Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberDE60126593 T2
Publication typeGrant
Application numberDE2001626593
PCT numberPCT/EP2001/003969
Publication date31 Oct 2007
Filing date6 Apr 2001
Priority date6 Apr 2000
Also published asDE60126593D1, EP1268857A2, EP1268861A2, EP1272670A2, EP1274865A2, EP1274865B1, EP1274866A2, EP1278893A2, EP1360319A2, EP1370685A2, EP2014776A2, EP2014776A3, US7195870, US20030082609, US20030148326, US20030148327, US20030162194, US20040067491, US20040076956, US20050282157, WO2001076451A2, WO2001076451A3, WO2001076451A9, WO2001077164A2, WO2001077164A3, WO2001077164A8, WO2001077375A2, WO2001077375A3, WO2001077375A8, WO2001077376A2, WO2001077376A3, WO2001077376A8, WO2001077377A2, WO2001077377A3, WO2001077377A8, WO2001077378A2, WO2001077378A3, WO2001081622A2, WO2001081622A3, WO2001081622A8, WO2001092565A2, WO2001092565A3, WO2001092565A8
Publication number01626593, 2001626593, DE 60126593 T2, DE 60126593T2, DE-T2-60126593, DE01626593, DE2001626593, DE60126593 T2, DE60126593T2, PCT/2001/3969, PCT/EP/1/003969, PCT/EP/1/03969, PCT/EP/2001/003969, PCT/EP/2001/03969, PCT/EP1/003969, PCT/EP1/03969, PCT/EP1003969, PCT/EP103969, PCT/EP2001/003969, PCT/EP2001/03969, PCT/EP2001003969, PCT/EP200103969
InventorsKurt Berlin, Alexander Olek, Christian Piepenbrock
ApplicantEpigenomics Ag
Export CitationBiBTeX, EndNote, RefMan
External Links: DPMA, Espacenet
Diagnose von mit apoptose assoziierten erkrankungen mittels ermittlung des methylierungszustandes von apoptose-assozierten genen Diagnosis of diseases associated with apoptosis by determination of the methylation state of apoptosis-associated antigenic translated from German
DE 60126593 T2
Abstract  available in
Claims(18)  translated from German
  1. Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern, die für die Diagnose von bestehenden Erkrankungen oder der Prädisposition für spezifische Erkrankungen geeignet sind, durch analysieren von Cytosinmethylierungen, dadurch gekennzeichnet , dass die folgenden Schritte durchgeführt werden: a) in einer genomischen DNA Probe werden Cytosinbasen, die an der 5-Position nicht methyliert sind, durch chemische Behandlung mittels einer Lösung eines Bisulfits, Hydrogensulfits oder Disulfits, zu Uracil oder einer anderen Base, die hinsichtlich ihres Hybridisierungsverhaltens von Cytosin unähnlich ist umgewandelt; Are a) in a genomic DNA sample: A method for ascertaining genetic and / or epigenetic parameters suitable for the diagnosis of existing diseases or the predisposition to specific diseases by analyzing cytosine methylations, characterized in that the following steps are performed cytosine bases which are unmethylated at the 5-position are converted by chemical treatment by means a solution of a bisulfite, hydrogen sulfite or disulfite, to uracil or another base which is dissimilar to cytosine in terms of their hybridization behavior; b) Fragmente der chemisch vorbehandelten genomischen DNA Probe werden unter der Verwendung eines Sets von mindestens zwei Primeroligonukleotiden und einer Polymerase amplifiziert, wobei die Oligomere in jedem Fall mindestens eine Basensequenz mit einer Länge von mindestens 9 Nukleotiden umfassen, die an eine chemisch vorbehandelte DNA eines Gens, das mit Apoptose assoziiert ist, nach einer der Seq ID Nrn. 73 oder 74 und dazu komplementären Sequenzen, hybridisiert oder dazu identisch ist, c) die Amplifikate werden an ein Set von mindestens zwei Oligonukleotiden und/oder PNA Sonden hybridisiert, die in jedem Fall eine Basensequenz umfassen, die eine Länge von mindestens 9 Nukleotiden aufweisen, die an eine chemisch vorbehandelte DNA eines Gens, das mit Apoptose assoziiert ist nach einer der Seq ID Nrn. 73 oder 74 und dazu komplementären Sequenzen oder andererseits an eine Anordnung dieser Oligonukleotide und/oder PNA Sonden hybridisiert oder dazu identisch ist; b) Fragments of the chemically pretreated genomic DNA sample are amplified using a set of at least two primer oligonucleotides and a polymerase, wherein the oligomers in each case comprise at least one base sequence having a length of at least 9 nucleotides which hybridises to a chemically pretreated DNA of a gene which is associated with apoptosis according to one of the Seq ID Nos. 73 or 74 and sequences complementary thereto, hybridized or is identical thereto, c) the amplificates are hybridized to a set of at least two oligonucleotides and / or PNA probes which in each case comprise a base sequence having a length of at least 9 nucleotides, and to a chemically pretreated DNA of a gene associated with apoptosis according to one of the Seq ID Nos. 73 or 74 and sequences complementary thereto, or on the other hand to an array of these oligonucleotides hybridized / or PNA probes or to identical; und d) die hybridisierten Amplifikate werden anschließend nachgewiesen. and d) the hybridized amplificates are subsequently detected.
  2. Verfahren nach Anspruch 1, wobei die Amplifikation der chemisch vorbehandelten genomischen DNA unter der Verwendung von Sets von Primeroligonukleotiden und einer Polymerase auf eine Weise durchgeführt wird, dass die Amplifikate einen nachweisbaren Marker tragen. The method of claim 1, wherein the amplification of the chemically pretreated genomic DNA is performed with the use of sets of primer oligonucleotides and a polymerase in a way that the amplificates carry a detectable label.
  3. Verfahren nach Anspruch 1 oder 2, weiter umfassend den Schritt von hybridisieren der Amplifikate an ein Set von Oligomeren (Oligonukleotide und/oder PNA Sonden) oder an eine Anordnung, wobei die Basensequenz der Oligomere mindestens ein CpG Dinukleotid einschließt. The method of claim 1 or 2, further comprising the step of hybridizing the amplificates to a set of oligomers (oligonucleotides and / or PNA probes) or to an array, wherein the base sequence of the oligomers includes at least one CpG dinucleotide.
  4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, dass das Cytosin des CpG Dinukleotids im mittleren Drittel des Oligomers lokalisiert ist. A method according to claim 3, characterized in that the cytosine of the CpG dinucleotide is located in the middle third of the oligomer.
  5. Verfahren nach einem der Ansprüche 1 bis 4, wobei ein Set an Oligomeren verwendet wird, umfassend Oligomere zum Nachweis des Methylierungszustands aller CpG Dinukleotide innerhalb einer der Sequenzen nach Seq. Method according to one of claims 1 to 4, wherein a set of oligomers is used, comprising oligomers for detecting the methylation state of all CpG dinucleotides within one of the sequences according to Seq. ID Nrn. 73 oder 74, und dazu komplementären Sequenzen. ID Nos. 73 or 74, and sequences complementary thereto.
  6. Verfahren nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass mehr als zehn verschiedene Fragmente mit einer Länge von 100-2000 Basenpaaren amplifiziert werden. Method according to one of claims 1 to 5, characterized in that more than ten different fragments are amplified with a length of 100-2000 base pairs.
  7. Verfahren nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass die Amplifikation von mehreren DNA Segmenten in einem Reaktionsgefäß durchgeführt wird. Method according to one of claims 1 to 6, characterized in that the amplification is performed by multiple DNA segments in one reaction vessel.
  8. Verfahren nach einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, dass die Polymerase eine Hitze-resistente DNA Polymerase ist, und wobei die Amplifikation bevorzugt mittels der Polymerase-Kettenreaktion (PCR) durchgeführt wird. Method according to one of claims 1 to 7, characterized in that the polymerase is a heat-resistant DNA polymerase and wherein the amplification is preferred carried out by means of the polymerase chain reaction (PCR).
  9. Verfahren nach einem der Ansprüche 2 bis 7, dadurch gekennzeichnet, dass die Marker der Amplifikate ausgewählt sind aus der Gruppe von Fluoreszenmarkern, Radionukliden und ablösbaren Molekülfragmenten, die eine typische Masse aufweisen, die in einem Massenspektrometer nachgewiesen wird. Method according to one of claims 2 to 7, characterized in that the markers of the amplificates are selected from the group of Fluoreszenmarkern, radionuclides, and detachable molecule fragments having a typical mass, which is detected in a mass spectrometer.
  10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass die hergestellten Fragmente eine einzelne positive oder negative Nettoladung für eine bessere Nachweisbarkeit in einem Massenspektrometer aufweisen. A method according to claim 9, characterized in that the fragments produced have a single positive or negative net charge for better detectability in a mass spectrometer.
  11. Verfahren nach Anspruch 9 oder 10, dadurch gekennzeichnet, dass die Amplifikate oder Fragmente der Amplifikate in einem Massenspektrometer nachgewiesen werden, wobei der Nachweis bevorzugt mittels Matrix-unterstützter Laserdesorptions-/Ionisierungs- Massenspektrometrie (MALDI) oder unter der Verwendung von Elektronenspray-Massenspektrometrie (ESI) durchgeführt und visualisiert wird. A method according to claim 9 or 10, characterized in that the amplificates or fragments of the amplificates are detected in a mass spectrometer, wherein the detection preferably by means of matrix-assisted laser desorption / ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI ) is performed and visualized.
  12. Verfahren nach einem der Ansprüche 1 bis 11, dadurch gekennzeichnet, dass die genomische DNA aus Zellen oder zellulären Komponenten, die DNA enthalten, erhalten wird, wobei Quellen an DNA zum Beispiel umfassen, Zelllinien, Biopsien, Blut, Sputum, Stuhl, Urin, cerebrospinale Flüssigkeit, Gewebe eingebettet in Paraffin, wie zum Beispiel Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologische Objektträger und alle mögliche Kombinationen davon. Method according to one of claims 1 to 11, characterized in that the genomic DNA from cells or cellular components which contain DNA, is obtained, wherein sources of DNA comprise, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebrospinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lungs, breast or liver, histological slides and all possible combinations thereof.
  13. Verfahren nach einem der Ansprüche 1 bis 12, weiter umfassend den Schritt von Durchführen einer Diagnose einer Erkrankung ausgewählt aus soliden Tumoren und Krebs. Method according to one of claims 1 to 12, further comprising the step of performing a diagnosis of a disease selected from solid tumors and cancers.
  14. Nukleinsäureamplifikat, hergestellt durch a) chemische Umwandlung von Cytosinbasen, die an der 5-Position nicht methyliert sind, in Uracil oder eine andere Base, die im Hinblick auf ihr Hybridisierungsverhalten von Cytosine unähnlich ist, in einer genomischen DNA-Probe mittels einer Lösung eines Bisulfits, Hydrogensulfits oder Disulfits und anschließender alkalischer Hydrolyse, und b) PCR-Amplifikation von Fragmenten aus der vorbehandelten genomischen DNA unter der Verwendung von mindestens zwei Primeroligonukleotiden und einer Polymerase, wobei die Primeroligonukleotide eine Basensequenz umfassen, die eine Länge von mindestens 18 Nukleotiden aufweist, die revers komplementär oder identisch ist zu einer chemisch vorbehandelten DNA eines Gens, das mit Apoptose assoziiert ist nach einer der Seq ID Nrn. 73 oder 74 und dazu komplementärer Sequenzen, wobei die Fragmente eine Länge von 100-2000 Basenpaaren aufweisen. Nukleinsäureamplifikat produced by a) chemical conversion of cytosine bases which are unmethylated at the 5-position into uracil or another base which is dissimilar with respect to their hybridization behavior of cytosines, in a genomic DNA-sample by means of a solution of a bisulfite , hydrogen sulfite or disulfite and subsequent alkaline hydrolysis, and b) PCR-amplification of fragments from said pretreated genomic DNA using at least two primer oligonucleotides and a polymerase, wherein the primer oligonucleotides comprise a base sequence having a length of at least 18 nucleotides reverse complementary or identical to a chemically pretreated DNA of a gene associated with apoptosis according to one of the Seq ID Nos. 73 or 74 and sequences complementary thereto, wherein the fragments have a length of 100-2000 base pairs.
  15. Nukleinsäure nach Anspruch 14, die einen nachweisbaren Marker trägt. A nucleic acid according to claim 14, which carries a detectable marker.
  16. Nukleinsäure nach Anspruch 14 oder 15 zur Verwendung in der Diagnose von Erkrankungen. The nucleic acid of claim 14 or 15 for use in the diagnosis of diseases.
  17. Verwendung einer Anordnung eines Sets von mindestens zwei verschiedenen Oligomeren (Array), die in jedem Fall eine Basensequenz umfassen, die eine Länge von mindestens 9 Nukleotiden aufweist, die identisch ist zu einer chemisch vorbehandelten DNA eines Gens, das mit Apoptose assoziiert ist nach einer der Seq ID Nrn. 73 oder 74 oder dazu komplementären Sequenzen, fixiert an ein Trägermaterial zur Analyse von Erkrankungen, die mit dem Methylierungszustand der CpG Dinukleotide einer der Seq. Use of an arrangement of a set of at least two different oligomers (array) which comprise in each case a base sequence having a length of at least 9 nucleotides which is identical to a chemically pretreated DNA of a gene associated with apoptosis according to a Seq ID Nos. 73 or 74 or sequences complementary thereto fixed to a carrier material for analyzing diseases associated with the methylation state of the CpG dinucleotides of one of the Seq. ID Nr. 73 oder Seq. ID NO. 73 or SEQ. ID Nr. 74 oder dazu komplementärer Sequenzen assoziiert sind. ID NO. 74 or to complementary sequences are associated.
  18. Verwendung einer Anordnung nach Anspruch 17 in einem Verfahren zur Diagnose von soliden Tumoren und Krebs nach Anspruch 13. Use of an arrangement according to claim 17 in a method for the diagnosis of solid tumors and cancers according to claim 13.
Description  translated from German
  • Gebiet der Erfindung Field of the Invention
  • [0001] [0001]
    Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebenen sind die Gene selbst, die Übersetzung dieser Gene in RNA und die daraus entstehenden Proteine. In accordance with the methodological developments of recent years in molecular biology well studied levels of observation are the genes themselves, the translation of these genes into RNA and the resulting proteins. Wann im Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Gene in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß und Charakter der Methylierung der Gene bzw. des Genoms korrelierbar. Which gene is turned on during the development of an individual and how the activation and inhibition of certain genes is controlled in certain cells and tissues is correlated with the extent and nature of the methylation of the genes or of the genome. Insofern äußern sich pathogene Zustände in einem veränderten Methylierungsmuster einzelner Gene oder des Genoms. This regard, pathogenic states are also expressed by a modified methylation pattern of individual genes or of the genome.
  • [0002] [0002]
    Die vorliegende Erfindung betrifft Nukleinsäuren und ein Verfahren zur Diagnose von Erkrankungen, die mit dem genetischen und/oder epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, und insbesondere deren Methylierungsstatus, in Zusammenhang stehen. The present invention relates to nucleic acids and a method for the diagnosis of diseases which are associated with the genetic and / or epigenetic parameters of genes associated with apoptosis, and in particular their methylation status.
  • Stand der Technik State of the art
  • [0003] [0003]
    Während der Embryogenese, der Gewebeerneuerung oder Metamorphose behalten multizelluläre eukaryotische Organismen ihre Fähigkeit bei, unerwünschte Zellen zu beseitigen. During embryogenesis, tissue renewal or metamorphosis multicellular eukaryotic organisms retain their ability to eliminate unwanted cells. Diese Form von programmiertem Zelltod wird "Apoptose" genannt. This form of programmed cell death is called "apoptosis". Die Apoptose findet in Antwort auf eine Vielzahl von Stimuli statt, die biochemische Signalwege auslösen die zu einem charakteristischen Set von Prozessen führen, die im Zelltod resultieren. Apoptosis occurs in response to a variety of stimuli that trigger the biochemical pathways that lead to a characteristic set of processes that result in cell death.
  • [0004] [0004]
    Die Stimuli, die Apoptose auslösen, können die Spiegel von essentiellen Wachstumsfaktoren, die Behandlung mit Glucocorticoiden, Bestrahlung und die Aktivierung von bestimmten Rezeptoren einschließen. The stimuli that trigger apoptosis, the levels of essential growth factors, treatment with corticosteroids, radiation, and the activation of specific receptors may include. Diese lösen eine Vielzahl von biochemischen Signalwegen aus. This solve a variety of biochemical pathways from. Der "klassische" Signalweg besteht aus einer Liganden-Rezeptor-Interaktion, die die Aktivierung einer Protease auslöst. The "classical" pathway consists of a ligand-receptor interaction that triggers the activation of a protease. Dies führt zu der Freisetzung von Cytochrom C aus den Mitochondrien. This leads to the release of cytochrome C from the mitochondria. Dieses aktiviert im Gegenzug eine Reihe von Proteasen, deren Wirkungen zu der Zerstörung von zellulären Strukturen führen. This in turn activates a number of proteases that cause the effects to the destruction of cellular structures.
  • [0005] [0005]
    Zum Beispiel schließt ein herkömmlicher Signalweg die Aktivierung von Caspase-8 durch Oligomerisierung an einem aktivierten Oberflächenrezeptor ein. For example, one conventional signaling an activation of caspase-8 by oligomerization of an activated surface receptor. Caspase-8 spaltet Bid, das die Freisetzung von Cytochrom C aus den Mitochondrien auslöst. Caspase-8 cleaves Bid, which triggers the release of cytochrome C from the mitochondria. Das Cytochrom C bewirkt, dass Apaf-1 mit Caspase-9 oligomerisiert. The cytochrome c causes Apaf-1 oligomerization with caspase-9. Die aktivierte Caspase-9 spaltet Procaspase-3, deren zwei Untereinheiten dann die aktive Protease bilden. The activated caspase-9 cleaves procaspase-3, which then form the two subunits of the active protease. Diese spaltet verschiedene Ziele, was zum Zelltod führt. This splits different targets, leading to cell death. Zelltod durch Apoptose ist durch Prozesse gekennzeichnet, in denen die Zelle kompakter wird, einer Blasenbildung an der Membranen auftritt, das Chromatin kondensiert wird und die DNA fragmentiert wird. Cell death by apoptosis is characterized by processes in which the cell is compact, the formation of bubbles in the membranes occurs, the chromatin condenses and the DNA is fragmented.
  • [0006] [0006]
    Die korrekte Kontrolle von Apoptose ist möglicherweise für alle höheren Organismen essentiell. The proper control of apoptosis may be essential for all higher organisms. Zum Beispiel sterben in dem Modell-Organismus C. elegans 131 der 1090 Zellen einen definierten Punkten des Lebenszyklus des Organismus. For example, die in the model organism C. elegans 131 of 1090 cells have a defined points in the life cycle of the organism. In Wirbeltieren wurde die Wichtigkeit der Apoptose durch die Verwendung von Knockout-Mausmodellen nachgewiesen. In vertebrates, the importance of apoptosis by the use of knock-out mouse models was demonstrated. In Menschen wurden Apoptose-Signalwege mit einer Vielzahl von Erkrankungen in Zusammenhang gebracht, einschließlich neurodegenerativen Erkrankungen, Alterung und Krebs: In human apoptosis-signaling pathways have been associated with a variety of diseases including neurodegenerative diseases, aging, and cancer:
    • – HIV-Infektion; - HIV infection; Badley et. Badley et. al. al. "Mechanisms of HIV-associated lymphocyte apoptotis" Blood, Vol. 96; "Mechanisms of HIV-associated lymphocyte apoptotis" Blood, vol. 96; 2951-2964 (2000). 2951-2964 (2000).
    • – Bloom Syndrom; - Bloom syndrome; Bischof et. Bishop et. al. al. "Selective cleavage of BLM, the Bloom syndrome protein, during apoptotic cell death." "Selective cleavage of BLM, the Bloom syndrome protein, During apoptotic cell death." J Biol Chem 2001 Jan 11. J Biol Chem 2001 Jan 11th
    • – Cardiomyopathie; - Cardiomyopathy; Narula et. Narula et. al. al. "Apoptosis in heart failure: release of cytochrome c from mitochondria and activation of caspase-3 in human cardiomyopathy" Proc Natl Acad Sci US A.; "Apoptosis in heart failure: release of cytochrome c from mitochondria and activation of caspase-3 in human cardiomyopathy" Proc Natl Acad Sci US A .; 96:8144-8149 (1999). 96: 8144-8149 (1999).
    • – Familiäre Alzheimer-Erkrankung; - Familial Alzheimer's disease; Simian et. Simian et. al. al. Presenilin-1 P264L Knock-In Mutation: Differential Effects on Aβ Production, Amyloid Deposition, and Neuronal Vulnerability The Journal of Neuroscience, 20(23):8717-8726 (1999). Presenilin-1 P264L knock-in mutation: differential effects on Aβ production, amyloid deposition, and Neuronal Vulnerability The Journal of Neuroscience, 20 (23): 8717-8726 (1999).
    • – Alterung; - Aging; Schindowski et. Schindowski et. al. al. "Age-related changes of apoptotic cell death in human lymphocytes." "Age-related changes of apoptotic cell death in human lymphocytes." Neurobiol Aging 2000 Sep-Oct; Neurobiol Aging 2000 Sep-Oct; 21(5):661-70. 21 (5): 661-70.
    • – Herpes Simplex Virus Infektion; - Herpes simplex virus infection; Perng et. Perng et. al. al. "Virus-Induced Neuronal Apoptosis Blocked by the Herpes Simplex Virus Latency-Associated Transcript" Science 287:1500-1503 (2000). "Induced Neuronal Apoptosis virus Blocked by the herpes simplex virus latency-associated transcript" Science 287: 1500-1503 (2000).
    • – Renale Ischämie; - Renal ischemia; Yuexian et. Yuexian et. al. al. "Downregulation of the calpain inhibitor protein calpastatin by caspases during renal ischemia-reperfusion" Am. "Down-regulation of the calpain inhibitor protein calpastatin by caspases renal ischemia-reperfusion During" Am. J. Physiol. J. Physiol. 279:509-517. 279: 509-517.
    • – Amyotrophe Lateralsklerose; - Amyotrophic lateral sclerosis; Li et. Li et. al. al. "Functional Role of Caspase-1 and Caspase-3 in an ALS Transgenic Mouse Model" Science 288 (5464); "Functional Role of caspase-1 and caspase-3 in ALS Transgenic Mouse Model" Science 288 (5464); 335-339 (2000). 335-339 (2000).
    • – Brustkrebs; - Breast cancer; Sierra et. Sierra et. al. al. "Bcl-2 with loss of apoptosis allows accumulation of genetic alterations: a pathway to metastatic progression in human breast cancer." "Bcl-2 with loss of apoptosis Allows accumulation of genetic alterations: a. Pathway to metastatic progression in human breast cancer" Int J Cancer. Int J Cancer. 2000 Mar 20; 2000 Mar 20; 89(2):142-7. 89 (2): 142-7.
  • [0007] [0007]
    Die Komplexitäten der Signalwege, die zu Apoptose führen, ermöglichen viele Mechanismen, durch die diese umgeleitet werden können. The complexities of the signaling pathways that lead to apoptosis, allowing many mechanisms by which they can be redirected. Zusätzlich zu genomischen Mutationen wurde die epigenetische Kontrolle von Genen mit Unterbrechungen in Apoptose-Signalwegen in Zusammenhang gebracht. In addition to genomic mutations in epigenetic control of genes has been associated with breaks in apoptosis signaling pathways. Der epigenetische Parameter, der am besten charakterisiert wurde, DNA-Methylierung, wurde als ein Schlüsselfaktor bei der Resistenz von Tumoren auf Chemotherapie impliziert. The epigenetic parameter which has been the best characterized, DNA methylation, has been implicated as a key factor in the resistance of tumors to chemotherapy. Es wurde gezeigt (Soengas et al „Inactivation of the apoptosis effector Apaf-1 in malignant melanoma" Nature 409; 207-211; 2001), das in malignen Melanomen Unterbrechungen in dem Apoptose-Signalweg einer Stummschaltung des Apaf-1 Gens zugeordnet werden konnten. It has been shown (Soengas et al "Inactivation of the apoptosis effector Apaf-1 in malignant melanoma" Nature 409, 207-211; 2001), the discontinuities in the apoptosis pathway of a muting of the Apaf-1 gene could be assigned in malignant melanoma ,
  • [0008] [0008]
    Die Identifizierung von Methylierung von Apoptosegenen als ein Faktor bei der Tumor-Malignität öffnet die Möglichkeit zur Erzeugung von alternativen Verfahren zur Behandlung. The identification of methylation of apoptosis genes as a factor in tumor malignancy opens the possibility for the generation of alternative methods of treatment. Methylierungs-basierte Therapien könnten beträchtliche Vorteile über augenblickliche Verfahren der Behandlung, wie z. B. Chemotherapie, Chirurgie und Radiotherapie haben. Methylation-based therapies may have significant advantages over current methods of treatment, such. As chemotherapy, surgery and radiotherapy. Sie können sogar, wie durch Soengas et al gezeigt, ein Mittel zur Behandlung von Tumoren zur Verfügung stellen, die gegenüber herkömmlichen Behandlungen resistent sind. They may even, as shown by Soengas et al, provide a means for the treatment of tumors are available which are resistant to conventional treatments. Zusätzlich zu der Entwicklung von Methylierungs-spezifischen Therapien haben Experimente mit Min-Mäusen gezeigt, daß die Inhibierung von DNA Methylierung die Tumorinitiation unterdrücken kann (Laird et. al. 'Suppression of intestinal neoplasia by DNA hypomethylation' Cell 81; 197-205 1995). In addition to the development of specific therapies methylation experiments with Min mice have shown that inhibition of DNA methylation can suppress tumor initiation (Laird et al 'Suppression of intestinal neoplasia by DNA hypomethylation' Cell 81;.. 197-205, 1995) , Weiterhin kann die DNA-Methylierungsanalyse neue Mittel zur Tumordia gnose zur Verfügung stellen, wie durch Rosas et. Furthermore, the DNA methylation analysis can provide new means for Tumordia forecast available, such as by Rosas et. al. al. 'Promoter hypermethylation patterns of p16, O6-methylguanine-DNA-methyltransferase, and death-associated protein kinase in tumors and saliva of head and neck cancer patients. 'Promoter hypermethylation patterns of p16, O6-methylguanine-DNA-methyltransferase, and death-associated protein kinase in tumors and saliva of head and neck cancer patients. 'Cancer Res 2001 Feb 1; 'Cancer Res 2001 Jan 1; 61(3):939-42 vorgeschlagen. 61 (3): 939-42 proposed.
  • [0009] [0009]
    5-Methylcytosin ist die häufigste kovalent modifizierte Base in der DNA eukaryontischer Zellen. 5-methylcytosine is the most frequent covalently modified base in the DNA of eukaryotic cells. Sie spielt beispielsweise eine Rolle in der Regulation der Transkription, beim genetischen Imprinting und in der Tumorgenese. Example, it plays a role in the regulation of transcription, in genetic imprinting and in tumorigenesis. Die Identifizierung von 5-Methylcytosin als Bestandteil genetischer Information ist daher von erheblichem Interesse. The identification of 5-methylcytosine as a component of genetic information is thus of considerable interest. 5-Methylcytosin-Positionen können jedoch nicht durch Sequenzierung identifiziert werden, da 5-Methylcytosin das gleiche Basenpaarungsverhalten aufweist wie Cytosin. However, 5-methylcytosine positions can not be identified by sequencing, since 5-methylcytosine has the same base pairing behavior as cytosine. Darüber hinaus geht bei einer PCR-Amplifikation die epigenetische Information, welche die 5-Methylcytosine tragen, vollständig verloren. Goes beyond the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
  • [0010] [0010]
    Eine relativ neue und die mittlerweile am häufigsten angewandte Methode zur Untersuchung von DNA auf 5-Methylcytosin beruht auf der spezifischen Reaktion von Bisulfit mit Cytosin, das nach anschließender alkalischer Hydrolyse in Uracil umgewandelt wird, welches in seinem Basenpaarungsverhalten dem Thymidin entspricht. A relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based on the specific reaction of bisulfite with cytosine, which is converted to uracil after subsequent alkaline hydrolysis, which corresponds in its base-pairing behavior to thymidine. 5-Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert. 5-methylcytosine is not modified under these conditions. Damit wird die ursprüngliche DNA so umgewandelt, dass Methylcytosin, welches ursprünglich durch sein Hybridisierungsverhalten vom Cytosin nicht unterschieden werden kann, jetzt durch "normale" molekularbiologische Techniken als einzig verbliebenes Cytosin beispielsweise durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Thus, the original DNA is converted so that methylcytosine, which originally can not be distinguished from cytosine by its hybridization behavior, can now be detected by "standard" molecular biology techniques as the only remaining cytosine, for example, by amplification and hybridization or sequencing. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt wird. All of these techniques are based on base pairing, which is now fully utilized. Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersuchende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulfit reagiert nur an einzelsträngiger DNA) verhindert und alle Fällungs- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15; 24(24):5064-6). The prior art, which concerns sensitivity is defined by a method to be examined DNA in an agarose matrix, so that the diffusion and renaturation of the DNA (bisulfite reacts only on single-stranded DNA) and all precipitation and purification steps replaced by rapid dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis, Nucleic Acids Res 1996 Dec 15; 24 (24):.. 5064-6). Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Methode veranschaulicht. With this method, individual cells can be examined, which illustrates the potential of the method. Allerdings werden bisher nur einzelne Regionen bis etwa 3000 Basenpaare Länge untersucht, eine globale Untersuchung von Zellen auf Tausenden von möglichen Methylierungsanalysen ist nicht möglich. However, so far only individual regions of up to approximately 3000 base pairs long, a global analysis of cells for thousands of possible methylation analyzes is not possible. Allerdings kann auch dieses Verfahren keine sehr klei nen Fragmente aus geringen Probenmengen zuverlässig analysieren. However, this method can analyze very Dressing nen fragments from small sample volumes reliably. Diese gehen trotz Diffusionsschutz durch die Matrix verloren. These are lost despite the protection from diffusion through the matrix.
  • [0011] [0011]
    Eine Übersicht über die weiteren bekannten Möglichkeiten, 5-Methylcytosine nachzuweisen, kann aus dem folgenden Übersichtsartikel entnommen werden: Rein, T., DePamphilis, ML, Zorbas, H., Nucleic Acids Res. 1998, 26, 2255. An overview of other known possibilities for detecting 5-methylcytosine may be gathered from the following review article: Rein, T., DePamphilis, ML, Zorbas, H., Nucleic Acids Res 1998, 26, 2255..
  • [0012] [0012]
    Katzenellenbogen et al, "Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies" Blood Vol. 93 No. Katzenellenbogen et al, "Hypermethylation of the DAP-kinase CpG Iceland is a common alteration in B-cell malignancies" Blood Vol. 93 No. 12; 12; 4347-53 beschreiben die MSP basierte Analyse der ersten 525 bp Region von der Transkriptionsstartstelle. 4347-53 describe the MSP-based analysis of the first 525 bp region from the transcription start site. Die Promotormethylierung wurde in B-Zell-malignen Erkrankungen beobachtet. The promoter methylation was observed in B-cell malignancies.
  • [0013] [0013]
    Die Bisulfit-Technik wird bisher bis auf wenige Ausnahmen (zB Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr; 5(2):94-8) nur in der Forschung angewendet. The bisulfite technique has been previously few exceptions (eg Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the .. Eur J Hum Genet SNRPN locus 1997 Mar-Apr; 5 (2): 94-8) used only in research. Immer aber werden kurze, spezifische Stücke eines bekannten Gens nach einer Bisulfit-Behandlung amplifiziert und entweder komplett sequenziert (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov; 17(3):275-6) oder einzelne Cytosin-Positionen durch eine "Primer-Extension-Reaktion" (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15; 25(12):2529-31, WO 95/00669) oder einen Enzymschnitt (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15; 25(12):2532-4) nachgewiesen. However, short, specific segments of a known gene are amplified after a bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint Nat Genet 1997 November; 17 (3):.. 275 -6) or individual cytosine positions by a "primer extension reaction" (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 June 15; 25 (12): 2529-31, WO 95/00669) or an enzyme cleavage (Xiong Z, Laird PW COBRA: a sensitive and quantitative DNA methylation assay Nucleic Acids Res 1997 June 15; 25 (12...) : 2532-4) detected. Zudem ist auch der Nachweis durch Hybridisierung beschrieben worden (Olek et al., WO 99/28498). In addition, is also the detection by hybridization has been described (Olek et al., WO 99/28498).
  • [0014] [0014]
    Weitere Publikationen, die sich mit der Anwendung der Bisulfit-Technik zum Methylierungsnachweis bei einzelnen Genen befassen, sind: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Other publications that deal with the application of the bisulfite technique for methylation detection in individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. Bioassays. 1994 Jun; 1994 June; 16(6):431-6, 431; 16 (6): 431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: DNA methylation patterns in the different Prader-Willi / Angelman syndrome region as by determined by the genomic sequencing method. Hum Mol Genet. Hum Mol Genet. 1997 Mar; 1997 Mar; 6(3):387-95; 6 (3): 387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb 25; Nucleic Acids Res. 1994 February 25; 22(4):695-6; 22 (4): 695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5' region of the pS2 gene and its expression in human breast cancer cell lines. Martin V, Ribieras S, Song Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5 'region of the pS2 gene and its expression in human breast cancer cell lines. Gene. Genes. 1995 May 19; 1995 May 19; 157(1-2):261-4; 157 (1-2): 261-4; WO 97/46705, WO 95/15373 und WO 97/45560. WO 97/46705, WO 95/15373 and WO 97/45560.
  • [0015] [0015]
    Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung läßt sich aus einer im Januar 1999 erschienenen Sonderausgabe von Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999) und der dort zitierten Literatur entnehmen. An overview of the state of the art in oligomer array production can be taken from a published in January 1999 special issue of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999) and the references cited therein.
  • [0016] [0016]
    Für die Abtastung eines immobilisierten DNA-Arrays werden vielfach fluoreszenzmarkierte Sonden verwendet. Often fluorescently labeled probes are used for scanning an immobilized DNA arrays. Besonders geeignet für Fluoreszenzmarkierungen ist das einfache Anbringen von Cy3 und Cy5 Farbstoffen am 5'-OH der jeweiligen Sonde. Particularly suitable for fluorescent labels is the simple introduction of Cy3 and Cy5 dyes at the 5'-OH of the specific probe. Der Nachweis der Fluoreszenz der hybridisierten Sonden erfolgt beispielsweise über ein Konfokalmikroskop. The detection of the fluorescence of the hybridized probes for example via a confocal microscope. Die Farbstoffe Cy3 und Cy5 sind, neben vielen anderen, kommerziell erhältlich. The dyes Cy3 and Cy5, among many others, are commercially available.
  • [0017] [0017]
    Matrix-assistierte Laser Desorptions/Ionisations-Massenspektrometrie (MALDI-TOF) ist eine sehr leistungsfähige Entwicklung für die Analyse von Biomolekülen (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15; 60(20):2299-301). Matrix-assisted laser desorption / ionization mass spectrometry (MALDI-TOF) is a very powerful development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons Anal Chem 1988 Oct 15..; 60 (20): 2299-301). Ein Analyt wird in eine lichtabsorbierende Matrix eingebettet. An analyte is embedded in a light-absorbing matrix. Durch einen kurzen Laserpuls wird die Matrix verdampft und das Analytmolekül so unfragmentiert in die Gasphase befördert. By a short laser pulse, the matrix is evaporated transporting the analyte unfragmented into the gas phase. Durch Stöße mit Matrixmolekülen wird die Ionisation des Analyten erreicht. By collisions with matrix molecules, the ionization of the analytes is achieved. Eine angelegte Spannung beschleunigt die Ionen in ein feldfreies Flugrohr. An applied voltage accelerates the ions into a field-free flight tube. Auf Grund ihrer verschiedenen Massen werden Ionen unterschiedlich stark beschleunigt. Due to their different masses, the ions are accelerated to varying degrees. Kleinere Ionen erreichen den Detektor früher als größere. Smaller ions reach the detector sooner than larger ones.
  • [0018] [0018]
    MALDI-TOF Spektrometrie eignet sich ausgezeichnet zur Analyse von Peptiden und Proteinen. MALDI-TOF spectrometry is excellently suited for the analysis of peptides and proteins. Die Analyse von Nukleinsäuren ist etwas schwieriger (Gut IG, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Cunent Innovations and Future Trends. 1995, 1; 147-57). The analysis of nucleic acids is somewhat more difficult (Gut IG, Beck S. DNA and matrix assisted laser desorption ionization mass spectrometry Cunent Innovations and Future Trends 1995 1;.. 147-57). Für Nukleinsäuren ist die Empfindlichkeit etwa 100 mal schlechter als für Peptide und nimmt mit zunehmender Fragmentgröße überproportional ab. For nucleic acids, the sensitivity is approximately 100 times poorer than for peptides and decreases with increasing fragment size from disproportionately. Für Nukleinsäuren, die ein vielfach negativ geladenes Rückgrat haben, ist der Ionisationsprozeß durch die Matrix wesentlich ineffizienter. For nucleic acids having a multiply negatively charged backbone, the ionization process through the matrix is considerably less efficient. In der MALDI-TOF Spektrometrie spielt die Wahl der Matrix eine eminent wichtige Rolle. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. Für die Desorption von Peptiden sind einige sehr leistungsfähige Matrizes gefunden worden, die eine sehr feine Kristallisation ergeben. For the desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallization. Für DNA gibt es zwar mittlerweile einige ansprechende Matrizes, jedoch wurde dadurch der Empfindlichkeitsunterschied nicht verringert. For DNA, there are now several responsive matrixes, but by the difference in sensitivity was not reduced. Der Empfindlichkeitsunterschied kann verringert werden, indem die DNA chemisch so modifiziert wird, dass sie einem Peptid ähnlicher wird. The difference in sensitivity can be reduced by modifying the DNA chemically in such a way that it is a peptide similar. Phosphorothioatnukleinsäuren, bei denen die gewöhnlichen Phosphate des Rückgrats durch Thiophosphate substituiert sind, lassen sich durch einfache Alkylierungschemie in eine ladungsneutrale DNA umwandeln (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr 25; 23(8):1367-73). Phosphorothioate nucleic acids in which the usual phosphates of the backbone are substituted by thiophosphates may be prepared by simple alkylation chemistry into a charge-neutral DNA convert (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 April 25 ; 23 (8): 1367-73). Die Kopplung eines "charge tags" an diese modifizierte DNA resultiert in der Steigerung der Empfindlichkeit um den gleichen Betrag, wie er für Peptide gefunden wird. The coupling of a "charge tag" to this modified DNA results in an increase in sensitivity by the same amount as is found for peptides. Ein weiterer Vorteil von "charge tagging" ist die erhöhte Stabilität der Analyse gegen Verunreinigungen, die den Nachweis unmodifizierter Substrate stark erschweren. Another advantage of "charge tagging" is the increased stability of the analysis against impurities which make the detection of unmodified substrates.
  • [0019] [0019]
    Genomische DNA wird durch Standardmethoden aus DNA von Zell-, Gewebe- oder sonstigen Versuchsproben gewonnen. Genomic DNA is obtained by standard methods from DNA of cells, tissue or other test samples. Diese Standardmethodik findet sich in Referenzen wie Fritsch und Maniatis Hrsg., Molecular Cloning: A Laboratory Manual, 1989. This standard methodology is found in references such as Fritsch and Maniatis eds, Molecular Cloning. A Laboratory Manual., 1989
  • Beschreibung Description
  • [0020] [0020]
    Es ist die Aufgabe der vorliegenden Erfindung, ein Amplifikat einer DNA von Genen zur Verfügung zu stellen, die mit Apoptose assoziiert sind, sowie ein Verfahren, welches sich zur Diagnose von genetischen und epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, eignet. It is the object of the present invention to provide an amplification of a DNA of genes are available which are associated with apoptosis, as well as a method for the diagnosis of genetic and epigenetic parameters of genes associated with apoptosis, is suitable. Der Erfindung liegt die Erkenntnis zugrunde, daß genetische und epigenetische Parameter und insbesondere die Cytosin-Methylierungsmuster von Genen, die mit Apoptose assoziiert sind, zur Diagnose von mit Apoptose assoziierten Erkrankungen besonders eignen. The invention is based, particularly that genetic and epigenetic parameters and, in particular, the cytosine methylation patterns of genes that are associated with apoptosis, for the diagnosis of diseases associated with apoptosis are the recognition.
  • [0021] [0021]
    Diese Aufgabe wird erfindungsgemäß durch ein Nukleinsäureamplifikat wie in Anspruch 14 beansprucht gelöst. This object is achieved according to the invention claimed by a Nukleinsäureamplifikat as in claim 14. In der Tabelle sind nach den aufgelisteten Gen-Bezeichnungen die jeweiligen Datenbanknummern (Zugangsnummern) angegeben, die die dazugehörigen Gensequenzen als einmalig definieren. In the table, the respective numbers database (accession numbers) are given by the listed gene designations that define the corresponding gene sequences as unique. GenBank am National Institute of Health wurde als die zu Grunde liegende Datenbank unter der Internet Adresse www.ncbi.nlm.nih.gov verwendet. GenBank at the National Institutes of Health was used as the underlying database used www.ncbi.nlm.nih.gov at the Internet address.
  • [0022] [0022]
    Die chemisch modifizierte Nukleinsäure konnte bisher nicht in Zusammenhang mit der Ermittlung von genetischen und epigenetische Parametern gebracht werden. The chemically modified nucleic acid has not yet been brought into connection with the determination of genetic and epigenetic parameters.
  • [0023] [0023]
    Die vorliegende Erfindung beschreibt weiter ein Oligonukleotid oder Oligomer zur Detektion des Cytosin-Methylierungszustandes in chemisch vorbehandelter DNA, enthaltend mindestens eine Basensequenz mit einer Länge von mindestens 13 Nukleotiden gelöst, die an eine chemisch vorbehandelte DNA von Genen, die mit Apoptose assoziiert sind gemäß einer der Seq. The present invention further describes an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing dissolved at least one base sequence having a length of at least 13 nucleotides which according to a chemically pretreated DNA of genes which are associated with apoptosis one of the Seq. ID No. ID No. 73 bis Seq. 73 to Seq. ID No. ID No. 74 und dazu komplementären Sequenzen hybridisiert. 74 and sequences complementary thereto. Die Oligomersonden wie beschrieben stellen wichtige und effektive Werkzeuge dar, welche die Ermittlung der genetischen und epigenetischen Parameter von Genen, die mit Apoptose assoziiert sind, zum ersten mal ermöglichen. The oligomer probes as described constitute important and effective tools which allow the identification of genetic and epigenetic parameters of genes associated with apoptosis, for the first time. Bevorzugterweise umfaßt die Basensequenz der Oligomere mindestens ein CpG Dinukleotid. Preferably, the base sequence of said oligomers comprises at least one CpG dinucleotide. Die Sonden können auch in Form einer PNA (Peptide Nucleic Acid) vorliegen, die besonders bevorzugte Paarungseigenschaften aufweist. The probes may also be in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties. Besonders bevorzugt sind Oligonukleotide wie beschrieben, bei denen das Cytosin des CpG Dinukleotids das 5.-9. Particularly preferred oligonucleotides are as described in which the cytosine of the CpG dinucleotide is the 5th to 9th Nukleotid vom 5'-Ende des 13 mers ist, im Falle von PNA-Oligomeren ist es bevorzugt, daß das Cytosin des CpG Dinukleotids das 4.-6. Nucleotide from the 5'-end of the 13-mer, in the case of PNA-oligomers, it is preferable that the cytosine of the CpG dinucleotide to be the 4th-6th Nukleotid vom 5'-Ende des 9 mers ist. Nucleotide from the 5 'end of the 9-mer is.
  • [0024] [0024]
    Die Oligomere wie beschreiben werden normalerweise in sogenannten Sets eingesetzt, die für jedes der CpG Dinukleotide eine der Sequenzen der Seq. The oligomers as described are typically used in so-called sets, for each of the CpG dinucleotides of one of the sequences of Seq. ID No. ID No. 73 bis Seq. 73 to Seq. ID No. ID No. 74 und dazu komplementären Sequenzen mindestens ein Oligomer umfassen. 74 and sequences complementary thereto comprise at least one oligomer. Bevorzugt ist ein Set, das für jedes der CpG Dinukleotide aus einer der Seq ID No. Preferably a kit for each of the CpG dinucleotides from one of SEQ ID No. 73 bis Seq ID No. 73 to SEQ ID No. 74 und dazu komplementären Sequenzen mindestens ein Oligomer umfaßt. 74 and sequences complementary thereto comprises at least one oligomer.
  • [0025] [0025]
    Darüber hinaus beschreibt die Erfindung ein Set von mindestens zwei Oligonukleotiden zur Verfügung, die als sogenannte "Primer-Oligonukleotide" zur Amplifikation von DNA-Sequenzen einer der Seq. In addition, the invention describes a set of at least two oligonucleotides are available that. As so-called "primer oligonucleotides" for amplifying DNA sequences of one of SEQ ID No. ID No. 73 bis Seq. 73 to Seq. ID No. ID No. 74 und dazu komplementärer Sequenzen davon eingesetzt werden können. 74 and to complementary sequences thereof can be used.
  • [0026] [0026]
    Im Falle der Sets von Oligonukleotiden wie beschrieben ist es bevorzugt, daß mindestens ein Oligonukleotid an eine Festphase gebunden ist. In the case of the sets of oligonucleotides as described it is preferred that at least one oligonucleotide is bound to a solid phase.
  • [0027] [0027]
    Die vorliegende Erfindung beschreibt weiterhin einen Satz von mindestens 10 n (Oligonukleotiden und/oder PNA-Oligomeren), die zur Detektion des Cytosin- Methylierungszustandes in chemisch vorbehandelter genomischer DNA (Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen) dienen. The present invention further describes a set of at least 10 n (oligonucleotides and / or PNA oligomers) used for the detection of cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No. 73 and Seq. ID No. 74 and complementary to sequences) are used. Mit diesen Sonden ist die Diagnose von genetischen und epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, möglich. With these probes, the diagnosis of genetic and epigenetic parameters of genes associated with apoptosis, possible. Das Set von Oligomeren kann auch zum Nachweis von Single Nucleotide Polymorphismen (SNPs) in der chemisch vorbehandelten DNA von Genen, die mit Apoptose assoziiert sind gemäß einer der Seq. The set of oligomers may also be for the detection of single nucleotide polymorphisms (SNPs) in chemically pretreated DNA of genes which are associated with apoptosis according to one of the Seq. ID No. ID No. 73 bis Seq. 73 to Seq. ID No. ID No. 74 und dazu komplementären Sequenzen verwendet werden. 74 and complementary sequences.
  • [0028] [0028]
    Erfindungsgemäß ist es bevorzugt, daß eine von der Erfindung zur Verfügung gestellte Anordnung aus unterschiedlichen Oligonukleotiden und/oder PNA-Oligomeren (ein sogenanntes "Array") ebenfalls an eine Festphase gebunden vorliegt. According to the invention, it is preferred that provided by the invention are available array of different oligonucleotides and / or PNA oligomers (called an "array") is also present bound to a solid phase. Dieses Array von unterschiedlichen Oligonukleotid- und/oder PNA-Oligomersequenzen kann dadurch gekennzeichnet sein, dass es auf der Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet ist. This array of different oligonucleotide and / or PNA oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. Bevorzugterweise besteht die Festphasenoberfläche aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold. Preferably, the solid phase surface of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold. Möglich sind jedoch auch Nitrocellulose sowie Kunststoffe wie zum Beispiel Nylon, die in Form von Kugeln oder auch als Harz-Matrizes vorliegen können. However, are also possible nitrocellulose as well as plastics such as nylon, which can exist in the form of pellets or also as resin matrices.
  • [0029] [0029]
    Daher wird weiter ein Verfahren zur Herstellung eines auf einem Trägermaterial fixierten Arrays zur Analyse in Zusammenhang mit Apoptose assoziierten Erkrankungen, bei dem mindestens ein Oligomer wie beschrieben an eine feste Phase gekoppelt wird. Therefore, a method for producing a fixed array on a support material for the analysis is continued in the context of apoptosis-related diseases, wherein the at least one oligomer as described is coupled to a solid phase. Verfahren zur Herstellung von solchen Arrays sind zum Beispiel aus der A method for manufacturing such arrays are known for example from US 5,744,305 US 5,744,305 mittels Festphasenchemie und photolabilen Schutzgruppen bekannt. by means of solid-phase chemistry and photolabile protecting groups.
  • [0030] [0030]
    Ein weiterer Gegenstand der Erfindung betrifft die Verwendung eines DNA-Chips zur Analyse von in Zusammenhang mit Apoptose stehenden Erkrankungen gemäß Anspruch 17. DNA-Chips sind zum Beispiel aus der Another object of the invention relates to the use of a DNA chip for analyzing diseases associated with apoptosis according to claim 17, DNA chips are known for example from US 5,837,832 US 5,837,832 bekannt. known.
  • [0031] [0031]
    Darüber hinaus wird auch ein Kit beschrieben, das zum Beispiel aus einer Bisulfit enthaltenden Reagenz, einem Satz von Primeroligonukleotiden umfassend mindestens zwei Oligonukleotide, deren Sequenzen jeweils mindestens einen 18 Basenpaaren langen Abschnitt der im Anhang aufgeführten Basensequenzen (Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen), Oligonukleotiden und/oder PNA-Oligomeren sowie einer Anleitung zur Durchführung und Auswertung des beschriebenen Verfahrens bestehen kann. In addition, a kit is also described, the reagent, for example containing a bisulfite, a set of primer comprising at least two oligonucleotides whose sequences are each at least 18 base pairs long section of the base sequences listed in the Annex (Seq. ID No. 73 and Seq. ID No. 74 and sequences complementary thereto), oligonucleotides and / or PNA oligomers as well as instructions for conducting and evaluating the described method. Ein Kit im Sinne wie beschrieben kann jedoch auch nur Teile der vorgenannten Bestandteile enthalten. A kit for the purposes as described can, however, contain any part of the above ingredients.
  • [0032] [0032]
    Die Erfindung stellt weiterhin ein Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern, die für die Diagnose von Erkrankungen brauchbar sind, die mit Apoptose assoziiert sind, durch Analyse von Cytosin-Methylierungen und Single Nucleotide Polymorphismen zur Verfügung, das folgende Schritte umfaßt: The invention further provides a method for ascertaining genetic and / or epigenetic parameters, which are useful for the diagnosis of diseases which are associated with apoptosis, by analysis of cytosine methylations and single nucleotide polymorphisms are available, comprising the steps of:
    In einem ersten Verfahrensschritt wird eine genomische DNA-Probe derart chemisch behandelt, daß an der 5'-Position unmethylierte Cytosinbasen in Uracil, Thymin oder eine andere vom Hybridisierungsverhalten her dem Cytosin unähnliche Base umgewandelt werden. In a first step, a genomic DNA sample is chemically treated in such a way that will be converted at the 5'-position unmethylated cytosine to uracil, thymine or another of hybridisation behavior unlike cytosine base. Dies wird im folgenden unter "chemischer Vorbehandlung" verstanden. This will be understood as the "chemical pre-treatment".
  • [0033] [0033]
    Die zu analysierende genomische DNA wird bevorzugt aus den üblichen Quellen für DNA erhalten, wie Zellen oder Zellbestandteilen, zum Beispiel Zellinien, Biopsien, Blut, Sputum, Stuhl, Urin, Gehirn-Rückenmarks-Flüssigkeit, in Paraffin eingebettetes Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologische Objektträger oder Kombinationen davon. The analyzed genomic DNA is obtained preferably from the usual sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebrospinal fluid, tissue embedded in paraffin, for example tissue from eyes, intestine, kidney, brain, heart, prostate, lungs, breast or liver, histologic object slides, or combinations thereof.
  • [0034] [0034]
    Bevorzugt wird dazu die oben beschriebene Behandlung genomischer DNA mit Bisulfit (Hydrogensulfit, Disulfit) und anschließender alkalischer Hydrolyse angewendet, die zu einer Umwandlung nicht methylierter Cytosin-Nukleobasen in Uracil oder eine andere vom Basenpaarungsverhalten her dem Cytosin unähnliche Base führt. Preferably, the treatment of genomic DNA with bisulfite (hydrogen sulfite, bisulfite) and subsequent alkaline hydrolysis as described above is to be applied, which leads to a conversion of unmethylated cytosine nucleobases to uracil or another from the base pairing behavior unlike cytosine base.
  • [0035] [0035]
    Aus dieser chemisch vorbehandelten genomischen DNA werden Fragmente unter Verwendung von Sätzen von Primer-Oligonukleotiden wie beschrieben und einer bevorzugterweise hitzestabilen Polymerase amplifiziert. Of this chemically pretreated genomic DNA fragments using sets of primer oligonucleotides as described and amplified a preferably heat-stable polymerase. Aus statistischen und praktikablen Erwägungen werden bevorzugterweise mehr als zehn unterschiedliche Fragmente amplifiziert, die 100-2000 Basenpaare lang sind. More than ten different fragments are amplified from statistical and practical considerations, preferably that are 100-2000 base pairs long. Die Amplifikation von mehreren DNA-Abschnitten kann simultan in ein und demselben Reaktionsgefäß durchgeführt werden. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Üblicherweise wird die Amplifikation mittels der Polymerasekettenreaktion (PCR) durchgeführt. Usually, the amplification by means of polymerase chain reaction (PCR) is performed.
  • [0036] [0036]
    Der Satz von Primer-Oligonukleotiden umfaßt bevorzugterweise mindestens zwei Oligonukleotide, deren Sequenzen jeweils revers komplementär oder identisch zu einem minde stens 18 Basenpaare langen Abschnitt der im Anhang (Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen und dazu komplementären Sequenzen) aufgelisteten Basensequenzen sind. The set of primer oligonucleotides preferably comprises at least two oligonucleotides whose sequences are each reverse complementary or identical to a minde least 18 base pairs long section of the appendix (Seq. ID No. 73 and Seq. ID No. 74 and sequences complementary thereto and to complementary sequences) listed base sequences. Die Primer-Oligonukleotide sind vorzugsweise dadurch gekennzeichnet, daß sie kein CpG Dinukleotid enthalten. The primer oligonucleotides are preferably characterized in that they contain no CpG dinucleotide.
  • [0037] [0037]
    Erfindungsgemäß bevorzugt ist es, daß bei der Amplifikation mindestens ein Primer-Oligonukleotid an eine Festphase gebunden ist. According to the invention it is preferred that in the amplification of at least one primer oligonucleotide is bound to a solid phase. Die unterschiedlichen Oligonukleotid und/oder PNA-Oligomersequenzen können auf einer ebenen Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet sein, wobei die Festphasenoberfläche bevorzugt aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold besteht, wobei auch andere Materialien, wie Nitrocellulose oder Kunststoffe verwendet werden können. The different oligonucleotide and / or PNA-oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface is preferably composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold, although other materials such as nitrocellulose or plastics can be used.
  • [0038] [0038]
    Die mittels der Amplifikation erhaltenen Fragmente können eine direkt oder indirekt nachweisbare Markierung tragen. The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Bevorzugt sind Markierungen in Form von Fluoreszenzmarkierungen, Radionukliden oder ablösbaren Molekülfragmenten mit typischer Masse, die in einem Massenspektrometer nachgewiesen werden können, wobei bevorzugt ist, daß die erzeugten Fragmente zur besseren Detektierbarkeit im Massenspektrometer eine einzelne positive oder negative Nettoladung aufweisen. Preferred are labels in the form of fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer, it being preferred that the fragments generated for better detectability in the mass spectrometer have a single positive or negative net charge. Der Nachweis kann mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchgeführt und visualisiert werden. The detection can be carried out and visualized by means of matrix assisted laser desorption / ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • [0039] [0039]
    Die im zweiten Verfahrensschritt erhaltenen Amplifikate werden anschließend an einen Satz von Oligonukleotiden und/oder PNA- Sonden der oder an ein Array hybridisiert. The amplified products obtained in the second step are then hybridized to a set of oligonucleotides and / or PNA probes or to an array. Die Hybridisierung erfolgt dabei auf die unten angegebene Art und Weise. Hybridization is carried out on the manner indicated below. Der bei der Hybridisierung verwendete Satz besteht bevorzugterweise aus mindestens 10 Oligonukleotid oder PNA-Oligomer Sonden. The rate used in the hybridization is preferably at least 10 oligonucleotide or PNA oligomer probes. Die Amplifikate dienen dabei als Sonden, die an vorher an einer Festphase gebundene Oligonukleotide hybridisieren. The amplified products serve as probes that hybridize to previously bound to a solid phase oligonucleotides. Die nicht hybridisierten Fragmente werden anschließend entfernt. The unhybridized fragments are then removed. Die besagten Oligonukleotide umfassen mindestens eine Basensequenz mit einer Länge von 13 Nukleotiden, die revers komplementär oder identisch zu einem Abschnitt der im Anhang aufgeführten Basensequenzen ist, der mindestens ein CpG Dinukleotid enthält. Said oligonucleotides contain at least one base sequence having a length of 13 nucleotides which is reverse complementary or identical to a segment of the base sequences listed in the Annex, which contains at least one CpG dinucleotide. Das Cytosin des CpG Dinukleotids ist das 5. bis 9. Nukleotid vom 5'-Ende des 13 mers aus betrachtet. The cytosine of CpG dinucleotide is the 5th to 9th nucleotide from the 5 'end of the 13-mer. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden. For each CpG dinucleotide an oligonucleotide is present. Die besagten PNA-Oligomere umfassen mindestens eine Basensequenz mit einer Länge von 9 Nukleo tiden, die revers komplementär oder identisch zu einem Abschnitt der im Anhang aufgeführten Basensequenzen ist, der mindestens ein CpG Dinukleotid enthält. Said PNA oligomers comprise at least one base sequence having a length of 9 nucleo tides, which is reverse complementary or identical to a segment of the base sequences listed in the Appendix, which contains at least one CpG dinucleotide. Das Cytosin des CpG Dinukleotids ist das 4. bis 6. Nukleotid vom 5'-Ende des 9 mers aus gesehen. The cytosine of CpG dinucleotide is the 4th to 6th nucleotide viewed from the 5'-end of the 9-mer. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden. For each CpG dinucleotide an oligonucleotide is present.
  • [0040] [0040]
    Im vierten Verfahrensschritt entfernt man die nicht hybridisierten Amplifikate. In the fourth step of removing the non-hybridized amplicons.
  • [0041] [0041]
    Im letzten Verfahrensschritt detektiert man die hybridisierten Amplifikate. In the last step of the method to detect the hybridized amplicons. Dabei ist bevorzugt, daß an den Amplifikaten angebrachte Markierungen an jeder Position der Festphase, an der sich eine Oligonukleotidsequenz befindet, identifizierbar sind. It is preferred that attached to the amplified markers are at each position of the solid phase at which an oligonucleotide sequence is identifiable.
  • [0042] [0042]
    Erfindungsgemäß bevorzugt ist es, daß die Markierungen der Amplifikate Fluoreszenzmarkierungen, Radionuklide oder ablösbare Molekülfragmente mit typischer Masse sind, die in einem Massenspektrometer nachgewiesen werden können. According to the invention there that the labels of the amplified products are fluorescent labels, radionuclides, or removable molecular fragments with typical mass which can be detected in a mass spectrometer. Der Nachweis der Amplifikate, Fragmente der Amplifikate oder zu den Amplifikaten komplementäre Sonden im Massenspektrometer ist bevorzugt, wobei man die Detektion mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchführen und visualisieren kann. The Detection of PCR, the amplified fragments or complementary to the amplified probe mass spectrometer is preferred, it being possible to perform the detection by matrix-assisted laser desorption / ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI) and visualize.
  • [0043] [0043]
    Zur besseren Detektierbarkeit im Massenspektrometer können die erzeugten Fragmente eine einzelne positive oder negative Nettoladung aufweisen. For better detectability in the mass spectrometer produced fragments may have a single positive or negative net charge. Bevorzugt wird das vorgenannte Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, verwendet. Preferably, the aforementioned method is used for ascertaining genetic and / or epigenetic parameters of genes associated with apoptosis.
  • [0044] [0044]
    Die Oligomere wie beschrieben oder Arrays derselben sowie ein Kit wie beschrieben sollen zur Diagnose einer mit Apoptose assoziierten Krankheit durch Analyse von Methylierungsmustern von Genen, die mit Apoptose assoziiert sind, verwendet werden. The oligomers or arrays thereof as described, as well as a kit as described are intended to be used for the diagnosis of an apoptosis-associated disease by analysis of methylation patterns of genes that are associated with apoptosis. Erfindungsgemäß bevorzugt ist die Verwendung des Verfahrens zur Diagnose bedeutender genetischer und/oder epigenetischer Parameter innerhalb von Genen, die mit Apoptose assoziiert sind. According to the invention is the use of the method for the diagnosis of important genetic and / or epigenetic parameters within genes associated with apoptosis.
  • [0045] [0045]
    Das erfindungsgemäße Verfahren wird zum Beispiel der Diagnose von soliden Tumoren und Krebsarten verwendet. The inventive method is used, for example, the diagnosis of solid tumors and cancers.
  • [0046] [0046]
    Die Nukleinsäuren der Seq. The nucleic acids of Seq. ID No. ID No. 73 bis Seq. 73 to Seq. ID No. ID No. 74 und dazu komplementäre Sequenzen können für die Diagnose von genetischen und/oder epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, verwendet werden. 74 and sequences complementary thereto may be used for the diagnosis of genetic and / or epigenetic parameters of genes associated with apoptosis.
  • [0047] [0047]
    Auch beschrieben wird ein Verfahren zur Herstellung eines Diagnostikums und/oder Therapeutikums zur Diagnose von Krankheiten, die mit Apoptose assoziiert sind durch Analyse von Methylierungsmustern von Genen, die mit Apoptose assoziiert sind, wobei das Diagnostikum und/oder das Therapeutikum dadurch gekennzeichnet ist, daß mindestens eine Nukleinsäure wie beschrieben, gegebenenfalls zusammen mit geeigneten Zusatz- und Hilfsstoffen zu dessen Herstellung verwendet wird. Also described is a process for the preparation of a diagnostic and / or therapeutic agent for diagnosing diseases associated with apoptosis by analysis of methylation patterns of genes that are associated with apoptosis, wherein the diagnostic agent and / or the therapeutic agent being characterized in that at least a nucleic acid as described, optionally together with suitable additives and auxiliary agents for the production thereof.
  • [0048] [0048]
    Die vorliegende Beschreibung betrifft weiter ein Diagnostikum und/oder Therapeutikum für Krankheiten, die mit Apoptose assoziiert sind, durch Analyse von Methylierungsmustern von Genen, die mit Apoptose assoziiert sind, wobei das Diagnostikum und/oder Therapeutikum dadurch gekennzeichnet ist, daß es mindestens eine Nukleinsäure wie beschrieben, gegebenenfalls zusammen mit geeigneten Zusatz- und Hilfsstoffen enthält. The present description further relates to a diagnostic and / or therapeutic agent for diseases associated with apoptosis, by analysis of methylation patterns of genes that are associated with apoptosis, wherein the diagnostic and / or therapeutic agent is characterized in that it as least one nucleic acid described, optionally together with suitable additives and adjuvants.
  • [0049] [0049]
    Die vorliegende Erfindung betrifft weiterhin die Diagnose nachteiliger Ereignisse für Patienten oder Individuen, bei dem die mittels der Erfindung erhaltenen bedeutenden genetischen und/oder epigenetischen Parameter innerhalb von Genen, die mit Apoptose assoziiert sind mit einem anderen Satz genetischen und/oder epigenetischen Parameter verglichen werden können und die so erhaltenen Unterschiede als Basis für eine Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen dienen. The present invention further relates to the diagnosis of adverse events for patients or individuals, wherein the obtained by the invention, important genetic and / or epigenetic parameters within genes associated with apoptosis can be compared to another set of genetic and / or epigenetic parameters serve and the differences serving as the basis for a diagnosis and / or prognosis of adverse events for patients or individuals.
  • [0050] [0050]
    Unter dem Begriff „Hybridisierung" im Sinne der vorliegenden Erfindung ist eine Bindung unter Ausbildung einer Duplex-Struktur eines Oligonukleotids an eine vollständig komplementäre Sequenz im Sinne der Watson-Crick Basenpaarungen in der Proben DNA zu verstehen. Unter „stringenten Hybridisierungsbedingungen" sind solche Bedingungen zu verstehen, bei denen eine Hybridisierung bei 60°C in 2,5 × SSC-Puffer, gefolgt von mehreren Waschschritten bei 37°C in einer geringeren Pufferkonzentration erfolgt und stabil bleibt. The term "hybridization" in the context of the present invention is a bond to form a duplex structure of an oligonucleotide to a completely complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA. "Stringent hybridization conditions" are those conditions understand where hybridization at 60 ° C in 2.5 × SSC buffer followed by several washing steps at 37 ° C in a lower buffer concentration, and remains stable.
  • [0051] [0051]
    Mit dem Begriff "funktionelle Varianten" sind alle DNA-Sequenzen bezeichnet, die komplementär zu einer DNA-Sequenz sind, die unter stringenten Bedingungen mit der Referenzse quenz hybridisieren und eine zu dem entsprechenden erfindungsgemäßen Polypeptid ähnliche Aktivität aufweisen. By the term "functional variants" designates all DNA-sequences that are complementary to a DNA sequence hybridizing under stringent conditions with the sequence Referenzse and have a similar activity to the corresponding polypeptide of the invention the.
  • [0052] [0052]
    "Genetische Parameter" im Sinne dieser Erfindung sind Mutationen und Polymorphismen von Genen, die mit Apoptose assoziiert sind und zu deren Regulation weiterhin erforderlicher Sequenzen. "Genetic parameters" for the purposes of this invention are mutations and polymorphisms of genes associated with apoptosis and their regulation sequences further required. Insbesondere sind als Mutationen Insertionen, Deletionen, Punktmutationen, Inversionen und Polymorphismen und besonders bevorzugt SNPs (Single Nucleotide Polymorphisms) zu bezeichnen. In particular, as mutations, insertions, deletions, point mutations, inversions and polymorphisms and more preferably SNPs (single nucleotide polymorphisms) are to be designated.
  • [0053] [0053]
    „Epigenetische Parameter" im Sinne dieser Erfindung sind insbesondere Cytosin-Methylierungen und weitere chemische Modifikationen von DNA-Basen von Genen, die mit Apoptose assoziiert sind und zu deren Regulation weiterhin erforderliche Sequenzen. Weitere epigenetische Parameter sind beispielsweise die Acetylierung von Histonen, die jedoch mit dem beschriebenen Verfahren nicht direkt analysiert werden kann, sondern wiederum mit der DNA-Methylierung korreliert. "Epigenetic parameters" for the purposes of this invention are particularly cytosine methylations and further chemical modifications of DNA bases of genes associated with apoptosis and their regulation sequences further required. Further epigenetic parameters include the acetylation of histones, but with the method described can not be analyzed directly, but in turn correlates with the DNA methylation.
  • [0054] [0054]
    Die Erfindung soll nun im folgenden auf Basis der Sequenzen und Beispiele unter bezug auf die beigefügte Figur weiter verdeutlicht werden, ohne daß die Erfindung hierauf eingeschränkt wird. The invention will now be further clarified hereinafter on the basis of the sequences and examples, with reference to the annexed figure, without the invention being restricted thereto.
  • 1 1
  • [0055] [0055]
    1 1 zeigte die Hybridisierung von Fluoreszenz-markierten Amplifikaten an ein Oberflächen-gebundenes Oligonukleotid. showed hybridization of fluorescently labeled amplicons to a surface-bound oligonucleotide. Probe I stammt von gesundem Gewebe und Probe II stammt von pilocytischem Astrocytoma(Tumor)-Gewebe. Sample I is derived from healthy tissue and sample II is from pilocytischem Astrocytoma (tumor) tissue. Die Fluoreszenz an einem Punkt zeigt die Hybridisierung des Amplifikats an. The fluorescence at a point indicates the hybridization of the amplified product. Die Hybridisierung an ein CG Oligonukleotid zeigt an, daß die Methylierung an der Cytosin-Position analysiert wird, die Hybridisierung an ein TG Oligonukleotid zeigt an, daß keine Methylierung an der Cytosin-Position analysiert wird. Hybridization to one CG oligonucleotide indicates that methylation is analyzed at the cytosine position, the hybridization to a TG oligonucleotide indicates that no methylation is analyzed at the cytosine position.
  • Sequenz ID Nos. Sequence ID Nos. 1 bis 74 1-74
  • [0056] [0056]
    Sequenzen, die ungerade Sequenznummern haben (zB, Seq. ID No. 1, 3, 5, ...) zeigen in jedem Fall Sequenzen der chemisch vorbehandelten genomischen DNAs von verschiedenen Genen, die mit Apoptose assoziiert sind. Sequences that have odd sequence numbers (for example, Seq. ID No. 1, 3, 5, ...) in each case show sequences of the chemically pretreated genomic DNAs of various genes associated with apoptosis. Sequenzen, die gerade Sequenznummern aufweisen (zB, Seq. ID No. 2, 4, 6, ...) zeigen in jedem Fall Sequenzen der chemisch vorbehandelten genomischen DNAs von verschiedenen Genen, die mit Apoptose assoziiert sind, die komplementär zu den voranstehenden Sequenzen sind (zB, die komplementäre Sequenz zu Seq. ID No. 1 ist Seq. ID No. 2, die komplementäre Sequenz zu Seq. ID No. 3 ist Seq. ID No. 4, usw.) Sequences which have straight sequence numbers (for example, Seq. ID No. 2, 4, 6, ...) in each case show sequences of the chemically pretreated genomic DNAs of various genes associated with apoptosis which are complementary to the foregoing sequences (for example, the sequence complementary to Seq. ID No. 1 Seq. ID No. 2, the sequence complementary to Seq. ID No. 3 is Seq. ID No. 4, etc.)
  • Seq ID No. Seq ID No. 75 bis Seq. 75 to Seq. ID No. ID No. 78 78
  • [0057] [0057]
    Seq. Seq. ID No. ID No. 75 bis Seq. 75 to Seq. ID No. ID No. 78 zeigen die Sequenzen von Oligonukleotiden, die in Beispiel 1 verwendet werden. 78 show the sequences of oligonucleotides used in Example 1.
  • [0058] [0058]
    Das folgende Beispiel betrifft ein Fragment eines Gens, das mit Apoptose assoziiert ist, in diesem Fall "Death-associated Protein 1" (DAPK1), worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird. The following example relates to a fragment of a gene which is associated with apoptosis, in this case, "Death-associated protein 1" (DAPK1), wherein a specific CG position is analyzed for their methylation status.
  • [0059] [0059]
    Beispiel 1: Methylierungsanalyse in dem mit Apoptose assoziierten Gen DAPK1Das folgende Beispiel betrifft ein Fragment des Gens DAPKI, worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird. Example 1: Methylation analysis in the associated with apoptosis gene DAPK1Das following example relates to a fragment of the gene DAPKI in which a specific CG position is analyzed for its methylation status.
  • [0060] [0060]
    Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, daß alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, daß eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben. In the first step, a genomic sequence using bisulfite (hydrogen sulfite, bisulfite) is treated in such a way that all the non-methylated at the 5-position of the base cytosines are changed so that a difference in regard to the base pairing behavior base formed, while the 5-position methylated cytosines remain unchanged.
  • [0061] [0061]
    Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Is used for the reaction of bisulfite, as an addition occurs at the unmethylated cytosine bases. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Also, a denaturing reagent or solvent as well as a radical trap must be present. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. A subsequent alkaline hydrolysis then leads to the conversion of unmethylated cytosine nucleobases to uracil. Chemisch umgewandelte DNA (Sequence ID Nos. 73 und 74) dient dann dazu, methylierte Cytosine nachzuweisen. Chemically converted DNA (Sequence ID Nos. 73 and 74) is then used to detect methylated cytosines. Im zweiten Verfahrensschritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wässrigen Lösung. In the second process step, the treated DNA sample is diluted with water or an aqueous solution. Bevorzugt wird anschließend eine Desulfonierung der DNA (10-30 min, 90-100°C) bei alkalischem pH-Wert durchgeführt. Preferably followed by a desulfonation of the DNA (10-30 min, 90-100 ° C) is carried out at alkaline pH. Im dritten Schritt des Verfahrens amplifiziert man die DNA-Probe in einer Polymerasekettenreaktion, bevorzugt mit einer hitzebeständigen DNA-Polymerase. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably with a heat-resistant DNA polymerase. Im vorliegenden Fall werden Cytosine des Gens DAPKI analysiert. In the present case, cytosines of the gene DAPKI be analyzed. Dazu wird mit den spezifischen Primeroligonukleotiden ATTAATATTATGTAAAGTGA (Seq. ID No. 75) und CTTACAACCATTCACCCACA (Seq. ID No. 76) ein definiertes Fragment der Länge 465 bp amplifiziert. For this purpose, with the specific primer ATTAATATTATGTAAAGTGA (Seq. ID No. 75) and CTTACAACCATTCACCCACA (Seq. ID No. 76), a defined fragment of length 465 bp amplified. Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einer Duplexstruktur hybridisiert, beispielsweise GTTATATCGTGGAGGATA (Seq. ID No. 76), wobei sich das nachzuweisende Cytosin an Position 135 des Amplifikats befindet. This amplified product serves as a probe that hybridizes to a previously bound to a solid phase oligonucleotide formed a duplex structure, for example GTTATATCGTGGAGGATA (Seq. ID No. 76), the cytosine is present at position 135 of the amplified product. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primer-Oligonukleotiden, die für die Amplifikation verwendet wurden. The detection of the hybridization product is based on Cy3 and Cy5 fluorescently labeled primers oligonucleotides that were used for the amplification. Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Only if in the bisulfite-treated DNA at this point a methylated cytosine was present, there is a hybridization reaction of the amplified DNA with the oligonucleotide. Somit kann der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt abgeleitet werden. Thus, the methylation status of the specific cytosine to be investigated can be derived from the hybridization product.
  • [0062] [0062]
    Um den Methylierungsstatus der Position zu überprüfen, wird eine Probe des Amplifikats weiterhin an ein anderes Oligonukleotid hybridisiert, das vorher an eine feste Phase gebunden wurde. To confirm the methylation status of the item, a sample of the amplified product is further hybridizes to another oligonucleotide, which has previously bound to a solid phase. Dieses Oligonukleotid ist identisch zu dem Oligonukleotid, das vorher benutzt wurde, um den Methylierungsstatus der Probe zu analysieren, mit der Ausnahme der fraglichen Position. This oligonucleotide is identical to the oligonucleotide that was previously used to analyze the methylation status of the sample, except for the position in question. An der zu analysierenden Position umfaßt das Oligonukleotid eine Thymin-Base, im Gegensatz zu einer Cytosin-Base dh die Sequenz GTTATATTGTGGAGGATA (Seq. ID No. 78). On the analyzed position, the oligonucleotide comprises a thymine base, as opposed to a cytosine base that is to say the sequence GTTATATTGTGGAGGATA (Seq. ID No. 78). Daher findet die Hybridisierungsreaktion nur statt, falls ein nicht-methyliertes Cytosin an der zu analysierenden Positionen vorhanden ist. Therefore, the hybridization reaction takes place only if a non-methylated cytosine at the positions to be analyzed is present. Das Verfahren wurde an zwei Zellproben aus 2 Patienten durchgeführt, wobei Probe 1 aus normalem gesunden Gewebe und Probe 2 aus einer pilocytischem Astrocytoma Tumorprobe stammte. The process was carried out at two cell samples from 2 patients, with Sample 1 came from normal healthy tissue and sample 2 from a pilocytischem astrocytoma tumor sample.
  • [0063] [0063]
    Aus den Ergebnissen (siehe From the results (see 1 1 ) kann gesehen werden, daß Probe I ein Gemisch von sowohl methylierten und nicht-methylierten Zellen an der Position des Amplifikats enthielt, wohingegen Probe 2 nur methylierte Zellen an Position 135 des Amplifikats enthielt. ) It can be seen that Sample I contained a mixture of both methylated and unmethylated cells at the position of the amplified product, whereas Sample 2 contained only cells methylated at position 135 of the amplificate.
  • Beispiel 2: Diagnose von mit Apoptose assoziierten Erkrankungen Example 2: Diagnosis of diseases associated with apoptosis
  • [0064] [0064]
    Um einen Bezug der Methylierungsmuster zu einer der mit Apoptose assoziierten Erkrankungen herzustellen, bedarf es zunächst der Untersuchung der DNA-Methylierungsmuster einer Gruppe von erkrankten und einer Gruppe von gesunden Personen. In order to relate the methylation patterns to those associated with apoptosis diseases, it is first necessary to analyze the DNA methylation pattern of a group of affected and a group of healthy people. Diese Untersuchungen werden zum Beispiel analog dem Beispiel 1 durchgeführt. These tests are performed, for example analogously to Example 1. Die so erhaltenen Ergebnisse werden in einer Datenbank abgespeichert und die CpG Dinukleotide identifiziert, die zwischen den beiden Gruppen unterschiedlich methyliert sind. The results thus obtained are stored in a database and the identified CpG dinucleotides, which are methylated different between the two groups. Dies kann durch Bestimmung einzelner CpG Methylierungsraten erfolgen, wie dies z. B. durch Sequenzieren relativ ungenau oder aber durch eine Methylierungs-sensitive "Primer-Extension-Reaktion" sehr genau möglich ist. This can be done by determining individual CpG methylation rates, as z. B. or by sequencing is very well possible relatively inaccurate by a methylation-sensitive "primer extension reaction".
  • [0065] [0065]
    Auch gleichzeitige Analyse des gesamten Methylierungsstatus ist möglich, und die Muster können zB mittels Clustering-Analysen, die zB durch einen Rechner durchgeführt werden können, verglichen werden. Also, simultaneous analysis of the total methylation status is possible, and the pattern can, for example, by clustering analysis that can be performed, for example by a computer, are compared.
  • [0066] [0066]
    Nachfolgend ist es möglich, untersuchte Patienten einer bestimmten Therapiegruppe zuzuordnen und diese Patienten gezielt mit einer individualisierten Therapie zu behandeln. Subsequently, it is possible examined patients assigned to a specific therapy group and to treat these patients specifically with an individualized therapy.
  • [0067] [0067]
    Beispiel 2 kann zum Beispiel für die folgenden Erkrankungen durchgeführt werden: HIV-Infektion, Bloom Syndrom, Cardiopathie, Alterung, neurodegenerativer Erkrankungen, Herpes simplex Virusinfektion, renaler Ischämie, Amyotropher Lateralsklerose, soliden Tumoren und Krebsarten. Example 2 can be carried out, for example, for the following diseases: HIV infection, Bloom syndrome, Cardiopathie, aging, neurodegenerative diseases, herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers. Sequenzprotokoll Sequence Listing
Classifications
International ClassificationA61P9/10, G01N27/62, A61P11/06, A61P7/04, G01N33/566, A61P35/00, A61K31/711, C12Q1/68, G01N33/53, C07K14/82, C12Q1/48, C07K14/46, A61P29/00, C12N15/09, G01N37/00, B01J19/00, C12M1/00, G01N33/483, A61P13/12, C07K14/47, A61K48/00
Cooperative ClassificationC12Q2600/154, C12Q2600/156, C07K14/4703, C07K14/82, C12Q1/6883, C12Q1/6886
European ClassificationC07K14/47A1A, C12Q1/68M6B, C07K14/82, C12Q1/68M6