and C5 described herein may specifically be used for identification of the C1q, C3 or C5 protein. [0068]
  • The SELEX process provides high affinity ligands of a target molecule. This represents a singular achievement that is unprecedented in the field of Nucleic Acids research. The present invention applies the SELEX procedure to the specific target C1q, which is part of the first component (C1) of the classical pathway of Complement System activation, to the specific target C3, which is part of both the classical and alternative pathway, and to the specific target C5, which is part of the terminal pathway. In the Example section below, the experimental parameters used to isolate and identify the Nucleic Acid Ligands to C1q, C3 and C5 are described. [0069]
  • In order to produce Nucleic Acids desirable for use as a pharmaceutical, it is preferred that the Nucleic Acid Ligand (1) binds to the target in a manner capable of achieving the desired effect on the target; (2) be as small as possible to obtain the desired effect; (3) be as stable as possible; and (4) be a specific ligand to the chosen target. In most situations, it is preferred that the Nucleic Acid Ligand have the highest possible affinity to the Target. [0070]
  • Pharmaceutical agents, which include, but are not limited to, small molecules, antisense oligonucleotides, nucleosides, and polypeptides can activate the Complement System in an undesirable manner. Nucleic Acid Ligands to Complement System Proteins could be used as a prophylactic by transiently inhibiting the Complement System, so that a pharmaceutical agent could be administered and achieve a therapeutically effective amount without eliciting the undesirable side effect of activating the Complement System. [0071]
  • In co-pending and commonly assigned U.S. patent application Ser. No. 07/964,624, filed October 21, 1992, now U.S. Pat. No. 5,496,938, (the '938 Patent), methods are described for obtaining improved Nucleic Acid Ligands after SELEX has been performed. The '938 Patent, entitled “Nucleic Acid Ligands to HIV-RT and HIV-1 Rev,” is specifically incorporated herein by reference in its entirety. [0072]
  • In the present invention, SELEX experiments were performed in order to identify RNA with specific high affinity for C1q, C3 and C5 from a degenerate library containing 30 or 50 random positions (30N or 50N). This invention includes the specific RNA ligands to C1q shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155), identified by the method described in Examples 2 and 6, the specific RNA ligands to C3 shown in Table 3 (SEQ ID NOS:21-46), identified by method described in Example 3, and the specific RNA ligands to C5 shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. [0073] 5A-B (SEQ ID NOS:160 and 193) identified by methods described in Examples 4, 9, 10 and 11. This invention further includes RNA ligands to C1q, C3 and C5 which inhibit the function of C1q, C3 and C5. The scope of the ligands covered by this invention extends to all Nucleic Acid Ligands of C1q, C3 and C5, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes Nucleic Acid sequences that are substantially homologous to the ligands shown in Tables 2-6, 8, 10 and 12-13 and FIGS. 5A-B (SEQ ID NOS:5-155 and 160-196). By substantially homologous, it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%, and even more preferably in excess of 90%, 95% or 99%. The percentage of homology as described herein is calculated as the percentage of nucleotides found in the smaller of the two sequences which align with identical nucleotide residues in the sequence being compared when 1 gap in a length of 10 nucleotides may be introduced to assist in that alignment. A review of the sequence homologies of the ligands of C1q shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155) shows that sequences with little or no primary homology may have substantially the same ability to bind C1q. Similarly, a review of the sequence homologies of the ligands of C3 shown in Table 3 (SEQ ID NOS:21-46) shows that sequences with little or no primary homology may have substantially the same ability to bind C3. Similarly, a review of the sequence homologies of the ligands of C5 shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID NOS:160 and 193) shows that sequences with little or no primary homology may have substantially the same ability to bind C5. For these reasons, this invention also includes Nucleic Acid Ligands that have substantially the same structure and ability to bind C1q as the Nucleic Acid Ligands shown in Table 2 (SEQ ID NOS:5-20) and Table 6 (SEQ ID NOS:84-155), Nucleic Acid Ligands that have substantially the same structure and ability to bind C3 as the Nucleic Acid Ligands shown in Table 3 (SEQ ID NOS:21-46) and Nucleic Acid Ligands that have substantially the same structure and ability to bind C5 as the Nucleic Acid Ligands shown in Table 4 (SEQ ID NOS:47-74), Table 5 (SEQ ID NOS:76-83), Table 8 (SEQ ID NOS:75, 160-162), Table 10 (SEQ ID NOS:163-189), Table 12 (SEQ ID NOS:190-192), Table 13 (SEQ ID NOS:194-196) and FIGS. 5A-B (SEQ ID NOS:160 and 193). Substantially the same ability to bind C1q, C3 or C5 means that the affinity is within one or two orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind C1q, C3 or C5.
  • The invention also includes Nucleic Acid Ligands that have substantially the same postulated structure or structural motifs. Substantially the same structure or structural motifs can be postulated by sequence alignment using the Zukerfold program (see Zucker (1989) Science 244:48-52). As would be known in the art, other computer programs can be used for predicting secondary structure and structural motifs. Substantially the same structure or structural motif of Nucleic Acid Ligands in solution or as a bound structure can also be postulated using NMR or other techniques as would be known in the art. [0074]
  • One potential problem encountered in the therapeutic, prophylactic and in vivo diagnostic use of Nucleic Acids is that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. Certain chemical modifications of the Nucleic Acid Ligand can be made to increase the in vivo stability of the Nucleic Acid Ligand or to enhance or to mediate the delivery of the Nucleic Acid Ligand. See, e.g., U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” now abandoned (see also U.S. Pat. No. 5,660,985) and U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes,” which are specifically incorporated herein by reference in their entirety. Modifications of the Nucleic Acid Ligands contemplated in this invention include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the Nucleic Acid Ligand bases or to the Nucleic Acid Ligand as a whole. Such modifications include, but are not limited to, 2′-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping. [0075]
  • Where the Nucleic Acid Ligands are derived by the SELEX method, the modifications can be pre- or post-SELEX modifications. Pre-SELEX modifications yield Nucleic Acid Ligands with both specificity for their SELEX Target and improved in vivo stability. Post-SELEX modifications made to 2′-OH Nucleic Acid Ligands can result in improved in vivo stability without adversely affecting the binding capacity of the Nucleic Acid Ligand. The preferred modifications of the Nucleic Acid Ligands of the subject invention are 5′ and 3′ phosphorothioate capping and/or 3′-3′ inverted phosphodiester linkage at the 3′ end. In one preferred embodiment, the preferred modification of the Nucleic Acid Ligand is a 3′-3′ inverted phosphodiester linkage at the 3′ end. Additional 2′-fluoro (2′-F) and/or 2′-amino (2′-NH[0076] 2) and/or 2′-O-methyl (2′-OMe) modification of some or all of the nucleotides is preferred. Described herein are Nucleic Acid Ligands that were 2′-NH2 modified or 2′-F modified and incorporated into the SELEX process. Further described herein are 2′-F modified Nucleic Acid Ligands derived from the SELEX process which were modified to comprise 2′-OMe purines in post-SELEX modifications.
  • Other modifications are known to one of ordinary skill in the art. Such modifications may be made post-SELEX (modification of previously identified unmodified ligands) or by incorporation into the SELEX process. [0077]
  • As described above, because of their ability to selectively bind C1q, C3 and C5, the Nucleic Acid Ligands to C1q, C3 and C5 described herein are useful as pharmaceuticals. This invention, therefore, also includes a method for treating Complement System-mediated diseases by administration of a Nucleic Acid Ligand capable of binding to a Complement System Protein or homologous proteins. Certain diseases or conditions such as Alzheimer's disease or myocardial infarction activate C1q through the collagen-like region. In Alzheimer's disease, β-amyloid activates C1q. Structures in heart muscle that are exposed during myocardial infarction such as intermediate filaments, mitochondrial membranes or actin activate C1q. Nucleic Acid Ligands to C3 or to C5 could also inhibit Complement System activation in Alzheimer's disease or myocardial infarction, whether the Complement System is activated through C1q by antibody or non-antibody mechanisms, or independent of C1q through the alternative pathway. Thus, the Nucleic Acid Ligands of the present invention may be useful in treating Alzheimer's disease or myocardial infarction. [0078]
  • Therapeutic compositions of the Nucleic Acid Ligands may be administered parenterally by injection, although other effective administration forms, such as intraarticular injection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories are also envisioned. One preferred carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used. In one preferred embodiment, it is envisioned that the carrier and the Nucleic Acid Ligand constitute a physiologically-compatible, slow release formulation. The primary solvent in such a carrier may be either aqueous or non-aqueous in nature. In addition, the carrier may contain other pharmacologically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation. Similarly, the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release or absorption of the ligand. Such excipients are those substances usually and customarily employed to formulate dosages for parental administration in either unit dose or multi-dose form. [0079]
  • Once the therapeutic composition has been formulated, it may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in a ready to use form or requiring reconstitution immediately prior to administration. The manner of administering formulations containing Nucleic Acid Ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intranasal or vaginal or rectal suppository. [0080]
  • The following Examples are provided to explain and illustrate the present invention and are not intended to be limiting of the invention. These Examples describe the use of SELEX methodology to identify high affinity RNA ligands to C1q, C3 and C5. Example 1 describes the various materials and experimental procedures used in Examples 2, 3, 4 and 6. Example 2 describes the generation of 2′-NH[0081] 2 RNA ligands to C1q. Example 3 describes the generation of 2′-F Nucleic Acid Ligands of Complement System Protein C3. Example 4 describes the generation of 2′-F Nucleic Acid Ligands of Complement System Protein C5. Example 5 describes the activation of the Complement System through C1q ligands. Example 6 describes the generation of 2′-F RNA ligands to C1q. Example 7 describes an assay for hemolytic inhibition for 2′-F RNA ligands to C5. Example 8 describes an assay for inhibition of C5a release by a Nucleic Acid Ligand (clone C6) to Human C5. Example 9 describes boundary experiments performed to determine the minimum binding sequence for Nucleic Acid Ligands to Human C5. Example 10 describes a Biased SELEX experiment performed to improve Nucleic Acid Ligand affinity, using a 42 mer truncated sequence of clone C6 as the random sequence in the template. Example 11 describes the results of 2′-OMe purine substitutions in a Human C5 Nucleic Acid Ligand in an interference assay. Example 12 describes the structure of a 38 mer truncate of a Nucleic Acid Ligand to human C5. Example 13 describes a hemolytic assay of 2′-OMe purine substituted Nucleic Acid Ligands to human C5.
  • Example 1
  • Experimental Procedures [0082]
  • This example provides general procedures followed and incorporated in Examples 2, 3, 4 and 6 for the identification of 2′-NH[0083] 2 and 2′-F RNA ligands to C1q, and 2′-F ligands to C3 and C5.
  • A. Biochemicals [0084]
  • C1q, C3, C5 and C4-deficient guinea pig sera were obtained from Quidel (San Diego, Calif.). Bovine serum albumin (BSA), rabbit anti-BSA, CRP, SAP and β-amyloid peptides 1-40 and 1-42 were obtained from Sigma (St. Louis, Mo.). Nucleotides GTP, ATP and deoxynucleotides were obtained from Pharmacia (Uppsala, Sweden). Taq polymerase was obtained from Perkin-Elmer (Norwalk, Conn.). [0085] Modified nucleotides 2′-NH2-CTP and 2′-NH2-UTP, and 2′-F-CTP and 2′-F-UTP, were prepared as described in Jellinek et al. (1995) Biochem. 34:11363. Avian reverse transcriptase was obtained from Life Sciences (St. Petersburg, Fla.) and T7 RNA polymerase from USB (Cleveland, Ohio.). Nitrocellulose filters were obtained from Millipore (Bedford, Mass.). All chemicals were the highest grade available.
  • B. RNA SELEX Procedures [0086]
  • The SELEX procedure has been described in detail in the SELEX Patent Applications (see also Jellinek et al. (1995) Biochem. 34:11363; Jellinek et al. (1994) Biochem. 33:10450). Briefly, a DNA template was synthesized with a 5′ fixed region containing the T7 promoter, followed by a 30N or a 50N stretch of random sequence, and then with a 3′-fixed region (Table 1; SEQ ID NOS:1 and 156). For the initial round of the SELEX process, 1 nmole (˜10[0087] 14 unique sequences) of RNA (Table 1; SEQ ID NOS:2 and 157) was in vitro transcribed by T7 polymerase (Milligan et al. (1987) Nucleic Acids Res. 12:785) using mixed GTP/ATP and 2′-NH2-CTP/UTP or 2′-F-CTP/UTP nucleotides, and with the addition of α-[32P]-ATP. For this and subsequent rounds of the SELEX process, the RNA was purified by electrophoresis on 8% acrylamide gels with 7 M urea, 10 mM Tris-Borate, 2 mM EDTA, pH 8.3 running buffer. After autoradiography, the band containing labeled, modified RNA transcript was excised and frozen at −70° C., then 400 μL of 100 mM NaCl, 2 mM EDTA was added, the gel was mashed, and the slurry was spun through 2 cm of glass-wool (Rnase-free—Alltech Associates, Deerfield, Ill.) and two nitrocellulose filters. The RNA was precipitated by addition of ⅕ vol of 6.6 M NH4OAc, pH 7.7, plus 2 vol of ethanol. The pellet was washed twice with 80% ethanol, and taken to dryness. The dry RNA pellet was dissolved in phosphate buffered saline (Sambrook et al. (1989) Molecular Cloning. A laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) containing 1 mM MgCl2 (MgPBS).
  • For each round of the SELEX process, the RNA was incubated with C1q, C3 or C5 in MgPBS for 10 minutes at 37° C. Then the sample was filtered through a 43 mm nitrocellulose filter, and the filter was washed with 10 mL of MgPBS. For some rounds, the diluted RNA was pre-soaked with nitrocellulose filters overnight to reduce background. Four samples were run in parallel for most rounds with lesser amounts (chosen to be in suitable range to measure binding) of both RNA and C1q, C3 or C5 to measure binding Kd for each sample. In addition, at each round, a sample of RNA was filtered without protein to determine background. [0088]
  • Filters were air-dried, sliced into strips, counted, and then extracted for 60 minutes at 37° C. with 400 μL of 1% SDS, 0.5 mg/mL Proteinase K (Boehringer Mannheim, Indianapolis, Ind.), 1.5 mM DTT, 10 mM EDTA, 0.1 M Tris, pH 7.5, with addition of 40 μg tRNA carrier. The aqueous RNA was extracted with phenol, phenol/chloroform (1:1), and chloroform and then precipitated following addition of NH[0089] 4OAc/EtOH as above. The RNA was reverse transcribed in a volume of 50 μL for between 1 hour and overnight. The DNA was PCR amplified with specific primers (Table 1; SEQ ID NOS:3-4) in a volume of 500 μL for 12-14 cycles, and then phenol/chloroform extracted and NaOAc/EtOH precipitated. The DNA pellet was taken up in H2O, and an aliquot was T7 transcribed for the next round of the SELEX process.
  • C. Cloning DNA from the 12[0090] th or the 14th round was PCR amplified with primers which also contained a ligation site to facilitate cloning. The DNA was cloned into a pUC9 vector, and colonies were picked for overnight growth and plasmid mini-preps (PERFECTprep, 5′-3′, Boulder, Colo.). The purified plasmids were PCR amplified with original 3′ and 5′ primers (as above), and products were analyzed by agarose gel electrophoresis (Sambrook et al. (1989) Molecular Cloning. A laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). DNA was T7 transcribed with α-[32P]-ATP to prepare radiolabeled RNA for binding analysis and without radiolabel to prepare RNA for inhibition studies.
  • D. Sequencing Plasmids purified using the PERFECTprep kit were sequenced with ABI dRhodamine Terminator cycling kit (Perkin-Elmer). Samples were sequenced on the ABI Prism 377 DNA Sequencer. [0091]
  • E. Binding Assays [0092]
  • Individual cloned DNA was T7 transcribed with α-[[0093] 32P]-ATP and the full length [32P]-2′-NH2-RNA or 2′-F-RNA was gel-purified (as above). RNA was suspended at approximately 5,000 cpm per 30 μL sample (<10 pM), and aliquots were incubated with various concentrations of C1q, C3 or C5 in MgPBS for 10 minutes at 37° C. Samples were then filtered through nitrocellulose, the filters washed with buffer and dried under an infrared lamp, and counted with addition of scintillation fluid (Ecoscint A, National Diagnostics, Atlanta, Ga.). A background sample of RNA alone was run in parallel. To measure inhibition of ligand binding to C1q, the RNA Nucleic Acid Ligand plus C1q plus inhibitor (e.g., the A-chain residue 14-26 site, SAP, β-amyloid peptide, CRP) were incubated for 10 minutes at 37° C., and then filtered. Filters were washed and counted.
  • RNA ligand binding to C1q was also measured in the presence of immune-complexes, which would block the binding of ligands to C1q head-groups. Immune complexes (IC) were formed by mixing 620 μg BSA at equivalence with 1 mL of rabbit anti-BSA (Sigma, St. Louis, Mo.) plus PEG 8000 added to 1% final concentration, and then the samples were incubated overnight at 4° C. The IC were pelleted by microfugation at 12,000 rpm for 10 minutes, washed five times with PBS, and suspended in 1 mL of MgPBS. For measurement of C1q RNA clone binding to C1q-immune complexes (C1q-IC), 20 μL of the purified [[0094] 32P]-RNA plus 20 μL of the IC were mixed with 20 μL of C1q at various concentrations at between 10−11 and 10−7 M in MgPBS plus 1% Triton. Samples were incubated for 30 minutes at room temperature, microfuged, and the pellets and supernatants counted.
  • F. Hemolytic Assays [0095]
  • Complement System consumption was measured by C4 hemolytic assay as described (Gaither et al. (1974) J. Immunol. 113:574). All samples were diluted and the assay run in veronal-buffered saline containing calcium, magnesium and 1% gelatin (GVB[0096] ++-complement buffer). For measurement of C4 consumption by β-amyloid peptide consumption, the peptide was added at 250 μg/mL to a 1/8 dilution of whole human serum and then incubated for 60 minutes at 37° C. The sample was then diluted for assay of C4 hemolytic activity. For assay of inhibition of β-amyloid peptide mediated complement consumption by C1 q 2′-NH2-RNA clones, the C1q RNA Nucleic Acid Ligand was included in the initial β-amyloid peptide-whole human serum incubation mixture, and then C4 amounts assayed as above.
  • Complement System inhibition by C5 Nucleic Acid Ligands was measured using human serum and antibody-coated sheep red blood cells. The red blood cells were incubated with a 1:40 dilution of fresh human serum and with serial dilutions of C5 ligand for 30 minutes at 37° C. Dilutions of serum and ligand were made in complement buffer (see previous paragraph). After incubation the samples were then diluted with 4° C. buffer containing EDTA to stop the reaction, and the hemoglobin release was quantitated from the optical density at 412 nm. [0097]
  • Example 2
  • 2′-NH[0098] 2 RNA Ligands to C1q
  • A. RNA SELEX [0099]
  • The pool of random 50N7-2′-NH[0100] 2 RNA bound to C1q by nitrocellulose filter assay with a Kd of 2.3 μM. For round 1 of the SELEX process, the C1q concentration was between 0.156-1.25 μM and the RNA concentration was 15 μM. Throughout the SELEX process, the RNA concentrations were maintained at approximately 10-fold greater than the concentration of C1q, which was reduced at each round with a final round 14 C1q concentration of 136 pM. Background binding of RNA to nitrocellulose filters remained low throughout the SELEX procedure, in part because RNA was pre-adsorbed with nitrocellulose filters. The binding of pool RNA to C1q improved at each round. The evolved round 14 pool 2′-NH2 RNA bound C1q with a Kd=670 pM, yielding an overall improvement in binding Kd of 3400-fold.
  • Bulk RNA was then cloned for sequence determination and evaluation of binding. Through comparison of binding at 0.1 and 0.5 nM C1q, individual clones were ranked, and clones with C1q binding above background were sequenced and are shown in Table 2 (SEQ ID NOS:5-20). [0101] Family 1 contained 12 of the 19 total sequences. Family 2 contained three sequences. Both Family 3 and Family 4 contained two sequences. Both Family 1 and Family 2 sequences contain G-rich regions and both have the repeated sequence motifs GGAG and GGUG. The identity and homology of Family 1 members is greatest in the 5′ half, which is G-rich. The C-rich 3′ half has only short stretches of sequence homology, and these are shown only with inclusion of large gap regions. Sequences from all families can be folded to give stem-loop structures with extensive Watson-Crick base-pairing. Full binding curves for the highest affinity ligands yielded a Kd range from 290 pM to 3.9 nM; the high affinity ligands were found in all four sequence families. All of the binding curves were monophasic. The binding maximum is not 100% because of variable amounts of nucleic acid alterations taking place during purification. This is known because usually ligands can be bound to protein, extracted, and then re-bound, and give maximum binding approaching 100% (data not shown).
  • B. Competition [0102]
  • 2′-NH[0103] 2 RNA ligands from different families interact with the same or overlapping sites on C1q, as shown by cross-competition. This site is on the collagen-like region, at or near the A-chain 14-26 residue site (Jiang et al. (1994) J. Immunol. 152:5050) as shown by two lines of evidence. First, C1q when bound to IC still binds the ligand #50 (SEQ ID NO:12); binding to immunoglobulin Fc would block the head region, but leave the collagen-like tail available, suggesting that nucleic acid ligands derived by the SELEX process are bound to the tail. Second, and more direct, ligand #50 is competed by proteins which are known to bind the A-chain residue 14-26 site, including SAP, β-amyloid peptide and CRP. Finally, ligand #50 is competed by a peptide that has the same amino acid sequence as residues 14-26 on the A-chain. This result is further supported by results for hemolytic inhibition as described below.
  • C. Consumption [0104]
  • Binding of a nucleic acid ligand derived by the SELEX process to the A-chain 14-26 amino acid site could activate C1q or alternatively, SELEX-derived nucleic acid ligands could inhibit the binding of other molecules and prevent C1q activation. This was tested by measuring C4 consumption in serum after incubation with a 2′-NH[0105] 2 SELEX-derived nucleic acid ligands, or after incubation with a known C1q activator together with a 2′-NH2 nucleic acid ligand. The SELEX-derived nucleic acid ligands when incubated in serum do not consume C4, and thus are not C1q activators. Nor do these ligands at this concentration inhibit serum lysis of antibody-coated sheep erythrocytes, which would occur if ligands bound near the C1q head groups (data not shown). The ligands do inhibit C4 consumption by another C1q activator, the β-amyloid 1-40 peptide. This peptide is known to activate C1q through binding at the A-chain 14-26 residue site; therefore, this inhibition confirms that SELEX-derived nucleic acid ligands bind at this A-chain site. Control ligands from the SELEX process that did not bind C1q by nitrocellulose assay were also ineffective in blocking the β-amyloid 1-40 peptide C1q activation.
  • Example 3
  • 2′-Fluoro Nucleic Acid Ligands of Complement System Protein C3 [0106]
  • In order to generate ligands to complement protein C3, a library of about 10[0107] 14 RNA was generated that contained 30 nucleotides of contiguous random sequence flanked by defined sequences. In this experiment, 30N random nucleotides of the initial Candidate Mixture were comprised of 2′-F pyrimidine bases. The rounds of selection and amplification were carried out as described in Example 1 using art-known techniques. In round 1 the 30N7-2′-F-RNA and C3 were both incubated at 3 μM. There was barely detectable binding at this round. Both the RNA and C3 concentrations were decreased during the SELEX procedure. Sequences derived from the SELEX procedure are shown in Table 3 (SEQ ID NOS:21-46).
  • Example 4
  • 2′-Fluoro Nucleic Acid Ligands of Complement System Protein C5 [0108]
  • In order to generate ligands to human complement protein C5, a library of about 10[0109] 14 RNA was generated that contained 30 nucleotides of contiguous random sequence flanked by defined sequences. In this experiment, the 30N random nucleotides of the initial Candidate Mixture were comprised of 2′-F pyrimidine bases. Briefly, a DNA template was synthesized with a 5′-fixed region containing the T7 promoter, followed by a 30N stretch of random sequence, and then with a 3′-fixed region (Table 1; SEQ ID NO:1). The rounds of selection and amplification were carried out as described in Example 1 using art-known techniques. The initial rounds of the SELEX experiment were set up with high concentrations of 2′-F RNA (7.5 μM) and protein (3 μM), as the binding of C5 to unselected RNA was quite low. The SELEX experiment was designed to promote binding of RNA at the C5a-C5b cleavage site. RNA and C5 were incubated together with small amounts of trypsin, with the reasoning that limited trypsin treatment of C5 produces a single site cleavage and generates C5a-like activity (Wetsel and Kolb (1983) J. Exp. Med. 157:2029). This cleavage led to a slight increase in random RNA binding. Enhanced RNA binding associated structurally with exposure of the C5a-like domain could evolve Nucleic Acid Ligands that bind near the C5 convertase site and could interfere with or inhibit C5 cleavage. The SELEX experiment was performed simultaneously to both the native and to the mildly-trypsinized protein, so that Nucleic Acid Ligand evolution would pick the highest affinity winner. With this procedure the highest affinity winner against the multiple protein species would be evolved, and multiple aptamers and specific aptamers might be obtained out of a single SELEX experiment.
  • For each round of the SELEX process, the procedure was performed in parallel in separate tubes with approximately 5-fold excess of RNA either in buffer alone or with addition of trypsin at between 0.3 and 0.0001 mg/mL. Samples were incubated in MgPBS for 45 minutes at 37° C., and then filtered through nitrocellulose. The filters were washed, dried and counted, extracted, reverse-transcribed, then PCR amplified and finally T7 transcribed in vitro into RNA using mixed GTP/ATP and 2′-F-CTP/UTP nucleotides and α-[[0110] 32P]-ATP. RNA was purified by electrophoresis in 8% acrylamide gels with 7M urea and Tris-Borate EDTA buffer (TBE). RNA was isolated and precipitated with NH4OAc/ethanol, and then dissolved in phosphate-buffered saline containing 1 nM MgCl2 (MgPBS). Filters with the highest binding were carried forward. At the end of each round, all of the RNA that bound to the protein (either with or without trypsin) was pooled. The protein and RNA concentrations at each round were reduced, with final concentrations of 2.5 nM and 10 nM respectively. Trypsin was added at concentrations between 0.3 and 0.0001 μg/mL. Background binding was monitored at each round, and starting at round four the transcribed RNA was presoaked overnight with nitrocellulose filters prior to the SELEX rounds to reduce background.
  • Based on binding of RNA to native C5 by nitrocellulose assay, round twelve DNA was cloned and sequences were obtained as shown in Table 4 (SEQ ID NOS:47-74). Sequences were grouped according to homology and function. Group I sequences are highly homologous and might have arisen by PCR mutation from a single original sequence. Binding affinities of the Group I Nucleic Acid Ligands are very similar and are shown in Table 7. Group II Nucleic Acid Ligands generally bound with similar affinity to Group I Nucleic Acid Ligands, although some weak binders were also present. Group II sequences and length are more diverse than Group I Nucleic Acid Ligands. The C5 Nucleic Acid Ligands do not bind other complement components including C1q, C3, or factors B, H, or D. [0111]
  • Nucleic Acid Ligands from each family were also assayed for inhibition of rat Complement System activity (Table 5; SEQ ID NOS:76-83). Nucleic Acid Ligands from Family I and Family III inhibited rat complement, whereas a Nucleic Acid Ligand from Family II did not. An inhibitory Nucleic Acid Ligand can be used to inhibit Complement System activity in various rat disease models including, but not limited to, myasthenia gravis, myocardial infarction, glomerulonephritis, ARDS, arthritis and transplantation. [0112]
  • Example 5
  • Activation of the Complement System through C1q Nucleic Acid Ligands [0113]
  • Oligonucleotides can activate both classical and alternative pathways. Particularly, poly-G oligonucleotides which can form G-quartet structures and can interact with the C1q collagen-like region are able to form high molecular weight aggregates, which both bind and activate C1q. Phosphorothioate oligonucleotides, which have increased non-specific binding as compared with phosphodiester oligonucleotides, are also efficient Complement System activators, particularly poly-G containing phosphorothioate oligonucleotides. Results for oligonucleotide activation of solution phase Complement are shown below where classical pathway activation is measure by the release of C4d fragment by ELISA (Quidel, San Diego, Calif.), and alternative pathway activation is measure by Bb ELISA (Quidel, San Diego, Calif.). Although these pathways are separate, there is evidence to suggest that oligonucleotide activation of both pathways is C1q dependent. [0114]
    [C4d] μg [Bb] μg
    Sample (Class.) (Altern.)
    Poly-AG Random Co-Polymer 8.1 18.9
    Poly-G Random Co-Polymer 1.2 29.3
    Poly-I Random Co-Polymer 0 14.7
    Poly-A Random Co-Polymer 0 0
    Poly-U Random Co-Polymer 0 1.8
    Poly-C Random Co-Polymer 0 2.5
    Phosphorothioate Oligonucleotides
    GGCGGGGCTACGTACCGGGGCTTTGTAAAACCCCGCC −7.1 32.4
    SEQ ID NO: 197
    CTCTCGCACCCATCTCTCTCCTTCT 0.0 3.9
    SEQ ID NO: 198
    BSA-anti-BSA Immune Complexes 8.0 11.9
    β-Amyloid Peptide 2.7 n/d
    Fucoidan Sulfated Carbohydrate 27
    buffer 0.0 0.0
  • Complement System activation is also initiated on the erythrocyte membrane and is tested by hemolytic assays. Known activators, including 2′-OH poly-G and phosphorothioate oligonucleotides, as well as potential activators such as multimerized C1q Nucleic Acid Ligands and small (e.g., 15-mer) 2′-F poly-G oligonucleotides are coated on sheep erythrocytes and subsequent lysis of the erythrocytes by serum complement is measured. Methods of coating oligonucleotides and Nucleic Acid Ligands on cells include passive adsorption, chemical conjugation, streptavidin-biotin coupling and specific Nucleic Acid binding. Following treatment with fresh rat or human serum, the deposition of complement components on the cell, membrane damage and lysis are measured by standard methods as would be known by one of skill in the art. [0115]
  • A. Aggregation of C1q Nucleic Acid Ligands [0116]
  • C1q Nucleic Acid Ligands are dimerized using chemical cross-linkers of various lengths. Alternatively, Nucleic Acid Ligand monomers are biotinylated and then multimerized with streptavidin. Each of these multimers are tested for complement activation and lysis of erythrocytes. [0117]
  • The addition of poly-G sequence to C1q Nucleic Acid Ligands provides additional binding ability and increases the ability of the oligonucleotide to activate the Complement System. In addition, short poly-G sequences on individual C1 q Nucleic Acid Ligands can interact to form higher order structures, which serve to multimerize the C1q Nucleic Acid Ligands and cause activation. [0118]
  • B. Lysis of Erythrocytes and Leukocytes [0119]
  • Nucleic Acid Ligands that promote erythrocyte lysis are tested on nucleated cells, including lymphocytes and tumor cells. Nucleated cells have mechanisms of complement resistance that erythrocytes lack. For example, nucleated cells can shed antigens, bleb off membrane vesicles containing the complement components and express increased levels of complement inhibitors as compared with erythrocytes and may up-regulate protective mechanisms upon initial complement attack. As high levels of activation are important for cell killing, activators are compared for amount of Complement System component deposition and extent of membrane damage. Also, different types and sources of tumor cells and lymphocytes are tested to determine if susceptibility is cell-type specific. [0120]
  • Nucleic Acid Ligands can be generated for virtually any target as described in the SELEX Patent Applications. Nucleic Acid Ligands to L-Selectin have been generated (See U.S. patent application Ser. No. 08/479,724, filed Jun. 7, 1995, entitled “High Affinity Nucleic Acid Ligands to Lectins,” now U.S. Pat. No. 5,780,228, which is incorporated herein by reference in its entirety). The diversity of lectin mediated functions provides a vast array of potential therapeutic targets for lectin antagonists. For example, antagonists to the mammalian selecting, a family of endogenous carbohydrate binding lectins, may have therapeutic applications in a variety of leukocyte-mediated disease states. Inhibition of selectin binding to its receptor blocks cellular adhesion and consequently may be useful in treating inflammation, coagulation, transplant rejection, tumor metastasis, rheumatoid arthritis, reperfusion injury, stroke, myocardial infarction, bums, psoriasis, multiple sclerosis, bacterial sepsis, hypovolaemic and traumatic shock, acute lung injury and ARDS. The coupling of C1q Nucleic Acid Ligands to L-Selectin Nucleic Acid Ligands makes the L-Selectin Nucleic Acid Ligand more efficient by promoting cell killing at the target. C1q Nucleic Acid Ligands are coupled to L-Selectin Nucleic Acid Ligands, and the conjugates are tested for leukocyte lysis as described above. Also, Nucleic Acid Ligands to other cell surface targets, antibodies to all targets that do not themselves activate complement, cytokines, growth factors, or a ligand to a cell receptor could be coupled to a C1q Nucleic Acid Ligand and used for cell killing. [0121]
  • C. In Vivo Testing of Complement Activation [0122]
  • Nucleic Acid Ligand-mediated Complement System activation is tested in animals to evaluate in vivo Nucleic Acid Ligand action. Erythrocytes and/or lymphocytes are coated with Nucleic Acid Ligands and injected into rats to test cell killing and lysis in vivo. Activating Nucleic Acid Ligands are also coupled to a Mab that does not activate the Complement System, where the antibody is directed against a rat cell antigen (e.g., lymphocyte antigen). These cells are then coated with the Nucleic Acid Ligand-antibody conjugate and injected into rats. Alternatively, the Nucleic Acid Ligand-antibody conjugate is injected directly into the rat and then in vivo leukocyte killing is measured. [0123]
  • It is also possible that C1q Nucleic Acid Ligands cross-react with non-human C1q, and non-human C1q could be used for in vivo assays. C1q Nucleic Acid Ligands are tested against species such as mouse, rat and rabbit C1q. C1q is purified from serum and cross-reactivity with C1q Nucleic Acid Ligands is tested by nitrocellulose binding assay. Alternatively, C1q is bound to immune complexes which are added to serum and then C1q Nucleic Acid Ligand binding to the aggregate is tested. If Nucleic Acid Ligands are species-specific, then rat serum is depleted of rat C1q by continuous perfusion over a Ig-Sepharose column, and the serum is reconstituted with human C1 q by methods known to one of skill in the art. These reconstituted animals are then used to test C1q Nucleic Acid Ligands for targeted Complement System activation and cell killing. [0124]
  • Example 6
  • 2′-Fluoro RNA Ligands of Complement System Protein C1q [0125]
  • A. RNA SELEX [0126]
  • The pool of random 30N7-2′-F RNA bound to C1q by nitrocellulose filter assay with a K[0127] d of 2.3 μM. For round 1 of the SELEX process, the C1q concentration was between 0.156-1.25 μM and the RNA concentration was 15 μM. Throughout the SELEX process, the RNA concentrations were maintained at approximately 10-fold greater than the concentration of C1q, which was reduced at each round with a final round 14 C1q concentration of 136 pM. Background binding of RNA to nitrocellulose filters remained low throughout the SELEX procedure, in part because RNA was pre-adsorbed with nitrocellulose filters. The binding of pool RNA to C1q improved at each round. The evolved round 14 pool 2′-F RNA bound C1q with a Kd of 2 nM, yielding an overall improvement in binding Kd of 1-3000-fold.
  • Bulk RNA was then cloned for sequence determination and evaluation of binding. Through comparison of binding at 0.1 and 0.5 nM C1q, individual clones were ranked for binding affinity. Sequences of 2′-F RNA ligands are shown in Table 6 (SEQ ID NOS:84-155). The 2′-F-RNA sequences are not easily grouped into families, but these sequences are G-rich and are similar but not homologous with the 2′-NH[0128] 2 RNA sequences described in Example 2.
  • Example 7
  • Hemolytic Inhibition for 2′-F RNA Ligands to C5 [0129]
  • The 2′-F RNA Nucleic Acid Ligands to C5 (Example 4) were assayed for hemolytic inhibition by including dilutions in a standard assay for human serum lysis of antibody-coated sheep erythrocytes. Sheep cells were mixed with a 1:40 dilution of serum containing Nucleic Acid Ligand or buffer, and incubated for 30 minutes at 37° C. After quenching with cold EDTA buffer, the samples were spun and supernatants read at OD 412 nm. Group I Nucleic Acid Ligands inhibited almost to background at 1 μM, with a K[0130] i of 60-100 nM. The results are shown in FIG. 1. The results of the hemolysis inhibition assay suggested that 2′-F RNA Nucleic Acid Ligands to C5 target a specific site on C5, where they block interaction of C5 with the Complement C5 convertase. These results also confirmed that the 2′-F RNA Nucleic Acid Ligands are stable in serum.
  • Example 8
  • Inhibition of C5a Release [0131]
  • Nucleic Acid Ligand-C5 interaction that inhibits cleavage of C5 would prevent formation of the C5b and MAC assembly. Inhibition of C5 cleavage should also inhibit C5a release, and this was shown in the following experiment with clone C6 (SEQ ID NO:51) (Example 4). For this experiment, dilutions of clone C6 were incubated with whole human serum in GVB[0132] ++ (veronal-buffered saline containing calcium, magnesium and 1% gelatin) plus addition of zymosan for 30 minutes at 37° C. The samples were then quenched with EDTA-buffer and spun, and supernatants were assayed for C5a by radioimmunoassay (RIA) (Wagner and Hugli (1984) Anal. Biochem. 136:75). The results showed that clone C6 inhibited C5a release with a Ki of approximately 100 nM (FIG. 2), whereas control random pool RNA gave no inhibition (data not shown). This assay also demonstrated the serum stability of clone C6.
  • Example 9
  • Boundaries of Clone C6 [0133]
  • Clone C6 (SEQ ID NO:51) (Example 4) was selected for determination of a minimal binding sequence. This was done in the following two ways. [0134]
  • 1) The minimal RNA sequences (5′ and 3′ boundaries) required for binding of clone C6 to C5 were determined by partially hydrolyzing clone C6 and determining protein binding (Green et al. (1995) Chem. Biol. 2:683). Briefly, clone C6 was synthesized as either 5′-[[0135] 32p]-kinase labeled (to determine the 3′ boundary) or 3′-[32P]-pCp labeled (to determine the 5′ boundary) and the oligonucleotides were purified. Then the oligonucleotides were subjected to alkaline hydrolysis, which cleaves oligonucleotides from the 3′ end to purine bases. The partially hydrolyzed RNA was then incubated with C5, and RNA which bound to the C5 protein was partitioned on nitrocellulose and eluted from the protein. The partitioned RNA together with an RNA ladder were run on an 8% acrylamide/7M urea sequencing gel. The boundary where removal of one more base would reduce or eliminate binding was determined by comparison of selected RNA (RNA which bound to C5) versus non-selected RNA (RNA which did not bind to C5).
  • The labeled RNA was also digested with T[0136] 1 nuclease (which cleaves oligonucleotides from the 3′ end to A residues), incubated with C5 and partitioned as above, for a second ladder. FIG. 3A shows the results of the digestion of the 5′-kinase-labeled RNA. In this figure, the 3′-sequence (5′-end labeled) is aligned with the alkaline hydrolysis ladder. On the left is the T1 ladder and on the right are RNA selected with 5× and 1× concentrations of C5. The boundary where removal of a base eliminates binding is shown by the arrow. The asterisk shows a G which is hypersensitive to T1. Other G nucleotides in the minimal sequences are protected from T1 digestion. FIG. 3B shows the results of the 3′-pCp-ligated RNA. In this figure, the 5′-sequence (3′-end-labled) is aligned with the alkaline hydrolysis ladder. The T1 and protein lanes, boundary and hypersensitive G nucleotides are as described for FIG. 3A.
  • 2) In a second experiment, the results obtained from the boundary experiments described above were used to construct synthetic truncated Nucleic Acid Ligands to C5. Several truncates between 34 and 42 nucleotides were synthesized by removing residues at both ends of clone C6 (SEQ ID NO:51), and assayed for C5 binding (Table 8). The shortest oligonucleotide which bound to C5 was a 38 mer (SEQ ID NO:160), which confirms the boundary gel and which provides a preliminary structure for further Nucleic Acid Ligand development. In the minimal 38 mer sequence, 30 bases originated from the random region and eight bases were from the 5′ fixed region of clone C6. Removing a base from both 5′ and 3′ ends of the 38 mer to produce a 36 mer (SEQ ID NO:161) reduced the binding. A 34 mer (SEQ ID NO:162) did not bind. Other truncated oligonucleotides with internal deletions also failed to bind. [0137]
  • Example 10
  • Biased SELEX [0138]
  • A biased SELEX experiment was performed to improve Nucleic Acid Ligand affinity and to further define the structure. The sequence of the 42 mer truncate (SEQ ID NO:75) from Example 9 (Table 8)was used as a template for the Biased SELEX experiment. A synthetic template comprising a 42N random region flanked by new n8 fixed regions (Table 10; SEQ ID NO:163) was constructed and synthesized (Oligos, Etc., CT), where the random region was biased toward the 42 mer truncate of clone C6 from the first SELEX experiment. A 42 mer random region was chosen rather than the minimal 38 mer sequence, as the four extra bases extended a terminal helix. While not wishing to be bound by any theory, the inventors believed that although these four extra bases were not essential for binding, a longer helix was thought desirable to aid in selecting the Nucleic Acid Ligand structure and in minimizing the possible use of fixed regions in the newly selected Nucleic Acid Ligand structure. Each base in the random region was synthesized to contain 0.67 mole fraction of the base corresponding to the base in the 42 mer sequence and 0.125 mole fraction of each of the other three bases. The Biased SELEX experiment was performed as described for the standard SELEX experiment in Example 1. PCR amplification was performed using primers shown in Table 1 (SEQ ID NOS:158-159). [0139]
  • The Biased SELEX experiment was performed with native C5 protein since clone C6 already inhibits hemolysis and trypsin treatment is not required for binding. The binding of the starting RNA pool to C5 was very low, so the protein and RNA concentrations were started at 2.6 μM and 7.1 μM, respectively, similar to the first SELEX experiment. The binding rapidly improved at round three. RNA and protein concentrations were gradually reduced at each subsequent round to final concentrations by round nine of 62.5 pM and 31 pM, respectively. The binding of the RNA pool to C5 was approximately 5 nM (Table 9), as compared to approximately 100 M for the RNA pool from the first SELEX experiment. Some of the improvements in the affinity of the pool results from absence of lower affinity ligands, size mutants and background binders, which were not allowed to build up to appreciable concentrations during this more rapid SELEX experiment. [0140]
  • The RNA pool after eight rounds of the Biased SELEX process was improved by 20-50 fold over the round twelve pool from the first SELEX experiment. The overall improvement in K[0141] d from the random pool to pool from eight rounds of the Biased SELEX process is estimated to be greater than 105-fold. The isolated and cloned sequences from the Biased SELEX experiment are shown in Table 10 (SEQ ID NOS:164-189). In the sequences shown in Table 10, the two base-pair stem which is dispensable for binding is separated from the minimal 38 mer sequence. These bases show no selective pressure except to maintain the stem. None of the sequences exactly match the original template sequence.
  • Clones from the Biased SELEX experiment were assayed and representative binding affinities are shown in Table 11. Most clones bound with a K[0142] d between 10 and 20 nM and are higher affinity binding ligands than the template (SEQ ID NO:163). One of the clones, YL-13 (SEQ ID NO:175), bound approximately five-fold higher affinity than other clones from the Biased SELEX experiment and approximately 10-fold higher affinity than clone C6 (SEQ ID NO:51). None of Nucleic Acid Ligand sequences exactly matched the sequence used for the template in the Biased SELEX experiment. Some bases substitutions are unique to this Biased SELEX experiment sequence set and might account for increased Nucleic Acid Ligand affinity.
  • Example 11
  • 2′-O-Methyl Substitution for Nuclease Protection [0143]
  • To further stabilize the Nucleic Acid Ligand, positions where 2′-OH-purine nucleotides could be substituted with nuclease-resistant 2′-O-methyl nucleosides were determined. An assay for simultaneously testing several positions for 2′-O-methyl interference was used following the method described in Green et al. (1995) Chem. Biol. 2:683. [0144]
  • In the 2′-O-methyl interference assay, three sets of oligonucleotides based on a 38 mer truncate of sequence YL-13 (SEQ ID NO:175) from the Biased SELEX experiment were synthesized. These sets of sequences, indicated as M3010 (SEQ ID NO:190), M3020 (SEQ ID NO:191) and M3030 (SEQ ID NO:192) in Table 12 were synthesized on an automated RNA synthesizer in a manner wherein each of the nucleotides indicated by bold underline in Table 12 were synthesized 50% as a 2′-OH-nucleotide and 50% as a 2′-OMe-substituted nucleotide. This resulted in a mixture of 2[0145] 5 or 32 different sequences for each of sets M3010, M3020 and M3030.
  • The partially substituted 2′-OMe oligonucleotides were 5′-[[0146] 32P]-kinase-labeled. The oligonucleotides were selected at 100 nM and 10 nM C5 and the binding to protein was greater than 10-fold over background filter binding. The oligonucleotides were eluted from the protein, alkaline hydrolyzed and then run on a 20% acrylamide/7 M urea/TBE sequencing gel. On adjacent tracks were run oligonucleotides not selected with C5. Band intensities were quantitated with on an InstantImager (Packard, Meriden, Conn.). When these oligonucleotides were separated on an acrylamide gel the mixed OH:OMe positions showed up at 50% intensity of a full 2′-OH position, because the 2′-OMe is resistant to hydrolysis. 2′-F pyrimidines are also resistant and do not show on the gel.
  • For each position, the ratio of (the intensity of the bands selected by protein binding)/(band intensity for oligonucleotide not selected to protein) was calculated. These ratios were plotted versus nucleotide position and a linear fit determined (FIG. 4, open circles). The same calculation was made for mixed 2′-OH/2′-OMe oligonucleotides, and these ratios were compared with previously determined curve (FIG. 4, closed circles). Where 2′-OMe substitution did not interfere with binding the ratio was within one standard deviation of the 2′-OH ratio. However, where 2′-OMe substitution interfered with binding, the binding preference for 2′-OH purine increased the ratio. Two nucleotides at positions 16 and 32 were determined to require 2′-OH nucleotides. Separately, residue g5 was determined independently to require 2′-OH and residue G20 was determined to allow 2′-OMe substitution, and these were used to normalize lanes. These results were confirmed by synthesis and assay of 2′-OMe substituted oligonucleotides. The obligate 2′-OH positions are in one of two bulges, or in the loop in the putative folding structure, suggesting these features are involved in the protein interaction. Once the permissible 2′-OMe positions were determined, substituted oligonucleotides were synthesized and relative binding affinities were measured. [0147]
  • Example 12
  • Human C5 Nucleic Acid Ligand Structure [0148]
  • The putative folding and base-pairing, based on truncation experiments, nuclease sensitivity, base substitution patterns from the Biased SELEX experiment, and 2′-OMe substitutions, for the 38 mer truncate of clone C6 together with alternative bases is shown in FIG. 5A. The basic sequences is the 38 mer truncate (SEQ ID NO:160). In parentheses are variants from the first SELEX experiment. In brackets are variants from the Biased SELEX experiment. Lower case bases are derived from the 5′-n7 fixed region from the first SELEX experiment. Upper case bases are derived from the original random region. [0149]
  • The stem-loop structure has between 12 and 14 base-pairs: a) the proposed 5′, 3′-terminal base pairs (c1-a3, and U36-G38); b) stem-loop base-pairs (U11-U14 and G24-A27) are supported by covariant changes during the Biased SELEX procedure; and c) the middle stem (g7-C10 and G28-C34), which is generally conserved, U9-A32 which is invariant and g8-C33 conserved during the Biased SELEX procedure. The u4→c4 change improves binding, and this change is found in all clones from the Biased SELEX experiment, and G29, A29 variants are found only in clones from the Biased SELEX experiment. [0150]
  • The UUU bulge is generally conserved. One original sequence contained two U bases, with no reduction in binding, and two Nucleic Acid Ligands with a single base substitution were found during Biased SELEX experiment. The C10-G28 base-pair following the UUU-bulge is conserved. This region with a conserved bulge and stem is likely involved in protein interaction. The stem-loop G15 to U23 is highly conserved, except for bases 19. [0151]
  • The 2′-OMe substitution pattern is consistent with this structure (SEQ ID NO:193; FIG. 5B). Positions where 2′-OMe substitutions can be made are shown in bold. The three positions which must be 2′-OH are shown as underlined. The obligate 2′-OH bases at g5, G17 and A32 are in bulge or loop regions which might form unique three-dimensional structures required for protein binding. Allowed positions for 2′-OMe substitution occur in stem regions where a standard helical structure is more likely. [0152]
  • Example 13
  • Hemolytic Assay of 2′-OMe-Substitued Nucleic Acid Ligands to Human C5 [0153]
  • Three oligonucleotides were synthesized based on clone YL-13 from the Biased SELEX experiment to compare the effect of 2′-OMe substitution on hemolytic inhibition: (1) a 38 mer truncate B2010 (SEQ ID NO:194), in which all of the nucleotides were 2′-OH; (2) a 38 mer in which one nucleotide (position 20) was a 2′-OMe-G (B2070; SEQ ID NO:195); and (3) a 38 mer in which the maximum number of allowable positions ([0154] positions 2, 7, 8, 13, 14, 15, 20, 21, 22, 26, 27, 28, 36 and 38) were synthesized as 2′-OMe-G and 2′-OMe-A (M6040; SEQ ID NO:196) as shown in Table 13. These were assayed in the hemolytic assay as described in Example 7. The results are shown in FIG. 6. As shown in FIG. 6, the Ki decreased with increased 2′-O-Me substitution. The Kd was marginally better (data not shown). This experiment showed that nucleic acid ligand stability is increased with 2′-OMe substitution, and that long term in vivo inhibition of the complement system is feasible.
    TABLE 1
    SEQ ID NO.
    Synthetic DNA Template:
    1 and 156 5′-TAATACGACTCACTATAGGGAGGACGATGCGG-[N]30 or 50-
    CAGACGACTCGCCCGA-3′
    Starting random sequence RNA pool:
    2 and 157 5′-GGGAGGACGAUGCGG-[N]30 or 50-CAGACGACUCGCCCGA-3′
    Primer Set for Standard SELEX:
    3 5′-PRIMER: 5′-TAATACGACTCACTATAGGGAGGACGATGCGG-3′
    4 3′-PRIMER: 5′-TCGGGCGAGTCGTCTG-3′
    Primer Set for Biased SELEX:
    158 5′-PRIMER: 5′-TAATACGACTCACTATAGGGAGATAAGAATAAACGCTCAA-3′
    159 3′ PRIMER: 5′ GCCTGTTGTGAGCCTCCTGTCGAA-3′
  • [0155]
    TABLE 2
    2′-NH2 RNA Ligands of Complement System Protein Clq*
    SEQ
    ID
    Clone No. NO: Kd(nM)
    Family 1
    3 gggaggacgaugcggGAGGAGUGGAGGUAAACAAUAGGUCGGUAGCGACUCCCACUAACAGGCCUcagacgacucgcccga 5
    12 gggaggacgaugcggGUGGAGUGGAGGUAAACAAUAGGUCGGUAGCGACUCCCAGUAACGGCCUcagacgacucgcccga 6
    23 cgggaggacgaugcaaGUGGAGUGGAGGUAUAACGGCCGGUAGGCAUCCCACUCGGGCCUAGCUcagacgacucgcccga 7
    30 gggaggacgaugcggGUGGAGUGGGGAUCAUACGGCUGGUAGCACGAGCUCCCUAACAGCGGUcagacgacucgcccga 8
    36 gggaggacgaugcggGAGGAGUGGAGGUAAACAAUAGGCCGGUAGCGACUCCCACUAACAGCCUcagacgacucgcccga 9 0.29
    45 gggaggacgaugcggUGGAGUGGAGGUAUACCGGCCGGUAGCGCAUCCCACUCGGGUCUGUGCUcagacgacucgcccga 10 1.38
    47 gggaggacgaugcggGUGGAGCGGAGGUUUAUACGGCUGGUAGCUCGAGCUCCCUAACACGCGGUagacgacucgcccga 11
    50 gggaggacgaugcggGUGGAGUGGAGGUAUAACGGCCGGUAGCGCAUCCCACUCGGGUCUGUGCUagacgacucgcccga 12 0.979
    78 gggaggacgaugcggGUGGAGUGGAGGGUAAACAAUGGCUGGUGGCAUUCGGAAUCUCCCAACGUagacgacucgcccga 13
    Family 2
    33 gggaggacgaugcggGUUGCUGGUAGCCUGAUGUGGGUGGAGUGAGUGGAGGGUUGAAAAAUGcagacgacucgcccga 14 3.85
    40 gggaggacgaugcggCUGGUAGCAUGUGCAUUGAUGGGAGGAGUGGAGGUCACCGUCAACCGUcagacgacucgcccga 15
    43 gggaggacgaugcggUUUCUCGGCCAGUAGUUUGCGGGUGGAGUGGAGGUAUAUCUGCGUCCUCGcagacgacucgcccga 16
    Family 3
    14 gggaggacgaugcggCACCUCACCUCCAUAUUGCCGc3UUAUCGCGUAGGGUGAGCCCAGACACGAcagacgacucgcccga 17 2.4
    23 gggaggacgaugcggCACUCACCUUCAUAUUGGCCGCCAUCCCCAGGGUUGAGCCCAGACACAGcagacgacucgcccga 18 23
    Family 4
    22 gggaggacgaugcggGCAUAGUGGGCAUCCCAGGGUUGCCUAACGGCAUCCGGGGUUGUUAUUGGcagacgacucgcccga 19
    67 gggaggacgaugcggCAGACGACUCGCCCGAGGGGAUCCCCCGGGCCUGCAGGAAUUCGAUAUcagacgacucgcccga 20
  • [0156]
    TABLE 3
    2′-F RNA Ligands of Complement System Protein of Human C3*
    SEQ
    Clone No. ID NO:
    C3c 10 gggaggacgaugcgg AACUCAAUGGGCCUACUUUUUCCGUGGUCCU cagacgacucgcccga 21
    C3C 16 gggaggacgaugcgg AACUCAAUGGGCCUACUUUUCCGUGGUCCU cagacgacucgcccga 22
    C3C 186 gggaggacgaugcgg AACUCAAUGGGCCGACUUUUUCCGUGUCCU cagacgacucgcccg 23
    C3C 162 gggaggacgaugcgg AACUCAAUGGGCCGACUUUCCGUGGUCCU cagacgacucgcccga 24
    C3C 141 gggaggacgaugcgg AACUCAAUGGGCNUACUUUUCCGUGGUCCU cagacgacucgcccga 25
    C3c 32 gggaggacgaugcgg AACUCAAUGGGCCGACUUUUCCGUGGUCCU cagacgacucgcccga 26
    27C3B143 gggaggacgaugcgg AACUCAAUGGGCCGACUUUUCCGUGGUCCU cagacgacugcccga 27
    30C3B149 gggaggacgaugcgg ACGCAGGGGAUGCUCACUUUGACUUUUAGGC cagacgacucgcccg 28
    c3a 29c gggaggacgaugcgg ACUCGGCAUUCACUAACUUUUGCGCUCGU cagacgacucgcccga 29
    C3B 25 gggaggacgaugcgg AUAACGAUUCGGCAUUCACUAACUUCUCGU cagacgacucgcccga 30
    C3c 3 gggaggacgaugcgg AUGACGAUUCGGCAUUCACUAACUUCUCGU cagacacucgcccga 31
    C3C 155 gggaggacgaugcgg AUGACGAUUCGGCAUUCACUAACUUCUCAU cagacgacucgcccga 32
    C3C 109 gggaggacgaugcgg AUGACGAUUCGGCAUUCACUAACUUCUACU cagacgacucgcccga 33
    C3-A 18c gggaggacgaugcgg AUCUGAGCCUAAAGUCAUUGUGAUCAUCCU cagacgacucgcccga 34
    C3c 35 gggaggacgaugcggg CGUUGGCGAUUCCUAAGUGUCGUUCUCGU cagacgacucgcccga 35
    C3B 41 gggaggacgaugcgg CGUCUCGAGCUCUAUGCGUCCUCUGUGGU cagacgacucgcccga 36
    C3B 108 gggaggacgaugcgg CGUCACGAGCUUUAUGCGUUCUCUGUGGU cagacgacucgcccga 37
    C3c 77 gggaggacgaugcgg CUUAAAGUUGUUUAUGAUCAUUCCGUACGU cagacgacucgcccga 38
    C3B 102 gggaggacgaugcgg GCGUUGGCGAUUGGUAAGUGUCGUUCUCGU cagacgacucgcccga 39
    c3a 9c gggaggacgaugcgg GCGUCUCGAGCUUUAUGCGUUCUCUGUGGU cagacgacucgcccga 40
    C3B 138 gggaggacgaugcgg GCGUCUCGAGCUCUAUGCGUUCUCUGUGGU cagacgacucgcccga 41
    c3-8c ggaggacgaugcgg GGCCUAAAGUCAAGUGAUCAUCCCCUGCGU cagacganucgcccga 42
    C3-230 gggaggacgaugcgg GUGGCGAUUCCAAGUCUUCCGUGAACAUGGU cagacgacucgcccg 43
    C3c 36 gggaggacgaugcgg GUGACUCGAUAUCUUCCAAUCUGUACAUGGU cagacgacucncccga 44
    188 gggaggacgaugcgg UGGCGAUUCCAAGUCUUCCGTGAACATGGT cagacgacucgcccga 45
    C3B 23 gggaggacgaugcgg TGGCGATTCCAAGTCTTCCGTGAACAT cagacgacucgcccga 46
  • [0157]
    TABLE 4
    2′-F RNA Ligands of Complement System Protein Human C5*
    SEQ
    Clone No: ID NO:
    Group I
    E5c/E11 gggaggacgaugcgg UCCGGCGCGCUGAGUGCCGGUUAUCCUCGU cagacgacucgcccga 47
    A6 gggaggacgaugcgg UCCGGCGCGCUGAGUGCCGGUUUAUCCUCGU cagacgacucgcccga 48
    F8 gggaggacgaugcgg UCUCAUGCGCCGAGUGUGAGUUUACCUUCGU cagacgacucgcccga 49
    K7 gggaggacgaugcgg UCUCAUGCGUCGAGUGUGAGUUUAACUGCGU cagacgacucgcccga 50
    C6 gggaggacgaugcgg UCUCAUGCGUCGAGUGUGAGUUUACCUUCGU cagacgacucgcccga 51
    G7 gggaggacgaugcgg UCUGCUACGCUGAGUGGCUGUUUACCUUCGU cagacgacucgcccga 52
    H1 gggaggacgaugcgg UCGGAUGCGCCGAGUCUCCGUUUACCUUCGU cagacgacucgcccga 53
    Group II
    F11 gggaggacgaugcgg UGAGCGCGUAUAGCGGUUUCGAUAGAGCUGCGU cagacgacucgcccga 54
    H2 gggaggacgaugcgg UGAGCGCGUAUAGCGGUUUCGAUAGAGCCU cagacgacucgcccga 55
    H6 gggaggacgaugcgg UGAGCGUGGCAAACGGUUUCGAUAGAGCCU cagacgacucgcccga 56
    H8 gggaggacgaugcgg UGAGCGUGUAAAACGGUUUCGAUAGAGCCU cagacgacucgcccga 57
    C9 gggaggacgaugcgg UGAGCGUGUAAAACGGUUUCGAUAGAGCCU cagacgacucgcccga 58
    C12 gggaggacgaugcgg UGGGCGUCAGCAUUUCGAUCUUCGGCACCU cagacgacucgcccga 59
    G9 gggaggacgaugcgg GAGUUGUUCGGCAUUUAGAUCUCCGCUCCCU cagacgacucgcccga 60
    F7 gggaggacgaugcgg GCAAAGUUCGGCAUUCAGAUCUCCAUGCCCU cagacgacucgcccga 61
    E9c gggaggacgaugcgg GGCUUCUCACAUAUUCUUCUCUUUCCCCGU cagacgacucgcccga 62
    E4c gggaggaggaucgg UGUUCAGCAUUCAGAUCUU cagacgacucgcccga 63
    G3 gggaggacgaugcgg UGUUCAGCAUUCAGN/AUCUUCACGUGUCGU cagacgacucgcccga 64
    F6 gggaggacgaugcgg UGUUCACCAUUCAGAUCUUCACGUGUCGU cagacgacucgcccga 65
    D9 gggaggacgaugc UGUUCAGCAUUCAGAUCUUCACGUGUGU cagacgacucgcccga 66
    F4 gggaggacgaugcgg UUUCGAUAGAGACUUACAGUUGAGCGCGGU cagacgacucgcccga 67
    D3 gggaggacgaugcgg UUUGUGAUUUGGAAGUGGGGGGGAUAGGGU cagacgacucgcccga 68
    F9 gggaggacgaugcgg UGAGCGUGGCAAACGGUUUCGAUAGAGCCU cagacgacucgcccga 69
    J1c ggagggcgaugg GGUGAGCGUGUAAAAGGUUGCGAUAGAGCCU cagacgacucgcccga 70
    D6 gggaggacgaugcgg GUAUCUUAUCUUGUUUUCGUUUUUCUGCCCU cagacgaucgcccga 71
    E8x gggaggacgaugcgg AGGGUUCUUUUCAUCUUCUUUCUUUCCCCU cagacgacucgcccga 72
    H11 gggaggacgaugcgg ACGAAGAAGGUGGUGGAGGAGUUUCGUGCU cagacgacucgcccga 73
    G10 gggaggacgaugcgg ACGAAGAAGGGGGUGGAGGAGUUUCGUGCU cagacuacucgcccga 74
  • [0158]
    TABLE 5
    Rat C5 2′F- RNA seguences*
    SEQ
    Clone No: ID NO:
    Family I
    RtC5-116 gggaggacgaugcgg CGAUUACUGGGACGGACUCGCGAUGUGAGCC cagacgacucgcccga 76
    RtC5-39 gggaggacgaugcgg CGAUUACUGGGACAGACUCGCGAUGUGAGCU cagacgacucgcccga 77
    RtC5-69 gggaggacgaugcgg CGACUACUGGGAAGGGUCGCGGUGAGCC cagacgacucgcccga 78
    RtC5-95 gggaggacgaugcgg CGAUUACUGGGACAGACUCGCGAUGUGAGCU cagacgacucgcccga 79
    RtC5-146 gggaggacgaugcgg CGACUACUGGGAGAGUACGCGAUGUGUGCC cagacgacucgcccga 80
    Family II
    RtC5-168 gggaggacgaugcgg GUCCUCGGGGAAAAUUUCGCGACGUGAACCU cagacgacucgcccga 81
    Family III
    RtC5-74 gggaggacgaugcgg CUUCUGAAGAUUAUUUCGCGAUGUQAACUUCAGACCCCU cagacgacucgcccga 82
    RtC5-100 gggaggacgaugcgg CUUCUGAAGAUUAUUUCGCGAUGUGAACUCCAGACCCCU cagacgacucgcccga 83
  • [0159]
    TABLE 6
    2′-F RNA Ligands of Complement System Protein Clq*
    SEQ
    Clone No: ID NO:
    c1qrdl7-33c gggaggacgaugcgg AAAGUGGAAGUGAAUGGCCGACUUGUCUGGU cagacgacucgcccga 84
    C1B100 gggaggacgaugcgg AAACCAAAUCGUCGAUCUUUCCACCGUCGU cagacgacucgcecga 85
    c1q-a8c gggaggacgaugcgg AACACGAAACGGAGGUUGACUCGAUCUGGC cagacgacucgcccga 86
    C1q5 cggaggacgaugcgg AACACGGAAGACAGUGCGACUCGAUCUGGUcagacgacucgcccga 87
    32.C1B76 cgggaggacgaugcgg AACAAGGACAAAAGUGCGAUUCUGUCUGG cagacgacucgcccg 88
    c110c gggaggacgaugcgg AACAGACGACUCGCGCAACUACUCUGACGU cagacgacucgcccga 89
    C1B121c gggaggacgaugcgg AACAGGUAGUUGGGUGACUCUGUGUGACCU cagacgacucgcccga 90
    C1q11c cggaggacgaugcgg AACCAAAUCGUCGAUCUUUCCACCGCUCGU cagacgacucgcccga 91
    C15c cgggaggacgaugcgg AACCGCUAUUGAAUGUCACUGCUUCGUGCU cagacgacucgcccga 92
    C1Q-A24′c cgggaggacgaugcgg AACCGCAUGAGUUAGCCUGGCUCG 93
    C1Q-A5′c gggaggacgaugcgg AACCCAAUCGUCUAAUUCGCUGCUCAUCGUcagacgacucgcccga 94
    C121c gggaggacgaugcgg AACUCAAUGGGCCUACULTUUCCGUGGUCCUcagacgacucgcccga 95
    c1q-a2C gggaggacgaugcgg AAGCGGUGAGUCGUGGCUUUCUCCUCGAUCCUCGU cagacgacucgcccga 96
    c1q-a12C gggaggacgaugcgg AAGGAUGACGAGGUGGUUGGGGUUUGUGCUcagacgacucgcccga 97
    c1qrd17-43c gggaggacgaugcgg ACAAGACGAGAACGGGGGGAGCUACCUGGC cagacgacucgcccga 98
    CIQ-A7′C gggaggacgaugcgg AGACACUAAACAAAUUGGCGACCUGACCGU cagacgacucgcccga 99
    03.C1Q.137c gggaggacgaugcgg AGACGCUCAGACGACUCGCCCGACCACGGAUGCGACCU cagacgacucgcccga 100
    14.C1Q156c gggaggacgaugcgg AGAUGGAUGGAAGUGCUAGUCUUCUGGGGU cagacgacucgccc 101
    C1B119 cgggaggacgaugcgg AGAUGGAUGGAAGUGCUAGUCUUUCUGGGGU cagacgacucgcccga 102
    C1Q-A28′C gggaggacgaugcqg AGCAGUUGAAAGACGUGCGUUUCGUUUGGU cagacgacucgcccga 103
    15.C1Q.157c gggaggacgaugcgg AGCACAAUUUUUUCCUUUUCUUUUCGUCCACGUGCU cagacgacucgcccga 104
    44c1qb60c gggaggacgaugcgg AGCUGAUGAAGAUCAUCUCUGACCCCU cagacgacucgcccga 105
    06.C1Q.143c gggaggacgaugcgg AGCUGAAAGCGAAGUGCGAGGUCUUUGGUC cagacgacucgcccga 106
    C1q4c ggaggacgaugcgg AGCGAAAGUGCGAGUGAUUGACCAGGUGCU cagacgacucgcccga 107
    c1qrd17-52c gggaggacgaugcgg AGCGUGAGAACAGUUGCGAGAUUGCCUGGU cagacgacucgcccga 108
    C111c gggaggacgaugcgg AGGAGAGUGUGGUGAGGGUCGUUUUGAGGGU cagacgacucgcccga 109
    44c1Qb60c gggaggacgaugcgg AGGAGCUGAUGAAGAUGAUCUCUGACCCCU cagacgacucgcccga 110
    24c1qb51C gggaggacgaugcgg AGUUCCCAGCCGCCUUGAUUUCUCCGUGGU cagacgacucgcccga 111
    31c1qb16 cgggaggacgaugcgg AUAAGUGCGAGUGUAUGAGGUGCGUGUGGU cagacgacucgcccga 112
    28c1Qb20c gggaggacgaugcgg AUCUGAGGAGCUCUUCGUCGUGCUGAGGGU cagacgacucgcccga 113
    c1qrd17-61c gggaggacgaugcgg AUCCGAAUCUUCCUUACACGUCCUGCUCGU cagacgacucgcccga 114
    C1q17 cggaggacgaugcgg AUCCGCAAACCGACAGCUCGAGUUCCGCCU cagacgacucgcccga 115
    34c1qb27c gggaggacgaugcgg AUGGUACUUUAGUCUUCCUUGAUUCCGCCU cagacgacucgcccga 116
    C1q7c cggaggacgaugcgg AUGAUGACUGAACGUGCGACUCGACCUGGC cagacgacucgcccga 117
    C1q7c ggaggacgaugcgg AUGAGGAGGAAGAGUCUGAGGUGCUGGGGU cagacgacucgcccga 118
    C1Q-A22′C gggaggacgaugcgg AUUUCGGUCGACUAAAUAGGGGUGGCUCGU cagacgacucgcccga 119
    C122c gggaggacgaugcgg CAAGAGGUCAGACGACUGCCCCGAGUCCUCCCCCGGU cagacgacucgcccga 120
    C115c gggaggacgaugcgg CAGUGAAAGGCGAGUUUUCUCCUCUCCCU cagacgacucgcccga 121
    09.C1Q.149c gggaggacgaugcgg CAUCGUUCAGGAGAAUCCACUUCGCCUCGU cagacgacucgcccga 122
    04.C1Q.138c gggaggacgaugcgg CAUCUUCCUUGUUCUUCCAACCCUCCUCCU cagacgacucgcccga 123
    C1Q-A4′C gggaggacgaugcgg CAUCGUAAACAAUUUGUUCCAUCUCCGCCU cagacgacucgcccga 124
    c1qrdl7-64c gggaggacgaugcgg CAUUGUCCAAGUUUAGCUGUCCGUGCUCGU cagacgacucgcccga 125
    46C1Qb64c gggaggacgaugcgg CAUACUCCGGAUACUAGUCACCAGCCUCGU agacgacucgcccga 126
    Cliq6c gggaggacgaugcgg CCGUCUCGAUCCUUCUAUGCCUUCGCUCGU cagacgacucgcccga 127
    23C1Qb4x gggaggacgaugcgg CGGGAAGUUUGAGGUGUANUACCUGUUGUCUGGU cagacgacucgcccga 128
    c1qrd17-63c gggaggacgaugcgg CUCAACUCUCCCACAGACGACUCGCCCGGGCCUCCU cagacgacucgcccga 129
    c1qrd17-47c gggaggacgaugcgg GACUCCUCGACCGACUCGACCGGCUCGU cagacgacucgccga 130
    C1g9c ggaggacgaugcgg GAACCAAAUCGUCGAUCUUUCCACCGCUCGU cagacgacucgcccga 131
    C1qrd-A63c10 cggaggacgaugcgg GACCACCUCGAUCCUCAGCGCCAUUGCCCU cagacgacucgcccga 132
    C119c gggaggacgaugcgg GAAGUGGAAGGGUAGUUGUGUGACCU cagacgacucgcccga 133
    c1qrd17-42c cggaggacgaugegg GCAAACUTUUUCCUUUUCCCUUUAUCUUCCUUGCCCU cagacgacucgcccga 134
    30c1Q24c gggaggacgaugcgg GGCCGACGAUUCACCAAUGUUCUCUCUGGU cagacgacucgcccga 135
    C1q10c ggaggacgaugcgg GGUUCCUCAAUCACGAUCUCCAUUCCGCUCGU cagacgacucgcccag 136
    C1q20c ggaggacgaugcgg GUCGACAUUGAAGCUGCUCUGCCUUGAUCCU cagacgacucgcccga 137
    08.C1Q.147c gggaggacgaugcgg UCCAAUUCGUUCUCAUGCCUUUCCGCUCGU cagacgacucgcccga 138
    11.C1Q.152c gggaggacgaugcgg UCCGCAACUUUAGCACUCACUGCCUCGU cagacgacucgcccga 139
    26c1Qb4c gggaggacgaugcgg UCCACAUCGAAUUUUCUGUCCGUUCGU cagacgacucgeccga 140
    C1B115c gggaggacgaugcgg UCGAUGUUCUUCCUCACCACUGCUCGUCGCCU cagacgacucgcccga 141
    33c1Q26c gggaggacgaugcgg UCGAGCUGAGAGGGGCUACUUGUUCUGGUCA cagacgacucgcccga 142
    01.C1Q.135c gggaggacgaugcgg UGGAAGCGAAUGGGCUAGGGUGGGCUGACCUC cagacgacucgcccga 143
    47c1qb65 cgggaggacgaugcgg UGGACUUCUUUUCCUCUUUCCUCCUUCCGCCGGU cagacgacucgcccga 144
    C1q14c ggaggacgaugcgg UUCCAAAUCGUCUAAGCAUCCCUCGCUCGU cagacgacucgcccag 145
    c1qrd17-53c gggaggacgaugcgg UUCCACAUCGCAAUUUUCUGUCCGUGCUCGU cagacgacucgcccga 146
    c1q-a6C gggaggacgaugcgg UUCCACAUCGAAUUUUCUGUCCGUGUCGU cagacgacucgcccga 147
    C1B114 cgggaggacgaugcgg UUCCGAUCGACUCCACAUACAUCUGCUCGU cagacgacucgcccga 148
    c1qrd17-56c gggaggacgaugcgg UUCCGACAUCGAUGUUGCUCUUCGCCUCGU cagacgacucgcccga 149
    05.C1Q.142c gggaggacgaugcgg UUCCGAAGUUCUUCCCCCGAGCCUUCCCCCUC cagacgacucgcccga 150
    30c1q24 cgggaggacgaugcgg UUCCGACGAUUCUCCAAUGUUCUCUCUGGU cagacgacucgcccga 151
    38c1qb45c gggaggacgaugcgg UUCCGACGAUUCUCCAAUCUUCUCUCUGGU cagacgacucgcccga 152
    10.C1Q151c gggaggacgaugcgg UUCCGCAAGUUUAGACACUCACUGCCUCGU cagacgacucgcccga 153
    C113x gggaggacgaugcgg UUCCGCAAAGUAGAUAUNUCAUCCGCACCU cagacgacucgcccga 154
    10.C1B.134c gggaggacgaugcgg UUGAGUGGACAGUGCGAUUCGUUUUGGGGU cagacgacucgcccga 155
  • [0160]
    TABLE 7
    Binding affinity of C5 nucleic acid ligands
    Clone SEQ ID NO Kd (nM)
    A6 48 35
     E11 47 60
    E4 63 50
    C6 51 30
    C9 58 45
    G3 64 55
    F8 49 30
  • [0161]
    TABLE 8
    Effect of truncation of clone C6 on C5 binding
    Length Kd
    SEQ ID NOS: Sequence (nts) (nM)
    *75 gA CgAUgCggUCUCAUgCgUCgAgUgUgAgUUUACCUUCg UC 42
    160 CgAUgCggUCUCAUgCgUCgAgUgUgAgUUUACCUUCg 38 20
    161 gAUgCggUCUCAUgCgUCgAgUgUgAgUUUACCUUC 36 50
    162 AUgCggUCUCAUgCgUCgAgUgUgAgUUUACCUU 34 >106
  • [0162]
    TABLE 9
    Binding of SELEX pools
    SELEX pool Kd
    random pool >1 nM
    First SELEX, round 12 100 nM
    Biased SELEX, round 8 5 nM
  • [0163]
    TABLE 10
    Clones from Biased SELEX
    SEQ ID
    Clone No. NO:
    template
    gggagataagaataaacgctcaag GA CGATGCGGTCTCATGCGTCGAGTGTGAGTTTACCTTCG TC ttcgacaggaggctcacaacaggc 163
    YL-8(10):
    gggagauaagaauaaacgcucaag UG CGACGCGGUCUCGAGCGCGGAGUUCGAGUUUACCUUCG CA uucgacaggaggcucacaacaggc 164
    YL-33(2):
    gggagauaagaauaaacgcucaag CU CGACGCGGUCCCAGGCGUGGAGUCUGGGUUUACCUUCG AG uucgacaggaggcucacaacaggc 165
    YL-79(3):
    gggagauaagaauaaacgcucaag AA CCACGCGGUCUCAGGCGUAGAGUCUGAGUUUACCUUGG UU uucgacaggaggcucacaacaggc 166
    YL-1(2):
    gggagauaagaauaaacgcucaag AA CCACGCGGUCUCAGGCGUAGAGUCUGUGUUUACCUUGG UU uucgacaggaggcucacaacaggc 167
    YL-71:
    gggagauaagaauaaacgcucaag UG CGACGCGGUCUCGAGCGCGGAGUUCGAGUUCACCUUCG CA uucgacaggaggcucacaacaggc 168
    YL-39:
    gggagauaagaauaaacgcucaag CA CAACGCGGUCUCAUGCGUCGAGUAUGAGUUUACCUUuG UG uucgacaggaggcucacaacaggc 169
    YL-60:
    gggagauaagaauaaacgcucaag GU CCUCGCGGUCUCAUGCGCCGAGUAUGAGUUUACCUAGG AC uucgacaggaggcucacaacaggc 170
    YL-9:
    gggagauaagaauaaacgcucaag GU CGUCGCGGUCUGAUGCGCUGAGUAUCAGUUUACCUACG AC uucgacaggaggcucacaacaggc 171
    YL-56:
    gggagauaagaauaaacgcucaag GU ACACGCGGUCUGACGCGCUGAGUGUCAGUUUACCUUGU AC uucgacaggaggcucacaacaggc 172
    YL-63:
    gggagauaagaauaaacgcucaag AAACCACGCGGUCUCAGGCGCAGAGUCUGAGUUACCUUCG CA uucgacaggaggcucacaacaggc 173
    YL-29:
    gggagauaagaauaaacgcucaag AA CCACGCGGUCUCAGGCGCAGAGUCUGAGUUACCUUGG UU uucgacaggaggcucacaacaggc 174
    YL-13:
    gggagauaagaauaaacgcucaag GA CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCG UC uucgacaggaggcucacaacaggc 175
    YL-24:
    gggagauaagaauaaacgcucaag GC UGACGCGGUCUCAGGCGUGGAGUCUGAGUUUACCUUCG GC uucgacaggaggcucacaacaggc 176
    YL-3:
    gggagauaagaauaaacgcucaag CA UGACGCGGUCUCAGGCGUGGAGUCUGAGUUUACCUUCG UG uucgacaggaggcucacaacaggc 177
    YL-67:
    gggagauaagaauaaacgcucaag GU CGACGCGGUCUCAGGCGUUGAGUCUGUGUUUACCUUCG AC uucgacaggaggcucacaacaggc 178
    YL-69:
    gggagauaagaauaaacgcucaag GU CGACGCGGUCUCAGGCGUUGAGUCUGUGUUUACCUUCG AC uucgacaggaggcucacaacaggc 179
    YL-81:
    gggagauaagaauaaacgcucaag GA CGCCGCGGUCUCAGGCGUUGAGUCUGAGUUUACCUGCG UC uucgacaggaggcucacaacaggc 180
    YL-15(7):
    gggagauaagaauaaacgcucaag GA CGACGCGGUCUGAUGCGCUGAGUGUCAGUUUACCUUCG UC uucgacaggaggcucacaacaggc 181
    YL-84:
    gggagauaagaauaaacgcucaag AA CGACGCGGUCUGAUGCGCUGAGUGUCAGUGUACCUUCG UC uuogacaggaggcucacaacaggc 182
    YL-4(3):
    gggagauaagaauaaacgcucaag GU CGACGCGGUCUGAUGCGUAGAGUGUCAGUUUACCUUCG AC uucgacaggaggcucacaacaggc 183
    YL-51:
    gggagauaagaauaaacgcucaag GU CGACGCGGUCUGAUGCGUAGAGUGUCAGUUCACCUUCG AC uucgacaggaggcucacaacaggc 184
    YL-14(2):
    gggagauaagaauaaacgcucaag UA CGACGCGGUCCCGUGCGUGGAGUGCGGGUUUACCUUCG UA uucgacaggaggcucacaacaggc 185
    YL-23:
    gggagauaagaauaaacgcucaag GA CGACGCGGUCUGAUGCGCAGAGUGUCGGUUUACCUUUG UC uucgacaggaggcucacaacaggc 186
    YL-59:
    gggagauaagaauaaacgcucaag GA CGACGCNGUCUGAUGCGCAGAGUGUCAGUUUACCUUCG AC uucgacaggaggcucacaacaggc 187
    YL-91:
    gggagauaagaauaaacgcucaag GA CGACGCGGUCUGAUGCGCAGAGUGUCAGUUUACCUUCG UC uucgacaggaggcucacaacaggc 188
    YL-50:
    gggagauaagaauaaacgcucaag GA CGACGCGGUCGGAUGCGCAGAGUGUCCGUUUACCUUCG UC uucgacaggaggcucacaacaggc 189
  • [0164]
    TABLE 11
    Binding affinity of clones from Biased SELEX experiment
    SEQ ID NO: Clone Kd (nM)
    166 YL-79 15
    172 YL-56 12
    175 YL-13  6
    185 YL-14 25
    163 Template 30
  • [0165]
    TABLE 12
    Sequences based on YL-13 from Biased SELEX
    Clone Sequence SEQ ID NO:
    M3010 CGC CGC GGU CUC AGG CGC UGA GUC UGA GUU UAC CUG CG 190
    M3020 CGC CGC GGU CUC GGG CGC UGA GUC UGA GUU UAC CUG CG 191
    M3030 CGC CGC GGU CUC AGGCGC UGA GUC UGA GUU UAC CUG CG 192
  • [0166]
    TABLE 13
    Truncates based on YL-13 for hemolytic assay
    Clone Sequence SEQ ID NO:
    YL-13t CGC CGC GGU CUC AGG CGC UGA GUC UGA GUU UAC CUG CG 194
    B2070 CGC CGC GGU CUC AGG CGC UGA GUC UGA GUU UAC CUG CG 195
    M6040 CGC CGC GGU CUCAGG CGC UGA GUC UGA GUU UAC CUGCG196
  • [0167]
  • 1 198 1 78 DNA Artificial Sequence unsure (33)..(62) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N′s at position 33-62 are a or c or g or t 1 taatacgact cactataggg aggacgatgc ggnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nncagacgac tcgcccga 78 2 61 RNA Artificial Sequence unsure (16)..(55) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N′s at position 16-55 are a or c or g or u. 2 gggaggacga ugcggnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncagac gacucgcccg 60 a 61 3 32 DNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 3 taatacgact cactataggg aggacgatgc gg 32 4 16 DNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 4 tcgggcgagt cgtctg 16 5 81 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 5 gggaggacga ugcgggagga guggagguaa acaauagguc gguagcgacu cccacuaaca 60 ggccucagac gacucgcccg a 81 6 80 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 6 gggaggacga ugcgggugga guggagguaa acaauagguc gguagcgacu cccaguaacg 60 gccucagacg acucgcccga 80 7 79 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 7 gggaggacga ugcaagugga guggagguau aacggccggu aggcauccca cucgggccua 60 gcucagacga cucgcccga 79 8 79 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 8 gggaggacga ugcgggugga guggggauca uacggcuggu agcacgagcu cccuaacagc 60 ggucagacga cucgcccga 79 9 80 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 9 gggaggacga ugcgggagga guggagguaa acaauaggcc gguagcgacu cccacuaaca 60 gccucagacg acucgcccga 80 10 80 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 10 gggaggacga ugcgguggag uggagguaua ccggccggua gcgcauccca cucgggucug 60 ugcucagacg acucgcccga 80 11 80 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 11 gggaggacga ugcgggugga gcggagguuu auacggcugg uagcucgagc ucccuaacac 60 gcgguagacg acucgcccga 80 12 80 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 12 gggaggacga ugcgggugga guggagguau aacggccggu agcgcauccc acucgggucu 60 gcgguagacg acucgcccga 80 13 80 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 13 gggaggacga ugcgggugga guggagggua aacaauggcu gguggcauuc ggaaucuccc 60 gcgguagacg acucgcccga 80 14 79 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 14 gggaggacga ugcggguugc ugguagccug augugggugg agugagugga ggguugaaaa 60 augcagacga cucgcccga 79 15 79 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 15 gggaggacga ugcggcuggu agcaugugca uugaugggag gaguggaggu caccgucaac 60 cgucagacga cucgcccga 79 16 81 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 16 gggaggacga ugcgguuucu cggccaguag uuugcgggug gaguggaggu auaucugcgu 60 ccucgcagac gacucgcccg a 81 17 81 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 17 gggaggacga ugcggcaccu caccuccaua uugccgguua ucgcguaggg ugagcccaga 60 cacgacagac gacucgcccg a 81 18 80 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 18 gggaggacga ugcggcacuc accuucauau uggccgccau ccccaggguu gagcccagac 60 acagcagacg acucgcccga 80 19 81 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 19 gggaggacga ugcgggcaua gugggcaucc caggguugcc uaacggcauc cgggguuguu 60 auuggcagac gacucgcccg a 81 20 78 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 20 gggaggacga ugcggcagac gacucgcccg aggggauccc ccgggccugc ggaauucgau 60 aucagacgac ucgcccga 78 21 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 21 gggaggacga ugcggaacuc aaugggccua cuuuuuccgu gguccucaga cgacucgccc 60 ga 62 22 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 22 gggaggacga ugcggaacuc aaugggccua cuuuuccgug guccucagac gacucgcccg 60 a 61 23 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 23 gggaggacga ugcggaacuc aaugggccga cuuuuuccgu guccucagac gacucgcccg 60 24 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 24 gggaggacga ugcggaacuc aaugggccga cuuuccgugg uccucagacg acucgcccga 60 25 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 25 gggaggacga ugcggaacuc aaugggcnua cuuuuccgug guccucagac gacucgcccg 60 a 61 26 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 26 gggaggacga ugcggaacuc aaugggccga cuuuuccgug guccucagac gacucgcccg 60 a 61 27 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 27 gggaggacga ugcggaacuc aaugggccga cuuuuccgug guccucagac gacugcccga 60 28 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 28 gggaggacga ugcggacgca ggggaugcuc acuuugacuu uaggccagac gacucgcccg 60 29 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 29 gggaggacga ugcggacucg gcauucacua acuuuugcgc ucgucagacg acucgcccga 60 30 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 30 gggaggacga ugcggauaac gauucggcau ucacuaacuu cucgucagac gacucgcccg 60 a 61 31 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 31 gggaggacga ugcggaugac gauucggcau ucacuaacuu cucgucagac gacucgcccg 60 a 61 32 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 32 gggaggacga ugcggaugac gauucggcau ucacuaacuu cucaucagac gacucgcccg 60 a 61 33 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 33 gggaggacga ugcggaugac gauucggcau ucacuaacuu cuacucagac gacucgcccg 60 a 61 34 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 34 gggaggacga ugcggaucug agccuaaagu cauugugauc auccucagac gacucgcccg 60 a 61 35 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 35 gggaggacga ugcgggcguu ggcgauuccu aagugucguu cucgucagac gacucgcccg 60 a 61 36 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 36 gggaggacga ugcggcgucu cgagcucuau gcguccucug uggucagacg acucgcccga 60 37 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 37 gggaggacga ugcggcguca cgagcuuuau gcguucucug uggucagacg acucgcccga 60 38 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 38 gggaggacga ugcggcuuaa aguuguuuau gaucauuccg uacgucagac gacucgcccg 60 a 61 39 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 39 gggaggacga ugcgggcguu ggcgauuggu aagugucguu cucgucagac gacucgcccg 60 a 61 40 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 40 gggaggacga ugcgggcguc ucgagcuuua ugcguucucu guggucagac gacucgcccg 60 a 61 41 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 41 gggaggacga ugcgggcguc ucgagcucua ugcguucucu guggucagac gacucgcccg 60 a 61 42 60 RNA Artificial Sequence unsure (52) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N at position 52 is a or c or g or u 42 ggaggacgau gcggggccua aagucaagug aucauccccu gcgucagacg anucgcccga 60 43 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 43 gggaggacga ugcggguggc gauuccaagu cuuccgugaa cauggucaga cgacucgccc 60 g 61 44 62 RNA Artificial Sequence unsure (57) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N at position 57 is a or c or g or u 44 gggaggacga ugcgggugac ucgauaucuu ccaaucugua cauggucaga cgacucnccc 60 ga 62 45 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 45 gggaggacga ugcgguggcg auuccaaguc uuccgugaac auggucagac gacucgcccg 60 a 61 46 58 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 46 gggaggacga ugcgguggcg auuccaaguc uuccgugaac aucagacgac ucgcccga 58 47 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 47 gggaggacga ugcgguccgg cgcgcugagu gccgguuauc cucgucagac gacucgcccg 60 a 61 48 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 48 gggaggacga ugcgguccgg cgcgcugagu gccgguuuau ccucgucaga cgacucgccc 60 ga 62 49 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 49 gggaggacga ugcggucuca ugcgccgagu gugaguuuac cuucgucaga cgacucgccc 60 ga 62 50 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 50 gggaggacga ugcggucuca ugcgucgagu gugaguuuaa cugcgucaga cgacucgccc 60 ga 62 51 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 51 gggaggacga ugcggucuca ugcgucgagu gugaguuuac cuucgucaga cgacucgccc 60 ga 62 52 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 52 gggaggacga ugcggucugc uacgcugagu ggcuguuuac cuucgucaga cgacucgccc 60 ga 62 53 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 53 gggaggacga ugcggucgga ugcgccgagu cuccguuuac cuucgucaga cgacucgccc 60 ga 62 54 64 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 54 gggaggacga ugcggugagc gcguauagcg guuucgauag agcugcguca gacgacucgc 60 ccga 64 55 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 55 gggaggacga ugcggugagc gcguauagcg guuucgauag agccucagac gacucgcccg 60 a 61 56 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 56 gggaggacga ugcggugagc guggcaaacg guuucgauag agccucagac gacucgcccg 60 a 61 57 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 57 gggaggacga ugcggugagc guguaaaacg guuucgauag agccucagac gacucgcccg 60 a 61 58 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 58 gggaggacga ugcggugagc guguaaaacg guuucgauag agccucagac gacucgcccg 60 a 61 59 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 59 gggaggacga ugcggugggc gucagcauuu cgaucuucgg caccucagac gacucgcccg 60 a 61 60 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 60 gggaggacga ugcgggaguu guucggcauu uagaucuccg cucccucaga cgacucgccc 60 ga 62 61 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 61 gggaggacga ugcgggcaaa guucggcauu cagaucucca ugcccucaga cgacucgccc 60 ga 62 62 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 62 gggaggacga ugcggggcuu cucacauauu cuucucuuuc cccgucagac gacucgcccg 60 a 61 63 49 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 63 gggaggagga ucgguguuca gcauucagau cuucagacga cucgcccga 49 64 61 RNA Artificial Sequence unsure (30) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N at position 30 is a or c or g or u 64 gggaggacga ugcgguguuc agcauucagn aucuucacgu gucgucagac gacucgcccg 60 a 61 65 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 65 gggaggacga ugcgguguuc accauucaga ucuucacgug ucgucagacg acucgcccga 60 66 57 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 66 gggaggacga ugcuguucag cauucagauc uucacgugug ucagacgacu cgcccga 57 67 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 67 gggaggacga ugcgguuucg auagagacuu acaguugagc gcggucagac gacucgcccg 60 a 61 68 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 68 gggaggacga ugcgguuugu gauuuggaag ugggggggau agggucagac gacucgcccg 60 a 61 69 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 69 gggaggacga ugcggugagc guggcaaacg guuucgauag agccucagac gacucgcccg 60 a 61 70 59 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 70 ggagggcgau ggggugagcg uguaaaaggu ugcgauagag ccucagacga cucgcccga 59 71 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 71 gggaggacga ugcggguauc uuaucuuguu uucguuuuuc ugcccucaga cgaucgcccg 60 a 61 72 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 72 gggaggacga ugcggagggu ucuuuucauc uucuuucuuu ccccucagac gacucgcccg 60 a 61 73 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 73 gggaggacga ugcggacgaa gaagguggug gaggaguuuc gugcucagac gacucgcccg 60 a 61 74 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 74 gggaggacga ugcggacgaa gaagggggug gaggaguuuc gugcucagac gacucgcccg 60 a 61 75 42 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 75 gacgaugcgg ucucaugcgu cgagugugag uuuaccuucg uc 42 76 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 76 gggaggacga ugcggcgauu acugggacgg acucgcgaug ugagcccaga cgacucgccc 60 ga 62 77 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 77 gggaggacga ugcggcgauu acugggacag acucgcgaug ugagcucaga cgacucgccc 60 ga 62 78 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 78 gggaggacga ugcggcgacu acugggaagg gucgcgaagu gagcccagac gacucgcccg 60 a 61 79 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 79 gggaggacga ugcggcgauu acugggacag acucgcgaug ugagcucaga cgacucgccc 60 ga 62 80 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 80 gggaggacga ugcggcgacu acugggagag uacgcgaugu gugcccagac gacucgcccg 60 a 61 81 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 81 gggaggacga ugcggguccu cggggaaaau uucgcgacgu gaaccucaga cgacucgccc 60 ga 62 82 70 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 82 gggaggacga ugcggcuucu gaagauuauu ucgcgaugug aacuucagac cccucagacg 60 acucgcccga 70 83 70 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 83 gggaggacga ugcggcuucu gaagauuauu ucgcgaugug aacuccagac cccucagacg 60 acucgcccga 70 84 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 84 gggaggacga ugcggaaagu ggaagugaau ggccgacuug ucuggucaga cgacucgccc 60 ga 62 85 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 85 gggaggacga ugcggaaacc aaaucgucga ucuuuccacc gucgucagac gacucgcccg 60 a 61 86 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 86 gggaggacga ugcggaacac gaaacggagg uugacucgau cuggccagac gacucgcccg 60 a 61 87 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 87 ggaggacgau gcggaacacg gaagacagug cgacucgauc uggucagacg acucgcccga 60 88 59 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 88 gggaggacga ugcggaacaa ggacaaaagu gcgauucugu cuggcagacg acucgcccg 59 89 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 89 gggaggacga ugcggaacag acgacucgcg caacuacucu gacgucagac gacucgcccg 60 a 61 90 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 90 gggaggacga ugcggaacag guaguugggu gacucugugu gaccucagac gacucgcccg 60 a 61 91 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 91 ggaggacgau gcggaaccaa aucgucgauc uuuccaccgc ucgucagacg acucgcccga 60 92 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 92 gggaggacga ugcggaaccg cuauugaaug ucacugcuuc gugcucagac gacucgcccg 60 a 61 93 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 93 gggaggacga ugcggaaccc aaucgucuaa uucgcugcuc aucgucagac gacucgcccg 60 a 61 94 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 94 gggaggacga ugcggaaccc aaucgucuaa uucgcugcuc aucgucagac gacucgcccg 60 a 61 95 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 95 gggaggacga ugcggaacuc aaugggccua cuuuuccgug guccucagac gacucgcccg 60 a 61 96 66 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 96 gggaggacga ugcggaagcg gugagucgug gcuuucuccu cgauccucgu cagacgacuc 60 gcccga 66 97 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 97 gggaggacga ugcggaagga ugacgaggug guugggguuu gugcucagac gacucgcccg 60 a 61 98 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 98 gggaggacga ugcggacaag acgagaacgg ggggagcuac cuggccagac gacucgcccg 60 a 61 99 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 99 gggaggacga ugcggagaca cuaaacaaau uggcgaccug accgucagac gacucgcccg 60 a 61 100 69 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 100 gggaggacga ugcggagagg cucagacgac ucgcccgacc acggaugcga ccucagacga 60 cucgcccga 69 101 59 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 101 gggaggacga ugcggagaug gauggaagug cuagucuucu ggggucagac gacucgccc 59 102 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 102 gggaggacga ugcggagaug gauggaagug cuagucuuuc uggggucaga cgacucgccc 60 ga 62 103 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 103 gggaggacga ugcggagcag uugaaagacg ugcguuucgu uuggucagac gacucgcccg 60 a 61 104 67 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 104 gggaggacga ugcggagcac aauuuuuucc uuuucuuuuc guccacgugc ucagacgacu 60 cgcccga 67 105 58 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 105 gggaggacga ugcggagcug augaagauga ucucugaccc cucagacgac ucgcccga 58 106 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 106 gggaggacga ugcggagcug aaagcgaagu gcgagguguu ugguccagac gacucgcccg 60 a 61 107 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 107 ggaggacgau gcggagcgaa agugcgagug auugaccagg ugcucagacg acucgcccga 60 108 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 108 gggaggacga ugcggagcgu gagaacaguu gcgagauugc cuggucagac gacucgcccg 60 a 61 109 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 109 gggaggacga ugcggaggag agugugguga gggucguuug agggucagac gacucgcccg 60 a 61 110 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 110 gggaggacga ugcggaggag cugaugaaga ugaucucuga ccccucagac gacucgcccg 60 a 61 111 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 111 gggaggacga ugcggaguuc ccagccgccu ugauuucucc guggucagac gacucgcccg 60 a 61 112 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 112 gggaggacga ugcggauaag ugcgagugua ugaggugcgu guggucagac gacucgcccg 60 a 61 113 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 113 gggaggacga ugcggaucug aggagcucuu cgucgugcug agggucagac gacucgcccg 60 a 61 114 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 114 gggaggacga ugcggauccg aaucuuccuu acacguccug cucgucagac gacucgcccg 60 a 61 115 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 115 ggaggacgau gcggauccgc aaaccgacag cucgaguucc gccucagacg acucgcccga 60 116 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 116 gggaggacga ugcggauggu acuuuagucu uccuugauuc cgccucagac gacucgcccg 60 a 61 117 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 117 ggaggacgau gcggaugaug acugaacgug cgacucgacc uggccagacg acucgcccga 60 118 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 118 ggaggacgau gcggaugagg aggaagaguc ugaggugcug gggucagacg acucgcccga 60 119 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 119 gggaggacga ugcggauuuc ggucgacuaa auaggggugg cucgucagac gacucgcccg 60 a 61 120 68 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 120 gggaggacga ugcggcaaga ggucagacga cugccccgag uccucccccg gucagacgac 60 ucgcccga 68 121 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 121 gggaggacga ugcggcagug aaaggcgagu uuucuccucu cccucagacg acucgcccga 60 122 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 122 gggaggacga ugcggcaucg uucaggagaa uccacuucgc cucgucagac gacucgcccg 60 a 61 123 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 123 gggaggacga ugcggcaucu uccuuguucu uccaaccgug cuccucagac gacucgcccg 60 a 61 124 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 124 gggaggacga ugcggcaucg uaaacaauuu guuccaucuc cgccucagac gacucgcccg 60 a 61 125 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 125 gggaggacga ugcggcauug uccaaguuua gcuguccgug cucgucagac gacucgcccg 60 a 61 126 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 126 gggaggacga ugcggcauag uccggauacu agucaccagc cucguagacg acucgcccga 60 127 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 127 gggaggacga ugcggccguc ucgauccuuc uaugccuucg cucgucagac gacucgcccg 60 a 61 128 65 RNA Artificial Sequence unsure (34) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N at position 34 is a or c or g or u 128 gggaggacga ugcggcggga aguuugaggu guanuaccug uugucugguc agacgacucg 60 cccga 65 129 67 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 129 gggaggacga ugcggcucaa cucucccaca gacgacucgc ccgggccucc ucagacgacu 60 cgcccga 67 130 58 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 130 gggaggacga ugcgggacuc cucgaccgac ucgaccggcu cgucagacga cucgccga 58 131 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 131 ggaggacgau gcgggaacca aaucgucgau cuuuccaccg cucgucagac gacucgcccg 60 a 61 132 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 132 gggaggacga ugcgggacca ccucgauccu cagcgccauu gcccucagac gacucgcccg 60 a 61 133 57 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 133 gggaggacga ugcgggaagu ggaaggguag uugugugacc ucagacgacu cgcccga 57 134 67 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 134 cggaggacga ugcgggcaaa cuuuuccuuu ucccuuuauc uuccuugccc ucagacgacu 60 cgcccga 67 135 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 135 gggaggacga ugcggggccg acgauucacc aauguucucu cuggucagac gacucgcccg 60 a 61 136 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 136 ggaggacgau gcgggguucc ucaaugacga ucuccauucc gcucgucaga cgacucgccc 60 ag 62 137 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 137 ggaggacgau gcgggucgac auugaagcug cucugccuug auccucagac gacucgcccg 60 a 61 138 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 138 gggaggacga ugcgguccaa uucguucuca ugccuuuccg cucgucagac gacucgcccg 60 a 61 139 59 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 139 gggaggacga ugcgguccgc aaguuuagca cucacugccu cgucagacga cucgcccga 59 140 58 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 140 gggaggacga ugcgguccac aucgaauuuu cuguccguuc gucagacgac ucgcccga 58 141 63 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 141 gggaggacga ugcggucgau guucuuccuc accacugcuc gucgccucag acgacucgcc 60 cga 63 142 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 142 gggaggacga ugcggucgag cugagagggg cuacuuguuc uggucacaga cgacucgccc 60 ga 62 143 63 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 143 gggaggacga ugcgguggaa gcgaaugggc uagggugggc ugaccuccag acgacucgcc 60 cga 63 144 64 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 144 gggaggacga ugcgguggac uucuuuuccu cuuccuccuu ccgccgguca gacgacucgc 60 ccga 64 145 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 145 ggaggacgau gcgguuccaa aucgucuaag caucgcucgc ucgucagacg acucgcccag 60 146 62 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 146 gggaggacga ugcgguucca caucgcaauu uucuguccgu gcucgucaga cgacucgccc 60 ga 62 147 60 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 147 gggaggacga ugcgguucca caucgaauuu ucuguccgug ucgucagacg acucgcccga 60 148 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 148 gggaggacga ugcgguuccg aucgacucca cauacaucug cucgucagac gacucgcccg 60 a 61 149 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 149 gggaggacga ugcgguuccg acaucgaugu ugcucuucgc cucgucagac gacucgcccg 60 a 61 150 63 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 150 gggaggacga ugcgguuccg aaguucuucc cccgagccuu cccccuccag acgacucgcc 60 cga 63 151 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 151 gggaggacga ugcgguuccg acgauucucc aauguucucu cuggucagac gacucgcccg 60 a 61 152 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 152 gggaggacga ugcgguuccg acgauucucc aaucuucucu cuggucagac gacucgcccg 60 a 61 153 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 153 gggaggacga ugcgguuccg caaguuuaga cacucacugc cucgucagac gacucgcccg 60 a 61 154 61 RNA Artificial Sequence unsure (33) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N at position 33 is a or c or g or u 154 gggaggacga ugcgguuccg caaaguagau aunucauccg cacgucagac gacucgcccg 60 a 61 155 61 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 155 gggaggacga ugcgguugag uggacagugc gauucguuuu ggggucagac gacucgcccg 60 a 61 156 98 DNA Artificial Sequence unsure (33)..(72) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N′s at positions 33-72 are a or c or g or t. 156 taatacgact cactataggg aggacgatgc ggnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nncagacgac tcgcccga 98 157 81 RNA Artificial Sequence unsure (16)..(65) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N′s at positions 16-65 are a or c or g or u. 157 gggaggacga ugcggnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnncagac gacucgcccg a 81 158 40 DNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 158 taatacgact cactataggg agataagaat aaacgctcaa 40 159 24 DNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 159 gcctgttgtg agcctcctgt cgaa 24 160 38 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 160 cgaugcgguc ucaugcgucg agugugaguu uaccuucg 38 161 36 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 161 gaugcggucu caugcgucga gugugaguuu accuuc 36 162 34 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 162 augcggucuc augcgucgag ugugaguuua ccuu 34 163 90 DNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 163 gggagataag aataaacgct caaggacgat gcggtctcat gcgtcgagtg tgagtttacc 60 ttcgtcttcg acaggaggct cacaacaggc 90 164 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 164 gggagauaag aauaaacgcu caagugcgac gcggucucga gcgcggaguu cgaguuuacc 60 uucgcauucg acaggaggcu cacaacaggc 90 165 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 165 gggagauaag aauaaacgcu caagcucgac gcggucccag gcguggaguc uggguuuacc 60 uucgaguucg acaggaggcu cacaacaggc 90 166 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 166 gggagauaag aauaaacgcu caagaaccac gcggucucag gcguagaguc ugaguuuacc 60 uugguuuucg acaggaggcu cacaacaggc 90 167 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 167 gggagauaag aauaaacgcu caagaaccac gcggucucag gcguagaguc uguguuuacc 60 uugguuuucg acaggaggcu cacaacaggc 90 168 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 168 gggagauaag aauaaacgcu caagugcgac gcggucucga gcgcggaguu cgaguucacc 60 uucgcauucg acaggaggcu cacaacaggc 90 169 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 169 gggagauaag aauaaacgcu caagcacaac gcggucucau gcgucgagua ugaguuuacc 60 uuuguguucg acaggaggcu cacaacaggc 90 170 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 170 gggagauaag aauaaacgcu caagguccuc gcggucucau gcgccgagua ugaguuuacc 60 uaggacuucg acaggaggcu cacaacaggc 90 171 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 171 gggagauaag aauaaacgcu caaggucguc gcggucugau gcgcugagua ucaguuuacc 60 uacgacuucg acaggaggcu cacaacaggc 90 172 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 172 gggagauaag aauaaacgcu caagguacac gcggucugac gcgcugagug ucaguuuacc 60 uuguacuucg acaggaggcu cacaacaggc 90 173 91 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 173 gggagauaag aauaaacgcu caagaaacca cgcggucuca ggcgcagagu cugaguuuac 60 cuucgcauuc gacaggaggc ucacaacagg c 91 174 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 174 gggagauaag aauaaacgcu caagaaccac gcggucucag gcgcagaguc ugaguuuacc 60 uugguuuucg acaggaggcu cacaacaggc 90 175 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 175 gggagauaag aauaaacgcu caaggacgcc gcggucucag gcgcugaguc ugaguuuacc 60 ugcgucuucg acaggaggcu cacaacaggc 90 176 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 176 gggagauaag aauaaacgcu caaggcugac gcggucucag gcguggaguc ugaguuuacc 60 uucggcuucg acaggaggcu cacaacaggc 90 177 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 177 gggagauaag aauaaacgcu caagcaugac gcggucucag gcguggaguc ugaguuuacc 60 uucguguucg acaggaggcu cacaacaggc 90 178 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 178 gggagauaag aauaaacgcu caaggucgac gcggucucag gcguugaguc uguguuuacc 60 uucgacuucg acaggaggcu cacaacaggc 90 179 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 179 gggagauaag aauaaacgcu caaggucgac gcggucucag gcguugaguc uguguuuacc 60 uucgacuucg acaggaggcu cacaacaggc 90 180 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 180 gggagauaag aauaaacgcu caaggacgcc gcggucucag gcguugaguc ugaguuuacc 60 ugcgucuucg acaggaggcu cacaacaggc 90 181 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 181 gggagauaag aauaaacgcu caaggacgac gcggucugau gcgcugagug ucaguuuacc 60 uucgucuucg acaggaggcu cacaacaggc 90 182 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 182 gggagauaag aauaaacgcu caagaacgac gcggucugau gcgcugagug ucaguguacc 60 uucgucuucg acaggaggcu cacaacaggc 90 183 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 183 gggagauaag aauaaacgcu caaggucgac gcggucugau gcguagagug ucaguuuacc 60 uucgacuucg acaggaggcu cacaacaggc 90 184 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 184 gggagauaag aauaaacgcu caaggucgac gcggucugau gcguagagug ucaguucacc 60 uucgacuucg acaggaggcu cacaacaggc 90 185 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 185 gggagauaag aauaaacgcu caaguacgac gcggucccgu gcguggagug cggguuuacc 60 uucguauucg acaggaggcu cacaacaggc 90 186 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 186 gggagauaag aauaaacgcu caaggacgac gcggucugau gcgcagagug ucgguuuacc 60 uuugucuucg acaggaggcu cacaacaggc 90 187 90 RNA Artificial Sequence unsure (33) Description of Artificial Sequence Completely Synthesized Nucleic Acid. N at position 33 is a or c or g or u 187 gggagauaag aauaaacgcu caaggacgac gcngucugau gcgcagagug ucaguuuacc 60 uucgacuucg acaggaggcu cacaacaggc 90 188 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 188 gggagauaag aauaaacgcu caaggacgac gcggucugau gcgcagagug ucaguuuacc 60 uucgucuucg acaggaggcu cacaacaggc 90 189 90 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 189 gggagauaag aauaaacgcu caaggacgac gcggucggau gcgcagagug uccguuuacc 60 uucgucuucg acaggaggcu cacaacaggc 90 190 38 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 190 cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 191 37 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 191 cgccgcgguu cgggcgcuga gucugaguuu accugcg 37 192 38 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 192 cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 193 38 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 193 cgaugcgguc ucaugcgucg agugugaguu uaccuucg 38 194 38 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 194 cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 195 38 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 195 cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 196 38 RNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 196 cgccgcgguc ucaggcgcug agucugaguu uaccugcg 38 197 37 DNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 197 ggcggggcta cgtaccgggg ctttgtaaaa ccccgcc 37 198 25 DNA Artificial Sequence Description of Artificial Sequence Completely Synthesized Nucleic Acid 198 ctctcgcacc catctctctc cttct 25

Claims (5)

We claim:
1. A method for treating a Complement System-mediated disease comprising administering to a patient in need thereof a pharmaceutically effective amount of a Nucleic Acid Ligand of a Complement System Protein.
2. The method of claim 1 wherein said Nucleic Acid Ligand is identified according to a method comprising:
a) preparing a candidate mixture of nucleic acids;
b) contacting the candidate mixture of nucleic acids with a Complement System Protein, wherein nucleic acids having an increased affinity to said Complement System Protein relative to the candidate mixture may be partitioned from the remainder of the candidate mixture;
c) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; and
d) amplifying the increased affinity nucleic acids to yield a mixture of nucleic acids enriched for nucleic acid sequences with relatively higher affinity and specificity for binding said Complement System Protein, wherein Nucleic Acid Ligands of said Complement System Protein may be identified.
3. The method of claim 1 wherein said Complement System Protein is selected from the group consisting of C1q, C3 and C5.
4. The method of claim 1 wherein said Complement System-mediated disease is selected from the group consisting of myocardial infarction and Alzheimer's disease.
5. A method of treating a Complement System-mediated disease comprising administering to a patient in need thereof a pharmaceutical agent which specifically treats said disease and administering a Nucleic Acid Ligand C1q inhibitor in an amount effective to inhibit activation of the Complement System.
US10/435,750 1990-06-11 2003-05-08 High affinity nucleic acid ligands of complement system proteins Abandoned US20030191084A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/435,750 US20030191084A1 (en) 1990-06-11 2003-05-08 High affinity nucleic acid ligands of complement system proteins
US11/288,622 US7964572B2 (en) 1996-02-01 2005-11-28 High affinity nucleic acid ligands of complement system proteins

Applications Claiming Priority (14)

Application Number Priority Date Filing Date Title
US53642890A 1990-06-11 1990-06-11
US08/409,442 US5696249A (en) 1990-06-11 1995-03-24 Nucleic acid ligands
US08/412,110 US5670637A (en) 1990-06-11 1995-03-27 Nucleic acid ligands
US42896495A 1995-04-25 1995-04-25
US08/469,609 US5843653A (en) 1990-06-11 1995-06-06 Method for detecting a target molecule in a sample using a nucleic acid ligand
US59533596A 1996-02-01 1996-02-01
PCT/US1997/001739 WO1997028178A1 (en) 1996-02-01 1997-01-30 High affinity nucleic acid ligands of complement system proteins
US09/023,228 US6140490A (en) 1996-02-01 1998-02-12 High affinity nucleic acid ligands of complement system proteins
US09/143,190 US6110900A (en) 1990-06-11 1998-08-27 Nucleic acid ligands
US09/163,025 US6395888B1 (en) 1996-02-01 1998-09-29 High affinity nucleic acid ligands of complement system proteins
US09/502,344 US6331398B1 (en) 1990-06-11 2000-02-10 Nucleic acid ligands
US10/037,986 US6933116B2 (en) 1990-06-11 2001-10-18 Nucleic acid ligand binding site identification
US10/037,282 US6566343B2 (en) 1996-02-01 2002-01-03 High affinity nucleic acid ligands of complement system proteins
US10/435,750 US20030191084A1 (en) 1990-06-11 2003-05-08 High affinity nucleic acid ligands of complement system proteins

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US10/037,986 Continuation-In-Part US6933116B2 (en) 1990-06-11 2001-10-18 Nucleic acid ligand binding site identification
US10/037,282 Continuation US6566343B2 (en) 1990-06-11 2002-01-03 High affinity nucleic acid ligands of complement system proteins

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/288,622 Continuation US7964572B2 (en) 1996-02-01 2005-11-28 High affinity nucleic acid ligands of complement system proteins

Publications (1)

Publication Number Publication Date
US20030191084A1 true US20030191084A1 (en) 2003-10-09

Family

ID=26696880

Family Applications (5)

Application Number Title Priority Date Filing Date
US09/163,025 Expired - Lifetime US6395888B1 (en) 1990-06-11 1998-09-29 High affinity nucleic acid ligands of complement system proteins
US10/037,282 Expired - Lifetime US6566343B2 (en) 1990-06-11 2002-01-03 High affinity nucleic acid ligands of complement system proteins
US10/435,750 Abandoned US20030191084A1 (en) 1990-06-11 2003-05-08 High affinity nucleic acid ligands of complement system proteins
US11/288,622 Expired - Fee Related US7964572B2 (en) 1996-02-01 2005-11-28 High affinity nucleic acid ligands of complement system proteins
US13/009,696 Abandoned US20110196021A1 (en) 1996-02-01 2011-01-19 High Affinity Nucleic Acid Ligands of Complement System Proteins

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US09/163,025 Expired - Lifetime US6395888B1 (en) 1990-06-11 1998-09-29 High affinity nucleic acid ligands of complement system proteins
US10/037,282 Expired - Lifetime US6566343B2 (en) 1990-06-11 2002-01-03 High affinity nucleic acid ligands of complement system proteins

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/288,622 Expired - Fee Related US7964572B2 (en) 1996-02-01 2005-11-28 High affinity nucleic acid ligands of complement system proteins
US13/009,696 Abandoned US20110196021A1 (en) 1996-02-01 2011-01-19 High Affinity Nucleic Acid Ligands of Complement System Proteins

Country Status (5)

Country Link
US (5) US6395888B1 (en)
EP (1) EP1062226B1 (en)
AU (1) AU765668B2 (en)
CA (1) CA2320100C (en)
WO (1) WO1999041271A1 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090269356A1 (en) * 2006-03-08 2009-10-29 David Epstein Complement Binding Aptamers and Anti-C5 Agents Useful in the Treatment of Ocular Disorders
US20100105611A1 (en) * 2006-09-08 2010-04-29 John Hamer Method of treating respiratory disorders
US20110060027A1 (en) * 2005-02-14 2011-03-10 Claude Benedict Aptamer Therapeutics Useful in the Treatment of Complement-Related Disorders
US8236570B2 (en) 2009-11-03 2012-08-07 Infoscitex Methods for identifying nucleic acid ligands
WO2012178083A1 (en) 2011-06-22 2012-12-27 Apellis Pharmaceuticals, Inc. Methods of treating chronic disorders with complement inhibitors
US8841429B2 (en) 2009-11-03 2014-09-23 Vivonics, Inc. Nucleic acid ligands against infectious prions
US9056076B2 (en) 2005-10-08 2015-06-16 Potentia Pharmaceuticals, Inc. Method of treating age-related macular degeneration comprising administering a compstatin analog
EP2979729A2 (en) 2007-02-05 2016-02-03 Apellis Pharmaceuticals, Inc. Compstatin analogues for use in the treatment of inflammatory conditions of the respiratory system
US9518265B2 (en) 2012-01-10 2016-12-13 Noxxon Pharma Ag C5a binding nucleic acids
US10308687B2 (en) 2013-03-15 2019-06-04 Apellis Pharmaceuticals, Inc. Cell-penetrating compstatin analogs and uses thereof
US10875893B2 (en) 2012-11-15 2020-12-29 Apellis Pharmaceuticals, Inc. Cell-reactive, long-acting, or targeted compstatin analogs and related compositions and methods
US10942184B2 (en) 2012-10-23 2021-03-09 Caris Science, Inc. Aptamers and uses thereof
WO2021067526A1 (en) 2019-10-02 2021-04-08 Alexion Pharmaceuticals, Inc. Complement inhibitors for treating drug-induced complement-mediated response
US11040107B2 (en) 2017-04-07 2021-06-22 Apellis Pharmaceuticals, Inc. Dosing regimens and related compositions and methods
US11903994B2 (en) 2015-10-07 2024-02-20 Apellis Pharmaceuticals, Inc. Dosing regimens

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6395888B1 (en) * 1996-02-01 2002-05-28 Gilead Sciences, Inc. High affinity nucleic acid ligands of complement system proteins
CA2328356A1 (en) * 1999-12-22 2001-06-22 Itty Atcravi Recreational vehicles
US7645743B2 (en) * 1999-12-22 2010-01-12 Altermune, Llc Chemically programmable immunity
EP2896631A1 (en) * 2000-10-10 2015-07-22 Genentech, Inc. Inhibition of complement C5 activation for the treatment and prevention of delayed xenograft or acute vascular rejection
JP4379561B2 (en) * 2001-01-30 2009-12-09 キヤノンファインテック株式会社 Sheet processing apparatus and image forming apparatus having the same
US7727969B2 (en) * 2003-06-06 2010-06-01 Massachusetts Institute Of Technology Controlled release nanoparticle having bound oligonucleotide for targeted delivery
AU2004268614C1 (en) * 2003-08-27 2010-10-28 Ophthotech Corporation Combination therapy for the treatment of ocular neovascular disorders
AU2012254935B2 (en) * 2004-02-12 2014-05-29 Archemix Llc Aptamer Therapeutics Useful in the Treatment of Complement-Related Disorders
AU2014218429B2 (en) * 2004-02-12 2016-06-09 Archemix Llc Aptamer Therapeutics Useful in the Treatment of Complement-Related Disorders
EP1727567B1 (en) 2004-02-12 2013-07-03 Archemix LLC Aptamer therapeutics useful in the treatment of complement-related disorders
US8318920B2 (en) * 2004-02-27 2012-11-27 Operational Technologies Corporation Therapeutic nucleic acid-3′-conjugates
US7910297B2 (en) * 2004-02-27 2011-03-22 Operational Technologies Corporation Therapeutic nucleic acid-3' -conjugates
US8389710B2 (en) 2004-02-27 2013-03-05 Operational Technologies Corporation Therapeutic nucleic acid-3′-conjugates
AU2008303775A1 (en) * 2007-09-24 2009-04-02 Noxxon Pharma Ag C5a binding nucleic acids
US8927509B2 (en) * 2008-05-20 2015-01-06 The Research Foundation Of State University Of New York Aptamer modulators of complement protein C3 and biologically active proteolytic products thereof
BRPI1011269A2 (en) * 2009-05-05 2016-09-27 Altermune Technologies Llc chemically programmable immunity
GB201114662D0 (en) 2011-08-24 2011-10-12 Altermune Technologies Llc Chemically programmable immunity
NZ628625A (en) 2012-02-20 2016-03-31 Swedish Orphan Biovitrum Ab Publ Polypeptides binding to human complement c5
WO2015006734A1 (en) 2013-07-12 2015-01-15 Ophthotech Corporation Methods for treating or preventing ophthalmological conditions
NO2718257T3 (en) 2014-05-30 2018-04-14
CA2991045A1 (en) * 2015-06-29 2017-01-05 Caris Science, Inc. Therapeutic oligonucleotides binding c1q

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5270163A (en) * 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
US5428149A (en) * 1993-06-14 1995-06-27 Washington State University Research Foundation Method for palladium catalyzed carbon-carbon coulping and products
US5459015A (en) * 1990-06-11 1995-10-17 Nexstar Pharmaceuticals, Inc. High-affinity RNA ligands of basic fibroblast growth factor
US5472841A (en) * 1990-06-11 1995-12-05 Nexstar Pharmaceuticals, Inc. Methods for identifying nucleic acid ligands of human neutrophil elastase
US5476766A (en) * 1990-06-11 1995-12-19 Nexstar Pharmaceuticals, Inc. Ligands of thrombin
US5496938A (en) * 1990-06-11 1996-03-05 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands to HIV-RT and HIV-1 rev
US5503978A (en) * 1990-06-11 1996-04-02 University Research Corporation Method for identification of high affinity DNA ligands of HIV-1 reverse transcriptase
US5527894A (en) * 1990-06-11 1996-06-18 Nexstar Pharmacueticals, Inc. Ligands of HIV-1 tat protein
US5543293A (en) * 1990-06-11 1996-08-06 Nexstar Pharmaceuticals, Inc. DNA ligands of thrombin
US5567588A (en) * 1990-06-11 1996-10-22 University Research Corporation Systematic evolution of ligands by exponential enrichment: Solution SELEX
US6140490A (en) * 1996-02-01 2000-10-31 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands of complement system proteins
US6395888B1 (en) * 1996-02-01 2002-05-28 Gilead Sciences, Inc. High affinity nucleic acid ligands of complement system proteins

Family Cites Families (72)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3710795A (en) 1970-09-29 1973-01-16 Alza Corp Drug-delivery device with stretched, rate-controlling membrane
US5212071A (en) 1988-04-01 1993-05-18 The Johns Hopkins University Nucleic acids encoding a human C3b/C4b receptor (CR1)
US5981481A (en) 1974-12-06 1999-11-09 The Johns Hopkins University Human C3b/C4b receptor (CR1)
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4959309A (en) 1983-07-14 1990-09-25 Molecular Diagnostics, Inc. Fast photochemical method of labelling nucleic acids for detection purposes in hybridization assays
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
GB2183661B (en) 1985-03-30 1989-06-28 Marc Ballivet Method for obtaining dna, rna, peptides, polypeptides or proteins by means of a dna recombinant technique
US4935363A (en) 1987-03-30 1990-06-19 Board Of Regents, The University Of Texas System Sterol regulatory elements
WO1989006694A1 (en) 1988-01-15 1989-07-27 Trustees Of The University Of Pennsylvania Process for selection of proteinaceous substances which mimic growth-inducing molecules
US5256642A (en) 1988-04-01 1993-10-26 The Johns Hopkins University Compositions of soluble complement receptor 1 (CR1) and a thrombolytic agent, and the methods of use thereof
US5244805A (en) 1989-05-17 1993-09-14 University Of Georgia Research Foundation, Inc. Baculovirus expression vectors
US5070010A (en) 1989-10-30 1991-12-03 Hoffman-La Roche Inc. Method for determining anti-viral transactivating activity
CA2078659A1 (en) 1990-03-21 1991-09-22 David J. Ecker Reagents and methods for modulating gene expression through rna mimicry
US5637459A (en) 1990-06-11 1997-06-10 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chimeric selex
US5648214A (en) 1990-06-11 1997-07-15 University Research Corporation High-affinity oligonucleotide ligands to the tachykinin substance P
US5705337A (en) 1990-06-11 1998-01-06 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-SELEX
US5683867A (en) 1990-06-11 1997-11-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: blended SELEX
US5580737A (en) 1990-06-11 1996-12-03 Nexstar Pharmaceuticals, Inc. High-affinity nucleic acid ligands that discriminate between theophylline and caffeine
US6011020A (en) 1990-06-11 2000-01-04 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US5789157A (en) 1990-06-11 1998-08-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: tissue selex
US5726017A (en) 1990-06-11 1998-03-10 Nexstar Pharmaceuticals, Inc. High affinity HIV-1 gag nucleic acid ligands
US6147204A (en) 1990-06-11 2000-11-14 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US5707796A (en) 1990-06-11 1998-01-13 Nexstar Pharmaceuticals, Inc. Method for selecting nucleic acids on the basis of structure
US5861254A (en) 1997-01-31 1999-01-19 Nexstar Pharmaceuticals, Inc. Flow cell SELEX
US5654151A (en) 1990-06-11 1997-08-05 Nexstar Pharmaceuticals, Inc. High affinity HIV Nucleocapsid nucleic acid ligands
US5660985A (en) 1990-06-11 1997-08-26 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands containing modified nucleotides
US5763177A (en) 1990-06-11 1998-06-09 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: photoselection of nucleic acid ligands and solution selex
US5674685A (en) 1990-06-11 1997-10-07 Nexstar Pharmaceuticals, Inc. High affinity PDGF nucleic acid ligands
US5668264A (en) 1990-06-11 1997-09-16 Nexstar Pharmaceuticals, Inc. High affinity PDGF nucleic acid ligands
US5635615A (en) 1990-06-11 1997-06-03 Nexstar Pharmaceuticals, Inc. High affinity HIV nucleocapsid nucleic acid ligands
US5763173A (en) 1990-06-11 1998-06-09 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand inhibitors to DNA polymerases
EP0533838B1 (en) 1990-06-11 1997-12-03 NeXstar Pharmaceuticals, Inc. Nucleic acid ligands
AU8547691A (en) 1990-09-21 1992-04-15 Fred Hutchinson Cancer Research Center Protein sequence-specific oligonucleotide sequences
PL169576B1 (en) 1990-10-12 1996-08-30 Max Planck Gesellschaft Method of obtaining rna molecule of catalytic activity
AU1456092A (en) 1991-02-21 1992-09-15 Gilead Sciences, Inc. Aptamers specific for thrombin and methods of use
CA2104698A1 (en) 1991-02-21 1992-08-22 John J. Toole Aptamers specific for biomolecules and methods of making
WO1994004679A1 (en) 1991-06-14 1994-03-03 Genentech, Inc. Method for making humanized antibodies
US5252216A (en) 1992-03-24 1993-10-12 Smithkline Beecham Corporation Protein purification
US5456909A (en) 1992-08-07 1995-10-10 T Cell Sciences, Inc. Glycoform fractions of recombinant soluble complement receptor 1 (sCR1) having extended half-lives in vivo
US5338671A (en) 1992-10-07 1994-08-16 Eastman Kodak Company DNA amplification with thermostable DNA polymerase and polymerase inhibiting antibody
US5262564A (en) 1992-10-30 1993-11-16 Octamer, Inc. Sulfinic acid adducts of organo nitroso compounds useful as retroviral inactivating agents anti-retroviral agents and anti-tumor agents
JP3689422B2 (en) 1993-02-12 2005-08-31 アーヴァント イミュノセラピューティクス インコーポレイテッド Intrapulmonary administration of sCR1 and other complement inhibitory proteins
DE69430016D1 (en) 1993-07-09 2002-04-04 Avant Immunotherapeutics Inc PROTEIN CLEANING
US5817635A (en) 1993-08-09 1998-10-06 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Modified ribozymes
CA2169536A1 (en) * 1993-09-08 1995-03-16 Larry Gold Nucleic acid ligands and improved methods for producing the same
US5919455A (en) 1993-10-27 1999-07-06 Enzon, Inc. Non-antigenic branched polymer conjugates
US6074642A (en) 1994-05-02 2000-06-13 Alexion Pharmaceuticals, Inc. Use of antibodies specific to human complement component C5 for the treatment of glomerulonephritis
US5932462A (en) 1995-01-10 1999-08-03 Shearwater Polymers, Inc. Multiarmed, monofunctional, polymer for coupling to molecules and surfaces
US5723750A (en) 1995-01-12 1998-03-03 Vanderbilt University Transgenic plants expressing disassembly deficient viral coat proteins
US6013443A (en) 1995-05-03 2000-01-11 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: tissue SELEX
DE69636656T2 (en) 1995-06-02 2007-10-04 Gilead Sciences, Inc., Foster City OLIGONUCLEOTIDE LIGANDS WITH HIGH AFFINITY FOR PDGF
AU726844B2 (en) 1995-06-07 2000-11-23 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands that bind to and inhibit DNA polymerases
US6229002B1 (en) 1995-06-07 2001-05-08 Nexstar Pharmaceuticlas, Inc. Platelet derived growth factor (PDGF) nucleic acid ligand complexes
EP0888374B1 (en) * 1996-02-01 2010-05-19 Gilead Sciences, Inc. HIGH AFFINITY NUCLEIC ACID LIGANDS OF THE COMPLEMENT SYSTEM PROTEIN C1q
WO1997042317A1 (en) * 1996-05-07 1997-11-13 T Cell Sciences, Inc. APTAMERS FOR COMPLEMENT PROTEIN C3b
US5971481A (en) * 1996-10-11 1999-10-26 Giroflex Entwicklungs Ag Chair, specially an office chair
ES2259188T3 (en) 1996-10-25 2006-09-16 Gilead Sciences, Inc. NUCLEIC ACID BINDING COMPLEXES OF VASCULAR ENDOTELIAL GROWTH FACTOR (VEGF).
US6051698A (en) 1997-06-06 2000-04-18 Janjic; Nebojsa Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US6278039B1 (en) 1997-05-28 2001-08-21 Axys Pharmaceuticals, Inc. C. elegans deletion mutants
US7419663B2 (en) 1998-03-20 2008-09-02 Genentech, Inc. Treatment of complement-associated disorders
US6251588B1 (en) 1998-02-10 2001-06-26 Agilent Technologies, Inc. Method for evaluating oligonucleotide probe sequences
US6573299B1 (en) 1999-09-20 2003-06-03 Advanced Medical Instruments Method and compositions for treatment of the aging eye
RU2222345C2 (en) 2002-01-21 2004-01-27 Волчек Игорь Анатольевич Pharmaceutical composition with cytokine and immunomodulating effects
US20040249130A1 (en) 2002-06-18 2004-12-09 Martin Stanton Aptamer-toxin molecules and methods for using same
US20040180360A1 (en) 2002-11-21 2004-09-16 Charles Wilson Multivalent aptamer therapeutics with improved pharmacodynamic properties and methods of making and using the same
WO2004050899A2 (en) 2002-12-03 2004-06-17 Archemix Corporation Method for in vitro selection of 2’-substituted nucleic acids
US20050037394A1 (en) 2002-12-03 2005-02-17 Keefe Anthony D. Method for in vitro selection of 2'-substituted nucleic acids
EP1727567B1 (en) 2004-02-12 2013-07-03 Archemix LLC Aptamer therapeutics useful in the treatment of complement-related disorders
US7803931B2 (en) 2004-02-12 2010-09-28 Archemix Corp. Aptamer therapeutics useful in the treatment of complement-related disorders
EP1732571A4 (en) 2004-03-05 2009-09-09 Archemix Corp Controlled modulation of the pharmacokinetics and biodistribution of aptamer therapeutics
KR20080025181A (en) 2005-06-30 2008-03-19 아케믹스 코포레이션 Materials and methods for generation of fully 2'-modified nucleic acid transcripts
RU2477137C2 (en) 2006-03-08 2013-03-10 АРКЕМИКС Эл Эл Си Complement-binding aptamers and c5 agents applicable for treating ocular disorders

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5503978A (en) * 1990-06-11 1996-04-02 University Research Corporation Method for identification of high affinity DNA ligands of HIV-1 reverse transcriptase
US5459015A (en) * 1990-06-11 1995-10-17 Nexstar Pharmaceuticals, Inc. High-affinity RNA ligands of basic fibroblast growth factor
US5472841A (en) * 1990-06-11 1995-12-05 Nexstar Pharmaceuticals, Inc. Methods for identifying nucleic acid ligands of human neutrophil elastase
US5476766A (en) * 1990-06-11 1995-12-19 Nexstar Pharmaceuticals, Inc. Ligands of thrombin
US5496938A (en) * 1990-06-11 1996-03-05 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands to HIV-RT and HIV-1 rev
US5270163A (en) * 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
US5527894A (en) * 1990-06-11 1996-06-18 Nexstar Pharmacueticals, Inc. Ligands of HIV-1 tat protein
US5543293A (en) * 1990-06-11 1996-08-06 Nexstar Pharmaceuticals, Inc. DNA ligands of thrombin
US5567588A (en) * 1990-06-11 1996-10-22 University Research Corporation Systematic evolution of ligands by exponential enrichment: Solution SELEX
US5428149A (en) * 1993-06-14 1995-06-27 Washington State University Research Foundation Method for palladium catalyzed carbon-carbon coulping and products
US6140490A (en) * 1996-02-01 2000-10-31 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands of complement system proteins
US6395888B1 (en) * 1996-02-01 2002-05-28 Gilead Sciences, Inc. High affinity nucleic acid ligands of complement system proteins
US6566343B2 (en) * 1996-02-01 2003-05-20 Gilead Sciences, Inc. High affinity nucleic acid ligands of complement system proteins

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9617546B2 (en) 2005-02-14 2017-04-11 Archemix Llc Aptamer therapeutics useful in the treatment of complement-related disorders
US20110060027A1 (en) * 2005-02-14 2011-03-10 Claude Benedict Aptamer Therapeutics Useful in the Treatment of Complement-Related Disorders
US8236773B2 (en) 2005-02-14 2012-08-07 Archemix Llc Aptamer therapeutics useful in the treatment of complement-related disorders
US11913000B2 (en) 2005-02-14 2024-02-27 Iveric Bio, Inc. Aptamer therapeutics useful in the treatment of complement-related disorders
US10947544B2 (en) 2005-02-14 2021-03-16 Archemix Llc Aptamer therapeutics useful in the treatment of complement-related disorders
US8436164B2 (en) 2005-02-14 2013-05-07 Archemix Llc Aptamer therapeutics useful in the treatment of complement-related disorders
US8946184B2 (en) 2005-02-14 2015-02-03 Archemix Llc Aptamer therapeutics useful in the treatment of complement-related disorders
US9056076B2 (en) 2005-10-08 2015-06-16 Potentia Pharmaceuticals, Inc. Method of treating age-related macular degeneration comprising administering a compstatin analog
US10407466B2 (en) 2005-10-08 2019-09-10 Apellis Pharmaceuticals, Inc. Methods of selecting compstatin mimetics
US20090269356A1 (en) * 2006-03-08 2009-10-29 David Epstein Complement Binding Aptamers and Anti-C5 Agents Useful in the Treatment of Ocular Disorders
US20100105611A1 (en) * 2006-09-08 2010-04-29 John Hamer Method of treating respiratory disorders
EP2979729A2 (en) 2007-02-05 2016-02-03 Apellis Pharmaceuticals, Inc. Compstatin analogues for use in the treatment of inflammatory conditions of the respiratory system
US8841429B2 (en) 2009-11-03 2014-09-23 Vivonics, Inc. Nucleic acid ligands against infectious prions
US8236570B2 (en) 2009-11-03 2012-08-07 Infoscitex Methods for identifying nucleic acid ligands
US9085773B2 (en) 2009-11-03 2015-07-21 Vivonics, Inc. Methods for identifying nucleic acid ligands
WO2012178083A1 (en) 2011-06-22 2012-12-27 Apellis Pharmaceuticals, Inc. Methods of treating chronic disorders with complement inhibitors
EP3524258A1 (en) 2011-06-22 2019-08-14 Apellis Pharmaceuticals, Inc. Methods of treating chronic disorders with complement inhibitors
US10590424B2 (en) 2012-01-10 2020-03-17 Noxxon Pharma Ag C5a binding nucleic acids
US9518265B2 (en) 2012-01-10 2016-12-13 Noxxon Pharma Ag C5a binding nucleic acids
US11492625B2 (en) 2012-01-10 2022-11-08 Aptarion Biotech Ag C5a binding nucleic acids
US10942184B2 (en) 2012-10-23 2021-03-09 Caris Science, Inc. Aptamers and uses thereof
US10875893B2 (en) 2012-11-15 2020-12-29 Apellis Pharmaceuticals, Inc. Cell-reactive, long-acting, or targeted compstatin analogs and related compositions and methods
US11292815B2 (en) 2012-11-15 2022-04-05 Apellis Pharmaceuticals, Inc. Cell-reactive, long-acting, or targeted compstatin analogs and related compositions and methods
US10941184B2 (en) 2013-03-15 2021-03-09 Apellis Pharmaceuticals, Inc. Cell-penetrating compstatin analogs and uses thereof
US11407789B2 (en) 2013-03-15 2022-08-09 Apellis Pharmaceuticals, Inc. Cell-penetrating compstatin analogs and uses thereof
US10308687B2 (en) 2013-03-15 2019-06-04 Apellis Pharmaceuticals, Inc. Cell-penetrating compstatin analogs and uses thereof
US11903994B2 (en) 2015-10-07 2024-02-20 Apellis Pharmaceuticals, Inc. Dosing regimens
US11040107B2 (en) 2017-04-07 2021-06-22 Apellis Pharmaceuticals, Inc. Dosing regimens and related compositions and methods
US11844841B2 (en) 2017-04-07 2023-12-19 Apellis Pharmaceuticals, Inc. Dosing regimens and related compositions and methods
WO2021067526A1 (en) 2019-10-02 2021-04-08 Alexion Pharmaceuticals, Inc. Complement inhibitors for treating drug-induced complement-mediated response

Also Published As

Publication number Publication date
US20110196021A1 (en) 2011-08-11
EP1062226A4 (en) 2006-06-14
AU2660999A (en) 1999-08-30
US6566343B2 (en) 2003-05-20
EP1062226A1 (en) 2000-12-27
US7964572B2 (en) 2011-06-21
WO1999041271A1 (en) 1999-08-19
CA2320100C (en) 2011-05-17
CA2320100A1 (en) 1999-08-19
EP1062226B1 (en) 2010-06-09
US6395888B1 (en) 2002-05-28
AU765668B2 (en) 2003-09-25
US20060079477A1 (en) 2006-04-13
US20030078221A1 (en) 2003-04-24

Similar Documents

Publication Publication Date Title
US7964572B2 (en) High affinity nucleic acid ligands of complement system proteins
US6140490A (en) High affinity nucleic acid ligands of complement system proteins
US6124449A (en) High affinity TGFβ nucleic acid ligands and inhibitors
AU777043B2 (en) Nucleic acid ligands to CD40ligand
US5668264A (en) High affinity PDGF nucleic acid ligands
ES2429442T3 (en) Therapeutic aptamers useful in the treatment of complement related disorders
RU2406507C2 (en) Aptameric therapeutic agents applicable for treating complement-related disorders
US5869641A (en) High affinity nucleic acid ligands of CD4
JP2001524320A (en) Nucleic acid ligands for tissue targets
EP0888374B1 (en) HIGH AFFINITY NUCLEIC ACID LIGANDS OF THE COMPLEMENT SYSTEM PROTEIN C1q
WO1995021853A1 (en) High-affinity ligands of basic fibroblast growth factor and thrombin
EP0840739A1 (en) High affinity nucleic acid ligands to lectins

Legal Events

Date Code Title Description
AS Assignment

Owner name: GILEAD SCIENCES, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NEXSTAR PHARMACEUTICALS, INC.;REEL/FRAME:013695/0621

Effective date: 20010123

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION