CN104853802A - Methods and devices for detection and acquisition of biomarkers - Google Patents

Methods and devices for detection and acquisition of biomarkers Download PDF

Info

Publication number
CN104853802A
CN104853802A CN201380065515.3A CN201380065515A CN104853802A CN 104853802 A CN104853802 A CN 104853802A CN 201380065515 A CN201380065515 A CN 201380065515A CN 104853802 A CN104853802 A CN 104853802A
Authority
CN
China
Prior art keywords
probe
micropin
biomarker
different
different probes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201380065515.3A
Other languages
Chinese (zh)
Other versions
CN104853802B (en
Inventor
塔希尔·A·玛穆德
图斌·J·迪克森
内蒂尔·A·玛穆德
佩特·卡佩克
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pleasant Virtue Draws Co
Scripps Research Institute
Mindera Health
Original Assignee
Pleasant Virtue Draws Co
Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pleasant Virtue Draws Co, Scripps Research Institute filed Critical Pleasant Virtue Draws Co
Priority to CN202111395029.0A priority Critical patent/CN114176586A/en
Publication of CN104853802A publication Critical patent/CN104853802A/en
Application granted granted Critical
Publication of CN104853802B publication Critical patent/CN104853802B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6841—In situ hybridisation
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54366—Apparatus specially adapted for solid-phase testing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B10/00—Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis; Sex determination; Ovulation-period determination; Throat striking implements
    • A61B10/0045—Devices for taking samples of body liquids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B10/00—Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis; Sex determination; Ovulation-period determination; Throat striking implements
    • A61B10/02—Instruments for taking cell samples or for biopsy
    • A61B10/0233—Pointed or sharp biopsy instruments
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/145—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue
    • A61B5/14503—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue invasive, e.g. introduced into the body by a catheter or needle or using implanted sensors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/145—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue
    • A61B5/14507—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue specially adapted for measuring characteristics of body fluids other than blood
    • A61B5/1451—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue specially adapted for measuring characteristics of body fluids other than blood for interstitial fluid
    • A61B5/14514—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue specially adapted for measuring characteristics of body fluids other than blood for interstitial fluid using means for aiding extraction of interstitial fluid, e.g. microneedles or suction
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/145—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue
    • A61B5/1468—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue using chemical or electrochemical methods, e.g. by polarographic means
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/15—Devices for taking samples of blood
    • A61B5/150007—Details
    • A61B5/150015—Source of blood
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/15—Devices for taking samples of blood
    • A61B5/150007—Details
    • A61B5/150015—Source of blood
    • A61B5/150022—Source of blood for capillary blood or interstitial fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/15—Devices for taking samples of blood
    • A61B5/150977—Arrays of piercing elements for simultaneous piercing
    • A61B5/150984—Microneedles or microblades
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A61K9/0021—Intradermal administration, e.g. through microneedle arrays, needleless injectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N1/00—Sampling; Preparing specimens for investigation
    • G01N1/02—Devices for withdrawing samples
    • G01N1/04—Devices for withdrawing samples in the solid state, e.g. by cutting
    • G01N1/08—Devices for withdrawing samples in the solid state, e.g. by cutting involving an extracting tool, e.g. core bit
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/551—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being inorganic
    • G01N33/553—Metal or metal coated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B10/00—Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis; Sex determination; Ovulation-period determination; Throat striking implements
    • A61B10/0045—Devices for taking samples of body liquids
    • A61B2010/008—Interstitial fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B2562/00—Details of sensors; Constructional details of sensor housings or probes; Accessories for sensors
    • A61B2562/04—Arrangements of multiple sensors of the same type
    • A61B2562/046—Arrangements of multiple sensors of the same type in a matrix array
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/68—Arrangements of detecting, measuring or recording means, e.g. sensors, in relation to patient
    • A61B5/6846—Arrangements of detecting, measuring or recording means, e.g. sensors, in relation to patient specially adapted to be brought in contact with an internal body part, i.e. invasive
    • A61B5/6847—Arrangements of detecting, measuring or recording means, e.g. sensors, in relation to patient specially adapted to be brought in contact with an internal body part, i.e. invasive mounted on an invasive device
    • A61B5/685—Microneedles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2543/00—Reactions characterised by the reaction site, e.g. cell or chromosome
    • C12Q2543/10—Reactions characterised by the reaction site, e.g. cell or chromosome the purpose being "in situ" analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/16—Ophthalmology
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/20—Dermatological disorders

Abstract

The present invention provides devices and methods for detecting and capturing molecular biomarkers from a subject in situ. Specifically, the devices contain an array of microneedles to which are attached probes specific for one or more biomarkers of interest. The devices can be used directly on a subject (e.g., via skin piercing) in detecting the biomarkers in the body of the subject (e.g., tissues, blood stream).

Description

For detecting and obtain the method and apparatus of biomarker
the cross reference of related application
This application claims the rights and interests of the U.S. Provisional Patent Application series number 61/737,237 of December in 2012 submission on the 14th, it is incorporated to herein by reference of text.
Background technology
The analysis of biomarker becomes the method for optimizing of the earlier detection of disease, triage and monitor therapy effect just rapidly.To the quick of biomarker change and super-sensitive detection is impossible usually technically, or the complicated procedures relating to multiple treatment step may be needed, need the diagnosis/prognosis timeline of large sample volume and prolongation.Sample from patient usually has limited volume and is not suitable for needing program or the process of the multiple steps extending the processing time.
Currently to depend on for the method for diagnostic application and extract body fluid (such as, blood, stroma liquid) for detecting interested Molecular biomarkers or biological analyte from patient.Specific biomarkers is measured just from this humoral sample.Nearest invention is not directly sampled to clinical relevant biomarker from application site, and on the contrary, needs the further process to body fluid.Not normally troublesome based on other diagnostic method such as biopsy of molecular assay, and due to its intrinsic vision and subjective quality with mistaken diagnosis risk.But, for local, for acyclic biomarker, this has become the selection of only diagnosis so far usually.
For suffering from various diseases or disease or being in the experimenter in the risk of development various diseases or disease, there is the demand of the better means to the biomarker existed in its body of determination and analysis in the art.Present invention accomplishes this and other demand.
Summary of the invention
In one aspect, the invention provides for from the tissue of experimenter or biological sample in situ detection or the device extracting one or more biomarkers.This device can comprise microneedle array and multiplely have specific probe to this biomarker, and wherein this probe is covalently attached to micropin.In devices described in some, this probe is specific to different biomarker, and each different probe is attached to different micropins.In some other devices, the same probe for specific biomarkers is attached to two or more micropins.Micropin in described device can be made up of polymer, metal, pottery or other suitable material any.
In some cases, present disclose provides for from the original position tissue of experimenter or biology sample detection or the device extracting one or more biomarkers, it comprises one or more micropin, have specific probe with one or more to this biomarker, wherein this probe is attached to micropin via covalently or non-covalently connecting.
Described device can comprise the first micropin.This first micropin can covalently be attached to the first probe, and the first probe is specific to the first biomarker.Or the first micropin can noncovalently be attached to the first probe.In addition, the first probe can be attached to multiple micropin.In some cases, the invention provides the device comprising the first micropin, wherein the first micropin covalently or non-covalently is attached to and has specific first probe to the first biomarker.In some cases, the first biomarker can be polynucleotide.First probe can be the polynucleotide with the first biomarker complementation.In other cases, the first biomarker can be polypeptide, antibody, metabolite or micromolecule.In addition, the first probe can be polynucleotide, polypeptide, protein, antibody, micromolecule or biological acceptor.In some cases, the first pin is formed in substrate.
Described device can also comprise the second probe, and the second probe is specific to the second biomarker.Second probe can be different from the first probe.Second probe can covalently or non-covalently be attached to the first micropin.Or the second probe can covalently or non-covalently be attached to the second micropin.Second biomarker can be polynucleotide.Second probe can be the polynucleotide with the second biomarker complementation.Second biomarker can also be polypeptide, antibody, metabolite or micromolecule.In addition, the second probe can be polynucleotide, polypeptide, protein, antibody, micromolecule, biological acceptor.In some cases, the first probe is combined specifically with the first nucleotide polymorphisms (polymorphism) and the second probe is combined specifically with the second nucleotide polymorphisms.In some cases, the first and second probes have specific different antibodies to the different epi-positions of identical biomarker separately.
In some cases, described device providing package is containing the micropin of polymer, metal or pottery.First probe can covalently or non-covalently be attached to multiple micropin.Second probe and other probe multiple can covalently or non-covalently be attached to multiple micropin.
Devices more of the present invention relate to detection biological nucleic acid mark.In these devices, the probe that can be conjugated to micropin is and the oligonucleotide of biomarker complementation or polynucleotide.The micropin that some device use thermoplastic polymers are made.Polynucleotide probes in device can be conjugated to micropin by including but not limited to the many suitable connection of sulfydryl/amino bifunctional linker or PEG connector.In some cases, device of the present invention comprises further for increasing and differentiating the compartment of the first and second biomarkers.
Other device more of the present invention is designed for detection of peptides or protein biomarkers especially.In the device that some are such, the probe be fixed on micropin has specific antibody to biomarker.In multiple embodiments of the present invention, planar substrates is used to support microneedle array.Device of the present invention can also comprise for increasing by the instrument of the biomarker of probe in detecting.
This device can comprise multiple micropin.The plurality of micropin can comprise at least one micropin covalently or non-covalently being attached to and biomarker being had at least one probe specific.This biomarker can indicate particular condition, includes but not limited to skin or eye condition.In some cases, this biomarker can indicate skin.In some instances, this skin is skin carcinoma.In other cases, this biomarker can indicate eye condition.In some instances, this eye condition is cancer eye or ocular inflamation.
In some cases, present disclose provides the device comprising multiple micropin, wherein said multiple micropin comprises at least one micropin covalently or non-covalently being attached to and biomarker being had at least one probe specific, and this biomarker instruction skin or eye condition.In some cases, this biomarker is polynucleotide, and this at least one probe and biomarker complementation.In some cases, this at least one probe comprises and has specific different polynucleotide probes to the different IPs nucleotide polymorphism of identical biomarker.In some cases, this biomarker is peptide or polypeptide, and at least one probe described has specific antibody to this biomarker.In some cases, at least one probe described comprises and has specific different antibodies to the different epi-positions of identical biomarker.
Device of the present invention can comprise and has specific multiple probe to multiple different biomarker, and wherein the plurality of probe is attached to identical or different micropin.In some cases, at least two different probes are attached to identical micropin.In some cases, this device comprises at least two same probe for specific biomarkers, and wherein said at least two same probe are attached to one or more micropin.
Or biomarker can also obtain during operation Program.Described device can also be included in the sensor of probe in detecting to utilizing emitted light signal during biomarker.In some instances, the optical signal of probe can change to during biomarker in probe in detecting.
In yet another aspect, present disclose provides for the method from the original position tissue (such as, skin, blood flow, tissue) in experimenter or in vitro tissue sample detection or one or more biomarkers that increase.The method requires that (a) prepares multiple micropin, multiple have specific probe to biomarker and be covalently attached to this micropin, b () makes the tissue of micropin and experimenter or biological sample contact, and (c) detects the biomarker that the probe on micropin is combined.
In some cases, present disclose provides for the method from the original position tissue in experimenter or one or more biomarkers of biology sample detection, it comprises (a) makes the tissue of micropin and experimenter or biological sample contact, wherein this micropin is attached to one group of probe, and wherein this probe is combined with one or more biomarker original positions; (b) one or more biomarkers be combined with probe are detected.
In some cases, present disclose provides the device comprising multiple micropin, wherein said multiple micropin comprises at least one micropin covalently or non-covalently being attached to and biomarker being had to specific probe, and wherein this probe comprises when this probe in detecting is to the sensor of utilizing emitted light signal during this biomarker.In some cases, the optical signal of this probe increases when it detects this biomarker.In some cases, the optical signal of this probe reduces when it detects this biomarker.
In some cases, present disclose provides for the method from the original position tissue in experimenter or one or more biomarkers of biology sample detection, it comprises (a) preparation and comprises the device of one or more micropin, and one or more have specific probe to biomarker and be covalently attached to described micropin; B () makes the tissue of microneedle devices and experimenter or biological sample contact; (c) biomarker that the probe on microneedle array is combined is detected.
In some cases, present disclose provides for the method from the original position tissue in experimenter or one or more biomarkers of biology sample detection, it comprises: (a) makes the tissue of microneedle devices and experimenter or biological sample contact, wherein this microneedle devices comprises and has specific one or more probe to one or more biomarkers described, and wherein at least one probe is included in this probe in detecting to the sensor launching visual signal during this biomarker; (b) biomarker is detected based on this visual signal.
Or, the method can comprise (a) makes the tissue of microneedle devices and experimenter or biological sample contact, and at least two probes have specificity to one or more biomarkers described, it is different for wherein having specific at least two probes to described biomarker, wherein this probe is attached to micropin via covalently or non-covalently connecting, and (b) detects the biomarker be combined with this probe.
In some cases, present disclose provides the method for detecting one or more biomarkers in the tissue of experimenter, it comprises (a) makes micropin contact with the tissue in situ of experimenter, wherein this tissue comprises extracellular matrix, wherein this micropin is covalently attached to one group of probe, and wherein this probe is combined with biomarker original position; (b) extracellular matrix is destroyed.In some cases, extracellular matrix is destroyed by enzymatic activity.In some cases, destroy extracellular matrix to comprise to extracellular matrix applying ultrasonic energy.In some cases, extracellular matrix is destroyed by electromotive force.
In additional examples, method can comprise (a) makes microneedle devices and the sample contacts comprising extracellular matrix, and wherein micropin is covalently attached to one group of probe, and wherein this probe is combined with biomarker original position; (b) extracellular matrix is destroyed.Or the method can comprise destruction cell membrane.In any one example, enzymatic activity, ultrasonic energy or electromotive force can be passed through and destroy extracellular matrix or cell membrane.
In another example, method can comprise: (a) makes the tissue of microneedle devices and experimenter or biological sample contact, and wherein this microneedle devices comprises and one or morely has specific probe to one or more biomarkers described; (b) increase this biomarker.
Biomarker can be polynucleotide, and probe can be the polynucleotide with this biomarker complementation.In some cases, probe can be have specific different polynucleotide probes to the different IPs nucleotide polymorphism of identical biomarker.
Biomarker can be peptide or polypeptide, and probe can be have specific antibody to this biomarker.In some cases, probe can be have specific different antibodies to the different epi-positions of identical biomarker.
In order to detect different biomarkers simultaneously, probe used in the process can be made for has specificity to different biomarkers.Probe can be attached to different micropins, or probe can be attached to identical micropin.In some of the other embodiments, at least two micropins can with identical probe, or multiple probe may be used for the biomarker of detection specificity.
The disclosure additionally provides the method preparing microneedle devices, and it comprises: (a) obtains the solution comprising inorganic salt; B () adds probe and micropin in this solution; (c) in this solution, make probe conjugate to micropin.In some cases, this inorganic salt is sodium chloride.In some cases, the concentration of this inorganic salt is less than 2.5M.
Any suitable material may be used for manufacturing the microneedle array used in these methods.Example includes but not limited to polymer, metal or pottery.Certain methods of the present invention is intended for detecting biological nucleic acid mark.In these methods, probe used has and the oligonucleotide of the sequence of the complementary of biomarker or polynucleotide molecule.In the method that some are such, the biological nucleic acid mark of being caught by microneedle devices by PCR or quantitative PCR in real time (qRT-PCR) determination and analysis.In the method that some are such, micropin is made up of polymer, and probe is attached to micropin via sulfydryl/amino bifunctional linker.Or micropin is made up of rustless steel and is used gold coating, and probe is attached to micropin via Thiol linker.In some embodiments, micropin can be solid.Other method more of the present invention is intended being used for detection of peptides or polypeptide biomarker.In these methods, probe used be can with the molecule of biomarker specific binding, such as monoclonal antibody.Through the antibody capture puted together with micropin, the peptide that the probe on micropin is combined or protein biomarkers can be detected by the interpolation second antibody of oligonucleotide marker and the pcr amplification of the follow-up label to puting together.
In some cases, the method for detecting one or more polynucleotide biomarkers from the skin in experimenter or ocular tissue can comprise makes the skin of microneedle devices and experimenter or ocular tissue contact.The method may further include and microneedle devices is contacted with the capillary of skin of experimenter.In other cases, the method makes the tissue of microneedle devices and experimenter or biological sample contact during can being included in operation Program.This tissue or biological sample can from the organs being selected from brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix uteri, prostate, kidney, intestinal, vermiform appendix and colon.The method makes the EDGE CONTACT of micropin and tumor after can also being included in and tumor being removed from experimenter.In some cases, method of the present disclosure detects the biomarker be present in the blood of experimenter.
The disclosure additionally provide for by probe conjugate to the method for micropin, wherein add inorganic salt.The example of inorganic salt includes but not limited to lithium salts, potassium salt, sodium salt, magnesium salt and calcium salt, and it has halogen gegenion usually.In some cases, this inorganic salt is sodium chloride.This inorganic salt can add with the concentration of about 0.1M to 2.0M.In addition, this inorganic salt can add with the concentration of about 0.5M to 1.5M.
Multiple method of the present invention may further include and detects one or more biomarkers from the reference tissue available from experimenter.Devices more of the present invention or method are designed to from the blood flow detection of experimenter and obtain biomarker.In these embodiments, the skin by piercing through experimenter makes the microneedle array of probe conjugate contact with the blood flow of experimenter.
In again in another, the invention provides the test kit comprising any device for detecting or extract the biomarker described in this application.This test kit can also comprise the group reagent for polymerase chain reaction.In some instances, this group reagent may be used for reverse transcriptase-polymerase chain reaction.This test kit can also comprise holder (holder) or the written explanation about its purposes.
In some cases, present disclose provides a kind of test kit, it comprises: (a) comprises the device of multiple micropin, and wherein said multiple micropin comprises at least one micropin covalently or non-covalently being attached to and biomarker being had to specific first probe; (b) for a group reagent of polymerase chain reaction.In some cases, this test kit comprises holder further.In some cases, this group reagent comprises polymerase, buffer and control sample.In some cases, this test kit comprises the written explanation about its purposes further.
On the other hand, the invention provides a kind of compositions, it comprises the multiple micropins applied with the material (substrate) that can destroy extracellular matrix.In some cases, this material can be enzyme.This enzyme can be selected from serine protease, thiol protease and MMP.Specific enzyme comprises papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymase, alpha-chymotrypsin, α-amylase, DNase, collagenase and sutilains (sutilain).In an example, this enzyme is hyaluronidase.
Can realize by reference to the remainder of description and claims the further understanding of character of the present invention and benefit.
quote and be incorporated to
The all publications mentioned in this manual and patent application are incorporated to all by reference, and its degree is just as especially and point out that each independent publication or patent application are incorporated to all by reference individually.
Accompanying drawing explanation
Set forth novel feature of the present invention in the dependent claims especially.By reference to the following the detailed description and the accompanying drawings (being also called " figure ") set forth the illustrative embodiment that wherein make use of the principle of the invention, the better understanding to characteristic sum benefit of the present invention will be obtained, in accompanying drawing:
Fig. 1 shows the scheme of the attachment of the chemical modification of polycarbonate surface and the DNA probe of sulfydryl modification.
Fig. 2 show use far infrared light filter (Far Red filter) by Laser Scanning Confocal Microscope imaging, with the polymer surfaces of the DNA modification modified with 5'-Cy5.Region in image left part is modified.
Fig. 3 shows the stainless steel surfaces with the DNA modification comprising fluorescent dUTP base.The little figure .DNA of A fluoroscopic image on the steel surface.The little figure of B. the bright field-of-view image on the surface of display rustless steel sample.
Fig. 4 is the diagram on the surface of the disclosure device with multiple micropin.
Fig. 5 shows the process that the DNA probe that is coupled to gold surface and biomarker are hybridized.
Fig. 6 shows the method utilizing device of the present disclosure to provide process.
Fig. 7 shows after NaCl is added into coupling procedure, the combination of the enhancing of oligonucleotide and metal micro-needle array surface.
Fig. 8 shows the qRT-PCR data using method of the present invention to measure the application on human skin sample acquisition of homogenization.
detailed Description Of The Invention
Although show in this article and describe multiple embodiments of the present invention, it will be apparent for a person skilled in the art that these embodiments only provide as an example.Without deviating from the invention, it may occur to persons skilled in the art that many changes, change and replacement.Should be appreciated that, multiple replacement schemes of embodiment of the present invention described herein can be used for implementing the present invention.
The invention provides for detecting from the health of experimenter and obtaining the apparatus and method of biomarker, especially Molecular biomarkers.In some embodiments, the device based on microneedle array with single or multiple micropin constructed in accordance.The length of the independent micropin on this array can change, such as, from 50 μm to 5mm.This device by different materials, composite and combination of materials manufacture, can include but not limited to metal and metal alloy, inorganic ceramic and polymer.Chemical modification micropin with by the probe conjugate for biomarker to microneedle surface.Concrete conjugation chemistry depends on the material of micropin.Different biomarkers can be detected with the homologous probe be fixed on identical array or identical micropin.Exemplarily, in order to the object making required biomarker combine with the probe presented, device can be put on the anatomical location of patient as skin, eye, tumor or other tissue.Hands (such as, thumb press) can be used, applicator device applies, and use in sampling period or do not use bar or band to hold it in appropriate location.The physics of micropin probe inserts and can destroy cell membrane to discharge hereditary material, comprises biomarker, makes it be combined by probe on the micropin inserted.Extracellular biological mark can directly be combined with probe, and does not need the material sample from being discharged by the cell destroyed.
Time needed for biomarker is combined with micropin will depend on many parameters, include but not limited to the ubiquity amount (prevalent quantity) of biomarker, bio distribution and concentration, histological structure, with the physics and chemistry size (such as, the number of surface area, probe, the number of binding site) of micropin probe.Application time can for be such as less than 10 seconds to 60 minutes.After tissue displacement microneedle array, can use and include but not limited to that the multiple different technologies of PCR, quantitative PCR, protein PCR, sandwich ELISA, eluting mass spectrography, eluting western blot method and eluting ELISA is to measure biomarker.Biomarker can measure or directly measure at micropin after being separated from micropin.
As described in detail in an embodiment, depending on micropin and treating the probe of coupling, number of chemical can be used in the puting together of probe and micropin.Many connections of having developed in the art can be utilized in order to the covalency attachment of biomolecule to carry out the chemical modification of the micropin be made up of polymer.Such as, for the micropin with polycarbonate surface, carbonate monomer comprises aryl moieties that can be chemically derived after polymerisation.Utilize nitric acid treatment micropin, then reduction gained nitryl group, provide amine handle (handle), by this handle, molecule can be coupled to main polymer chain.Importantly, this two-step reaction can carry out on the microneedle array of preparation, and can not damage the integrity of array or independent micropin.Use this program, standard amide key coupling reagent may be used for being attached to containing carboxylic acid probe on microneedle surface.
When manufacturing micropin with metal, be obtainable to metal surface application such as the same principle as described in for polymer surfaces.Such as, can by sputtering cladding process gold coating stainless steel surfaces, thus provide chemical handle for attachment.By utilizing the affinity of sulfydryl to gold surface of well-characterized, the divalent linker can on another end having sulfydryl on an end with amine is attached on metal surface, allows identical probe molecule to the conjugation chemistry of microneedle surface thus.The appropriate method of carrying out chemical modification to other type microneedle surface (such as, inorganic ceramic) in order to the covalently bound of biomolecule is also known in the art.
Invention described herein has the suitability widely at many different aspects of diagnosis, and described different aspect comprises for diagnosing and the heredity of disease prognosis (such as, mRNA, DNA), protein, hormone, micromolecule and cell biological mark.Such as, device described herein or method may be used for detecting based on skin biomarker, detect systemic circulation biomarker, pathogen detection (such as, antibacterial, virus or parasite) or at the edge determining tumor in lumpectomy procedure of performing the operation.As described herein, the instantiation of the diagnostic application based on skin of the present invention comprises CMM, non-melanocyte cell skin skin cancer (such as, basal cell carcinoma, squamous cell carcinoma), autoimmune disease (such as, psoriasis), the detection of the biomarker of infectious disease and tropical disease (such as, buruli ulcer, onchocerciasis).The instantiation of the non-diagnostic application based on skin of the present invention comprises tumor disease, disease in the blood system, cardiovascular diseases, the detection of mark of mongolism and real-time, the biomarker detection fast during clinical trial.
Part below provides about enforcement more detailed guidance of the present invention.
definition
Unless otherwise defined, all technology used herein and scientific terminology all have the identical meanings as those skilled in the art in the invention understand usually.List of references below provides the general definition of many terms used in the present invention to technical staff: Academic PressDictionary of Science and Technology, Morris (volume), Academic Press (the 1st edition, 1992); Oxford Dictionary of Biochemistry and Molecular Biology, Smith etc. (volume), Oxford University Press (revised edition, 2000); Encyclopaedic Dictionary ofChemistry, Kumar (volume), Anmol Publications Pvt.Ltd. (2002); Dictionary ofMicrobiology and Molecular Biology, Singleton etc. (volume), John Wiley & Sons (the 3rd edition, 2002); Dictionary of Chemistry, Hunt (volume), Routledge (the 1st edition, 1999); Dictionary of Pharmaceutical Medicine, Nahler (volume), Springer-VerlagTelos (1994); Dictionary of Organic Chemistry, Kumar and Anandand (volume), Anmol Publications Pvt.Ltd. (2002); And A Dictionary ofBiology (Oxford Paperback Reference), Martin and Hine (volume), OxfordUniversity Press (the 4th edition, 2000).In addition, definition is below provided to implement the present invention to help reader.
Biomarker broadly refers to the index responded as normal biological processes, pathogenic course or the pharmacology to therapeutic intervention and any feature measured objectively and evaluate.Unless otherwise noted, biomarker refers to the biomarker with biophysical properties especially as the term is employed herein, this biomarker allows their measurements in biological sample (such as, blood plasma, serum, cerebrospinal fluid, bronchoalveolar lavage fluid, biopsy article).Unless otherwise noted, term biomarker and " Molecular biomarkers " or " molecular marker " are used interchangeably.The example of biomarker comprises biological nucleic acid mark (such as, oligonucleotide or polynucleotide), peptide or protein biomarkers, lipid and lipopolysaccharide mark.
As used herein, microneedle devices or microneedle array (microarray) refer to and comprise at least one to diagnostic agent fixing on it or the tiny piercing elements of compound or the device of micropin.Micropin can pierce through the biological barrier (such as, the horny layer of skin) in people or other mammalian subject when contacting.Preferably, this device comprises multiple such micropin, such as, 2,5,10,25,50,100,150,200,250,300,350,400,450,500,550,600,650,700,750,800,850,900,950,1000,2000,5000,10000,20000 or more.By diagnostic probe is conjugated to micropin, microneedle devices of the present invention provides the means for the biomarker in the tissue of in situ detection experimenter or biological sample (such as, blood flow or skin).
" polynucleotide " or " nucleic acid " refer to the polymerized form of the nucleotide (ribonucleotide or deoxyribonucleotide) of any length as the term is employed herein, its comprise purine and pyrimidine bases or other natural, chemistry or biochemical modification, non-natural or derivative nucleotide base.The polynucleotide of embodiment of the present invention comprise the sequence of DNA copy (cDNA) of DNA (deoxyribonucleic acid) (DNA), ribonucleic acid (RNA) or ribonucleic acid, and all these can be separated by natural origin, recombinate generation or synthetic.The other example of polynucleotide is polyamide polynucleotide (PNA).Polynucleotide and nucleic acid can exist as strand or double-strand.The main chain of polynucleotide can comprise as the sugar that can find in RNA or DNA and phosphate group, or to modify or the sugar that replaces or phosphate group.Polynucleotide can comprise the nucleotide of modification, such as methylated nucleotide and nucleotide analog.The sequence of nucleotide can be interrupted by non-nucleotide component.The polymer be made up of nucleotide such as nucleic acid, polynucleotide and polynucleotide can also be called nucleotide polymer in this article.
Term " oligonucleotide " is defined as comprising two or more deoxyribonucleotides, preferably more than the molecule of three deoxyribonucleotides.Its definite large young pathbreaker depends on many factors, these factors and then depend on final function and the purposes of oligonucleotide." primer " refers to oligonucleotide as the term is employed herein, no matter be as naturally occurring in the restriction digest thing of purification or synthesis generation, when being placed in induction with under the condition of the synthesis of the primer extension product of nucleic acid chains complementation, namely, under nucleotide and derivant are as the existence of archaeal dna polymerase and at suitable temperature and pH, it can serve as the start-up point of synthesis.Primer can be strand or double-strand, and sufficiently long with the synthesis causing required extension products under the existence of derivant.The definite length of primer will depend on many factors, comprise temperature, Primer Source and method therefor.Such as, for diagnostic application, depend on the complexity of target sequence, oligonucleotide primers comprises 15-25 or more nucleotide usually, although it can comprise less nucleotide.The factor related in the appropriate length determining primer is that those of ordinary skill in the art easily know.
Polypeptide is the polymer chain comprising the amino acid residue monomers linked together by amido link (peptide bond).This aminoacid can be L-optical isomer or D-optical isomer.Usually, polypeptide refers to the long polymer of amino acid residue, such as, by least more than the polymer that 10,20,50,100,200,500 or more amino acid residue monomers form.Polypeptide can be the chain of at least two aminoacid, peptide mimics, protein, recombiant protein, antibody (monoclonal or polyclonal), antibody fragment, antigen, epi-position, enzyme, receptor, vitamin or its analog or combination.But unless otherwise noted, polypeptide also comprises small peptide as the term is employed herein, it comprises two or more amino acid monomers usually, but is usually no more than 10,15 or 20 amino acid monomers.
Protein is the amino acid whose long polymer that connected by peptide bond and it can also comprise two or more polypeptide chains.More specifically, term " protein " refers to the molecule of amino acid whose one or more chain comprising particular order; Such as, the order determined by the base sequence of the gene nucleotide of this protein of coding.Protein is absolutely necessary for the structure of the cell of health, tissue and organ, function and adjustment, and various protein has unique function.Example is hormone, enzyme and antibody.In some embodiments, term peptide and protein can exchange use.
" biological sample " suspects comprise interested biomarker or analyze the biological tissue of thing or the sample of chemical fluid as used herein.Sample can be vitro samples or vivo sample.Sample comprises, and such as, body fluid is as whole blood, serum, blood plasma, cerebrospinal fluid, urine, lymph fluid, and the multiple exotocrine of respiratory tract, intestinal and urogenital tract is as tear, saliva, seminal fluid, milk etc.; With other biofluid as cell culture suspension, cell extract, cell culture supernatant.Sample can also comprise such as from the biopsy thing of lung, liver, brain, eye, tongue, colon, kidney, muscle, heart, skin, pancreas, uterus, cervix uteri, prostate, salivary gland etc.Sample can also be such as use laser capture microscope post-mortem method to extract and with micromanipulative biopsy thing (microbiopsies), the small sample or even unicellular of post processing from patient.Sample can suspend or be dissolved in such as buffer, extractant, solvent etc.
As used herein, term " tissue " refers to the set of similar cellular and the intracellular matter around them.There are 4 kinds of fundamental tissue in the body: 1) epithelium; 2) connective tissue, comprises blood, bone and cartilage; 3) muscular tissue; With 4) nervous tissue.
Scope can be expressed as from " about " particular value and/or to " about " another particular value in this article.When such a range is expressed, another embodiment comprises from a particular value and/or to another particular value.Similarly, on duty by use preceding " about " and be expressed as approximation time, be to be understood that described particular value forms another embodiment.Can understand further, the end points of each scope is when relevant to another end points and independent of being all important during another end points." about " refers in the background of special-purpose from the scope of specifying numerical value ± 15% as the term is employed herein.Such as, about 10 will comprise the scope of 8.5 to 11.5.
Covalent bond relates to the chemical bond shared of interatomic electron pair.Covalent bonding comprises multiple interaction, comprises σ-bonding, π-bonding, metal-metal bonding, grabs hydrogen (agostic) interaction and three center two Electronic Keyings.The difference of noncovalent interaction and covalent bond is that it does not relate to sharing of electronics.Non-covalent bond can be divided into 4 classifications usually: electrostatic, π-effect, Van der Waals force and hydrophobic interaction.
biomarker
Apparatus and method as herein described can be used in multiple diagnostic application to detect and to catch specific biomarkers.Biomarker can be used in clinical practice identifying disease risk or diagnose the illness, patient carried out to layering, evaluate disease severity or progress, predict prognosis or guiding treatment.In drug development, biomarker may be used for help and determines how medicine works in vivo, to determine the biological effective dose of medicine, help to evaluate medicine whether safety or effectively, and the patient helping to differentiate most probable response treatment is maybe when with the patient that least may suffer adverse events during Drug therapy.Biomarker can be used as a part for the approval process of medicine or treatment sometimes, to provide information to management decision-making.
In some cases, utilize microneedle array device as herein described and the conventional amplification technique (such as, genome or protein technique) implemented, the multiple biomarker in method and apparatus of the present invention detection subject can be used.In some cases, microneedle array device can be used to catch a kind of biomarker or one group of biomarker, then use the probe of one or more extra labelling to detect captured biomarker, thus detect the multiple biomarker from experimenter.
The biomarker that the disclosure can be used to detect comprises based on the biomarker (DNA, RNA, mRNA transcript, genomic DNA, tRNA, siRNA, miRNA, mitochondrial DNA, mitochondrial RNA (mt RNA), allochthon (exosomal) nucleic acid, Cell-free DNA or RNA, polynucleotide with mutant gene and polymorphism) of nucleic acid, peptide, protein, lipid, lipid metabolism thing and micromolecule.Biomarker comprises diagnostic biomarker (such as, for the cardiac troponin of the diagnosis of myocardial infarction), staging biomarker (brain natriuretic peptide (brain natriuretic peptide) for congestive heart failure), disease prognosis biomarker (biomarker for cancer) and the biomarker (HbAlc for antidiabetic treatment) for monitoring the clinical response to intervention.They are also included in biomarker used in the decision-making in early stage drug development.Such as, pharmacodynamics (PD) biomarker is the mark of particular drug Neo-Confucianism response, and it is significant especially in injectivity optimizing research.The example of the biomarker having disease to imply comprises the serum LDL for hypercholesterolemia and blood pressure, the P53 gene for cancer and MMP.Described below other example of specific nucleic acid biomarker and the protein biomarkers being applicable to detect with method and apparatus of the present invention.
Certain preferred embodiments of the present invention relates to detection and the amplification of biological nucleic acid mark.Be known in the art many biological nucleic acid marks.Example comprises the reverse transcriptase of telomere mRNA (Miura etc. of the diagnostic biomarker as hepatocarcinoma, Clin.Cancer Res.11:3205 – 9, 2005), as the blood plasma hnRNP B1 mRNA (Sato etc. of the biomarker of pulmonary carcinoma, J.Cancer Res.Clin.Oncol.134:1191-7, 2008), as the GD2/GM2 synthase mRNA (Chen etc. of the biomarker of small cell lung cancer, Lung Cancer.67:216-20, 2010), as the seroconversion Transforming Growth Factor Alpha mRNA (Miura etc. of the prognosis biomarker of acute severe hepatitis, Hepatol Int.2:213-21, 2008), for the close speckle protein-3 mRNA (Valladares-Ayerbes etc. of human primary gastrointestinal cancers, Cancer Epidemiol Biomarkers Prev.19:1432-1440, 2010), as the metallothionein (Yamada etc. of the biomarker that heavy metal exposes, Industrial Health 39:29-32, 2001), as the WT1 mRNA (Sakamoto etc. of the biomarker for monitoring the minimum residual disease in acute myeloid leukemia, Tohoku J Exp Med.219:169-76, 2009) granzyme A mRNA (the van Ham etc. of the biomarker with as renal transplant rejection, Kidney Int ' is on August 18, in l.2010).These biomarkers and other biological nucleic acid mark multiple be known in the art all are suitable for detecting with method and apparatus of the present invention.The polynucleotide sequence of these known organism marks describes in the art and characterizes.Based on their known array, easily can to design for specific probe for these biomarkers of detection (such as, oligonucleotide primers) and synthesize with molecular biological conventional practice.See such as Sambrook etc., Molecular Cloning:ALaboratory Manual, Cold Spring Harbor Press, N.Y., (the 3rd edition, 2000); With Brent etc., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003).
In some of the other embodiments, with apparatus and method detection of peptides of the present invention or protein biomarkers.Method and apparatus as herein described can be used for detecting the multiple peptide or protein biomarkers that have characterized in the art.The instantiation being applicable to peptide of the present invention or protein biomarkers includes but not limited to, as the PSA (Polascik etc. of the biomarker of carcinoma of prostate, J.Urol.162:293-306, 1999), as cancer antigen 125 (the CA125) (Jacobs etc. of the biomarker of ovarian cancer, Lancet 353:1207 – 1210, 1999), as the BC1 of the serum biomarkers for detecting breast carcinoma, BC2 and BC3 (Mathelin etc., Breast Cancer Res.Treat.96:83-90, 2006), as beta-defensin-2 albumen (Patrick etc. of psoriatic serum biomarkers, PLoS ONE 4:e4725, 2009), as the C reactive protein (Johnson etc. of the biomarker of the transfer of renal cell carcinoma, Mol.Diagn.Ther.14:191-3, 2010), as the high molecular melanoma associated antigen (Goto etc. of the biomarker of desmoplastic melanoma, Pigment Cell Melanoma Res.23:137 – 140, 2010), as the Telomerase Expression (Gonzalo etc. of the biomarker of vicious transformation in patients with inflammatory bowel, Gastroenterol Hepatol.33:288-96, 2010) insulin-like growth factor II mRNA-associated proteins 3 (the IMP3) (Li etc. of the prognostic biomarker with as oral squamous cell carcinoma, Head Neck.2010 July 22).For detecting the probe of these biomarkers (such as, monoclonal antibody) can easily utilize standard immunological techniques (such as, hybridoma technology) generate or available from commercial supplier (such as, Abnova Corporation, Full Moon BioSystems and Spring Bioscience).
Depend on the particular type of biomarker to be detected, microneedle devices as herein described can with multiple Combination of Methods known in the art for increasing and checking molecular entity.Many genomes and protein technique are suitable in apparatus and method of the present invention for determination and analysis protein and nucleic acids marker.Such as, PCR may be used for increasing and checking the nucleic acid molecules that the probe on micropin is combined.ELISA may be used for analyzing by peptide of catching based on the device of micropin of the present invention or protein markers.Except genomics and proteomics platform biomarker determination techniques, metabolomic research, lipidomics (lipidomics) and sugared omics technology also can be used for discriminating and the detection of the biomarker of other chemical classes.Such as, mass spectrography, chromatography and nuclear magnetic resonance method can be used for the various biomolecules that determination and analysis is combined with micropin.
for being attached the micropin of diagnostic probe
The invention provides the microneedle devices of molecular probe with covalency attachment, it is for from experimenter's in situ detection with obtain biomarker.Device based on micropin comprises one or morely can thrust mammiferous biological barrier as the micropin in skin or mucosa.Usually, micropin is noninvasive or Wicresoft.When there is multiple micropin, this device can also have the planar substrates supporting micropin.This substrate can be made up of the material identical with the material of micropin.This substrate also can be made from a variety of materials.Micropin used in the present invention has and is generally 20 μm to 1mm, the preferably length (highly) of 50 μm to 500 μm.Fig. 4 is the diagram comprising the surface of the device of multiple micropin of the present invention.Each " square " in 401 shows single micropin.401 show the multiple micropins on the surface of apparatus of the present invention, and the height of wherein said pin is about 400 μm to about 1000 μm.In some embodiments, the height of micropin is about 20 μm to about 50 μm, about 20 μm to about 100 μm, about 20 μm to about 150 μm, about 20 μm to about 200 μm, about 20 μm to about 250 μm, about 20 μm to about 300 μm, about 20 μm to about 350 μm, about 20 μm to about 400 μm, about 20 μm to about 450 μm, about 20 μm to about 500 μm, about 20 μm to about 550 μm, about 20 μm to about 600 μm, about 20 μm to about 650 μm, about 20 μm to about 700 μm, about 20 μm to about 750 μm, about 20 μm to about 800 μm, about 20 μm to about 850 μm, about 20 μm to about 900 μm, about 20 μm to about 950 μm or about 20 μm are to about 1mm.In some cases, the height of micropin is less than 1 μm, is less than 5 μm, is less than 10 μm, is less than 15 μm, is less than 20 μm, is less than 25 μm, is less than 30 μm, is less than 35 μm, is less than 40 μm, is less than 45 μm, is less than 50 μm, is less than 75 μm, is less than 100 μm, is less than 150 μm, is less than 200 μm, is less than 250 μm, is less than 300 μm, is less than 500 μm, is less than 750 μm, is less than 1000 μm, is less than 2000 μm, is less than 3000 μm, is less than 4000 μm, is less than 5000 μm, is less than 7500 μm or be less than 10000 μm.In some cases, the height of micropin is greater than 1 μm, is greater than 5 μm, is greater than 10 μm, is greater than 15 μm, is greater than 20 μm, is greater than 25 μm, is greater than 30 μm, is greater than 35 μm, is greater than 40 μm, is greater than 45 μm, is greater than 50 μm, is greater than 75 μm, is greater than 100 μm, is greater than 150 μm, is greater than 200 μm, is greater than 250 μm, is greater than 300 μm, is greater than 500 μm, is greater than 750 μm, is greater than 1000 μm, is greater than 2000 μm, is greater than 3000 μm, is greater than 4000 μm, is greater than 5000 μm, is greater than 7500 μm or be greater than 10000 μm.
Although aciculiform micropin can be blunt body, it is preferably the object of tip.In some embodiments, micropin has base diameter and is generally 10 μm to 500 μm, the preferably conical structure of 20 μm to 200 μm.The 401 display surfaces with the device of multiple micropin of the present invention, wherein the diameter of base portion is less than 10mm on width.For the device comprising multiple micropin, micropin can be present on device with embarking on journey.In some embodiments, described row can according to and the almost equal spaced apart in the interval of the middle pin alignd of being expert at.In some embodiments, described row can by irregular spaced apart.
Micropin can have various shape, and such as micropin can be circle, taper shape, triangle, square, rectangle, pentagon, hexagon, hexagon, octagonal or other suitable shape any.Micropin can be sharp micropin, blunt micropin or its combination in any.Such as, the device comprising multiple sharp micropin of the present invention may be used for penetrating the skin of experimenter, makes the probe on micropin contact with such as RNA biomarker thus.Point micropin may be used for the tissue destroying biological sample, such as cellular layer or epicyte.Blunt micropin may be used for the skin surface touching experimenter, makes micropin contact with the cell surface biomarker on such as skin thus.In some cases, present disclose provides the microneedle devices comprising and there is difform micropin (such as, sharp and blunt micropin).
In some embodiments, device of the present invention comprises at least 1 micropin, at least 100 micropins, at least 200 micropins, at least 300 micropins, at least 400 micropins, at least 500 micropins, at least 600 micropins, at least 700 micropins, at least 800 micropins, at least 900 micropins, at least 1000 micropins, at least 1100 micropins, at least 1200 micropins, at least 1300 micropins, at least 1400 micropins, at least 1500 micropins, at least 1600 micropins, at least 1700 micropins, at least 1800 micropins, at least 1900 micropins, at least 2000 micropins, at least 2100 micropins, at least 2200 micropins, at least 2300 micropins, at least 2400 micropins, at least 2500 micropins, at least 2600 micropins, at least 2700 micropins, at least 2800 micropins, at least 2900 micropins, at least 3000 micropins, at least 3100 micropins, at least 3200 micropins, at least 3300 micropins, at least 3400 micropins, at least 3500 micropins, at least 3600 micropins, at least 3700 micropins, at least 3800 micropins, at least 3900 micropins, at least 4000 micropins, at least 4100 micropins, at least 4200 micropins, at least 4300 micropins, at least 4400 micropins, at least 4500 micropins, at least 4600 micropins, at least 4700 micropins, at least 4800 micropins, at least 4900 micropins or at least 5000 micropins.
In some embodiments, device of the present invention comprises 10000 micropins at the most, 5000 micropins at the most, 2500 micropins at the most, 2000 micropins at the most, 1000 micropins at the most, 500 micropins at the most, 400 micropins at the most, 300 micropins at the most, 100 micropins at the most, 90 micropins at the most, 50 micropins at the most, 40 micropins at the most, 30 micropins at the most, 20 micropins at the most, 15 micropins at the most, 10 micropins at the most, 9 micropins at the most, 8 micropins at the most, 7 micropins at the most, 6 micropins at the most, 5 micropins at the most, 4 micropins at the most, 3 micropins at the most, 2 micropins or 1 micropin at the most.
In some embodiments, device of the present invention comprises about 1 micropin to about 100 micropins, about 1 micropin is to about 200 micropins, about 1 micropin is to about 300 micropins, about 1 micropin is to about 400 micropins, about 1 micropin is to about 500 micropins, about 1 micropin is to about 600 micropins, about 1 micropin is to about 700 micropins, about 1 micropin is to about 800 micropins, about 1 micropin is to about 900 micropins, about 1 micropin is to about 1000 micropins, about 1 micropin is to about 1100 micropins, about 1 micropin is to about 1200 micropins, about 1 micropin is to about 1300 micropins, about 1 micropin is to about 1400 micropins, about 1 micropin is to about 1500 micropins, about 1 micropin is to about 1600 micropins, about 1 micropin is to about 1700 micropins, about 1 micropin is to about 1800 micropins, about 1 micropin is to about 1900 micropins, about 1 micropin is to about 2000 micropins, about 1 micropin is to about 2100 micropins, about 1 micropin is to about 2200 micropins, about 1 micropin is to about 2300 micropins, about 1 micropin is to about 2400 micropins, about 1 micropin is to about 2500 micropins, about 1 micropin is to about 2600 micropins, about 1 micropin is to about 2700 micropins, about 1 micropin is to about 2800 micropins, about 1 micropin is to about 2900 micropins, about 1 micropin is to about 3000 micropins, about 1 micropin is to about 3100 micropins, about 1 micropin is to about 3200 micropins, about 1 micropin is to about 3300 micropins, about 1 micropin is to about 3400 micropins, about 1 micropin is to about 3500 micropins, about 1 micropin is to about 3600 micropins, about 1 micropin is to about 3700 micropins, about 1 micropin is to about 3800 micropins, about 1 micropin is to about 3900 micropins, about 1 micropin is to about 4000 micropins, about 1 micropin is to about 4100 micropins, about 1 micropin is to about 4200 micropins, about 1 micropin is to about 4300 micropins, about 1 micropin is to about 4400 micropins, about 1 micropin is to about 4500 micropins, about 1 micropin is to about 4600 micropins, about 1 micropin is to about 4700 micropins, about 1 micropin is to about 4800 micropins, about 1 micropin is to about 4900 micropins or about 1 micropin extremely about 5000 micropins.
The substrate of array and micropin can be made up of multiple biodegradable or not biodegradable material.The example of the material of micropin or substrate comprises poly-(methyl methacrylate), silicon, silicon dioxide, pottery, metal (such as rustless steel, titanium, nickel, molybdenum, chromium and cobalt) and synthesis or natural resin material.Some embodiments use biodegradable polymer, such as polylactic acid, PGA, polylactic acid-PGA copolymer, amylopectin, caprolactone (capronolactone), polyurethane or polyanhydride.In some of the other embodiments, nondegradable material is for the manufacture of microneedle array, and such as polymer poly carbonic ester, synthesis or natural resin material are as polymethylacrylic acid, ethylene vinyl acetate, politef, polysulfones or polyformaldehyde.In some embodiments, material therefor comprises polysaccharide that such as hyaluronic acid, amylopectin, glucosan, dextrin or chondroitin sulfate are such or applies with this polysaccharide.In some cases, micropin thermoplastic polymer manufactures.
The substrate of array and micropin can be made up of multiple thermoplastic polymer.The limiting examples of thermoplastic polymer comprises acrylate copolymer as poly-(methyl methacrylate) (PMMA), nylon, polyethylene, polypropylene, polystyrene, polrvinyl chloride or polytetrafluoroethylene (Teflon).In some cases, device of the present invention uses and is selected from Merlon, poly-(methyl methacrylate), polyethylene and polyacrylic thermoplastic polymer manufacture.
The limiting examples of nondegradable polymer comprises such as siloxanes, hydrogel is as crosslinked poly-(vinyl alcohol) and poly-(hydroxyethyl methylacrylate), ethane-acetic acid ethyenyl ester, the cellulose acetate of acyl substituted and alkyl derivative thereof, the alkylene vinyl acetate copolymer of part and complete hydrolysis, unplasticizied polrvinyl chloride, the homopolymer of crosslinked polyvinyl acetate and copolymer, crosslinked acrylic acid and/or the polyester of methacrylic acid, Polyvinylalkylethers, polyvinyl fluoride, Merlon, polyurethane, polyamide, polysulfones, styrene acrylonitrile copolymer, crosslinked poly-(oxirane), poly-(alkylidene), poly-(vinyl imidazole), polyester, poly-(PETP), polyphosphazene and chlorosulfonated polyolefin and combination thereof.In some embodiments, this polymer comprises ethylene vinyl acetate.
The limiting examples of biodegradable polymer comprises polyester, such as 3-hydroxy propionate, 3-hydroxybutyrate ester, 3-hydroxyl valerate, 3-hydroxycaproic ester, 3-hydroxyheptanoate, 3-Hydroxycaprylic acid ester, 3-hydroxynonanoate, 3-hydroxydecanoic acid ester, 3-hydroxyl undecylate, 3-hydroxyl dodecanoic acid ester, 4 hydroxybutyric acid ester, 5-hydroxyl valerate, polylactide or polylactic acid, comprise poly-(d-lactic acid), poly-(1-lactic acid), poly-(d, l-lactic acid), polyglycolic acid and PGA, poly-(lactic acid-ethanol) copolymer, poly-(lactide coglycolide) copolymer, poly-(6-caprolactone) and Ju diethyleno dioxide ketone.The polysaccharide comprising starch, glycogen, cellulose and chitin also can be used as biodegradable material.
402 surfaces 401 showing device of the present disclosure, its comprise multiple with the micropin of the probe conjugate of at least one type.402 can with such as polynucleotide probes, peptide probes, protein probe or its combination in any coupling.The probe being attached to the micropin on device 402 covalently or non-covalently can be coupled to micropin.Embodiment 1 and 2 describes the multiple method for probe being covalently coupled to surface in further detail.
Distance between the center that can calculate two micropins on device of the present disclosure is to determine the density of the micropin in this device.In some embodiments, the center to center distance between two micropins can be less than 1000 μm, be less than 900 μm, be less than 800 μm, be less than 700 μm, be less than 600 μm, be less than 500 μm, be less than 400 μm, be less than 300 μm, be less than 200 μm or be less than 100 μm.In some embodiments, the center to center distance between two micropins can be not more than 100 μm, be not more than 200 μm, be not more than 300 μm, be not more than 400 μm, be not more than 500 μm, be not more than 600 μm, be not more than 700 μm, be not more than 800 μm, be not more than 900 μm or be not more than 1000 μm.
Micropin of the present disclosure can comprise multiple different-diameter or base widths.The shape of the base portion of micropin can be such as circle, rectangle, triangle, square, pentagon, hexagon, hexagon or other geometry.Micropin of the present disclosure can have and is not more than 500 μm, be not more than 400 μm, be not more than 300 μm, be not more than 200 μm, be not more than 100 μm, be not more than 50 μm, be not more than 40 μm, be not more than 30 μm, be not more than 20 μm, be not more than 10 μm, be not more than 1000nm, be not more than 900nm, be not more than 800nm, be not more than 700nm, be not more than 600nm, be not more than 500nm, be not more than 400nm, be not more than 300nm, be not more than 200nm or be not more than diameter or the base widths of 100nm.
Probe covalently or non-covalently can be attached to micropin in the multiple different depth places in micropin.403 show the micropin with 600 μm of height and 200 μm of width.404 show the micropin with 600 μm of height and 200 μm of width and the probe be attached at 10 μm of depth covalency.405 show the micropin with 600 μm of height and 200 μm of width and the probe be attached at 500 μm of depth covalency.In some cases, the degree of depth of micropin internal probe can be used for determining can find in the tissue the degree of depth of biomarker.In some cases, the device that the different depth place being included in different micropin is attached with multiple micropins of multiple probe can be used for determining that where can find biomarker in the tissue.Such as, this device can be used for determining that pathological changes is as the size of cancerous lesion or the degree of depth.
The degree of depth of probe can be about 10 μm, about 20 μm, about 30 μm, about 40 μm, about 50 μm, about 60 μm, about 70 μm, about 80 μm, about 90 μm, about 100 μm, about 110 μm, about 120 μm, about 130 μm, about 140 μm, about 150 μm, about 160 μm, about 170 μm, about 180 μm, about 190 μm, about 200 μm, about 210 μm, about 220 μm, about 230 μm, about 240 μm, about 250 μm, about 260 μm, about 270 μm, about 280 μm, about 290 μm, about 300 μm, about 310 μm, about 320 μm, about 330 μm, about 340 μm, about 350 μm, about 360 μm, about 370 μm, about 380 μm, about 390 μm, about 400 μm, about 410 μm, about 420 μm, about 430 μm, about 440 μm, about 450 μm, about 460 μm, about 470 μm, about 480 μm, about 490 μm, about 500 μm, about 510 μm, about 520 μm, about 530 μm, about 540 μm, about 550 μm, about 560 μm, about 570 μm, about 580 μm, about 590 μm, about 600 μm, about 610 μm, about 620 μm, about 630 μm, about 640 μm, about 650 μm, about 660 μm, about 670 μm, about 680 μm, about 690 μm, about 700 μm, about 710 μm, about 720 μm, about 730 μm, about 740 μm, about 750 μm, about 760 μm, about 770 μm, about 780 μm, about 790 μm, about 800 μm, about 810 μm, about 820 μm, about 830 μm, about 840 μm, about 850 μm, about 860 μm, about 870 μm, about 880 μm, about 890 μm, about 900 μm, about 910 μm, about 920 μm, about 930 μm, about 940 μm, about 950 μm, about 960 μm, about 970 μm, about 980 μm, about 990 μm or about 1000 μm.
Optionally, microneedle devices of the present invention also can comprise the applicator unit that can be used for this device to put on experimenter.This applicator unit can control multiple application parameter, such as, apply the speed of array, apply the angle of the power of array and/or the tissue (such as, skin) of array impact experimenter.In addition, applicator can help process or otherwise array is transferred to experimenter from storage unit.In some embodiments, this applicator can be single use, the discardable instrument that the single serving as storage unit and the instrument of applying uses.The example of the method for suitable applicator and applying microneedle array is at United States Patent (USP) 6,293,925 (Safabash etc.), 6,743,211 (Prausnitz etc.), 6,881,203 (Delmore etc.) and 6, disclose in 855,131 (Trautman etc.) and U.S. Patent Application Publication 2004/0181203 (Cormier etc.), 2002/0032415 (Trautman etc.) and 2002/0087182 (Trautman etc.).This applicator unit can have multiple different shape.In some embodiments, this applicator unit can be such as linear, triangle, rectangle or disc.In some embodiments, this applicator unit is an applicator.
Microneedle array for puting together diagnostic probe can easily use the materials and methods of the array for the preparation of having micro-bulge-structure as known in the art to manufacture.See, such as United States Patent (USP) 7416541,7332197,6663820,6503231, U.S. Patent application 20100106105 and european patent application 2119469A.Such as, microneedle array can be processed by using the wet etching of silicon base or dry etching is processed, use the precision optical machinery of metal or resin processing (such as, discharge processing, Laser Processing, cutting processing, hot padding and injection moulding) and machine cuts to manufacture.Utilize this type of processing method, pin part and support section are molded as one.Method by using Laser Processing etc. to carry out secondary operations after the example making pin part become the method for hollow is included in manufacturing needles part.In some cases, micropin of the present disclosure can be the micropin of solid (non-hollow).In some cases, micropin of the present disclosure can be etched to increase the surface area of micropin.
May need multiple method of cell disruption to make biomarker become probe can and.Can by destroying extracellular matrix or destroying cell membrane and smudge cells.When such as at least one micropin contacts and penetrates biological sample as application on human skin, device of the present disclosure can cause cell breakage.
Multiple original position or isolated cells can be come broken with material.So, the present invention further provides and comprise the compositions that multiple use can destroy the micropin of the coating substance of extracellular matrix.In some cases, this material is enzyme.Multiple enzyme, includes but not limited to serine protease, thiol protease and MMP, may be used for this process.The limiting examples that can be used for the enzyme that biological cells and tissues destroys includes but not limited to papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymase, alpha-chymotrypsin, α-amylase, DNase, collagenase, sutilains protease, lysozyme, lipase, zymolase, cellulase, mutanolysin or dextranase.In some instances, this enzyme is hyaluronidase.
Biological cells and tissues destroy other method can comprise, such as, supersound process, electroporation, pulverize at low temperature, utilize the physical damage of pressure, grinding, based on detergent lysis or utilize such as homogenizer to tissue mechanical shearing.Such as, extracellular matrix or cell membrane or can pass through electromotive force and destroy by ultrasonic energy.Apply solvent to biological sample to can also be used to biomarker be can be used for and probe hybridization.
Device of the present disclosure can original position or destroy biological tissue in a minimally invasive manner in vitro.Such as, micropin of the present disclosure can with the contact skin in experimenter's eye.This micropin leniently can destroy the film of the cellular layer in the skin of eye, provides biomarker in eye for the accessibility of the probe in micropin thus.In some embodiments, method and apparatus of the present disclosure can be applied to discriminating and characterize from the tissue of fragility or the biomarker of inoperable tissue.Such as, the biomarker in eye or brain is present in.In some embodiments, method and apparatus of the present disclosure is applied to the in-situ characterization to the biomarker carrying out biological sample, and this biological sample possibly cannot be performed the operation and be removed in biopsy, such as, and the cerebral tumor of some type.
probe conjugate and for increasing and detecting the mensuration of biomarker
With the micropin of probe conjugate.
Multiple probe can be attached to micropin of the present disclosure.In some cases, described probe comprises polynucleotide (such as, DNA, RNA, cDNA, cRNA etc.).Usually polynucleotide probes is designed to combine or hybrid specificities polynucleotide biomarker.The disclosure is also provided for the method and apparatus of detection of peptides or protein biomarkers.In these embodiments, the probe being attached to micropin can identify and specifically in conjunction with interested target peptide or protein.Described probe can be any material that can be combined with particular peptide or protein biomarkers.They can be such as protein (such as, antibody, antigen or its fragment), sugar or polynucleotide.These polynucleotide can have the sequence-specific for biomarker.
Probe to be used depends on one or more biomarkers to be detected.Therefore, according to character and the number of biomarker to be detected, the number being fixed on the probe on micropin can be 2,3,4,5,6,7,8,9,10 or more.In some cases, the sum of the probe in micropin can be about 1 probe to about 1,000 probe, about 1 probe to about 10,000 probe, about 1 probe to about 100,000 probe, about 1 probe is to about 1,000,000 probe, about 1 probe is to about 10,000,000, about 1 probe is to about 100,000,000 probe, about 1,000 probe to about 10,000 probe, about 1,000 probe to about 100,000 probe, about 1,000 probe is to about 1,000,000 probe, about 1,000 probe is to about 10,000,000, about 1,000 probe is to about 100,000,000 probe, about 10,000 probe to about 100,000 probe, about 10,000 probe is to about 1,000,000 probe, about 10,000 probe is to about 10,000,000 probe, about 10,000 probe is to about 100,000,000 probe, about 100,000 probe is to about 1,000,000 probe, about 100,000 probe is to about 10,000,000 probe, about 100,000 probe is to about 100,000,000 probe, about 1,000,000 probe is to about 10,000,000 probe, about 1,000,000 probe is to about 100,000,000 probe or about 10, and 000,000 probe is to about 100,000,000 probe.
In some cases, the sum of the probe in micropin is at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 40000, about 50000, about 60000, about 70000, about 80000, about 90000, about 100000, about 200000, about 300000, about 400000, about 500000, about 600000, about 700000, about 800000, about 900000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6,000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000 or about 100,000,000 probe.
In some cases, the sum of the probe in micropin is less than about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 40000, about 50000, about 60000, about 70000, about 80000, about 90000, about 100000, about 200000, about 300000, about 400000, about 500000, about 600000, about 700000, about 800000, about 900000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6,000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000 or about 100,000,000 probe.
In addition, as further described herein, the probe for biomarker can be fixed to the multiple micropins in device of the present disclosure, especially for the biomarker detecting low concentration.In some cases, single micropin comprise multiple can in conjunction with or detect the different probe of identical biomarker.In some cases, single micropin comprises at least two different probes for identical biomarker, at least 3 different probes, at least 4 different probes, at least 5 different probes, at least 6 different probes, at least 7 different probes, at least 8 different probes, at least 9 different probes, at least 10 different probes, at least 11 different probes, at least 12 different probes, at least 13 different probes, at least 14 different probes, at least 15 different probes, at least 16 different probes, at least 17 different probes, at least 18 different probes, at least 19 different probes, at least 20 different probes, at least 21 different probes, at least 22 different probes, at least 23 different probes, at least 24 different probes, at least 25 different probes, at least 26 different probes, at least 27 different probes, at least 28 different probes, at least 29 different probes, at least 30 different probes, at least 40 different probes, at least 41 different probes, at least 42 different probes, at least 43 different probes, at least 44 different probes, at least 45 different probes, at least 46 different probes, at least 47 different probes, at least 48 different probes, at least 49 different probes or at least 50 different probes for identical biomarker.In some cases, identical micropin comprise for identical biomarker more than 50 kinds of dissimilar probes.
In some cases, identical micropin comprises multiple different probe.Described different probe can be specific to identical biomarker or to different biomarkers.Micropin can comprise at least 2 different probes, at least 10 different probes, at least 100 different probes, at least 200 different probes, at least 300 different probes, at least 400 different probes, at least 500 different probes, at least 600 different probes, at least 700 different probes, at least 800 different probes, at least 900 different probes, at least 1,000 different probe, at least 1,100 different probes, at least 1,200 different probes, at least 1,300 different probes, at least Isosorbide-5-Nitrae 00 different probe, at least 1,500 different probes, at least 1,600 different probes, at least 1,700 different probes, at least 1,800 different probes, at least 1,900 different probes, at least 2,000 different probe, at least 2,100 different probes, at least 2,200 different probes, at least 2,300 different probes, at least 2,400 different probes, at least 2,500 different probes, at least 2,600 different probes, at least 2,700 different probes, at least 2,800 different probes, at least 2,900 different probes, at least 3,000 different probe, at least 3,100 different probes, at least 3,200 different probes, at least 3,300 different probes, at least 3,400 different probes, at least 3,500 different probes, at least 3,600 different probes, at least 3,700 different probes, at least 3,800 different probes, at least 3,900 different probes, at least 4,000 different probe, at least 4,100 different probes, at least 4,200 different probes, at least 4,300 different probes, at least 4,400 different probes, at least 4,500 different probes, at least 4,600 different probes, at least 4,700 different probes, at least 4,800 different probes, at least 4,900 different probes, at least 5,000 different probe, at least 5,100 different probes, at least 5,200 different probes, at least 5,300 different probes, at least 5,400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probe, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes, at least 6,500 different probes, at least 6,600 different probes, at least 6,700 different probes, at least 6,800 different probes, at least 6,900 different probes, at least 7,000 different probe, at least 7,100 different probes, at least 7,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probe, at least 8,100 different probes, at least 8,200 different probes, at least 8,300 different probes, at least 8,400 different probes, at least 8,500 different probes, at least 8,600 different probes, at least 8,700 different probes, at least 8,800 different probes, at least 8,900 different probes, at least 9,000 different probe, at least 9,100 different probes, at least 9,200 different probes, at least 9,300 different probes, at least 9,400 different probes, at least 9,500 different probes, at least 9,600 different probes, at least 9,700 different probes, at least 9,800 different probes, at least 9,900 different probes or at least 10,000 different probe.Micropin can comprise and be less than 2 different probes, be less than 10 different probes, be less than 100 different probes, be less than 200 different probes, be less than 300 different probes, be less than 400 different probes, be less than 500 different probes, be less than 600 different probes, be less than 700 different probes, be less than 800 different probes, be less than 900 different probes, be less than 1,000 different probe, be less than 1,100 different probes, be less than 1,200 different probes, be less than 1,300 different probes, be less than Isosorbide-5-Nitrae 00 different probe, be less than 1,500 different probes, be less than 1,600 different probes, be less than 1,700 different probes, be less than 1,800 different probes, be less than 1,900 different probes, be less than 2,000 different probe, be less than 2,100 different probes, be less than 2,200 different probes, be less than 2,300 different probes, be less than 2,400 different probes, be less than 2,500 different probes, be less than 2,600 different probes, be less than 2,700 different probes, be less than 2,800 different probes, be less than 2,900 different probes, be less than 3,000 different probe, be less than 3,100 different probes, be less than 3,200 different probes, be less than 3,300 different probes, be less than 3,400 different probes, be less than 3,500 different probes, be less than 3,600 different probes, be less than 3,700 different probes, be less than 3,800 different probes, be less than 3,900 different probes, be less than 4,000 different probe, be less than 4,100 different probes, be less than 4,200 different probes, be less than 4,300 different probes, be less than 4,400 different probes, be less than 4,500 different probes, be less than 4,600 different probes, be less than 4,700 different probes, be less than 4,800 different probes, be less than 4,900 different probes, be less than 5,000 different probe, be less than 5,100 different probes, be less than 5,200 different probes, be less than 5,300 different probes, be less than 5,400 different probes, be less than 5,500 different probes, be less than 5,600 different probes, be less than 5,700 different probes, be less than 5,800 different probes, be less than 5,900 different probes, be less than 6,000 different probe, be less than 6,100 different probes, be less than 6,200 different probes, be less than 6,300 different probes, be less than 6,400 different probes, be less than 6,500 different probes, be less than 6,600 different probes, be less than 6,700 different probes, be less than 6,800 different probes, be less than 6,900 different probes, be less than 7,000 different probe, be less than 7,100 different probes, be less than 7,200 different probes, be less than 7,300 different probes, be less than 7,400 different probes, be less than 7,500 different probes, be less than 7,600 different probes, be less than 7,700 different probes, be less than 7,800 different probes, be less than 7,900 different probes, be less than 8,000 different probe, be less than 8,100 different probes, be less than 8,200 different probes, be less than 8,300 different probes, be less than 8,400 different probes, be less than 8,500 different probes, be less than 8,600 different probes, be less than 8,700 different probes, be less than 8,800 different probes, be less than 8,900 different probes, be less than 9,000 different probe, be less than 9,100 different probes, be less than 9,200 different probes, be less than 9,300 different probes, be less than 9,400 different probes, be less than 9,500 different probes, be less than 9,600 different probes, be less than 9,700 different probes, be less than 9,800 different probes, be less than 9,900 different probes or be less than 10,000 different probe.
In some cases, described multiple probe is identical (such as, the identical copies of identical polynucleotide or antibody).In some embodiments, micropin can be associated with multiple copies of same probe (such as, same probe copy more than 2,5,10,50,100,1000,5000,7500,10000 or 50000).Such as, micropin can comprise multiple copies of polynucleotide probes, and this polynucleotide probes is designed to hybridize with identical polymorphism or biomarker.In some cases, micropin can comprise multiple copies of the antibody probe be designed in conjunction with identical epi-position.
In some cases, micropin comprises polynucleotide probes.This probe can be designed to detect the different biomarkers relevant from identical disease, disease or situation.In some cases, the polymorphism (such as, DNA polymorphism, RNA polymorphism) of the first probe identification and disease association, and the different polymorphisms that the second probe identification is relevant from same disease.Such as, the first DNA probe on micropin can be designed to the first polymorphism detecting the RNA biomarker relevant to onchocerciasis (a kind of skin).The second DNA probe on micropin can be designed to the second polymorphism detecting the RNA biomarker relevant to onchocerciasis.Polymorphism can be such as single nucleotide polymorphism (SNP).Heredity and genome mutation can comprise single SNP or multiple SNP.SNP can occur at individual gene seat or at multiple locus place.Carry the allelic individuality of specific SNP at a locus place and predictably can carry specificity SNP allele at other locus place.The dependency of SNP can provide relatedness between the allele making individual susceptible disease or situation.In some cases, different polynucleotide probes is designed to detect the different biomarkers relevant from different situation.Such as, a probe can detect the biomarker of disease, and other probe can detect housekeeping gene or gene outcome.In some cases, micropin is attached to the mixture of polynucleotide, polypeptide or polynucleotide and polypeptide.
Micropin can also be associated from multiple different protein or antibody probe.Such as, the first antibody probe on micropin can be designed to the first epi-position detecting the antigen relevant to such as skin carcinoma.Second antibody probe can be designed to detect second epi-position relevant to this antigen.Or in some cases, second antibody probe can detect the epi-position relevant to different skin situation.
In some cases, disclosure providing package is containing the microneedle devices of one group of micropin, and wherein each micropin in this set comprises identical probe or one group of probe.In some embodiments, identical probe is attached to multiple micropins of device.Identical probe can be attached to, such as, about 1% micropin, about 5% micropin, about 10% micropin, about 15% micropin, about 20% micropin, about 25% micropin, about 30% micropin, about 35% micropin, about 40% micropin, about 45% micropin, about 50% micropin, about 55% micropin, about 60% micropin, about 65% micropin, about 70% micropin, about 75% micropin, about 80% micropin, about 85% micropin, the micropin of about 90%, the micropin of about 95% or about 100% micropin.In some embodiments, identical probe is attached to the micropin of no more than 5%, the micropin of no more than 10%, the micropin of no more than 15%, the micropin of no more than 20%, the micropin of no more than 25%, the micropin of no more than 30%, the micropin of no more than 35%, the micropin of no more than 40%, the micropin of no more than 45%, the micropin of no more than 50%, the micropin of no more than 55%, the micropin of no more than 60%, the micropin of no more than 70%, the micropin of no more than 75%, the micropin of no more than 80%, the micropin of no more than 85%, the micropin of no more than 90%, the micropin of no more than 95% or the micropin of no more than 99%.
In some cases, one group of micropin can comprise at least one micropin being attached to the first probe and at least one micropin being attached to the second probe being different from the first probe.Such as, as described herein, first probe can be specifically in conjunction with the polynucleotide of the biomarker of disease or disease or polypeptide (such as, antibody, protein), and the second probe can be the polynucleotide or the polypeptide that combine the different biomarkers of being correlated with from same disease or disease specifically.In some cases, first probe can be specifically in conjunction with the polynucleotide of the biomarker of disease or disease or polypeptide (such as, antibody, protein), and the second probe can be the polynucleotide or the polypeptide that combine the different biomarkers of being correlated with from various disease, disease or situation specifically.In some cases, this various disease, situation or disease are relevant to homolog.Such as, the first probe can be relevant to skin the first disease, disease or situation are associated; And the second probe can be associated to skin or relevant the second disease, disease or the situation of eye.In some cases, this device can comprise microneedle array, and wherein each micropin comprises the probe detecting the biomarker be associated to various disease, disease or the situation relevant with homolog.The array of micropin can comprise relevant to various disease, disease or situation more than 2,3,4,5,6,7,8,9,10,20,30,40,50,75,100,150,200,50 or 1000 micropins.In some cases, this various disease, disease or situation and Different Organs (such as, more than 1,2,3,4,5,6,7,8,9,10,15 or 20 organ) are correlated with.
In some cases, microneedle devices comprises multiple microneedle array; Usually, the plurality of microneedle array is applicable to multiple reaction.In some cases, the plurality of array comprises two or more microneedle arrays, and wherein this array is designed to detect different biomarkers.In some cases, the first microneedle array can be designed to detect the biomarker relevant to disease, disease or situation, and the second microneedle array is designed to detect the different biomarkers relevant from same disease, disease or situation.In some cases, the first microneedle array can be designed to detect the biomarker relevant to disease, disease or situation, and the second microneedle array can be designed to detect the different biomarkers relevant from various disease, disease or situation.In some cases, the first microneedle array can be designed to detect the multiple biomarker relevant to disease, disease or situation; And the second microneedle array can be designed to detect the multiple biomarker relevant to various disease, disease or situation.In some cases, the second microneedle array can be designed to detect contrast biomarker (such as, housekeeping gene), and it is positive control or negative control.
In some cases, method and apparatus provided herein can be used for using or not using fluorescence to carry out multiple reaction.Such as, each micropin can insert in the chamber (such as, pin hole chamber) of himself, and described chamber comprises unique PCR reagent (such as, unique probe or primer).The multiple biomarker that PCR reaction also can analyze sample can be carried out.In some cases, the probe of fluorescently-labeled probe or the different optical signal of transmitting is used to carry out multiple reaction.In some cases, fluorescence is not used.
Microneedle devices described herein can comprise the probe of arbitrary number; Usually, probe is attached to the multiple pins in this device.Probe can be identical or different.In addition, the probe for biomarker can be fixed to the multiple micropins in device of the present disclosure, especially for the biomarker detecting low concentration.In some cases, the sum of the probe in microneedle devices can be about 1 probe to about 1,000 probe, about 1 probe to about 10,000 probe, about 1 probe to about 100,000 probe, about 1 probe is to about 1,000,000 probe, about 1 probe is to about 10,000,000, about 1 probe is to about 100,000,000 probe, about 1,000 probe to about 10,000 probe, about 1,000 probe to about 100,000 probe, about 1,000 probe is to about 1,000,000 probe, about 1,000 probe is to about 10,000,000, about 1,000 probe is to about 100,000,000 probe, about 10,000 probe to about 100,000 probe, about 10,000 probe is to about 1,000,000 probe, about 10,000 probe is to about 10,000,000 probe, about 10,000 probe is to about 100,000,000 probe, about 100,000 probe is to about 1,000,000 probe, about 100,000 probe is to about 10,000,000 probe, about 100,000 probe is to about 100,000,000 probe, about 1,000,000 probe is to about 10,000,000 probe, about 1,000,000 probe is to about 100,000,000 probe or about 10, and 000,000 probe is to about 100,000,000 probe.
In some cases, the probe in microneedle devices add up at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 40000, about 50000, about 60000, about 70000, about 80000, about 90000, about 100000, about 200000, about 300000, about 400000, about 500000, about 600000, about 700000, about 800000, about 900000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6,000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000 or about 100,000,000 probe.
In some cases, the sum of the probe in microneedle devices is less than about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 40000, about 50000, about 60000, about 70000, about 80000, about 90000, about 100000, about 200000, about 300000, about 400000, about 500000, about 600000, about 700000, about 800000, about 900000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6,000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000 or about 100,000,000 probe.
In some cases, microneedle devices comprises at least 2 different probes for identical biomarker, at least 3 different probes, at least 4 different probes, at least 5 different probes, at least 6 different probes, at least 7 different probes, at least 8 different probes, at least 9 different probes, at least 10 different probes, at least 11 different probes, at least 12 different probes, at least 13 different probes, at least 14 different probes, at least 15 different probes, at least 16 different probes, at least 17 different probes, at least 18 different probes, at least 19 different probes, at least 20 different probes, at least 21 different probes, at least 22 different probes, at least 23 different probes, at least 24 different probes, at least 25 different probes, at least 26 different probes, at least 27 different probes, at least 28 different probes, at least 29 different probes, at least 30 different probes, at least 40 different probes, at least 41 different probes, at least 42 different probes, at least 43 different probes, at least 44 different probes, at least 45 different probes, at least 46 different probes, at least 47 different probes, at least 48 different probes, at least 49 different probes or at least 50 different probes for identical biomarker.In some cases, identical micropin comprise for identical biomarker more than 50 kinds of dissimilar probes.
In some cases, microneedle devices comprises multiple different probe.Described different probe can be specific to identical biomarker or to different biomarkers.Microneedle devices can comprise at least 2 different probes, at least 10 different probes, at least 100 different probes, at least 200 different probes, at least 300 different probes, at least 400 different probes, at least 500 different probes, at least 600 different probes, at least 700 different probes, at least 800 different probes, at least 900 different probes, at least 1,000 different probe, at least 1,100 different probes, at least 1,200 different probes, at least 1,300 different probes, at least Isosorbide-5-Nitrae 00 different probe, at least 1,500 different probes, at least 1,600 different probes, at least 1,700 different probes, at least 1,800 different probes, at least 1,900 different probes, at least 2,000 different probe, at least 2,100 different probes, at least 2,200 different probes, at least 2,300 different probes, at least 2,400 different probes, at least 2,500 different probes, at least 2,600 different probes, at least 2,700 different probes, at least 2,800 different probes, at least 2,900 different probes, at least 3,000 different probe, at least 3,100 different probes, at least 3,200 different probes, at least 3,300 different probes, at least 3,400 different probes, at least 3,500 different probes, at least 3,600 different probes, at least 3,700 different probes, at least 3,800 different probes, at least 3,900 different probes, at least 4,000 different probe, at least 4,100 different probes, at least 4,200 different probes, at least 4,300 different probes, at least 4,400 different probes, at least 4,500 different probes, at least 4,600 different probes, at least 4,700 different probes, at least 4,800 different probes, at least 4,900 different probes, at least 5,000 different probe, at least 5,100 different probes, at least 5,200 different probes, at least 5,300 different probes, at least 5,400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probe, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes, at least 6,500 different probes, at least 6,600 different probes, at least 6,700 different probes, at least 6,800 different probes, at least 6,900 different probes, at least 7,000 different probe, at least 7,100 different probes, at least 7,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probe, at least 8,100 different probes, at least 8,200 different probes, at least 8,300 different probes, at least 8,400 different probes, at least 8,500 different probes, at least 8,600 different probes, at least 8,700 different probes, at least 8,800 different probes, at least 8,900 different probes, at least 9,000 different probe, at least 9,100 different probes, at least 9,200 different probes, at least 9,300 different probes, at least 9,400 different probes, at least 9,500 different probes, at least 9,600 different probes, at least 9,700 different probes, at least 9,800 different probes, at least 9,900 different probes or at least 10,000 different probe.In some cases, microneedle devices can comprise and be less than 2 different probes, be less than 10 different probes, be less than 100 different probes, be less than 200 different probes, be less than 300 different probes, be less than 400 different probes, be less than 500 different probes, be less than 600 different probes, be less than 700 different probes, be less than 800 different probes, be less than 900 different probes, be less than 1,000 different probe, be less than 1,100 different probes, be less than 1,200 different probes, be less than 1,300 different probes, be less than Isosorbide-5-Nitrae 00 different probe, be less than 1,500 different probes, be less than 1,600 different probes, be less than 1,700 different probes, be less than 1,800 different probes, be less than 1,900 different probes, be less than 2,000 different probe, be less than 2,100 different probes, be less than 2,200 different probes, be less than 2,300 different probes, be less than 2,400 different probes, be less than 2,500 different probes, be less than 2,600 different probes, be less than 2,700 different probes, be less than 2,800 different probes, be less than 2,900 different probes, be less than 3,000 different probe, be less than 3,100 different probes, be less than 3,200 different probes, be less than 3,300 different probes, be less than 3,400 different probes, be less than 3,500 different probes, be less than 3,600 different probes, be less than 3,700 different probes, be less than 3,800 different probes, be less than 3,900 different probes, be less than 4,000 different probe, be less than 4,100 different probes, be less than 4,200 different probes, be less than 4,300 different probes, be less than 4,400 different probes, be less than 4,500 different probes, be less than 4,600 different probes, be less than 4,700 different probes, be less than 4,800 different probes, be less than 4,900 different probes, be less than 5,000 different probe, be less than 5,100 different probes, be less than 5,200 different probes, be less than 5,300 different probes, be less than 5,400 different probes, be less than 5,500 different probes, be less than 5,600 different probes, be less than 5,700 different probes, be less than 5,800 different probes, be less than 5,900 different probes, be less than 6,000 different probe, be less than 6,100 different probes, be less than 6,200 different probes, be less than 6,300 different probes, be less than 6,400 different probes, be less than 6,500 different probes, be less than 6,600 different probes, be less than 6,700 different probes, be less than 6,800 different probes, be less than 6,900 different probes, be less than 7,000 different probe, be less than 7,100 different probes, be less than 7,200 different probes, be less than 7,300 different probes, be less than 7,400 different probes, be less than 7,500 different probes, be less than 7,600 different probes, be less than 7,700 different probes, be less than 7,800 different probes, be less than 7,900 different probes, be less than 8,000 different probe, be less than 8,100 different probes, be less than 8,200 different probes, be less than 8,300 different probes, be less than 8,400 different probes, be less than 8,500 different probes, be less than 8,600 different probes, be less than 8,700 different probes, be less than 8,800 different probes, be less than 8,900 different probes, be less than 9,000 different probe, be less than 9,100 different probes, be less than 9,200 different probes, be less than 9,300 different probes, be less than 9,400 different probes, be less than 9,500 different probes, be less than 9,600 different probes, be less than 9,700 different probes, be less than 9,800 different probes, be less than 9,900 different probes or be less than 10,000 different probe.
Probe for detecting different biomarker business can obtain or synthesize according to method well known in the art.This probe can design according to any suitable method.Such as, computerized search program can be used for design to the target biomarker sequence (such as, mRNA) with minimum crisscrossing and similar hybridization efficiency, there is specific nucleic probe.Such exemplary process comprises Oligo 5.0 (National Biosciences Inc.), Primer 3 (MIT) and Array Designer (Telechem International Inc.).The nucleotide probe used in the method can have the length of any appropriate, such as about 15 to about 100 nucleotide.For protein biomarkers, the specific probe (antibody) for detecting biomarker can easily generate or business obtains.The nucleotide probe used in the method or polypeptide probe can comprise detectable label.The labelling of any appropriate can be used.Such as, detectable label can pass through the detection of light, magnetic, machinery, spectrum, photochemistry, biochemistry, immunochemistry, radioactivity or enzyme means.In some embodiments, detectable label is fluorescence or chemiluminescent labeling, such as GFP; Magnetic part; Protein, such as avidin, Succ-PEG-DSPE; Or peptide tag, such as histidine-tagged or FLAG label.
Fixing probe is present on the surface of microneedle devices as herein described.Fixing probe covalently or non-covalently can be bonded to the surface of micropin by methods known in the art or the specific method of attachment described in this paper embodiment.Such as, probe can interact via such as biotin-avidin or biotin-streptavidin, a-protein interacts, protein G interacts, goat anti-mouse Fc interacts, amido link or covalently or non-covalently interacted by any other and be conjugated to micropin.Probe can have or not have suitable spacer element and covalently be attached to micropin as PEG (PEG) between probe and microneedle surface.Can easily adopt and suitably revise the conventional method for sessile antibody probe or nucleotide probe implemented in the art in enforcement of the present invention.These methods describe in the art, such as, and Mendoza etc., Biotechniques 27:778 – 786,1999; Arenkov etc., Anal.Biochem.278:123 – 131,2000; Zhu etc., Nat.Genet.26:283 – 289,2000; MacBeath etc., Science 289:1760 – 1763,2000; Jyoung etc., Biosens.Bioelectron.21:2315 – 2319,2006; Lu etc., Anal.Chem.67:8387,1995; Vijayendran etc., Anal.Chem.73:471 – 480,2001; Nakanishi etc., Anal.Chem.68:1695 – 1700,1996; Rowe etc., Anal.Chem.71:433 – 439,1999; Day etc., Bichem.J.278:735-740,1991; Fodor etc., Science 251:767-773,1991; Schene etc., Science 270:467-470,1995; Lamture etc., Nucl.Acids Res.22:2121-2125,1994; Guo etc., Nucl.Acids Res.22:5456-5465,1994; And PCT open WO00/22108, WO01/75447 and WO02/12891.
This probe can also be modified by reactivity part and be attached to the surface of the gold coating of one or more micropin.This reactivity part can be mercapto groups.In some cases, inorganic salt can be added.The example of inorganic salt includes but not limited to usually to have the lithium salts of halogen gegenion, potassium salt, sodium salt, magnesium salt and calcium salt.In some cases, this inorganic salt is sodium chloride.This inorganic salt can exist with the concentration of preferred about 0.1M to 2.0M, about 0.2M to 2.0M, about 0.2M to 1.5M or about 0.5M to 1.5M.In some cases, the concentration of this inorganic salt is less than about 0.1M, is less than about 0.2M, is less than about 0.2M, is less than about 0.3M, is less than about 0.4M, is less than about 0.5M, is less than about 1.0M, is less than about 1.1M, is less than about 1.2M, is less than about 1.3M, is less than about 1.4M, is less than about 1.5M, is less than about 1.6M, is less than about 1.7M, is less than about 1.8M, is less than about 1.9M, is less than about 2.0M, is less than about 2.5M, is less than about 3.0M, is less than about 3.5M, is less than about 4.0M or is less than about 4.5M.In some cases, the concentration of this inorganic salt is greater than about 0.1M, is greater than about 0.2M, is greater than about 0.2M, is greater than about 0.3M, is greater than about 0.4M, is greater than about 0.5M, is greater than about 1.0M, is greater than about 1.1M, is greater than about 1.2M, is greater than about 1.3M, is greater than about 1.4M, is greater than about 1.5M, is greater than about 1.6M, is greater than about 1.7M, is greater than about 1.8M, is greater than about 1.9M, is greater than about 2.0M, is greater than about 2.5M, is greater than about 3.0M, is greater than about 3.5M, is greater than about 4.0M or is greater than about 4.5M.
Catch biomarker
The micropin covalently or non-covalently being attached to probe original position can be inserted into biological sample, as the tissue in application on human skin, eye, operation, dermal capillary etc.The micropin being covalently attached to probe also can be inserted in vitro biological sample, as in the tissue that extracts in biopsy procedure.Probe can be made to hybridize with biomarker under the physiological condition of biological sample or in conjunction with specific a period of time.The concentration of glucose of the temperature range of about 20 to about 40 degrees Celsius, 1 atmospheric pressure, pH 6-8,1-20mM, atmospheric oxygen concentration and terrestrial gravitation can be the examples of the physiological condition of most subjects.Probe and biological sample can be made to hybridize or combine at least 1 minute, at least 2 minutes, at least 3 minutes, at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 25 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 5 hours, at least 10 hours or at least 24 hours.In some embodiments, probe and biological sample can be made to hybridize and to be no more than 1 minute, be no more than 2 minutes, be no more than 3 minutes, be no more than 5 minutes, be no more than 10 minutes, be no more than 15 minutes, be no more than 20 minutes, be no more than 25 minutes, be no more than 30 minutes, be no more than 1 hour, be no more than 2 hours, be no more than 3 hours, be no more than 5 hours or be no more than 10 hours.The micropin with the probe covalently or non-covalently connected can from biological sample as application on human skin removes.Can be separated with the biomarker of probe hybridization or combination from biological sample by removing micropin from application on human skin.
Detect biomarker
Embodiments more of the present invention relate to detection polynucleotide biomarker (such as, mRNA, DNA).In these embodiments, the probe (such as, oligonucleotide probe, polynucleotide probes) for one or more biomarkers easily can synthesize based on the sequence of target biomarker.Once the probe of biological nucleic acid mark in microneedle devices of the present invention is combined, they are usually experienced amplified reaction (such as, PCR, reverse transcription PCR) or are detected by the label of labelling.The label of labelling can directly be connected with the probe being attached to micropin, or in some cases, and the label of labelling is combined with biomarker after the probe that it has been attached to micropin is caught.
The conventional many methods implemented easily can be used for the biological nucleic acid mark obtained from experimenter that increases in the art.These methods comprise, such as polymerase chain reaction (PCR) or reverse transcription PCR.Generally see PCR Technology:Principles and Applicationsfor DNA Amplification (H.A.Erlich compiles, Freeman Press, NY, NY, 1992); PCR Protocols:A Guide to Methods and Applications (volume such as Innis, Academic Press, San Diego, CA, 1990); Mattila etc., Nucleic Acids Res.19,4967 (1991); Eckert etc., PCR Methods and Applications 1,17 (1991); PCR (volume such as McPherson, IRL Press, Oxford); With United States Patent (USP) 4,683,202 (its each be all incorporated to by reference in order to all objects).Other suitable amplification method comprises ligase chain reaction (LCR) (see Wu and Wallace, Genomics 4,560 (1989), Landegren etc., Science 241,1077 (1988)), transcription amplification (Kwoh etc., Proc.Natl.Acad.Sci.USA 86,1173 (1989)) sequence replicating (Guatelli etc. and are automatically maintained, Proc.Nat.Acad.Sci.USA, 87,1874 (1990)) with based on the sequence amplification (NASBA) of nucleic acid.Latter two amplification method relates to the isothermal reaction based on isothermal transcription, its respectively using about 30 or 100:1 ratio produce single stranded RNA (ssRNA) and double-stranded DNA (dsDNA) as amplified production.Once amplification, then can easily confirm the identity of the biomarker of catching by the such as standard technique such as sequence analysis, electrophoresis subsequently.
Embodiment more of the present invention uses PCR to detect and probe hybridization or the biomarker that is otherwise connected.Several order of magnitude can be crossed over by PCR to the amplification of biomarker, sometimes from the single of target or several copy, produce the thousands of to millions of copies of specific dna sequence.PCR can adopt thermal cycle, and it comprises and to unwind for DNA and the circulation of Repeat-heating that the enzymatic of DNA copies and this reaction of cooling.These thermal cycles operation can be called as in the process that DNA unwinds at high temperature two chains in physically DNA isolation Double helix.At a lower temperature, every bar chain can be used as template, with the target DNA that optionally increases subsequently in the DNA synthesis undertaken by archaeal dna polymerase.The selectivity of PCR may be cause with the primer (short dna fragment) preparing the region of DNA territory complementation of increasing by using under particular thermal cycling condition.
Increase with repeatability containing can be used for realizing selectivity with the primer of the sequence of interested biomarker complementation together with archaeal dna polymerase.Along with PCR carries out, the DNA of generation as the template copied, can start the chain reaction of wherein DNA profiling exponential amplification.PCR application can adopt heat-staple archaeal dna polymerase, and as Taq polymerase, this is a kind of initial enzyme be separated from antibacterial thermus aquaticus (Thermus aquaticus).This archaeal dna polymerase can assemble new DNA chain from nucleotide enzymatic, such as, by using single stranded DNA as template and using DNA oligonucleotide (also referred to as DNA primer) to start DNA synthesis.
PCR reaction can directly be carried out being inserted on the micropin in biological sample.Such as, micropin can be placed in the pipe comprising the required reagent of PCR reaction or between two boards (such as microscope slide).By multiple diverse ways, biomarker departed from from pin and be discharged in PCR pipe.Such as, micropin can be heated to discharge biomarker from micropin, or biomarker spontaneously can be released in PCR solution from pin.PCR reaction can be carried out as mentioned above, and can standardization program be used, such as electrophoresis, PCR in real time and other program, as at PCR Technology:Principles and Applications for DNA Amplification, (H.A.Erlich compiles, Freeman Press, NY, NY, 1992), the PCR Protocols:AGuide to Methods and Applications (volume such as Innis, Academic Press, SanDiego, CA, 1990) program described in, analyzes PCR primer.Different PCR method can be used to analyze this sample, such as standard pcr and real-time PCR method.PCR in real time (RT-PCR) is the laboratory technique of PCR-based, and it may be used for increasing and quantizes the DNA molecular of targeting simultaneously.PCR in real time can be combined with reverse transcription, with the messenger RNA in quantization cell or tissue and non-coding RNA.
In some embodiments, device of the present disclosure can be configured to comprise the compartment that at least one can carry out PCR reaction further.Such as, device of the present disclosure can be configured to comprise multiple micropin or microneedle array and can carry out the compartment of PCR reaction wherein.
PCR reacts the biomarker of having hybridized with specific micropin that optionally increases, or PCR reacts the one group of biomarker of having hybridized with multiple micropin that can increase.Such as, 402 surfaces showing the apparatus of the present invention comprising multiple micropin contacted with biological sample.Each " square " in 402 shows single micropin, and wherein each independent micropin comprises at least one probe.Each probe in 402 can be hybridized with biomarker or not hybridize.Each micropin shown in 402 can be placed in independent PCR pipe and can analyze each PCR primer individually.Or the multiple micropins shown in 402 can be placed in same PCR pipe for analyzing simultaneously.
In some cases, the biomarker of catching detects by using the probe of the labelling that can be combined with the biomarker of catching.In some cases, after biomarker is caught by the probe being attached to micropin as herein described, the probe of labelling is combined with this biomarker.In some cases, micropin is directly attached to probe, this probe be designed to when with biomarker in conjunction with time change the labelling labelling in addition of its optical signal (or reduce or gain in strength).
The probe of labelling can comprise can the labelling (such as, fluorogen, radiosiotope etc.) of utilizing emitted light signal.Fluorescing fractions can be fluorescin, as green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescence protein (YFP) or its variant.In some cases, the probe of labelling comprises the labelling when probe and its target increase in conjunction with optical signal or reduce.Fluorescing fractions can be the RNA aptamers be combined with fluorogen.RNA-fluorogen complex can launch the optical signal crossing over visible spectrum, see Paige etc., Science 333, and 6042 (2011).Such as, " Herba Spinaciae (Spinach) aptamers sequence " is the RNA analogies of the GFP that can be configured to the emitting fluorescence optical signal when hybridizing with biomarker.
In some embodiments, comprise one group wherein micropin that is non-covalent or covalently bound probe can be used for detecting the biomarker in experimenter.Such as, device of the present disclosure can with the contact skin of experimenter.This device can comprise the polynucleotide probes containing RNA-fluorophore-part.RNA-fluorophore-part can be configured to the utilizing emitted light signal when hybridizing with interested biomarker, as fluorescence signal.
Protein or peptide biomarker detect by as well known to those skilled in the art for any means in many methods of polypeptide detection and quantize.These methods comprise mensuration form, as protein PCR and ELISA.Local and general protein and peptide biomarker all can use microneedle array device of the present invention to measure.Other method being suitable for this object comprises analytical biochemistry method as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), super diffusion chromatography, mass spectrography etc., or other immunological method various is as fluid or the reaction of gel precipitation element, immunodiffusion (single or two), immunohistochemistry, affinity chromatography, immunoelectrophoresis, radioimmunoassay (RIA), immunofluorescence assay, western blot method, test paper method (dipstick) etc.Generality about immunoassay is summarized, and refers to Methods in Cell Biology the 37th volume: Antibodies in Cell Biology, Asai compile Academic Press, Inc.New York (1993); Basic and Clinical Immunology the 7th edition, Stites and Terr compile (1991); IMMUNOASSAYS FOR THE 80s.Voller, A. etc. (volume), Baltimore:University Park Press (1981); Maggio etc., ENZYME-IMMUNOASSAY, Boca Raton:CRC Press pp 172-176 (1980) and Tijssen, Laboratory Techniques in Biochemistry and MolecularBiology:Practice and Theory of Immunoassays, vol 15, Elsevier 1985.For carry out with any specific protein or peptide biomarker (such as, antibody) reagent of measuring of relevant these can easily be obtained from commercial source or be produced by standard and the conventional technology (such as, for the production of the hybridoma technology of monoclonal antibody) implemented.
Binding interactions between probe and biomarker can use the second detectable such as second antibody to detect.Such as, " sandwich ELISA " can be used for the combination detecting biomarker and antibody probe.Biomarker and the combination of probe can use to be had specific detection antibody to the different epi-positions of this biomarker and detects.The antibody used in the detection can be the isotype different from the antibody being used as probe, and such as, antibody probe can be IgG antibody (comprising its any hypotype, as IgG1, IgG2, IgG3 and IgG4), and second antibody can be IGA, IgM.Detect antibody can such as with detectable label as fluorescing fractions or radioactive label are puted together.Based on the detection method of antibody, as enzyme-linked immunosorbent assay (ELISA) method, can be used for the combination of detector probe and biomarker.
Protein and peptide biomarker also can use protein round pcr to measure.Such as, in such applications, a kind of mensuration being suitable for detecting biomarker is PCR-ELISA scheme.This mensuration adopts standard immunoassay to measure program.Capture antibody is attached to the surface of the micropin of this device.Not that operation report enzyme develops to analytic signal, but second antibody and the single stranded oligonucleotide that can use PCR to increase subsequently are merged.To insert and after catching biomarker, by add oligonucleotide marker second antibody and subsequently to the pcr analysis of the label puted together to detect the existence of this biomarker.
diagnostic application and relevant test kit
Apparatus and method as herein described can be used for detecting and catching biomarker in multiple diagnostic application.These application comprise, the detection of such as dermopathic diagnosis, circulation genetic marker and the detection of protein or peptide biomarker.As an example, this device can be advantageously used in be suffered from CMM (CMM) in suspection or is in the diagnosis of CMM in the experimenter in the risk of development CMM.In such applications, for CMM specific biomarkers probe can with micropin coupling.Then, the device of the micropin containing one or more probe conjugate can be applied directly to all birthmarks (nevus) on subjects skin.This device is removed from each nevus, and on device, measures any biomarker of being caught by micropin afterwards in situ or from device separation subsequently.Device of the present disclosure can be applied for diagnosis and prognosis clinically.
As another embody rule, apparatus and method as herein described are used for the rim detection in skin carcinoma excision process.In these embodiments, described device comprises the micropin of the probe conjugate of different length.With these devices to the detection of tumour-specific biomarker with measure and can inform that surgeon invades the degree of skin, subcutaneous and lower space about tumor.These application avoid the current histopathological examination repeatedly determined in cutaneous tumor excision needed for edge.In some cases, the method does not comprise the biopsy of skin.
Method and apparatus of the present invention can be used for diagnosis and/or the treatment of skin.These methods can comprise makes micropin contact with the skin histology of experimenter.Skin can be benign condition, premalignant condition or malignant condition.Skin can be health status.The limiting examples of skin comprises: skin carcinoma is as melanoma and Mohs skin carcinoma (Mohs skin cancer); Onchocerciasis; Lupus; Measles (rubeola) (measles (measles)); Hemangioma; Psoriasis; Rosacea; Seborrheic eczema; Urticaria, vitiligo; Wart; Necrotizing fasciitis; Dermatocandidiasis; Carbuncle; Cellulitis; Hypohidrosis; Impetigo; Cutis laxa; Decubital ulcer; Erysipelas; Pompholyx eczema; Recurrent canker sores; Birthmark; Herpetic stomatitis; Ichthyosis vulgaris; Acne; Cold bleb; Dermatomyositis; Molluscum contagiosum; Acrodermatitis; Sebaceous cyst; Seborrheic keratosis; Hide hair hole; Keloid; Lichen planus; Actinic keratosis; Stasis dermatitis; Skin clavus and callus; Eczema; Tinea versicolor; Pemphigoid; Ulcer; Or herpes zoster.Method and apparatus of the present invention can be used for the multiple eye condition of Diagnosis and Treat, as uveitis, xerophthalmia, retinal diseases, glaucoma, inflammatory diseases.Device of the present invention can be used for cancer staging.Cancer can be 0 phase, I phase, II phase, III phase or IV phase by stages.
Method and apparatus of the present invention also can be used for diagnosis and/or treatment eye condition, such as anterior corneal surface inflammation, uveitis or xerophthalmia.These methods can comprise makes micropin contact with the ocular tissue of experimenter, such as, by contact subconjunctival space.Eye condition can be benign condition, premalignant condition or malignant condition.Eye condition can be health status.The limiting examples of eye condition comprises: retinoblastoma, skin or ophthalmic (eye) melanoma, retinitis pigmentosa (RP), diabetic renal papillary necrosis, glaucoma (comprises open angle glaucoma (such as primary open angle glaucoma), angle closure glaucoma and secondary glaucoma (such as pigmentary glaucoma, PE's property glaucoma and the glaucoma caused by wound and inflammatory diseases)), detachment of retina, age related or other maculopathy, age-related macular degeneration, photic retinopathy, the retinopathy that operation is brought out, toxic retinopathy, retinopathy of prematurity, because the wound of eye or penetrance damage the retinopathy caused, hereditary retinal dystrophy, the retinopathy that operation is brought out, toxic retinopathy, because the wound of eye or penetrance damage the retinopathy caused.The concrete example of interested heritability situation is including but not limited to bar ratio two Cotards (Bardet-Biedl syndrome), congenital blindness, the cone or retinal cone-rod dystrophy, congenital stationary night blindness, degeneration of macula, optic atrophy, syndromic or systemic retinopathy and Usher syndrome.
Method and apparatus of the present invention to be used in operation technique or the expression of monitoring bio mark in cosmetic procedures.Apparatus and method of the present disclosure can be used for such as carrying out the biopsy of fragile tissue as ocular tissue or cerebral tissue.In some cases, microneedle devices can contact with the tissue of experimenter or biological sample during operation Program.This tissue or biological sample can obtain from the organ being selected from brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix uteri, prostate, kidney, intestinal, vermiform appendix and colon.In yet a further case, micropin can remove the EDGE CONTACT with tumor before or after tumor from experimenter.
As the further example of diagnostic application of the present invention, method and apparatus as herein described can be used for the detection of system in experimenter's body fluid (such as blood flow) and circulation genetic biomarkers thing.Known numerous disease (such as, mongolism) has heredity (such as, the mRNA) biomarker circulated in blood.By extending the length of the micropin in apparatus of the present invention, the probe for biomarker can by thrusting and arriving corium or subcutaneous capillary and be combined specifically with this type of biomarker.Also known other biological nucleic acid mark any be present in blood can be detected in a similar fashion.Such as, the micropin on device of the present disclosure original position can penetrate the skin of experimenter and contacts with the dermal capillary of experimenter.Dermal capillary may be the minimum blood vessel in subject, and the interior leather lining of dermal capillary can be the thickness of about one layer of cells.When the contact skin of device of the present disclosure and experimenter, this device can penetrate the film of one or more dermal capillary.In some embodiments, device of the present disclosure can be used for detecting the biomarker that circulates in blood flow and without the need to pipetting blood sample from experimenter.In some cases, device of the present disclosure can the fetus of detected status or maternal biological mark, comprises the biomarker relevant to gestation.In some cases, device of the present invention can detect the biomarker circulated in blood flow, as protein, hormone, vitamin, cofactor or polynucleotide.
The limiting examples of the hereditary conditions can diagnosed based on polynucleotide biomarker with method and apparatus of the present invention comprises: cystic fibrosis, Du Shi muscular dystrophy, hemochromatosis, Tay Sachs disease (Tay-Sachs disease), Prader-Willi syndrome (Prader-Willi syndrome), angelman syndrome (Angelman syndrome), neurofibromatosis, phenylketonuria, canavan's disease (Canavan disease), celiac disease, acid β-glucosyl enzym deficiency disease, Gaucher disease (Gaucher), charcot-Marie-Tooth disease (Charcot – Marie – Tooth disease), achromatopsia, cri du chat (Cri du chat), POLYCYSTIC KIDNEY DISEASE, craniosynostosis, familial adenomatous polyposis, disorder of adrenal gland, amyotrophic lateral sclerosis (ALS), Alzheimer, parkinson disease, anemia, ataxia, ataxia telangiectasia, autism, bone marrow disease, bonnevie-Ullrich syndrome (Bonnevie-Ullrich syndrome), brain diseases, hippel-Lindau disease (vonHippel-Lindau disease), congenital heart disease, Crohn disease, dull-witted, myotonic dystrophy, Fabry (Fabry disease), fragile X mental retardation, galactosemia, hereditary emphysema, retinoblastoma, Pendred syndrome (Pendredsyndrome), Usher syndrome, Wilson is sick, neuropathy, Huntington Chorea, disorder of immune system, gout, the spino-bulbar muscular atrophy that X is chain, learning disability, li-Fraumeni syndrome (Li-Fraumeni syndrome), lipase D lacks, Lou Gehrig is sick, Marfan syndrome (Marfan syndrome), metabolism disorder, Niemann-Pick disease (Niemann-Pick), Noonan syndrome (Noonan syndrome), osteogenesis imperfecta, Peutz Jeghers syndrome (Peutz-Jeghers syndrome), Pfeiffer syndrome (Pfeiffer syndrome), porphyria, senilism disease, Rett syndrome, tuberous sclerosis, speech and communication disorder, spinal muscular atrophy, Te Leiche Collins syndrome (Treacher Collins syndrome), trisomy and monosomy.
In some cases, probe of the present invention can be used for detecting immune situation.Device of the present invention can be used for allergy and detects, to confirm or to get rid of allergy.In some cases, device of the present invention can be used for analyzing allergy group.The limiting examples of immunologic derangement comprises: HIV, diabetes, parkinson disease, Alzheimer, rheumatoid arthritis, lupus, cancer, multiple sclerosis, inflammatory bowel, psoriasis, scleroderma, autoimmune thyroid disease, vasculitis, pernicious anemia, severe combined immunodeficiency (SCID), DiGeorge syndrome (DiGeorge syndrome), Hyperimmunoglobulin E syndrome, common variable immunodeficiency, chronic granulo matosis, Wiskott-Aldrich syndrome (Wiskott-Aldrich syndrome), autoimmunity lymphoproliferative syndrome (ALPS), high IgM syndrome, leukocyte adhesion deficiency (LAD), required modulation protein (NEMO) disease of NF-κ B, selectivity immunoglobulin A lacks, the agammaglobulinemia that X is chain, the lymphoproliferative disease that X-is chain, asynergy-capillary dilation, seasonal allergy, mastocytosis, perennially allergy, anaphylaxis, food allergy, allergic rhinitis and atopic dermatitis.
In some embodiments, apparatus and method of the present invention can be used for diagnosing the multiple biomarker relevant to kinds cancer.The limiting examples of cancer can comprise: acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, the cancer that AIDS is relevant, the lymphoma that AIDS is relevant, anus cancer, vermiform appendix cancer, astrocytoma, basal cell carcinoma, cancer of biliary duct, bladder cancer, osteocarcinoma, brain tumor is as cerebellar astrocytoma, cerebral astrocytoma/glioblastoma, ependymoma, medulloblastoma, primitive neuroectodermal tumor on curtain, pathways for vision and hypothalamus glioma, breast carcinoma, bronchial adenoma, Burkitt lymphoma, the cancer in unknown former initiation source, central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disease, colon cancer, cutaneous T cell lymphoma, desmoplastic small round cell tumor, carcinoma of endometrium, ependymoma, the esophageal carcinoma, Ewing sarcoma, germ cell tumor, carcinoma of gallbladder, gastric cancer, gastrointestinal associated cancers tumor, gastrointestinal stromal tumor, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocyte (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, islet-cell carcinoma, Kaposi sarcoma, renal carcinoma, laryngeal carcinoma, lip and oral cancer, liposarcoma, hepatocarcinoma, pulmonary carcinoma is as non-small cell and small cell lung cancer, lymphoma, leukemia, macroglobulinemia, bone malignant fibrous histiocytoma/osteosarcoma, medulloblastoma, melanoma, mesothelioma, recessive constitutional transitivity squamous neck cancer, mouth cancer, multiple endocrine neoplasia syndrome, myelodysplastic syndrome, myeloid leukemia, nasal cavity and nasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin lymphoma, nonsmall-cell lung cancer, oral cancer, oropharynx cancer, osteosarcoma/malignant fibrous histiocytoma of bone, ovarian cancer, epithelial ovarian cancer, ovarian germ cell tumors, cancer of pancreas, cancer of pancreas islet cells, paranasal sinus and tumor of nasal cavity, parathyroid carcinoma, carcinoma of penis, pharyngeal cancer, pheochromocytoma, pinus astrocytoma, Pineal Germ-cell Tumor, pituitary adenoma, pleuropulinonary blastoma, plasmocytoma, primary central nervous system lymphoma, carcinoma of prostate, rectal cancer, renal cell carcinoma, renal pelvis and transitional cell carcinoma of ureter, retinoblastoma, rhabdomyosarcoma, salivary-gland carcinoma, sarcoma, skin carcinoma, skin carcinoma Merkel cell, carcinoma of small intestine, soft tissue sarcoma, squamous cell carcinoma, gastric cancer, t cell lymphoma, laryngeal carcinoma, thymoma, thymic carcinoma, thyroid carcinoma, Trophoblastic (gestation), the cancer of unknown original site, carcinoma of urethra, sarcoma of uterus, cancer of vagina, carcinoma vulvae, macroglobulinemia Waldenstron ( and nephroblastoma (Wilmstumor) macroglobulinemia).
Device of the present disclosure can be used for independently diagnostic method, or diagnoses as the adjoint of information provided about therapeutic treatment.Micropin of the present disclosure and method provide Wicresoft, fast and accurately diagnostic method and Therapeutic Method.In addition, apparatus and method disclosed herein can provide portable to multiple experimenter, no pain and affordable diagnosis.Experimenter of the present invention can be any age, comprises such as older adults, adult, teenager, preadolescence, child, child and baby.Experimenter of the present invention can be mammal, bird, fish, reptile or Amphibian.The limiting examples of experimenter comprises people, primate, Canis familiaris L., cat, horse, pig and mice.
Experimenter can provide multiple biological sample to analyze for use micropin of the present invention.The analysis of the biological sample of experimenter can original position or carry out in vitro.Such as, in-situ study can comprise and makes micropin of the present invention directly and the contact skin of experimenter.Ex vivo analyses can comprise makes micropin of the present invention contact with biopsy.In some embodiments, the biomarker analysis using micropin of the present invention and method to carry out needs about 1mg, about 5mg, about 10mg, about 15mg, about 20mg, about 25mg, about 30mg, about 35mg, about 40mg, about 45mg, about 50mg, about 55mg, about 60mg, about 65mg, about 7mg, about 75mg, about 80mg, about 85mg, about 90mg, about 95mg or about 100mg biological sample.
In some embodiments, method of the present invention and micropin need to be no more than about 1mg to about 5mg, be no more than about 1mg to about 10mg, be no more than about 1mg to about 20mg, be no more than about 1mg to about 30mg, be no more than about 1mg to about 40mg, be no more than about 1mg to about 50mg, be no more than about 50mg to about 60mg, be no more than about 50mg to about 70mg, be no more than about 50mg to about 80mg, be no more than about 50mg to about 90mg, be no more than about 50mg to about 100mg, be no more than about 100mg to about 1g, be no more than about 100mg to about 2g, be no more than about 100mg to about 3g, be no more than about 100mg to about 4g, be no more than about 100mg to about 5g, be no more than about 100mg to about 6g, be no more than about 100mg to about 7g, be no more than about 100mg to about 8g, be no more than about 100mg to about 9g, be no more than about 100mg to about 10g, be no more than about 1g to about 2g, be no more than about 1g to about 3g, be no more than about 1g to about 4g, be no more than about 1g to about 5g, be no more than about 1g to about 6g, be no more than about 1g to about 7g, be no more than about 1g to about 8g, be no more than about 1g to about 9g or be no more than about 1g to about 10g biological sample.
In some embodiments, extra mensuration is used to verify the discriminating based on the biomarker differentiated by micropin of the present disclosure and method and the diagnosis made.Can verify that the limiting examples of the mensuration of biomarker comprises: a) the interactional mensuration of evaluating protein matter and DNA, as DNA enzymatic footprint measures and Gel migration mensuration; B) assess the mensuration of the integrity of RNA molecule, measure as core joins together; C) endpoint determination, it can measure the final result of this mensuration quantitatively or qualitatively; D) kinetic determination, it can be assessed and compare the kinetics of bioprocess at multiple interval to the reading of data point; E) semiquantitative determination, it provides the reading can carrying out quantizing under certain background, as western blot method, blood coagulation and CA; F) immunoassay, the response of its assessment antigen-antibody conjunction type reaction; G) enzyme assay, its test function and activity; H) colony forming assay, its can test cell propagation and differentiation ability; I) counting measures, as Flow Cytometry Assay; With j) multiple PCR measures, as PCR in real time.
In addition, method of the present disclosure can comprise further and detects one or more biomarkers from the reference tissue available from experimenter.Such as, the method can comprise from sample tissue and reference tissue detection biomarker.Reference tissue can be benign tissue.In some cases, reference tissue is the tissue in organ from identical with sample tissue or region.In some cases, sample tissue comprises suspection and has the tissue of disease or disease (such as, malignant tumor) and reference tissue comprises the known tissue without the homolog of this disease or disease.In some cases, the level of the biomarker in the sample tissue detected can compare with the level of the biomarker in the reference tissue detected further.
In some cases, device of the present disclosure can use remove tumor and/or differentiate borderline tumor at intra-operative.Device of the present invention can be used for original position or characterizes the tissue and organization edge with different shape in vitro.Such as, in the operation of Mohs skin carcinoma, wherein usually by Histological method, tissue to be removed, cut into slices and evaluate, the edge of device analysis tumor of the present invention can be utilized.In some cases, device of the present invention by analyze tissue edge and for differentiating cancer metastasis.
Apparatus and method of the present disclosure can be used for carrying out personalization to medical applications.Experimenter can provide a certain amount of such as skin samples to clinician.Clinician can use device of the present disclosure to detect the multiple biomarker relevant to the skin of experimenter.Clinician can use the biomarker through differentiating to determine the therapeutic effect of the expection to particular subject.Apparatus and method of the present disclosure also can be used for monitoring experimenter to the reaction of particular treatment, such as, by increase or the minimizing of monitoring bio marker expression.Clinician can rely on the increase of biomarker expression level or reduce the effectiveness of determining to treat.Device of the present invention can be used for the expression of measuring biomarker quantitatively.Such as, quantitative PCR can be used increase the copy number of the biomarker of hybridizing with the polynucleotide probes on micropin.The micropin do not contacted with biological sample or hybridize can be used as negative control.Standard control such as the micropin of housekeeping gene with known quantity can as the positive control of reaction.Quantitative PCR can as The PCR Technique:Quantitative PCR, and James W.Larrick, June 1997, Eaton carries out described in Publishing.
Apparatus and method of the present disclosure can be used in biophylaxis.Biophylaxis can comprise the release or propagation that detect biological or chemical material.These materials can be antibacterial, virus or toxin, and can be naturally occurring or manually modified forms.Device of the present disclosure can be used for detecting the relevant biomarker of the multiple pathology agent to using in biological war.
Biological and/or chemical warfare agent can comprise can be used as such as causing terror, any biology of confusion, disease, discomfort and/or dead weapon and/or chemical entities.The limiting examples of chemistry and biological agent comprises anthrax; Variola; Tularemia; Bird flu; Mus epidemic disease; HIV; Ebola virus; Foot and mouth disease; Ricin; Neurotoxicity organophosphorus compounds; Cyanide; Blister agent (or vesicant agent), as mustard gas and routes optimal choice; ASPHYX, as chlorine photoreactive gas; Never poison, as sarin, tabun (Tabun), soman (Soman) and VX; Hallucinogen, as BZ; Insecticide, as parathion, Malathion and Bayer 17147; And derivant or combination.
Invention further provides the test kit for carrying out diagnostic application as herein described.This test kit comprises the microneedle devices containing one or more micropin usually.In some test kits, micropin with to detecting one or more biomarkers has specific probe conjugate.In some other test kits, become to assign to provide as independent for the probe that detects one or more biomarkers and the reagent for they and micropin are puted together.Test kits more of the present invention are intended to a kind of specific biomarkers (such as, for the close speckle protein-3 mRNA of human primary gastrointestinal cancers) for detecting and catch for known disease or disease.In these test kits, the micropin of this device usually with or will put together with identical probe molecule the oligonucleotide of the complementation of target biomarker (such as, with).Other test kit more of the present invention is designed to detect the multiple biomarker relevant to one or more diseases or disease.In these test kits, the different probe for different biomarker is conjugated to or prepares the micropin being conjugated to this device.Except microneedle devices and probe, test kit of the present invention also can comprise for applying this device or other reagent (such as, for the reagent of the pcr amplification of biomarker) for analyzing captured biomarker to experimenter.This test kit also can comprise the description (such as, about the packaging material of the explanation page in test kit or test kit) about using this test kit to carry out the diagnostic application of expecting.
Device of the present invention can be packaged as test kit.In some embodiments, test kit comprises about this device of use treatment situation as the printed instructions of basal cell carcinoma.This written material can be, such as label.This written material can provide suggestion to the condition and method using micropin and the additive reagent comprised in test kit.This description provides the best about the optimum detection realizing biomarker to instruct to experimenter and supervision doctor.
Test kit of the present disclosure can comprise device as herein described and the group reagent for polymerase chain reaction.The group reagent that test kit of the present disclosure can comprise device as herein described and measure for ELISA.Test kit can be designed for differentiates specific situation, as basal cell carcinoma, or test kit can be designed for the multiple situations such as such as squamous cell carcinoma, Kaposi sarcoma, melanoma, basal cell carcinoma and actinic keratosis (tendency of squamous cell carcinoma) while diagnosis.In some cases, test kit of the present disclosure can comprise device of the present invention and written material.In some cases, test kit of the present disclosure can comprise device of the present invention, one group of probe and can be used for probe to be connected to a group reagent of micropin.
Test kit of the present disclosure can comprise the positive and negative control.Positive control can be, such as, comprise the sample of known organism mark.Positive control can be the polynucleotide of known array, as the polynucleotide of the known SNP relevant to basal cell carcinoma.Negative control can be, such as mixed and disorderly (scrambled) polynucleotide sequence.In some cases, test kit can comprise the reagent (such as polypeptide, polynucleotide) of concentration known or amount, and it can be used to production standard curve to quantize the amount of the biomarker existed in tissue or biological sample.This kind of reagent can also use together with any method provided herein.
animal model
Animal model can be used develop for many medicines of disease, treatment and healing.Animal model can be the live animal used in the research and fact-finding process of disease.The pharmacopedics exploitation of medicine can be included in the research of undetected toxicity and adverse side effect in test cell line.Animal model can be used for evaluating effect of Drug therapy, absorption, metabolism, distribution, excretion, toxicity, pharmacology and side effect.Apparatus and method of the present invention can be used for differentiating that biomarker on animal model is to the response of Drug therapy.
Animal model can provide guidance to selection medical compounds for assessing further.Such as, animal model can provide guidance to the pharmacokinetics in the mankind/metabolism research.Animal model may be used for such as absorbing, distribute, metabolism, excretion and toxicology (ADMET) parameter evaluation, apply with supportive test new drug (IND).Research in animal model such as can cause the compound selecting to evaluate further in preclinical test and clinical trial.
clinical intervention and clinical trial
Device of the present disclosure can use in clinical trial.Such as, device of the present disclosure can be organized for differentiating what be difficult to arrive maybe can not excise and remove for the biomarker in the tissue of biopsy during operation technique.Such as, device of the present disclosure can be used for detecting the biomarker be exposed to during operation technique in the cardiovascular organization of clinician, cerebral tissue or internal.In some cases, device of the present invention can prevent medical complication, otherwise when clinician removes tissue for there is this medical complication during biopsy from experimenter.Device of the present disclosure can use or be used by experimenter in experimenter family in such as regular medication is seeked advice from, during operation technique.Device of the present invention can use in such as cardiovascular surgical procedure or eye surgery.
Device of the present disclosure can use in the design of clinical trial protocol.Such as, device of the present disclosure can use together with clinical trial, to detect the level of biomarker and to monitor the response of experimenter to Drug therapy.Device of the present disclosure can provide guidance to the design of exploitation and clinical trial before clinical, enforcement and analysis.This disclosure provides the method differentiated and quantize the biomarker can selected in order to optimal application treats compounds effective.
Device of the present disclosure can be used for prediction experimenter in clinical trial to the response of different pharmaceutical dosage.Such as, by monitoring ocular tissue, biomarker is as the increase of the level of the biomarker of retinal diseases or minimizing, method and apparatus of the present invention can establish the curative effect of Drug therapy to retinal diseases.In some cases, based on the clinical trial carrying out or change therapeutic agent with device of the present disclosure to the detection of biomarker.In some cases, method and apparatus of the present disclosure can be used to compare the treatment evaluated in clinical trial and known standard looks after treatment.
Clinical trial carries out several step usually, comprises preclinical study, preliminary study, safety screening study and Efficacy Evaluation.For issued for approval and the medicine of listing, usually must meet all milestones of specifying in clinical trial protocol, be included in the proof of the effect in the confidence interval of proposition, and the individuality comprising significant number is to prove statistical power of the present invention.The limiting examples of application of the present invention is included in whole clinical trial process monitors multiple biomarker.How apparatus and method of the present disclosure can affect the expression of biomarker at the commitment (with the I phase before clinical) of clinical trial if also can be used for monitoring different pharmaceutical treatment.
Apparatus and method of the present disclosure also can be used to the expression based on the biomarker differentiated and predict the change of the potential cellular pathways by medication affect.The limiting examples of the pharmacodynamics and pharmacokinetic parameter that can affect the Drug therapy of potential cellular pathways comprises: a) dosage, and it can be expressed as dosage D; B) dosing interval, it can be expressed as τ; C) drug distribution apparent volume wherein, it can be expressed as volume of distribution V d, wherein V d=D/C 0; D) medication amount in the blood plasma of given volume, it can be expressed as concentration C 0or C ss, wherein C 0or C ss=D/Vd; E) the half-life t of medicine 1/2, wherein t 1/2=ln (2)/k e; F) the speed k that removes in body of medicine e, wherein k e=ln (2)/t 1/2=CL/V d; G) the infusion rates K needed for equilibrium equation in, wherein K in=C ss.CL; The integration of the concentration-time curve h) after single dose administration, it can be expressed as AUC 0-∞, wherein or being in stable state, it can be expressed as AUC τ , ss, wherein remove the volume of the blood plasma of medicine in time per unit, it can be expressed as CL (removing), wherein CL=V d.k e=D/AUC; J) the whole body available scores of medicine, it can be expressed as f, wherein k) the peak plasma concentrations C of medicine after administration max; L) medicine reaches C maxinstitute time spent t max; M) the least concentration C using subsequent dose prodrug and reach min; And peak valley fluctuation n) in the steady state in a dosing interval, it can be expressed as % P T F 100. ( C m a x , s s - C m i n , s s ) C a v , s s Wherein C a v , s s = A U C τ , s s τ .
Embodiment
The following example is provided to be to further illustrate the present invention and its scope unrestricted.
ssDNA in the probe in detecting solution that embodiment 1. is fixed with Merlon
This embodiment describes with the functionalized Merlon of DNA probe and from solution specificity catch the application of ssDNA.
The attachment of DNA probe and Merlon: first carry out nitrated to the surface of Merlon and reduce, is further used for being attached the amino (Fig. 1) of commercially available sulfydryl/amino bifunctional linker to introduce.To there is the DNA of 3' sulfydryl modification and the connector coupling tied on Merlon subsequently.
DNA visual that the 5'-Cy5 being attached to Merlon modifies: in order to carry out visual to the DNA on polycarbonate surface, uses above-mentioned chemistry to be attached at 5' with a Cy5 modification and at the DNA of 3' sulfydryl modification.Carry out imaging (Fig. 2) with Laser Scanning Confocal Microscope inspection to monolayer 5'Cy5-DNA, the success of display surface is functionalized.The external of ssDNA on the Merlon modified with specificity DNA probing needle catches: the ability of catching (hybridization) ssDNA in order to test the DNA probe being attached to Merlon from solution specifically, polycarbonate disc is modified with the DNA probe of the regional complementarity with single-stranded cyclic DNA (ssDNA, about 3.4kb size).After the dish modified is hatched together with ssDNA solution, thoroughly this dish of washing, is discharged the ssDNA of hybridization from dish by high-temperature denatured and quantized by quantitative PCR (qPCR).The amount of the DNA that the Merlon modified with specificity DNA probing needle is caught is represented as and the quantity of the catch on the Merlon only modified with connector---the ratio (Fig. 1) of ground control.
What obtain from this research the results are summarized in table 1.Data show, and under the ssDNA concentration (concentration change is more than 6log) of all tests, ssDNA target is successfully enriched on specific probe.
Table 1. is expressed as and reclaims the capture rate with the ratio reclaimed from the DNA of the dish only modified with connector from the DNA of the dish with specific probe.
The materials and methods used in this research is hereafter being described in detail.
Merlon derivatization: Merlon is at 30%HNO 3in 65 DEG C of vibrations 30 minutes in aqueous solution, then fully wash with water.Nitrated Merlon (step 1) is immersed in 10%NaBH 4in aqueous solution and at room temperature shaken overnight, finally fully washs with water.Amido modified Merlon (step 2) is immersed in the solution of 6.4mM sulfo group-GMBS (Pierce) in PBSpH 7.2 and also at room temperature vibrates 1.5 hours, finally fully wash with water.
The deprotection of DNA mercapto groups: DNA holds purchased from IDT and at 3' has sulfydryl modification thing C3S-S.In order to make sulfydryl modification deprotection, 100 μMs of aqueous dnas of 5 μ L at room temperature process 30 minutes with the 100mM 2 mercapto ethanol of 25 μ L in PBS pH 8.1.In order to the DNA of purification deprotection, the PN buffer that 600 μ L remove test kit from Qiagen nucleotide is joined in reactant mixture, adds isopropyl alcohol (250 μ L) subsequently.This solution is applied to Qiagen nucleotide to remove on the silica column of test kit, and washs according to the description of test kit, use PBS pH 7.2 eluting of 35 μ L subsequently.DNA is to the attachment of Merlon: be applied to by the solution (step 4) of the DNA of the sulfydryl modification of deprotection immediately on the Merlon modified with maleimide connector (step 3) hatch 45 minutes at 37 DEG C in the atmosphere of humidity, then fully washs with water and air-dry.
The DNA's that Cy5 modifies is visual: use above-mentioned chemistry, will hold with a Cy5 modification at 5' and hold the 25 aggressiveness DNA with sulfydryl modification to be attached on the surface of Merlon at 3'.Fully washing with water and after drying, Merlon be installed on microscope slide also with using the Laser Scanning Confocal Microscope of far infrared light filter to carry out imaging.The edge in the region of the DNA modification on effects on surface positions and imaging, clearly demonstrates the effect of modifying with the DNA single layer of Cy5 labelling.
SsDNA on the Merlon functionalized with specificity DNA probing needle catches: use said procedure (step 1-4), the DNA probe (5'-CAAGTTTGCCTTTAGCGTCAGACTGTATTTTTTTT/ThioMC3/-3') (SEQ ID NO:1) at 3' with sulfydryl modification is attached to polycarbonate disc.Dish for negative control experiment only carries out modifying (step 1-3) with connector.Dish to be immersed in the ring-type ssDNA that is separated from the filobactivirus solution (about DNA concentration see table 1) in SSC buffer 3x (150mM NaCl, 15mM sodium citrate) and hatch 10 minutes at 37 DEG C.This dish is washed subsequently with three kinds of lavation buffer solutions.Lavation buffer solution 1:1x SSC+0.03%SDS; Lavation buffer solution 2:0.2x SSC, lavation buffer solution 3:0.05xSSC.After washing, dish to be immersed in the sterile distilled water of minimum volume and to heat 2 minutes at 90 DEG C, after this from the still warm water of dish removal.Use, to the p3 gene of filobactivirus, there is specific primer, utilize qPCR to quantize the ssDNA in aqueous solution equal portions.
puting together of embodiment 2.DNA probe and stainless steel surfaces
This embodiment describes the attachment of the stainless steel surfaces that the DNA oligomer probe containing 3' sulfydryl modification applies with gold.The stainless attachment that DNA probe applies with gold: easily modify gold surface by the single stranded DNA being attached sulfydryl derivatization.The sulphur atom of sulfhydrylation DNA form forms covalent bond with gold.DNA visual on the rustless steel of gold coating: in order to the DNA on the rustless steel sample surfaces that apply gold carries out visual, use fluorescently-labeled dUTP to carry out filling PCR and react with the complementary strand of synthesizing single-stranded DNA.Gained double-strand oligomer contains alexa multiple copies of 488-5-dUTP, it is similar to fluorescein, fluoresces in green channel.Fluorescence microscopy demonstrates the success functionalized (Fig. 3) of the stainless steel surfaces of gold coating.
The materials and methods used in this research is hereafter being described in detail.
The deprotection of DNA mercapto groups and puting together with stainless: DNA holds purchased from IDT and at 3' has sulfydryl modification thing C3S-S.In order to make sulfydryl modification deprotection, the 100mM 2 mercapto ethanol of 100pM aqueous dna 25pL in PBS pH 8.1 of 5pL at room temperature processes 30 minutes.In order to the DNA of purification deprotection, the PN buffer that 600pL removes test kit from Qiagen nucleotide is joined in reactant mixture, adds isopropyl alcohol (300pL) subsequently.This solution is applied to Qiagen nucleic acid to remove on the silica column of test kit, and washs according to the description of test kit, use TE buffer (the 10mM Tris of 24pL subsequently; 1mM EDTA) pH 7.2 eluting.
Immediately the DNA solution of the sulfydryl modification of deprotection is applied in the gold surface of a slice rustless steel (about 5mm x 2.5mm).Solution is hatched 16-20 hour in the atmosphere of humidity at 37 DEG C, then fully washs with water, air-dry subsequently.
Filling-in for amplification fluorescent signal: surface 75bp single stranded DNA oligomer (5'-GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCGCCTGTGGGCG AC TAAATTCCGTTAAAGCCGGC/ThiolMC3/-3') (the SEQ ID NO:2) at 3' end with sulfydryl derivatization being attached to the gold coating of rustless steel sample.Rustless steel sample also, after drying, is placed in 0.5mL pipe by washing.Add 48.5pL dH subsequently 2the 3' of the DNA of O and 1.5pL10pM and sulfydryl derivatization holds complementary primer.Mixture is hatched 2 minutes at 55 DEG C, anneals to make primer and single stranded DNA.Then, mixture is allowed to return to room temperature.
Then, use purchased from Invitrogen's alexa 488-5-dUTP carries out filling-in.Following component is joined in the mixture of step 3: the 10mM dNTP mixture (dATP, dGTP, dCTP) of 2pL, the 10X Klenow fragment buffer (New England Biolabs) of 7.5pL, 9.5pL dH 2the Klenow fragment (New England Biolabs) of 1mM488-5-dUTP and 2pL of O, 4pL.This reaction hatches 30 minutes at 37 DEG C.Rustless steel sample is taken out from pipe, fully washs with water and make it air-dry.
alexa the DNA's modified is visual: once rustless steel sample drying, then attach it on microscope slide also with using the fluorescence microscope of green filter to carry out imaging.Locate the edge in the region of the DNA modification on rustless steel and to its imaging, clearly demonstrate that puting together of the surface that DNA applies with gold.
the combination of the enhancing of embodiment 3. oligonucleotide and metal micro-needle array surface
In order to promote the attachment of the stainless steel surfaces that the DNA oligomer probe comprising 3' sulfydryl modification applies with gold further, introduce NaCl titration.Scheme in above-described embodiment 2 is carried out when increasing the NaCl that concentration improves gradually.Increase pro rata with the amount of the NaCl added with the amount of the ssDNA of this surperficial coupling, and under 1M NaCl concentration, observe the increase (Fig. 7) of about 10 times.Quanti-iT Green ssDNA Reagent test kit (Invitrogen) is used to determine that the DNA's be combined with gold surface is quantitative.
embodiment 4. diagnostic method
Lacking melanomatous diagnosis to dermatologist is a very important problem.The consequence of failing to pinpoint a disease in diagnosis may be catastrophic for patients, is of a high price for insurance company, and is nocuous for doctor, and therefore melanomatous earlier detection is vital.But the intrusion character of standard biopsy program can stop doctor to carry out biopsy appearing as optimum tissue.Fig. 5 and Fig. 6 shows by apparatus and method of the present disclosure melanomatous non-invasive diagnostic.501-505 describe in further detail the surface of 603.
Fig. 5 shows a process, makes the biomarker being designed to DNA probe and the expectation detecting melanomatous biomarker hybridize thus.501 show the single DNA probe be attached in the gold surface of micropin.DNA probe in 501 comprises the single nucleotide polymorphism that optionally RNA relevant to melanoma is hybridized.As described in Example 2, the DNA probe in 501 is covalently connected to the gold surface of micropin.The 505 bright visual field and the fluorescence field-of-view images showing the surface of apparatus of the present invention, comprise multiple micropin with covalently bound DNA probe.When this device touches the skin of experimenter, micropin destroys the cell membrane of the skin contacted lightly.This process makes the probe on micropin be exposed to intracellular polynucleotide, peptides and proteins biomarker.A period of time that the probe on micropin is specified with biomarker in situ hybridization 502 in physiological conditions can be made, such as, probe can be made under physiological body temperature (about 37 DEG C) to hybridize about 30 minutes.Reverse transcriptase-PCR (RT-PCR) tests 503 and can be used for the RNA of hybridization to be transformed into DNA.Standard PCR protocol 504 can be used for the product of amplification 503.
Fig. 6 shows the general introduction of the method providing process with device of the present invention.601 show the clinician skin of experimenter being carried out to visual examination.It is health or unsound that clinician 601 can determine that a part for skin 602 or skin looks like.Clinician can with the skin of device of the present invention touching experimenter, thus make the contact skin of probe for biomarker and experimenter in the mode of Noninvasive.603 is the diagrams on the surface of device, and it describes in Figure 5 in more detail.604 show as the biomarker of amplified hybridization and the PCR that carries out measures.605 show clinician is back to experimenter by analysis result.
the body build-in test of the polymer micro needle array that embodiment 5. is modified
Present embodiment describes and use the polymer micro needle array of the modification described in the application to detect in the body of Mouse Muscle filamentous actin.Merlon micropin Mouse Muscle filamentous actin ssDNA probe modification, and also apply with hyaluronidase with the micropin sample of ssDNA probe conjugate.With the Merlon micropin process mice (n=4 that ssDNA modifies; A/J, Swiss Webster).Use thumb press microneedle array to be applied to the hind leg shaving hair of mice, and remain on appropriate location about 10 seconds.Then, by overturning this array on microscope slide, with the space between oil seal needle stand and microscope slide, and microscope slide is placed in 50 DEG C of hot block upper 30 minutes, the mRNA be combined with array is directly transcribed into cDNA in microneedle surface superinverse.Then reactant mixture to be transferred to PCR pipe from microscope slide and to use traditional PCR technique to increase.Cyclic program is carried out as follows: 94 DEG C 1 minute; 94 DEG C 15 seconds, 55 DEG C 30 seconds, 68 DEG C 40 circulations of 60 seconds; 68 DEG C 5 minutes.Sample is undertaken visual by gel imaging and uses light densitometry to quantize.
Observed the remarkable increase of the mRNA amount be separated from the micropin comprising probe.The difference comprised between the sample of ssDNA probe and the microneedle array of unmodified is about 2-3 doubly, and the difference simultaneously comprised between the sample of ssDNA probe and hyaluronidase and the array of unmodified is about 8 times.This shows that not only micropin is from skin extraction target, and the destruction of extracellular matrix can promote this leaching process, thus causes higher yield.Many enzymes, include but not limited to serine protease, thiol protease and MMP, may be useful in this process.Other instantiation of enzyme includes but not limited to papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymase, alpha-chymotrypsin, α-amylase (amlyase), DNase, collagenase and sutilains.
embodiment 6. is separated said target mrna from the application on human skin of homogenization
Present embodiment describes and be separated said target mrna from the application on human skin of homogenization.The excessive application on human skin not only having comprised cancerous tissue but also comprised benign tissue obtains from Scripps Clinic, its excision in Mohs (Mohs) microphotograph operation.Use following program by Skin Homogenate and extract total serum IgE.At RNAlater tMmiddle use MP Biomedical FastPrep-24 and LysingMatrix D beadlet (about 30-40mg organize/pipe) are with 6.0 arrange Skin Homogenate 25s.Then, RNA is used to extract test kit (Qiagen tM) from this homogenate, be separated total serum IgE according to the explanation of manufacturer.Have and be conjugated to the golden rustless steel micropin applied with the DNA probe of the sequence of people's beta-actin complementation, be placed in the RNA solution be separated from the skin of homogenization, and hatch a period of time at room temperature or 37 DEG C.From solution, be separated stainless steel strip and combining mRNA reverse transcription is cDNA, then use qRT-PCR increase to it and analyze.As a result, only having with beta-actin probe conjugate and use the micropin of suitable beta-actin probe amplification to produce subsequently can the target (Fig. 8) of measuring amount.In the present embodiment, non-specific DNA sequence is conjugated to microneedle surface; BMP-4:Taqman probe is used for non-actin target; And Actb-people-1: beta-actin sequence is conjugated to microneedle surface.
embodiment 7. uses microneedle array to detect mRNA from mouse skin mRNA library
In these experiments, from mouse skin mRNA library (Zyagen tM) in isolate said target mrna.The total concentration of the mRNA in aggregation is 250 μ g/mL.Then, the rustless steel microneedle array having the gold of probe ssDNA to apply coupling on it adds to mRNA library (5 μ L, in 20 μ L water) and at 37 DEG C, hatches about 10 minutes.Wash array lightly subsequently and make it air-dry momently.Then, by by reverse transcriptase reaction mixture (3 μ L 10x reverse transcriptase buffer, 6 μ L 25mM MgCl 2, 3 μ L 0.1M DTT, 1.5 μ L RNaseOUT tM, 13 μ L DEPC water, 2 μ L 10mM dNTP mixture) join containing microneedle array pipe in and at 42 DEG C, hatch 2 minutes, add the SuperScriptII of 1.5 μ L subsequently tMreverse transcriptase, carries out cDNA synthesis.This reaction is circulated by follow procedure: 42 DEG C 50 minutes, 70 DEG C 15 minutes, then at about 15 minutes on ice.Then RNase H is joined each reaction (1.5 μ L) in and reaction is hatched 20 minutes at 37 DEG C.Use 20x TaqMan afterwards tMmeasure primer (1.5 μ L) and 2x TaqMan tMgene expression mixture (15 μ L) carries out TaqMan tMpcr amplification.Reaction has the cumulative volume of 30 μ L.After four circulations, take out 5 μ L solution and as the TaqMan of template for carrying out according to the description of manufacturer tMqRT-PCR (40 circulations).
Although described in detail foregoing invention in order to the object of clear understanding in the mode illustrated and illustrate, but those of ordinary skill in the art will easily understand according to instruction of the present invention, certain change and amendment can be carried out to it when not departing from the spirit or scope of claims.
The all publications quoted in this description, data base, GenBank sequence, patent and patent application are incorporated to herein all by reference, as pointed out that wherein each is incorporated to all by reference particularly and individually.

Claims (148)

1. comprise a device for the first micropin, wherein this first micropin covalently or non-covalently is attached to and has specific first probe to the first biomarker.
2. the device of claim 1, wherein said first biomarker is polynucleotide, and described first probe is the polynucleotide with described first biomarker complementation.
3. the device of claim 1, wherein said first biomarker is polypeptide.
4. the device of claim 1, wherein said first probe has specific antibody to described first biomarker.
5. the device of claim 1, it comprises further and has specific second probe to the second biomarker, and wherein this second probe is different from described first probe.
6. the device of claim 5, wherein said second probe covalently or non-covalently is attached to described first micropin.
7. the device of claim 5, wherein said second probe covalently or non-covalently is attached to the second micropin.
8. the device of claim 5, wherein said second biomarker is polynucleotide, and described second probe is the polynucleotide with described second biomarker complementation.
9. the device of claim 5, wherein said first probe is combined specifically with the first nucleotide polymorphisms, and described second probe is combined specifically with the second nucleotide polymorphisms.
10. the device of claim 5, wherein said second biomarker is polypeptide.
The device of 11. claim 5, wherein said first and second probes have specific different antibodies to the different epi-positions of identical biomarker separately.
The device of 12. claim 1, wherein said first probe is attached to multiple micropin.
The device of 13. claim 1, wherein said first micropin comprises polymer, metal or pottery.
The device of 14. claim 1, wherein said first micropin comprises polymer.
The device of 15. claim 1, wherein said first probe is attached to described first micropin via connector.
The device of 16. claim 15, wherein said connector is sulfydryl/amino bifunctional linker.
The device of 17. claim 15, wherein said connector is PEG connector.
The device of 18. claim 1, wherein said first micropin is formed in substrate.
The device of 19. claim 1, it comprises further for increasing and differentiating the compartment of described first and second biomarkers.
20. 1 kinds of devices comprising multiple micropin, wherein said multiple micropin comprises at least one micropin covalently or non-covalently being attached to and biomarker being had at least one probe specific, and this biomarker instruction skin or eye condition.
The device of 21. claim 20, wherein said biomarker instruction skin.
The device of 22. claim 21, wherein said skin is skin carcinoma.
The device of 23. claim 20, wherein said biomarker instruction eye condition.
The device of 24. claim 21, wherein said eye condition is ocular inflamation or cancer eye.
The device of 25. claim 20, wherein said biomarker is polynucleotide, and at least one probe described and the complementation of described biomarker.
The device of 26. claim 25, at least one probe wherein said comprises and has specific different polynucleotide probes to the different IPs nucleotide polymorphism of identical biomarker.
The device of 27. claim 20, wherein said biomarker is peptide or polypeptide, and at least one probe described has specific antibody to described biomarker.
The device of 28. claim 27, at least one probe wherein said comprises and has specific different antibodies to the different epi-positions of identical biomarker.
The device of 29. claim 20, it comprises and has specific multiple probe to multiple different biomarker, and wherein said multiple probe is attached to identical or different micropin.
The device of 30. claim 29, wherein at least two different probes are attached to identical micropin.
The device of 31. claim 20, it comprises at least two of specific biomarkers identical probes, and wherein said at least two identical probes are attached to one or more micropin.
The device of 32. claim 20, wherein said micropin comprises polymer, metal or pottery.
The device of 33. claim 32, wherein said micropin comprises polymer.
The device of 34. claim 20, wherein said probe is attached to described micropin via connector.
The device of 35. claim 34, wherein said connector is sulfydryl/amino bifunctional linker.
The device of 36. claim 34, wherein said connector is PEG connector.
37. rights want the device of 20, and wherein said multiple micropin is formed in substrate.
The device of 38. claim 20, it is comprised further for original position amplification and the compartment differentiating the biomarker of being caught by probe.
39. 1 kinds of devices comprising multiple micropin, wherein said multiple micropin comprises at least one micropin covalently or non-covalently being attached to and biomarker being had to specific probe, and wherein said probe comprises when this probe in detecting is to the sensor of utilizing emitted light signal during this biomarker.
The device of 40. claim 39, wherein when it detects described biomarker, the optical signal of described probe increases.
The device of 41. claim 39, wherein when it detects described biomarker, the optical signal of described probe reduces.
The device of 42. claim 39, wherein said biomarker is polynucleotide, and described probe is the polynucleotide with described biomarker complementation.
The device of 43. claim 42, wherein said probe has specific different polynucleotide probes to the different IPs nucleotide polymorphism of identical biomarker.
The device of 44. claim 39, wherein said biomarker is peptide or polypeptide, and described probe has specific antibody to described biomarker.
The device of 45. claim 44, wherein said probe has specific different antibodies to the different epi-positions of identical biomarker.
The device of 46. claim 39, it comprises and has specific multiple probe to multiple different biomarker, and wherein said multiple probe is attached to identical or different micropin.
The device of 47. claim 39, wherein at least two different probes are attached to identical micropin.
The device of 48. claim 39, it comprises at least two of specific biomarkers identical probes, and wherein identical probe is attached to one or more micropin.
The device of 49. claim 39, wherein said micropin is made up of polymer, metal or pottery.
The device of 50. claim 49, wherein said micropin comprises polymer.
The device of 51. claim 39, wherein said probe is attached to micropin via connector.
The device of 52. claim 51, wherein said connector is sulfydryl/amino bifunctional linker.
The device of 53. claim 51, wherein said connector is PEG connector.
The device of 54. claim 39, it is comprised further for original position amplification and the compartment differentiating the biomarker of being caught by probe.
55. 1 kinds of test kits, it comprises:
A () comprises the device of multiple micropin, wherein said multiple micropin comprises at least one micropin covalently or non-covalently being attached to and biomarker being had to specific first probe; With
B () is for a group reagent of polymerase chain reaction.
The test kit of 56. claim 55, wherein at least one micropin covalently or non-covalently is attached to and has specific second probe to different biomarker.
The test kit of 57. claim 55, wherein said test kit comprises holder further.
The test kit of 58. claim 55, wherein said biomarker is polynucleotide, and described probe is the polynucleotide with described biomarker complementation.
The test kit of 59. claim 58, wherein said probe has specific different polynucleotide probes to the different IPs nucleotide polymorphism of identical biomarker.
The test kit of 60. claim 55, wherein this group reagent comprises polymerase, buffer and control sample.
The test kit of 61. claim 55, wherein said test kit comprises the written explanation about its purposes further.
The test kit of 62. claim 55, it comprises and multiplely has specific probe to multiple different biomarker, and wherein said multiple probe is attached to identical or different micropin.
The test kit of 63. claim 62, wherein at least two different probes are attached to identical micropin.
The test kit of 64. claim 55, it comprises further at least two of specific biomarkers identical probes, and wherein identical probe is attached to one or more micropin.
The test kit of 65. claim 55, wherein said micropin is made up of polymer, metal or pottery.
The test kit of 66. claim 65, wherein said micropin comprises polymer.
The test kit of 67. claim 55, wherein said probe is attached to described micropin via connector.
The test kit of 68. claim 67, wherein said connector is sulfydryl/amino bifunctional linker.
The test kit of 69. claim 67, wherein said connector is PEG connector.
The test kit of 70. claim 55, it is comprised further for original position amplification and the compartment differentiating the biomarker of being caught by probe.
The test kit of 71. claim 55, wherein said probe comprises when this probe in detecting is to the sensor launching visual signal during described biomarker.
The test kit of 72. claim 55, wherein detects from skin with the contact of biological sample or extracts one or more biomarkers.
The test kit of 73. claim 55, wherein with the contact of biological sample from eye condition detection or extract one or more biomarkers.
The test kit of 74. claim 55, wherein this group reagent is used for reverse transcriptase-polymerase chain reaction.
75. 1 kinds for the method from the original position tissue in experimenter or one or more biomarkers of biology sample detection, the method comprises (a) makes the tissue of micropin and experimenter or biological sample contact, wherein said micropin is attached to one group of probe, and wherein said probe is combined with one or more biomarker original positions described; (b) one or more biomarkers described be combined with described probe are detected.
The method of 76. claim 75, one or more biomarkers wherein said are polynucleotide, and described probe is the polynucleotide with described biomarker complementation.
The method of 77. claim 76, wherein said probe has specific different polynucleotide probes to the different IPs nucleotide polymorphism of identical biomarker.
The method of 78. claim 75, one or more biomarkers wherein said are peptide or polypeptide, and described probe has specific antibody to described biomarker.
The method of 79. claim 78, wherein said probe has specific different antibodies to the different epi-positions of identical biomarker.
The method of 80. claim 75, it comprises and has specific multiple probe to multiple different biomarker, and wherein said multiple probe is attached to identical or different micropin.
The method of 81. claim 80, wherein at least two different probes are attached to identical micropin.
The method of 82. claim 75, it comprises at least two of specific biomarkers identical probes, and wherein identical probe is attached to one or more micropin.
The method of 83. claim 75, wherein said micropin comprises polymer, metal or pottery.
The method of 84. claim 83, wherein said micropin comprises polymer.
The method of 85. claim 75, wherein said probe is attached to micropin via connector.
The method of 86. claim 85, wherein said connector is sulfydryl/amino bifunctional linker.
The method of 87. claim 85, wherein said connector is PEG connector.
The method of 88. claim 75, wherein said detection comprises makes one or more biomarkers described contact with detectable label.
The method of 89. claim 88, wherein said detectable label is fluorogen.
The method of 90. claim 75, wherein said detection comprises the described biomarker of amplification.
The method of 91. claim 75, the described biomarker that the described probe wherein detected on described micropin by polymerase chain reaction is combined.
The method of 92. claim 75, wherein by the second antibody of polynucleotide labelling with by detecting the described biomarker that the described probe on described micropin is combined to the pcr amplification of this polynucleotide label.
The method of 93. claim 75, wherein said biomarker is micromolecule or metabolite, and described probe has specific part to described biomarker.
94. 1 kinds for the method from the original position tissue in experimenter or one or more biomarkers of biology sample detection, the method comprises: (a) makes the tissue of microneedle devices and experimenter or biological sample contact, wherein said microneedle devices comprises and has specific one or more probe to one or more biomarkers described, and wherein at least one probe comprises when this probe in detecting is to the sensor launching visual signal during this biomarker; (b) biomarker is detected based on this visual signal.
The method of 95. claim 94, one or more biomarkers wherein said are polynucleotide, and described probe is the polynucleotide with described biomarker complementation.
The method of 96. claim 95, wherein said probe has specific different polynucleotide probes to the different IPs nucleotide polymorphism of identical biomarker.
The method of 97. claim 94, one or more biomarkers wherein said are peptide or polypeptide, and described probe has specific antibody to described biomarker.
The method of 98. claim 96, wherein said probe has specific different antibodies to the different epi-positions of identical biomarker.
The method of 99. claim 94, it comprises and has specific multiple probe to multiple different biomarker, and wherein said multiple probe is attached to identical or different micropin.
The method of 100. claim 99, wherein at least two different probes are attached to identical micropin.
The method of 101. claim 94, it comprises further at least two of specific biomarkers identical probes, and wherein identical probe is attached to one or more micropin.
The method of 102. claim 94, wherein said micropin is made up of polymer, metal or pottery.
The method of 103. claim 102, wherein said micropin comprises polymer.
The method of 104. claim 94, wherein said probe is attached to described micropin via connector.
The method of 105. claim 104, wherein said connector is sulfydryl/amino bifunctional linker.
The method of 106. claim 104, wherein said connector is PEG connector.
The method of 107. claim 94, it is comprised further for original position amplification and the system differentiating the biomarker of being caught by probe.
The method of 108. claim 94, wherein said detection comprises makes one or more biomarkers described contact with detectable label.
The method of 109. claim 108, wherein said detectable label is fluorogen.
The method of 110. claim 94, wherein said detection comprises the described biomarker of amplification.
The method of 111. claim 94, the described biomarker that the probe wherein detected on described micropin by polymerase chain reaction is combined.
The method of 112. claim 94, wherein by the second antibody of polynucleotide labelling with by detecting the described biomarker that the described probe on described micropin is combined to the pcr amplification of this polynucleotide label.
The method of 113. claim 94, wherein said biomarker is micromolecule or metabolite, and described probe has specific part to described biomarker.
The method of 114. claim 94, one or more biomarkers wherein said are relevant to skin.
The method of 115. claim 94, one or more biomarkers wherein said are relevant to eye condition.
The method of 116. claim 94, wherein etches described micropin to increase the surface area of described micropin.
117. one kinds of compositionss comprising multiple micropin, the reagent coating that can destroy extracellular matrix of described micropin.
The compositions of 118. claim 117, wherein said reagent is enzyme.
The compositions of 119. claim 117, wherein said enzyme is selected from serine protease, thiol protease, MMP, papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymase, alpha-chymotrypsin, α-amylase, DNase, collagenase and sutilains.
The compositions of 120. claim 117, wherein said enzyme is hyaluronidase.
121. one kinds for detecting the method for one or more biomarkers in the tissue of experimenter, the method comprises (a) makes micropin contact with the tissue in situ of experimenter, wherein said tissue comprises extracellular matrix, wherein said micropin is covalently attached to one group of probe, and wherein said probe is combined with biomarker original position; (b) extracellular matrix is destroyed.
The method of 122. claim 121, wherein said extracellular matrix is destroyed by enzymatic activity.
The method of 123. claim 121, wherein destroys extracellular matrix and comprises to extracellular matrix applying ultrasonic energy.
The method of 124. claim 121, wherein said extracellular matrix is destroyed by electromotive force.
125. one kinds of methods for one or more biomarkers of original position tissue detection from experimenter, the method comprises (a) makes micropin and described contact tissue, wherein said tissue comprises cell membrane, wherein said micropin is attached to one group of probe, and wherein said probe is combined with biomarker original position, and (b) destroys cell membrane.
The method of 126. claim 125, wherein said cell membrane is destroyed by enzymatic activity.
The method of 127. claim 125, wherein destroys cell membrane and comprises to described cell membrane applying ultrasonic energy.
The method of 128. claim 125, wherein said cell membrane is destroyed by electromotive force.
129. one kinds of methods preparing microneedle devices, the method comprises:
A () obtains the solution comprising inorganic salt;
B () adds probe and micropin in described solution; With
C () makes described probe be conjugated to described micropin in described solution.
The method of 130. claim 129, wherein said inorganic salt is sodium chloride.
The method of 131. claim 129, the concentration of wherein said inorganic salt is less than 2.5M.
132. one kinds for detecting the method for one or more biomarkers in experimenter, the method comprises makes the skin of microneedle devices and experimenter or ocular tissue contact.
The method of 133. claim 132, one or more biomarkers wherein said are relevant to skin or eye condition.
The method of 134. claim 132, wherein said biomarker is polynucleotide.
The method of 135. claim 132, wherein said biomarker is present in the blood of experimenter.
136. one kinds for detecting the method for one or more biomarkers in experimenter, the method comprises makes microneedle devices contact with the capillary of skin of experimenter.
The method of 137. claim 136, it comprises further makes microneedle devices contact with the blood sample of experimenter.
138. one kinds for the method from one or more polynucleotide biomarkers of original position tissue detection in experimenter, described method comprise make microneedle devices and experimenter be organized in Program of performing the operation during contact.
The method of 139. claim 138, wherein said tissue is from the organ being selected from brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix uteri, prostate, kidney, intestinal, vermiform appendix, thyroid and colon.
The method of 140. claim 138, the tissue of wherein said experimenter comprises benign tissue.
The method of 141. claim 138, the tissue of wherein said experimenter comprises doubtful malignant tissue.
The method of 142. claim 138, wherein said microneedle devices contact malignant tissue and the benign tissue adjacent with this malignant tissue.
The method of 143. claim 138, the benign tissue that wherein said microneedle devices contact is adjacent with malignant tissue.
The method of 144. claim 138, wherein said microneedle devices contact tumor.
The method of 145. claim 138, it comprises the operation edge determining tumor further.
The method of 146. claim 75,94,121,125,129,132,136 or 138, it comprises further and detects one or more biomarkers from the reference tissue available from experimenter.
The device of 147. claim 14, wherein said polymer is thermoplastic polymer.
The device of 148. claim 14, wherein said thermoplastic polymer is selected from Merlon, poly-(methyl methacrylate), polyethylene and polypropylene.
CN201380065515.3A 2012-12-14 2013-12-13 Method and apparatus for detecting and acquiring biomarkers Active CN104853802B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111395029.0A CN114176586A (en) 2012-12-14 2013-12-13 Method and apparatus for detecting and acquiring biomarkers

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201261737237P 2012-12-14 2012-12-14
US61/737,237 2012-12-14
PCT/US2013/075187 WO2014093934A1 (en) 2012-12-14 2013-12-13 Methods and devices for detection and acquisition of biomarkers

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN202111395029.0A Division CN114176586A (en) 2012-12-14 2013-12-13 Method and apparatus for detecting and acquiring biomarkers

Publications (2)

Publication Number Publication Date
CN104853802A true CN104853802A (en) 2015-08-19
CN104853802B CN104853802B (en) 2021-12-07

Family

ID=50935018

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201380065515.3A Active CN104853802B (en) 2012-12-14 2013-12-13 Method and apparatus for detecting and acquiring biomarkers
CN202111395029.0A Pending CN114176586A (en) 2012-12-14 2013-12-13 Method and apparatus for detecting and acquiring biomarkers

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN202111395029.0A Pending CN114176586A (en) 2012-12-14 2013-12-13 Method and apparatus for detecting and acquiring biomarkers

Country Status (9)

Country Link
US (3) US9540684B2 (en)
EP (2) EP2931356B1 (en)
JP (3) JP2016509471A (en)
KR (3) KR102378235B1 (en)
CN (2) CN104853802B (en)
AU (4) AU2013358890A1 (en)
CA (1) CA2892587A1 (en)
HK (1) HK1212932A1 (en)
WO (1) WO2014093934A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109459569A (en) * 2018-07-28 2019-03-12 南昌大学 A method of exempting from blood sample tumour early monitoring
CN110114675A (en) * 2016-12-28 2019-08-09 (株)纳斯摩仕 The preparation method and patch of diagnosis skin patch based on the micropin coated with aptamers
CN110958853A (en) * 2017-06-02 2020-04-03 威拉赛特公司 Methods and systems for identifying or monitoring lung disease
CN114113024A (en) * 2021-12-20 2022-03-01 深圳大学 Microneedle for detecting markers in interstitial fluid of breast cancer tissues and preparation method thereof
CN114302643A (en) * 2019-06-14 2022-04-08 伯乐实验室有限公司 System and method for automated single cell processing and analysis
US11639527B2 (en) 2014-11-05 2023-05-02 Veracyte, Inc. Methods for nucleic acid sequencing

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2931356B1 (en) 2012-12-14 2019-03-06 Mindera Corporation Methods and devices for detection and acquisition of biomarkers
WO2015195949A2 (en) 2014-06-18 2015-12-23 Clear Gene, Inc. Methods, compositions, and devices for rapid analysis of biological markers
US10321858B2 (en) * 2014-08-18 2019-06-18 Proteadx, Inc. Apparatus and methods for transdermal sensing of analytes in interstitial fluid and associated data transmission systems
WO2017007271A1 (en) * 2015-07-09 2017-01-12 주식회사 넥스모스 Aptamer-coated microneedle-based diagnostic skin patch
GB201517373D0 (en) 2015-10-01 2015-11-18 Ge Healthcare Uk Ltd Micro-Needle Sampling Device And Use Thereof
WO2017106790A1 (en) * 2015-12-18 2017-06-22 Clear Gene, Inc. Methods, compositions, kits and devices for rapid analysis of biological markers
JP6930986B2 (en) * 2016-03-02 2021-09-01 ジェイ・ピィ・サイエンティフィック・リミテッドＪｐ Ｓｃｉｅｎｔｉｆｉｃ Ｌｉｍｉｔｅｄ Methods and equipment for extracting components from samples
US11913061B2 (en) 2016-07-08 2024-02-27 Kao Corporation Method for preparing nucleic acid sample
JP6231252B1 (en) * 2016-07-08 2017-11-15 花王株式会社 Nucleic acid sample preparation method
WO2019089567A1 (en) 2017-10-30 2019-05-09 Massachusetts Institute Of Technology Layer-by-layer nanoparticles for cytokine therapy in cancer treatment
DE102018103215B3 (en) 2018-02-13 2019-08-14 Gna Biosolutions Gmbh Method and device for extracting a nucleic acid from a sample fluid
KR102239272B1 (en) * 2018-11-20 2021-04-12 부산대학교 산학협력단 Microneedle, patch comprising microneedle and manufacturing method of the microneedle
KR102187439B1 (en) * 2019-01-30 2020-12-07 주식회사 라파스 Minimally invasive skin biopsy method using microneedle patch
KR102513569B1 (en) * 2019-03-19 2023-03-24 한국생명공학연구원 High sensitive sensor on transcriptional system
US20200377929A1 (en) * 2019-05-30 2020-12-03 Massachusetts Institute Of Technology Peptide nucleic acid functionalized hydrogel microneedles for sampling and detection of interstitial fluid nucleic acids
NL2024277B1 (en) * 2019-11-21 2021-08-11 Imcomet B V Interstitial fluid removal device
US20210380965A1 (en) * 2020-06-08 2021-12-09 North Carolina State University Microneedle-based rapid analyte extraction from plant and animal tissues and related methods and systems
JP2023531776A (en) * 2020-06-26 2023-07-25 アリマブ・インコーポレイテッド binding modulator
AU2021385427A1 (en) * 2020-11-30 2023-06-29 Mindera Corporation Microneedle devices and methods, and skin condition assays
WO2022115906A1 (en) * 2020-12-04 2022-06-09 Stefan Mazy Minimally invasive skin sample collection apparatus
WO2023192004A2 (en) * 2022-03-30 2023-10-05 Inflammatix, Inc. Methods for diagnosing myocardial infarction

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050178760A1 (en) * 2004-02-17 2005-08-18 Eng-Pi Chang Method of making microneedles
CN1688693A (en) * 1999-11-23 2005-10-26 克罗莫塞尔公司 Selection and isolation of living cells using mRNA-binding probes
US20110160069A1 (en) * 2008-05-23 2011-06-30 The University Of Queensland Analyte detection using a needle projection patch
US20120034598A1 (en) * 2006-05-10 2012-02-09 Holmes Elizabeth A Real-Time Detection of Influenza Virus

Family Cites Families (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
CA2484271C (en) 1997-12-31 2007-04-24 Medtronic Minimed, Inc. Insertion device for an insertion set and method of using the same
US6503231B1 (en) 1998-06-10 2003-01-07 Georgia Tech Research Corporation Microneedle device for transport of molecules across tissue
AU6123899A (en) 1998-10-15 2000-05-01 Toyo Kohan Co. Ltd. Supports for immobilizing dna or the like
US6743211B1 (en) 1999-11-23 2004-06-01 Georgia Tech Research Corporation Devices and methods for enhanced microneedle penetration of biological barriers
US6256533B1 (en) 1999-06-09 2001-07-03 The Procter & Gamble Company Apparatus and method for using an intracutaneous microneedle array
US6511463B1 (en) 1999-11-18 2003-01-28 Jds Uniphase Corporation Methods of fabricating microneedle arrays using sacrificial molds
DE60024312T2 (en) 1999-12-10 2006-08-17 Alza Corp., Mountain View Transdermal drug delivery of macromolecular agents and device therefor
DE60020159T2 (en) 1999-12-10 2005-10-06 Alza Corp., Mountain View SKIN TREATMENT DEVICE FOR EXTENDED TRANSDERMAL ADMINISTRATION OF MEDICAMENTS
AU2000274500A1 (en) 2000-04-04 2001-10-15 Toyo Kohan Co. Ltd. Slide glass having surface treatment layer formed thereon
EP1310793A4 (en) 2000-08-08 2005-11-16 Toyo Kohan Co Ltd Substrate activation kit and method of detecting dna or the like by using the same
US6749575B2 (en) * 2001-08-20 2004-06-15 Alza Corporation Method for transdermal nucleic acid sampling
US6533949B1 (en) 2000-08-28 2003-03-18 Nanopass Ltd. Microneedle structure and production method therefor
BR0114628A (en) 2000-10-13 2004-01-20 Alza Corp Impact applicator microprojection retention member
PT1341442E (en) 2000-10-13 2005-09-30 Alza Corp IMPACT APPLICATOR WITH A MICROLAMIN ASSEMBLY
JP3605039B2 (en) * 2001-01-09 2004-12-22 株式会社日立製作所 Nucleic acid microarray, method for producing the same, and method for detecting nucleic acid using the same
WO2002072889A2 (en) * 2001-01-12 2002-09-19 Applera Corporation Methods and compositions for microarray control
US6663820B2 (en) 2001-03-14 2003-12-16 The Procter & Gamble Company Method of manufacturing microneedle structures using soft lithography and photolithography
WO2003016574A1 (en) * 2001-08-16 2003-02-27 Zhifeng Shao Analysis of gene expression profiles using sequential hybridization
US6881203B2 (en) 2001-09-05 2005-04-19 3M Innovative Properties Company Microneedle arrays and methods of manufacturing the same
CA2500452A1 (en) * 2001-09-28 2003-04-03 Biovalve Technologies, Inc. Switchable microneedle arrays and systems and methods relating to same
US20030211528A1 (en) * 2002-03-12 2003-11-13 Norman Iscove Exponential amplification of sub-picogram nucleic acid samples with retention of quantitative representation
AU2012213965B2 (en) * 2003-09-11 2015-10-22 Labrador Diagnostics Llc Medical device for analyte monitoring and drug delivery
JP4202391B2 (en) * 2004-03-17 2008-12-24 パナソニック株式会社 Biochip manufacturing method, probe solution, and biochip
ES2906559T3 (en) 2004-09-10 2022-04-19 Becton Dickinson Co Patch type infusion device
EP2489745B1 (en) * 2006-06-05 2017-01-11 California Institute Of Technology Real time micro arrays
CA2657576C (en) * 2006-07-14 2023-10-31 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
US20100178651A1 (en) * 2006-11-03 2010-07-15 Christos Hatzis Bifunctional Predictors of Cancer Treatment Sensitivity and Resistance
JP5241517B2 (en) 2007-02-06 2013-07-17 久光製薬株式会社 Microneedle device for allergy diagnosis
US20100105104A1 (en) * 2007-03-05 2010-04-29 On-Chip Cellomics Consortium Chip for sampling cell component, system for analyzing cell component and method of analyzing cell component using the same
US20100286290A1 (en) * 2007-06-04 2010-11-11 Jakob Schwalbe Lohmann Enzyme activity assay using rolling circle amplification
US8609041B2 (en) 2007-08-06 2013-12-17 Samir Mitragotri Apparatus for solubilizing tissue
EP2185711B1 (en) 2007-08-10 2017-05-10 Wayne State University Compositions and methods for detecting and modulating cell death by a translation regulated gene expression system
WO2009066763A1 (en) 2007-11-21 2009-05-28 Bioserentach Co., Ltd. Preparation for application to body surface and preparation holding sheet for application to body surface
WO2010031059A2 (en) 2008-09-15 2010-03-18 Deka Products Limited Partnership Systems and methods for fluid delivery
US8221480B2 (en) 2008-10-31 2012-07-17 The Invention Science Fund I, Llc Compositions and methods for biological remodeling with frozen particle compositions
WO2010101625A2 (en) 2009-03-02 2010-09-10 Seventh Sense Biosystems, Inc. Oxygen sensor
WO2010128158A1 (en) * 2009-05-08 2010-11-11 Novartis Ag Diagnostic biomarkers for fibrotic disorders
EP2275164A1 (en) 2009-07-15 2011-01-19 Debiotech S.A. Multichannel micro-needles
JP5871907B2 (en) 2010-04-28 2016-03-01 キンバリー クラーク ワールドワイド インコーポレイテッド Nanopatterned medical device with enhanced cell-cell interaction
US20110294996A1 (en) * 2010-05-31 2011-12-01 Scheiber Lane Bernard Quantum unit of inheritance
WO2012074085A1 (en) * 2010-12-03 2012-06-07 学校法人埼玉医科大学 Marker for determination of sensitivity to triplet combination anti-cancer agent
EP2931356B1 (en) 2012-12-14 2019-03-06 Mindera Corporation Methods and devices for detection and acquisition of biomarkers

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1688693A (en) * 1999-11-23 2005-10-26 克罗莫塞尔公司 Selection and isolation of living cells using mRNA-binding probes
US20050178760A1 (en) * 2004-02-17 2005-08-18 Eng-Pi Chang Method of making microneedles
US20120034598A1 (en) * 2006-05-10 2012-02-09 Holmes Elizabeth A Real-Time Detection of Influenza Virus
US20110160069A1 (en) * 2008-05-23 2011-06-30 The University Of Queensland Analyte detection using a needle projection patch

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11639527B2 (en) 2014-11-05 2023-05-02 Veracyte, Inc. Methods for nucleic acid sequencing
CN110114675A (en) * 2016-12-28 2019-08-09 (株)纳斯摩仕 The preparation method and patch of diagnosis skin patch based on the micropin coated with aptamers
CN110958853A (en) * 2017-06-02 2020-04-03 威拉赛特公司 Methods and systems for identifying or monitoring lung disease
CN110958853B (en) * 2017-06-02 2023-08-25 威拉赛特公司 Methods and systems for identifying or monitoring lung disease
CN109459569A (en) * 2018-07-28 2019-03-12 南昌大学 A method of exempting from blood sample tumour early monitoring
CN114302643A (en) * 2019-06-14 2022-04-08 伯乐实验室有限公司 System and method for automated single cell processing and analysis
CN114302643B (en) * 2019-06-14 2024-02-27 伯乐实验室有限公司 Systems and methods for automated single cell processing and analysis
CN114113024A (en) * 2021-12-20 2022-03-01 深圳大学 Microneedle for detecting markers in interstitial fluid of breast cancer tissues and preparation method thereof

Also Published As

Publication number Publication date
EP2931356A4 (en) 2016-08-24
CN104853802B (en) 2021-12-07
AU2013358890A1 (en) 2015-06-04
AU2023204575A1 (en) 2023-08-03
US10995366B2 (en) 2021-05-04
HK1212932A1 (en) 2016-06-24
EP3542850A1 (en) 2019-09-25
JP2016509471A (en) 2016-03-31
US20140287942A1 (en) 2014-09-25
KR102216949B1 (en) 2021-02-22
AU2020239750B2 (en) 2023-04-20
KR102378235B1 (en) 2022-03-25
EP2931356A1 (en) 2015-10-21
CN114176586A (en) 2022-03-15
US20170145489A1 (en) 2017-05-25
KR20150123788A (en) 2015-11-04
AU2020239750A1 (en) 2020-10-22
WO2014093934A1 (en) 2014-06-19
CA2892587A1 (en) 2014-06-19
AU2019201136A1 (en) 2019-03-07
US20210317513A1 (en) 2021-10-14
AU2019201136B2 (en) 2020-06-25
EP2931356B1 (en) 2019-03-06
US9540684B2 (en) 2017-01-10
JP2022177287A (en) 2022-11-30
JP2019216746A (en) 2019-12-26
KR20220038832A (en) 2022-03-29
KR20210020164A (en) 2021-02-23

Similar Documents

Publication Publication Date Title
CN104853802A (en) Methods and devices for detection and acquisition of biomarkers
Bajaj et al. Array-based sensing of normal, cancerous, and metastatic cells using conjugated fluorescent polymers
CN108430336A (en) Circulating cells, the internal collection of protein and nucleic acid and Local Quantitative and signature analysis
CN107142320A (en) Gene marker for detecting liver cancer and application thereof
Chen et al. Nanopore single-molecule analysis of biomarkers: Providing possible clues to disease diagnosis
CN108624680B (en) The application of RAE1 gene or albumen as the biomarker of diagnosing myocardial infarction
Koebley et al. Digital Polymerase Chain Reaction Paired with High-Speed Atomic Force Microscopy for Quantitation and Length Analysis of DNA Length Polymorphisms
JP2014518086A (en) Determination of tumor origin
CN108796067A (en) The diagnosis new function of MAEA genes in blood
CN108753956A (en) Application of the KDSR genes in preparing myocardial infarction diagnosis tool
Marsella et al. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis
Rani et al. Biosensor based on bioreceptor: a potential biomedical device toward early detection of bone cancer
CN116875673A (en) System for diagnosing myocardial infarction
Lan et al. Strategic research on the molecular diagnostics industry in China
Gomase et al. Physiomics
WO2024077282A2 (en) Biomarkers for the diagnosis of amyotrophic lateral sclerosis
WO2023018756A1 (en) In situ epitranscriptomic profiling
JP2014166173A (en) Analyzer
WO2018039587A1 (en) Phi29 nanochannel for early detection of breast cancer biomarkers
CN108300783A (en) The method of gene marker for screening intestinal cancer and/or gastric cancer, the gene marker and application thereof screened with this method
GB2604048A (en) Method and assay kit to detect an analyte

Legal Events

Date Code Title Description
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant