US20030148326A1 - Diagnosis of diseases associated with dna transcription - Google Patents

Diagnosis of diseases associated with dna transcription Download PDF

Info

Publication number
US20030148326A1
US20030148326A1 US10/240,453 US24045303A US2003148326A1 US 20030148326 A1 US20030148326 A1 US 20030148326A1 US 24045303 A US24045303 A US 24045303A US 2003148326 A1 US2003148326 A1 US 2003148326A1
Authority
US
United States
Prior art keywords
dna
recited
syndrome
genes
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/240,453
Other languages
English (en)
Inventor
Alexander Olek
Christian Piepenbrock
Kurt Berlin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10019058A external-priority patent/DE10019058A1/de
Priority claimed from DE10032529A external-priority patent/DE10032529A1/de
Application filed by Epigenomics AG filed Critical Epigenomics AG
Assigned to EPIGENOMICS AG reassignment EPIGENOMICS AG ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: OLEK, ALEXANDER, PIEPENBROCK, CHRISTIAN, BERLIN, KURT
Publication of US20030148326A1 publication Critical patent/US20030148326A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to nucleic acids, oligonucleotides, PNA-oligomers and to a method for the diagnosis and/or therapy of diseases which have a connection with the genetic and/or epigenetic parameters of genes associated with DNA transcription and, in particular, with the methylation status thereof.
  • DNA transcription the process of using genomic DNA as a template for the synthesis of RNA is a complex process. It requires the interaction of various factors, enzymes and sequences.
  • the initiation of DNA transcription requires a complex known as the basal transcription apparatus consisting of RNA polymerase combined with various factors. They form a complex at the startpoint from which transcription proceeds. Examples of such factors include TFIID, TRF1 and TRF2. This is a major control point for gene expression.
  • Transcription factors are often classified according to their DNA binding domain. Members of the same group have sequence variations of a specific motif that confer specificity for individual target sites. Common categories include, steroid receptors, zinc finger motifs, helix-turn-helix motifs, helix-loop-helix motifs and leucine zippers.
  • DNA sequence components of the system include both promoter and enhancer elements. Promoter sequences are located in the vicinity of the transcribed region and enhancer elements are located at a distance from the startpoint. These sequences interact with the factors mentioned above to regulate the transcription of RNA.
  • control may be exerted by the action of insulator elements, specialised chromatin structures that have hypersensitive sites. They are able to block passage of any activating or inactivating effects from enhancers, silencers, or LCRs.
  • a further requirement of DNA transcription is that the DNA be accessible. In most cases the initiation of transcription requires that the DNA be free of nucleosomes. Therefore, a transcription factor, or some other nonhistone protein concerned with the particular function of the site, modifies the properties of a short region of DNA so that nucleosomes are excluded. Several chromatin modification mechanisms are utilised, including histone acetylation and deacetylation activity.
  • a further parameter that regulates genomic transcription is methylation.
  • Methylation of CpG islands in the regulatory regions of genes has been shown to be a common method of transcription regulation.
  • aberrant methylation patterns have been associated with a variety of disease phenotypes. For example:
  • Head and neck cancer Sanchez-Cespedes M et al. ‘Gene promoter hypermethylation in tumours and serum of head and neck cancer patients’ Cancer Res. Feb. 15, 2000;60 (4):892-5;
  • Hodgkin's disease Garcia J F et al ‘Loss of p16 protein expression associated with methylation of the p16INK4A gene is a frequent finding in Hodgkin's disease’ Lab invest December 1999;79 (12):1453-9;
  • Prader-Willi/Angelman's syndrome Zeschnigh et al ‘Imprinted segments in the human genome: different DNA methylation patterns in the Prader Willi/Angelman syndrome region as determined by the genomic sequencing method’ Human Mol. Genetics (1997) (6) 3 pp 387-395;
  • ICF syndrome Tuck-Muller et al ‘CMDNA hypomethylation and unusual chromosome instability in cell lines from ICF syndrome patients’ Cytogenet Call Genet 2000; 89(1-2):121-8;
  • Dermatofibroma Chen T C et al ‘Dermatofibroma is a clonal proliferative disease’ J Cutan Pathol January 2000;27 (1):36-9);
  • Fragile X Syndrome Hornstra I K et al. ‘High resolution methylation analysis of the FMR1 gene trinucleotide repeat region in fragile X syndrome’ Hum Mol Genet October 1993, 2(10):1659-65;
  • Huntigton's disease Ferluga J et al. ‘possible organ and age related epigenetic factors in Huntington's disease and colorectal carcinoma’ Med hypotheses May 1989;29(1);51-4;
  • Adenosine deaminase deficiency Ariga T ‘Gene therapy for adenosine deaminase (ADA) deficiency: review of the past, the present and the future’ Nippon Rinsho January 2001;59(1):72-5;
  • Hodgkin's disease Sandvej K, Andresen B S, Zhou X G, Gregersen N, Hamilton-Dutoit S ‘Analysis of the Epstein-Barr virus (EBV) latent membrane protein 1 (LMP-1) gene and promoter in Hodgkin's disease isolates: selection against EBV variants with mutations in the LMP-1 promoter ATF-1/CREB-1 binding site’ Mol Pathol October 2000;53(5):280-8;
  • EBV Epstein-Barr virus
  • LMP-1 latent membrane protein 1
  • Ewing's sarcoma family tumors Aryee D N, Sommergruber W, Muehlbacher K, Dockhorn-Dworniczak B, Zoubek A, Kovar H ‘Variability in gene expression patterns of Ewing tumor cell lines differing in EWS-FLI1 fusion type’ Lab Invest December 2000;80(12):1833-44;
  • Colon cancer Ishiguro T, Nagawa H, Naito M, Tsuruo T Jpn J ‘Inhibitory effect of ATF3 antisense oligonucleotide on ectopic growth of HT29 human colon cancer cells’ Cancer Res August 2000;91(8):833-6;
  • Endometrial cancer Hori M, Takechi K, Arai Y, Yomo H, Itabashi M, Shimazaki J, Inagawa S, Hori M ‘Comparison of macroscopic appearance and estrogen receptor-alpha regulators after gene alteration in human endometrial cancer’ Int J Gynecol Cancer November 2000; 10(6):469-476;
  • Wilms' tumor Inoue K, Sugiyama H, Ogawa H, Nakagawa M, Yamagami T, Miwa H, Kita K, Hiraoka A, Masaoka T, Nasu K, et al ‘WT1 as a new prognostic factor and a new marker for the detection of minimal residual disease in acute leukemia’ Blood Nov. 1, 1994;84(9):3071-9;
  • Rheumatoid arthritis Pascual M, Nieto A, Lopez-Nevot M A, Ramal L, Mataran L, Caballero A, Alonso A, Martin J, Zanelli E ‘Rheumatoid arthritis in southern Spain: toward elucidation of a unifying role of the HLA class II region in disease predisposition’ Arthritis Rheum February 2001;44(2):307-14;
  • Myelodysplastic syndrome and acute leukemia Patmasiriwat P, Fraizer G, Kantarjian H, Saunders G F ‘WT1 and GATA1 expression in myelodysplastic syndrome and acute leukemia’ Leukemia June 1999;13(6):891-900;
  • HDR syndrome Van Esch H, Groenen P, Nesbit M A, Schuffenhauer S, Lichtner P, Vanderlinden G, Harding B, Beetz R, Bilous R W, Holdaway I, Shaw N J, Fryns J P, Van de Ven W, Thakker R V, Devriendt K ‘GATA3 haplo-insufficiency causes human HDR syndrome’ Nature Jul. 27, 2000;406(6794):419-22;
  • Congenital heart disease Pehlivan T, Pober B R, Brueckner M, Garrett S, Slaugh R, Van Rheeden R, Wilson D B, Watson M S, Hing A V‘GATA4 haploinsufficiency in patients with interstitial deletion of chromosome region 8p23.1 and congenital heart disease’ Am J Med Genet Mar. 19, 1999;83(3):201-6;
  • Angiogenesis and erythropoiesis Krieg M, Haas R, Brauch H, Acker T, Flamme I, Plate K H ‘Up-regulation of hypoxia-inducible factors HIF-1alpha and HIF-2alpha under normoxic conditions in renal carcinoma cells by von Hippel-Lindau tumor suppressor gene loss of function Oncogene Nov. 16, 2000;19(48):5435-43;
  • AIDS-related non-Hodgkin lymphomas and Hodgkin lymphomas arising in HIV+ patients Carbone A, Gloghini A, Larocca L M, Capello D, Pierconti F, Canzonieri V, Tirelli U, Dalla-Favera R,Gaidano G ‘Expression profile of MUM1/IRF4, BCL-6, and CD138/syndecan-1 defines novel histogenetic subsets of human immunodeficiency virus-related lymphomas’ Blood Feb. 1, 2001;97(3):744-51;
  • Myelodysplastic syndrome and acute myeloid leukemia Xie J, Briggs J A, Morris S W, Olson M O, Kinney M C, Briggs R C ‘MNDA binds NPM/B23 and the NPM-MLF1 chimera generated by the t(3;5) associated with myelodysplastic syndrome and acute myeloid leukemia’ Exp Hematol October 1997;25(11):111-7;
  • Niemann-Pick type C2 disease Naureckiene S, Sleat D E, Lackland H, Fensom A, Vanier M T, Wattiaux R, Jadot M, Lobel P ‘Identification of HE1 as the second gene of Niemann-Pick C disease’ Science Dec. 22, 2000;290(5500):2298-301;
  • Waardenburg syndrome Bondurand N, Pingault V, Goerich D E, Lemort N, Sock E, Caignec C L, Wegner M, Goossens M ‘Interaction among SOX10, PAX3 and MITF, three genes altered in Waardenburg syndrome’ Hum Mol Genet Aug. 12, 2000;9(13):1907-17;
  • Neurological disorders Geisbrecht B V, Collins C S, Reuber B E, Gould S J ‘Disruption of a PEX1-PEX6 interaction is the most common cause of the neurologic disorders Zellweger syndrome, neonatal adrenoleukodystrophy, and infantile Refsum disease’ Proc Natl Acad Sci USA Jul. 21, 1998;95(15):8630-5;
  • Psoriasis vulgaris Oka A, Tamiya G, Tomizawa M, Ota M, Katsuyama Y, Makino S, Shiina T, Yoshitome M, Ezuka M, Sasao Y, Iwashita K, Kawakubo Y, Sugai J, Ozawa A, Ohkido M, Kimura M, Bahram S, Inoko H ‘Association analysis using refined microsatellite markers localizes a susceptibility locus for psoriasis vulgaris within a 111 kb segment telomeric to the HLA-C gene’ Hum Mol Genet November 1999;8(12):2165-70;
  • Tuberculosis Selvaraj P, Narayanan P R, Reetha A M ‘Association of vitamin D receptor genotypes with the susceptibility to pulmonary tuberculosis in female patients & resistance in female contacts’ Indian J Med Res May 2000;111:172-9;
  • Hematological disorders Elbein S C, Teng K, Eddings K, Hargrove D, Scroggin E ‘Molecular scanning analysis of hepatocyte nuclear factor 1alpha (TCF1) gene in typical familial type 2 diabetes in African Americans’ Metabolism February 2000;49(2):280-4;
  • Sezary syndrome Showe L C, Fox F E, Williams D, Au K, Niu Z, Rook A H ‘Depressed IL-12-mediated signal transduction in T cells from patients with Sezary syndrome is associated with the absence of IL-12 receptor beta 2 mRNA and highly reduced levels of STAT4’ J Immunol Oct. 1, 1999;163(7):4073-9;
  • a global analysis of the status of DNA transcription mechanisms would provide a basis for the development of appropriate and specific therapies for diseases associated with DNA replication.
  • the current state of the art is such that the analysis may be carried out in a gene specific manner based on the results of gene expression, e.g. DNA micro array analysis of mRNA expression or proteomic analysis.
  • the next step would then be to look at the causal factors involved at earlier stages in the regulatory mechanisms controlling DNA transcription.
  • DNA methylation provides a novel level of information at which to analyse the genome.
  • 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
  • a relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior.
  • 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using “normal” molecular biological techniques, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing which can now be fully exploited.
  • the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. Dec. 15, 1996;24(24):5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method.
  • Methylation analysis on individual chromosomes improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. Feb. 25, 1994;22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio M C, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5′ region of the pS2 gene and its expression in human breast cancer cell lines. Gene. May 19, 1995;157(1-2):261-4; WO 97/46705, WO 95/15373 and WO 97/45560.
  • Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays.
  • the simple attachment of Cy3 and Cy5 dyes to the 5′-OH of the specific probe are particularly suitable for fluorescence labels.
  • the detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
  • Matrix Assisted Laser Desorption Ionization Mass Spectrometry is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. Oct. 15, 1998;60(20):2299-301).
  • An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner.
  • the analyte is ionized by collisions with matrix molecules.
  • An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
  • MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins.
  • the analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 350-57).
  • the sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size. For nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is considerably less efficient.
  • MALDI-TOF spectrometry the selection of the matrix plays an eminently important role.
  • Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard methodology is found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
  • the object of the present invention is to provide the chemically modified DNA of genes associated with DNA transcription, as well as oligonucleotides and/or PNA-oligomers for detecting cytosine methylations, as well as a method which is particularly suitable for the diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with DNA transcription.
  • the present invention is based on the discovery that genetic and epigenetic parameters and, in particular, the cytosine methylation pattern of genes associated with DNA transcription are particularly suitable for the diagnosis and/or therapy of diseases associated with DNA transcription.
  • This objective is achieved according to the present invention using a nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated DNA of genes associated with DNA transcription according to one of Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto.
  • the respective data bank numbers accession numbers
  • GenBank was used as the underlying data bank, which is located at the National Institute of Health at internet address http://www.ncbi.nlm.nih.gov.
  • the object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing at least one base sequence having a length of at least 13 nucleotides which hybridizes to a chemically pretreated DNA of genes associated with DNA transcription according to Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto.
  • the oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain the genetic and epigenetic parameters of genes associated with DNA transcription.
  • the base sequence of the oligomers preferably contain at least one CpG dinucleotide.
  • the probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties.
  • PNA peptide nucleic acid
  • the oligomers according to the present invention are normally used in so called “sets” which contain at least one oligomer for each of the CpG dinucleotides of the sequences of Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto.
  • sets which contain at least one oligomer for each of the CpG dinucleotides from one of Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto.
  • the present invention makes available a set of at least two oligonucleotides which can be used as so-called “primer oligonucleotides” for amplifying DNA sequences of one of Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto, or segments thereof.
  • At least one oligonucleotide is bound to a solid phase.
  • the present invention moreover relates to a set of at least 10 n (oligonucleotides and/or PNA-oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto).
  • chemically pretreated genomic DNA Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto.
  • SNPs single nucleotide polymorphisms
  • an arrangement of different oligonucleotides- and/or PNA-oligomers made available by the present invention is present in a manner that it is likewise bound to a solid phase.
  • This array of different oligonucleotide- and/or PNA-oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice.
  • the solid phase surface is preferably composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold.
  • nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are possible as well.
  • a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for analysis in connection with diseases associated with DNA transcription in which method at least one oligomer according to the present invention is coupled to a solid phase.
  • Methods for manufacturing such arrays are known, for example, from U.S. Pat. No. 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
  • a further subject matter of the present invention relates to a DNA chip for the analysis of diseases associated with DNA transcription which contains at least one nucleic acid according to the present invention.
  • DNA chips are known, for example, for U.S. Pat. No. 5,837,832.
  • kits which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method.
  • a kit along the lines of the present invention can also contain only part of the aforementioned components.
  • the present invention also makes available a method for ascertaining genetic and/or epigenetic parameters of genes associated with the cycle cell by analyzing cytosine methylations and single nucleotide polymorphisms, including the following steps:
  • a genomic DNA sample is chemically treated in such a manner that cytosine bases which are unmethylated at the 5′-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as ‘chemical pretreatment’ hereinafter.
  • the genomic DNA to be analyzed is preferably obtained form usual sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
  • sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
  • genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.
  • bisulfite hydrogen sulfite, disulfite
  • Fragments of the chemically pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a, preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100-2000 base pairs are amplified.
  • the amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the set of primer oligonucleotides includes at least two olignonucleotides whose sequences are each reverse complementary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto).
  • the primer oligonucleotides are preferably characterized in that they do not contain any CpG dinucleotides.
  • At least one primer oligonucleotide is bonded to a solid phase during amplification.
  • the different oligonucleotide and/or PNA-oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
  • the fragments obtained by means of the amplification can carry a directly or indirectly detectable label.
  • the detection may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • MALDI matrix assisted laser desorption/ionization mass spectrometry
  • ESI electron spray mass spectrometry
  • the amplificates obtained in the second step of the method are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes.
  • the hybridization takes place in the manner described in the following.
  • the set of probes used during the hybridization is preferably composed of at least 10 oligonucleotides or PNA-oligomers.
  • the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase. The non-hybridized fragments are subsequently removed.
  • Said oligonucleotides contain at least one base sequence having a length of 13 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide.
  • the cytosine of the CpG dinucleotide is the 5 th to 9 th nucleotide from the 5′-end of the 13-mer.
  • One oligonucleotide exists for each CpG dinucleotide.
  • Said PNA-oligomers contain at least one base sequence having a length of 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide.
  • the cytosine of the CpG dinucleotide is the 4 th to 6 th nucleotide seen from the 5′-end of the 9-mer.
  • One oligonucleotide exists for each CpG dinucleotide.
  • the non-hybridized amplificates are removed.
  • the hybridized amplificates are detected.
  • labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
  • the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer.
  • the mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • MALDI matrix assisted laser desorption/ionization mass spectrometry
  • ESI electron spray mass spectrometry
  • the produced fragments may have a single positive or negative net charge for better detectability in the mass spectrometer.
  • the aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genes associated with DNA transcription.
  • the oligomers according to the present invention or arrays thereof as well as a kit according to the present invention are intended to be used for the diagnosis and/or therapy of diseases associated with DNA transcription by analyzing methylation patterns of genes associated with DNA transcription.
  • the method is preferably used for the diagnosis and/or therapy of important genetic and/or epigenetic parameters within genes associated with DNA transcription.
  • the method according to the present invention is used, for example, for the diagnosis and/or therapy of diseases.
  • nucleic acids according to the present invention of Seq. ID No.1 through Seq. ID No.346 and sequences complementary thereto and/or a chemically pretreated DNA of genes according to the sequences of genes according to table 1 and sequences complementary thereto can be used for the diagnosis and/or therapy of genetic and/or epigenetic parameters of genes associated with DNA transcription.
  • the present invention moreover relates to a method for manufacturing a diagnostic agent and/or therapeutic agent for the diagnosis and/or therapy of diseases associated with DNA transcription by analyzing methylation patterns of genes associated with DNA transcription, the diagnostic agent and/or therapeutic agent being characterized in that at least one nucleic acid according to the present invention is used for manufacturing it, possibly together with suitable additives and auxiliary agents.
  • a further subject matter of the present invention relates to a diagnostic agent and/or therapeutic agent for diseases associated with DNA transcription by analyzing methylation patterns of genes associated with DNA transcription, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and auxiliary agents.
  • the present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous to patients or individuals in which important genetic and/or epigenetic parameters within genes associated with DNA transcription said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
  • hybridization is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure.
  • stringent hybridization conditions are those conditions in which a hybridization is carried out at 60° C. in 2.5 ⁇ SSC buffer, followed by several washing steps at 37° C. in a low buffer concentration, and remains stable.
  • the term “functional variants” denotes all DNA sequences which are complementary to a DNA sequence, and which hybridize to the reference sequence under stringent conditions and have an activity similar to the corresponding polypeptide according to the present invention.
  • “genetic parameters” are mutations and polymorphisms of genes associated with DNA transcription and sequences further required for their regulation.
  • mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
  • epigenetic parameters are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes associated with DNA transcription and sequences further required for their regulation.
  • Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlates with the DNA methylation.
  • FIG. 1 shows the hybridisation of fluorescent labelled amplificates to a surface bound olumbleucleotide.
  • Sample I being from a pilocytic astrocytoma tumor sample and sample II being form an oligodenrogliome grade II tumor sample.
  • Flourescence at a spot shows hybridisation of the amplificate to the olignonucleotide.
  • Hybridisation to a CG olgnonucleotide denotes methylation at the cytosine position being analysed
  • gybridisation to a TG olignonucleotide denates no methylation at the cytosine position being analysed.
  • Sequences having odd sequence numbers exhibit in each case sequences of the chemically pretreated genomic DNAs of different genes associated with DNA transcription.
  • Sequences having even sequence numbers exhibit in each case the sequences of the chemically pretreated genomic DNAs of genes associated with DNA transcription which are complementary to the preceeding sequences (e.g., the complementary sequence to Seq. ID No.1 is Seq. ID No.2, the complementary sequence to Seq. ID No.3 is Seq. ID No.4, etc.)
  • Seq. ID No. 347 through Seq. ID No. 350 show sequences of oligonucleotides used in Example 1.
  • the following example relates to a fragment of a gene associated with DNA transcription, in this case, CFOS in which a specific CG-position is analyzed for its methylation status.
  • the following example relates to a fragment of the gene CFOS in which a specific CG-position is to be analyzed for methylation.
  • a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner that all cytosines which are not methylated at the 5-position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5-position remain unchanged.
  • bisulfite hydrogen sulfite, disulfite
  • the treated DNA sample is diluted with water or an aqueous solution.
  • the DNA is subsequently desulfonated (10-30 min, 90-100° C.) at an alkaline pH value.
  • the DNA sample is amplified in a polymerase chain reaction, preferably using a heat-resistant DNA polymerase.
  • cytosines of the gene CFOS are analyzed.
  • a defined fragment having a length of 951 bp is amplified with the specific primer oligonucleotides TTTTGAGTTTTAGAATTGTT (Sequence ID No. 347) and AAAAACCCCCTACTCATCTA (Sequence ID No. 348).
  • This amplificate serves as a sample which hybridizes to an oligonucleotide previously bonded to a solid phase, forming a duplex structure, for example AAAACATTCGCACCTAAT (Sequence ID No.
  • the cytosine to be detected being located at position 105. of the amplificate.
  • the detection of the hybridization product is based on Cy3 and Cy5 fluorescently labeled primer oligonucleotides which have been used for the amplification.
  • a hybridization reaction of the amplified DNA with the oligonucleotide takes place only if a methylated cytosine was present at this location in the bisulfite-treated DNA.
  • the methylation status of the specific cytosine to be analyzed is inferred from the hybridization product.
  • a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase.
  • Said oligonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, with the exception of the position in question.
  • said oligonucleotide comprises a thymine base as opposed to a cytosine base i.e AAAACATTCACACCTAAT (Sequence ID No. 350). Therefore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed.
  • the procedure was carried out on cell samples from 2 patients, sample I being from a pilocytic astrocytoma tumor sample and sample II being from an oligodenrogliome grade II tumor sample.
  • Example 2 can be carried out, for example, for the following diseases: Adenosine deaminase deficiency, Viral infection, Retroviral infection, Sezary syndrome, Hematological disorders, Immunological disorders, Werner syndrome, Tuberculosis, Developmental disorders, Psoriasis, Rieger syndrome, Neurological disorders, Neurodegenerative disorders, Waardenburg syndrome, Niemann-Pick disease, Myelodysplastic syndrome, Myocardial infarction, Hypertension, Angiogenesis, Erythropoiesis, Congenital heart disease, HDR syndrome, Myelodysplastic syndrome, Arthiritis, Polyglutamine disorders, solid tumors and cancer TABLE 1 Listing of particularly preferred genes of the present invention associated with DNA transcription Database Entry No.
US10/240,453 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna transcription Abandoned US20030148326A1 (en)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
DE10019058.8 2000-04-06
DE10019058A DE10019058A1 (de) 2000-04-06 2000-04-06 Detektion von Variationen des DNA-Methylierungsprofils
DE10019173 2000-04-07
DE10019173.8 2000-04-07
DE10032529A DE10032529A1 (de) 2000-06-30 2000-06-30 Diagnose von bedeutenden genetischen Parametern innerhalb des Major Histocompatibility Complex (MHC)
DE10032529.7 2000-06-30
DE10043826 2000-09-01
DE10043826.1 2000-09-01

Publications (1)

Publication Number Publication Date
US20030148326A1 true US20030148326A1 (en) 2003-08-07

Family

ID=27437807

Family Applications (7)

Application Number Title Priority Date Filing Date
US10/239,676 Expired - Fee Related US7195870B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation
US10/240,454 Abandoned US20040067491A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
US10/240,589 Abandoned US20040076956A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair
US10/240,453 Abandoned US20030148326A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna transcription
US10/240,485 Abandoned US20030148327A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis
US10/240,452 Abandoned US20030162194A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
US10/240,708 Abandoned US20050282157A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication

Family Applications Before (3)

Application Number Title Priority Date Filing Date
US10/239,676 Expired - Fee Related US7195870B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation
US10/240,454 Abandoned US20040067491A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
US10/240,589 Abandoned US20040076956A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair

Family Applications After (3)

Application Number Title Priority Date Filing Date
US10/240,485 Abandoned US20030148327A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis
US10/240,452 Abandoned US20030162194A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
US10/240,708 Abandoned US20050282157A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication

Country Status (7)

Country Link
US (7) US7195870B2 (fr)
EP (9) EP1274866A2 (fr)
JP (3) JP2003534780A (fr)
AT (1) ATE353975T1 (fr)
AU (9) AU2001254788A1 (fr)
DE (1) DE60126593T2 (fr)
WO (8) WO2001077164A2 (fr)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US20060068402A1 (en) * 2004-09-24 2006-03-30 Genomictree, Inc. Methylated promoters of colon cancer-specific expression-decreased genes and use thereof
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20080108073A1 (en) * 2001-11-19 2008-05-08 Affymetrix, Inc. Methods of Analysis of Methylation
US7611841B2 (en) 2004-09-21 2009-11-03 Genomictree, Inc. Method for detecting methylation of promoter using restriction enzyme and DNA chip
US20100323917A1 (en) * 2009-04-07 2010-12-23 Akos Vertes Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US8084734B2 (en) 2006-05-26 2011-12-27 The George Washington University Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US9000361B2 (en) 2009-01-17 2015-04-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US9133521B2 (en) 2012-12-07 2015-09-15 EWHA University—Industry Collaboration Foundation Composition for diagnosing Alzheimer's disease using methylation status of HMOX1 gene and method for diagnosing Alzheimer's disease using the same
US10435743B2 (en) 2011-05-20 2019-10-08 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
WO2020150705A1 (fr) 2019-01-18 2020-07-23 The Regents Of The University Of California Mesure de méthylation d'adn pour des mammifères sur la base de loci conservés
WO2021075797A2 (fr) 2019-10-14 2021-04-22 주식회사 젠큐릭스 Composition pour le diagnostic de cancer du foie à l'aide de modifications de la méthylation de cpg dans des gènes spécifiques et son utilisation
WO2021154009A1 (fr) 2020-01-28 2021-08-05 주식회사 젠큐릭스 Composition utilisant des changements de méthylation cpg dans des gènes spécifiques pour diagnostiquer le cancer de la vessie, et son utilisation
WO2021206467A1 (fr) 2020-04-08 2021-10-14 주식회사 젠큐릭스 Composition pour diagnostiquer un cancer colorectal, un cancer rectal ou un adénome colorectal à l'aide d'un changement de méthylation cpg du gène glrb, et son utilisation
WO2023175019A1 (fr) 2022-03-15 2023-09-21 Genknowme S.A. Procédé pour déterminer la différence entre l'âge biologique et l'âge chronologique d'un sujet

Families Citing this family (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6780982B2 (en) * 1996-07-12 2004-08-24 Third Wave Technologies, Inc. Charge tags and the separation of nucleic acid molecules
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
EP1274866A2 (fr) 2000-04-06 2003-01-15 Epigenomics AG Diagnostic de maladies associees a la metastase
AU2001275294A1 (en) * 2000-06-07 2001-12-17 Biosynexus Incorporated. Immunostimulatory RNA/DNA hybrid molecules
EP1294947A2 (fr) * 2000-06-30 2003-03-26 Epigenomics AG Procede et acides nucleiques pour analyse de methylation pharmacogenomique
AUPR142500A0 (en) * 2000-11-13 2000-12-07 Human Genetic Signatures Pty Ltd A peptide nucleic acid-based assay for the detection of specific nucleic acid sequences
DE10128508A1 (de) 2001-06-14 2003-02-06 Epigenomics Ag Verfahren und Nukleinsäuren für die Differenzierung von Prostata-Tumoren
WO2003031932A2 (fr) * 2001-10-05 2003-04-17 Case Western Reserve University Procedes et compositions pour detecter les cancers du colon
JP2003144172A (ja) * 2001-11-16 2003-05-20 Nisshinbo Ind Inc メチル化検出用オリゴヌクレオチド固定化基板
DE10161625A1 (de) * 2001-12-14 2003-07-10 Epigenomics Ag Verfahren und Nukleinsäuren für die Analyse einer Lungenzell-Zellteilungsstörung
WO2003076593A2 (fr) * 2002-03-07 2003-09-18 The Johns Hopkins University School Of Medicine Depistage genomique pour genes lies au cancer rendus epigenetiquement silencieux
EP1344832A1 (fr) * 2002-03-15 2003-09-17 Epigenomics AG Procédé et acides nucléiques pour l'analyse de méthylation dans le gène de melastatin
WO2003083107A1 (fr) * 2002-03-25 2003-10-09 The Board Of Trustees Of The University Of Arkansas Extraction au cpg de l'adn de specimens pathologiques fixes au formaldehyde
AU2003247880B2 (en) * 2002-07-03 2010-09-02 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
CA2500255A1 (fr) * 2002-10-01 2004-04-29 Epigenomics Ag Procede et acides nucleiques permettant d'ameliorer le traitement de troubles de la proliferation de celllules mammaires
WO2004050915A1 (fr) * 2002-12-02 2004-06-17 Solexa Limited Determination de la methylation de sequences d'acide nucleique
DE10304219B3 (de) * 2003-01-30 2004-08-19 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungsmustern mit hoher Sensitivität
US20050266409A1 (en) * 2003-02-04 2005-12-01 Wyeth Compositions and methods for diagnosing, preventing, and treating cancers
WO2004111266A1 (fr) 2003-06-17 2004-12-23 Human Genetic Signatures Pty Ltd Procedes d'amplification de genome
EP1660683B1 (fr) 2003-08-14 2017-04-19 Case Western Reserve University Procedes et compositions pour le depistage de cancers du colon
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
DE10338308B4 (de) 2003-08-15 2006-10-19 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungen in DNA
CA2537810C (fr) 2003-09-04 2012-12-18 Human Genetic Signatures Pty Ltd Dosage de detection d'acide nucleique
AU2004281299B2 (en) * 2003-10-20 2010-11-18 St Vincent's Hospital Sydney Limited Assessment of disease risk by quantitative determination of epimutation in normal tissues
EP3269826B1 (fr) * 2003-12-01 2020-03-11 Epigenomics AG Procédés et acides nucléiques pour l'analyse d'expression de gènes associés au développement des troubles de prolifération cellulaire de la prostate
EP1561821B1 (fr) 2003-12-11 2011-02-16 Epigenomics AG Marqueurs pour le pronostic de la réponse à la thérapie et/ou de la survie chez les patients du cancer du sein
EP1568786A3 (fr) * 2004-02-13 2007-08-29 Affymetrix, Inc. (A US Entity) Analyse de la méthylation utilisant des matrices d'acides nucléiques
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
ATE476439T1 (de) 2004-09-10 2010-08-15 Human Genetic Signatures Pty Amplifikationsblocker umfassend interkalierende nukleinsäuren (ina) enthaltend interkalierende pseudonukleotide (ipn)
EP1828411B1 (fr) 2004-12-03 2012-11-07 Human Genetic Signatures PTY Ltd Procedes de simplification d'acides nucleiques microbiens par modification chimique de cytosines
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
WO2006088978A1 (fr) 2005-02-16 2006-08-24 Epigenomics, Inc. Procede de determination du modele de methylation d'un acide polynucleique
SI1871912T1 (sl) 2005-04-15 2012-06-29 Epigenomics Ag Postopek za določitev DNA metilacije v vzorcih krvi ali urina
WO2006111586A2 (fr) * 2005-04-20 2006-10-26 Proyecto De Biomedicina Cima, S.L. Procede permettant de determiner in vitro le degre de methylation du promoteur de line-1
JP2008541705A (ja) 2005-05-26 2008-11-27 ヒューマン ジェネティック シグネチャーズ ピーティーワイ リミテッド 非標準塩基を含むプライマーを使用する等温鎖置換増幅
ATE531820T1 (de) 2005-09-14 2011-11-15 Human Genetic Signatures Pty Gesundheitszustandstest
WO2007082099A2 (fr) 2006-01-11 2007-07-19 Genomic Health, Inc. Marqueurs d'expression de gène pour pronostic colorectal de cancer
US7465544B2 (en) * 2006-01-11 2008-12-16 Wisconsin Alumni Research Foundation Synthetic cofactor analogs of S-adenosylmethionine as ligatable probes of biological methylation and methods for their use
EP1826278A1 (fr) * 2006-02-28 2007-08-29 Epiontis GmbH Modification épigénétique des loci pour camta1 et/ou foxp3 à des fins de marquage dans le traitement du cancer
EP2471951A1 (fr) * 2006-05-02 2012-07-04 University of Southhampton Prédiction du développement cognitif au moyen de l'analyse de méthylation
WO2008096146A1 (fr) * 2007-02-07 2008-08-14 Solexa Limited Préparation de matrices pour l'analyse de méthylation
ES2685678T3 (es) * 2007-10-23 2018-10-10 Clinical Genomics Pty Ltd Un método para el diagnóstico de neoplasias - II
EP2215250B1 (fr) 2007-11-27 2013-02-27 Human Genetic Signatures Pty Ltd Enzymes pour l'amplification et la copie d'acides nucléiques modifiés par du bisulfite
WO2010007083A2 (fr) * 2008-07-15 2010-01-21 Epigenomics Ag Procédés et acides nucléiques pour l’analyse de troubles prolifératifs cellulaires
US8541207B2 (en) 2008-10-22 2013-09-24 Illumina, Inc. Preservation of information related to genomic DNA methylation
CA2760333A1 (fr) 2009-05-01 2010-11-04 Genomic Health Inc. Algorithme de profil d'expression genique et analyse de probabilite de recurrence de cancer colorectal et reponse a la chimiotherapie
CA2769862A1 (fr) 2009-08-28 2011-03-03 Cellular Dynamics International, Inc. Identification de variation genetique dans les tissus affectes a partir de cellules souches pluripotentes induites
WO2011080314A2 (fr) * 2009-12-31 2011-07-07 Deutsches Krebsforschungszentrum Nouveaux modulateurs de signalisation par trail
WO2012149245A2 (fr) * 2011-04-28 2012-11-01 Ostrer Harry Signatures génomiques d'une métastase dans le cancer de la prostate
NZ622418A (en) 2011-09-07 2014-12-24 Human Genetic Signatures Pty Molecular detection assay
EP2821487B1 (fr) * 2012-02-29 2016-10-26 Sysmex Corporation Procédé pour déterminer la présence ou l'absence de cellule cancéreuse issue d'un carcinome hépatocellulaire, et marqueur de détermination et trousse
US10706957B2 (en) 2012-09-20 2020-07-07 The Chinese University Of Hong Kong Non-invasive determination of methylome of tumor from plasma
US9732390B2 (en) 2012-09-20 2017-08-15 The Chinese University Of Hong Kong Non-invasive determination of methylome of fetus or tumor from plasma
US20140274757A1 (en) 2013-03-14 2014-09-18 Marie K. Kirby Differential Methylation Level of CpG Loci That Are Determinative of a Biochemical Reoccurrence of Prostate Cancer
SG11201608403TA (en) * 2014-04-28 2016-11-29 Sigma Aldrich Co Llc Epigenetic modification of mammalian genomes using targeted endonucleases
EP3850083A4 (fr) * 2018-09-14 2022-06-29 Shinozaki, Gen Systèmes et procédés de détection de risque de délire à l'aide de marqueurs épigénétiques
CN111217900A (zh) * 2018-11-27 2020-06-02 上海交通大学 一种血管新生的转录调控因子及其用途
CN111500702B (zh) * 2020-04-26 2021-04-20 江苏大学附属医院 RPN1基因cg00843506位点甲基化在诊断哮喘中的用途

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744305A (en) * 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US20030036081A1 (en) * 2001-07-02 2003-02-20 Epigenomics Ag Distributed system for epigenetic based prediction of complex phenotypes
US20030113750A1 (en) * 2001-06-14 2003-06-19 Juergen Distler Method and nucleic acids for the differentiation of prostate tumors
US6977146B1 (en) * 1999-01-29 2005-12-20 Epigenomics Ag Method of identifying cytosine methylation patterns in genomic DNA samples

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
SE501439C2 (sv) 1993-06-22 1995-02-13 Pharmacia Lkb Biotech Sätt och anordning för analys av polynukleotidsekvenser
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
DE69433180T2 (de) * 1993-10-26 2004-06-24 Affymetrix, Inc., Santa Clara Felder von nukleinsaeuresonden auf biologischen chips
KR100392057B1 (ko) 1993-11-30 2003-10-30 맥길 유니버시티 세포의 CpG 디뉴클레오티드 내의 시토신의 메틸화를 감소하는 방법
US5858661A (en) * 1995-05-16 1999-01-12 Ramot-University Authority For Applied Research And Industrial Development Ataxia-telangiectasia gene and its genomic organization
US5871917A (en) 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
WO1998056952A1 (fr) * 1997-06-09 1998-12-17 University Of Southern California Methode de diagnostic du cancer basee sur des differences de methylation d'adn
DE19750172C1 (de) * 1997-11-12 1998-10-01 Deutsches Krebsforsch DNA mit Promotor-Aktivität für Zellzyklus-Gen
DE19754482A1 (de) * 1997-11-27 1999-07-01 Epigenomics Gmbh Verfahren zur Herstellung komplexer DNA-Methylierungs-Fingerabdrücke
WO1999029898A2 (fr) * 1997-12-05 1999-06-17 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Procede d'identification d'acides nucleiques par spectrometrie de masse par ionisation/desorption laser assistee par matrice
AU5128999A (en) * 1998-07-24 2000-02-14 Yeda Research And Development Co. Ltd. Prevention of metastasis with 5-aza-2'-deoxycytidine
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US6783933B1 (en) * 1999-09-15 2004-08-31 The Johns Hopkins University School Of Medicine CACNA1G polynucleotide, polypeptide and methods of use therefor
US7332275B2 (en) * 1999-10-13 2008-02-19 Sequenom, Inc. Methods for detecting methylated nucleotides
EP1283905A2 (fr) * 2000-03-15 2003-02-19 Epigenomics AG Diagnostic d'affections associees au cycle cellulaire
EP1274866A2 (fr) 2000-04-06 2003-01-15 Epigenomics AG Diagnostic de maladies associees a la metastase
EP1294947A2 (fr) 2000-06-30 2003-03-26 Epigenomics AG Procede et acides nucleiques pour analyse de methylation pharmacogenomique
DE10037769A1 (de) 2000-08-03 2002-02-21 Epigenomics Gmbh Diagnose von mit CD24 assoziierten Krankheiten
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
DE10054974A1 (de) 2000-11-06 2002-06-06 Epigenomics Ag Diagnose von mit Cdk4 assoziierten Krankheiten
DE10054972A1 (de) 2000-11-06 2002-06-06 Epigenomics Ag Diagnose von mit humos assoziierten Krankheiten

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744305A (en) * 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US6977146B1 (en) * 1999-01-29 2005-12-20 Epigenomics Ag Method of identifying cytosine methylation patterns in genomic DNA samples
US20030113750A1 (en) * 2001-06-14 2003-06-19 Juergen Distler Method and nucleic acids for the differentiation of prostate tumors
US20030036081A1 (en) * 2001-07-02 2003-02-20 Epigenomics Ag Distributed system for epigenetic based prediction of complex phenotypes

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10407717B2 (en) 2001-11-19 2019-09-10 Affymetrix, Inc. Methods of analysis of methylation
US20080108073A1 (en) * 2001-11-19 2008-05-08 Affymetrix, Inc. Methods of Analysis of Methylation
US10822642B2 (en) 2001-11-19 2020-11-03 Affymetrix, Inc. Methods of analysis of methylation
US20110151438A9 (en) * 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US7611841B2 (en) 2004-09-21 2009-11-03 Genomictree, Inc. Method for detecting methylation of promoter using restriction enzyme and DNA chip
US20060068402A1 (en) * 2004-09-24 2006-03-30 Genomictree, Inc. Methylated promoters of colon cancer-specific expression-decreased genes and use thereof
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US10822659B2 (en) 2006-03-31 2020-11-03 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US8709716B2 (en) 2006-03-31 2014-04-29 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20110166037A1 (en) * 2006-03-31 2011-07-07 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US9828640B2 (en) 2006-03-31 2017-11-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US8084734B2 (en) 2006-05-26 2011-12-27 The George Washington University Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US9000361B2 (en) 2009-01-17 2015-04-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US9490113B2 (en) 2009-04-07 2016-11-08 The George Washington University Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry
US20100323917A1 (en) * 2009-04-07 2010-12-23 Akos Vertes Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry
US10435743B2 (en) 2011-05-20 2019-10-08 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
US9133521B2 (en) 2012-12-07 2015-09-15 EWHA University—Industry Collaboration Foundation Composition for diagnosing Alzheimer's disease using methylation status of HMOX1 gene and method for diagnosing Alzheimer's disease using the same
WO2020150705A1 (fr) 2019-01-18 2020-07-23 The Regents Of The University Of California Mesure de méthylation d'adn pour des mammifères sur la base de loci conservés
WO2021075797A2 (fr) 2019-10-14 2021-04-22 주식회사 젠큐릭스 Composition pour le diagnostic de cancer du foie à l'aide de modifications de la méthylation de cpg dans des gènes spécifiques et son utilisation
WO2021154009A1 (fr) 2020-01-28 2021-08-05 주식회사 젠큐릭스 Composition utilisant des changements de méthylation cpg dans des gènes spécifiques pour diagnostiquer le cancer de la vessie, et son utilisation
WO2021206467A1 (fr) 2020-04-08 2021-10-14 주식회사 젠큐릭스 Composition pour diagnostiquer un cancer colorectal, un cancer rectal ou un adénome colorectal à l'aide d'un changement de méthylation cpg du gène glrb, et son utilisation
WO2023175019A1 (fr) 2022-03-15 2023-09-21 Genknowme S.A. Procédé pour déterminer la différence entre l'âge biologique et l'âge chronologique d'un sujet

Also Published As

Publication number Publication date
ATE353975T1 (de) 2007-03-15
US20030162194A1 (en) 2003-08-28
JP2003534780A (ja) 2003-11-25
DE60126593D1 (de) 2007-03-29
DE60126593T2 (de) 2007-10-31
WO2001081622A3 (fr) 2003-09-04
WO2001092565A3 (fr) 2002-09-06
EP1272670A2 (fr) 2003-01-08
AU2001254794A1 (en) 2001-10-23
AU7633001A (en) 2001-10-23
WO2001092565A8 (fr) 2002-05-30
US7195870B2 (en) 2007-03-27
WO2001076451A9 (fr) 2002-08-08
WO2001077375A8 (fr) 2002-10-24
WO2001081622A8 (fr) 2002-05-16
WO2001092565A2 (fr) 2001-12-06
AU2001276330B2 (en) 2006-08-31
EP1370685A2 (fr) 2003-12-17
WO2001077377A2 (fr) 2001-10-18
WO2001077164A8 (fr) 2002-03-21
US20030082609A1 (en) 2003-05-01
EP1274866A2 (fr) 2003-01-15
WO2001077378A3 (fr) 2002-10-17
WO2001077376A8 (fr) 2002-03-21
AU2001254788A1 (en) 2001-10-23
WO2001077375A2 (fr) 2001-10-18
WO2001077377A8 (fr) 2002-02-28
US20040076956A1 (en) 2004-04-22
US20040067491A1 (en) 2004-04-08
US20030148327A1 (en) 2003-08-07
EP1274865B1 (fr) 2007-02-14
WO2001077376A3 (fr) 2002-08-08
AU2001275663A1 (en) 2001-10-23
WO2001077376A2 (fr) 2001-10-18
EP1278893A2 (fr) 2003-01-29
WO2001077164A2 (fr) 2001-10-18
EP1360319A2 (fr) 2003-11-12
JP2004508807A (ja) 2004-03-25
WO2001076451A3 (fr) 2003-09-04
AU2001276331A1 (en) 2001-10-23
AU2001277487A1 (en) 2001-10-23
EP1268857A2 (fr) 2003-01-02
WO2001077375A3 (fr) 2002-06-27
WO2001077377A3 (fr) 2002-07-11
WO2001076451A2 (fr) 2001-10-18
AU2001289600A1 (en) 2001-12-11
WO2001081622A2 (fr) 2001-11-01
EP2014776A2 (fr) 2009-01-14
EP2014776A3 (fr) 2009-04-01
EP1268861A2 (fr) 2003-01-02
EP1274865A2 (fr) 2003-01-15
WO2001077378A2 (fr) 2001-10-18
US20050282157A1 (en) 2005-12-22
WO2001077164A3 (fr) 2002-06-20
AU2001278420A1 (en) 2001-11-07
JP2003531589A (ja) 2003-10-28

Similar Documents

Publication Publication Date Title
US20030148326A1 (en) Diagnosis of diseases associated with dna transcription
EP1676927A2 (fr) Diagnose d'une maladie associée à des gènes de développement par détermination de l'état de méthylation
US20040029123A1 (en) Diagnosis of diseases associated with the cell cycle
AU2001276330A1 (en) Diagnosis of diseases associated with apoptosis
EP1344832A1 (fr) Procédé et acides nucléiques pour l'analyse de méthylation dans le gène de melastatin
DE20121972U1 (de) Nukleinsäuren für die Diagnose von mit DNA Transkription assoziierten Krankheiten
AU2006213968A1 (en) Diagnosis of diseases associated with DNA replication
AU2006203475A1 (en) Diagnosis of Diseases Associated with Gene Regulation
AU2006225250A1 (en) Diagnosis of diseases associated with metastasis

Legal Events

Date Code Title Description
AS Assignment

Owner name: EPIGENOMICS AG, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLEK, ALEXANDER;PIEPENBROCK, CHRISTIAN;BERLIN, KURT;REEL/FRAME:013672/0099;SIGNING DATES FROM 20020930 TO 20021001

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION