US20030148327A1 - Diagnosis of diseases associated with metastasis - Google Patents

Diagnosis of diseases associated with metastasis Download PDF

Info

Publication number
US20030148327A1
US20030148327A1 US10/240,485 US24048503A US2003148327A1 US 20030148327 A1 US20030148327 A1 US 20030148327A1 US 24048503 A US24048503 A US 24048503A US 2003148327 A1 US2003148327 A1 US 2003148327A1
Authority
US
United States
Prior art keywords
dna
recited
sequences
genes
oligomer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/240,485
Other languages
English (en)
Inventor
Alexander Olek
Christian Piepenbrock
Kurt Berlin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10019058A external-priority patent/DE10019058A1/de
Priority claimed from DE10032529A external-priority patent/DE10032529A1/de
Application filed by Epigenomics AG filed Critical Epigenomics AG
Assigned to EPIGENOMICS AG reassignment EPIGENOMICS AG ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BERLIN, KURT, OLEK, ALEXANDER, PIEPENBROCK, CHRISTIAN
Publication of US20030148327A1 publication Critical patent/US20030148327A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82Translation products from oncogenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates to nucleic acids, oligonucleotides, PNA-oligomers and to a method for the diagnosis and/or therapy of diseases which have a connection with the genetic and/or epigenetic parameters of genes associated with metastasis and, in particular, with the methylation status thereof.
  • metastasis The key feature of malignant cells is their ability to invade normal healthy tissue and to be disseminated through the body to distant organs. This ability, known as metastasis, is one of the most fatal metastasis of cancer. In breast cancer for example, the extent of metastasis to the lymph nodes is a key prognostic factor of the disease. Approximately 30% of cancers are metastatic at the time of diagnosis, and a further 30-40% of the remaining case harbour occult metastases.
  • Metastasis is a highly complicated pathway involving multiple proteolytic enzymes, cell adhesion, deformability, cell receptors and motility. Cancer metastasis can be described in the following steps. The initial events involve establishment of the primary tumour. These comprise prise the initial transforming event and proliferation of the transformed cells followed by evasion of the immune mechanism and establishment of a nutritional supply.
  • tumour cell surface proteins such as laminin, type IV collagen, and fibronectin.
  • Invasion then proceeds by enzymatic means, both proteinases (serine, cysteine, aspartic proteinases and metalloproteinases) and tumour secreted hydrolytic enzymes (e.g. glycosidase, hyaluronidase and heparanase) have been implicated.
  • tumour cells The next step involves the migration of tumour cells from the primary tumour.
  • the movement of the cells through biological barriers may be driven by a number of factors. These include tumour-derived chemotactic factors, host-derived chemoattractants, and combinations of the two.
  • tumour-derived chemotactic factors include tumour-derived chemotactic factors, host-derived chemoattractants, and combinations of the two.
  • growth factors include growth factors, collagen, peptides, matrix components and proteolytic fragments of matrix components, adhesion proteins such as laminin and fibronectin, and tumour-derived attractants.
  • adhesion proteins such as laminin and fibronectin
  • tumour-derived attractants the importance of autocrine growth factors for transformed cell motility has also been demonstrated.
  • the mobilised cells then attempt to penetrate blood vessel walls. Once the mobilised cells enter the blood stream they are embolized to distant organs. The cells may then be arrested in the lumen of small blood vessels or lymphatics. The cancer cells then proceed to extrude themselves through the walls of the vessels. Establishment of secondary tumours then proceeds by proliferation of the transformed cells followed by evasion of the immune mechanism and establishment of a nutritional supply.
  • Hodgkin's disease Garcia J F et al “Loss of p16 protein expression associated with methylation of the p16INK4A gene is a frequent finding in Hodgkin's disease” Lab invest 1999 December; 79 (12):1453-9)
  • Methylation based therapies could have considerable advantages over current methods of treatment, such as chemotherapy, surgery and radiotherapy. They may even provide a means of treating tumors which are resistant to conventional methods of therapy, as demonstrated by Soengas et al “Inactivation of the apoptosis effector Apaf-1 in malignant melanoma” Nature 409; 207-211(2001).
  • experiments with Min mice have shown that inhibition of DNA methylation can suppress tumor initiation, Laird et. al. “Suppression of intestinal neoplasia by DNA hypomethylation” Cell 81; 197-205 (1995).
  • DNA methylation analysis may provide novel means for cancer diagnosis.
  • 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
  • a relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior.
  • 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using “normal” molecular biological techniques, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing which can now be fully exploited.
  • the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec. 15; 24(24):5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method.
  • Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays.
  • the simple attachment of Cy3 and Cy5 dyes to the 5′-OH of the specific probe are particularly suitable for fluorescence labels.
  • the detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
  • Matrix Assisted Laser Desorption Ionization Mass Spectrometry is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct. 15; 60(20):2299-301).
  • An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner.
  • the analyte is ionized by collisions with matrix molecules.
  • An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
  • MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins.
  • the analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57).
  • the sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size.
  • the ionization process via the matrix is considerably less efficient.
  • the selection of the matrix plays an eminently important role.
  • the object of the present invention is to provide the chemically modified DNA of genes associated with metastasis, as well as oligonucleotides and/or PNA-oligomers for detecting cytosine methylations, as well as a method which is particularly suitable for the diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with metastasis.
  • the present invention is based on the discovery that genetic and epigenetic parameters and, in particular, the cytosine methylation pattern of genes associated with metastasis are particularly suitable for the diagnosis and/or therapy of diseases associated with metastasis.
  • nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated DNA of genes associated with metastasis according to one of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto.
  • the respective data bank numbers accession numbers
  • GenBank was used as the underlying data bank, which is located at the National Institute of Health, interact address www.ncbi.nlm.nih.gov.
  • the object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing at least one base sequence having a length of at least 13 nucleotides which hybridizes to a chemically pretreated DNA of genes associated with metastasis according to Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto.
  • the oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain the genetic and epigenetic parameters of genes associated with metastasis.
  • the base sequence of the oligomers preferably contains at least one CpG dinucleotide.
  • the probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties.
  • PNA peptide nucleic acid
  • Particularly preferred are oligonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is the 5 th -9 th nucleotide from the 5′-end of the 13-mer; in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4 th -6 th nucleotide from the 5′-end of the 9-mer.
  • the oligomers according to the present invention are normally used in so called “sets” which contain at least one oligomer for each of the CpG dinucleotides of the sequences of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto.
  • Preferred is a set which contains at least one oligomer for each of the CpG dinucleotides from one of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto.
  • the present invention makes available a set of at least two oligonucleotides which can be used as so-called “primer oligonucleotides” for amplifying DNA sequences of one of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto, or segments thereof.
  • At least one oligonucleotide is bound to a solid phase.
  • the present invention moreover relates to a set of at least 10 n (oligonucleotides and/or PNA-oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementry thereto).
  • These probes enable diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with metastasis.
  • the set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA of genes associated with metastasis according to one of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto.
  • SNPs single nucleotide polymorphisms
  • a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for analysis in connection with diseases associated with metastasis in which method at least one oligomer according to the present invention is coupled to a solid phase.
  • Methods for manufacturing such arrays are known, for example, from U.S. Pat. No. 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
  • kits which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table I and sequences complementary thereto), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method.
  • a kit along the lines of the present invention can also contain only part of the aforementioned components.
  • the genomic DNA to be analyzed is preferably obtained form usual sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal spinal fluid, tissue embedded in paraffm such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
  • sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal spinal fluid, tissue embedded in paraffm such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
  • the above described treatment of genomic DNA is preferably carried out with bisulfite (hydroben sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.
  • Fragments of the chemically pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a, preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100-2000 base pairs are amplified.
  • the amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • At least one primer oligonucleotide is bonded to a solid phase during amplification.
  • the different oligonucleotide and/or PNA oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
  • the fragments obtained by means of the amplification can carry a directly or indirectly detectable label.
  • the detection may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • MALDI matrix assisted laser desorption/ionization mass spectrometry
  • ESI electron spray mass spectrometry
  • Said oligonucleotides contain at least one base sequence having a length of 13 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide.
  • the cytosine of the CpG dinucleotide is the 5 th to 9 th nucleotide from the 5′-end of the 13-mer.
  • One oligonucleotide exists for each CpG dinucleotide.
  • the hybridized amplificates are detected.
  • labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
  • the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer.
  • the mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • MALDI matrix assisted laser desorption/ionization mass spectrometry
  • ESI electron spray mass spectrometry
  • the produced fragments may have a single positive or negative net charge for better detectability in the mass spectrometer.
  • the aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genes associated with metastasis.
  • the oligomers according to the present invention or arrays thereof as well as a kit according to the present invention are intended to be used for the diagnosis and/or therapy of diseases associated with metastasis by analyzing methylation patterns of genes associated with metastasis.
  • the method is preferably used for the diagnosis and/or therapy of important genetic and/or epigenctic parameters within genes associated with metastasis.
  • the method according to the present invention is used, for example, for the diagnosis and/or therapy of solid tumours and cancer.
  • nucleic acids according to the present invention of Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto can be used for the diagnosis and/or therapy of genetic and/or epigenetic parameters of genes associated with metastasis
  • the present invention moreover relates to a method for manufacturing a diagnostic agent and/or therapeutic agent for the diagnosis and/or therapy of diseases associated with metastasis by analyzing methylation patterns of genes associated with metastasis, the diagnostic agent and/or therapeutic agent being characterized in that at least one nucleic acid according to the present invention is used for manufacturing it, possibly together with suitable additives and auxiliary agents.
  • a further subject matter of the present invention relates to a diagnostic agent and/or therapeutic agent for diseases associated with metastasis by analyzing methylation patterns of genes associated with metastasis, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and auxiliary agents.
  • the present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous to patients or individuals in which important genetic and/or epigenetic parameters within genes associated with metastasis said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
  • hybridization is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the WatsonCrick Crick base pairings in the sample DNA, forming a duplex structure.
  • stringent hybridization conditions are those conditions in which a hybridization is carried out at 60° C. in 2.5 ⁇ SSC buffer, followed by several washing steps at 37° C. in a low buffer concentration, and remains stable.
  • the term “functional variants” denotes all DNA sequences which are complementary to a DNA sequence, and which hybridize to the reference sequence under stringent conditions and have an activity similar to the corresponding polypeptide according to the present invention.
  • “genetic parameters” are mutations and polymorphisms of genes associated with metastasis and sequences further required for their regulation.
  • mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
  • epigenetic parameters are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes associated with metastasis and sequences further required for their regulation.
  • Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlates with the DNA methylation.
  • Sequences having odd sequence numbers exhibit in each case sequences of the chemically pretreated genomic DNAs of different genes associated with metastasis.
  • Sequences having even sequence numbers exhibit in each case the sequences of the chemically pretreated genomic DNAs of genes associated with metastasis which are complementary to the preceeding sequences (e.g., the complementary sequence to Seq. ID No.1 is Seq. ID No.2, the complementary sequence to Seq. ID No.3 is Seq. ID No.4, etc.)
  • Sequence ID Nos. 199 to 202 show the sequences of oligonucleotides used in Example 1.
  • the following example relates to a fragment of a gene associated with metastasis, in this case, CD22 in which a specific CG-position is analyzed for its methylation status.
  • the following example relates to a fragment of the gene CD22 in which a specific CG-position is to be analyzed for methylation.
  • a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner that all cytosines which are not methylated at the 5-position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5-position remain unchanged.
  • bisulfite hydrogen sulfite, disulfite
  • the treated DNA sample is diluted with water or an aqueous solution.
  • the DNA is subsequently desulfonated (10-30 min, 90-100 ° C.) at an alkaline pH value.
  • the DNA sample is amplified in a polymerase chain reaction, preferably using a heatresistant DNA polymerase.
  • cytosines of the gene CD22 are analyzed.
  • a defined fragment having a length of 470 bp is amplified with the specific primer oligonucleotides TGTGTGTTGTTAAATGAAGA (Sequence ID No. 199) and ACACAAATATTAAAATTATC (Sequence ID No. 200).
  • This amplificate serves as a sample which hybridizes to an oligonucleotide previously bonded to a solid phase, forming a duplex structure, for example TTGTTATACGTTTTGTTT (Sequence ID No.
  • the cytosine to be detected being located at position 210 of the amplificate.
  • the detection of the hybridization product is based on Cy3 and Cy5 fluorescently labelled primer oligonucleotides which have been used for the amplification.
  • a hybridization reaction of the amplified DNA with the oligonucleotide takes place only if a methylated cytosine was present at this location in the bisulfite-treated DNA.
  • the methylation status of the specific cytosine to be analyzed is inferred from the hybridization product.
  • a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase.
  • Said olignonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, with the exception of the position in question.
  • said oligonucleotide comprises a thymine base as opposed to a cytosine base i.e TTGTTATATGTTTTGTTT (Sequence ID No. 202). Therefore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed.
  • methylation patterns In order to relate the methylation patterns to one of the diseases associated with metastasis, it is initially required to analyze the DNA methylation patterns of a group of diseased and of a group of healthy patients. These analyses are carried out, for example, analogously to Example 1. The results obtained in this manner are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be carried out by determining individual CpG methylation rates as can be done, for example, in a relatively imprecise manner, by sequencing or else, in a very precise manner, by a methylation-sensitive “primer extension reaction”. It is also possible for the entire methylation status to be analyzed simultaneously, and for the patterns to be compared, for example, by clustering analyses which can be carried out, for example, by a computer.
  • Example 2 can be carried out, for example, for cancer and solid tumours.
  • TABLE 1 List of preferred genes associated with metastasis according to the invention GenBank Entry No. Gene (http://www.ncbi.nim.nih.gov) CD20 L23418 FN1 M10905 SDC2 H04621 ACTG1 NM_001614 CDH2 NM_001792 CDH4 NM_001794 CDW52 NM_001803 ITGAX NM_000887 UTGB1 NM_002211 ITGB5 NM_002213 ITGB7 NM_000889 NEO1 NM_002499 PCDH1 NM_002587 ENPP1 NM_006208 RTN1 NM_021136 SELPLG NM_003006 TM4SF2 NM_004615 ITGAE NM_002208 SPTB NM_000347 ITGB1 NM_002211
US10/240,485 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis Abandoned US20030148327A1 (en)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
DE10019058.8 2000-04-06
DE10019058A DE10019058A1 (de) 2000-04-06 2000-04-06 Detektion von Variationen des DNA-Methylierungsprofils
DE10019173 2000-04-07
DE10019173.8 2000-04-07
DE10032529A DE10032529A1 (de) 2000-06-30 2000-06-30 Diagnose von bedeutenden genetischen Parametern innerhalb des Major Histocompatibility Complex (MHC)
DE100529.7 2000-06-30
DE10043826 2000-09-01
DE10043826.1 2000-09-01

Publications (1)

Publication Number Publication Date
US20030148327A1 true US20030148327A1 (en) 2003-08-07

Family

ID=27437807

Family Applications (7)

Application Number Title Priority Date Filing Date
US10/239,676 Expired - Fee Related US7195870B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation
US10/240,454 Abandoned US20040067491A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
US10/240,589 Abandoned US20040076956A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair
US10/240,453 Abandoned US20030148326A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna transcription
US10/240,485 Abandoned US20030148327A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis
US10/240,452 Abandoned US20030162194A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
US10/240,708 Abandoned US20050282157A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication

Family Applications Before (4)

Application Number Title Priority Date Filing Date
US10/239,676 Expired - Fee Related US7195870B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation
US10/240,454 Abandoned US20040067491A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
US10/240,589 Abandoned US20040076956A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair
US10/240,453 Abandoned US20030148326A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna transcription

Family Applications After (2)

Application Number Title Priority Date Filing Date
US10/240,452 Abandoned US20030162194A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
US10/240,708 Abandoned US20050282157A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication

Country Status (7)

Country Link
US (7) US7195870B2 (fr)
EP (9) EP1274866A2 (fr)
JP (3) JP2003534780A (fr)
AT (1) ATE353975T1 (fr)
AU (9) AU2001254788A1 (fr)
DE (1) DE60126593T2 (fr)
WO (8) WO2001077164A2 (fr)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040052763A1 (en) * 2000-06-07 2004-03-18 Mond James J. Immunostimulatory RNA/DNA hybrid molecules
WO2005017207A2 (fr) * 2003-08-14 2005-02-24 Case Western Reserve University Procedes et compositions pour le depistage de cancers du colon
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20080108073A1 (en) * 2001-11-19 2008-05-08 Affymetrix, Inc. Methods of Analysis of Methylation
US20090321626A1 (en) * 2006-05-26 2009-12-31 Akos Vertes Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US20100323917A1 (en) * 2009-04-07 2010-12-23 Akos Vertes Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
WO2012149245A3 (fr) * 2011-04-28 2013-01-17 Ostrer Harry Signatures génomiques d'une métastase dans le cancer de la prostate
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US20140287940A1 (en) * 2007-10-23 2014-09-25 Commonwealth Scientific And Industrial Research Organisation Method of diagnosing neoplasms - ii
US9000361B2 (en) 2009-01-17 2015-04-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US10435743B2 (en) 2011-05-20 2019-10-08 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
WO2020150705A1 (fr) 2019-01-18 2020-07-23 The Regents Of The University Of California Mesure de méthylation d'adn pour des mammifères sur la base de loci conservés
WO2023175019A1 (fr) 2022-03-15 2023-09-21 Genknowme S.A. Procédé pour déterminer la différence entre l'âge biologique et l'âge chronologique d'un sujet

Families Citing this family (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6780982B2 (en) * 1996-07-12 2004-08-24 Third Wave Technologies, Inc. Charge tags and the separation of nucleic acid molecules
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
EP1274866A2 (fr) 2000-04-06 2003-01-15 Epigenomics AG Diagnostic de maladies associees a la metastase
EP1294947A2 (fr) * 2000-06-30 2003-03-26 Epigenomics AG Procede et acides nucleiques pour analyse de methylation pharmacogenomique
AUPR142500A0 (en) * 2000-11-13 2000-12-07 Human Genetic Signatures Pty Ltd A peptide nucleic acid-based assay for the detection of specific nucleic acid sequences
DE10128508A1 (de) 2001-06-14 2003-02-06 Epigenomics Ag Verfahren und Nukleinsäuren für die Differenzierung von Prostata-Tumoren
WO2003031932A2 (fr) * 2001-10-05 2003-04-17 Case Western Reserve University Procedes et compositions pour detecter les cancers du colon
JP2003144172A (ja) * 2001-11-16 2003-05-20 Nisshinbo Ind Inc メチル化検出用オリゴヌクレオチド固定化基板
DE10161625A1 (de) * 2001-12-14 2003-07-10 Epigenomics Ag Verfahren und Nukleinsäuren für die Analyse einer Lungenzell-Zellteilungsstörung
WO2003076593A2 (fr) * 2002-03-07 2003-09-18 The Johns Hopkins University School Of Medicine Depistage genomique pour genes lies au cancer rendus epigenetiquement silencieux
EP1344832A1 (fr) * 2002-03-15 2003-09-17 Epigenomics AG Procédé et acides nucléiques pour l'analyse de méthylation dans le gène de melastatin
WO2003083107A1 (fr) * 2002-03-25 2003-10-09 The Board Of Trustees Of The University Of Arkansas Extraction au cpg de l'adn de specimens pathologiques fixes au formaldehyde
AU2003247880B2 (en) * 2002-07-03 2010-09-02 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
CA2500255A1 (fr) * 2002-10-01 2004-04-29 Epigenomics Ag Procede et acides nucleiques permettant d'ameliorer le traitement de troubles de la proliferation de celllules mammaires
WO2004050915A1 (fr) * 2002-12-02 2004-06-17 Solexa Limited Determination de la methylation de sequences d'acide nucleique
DE10304219B3 (de) * 2003-01-30 2004-08-19 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungsmustern mit hoher Sensitivität
US20050266409A1 (en) * 2003-02-04 2005-12-01 Wyeth Compositions and methods for diagnosing, preventing, and treating cancers
WO2004111266A1 (fr) 2003-06-17 2004-12-23 Human Genetic Signatures Pty Ltd Procedes d'amplification de genome
DE10338308B4 (de) 2003-08-15 2006-10-19 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungen in DNA
CA2537810C (fr) 2003-09-04 2012-12-18 Human Genetic Signatures Pty Ltd Dosage de detection d'acide nucleique
AU2004281299B2 (en) * 2003-10-20 2010-11-18 St Vincent's Hospital Sydney Limited Assessment of disease risk by quantitative determination of epimutation in normal tissues
EP3269826B1 (fr) * 2003-12-01 2020-03-11 Epigenomics AG Procédés et acides nucléiques pour l'analyse d'expression de gènes associés au développement des troubles de prolifération cellulaire de la prostate
EP1561821B1 (fr) 2003-12-11 2011-02-16 Epigenomics AG Marqueurs pour le pronostic de la réponse à la thérapie et/ou de la survie chez les patients du cancer du sein
EP1568786A3 (fr) * 2004-02-13 2007-08-29 Affymetrix, Inc. (A US Entity) Analyse de la méthylation utilisant des matrices d'acides nucléiques
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
ATE476439T1 (de) 2004-09-10 2010-08-15 Human Genetic Signatures Pty Amplifikationsblocker umfassend interkalierende nukleinsäuren (ina) enthaltend interkalierende pseudonukleotide (ipn)
KR20060026595A (ko) 2004-09-21 2006-03-24 (주)지노믹트리 제한효소와 dna 칩을 이용한 프로모터의 메틸화 검출방법
KR100617649B1 (ko) * 2004-09-24 2006-09-04 (주)지노믹트리 대장암 특이적 발현감소 유전자의 메틸화된 프로모터를 함유하는 암 진단용 조성물 및 그 용도
EP1828411B1 (fr) 2004-12-03 2012-11-07 Human Genetic Signatures PTY Ltd Procedes de simplification d'acides nucleiques microbiens par modification chimique de cytosines
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
WO2006088978A1 (fr) 2005-02-16 2006-08-24 Epigenomics, Inc. Procede de determination du modele de methylation d'un acide polynucleique
SI1871912T1 (sl) 2005-04-15 2012-06-29 Epigenomics Ag Postopek za določitev DNA metilacije v vzorcih krvi ali urina
WO2006111586A2 (fr) * 2005-04-20 2006-10-26 Proyecto De Biomedicina Cima, S.L. Procede permettant de determiner in vitro le degre de methylation du promoteur de line-1
JP2008541705A (ja) 2005-05-26 2008-11-27 ヒューマン ジェネティック シグネチャーズ ピーティーワイ リミテッド 非標準塩基を含むプライマーを使用する等温鎖置換増幅
ATE531820T1 (de) 2005-09-14 2011-11-15 Human Genetic Signatures Pty Gesundheitszustandstest
WO2007082099A2 (fr) 2006-01-11 2007-07-19 Genomic Health, Inc. Marqueurs d'expression de gène pour pronostic colorectal de cancer
US7465544B2 (en) * 2006-01-11 2008-12-16 Wisconsin Alumni Research Foundation Synthetic cofactor analogs of S-adenosylmethionine as ligatable probes of biological methylation and methods for their use
EP1826278A1 (fr) * 2006-02-28 2007-08-29 Epiontis GmbH Modification épigénétique des loci pour camta1 et/ou foxp3 à des fins de marquage dans le traitement du cancer
EP2471951A1 (fr) * 2006-05-02 2012-07-04 University of Southhampton Prédiction du développement cognitif au moyen de l'analyse de méthylation
WO2008096146A1 (fr) * 2007-02-07 2008-08-14 Solexa Limited Préparation de matrices pour l'analyse de méthylation
EP2215250B1 (fr) 2007-11-27 2013-02-27 Human Genetic Signatures Pty Ltd Enzymes pour l'amplification et la copie d'acides nucléiques modifiés par du bisulfite
WO2010007083A2 (fr) * 2008-07-15 2010-01-21 Epigenomics Ag Procédés et acides nucléiques pour l’analyse de troubles prolifératifs cellulaires
US8541207B2 (en) 2008-10-22 2013-09-24 Illumina, Inc. Preservation of information related to genomic DNA methylation
CA2760333A1 (fr) 2009-05-01 2010-11-04 Genomic Health Inc. Algorithme de profil d'expression genique et analyse de probabilite de recurrence de cancer colorectal et reponse a la chimiotherapie
CA2769862A1 (fr) 2009-08-28 2011-03-03 Cellular Dynamics International, Inc. Identification de variation genetique dans les tissus affectes a partir de cellules souches pluripotentes induites
WO2011080314A2 (fr) * 2009-12-31 2011-07-07 Deutsches Krebsforschungszentrum Nouveaux modulateurs de signalisation par trail
NZ622418A (en) 2011-09-07 2014-12-24 Human Genetic Signatures Pty Molecular detection assay
EP2821487B1 (fr) * 2012-02-29 2016-10-26 Sysmex Corporation Procédé pour déterminer la présence ou l'absence de cellule cancéreuse issue d'un carcinome hépatocellulaire, et marqueur de détermination et trousse
US10706957B2 (en) 2012-09-20 2020-07-07 The Chinese University Of Hong Kong Non-invasive determination of methylome of tumor from plasma
US9732390B2 (en) 2012-09-20 2017-08-15 The Chinese University Of Hong Kong Non-invasive determination of methylome of fetus or tumor from plasma
KR101302173B1 (ko) 2012-12-07 2013-08-30 이화여자대학교 산학협력단 Hmox1 유전자의 메틸화 변화를 이용한 알츠하이머 질환의 진단용 조성물 및 이를 이용한 알츠하이머 질환의 진단방법
US20140274757A1 (en) 2013-03-14 2014-09-18 Marie K. Kirby Differential Methylation Level of CpG Loci That Are Determinative of a Biochemical Reoccurrence of Prostate Cancer
SG11201608403TA (en) * 2014-04-28 2016-11-29 Sigma Aldrich Co Llc Epigenetic modification of mammalian genomes using targeted endonucleases
EP3850083A4 (fr) * 2018-09-14 2022-06-29 Shinozaki, Gen Systèmes et procédés de détection de risque de délire à l'aide de marqueurs épigénétiques
CN111217900A (zh) * 2018-11-27 2020-06-02 上海交通大学 一种血管新生的转录调控因子及其用途
EP4047102A4 (fr) 2019-10-14 2024-04-17 Gencurix Inc Composition pour le diagnostic de cancer du foie à l'aide de modifications de la méthylation de cpg dans des gènes spécifiques et son utilisation
KR102637032B1 (ko) 2020-01-28 2024-02-15 주식회사 젠큐릭스 특정 유전자의 CpG 메틸화 변화를 이용한 방광암 진단용 조성물 및 이의 용도
WO2021206467A1 (fr) 2020-04-08 2021-10-14 주식회사 젠큐릭스 Composition pour diagnostiquer un cancer colorectal, un cancer rectal ou un adénome colorectal à l'aide d'un changement de méthylation cpg du gène glrb, et son utilisation
CN111500702B (zh) * 2020-04-26 2021-04-20 江苏大学附属医院 RPN1基因cg00843506位点甲基化在诊断哮喘中的用途

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6214556B1 (en) * 1997-11-27 2001-04-10 Epigenomics Ag Method for producing complex DNA methylation fingerprints
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US20030036081A1 (en) * 2001-07-02 2003-02-20 Epigenomics Ag Distributed system for epigenetic based prediction of complex phenotypes
US20030113750A1 (en) * 2001-06-14 2003-06-19 Juergen Distler Method and nucleic acids for the differentiation of prostate tumors
US20030180748A1 (en) * 1999-10-13 2003-09-25 Andreas Braun Methods for generating databases and databases for identifying polymorphic genetic markers

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744101A (en) * 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
SE501439C2 (sv) 1993-06-22 1995-02-13 Pharmacia Lkb Biotech Sätt och anordning för analys av polynukleotidsekvenser
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
DE69433180T2 (de) * 1993-10-26 2004-06-24 Affymetrix, Inc., Santa Clara Felder von nukleinsaeuresonden auf biologischen chips
KR100392057B1 (ko) 1993-11-30 2003-10-30 맥길 유니버시티 세포의 CpG 디뉴클레오티드 내의 시토신의 메틸화를 감소하는 방법
US5858661A (en) * 1995-05-16 1999-01-12 Ramot-University Authority For Applied Research And Industrial Development Ataxia-telangiectasia gene and its genomic organization
US5871917A (en) 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids
WO1998056952A1 (fr) * 1997-06-09 1998-12-17 University Of Southern California Methode de diagnostic du cancer basee sur des differences de methylation d'adn
DE19750172C1 (de) * 1997-11-12 1998-10-01 Deutsches Krebsforsch DNA mit Promotor-Aktivität für Zellzyklus-Gen
WO1999029898A2 (fr) * 1997-12-05 1999-06-17 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Procede d'identification d'acides nucleiques par spectrometrie de masse par ionisation/desorption laser assistee par matrice
AU5128999A (en) * 1998-07-24 2000-02-14 Yeda Research And Development Co. Ltd. Prevention of metastasis with 5-aza-2'-deoxycytidine
DE19905082C1 (de) * 1999-01-29 2000-05-18 Epigenomics Gmbh Verfahren zur Identifikation von Cytosin-Methylierungsmustern in genomischen DNA-Proben
US6783933B1 (en) * 1999-09-15 2004-08-31 The Johns Hopkins University School Of Medicine CACNA1G polynucleotide, polypeptide and methods of use therefor
EP1283905A2 (fr) * 2000-03-15 2003-02-19 Epigenomics AG Diagnostic d'affections associees au cycle cellulaire
EP1274866A2 (fr) 2000-04-06 2003-01-15 Epigenomics AG Diagnostic de maladies associees a la metastase
EP1294947A2 (fr) 2000-06-30 2003-03-26 Epigenomics AG Procede et acides nucleiques pour analyse de methylation pharmacogenomique
DE10037769A1 (de) 2000-08-03 2002-02-21 Epigenomics Gmbh Diagnose von mit CD24 assoziierten Krankheiten
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
DE10054974A1 (de) 2000-11-06 2002-06-06 Epigenomics Ag Diagnose von mit Cdk4 assoziierten Krankheiten
DE10054972A1 (de) 2000-11-06 2002-06-06 Epigenomics Ag Diagnose von mit humos assoziierten Krankheiten

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6214556B1 (en) * 1997-11-27 2001-04-10 Epigenomics Ag Method for producing complex DNA methylation fingerprints
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US20030180748A1 (en) * 1999-10-13 2003-09-25 Andreas Braun Methods for generating databases and databases for identifying polymorphic genetic markers
US20030113750A1 (en) * 2001-06-14 2003-06-19 Juergen Distler Method and nucleic acids for the differentiation of prostate tumors
US20030036081A1 (en) * 2001-07-02 2003-02-20 Epigenomics Ag Distributed system for epigenetic based prediction of complex phenotypes

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040052763A1 (en) * 2000-06-07 2004-03-18 Mond James J. Immunostimulatory RNA/DNA hybrid molecules
US20080108073A1 (en) * 2001-11-19 2008-05-08 Affymetrix, Inc. Methods of Analysis of Methylation
US10822642B2 (en) 2001-11-19 2020-11-03 Affymetrix, Inc. Methods of analysis of methylation
US10407717B2 (en) 2001-11-19 2019-09-10 Affymetrix, Inc. Methods of analysis of methylation
US20110151438A9 (en) * 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US8221977B2 (en) 2003-08-14 2012-07-17 Case Western Reserve University Methods and compositions for detecting colon cancers
US20050106593A1 (en) * 2003-08-14 2005-05-19 Markowitz Sanford D. Methods and compositions for detecting colon cancers
US7485420B2 (en) * 2003-08-14 2009-02-03 Case Western Reserve University Methods and compositions for detecting colon cancers
US11136629B2 (en) 2003-08-14 2021-10-05 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US20100009359A1 (en) * 2003-08-14 2010-01-14 Case Western Reserve University Methods and compositions for detecting colon cancers
US20100209906A1 (en) * 2003-08-14 2010-08-19 Case Western Reserve University Methods and compositions for detecting colon cancers
WO2005017207A2 (fr) * 2003-08-14 2005-02-24 Case Western Reserve University Procedes et compositions pour le depistage de cancers du colon
US10450615B2 (en) 2003-08-14 2019-10-22 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US7964353B2 (en) 2003-08-14 2011-06-21 Case Western Reserve University Methods and compositions for detecting colon cancers
JP2007502121A (ja) * 2003-08-14 2007-02-08 ケース ウエスタン リザーブ ユニバーシティ 大腸癌を検出する方法及び組成物
US10400286B2 (en) 2003-08-14 2019-09-03 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US20110217708A1 (en) * 2003-08-14 2011-09-08 Case Western Reserve University Methods and compositions for detecting colon cancers
JP4781267B2 (ja) * 2003-08-14 2011-09-28 ケース ウエスタン リザーブ ユニバーシティ 大腸癌を検出する方法及び組成物
US9580754B2 (en) 2003-08-14 2017-02-28 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
WO2005017207A3 (fr) * 2003-08-14 2005-10-27 Univ Case Western Reserve Procedes et compositions pour le depistage de cancers du colon
US8481707B2 (en) 2003-08-14 2013-07-09 Case Western Reserve University Methods and compositions for detecting colon cancers
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US8709716B2 (en) 2006-03-31 2014-04-29 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US9828640B2 (en) 2006-03-31 2017-11-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20110166037A1 (en) * 2006-03-31 2011-07-07 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US10822659B2 (en) 2006-03-31 2020-11-03 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20090321626A1 (en) * 2006-05-26 2009-12-31 Akos Vertes Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US8084734B2 (en) 2006-05-26 2011-12-27 The George Washington University Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US20140287940A1 (en) * 2007-10-23 2014-09-25 Commonwealth Scientific And Industrial Research Organisation Method of diagnosing neoplasms - ii
US9000361B2 (en) 2009-01-17 2015-04-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US9490113B2 (en) 2009-04-07 2016-11-08 The George Washington University Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry
US20100323917A1 (en) * 2009-04-07 2010-12-23 Akos Vertes Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry
US10519505B2 (en) 2011-04-28 2019-12-31 Harry Ostrer Genomic signatures of metastasis in prostate cancer
WO2012149245A3 (fr) * 2011-04-28 2013-01-17 Ostrer Harry Signatures génomiques d'une métastase dans le cancer de la prostate
US10435743B2 (en) 2011-05-20 2019-10-08 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
WO2020150705A1 (fr) 2019-01-18 2020-07-23 The Regents Of The University Of California Mesure de méthylation d'adn pour des mammifères sur la base de loci conservés
WO2023175019A1 (fr) 2022-03-15 2023-09-21 Genknowme S.A. Procédé pour déterminer la différence entre l'âge biologique et l'âge chronologique d'un sujet

Also Published As

Publication number Publication date
ATE353975T1 (de) 2007-03-15
US20030162194A1 (en) 2003-08-28
JP2003534780A (ja) 2003-11-25
DE60126593D1 (de) 2007-03-29
DE60126593T2 (de) 2007-10-31
WO2001081622A3 (fr) 2003-09-04
WO2001092565A3 (fr) 2002-09-06
EP1272670A2 (fr) 2003-01-08
AU2001254794A1 (en) 2001-10-23
AU7633001A (en) 2001-10-23
WO2001092565A8 (fr) 2002-05-30
US7195870B2 (en) 2007-03-27
WO2001076451A9 (fr) 2002-08-08
WO2001077375A8 (fr) 2002-10-24
WO2001081622A8 (fr) 2002-05-16
WO2001092565A2 (fr) 2001-12-06
AU2001276330B2 (en) 2006-08-31
EP1370685A2 (fr) 2003-12-17
WO2001077377A2 (fr) 2001-10-18
WO2001077164A8 (fr) 2002-03-21
US20030082609A1 (en) 2003-05-01
EP1274866A2 (fr) 2003-01-15
WO2001077378A3 (fr) 2002-10-17
WO2001077376A8 (fr) 2002-03-21
AU2001254788A1 (en) 2001-10-23
WO2001077375A2 (fr) 2001-10-18
WO2001077377A8 (fr) 2002-02-28
US20040076956A1 (en) 2004-04-22
US20040067491A1 (en) 2004-04-08
EP1274865B1 (fr) 2007-02-14
WO2001077376A3 (fr) 2002-08-08
AU2001275663A1 (en) 2001-10-23
WO2001077376A2 (fr) 2001-10-18
EP1278893A2 (fr) 2003-01-29
WO2001077164A2 (fr) 2001-10-18
EP1360319A2 (fr) 2003-11-12
JP2004508807A (ja) 2004-03-25
US20030148326A1 (en) 2003-08-07
WO2001076451A3 (fr) 2003-09-04
AU2001276331A1 (en) 2001-10-23
AU2001277487A1 (en) 2001-10-23
EP1268857A2 (fr) 2003-01-02
WO2001077375A3 (fr) 2002-06-27
WO2001077377A3 (fr) 2002-07-11
WO2001076451A2 (fr) 2001-10-18
AU2001289600A1 (en) 2001-12-11
WO2001081622A2 (fr) 2001-11-01
EP2014776A2 (fr) 2009-01-14
EP2014776A3 (fr) 2009-04-01
EP1268861A2 (fr) 2003-01-02
EP1274865A2 (fr) 2003-01-15
WO2001077378A2 (fr) 2001-10-18
US20050282157A1 (en) 2005-12-22
WO2001077164A3 (fr) 2002-06-20
AU2001278420A1 (en) 2001-11-07
JP2003531589A (ja) 2003-10-28

Similar Documents

Publication Publication Date Title
US20030148327A1 (en) Diagnosis of diseases associated with metastasis
US20040048254A1 (en) Diagnosis of diseases associated with tumor supressor genes and oncogenes
AU2001276330A1 (en) Diagnosis of diseases associated with apoptosis
US20040023230A1 (en) Method and nucleic acids for pharmacogenomic methylation analysis
EP1344832A1 (fr) Procédé et acides nucléiques pour l'analyse de méthylation dans le gène de melastatin
US20060210976A1 (en) Methods and nucleic acids for the analysis of methylation patterns within the dd3 gene
AU2006225250A1 (en) Diagnosis of diseases associated with metastasis
AU2006213968A1 (en) Diagnosis of diseases associated with DNA replication
AU2006203475A1 (en) Diagnosis of Diseases Associated with Gene Regulation

Legal Events

Date Code Title Description
AS Assignment

Owner name: EPIGENOMICS AG, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLEK, ALEXANDER;PIEPENBROCK, CHRISTIAN;BERLIN, KURT;REEL/FRAME:013680/0032

Effective date: 20021001

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION