CN101240263B - TPO gene modifying human marrow stroma stem cell and its preparation method and use - Google Patents
TPO gene modifying human marrow stroma stem cell and its preparation method and use Download PDFInfo
- Publication number
- CN101240263B CN101240263B CN2007100343961A CN200710034396A CN101240263B CN 101240263 B CN101240263 B CN 101240263B CN 2007100343961 A CN2007100343961 A CN 2007100343961A CN 200710034396 A CN200710034396 A CN 200710034396A CN 101240263 B CN101240263 B CN 101240263B
- Authority
- CN
- China
- Prior art keywords
- tpo
- stem cell
- human marrow
- paav
- interstitial stem
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses human marrow-interstitial stem cell modified by TPO gene, its preparing process and use. The human marrow-interstitial stem cell is obtained by recombination gland relevant virus meso-guide TPO gene decoration. The preparation method comprises the following steps consequently cloning human tyre liver TPO gene, constructing carrier plasmid Paav-tpo-ires-hrGFP, preparing Raav-TPO viral vectors, culturing human marrow-interstitial stem cell, transfecting Raav-TPO on human marrow-interstitial stem cell. The human marrow-interstitial stem cell modified by TPO gene or human marrow-interstitial stem cell exudate modified by TPO gene can be used for preparing medicine of urging blood platelet-generating. The MSCs modified by TPO gene generates internal source TPO through cell secreting for treating blood platelet reduction so the side-effect generated from injection human recombination TPO is not generated.
Description
Technical field
The present invention relates to genetic modification bone marrow interstital stem cell field.
Background technology
Thrombopoietin (thrombopoietin; TPO) be to regulate megalokaryocyte and thrombopoietic cytokine, TPO has the megalokaryocyte of startup clone and forms, stimulates the Hyperploidy megalokaryocyte to generate and ripe Megakaryocytic generation and the thrombopoietic whole process function of support function property.
Experimentation on animals shows, recombinant human TPO recover platelet levels, promote on the function of other Hemopoietic factor vigor more more effective than other Hemopoietic factors; Clinical experiment shows that also recombinant human TPO can effectively alleviate the thrombopenia that chemotherapy causes.The TPO that is applied to clinical study at present mainly contains two kinds of forms: by the total length of the half long molecule TPO (PEG-rHuMGDF) that modifies through PEG of bacterial expression and mammalian cell expression, glycosylated TPO (rhTPO).Yet; Multiple doses PEG-rHuMGDF treatment cancer patients finds with the experimental study that is used for the healthy volunteer; PEG-rHuMGDF produces a kind of neutralizing antibody in application; Cross reaction takes place in the Ig G type antibody of this PEG-rHuMGDF and endogenic TPO, and thrombocytopenia takes place its biological effect of having neutralized then.Because of its spinoff, PEG-rHuMGDF is withdrawn from clinical trial in September, 1998 in the U.S..And present research demonstration for rhTPO; In rhTPO II, III phase are clinical; Several TPO toxicity test results confirm that it is feasible that rhTPO uses in cancer patients's body, but the patient with heart, lung, blood vessel or blood medical history is still eliminating at the row of II, III phase clinical experiment.
Owing to use reorganization TPO possibly produce the danger and the high cost thereof of neutralizing antibody repeatedly, therefore, to treat thrombocytopenia will be another important outlet to TPO to replace injection to recombinate with the strategy of gene therapy, and vast potential for future development is arranged.
Bone marrow interstital stem cell (mesenchymal stem cells; MSCs) and the stroma cell of differentiation form bone marrow microenvironment; (haemopoietic stem cell, survival HSC), self, migration and differentiation produce broad profile of cytokine to regulate hemopoietic stem cell.MSCs can produce many cytokine hematopoiesis supports, for example SCF, LIF, SDF-1, OSM, BMP-4, Flt-3, TGF-β, IL-1, IL-6, IL-7, IL-8, IL-11, IL-12, IL-14, IL-15.IL-6 among the MSCs, IL-11, LIF, SCF, TPO all has expression at transcriptional level, but can detect IL-6 with the ELISA method, IL-11, LIF, the proteic expression of SCF but can not detect the proteic expression of TPO.If with the generation that the MSCs of TPO genetic modification comes the hematopoiesis support cell, the known or unknown cytokine hematopoiesis support of the collaborative MSCs excretory of TPO is generated; On the other hand, can avoid in the system of hematopoiesis support, adding in addition cytokine.Therefore, the bone marrow interstital stem cell of TPO genetic modification will become the thrombopoietic sustenticular cell of a kind of new promotion.
Summary of the invention
The object of the invention is with recombined gland relative virus mediated TPO gene, and people MSCs, the generation that comes the hematopoiesis support cell with the MSCs of TPO genetic modification are arrived in the TPO gene transfection.
The human marrow-interstitial stem cell of TPO genetic modification of the present invention is obtained the transfection of TPO gene mediated by recombinant adeno-associated virus to human marrow-interstitial stem cell.
The concrete preparation method of the human marrow-interstitial stem cell of TPO genetic modification of the present invention comprises following steps: (1) human cloning tire liver TPO gene, carrier construction plasmid pAAV-TPO-IRES-hrGFP (pAAV-TPO); (2) preparation rAAV-TPO virus vector; (3) culturing human bone marrow interstital stem cell; (4) human marrow-interstitial stem cell is arrived in the rAAV-TPO transfection.
Wherein, the TPO gene fragment in the step (1) is cut the back through EcoR I enzyme and is inserted pAAV-GFP; The plasmid pAAV-TPO-IRES-hrGFP that makes up synthesizes one section primer as sequencing primer: ATTCTGAGTCCAAGCTAGGC in β-globin intron sequence.In order to continue to detect the full length sequence of TPO gene, synthesize sequencing primer in the 480bp position and the 858bp position of TPO gene respectively, be respectively: 5 '-GCGTTTCCTGATGCTTGTAG-3 ', 5 '-CAACCTCCAGCCTGGATATT-3 '.
Step (2) adopts the coprecipitation of calcium phosphate method that pAAV-TPO, pAAV-RC, three kinds of plasmid cotransfections of pHelper are prepared the rAAV-TPO virus vector to HEK293.
Step (4) with the rAAV-TPO transfection to the process of human marrow-interstitial stem cell is: with people MSCs with 0.25% trypsinase/0.02%EDTA digestion after, with the washing of PBS damping fluid, counting cells is by 1 MSCs adding 10
5Particulate rAAV-TPO virus liquid mixing is cultivated.
The human marrow-interstitial stem cell of selecting for use in the step (4) is preferably the growth fusion and reaches 80%～90% the 3rd generation people MSCs.
The human marrow-interstitial stem cell of TPO genetic modification, and the human marrow-interstitial stem cell juice of TPO genetic modification can be used for being prepared into short thrombopoietic medicine, are used for treating thrombocytopenia.
The bone marrow interstital stem cell of TPO genetic modification will become the thrombopoietic sustenticular cell of a kind of new promotion.MSCs with the TPO genetic modification is prepared into short thrombopoietic medicine; Because it produces endogenous TPO through emiocytosis, is used to treat thrombopenia, therefore do not exist and inject people's spinoff that TPO occurred of recombinating; It can make the known or unknown cytokine hematopoiesis support of the collaborative MSCs excretory of TPO generate on the one hand; On the other hand, can avoid in the system of hematopoiesis support adding in addition cytokine, the simple end user of function ratio that its hematopoiesis support cell the generates TPO that recombinates is even better.
Description of drawings
Fig. 1: pAAV-TPO-IRES-GFP vector plasmid expression cassette synoptic diagram;
Fig. 2: the GFP gene with digoxigenin labeled is made probe, the dot blot figure of rAAV-TPO titre behind the detection purifying;
Fig. 3: the rAAV-TPO transfection HEK293 cell of different physics titres, the photo under 100 times of inverted fluorescence microscopes;
1. 10
2Particle/cell 4. 10
5Particle/cell
2. 10
3Particle/cell 5. 10
6Particle/cell
3. 10
4Particle/cell
Fig. 4: the external former photo of people MSCs under 200 times of inverted microscopes of being commissioned to train and supporting the 14th day;
Fig. 5: RT-PCR detects the electrophorogram that TPO mRNA expresses among the MSCs;
Fig. 6: Western blot detects the electrophorogram of TPO protein expression among the MSCs;
Embodiment
Specify practical implementation of the present invention below in conjunction with accompanying drawing:
(1) makes up pAAV-TPO-IRES-hrGFP: obtain total length TPO cDNA through the method for RT-PCR from people's tire liver total rna; With the MCS of TPO gene clone to the pAAV-IRES-hrGFP carrier; Thereby make up pAAV-TPO-IRES-hrGFP (pAAV-TPO), its structure is shown in accompanying drawing 1.
β in the pAAV-IRES-hrGFP plasmid-globin intron (beta-globin intron) sequence is positioned at the upper reaches in EcoRI site; The TPO gene fragment is cut the back through EcoR I enzyme and is inserted pAAV-GFP, so in β-globin intron sequence, synthesize one section primer as sequencing primer.The sequencing primer sequence is: ATTCTGAGTCCAAGCTAGGC.In order to continue to detect the full length sequence of TPO gene, synthesize sequencing primer in the 480bp position and the 858bp position of TPO gene respectively, be respectively: 5 '-GCGTTTCCTGATGCTTGTAG-3 ', 5 '-CAACCTCCAGCCTGGATATT-3 '.
(2) preparation rAAV-TPO virus vector: the HEK293 cell is pressed 3 * 10
4/ ware is cultivated and to be reached 80%～85% in about 48～60 hours and merge, adopt the coprecipitation of calcium phosphate method with pAAV-TPO, pAAV-RC, three kinds of plasmid cotransfections of pHelper to the HEK293 cell.Transfection mixed solution layoutprocedure is: pAAV-TPO, pAAV-RC, each 10 μ g/ ware of pHelper, the CaCl of 1.5mol/L
2, adding water to 20ml, mixing is formed the transfection mixed solution; Dropwise drip 2 * HEPES20ml again, fully mixing leaves standstill 5min, and white cloud appears in liquid to be mixed, the beginning transfection.Dropwise mixed solution is dropped in the HEK293 Tissue Culture Dish equably, the 2ml/ ware is seen uniform fine particle at 100 times microscopically.Continue to cultivate about 60～72 hours, microscopically is observed cell and tangible pathological change occurred.Cell is scraped from petridish, and centrifugal 10 minutes of room temperature 2000rpm abandons supernatant, and adding PBS damping fluid (pH7.4) is resuspended, and 2000rpm is centrifugal 10 minutes under the room temperature, abandons supernatant, separation and purification rAAV-TPO.
GFP through digoxigenin labeled is that the dot hybridization of probe is measured rAAV-TPO, and specific practice is: the pAAV-GFP plasmid of getting 2.5 μ g or 0.25 μ g is dissolved in the 100 μ l aseptic double-distilled waters, with 20 * SSC by 1: 2 two-fold dilution as standard; The rAAV-TPO virus 1 μ l or the 0.1 μ l that get behind the purifying are dissolved in the 100 μ l aseptic double-distilled waters, with 20 * SSC by point sample behind 1: 2 two-fold dilution on nylon membrane, with the GFP gene segment as probe hybridization.Through prehybridization, hybridize, wash film, colour developing back result is as shown in Figure 2.Physics titre through calculating rAAV-TPO is 1.2 * 10
12Particles/ml.
Adopt different pAAV-TPO physics titres (10 respectively
2Particle/cell, 10
3Particle/cell, 10
4Particle/cell, 10
5Particle/cell, 10
6Particle/cell) transfection HEK293 cell, the result is as shown in Figure 3, and 10
5Comparatively suitable concentration when particle/cell is the rAAV-TPO transfectional cell.
(3) culturing human bone marrow interstital stem cell: people's rib of getting the thoracic surgery excision is gone out medullary cell with the DMEM that contains 15% foetal calf serum (FCS), and the centrifugal 10min of 1500rpm abandons supernatant and lipid layer, and with the abundant mixing of DMEM, being added to density gently is 1.077 * 10
3On the lymphocyte separation medium of g/L, the centrifugal 30min of 2500rpm collects the mononuclearcell layer, DMEM washing 2 times.Collecting cell, the adjustment cell density is by 1 * 10
6Individual/cm
2The density inoculation, culture condition is the DMEM nutrient solution that contains 15%FCS, puts 37 ℃, 5%CO
2, cultivate (be former generation, be labeled as P0) under the saturated humidity condition.Full dose is changed liquid to remove not attached cell behind the 48h, and amount was changed liquid once in later per 3～4 days half.When treating that cell grows to about 80% degree of converging, wash twice, 37 ℃ with the PBS damping fluid of no calcium ions and magnesium ions and digest 3～5min with 0.25% trypsinase/0.02%EDTA down; Stop digestion with perfect medium, the centrifugal 5min of 1200rpm removes supernatant; Go down to posterity with 1: 3 ratio; In each generation, be designated as P1, P2, P3 successively ...Near converging, this moment, mostly cellular form was spindle shape, was similar to fibroblast-like cells (like Fig. 4) about former 14 days of being commissioned to train foster.
(4) with the rAAV-TPO transfection to human marrow-interstitial stem cell: getting growth and merging and reach 80%～90% the 3rd generation (P3) people bone marrow MSCs, after 0.25% trypsinase/0.02%EDTA digestion, washing 1 time counting cells with the PBS damping fluid.With 10
5The transfection ratio transfection of a particulate rAAV-TPO/1 MSCs.With the resuspended MSCs of DMEM of 100 μ l serum-frees, add the rAAV-TPO virus liquid of 100 μ l, behind the mixing, place 37 ℃, 5%CO
2Cultivated 2 hours in the incubator, whenever hang mixing 1 time at a distance from 15 minutes bullets.With PBS damping fluid washing 2 times, cell places the 100mm ware to cultivate again after the transfection.
RNA and the albumen of MSCs after extraction untransfected or the transfection, the method with RT-PCR and Westernblot detects the expression of TPO at mRNA and protein level respectively.The MSCs that detects untransfected with the RT-PCR method and rAAV mediate the expression of people TPO mRNA among the MSCs of TPO gene transfection.Result (as shown in Figure 5) shows, the expression amount of the expression amount of people TPO mRNA people TPO mRNA in the MSCs of untransfected among the MSCs of virus-mediated TPO gene transfection.The expression no significant difference of β-actin.Western blot result (as shown in Figure 6) shows that the TPO protein expression level obviously increases in MSCs and the tire liver-yang property control group of rAAV mediation TPO gene transfection.Yet, not detecting the TPO protein expression among the MSCs of untransfected, this maybe be extremely low relevant with TPO protein expression among the MSCs.
Claims (5)
1.TPO the human marrow-interstitial stem cell of genetic modification; It is characterized in that: said human marrow-interstitial stem cell is modified by recombined gland relative virus mediated TPO gene; The recombinant adeno-associated virus of this mediation TPO gene prepares through following method: obtain total length TPO cDNA from people's tire liver total rna through the method for RT-PCR; This total length TPO cDNA is cloned into the MCS of pAAV-IRES-hrGFP carrier, thus carrier construction plasmid pAAV-TPO-IRES-hrGFP; Adopt the coprecipitation of calcium phosphate method that pAAV-TPO-IRES-hrGFP, pAAV-RC, three kinds of plasmid cotransfections of pHelper are obtained recombinant adeno-associated virus rAAV-TPO to HEK293.
2. the preparation method of the human marrow-interstitial stem cell of TPO genetic modification as claimed in claim 1; It is characterized in that comprising successively following steps: (1) obtains total length TPO cDNA from people's tire liver total rna through the method for RT-PCR; This total length TPO cDNA is cloned into the MCS of pAAV-IRES-hrGFP carrier, thus carrier construction plasmid pAAV-TPO-IRES-hrGFP; (2) adopt the coprecipitation of calcium phosphate method that pAAV-TPO-IRES-hrGFP, pAAV-RC, three kinds of plasmid cotransfections of pHelper are prepared the rAAV-TPO virus vector to HEK293; (3) culturing human bone marrow interstital stem cell; (4) human marrow-interstitial stem cell is arrived in the rAAV-TPO transfection.
3. method as claimed in claim 2 is characterized in that said step (4) rAAV-TPO transfection to the process of human marrow-interstitial stem cell is: after people MSCs is digested with 0.25% trypsinase/0.02%EDTA, with the washing of PBS damping fluid, add 10 by 1 MSCs
5Particulate rAAV-TPO virus liquid mixing is cultivated.
4. method as claimed in claim 3 is characterized in that: said human marrow-interstitial stem cell reaches 80%～90% the 3rd generation people MSCs for the growth fusion.
5. the human marrow-interstitial stem cell of TPO genetic modification as claimed in claim 1 generates the purposes in the medicine at the short thrombocyte of preparation, it is characterized in that: human marrow-interstitial stem cell or its juice with TPO genetic modification as claimed in claim 1 are prepared into short thrombopoietic medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100343961A CN101240263B (en) | 2007-02-07 | 2007-02-07 | TPO gene modifying human marrow stroma stem cell and its preparation method and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100343961A CN101240263B (en) | 2007-02-07 | 2007-02-07 | TPO gene modifying human marrow stroma stem cell and its preparation method and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101240263A CN101240263A (en) | 2008-08-13 |
| CN101240263B true CN101240263B (en) | 2012-06-27 |
Family
ID=39932094
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100343961A Expired - Fee Related CN101240263B (en) | 2007-02-07 | 2007-02-07 | TPO gene modifying human marrow stroma stem cell and its preparation method and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101240263B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5591625A (en) * | 1993-11-24 | 1997-01-07 | Case Western Reserve University | Transduced mesenchymal stem cells |
| US6225119B1 (en) * | 1998-05-22 | 2001-05-01 | Osiris Therapeutics, Inc. | Production of megakaryocytes by the use of human mesenchymal stem cells |
-
2007
- 2007-02-07 CN CN2007100343961A patent/CN101240263B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5591625A (en) * | 1993-11-24 | 1997-01-07 | Case Western Reserve University | Transduced mesenchymal stem cells |
| US6225119B1 (en) * | 1998-05-22 | 2001-05-01 | Osiris Therapeutics, Inc. | Production of megakaryocytes by the use of human mesenchymal stem cells |
Non-Patent Citations (3)
| Title |
|---|
| US 5591625 A,说明书第4栏第60行-第6栏第41行. |
| 黄云剑等.Smad 6和Smad 7基因腺相关病毒载体的构建及其表达.细胞与分子免疫学杂志20 3.2004,20(3),274-277. |
| 黄云剑等.Smad 6和Smad 7基因腺相关病毒载体的构建及其表达.细胞与分子免疫学杂志20 3.2004,20(3),274-277. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101240263A (en) | 2008-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bosch et al. | Osteoprogenitor cells within skeletal muscle | |
| Zhang et al. | Novel chitosan/collagen scaffold containing transforming growth factor-β1 DNA for periodontal tissue engineering | |
| Tsigkou et al. | Engineered vascularized bone grafts | |
| CN101735981B (en) | Process for producing cytotoxic lymphocyte | |
| Lo et al. | Enhanced critical-size calvarial bone healing by ASCs engineered with Cre/loxP-based hybrid baculovirus | |
| CN101348786B (en) | Human beta-globin gene and recombinant adenovirus related virus vector thereof | |
| JP2003521877A (en) | Apparatus and methods for producing and using high density cells and products therefrom | |
| BR112012002151A2 (en) | METHODS FOR EXPRESSING A DISINTEGRIN AND METALLOPROTEINASE WITH THOMBOSPONDINE MOTIF PROTEIN, TO PRODUCE A COMPOSITION OF DISINTEGRIN AND METALOPROTEINASE WITH THOMBOSPONDINE MOTIVE PROTEIN, TO PRODUCE A COMPOSITION OF MOTIN AND METHODOPHINES WITH THROMBOSPONDINE MOTIF PROTEIN. | |
| CN111500578B (en) | Regulating ADSCs osteogenic differentiation and tissue regeneration circRNA-FTO and application thereof | |
| CN101285053A (en) | Process for coculturing cord blood hematopoietic stem cells and mesenchymal stem cells in dynamic suspending condition | |
| CN100567482C (en) | The Chinese hamster ovary celI strain and the establishment method thereof of highly effective expressing rhBMP 2 | |
| CN101580817A (en) | Method for preparing cell group containing cytokine-induced killing cell | |
| CN103237885A (en) | Compositions and methods for cell homing and adipogenesis | |
| EA012520B1 (en) | Process for producing cytotoxic lymphocytes | |
| Wu et al. | Assessment of polyglycolic acid scaffolds for periodontal ligament regeneration | |
| CN111139222B (en) | Recombinant mesenchymal stem cell and preparation method and application thereof | |
| CN109402062A (en) | Application of the ZIP1 gene in the product that preparation inhibits apoptosis of mesenchymal stem cell | |
| CN109504710B (en) | Application of KDM4D | |
| CN101240263B (en) | TPO gene modifying human marrow stroma stem cell and its preparation method and use | |
| Chen et al. | Bone Morphogenetic Protein-2 regulates in vitro osteogenic differentiation of mouse adipose derived stem cells | |
| CN101591657B (en) | Thymosin beta4 gene expression inhibiting RNA and use thereof | |
| CN106065401B (en) | Treatment use of the lentivirus mediated CXCR7 high expression engineering endothelial progenitor cells in ischemic disease | |
| CN104450781B (en) | A kind of cell line of overexpression CIAPIN1 albumen and its preparation method and application | |
| CN104774874B (en) | A kind of construction method of pilose antler bioreactor | |
| CN104174064B (en) | Tissue-engineered bone of genetic modification and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120627 Termination date: 20180207 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |