CN102409089B - Kit, method and application for detecting mutation of predetermined locus in DNA sample - Google Patents

Kit, method and application for detecting mutation of predetermined locus in DNA sample Download PDF

Info

Publication number
CN102409089B
CN102409089B CN201110301714.2A CN201110301714A CN102409089B CN 102409089 B CN102409089 B CN 102409089B CN 201110301714 A CN201110301714 A CN 201110301714A CN 102409089 B CN102409089 B CN 102409089B
Authority
CN
China
Prior art keywords
primer
seq
extension
mutation
genes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201110301714.2A
Other languages
Chinese (zh)
Other versions
CN102409089A (en
Inventor
王秋菊
冯大飞
邹婧
刘兴旺
王夏曼
汪建
王俊
杨焕明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chinese PLA General Hospital
BGI Shenzhen Co Ltd
Original Assignee
Chinese PLA General Hospital
BGI Shenzhen Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chinese PLA General Hospital, BGI Shenzhen Co Ltd filed Critical Chinese PLA General Hospital
Priority to CN201110301714.2A priority Critical patent/CN102409089B/en
Publication of CN102409089A publication Critical patent/CN102409089A/en
Priority to TW101136210A priority patent/TW201315812A/en
Priority to PCT/CN2012/001382 priority patent/WO2013049975A1/en
Application granted granted Critical
Publication of CN102409089B publication Critical patent/CN102409089B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a kit, a method and an application for detecting mutation of predetermined locus in DNA sample. The method for detecting mutation of predetermined locus in DNA sample comprises the following steps: using an amplification primer for performing PCR amplification reaction on the DNA sample, using an extended primer and dd NTP; using the amplification product as template, performing the oligonucleotide extension reaction, so as to obtain the extended primer having a 3' end connected with a base, which is the extended product; and based on the molecular weight of the extended primer, determining the mutation type of the predetermined locus. The invention can effectively determine whether there is mutation in the predetermined locus and can determine the mutation type.

Description

The test kit of the mutation of predetermined site, method and application in detection DNA sample
Technical field
The present invention relates to detect the test kit of the mutation of predetermined site in DNA sample, primer combination, method and application.
Background technology
The research meanses commonly used during mutation is molecular biology experiment are formed in specific site, analysis is can aid in specific The point mutation in site is for the effect of gene function.Typically, after targeted mutagenesis body is constructed, how to the site whether Mutation is correctly there occurs, is those skilled in the art's problem encountered.
However, at present in biology field, for the detection of specific locus mutation still has much room for improvement.
The content of the invention
It is contemplated that at least solving one of technical problem present in prior art.For this purpose, one object of the present invention Be propose it is a kind of can in effective detection DNA sample the mutation of predetermined site method.
According to the first aspect of the invention, the present invention proposes a kind of side of the mutation of predetermined site in detection DNA sample Method.Embodiments in accordance with the present invention, the method is comprised the following steps：Enter performing PCR amplification to the DNA sample using amplimer Reaction, to obtain amplified production, the amplified production includes the predetermined site；Using extension primer and ddNTP, with institute It is template to state amplified production, carries out oligonucleotide extension, to obtain 3 ' one alkali of end connection in the extension primer The extension products of base, wherein, 3 ' ends of the extension primer are close to the predetermined site；Molecular weight is carried out to the extension products Detection, to obtain the molecular weight of the extension products；And the molecular weight based on the extension products, determine the pre-determined bit The mutation type of point.Because extension is, with the amplified production comprising predetermined site as template, and to carry out extension 3 ' ends of extension primer and use ddNTP when extension is carried out as raw material close to the predetermined site, thus can be with Ensure that extension can only extend a base, that is, correspond to predetermined site, the molecular weight based on each different base is present More significant difference, thus, detected by the molecular weight to extension products, obtained extension products can be passed through Molecular weight is determining whether predetermined site there occurs mutation, and the type undergone mutation.Thus, it is possible to extensively application In molecular biological arts, for example, detect whether successfully to construct corresponding mutant.
Embodiments in accordance with the present invention, under the method for the mutation of predetermined site can also have in above-mentioned detection DNA sample Row additional technical feature：
According to one embodiment of present invention, the DNA sample behaviour complete genome DNA.Thus, it is possible to effectively to people The gene mutation of apoplexy due to endogenous wind is detected.
According to one embodiment of present invention, the predetermined site sport selected from GJB2 genes, GJB3 genes, The mutation of at least one gene of SLC26A4 genes and mtDNA.Thus, it is possible to effectively detect and deaf related gene Mutation.
According to one embodiment of present invention, the GJB2 genes are sported selected from 35delG, 167delT, 176- At least one of 191del16,299_300delAT and 235delC, the GJB3 genes are sported selected from site 538C ＞ T With at least one of 547G ＞ A, the SLC26A4 genes sport selected from 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, 2162C ＞ T, 2168A ＞ G and IVS15+5G ＞ A At least one, and at least one sported selected from 1494C ＞ T and 1555A ＞ G of the mt DNA.Thus, it is possible to effectively The related gene mutation of ground detection hereditary hearing impairment.
According to one embodiment of present invention, the amplimer includes the first primer and the second primer, wherein, for institute The 35delG mutation of GJB2 genes are stated, first primer is such as SEQ ID NO：Shown in 1, second primer is such as SEQ ID NO：Shown in 2, the extension primer is such as SEQ ID NO：Shown in 33；It is mutated for the 167delT of the GJB2 genes, it is described First primer is such as SEQ ID NO：Shown in 3, second primer is such as SEQ ID NO：Shown in 4, the extension primer be as SEQ ID NO：Shown in 34；It is mutated for the 176-191del16 of the GJB2 genes, first primer is such as SEQ ID NO：Shown in 5, second primer is such as SEQ ID NO：Shown in 6, the extension primer is such as SEQ ID NO：Shown in 35；Pin The 299_300delAT of the GJB2 genes is mutated, first primer is such as SEQ ID NO：Shown in 7, second primer It is such as SEQ ID NO：Shown in 8, the extension primer is such as SEQ ID NO：Shown in 36；For the GJB2 genes 235delC is mutated, and first primer is such as SEQ ID NO：Shown in 9, second primer is such as SEQID NO：Shown in 10, The extension primer is such as SEQ ID NO：Shown in 37；It is mutated for the 538C ＞ T of the GJB3 genes, first primer is Such as SEQ ID NO：Shown in 11, second primer is such as SEQ ID NO：Shown in 12, the extension primer is such as SEQ ID NO：Shown in 38；It is mutated for the 547G ＞ A of the GJB3 genes, first primer is such as SEQ ID NO：It is described shown in 13 Second primer is such as SEQ ID NO：Shown in 14, the extension primer is such as SEQ ID NO：Shown in 39；For the SLC26A4 The 281C ＞ T mutation of gene, first primer is such as SEQ ID NO：Shown in 15, second primer is such as SEQ ID NO： Shown in 16, the extension primer is such as SEQID NO：Shown in 40；It is mutated for the 589G ＞ A of the SLC26A4 genes, it is described First primer is such as SEQ ID NO：Shown in 17, second primer is such as SEQ ID NO：Shown in 18, the extension primer is Such as SEQ ID NO：Shown in 41；It is mutated for the 919-2A ＞ G of the SLC26A4 genes, first primer is such as SEQ ID NO：Shown in 19, second primer is such as SEQ ID NO：Shown in 20, the extension primer is such as SEQ ID NO：Shown in 42； It is mutated for the 1174A ＞ T of the SLC26A4 genes, first primer is such as SEQ ID NO：Shown in 21, described second draws Thing is such as SEQ ID NO：Shown in 22, the extension primer is such as SEQ ID NO：Shown in 43；For the SLC26A4 genes 1226G ＞ A are mutated, and first primer is such as SEQ ID NO：Shown in 21, second primer is such as SEQ ID NO：22 institutes Show, the extension primer is such as SEQ ID NO：Shown in 44；It is mutated for the 1229C ＞ T of the SLC26A4 genes, described the One primer is such as SEQID NO：Shown in 21, second primer is such as SEQ ID NO：Shown in 22, the extension primer be as SEQ ID NO：Shown in 45；It is mutated for the 1975G ＞ C of the SLC26A4 genes, first primer is such as SEQ ID NO： Shown in 25, second primer is such as SEQ ID NO：Shown in 26, the extension primer is such as SEQ ID NO：Shown in 47；For The 2027T ＞ A mutation of the SLC26A4 genes, first primer is such as SEQ ID NO：Shown in 25, second primer is Such as SEQ ID NO：Shown in 26, the extension primer is such as SEQ ID NO：Shown in 48；For the SLC26A4 genes 2162C ＞ T are mutated, and first primer is such as SEQ ID NO：Shown in 27, second primer is such as SEQ ID NO：28 institutes Show, the extension primer is such as SEQ ID NO：Shown in 49；It is mutated for the 2168A ＞ G of the SLC26A4 genes, described the One primer is such as SEQ ID NO：Shown in 27, second primer is such as SEQ ID NO：Shown in 28, the extension primer be as SEQ ID NO：Shown in 50；It is mutated for the IVS15+5G ＞ A of the SLC26A4 genes, first primer is such as SEQ ID NO：Shown in 23, second primer is such as SEQ ID NO：Shown in 24, the extension primer is such as SEQ ID NO：Shown in 46； It is mutated for the 1494C ＞ T of the mtDNA genes, first primer is such as SEQ ID NO：Shown in 29, second primer It is such as SEQ ID NO：Shown in 30, the extension primer is such as SEQ ID NO：Shown in 51；And for the mt DNA genes 1555A ＞ G mutation, first primer is such as SEQ ID NO：Shown in 31, second primer is such as SEQ ID NO：32 Shown, the extension primer is such as SEQ ID NO：Shown in 52.
For convenience of stating, by the combination of above-mentioned primer respectively summary and table 1 below and 2.
Table 1：For the amplimer in above-mentioned 20 deaf gene mutational sites.
*：For each mutation type, from top to bottom, respectively each amplimer is to (otherwise referred to as expanding herein Increase primer) the first primer (otherwise referred to as forward primer) and the second primer (otherwise referred to as downstream primer).
**：According to one embodiment of present invention, can also be all at the first primer and the second primer 5 ' end of amplimer With 10 bases acgttggatg (SEQ ID NO：53) sequence label, inventor has found, by using above-mentioned label sequence Row, can cause the molecular weight of above-mentioned first primer and the second primer not in mass spectrographic detection range, thereby, it is possible to further Improve the degree of accuracy and efficiency of detection.
Table 2：For the extension primer in above-mentioned 20 deaf gene mutational sites.
Sequence number Primer sequence Primer explanation
SEQ ID NO：33 TTTGTTCACACCCCC The extension primer of site 35delG
SEQ ID NO：34 gggcCTTTGTCTGCAACACCC The extension primer of site 167delT
SEQ ID NO：35 ctccGCAACACCCTGCAGCCAG The extension primer of site 176_191del16
SEQ ID NO：36 gcTGAACTTCCTCTTCTTCTC The extension primer of site 299_300delAT
SEQ ID NO：37 ggATCCTGCTATGGGCC The extension primer of site 235delC
SEQ ID NO：38 ccctaGTGGACTGCTACATTGCC The extension primer of site 538C ＞ T
SEQ ID NO：39 ctgcAGTAGGTGAAGATTTTCTTCT The extension primer of site 547G ＞ A
SEQ ID NO：40 GTCATTTCGGGAGTTAGTA The extension primer of site 281C ＞ T
SEQ ID NO：41 CTTGTAAGTTCATTACCTGTATAATTC The extension primer of site 589G ＞ A
SEQ ID NO：42 GCAGTAGCAATTATCGTC The extension primer of site 919-2A ＞ G
SEQ ID NO：43 GCCTTTGGGATCAGC The extension primer of site 1174A ＞ T
SEQ ID NO：44 CACCACTGCTCTTTCCC The extension primer of site 12 26G ＞ A
SEQ ID NO：45 ttCCACCACTGCTCTTTCCCCCA The extension primer of site 12 29C ＞ T
SEQ ID NO：46 AAAACAAATTTCTAGGGATAAAATA The extension primer of site IVS15+5G ＞ A
SEQ ID NO：47 CTCCACAGTCAAGCA The extension primer of site 1975G ＞ C
SEQ ID NO：48 AGAACCTTACCACCCGC The extension primer of site 2027T ＞ A
SEQ ID NO：49 CAGAGTATAGCATCAAGGACC The extension primer of site 2162C ＞ T
SEQ ID NO：50 TCTGTAGATAGAGTATAGCATCA The extension primer of site 2168A ＞ G
SEQ ID NO：51 CGTACACACCGCCCGTCAC The extension primer of site 1494C ＞ T
SEQ ID NO：52 ACTTACCATGTTACGACTTG The extension primer of site 1555A ＞ G
As shown in Table 1 and Table 2, the length of amplimer is of about 30 bases, and the length of extension primer is 17-28 alkali Base.In addition, inventor has found, combined based on aforementioned primer, the extension primer of different loci and extension products, extension products and prolonged The molecular weight difference stretched between product is not less than 30D.Inventors of the present invention have surprisingly found that and combined by using above-mentioned primer, Listed mutation type can be effectively detected, and is suitable to while detecting the various mutations type in various sites, root According to embodiments of the invention, above-mentioned 20 kinds of mutation types accurately and quickly can be detected simultaneously.
According to one embodiment of present invention, before the oligonucleotide extension is carried out, further include：Use The step of alkali phosphatase is processed the amplified production.Thus, amplified production is processed by alkali phosphatase, The dNTP of remaining in amplified production can be removed, such that it is able to improve the efficiency of follow-up extension, and then can be realized efficiently The mutation of predetermined site in ground detection DNA sample.
According to one embodiment of present invention, molecular weight is carried out to the extension products by MALDI-TOF Mass Spectrometer Method Detection.Thereby, it is possible to accurately, efficiently to extension products carry out molecular weight detection, it is surprisingly found by the inventors that passing through MALDI- TOF Mass Spectrometer Method can even realize the detection to heterozygous mutant in DNA sample or homozygous mutation.
According to one embodiment of present invention, before MALDI-TOF Mass Spectrometer Method is carried out to the extension products, one is entered Step includes the step of carrying out purification to the extension products.Thus, it is possible to further improve the accurate of MALDI-TOF Mass Spectrometer Method Degree, so as to improve the Efficiency and accuracy for detecting the mutation of predetermined site in DNA sample.
The extension products are carried out purification by specific example of the invention using resin anion (R.A.).Thereby, it is possible to more The degree of accuracy of MALDI-TOF Mass Spectrometer Method is further improved, so as to improve the efficiency for detecting the mutation of predetermined site in DNA sample And degree of accuracy.
According to the second aspect of the invention, the present invention propose it is a kind of for detecting DNA sample in predetermined site mutation System.Embodiments in accordance with the present invention, this is used to detect that the system of the mutation of predetermined site in DNA sample includes：DNA sample Amplification device, the DNA sample amplification device, for entering performing PCR amplification, to obtain amplified production, institute to the DNA sample Amplified production is stated comprising the predetermined site；Amplified production extension apparatus, the amplified production extension apparatus and the DNA sample Amplification device is connected, and to receive amplified production from the DNA sample amplification device, and carries out few core to the amplified production Thuja acid extension, to obtain the extension products of 3 ' one base of end connection in the extension primer, wherein, the extension 3 ' ends of primer are close to the predetermined site；Molecular weight detection device, the molecular weight detection device prolongs with the amplified production Stretch device to be connected, to determine the molecular weight of the extension products；And mutation analysises device, the mutation analysises device is based on The molecular weight of the extension products, determines the mutation type of the predetermined site.Using the system, can effectively implement basis The method of the mutation of predetermined site in the detection DNA sample of the embodiment of the present invention, so as to effectively determine pre-determined bit in DNA sample The mutation of point.
Embodiments in accordance with the present invention, under the system of the mutation of predetermined site can also have in above-mentioned detection DNA sample Row additional technical feature：
According to one embodiment of present invention, amplimer pair, the amplification are provided with the DNA sample amplification device Extension primer is provided with product extension apparatus.Thus, it is easy to DNA sample amplification device and amplified production extension apparatus right respectively DNA sample is expanded, and carries out oligonucleotide extension.
According to one embodiment of present invention, the predetermined site sport selected from GJB2 genes, GJB3 genes, The mutation of at least one gene of SLC26A4 genes and mtDNA, the GJB2 genes sport selected from 35delG, At least one of 167delT, 176-191del16,299_300delAT and 235delC, the sporting for GJB3 genes is selected from At least one of site 538C ＞ T and 547G ＞ A, the SLC26A4 genes sport selected from 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, 2162C ＞ T, 2168A ＞ G and At least one of IVS15+5G ＞ A, and at least one sported selected from 1494C ＞ T and 1555A ＞ G of the mt DNA, The amplimer includes the first primer and the second primer, wherein, for these mutation, can be using listed in Tables 1 and 2 Primer combination (above having a detailed description, will not be described here).Inventors of the present invention have surprisingly found that by using upper The primer combination stated, can effectively detect listed mutation type.
According to one embodiment of present invention, further include：Amplified production purifier, the amplified production purification dress Put and be connected with the DNA sample amplification device and the amplified production extension apparatus respectively, to carry out to the amplified production Purified treatment, and will be input into the amplified production extension apparatus through the amplified production of purification.Thus, it is possible to remove amplification produce The dNTP of remaining, such that it is able to improve the efficiency of follow-up extension, and then can realize efficiently detecting in DNA sample in thing The mutation of predetermined site.
According to one embodiment of present invention, the molecular weight detection device is MALDI-TOF mass spectrometric apparatus.
According to one embodiment of present invention, extension products purification devices are further included, wherein, the extension products are pure Makeup is put and is connected with the amplified production extension apparatus and the MALDI-TOF mass spectrometric apparatus respectively, to produce to described extension Thing carries out purification process, and purified extension products are input into the MALDI-TOF mass spectrometric apparatus.
According to one embodiment of present invention, the extension products purification devices are resin anion (R.A.).
According to the third aspect of the invention we, the present invention propose it is a kind of for determining DNA sample in predetermined site mutation Test kit.Embodiments in accordance with the present invention, the test kit includes：Amplimer pair, the amplimer is to being suitable to described DNA sample carries out pcr amplification reaction, and to obtain amplified production, the amplified production includes the predetermined site；And extend Primer, the extension products are suitable to utilize ddNTP, with the amplified production as template, carry out oligonucleotide extension, so as to The extension products of 3 ' one base of end connection in the extension primer are obtained, wherein, 3 ' ends of the extension primer are close to institute State predetermined site.Using the test kit, prepared extension products, can be efficiently used for determining predetermined site in DNA sample Mutation, so as to implement determination DNA sample according to embodiments of the present invention in predetermined site mutation method.
Embodiments in accordance with the present invention, it is above-mentioned for determining DNA sample in the test kit of mutation of predetermined site can be with With following additional technical feature：
According to one embodiment of present invention, the predetermined site sport selected from GJB2 genes, GJB3 genes, The mutation of at least one gene of SLC26A4 genes and mtDNA, the GJB2 genes sport selected from 35delG, At least one of 167delT, 176-191del16,299_300delAT and 235delC, the sporting for GJB3 genes is selected from At least one of site 538C ＞ T and 547G ＞ A, the SLC26A4 genes sport selected from 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, 2162C ＞ T, 2168A ＞ G and At least one of IVS15+5G ＞ A, and at least one sported selected from 1494C ＞ T and 1555A ＞ G of the mt DNA, The amplimer includes the first primer and the second primer, and the amplimer includes the first primer and the second primer, wherein, pin To these mutation, primer combination (above having a detailed description, will not be described here) listed in Tables 1 and 2 can be adopted. Inventors of the present invention have surprisingly found that and combined by using above-mentioned primer, can effectively detect listed mutation Type.
According to the fourth aspect of the invention, the present invention proposes a kind of deaf method of diagnosing hereditary.According to the present invention Embodiment, comprise the following steps：Extract the DNA sample for suspecting the experimenter with hereditary hearing impairment；According to aforementioned determination DNA The method of the mutation of predetermined site in sample, the mutation to predetermined site in the DNA sample is analyzed；And based on described There is the mutation of the predetermined site in DNA sample, determine the experimenter with hereditary hearing impairment, wherein, the pre-determined bit The mutation for sporting at least one gene selected from GJB2 genes, GJB3 genes, SLC26A4 genes and mtDNA of point, it is described Sport selected from 35delG, 167delT, 176-191del16,299_300delAT and 235delC at least the one of GJB2 genes Kind, at least one sported selected from site 538C ＞ T and 547G ＞ A of the GJB3 genes, the SLC26A4 genes it is prominent It is changed into selected from 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ At least one of A, 2162C ＞ T, 2168A ＞ G and IVS15+5G ＞ A, and the mt DNA are sported selected from 1494C ＞ T With at least one of 1555A ＞ G.Thus, the deaf method of diagnosing hereditary according to embodiments of the present invention, can effectively examine Whether disconnected experimenter belongs to hereditary hearing impairment, and can aid in confirming the deaf cause of disease, and then can adopt phase for the cause of disease The treatment answered and ancillary method.
Embodiments in accordance with the present invention, the deaf method of above-mentioned diagnosing hereditary can also have following supplementary technology special Levy：
According to one embodiment of present invention, the amplimer includes the first primer and the second primer, wherein, for front Mutation is stated, primer combination (above having a detailed description, will not be described here) listed in Tables 1 and 2 can be adopted.This It is bright it is surprisingly found by the inventors that combined by using above-mentioned primer, can effectively detect listed mutation class Type, such that it is able to efficiently determine experimenter whether with hereditary hearing impairment.
According to the fifth aspect of the invention, the present invention proposes a kind of method of prenatal diagnosis hereditary hearing impairment.According to this Inventive embodiment, the method for the prenatal diagnosis hereditary hearing impairment is comprised the following steps：Isolating fetal DNA sample；According to aforementioned The method for determining the mutation of predetermined site in DNA sample, the mutation to predetermined site in the foetal DNA sample is analyzed； And based on the mutation that there is the predetermined site in the foetal DNA sample, thus it is speculated that the fetus suffers from hereditary hearing impairment, its In, at least one base sported selected from GJB2 genes, GJB3 genes, SLC26A4 genes and mtDNA of the predetermined site The mutation of cause, the GJB2 genes sport selected from 35delG, 167delT, 176-191del16,299_300delAT and At least one of 235delC, at least one sported selected from site 538C ＞ T and 547G ＞ A of the GJB3 genes is described SLC26A4 genes sport selected from 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, 2162C ＞ T, at least one of 2168A ＞ G and IVS15+5G ＞ A, and the mt DNA's is prominent It is changed at least one selected from 1494C ＞ T and 1555A ＞ G.Thus, diagnosing hereditary deafness according to embodiments of the present invention Method, can aid in speculating fetus with hereditary hearing impairment, and can aid in confirming the deaf cause of disease, and then can be for disease Because using corresponding treatment and ancillary method.
According to one embodiment of present invention, the amplimer includes the first primer and the second primer, wherein, for front Mutation is stated, primer combination (above having a detailed description, will not be described here) listed in Tables 1 and 2 can be adopted.This It is bright it is surprisingly found by the inventors that combined by using above-mentioned primer, can effectively detect listed mutation class Type, such that it is able to speculate fetus whether with hereditary hearing impairment.
According to one embodiment of present invention, the foetal DNA is extracted from the chorion of anemia of pregnant woman, amniotic fluid or Cord blood 's.Thus, it is possible in pregnant early stage whether fetus can either be speculated with hereditary hearing impairment, and will not be due to directly from fetus group Extraction sample is knitted, and causes the accidents such as fetal abortion.
According to the sixth aspect of the invention, the present invention proposes a kind of method of prediction cochlear implant effect.According to this Bright embodiment, the method for the prediction cochlear implant effect is comprised the following steps：Extract the DNA sample of deafness patient；According to front The method for determining the mutation of predetermined site in DNA sample is stated, the mutation to predetermined site in the DNA sample is analyzed；Base There is the mutation of the predetermined site in the DNA sample, determine that the deafness patient suffers from hereditary hearing impairment；Based on described Deafness patient suffers from hereditary hearing impairment, prediction cochlear implant for the deafness patient effectively, wherein, the predetermined site it is prominent It is changed into the mutation of at least one gene selected from GJB2 genes, GJB3 genes, SLC26A4 genes and mtDNA, the GJB2 bases At least one sported selected from 35delG, 167delT, 176-191del16,299_300delAT and 235delC of cause, institute State at least one sported selected from site 538C ＞ T and 547G ＞ A of GJB3 genes, the SLC26A4 genes are sported Selected from 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, At least one of 2162C ＞ T, 2168A ＞ G and IVS15+5G ＞ A, and the mt DNA sport selected from 1494C ＞ T and At least one of 1555A ＞ G.Thus, it is possible to pass through the cause of disease for determining deafness patient determining whether to adopt cochlear implant To aid in deafness patient to obtain audition.
Embodiments in accordance with the present invention, the method for above-mentioned prediction cochlear implant effect can have following supplementary technology special Levy：
According to one embodiment of present invention, the amplimer includes the first primer and the second primer, wherein, wherein, For aforementioned mutation, primer combination listed in Tables 1 and 2 can be adopted (above to have a detailed description, here is no longer gone to live in the household of one's in-laws on getting married State).Inventors of the present invention have surprisingly found that and combined by using above-mentioned primer, can effectively detect listed Mutation type, such that it is able to efficiently speculate fetus whether with hereditary hearing impairment.
According to the seventh aspect of the invention, the present invention proposes a kind of test kit, it is characterised in that include：Amplimer It is right, the amplimer to being suitable to carry out pcr amplification reaction to DNA sample, to obtain amplified production, the amplified production bag Containing the predetermined site；And extension primer, the extension products are suitable to utilize ddNTP, with the amplified production as template, enter Row oligonucleotide extension, to obtain the extension products of 3 ' one base of end connection in the extension primer, wherein, institute 3 ' ends of extension primer are stated close to the predetermined site, the predetermined site sport selected from GJB2 genes, GJB3 genes, The mutation of at least one gene of SLC26A4 genes and mtDNA, the GJB2 genes sport selected from 35delG, At least one of 167delT, 176-191del16,299_300delAT and 235delC, the sporting for GJB3 genes is selected from At least one of site 538C ＞ T and 547G ＞ A, the SLC26A4 genes sport selected from 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, 2162C ＞ T, 2168A ＞ G and At least one of IVS15+5G ＞ A, and at least one sported selected from 1494C ＞ T and 1555A ＞ G of the mt DNA, The amplimer includes the first primer and the second primer, wherein, for aforementioned mutation, can be using listed in Tables 1 and 2 Primer combination (above having a detailed description, will not be described here).Inventors of the present invention have surprisingly found that by using upper Extension products prepared by the primer combination stated, can be used very efficiently for detecting listed mutation type, such that it is able to height Effect ground determines hereditary hearing impairment.
According to one embodiment of present invention, the test kit can be used for selected from diagnosing hereditary deafness, prenatal diagnosis At least one of hereditary hearing impairment and prediction cochlear implant effect.Thus, using the test kit, before can effectively implementing Diagnosing hereditary deafness according to embodiments of the present invention, prenatal diagnosis hereditary hearing impairment and the prediction cochlear implant effect stated Method.
The additional aspect and advantage of the present invention will be set forth in part in the description, and partly will become from the following description Obtain substantially, or recognized by the practice of the present invention.
Description of the drawings
The above-mentioned and/or additional aspect and advantage of the present invention will become from the description with reference to accompanying drawings below to embodiment It is substantially and easy to understand, wherein：
Fig. 1 is that the flow process of the method for the mutation of predetermined site in detection DNA sample according to an embodiment of the invention is shown It is intended to；
Fig. 2 be one embodiment of the invention for detecting DNA sample in predetermined site mutation system schematic diagram；
Fig. 3-14 is the mass spectrum inspection result of detection hereditary hearing impairment associated gene mutation according to embodiments of the present invention.
Specific embodiment
Embodiments of the invention are described below in detail, the example of the embodiment is shown in the drawings, wherein from start to finish Same or similar label represents same or similar element or the element with same or like function.Below with reference to attached The embodiment of figure description is exemplary, is only used for explaining the present invention, and is not considered as limiting the invention.
The term " first " for using in the present invention and " second " are only used for describing purpose, and it is not intended that indicating or dark Show relative importance or the implicit quantity for indicating indicated technical characteristic.Thus, " first ", the feature of " second " are defined Can express or implicitly include one or more this feature.Further, in describing the invention, unless otherwise Illustrate, " multiple " are meant that two or more.
The present invention is completed based on the following discovery of inventor：For the gene mutation of known site, because of its mutation Type is known, thus the molecular weight of the oligonucleotide sequence by one section length-specific of the detection comprising the known site, The numerical value that the molecular weight can be based on is judged in the site with the presence or absence of mutation, and by calculating, can know the mutation Type.
The method of the mutation of predetermined site in detection DNA sample
According to the first aspect of the invention, the present invention proposes a kind of side of the mutation of predetermined site in detection DNA sample Method.The term " predetermined site " for being used herein refers to the target site of DNA sample mutation analysises, is commonly referred to as The mutation type in the site is fully studied, the clear site of its function.Herein, the term for being used is " prominent Become ", refer to and the distinguishing situation of wild-type DNA-sequence, it can include inserting, replacing, lacking one or more alkali Base, you being point mutation, it is also possible to the overall change of one section of sequence.
With reference to Fig. 1, embodiments in accordance with the present invention, detect the method for the mutation of predetermined site in DNA sample including following Step：
S100：Pcr amplification reaction is carried out to DNA sample using amplimer, to obtain amplified production, amplified production bag Containing predetermined site.Embodiments in accordance with the present invention, the source of the DNA sample that can be adopted, are not particularly limited.According to the present invention An example, the DNA sample behaviour complete genome DNA that can be adopted.According to one embodiment of present invention, can adopt and contain The DNA fragmentation for needing location point detected as DNA sample, can so improve the efficiency and precision of detection.For example, can be with The all DNA in biological specimen is extracted first, then by conventional separation method, obtains the DNA fragmentation containing specific site.
Embodiments in accordance with the present invention, the mutation of the predetermined site that can be studied by the method for the present invention is not by spy Do not limit.According to some embodiments of the invention, can by the method for the present invention, the mutation of the predetermined site for being detected be for Selected from the mutation of at least one gene of mankind's GJB2 genes, GJB3 genes, SLC26A4 genes and mtDNA.The present invention's sends out A person of good sense to the mutational site in said gene it has surprisingly been found that by the method for the embodiment of the present invention, effectively can examine A specific example of the invention is surveyed, the mutational site that can be detected and common mutation type are in table 3 below Any one listed：
The deaf associated gene mutation of the human inheritance's property of table 3
It should be noted that the method for expressing in these mutational sites is expression way well known by persons skilled in the art. In view of mutational site both can occur in cDNA sequence, it is also possible to occur on intron.For this purpose, inventor provides mutation Illustrate, to be described to the exact site being mutated.Wherein, illustrate that rule is：
1) letter is added to distinguish the type of referenced sequence before site：
1. " c. " represents the sequence with reference to cDNA, such as：C.235delC, the 25th base C disappearance of cDNA sequence is represented
2. " m. " expression refers to mitochondrial sequence, such as：M.1494C ＞ T, represent the 1494th alkali of mtdna sequence Base C is replaced into T.
2) started with intron：Exon sequence number+the site in the position of intron such as：IVS15+5G ＞ A, represent 5th bases G in the downstream of the 15th exon of SLC26A4 genes is replaced into A.
With regard to the said gene of human wild type, can be obtained by NCBI Shelf numbers.The NCBI of human wild type GJB2 Shelf number is NG_ for the NCBI Shelf numbers of NG_008309.1, SLC26A4 for the NCBI Shelf numbers of NG_008358.1, GJB3 008489.1st, the NCBI Shelf numbers of mt DNA (mitochondrial DNA) are NC_012920.
For convenience of understanding, GJB2, GJB3, SLC26A4, mt DNA (mitochondrial DNA) is briefly introduced below.
GJB2 genes：The gene mapping in autosome 13q11-12 regions, DNA total lengths 4804bp, containing 2 exons, Coding region is 678bp, encodes the inserted by connexin Connexin 26 being made up of 266 amino acid residues, belongs to β -2 albumen, It is a part for potassium ion peripheral passage.GJB2 gene mutation is the modal cause of disease of hereditary hearing impairment, and GJB2 gene mutation is led The deafness of cause is before language, bilateral, symmetry are deaf, and deafness variation is larger, can be by slightly to pole severe, but majority being Severe or pole severe deafness.In Chinese population, common GJB2 gene mutation types mainly have 235delC, 299_300delAT, 176_191del16 etc., can account for more than the 80% of GJB2 gene mutation crowds.With regard to the detailed description of the gene, may refer to Dai P, Yu F, Han B, et al.GJB2mutation spectrum in 2,063Chinese patients with Nonsyndromic hearing impairment [J] .J Transl Med, 2009,7：26, here is by referring to being incorporated to this Text.
GJB3 genes：The gene mapping has 2 exons in 1p33-p35, encodes the gap containing 270 aminoacid and connects Connect PROTEIN C onnexin31.GJB3 gene mutation can cause autosomal dominant or recessive non-syndrome deaf, quilt Think relevant with high-frequency balance.With regard to the detailed description of the gene, Xia JH, Liu CY, Tang BS, et are may refer to al.Mutat ions in the gene encoding gap junction protein beta-3 associated With autosomal dominant hearing impairment.NatGenet, 1998,20：370-373, here passes through Reference is expressly incorporated herein.
SLC26A4 genes：Also referred to as PDS genes, the gene mapping shows outward in autosome 7q31 regions containing 21 Son, encodes 1 multiple transmembrane protein Pendrin being made up of 780 amino acid residues, belongs to ion transport body family, mainly It is relevant with iodine/chloride ion transhipment.Clinical signs are that congenital or posteriority is deaf, and deafness occurs or increases and wound, flu It is relevant.PDS gene mutation species is more, but 919--2A ＞ G, 2168A ＞ G, 1226G ＞ A, 1975G ＞ C, 1229C ＞ T, 1174A ＞ T, 1687_1692insA, IVS15+5G ＞ A, 2027T ＞ A, 589G ＞ A and 281C ＞ T mutant frequencies are up to 82.51%.With regard to the detailed description of the gene, Yuan Yongyi is may refer to, kingdom builds, Huang Deliang, etc. large vestibular aqueduct is related SLC26A4 hotspot mutations region examination Discussion on Project. Chinese Journal of Otology；2010,8 (3)：292-295, here passes through Reference is expressly incorporated herein.
Mitochondrial DNA gene：The drug induced deafness that mitochondrial gene mutation causes with aminoglycosides antibiotics (AmAn) Relevant, mitochondrial gene mutation can cause mitochondrial defect, have influence on the cochlear hair cell mitochondrion directly related with audition Production capacity it is not enough, so as to cause cochlea with vestibule cell injury or death.Mitochondrial DNA gene mutation be maternal inheritance, Chang Early stage of growing up occurs, and shows as bilateral symmetric property, based on high-frequency balance, the phonosensitive nerve deafness of varying degree.Line The major site of mitochondrial genes mutation has 1555A ＞ G and 1494C ＞ T.
With regard to the detailed description of said gene mutation type, the Research Literature of correlation can be seen, for convenience of the special list of description It is as follows, by reference to cited document is expressly incorporated herein.
Thus, using method according to embodiments of the present invention, the gene mutation of deaf correlation can be effectively detected, and And then can effectively predict that experimenter suffers from hereditary hearing impairment, for example can with the deaf pathogenic factor of auxiliary diagnosis patient, from And can pointedly adopt corresponding therapeutic scheme.
It will be appreciated to those of skill in the art that can be expanded using any PCR method DNA sample, as long as institute Predetermined site is included in the amplified production for obtaining.Specific example of the invention, in order to diagnose above table 3 in it is listed Mutation type, the first primer and the second primer of listed primer pair respectively as amplimer in table 1 can be adopted.This Invention it is surprisingly found by the inventors that by using above-mentioned amplimer, the amplification to predetermined site can be effectively realized, And the efficiency and accuracy of detection mutation type can be subsequently being effectively improved, such that it is able to efficiently determine that experimenter is It is no with hereditary hearing impairment.According to one embodiment of present invention, shown in table 1 the first primer and the second primer 5 ' is held Can also all have 10 base acgttggatg (SEQ ID NO：53) sequence label, inventor has found, by using upper Sequence label is stated, can cause the molecular weight of above-mentioned first primer and the second primer not in follow-up mass spectrographic detection range, by This, can further improve the degree of accuracy and efficiency of detection.
S200：After the amplified production comprising predetermined site is obtained, it is possible to use extension primer and ddNTP, with institute The amplified production of acquisition is template, carries out oligonucleotide extension, to obtain 3 ' the end connections one in the extension primer The extension products of individual base.Embodiments in accordance with the present invention, 3 ' ends of extension primer are close to predetermined site.Thus, obtained Base corresponding to 3 ' ends of extension products includes the abrupt information of predetermined site, can subsequently pass through dividing for molecular weight Analysis, determines that whether the site has catastrophic event, and can determine the type of the catastrophic event.Those skilled in the art can be with Understand, above-mentioned oligonucleotide extension can be carried out to amplified production by any of PCR method.It is of the invention One embodiment, can adopt primer listed in table 2 to carry out above-mentioned oligonucleotide extension as extension primer.This It is bright it is surprisingly found by the inventors that combined by using primer listed in Tables 1 and 2, can effectively detect listed The mutation type for going out.
According to one embodiment of present invention, before the oligonucleotide extension is carried out, may further include The amplified production for being obtained is processed using alkali phosphatase the step of.Thus, by alkali phosphatase to amplified production Processed, the dNTP of remaining in amplified production can be removed, such that it is able to improve the efficiency of follow-up extension, and then can Realize efficiently detecting the mutation of predetermined site in DNA sample.
S300：After above-mentioned extension products are obtained, molecular weight detection can be carried out to extension products, to be extended The molecular weight of product.Embodiments in accordance with the present invention, can adopt carries out molecular weight inspection to extension products by any known method Survey.According to one embodiment of present invention, by MALDI-TOF mass spectrums (Matrix-assisted laser desorption ionization, Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) Detection carries out molecular weight detection to the extension products.MALDI-TOF mass spectrums are developed in recent years a kind of new soft Ionized biological mass spectrum, is mainly made up of two parts：MALDI (MALDI) and time of flight mass Analyzer (TOF).The principle of MALDI is to use laser irradiating sample and substrate formed cocrystallization film, substrate to inhale from laser Energy transmission is received to biomolecule, and proton is obtained by proton translocation to biomolecule or from biomolecule in ionization process, and The process for ionizing biomolecule.The principle of TOF is that ion accelerates to fly over dirft tube under electric field action, is detected according to reaching Flight time of device is different and be detected and determine the mass-to-charge ratio (M/Z) of ion and be directly proportional to the flight time of ion, it is right to realize The detection of ion.
Thereby, it is possible to accurately, efficiently to extension products carry out molecular weight detection, it is surprisingly found by the inventors that passing through MALDI-TOF Mass Spectrometer Method can even realize the detection to heterozygous mutant in DNA sample or homozygous mutation.It is of the invention One embodiment, before MALDI-TOF Mass Spectrometer Method is carried out to extension products, further includes to carry out the extension products The step of purification.Thus, it is possible to further improve the degree of accuracy of MALDI-TOF Mass Spectrometer Method, detect in DNA sample so as to improve The Efficiency and accuracy of the mutation of predetermined site.Specific example of the invention, is produced using resin anion (R.A.) to described extension Thing carries out purification.Thereby, it is possible to further improve the degree of accuracy of MALDI-TOF Mass Spectrometer Method, so as to improve detection DNA sample The Efficiency and accuracy of the mutation of middle predetermined site.
S400：Finally, based on the extension products molecular weight for detecting acquisition, the mutation type of the predetermined site is determined. Due to extension be with comprising predetermined site amplified production as template, and carry out extension extension primer 3 ' end Close to the predetermined site, and ddNTP is used when extension is carried out as raw material, thus can ensure that extension can Only to extend a base, that is, predetermined site is corresponded to, the molecular weight based on each different base has more significant difference, Thus, detected by the molecular weight to extension products, the molecular weight of obtained extension products can be passed through to determine Whether predetermined site there occurs mutation, and the type undergone mutation.It should be noted that analysis here can be passed through The molecular weight of extension products and standard reference are compared to obtain.Term " standard reference " used herein can be advance The values for molecular weight of parallel test acquisition is carried out to the sample with known mutations.
Compared with prior art, method according to embodiments of the present invention at least has one of following advantages：
(1) the reagent consumptive material for using is relatively easy and stable, it is not necessary to the expensive examination such as fluorescent dye, special enzyme Agent；
(2) reaction can be carried out in micro system, reduce the use of sample and various consumable goodss；
(3) due to mass-spectrometric technique direct detection DNA molecular weight (mass-to-charge ratio) and directly determine base type (i.e., not Need to be changed through any type of signal), therefore, as long as there is the mutant fragments such as mononucleotide of a copy many in theory State property (SNP) is amplified and can recognize that, so as to prevent the possibility of false positive generation；
(4) the features such as mass-spectrometric technique also has automatization, high throughput testing, therefore, mass-spectrometric technique and many primer extension techniques It is used in combination, multiple deaf mutational sites can be detected simultaneously in a reaction system, with reference to DNA equipment, many is automatically extracted Weight PCR primer design software and data analysis software, significantly reduce workload, improve detection flux, and reduce detection Expense；
(5) have the advantages that easy to operate, result is accurate, flux is high, cheap compared with gene sequencing
The system of the mutation of predetermined site in for detecting DNA sample
According to the second aspect of the invention, the present invention propose it is a kind of for detecting DNA sample in predetermined site mutation System.With reference to Fig. 2, embodiments in accordance with the present invention, this is used to detect the system 1000 of the mutation of predetermined site in DNA sample Including：DNA sample amplification device 100, amplified production extension apparatus 200, molecular weight detection device 300 and mutation analysises device 400。
Embodiments in accordance with the present invention, DNA sample amplification device 100 is used to enter DNA sample performing PCR amplification, to obtain The amplified production of predetermined site must be included.According to one embodiment of present invention, it is provided with expansion in DNA sample amplification device 100 Increase primer pair, in the amplified production extension apparatus extension primer is provided with.Thus, it is easy to DNA sample amplification device and amplification Product extension apparatus is expanded respectively to DNA sample, and carries out oligonucleotide extension.As it was previously stated, according to the present invention Embodiment, DNA sample amplification device 100 is not particularly limited, and it can be any dress for being suitable to and being expanded to DNA sample Put.According to one embodiment of present invention, can be using known PCR device as DNA sample amplification device 100.In addition, root According to embodiments of the invention, amplimer pair can be pre-set in DNA sample amplification device 100, it is possible thereby to conveniently enter Row operation.Those skilled in the art can determine the amplimer sequence that can be adopted according to the site to be analyzed. According to one embodiment of present invention, the predetermined site is sported selected from GJB2 genes, GJB3 genes, SLC26A4 genes And the mutation of at least one gene of mtDNA, the GJB2 genes are sported selected from 35delG, 167delT, 176- At least one of 191del16,299_300delAT and 235delC, the GJB3 genes are sported selected from site 538C ＞ T With at least one of 547G ＞ A, the SLC26A4 genes sport selected from 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, 2162C ＞ T, 2168A ＞ G and IVS15+5G ＞ A At least one, and at least one sported selected from 1494C ＞ T and 1555A ＞ G of the mt DNA.With regard to these mutation, Above having been carried out describing in detail, will not be described here.For these mutation, can be using listed in Tables 1 and 2 Primer combines (above having a detailed description, will not be described here) as amplimer pair.The present inventor sends out in surprise Now combined by using above-mentioned primer, can effectively detect listed mutation type.It should be noted that at this Term " connected " used in invention should be interpreted broadly, and it can be joined directly together, or by the indirect phase of medium Even, as long as linking functionally can be realized.
Embodiments in accordance with the present invention, amplified production extension apparatus 300 is connected with DNA sample amplification device 100, so as to from DNA sample amplification device 100 receives amplified production, and carries out oligonucleotide extension to amplified production, to obtain The extension products of 3 ' one base of end connection of the extension primer, wherein, 3 ' ends of extension primer are close to the predetermined site. According to one embodiment of present invention, amplified production purifier (not shown) is may further include, amplified production is net Makeup is put and can be connected with DNA sample amplification device 100 and amplified production extension apparatus 200 respectively, to enter to amplified production Row purified treatment, and will be input into amplified production extension apparatus 200 through the amplified production of purification.Thus, it is possible to remove amplification The dNTP of remaining, such that it is able to improve the efficiency of follow-up extension, and then can realize efficiently detecting DNA sample in product The mutation of middle predetermined site.
Embodiments in accordance with the present invention, molecular weight detection device 300 can be connected with amplified production extension apparatus 200, with Just the molecular weight of the extension products is determined.According to one embodiment of present invention, the molecular weight detection device is MALDI- TOF mass spectrometric apparatus.Thereby, it is possible to accurately, efficiently to extension products carry out molecular weight detection, it is surprisingly found by the inventors that passing through MALDI-TOF Mass Spectrometer Method can even realize the detection to heterozygous mutant in sample or homozygous mutation.Of the invention one Individual embodiment, further includes extension products purification devices (not shown).Extension products purification devices can respectively with expansion Volume increase thing extension apparatus 200 is connected with MALDI-TOF mass spectrometric apparatus 300, so that extension products are carried out with purification process, and by Jing The extension products for crossing purification are input into the MALDI-TOF mass spectrometric apparatus.Thus, it is possible to further improve MALDI-TOF mass spectrums The degree of accuracy of detection, so as to improve the Efficiency and accuracy for detecting the mutation of predetermined site in DNA sample.Of the invention one Individual embodiment, the extension products purification devices are resin anion (R.A.).Thereby, it is possible to further improve MALDI-TOF mass spectrums The degree of accuracy of detection, so as to improve the Efficiency and accuracy for detecting the mutation of predetermined site in DNA sample.
Embodiments in accordance with the present invention, mutation analysises device 400 can be connected with molecular weight detection device 300, based on institute The molecular weight of the extension products for obtaining, determines the mutation type of the predetermined site.Embodiments in accordance with the present invention, mutation analysises Device 400 can with have standard reference, by drawing and be the molecular weight of extension products and standard with reference to being compared The no conclusion that there is mutation and mutation type.Term " standard reference " used herein can be in advance to known mutations Sample carry out the values for molecular weight of parallel test acquisition.In addition, embodiments in accordance with the present invention, mutation analysises device 400 is also May be adapted to carry out various statistical check analysis, to realize more accurately more accurately analyzing.
Thus, using system according to embodiments of the present invention, detection according to embodiments of the present invention can effectively be implemented The method of the mutation of predetermined site in DNA sample, so as to effectively determine the mutation of predetermined site in DNA sample.Need explanation , the function of each device mentioned above can be completed in identical container, as long as above-mentioned functions can be realized i.e. Can.
Using
According to an embodiment of the invention determine DNA sample in predetermined site mutation method can apply to it is various with The related detection of gene mutation.For example, the mutation type of mutant that can effectively to building in laboratory is detected.
Embodiments in accordance with the present invention, said method can also be applied to the deaf method of diagnosing hereditary, antenatal be examined The method of disconnected hereditary hearing impairment, the method for prenatal diagnosis hereditary hearing impairment.
Specifically, according to an aspect of the present invention, the present invention proposes a kind of deaf method of diagnosing hereditary.According to Embodiments of the invention, the deaf method of diagnosing hereditary is comprised the following steps：Extract and suspect tested with hereditary hearing impairment The DNA sample of person；According to the method for the mutation of predetermined site in aforementioned determination DNA sample, to predetermined site in the DNA sample Mutation be analyzed；And based on the mutation that there is the predetermined site in DNA sample, determine the experimenter with heredity Property it is deaf, wherein, at least one for sporting mutation listed in table 3 of the predetermined site.Thus, according to of the invention real The deaf method of the diagnosing hereditary of example is applied, can effectively diagnose whether experimenter belongs to hereditary hearing impairment, and can be auxiliary Help and confirm the deaf cause of disease, and then can be for the cause of disease using corresponding treatment and ancillary method.Embodiments in accordance with the present invention, The type of the DNA sample that can be adopted is not particularly restricted, and can adopt the complete genome DNA of experimenter, it would however also be possible to employ Come from the DNA fragmentation comprising specific gene, specific gene mentioned here refers to deaf-related gene.It is of the invention Embodiment, for mutation listed in table 3, can adopt primer combination listed in Tables 1 and 2 (above existing detailed Description, will not be described here).Inventors of the present invention have surprisingly found that and combined by using above-mentioned primer, can have very much The listed mutation type of effect ground detection, such that it is able to efficiently determine experimenter whether with hereditary hearing impairment.With regard to each step Rapid details, may refer to associated description above, will not be described here.
Further, the present invention proposes a kind of method of prenatal diagnosis hereditary hearing impairment.Embodiments in accordance with the present invention, should The method of prenatal diagnosis hereditary hearing impairment is comprised the following steps：Isolating fetal DNA sample；According to pre- in aforementioned determination DNA sample The method of the mutation of anchor point, the mutation to predetermined site in the foetal DNA sample is analyzed；And based on the fetus There is the mutation of the predetermined site in DNA sample, determine the fetus with hereditary hearing impairment, wherein, the predetermined site At least one for sporting mutation listed in table 3.Thus, the deaf side of diagnosing hereditary according to embodiments of the present invention Method, can aid in speculating fetus with hereditary hearing impairment, and can aid in confirming the deaf cause of disease, and then can be directed to the cause of disease Using corresponding treatment and ancillary method.For mutation listed in table 3, primer listed in Tables 1 and 2 can be adopted Combination (above having a detailed description, will not be described here).Inventors of the present invention have surprisingly found that and drawn by using above-mentioned Whether thing is combined, and can effectively detect listed mutation type, such that it is able to speculate fetus with hereditary hearing impairment. Embodiments in accordance with the present invention, the type of the DNA sample that can be adopted is not particularly restricted, and can adopt the full genome of fetus Group DNA, it would however also be possible to employ come from the DNA fragmentation comprising specific gene of fetus, specific gene mentioned here refers to ear Deaf related gene.Embodiments in accordance with the present invention, the source of Fetal genome DNA is not particularly limited.Of the invention one Individual embodiment, fetus complete genome DNA is extracted from the chorion of anemia of pregnant woman, amniotic fluid or Cord blood.Thus, it is possible in pregnant morning Whether the phase just can effectively speculate fetus with hereditary hearing impairment.In addition, according to one embodiment of present invention, it is also possible to pass through The free nucleic acid for coming from fetus is separated from the peripheral blood of anemia of pregnant woman, as the DNA sample for carrying out deaf coherent detection.
According to another aspect of the invention, present invention also offers a kind of method of prediction cochlear implant effect.According to this Inventive embodiment, the method for the prediction cochlear implant effect is comprised the following steps：Extract the DNA sample of deafness patient；According to The method of the mutation of predetermined site in aforementioned determination DNA sample, the mutation to predetermined site in the DNA sample is analyzed； Based on the mutation that there is the predetermined site in the DNA sample, determine that the deafness patient suffers from hereditary hearing impairment；Based on institute Deafness patient is stated with hereditary hearing impairment, prediction cochlear implant is effective for the deafness patient, wherein, the predetermined site Sport at least one of mutation listed in table 3.Thus, it is possible to pass through the cause of disease for determining deafness patient determining whether Deafness patient can be aided in using cochlear implant to obtain audition.For mutation listed in table 3, Tables 1 and 2 can be adopted In listed primer combination (above having a detailed description, will not be described here).Inventors of the present invention have surprisingly found that logical Cross and use above-mentioned primer to combine, listed mutation type can be effectively detected, such that it is able to predict deafness patient Whether there is remaining spiral ganglion, on the premise of not treat to disease, to bypass using cochlear implant and receiving The hair cell of damage directly utilizes galvanism acoustic nerve so as to rebuild audition.Embodiments in accordance with the present invention, the DNA that can be adopted The type of sample is not particularly restricted, and can adopt the complete genome DNA of fetus, it would however also be possible to employ come from including for fetus The DNA fragmentation of specific gene, specific gene mentioned here refers to deaf-related gene.
Test kit
The invention allows for a kind of test kit, it is characterised in that include：Amplimer pair and extension primer.According to Embodiments of the invention, amplimer to being suitable to carry out pcr amplification reaction to DNA, to obtain the amplification comprising predetermined site Product, extension products are suitable to utilize ddNTP, with resulting amplified production as template, carry out oligonucleotide extension, so as to The extension products of 3 ' one base of end connection in the extension primer are obtained, wherein, 3 ' ends of extension primer are close to described pre- Anchor point, at least one for sporting mutation listed in table 3 of the predetermined site.For mutation listed in table 3, Primer combination (above having a detailed description, will not be described here) listed in Tables 1 and 2 can be adopted respectively as amplification Primer pair and extension primer.Inventors of the present invention have surprisingly found that the extension prepared by using above-mentioned primer combination is produced Thing, can be used very efficiently for detecting listed mutation type, such that it is able to efficiently determine hereditary hearing impairment.According to this One embodiment of invention, using the test kit, can effectively implement aforesaid detection DNA samples according to embodiments of the present invention The side of the mutation of predetermined site, deaf diagnosing hereditary, prenatal diagnosis hereditary hearing impairment and prediction cochlear implant effect in product Method.Embodiments in accordance with the present invention, the invention allows for one group of primer combination that can be used for mentioned reagent box.Drawn using this Thing is combined, and can effectively detect the mutation of predetermined site in DNA sample, diagnosing hereditary deafness, prenatal diagnosis heritability ear Deaf and prediction cochlear implant effect method.
Below according to specific embodiment, the present invention will be described.It should be noted that these embodiments are only to be The explanation present invention, and can not by any way be construed to limitation of the present invention.In addition, unless stated otherwise, following Involved method is conventional method in embodiment, and involved material and preparation is also commercially available.
Embodiment 1
1. design of primers
According to 20, selected to be detected and/or typing deaf gene mutational site, including 4 genes, it is respectively： GJB2 genes (including site 35delG, 167delT, 176-191del16,299_300delAT and 235delC), GJB3 genes (comprising site 538C ＞ T and 547G ＞ A), SLC26A4 genes (comprising site 281C ＞ T, 589G ＞ A, 919-2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, 2162C ＞ T, 2168A ＞ G and IVS15+5G ＞ A) With the 1494C ＞ T and 1555A ＞ G of mt DNA.
Position and genotype design amplimer pair and an extension primer according to mutational site, wherein amplimer Length has the sequence label of 10 bases acgttggatg at 5 ' ends in 30 bases or so, its amplimer；Extension primer Length be 17-28 base, it is allowed to there are 1-5 base and a template incomplete pairing in 5 ' ends, and 3 ' terminal bases and are mutated The end of site 3 ' adjacent base is matched completely.In addition, the extension primer of different loci and extension products, extension products and extension products Between molecular weight difference be not less than 30D.The amplimer for above-mentioned 20 deaf gene mutational sites of present invention design is joined 1 (carrying sequence label acgttggatg at 5 ' ends of First ray and the second sequence) is shown in Table, extension primer is referring to table 2.
2. DNA extraction
8 parts of clinical blood samples that clinic is collected, using paramagnetic particle method DNA is extracted.
3. PCR amplifications
Expanded by PCR, obtain target sequence amplification product.Pcr amplification reaction system is referring to table 4.Wherein, all reagent purchases Buy from Sequenom companies of the U.S., PCR instrument is PCR System 9700Dual 384-Well Sample Block Module。
Table 4
PCR reaction conditions are 94 DEG C, 2 minutes；94 DEG C of degeneration 20 seconds, 56 DEG C are annealed 30 seconds, and 72 DEG C extend 1 minute, expand altogether Increase 45 to circulate；Final 72 DEG C extend 5 minutes.In the present embodiment, the template for using is known site 299_300delAT, 281C There is the human genome DNA of mutation in ＞ T, 1229C ＞ T, IVS15+5G ＞ A, 2168A ＞ G and 1494C ＞ T, and positive control is The normal human genome DNA of known array, negative control is aseptic double-distilled water.
4. SAP process
By SAP enzymes (shrimp alkaline phosphotase) process, the dNTP contained in the amplified production that 2. removing step obtains, with true Only extend a base when protecting extension.SAP enzyme reaction systems see the table below 5.All reagent purchases are public from U.S. Sequenom Take charge of, PCR instrument isPCRSystem 9700Dual 384-Well Sample Block Module。
Table 5
Reagent Volume/reaction
Water (HPLE levels) 1.53 microlitre
SAP enzyme buffer liquids 0.17 microlitre
SAP enzymes 0.30 microlitre
Pcr amplification product 5.0 microlitre
Cumulative volume 7.0 microlitre
SAP enzyme reactions condition be 37 DEG C incubate 40 minutes, to remove pcr amplification reaction in remaining dNTP；85 DEG C incubate 5 Minute, so that SAP enzymes inactivation.
5. extension
Amplified production with 3. middle acquisition, by extension, at 3 ' ends of extension primer a bases is connected as template, So as to obtain extension products.The raw material that extension is used is the ddNTP through modification of liquor quality, and it both ensure that extension Only connect a base, the resolution that whole system can be made again is improved.Extension system is shown in Table 6.All reagent purchases are from U.S. Sequenom companies of state, PCR instrument is PCRSystem 9700Dual 384-Well Sample Block Module。。
Table 6
* wherein extension primer mixture carries out linear relationship adjustment (that is, according to every kind of according to the molecular size range of each primer The usage amount of the every kind of primer of molecular weight calculation of extension primer).With the extension being optimal, optimum mass spectra peak is obtained Figure.
Extension condition is 94 DEG C, 30 seconds；94 DEG C of degeneration 5 seconds, 52 DEG C are annealed 5 seconds, and 80 DEG C extend 5 seconds, coamplification 40 Individual circulation, and in each cycle annealing and extension carry out 5 partial circulatings；Final 72 DEG C extend 3 minutes.
6. resin purification
Using the extension products of resin (model 08040, buy from Sequenom companies of the U.S.) purification step 4. middle acquisition. 6mg resins, 18.00 microlitres of water is added vertically to shake up 40min in extension products.After the reaction of this step, resin will be with reaction Cation in system is fully combined, so that reaction system desalination.Purified product after the completion of reaction can preserve number at 4 DEG C My god, also can preserve several weeks at -20 DEG C.The purified product of gained takes supernatant and is directly used in mass spectrum after 4000rpm is centrifuged 5 minutes Detection.
7. Mass Spectrometer Method
By point sample instrument (model MassARRAY Nanodispenser RS1000 are bought from Sequenom companies of the U.S.) Jing steps extension products 5. after purification are transferred on 384 hole spectroCHIPII chips, chip matrix is tied altogether with product Crystalline substance, in Sequenom MALDI-TOF mass spectrographs, (model MassARRAY Analyzer Compact buy from the U.S. chip Sequenom companies) on carry out Mass Spectrometer Method, so that it is determined that the genotype in mutational site to be detected.
Mass Spectrometer Method result is shown in Fig. 3-8,
Fig. 3 is shown using extension primer SEQ ID NO：What the 36 couples of test sample site 299_300delAT were detected As a result.Knowable to Fig. 3-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 6545.3, the peak Jing be analyzed to identify for Wild type AT (samples sources are in normal person), it is as a result consistent with actual.Knowable to Fig. 3-2, MALDI-TOF Mass Spectrometer Method is in molecule Peak is detected at amount 6545.3 and 6561.3, the peak Jing is analyzed to identify as heterozygous deletion mutation that (samples sources are in clinical sample 1) it is, as a result consistent with actual.Knowable to Fig. 3-3, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 6561.3, described Peak Jing is analyzed to identify and is mutated (samples sources are in clinical sample 2) for homozygous deletion, as a result consistent with actual.
Fig. 4 is shown using extension primer SEQ ID NO：The result that 40 couples of test sample site 281C ＞ T are detected. Knowable to Fig. 4-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 6121, and the peak Jing is analyzed to identify as wild type C (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Fig. 4-2, MALDI-TOF Mass Spectrometer Method is being divided Peak is detected at son amount 6121 and 6200.9, the peak Jing is analyzed to identify as heterozygosis CT (samples sources are in clinical sample 3), as a result It is consistent with actual.
Fig. 5 is shown using extension primer SEQ ID NO：The knot that 41 couples of test sample site 12 29C ＞ T are detected Really.Knowable to Fig. 5-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 7053.6, and the peak Jing is analyzed to identify as open country Raw type C (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Fig. 5-2, MALDI-TOF Mass Spectrometer Method Detect peak at molecular weight 7053.6 and 7133.5, the peak Jing is analyzed to identify as heterozygosis CT that (samples sources are in clinical sample 4) it is, as a result consistent with actual.
Fig. 6 is shown using extension primer SEQ ID NO：What the 46 couples of test sample site IVS15+5G ＞ A were detected As a result.Knowable to Fig. 6-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 7961.3, the peak Jing be analyzed to identify for Wild type G (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Fig. 4-2, the inspection of MALDI-TOF mass spectrums Survey detects peak at molecular weight 7961.3 and 8041.2, and the peak Jing is analyzed to identify as heterozygosis GA that (samples sources are in clinical sample This is 5) as a result consistent with actual.
Fig. 7 is shown using extension primer SEQ ID NO：The knot that 50 couples of test sample site 2168A ＞ G are detected Really.Knowable to Fig. 7-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 7413.7, and the peak Jing is analyzed to identify as open country Raw type A (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Fig. 7-2, MALDI-TOF Mass Spectrometer Method Detect peak at molecular weight 7333.8 and 7413.7, the peak Jing is analyzed to identify as heterozygosis AG that (samples sources are in clinical sample 6) it is, as a result consistent with actual.
Fig. 8 is shown using extension primer SEQ ID NO：The knot that 51 couples of test sample site 1494C ＞ T are detected Really.Knowable to Fig. 8-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 5925.9, and the peak Jing is analyzed to identify as open country Raw type C (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Fig. 8-2, MALDI-TOF Mass Spectrometer Method Peak is detected at molecular weight 6005.8, the peak Jing is analyzed to identify as mutant homozygous T (samples sources are in clinical sample 7), knot Fruit is consistent with actual.
Embodiment 2
1. design of primers
According to 14, selected to be detected and/or typing deaf gene mutational site, in being distributed in 3 genes, point It is not：GJB2 genes (including site 299_300delAT and 235delC), SLC26A4 genes (include site 281C ＞ T, 919- 2A ＞ G, 1174A ＞ T, 1226G ＞ A, 1229C ＞ T, 1975G ＞ C, 2027T ＞ A, 2162C ＞ T, 2168A ＞ G and IVS15+ 5G ＞ A) with the 1494C ＞ T and 1555A ＞ G of mt DNA.Present invention design for above-mentioned 14 deaf gene mutational sites Amplimer is selected from the primer of embodiment 1 referring to table 7.The prolonging for above-mentioned 14 deaf gene mutational sites of present invention design The thing that extends is selected from the primer of embodiment 1 referring to table 8.
Table 7：For the amplimer in above-mentioned 14 deaf gene mutational sites.
Table 8：For the extension primer in above-mentioned 14 deaf gene mutational sites.
Subsequent experimental procedure is (i.e.：DNA extraction, PCR amplifications, SAP process, extension, resin purification and Mass Spectrometer Method) Same as Example 1, the template for except for the difference that using is known site 235delC, 1226G ＞ A, 2027T ＞ A and 1555A ＞ G There is the human genome DNA of mutation.
Mass Spectrometer Method result is shown in Fig. 9-12.
Fig. 9 is shown using extension primer SEQ ID NO：The result that 37 couples of test sample site 235delC are detected. Knowable to Fig. 9-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 5449.6, and the peak Jing is analyzed to identify as wild Type C (samples sources of the same Fig. 3-1 of samples sources) is as a result consistent with actual.Knowable to Fig. 9-2, MALDI-TOF Mass Spectrometer Method exists Detect peak at molecular weight 5449.6 and 5529.5, the peak Jing is analyzed to identify as heterozygous deletion mutation that (samples sources are in clinic Sample 8), it is as a result consistent with actual.
Figure 10 is shown using extension primer SEQ ID NO：The knot that 44 couples of test sample site 12 26G ＞ A are detected Really.Knowable to Figure 10-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 5304.5, the peak Jing be analyzed to identify for Wild type G (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Figure 10-2, MALDI-TOF mass spectrums Detection detects peak at molecular weight 5288.5 and 5304.5, and the peak Jing is analyzed to identify as heterozygosis GA that (samples sources are in clinic Sample 9), it is as a result consistent with actual.
Figure 11 is shown using extension primer SEQ ID NO：The knot that 48 couples of test sample site 2027T ＞ A are detected Really.Knowable to Figure 11-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 5355.5, the peak Jing be analyzed to identify for Wild type G (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Figure 11-2, MALDI-TOF mass spectrums Detection detects peak at molecular weight 5355.5 and 5411.4, and the peak Jing is analyzed to identify as heterozygosis GA that (samples sources are in clinic Sample 10), it is as a result consistent with actual.
Figure 12 is shown using extension primer SEQ ID NO：The knot that 52 couples of test sample site 1555A ＞ G are detected Really.Knowable to Figure 12-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 6394.1, the peak Jing be analyzed to identify for Wild type A (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Figure 12-2, MALDI-TOF mass spectrums Detection detects peak at molecular weight 6314.2, and the peak Jing is analyzed to identify as mutant homozygous G that (samples sources are in clinical sample 11 Samples sources), it is as a result consistent with actual.
Embodiment 3
1. design of primers
According to 4, selected to be detected and/or typing deaf gene mutational site, in being distributed in 3 genes, respectively It is：The 1494C ＞ T of GJB2 genes (including site 235delC), SLC26A4 genes (including site 919-2A ＞ G) with mt DNA With 1555A ＞ G.The amplimer for above-mentioned 4 deaf gene mutational sites of present invention design is referring to table 9, extension primer Referring to table 10.
Table 9：For the amplimer in above-mentioned 4 deaf gene mutational sites.
Table 10：For the extension primer in above-mentioned 4 deaf gene mutational sites.
Sequence number Primer sequence Primer explanation
SEQ ID NO：37 ggATCCTGCTATGGGCC The extension primer of site 235delC
SEQ ID NO：42 GCAGTAGCAATTATCGTC The extension primer of site 919-2A ＞ G
SEQ ID NO：51 CGTACACACCGCCCGTCAC The extension primer of site 1494C ＞ T
SEQ ID NO：52 ACTTACCATGTTACGACTTG The extension primer of site 1555A ＞ G
Subsequent experimental procedure is (i.e.：DNA extraction, PCR amplifications, SAP process, extension, resin purification and Mass Spectrometer Method) Same as Example 1, the template for except for the difference that using is mankind's base that mutation occur in known site 919-2A ＞ G and 1555A ＞ G Because of a group DNA.
Mass Spectrometer Method result is shown in Figure 13-14.
Figure 13 is using extension primer SEQ ID NO：The result that 42 couples of test sample site 919-2A ＞ G are detected. Knowable to Figure 13-1, MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 5825.7, and the peak Jing is analyzed to identify as wild Type A (samples sources of the same Fig. 3-1 of samples sources) is as a result consistent with actual.Knowable to Figure 13-2, MALDI-TOF Mass Spectrometer Method Detect peak at molecular weight 5745.8 and 5825.7, the peak Jing is analyzed to identify as heterozygosis AG, as a result consistent with actual.From figure 13-3 understands that MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 5745.8, and the peak Jing is analyzed to identify mutant homozygous G (samples sources are in clinical sample 12), it is as a result consistent with actual.
Figure 14 is using extension primer SEQ ID NO：The result that 52 couples of test sample site 1555A ＞ G are detected.From Figure 13-1 understands that MALDI-TOF Mass Spectrometer Method detects peak at molecular weight 6394.1, and the peak Jing is analyzed to identify as wild type A (samples sources of the same Fig. 3-1 of samples sources), it is as a result consistent with actual.Knowable to Figure 13-2, MALDI-TOF Mass Spectrometer Method exists Detect peak at molecular weight 6314.2, the peak Jing is analyzed to identify as mutant homozygous G (samples sources are in clinical sample 11), as a result It is consistent with actual.
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show The description of example " or " some examples " etc. means to combine specific features, structure, material or spy that the embodiment or example are described Point is contained at least one embodiment of the present invention or example.In this manual, to the schematic representation of above-mentioned term not Necessarily refer to identical embodiment or example.And, the specific features of description, structure, material or feature can be any One or more embodiments or example in combine in an appropriate manner.
Although an embodiment of the present invention has been shown and described, it will be understood by those skilled in the art that：Not These embodiments can be carried out with various changes, modification, replacement and modification in the case of the principle and objective that depart from the present invention, this The scope of invention is limited by claim and its equivalent.

Claims (9)

1. it is a kind of for detecting DNA sample in deaf relevant mutational site combination system, it is characterised in that include：
DNA sample amplification device, the DNA sample amplification device, for entering performing PCR amplification to the DNA sample, to obtain Amplified production, the amplified production includes the mutational site；
Amplified production extension apparatus, the amplified production extension apparatus is connected with the DNA sample amplification device, so as to from described DNA sample amplification device receives amplified production, and carries out oligonucleotide extension to the amplified production, to obtain The extension products of 3 ' one base of end connection of the extension primer, wherein, 3 ' ends of the extension primer are close to the mutation Site；
Molecular weight detection device, the molecular weight detection device is connected with the amplified production extension apparatus, described to determine The molecular weight of extension products；And
Mutation analysises device, molecular weight of the mutation analysises device based on the extension products, determines the mutational site Mutation type,
Wherein, detect that testing result when being the positive is with all mutational sites in the deaf relevant mutational site combination Standard,
Amplimer pair is provided with the DNA sample amplification device, extension is provided with the amplified production extension apparatus and is drawn Thing,
The mutation for sporting GJB2 genes, SLC26A4 genes and mtDNA,
The deaf relevant mutational site is combined as：The mutation 299_300delAT and 235delC of the GJB2 genes, it is described The mutation 281C of SLC26A4 genes>T、919-2A>G、1226G>A、1229C>T、2027T>A、2168A>G and IVS15+5G>A, And the mutation 1494C of the mt DNA>T and 1555A>G,
The amplimer includes the first primer and the second primer, is mutated for the 299_300delAT of the GJB2 genes, institute It is such as SEQ ID NO to state the first primer：Shown in 7, second primer is such as SEQ ID NO：Shown in 8, the extension primer is Such as SEQ ID NO：Shown in 36；It is mutated for the 235delC of the GJB2 genes, first primer is such as SEQ ID NO：9 Shown, second primer is such as SEQ ID NO：Shown in 10, the extension primer is such as SEQ ID NO：Shown in 37；For institute State the 281C of SLC26A4 genes>T is mutated, and first primer is such as SEQ ID NO：Shown in 15, second primer be as SEQ ID NO：Shown in 16, the extension primer is such as SEQ ID NO：Shown in 40；For the 919-2A of the SLC26A4 genes >G is mutated, and first primer is such as SEQ ID NO：Shown in 19, second primer is such as SEQ ID NO：It is described shown in 20 Extension primer is such as SEQ ID NO：Shown in 42；For the 1226G of the SLC26A4 genes>A is mutated, and first primer is Such as SEQ ID NO：Shown in 21, second primer is such as SEQ ID NO：Shown in 22, the extension primer is such as SEQ ID NO：Shown in 44；For the 1229C of the SLC26A4 genes>T is mutated, and first primer is such as SEQ ID NO：Shown in 21, Second primer is such as SEQ ID NO：Shown in 22, the extension primer is such as SEQ ID NO：Shown in 45；For described The 2027T of SLC26A4 genes>A is mutated, and first primer is such as SEQ ID NO：Shown in 25, second primer is such as SEQ ID NO：Shown in 26, the extension primer is such as SEQ ID NO：Shown in 48；For the 2168A of the SLC26A4 genes>G dashes forward Become, first primer is such as SEQ ID NO：Shown in 27, second primer is such as SEQ ID NO：Shown in 28, the extension Primer is such as SEQ ID NO：Shown in 50；For the IVS15+5G of the SLC26A4 genes>A be mutated, first primer be as SEQ ID NO：Shown in 23, second primer is such as SEQ ID NO：Shown in 24, the extension primer is such as SEQ ID NO： Shown in 46；For the 1494C of the mt DNA genes>T is mutated, and first primer is such as SEQ ID NO：It is described shown in 29 Second primer is such as SEQ ID NO：Shown in 30, the extension primer is such as SEQ ID NO：Shown in 51；And for the mt The 1555A of DNA genes>G is mutated, and first primer is such as SEQ ID NO：Shown in 31, second primer is such as SEQ ID NO：Shown in 32, the extension primer is such as SEQ ID NO：Shown in 52.
2. system according to claim 1, it is characterised in that further include：
Amplified production purifier, the amplified production purifier respectively with the DNA sample amplification device and the amplification Product extension apparatus is connected, to carry out purified treatment to the amplified production, and by through the amplified production of purification be input into The amplified production extension apparatus.
3. system according to claim 1, it is characterised in that the molecular weight detection device is MALDI-TOF mass spectrums dress Put.
4. system according to claim 3, it is characterised in that further include extension products purification devices,
Wherein,
The extension products purification devices respectively with the amplified production extension apparatus and the MALDI-TOF mass spectrometric apparatus phase Even, so that the extension products are carried out with purification process, and purified extension products are input into the MALDI-TOF matter Spectral apparatus.
5. system according to claim 4, it is characterised in that the extension products purification devices are resin anion (R.A.).
6. a kind of Primer composition, it is characterised in that include：
Amplimer pair, the amplimer to being suitable to carry out pcr amplification reaction to DNA sample, to obtain amplified production, institute Amplified production is stated comprising predetermined site；And
Extension primer, the extension products are suitable to utilize ddNTP, with the amplified production as template, carry out oligonucleotide extension Reaction, to obtain the extension products of 3 ' one base of end connection in the extension primer, wherein, the 3 ' of the extension primer Hold close to the predetermined site,
Wherein,
The predetermined site is deaf relevant mutational site, and the Primer composition is used to detect deaf related prominent in DNA sample Become Sites Combination, the mutation for sporting GJB2 genes, SLC26A4 genes and mtDNA, the deaf relevant mutational site It is combined as：The mutation 299_300delAT and 235delC of the GJB2 genes, the mutation 281C of the SLC26A4 genes>T、 919-2A>G、1226G>A、1229C>T、2027T>A、2168A>G and IVS15+5G>A, and the mutation of the mt DNA 1494C>T and 1555A>G,
The amplimer to including the first primer and the second primer, wherein, for the 299_300delAT of the GJB2 genes Mutation, first primer is such as SEQ ID NO：Shown in 7, second primer is such as SEQ ID NO：Shown in 8, the extension Primer is such as SEQ ID NO：Shown in 36；It is mutated for the 235delC of the GJB2 genes, first primer is such as SEQ ID NO：Shown in 9, second primer is such as SEQ ID NO：Shown in 10, the extension primer is such as SEQ ID NO：Shown in 37；Pin 281C to the SLC26A4 genes>T is mutated, and first primer is such as SEQ ID NO：Shown in 15, second primer is Such as SEQ ID NO：Shown in 16, the extension primer is such as SEQ ID NO：Shown in 40；For the 919- of the SLC26A4 genes 2A>G is mutated, and first primer is such as SEQ ID NO：Shown in 19, second primer is such as SEQ ID NO：Shown in 20, institute It is such as SEQ ID NO to state extension primer：Shown in 42；For the 1226G of the SLC26A4 genes>A is mutated, first primer It is such as SEQ ID NO：Shown in 21, second primer is such as SEQ ID NO：Shown in 22, the extension primer is such as SEQ ID NO：Shown in 44；For the 1229C of the SLC26A4 genes>T is mutated, and first primer is such as SEQ ID NO：Shown in 21, Second primer is such as SEQ ID NO：Shown in 22, the extension primer is such as SEQ ID NO：Shown in 45；For described The 2027T of SLC26A4 genes>A is mutated, and first primer is such as SEQ ID NO：Shown in 25, second primer is such as SEQ ID NO：Shown in 26, the extension primer is such as SEQ ID NO：Shown in 48；For the 2168A of the SLC26A4 genes>G dashes forward Become, first primer is such as SEQ ID NO：Shown in 27, second primer is such as SEQ ID NO：Shown in 28, the extension Primer is such as SEQ ID NO：Shown in 50；For the IVS15+5G of the SLC26A4 genes>A be mutated, first primer be as SEQ ID NO：Shown in 23, second primer is such as SEQ ID NO：Shown in 24, the extension primer is such as SEQ ID NO： Shown in 46；For the 1494C of the mt DNA genes>T is mutated, and first primer is such as SEQ ID NO：It is described shown in 29 Second primer is such as SEQ ID NO：Shown in 30, the extension primer is such as SEQ ID NO：Shown in 51；And for the mt The 1555A of DNA genes>G is mutated, and first primer is such as SEQ ID NO：Shown in 31, second primer is such as SEQ ID NO：Shown in 32, the extension primer is such as SEQ ID NO：Shown in 52.
7. Primer composition according to claim 6, it is characterised in that 5 ' ends of first primer and the second primer are equal With sequence label, the sequence label is such as SEQ ID NO：Shown in 53.
8. a kind of test kit, it is characterised in that include：
A kind of Primer composition described in claim 6 or 7.
9. test kit according to claim 8, it is characterised in that the test kit is used for selected from detection DNA sample middle ear Deaf relevant mutational site combination, deaf diagnosing hereditary, prenatal diagnosis hereditary hearing impairment and prediction cochlear implant effect are extremely Few one kind.
CN201110301714.2A 2011-10-08 2011-10-08 Kit, method and application for detecting mutation of predetermined locus in DNA sample Active CN102409089B (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201110301714.2A CN102409089B (en) 2011-10-08 2011-10-08 Kit, method and application for detecting mutation of predetermined locus in DNA sample
TW101136210A TW201315812A (en) 2011-10-08 2012-09-28 Kit, method and application of detecting predetermined locus mutation in DNA sample
PCT/CN2012/001382 WO2013049975A1 (en) 2011-10-08 2012-10-12 Kit and method for detecting mutation of predetermined site in dna sample and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201110301714.2A CN102409089B (en) 2011-10-08 2011-10-08 Kit, method and application for detecting mutation of predetermined locus in DNA sample

Publications (2)

Publication Number Publication Date
CN102409089A CN102409089A (en) 2012-04-11
CN102409089B true CN102409089B (en) 2017-04-19

Family

ID=45911428

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201110301714.2A Active CN102409089B (en) 2011-10-08 2011-10-08 Kit, method and application for detecting mutation of predetermined locus in DNA sample

Country Status (3)

Country Link
CN (1) CN102409089B (en)
TW (1) TW201315812A (en)
WO (1) WO2013049975A1 (en)

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102409089B (en) * 2011-10-08 2017-04-19 深圳华大基因股份有限公司 Kit, method and application for detecting mutation of predetermined locus in DNA sample
CN106282195A (en) * 2013-04-28 2017-01-04 中国人民解放军总医院 Gene mutation body and application thereof
CN103352073B (en) * 2013-05-14 2015-07-08 北京毅新博创生物科技有限公司 Primer system for detecting gene SNP related to genetic deafness, and use thereof
CN105087756A (en) * 2014-04-23 2015-11-25 北京贝瑞和康生物技术有限公司 Method and kit for non-invasive measurement on fetus deaf pathogenic gene mutation
CN104131008B (en) * 2014-07-24 2017-09-19 深圳华大基因股份有限公司 DNA labels, PCR primer and its application
CN105296471B (en) * 2014-08-01 2020-02-21 天津华大基因科技有限公司 DNA label, PCR primer and application thereof
CN104232631B (en) * 2014-08-26 2017-12-15 深圳华大基因股份有限公司 Label, Tag primer, kit and application thereof
CN104498609B (en) * 2014-12-18 2016-08-31 亚能生物技术（深圳）有限公司 The nucleic acid film bar of a kind of hereditary hearing impairment gene test and test kit
CN105803052A (en) * 2014-12-31 2016-07-27 天津华大基因科技有限公司 Method and kit for detecting ethanol resistance gene
CN105986010B (en) * 2015-01-30 2020-01-17 天津华大基因科技有限公司 Method and kit for detecting folate metabolism related gene
CN105255999A (en) * 2015-07-22 2016-01-20 广州市达瑞生物技术股份有限公司 Method for detecting 20 mutation sites of deaf genes
CN106480222B (en) * 2016-12-20 2019-09-24 广东辉锦创兴生物医学科技有限公司 Probe, primer, detection kit and detection method based on suspension microballon array system detection hereditary hearing impairment
CN106811533B (en) * 2017-03-06 2020-10-16 亚能生物技术（深圳）有限公司 Genetic deafness gene detection kit
CN107022641B (en) * 2017-06-09 2020-06-19 北京博奥医学检验所有限公司 Primer for detecting deafness gene and application thereof
CN109097457A (en) * 2017-06-20 2018-12-28 深圳华大智造科技有限公司 The method for determining predetermined site mutation type in sample of nucleic acid
CN110240999B (en) * 2018-03-09 2022-09-06 浙江品级基因科技有限公司 Detection device and method for improving circulating tumor DNA detection rate
CN112538523A (en) * 2019-12-31 2021-03-23 北京毅新博创生物科技有限公司 Primer group for detecting gene SNP (Single nucleotide polymorphism) related to deafness
CN112538524A (en) * 2019-12-31 2021-03-23 北京毅新博创生物科技有限公司 Detection product for detecting gene SNP related to deafness
CN111304320B (en) * 2020-04-17 2024-02-06 浙江迪谱诊断技术有限公司 Primer sequence and kit for detecting child safety drug genes
CN114250268A (en) * 2021-12-23 2022-03-29 北京毅新博创生物科技有限公司 Product for detecting capping efficiency of mRNA sample and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101514371A (en) * 2009-02-19 2009-08-26 上海交通大学 Method for detecting rs16856187 polymorphic site on 3' region of G6PC2 gene
WO2009132089A2 (en) * 2008-04-24 2009-10-29 Monsanto Technology Llc A method to identify asian soybean rust resistance quantitative trait loci in soybean and compositions thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101838683B (en) * 2008-12-12 2013-09-18 深圳华大基因科技有限公司 Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene
CN101760566B (en) * 2008-12-12 2014-01-15 深圳华大基因健康科技有限公司 Detection method on mutant site of ribonucleotide of HBV gene
CN101440407A (en) * 2008-12-12 2009-05-27 深圳华大基因科技有限公司 Method for detecting nucleotide mutant site
CN101838702A (en) * 2010-06-02 2010-09-22 何农跃 Detection method of single nucleotide polymorphism with high throughout
CN102409089B (en) * 2011-10-08 2017-04-19 深圳华大基因股份有限公司 Kit, method and application for detecting mutation of predetermined locus in DNA sample

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009132089A2 (en) * 2008-04-24 2009-10-29 Monsanto Technology Llc A method to identify asian soybean rust resistance quantitative trait loci in soybean and compositions thereof
CN101514371A (en) * 2009-02-19 2009-08-26 上海交通大学 Method for detecting rs16856187 polymorphic site on 3' region of G6PC2 gene

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Development and evaluation of a PCR and mass spectroscopy (PCR–MS)-based method for quantitative, type-specific detection of human papillomavirus;Divya A. Patel等;《Journal of Virological Methods》;20090503;第160卷;第79页右栏第1段 *
High levelmultiplex genotyping by MALDI-TOF mass spectrometry;Philip Ross等;《Nature Biotechnology》;19981231;第16卷;摘要，第1347页右栏第2段至第1351页左栏第1段 *

Also Published As

Publication number Publication date
TW201315812A (en) 2013-04-16
CN102409089A (en) 2012-04-11
WO2013049975A1 (en) 2013-04-11

Similar Documents

Publication Publication Date Title
CN102409089B (en) Kit, method and application for detecting mutation of predetermined locus in DNA sample
JP6760917B2 (en) Analysis of genomic fractions using polymorphic counts
Fucharoen et al. Prenatal detection of fetal hemoglobin E gene from maternal plasma
CN105255999A (en) Method for detecting 20 mutation sites of deaf genes
CN107849607A (en) The single-molecule sequencing of plasma dna
CN105874081A (en) Genetic analysis method
WO2013053183A1 (en) Method and system for genotyping predetermined region in nucleic acid sample
HUE030510T2 (en) Diagnosing fetal chromosomal aneuploidy using genomic sequencing
EP1364062A2 (en) Diagnostic test for the detection of chromosomal abnormalities in a fetus
WO2012027483A2 (en) Defining diagnostic and therapeutic targets of conserved free floating fetal dna in maternal circulating blood
Brown et al. Molecular diagnosis of hearing loss
CN106868106A (en) Use the methods for prenatal diagnosis of digital pcr
Ordoñez et al. Evaluation of sample stability and automated DNA extraction for fetal sex determination using cell-free fetal DNA in maternal plasma
CN108998507B (en) Noninvasive high-throughput detection method applied to crowd complex genetic relationship identification
Chang et al. A novel method for noninvasive diagnosis of monogenic diseases from circulating fetal cells
CN106995851A (en) Expand PCR primer, the kit of detection PKD1 gene mutations and the application of PKD1 extron overlength fragments
WO2018135464A1 (en) Rapid genetic screening method using next generation sequencer
Yu et al. Seed weight differences between wild and domesticated soybeans are associated with specific changes in gene expression
Zupanič Pajnič et al. Slovenian population data for five new European Standard Set short tandem repeat loci and SE33 locus
CN114774549A (en) Second-generation sequencing kit for targeted detection of CAH candidate gene
CN105506066B (en) Cell identification method for new-generation noninvasive prenatal diagnosis field
US11869630B2 (en) Screening system and method for determining a presence and an assessment score of cell-free DNA fragments
CN113337598A (en) Detection kit for pregnancy vitamin B12 deficiency risk assessment and application method
KR20170051256A (en) A method for prenatal diagnosis using digital PCR
Fabre et al. Is saliva a good alternative to blood for high density genotyping studies: SNP and CNV comparisons

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1168130

Country of ref document: HK

ASS Succession or assignment of patent right

Free format text: FORMER OWNER: BGI-SHENZHEN

Effective date: 20150729

Owner name: SHENZHEN BGI CORPORATION

Free format text: FORMER OWNER: BGI-SHENZHEN CO., LTD.

Effective date: 20150729

C41 Transfer of patent application or patent right or utility model
TA01 Transfer of patent application right

Effective date of registration: 20150729

Address after: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer

Applicant after: BGI SHENZHEN CO LTD

Address before: North Road No. 146, building 11F-3 Industrial Zone in Yantian District of Shenzhen city of Guangdong Province in 518083

Applicant before: BGI-Shenzhen Co., Ltd.

Applicant before: BGI-Shenzhen

C41 Transfer of patent application or patent right or utility model
CB03 Change of inventor or designer information

Inventor after: Wang Qiuju

Inventor after: Feng Dafei

Inventor after: Zou Jing

Inventor after: Liu Xingwang

Inventor after: Wang Xiaman

Inventor after: Wang Jian

Inventor after: Wang Jun

Inventor after: Yang Huanming

Inventor before: Feng Dafei

Inventor before: Zou Jing

Inventor before: Liu Xingwang

Inventor before: Wang Xiaman

Inventor before: Wang Jian

Inventor before: Wang Jun

Inventor before: Yang Huanming

COR Change of bibliographic data
TA01 Transfer of patent application right

Effective date of registration: 20160504

Address after: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer

Applicant after: BGI SHENZHEN CO LTD

Applicant after: General Hospital of Chinese PLA

Address before: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer

Applicant before: BGI SHENZHEN CO LTD

GR01 Patent grant
GR01 Patent grant
EE01 Entry into force of recordation of patent licensing contract
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20120411

Assignee: Huada biological technology (Wuhan) Co., Ltd.

Assignor: BGI SHENZHEN CO LTD

Contract record no.: 2017990000372

Denomination of invention: Kit, method and application for detecting mutation of predetermined locus in DNA sample

Granted publication date: 20170419

License type: Common License

Record date: 20170918

REG Reference to a national code

Ref country code: HK

Ref legal event code: GR

Ref document number: 1168130

Country of ref document: HK