CN102199624B - Method for efficiently producing recombinant proteins in mammary glands by utilizing artificial chromosomes - Google Patents

Abstract

The invention provides a method for efficiently producing recombinant proteins in mammary glands by utilizing artificial chromosomes (including BAC, PAC and YAC). In the method, a recombinant technology is adopted to completely replace target genes on artificial chromosomes of mammary gland-specific expressed proteins (including as1-casein, beta-casein, beta lactoglobulin, rabbit or mouse whey acidic protein and the like) of a mammal with an exogenous gene, so that the exogenous gene obtains an intact regulatory sequence of a mammary gland high-level expression target gene, the 'position effect' is avoided, the higher-level expression of human lysozyme or other recombinant proteins in the mammary glands can be realized, the success rate of transgenic breeding is improved, and the cost for producing and purifying the recombinant proteins at a later stage can be saved at the same time.

Description

A kind of method of utilizing artificial chromosome High-efficient Production recombinant protein in mammary gland

Technical field

The present invention relates to the genetically engineered field, particularly relate to a kind of method of utilizing artificial chromosome High-efficient Production recombinant protein in mammary gland.

Background technology

In order to improve the expression level of recombinant protein, guaranteeing the integrity of controlling element and overcoming " position effect " is two important elements that need consideration.At present, feasible solution has two kinds, and the one, by gene targeting, make fixed point integration of foreign gene at chromosomal specific position, produce transgenic animal by body-cell neucleus transplanting again.It is strong that the method has a site-specific nature, but genetic stability and foreign gene are not affected by position effect, on the contiguous gene also advantage such as impact not.But, large animal does not also have to obtain to have the stem cell of using value, and common somatic gene targeting is a very difficult job, just just can succeed once in a while, reason is that the algebraically that somatocyte can pass is very limited, and after drug screening, cell viability is very poor, carry out the nuclear transplantation experiment with such cell, embryo development rate is low.In addition, middle target cell can not be able to effectively expand numerous, and evaluation work is difficult to carry out at cell levels.The 2nd, produce transgenic animal take large fragment DNA as carrier.The large fragment DNA carrier has guaranteed the integrity of goal gene upstream and downstream flanking sequence, can comprise the important regulating and controlling elements such as enhanser, insulator and seat control region (LCR), not only can eliminate or " position effect " of reducer after integrating, and can be in the environment of a kind of relatively " nature " effective expression of assurance foreign gene.Therefore, the large fragment DNA carrier very likely becomes genetically modified development trend.

At present, reported that the large fragment DNA carrier of producing transgenic animal mainly contained yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) and P1 karyomit(e) (PAC) etc.In these three kinds of large fragment DNA carriers, BAC has unrivaled advantage as transgene carrier, can be used as first-selection.At first BAC is circular plasmids, the screening of available chlorine mycin, and it is simpler than YAC to operate; Secondly, the BAC replicon derives from single copy plasmid F-factor, and it only has the only a few copy in Host Strains, but genetic stability, and without disappearance, restructuring and chimerism, but repetitive operation repeatedly and not can produce sudden change; The 3rd, BAC carrier is the library commonly used of genome sequencing, and its quantity increases sharply along with the development of genome sequencing, and it is very convenient to buy.1999, the usefulness goat alpha-lactalbumin BAC such as Stinnakre produced transgenic mice, and recombinant protein has overcome " position benefit " as a result, obtained efficiently expressing, and expression amount and copy number were linear.But because the shortcoming of technology, people are difficult to BAC be operated more impossible expression of removing certain foreign gene with whole BAC.

Operation large fragment DNA carrier depends on the development of recombinant technology (Recombineering), it is divided into four developmental stage, restructuring, RecET recombination system and the Red recombination system of the restructuring of RecBCD defective mediation, RecA mediation, wherein convenient and efficient with the Red recombination system.The Red recombination system can be expressed 3 kinds of phage homologous recombination protein: exo, beta and gam, and wherein gam albumen can suppress the 5 prime excision enzyme activity of RecBCD albumen, stops the degraded of external source double-stranded DNA; Exo albumen then has 5 ' → 3 ' exonuclease activity, the double-stranded DNA of linear fragment can be opened from 5 ' end-grain cutting, forms 3 ' strand protruding terminus; Beta albumen can be combined with 3 ' strand protruding terminus, promotes the annealing between strand and homologous sequence, realizes the homologous recombination between linear DNA fragment and target sequence.

Summary of the invention

The purpose of this invention is to provide a kind of method of utilizing artificial chromosome High-efficient Production recombinant protein in mammary gland, it can guarantee the integrity of controlling element and overcome " position benefit ", significantly improves the expression amount of foreign gene, improves success rate of breeding.

In order to realize the object of the invention, a kind of method of utilizing artificial chromosome High-efficient Production recombinant protein in mammary gland of the present invention, it is to adopt recombinant technology with the target gene on the artificial chromosome of the mammiferous mammary gland specific expression protein of the complete replacement of foreign gene, make foreign gene obtain the regulating and controlling sequence that complete mammary gland efficiently expresses target gene, the Recombinant Artificial karyomit(e) that obtains is changed in the Mammals, thereby foreign gene is efficiently expressed in animal's mammary gland.

Aforesaid method, described artificial chromosome are yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) or P1 karyomit(e) (PAC) etc., preferred BAC.

Aforesaid method, described foreign gene are human lysozyme gene, hBSSL or butyrylcholine esterase etc.

Aforesaid method, described foreign gene adopts genome sequence.

Aforesaid method, described mammary gland specific expression protein are as1-casein, beta-casein, beta lactoglobulin, rabbit or mouse whey acid protein etc.

Aforesaid method, described Mammals are ox, sheep, rabbit, mouse etc.

Purpose of the present invention can also be further achieved by the following technical measures.

According to a preferred embodiment of the present invention, adopt recombinant technology with the target gene on the complete replacement human lactoferrin of the human lysozyme gene BAC, obtained a kind of efficient expression vector that makes up according to aforesaid method, it has pBAC-hLF-hLZ-Neo carrier structure as shown in Figure 1.It can efficiently express the production human lysozyme in bovine mammary gland.

By technique scheme, the present invention has following advantages and beneficial effect at least:

(1) a kind of method of utilizing artificial chromosome High-efficient Production recombinant protein in mammary gland of the present invention can guarantee the integrity of controlling element and overcome " position benefit ", significantly improves the expression amount of foreign gene, improves success rate of breeding.

(2) target gene on the human lactoferrin BAC of human lysozyme or the complete replacement mammary gland of other goal gene transcriptionally active, obtained complete controlling element, overcome " position effect ", can realize the higher level expression in mammary gland of human lysozyme or other recombinant protein, improve the success ratio of transgenic breeding, can save the cost of later stage production purification of recombinant proteins simultaneously.

(3) utilize the upper complete controlling element of BAC to instruct exogenous gene expression, can realize the expression of human lysozyme gene or other goal gene higher level, reduced simultaneously owing to the imperfect ectopic expression that causes of controlling element in traditional transgenic research, improved the transgenosis success ratio.

(4) available other gene replaces human lysozyme sequence among the present invention, and also the milk-protein BAC that efficiently expresses of available other mammary gland substitutes human lactoferrin BAC.

Description of drawings

Fig. 1 is the structure flow process (being divided into was three steps) of expression vector pBAC-hLF-hLZ-Neo in the embodiment of the invention 1;

Fig. 2 is that the PCR method is identified the BAC that modifies in the embodiment of the invention 1, and wherein a, b, c detect respectively first, second and third step in the BAC modification;

Fig. 3 is the elimination that sequencing is identified the FRT site in the embodiment of the invention 1;

Fig. 4 is the molecular Biological Detection of transgenic mice in the embodiment of the invention 2, and wherein a is that PCR detects positive transgenic mice; M, 100bp gradient dna molecular amount standard, the positive contrast of PC, the negative contrast of NC; B is Southern hybridization check pBAC-hLF-hLZ-Neo expression vector integration in the transgenic mice genome; P1, P5, P10 are respectively 1,5,10 copies of positive control; C is that RT-PCR detects the expression of human lysozyme in each tissue of transgenic mice; M, 100bp gradient dna molecular amount standard, 1 mammary tissue, 2 hearts, 3 livers, 4 spleens, 5 lungs, 6 kidneys, 7 stomaches, 8 intestines; Mouse housekeeping gene GAPDH is contrast;

Fig. 5 is the expression that Western Blot detects human lysozyme in the transgenic mice breast sample in the embodiment of the invention 2, wherein with PBS dilution (1: 10) mouse breast sample, gets 3 μ L loadings; Positive control PC is 0.5 μ g human lysozyme standard substance, and negative control is the newborn sample of common non-transgenic mouse, and the size of human lysozyme is 14.7kDa;

Fig. 6 is the anti-microbial activity that agar plate method detects human lysozyme in the embodiment of the invention 2; Filter paper directly is 6mm, and the applied sample amount of each filter paper is the former milk of 1 μ L (being diluted to 10 μ L loadings); PC0.5 is 0.5 μ g human lysozyme standard substance, and PC1.0 is 1 μ g human lysozyme standard substance, and negative control is the newborn sample of common non-transgenic mouse;

Fig. 7 is that bovine fetal fibroblast PCR identifies that wherein PC is that the pBAC-hLF-hLZ-Neo carrier is as positive control in the embodiment of the invention 3; NC is that 094 cow genome group is as negative control; The cell clone point that 1-13:G418 filters out; M:100bp gradient dna molecular amount standard;

Fig. 8 is the structure flow process of the hBSSL BAC carrier (pBAC-hLF-BSSL-Neo) that mammary gland efficiently expresses in the embodiment of the invention 4;

Fig. 9 is the gel electrophoresis figure of identifying carrier pBAC-hLF-BSSL-Neo in the embodiment of the invention 4;

Figure 10 is the structure flow process of the hBCHE BAC carrier (pBAC-hLF-BCHE-cDNA-Neo) that mammary gland efficiently expresses in the embodiment of the invention 5;

Figure 11 is the gel electrophoresis figure of identifying carrier pBAC-hLF-BCHE-cDNA-Neo in the embodiment of the invention 5;

Figure 12 is transgenic mice preparation flow in the embodiment of the invention 2.

Embodiment

Following examples are used for explanation the present invention, but are not used for limiting the scope of the invention.

Employed carrier, bacterial classification, reagent and source thereof in following examples:

HLF BAC clone (Genbank numbering: U95626), hLZ BAC clone (Genbank numbering: RP11-1143G9) (Genome Systems company), plasmid 707-FLPe (GeneBridges company), SW102 bacterial strain, PL452 plasmid are available from Biological resources branch of NIH; Taq archaeal dna polymerase, T4DNA ligase enzyme, restriction enzyme are available from TaKaRa company, and the synthetic sequencing that reaches of primer is finished by the living worker in Shanghai; The anti-human N,O-Diacetylmuramidase polyclonal antibody of rabbit is available from US Biological company, and human lysozyme ELISA detection kit is available from Biomedical Technologies company.The normal experiment operation stepss such as enzyme is cut, connected, recovery, conversion, pcr amplification see " molecular cloning (third edition) " for details.

The structure (take human lysozyme gene, human lactoferrin BAC as example) of embodiment 1 expression vector pBAC-hLF-hLZ-Neo heterozygosis BAC

1.1 the structure of human lysozyme mammary gland expression vector

It was three steps that expression vector pBAC-hLF-hLZ-Neo building process is divided into, as shown in Figure 1:

The first step, the target gene on the complete replacement of the hLZ genomic dna hLF BAC.Take hLZBAC as template, amplify the 4.8kb hLZ gene with homology arm;

Primer: hLF-hLZ-F (5 '-CTA GCTAGCAAAGCCCTGAATAAAGGGGCGCAGGGCAGGCGCAAGTGGCAGAGCCTTCGTTTGCC AAGTCGCCTCCAGACCGCAGACATGAAGGCTCTCATTGTTCTG-3 ') and hLF-hLZ-R (5 '-CTA GCTAGCAGGGGAGGCCAAGGCCCCAACACACCTGGGGAGAAGAGCTGGGGGCAGTGAATGGC TGAGGCTTTCTTGGGGAGCTGGGCCATCTTCTTCGGTTTTACACTCCACAACCTTG AAC-3 ');

Underscore is Nhe I restriction enzyme site, and boldface letter is homology arm.The PCR product be connected into the pMD19-T carrier and sequence verification correct.In the intron 2 of hLZ gene, search out a Hpa I restriction enzyme site, cut connection method by conventional enzyme and add FRT-Zeo protokaryon selection markers (the FRT site has the function the same with the LoxP site, the Zeo gene can be removed).With the hLZ plasmid with restriction endonuclease Nhe I linearizing and cut glue and reclaim, electric shock changes in the SW102 bacterial strain that contains hLF BAC, after homologous recombination occured, hLZ-FRT-Zeo had replaced hLF gene (from the ATG initiator codon to the TAA terminator codon), obtains the pBAC-hLF-hLZ-Zeo carrier;

Second step: the embedding of resistance screening mark Neo gene, for body-cell neucleus transplanting is prepared.Take plasmid PL452 as template, amplify the Neo gene with 2 LoxP sites;

Primer: hLF-Neo-F (5 '-GTCTCCTCCTTACCCTGGACTGACACATGGACTCTCATTTGAACTACTTTCTCAGT CTCAAGCCCAATTCCGATCATA-3 ') and hLF-Neo-R (5 '-CACTTTATGTGAAATCTAACAAAGTTGAACTCGTAGAAGTAGAGTGTAGAAAGAGA TTGGCCGCTCTAGAACTAGTGGAT-3 ');

Bolded section represents homology arm.The PCR product changes in the SW102 bacterial strain that contains the pBAC-hLF-hLZ-Zeo carrier through cutting to shock by electricity after glue reclaims, after the homologous recombination second time occurs, obtain the pBAC-hLF-hLZ-Zeo-Neo carrier, the insertion point of Neo on hLF BAC is foremost 2kb place of 5 ' flanking region;

The 3rd step: the removal of protokaryon selection markers Zeo gene.The pBAC-hLF-hLZ-Zeo-Neo carrier is changed in the DH10 β competent cell that contains plasmid 707-FLPe, 37 ℃ of overnight incubation, the FLP protein expression, the Zeo gene is deleted, only surplus next FRT site.Simultaneously, because the replication origin of plasmid 707-FLPe is pSC101, this site can't be copied at 37 ℃, and therefore, the 707-FLP plasmid will be died away in bacterium, can not cause plasmid to pollute.Obtain final expression vector pBAC-hLF-hLZ-Neo.

1.2 restructuring

1.2.1BAC extraction

The method that provides on the test kit (NucleoBond BAC 100Kit) is provided the BAC extraction step.Slightly carry BAC according to the step of test kit, add P1, P2 and P3, then use the isopropanol precipitating of 0.7 times of volume, the electric shock that the BAC that slightly carries can be used for bacterium transforms.

1.2.2SW102 the electric transformed competence colibacillus preparation of bacterial strain

Concrete steps are: a. initial incubation, get mono-clonal with the rifle choicest, and adding fills in the sterile tube of 5ml LB substratum, and 32 ℃, 220rpm, incubated overnight; B. enlarged culturing is transferred to incubated overnight liquid in the sterilization triangular flask that fills 50ml LB substratum in about 1: 70 ratio, and 32 ℃, 220rpm treats that OD600 reaches at 0.4 o'clock, stops to cultivate; C. bacterium liquid is divided into 2 parts, first part in 42 ℃ of (strictly) water-baths, 220rpm, oscillation incubation 15min; Second part is contrast, 32 ℃ of water-baths, 220rpm, oscillation incubation 15min; D. 2 parts of bacterium liquid are cooled off in ice-water bath more than the 10min fast, afterwards in 4 ℃, the centrifugal 10min of 5000rpm; E. abandon supernatant, again pipe is placed ice-water bath, add the ddH of 1ml precooling on ice ₂O rotates resuspendedly gently, adds the ddH of 10ml precooling again ₂O reverses several times fast, and 4 ℃, the centrifugal 5min of 5000rpm; F. abandon supernatant, again pipe is placed ice-water bath, 10% glycerine of adding 1ml precooling on ice+90%ddH ₂O rotates resuspendedly gently, adds 10% glycerine of 10ml precooling+90%ddH again ₂O reverses several times fast, and 4 ℃, the centrifugal 5min of 5000rpm; G. abandon supernatant, 10% glycerine of adding 100～200 μ L precoolings+90%ddH ₂O, resuspended precipitation; H. packing adds 40 μ L in the tubule of every 0.5ml ,-80 ℃ of preservations are for subsequent use behind the liquid nitrogen flash freezer.

1.2.3BAC or the electricity of dna fragmentation transforms

Concrete operations are: a. gets 40 μ L competent cells and mixes with 5 μ L BAC solution or PCR product, is transferred in the sufficient 0.2em electric shock of the ice bath cup, can not form bubble; B. the cup water on every side that will shock by electricity is dried, and places electric shock tank, starts the electric shock program of bacterium; C. hear " puff " one, electric shock transforms and finishes, and adds 0.8ml SOC substratum in the electric shock cup, use the rifle sucking-off, places the 1.5ml centrifuge tube, vibrate renewal cultivation 2 hours of 32 ℃ of water-baths; D. coat and contain on the corresponding antibiotic LB plate overnight incubation in 32 ℃ of incubators; E.PCR and Cracking method are identified positive colony.

1.2.4 the design with the PCR long segment primer of homology arm

General structure with the long segment primer of homology arm is: respectively with the homologous sequence of about 50bp, and can introduce the sequence such as restriction enzyme site at 5 ' end of regular-PCR primer between homology arm and general primer.The design of modifying the BAC homology arm is as follows: choose the about 50bp sequence of 5 ' end next-door neighbour of target sequence as 5 ' homology arm, be added to 5 ' end of a general primer; Choose the about 50bp sequence of 3 ' end next-door neighbour of target sequence, get the 5 ' end that its reverse complementary sequence is added to another general primer, as 3 ' homology arm.

1.3 the evaluation of expression vector pBAC-hLF-hLZ-Neo positive colony

Primer P1, P2 and P3 (table 1) are respectively first and second and three primers designed that go on foot, and Fig. 1 is seen in the position on BAC.P1 is for merging primer, and positive bacterium colony can amplify the dna fragmentation of 703bp, and (Fig. 2 a); The P2 primer is 2541bp in the PCR product length that positive bacterium colony amplifies, and feminine gender is 1960bp; The P3 primer is because the removal of Zeo gene, about the end 1kb of the PCR product Length Ratio feminine gender of positive bacteria (Fig. 2 b), further sequencing result shows, under the effect of FLP enzyme, remove the Zeo gene fragment, remained single FRT site and restriction enzyme site vestiges (Fig. 2 c).

Foundation and the detection of embodiment 2 transgene mouse models

2.1 microinjection obtains transgenic mice

The transgenic mice preparation flow as shown in figure 12.

The transgenic mice preparation process is referring to " mice embryonic operation experiments guide " (work such as A. Na Ji, 2004, Science Press), and the present invention adopts annular BAC injection mouse, has the same high transgene efficiency with linear BAC.

Produce transgenic mice with microinjection, for common small segment carrier, linear ratio annular integration efficiency is high, therefore will be cut into the expression vector enzyme that builds and linearly just can carry out microinjection.And the BAC carrier of large fragment because its structure is large, in the removal process, is easy to fracture after the linearizing, if do not reclaim, can obtain same high transgene efficiency, will greatly improve success ratio and save the working hour.In the present invention, obtain altogether 41 mouse, 5 positive, and transgene efficiency is 12.2%.Common transgene efficiency 5～20% between.The result shows that annular BAC has the same high transgene efficiency with linear BAC.

2.2 the PCR of transgenic mice detects

Get 2～3 age in week transgenic mice tail organize sample, extract genome (take conventional DNA recovery method as example).Take the genome that extracts as template, in positive mouse, can amplify the fragment of 703bp with primer P1 (table 1), PCR take common mouse (non-transgenic mouse) genome as template reacts negative contrast, the positive contrast of the reaction take carrier pBAC-hLF-hLZ-Neo as template.Amplification condition is 94 ℃, 30sec; 60 ℃, 30sec; 72 ℃, 60sec; 35 circulations, 1.0% agarose electrophoresis observations.PCR detects 5 positive mouse in F0 41 mouse in generation, the result is shown in Fig. 4 a, and positive mouse is: 26,30,32,35, and No. 39.

2.3 the Southern hybridization check of transgenic mice

F0 generation 5 transgenic mices with the PCR test positive, strand afterbody tissue also extracts genome, getting about 10 μ g digests with the EcoRI restriction endonuclease, the negative contrast of wild-type mice genome of cutting with the EcoRI enzyme, the positive contrast of pBAC-hLF-hLZ-Neo injection carrier segments that the EcoRI enzyme is cut, hybridization probe is the PCR product (table 1) of primer P4, and length is 637bp, by digoxin (DIG) mark.With various sample low pressure electrophoresis at a slow speed, adopt the alkali transfer method that DNA is transferred to nylon membrane from agarose, the one side that nylon membrane is had a DNA is rolled into tubular and puts into hybrid pipe inwardly, add prehybridization solution, be not shorter than 1 hour in 65 ℃ of prehybridizations, add the probe through the DIG mark of heat denatured, hybridized 12～16 hours for 65 ℃, wrap with preservative film after washing film, put in the magazine, press X-ray, observations in the darkroom.The Southern results of hybridization is shown in Fig. 4 b, and the result shows positive mouse Southern hybridization check result consistent with the PCR detected result (Fig. 4 b).Integrate copy number and see Table 2.

2.4 the RT-PCR of transgenic mice detects

Extract the mammary gland in lactation period and total RNA of each tissue (heart, liver, spleen, lung, kidney, stomach, intestines) with Trizol reagent, get the total RNA of 1 μ g and carry out reverse transcription, the cDNA that reverse transcription is obtained is as template, increase as Exon1-2-F and Exon4-R (table 1) to merge primer, amplified production is the dna fragmentation of 322bp.Take the housekeeping gene GAPDH of mouse as contrast (530bp).The result shows that human lysozyme efficiently expresses in mammary gland, but in the tissues such as the heart, liver, spleen, lung, kidney, intestines faint expression (Fig. 4 c) is arranged also.

2.5 the Western blotting of transgenic mice breast sample detects

Gather F0 generation 32, No. 39 mouse, F1 is for 30-11,35-17, and the 26-22 mouse is breast often, and negative mouse milk is as negative control.Milk week after mouse birth gathers, before gathering female mouse separated more than 3 hours with newborn mouse, and to the pitocin of abdominal injection doses.Full milk and the newborn sample processed through degreasing demargarinate albumen are with 15% SDS-PAGE gel electrophoresis, 50V, 1h; 90V, 2h carries out electrophoresis.Utilize the wet film instrument 350mA that walks around of Bio-Rad after electrophoresis is complete, transferring film 30min.After transferring film is finished, spend the night with the sealing of 5% skim-milk, then the anti-human primary antibodie of rabbit (dilution in 1: 3000) is hatched 1h, TBST washes film 3 * 10min, then the goat-anti rabbit two anti-(dilution in 1: 10000) of HRP mark hatches 1h, and TBST washes film 3 * 10min, carries out at last the BCL colour developing.The result has 5 to efficiently express human lysozyme in 6 female mouse as shown in Figure 5, and No. 32 female mouse also has expression, but relatively.The human lysozyme size is 14.7kDa (Fig. 5).

2.6 transgenic mice breast sample ELISA detects expression amount

With ELISA the expression amount in the transgenic mice milk is analyzed, the reagent of analyzing usefulness comes from the Human Lysozyme of Biomedical Technologies company detection kit.Each each sample of concentration of measuring is done two repetitions, gets two and repeats average as the one-shot measurement value, and each sample is surveyed concentration three times at least, and calculating concentration average and average value standard deviation are listed in table 2.

2.7 the biological activity assay of human lysozyme

2.7.1 agar plate method

Getting respectively 100uL micrococcus lysodeikticus (M.Lysodeikticus) evenly coats at the bottom of 1.5% agar powder on the meat soup culture plate, on substratum, put into respectively the filter paper that is added with 1uL breast sample, the negative contrast of newborn sample (NC) of non-transgenic mouse, positive control is the human lysozyme standard substance, PC0.5 is 0.5 μ g human lysozyme standard substance, and PC1.0 is 1 μ g human lysozyme standard substance.4 repetitions are set, cultivated 36 hours for 28 ℃, observe the diameter of inhibition zone, but the expression amount of intuitive judgment human lysozyme and activity (Fig. 6).

2.7.2 reduced turbidity method

With cultivating 24 hours in the micrococcus lysodeikticus liquid medium within, then with the centrifugal bacterium liquid of 5000rpm, collect thalline.Wash bacterium liquid 2 times with the 66mM potassium phosphate buffer, 5000rpm is centrifugal.With 66mM potassium phosphate buffer dissolving thalline to OD450 be about 0.8.Ultra-violet and visible spectrophotometer is opened preheating, transfer to OD450.With egg white lysozyme production standard curve, each concentration is 1000,2000,3000,4000,5000,6000 and 8000U/mL.Get 1 μ L milk sample, add 99 μ L damping fluids.Be to add the mixed bacteria suspension of 2.5mL in the quartz cuvette of 1cm at light path, add rapidly the sample that 100uL configures.Each experiment repeats 3 times.Calculate bacteriostatic activity average and average value standard deviation and list in table 2.

Table 1 is identified the primer of restructuring BAC and transgenic mice

The expression of table 2 human lysozyme in transgenic mice

Embodiment 3 efficiently expresses the preparation of human lysozyme transgenic cattle

3.1 bovine fetal fibroblast system sets up

Bovine fetal fibroblast is set up and is adopted trypsin digestion.Concrete grammar is as follows: a. butchers the cow of 42day, takes out placenta and puts into the DMEM substratum, and 12h returns the laboratory.B. in containing the Tissue Culture Dish of 5 * DPBS, reject fetal head, four limbs, internal organ and cartilaginous tissue, the residue tissue is put into a new 10cm Tissue Culture Dish, shred with eye scissors as far as possible.C. add the 1ml perfect medium, will organize fragment and media transfer in the centrifuge tube of 15ml with the 1ml rifle head of haircut, add 7ml DPBS, several lower with pipettor piping and druming, after tissue block is avaled, abandon supernatant, repeated washing is once.D. in the 15ml centrifuge tube, add 10ml 0.25% pancreatin, then digest 30min in 37 ℃ of water-baths.E. carefully draw the supernatant cell suspension in another 15ml centrifuge tube, room temperature 1200rpm, centrifugal 5min collecting cell.Repeat d, e step each once and collecting cell.F. with the cell of centrifugal acquisition according to 1 * 10 ⁶In the concentration inoculation T25 Tissue Culture Flask of/bottle, place 37.5 ℃, 5%CO ₂Cultivate in the incubator, change every three days a not good liquor, cover with until cell rear frozen, and called after 094 bovine fetal fibroblast.

3.2 cell transfecting

Cell transfecting adopts consideration convey to move (Amaxa Nucleofector) to carry out electricity and turn.Idiographic flow is as follows: two bottles of T25 cells (about 8 * 10 that will digest and collect ⁶), with Not I linearizing pBAC-hLF-hLZ-Neo carrier, get 3 μ g and 100 μ l Nucleofector reagent mixings, then the transfection of shocking by electricity of the electric shock of packing into cup cultivates in four bottles of T-25 culture dish respectively.Behind the 48h with cultured cells digestion and be taped against the substratum that contains 500 μ g/ml G418 in the ware of 60 10cm and carry out cell screening, screen after about 10 days the picking mono-clonal totally 40 cultivate to 48 orifice plates.It is numerous to the cultivation of 24 orifice plates to converge rear expansion until cell 90%, has 13 clone's point growth conditions better, and half is frozen for the cell after then will covering with, and second half is used for, and genome extracts and the PCR evaluation.

3.3 the evaluation of positive cell

With 13 cell extraction genomes of cloning point that obtain, the genomic dna of getting 50ng is used for PCR and detects, and primer is P4 (table 1).The PCR detected result shows have 10 to integrate the pBAC-hLF-hLZ-Neo carrier in 13 clone's points that obtain, augmentation detection has arrived the purpose fragment (Fig. 7) of 637bp.The cell clone that positive signal is stronger is used for nuclear transplantation, will obtain the human lysozyme transgenic dairy.

The structure of the hBSSL BAC carrier (pBAC-hLF-BSSL-Neo) that embodiment 4 mammary gland efficiently express (take hBSSL gene, human lactoferrin BAC as example)

Made up the high-expression vector (Fig. 8) of BSSL gene with the three step methods of arresting.At first, design pair of homologous arm T1 and T2 for BSSL BAC gene BSSL gene downstream, utilized PCR that T1 and T2 are connected to flank with the both sides of the Neo gene in LoxP site, formed the linear carrier of arresting; Linearity is arrested the carrier electricity forward in the SW102 bacterial strain that contains BSSL BAC gene, through the effect of Red recombination system, flank is inserted into the downstream of BSSL gene with the Neo gene in LoxP site; Pair of primers P1 and P2 have been designed in junction for Neo gene and BSSL gene, turn the clone who obtains by the Kan screening with P1 and P2 amplification electricity, positive colony can amplify the fragment that comprises complete Neo gene between the primer, about 2kb, electrophoresis detection such as Fig. 9 a, and through sequence verification.

Secondly, for BSSL BAC gene upstream and downstream design pair of homologous arm T3 and T4, for hLF BAC design pair of homologous arm T5 and T6, two pairs of homology arms are coupled together by overlapping PCR, and be connected on the PBR322 plasmid, cut with Not I between T3 and the T4, form linear PBR322 and arrest carrier; Linearity is arrested the carrier electricity forward the first step to and arrest in the SW102 positive strain that contains BSSL-Neo BAC that obtains, by homologous recombination, the BSSL-Neo gene among the BSSL-NeoBAC is arrested, form the PBR322 cyclic plasmid that contains the BSSL-Neo gene; The bacterium liquid that electricity is turned rear recovery is coated on the flat board that contains the Amp resistance, use for the primer P3 of PBR322 plasmid and BSSL-Neo upstream design and P4 and for primer P5 and the P6 of PBR322 plasmid and the design of BSSL-Neo downstream and identify the clone who obtains, detect such as Fig. 9 b, and pass through sequence verification; From positive colony, extract the successful PBR322 plasmid of restructuring, cut evaluation with ASC I enzyme, detect such as Fig. 9 c.

At last, cut the PBR322 that extracts in the second step successful plasmid of recombinating with Asc I enzyme, reclaim the purpose fragment that contains T5-BSSL-Neo-T6, obtain linearity and arrest carrier; Linearity is arrested the carrier electricity forward in the SW105 bacterial strain that contains hLF BAC gene, the homology of T5 T6 homology arm and hLF BAC is partly recombinated, and BSSL-Neo gene and hLF gene coding region are replaced, and finishes the structure of BSSL high-expression vector; The bacterium liquid that electricity is turned rear recovery is applied on the flat board that contains the Kan resistance, use for the primer P7 of hLF5 ' UTR and the design of BSSL-Neo gene junction and the primer P9 of P8 and hLF3 ' UTR and the design of BSSL-Neo gene junction, P10 identifies the clone on the Kan flat board, detect such as Fig. 9 d and 9e, and through sequence verification; From positive colony, extract restructuring BAC, detect such as Fig. 9 f.

Transgenic animal according to the method for embodiment 1-3 can be produced the hBSSL that mammary gland efficiently expresses comprise transgenic dairy, goat and rabbit etc.

Table 3 makes up the used primer sequence of pBAC-hLF-BSSL-Neo expression vector

The structure of the hBCHE BAC carrier (pBAC-hLF-BCHE-cDNA-Neo) that embodiment 5 mammary gland efficiently express (take hBCHE cDNA sequence, human lactoferrin BAC as example)

Butyrylcholine esterase enters blood by the liver cell synthesis secretion, mainly be distributed in liver, serum and the lymph liquid, contain 28 amino acid whose signal peptides, in order not affect butyrylcholine esterase in the secretion of mammary gland, so replace the signal peptide of butyrylcholine esterase with sheep-casein signal peptide: take pRcCMV-BCHE (available from U.S. Oksana Lockridge company) (containing hBCHE cDNA) as masterplate;

Primer: BCHE-F:5 '-ATA TTC TCG AG A GCC ATG AAG GTC CTC ATC CTT GCC TGT CTG GTG GCT CTG GCC CTT GCA AGAGAA GAT GAC ATC ATA ATT GCA ACA-3 ', BCHE-R:5 '-CATTGA CTCGAG AA TTA GAG ACC CAC ACA ACT TTC TTT-3 ';

Bolded section is signal peptide sequence, and italicized item is Xho I restriction enzyme site, and amplified fragments connects the order-checking of pMD19-T carrier, and correct clone is the BCHE that has added signal peptide.The human lactoferrin BAC that adopts preserves for this laboratory,

The homology arm primer is hLF-BCHE-F:(5 '-AAGCTTGAATAAAGGGGCGCAGGGCAGGCGCAAGTGGCAGAGCCTTCGTTTGCCAA GTCGCCTCCAGACCGCAGACATGAAGGTCCTCATCCTTGCCTGT-3 ') and hLF-BCHE-R:(5 '-AAGCTTGGCAAGATGGCAGCTTCTAGCCTCAGTCACAGGCTTCCGTTTGCCATCGA GGATCCGATTACCTAGTCGACTTAGAGACCCACACAACTTTC-3 ');

Bolded section is the homology arm sequence of human lactoferrin BAC, and italicized item is restriction endonuclease sites.Amplified fragments (hLF-BCHE-cDNA) links to each other with the pMD19-T carrier.With Sal I and BamH I double digestion PL452 plasmid, reclaim 1.9kbNeo resistance fragment, be connected into above-mentioned carrier, obtain among the hLF-BCHE-cDNA-Neo.According to the method (Figure 10) of above-mentioned vector construction, adopt the SW102 recombination system, change the hLF-BCHE-cDNA-cDNA fragment over to contain human lactoferrin BAC recombinant bacterial strain, after recombinating, obtain pBAC-hLF-BCHE-cDNA-Neo.The several clones of picking identify at random, usefulness fusion primers F (5 '-AAGGCGATCTTCAAGTAAA-3 ') and R (5 '-CCACCACCATAAATCCATA-3 ') end connector detection primer, the amplified fragments detected result is as shown in figure 11.

Transgenic animal according to the method for embodiment 1-3 can be produced the hBCHE that mammary gland efficiently expresses comprise transgenic dairy, goat and rabbit etc.

Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.

Claims (1)

1. method of utilizing artificial chromosome High-efficient Production recombinant protein in mammary gland, it is characterized in that, it is to adopt homologous recombination technique with the target gene on the artificial chromosome of the mammiferous mammary gland specific expression protein of the complete replacement of foreign gene, make foreign gene obtain the regulating and controlling sequence that complete mammary gland efficiently expresses target gene, the Recombinant Artificial karyomit(e) that obtains is changed in Mammals or the cell, thereby foreign gene is efficiently expressed in animal's mammary gland or cell;

Wherein, described foreign gene is human lysozyme gene, hBSSL gene or butyrylcholine esterase gene; Target gene on the artificial chromosome of described mammiferous mammary gland specific expression protein is the hLF target gene among the hLF BAC; Described Mammals is mouse, and described cell is bovine fetal fibroblast system.

Images