CN102409089A - Kit, method and application for detecting mutation of predetermined locus in DNA sample - Google Patents
Kit, method and application for detecting mutation of predetermined locus in DNA sample Download PDFInfo
- Publication number
- CN102409089A CN102409089A CN2011103017142A CN201110301714A CN102409089A CN 102409089 A CN102409089 A CN 102409089A CN 2011103017142 A CN2011103017142 A CN 2011103017142A CN 201110301714 A CN201110301714 A CN 201110301714A CN 102409089 A CN102409089 A CN 102409089A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- extension
- sudden change
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000000034 method Methods 0.000 title claims abstract description 71
- 230000035772 mutation Effects 0.000 title claims abstract description 55
- 230000003321 amplification Effects 0.000 claims abstract description 27
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 27
- 238000006243 chemical reaction Methods 0.000 claims abstract description 20
- 108091034117 Oligonucleotide Proteins 0.000 claims abstract description 19
- 238000012408 PCR amplification Methods 0.000 claims abstract description 18
- 230000008859 change Effects 0.000 claims description 195
- 108020004414 DNA Proteins 0.000 claims description 146
- 238000001514 detection method Methods 0.000 claims description 88
- 238000004519 manufacturing process Methods 0.000 claims description 84
- 101150030803 SLC26A4 gene Proteins 0.000 claims description 73
- 208000016354 hearing loss disease Diseases 0.000 claims description 70
- 206010011878 Deafness Diseases 0.000 claims description 63
- 238000001840 matrix-assisted laser desorption--ionisation time-of-flight mass spectrometry Methods 0.000 claims description 51
- 108090000623 proteins and genes Proteins 0.000 claims description 50
- 101150034593 Gjb2 gene Proteins 0.000 claims description 47
- 108020005196 Mitochondrial DNA Proteins 0.000 claims description 44
- 238000004458 analytical method Methods 0.000 claims description 37
- 101150113584 GJB3 gene Proteins 0.000 claims description 33
- 238000012360 testing method Methods 0.000 claims description 30
- 231100000895 deafness Toxicity 0.000 claims description 23
- 102220285550 rs730881360 Human genes 0.000 claims description 22
- 210000003754 fetus Anatomy 0.000 claims description 21
- 102220193786 rs1057516953 Human genes 0.000 claims description 21
- 102200115376 rs111033318 Human genes 0.000 claims description 21
- 102200115374 rs121908362 Human genes 0.000 claims description 21
- 238000000746 purification Methods 0.000 claims description 19
- 102200115471 rs111033220 Human genes 0.000 claims description 19
- 102200115469 rs111033305 Human genes 0.000 claims description 19
- 102220063029 rs200455203 Human genes 0.000 claims description 19
- 102200115475 rs201562855 Human genes 0.000 claims description 19
- 102220013037 rs111033380 Human genes 0.000 claims description 18
- 102200115372 rs121908363 Human genes 0.000 claims description 18
- 210000003477 cochlea Anatomy 0.000 claims description 15
- 238000003745 diagnosis Methods 0.000 claims description 13
- 230000000694 effects Effects 0.000 claims description 12
- 239000011347 resin Substances 0.000 claims description 12
- 229920005989 resin Polymers 0.000 claims description 12
- 102200018568 rs121912926 Human genes 0.000 claims description 12
- 102200029752 rs2760118 Human genes 0.000 claims description 12
- 239000000284 extract Substances 0.000 claims description 9
- 102000053602 DNA Human genes 0.000 claims description 8
- 150000001450 anions Chemical class 0.000 claims description 6
- 238000007670 refining Methods 0.000 claims description 6
- 102200083961 rs74315318 Human genes 0.000 claims description 5
- 102220002486 rs74315319 Human genes 0.000 claims description 5
- 230000001605 fetal effect Effects 0.000 claims description 4
- 210000004381 amniotic fluid Anatomy 0.000 claims description 3
- 210000001136 chorion Anatomy 0.000 claims description 3
- 210000004700 fetal blood Anatomy 0.000 claims description 3
- 238000010241 blood sampling Methods 0.000 claims 1
- 239000000047 product Substances 0.000 description 65
- 238000012790 confirmation Methods 0.000 description 26
- 230000000869 mutational effect Effects 0.000 description 21
- 201000010099 disease Diseases 0.000 description 12
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 12
- 238000013461 design Methods 0.000 description 8
- 206010064571 Gene mutation Diseases 0.000 description 7
- 239000003153 chemical reaction reagent Substances 0.000 description 7
- 230000006870 function Effects 0.000 description 6
- 102000004190 Enzymes Human genes 0.000 description 5
- 108090000790 Enzymes Proteins 0.000 description 5
- 102100037156 Gap junction beta-2 protein Human genes 0.000 description 5
- 101000954092 Homo sapiens Gap junction beta-2 protein Proteins 0.000 description 5
- 238000013467 fragmentation Methods 0.000 description 5
- 238000006062 fragmentation reaction Methods 0.000 description 5
- 241000196324 Embryophyta Species 0.000 description 4
- 102100039397 Gap junction beta-3 protein Human genes 0.000 description 4
- 101000889136 Homo sapiens Gap junction beta-3 protein Proteins 0.000 description 4
- 102100035278 Pendrin Human genes 0.000 description 4
- 230000008901 benefit Effects 0.000 description 4
- 230000004087 circulation Effects 0.000 description 4
- 150000002500 ions Chemical class 0.000 description 4
- 239000000463 material Substances 0.000 description 4
- 238000007400 DNA extraction Methods 0.000 description 3
- 206010011882 Deafness congenital Diseases 0.000 description 3
- 108700024394 Exon Proteins 0.000 description 3
- 238000000137 annealing Methods 0.000 description 3
- 239000002299 complementary DNA Substances 0.000 description 3
- 238000012217 deletion Methods 0.000 description 3
- 230000037430 deletion Effects 0.000 description 3
- 239000007943 implant Substances 0.000 description 3
- 238000013507 mapping Methods 0.000 description 3
- 238000001819 mass spectrum Methods 0.000 description 3
- 230000002438 mitochondrial effect Effects 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 239000002994 raw material Substances 0.000 description 3
- 206010013886 Dysaesthesia Diseases 0.000 description 2
- 108091006507 SLC26A4 Proteins 0.000 description 2
- 125000000539 amino acid group Chemical group 0.000 description 2
- 230000002146 bilateral effect Effects 0.000 description 2
- 239000003795 chemical substances by application Substances 0.000 description 2
- 238000002288 cocrystallisation Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 238000006911 enzymatic reaction Methods 0.000 description 2
- 230000004907 flux Effects 0.000 description 2
- 238000011534 incubation Methods 0.000 description 2
- 238000001254 matrix assisted laser desorption--ionisation time-of-flight mass spectrum Methods 0.000 description 2
- 239000011159 matrix material Substances 0.000 description 2
- 238000000816 matrix-assisted laser desorption--ionisation Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 231100000350 mutagenesis Toxicity 0.000 description 2
- 208000035824 paresthesia Diseases 0.000 description 2
- 238000012545 processing Methods 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 239000012264 purified product Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000003595 spectral effect Effects 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- ZCYVEMRRCGMTRW-UHFFFAOYSA-N 7553-56-2 Chemical compound [I] ZCYVEMRRCGMTRW-UHFFFAOYSA-N 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 206010010356 Congenital anomaly Diseases 0.000 description 1
- 206010011891 Deafness neurosensory Diseases 0.000 description 1
- 241000238557 Decapoda Species 0.000 description 1
- 240000004859 Gamochaeta purpurea Species 0.000 description 1
- 101100276179 Homo sapiens GJB2 gene Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 101150108119 PDS gene Proteins 0.000 description 1
- 108050001616 Pendrin Proteins 0.000 description 1
- NPYPAHLBTDXSSS-UHFFFAOYSA-N Potassium ion Chemical compound [K+] NPYPAHLBTDXSSS-UHFFFAOYSA-N 0.000 description 1
- 208000027418 Wounds and injury Diseases 0.000 description 1
- 206010000210 abortion Diseases 0.000 description 1
- 231100000176 abortion Toxicity 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 150000001413 amino acids Chemical class 0.000 description 1
- 229940126575 aminoglycoside Drugs 0.000 description 1
- 239000003242 anti bacterial agent Substances 0.000 description 1
- 229940088710 antibiotic agent Drugs 0.000 description 1
- 210000003030 auditory receptor cell Anatomy 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 230000005779 cell damage Effects 0.000 description 1
- 230000030833 cell death Effects 0.000 description 1
- 208000037887 cell injury Diseases 0.000 description 1
- 210000000860 cochlear nerve Anatomy 0.000 description 1
- 230000009849 deactivation Effects 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 238000010612 desalination reaction Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000008034 disappearance Effects 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 230000005684 electric field Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 210000002768 hair cell Anatomy 0.000 description 1
- 230000001771 impaired effect Effects 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 229910052740 iodine Inorganic materials 0.000 description 1
- 239000011630 iodine Substances 0.000 description 1
- 230000037427 ion transport Effects 0.000 description 1
- 238000000752 ionisation method Methods 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 238000004949 mass spectrometry Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000002703 mutagenesis Methods 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 230000003287 optical effect Effects 0.000 description 1
- 230000005298 paramagnetic effect Effects 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 210000005259 peripheral blood Anatomy 0.000 description 1
- 239000011886 peripheral blood Substances 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 229910001414 potassium ion Inorganic materials 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000004445 quantitative analysis Methods 0.000 description 1
- 230000005855 radiation Effects 0.000 description 1
- 102220030676 rs11231865 Human genes 0.000 description 1
- 102220174146 rs772608978 Human genes 0.000 description 1
- 102220005909 rs80338943 Human genes 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 210000001323 spiral ganglion Anatomy 0.000 description 1
- 239000000758 substrate Substances 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 102000035160 transmembrane proteins Human genes 0.000 description 1
- 108091005703 transmembrane proteins Proteins 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 230000001720 vestibular Effects 0.000 description 1
- 210000002905 vestibular aqueduct Anatomy 0.000 description 1
- 230000004304 visual acuity Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
Abstract
The invention relates to a kit, a method and an application for detecting mutation of predetermined locus in DNA sample. The method for detecting mutation of predetermined locus in DNA sample comprises the following steps: using an amplification primer for performing PCR amplification reaction on the DNA sample, using an extended primer and dd NTP; using the amplification product as template, performing the oligonucleotide extension reaction, so as to obtain the extended primer having a 3' end connected with a base, which is the extended product; and based on the molecular weight of the extended primer, determining the mutation type of the predetermined locus. The invention can effectively determine whether there is mutation in the predetermined locus and can determine the mutation type.
Description
Technical field
The present invention relates to detect test kit, combination of primers, method and the application of the sudden change of predetermined site in the DNA sample.
Background technology
Forming sudden change at specific site is research means commonly used in the molecular biology experiment, can help to analyze the effect of the point mutation of specific site for gene function.Usually, after having made up the targeted mutagenesis body, how whether this site sudden change correctly having been taken place, is the problem that those skilled in the art face.
Yet, at present in the biology field, still remain to be improved for the detection of specific locus mutation.
Summary of the invention
The present invention is intended to solve at least one of technical problem that exists in the prior art.For this reason, one object of the present invention is to propose a kind of method that can effectively detect the sudden change of predetermined site in the DNA sample.
According to a first aspect of the invention, the present invention proposes the method for the sudden change of predetermined site in a kind of DNA of detection sample.According to embodiments of the invention, this method may further comprise the steps: use amplimer that said DNA sample is carried out pcr amplification reaction, so that obtain amplified production, said amplified production comprises said predetermined site; Using and extend primer and ddNTP, is template with said amplified production, carries out the oligonucleotide extension, so that obtain to connect the extension products of a base at 3 ' end of said extension primer, wherein, the said predetermined site of 3 ' end next-door neighbour of said extension primer; Said extension products is carried out molecular weight detection, so that obtain the molecular weight of said extension products; And, confirm the mutation type of said predetermined site based on the molecular weight of said extension products.Because extension is to be template with the amplified production that comprises predetermined site, and carry out the said predetermined site of 3 ' end next-door neighbour of the extension primer of extension, and when carrying out extension, use ddNTP as raw material; Thereby can guarantee that extension can only extend a base; Promptly corresponding predetermined site, based on the molecular weight existence difference comparatively significantly of each different bases, thereby; Molecular weight through to extension products detects; The molecular weight of the extension products that can pass through to be obtained confirms at predetermined site whether sudden change to have taken place, and the type of being undergone mutation.Thus, can be widely used in the molecular biosciences field, for example detect whether successfully made up corresponding two mutants.
According to embodiments of the invention, the method for the sudden change of predetermined site can also have following additional technical feature in the above-mentioned detection DNA sample:
According to one embodiment of present invention, said DNA sample behaviour complete genome DNA.Thus, can detect the transgenation among the mankind effectively.
According to one embodiment of present invention, the sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of said predetermined site.Thus, can detect effectively and deaf relevant transgenation.
According to one embodiment of present invention; Sporting of said GJB2 gene is selected from least a of 35delG, 167delT, 176-191del16,299_300delAT and 235delC; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from least a of 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A, and sporting of said mt DNA is selected from least a of 1494C＞T and 1555A＞G.Thus, can detect the relevant transgenation of hereditary hearing impairment effectively.
According to one embodiment of present invention; Said amplimer comprises first primer and second primer; Wherein, to the 35delG sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:1; Said second primer is shown in SEQ ID NO:2, and said extension primer is shown in SEQ ID NO:33; To the 167delT sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:3, and said second primer is shown in SEQ ID NO:4, and said extension primer is shown in SEQ ID NO:34; To the 176-191del16 sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:5, and said second primer is shown in SEQ ID NO:6, and said extension primer is shown in SEQ ID NO:35; To the 299_300delAT sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:7, and said second primer is shown in SEQ ID NO:8, and said extension primer is shown in SEQ ID NO:36; To the 235delC sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:9, and said second primer is shown in SEQID NO:10, and said extension primer is shown in SEQ ID NO:37; To the 538C＞T sudden change of said GJB3 gene, said first primer is shown in SEQ ID NO:11, and said second primer is shown in SEQ ID NO:12, and said extension primer is shown in SEQ ID NO:38; To the 547G＞A sudden change of said GJB3 gene, said first primer is shown in SEQ ID NO:13, and said second primer is shown in SEQ ID NO:14, and said extension primer is shown in SEQ ID NO:39; To the 281C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:15, and said second primer is shown in SEQ ID NO:16, and said extension primer is shown in SEQID NO:40; To the 589G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:17, and said second primer is shown in SEQ ID NO:18, and said extension primer is shown in SEQ ID NO:41; To the 919-2A＞G sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:19, and said second primer is shown in SEQ ID NO:20, and said extension primer is shown in SEQ ID NO:42; To the 1174A＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:43; To the 1226G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:44; To the 1229C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:45; To the 1975G＞C sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:25, and said second primer is shown in SEQ ID NO:26, and said extension primer is shown in SEQ ID NO:47; To the 2027T＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:25, and said second primer is shown in SEQ ID NO:26, and said extension primer is shown in SEQ ID NO:48; To the 2162C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:27, and said second primer is shown in SEQ ID NO:28, and said extension primer is shown in SEQ ID NO:49; To the 2168A＞G sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:27, and said second primer is shown in SEQ ID NO:28, and said extension primer is shown in SEQ ID NO:50; To the IVS15+5G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:23, and said second primer is shown in SEQ ID NO:24, and said extension primer is shown in SEQ ID NO:46; To the 1494C＞T sudden change of said mtDNA gene, said first primer is shown in SEQ ID NO:29, and said second primer is shown in SEQ ID NO:30, and said extension primer is shown in SEQ ID NO:51; And the 1555A＞G sudden change that is directed against said mt DNA gene, said first primer is shown in SEQ ID NO:31, and said second primer is shown in SEQ ID NO:32, and said extension primer is shown in SEQ ID NO:52.
Be convenient statement, with above-mentioned combination of primers sum up respectively with following table 1 and 2 in.
Table 1: to the amplimer in above-mentioned 20 deaf gene mutational sites.
*:, from top to bottom, be respectively first primer (sometimes be also referred to as upstream primer) and second primer (sometimes be also referred to as downstream primer) of each amplimer to (being also referred to as amplimer in this article sometimes) for each mutation type.
*: according to one embodiment of present invention; The sequence label that can also all have 10 base acgttggatg (SEQ ID NO:53) at first primer and the second primer 5 ' end of amplimer; The contriver finds, through adopting above-mentioned sequence label, can so that the molecular weight of above-mentioned first primer and second primer not in mass spectral sensing range; Thus, can further improve the tolerance range and the efficient of detection.
Table 2: to the extension primer in above-mentioned 20 deaf gene mutational sites.
| Sequence numbering | Primer sequence | The primer explanation |
| SEQ?ID?NO：33 | TTTGTTCACACCCCC | The extension primer of site 35delG |
| SEQ?ID?NO：34 | gggcCTTTGTCTGCAACACCC | The extension primer of site 167delT |
| SEQ?ID?NO：35 | ctccGCAACACCCTGCAGCCAG | The extension primer of site 176_191del16 |
| SEQ?ID?NO：36 | gcTGAACTTCCTCTTCTTCTC | The extension primer of site 299_300delAT |
| SEQ?ID?NO：37 | ggATCCTGCTATGGGCC | The extension primer of site 235delC |
| SEQ?ID?NO：38 | ccctaGTGGACTGCTACATTGCC | The extension primer of site 538C＞T |
| SEQ?ID?NO：39 | ctgcAGTAGGTGAAGATTTTCTTCT | The extension primer of site 547G＞A |
| SEQ?ID?NO：40 | GTCATTTCGGGAGTTAGTA | The extension primer of |
| SEQ?ID?NO：41 | CTTGTAAGTTCATTACCTGTATAATTC | The extension primer of site 589G＞A |
| SEQ?ID?NO：42 | GCAGTAGCAATTATCGTC | The extension primer of site 919-2A＞G |
| SEQ?ID?NO：43 | GCCTTTGGGATCAGC | The extension primer of site 1174A＞T |
| SEQ?ID?NO：44 | CACCACTGCTCTTTCCC | The extension primer of |
| SEQ?ID?NO：45 | ttCCACCACTGCTCTTTCCCCCA | The extension primer of |
| SEQ?ID?NO：46 | AAAACAAATTTCTAGGGATAAAATA | The extension primer of site IVS15+5G＞A |
| SEQ?ID?NO：47 | CTCCACAGTCAAGCA | The extension primer of site 1975G＞C |
| SEQ?ID?NO：48 | AGAACCTTACCACCCGC | The extension primer of |
| SEQ?ID?NO：49 | CAGAGTATAGCATCAAGGACC | The extension primer of site 2162C＞T |
| SEQ?ID?NO：50 | TCTGTAGATAGAGTATAGCATCA | The extension primer of |
| SEQ?ID?NO：51 | CGTACACACCGCCCGTCAC | The extension primer of |
| SEQ?ID?NO：52 | ACTTACCATGTTACGACTTG | The extension primer of |
Shown in table 1 and table 2, the length of amplimer is about 30 bases, and the length of extending primer is 17-28 base.In addition, the contriver finds that based on aforementioned combination of primers, the extension primer of different loci and the molecular weight difference between extension products, extension products and extension products are not less than 30D.Contriver of the present invention is surprised to find through using above-mentioned combination of primers; Can detect listed mutation type very effectively; And be suitable for detecting simultaneously the various mutations type in multiple site; According to embodiments of the invention, can accurately detect apace above-mentioned 20 kinds of mutation types simultaneously.
According to one embodiment of present invention, before carrying out said oligonucleotide extension, further comprise: use SEAP that said amplified production is carried out processed steps.Thus, amplified production is handled, can be removed dNTP remaining in the amplified production, thereby can improve the efficient of follow-up extension, and then can realize detecting efficiently the sudden change of predetermined site in the DNA sample through SEAP.
According to one embodiment of present invention, through the MALDI-TOF mass spectrometric detection said extension products is carried out molecular weight detection.Thus, can be accurately, efficiently extension products is carried out molecular weight detection, the contriver is surprised to find through the MALDI-TOF mass spectrometric detection even can realizes the detection to heterozygous mutant or homozygous mutation in the DNA sample.
According to one embodiment of present invention, before said extension products is carried out the MALDI-TOF mass spectrometric detection, further comprise the step of said extension products being carried out purifying.Thus, can further improve the tolerance range of MALDI-TOF mass spectrometric detection, thereby improve efficient and the tolerance range that detects the sudden change of predetermined site in the DNA sample.
According to concrete example of the present invention, utilize resin anion(R.A) that said extension products is carried out purifying.Thus, can further improve the tolerance range of MALDI-TOF mass spectrometric detection, thereby improve efficient and the tolerance range that detects the sudden change of predetermined site in the DNA sample.
According to a second aspect of the invention, the present invention proposes a kind of system that is used for detecting the sudden change of DNA sample predetermined site.According to embodiments of the invention; This system that is used for detecting the sudden change of DNA sample predetermined site comprises: DNA sample amplification device, and said DNA sample amplification device is used for said DNA sample is carried out pcr amplification; So that the acquisition amplified production, said amplified production comprises said predetermined site; The amplified production extension apparatus; Said amplified production extension apparatus links to each other with said DNA sample amplification device; So that receive amplified production, and said amplified production is carried out the oligonucleotide extension, so that obtain to connect the extension products of a base at 3 ' end of said extension primer from said DNA sample amplification device; Wherein, the said predetermined site of 3 ' of said extension primer end next-door neighbour; The molecular weight detection device, said molecular weight detection device links to each other with said amplified production extension apparatus, so that confirm the molecular weight of said extension products; And the mutation analysis device, said mutation analysis device is confirmed the mutation type of said predetermined site based on the molecular weight of said extension products.Utilize this system, can implement method effectively, thereby confirm the sudden change of predetermined site in the DNA sample effectively according to the sudden change of predetermined site in the detection DNA sample of the embodiment of the invention.
According to embodiments of the invention, the system of the sudden change of predetermined site can also have following additional technical feature in the above-mentioned detection DNA sample:
According to one embodiment of present invention, it is right to be provided with amplimer in the said DNA sample amplification device, is provided with the extension primer in the said amplified production extension apparatus.Thus, being convenient to DNA sample amplification device and amplified production extension apparatus increases to the DNA sample respectively and carries out the oligonucleotide extension.
According to one embodiment of present invention; The sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of said predetermined site; Sporting of said GJB2 gene is selected from least a of 35delG, 167delT, 176-191del16,299_300delAT and 235delC; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from least a of 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A, and sporting of said mt DNA be selected from least a of 1494C＞T and 1555A＞G, and said amplimer comprises first primer and second primer; Wherein, To these sudden changes, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this).Contriver of the present invention is surprised to find through using above-mentioned combination of primers, can detect listed mutation type very effectively.
According to one embodiment of present invention; Further comprise: the amplified production refining plant; Said amplified production refining plant links to each other with said amplified production extension apparatus with said DNA sample amplification device respectively; So that said amplified production is carried out purifying treatment, and the amplified production that will pass through purification inputs to said amplified production extension apparatus.Thus, can remove dNTP remaining in the amplified production, thereby can improve the efficient of follow-up extension, and then can realize detecting efficiently the sudden change of predetermined site in the DNA sample.
According to one embodiment of present invention, said molecular weight detection device is the MALDI-TOF mass spectrometric apparatus.
According to one embodiment of present invention; Further comprise the extension products purification devices; Wherein, Said extension products purification devices links to each other with said MALDI-TOF mass spectrometric apparatus with said amplified production extension apparatus respectively, so that said extension products is carried out purification process, and purified extension products is inputed to said MALDI-TOF mass spectrometric apparatus.
According to one embodiment of present invention, said extension products purification devices is a resin anion(R.A).
According to a third aspect of the invention we, the present invention proposes a kind of test kit that is used for the sudden change of definite DNA sample predetermined site.According to embodiments of the invention, this test kit comprises: amplimer is right, and said amplimer carries out pcr amplification reaction to being suitable for to said DNA sample, so that obtain amplified production, said amplified production comprises said predetermined site; And the extension primer, said extension products is suitable for utilizing ddNTP, is template with said amplified production; Carry out the oligonucleotide extension; So that obtain to connect the extension products of a base at 3 ' end of said extension primer, wherein, the said predetermined site of 3 ' end next-door neighbour of said extension primer.Utilize this test kit, prepared extension products can be used for confirming the sudden change of DNA sample predetermined site effectively, thereby implements the method according to the sudden change of predetermined site in definite DNA sample of the embodiment of the invention.
According to embodiments of the invention, the above-mentioned test kit that is used for the sudden change of definite DNA sample predetermined site can also have following additional technical feature:
According to one embodiment of present invention; The sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of said predetermined site; Sporting of said GJB2 gene is selected from least a of 35delG, 167delT, 176-191del16,299_300delAT and 235delC; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from least a of 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A; And sporting of said mt DNA be selected from least a of 1494C＞T and 1555A＞G, and said amplimer comprises first primer and second primer, and said amplimer comprises first primer and second primer; Wherein, To these sudden changes, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this).Contriver of the present invention is surprised to find through using above-mentioned combination of primers, can detect listed mutation type very effectively.
According to a forth aspect of the invention, the present invention proposes the deaf method of a kind of diagnosing hereditary.According to embodiments of the invention, may further comprise the steps: extract the DNA sample of suspecting the experimenter who suffers from hereditary hearing impairment; According to the method for the sudden change of predetermined site in aforementioned definite DNA sample, the sudden change of predetermined site in the said DNA sample is analyzed; And based on the sudden change that has said predetermined site in the said DNA sample; Confirm that said experimenter suffers from hereditary hearing impairment; Wherein, The sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of said predetermined site; Sporting of said GJB2 gene is selected from least a of 35delG, 167delT, 176-191del16,299_300delAT and 235delC; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from least a of 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A, and sporting of said mt DNA is selected from least a of 1494C＞T and 1555A＞G.Thus,, can diagnose the experimenter whether to belong to hereditary hearing impairment effectively, and can assist and confirm the deaf cause of disease, and then can adopt corresponding treatment and assist measure to the cause of disease according to the deaf method of the diagnosing hereditary of the embodiment of the invention.
According to embodiments of the invention, the deaf method of above-mentioned diagnosing hereditary can also have following additional technical feature:
According to one embodiment of present invention, said amplimer comprises first primer and second primer, wherein, to aforementioned sudden change, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this).Contriver of the present invention is surprised to find through using above-mentioned combination of primers, can detect listed mutation type very effectively, thereby can confirm efficiently whether the experimenter suffers from hereditary hearing impairment.
According to a fifth aspect of the invention, the present invention proposes a kind of method of antenatal diagnosis hereditary hearing impairment.According to embodiments of the invention, the method for this antenatal diagnosis hereditary hearing impairment may further comprise the steps: isolating fetal DNA sample; According to the method for the sudden change of predetermined site in aforementioned definite DNA sample, the sudden change of predetermined site in the said foetal DNA sample is analyzed; And based on the sudden change that has said predetermined site in the said foetal DNA sample; Infer that said fetus suffers from hereditary hearing impairment; Wherein, The sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of said predetermined site; Sporting of said GJB2 gene is selected from least a of 35delG, 167delT, 176-191del16,299_300delAT and 235delC; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from least a of 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A, and sporting of said mt DNA is selected from least a of 1494C＞T and 1555A＞G.Thus, according to the deaf method of the diagnosing hereditary of the embodiment of the invention, can assist and infer that fetus suffers from hereditary hearing impairment, and can assist and confirm the deaf cause of disease, and then can adopt corresponding treatment and assist measure to the cause of disease.
According to one embodiment of present invention, said amplimer comprises first primer and second primer, wherein, to aforementioned sudden change, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this).Contriver of the present invention is surprised to find through using above-mentioned combination of primers, can detect listed mutation type very effectively, thereby can infer whether fetus suffers from hereditary hearing impairment.
According to one embodiment of present invention, said foetal DNA is to extract chorion, amniotic fluid or the Cord blood from the pregnant woman.Thus, can either infer in early days whether fetus suffers from hereditary hearing impairment, and can be owing to directly not extracting sample, and cause accident such as fetal abortion from fetal tissue pregnant.
According to a sixth aspect of the invention, the present invention proposes a kind of method of predict electronic cochlea effect.According to embodiments of the invention, the method for this predict electronic cochlea effect may further comprise the steps: the DNA sample that extracts deafness patient; According to the method for the sudden change of predetermined site in aforementioned definite DNA sample, the sudden change of predetermined site in the said DNA sample is analyzed; Based on the sudden change that has said predetermined site in the said DNA sample, confirm that said deafness patient suffers from hereditary hearing impairment; Suffers from hereditary hearing impairment based on said deafness patient; The predict electronic cochlea is effective for said deafness patient; Wherein, The sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of said predetermined site; Sporting of said GJB2 gene is selected from least a of 35delG, 167delT, 176-191del16,299_300delAT and 235delC; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from least a of 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A, and sporting of said mt DNA is selected from least a of 1494C＞T and 1555A＞G.Thus, can determine whether to adopt cochlear implant to assist deafness patient to obtain hearing through confirming the cause of disease of deafness patient.
According to embodiments of the invention, the method for above-mentioned predict electronic cochlea effect can have following additional technical feature:
According to one embodiment of present invention, said amplimer comprises first primer and second primer, wherein, wherein, to aforementioned sudden change, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this).Contriver of the present invention is surprised to find through using above-mentioned combination of primers, can detect listed mutation type very effectively, thereby can infer efficiently whether fetus suffers from hereditary hearing impairment.
According to a seventh aspect of the invention, the present invention proposes a kind of test kit, it is characterized in that; Comprise: amplimer is right; Said amplimer carries out pcr amplification reaction to being suitable for to the DNA sample, so that obtain amplified production, said amplified production comprises said predetermined site; And extension primer; Said extension products is suitable for utilizing ddNTP; With said amplified production is template, carries out the oligonucleotide extension, so that obtain to connect at 3 ' end of said extension primer the extension products of a base; Wherein, The said predetermined site of 3 ' end next-door neighbour of said extension primer, the sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of said predetermined site, sporting of said GJB2 gene is selected from least a of 35delG, 167delT, 176-191del16,299_300delAT and 235delC; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from least a of 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A, and sporting of said mt DNA be selected from least a of 1494C＞T and 1555A＞G, and said amplimer comprises first primer and second primer; Wherein, To aforementioned sudden change, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this).Contriver of the present invention is surprised to find through using the extension products of above-mentioned combination of primers preparation, can be used to detect listed mutation type very effectively, thereby can confirm hereditary hearing impairment efficiently.
According to one embodiment of present invention, said test kit can be used to be selected from least a of diagnosing hereditary deafness, antenatal diagnosis hereditary hearing impairment and predict electronic cochlea effect.Thus, utilize this test kit, can implement effectively that aforesaid diagnosing hereditary according to the embodiment of the invention is deaf, the method for antenatal diagnosis hereditary hearing impairment and predict electronic cochlea effect.
Additional aspect of the present invention and advantage part in the following description provide, and part will become obviously from the following description, or recognize through practice of the present invention.
Description of drawings
Above-mentioned and/or additional aspect of the present invention and advantage obviously with are easily understood becoming the description of embodiment from combining figs, wherein:
Fig. 1 is the schematic flow sheet that detects the method for the sudden change of predetermined site in the DNA sample according to an embodiment of the invention;
Fig. 2 is the synoptic diagram of system of sudden change that is used for detecting DNA sample predetermined site of one embodiment of the invention;
Fig. 3-the 14th is according to the mass spectrum inspection result of the detection hereditary hearing impairment associated gene mutation of the embodiment of the invention.
Embodiment
Describe embodiments of the invention below in detail, the example of said embodiment is shown in the drawings, and wherein identical from start to finish or similar label is represented identical or similar elements or the element with identical or similar functions.Be exemplary through the embodiment that is described with reference to the drawings below, only be used to explain the present invention, and can not be interpreted as limitation of the present invention.
Term " first " and " second " of using in the present invention only are used to describe purpose, and can not be interpreted as indication or hint relative importance or the implicit quantity that indicates indicated technical characterictic.Thus, one or more a plurality of these characteristics can be shown or impliedly comprised to the characteristic that is limited with " first ", " second " clearly.Further, in description of the invention, except as otherwise noted, the implication of " a plurality of " is two or more.
The present invention is based on contriver's following discovery and accomplishes: for the transgenation of known site; Because of its mutation type is known; Thereby comprise the molecular weight of oligonucleotide sequence of one section length-specific of this known site through detection; Can judge whether there is sudden change in this site based on the numerical value of this molecular weight, and, can know the type of this sudden change through calculating.
Detect the method for the sudden change of predetermined site in the DNA sample
According to a first aspect of the invention, the present invention proposes the method for the sudden change of predetermined site in a kind of DNA of detection sample.Employed in this article term " predetermined site " is meant the target site of DNA sample mutation analysis, is commonly referred to as this site mutation type is fully studied the site that its function is clear.In this article, employed term " sudden change " refers to and the distinguishing situation of wild-type dna sequence dna, and it can comprise insertion, replace, lacks one or more base, promptly can be point mutation, and integral body that also can one section sequence changes.
With reference to figure 1, according to embodiments of the invention, the method that detects the sudden change of predetermined site in the DNA sample may further comprise the steps:
S100: use amplimer that the DNA sample is carried out pcr amplification reaction, so that obtain amplified production, amplified production comprises predetermined site.According to embodiments of the invention, the source of the DNA sample that can adopt does not receive special restriction.According to an example of the present invention, the DNA sample behaviour complete genome DNA that can adopt.According to one embodiment of present invention, can adopt the dna fragmentation that contains site to be measured to detect, can improve the efficient and the precision of detection like this as the DNA sample.For example, can at first extract all DNA in the biological specimen,, obtain to contain the dna fragmentation of specific site then through conventional separation method.
According to embodiments of the invention, the sudden change of the predetermined site that can study through method of the present invention does not receive special restriction.According to some embodiments of the invention, can be through method of the present invention, the sudden change of the predetermined site that detects is the sudden change at least a gene that is selected from human GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA.Contriver of the present invention is surprised to find; Method by the embodiment of the invention; Can detect according to a concrete example of the present invention the mutational site in the said gene effectively, the mutational site that can detect and common mutation type are listed any one in the following table 3:
The associated gene mutation of table 3 human inheritance induced deafness
Need to prove that the method for expressing in these mutational sites is phraseology well known by persons skilled in the art.In view of the mutational site both can occur on the cDNA sequence, also might occur on the intron.For this reason, the contriver provides the sudden change explanation, so that the accurate site of sudden change is described.Wherein, explain that rule is:
1) add the type of letter in the front, site with district office's reference sequences:
1. " c. " representes the sequence with reference to cDNA, as: c.235delC, the 25th base C disappearance of expression cDNA sequence
2. " m. " representes with reference to mitochondrial sequence, as: m.1494C＞and T, the 1494th base C of expression mtdna sequence is replaced into T.
2) begin with intron: exon sequence number+this site in the position of intron as: IVS15+5G＞A, the 5th bases G that is illustrated in the downstream of the 15th exon of SLC26A4 gene is replaced into A.
About the said gene of human wild type, can obtain through the NCBI number of asking for.The NCBI number of asking for of human wild type GJB2 is that the NCBI number of asking for of NG_008358.1, GJB3 is that the NCBI number of asking for of NG_008309.1, SLC26A4 is that the NCBI number of asking for of NG_008489.1, mt DNA (Mitochondrial DNA) is NC_012920.
Understand for convenient, briefly introduce in the face of GJB2, GJB3, SLC26A4, mt DNA (Mitochondrial DNA) down.
The GJB2 gene: this assignment of genes gene mapping is in euchromosome 13q11-12 zone, and DNA total length 4804bp contains 2 exons; The coding region is 678bp; The slit that coding is made up of 266 amino-acid residues connects PROTEIN C onnexin 26, belongs to β-2 albumen, is the part of potassium ion circulation path.The GJB2 transgenation is the modal cause of disease of hereditary hearing impairment, the deafness that the GJB2 transgenation causes for language before, bilateral, symmetry be deaf, the deafness variation is bigger, can be by slight to utmost point severe, but majority is severe or utmost point severe deafness.In Chinese population, common GJB2 gene mutation type mainly contains 235delC, 299_300delAT, 176_191del16 etc., can account for more than 80% of GJB2 transgenation crowd.About the detailed description of this gene, can be referring to Dai P, Yu F; Han B; Et al.GJB2mutation spectrum in 2,063Chinese patients with nonsyndromic hearing impairment [J] .J Transl Med, 2009; 7:26 incorporates this paper at this into through reference.
The GJB3 gene: this assignment of genes gene mapping has 2 exons at 1p33-p35, and coding contains 270 amino acid whose slits and connects PROTEIN C onnexin31.The GJB3 transgenation can cause autosomal dominant or recessive inheritance property non-syndrome induced deafness, is considered to relevant with the high frequency auditory dysesthesia.Detailed description about this gene; Can be referring to Xia JH, Liu CY, Tang BS; Et al.Mutat ions in the gene encoding gap junction protein beta-3 associated with autosomal dominant hearing impairment.NatGenet; 1998,20:370-373 incorporates this paper at this into through reference.
SLC26A4 gene: also be called as the PDS gene; This assignment of genes gene mapping contains 21 exons in euchromosome 7q31 zone, and 1 repeatedly transmembrane protein Pendrin that is made up of 780 amino-acid residues encodes; Belong to ion transport body family, mainly relevant with iodine/cl ions transhipment.Show as congenital clinically or acquired character is deaf, deaf take place or increase the weight of with wound, catch a cold relevant.PDS transgenation kind is more, but 919--2A＞G, 2168A＞G, 1226G＞A, 1975G＞C, 1229C＞T, 1174A＞T, 1687_1692insA, IVS15+5G＞A, 2027T＞A, 589G＞A and 281C＞T mutant frequency is up to 82.51%.About the detailed description of this gene, can be referring to Yuan Yongyi, kingdom builds, and Huang Deliang inquires into etc. the relevant SLC26A4 gene hot of. the large vestibular aqueduct regional examination scheme of suddenling change. Chinese otology magazine; 2010,8 (3): 292-295, incorporate this paper at this into through reference.
The Mitochondrial DNA gene: mitochondrial gene mutation is relevant with the drug induced deafness that aminoglycosides antibiotics (AmAn) causes; Mitochondrial gene mutation can cause mitochondrial defective; It is not enough to have influence on the mitochondrial production capacity of the cochlear hair cell directly related with hearing, thereby causes cochlea and vestibular cell injury or death.The Mitochondrial DNA transgenation is a matrilinear inheritance, and early stage generation of growing up of being everlasting shows as bilateral symmetric property, is the phonosensitive nerve deafness of master, varying degree with the high frequency auditory dysesthesia.There are 1555A＞G and 1494C＞T in the main site of mitochondrial gene mutation.
About the detailed description of said gene mutation type, can see relevant research document, special tabulation is described as follows for convenient, incorporate cited document into this paper through reference.
Thus; Utilization is according to the method for the embodiment of the invention, can detect deaf relevant transgenation effectively, and and then can predict effectively that the experimenter suffers from hereditary hearing impairment; For example can the auxiliary diagnosis patient deaf pathogenic factor, thereby can adopt the corresponding treatment scheme pointedly.
Those skilled in the art can be understood that, can adopt any PCR method DNA sample to increase, as long as comprise predetermined site in the resulting amplified production.According to concrete example of the present invention,, can adopt primer listed in the table 1 to respectively as first primer and second primer of amplimer in order to diagnose mutation type listed in the previous table 3.Contriver of the present invention is surprised to find through using above-mentioned amplimer; Can realize amplification effectively to predetermined site; And can improve efficient and the particularity that detects mutation type effectively follow-up, thereby can confirm efficiently whether the experimenter suffers from hereditary hearing impairment.According to one embodiment of present invention; The sequence label that can also all have 10 base acgttggatg (SEQ ID NO:53) at first primer shown in the table 1 and second primer 5 ' end; The contriver finds, through adopting above-mentioned sequence label, can so that the molecular weight of above-mentioned first primer and second primer not in follow-up mass spectral sensing range; Thus, can further improve the tolerance range and the efficient of detection.
S200: after obtaining to comprise the amplified production of predetermined site; Can use and extend primer and ddNTP; With the amplified production that is obtained is template, carries out the oligonucleotide extension, so that obtain to connect at 3 ' end of said extension primer the extension products of a base.According to embodiments of the invention, extend 3 ' end next-door neighbour predetermined site of primer.Thus, 3 ' terminal pairing base of the extension products that is obtained includes the sudden change information of predetermined site, can pass through the molecule quantitative analysis follow-up, confirms whether this site has catastrophic event, and can confirm the type of this catastrophic event.It will be understood by those skilled in the art that and to carry out above-mentioned oligonucleotide extension through any known PCR method to amplified production.According to one embodiment of present invention, primer listed in can employing table 2 carries out above-mentioned oligonucleotide extension as extending primer.Contriver of the present invention is surprised to find through combination of primers listed in use table 1 and the table 2, can detect listed mutation type very effectively.
According to one embodiment of present invention, before carrying out said oligonucleotide extension, may further include and use SEAP that the amplified production that is obtained is carried out processed steps.Thus, amplified production is handled, can be removed dNTP remaining in the amplified production, thereby can improve the efficient of follow-up extension, and then can realize detecting efficiently the sudden change of predetermined site in the DNA sample through SEAP.
S300: after obtaining above-mentioned extension products, can carry out molecular weight detection, so that obtain the molecular weight of extension products to extension products.According to embodiments of the invention, can adopt any known method that extension products is carried out molecular weight detection.According to one embodiment of present invention; Through MALDI-TOF mass spectrum (substance assistant laser desorpted ionized flight time mass spectrum, Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) detection said extension products is carried out molecular weight detection.The MALDI-TOF mass spectrum is a kind of novel soft ionization biological mass spectrometry that development in recent years is got up, and mainly is made up of two portions: substance assistant laser desorpted ionized ion source (MALDI) and time of flight mass analyzer (TOF).The principle of MALDI is with laser radiation sample and substrate formed cocrystallization film; Matrix absorbs transmission ofenergy and gives biomolecules from laser; And in the ionization process prototropy is obtained proton to biomolecules or from biomolecules, and make the ionized process of biomolecules.The principle of TOF is that ion quickens to fly over dirft tube under electric field action, and the ionic mass-to-charge ratio (M/Z) of promptly measuring to be detected was directly proportional with the ionic flight time according to the flight time that arrives detector is different, realizes ionic is detected.
Thus, can be accurately, efficiently extension products is carried out molecular weight detection, the contriver is surprised to find through the MALDI-TOF mass spectrometric detection even can realizes the detection to heterozygous mutant or homozygous mutation in the DNA sample.According to one embodiment of present invention, before extension products is carried out the MALDI-TOF mass spectrometric detection, further comprise the step of said extension products being carried out purifying.Thus, can further improve the tolerance range of MALDI-TOF mass spectrometric detection, thereby improve efficient and the tolerance range that detects the sudden change of predetermined site in the DNA sample.According to concrete example of the present invention, utilize resin anion(R.A) that said extension products is carried out purifying.Thus, can further improve the tolerance range of MALDI-TOF mass spectrometric detection, thereby improve efficient and the tolerance range that detects the sudden change of predetermined site in the DNA sample.
S400: last, based on the detect extension products molecular weight that obtains, confirm the mutation type of said predetermined site.Because extension is to be template with the amplified production that comprises predetermined site, and carry out the said predetermined site of 3 ' end next-door neighbour of the extension primer of extension, and when carrying out extension, use ddNTP as raw material; Thereby can guarantee that extension can only extend a base; Promptly corresponding predetermined site, based on the molecular weight existence difference comparatively significantly of each different bases, thereby; Molecular weight through to extension products detects; The molecular weight of the extension products that can pass through to be obtained confirms at predetermined site whether sudden change to have taken place, and the type of being undergone mutation.Need to prove that the analysis here can be to obtain through the molecular weight of extension products and standard reference are compared.Term used herein " standard reference " can be in advance the sample with known mutations to be carried out the values for molecular weight that parallel test obtains.
Compared with prior art, the method according to the embodiment of the invention has one of advantage at least:
(1) the reagent consumptive material that uses is simple relatively and stable, does not need optical dye, special expensive reagent such as enzyme;
(2) reaction can be carried out in micro-system, has reduced the use of sample and various running stores;
(3) since the type that mass-spectrometric technique directly detects the molecular weight (mass-to-charge ratio) of DNA and directly confirms base (promptly; Need not pass through any type of conversion of signals); Therefore; As long as the sudden change fragment that a copy arranged in theory for example SNP (SNP) increase and can discern, thereby stopped the possibility of false positive generation;
(4) mass-spectrometric technique also has characteristics such as robotization, high throughput testing; Therefore, mass-spectrometric technique is used in combination with many primer extensions technology, can in a reaction system, detect a plurality of deaf mutational sites simultaneously; Automatically extract equipment, multiple PCR primer design software and DAS in conjunction with DNA; Alleviate workload greatly, improved the detection flux, and reduced testing cost;
(5) compare with gene sequencing and have advantage easy and simple to handle, that the result is accurate, flux is high, cheap
Be used for detecting the system of the sudden change of DNA sample predetermined site
According to a second aspect of the invention, the present invention proposes a kind of system that is used for detecting the sudden change of DNA sample predetermined site.With reference to figure 2, according to embodiments of the invention, this system 1000 that is used for detecting the sudden change of DNA sample predetermined site comprises: DNA sample amplification device 100, amplified production extension apparatus 200, molecular weight detection device 300 and mutation analysis device 400.
According to embodiments of the invention, DNA sample amplification device 100 is used for the DNA sample is carried out pcr amplification, so that obtain to comprise the amplified production of predetermined site.According to one embodiment of present invention, it is right to be provided with amplimer in the DNA sample amplification device 100, is provided with the extension primer in the said amplified production extension apparatus.Thus, being convenient to DNA sample amplification device and amplified production extension apparatus increases to the DNA sample respectively and carries out the oligonucleotide extension.As previously mentioned, according to embodiments of the invention, DNA sample amplification device 100 does not receive special restriction, and it can be any device that the DNA sample is increased of being suitable for.According to one embodiment of present invention, can adopt known PCR device as DNA sample amplification device 100.In addition, according to embodiments of the invention, it is right in DNA sample amplification device 100, amplimer to be set in advance, can conveniently operate thus.Those skilled in the art can according to the site that will analyze confirm the amplimer sequence that can adopt.According to one embodiment of present invention; The sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of said predetermined site; Sporting of said GJB2 gene is selected from least a of 35delG, 167delT, 176-191del16,299_300delAT and 235delC; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from least a of 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A, and sporting of said mt DNA is selected from least a of 1494C＞T and 1555A＞G.About these sudden changes, describe in detail in front, repeat no more at this.To these sudden changes, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this) right as amplimer.Contriver of the present invention is surprised to find through using above-mentioned combination of primers, can detect listed mutation type very effectively.Need to prove that employed in the present invention term " links to each other " and should do broad understanding, it can be directly to link to each other, and also can be to link to each other indirectly through media, as long as can realize the linking on the function.
According to embodiments of the invention; Amplified production extension apparatus 300 links to each other with DNA sample amplification device 100; So that receive amplified production from DNA sample amplification device 100, and amplified production carried out the oligonucleotide extension, so that obtain to connect the extension products of a base at 3 ' end of said extension primer; Wherein, extend the said predetermined site of 3 ' end next-door neighbour of primer.According to one embodiment of present invention; May further include amplified production refining plant (not shown); The amplified production refining plant can link to each other with amplified production extension apparatus 200 with DNA sample amplification device 100 respectively; So that amplified production is carried out purifying treatment, and the amplified production that will pass through purification inputs to amplified production extension apparatus 200.Thus, can remove dNTP remaining in the amplified production, thereby can improve the efficient of follow-up extension, and then can realize detecting efficiently the sudden change of predetermined site in the DNA sample.
According to embodiments of the invention, molecular weight detection device 300 can link to each other with amplified production extension apparatus 200, so that confirm the molecular weight of said extension products.According to one embodiment of present invention, said molecular weight detection device is the MALDI-TOF mass spectrometric apparatus.Thus, can be accurately, efficiently extension products is carried out molecular weight detection, the contriver is surprised to find through the MALDI-TOF mass spectrometric detection even can realizes the detection to heterozygous mutant in the sample or homozygous mutation.According to one embodiment of present invention, further comprise extension products purification devices (not shown).The extension products purification devices can link to each other with MALDI-TOF mass spectrometric apparatus 300 with amplified production extension apparatus 200 respectively, so that extension products is carried out purification process, and purified extension products is inputed to said MALDI-TOF mass spectrometric apparatus.Thus, can further improve the tolerance range of MALDI-TOF mass spectrometric detection, thereby improve efficient and the tolerance range that detects the sudden change of predetermined site in the DNA sample.According to one embodiment of present invention, said extension products purification devices is a resin anion(R.A).Thus, can further improve the tolerance range of MALDI-TOF mass spectrometric detection, thereby improve efficient and the tolerance range that detects the sudden change of predetermined site in the DNA sample.
According to embodiments of the invention, mutation analysis device 400 can link to each other with molecular weight detection device 300, based on the molecular weight of resulting extension products, confirms the mutation type of said predetermined site.According to embodiments of the invention, mutation analysis device 400 can with have standard reference, can draw the conclusion that whether has sudden change and mutation type through the molecular weight of extension products and standard reference are compared.Term used herein " standard reference " can be in advance the sample with known mutations to be carried out the values for molecular weight that parallel test obtains.In addition, according to embodiments of the invention, mutation analysis device 400 can also be suitable for carrying out various statistical check analysis, more accurately analyzes more accurately so that realize.
Thus, utilize system, can implement method effectively, thereby confirm the sudden change of predetermined site in the DNA sample effectively according to the sudden change of predetermined site in the detection DNA sample of the embodiment of the invention according to the embodiment of the invention.Need to prove, above the function of each device of being mentioned can in identical container, accomplish, as long as can realize above-mentioned functions.
Use
The method of confirming the sudden change of predetermined site in the DNA sample according to an embodiment of the invention can be applied to the various detections relevant with transgenation.For example, can be effectively the mutation type of the two mutants that makes up in the laboratory be detected.
According to embodiments of the invention, can also aforesaid method be applied to the deaf method of diagnosing hereditary, the method for antenatal diagnosis hereditary hearing impairment, the method for antenatal diagnosis hereditary hearing impairment.
Particularly, according to an aspect of the present invention, the present invention proposes the deaf method of a kind of diagnosing hereditary.According to embodiments of the invention, the deaf method of diagnosing hereditary may further comprise the steps: extract the DNA sample of suspecting the experimenter who suffers from hereditary hearing impairment; According to the method for the sudden change of predetermined site in aforementioned definite DNA sample, the sudden change of predetermined site in the said DNA sample is analyzed; And based on the sudden change that has said predetermined site in the DNA sample, confirm that said experimenter suffers from hereditary hearing impairment, wherein, said predetermined site sport at least a of sudden change listed in the table 3.Thus,, can diagnose the experimenter whether to belong to hereditary hearing impairment effectively, and can assist and confirm the deaf cause of disease, and then can adopt corresponding treatment and assist measure to the cause of disease according to the deaf method of the diagnosing hereditary of the embodiment of the invention.According to embodiments of the invention; The type of the DNA sample that can adopt does not receive special restriction; Can adopt experimenter's complete genome DNA, also can adopt to come from the dna fragmentation that comprises specific gene, said here specific gene refers to deaf-related gene.According to embodiments of the invention,, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this) to sudden change listed in the table 3.Contriver of the present invention is surprised to find through using above-mentioned combination of primers, can detect listed mutation type very effectively, thereby can confirm efficiently whether the experimenter suffers from hereditary hearing impairment.About the details of each step, can repeat no more at this referring to the associated description of front.
Further, the present invention proposes a kind of method of antenatal diagnosis hereditary hearing impairment.According to embodiments of the invention, the method for this antenatal diagnosis hereditary hearing impairment may further comprise the steps: isolating fetal DNA sample; According to the method for the sudden change of predetermined site in aforementioned definite DNA sample, the sudden change of predetermined site in the said foetal DNA sample is analyzed; And based on the sudden change that has said predetermined site in the said foetal DNA sample, confirm that said fetus suffers from hereditary hearing impairment, wherein, said predetermined site sport at least a of sudden change listed in the table 3.Thus, according to the deaf method of the diagnosing hereditary of the embodiment of the invention, can assist and infer that fetus suffers from hereditary hearing impairment, and can assist and confirm the deaf cause of disease, and then can adopt corresponding treatment and assist measure to the cause of disease.To sudden change listed in the table 3, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this).Contriver of the present invention is surprised to find through using above-mentioned combination of primers, can detect listed mutation type very effectively, thereby can infer whether fetus suffers from hereditary hearing impairment.According to embodiments of the invention; The type of the DNA sample that can adopt does not receive special restriction; Can adopt the complete genome DNA of fetus, also can adopt the dna fragmentation that comprises specific gene that comes from fetus, said here specific gene refers to deaf-related gene.According to embodiments of the invention, the source of fetus genomic dna does not receive special restriction.According to one embodiment of present invention, the fetus complete genome DNA is to extract chorion, amniotic fluid or the Cord blood from the pregnant woman.Thus, can just can infer effectively whether fetus suffers from hereditary hearing impairment in early days pregnant.In addition, according to one embodiment of present invention, also can be through from pregnant woman's peripheral blood, separating the free nucleic acid that comes from fetus, as the DNA sample that carries out deaf correlation detection.
According to another aspect of the invention, the present invention also provides a kind of method of predict electronic cochlea effect.According to embodiments of the invention, the method for this predict electronic cochlea effect may further comprise the steps: the DNA sample that extracts deafness patient; According to the method for the sudden change of predetermined site in aforementioned definite DNA sample, the sudden change of predetermined site in the said DNA sample is analyzed; Based on the sudden change that has said predetermined site in the said DNA sample, confirm that said deafness patient suffers from hereditary hearing impairment; Suffer from hereditary hearing impairment based on said deafness patient, the predict electronic cochlea is effective for said deafness patient, wherein, said predetermined site sport at least a of sudden change listed in the table 3.Thus, can determine whether to adopt cochlear implant to assist deafness patient to obtain hearing through confirming the cause of disease of deafness patient.To sudden change listed in the table 3, can adopt combination of primers listed in table 1 and the table 2 (front is existing to be described in detail, repeats no more at this).Contriver of the present invention is surprised to find through using above-mentioned combination of primers; Can detect listed mutation type very effectively; Thereby can predict whether deafness patient has remaining spiral ganglion; So that under the prerequisite of disease not being treated, directly utilize the galvanism auditory nerve to rebuild the sense of hearing thereby adopt cochlear implant to walk around impaired hair cell.According to embodiments of the invention; The type of the DNA sample that can adopt does not receive special restriction; Can adopt the complete genome DNA of fetus, also can adopt the dna fragmentation that comprises specific gene that comes from fetus, said here specific gene refers to deaf-related gene.
Test kit
The invention allows for a kind of test kit, it is characterized in that, comprising: amplimer to and extend primer.According to embodiments of the invention, amplimer carries out pcr amplification reaction to being suitable for to DNA, so that obtain to comprise the amplified production of predetermined site; Extension products is suitable for utilizing ddNTP, is template with resulting amplified production, carries out the oligonucleotide extension; So that obtain to connect the extension products of a base at 3 ' end of said extension primer; Wherein, extend the said predetermined site of 3 ' end next-door neighbour of primer, said predetermined site sport at least a of sudden change listed in the table 3.To sudden change listed in the table 3, can adopt combination of primers listed in table 1 and the table 2 (front existing describe in detail, repeat no more) at this respectively as amplimer to extend primer.Contriver of the present invention is surprised to find through using the extension products of above-mentioned combination of primers preparation, can be used to detect listed mutation type very effectively, thereby can confirm hereditary hearing impairment efficiently.According to one embodiment of present invention; Utilize this test kit, can implement the method for aforesaid sudden change, diagnosing hereditary deafness, antenatal diagnosis hereditary hearing impairment and predict electronic cochlea effect effectively according to predetermined site in the detection DNA sample of the embodiment of the invention.According to embodiments of the invention, the invention allows for one group of combination of primers that can be used for the mentioned reagent box.Utilize this combination of primers, can detect the method for sudden change, diagnosing hereditary deafness, antenatal diagnosis hereditary hearing impairment and the predict electronic cochlea effect of predetermined site in the DNA sample effectively.
The present invention will be described for the concrete embodiment of following basis.Need to prove that these embodiment only are for the present invention is described, and can not be interpreted as limitation of the present invention by any way.In addition, unless stated otherwise, related method is an ordinary method among the embodiment below, and related material and preparation also are commercially available getting.
Embodiment 1
1. design of primers
According to 20 in the deaf gene mutational site of selected to be detected and/or somatotype; Comprise 4 genes, be respectively: GJB2 gene (comprising site 35delG, 167delT, 176-191del16,299_300delAT and 235delC), GJB3 gene (comprise site 538C＞T and 547G＞A), SLC26A4 gene (1494C＞T and the 1555A＞G that comprise site 281C＞T, 589G＞A, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A) and mt DNA.
According to the position in mutational site and genotype design of amplification primers to one extend primer, wherein the length of amplimer is about 30 bases, its amplimer has the sequence label of 10 base acgttggatg at 5 ' end; The length of extending primer is 17-28 base, allows 5 ' hold 1-5 base and template incomplete pairing are arranged, and 3 ' terminal bases and mutational site 3 ' adjacent base of end are mated fully.In addition, the extension primer of different loci and the molecular weight difference between extension products, extension products and extension products are not less than 30D.The amplimer that is directed against above-mentioned 20 deaf gene mutational sites of the present invention's design extends primer referring to table 2 referring to table 1 (5 ' end in first sequence and second sequence all has sequence label acgttggatg).
2. DNA extraction
8 parts of clinical blood samples of clinical collection use paramagnetic particle method to extract DNA.
3. pcr amplification
Through pcr amplification, obtain the target sequence amplified production.The pcr amplification reaction system is referring to table 4.Wherein, All reagent are bought from U.S. Sequenom company, and the PCR appearance is
PCR System 9700Dual 384-Well Sample Block Module.
Table 4
The PCR reaction conditions is 94 ℃, 2 minutes; 94 ℃ of sex change 20 seconds, 56 ℃ of annealing 30 seconds, 72 ℃ were extended 1 minute, coamplification 45 circulations; Final 72 ℃ were extended 5 minutes.In the present embodiment; The template of using is the human genome DNA that sudden change appears in known site 299_300delAT, 281C＞T, 1229C＞T, IVS15+5G＞A, 2168A＞G and 1494C＞T; Positive control is the normal human genome DNA of known array, and negative control is an aseptic double-distilled water.
4. SAP handles
Handle through SAP enzyme (shrimp alkaline phosphotase), remove the dNTP that contains in the amplified production that 2. step obtain, only extend a base when guaranteeing extension.SAP enzyme reaction system sees the following form 5.All reagent are bought from U.S. Sequenom company, and the PCR appearance is
PCRSystem 9700Dual 384-Well Sample Block Module.
Table 5
| Reagent | Volume/reaction |
| Water (HPLE level) | 1.53 microlitre |
| SAP enzyme buffer liquid | 0.17 microlitre |
| The SAP enzyme | 0.30 microlitre |
| Pcr amplification product | 5.0 microlitre |
| TV | 7.0 microlitre |
SAP enzyme reaction condition is 37 ℃ of incubations 40 minutes, to remove remaining dNTP in the pcr amplification reaction; 85 ℃ of incubations 5 minutes are so that the SAP enzyme deactivation.
5. extension
Amplified production with 3. middle acquisition is a template, through extension, connects a base at the 3 ' end that extends primer, thereby obtains extension products.The employed raw material of extension is the ddNTP that modifies through quality, and it had both guaranteed that extension only connected a base, and the resolving power of total system is improved.The extension system is seen table 6.All reagent are bought from U.S. Sequenom company, and the PCR appearance is
PCRSystem 9700Dual 384-Well Sample Block Module.。
Table 6
* wherein extend primer mixture and carry out linear relationship adjustment (that is, according to every kind of usage quantity of extending every kind of primer of molecular weight calculating of primer) according to the molecular weight size of each primer.To reach optimum extension, obtain optimum mass spectra peak figure.
The extension condition is 94 ℃, 30 seconds; 94 ℃ of sex change 5 seconds, 52 ℃ of annealing 5 seconds, 80 ℃ were extended 5 seconds, 40 circulations of coamplification, and 5 partial circulatings are carried out in annealing and extension in each circulation; Final 72 ℃ were extended 3 minutes.
6. resin purification
Adopt resin (model 08040 is bought from U.S. Sequenom company) purification step 4. in the extension products of acquisition.In extension products, add the 6mg resin, 18.00 microliters of water vertically shake up 40min.After the reaction of this step, resin will fully combine with the positively charged ion in the reaction system, thereby makes the reaction system desalination.Purified product after reaction is accomplished can be preserved a couple of days at 4 ℃, also can preserve several weeks at-20 ℃.The purified product of gained is got supernatant and directly is used for mass spectrometric detection after 4000rpm is centrifugal 5 minutes.
7. mass spectrometric detection
Through point sample instrument (model MassARRAY Nanodispenser RS1000; Purchase is from U.S. Sequenom company) through step 5. the extension products behind the purifying transfer on the 384 hole spectroCHIPII chips; Chip matrix and product cocrystallization; This chip carries out mass spectrometric detection on Sequenom MALDI-TOF mass spectrograph (model MassARRAY Analyzer Compact buys from U.S. Sequenom company), thereby confirms the genotype in mutational site to be detected.
Mass spectrometric detection result is shown among Fig. 3-8,
Fig. 3 has shown the result who uses extension primer SEQ ID NO:36 that test sample book site 299_300delAT is detected.Can know that from Fig. 3-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6545.3 places, said peak is wild-type AT (sample derives from the normal people) through analysis confirmation, and the result is with actual consistent.Can know that from Fig. 3-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6545.3 and 6561.3 places, said peak is heterozygous deletion sudden change (sample derives from clinical sample 1) through analysis confirmation, and the result is with actual consistent.Can know that from Fig. 3-3 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6561.3 places, said peak is homozygous deletion sudden change (sample derives from clinical sample 2) through analysis confirmation, and the result is with actual consistent.
Fig. 4 has shown the result who uses extension primer SEQ ID NO:40 that test sample book site 281C＞T is detected.Can know that from Fig. 4-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6121 places, said peak is wild-type C (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Fig. 4-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6121 and 6200.9 places, said peak is heterozygosis CT (sample derives from clinical sample 3) through analysis confirmation, and the result is with actual consistent.
Fig. 5 has shown the result who uses extension primer SEQ ID NO:41 that test sample book site 12 29C＞T is detected.Can know that from Fig. 5-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 7053.6 places, said peak is wild-type C (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Fig. 5-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 7053.6 and 7133.5 places, said peak is heterozygosis CT (sample derives from clinical sample 4) through analysis confirmation, and the result is with actual consistent.
Fig. 6 has shown the result who uses extension primer SEQ ID NO:46 that test sample book site IVS15+5G＞A is detected.Can know that from Fig. 6-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 7961.3 places, said peak is wild-type G (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Fig. 4-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 7961.3 and 8041.2 places, said peak is heterozygosis GA (sample derives from clinical sample 5) through analysis confirmation, and the result is with actual consistent.
Fig. 7 has shown the result who uses extension primer SEQ ID NO:50 that test sample book site 2168A＞G is detected.Can know that from Fig. 7-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 7413.7 places, said peak is wild-type A (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Fig. 7-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 7333.8 and 7413.7 places, said peak is heterozygosis AG (sample derives from clinical sample 6) through analysis confirmation, and the result is with actual consistent.
Fig. 8 has shown the result who uses extension primer SEQ ID NO:51 that test sample book site 1494C＞T is detected.Can know that from Fig. 8-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5925.9 places, said peak is wild-type C (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Fig. 8-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6005.8 places, said peak is the T (sample derives from clinical sample 7) that isozygotys that suddenlys change through analysis confirmation, and the result is with actual consistent.
1. design of primers
According to 14 in the deaf gene mutational site of selected to be detected and/or somatotype; Be distributed in 3 genes, be respectively: GJB2 gene (comprising site 299_300delAT and 235delC), SLC26A4 gene (1494C＞T and the 1555A＞G that comprise site 281C＞T, 919-2A＞G, 1174A＞T, 1226G＞A, 1229C＞T, 1975G＞C, 2027T＞A, 2162C＞T, 2168A＞G and IVS15+5G＞A) and mt DNA.The primer that the amplimer to above-mentioned 14 deaf gene mutational sites of the present invention's design is selected from embodiment 1 is referring to table 7.The primer that the extension primer to above-mentioned 14 deaf gene mutational sites of the present invention's design is selected from embodiment 1 is referring to table 8.
Table 7: to the amplimer in above-mentioned 14 deaf gene mutational sites.
Table 8: to the extension primer in above-mentioned 14 deaf gene mutational sites.
Subsequent experimental step (that is: DNA extraction, pcr amplification, SAP processing, extension, resin purification and mass spectrometric detection) is identical with embodiment 1, and the different templates that is to use is the human genome DNA that sudden change appears in known site 235delC, 1226G＞A, 2027T＞A and 1555A＞G.
Mass spectrometric detection result is shown among Fig. 9-12.
Fig. 9 has shown the result who uses extension primer SEQ ID NO:37 that test sample book site 235delC is detected.Can know that from Fig. 9-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5449.6 places, said peak is wild-type C (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Fig. 9-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5449.6 and 5529.5 places, said peak is heterozygous deletion sudden change (sample derives from clinical sample 8) through analysis confirmation, and the result is with actual consistent.
Figure 10 has shown the result who uses extension primer SEQ ID NO:44 that test sample book site 12 26G＞A is detected.Can know that from Figure 10-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5304.5 places, said peak is wild-type G (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Figure 10-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5288.5 and 5304.5 places, said peak is heterozygosis GA (sample derives from clinical sample 9) through analysis confirmation, and the result is with actual consistent.
Figure 11 has shown the result who uses extension primer SEQ ID NO:48 that test sample book site 2027T＞A is detected.Can know that from Figure 11-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5355.5 places, said peak is wild-type G (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Figure 11-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5355.5 and 5411.4 places, said peak is heterozygosis GA (sample derives from clinical sample 10) through analysis confirmation, and the result is with actual consistent.
Figure 12 has shown the result who uses extension primer SEQ ID NO:52 that test sample book site 1555A＞G is detected.Can know that from Figure 12-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6394.1 places, said peak is wild-type A (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Figure 12-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6314.2 places, said peak is the G (sample derives from the sample source of clinical sample 11) that isozygotys that suddenlys change through analysis confirmation, and the result is with actual consistent.
Embodiment 3
1. design of primers
According to 4 in the deaf gene mutational site of selected to be detected and/or somatotype; Be distributed in 3 genes, be respectively: GJB2 gene (comprising site 235delC), SLC26A4 gene (1494C＞T and the 1555A＞G that comprise site 919-2A＞G) and mt DNA.The amplimer that is directed against above-mentioned 4 deaf gene mutational sites of the present invention's design extends primer referring to table 10 referring to table 9.
Table 9: to the amplimer in above-mentioned 4 deaf gene mutational sites.
Table 10: to the extension primer in above-mentioned 4 deaf gene mutational sites.
| Sequence numbering | Primer sequence | The primer explanation |
| ?SEQ?ID?NO：37 | ggATCCTGCTATGGGCC | The extension primer of site 235delC |
| ?SEQ?ID?NO：42 | GCAGTAGCAATTATCGTC | The extension primer of site 919-2A＞G |
| ?SEQ?ID?NO：51 | CGTACACACCGCCCGTCAC | The extension primer of |
| ?SEQ?ID?NO：52 | ACTTACCATGTTACGACTTG | The extension primer of |
Subsequent experimental step (that is: DNA extraction, pcr amplification, SAP processing, extension, resin purification and mass spectrometric detection) is identical with embodiment 1, and the different templates that is to use is the human genome DNA that sudden change appears in known site 919-2A＞G and 1555A＞G.
Mass spectrometric detection result is shown among Figure 13-14.
Figure 13 extends the result that primer SEQ ID NO:42 detects test sample book site 919-2A＞G for using.Can know that from Figure 13-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5825.7 places, said peak is wild-type A (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Figure 13-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5745.8 and 5825.7 places, said peak is heterozygosis AG through analysis confirmation, and the result is with actual consistent.Can know that from Figure 13-3 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 5745.8 places, said peak is through the analysis confirmation sudden change G (sample derives from clinical sample 12) that isozygotys, and the result is consistent with reality.
Figure 14 extends the result that primer SEQ ID NO:52 detects test sample book site 1555A＞G for using.Can know that from Figure 13-1 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6394.1 places, said peak is wild-type A (sample originate same Fig. 3-1 sample source) through analysis confirmation, and the result is consistent with reality.Can know that from Figure 13-2 the MALDI-TOF mass spectrometric detection detects the peak at molecular weight 6314.2 places, said peak is the G (sample derives from clinical sample 11) that isozygotys that suddenlys change through analysis confirmation, and the result is with actual consistent.
In the description of this specification sheets, the description of reference term " embodiment ", " some embodiment ", " example ", " concrete example " or " some examples " etc. means the concrete characteristic, structure, material or the characteristics that combine this embodiment or example to describe and is contained at least one embodiment of the present invention or the example.In this manual, the schematic statement to above-mentioned term not necessarily refers to identical embodiment or example.And concrete characteristic, structure, material or the characteristics of description can combine with suitable manner in any one or more embodiment or example.
Although illustrated and described embodiments of the invention; Those having ordinary skill in the art will appreciate that: under the situation that does not break away from principle of the present invention and aim, can carry out multiple variation, modification, replacement and modification to these embodiment, scope of the present invention is limited claim and equivalent thereof.
Claims (10)
1. a method that detects the sudden change of predetermined site in the DNA sample is characterized in that, may further comprise the steps:
Use amplimer that said DNA sample is carried out pcr amplification reaction, so that obtain amplified production, said amplified production comprises said predetermined site;
Using and extend primer and ddNTP, is template with said amplified production, carries out the oligonucleotide extension, so that obtain to connect the extension products of a base at 3 ' end of said extension primer, wherein, the said predetermined site of 3 ' end next-door neighbour of said extension primer;
Said extension products is carried out molecular weight detection, so that obtain the molecular weight of said extension products; And
Based on the molecular weight of said extension products, confirm the mutation type of said predetermined site,
Wherein,
Preferred said DNA sample behaviour complete genome DNA,
The sudden change that sports at least a gene that is selected from GJB2 gene, GJB3 gene, SLC26A4 gene and mtDNA of preferred said predetermined site,
More preferably; Sporting of said GJB2 gene is selected from 35delG; 167delT; 176-191del16; 299_300delAT and 235delC's is at least a; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from 281C＞T; 589G＞A; 919-2A＞G; 1174A＞T; 1226G＞A; 1229C＞T; 1975G＞C; 2027T＞A; 2162C＞T; 2168A＞G and IVS15+5G＞A's is at least a; And sporting of said mt DNA is selected from least a of 1494C＞T and 1555A＞G
Said amplimer comprises first primer and second primer; Preferably, to the 35delG sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:1; Said second primer is shown in SEQ ID NO:2, and said extension primer is shown in SEQ ID NO:33; To the 167delT sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:3, and said second primer is shown in SEQID NO:4, and said extension primer is shown in SEQ ID NO:34; To the 176-191del16 sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:5, and said second primer is shown in SEQ ID NO:6, and said extension primer is shown in SEQ ID NO:35; To the 299_300delAT sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:7, and said second primer is shown in SEQ ID NO:8, and said extension primer is shown in SEQ ID NO:36; To the 235delC sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:9, and said second primer is shown in SEQ ID NO:10, and said extension primer is shown in SEQ ID NO:37; To the 538C＞T sudden change of said GJB3 gene, said first primer is shown in SEQ ID NO:11, and said second primer is shown in SEQ ID NO:12, and said extension primer is shown in SEQ ID NO:38; To the 547G＞A sudden change of said GJB3 gene, said first primer is shown in SEQ ID NO:13, and said second primer is shown in SEQ ID NO:14, and said extension primer is shown in SEQ ID NO:39; To the 281C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:15, and said second primer is shown in SEQ ID NO:16, and said extension primer is shown in SEQ ID NO:40; To the 589G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:17, and said second primer is shown in SEQ ID NO:18, and said extension primer is shown in SEQ ID NO:41; To the 919-2A＞G sudden change of said SLC26A4 gene, said first primer is shown in SEQID NO:19, and said second primer is shown in SEQ ID NO:20, and said extension primer is shown in SEQ ID NO:42; To the 1174A＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:43; To the 1226G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:44; To the 1229C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:45; To the 1975G＞C sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:25, and said second primer is shown in SEQ ID NO:26, and said extension primer is shown in SEQ ID NO:47; To the 2027T＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:25, and said second primer is shown in SEQ ID NO:26, and said extension primer is shown in SEQ ID NO:48; To the 2162C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:27, and said second primer is shown in SEQ ID NO:28, and said extension primer is shown in SEQ ID NO:49; To the 2168A＞G sudden change of said SLC26A4 gene, said first primer is shown in SEQID NO:27, and said second primer is shown in SEQ ID NO:28, and said extension primer is shown in SEQ ID NO:50; To the IVS15+5G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:23, and said second primer is shown in SEQ ID NO:24, and said extension primer is shown in SEQ ID NO:46; To the 1494C＞T sudden change of said mt DNA gene, said first primer is shown in SEQ ID NO:29, and said second primer is shown in SEQ ID NO:30, and said extension primer is shown in SEQ ID NO:51; And the 1555A＞G sudden change that is directed against said mt DNA gene, said first primer is shown in SEQ ID NO:31, and said second primer is shown in SEQ ID NO:32, and said extension primer is shown in SEQ ID NO:52,
5 ' end of preferred said first primer and second primer all has sequence label, and said sequence label is shown in SEQ ID NO:53,
Preferably before carrying out said oligonucleotide extension, further comprise: use SEAP that said amplified production is carried out processed steps.
2. method according to claim 1 is characterized in that, through the MALDI-TOF mass spectrometric detection said extension products is carried out molecular weight detection,
Preferably before said extension products is carried out the MALDI-TOF mass spectrometric detection, further comprise the step of said extension products being carried out purifying, preferably utilize resin anion(R.A) that said extension products is carried out purifying.
3. a system that is used for detecting the sudden change of DNA sample predetermined site is characterized in that, comprising:
DNA sample amplification device, said DNA sample amplification device is used for said DNA sample is carried out pcr amplification, so that obtain amplified production, said amplified production comprises said predetermined site;
The amplified production extension apparatus; Said amplified production extension apparatus links to each other with said DNA sample amplification device; So that receive amplified production, and said amplified production is carried out the oligonucleotide extension, so that obtain to connect the extension products of a base at 3 ' end of said extension primer from said DNA sample amplification device; Wherein, the said predetermined site of 3 ' of said extension primer end next-door neighbour;
The molecular weight detection device, said molecular weight detection device links to each other with said amplified production extension apparatus, so that confirm the molecular weight of said extension products; And
Mutation analysis device, said mutation analysis device are confirmed the mutation type of said predetermined site based on the molecular weight of said extension products,
Wherein,
It is right to be provided with amplimer in the preferred said DNA sample amplification device, is provided with the extension primer in the said amplified production extension apparatus,
Sporting of preferred said predetermined site is selected from the GJB2 gene; The GJB3 gene; The sudden change of at least a gene of SLC26A4 gene and mtDNA; Sporting of more preferably said GJB2 gene is selected from 35delG; 167delT; 176-191del16; 299_300delAT and 235delC's is at least a; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from 281C＞T; 589G＞A; 919-2A＞G; 1174A＞T; 1226G＞A; 1229C＞T; 1975G＞C; 2027T＞A; 2162C＞T; 2168A＞G and IVS15+5G＞A's is at least a; And sporting of said mt DNA is selected from least a of 1494C＞T and 1555A＞G
Said amplimer comprises first primer and second primer; Preferred pin is to the 35delG sudden change of said GJB2 gene; Said first primer is shown in SEQ ID NO:1, and said second primer is shown in SEQ ID NO:2, and said extension primer is shown in SEQ ID NO:33; To the 167delT sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:3, and said second primer is shown in SEQ ID NO:4, and said extension primer is shown in SEQ ID NO:34; To the 176-191del16 sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:5, and said second primer is shown in SEQ ID NO:6, and said extension primer is shown in SEQ ID NO:35; To the 299_300delAT sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:7, and said second primer is shown in SEQ ID NO:8, and said extension primer is shown in SEQ ID NO:36; To the 235delC sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:9, and said second primer is shown in SEQ ID NO:10, and said extension primer is shown in SEQ ID NO:37; To the 538C＞T sudden change of said GJB3 gene, said first primer is shown in SEQ ID NO:11, and said second primer is shown in SEQ ID NO:12, and said extension primer is shown in SEQ ID NO:38; To the 547G＞A sudden change of said GJB3 gene, said first primer is shown in SEQ ID NO:13, and said second primer is shown in SEQ ID NO:14, and said extension primer is shown in SEQ ID NO:39; To the 281C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:15, and said second primer is shown in SEQ ID NO:16, and said extension primer is shown in SEQ ID NO:40; To the 589G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:17, and said second primer is shown in SEQ ID NO:18, and said extension primer is shown in SEQ ID NO:41; To the 919-2A＞G sudden change of said SLC26A4 gene, said first primer is shown in SEQ IDNO:19, and said second primer is shown in SEQ ID NO:20, and said extension primer is shown in SEQ ID NO:42; To the 1174A＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:43; To the 1226G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:44; To the 1229C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:45; To the 1975G＞C sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:25, and said second primer is shown in SEQ ID NO:26, and said extension primer is shown in SEQ ID NO:47; To the 2027T＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:25, and said second primer is shown in SEQ ID NO:26, and said extension primer is shown in SEQ ID NO:48; To the 2162C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:27, and said second primer is shown in SEQ ID NO:28, and said extension primer is shown in SEQ ID NO:49; To the 2168A＞G sudden change of said SLC26A4 gene, said first primer is shown in SEQID NO:27, and said second primer is shown in SEQ ID NO:28, and said extension primer is shown in SEQ ID NO:50; To the IVS15+5G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:23, and said second primer is shown in SEQ IDNO:24, and said extension primer is shown in SEQ ID NO:46; To the 1494C＞T sudden change of said mt DNA gene, said first primer is shown in SEQ ID NO:29, and said second primer is shown in SEQ ID NO:30, and said extension primer is shown in SEQ ID NO:51; And the 1555A＞G sudden change that is directed against said mt DNA gene, said first primer is shown in SEQ ID NO:31, and said second primer is shown in SEQ ID NO:32, and said extension primer is shown in SEQ ID NO:52,
Preferably further comprise:
The amplified production refining plant; Said amplified production refining plant links to each other with said amplified production extension apparatus with said DNA sample amplification device respectively; So that said amplified production is carried out purifying treatment, and the amplified production that will pass through purification inputs to said amplified production extension apparatus.
4. system according to claim 3 is characterized in that, said molecular weight detection device is the MALDI-TOF mass spectrometric apparatus.
5. system according to claim 4 is characterized in that, further comprises the extension products purification devices,
Wherein,
Said extension products purification devices links to each other with said MALDI-TOF mass spectrometric apparatus with said amplified production extension apparatus respectively, so that said extension products is carried out purification process, and purified extension products is inputed to said MALDI-TOF mass spectrometric apparatus,
Preferred said extension products purification devices is a resin anion(R.A).
6. the method that diagnosing hereditary is deaf is characterized in that, may further comprise the steps:
Extract the DNA sample of suspecting the experimenter who suffers from hereditary hearing impairment;
According to claim 1 and 2 described methods the sudden change of predetermined site in the said DNA sample is analyzed; And
Based on the sudden change that has said predetermined site in the said DNA sample, confirm that said experimenter suffers from hereditary hearing impairment.
7. the method for an antenatal diagnosis hereditary hearing impairment is characterized in that, may further comprise the steps:
The DNA sample of isolating fetal, the DNA sample of preferred said fetus extracts from chorion, amniotic fluid or Cord blood sampling;
Method according to claim 1 and 2 is analyzed the sudden change of predetermined site in the DNA sample of said fetus; And
There is the sudden change of said predetermined site in the DNA sample based on said fetus, infers that said fetus suffers from hereditary hearing impairment.
8. the method for a predict electronic cochlea effect is characterized in that, may further comprise the steps:
Extract the DNA sample of deafness patient;
Method according to claim 1 and 2 is analyzed the sudden change of predetermined site in the said DNA sample;
Based on the sudden change that has said predetermined site in the said DNA sample, confirm that said deafness patient suffers from hereditary hearing impairment;
Suffer from hereditary hearing impairment based on said deafness patient, the predict electronic cochlea is effective for said deafness patient.
9. a combination of primers is characterized in that, comprising:
Amplimer is right, and said amplimer carries out pcr amplification reaction to being suitable for to the DNA sample, so that obtain amplified production, said amplified production comprises predetermined site; And
Extend primer, said extension products is suitable for utilizing ddNTP, is template with said amplified production; Carry out the oligonucleotide extension, so that obtain to connect the extension products of a base, wherein at 3 ' end of said extension primer; The said predetermined site of 3 ' end next-door neighbour of said extension primer
Sporting of said predetermined site is selected from the GJB2 gene; The GJB3 gene; The sudden change of at least a gene of SLC26A4 gene and mtDNA; Sporting of said GJB2 gene is selected from 35delG; 167delT; 176-191del16; 299_300delAT and 235delC's is at least a; Sporting of said GJB3 gene is selected from least a of site 538C＞T and 547G＞A; Sporting of said SLC26A4 gene is selected from 281C＞T; 589G＞A; 919-2A＞G; 1174A＞T; 1226G＞A; 1229C＞T; 1975G＞C; 2027T＞A; 2162C＞T; 2168A＞G and IVS15+5G＞A's is at least a; And sporting of said mt DNA is selected from least a of 1494C＞T and 1555A＞G; Said amplimer comprises first primer and second primer
Wherein,
To the 35delG sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:1, and said second primer is shown in SEQ ID NO:2, and said extension primer is shown in SEQ ID NO:33; To the 167delT sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:3, and said second primer is shown in SEQ ID NO:4, and said extension primer is shown in SEQ ID NO:34; To the 176-191del16 sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:5, and said second primer is shown in SEQ ID NO:6, and said extension primer is shown in SEQ ID NO:35; To the 299_300delAT sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:7, and said second primer is shown in SEQ ID NO:8, and said extension primer is shown in SEQ ID NO:36; To the 235delC sudden change of said GJB2 gene, said first primer is shown in SEQ ID NO:9, and said second primer is shown in SEQ ID NO:10, and said extension primer is shown in SEQ ID NO:37; To the 538C＞T sudden change of said GJB3 gene, said first primer is shown in SEQ ID NO:11, and said second primer is shown in SEQ ID NO:12, and said extension primer is shown in SEQ ID NO:38; To the 547G＞A sudden change of said GJB3 gene, said first primer is shown in SEQ ID NO:13, and said second primer is shown in SEQ ID NO:14, and said extension primer is shown in SEQ ID NO:39; To the 281C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:15, and said second primer is shown in SEQ ID NO:16, and said extension primer is shown in SEQ ID NO:40; To the 589G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:17, and said second primer is shown in SEQ ID NO:18, and said extension primer is shown in SEQ ID NO:41; To the 919-2A＞G sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:19, and said second primer is shown in SEQ ID NO:20, and said extension primer is shown in SEQ ID NO:42; To the 1174A＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:43; To the 1226G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:44; To the 1229C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:21, and said second primer is shown in SEQ ID NO:22, and said extension primer is shown in SEQ ID NO:45; To the 1975G＞C sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:25, and said second primer is shown in SEQ ID NO:26, and said extension primer is shown in SEQ ID NO:47; To the 2027T＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:25, and said second primer is shown in SEQ ID NO:26, and said extension primer is shown in SEQ ID NO:48; To the 2162C＞T sudden change of said SLC26A4 gene, said first primer is shown in SEQID NO:27, and said second primer is shown in SEQ ID NO:28, and said extension primer is shown in SEQ ID NO:49; To the 2168A＞G sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:27, and said second primer is shown in SEQ ID NO:28, and said extension primer is shown in SEQ ID NO:50; To the IVS15+5G＞A sudden change of said SLC26A4 gene, said first primer is shown in SEQ ID NO:23, and said second primer is shown in SEQ ID NO:24, and said extension primer is shown in SEQ ID NO:46; To the 1494C＞T sudden change of said mt DNA gene, said first primer is shown in SEQ ID NO:29, and said second primer is shown in SEQ ID NO:30, and said extension primer is shown in SEQ ID NO:51; And the 1555A＞G sudden change that is directed against said mt DNA gene, said first primer is shown in SEQ ID NO:31, and said second primer is shown in SEQ ID NO:32, and said extension primer is shown in SEQ ID NO:52,
5 ' end of preferred said first primer and second primer all has sequence label, and said sequence label is shown in SEQ ID NO:53.
10. a test kit is characterized in that, comprising:
The described a kind of combination of primers of claim 9,
Preferred said test kit is used for being selected from that the sudden change, the diagnosing hereditary that detect DNA sample predetermined site are deaf, antenatal diagnosis hereditary hearing impairment and predict electronic cochlea effect at least a.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110301714.2A CN102409089B (en) | 2011-10-08 | 2011-10-08 | Kit, method and application for detecting mutation of predetermined locus in DNA sample |
| TW101136210A TW201315812A (en) | 2011-10-08 | 2012-09-28 | Kit, method and application of detecting predetermined locus mutation in DNA sample |
| PCT/CN2012/001382 WO2013049975A1 (en) | 2011-10-08 | 2012-10-12 | Kit and method for detecting mutation of predetermined site in dna sample and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110301714.2A CN102409089B (en) | 2011-10-08 | 2011-10-08 | Kit, method and application for detecting mutation of predetermined locus in DNA sample |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102409089A true CN102409089A (en) | 2012-04-11 |
| CN102409089B CN102409089B (en) | 2017-04-19 |
Family
ID=45911428
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110301714.2A Active CN102409089B (en) | 2011-10-08 | 2011-10-08 | Kit, method and application for detecting mutation of predetermined locus in DNA sample |
Country Status (3)
| Country | Link |
|---|---|
| CN (1) | CN102409089B (en) |
| TW (1) | TW201315812A (en) |
| WO (1) | WO2013049975A1 (en) |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013049975A1 (en) * | 2011-10-08 | 2013-04-11 | 深圳华大基因科技有限公司 | Kit and method for detecting mutation of predetermined site in dna sample and use thereof |
| CN103352073A (en) * | 2013-05-14 | 2013-10-16 | 向华 | Primer system for detecting gene SNP related to genetic deafness, and use thereof |
| CN104120133A (en) * | 2013-04-28 | 2014-10-29 | 中国人民解放军总医院 | Gene mutant and application thereof |
| CN104131008A (en) * | 2014-07-24 | 2014-11-05 | 深圳华大基因医学有限公司 | DNA labels, PCR primers and application thereof |
| CN104232631A (en) * | 2014-08-26 | 2014-12-24 | 深圳华大基因医学有限公司 | Tags, tag primers, kit and application of kit |
| CN104498609A (en) * | 2014-12-18 | 2015-04-08 | 亚能生物技术（深圳）有限公司 | Nucleic acid membrane strip and kit for detecting gene of hereditary hearing loss |
| CN105087756A (en) * | 2014-04-23 | 2015-11-25 | 北京贝瑞和康生物技术有限公司 | Method and kit for non-invasive measurement on fetus deaf pathogenic gene mutation |
| CN105255999A (en) * | 2015-07-22 | 2016-01-20 | 广州市达瑞生物技术股份有限公司 | Method for detecting 20 mutation sites of deaf genes |
| CN105296471A (en) * | 2014-08-01 | 2016-02-03 | 天津华大基因科技有限公司 | DNA label, PCR primer and application thereof |
| CN105803052A (en) * | 2014-12-31 | 2016-07-27 | 天津华大基因科技有限公司 | Method and kit for detecting ethanol resistance gene |
| CN105986010A (en) * | 2015-01-30 | 2016-10-05 | 天津华大基因科技有限公司 | Method for detecting folate metabolism-related gene and kit thereof |
| CN106480222A (en) * | 2016-12-20 | 2017-03-08 | 广州中心法则生物科技有限公司 | Based on the probe of suspension microballon array system detection hereditary hearing impairment, primer, detection kit and detection method |
| CN107022641A (en) * | 2017-06-09 | 2017-08-08 | 北京博奥医学检验所有限公司 | A kind of primer for detecting deaf gene and its application |
| CN109097457A (en) * | 2017-06-20 | 2018-12-28 | 深圳华大智造科技有限公司 | The method for determining predetermined site mutation type in sample of nucleic acid |
| CN110240999A (en) * | 2018-03-09 | 2019-09-17 | 林云富 | A kind of detection device and method improving Circulating tumor DNA recall rate |
| CN111304320A (en) * | 2020-04-17 | 2020-06-19 | 浙江迪谱诊断技术有限公司 | Primer sequence and kit for detecting safe medication gene of children |
| CN112538523A (en) * | 2019-12-31 | 2021-03-23 | 北京毅新博创生物科技有限公司 | Primer group for detecting gene SNP (Single nucleotide polymorphism) related to deafness |
| CN112538524A (en) * | 2019-12-31 | 2021-03-23 | 北京毅新博创生物科技有限公司 | Detection product for detecting gene SNP related to deafness |
| CN114250268A (en) * | 2021-12-23 | 2022-03-29 | 北京毅新博创生物科技有限公司 | Product for detecting capping efficiency of mRNA sample and application |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811533B (en) * | 2017-03-06 | 2020-10-16 | 亚能生物技术（深圳）有限公司 | Genetic deafness gene detection kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101514371A (en) * | 2009-02-19 | 2009-08-26 | 上海交通大学 | Method for detecting rs16856187 polymorphic site on 3' region of G6PC2 gene |
| WO2009132089A2 (en) * | 2008-04-24 | 2009-10-29 | Monsanto Technology Llc | A method to identify asian soybean rust resistance quantitative trait loci in soybean and compositions thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838683B (en) * | 2008-12-12 | 2013-09-18 | 深圳华大基因科技有限公司 | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene |
| CN101760566B (en) * | 2008-12-12 | 2014-01-15 | 深圳华大基因健康科技有限公司 | Detection method on mutant site of ribonucleotide of HBV gene |
| CN101440407A (en) * | 2008-12-12 | 2009-05-27 | 深圳华大基因科技有限公司 | Method for detecting nucleotide mutant site |
| CN101838702A (en) * | 2010-06-02 | 2010-09-22 | 何农跃 | Detection method of single nucleotide polymorphism with high throughout |
| CN102409089B (en) * | 2011-10-08 | 2017-04-19 | 深圳华大基因股份有限公司 | Kit, method and application for detecting mutation of predetermined locus in DNA sample |
-
2011
- 2011-10-08 CN CN201110301714.2A patent/CN102409089B/en active Active
-
2012
- 2012-09-28 TW TW101136210A patent/TW201315812A/en unknown
- 2012-10-12 WO PCT/CN2012/001382 patent/WO2013049975A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009132089A2 (en) * | 2008-04-24 | 2009-10-29 | Monsanto Technology Llc | A method to identify asian soybean rust resistance quantitative trait loci in soybean and compositions thereof |
| CN101514371A (en) * | 2009-02-19 | 2009-08-26 | 上海交通大学 | Method for detecting rs16856187 polymorphic site on 3' region of G6PC2 gene |
Non-Patent Citations (3)
| Title |
|---|
| 《Journal of Virological Methods》 20090503 Divya A. Patel等 Development and evaluation of a PCR and mass spectroscopy (PCR-MS)-based method for quantitative, type-specific detection of human papillomavirus 第160卷, * |
| DIVYA A. PATEL等: "Development and evaluation of a PCR and mass spectroscopy (PCR–MS)-based method for quantitative, type-specific detection of human papillomavirus", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| PHILIP ROSS等: "High levelmultiplex genotyping by MALDI-TOF mass spectrometry", 《NATURE BIOTECHNOLOGY》 * |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013049975A1 (en) * | 2011-10-08 | 2013-04-11 | 深圳华大基因科技有限公司 | Kit and method for detecting mutation of predetermined site in dna sample and use thereof |
| CN104120133A (en) * | 2013-04-28 | 2014-10-29 | 中国人民解放军总医院 | Gene mutant and application thereof |
| CN103352073A (en) * | 2013-05-14 | 2013-10-16 | 向华 | Primer system for detecting gene SNP related to genetic deafness, and use thereof |
| CN103352073B (en) * | 2013-05-14 | 2015-07-08 | 北京毅新博创生物科技有限公司 | Primer system for detecting gene SNP related to genetic deafness, and use thereof |
| CN105087756A (en) * | 2014-04-23 | 2015-11-25 | 北京贝瑞和康生物技术有限公司 | Method and kit for non-invasive measurement on fetus deaf pathogenic gene mutation |
| CN104131008A (en) * | 2014-07-24 | 2014-11-05 | 深圳华大基因医学有限公司 | DNA labels, PCR primers and application thereof |
| CN105296471B (en) * | 2014-08-01 | 2020-02-21 | 天津华大基因科技有限公司 | DNA label, PCR primer and application thereof |
| CN105296471A (en) * | 2014-08-01 | 2016-02-03 | 天津华大基因科技有限公司 | DNA label, PCR primer and application thereof |
| CN104232631A (en) * | 2014-08-26 | 2014-12-24 | 深圳华大基因医学有限公司 | Tags, tag primers, kit and application of kit |
| CN104498609A (en) * | 2014-12-18 | 2015-04-08 | 亚能生物技术（深圳）有限公司 | Nucleic acid membrane strip and kit for detecting gene of hereditary hearing loss |
| CN104498609B (en) * | 2014-12-18 | 2016-08-31 | 亚能生物技术（深圳）有限公司 | The nucleic acid film bar of a kind of hereditary hearing impairment gene test and test kit |
| CN105803052A (en) * | 2014-12-31 | 2016-07-27 | 天津华大基因科技有限公司 | Method and kit for detecting ethanol resistance gene |
| CN105986010A (en) * | 2015-01-30 | 2016-10-05 | 天津华大基因科技有限公司 | Method for detecting folate metabolism-related gene and kit thereof |
| CN105986010B (en) * | 2015-01-30 | 2020-01-17 | 天津华大基因科技有限公司 | Method and kit for detecting folate metabolism related gene |
| CN105255999A (en) * | 2015-07-22 | 2016-01-20 | 广州市达瑞生物技术股份有限公司 | Method for detecting 20 mutation sites of deaf genes |
| CN106480222A (en) * | 2016-12-20 | 2017-03-08 | 广州中心法则生物科技有限公司 | Based on the probe of suspension microballon array system detection hereditary hearing impairment, primer, detection kit and detection method |
| CN106480222B (en) * | 2016-12-20 | 2019-09-24 | 广东辉锦创兴生物医学科技有限公司 | Probe, primer, detection kit and detection method based on suspension microballon array system detection hereditary hearing impairment |
| CN107022641B (en) * | 2017-06-09 | 2020-06-19 | 北京博奥医学检验所有限公司 | Primer for detecting deafness gene and application thereof |
| CN107022641A (en) * | 2017-06-09 | 2017-08-08 | 北京博奥医学检验所有限公司 | A kind of primer for detecting deaf gene and its application |
| CN109097457A (en) * | 2017-06-20 | 2018-12-28 | 深圳华大智造科技有限公司 | The method for determining predetermined site mutation type in sample of nucleic acid |
| CN110240999A (en) * | 2018-03-09 | 2019-09-17 | 林云富 | A kind of detection device and method improving Circulating tumor DNA recall rate |
| CN112538523A (en) * | 2019-12-31 | 2021-03-23 | 北京毅新博创生物科技有限公司 | Primer group for detecting gene SNP (Single nucleotide polymorphism) related to deafness |
| CN112538524A (en) * | 2019-12-31 | 2021-03-23 | 北京毅新博创生物科技有限公司 | Detection product for detecting gene SNP related to deafness |
| CN111304320A (en) * | 2020-04-17 | 2020-06-19 | 浙江迪谱诊断技术有限公司 | Primer sequence and kit for detecting safe medication gene of children |
| CN111304320B (en) * | 2020-04-17 | 2024-02-06 | 浙江迪谱诊断技术有限公司 | Primer sequence and kit for detecting child safety drug genes |
| CN114250268A (en) * | 2021-12-23 | 2022-03-29 | 北京毅新博创生物科技有限公司 | Product for detecting capping efficiency of mRNA sample and application |
Also Published As
| Publication number | Publication date |
|---|---|
| TW201315812A (en) | 2013-04-16 |
| CN102409089B (en) | 2017-04-19 |
| WO2013049975A1 (en) | 2013-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102409089A (en) | Kit, method and application for detecting mutation of predetermined locus in DNA sample | |
| CN105255999A (en) | Method for detecting 20 mutation sites of deaf genes | |
| Mnejja et al. | Development and transportability across Prunus species of 42 polymorphic almond microsatellites | |
| CN110205393B (en) | Primer group, application, product and method for detecting SNP (single nucleotide polymorphism) sites related to nutritional metabolic capability | |
| CN104975105B (en) | SNP marker, primer pair and its application for mouse metallothionein-Ⅰ identification | |
| CN106399523B (en) | A kind of molecular labeling SV193 and its application technology distinguishing Chinese native pig breed and Large White | |
| CN107190064B (en) | SnaPshot kit for detecting polymorphism of 22-site deafness genes | |
| Bushley et al. | Isolation of the MAT1-1 mating type idiomorph and evidence for selfing in the Chinese medicinal fungus Ophiocordyceps sinensis | |
| CN104846089B (en) | A kind of quantitative approach of fetal cell-free DNA in maternal plasma ratio | |
| AU2016275186A1 (en) | Methods and compositions for cannabis characterization | |
| CN106367491A (en) | Kit for detecting deafness susceptibility genes | |
| US6887666B1 (en) | Methods for identification of identical nucleic acid fragments from different nucleic acid populations | |
| Xia et al. | Third-generation sequencing revises the molecular karyotype for Toxoplasma gondii and identifies emerging copy number variants in sexual recombinants | |
| CN105200040B (en) | Kit for simultaneously detecting multiple deafness genes on single cell level | |
| Arbeiter et al. | Identification and validation of novel EST-SSR markers in olives | |
| CN104928389A (en) | Method and kit for detecting human ATP7B gene mutation type | |
| Agung et al. | Study of genetic diversity among Simmental cross cattle in West Sumatra based on microsatellite markers | |
| CN108998507B (en) | Noninvasive high-throughput detection method applied to crowd complex genetic relationship identification | |
| CN110923333B (en) | Haplotype marker related to lambing number in first intron of goat ZBP1 gene and application thereof | |
| CN104357578A (en) | New deafness associated gene mutation multi-site detecting system and reagent kit | |
| CN105441540A (en) | Non-syndromic deafness gene polymorphism detecting kit and application thereof | |
| CN110551813A (en) | primer group, application, product and method for detecting related SNP (single nucleotide polymorphism) sites of drug metabolic capability of rheumatic immune disease | |
| CN104419757A (en) | Novel deafness related gene mutation detection system and kit | |
| CN107267660B (en) | SSR molecular marker for detecting fertility of beet stamens and application thereof | |
| Santos et al. | Efficiency of biparental crossing in sugarcane analyzed by SSR markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1168130 Country of ref document: HK |
|
| ASS | Succession or assignment of patent right |
Free format text: FORMER OWNER: BGI-SHENZHEN Effective date: 20150729 Owner name: SHENZHEN BGI CORPORATION Free format text: FORMER OWNER: BGI-SHENZHEN CO., LTD. Effective date: 20150729 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20150729 Address after: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer Applicant after: BGI SHENZHEN CO LTD Address before: North Road No. 146, building 11F-3 Industrial Zone in Yantian District of Shenzhen city of Guangdong Province in 518083 Applicant before: BGI-Shenzhen Co., Ltd. Applicant before: BGI-Shenzhen |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Qiuju Inventor after: Feng Dafei Inventor after: Zou Jing Inventor after: Liu Xingwang Inventor after: Wang Xiaman Inventor after: Wang Jian Inventor after: Wang Jun Inventor after: Yang Huanming Inventor before: Feng Dafei Inventor before: Zou Jing Inventor before: Liu Xingwang Inventor before: Wang Xiaman Inventor before: Wang Jian Inventor before: Wang Jun Inventor before: Yang Huanming |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160504 Address after: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer Applicant after: BGI SHENZHEN CO LTD Applicant after: General Hospital of Chinese PLA Address before: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer Applicant before: BGI SHENZHEN CO LTD |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20120411 Assignee: Huada biological technology (Wuhan) Co., Ltd. Assignor: BGI SHENZHEN CO LTD Contract record no.: 2017990000372 Denomination of invention: Kit, method and application for detecting mutation of predetermined locus in DNA sample Granted publication date: 20170419 License type: Common License Record date: 20170918 |
|
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1168130 Country of ref document: HK |