CA2658224A1 - Detection of nucleic acids by multiple sequential invasive cleavages - Google Patents

Abstract

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner.
The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge.
The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

Description

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.

CECI EST LE TOME DE _2 NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.

JUMBO APPLICATIONS / PATENTS

THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.

THIS IS VOLUME OF _2 NOTE: For additional volumes please contact the Canadian Patent Office.

DETECTION OF NUCLEIC ACIDS BY
MULTIPLE SEQUENTIAL INVASIVE CLEAVAGES
This application is a divisional of Serial No. 2,284,552, filed March 24, 1998.
FIELD OF THE INVENTION

The present invention relates to means for the detection and characterization of nucleic acid sequences and variations in nucleic acid sequences. The present invention relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage stiructure in a site4peeific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the targiardependent cleavage structure, thereby indicating the presence of specific nucleie acid sequences or specific variations thereof.
The present invention further provides novel methods-and devices for the separation of nucleic acid molecules based by charge. The present invention further provides methods for the -detection of:non-target cleavage products via the formation of a complete and activated protein binding region.

.BACKGROUND OF THE INVENTION
The detection and characterization of specific nucleic acid sequences~and sequence variations has been utilized to. detect the. presence af. viral or bacterial nucleicsiacid sequences :4*dtqative,,of,-an i.nfection, the presence of variants, o;r4lleles of mammalian - genes associated with:disease and cancers and the identification of =thet.source of nucleic acids found in forensic .samples, as well as in paternity determitiations.
Various methods are known ta the art which may- be used to detect and characterize specific nucleic acid sequences and sequence variants. Nonetheless, as nucleic.` acid sequence data of, the human genome, as well as the genomes of pathogenic organisms accumulates, the demand for fast, reliable, cost-effective and user-friendly tests for the detection of specific nucleic acid sequences continues to grow. Importantly, these tests must be able to create a detectable signal from samples which contain very few copies of the sequence of interest.
The following discussion examines two levels of nucleic acid detection assays currently in use: I. Signal Amplification Technology for detection of rare sequences; and II. Direct Detection Technology for quantitative detection of sequences.

74b67-130 I. Signal Amplification Technology Metbods For. Amplification The "Polymerase Chain Reaction" (PCR) comprises the first generation of methods for nucleic acid amplification. However, several other methods have been developed. that employ the same basis of specificity, but create signal by different amplification mechanisms. These S methods include the "Ligase Chain Reaction" (LCR), "Self-Sustained Synthetic Reaction"
(3SR/NASBA), and "Q(3-Replicase" (Q(3).

Polymerase Chain Reaction (PCR) The polymerase chain reaction (PCR), as described in U.S. Patent Nos.
4,683,195 and 4,683,202 to Mullis and Mullis. et al. , describe a method for increasing the concentration of a segment of target sequence in a mixture of genomic DNA without cloning or purification. This technology prqvides one approach to the problems of low target sequence concentration. PCR can be used to directly increase the concentration of the target to an easily detectable level. This process for amplifying the target sequence involves introducing a molar excess of two oligonucleotide primers which are complementary to their respective strands of the double-stranded target sequence to the DNA mixture containing the desired target sequence. The mixture is denatured and then allowed to hybridiu. Following hybridization,.the primers are extended with polymerase so as to form complementary strands. The steps of denaturation, hybridization, and polymerase extension can be repeated as often as needed, in'order to obtain relatively high concentrations of a segment of the desiredtarget sequence.
The length of the segment of the desired target;sequence is determined by the relative positions of the primers with respect to each other, and,,* therefore, this length is a controllable parameter. Because the desired segments of the target sequence become the dominant sequences (in terms of concentration) in the mixture, they are said to be "PCR
amplified."
Ligase Cbain Reaction (LCR or LAR) The ligase chain reaction (LCR; sometimes referred to as "Ligase Amplification Reaction" (LAR) described by Barany, Proc. Natl. Acad. Sci., 88:189 (1991);
Barany, PCR
Methods and Applic., 1:5 (1991);-and Wu and Wallace , Genomics 4:560 (1989) has developed into a well-recognized alternative method for amplifying nucleic acids. In LCR, four oligonucleotides, two adjacent oligonucleotides which uniquely hybridize to one strand of target DNA, and a complementary set of adjacent oligonueleotides, which hybridize to the 3 PC1'/US98/05809 opposite strand are mixed and DNA ligase is added to the mixture. Provided that there is complete complementarity at the junction, ligase will covalently link each set of hybridized molecules. Importantly, in LCR, two probes are ligated together only when they base-pair with sequences in the target sample, without gaps or mismatches. Repeated cycles of denaturation, hybridization and ligation amplify a short segment of DNA. LCR
has also been used in combination with PCR to achieve enhanced detection of single-base changes. Segev, PCT Public. No. W09001069 Al (1990). However, because the four oligonucleotides used in this assay can pair to form two short ligatable fragments, there is the potential for the generation of target-independent background signal. The use of LCR for mutant screening is limited to the examination of specific, nucleic acid positions.

Self-Sustained Synthetic Reaction (3SR/NASBA) The self-sustained sequence replication reaction (3SR) (Guatelli et al., Proc.
Nati.
Acad. Sci., 87:1874-1878 [1990], with an erratum at Proc. Natl. Aead. Sci., 87:7797 [1990]) is a transcription-based in vitro amplification system (Kwok et al., Proc.
Natl. Acad. Sci., 86:1.173-1177 [1989]) that ean-exponentially anaplify'RNA sequences at a uniform temperature. The amplified RNA can then be utilized for mutation detection (Fahy et al., PCR Meth. Appi., -1;25-33 ~[1991]). In this method, an oligonucleotide primer.is used to add a phage RNA polymerase promoter to the 5' end of the sequence of interest. In a cocktail of enzymes and substrates that includes a second primer, reverse transcriptaSe, RNase H, RNA
polymerase and ribo-and deoxyribonucieoside triphosphates, the target sequence undergoes repeated rounds of transcription, cDNA synthesis and second-strand synthesis to amplify the area of interest. The use of 3SR to detect mutations is kinetically. limited to screening small segments of DNA (e.g., 200-300 base pairs).
Q-Beta (Q6) Replicase In this method, a probe which recognizes the sequence of interest is attached to the replicatable RNA template for Q(3 replicase. A previously identified major problem with false positives resulting from the replication of unhybridized probes has been addressed through use of a sequence-specific ligation step. However, available thermostable DNA
ligases are not effective on this RNA substrate, so the ligation must be performed by T4 DNA ligase at low temperatures (37 C). This prevents the use of high temperature as a means of achieving specificity as in the LCR, the ligation event can be used to detect a mutation at the junction site, but not elsewhere.
Table 1 below, lists some of the features desirable for systems useful in sensitive nucleic acid diagnostics, and summarizes the abilities of each of the major amplification =
methods (See also, Landgren, Trends in Genetics 9:199 [1993]):
A successful diagnostic method must be very specific. A straight-forward method of controlling the specificity of nucleic acid hybridization is by controlling the temperature of the reaction. While the 3SR/NASBA, and Q(3 systems are all able to generate a large quantity of signal, one or more of the : enzymes involved - in each cannot be used at high temperature (i.e., >55 C). Therefore the reaction temperatures cannot be raised to prevent non-specific hybridization of the probes. If probes are shortened in order to make them melt more easily at low temperatures, the likelihood of-having more than one perfect match in a complex genome increases. For these reasons, PCR and LCR currently dominate the research field in detection technologies.

Festar.e Mttho:d PCR LCR PCR & :, . 3SR Qa :NASgA

Amplifies Target + - + +
Recognition of Independent +
Sequences Required Performed at High Temp. + +
Operates at Fixed Tetap. + +
Exponential Amplification + + + + +
Generic Signal Generation +
Easily Automatable The basis of the amplification procedure in the PCR and LCR is the fact that the products of one cycle become usable templates in all subsequent cycles, consequently doubling the population with each cycle. The final yield of any 'such doubling systeni can be expressed as: (1+X)" = y, where "X" is the mean efficiency (percent copied in-each cycle), "n" is the number of cycles, and ;"y" is the overall efficiency, or- yield of the reaction (Mullis, PCR Methods Applic., 1:1 [ 1991 ]): If every copy of a target DNA. is utilized as a ternplate =-in every cycle of a polymerase chain reaction, then the mean efficiency is 100%. If 20 cycles of PCR are performed, then the yield will be 220, or -1,048,576 copies of the starting material.
If the reaction conditions reduce the mean efficiency to 85%, then the yield in those 20 cycles will be only 1.8520, or 220,513 copies of the starting material. In other words, a PCR running at 85% efficiency will yield only 21% as much final product, compared to a reaction running at 100% efficiency. A reaction that is reduced to 50% mean efficiency will yield less than 1% of the possible product.
In practice, routine polymerase chain reactions rarely achieve the theoretical maximum yield, and PCRs are usually run for more than 20 cycles to compensate for the lower yield.
At 50% mean efficiency, it would take 34 cycles. to achieve the million-fold amplification theoretically possible in 20, and at lower efficiencies, the number of cycles required becomes prohibitive. In addition, any background products that amplify with a better mean efficiency than the intended target will become the dominant products:
Also, many variables can influence the mean efficiency of PCR, including target DNA
length and secondary structure, primer length and design, primer and dNTP
concentrations, and buffer composition, to name but a few. : Contamination,of the reaction withexogenous DNA (e.g.,; DNA spilled onto lab surfaces) or cross=contamination is also a maJor consideration. Reaction conditions must be carefully optimized for each different primer pair and target sequence, and the process can take days, even for an experienced investigator. The laboriousness of this process, including numerous technical considerations and other factors, presents a significant drawback to using PCR in the clinical setting. Indeed, PER has yet to penetrate the clinical market in a significant way. The same concerns arise with LCR, as LCR must also be optimized to use different oligonucleotide sequences for each target sequence. In addition, both methods require expensive equipment, capable of precise temperature cycling.
Many applications of nucle'tc acid detection technologies, such as in studies of allelic variation, involve not only detection of a specific sequence in a complex background, but also the discrimination between sequences with few, or single, nucleotide differences. One method for the detection of allele-specific variants by PCR is based upon the fact that it is difficult for Taq polymerase to synthesize a DNA strand when there is a mismatch between the template strand and the 3' end of the primer. An allele-specific variant may be detected by the use of a primer that is perfectly matched with only one of the possible alleles; the mismatch to the other allele acts to prevent the extension of the primer, thereby preventing the amplification of that sequence. This method has a substantial limitation in that the base composition of the mismatch influences the ability to prevent extension across the mismatch, and certain mismatches do not prevent extension or have only a minimal effect (Kwok et al., Nucl. Acids Res., 18:999 [1990]).) A similar 3'-mismatch strategy is used with greater effect to prevent ligation in the =
LCR (Barany, PCR Meth. Applic., 1:5 [1991]). Any mismatch effectively blocks the action of the thermostable ligase, but LCR still has the drawback of target-independent background ligation products initiating the amplification.
Moreover, the combination of PCR with subsequent LCR to identify the nucleotides at individual positions is also a clearly cumbersome proposition for the clinical laboratory.
II. Direct Detection Technology When a sufficient amount of a nucleic acid to be detected is available, there are advantages to detecting that sequence directly, instead of making more copies of that target, (e.g., as in PCR and LCR). Most notably, a method that does not amplify the sfgiial exponentially is more amenable ,to quantitative analysis. Even if the 'signal is enh'anced by attaching multiple dyes to a, single oligonucleotide, the correlation between the. final tignal intensity and amount of target is. direct. Such a system has an additional advantagethat the products of the reaction will not themselves promote further reaction, so con'tamination of lab surfaces by the products is. not as-tnuch of a concern. Traditional methods of direct detection including Northern and Southern blotting and RNase protection assays -usually requi'rethe use of radioactivity and are not amenable to automation. Recently devised techniques tiave sought to eliminate the use of radioactivity. and/Qr improve the serisitivity'in automatable formats. Two examples are the "Cycling Probe Reaction" (CPR), and ="Branched DNA"
(bDNA) The cycling probe reaction (CPR) (Duck et al., BioTech., 9:142`[1990]), uses a long chimeric oligonucleotide in which a central portion is made of RNA while the two termini are made of DNA. Hybridization of the probe to a target DNA and exposure to~
athermostable RNase H causes the RNA portion to be digested. This destabilizes the remaining DNA
portions of the duplex, releasing the remainder of the probe from the target DNA and allowing another probe molecule to repeat the process. The signal, in the form of-cleaved _ probe molecules, accumulates;at a linear rate. While the repeating process increases the ~
signal, the RNA portion of the oligonucleotide is vulnerable to RNases that may becarried --through sample preparation.

--~ .
~~ = ~

Branched DNA (bDNA), described by Urdea el al., Gene 61:253-264 (1987), involves oligonucleotides with branched structures that allow each individual oligonucleotide to carry 35 to 40 labels (e.g., alkaline phosphatase enzymes). While this enhances the signal from a hybridization event, signal from non-specific binding is similarly increased.
While both of these methods have the advantages of direct detection discussed above, neither the CPR or bDNA methods can make use of the specificity allowed by the requirement of independent recognition by two or more probe (oligonucleotide) sequences, as is common in the signal amplification methods described in Section I. above.
The requirement that two oligonucleotides must hybridize to a target nucleic acid in order for a detectable signal to be generated confers an extra measure of stringency on any detection assay. Requiring two oligonucleotides to bind to a target nucleic acid reduces the chance that false "positive" results will be produced due to the non-specific binding of a probe to the target. The further requirement that the two oligonucleotides must bind ina specific orientation relative to the target,as is required in PCR, where oligonucleotides -must be oppo.sitely but appropriately oriented such that the DNA polymerase can -bridge the"gap between the two oligonucleotides in both directions, _furrher enhances specificity of the detection reaction. However, it is well known to those in the art that even though PCR
utilizes two oligonucleotide probes (termed primers): "non-specific"
amplification (i.e:, amplification of sequences not directed by the two primers used) -is a commorr artifact: This :is in part because the DNA polymerase used in PCR can accommodate very large distances, measured in nucleotides, between the oligonucleotides and thus there is a large window in which non-specific binding of an oligonucleotide can lead to -exponen'tial amplification of inappropriate product. The LCR, in contrast, cannot proceed unless the oligonucleotides used are bound to the target adjacent to each other and so the full benefit of the dual oligonucleotide hybridization is realized.
An ideal direct detection method would combine the advantages of the direct detection assays (e.g., easy quantification and minimal risk of carry-over contamination) with the specificity provided by a dual oligonucleotide hybridization assay.

SUMMARY OF THE INVENTION
The present invention relates to means for cleaving a nucleic acid cleavage structure in a site-specific manner. In a preferred embodiment, the means for cleaving is a structure-specific nuclease. Particularly preferred structure-specific nucleases are therniostable structure-specific nucleases. In one embodiment, the structure-specific nuclease is an enzyme comprising 5' nucleases derived from thermostable DNA polymerases. These polymerases form the basis of a novel method of detection of specific nucleic acid sequences. The present invention contemplates use of novel detection methods for various uses, including, but not =, limited to clinical diagnostic purposes. -r.
In one embodiment, the present invention contemplates a DNA sequence encoding a DNA polymerase altered in sequence (Le., a "mutant" DNA polymerase) relative 'to the native sequence, such that it exhibits altered DNA synthetic activity from that of the native (i. e. , "wild type") DNA polymerase. It is preferred that the encoded DNA polymerase is altered such that it exhibits reduced synthetic activity compared to that of the native DNA
polymerase. In this manner, the enzymes of the invention are predominantly 5' nucleases and are capable of cleaving nucleie acids in. a structure-specific manner in the absence of interfering synthetic activity.
Importantly, the 5' nucleases of.the~present invention are capable of cleaving linear duplex structures=to create.single discrete cleavage products. These 'linear stiucturts are either 1) not cleaved by the wild type enzycnes (to any significant degree), vr 2) are cleaved~ by the wiid type enzymes so as to create multiple produets. This characteristio of the 5'''nudiases has been found to be a consistent: property of enzymes derived. in this manner from thermostable polymerases across-eubacterial'thertnophilic species.
It is not intended that-the. invention be Iirnited by the nature:of the alteration necessary to render the polymerase synthesisideficient: Nor is it intended'fhat the invention belimited by the extent of the deficiency. The present -invention contemplates various structutes;
ary, secondary; etc.), as well as native structures, that may including altered structures (prun ' ' be inhibited by synthesis inhibitors:
Where the polymerase structure is altered, it is not intended that the invention be limited by the means by which the .structure is altered. In one embodiment, the alteration of the native DNA sequence comprises a:change in a single nucleotide. In another, embodiment, the alteration of the native DNA sequence comprises a deletion of one or more nucieotides.
In yet another embodiment, the alteration of the native DNA sequence comprises an insertion of one or more nucleotides. It is contemplated that the +change in DNA
sequence may _ manifest itself as change in amino acid sequence.

The present invention contemplates strueture-specific nucleases from a variety of sources, including mesophilic, psychrophilic, thermophilic, and hyperthermophilic organisms.

The preferred structure-specific nucleases are thermostable. Thermostable structure-specifie nucleases are contemplated as particularly useful in that they operate at temperatures where nucleic acid hybridization is extremely specific, allowing for allele-specific detection (including single-base mismatches). In one embodiment, the thermostable structure-specific are thermostable 5' nucleases which are selected from the group consisting of altered polymerases derived from the native polymerases of Thermus species, including, but not limited to Thermus aquaticus, Thermus, flavus, and Thermus thermophilus.
However, the invention is not limited to the use of thermostable 5' nucleases.
Thermost.able structure-specifie nucleases from the FEN-1, RAD2 and XPG class of nucleases are also preferred.
Accordingly, the present invention provides improved enzymatic cleavage means.
In one embod'unent, the present invention provides a thermostable structure-specific nuclease having an amino acid sequence selected from the group consisting of SEQ ID
NOS:61, 66, 69 and 72. In another embodiment, the nuclease is encoded by a DNA sequence selected from the group consisting of SEQ ID NO:60, 65, 68 and 70.
As noted above, the present invention contemplates the use of structure-specifie nucleases in a detection method. ..In one embodiment, the present invention provides' a method of detecting the presence of a target nucleic acid molecule compTising:
a) providing:
i) a cleavage means; ii) a source of a first target nucleic acid, the first target nucleic acid having a first region, a second region and a third region, wherein the first iegion is located adjacent to and downstream from the second region and-wherein the second region is located adjacent to and downstream from the third region; iii) a first oligonucleotide having a 5' and a 3' portion wherein the 5' portion of the first oligonucleotide contains a sequence complementary to (at least a portion of) the second region of the fnst target nucleic acid and wherein the 3' portion of the first.oligonucleotide contains a sequence complementary to at least a portion of the third region of the first target nucleic acid; iv) a second oligonucleotide having a 5' and a 3' portion wherein the 5' portion of the second oligonucleotide contains a sequence complementary to at least a portion of the first region of the first target nucleic acid and wherein the 3' portion of the second oligonucleotide contains a sequence complementary to at least a portion of the second region of the first target nucleic acid;
v) a source of a second target nucleic acid, the second taiget nucleic acid having a first region, a second region and a third region, wherein the first region is located adjacent to and downstream from the second region and wherein the second region is located adjacent to and downstream from the third region; vi) a third oligonucleotide having a 5' and a 3' portion wherein the 5' ,.... -portion of the third oligonucleotide contains a sequence complementary to at least a portion of the second region of the second target nucleic acid and wherein the 3' portion of the third oligonucleotide contains a sequence complementary to at least a portion of the third region of the second target nucleic acid; b) generating a first cleavage structure wherein at least the 3' =
portion of the first oligonucleotide is annealed to the first target nucleic acid and wherein at least the 5' portion of the second oligonucleotide is annealed to the first target nucleic acid and. wherein cleavage of the first cleavage structure occurs via the cleavage means thereby cleaving the first oligonucleotide to generate a fourth oligonucleotide, the fourth oligonucleotide having a 5' and a 3' portion wherein the 5' pordon of the fourth oligonucleotide contains a sequence complementary to at least a portion of the first region of the second target nucleic acid and wherein the 3' portion of the fourth oligonucleotide contains a sequence complementary to at least a portion of the second region of the second target nucleic acid; c) generating a second cleavage structure under conditions wlierein the at least the 3' portion of the third oligonucleotide is annealed to the second target nucleic acid and wherein at least.t10' ;portion of:.:the fourth:oligonucleotide is annealed to the second target nucleic; acid- oligonucleotide and wherein cleavage uf the secoud' cleavage"structure occurs to generate a fifth oligonucleotide, the fifth oligonucleotide having a 3'-hydroxyl group; and d) detecting the fifth oligonucleotide.
It is contemplated that the first, second and third regions of the target nucleic acids be located adjacent to each other. However, the invention is not limited -to the use of a target in which the three regions are contiguous with each other. Thus, the present invention contemplates the use of target nucleic acids wherein these three regions are contiguous with each other, as well. as target acids wherein these three regions are not contiguous. It is further contemplated that gaps of approximately 2-10 nucleotides, representing regions of non-complementarity to the oligonucleotides (e.g., the first and/or second oligonucleotides), may be present between the three regions of the target nucleic acid.
The methods of the present invention are not limited by the size of the oligonucleotides employed. In a preferred embodiment; the first oligonucleotide has a length between eleven and fifteen nucleotides.
It is intended that the generation of the f rst and - second cleavage structures and cleavage of these structures occurs under a variety of conditions. In a preferred format, the conditions of generating the cleavage structures comprises mixing together the target nucleic .-acids with the first, second and third oligonucleotides and the cleavage means in an aqueous f,.
solution in which a source of divalent cations is lacking. In this format, the cleavage reaction is initiated by the addition of a solution containing Mn' or MgZ' ions. In another preferred format, the conditions of mixing comprises mixing together the target nucleic acid, and the first, second and third oligonucleotides in an aqueous solution containing Mn2' or Mg2+ ions, and then adding the cleavage means to the reaction mixture.
It is contemplated that the oligonucleotides may be labelled. Thus, if the cleavage reaction employs a third oligonucleotide containing a label, detection of the cleavage product of the third oligonucleotide (i.e., the fifth oligonucleotide) may comprise detection of the label. The invention is not limited by the nature of the label chosen, including, but not limited to, labels which comprise a dye or a radionucleotide (e.g., 32P), fluorescein moiety, a - biotin moiety, luminogenic, fluorogenic, phosphorescent, or fluors in combination with moieties that can suppress emission by fluorescence energy transfer (FET).
Numerous methcxls.are available for the. detection of nucleic acids containing any of the above-listed labels. For example, biotin-labeled oligonucleotide(s) may be detected using non=isotopic detection methods which employ streptavidin-alkaline phosphatase- con}ugates.
" Fluorescein-labelled oligonucleotide(s) may be detected using a'fluorescein=imager.
Further -the'"
oligonucleotide and particularly the probe oligonucleotides may contain positively charged adducts (e.g., the Cy3 and Cy5 dyes; the dyes shown in' Fig. 66, etc.) and/or' positiveiy~
charged amino acids and/or a phosphonate backbone to` permit the detection of the fifth oligonucleotide (i.e., the non-target cleavage product generated by cleavage of'the second [or terminal if more than two reactions are employed in the cascade] cleavage structure) by selective charge reversal as described herein (See, section IV of the Description of the Invention). The oligonucleotides may be labelled with different labels (e.g., the first and the third oligonucleotides may each bear a different label).
It is also, contemplated that labelled oligonucleotides (cleaved or uncleaved) may be separated by means other than electrophoresis. For example, biotin-labelled oligonucleotides may be separated from nucleic acid present in the reaction mixture using para-magnetic or magnetic beads, or particles which are coated with avidin (or streptavidin).
In this manner, the biotinylated oligonucleotide/avidin-magnetic bead complex can be physically separated from the other components in the-mixture by exposing'the' complexes to a magnetic field.
Additionally, the signal from the cleaved oligonucleotides may be resolved from that of the uncleaved oligonucleotides without physical separation. For example, a change in` size, and therefore rate of rotation in solution of fluorescent molecules can be detected by fluorescence polarization analysis.
In a preferred embodiment, the reaction conditions comprise a cleavage reaction temperature which is less than the melting temperature of the first oligonucleotide and greater =
than the melting temperature of the 3' portion of the first oligonucleotide.
In a particularly {
preferred embodiment, the reaction temperature is between approximately 40-75 C; in another embodiment the reaction temperature is between approximately 40-60 C.
It is contemplated that the reaction temperature at which the cleavage reaction occurs be selected with regard to the guidelines provided in. the Description of the Invention.
The method of the present invention is not limited by the nature of the target nucleic acid. The target nucleic acid may comprise single-stranded or double-stranded DNA; RNA, and/or DNA/RNA hybrids. When a double-stranded target nucleic acid is employed, the reaction mixture may be treated such that the aid double-strandcd DNA is rendc:red substantially single-stranded. . A preferred methodfor rendering double-stranded DNA
substantially single-strand.ed.Js.by the use.of increased temperature: When target-nucleic acids comprising RNA are employed, the oligonucleotides may comprise DNA, RNA
or an oligonucleotide comprising a mixture,of RNA and DNA. . it is not intended that the invention be limited by the nature of the oligonucleotides employed.
The oligonucleotides "may.- comprise DNA, RNA or an oligonucleotide comprising a mixture of RNA and DNA. Tlie, invention also contemplates the use of a second oligonucleotide (i.e., the upstream :oligonucleotide in the first cleavage structure) which' comprises afpnctional .group (e.g., a 5': peptide region) which prevents the dissociation= of the 5' portion of the second oligonucleotide from the first region of the target nucleic acid.
When such a functional group is present on the second oligonucleotide, the interaction between the 3' portion of the second oligonucleotide and the first region of the target nucleic acid may be destabilized (i.e., designed to have.a lower local melting temperature) through the use of A-T rich sequences, base analogs that form fewer hydrogen bonds (e.g:, dG-dU
pairs) or through the use of phosphorothioate backbones, in order to allow the 5'--region of the first oligo.nucleotide to compete successfully for hybridization. 30 The invention is not limited to use of oligonucleotides which are completely, =
complementary to their cognatetarget sequences. In one embodiment, both the first and second oligonucleotides are completely complementary to the firsttarget nucleic acid: -' "In .-another embodiment, the first oligonucleotide is partially complementary to the first target WO 98/42873 PCT/US98/05809 nucleic acid. In yet another embodiment, the second oligonucleotide is partially complementary to the first target nucleic acid. In yet another embodiment, both the first and the second oligonucleotide are partially complementary to the first target nucleic acid.
Likewise, the third and fourth oligonucleotides may be either completely or partially complementary to the second target nucleic acid.
The methods of the invention may employ a source of target nucleic acid which comprises a sample containing genomic DNA. In a preferred embodiment, the sample containing genomic DNA is selected from the group including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
In a preferred embodiment, the method: employs reaction conditions which comprise providing a source of divalent cations. In a' particularly preferred embodiment, the' divalent cation is selected from the group comprising MnZ+ and Mg" ions.
The invention is not limited by the nature of the cleavage means. As discussed above, the invention contemplates that the cleavage means comprises a thermostable 5' nudlease, although the invention is not limited.to the use. of a,thermostable 5' nuclease. Wherr a thermostable 5': nuclease is employed, a portion of the+amino acid=sequence of the fi~
may. be homologous to a portion of the amino acid sequence of a thermostable DNA
polymerase. derived from a, thermophilic organism.. .-P.articularly preferredcleavage'means are structure-specific nucleases, with thermostable structure-.specific nucleases being most preferred. In a preferred embodiment, the thermostable structure-specific nuclease is `
encoded by a DNA sequence selected from thegroup consisting of SEQ ID NOS:1-3, 9, 10, 12, 21, 25, 26, 60, 65, 68, 70, 74, and 78. In another:.preferred- embodiment, the thermostable structure-specific nuclease is a nuclease from the FEN-1/RAD2/XPG
class of nucleases. A preferred thermostable structure-specific nuclease is,the Pyrococcus woesii FEN-1 endonuclease.
In another preferred embodiment, one or more of the first, second, and third oligonucleotides contain a dideoxynucleotide at the 3' terminus. When dideoxynucleotide-containing oligonucleotides are employed, the. detectionof the fifth oligonucleotide preferably comprises: a) incubating the fifth oligonucleotide with a template-independent polymerase and at.least one labelled nucleoside triphosphate under conditions such that at least one labelled nucleotide is added to the 3'-hydroxyl group of the fifth oligonucleotide to generate a labelled fifth oligonucleotide; and b), detecting the-presenee of the labelled fifth oligonucleotide. The invention is not limited by the nature of the template-independent - --_=, polymerase employed; in one embodiment, the template-independent polymerase is selected from the group consisting of terminal deoxynucleotidyl transferase (TdT) and poly A
polymerase. When TdT or polyA polymerase are employed in the detection step, the third oligonucleotide may contain a 5' end label, the 5' end label being a different label than the label present upon the labelled nucleoside triphosphate. The invention is not limited by the nature of the 5' end label; a wide variety of suitable 5' end labels are known to the art and -.
include biotin, fluorescein, tetrachiorofluorescein, hexachlorofluorescein, Cy3, Cy5 and digoxigenin.
In another embodiment, detecting the fifth oligonucleotide comprises: a) incubating the fifth oligonucleotide with a template-independent polymerase and at least one nucleoside triphosphate under conditions such that at least one nucleotide is'=added to the 3'-hydroxyl group of the fifth oligonucleotide to. generate a tailed fifth oligonucleotide; and b)detecting the presence of the tailed fifth oligonucleotide. The invention is not limited by the nature of the template-independent polymerase employed; in one embodiment, the teinplate-independent polymerase is selected from the group :consisting of terminal deoxynucleotidyl` transferase (TdT) and poly. A polymerase..,- When -TdT or polyA -polymerase are remployed'in the"
detection step, the second oligonucleotide may contain a 5' end label. The invention' is not limited by the nature of the 5' : end label; a wide variety of suitable 5' end iabelsate Tcnown to the art and include biotin, fluorescein, tetrachiorofluorescein, hexachlorofluoresceiii,Cy3, Cy5 and digoxigenin.
- The invention further provides a method of detecting the fifth oligonucleotide (i.e., the non-target cleavage product generated by cleavage of the second cleavage stnicture) -comprising: a) providing: i) the fifth oligonucleotide; ii) a composition comprising tvvo single-stranded nucleic acids annealed so= as to defme a single-stranded portion of a protein binding region; iii) a nucleic acid producing protein; b) exposing the fifth oligonucleotide to the single-stranded portion of the protein binding region under conditions such `that the nucleic acid producing protein binds to the protein binding region and produces nucleic acid.
In a preferred embodiment, the single-stranded portion of the protein binding region comprises: a) a first single continuous strand of-nucleic acid comprising a sequence defining the template strand of an RNA polymerase binding region; and b) a second single continuous strand of nucleic acid having a 5': and a 3' end, the second nucleic acid eomprising "a region complementary to a portion of the- first nucleio acid, wherein the second nucleic acid is = ~ .
. . ~~_ ` F . . .

annealed to the first nucleic acid so as to define the single-stranded portion of the protein binding region.
The invention is not limited by the nature of the protein binding region employed. In a preferred embodiment, the protein binding region is a template-dependent RNA
polymerase binding region, more preferably a T7 RNA polymerase binding region.
The invention further provides a method of detecting the fifth oligonucleotide comprising: a) providing: i) the fifth oligonucleotide; ii) a single continuous strand of nucleic acid comprising a sequence defining a single strand of an RNA
polymerase.binding region; iii) a template-dependent DNA polymerase; iv) a template-dependent RNA
polymerase; b) exposing the fifth oligonucleotide to the RNA polymerase binding region under conditions such that the fifth oligonucleotide binds to a portion of the single strand of the RNA polymerase binding region; c) exposing the bound fifth oligonucleotide to the template-dependent DNA polymerase under conditions such that a double-stranded RNA
polymerase binding region is produced; and d) exposing the double-stranded RNA
~ ~ `
polymerase binding region to the template-dependent RNA polymerase under conditions such that RNA transcripts are produced. In a-preferred embodiment, the: method further- comprises detecting the RNA transcripts.
The invention is not limitedby the nature of the=protein binding region employed. In a preferred embodiment, the protein binding region is a template-dependent RNA
polymerase binding region, more preferably a T7 RNA polymerase binding region.
The present invention also provides a method of detecting the presence of a target nucleic acid molecule comprising: a) providing: i) a cleavage means, ii) a source of a first target nucleic acid, the first target nucleic acid having a first region, a second region, a third region and a fourth region, wherein the first region is located adjacent to and downstream from the second region, the second region is located adjacent to and downstream from the third region and the third region is located adjacent to and downstream from the fourth region; iii) a first oligonucleotide complementaryto (at least a portion of) the fourth region of the first target nucleic acid; iv) a second oligonucleotide having a 5' portion and a 3' portion wherein the 5', portion of the second oligonucleotide contains a sequence complementary to (atleast a-portion of) the second region of the first target nucleic acidand wherein the 3' portion of the second oligonucleotide contains a sequence complementary to (at least a portion of) the third region of the first target nucleic acid; iv) a third oligonucleotide having a 5', and a 3' portion wherein the 5' portion of the third oligonucleotide contains a sequence complementary to (at least a portion of) the first region of the first target nucleic acid and wherein the 3' portion of the third oligonucleotide contains a sequence complementary to (at least a portion of) the second region of the first target nucleic acid; v) a source of a second target nucleic acid, the second target nucleic acid having a first region, a second region and a third region, wherein the first region is located adjacent to and downstream from the second region and wherein the second region is located adjacent to and downstream from the third region; vi) a fourth oligonucleotide having a 5' and a 3' portion wherein the 5' portion of the fourth oligonucleotide contains a sequence complementary to (at least a portion of) the second region of the second target nucleic acid and wherein the 3' portion of the fourth oligonucleotide contains a sequence complementary to (at least a portion of) the third region of the second target nucleic acid; b) generating a first cleavage structure wherein the first oligonucleotide is annealed to the fourth region of the first target nucleic acid and wherein at least the 3' portion of the second oligonucleotide is annealed to the first target nucleic acid and vvherein:at, least the 5' portion of the third, oligonucieotide is annealed to the first target nucleic acid; and wherein :cleavage of the first cleavage structure occurs thereby cleaving the second oligonucleotide to generate a fifth oligonucleotide, the fifth oligonucleotide having a 5' and a 3' portion wherein the 5' portion of the fifth oligonueleotide contains a sequence complementary to (at least a portion of) the first region of the second target nucleic acid and wherein the: 3:', portion of the fifth oligonucleotide contains a sequence complementary to (at least a portion of) the second region of the secorid target nucleic acid; c) generating a second cleavage structure under conditions wherein the at least the 3' portion of the fourth oligonucleotide is annealed to the second target nucleic acid and wherein at least the 5' portion of the fifth oligonucleotide is annealed to the second target nucleic acid and wherein cleavage of <the second cleavage structure occurs to -geiierate a sixth oligonucleotide, the sixth oligonucleotide ltaving a 3'-hydroxyl group; and d) detecting the sixth oligonucleotide.
The detection of the sixth oligonucleotide may be accomplishedby a variety of methods, such as those described above for the method in which the fifth oligonucleotide is to be detected. As described above, the invention is not limited by the nature of the target nucleic acids, the nature of the cleavage means, the nature of the oligonucleotides; etc.
The invention also :provides a method of detecting the presence of 'a target nucleic acid molecule comprising: a) provi(fing: i) a cleavage means; ii) asource of a target nucleic acid, the target nucleic acid having a first region, a second region and a third region, wheiein the --first region.is located adjacent to and downstream from the second region and wherein the second region is located adjacent to and downstream from the third region; -iii) a first oligonucleotide having a 5' and a.3' portion wherein the 5' portion of the first=
oligonucleotid.e contains a sequence complementary to (at leasva portion of)=the second region, of the target nucleic acid and wherein the: 5-' portion of the first oligonucleotide 5 contains a region of self-complementarity_ and wherein the.3'. portion: of. the . firsi oligonucleotide contains a sequence complementary to (at least :a portioir of) the third region of the target nucleic acid; iv) a second . oligonucleotide. having =a 5' and a-3' portion wherein the, 5' portion.of the second oligonucleotide contains a sequence-complementary 16 (at least a portion of) the.first region of the target nucleic acid and wherein-:the 3' portioriof-ttiesecond oligonucleotide contains a sequence co.mplementary to (at .Jeast_-a portioa of) the secon&
region of the target nucleic acid.; v) a,_third oligonucleotide having a'S s and-a. 3'..poition wherein the 3' portion of the third _oligonucleotide contains a sequence-oomplementa ry to (at least a portion,of),the S'_poriion,_of:the fust.oligonucleotide; b), generating=w-first cleavage structure wherein at least the,3:' portion. of the_,first oligonucleotide is annealed=to the target l5 nucleic acid and wherein at least the S'.;portion.of the second o1igonucleotide'is=atinealed to the.target nucleic acid and wherein cleavage of the first-cleavage~stracture occuis=<thereby cleaving thefrst oligonucleotide to gen. erate a fourth oligonucleotide;.
the`.fourtli-oligonucleotide having a first regionps second-region and: a third-regioj*wherein 31ie'fiirst region is located adjacent -to. and; upstream of the second region an&
wherein.thesecond`
region is located adjacent to and upstream of the third region :and wherein -ttie. third- region of the fourth oligonucleotide contains.a;region of self-complementarity;-c) generating a second cleavage structure under conditions wherein: at- least:the 3-1portion of :the tliiid aligonucleotide is annealed to the first,region of the fourth oligonucleoti.de=anidd wherein the third.region of the fourth oligonucleotide- forms a hairpin structure and wherein cleavage of the..second-cleavage structure occurs-`to generate a fiRh oligonucleotide, the fifth oligonucleotide having a.3'-hydroxyl group;-and-=d)-detecting the fifth oligonucleotide.
The detection of the fifth olig.onucleotide may be accomplishedrby a: variety of methods, such as those described above. As described above, the invention is not limited by the nature.of the target nucleic acids, the nature of the cleavage means,_the nature of-the oligonucleotides, etc.

.-., 4_.: = "

The invention further provides a method of detecting the presence of human cytomegalovirus (HCMV) nucleic acid in a sample comprising: a) providing: i) a cleavage means, ii) a sample suspected of containing human cytomegalovirus target nucleic acid, the target nucleic acid having a first region, a second region and a third region, wherein the first region is located adjacent to and downstream from the second region and wherein the second region is located adjacent to and downstream from the third region; iii) a first oligonucleotide --having a 5' and a 3' portion wherein the 5' portion of the first oligonucteotide contains a sequence complementary to (at least a portion of) the second region of the target nucleic acid and wherein the 3' portion of the first oligonucleotide contains a sequence complementary to (at.least a por tion of) the third region of the target nucleic acid; iv) a second oligonucleotide having a 5' and a 3' portion wherein the 5' portion of the second oligonucleotide contains a sequence complementary to (at least a-portion of) the first region of the target nucleic acid and wherein the 3' portion of the second oligonucleotide contains a sequence complementary to (at least a portion of) the second regiori of the target nucleic acid; b) generating a-cleavage structure wherein at =least the 3'- -_portion of the first oligonucleotide is annealed to the target nucleic acid and wherein at least the 5' ~portion of the second oligonucleotide is annealed to the target-nucleic acid and wherein cleavage of the cleavage structure 'occurs via tlie -cYeavage means to::generate non-target. cleavage products, each non=target cleavage product having a 3' hydroxyl group; and c) detecting the non=target c-leavage products and thereby detecting the presence of .human cytomegalovirus: nucleic acid in the sample. In one embodiment; the first oligonucleotide has a length" between eleven and fifteen nucleotides.
The detection of the fifth oligonucleotide (indicative of the presence of HCMV
nucleic acid in the sample) may be accomplished by a variety of inethods, such as those -deseribed above. As described above, the invention is- not limited by the nature of the target nucleic acids, the nature of the cleavage means, the nature of the oligonucleotides;
etc.
The invention also provides a method of detecting the presence of human cytomegalovirus nucleic acid in a sample comprising: a) providing: i) a cleavage means, ii) a sample suspected of containing human cytomegalovirus target nucleic acid, the target nucleic acid having a first region, a second region, a third region and a fourth region, wherein the first region is located adjacent to and downstream from the second region, the second region is located.adjacent to and downstream from the third region and the third region is located adjacent to and downstream from the fourth region; iii) a first oligonucleotide --coniplementary to (at least a portion of) the fourth region of the target nucleic acid; iv) a - --, _ . 3 W0;98/42873 PCT/US98/05809 second oligonucleotide having a 5' portion and a 3' portion wherein the 5' portion of the second oligonucleotide contains a sequence complementary to (at least a portion of) the second region of the target nucleic acid and wherein the 3' portion of the first oligonucleotide contains a sequence complementary to (at least a portion of) the third region of the target nucleic acid; v) a third oligonucleotide having a 5' portion and a 3' portion wherein the 5' portion of the third oligonucleotide contains a sequence complementary to (at least a portion of) the first region of the target nucleic acid and wherein the 3' portion of the third oligonucleotide contains a sequence complementary to (at least a portion of) the second region of the target nucleic acid; b) generating a cleavage structure wherein the first oligonucleotide is annealed to the fourth region of the target nucleic acid and wherein at least the 3' portion of the second oligonucleotide is annealed to the target nucleic acid and wherein at least the 5' portion of the third oligonucleotide is annealed to the target nucleic acid and wherein cleavage of the cleavage stnicture occurs via the cleavage means to generate non-target cleavage products, each non-target cleavage product having a 3' hydroxyl group; and c) detecting the non-target cleavage products and< thereby = detecting the presence- of human cytomegalovirus nucleic acid in the sample.. The detection. of the non-targetcleavage%product (indicative of thepresence of HCMV, nucleic acid in the>sample) may be accomplished by a variety. of methods, such as those described above for ahe detection of the fifth oligonucleotide. As described above, the invention is not limited by the nature of the target nucleic acids,, the nature of the cleavage means, the nature of the oligonucleotides, etc.
The present invention further provides a method of detecting the presence of a target nucleic acid molecule comprising: a) providing:, a cleavagemeans; a source of a first target nucleic.acid, wherein the first target nucleic acid has a first region, a second region and a third region, and wherein the first region is located adjacent to and downstream from the second region and wherein the second region is located adjacent to and downstream from the third region; first and second oligonucleotides having 3' and 5' portions, wherein the 3' portion of the first oligonucleotide contains a sequence complementary to the third region of the target nucleic acid and wherein the 5' portion of the first oligonucleotide and the 3' portion of the second oligonucleotide each contain sequence full complementary to the second region of the target nucleic acid, and wherein the 5' portion of the second oligonucleotide contains sequence;complementary to the first region.of the target.nucleic acid; a source of a second target nucleic acid, the second target nucleic acid having a first region, a second region and a third region, wherein the first region is located adjacent to and downstream from . , .

the second region and wherein the second region is located adjacent to and downstream from the third region; a third oligonucleotide having a 5' and a 3' portion wherein the 5' portion of the third oligonucleotide contains a sequence complementary to the second region of the second target nucleic acid and wherein the 3' portion of the third oligonucleotide contains a sequence complementary to the third region of the second target nucleic acid;
b) generating a first cleavage structure wherein at least the 3' portion of the first oligonucleotide is annealed --to the first target nucleic acid and wherein at least the 5' portion of the second oligonucleotide is annealed to the first target nucleic acid and wherein cleavage of the first cleavage structure occurs via the cleavage means thereby cleaving the first oligonucleotide to generate a fourth oligonucleotide, the fourth oligonucleotide having a 5' and a 3' portion wherein said 5' portion of the fourth oligonucleotide contains a sequence complementary to the first region of the second target nucleic acid and wherein the 3' portion of the fourth oligornicleotide contains a sequence complementary to the second region of the second target nucleic acid; c) generating a second cleavage structure under conditions wherein at least the 3' portion of the third oligonucleotide is annealed to the second target nucleic acid and wher.ein.at least the 5' portion;-of the fourth oligonucleotide is annealed to the second'target nucleic acid oligonucleotide and-wherein cleavage of the second cleavage -structure occurs to generate a-fifth -oligonucleotide; the fifth oligonucleotide having a 3'-hydroxyl group;, and d) detecting the.fifth oligonucleotide.
In some embodiments of this method, the first oligonucleotide has a length between eleven and fiffteen nucleotides. -In other embodiments, the cleavage means is a structure-specific nuclease. In yet other embodiments, the structure-specific nuclease is a thermostable structure-specific nuclease: In further embodiments, the therrnostable structure-specific nuclease is an Afu FEN-1 endonuclease. In additional embodiments, the one or more first, second, and/or the third oligonucleotides contain a dideoxynucleotide at the 3' terminus. In particularly preferred embodiments, the method further comprises providing an ArrestorTM, wherein the ArrestorTM reduces interaction between the first oligonucleotide and the second target.
In some preferred embodiments of the method the step of detecting the fifth ; oligonucleotide comprises: incubating the fiftti oligonucleotide and at least one labelled nucleoside triphosphate under conditions such that at least one labelled nucleotide is added to the 3'-hydroxyl group of the fifth olignucleotide to generate a labelled, fifth oligonucleotide; --and:detecting the presence of the labelled fifth oligonucleotide. In yet other preferred --~, ~ ` .

embodiments of the method, the incubation is conducted in the presence of a polymerase. In alternative preferred embodiments, the polymerase is a template-dependent polymerase. In particularly preferred embodiments, the template-dependent polymerase is selected from the group consisting of terminal deoxynucleotidyl transferase and poly A
polymerase: In yet other embodiments, the third oligonucleotide contains a 5' end label, the 5' end label being a different label than the label present upon the labelled nucleoside triphosphate.
In additional embodiments of the method the step of detecting the fifth oligonucleotide comprises: incubating the fifth oligonucleotide with a polymerase and at least one nucleoside triphosphate under conditions such that at least one nucleotide is added to the 3'-hydroxyl group of the fifth oligonucleotide to generate a tailed oligonucleotide; and detecting the presence of the tailed fifth oligonucleotide. In some preferred embodiments, the polymerase is a template-dependent polymerase. In other preferred embodiments, the template-dependent polymerase is selected from the group consisting of terminal deoxynucleotidyl transferase and poly A polymerase: In yet other embodiments, the third oligonucleotide contains a 5' end label.
In further embodiments of the method, the step of deteeting`the'-,fifth oligonucleotide comprises: . a) providing the fifth oligonucleotide; a single continuous strand of nucleic"acid comprising a sequence definining a single strand of an RNA polymerase binding region, a template-dependent DNA polymerase, and a template-dependent RNA polymerase; b) exposing the fifth oligonucleotide to an RNA polymerase binding region under conditions such that the fifth oligonucleotide binds to a portion of the single strand of the RN-A
polymerase binding region to produce a bound fifth oligonucleotide; c) exposing the bound fifth oligonucleotide to the template-dependent DNA polymerase under conditions such that a double-stranded RNA polymerase binding region is produced; and d) exposing the double-stranded RNA polymerase binding region to the template-dependent RNA'polymerase under conditions. such that RNA transcripts are produced. In alternative embodiments of this method, the single-stranded portion of the protein binding region comprises: a first single continuous strand of nucleic acid comprising a sequence defining the template strand of an RNA polymerase binding region; and a second single continuous strand of nucleic acid having a 5' and a 3' end, the second nucleic acid comprising a region complementary to a portion . of the first nucleic acid, wherein the second- nucleic acid is annealed to the first nucleic acid so as to define the single-stranded portion of the protein binding region. In yet other embodiments of the method, the protein binding region is a template-dependent RNA

~ ^~ ~ = _ .

polymerase binding region. In still other embodiments, the template-dependent RNA
polymerase binding region is the T7 RNA polymerase binding region.
In alternative preferred embodiments of the method, the step of detecting the fifth oligonucleotide comprises: providing a fifth oligonucleotide, a single continuous strand of =
nucleic acid comprising a sequence defining a single strand of an RNA
polymerase binding region, a template-dependent DNA .polymerase, and a template-dependent RNA
polymerase;
exppsing the fifth oligonucleotide to an RNA polymerase binding region under conditions such that the fifth oligonucleotide binds to a portion of the single strand of the RNA
polymerase binding region; exposing the bound fifth oligonucleotide to the template-dependent DNA polymerase under conditions such that a double-stranded RNA
polymerase binding region is produced; and exposing the double-stranded RNA polymerase binding region to the template-dependent RNA polymerase under conditions such that RNA
transcripts are produced. In preferred embodiments, the method further comprises detecting the RNA
transcripts. In. some preferred:embodiments, the template-dependent RNA
polymerase is T7 RNA polymerase. .
_ The present invention also provides methods for detecting {the presence of a target nucleic acid molecule _ T'hese. methods comprise a) providing; a cleavage means; a source of a first target: nucleic acid, wherein.the first target nucleicc acid has a-first region; a~ second region, a third region and a fourth. region, wherein the first region is located adjacent toand downstream fromthe second region, the second region is located adjacent to and dowristream from the, third region and the third region is located adjacent to and downstream from the fourth region; a first oligonucleotide complementary to the fourth region ofthe first target nucleic aeid;.second -and xhird- oligonucleotides having 3' and 5' portions, wherein the-3' portiQn of the second oligonucleotide contains a sequence complementary to the third region of the target nucleic acid and wherein the 5' portion of the second oligonucleotide and'the 3' portion of the third oligonucleotide. each contain sequence completely complementary to the second region of the target nucleic acid, and wherein the 5' portion of the third oligonucleotide contains sequence complementary to the first region of the target nucleic acid;
a source of a second target nucleic acid, wherein the second target nucleic acid has a first region, a second region and a.third region, wherein the first region is located adjacent'to and _ downstream from the second region and wherein the second region is located adjacen't 'to and downstream from the third region;.:a fourth oligonucleotide having a 5', and a 3' portion --wherein the 5' portion of the fourth oligonueleotide contains a sequence complementary to ~~ =~~ .

the second region of the second target nucleic acid and wherein the 3' portion of the fourth oligonucleotide contains a sequence complementary to the third region of the second target nucleic acid; b) generating a first cleavage structure wherein the first oligonucleotide is annealed to the fourth region of the first target nucleic acid and wherein at least the 3' portion of the second oligonucleotide is annealed to the first target nucleic acid and wherein at least the 5' portion of the third oligonucleotide is annealed to the first target nucleic acid and wherein cleavage of the first cleavage structure occurs thereby cleaving the second oligonucleotide to generate a fifth oligonucleotide, the fifth oligonucleotide having a 5' and a 3' portion wherein the 5' portion of the fifth oligonucleotide contains a sequence complementary to the first region of the second target nucleic acid and wherein the 3' portion of the fifth oligonucleotide contains a sequence complementary to the second region of the second target nucleic acid; c) generating a second cleavage structure under conditions wherein at least the 3' portion of the fourth oligonucleotide is annealed to the second target nucleic acid and wherein at least the 5' portinn of the fifth oligonucleotide is annealed to,the second target nucleic acid and wherein cleavage of the second cleavage structure occurs to generate a sixth oligonucleotide, the sixth oligonucleotide having a 3'-hydroxyl group;
and d) detecting the sixth oligonucleotide. In some embodiments, the first oligonucleotide has a length between eleven and fifteen nucleotides. In yet other embodiments, the cleavage" means is a structure-specific nuclease. In preferred embodiments, the structure-specific nuclease is a thermostable structure-specific nuclease. In particularly preferred embodiments, the thermostable structure-specific nuclease is an Afu FEN-1 endonuclease. In yet other embodiments, the one or more first, second, and/or third oligonucleotides contain a dideoxynucleotide at the 3' terminus. In particularly preferred embodiments, the method further comprises providing an ArrestorTM, wherein the ArrestorTM reduces interaction between the first oligonucleotide and the second target.
In other embodiments of the method, the detecting of the sixth oligonucleotide comprises: incubating the sixth oligonucleotide and at least one labelled nucleoside triphosphate under conditions such that at least one labelled nucleotide is added to the 3'-hydroxyl group of the sixth olignucleotide to generate a labelled sixth oligonucleotide; and detecting the presence of the labelled sixth oligonucleotide. In preferred embodiments, the incubation step further comprises incubating a polymerase with the sixth oligonucleotide and at least one labelled nucleoside triphosphate. In particularly preferred embodiments, the polymerase is a template-dependent polymerase. In alternativeiy preferred embodiments, the template-dependent polymerase is selected from the group consisting of terminal deoxynucleotidyl transferase and poly A polymerase.

The present invention also provides a kit, comprising: a) a first oligonucleotide comprising a 3' portion and a 5' portion, said 3' portion completely complementary to an entire first region of a target nucleic acid, and said 5' portion non-complementary to said target nucleic acid; and b) a second oligonucleotide comprising a 3' portion and a 5' portion, said 5' portion completely complementary to an entire second region of said target nucleic acid downstream of and contiguous to said first region; and c) a thermostable structure-specific 5'-nuclease.
DESCRIPTION OF THE DRAWINGS

Fig. 1 is a comparison of the nucleotide structure of the DNAP genes isolated from Thermus aquaticus (SEQ ID NO:1), Thermus flavus (SEQ ID NO:2) and Thermus thermophilus (SEQ ID NO:3); the consensus sequence (SEQ ID NO:7) is shown at the top of each row.

Fig. 2 is a comparison of the amino acid sequence of the DNAP isolated from Thermus aquaticus (SEQ ID NO:4), Thermus flavus (SEQ ID NO:5), and Thermus thermophilus (SEQ ID NO:6); the consensus sequence (SEQ ID NO:8) is shown at the top of each row.

Figs. 3A-G are a set of diagrams of wild-type and synthesis-deficient DNAPTaq genes.

Fig. 4A depicts the wild-type Thermus flavus polymerase gene.

Fig. 4B depicts a synthesis-deficient Thermus flavus polymerase gene.

Fig. 5 depicts a structure which cannot be amplified using DNAPTaq; this Figure shows SEQ ID NO:17 (primer) and SEQ ID NO:15 (hairpin).

Fig. 6 is a ethidium bromide-stained gel demonstrating attempts to amplify a bifurcated duplex using either DNAPTaq or DNAPStf (i.e., the Stoffel fragment of DNAPTaq).

Fig. 7 is an autoradiogram of a gel analyzing the cleavage of a bifurcated duplex by DNAPTaq and lack of cleavage by DNAPStf.

Figs. 8A-B are a set of autoradiograms of gels analyzing cleavage or lack of cleavage upon addition of different reaction components and change of incubation temperature during attempts to cleave a bifurcated duplex with DNAPTaq.

Figs. 9A-B are an autoradiogram displaying timed cleavage reactions, with and without primer.

Figs. 10A-B are a set of autoradiograms of gels demonstrating attempts to cleave a bifurcated duplex (with and without primer) with various DNAPs.

Fig. 11A shows the substrate and oligonucleotides (19-12 [SEQ ID NO:18] and 30-12 [SEQ ID NO:19] ) used to test the specific cleavage of substrate DNAs targeted by pilot oligonucleotides.

- 24a -Fig. l1B shows an autoradiogram of a gel showing the results of cleavage reactions using the substrates and oligonucleotides shown Fig. 11A.
Fig. 12A shows the substrate and oligonucleotide (30-0 [SEQ ID NO:20]). used to test the specific cleavage of a substrate RNA targeted by a pilot oligonucleotide.
Fig. 12B shows an autoradiogram of a gel showing the results of a cleavage reaction using the substrate and oligonucleotide shown in Fig. 12A.
Fig. 13. is a diagram of vector pTTQ18.
Fig. 14 is a diagram of vector pET-3c.
Figs. 15A-E depicts a set of molecules which are suitable substrates for cleavage by the 5' nuclease activity of DNAPs (SEQ ID NOS:15 and 17 are depicted in Fig.15E).
Fig. 16 is an autoradiogram of a gel showing the results of a cleavage reaction run with synthesis-deficient DNAPs.
Fig. 17 is an autoradiogram of a PEI chromatogram resolving the products of an assay for synthetic activity in synthesis-deficient DNAPTaq clones.
Fig. 18A depicts the substrate molecule (SEQ ID NOS:15 and 17) used to test the ability of synthesis-deficient DNAPs to cleave short hairpin structures.
Fig. l8B shows an autoradiograin of a gel resolving the products of a cleavage reaction run using the substrate shown in Fig. 18A.
Fig. 19 provides the complete 206-mer duplex sequence (SEQ ID NO:27) employed as a substrate for the 5' nucleases of the present invention Figs. 20A and B show the cleavage of linear nucleic acid substrates (based on the-206-mer of Fig. 19) by wild type DNAPs and 5' nucleases isolated from Thermus aquaticus and Thermusfiavus.
Fig. 21A shows the "nibbling" phenomenon detected with the DNAPs of the present invention.
Fig. 21B shows that the "nibbling" of Fig. 25A is 5' nucleolytic cleavage and not phosphatase cleavage.
Fig. 22 demonstrates that the "nibbling" phenomenon is duplex dependent.
In particular, Fig. 22A shows both a single stranded, internally labeled 206-mer, and a double stranded 206-mer with one of the strands internally labeled. Fig. 22B
shows an autoradiograph produced according to Example 6, where no cleavage of the single stranded structure is detected (lane A), whereas cleavage of the 206-mer duplex (Iane B) is complete.

Fig. 23 is a schematic showing how "nibbling" can be employed in a detection assay.
Figs. 24A and B demonstrates that "nibbling" can be target directed.
Fig. 25 provides a schematic drawing of a target nucleic acid with an lnvaderTM
oligonucleotide and a probe oligonucleotide annealed to the target.

- 25a -- --'~. .
= = , - 1 Fig. 26 provides a schematic showing the S-60 hairpin oligonucleotide (SEQ ID
NO:29) with the annealed P-15 oligonucleotide (SEQ ID NO:30).
Fig. 27 is an autoradiogram of a gel showing the results of a cleavage reaction run using the S-60 hairpin in the presence or absence of the P-15 oligonucleotide.
Fig. 28 provides a schematic showing three different arrangements of target-specific oligonucleotides and their hybridization to a target nucleic acid which also has a probe ~-oligonucleotide annealed thereto (SEQ ID NOS:31-35).
Fig. 29 is the image generated by a fluoroscence imager showing that the presence of an InvaderTm oligonucleotide causes a shift in the site of cleavage in a probe/target duplex.
Fig. 30 is the image generated by a fluoroscence imager showing the products of InvaderTM-directed cleavage assays run using the three target-specific oligonucleotides diagrammed in Fig. 28.
Fig. 31 is the image generated by a fluoroscence imager showing the products of InvaderT"'-directed cleavage a.ssays run in the presence or absence of non-target nucleic acid molecules.
Fig. 32 is the image generated by a-fluoroscence imager showing the products of InvaderT"'-directed cleavage assays run in the presence of decreasing amounts of target nucleic acid.
Fig. 33 is the image generated by a fluoroscence imager showing the products of Inva.derT"'-directed cleavage assays run in the presence or absence of saliva extract using various thermostable 5' nucleases or DNA polymerases.
Fig. 34 is the image generated by a fluoroseence imager showing the products of InvaderTm-directed cleavage assays run using various 5' nucleases.
Fig. 35 is the image generated by a fluoroscence imager showing the products of InvaderT"I-directed cleavage assays run using two target nucleic acids which differ by a single basepair at two different reaction temperatures.
Fig. 36A provides a schematic showing the effect of elevated temperature upon the annealing and cleavage of a probe oligonucleotide along a target nucleic acid wherein the probe contains a region of noncomplementarity with the target.
Fig. 36B provides a schematic showing the effect of adding'an upstream .
oligonucleotide upon the annealing and cleavage of a probe oligonucleotide along a target nucleic acid wherein the probe contains a region of noncomplementarity with the target. --ti .74667-130 Fig. 37 provides a schematic showing an arrangement of a target-specific InvaderTM
oligonucleotide (SEQ ID NO:39) and a target-specific probe oligonucleotide (SEQ ID NO:38) bearing a 5' Cy3 label along a target nucleic acid (SEQ ID NO:31).
Fig. 38 is the image generaied by a fluorescence imager showing the products of InvaderT'"-directed cleavage assays run in the presence of increasing concentrations of KC1.
Fig. 39 is the image generated by a fluorescence imager showing the products of InvaderTm-directed cleavage assays run in the presence of increasing concentrations of MnC12 or MgC12.
Fig. 40 is the image generated by a fluorescence imager showing the products of InvaderT'"-directed cleavage assays run in the presence of increasing amounts of genomic DNA or tRNA.
Fig. 41 is the image generated by a fluorescence imager showing the products of InvaderTM-directed cleavage assays run use a HCV RNA target.
Fig. 42 is the image generated by a fluorescence imager showing the products of InvaderTM'-directed cleavage assays run using a HCV RNA target and demonstrate the stability of RNA targets under InvaderTm-directed cleavage assay conditions. Fig. 42A
shows 5 minute reactions and Fig. 42B shows 30 min reactions.
Fig. 43 is the image generated by a fluorescence imager showing the sensitivity of detection and the stability of RNA in InvaderT"'-directed cleavage assays run using a HCV
RNA target.
Fig. 44 is the image generated by a fluorescence:.imager showing thermal degradation of oligonucleotides containing or lacking a 3' phosphate group.
Fig. 45 depicts the structure of amino-modifed oligonucleotides 70 and 74.
Fig. 46 depicts the structure of amino-modified oligonucleotide 75 Fig. 47 depicts the structure of amino-modified oligonucleotide 76.
Fig. 48 is the image generated by a fluorescence imager scan of an IEF gel showing the migration of substrates 70, 70dp, 74, 74dp, 75, 75dp, 76 and 76dp.
Fig. 49A provides a schematic showing an arrangement of a target-specific InvaderTm oligonucleotide (SEQ ID NO;50) and a target-specific probe oligonucleotide (SEQ ID NO:51) bearing a 5' Cy3 label along a target nucleic acid (SEQ ID NO:52).
Fig. 49B is the image generated by a fluorescence imager showing the detection of specific cleavage products generated in an invasive cleavage assay using charge reversal (i.e., charge based separation of cleavage products).

, WO 98/42873 PCTlUS98/05809 Fig. 50 is the image generated by a fluorescence imager which depicts the sensitivity of detection of specific cleavage products generated in an invasive cleavage assay using charge reversal.
Fig. 51 depicts a first embodiment of a device for the charge-based separation of oligonucleotides.
Fig. 52 depicts a second embodiment of a device for the charge-based separation of -oligonucieotides.
Fig. 53 shows an autoradiogram of a gel showing the results of cleavage reactions run in the presence or absence of a primer oligonucleotide; a sequencing ladder is shown as a size marker.
Figs. 54A-D depict four pairs of oligonucleotides; in each pair shown, the upper arrangement of a probe annealed to a target nucleic acid lacks an upstream oligonucleotide and the lower arrangement contains an upstream oligonucleotide (SEQ ID NOS:32 and 54-58 are.shown in Figs. 54A-D):
Fig. 55 sliows: the.chemical structure of several positively'charged heterodiineric ---DNA-binding dyes.
Fig.. 56 is a schematic showing alternative methods for the tailing and detection of specific cleavage produots in the context ofthe InvaderTM-directed cleavage`assay.
Fig. 57 provides a schematic drawing of a target nucleic acid with an InvaderTM
oiigonucleotide,.a miniprobe, and a stacker oligonucleotide annealed to the target.
Fig. 58 provides a space-filling model of the 3-dimensional structure of the T5 5'-exonuclease.
Fig. 59 provides an alignment of the amino acid, sequences of several FEN-I
nucleases including the A%iethanoeoccus jannaschii FEN-1 protein (MJAFENI:PRO), the Pyrococcus furiosus FEN-1 protein (PFUFENI.PRO), the human FEN-1 protein (HUMFENI.PRO), the mouse FEN-1 protein (1VIUSFENI.PRO), theSaccharomyces cerevisiae YKL510 protein (YSkT510.PRO), the Saccharomyces cerevisiae RAD2 protein (YSTRAD2.PRO), the Shizosaccharomycespombe RAD13 protein'(SPORADI3.PRO); the human XPG protein (HUMXPG.PRO), the mouse XPG protein (MUSXPG.PRO), the Xenopus' laevis XPG
protein (XENXPG:PRO)`and. the C. elegans RAD2 protein (CELRAD2.PRO) (SEQ'ID NOS:135-145; respectively); portions of the amino acid sequenceof'some of these proteins were not shown in order to maximize the alignment between proteins (specifically, amino acids 122 to 765 of the YSTRAD2 sequence were deleted; amino acids 122 to 746 of the --~, .WO 98/42873 PCT/US98/05809`
sequence were deleted; amino acids 122 to 757 of the HUMXPG sequence were deleted;
amino acids 122 to 770 of the MUSXPG sequence were deleted; and amino acids 122 to 790 of the XENXPG sequence were deleted). The numbers to the left of each line of sequence refers to the amino acid residue number; dashes represent-gaps introduced to maximize alignment.
Fig. 60 is a schematic showing the S-33 (SEQ ID NO:84) and 11-8-0 (SEQ ID
NO:85) oligonucleotides in a folded configuration; the cleavage site is indicated by the arrowhead.
Fig. 61 shows a Coomassie stained SDS-PAGE gel showing the thrombin digestion of Cleavase BN/thrombin.
Fig. 62 is the image generated by a fluorescence imager showing the products produced by the cleavage of the S-60 hairpin using Cleavase BN/thrombin (before and after thr.ombin digestion).
Fig. 63 is the image generated,by a fluorescence imager showing the products produced by the cleavage of circular M13 DNA using Cleavase BN/thYornbirr:
Fig. 64 is an SDS PAGE gel`showing the migration of purified Cleavase BN
nuclease, Pfu FEN-i,-.Pwo FEN-71 and Mja FEN-fi.<' Fig. 65 is the image generated by a fluorescence imager showing the products produced by the cleavage of the S-33 and 11-8-0 oligonucleotides by Cleavase BN and the Mja: FEN-1 nucleases..
Fig. 66 is the image generated by a fluorescence imager showing the products produced by the incubation of an oligonucleotide either having or lacking a 3'-0H group with TdT.
Fig. 67 is the image generated by afluorescence imager-showing the products -25 produced the incubation of cleavage products with TdT.
Fig. 68 is a photograph of a Universal GeneCombT"I card showing the capture and detection of cleavage products on a nitrocellulose support.
Fig. 69 is the image generated by a fluorescence imager showing the products produced using the Cleavase(D A/G and Pfu FEN-1 nucleases and a fluorescein-labeled probe.
Fig. :70 is the image generated by a fluorescence imager showing the products ' produced using the CleavaseO A/G. and Pfu FEN-1 nuclease's and a Cy3-labeled probe.
Fig. 71 is the image generated by a fluorescence ;imager showing the' products produced using the Cleavase A/G and Pfu FEN-1 nucleases and a TET-labeled probe.

Figs. 72A and 72B are.images generated by a fluorescence imager showing the products produced using the CleavaseOD A/G and Pfu FEN-1 nucleases and probes having or lacking a 5' positive charge; the gel shown in Fig. 83A was run in the standard direction and the gel shown in Fig. 84B was run in the reverse direction.
Fig. 73 shows the structure of 3-nitropyrrole and 5-nitroindole.
Fig. 74 shows the sequence of oligos 109, 61 and 67 (SEQ ID NOS:97, 50 and 51) --annealed into a cleavage structure as well as the sequence of oligo 67 (SEQ ID
NO:51) and a composite of SEQ ID NOS:98, 99, 101 and 102.
Fig. 75A-C show images generated by a fluorescence imager showing the products produced in an InvaderTM-directed cleavage assay performed at various temperatures using a miniprobe which, is either completely complementary to the target or contains a single mismatch with the target.
Fig. 76 shows the sequence of oligos 166 (SEQ ID NO:103), 165 (SEQ ID NO:104), 161(SEQ ID NO:106), 162 (SEQ ID NO:105) and 164 (SEQ II3 NO:107) as well as a cleavage _structure.
Fig. 77 shows the image generated by a fluorescence imager showing the products produced in an InvaderTM-directed cleavage assay .performed using ras gene .sequences as the target.
Figs. 78A-C show the sequence of the S-60 hairpin (SEQ ID NO:29) (A),'and the P-15 oligo (SEQ ID NO:30) (shown annealed to the S-60 hairpin in B) and the image generated by a fluorescence imager showing the products produced by cleavage of the S-60 hairpin in the ; presence of various InvaderTM oligos.
Fig. 79 shows the structure of various 3' end substituents.
Fig. 80 is a cpmposite graph showing the effect of probe concentration, temperature and a stacker oligonucleotide on the cleavage. of miniprobes.
Fig. 81 shows the sequence .of the IT-2 oligonucleotide (SEQ' ID NO:115; shown in a folded configuration) as well as the -sequence of the IT-1 (SEQ ID NO: 116) and IT-A- (SEQ
ID NO;117) oligos.
Fig. 82.shows the image generated by a fluorescence imager -showing the =products produced by cleavage of the oligos shown in Fig. 92 by Cleavase A/G -nuclease. .
Fig. 83 shows the imageõ generated by a fluorescence imager which provides a comparison of the rates of cleavage by the Pfu FEN-1. and Mja.FEN-1 nucleases.

'~ -WO 98/42873 PCT/US98/05809' Fig. 84 shows the image generated by a fluorescence imager which depicts the detection of RNA targets using a miniprobe and stacker oligonucleotides.
Figs. 85A-C provide schematics showing particular embodiments of the present invention wherein a T7 promoter region and copy template annealed with either no oligo (A), a complete promoter oligo (B) or a complete promoter oligo with a 3' tail (C);
one strand of the T7.promoter region is indicated by the hatched, line.
Figs. 86A-D provide schematics showing particular embodiments of the present invention wherein a T7 promoter region and copy template annealed with either a cut probe(A), a partial promoter oligo (B), an uncut oligo (C) or both an uncut probe and a partial promoter oligo (D).
Fig. 87 provides a schematic illustrating one embodiment of the present invention wherein a template-dependent DNA polymerase is used to extend a cut probe to complete a T7 promoter, region and thereby allow transcription.
Fig. 88 provides a schematic illustrating that an. uncut probe combined with a> partial promoter oligo does not permit transcription.while a cut probe combined with a partial promoter oligo generates a complete (but nicked) promotEr which supports transcription:
Fig. 89 shows the image generated by a fluorescence imager which shows thatprimer extension can be used to complete a partial promoter formed by a cut probe (lanes 1-5) and that annealing a cut probe generated in an invasive cleavage assay can complete a partial T7 promoter to, permit transcription (lanes 6-9).
Figs. 90A-C provide, schematics showing particular embodiments of the present invention which illustrate that the use of a partial promoter -oligo with a paired 5' tail can be used to block transcription from a composite promoter formed by the annealing of an uncut probe, Fig. 91 shows the image generated by a fluorescence imager which shows that txanscription from a"leaky" branched T7 composite promoter can be shut down by the use of a downstream partial promoter oligo having a paired 5' tail.
Fig. 92 shows the image generated by a fluorescence imager which shows that the location of the nick site. in a nicked composite T7. promoter can effect the efficiency of transcription.
.1?ig..93 shows the image generated by a fluorescence imager which shows that the presence of an unpaired 3' tail on a full-length promoter oligo decreases but does not abolish __ --~

transcription. Beneath the image are schematics showing the nucleic acids tested in reactions 1-4; these schematics show SEQ ID NOS:123-125.
Fig. 94 is a schematic which illustrates one embodiment of the present invention where a composite T7 promoter region is created by the binding of the cut probe oligo downstream of the partial promoter oligo.
Figs. 95A-D provide schematies showing particular embodiments of the present -invention which show various ways in which a composite promoter can be formed wherein the nick is located in the template (or bottom) strand.
Fig. 96 is a schematic which illustrates one embodiment of the present invention where the cut probe from an initial invasive cleavage reaction is employed as the InvaderT"' oligonucleotide in a second invasive cleavage reaction.
Fig. 97 is a schematic which illustrates one embodiment of the present invention where the cut probe from an initial invasive cleavage reaction is employed as an integrated InvaderT"'-target complex in a second invasive cleavagereaction:
Fig. 98 shows thenucleotide sequence of the PRl probe (SEQ ID NO:119),the IT3 InvaderTM-Target oligonculeotide (SEQ iD'NO::118), the -IT3=8, IT3-6, IT347 IT3-Sand IT3-0 oligonucieotides (SEQ ID NOS:147-151, respeetively).
Fig. 99 depicts structures that -rnay be employed to determine the ablity of'an "enzyme to cleave a probe in the presence = and the absence of an upstream oligonucleotide: F'ig. 99 displays the sequence of oligo 89-15-1 (SEQ ID NO:152), oligo 81-69-5 {SEQ'ID"NO:156), oligo 81-69-4 (SEQ ID N0155), oligo 81 -69=3 (SEQ ID NO:154), oligo 81=69-2 (SEQ ID
N0;153) and a portion of M13mp18 (SEQ ID NO:163).
Fig. 100 shows the image generated by a fluorescence imager which shows thie dependence of Pfu FEN-1 on the presence of an overlapping upstream oligonucleotide for specific cleavage of the probe.
Fig. 101a shows the image generated by a fluorescence imager which compares the amount of product generated in a standard (i.e., a non-sequential invasive eleavage reaction) and a sequential invasive cleavage reaction.
, Figure 101 b is a graph comparing the amount of product generated in a standard or basic (i.e., a non-sequential invasive cleavage reaction) and a sequential invasive cleavage reaction ("invader sqrd") (y axis = fluorescence units; x axix = attomoles of target):

Fig. 102 shows the image generated by a fluorescence imager which shows that the products of a completed sequential invasive cleavage reaction cannot cross contaminant a subsequent similar reaction.
Fig. 103 shows the sequence of the oligonucleotide employed in an invasive cleavage reaction for the detection of HCMV viral DNA; Fig. 103 shows the sequence of oligo 89-76 (SEQ ID NO:161), oligo 89-44 (SEQ ID NO:160) and nucleotides 3057-3110 of the HCMV
genome (SEQ ID NO:162).
Fig. 104 shows the image generated by a fluorescence imager which shows the sensitive detection of HCMV viral DNA in samples containing human genomic DNA
using an invasive cleavage reaction.
Fig. 105 is a schematic which illustrates one embodiment of the present invention, where the cut probe from an initial invasive cleavage reaction is employed as the InvaderTM
oligonucleotide in a second invasivc cleavage reaction, and where an ArrestnrI
M
oligonucleotide prevents participation of remaining uncut first probe in the cleavage of the seeond; probe.
Fig. 106 is a schematic which illustrates one embodiment of the present inveon, where the cut probe from an initial invasive cleavage reactioti is employed as an'integrated InvaderTM-target complex in a second invasive cleavage reaction, and where an ArrestorTM
oligonucleotide prevents participation of remaining uncut first probe in the cleavage ofthe second probe.
Fig. 107 shows three images generated by a fluorescence imager showing that two different lengths of 2' 0-methyl, 3' terminal amine-modified ArrestorT"' aligonucleotide both reduce non-specific background cleavage of the secondary probe when included in the second step of a reaction where the cut probe from an initial invasive cleavage reaction is employed as an integrated InvaderTM-target complex in a second invasive cleavage reaction.
Fig. 108A shows two images generated by a fluorescence imager showing the effects on nonspecific and specific cleavage signal of increasing concentrations of primary probe in the first step of a reaction where the cut probe from an initial invasive cleavage reaction is employed. as =the Invaderm oligonucleotide in a second invasive cleavage reaction.
Fig. 108B shows two images generated by a fluorescence imager showing the effects on nonspecific and specific cleavage signal of increasing concentrations of primary probe in the first step of a reaction, and inclusion of a 2' 0-methyl, 3' terminal amine-modified ArrestorTM oligonucleotide in the second step of a reaction where the cut probe from an initial invasive cleavage reaction is employed as the InvaderTM oligonucleotide in a second invasive cleavage reaction.
Fig. 108C shows shows a graph generated using the spreadsheet Microsoft Excel software, comparing the effects on nonspecific and specific cleavage signal of increasing concentrations of primary probe in the first step of a reaction , in the presence or absence of a 2' 0-methyl, 3' terminal amine-modified ArrestorTM oligonucleotide in the second step of a reaction where the cut probe from an initial invasive cleavage reaction is employed as the InvaderTM oligonucleotide in a second invasive cleavage reaction.
Fig. 109A shows two images generated by a fluorescence imager showing the effects on nonspecific and specific cleavage signal of including an unmodified ArrestorTM
oligonucleotide in the second step of a reaction where the cut probe from an initial invasive cleavage reaction is employed as the InvaderTM oligonucleotide in a second invasive cleavage reaction.
Fig: 109B shows two images generated by a fluorescence imagcr showing the effects on nonspecific and specific cleavage signal of including a 3' terminal amine modified ArrestorTM, a partially 2' 0-methyl substituted, 3' terminal amine modified ArrestorTM, or axi entirely. 2' 0-methyl, 3' terminal amine modified ArrestbrTM oligonucleotide in the second step. of a reaction, where the cut probe from an initial invasive cleavage reaction is employed as the InvaderTM oligonucleotide in a second invasive cleavage reaction.
20. Fig. 110A shows two images generated by a fluorescence imager comparing the effects on nonspecific and specific cleavage signal of including an ArrestorTM
oligonucleotides of different lengths in the second step of a reaction where the cut probe from an initial invasive cleavage reaction is employed as the InvaderTM oligonucleotide in a second invasive cleavage reaction.
Figure 110B shows two images generated by a fluorescence imager comparing the effects on nonspecific and specific cleavage signal of including an arrestoer oligonucleotides of different lengths in the second step of a:reaction where the cut probe from an initial invasive cleavage reaction is employed as the InvaderTM oligonucleotide in a second invasive cleavage reaction, and in which a longer variant of the secondary probe used in the reactions in Fig. 110A is tested.
Fig. 110C shows a schematic diagram of a primary probe aligned with-several' ArrestorTM oligonucleotides of different lengths. The region of the primary probe that is --,_ .
.WO 98/42873 PCT/US98/05809 complementary to the HBV target sequence is underlined. The ArrestorsTM are aligned with the probe by complementarity.
Fig. 111 shows two images generated by a fluorescence imager comparing the effects on nonspecific and specific cleavage signal of including ArrestorTM
oligonucleotides of different lengths in the second step of a reaction where the cut probe from an initial invasive cleavage reaction is employed as the InvaderT"' oligonucleotide in a second invasive cleavage reaction, using secondary probes of two different lengths.

DEFINITIONS
As used herein, the terms "complementary" or "complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence "A-G-T," is complementary to the sequence "T-C-A." Complementarity may be "partial," in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or,, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity, between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strarfds. This is of particular importance in amplification reactions, as well as detection methods which depend upon binding between nucleic acids.
The term "self-complementar.ity" when used in reference to a nucleic acid strand (e.g:;
. anoligonucleotide) means that separate regions of that strand can base-pair.
Because this term _ refers only, to intramolecular base-pairing, any strand said to have a region of self-complementarity must have at least two regions capable of base-pairing with one another. As defined above, complementarity may be either "complete" or "partial". As used in reference to the probe oligonucleotides of the present invention, regions are considered to have signifieant self-complementarity when they may form a duplex of at least 3 contiguous base pairs (i.e., three base pairs of complete complementarity), or when they may form a longer duplex that is partially complementary. The ability of an oligonucleotide having a region of self: eomplementarity to successfully serve both as a target strand for a probe, and as an upstream oligonucleotide that directs irivasive cleavage of that probe as depicted in Fig. 97, is considered sufficient demonstration of self-complementarity as defined herein.

~~
. ~~... ' ...~.~ N WO 98/42873 PCTIUS98/05809 The term "homology" refers to a degree of identity. There may be partial homology or complete homology. A partially identical sequence is one that is less than I00% identical to another sequence.
As used herein, the term "hybridization" is used in reference to the pairing of =
complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the T. of the formed hybrid, and the G:C ratio within the nucleic acids.
As used herein, the term "Tm' is used in reference to the "melting temperature." The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes. half dissociated into single strands. The equation-for calculating the T.
of nucleic,acids is well known in the art. As indicated by standard references, a' simple estimate of the T. value may be calculated: by the equation; T. = 81.5 - + 0.4 i(% G+ C), when a nucleic acid is in aqueous solution at 1 M hlaCl (See e.g, Anderson and Young, Quantitative Filter Hybridization, inNucleic Acid Hybridization (1985). -Other references include more = sophisticated computations which take stractural as well as sequence characteristics into account for the- calculation of T;õ.
As used -herein the term "stringency" is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted... With "high stringency" conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high* frequency of complementary ..base sequences: ; Thus, conditions of "weak" or "low" stringency are often requited - when it is ..desired that. nucleic acids which are not completely complementary to -one another be hybridized or annealed together.
The term_"gene" refers,to a DNA sequence that comprises control and coding sequences necessary for the production of a-polypeptide or precursor. The polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired enzymatic a,ctivity is retained.
The term "wild-type". refers to a gene or gene product which has the characteristics of that gene or gene product when isolated from a naturally occurring souree: - A
wild-type gene is that which is most frequently, observed in a population and is thus arbitrarily designed the normal" or "wild-type" form of the gene. In contrast, the^'term "modified" or "mutant" refers to a gene or gene product which displays modifications in sequence and or functional .WO 98/42873 PCT/US98/05809 properties (i.e., altered characteristics) when compared to the wild-type gene or gene product.
It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
The term "recombinant DNA vector" as used herein refers to DNA sequences containing a desired coding sequence and appropriate DNA sequences necessary for the expression of the operably linked coding sequence in a particular host organism. DNA
sequences necessary for expression in procaryotes include a promoter, optionally an operator sequence, a ribosome binding site and possibly other sequences. Eukaryotic cells are known to utilize promoters, polyadenlyation signals and enhancers.
The term "LTR" as used herein refers to the long terminal repeat found at each end of a provirus (i.e., the integrated form of a retrovirus). TheLTR contains numerous regulatory signals including transcriptional control elements, polyadenylation signals and sequences needed for replication and integration of the viral genome. The viral LTR is divided into three regions called U3, R and U5.
The ,U3 region contains the enhancer :and promoter elements. The U5 region contains the polyadenylation signals. The R-(repeat) region separates the U3 and U5 regions amd transcribed sequences of the R region appear at both the 5', and 3' ends of the viral RNA.
The term "oligonucleotide" as used herein is defined as a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably- at least about 10-15 nucleotides and more preferably at least.
about 15 to 30 nucleotides. The exact size will depend on many factors, which in turn depends on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner,. including chemical. synthesis, DNA replication, reverse tr-anscription, or a combination thereof.
Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide-is referred to as the "5' end" if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end" if its Y oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5' and 3' ends. A first region along a nucleic acid strand is said to be upstream of another xegion if the WO 98/42873 PCT/US98/05809 .
3' end of the first region is before the 5' end of the second region when moving along a strand of nucleic acid in a 5' to 3' direction.
When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3' end of one oligonucleotide points towards the 5' end of the other, the former may be called the "upstream"
oligonucleotide and the latter the "downstream" oligonucleotide.
The term "primer" refers to an oligonucleotide which is capable of acting as a point of initiation of synthesis when placed under conditions in which, primer extension is initiated.
An oligonucleotide "primer" may occur naturally, as in a purified restriction digest or may be produced synthetically.
A primer is selected to be "substantially" complementary to a strand of specific sequence of the template. A primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. A primer sequence need' not reflect the exact sequence of the template. For example, a non-complementary nucleotide fr=agment 'niay be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand.' Non-corriplementary bases or longer sequences can be,interspersed into the primer, provided that the primer sequence has sufficient -complementarity with the sequence of the template to hybridize and thereby form a template primer complex for synthesis ofthe extension product of the primer.
"Hybridization" methods involve the. annealing of a complementaty 'sequence to`the target nucleic acid (the sequence =to be detected; the detection of this sequence may be by either direct or indirect means). The ability of two polymers of nucleie acid containing complementary sequences to find :each other and anneal through base pairing`
interaction is a well-recognized phenomenon. The initial observations of the "hybridization"
process `by Marmur and Lane, Proc. Natl. Acad Sci. USA 46:453 (1960) and Doty et al., Proc. Natl.
Acad. Sci. USA 46:461 (1960) have been followed by the refinement of this process into an essential tool of modern biology.
With regard to complementarity, it is important for some diagnostic appYieations to determine whether the hybridization represents complete or partial complementarity. For example, where it is desired to detect simply the presence or absence of pathogen `DNA (such as from a virus, bacterium, fungi, mycoplasma, protozoan) it is only impot'tant`that'the hybridization method ensures hybridization when the relevant sequence is present; conditions --can be selected where both partially complementary probes and completely complementary ,---.
.WO 98/42873 PCT/US98/05809 probes will hybridize. Other diagnostic applications, however, may require that the hybridization method distinguish between partial and complete complementarity.
It may be of interest to detect genetic polymorphisms. For example, human hemoglobin is composed, in part, of four polypeptide chains. Two of these chains are identical'ehains of 141 amino acids (alpha chains) and two of these chains are identical chains of 146 amino acids (beta chains).
The gene encoding the beta chain is known to exhibit polymorphism. The normal allele encodes a beta chain having glutamic acid at the sixth position. The mutant allele encodes a beta chain having valine at the sixth position. This difference in amino acids has a. profound (most profound when the individual, is homozygous for the mutant allele) physiological impact known clinically as sickle cell anemia. It is well known that the genetic basis of the amino acid change involves a single base difference between the nornZal alleleDNA sequence and the mutant allele DNA sequence.
The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5'- end of one sequence is paired with the 3' end of the other, is in "antiparallel association." Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine:
Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide; ionic strength and-incidence of =
mismatched base pairs.
Stability of a nucleic acid duplex is measured by the melting temperature, or "Tm."
The Tm of aparticular nucleic acid duplex under specified conditions is the temperature at which on average half of the base pairs have disassociated.
The term "label" as used herein refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be attached to a nucleic acid or protein. Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption,-'magnetism;
enzymatic activity, and the like. A label.may be a charged moeity (positive or negative charge) or alternatively, may be charge neutral.
The term "cleavage structure" as used herein, refers to a structure which is formed by the interaction of a probe oligonucleotide and a target nucleic acid to form a duplex, said resulting structure being cleavable by a cleavage means, including but not limited to an enzyme. The cleavage structure is a substrate for specific cleavage by said cleavage means in contrast to a nucleic acid molecule which is a substrate for non-specific cleavage by agents such as phosphodiesterases which cleave nucleic acid molecules without regard to secondary =
structure (i.e., no formation of a duplexed structure is required).
The term "cleavage means" as used herein refers to any means which is capable of cle.aving a cleavage structure, including but not limited to enzymes. The cleavage means may include native DNAPs having 5' nuclease activity (e.g., Taq DNA polymerase, E.
coli DNA
polymerase I) and, more specifically, modified DNAPs having 5' nuclease but lacking synthetic activity. The ability of S' nucleases to cleave naturally occurring structures in nucleic acid templates (structure-specific cleavage) is useful to detect internal sequence differences in nucleic acids without prior knowledge of the specific sequence of the nucleic acid. In this manner, they are structure-specific enzymes. "Structure-specific nucleases" or "structure-specific enzymes" are enzymes which recognize specific secondary structures in a nucleic molecule and cleave these sttuctures., The cleavage means of the invention cleave a nucleic acid molecule in response to ahe formation of cieavage structures; it is not necessary that the cleavage means cleave the cleavage structure at any particular location within the cleavage structure.
The cleavage means is not. restricted to enzymes having solely 5' nuclease activity.
The cleavage means may include nuclease activity provided from a variety of -sourees including= the Gleavase(& enzymes, the 1: EN. -1 endonucleases"(ittcluding RAD2 and XPG
proteins), Taq DNA polymerase and E. coli DNA polymerase I.
;.. The-term "thermostable" when used in reference to 'an enzyme; such 'as a 5' nuclease, indicates that the enzyme is functional or active (i:e., can perform catalysis) at an elevated temperature (i.e., at about 55 C or higher).
The term "cleavage products" as used. herein, refers to products generated by the reaction of a cleavage means with a cleavage structure (i.e., the treatnient of a cleavage structure with a cleavage means).
The term "target nucleic acid"refers,to a nucleic acid 'molecule which confains a sequence which has at least partial complementarity with at least a ptobe'oligonucleotide and' --may also have at least partial complementarity with an InvaderT'"
oligonucleotide: The target nucleic.acid may comprise single- or double-stranded DNA or RNA.

The term "probe oligonucleotide" refers to an oligonucleotide which interacts with a target nucleic acid to form a cleavage structure in the presence or absence of an InvaderTM
oligonucleotide. When annealed to the target nucleic acid, the probe oligonucleotide and target form a cleavage structure and cleavage occurs within the probe oligonucleotide. In the presence of an InvaderTM oligonucleotide upstream of the probe oligonucleotide along the target nucleic acid will shift the site of cleavage within the probe oligonucleotide (relative to the. site of cleavage in the absence of the InvaderTM).
The term "non-target cleavage product" refers to a product of a cleavage reaction which is not derived from the target nucleic acid. As discussed above, in the methods of the present invention, cleavage of the cleavage structure occurs within the probe oligonucleotide.
The fragments of the probe oligonucleotide generated by this target nucleic acid-dependent cleavage are "non-target cleavage products."
The terra "InvaderTM oligonucleotide" refers to an oligonucleotide which contains sequences at its 3' end which are substantially the same as sequences located at the 5' end of a probe oligonucleotide; these regions will compete for hybridization to the same segment along a,complementary target nucleic acid.
The term "substantially single-stranded" when used in reference to a-nueleic acid substrate means that the substrate molecule exists primarily as a single strand-of nucleic acid in contrast to a double-stranded substrate which exists as two strands of nucleic acid which areheld together by inter-strand base pairing interactions.
,. The term "sequence variation" as used herein refers to differences in nucleic acid sequence between two nucleic acids. For example, a wild-type structural gene and a mutant form of this wild-type structural gene may vary in sequence by the presence of single base substitutions and/or deletions or insertions of one or more nucleotides. These two forms of the structural gene are said to vary in sequence from one another. A second mutant form of the structural gene may exist. This second mutant form is said to vary in sequence from both the wild-type gene and the first mutant form of the gene.
The term "liberating" as used herein refers to the release of a nucleic acid fragment from a larger nucleic acid fragment, such as an oligonucleotide, by the action of a 5' nuclease such that the released fragment is no longer covalently attached to the remainder of the oligonucleotide.

The term "K,,," as used herein refers to the Michaelis-Menten constant for an enzyme and is defined as the concentration of the specific substrate at which a given enzyme yields one-half its maximum velocity in an enzyme catalyzed reaction.
The term "nucleotide analog" as used herein refers to modified or non-naturally =
occurring nucleotides such as 7-deaza purines (i.e., 7-deaza-dATP and 7-deaza-dGTP).
Nucleotide analogs include base analogs and comprise modified forms of _ deoxyribonucleotides as well as ribonucleotides.
The term "polymorphic locus" is a locus present in a population which shows variation between members of the population (i.e., the most common allele has a frequency of less than 0.95). In contrast, a "monomorphic locus" is a genetic locus at little or no variations seen between members of the population (generally taken to be a locus at which the most common aliele exceeds a frequency of 0.95 in the gene pool of the population).
The term "microorganism!' as used herein means an organism too small to be observed with the unaided eye and,includes, but is not limited to bacteria, vinis, protozoans, fungi, and ciliates., .
The term "microbial gene sequences" refers to gene -sequences derived from a microorganism.
The term "bacteria" refers to any bacterial species including eubacterial and archaebacterial species.
The term "virus" refers to. obligate, ultramicrascopic, intracellular parasites incapable of autonomousreplication (i.e:, replication requiresthe use of-the host cell's machinery).
,Theterrn "multi-drug -resistant" or multiple-drug resistant" refers to a microorganism which is resistant to more: than one of the antibiotics or antirnicrobial agents used in the treatment of said microorganism.
The term "sample" in the present specification and claims is used-in its broadest sense.
On the one hand it is meant to include a specimen or culture (e.g., microbiological cultures).
On the other hand, it is meant to include both biological and environmental samples.
Biological, samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items;
vegetables, meat and meat by-products, and waste. Biological samples may be obtained from -, all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals- as ungulates, bear, fish, lagamorphs, rodents, etc. --= . .j~

Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples, are not to be construed as limiting the -sample types applicable to the present invention.
The term "source of target nucleic acid" refers to any sample which -contains nucleic acids (RNA or DNA). Particularly preferred sources of target nucleic acids aie biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
An oligonucleotide is said to be present in "excess" relative to another oligonucleotide (or target nucleic acid sequence) if that oligonucleotide is present at a higher molar concentration that the other oligonucleotide (or target nucleic acid sequence). When an oligonucleotide such as a probe oligonucleotide- is present in a cleavage reaction in excess relative to the concentration of the complementary target nucleic acid sequence, the reaction may be used to indicate the amount of the target nucleic acid present.
Typically, when present in excess, the probe oligonucleotide will `fie present at least a 100-fold molar excess;
typically at least I pmole of each probe oligonucleotide would be used when'the target nucleic acid sequence was present at about -10 fmoles or less.
A sample "suspected of containing" a first and a second target nucleic acid miLy contain either, both. or neither target nucleic acid molecule.
The term "charge-balanced" oligonucleotide refers to an oligonucleotide (the input oligonucleotide in a reaction) which has been modified such that the modified oligonucleotide bears a charge, such that when the modified oligonucleotide is either cleaved (i.eshortened) or elongated, a resulting product bears a charge different from the -input oligonucleotide (the "charge-unbalanced" oligonucleotide) thereby permitting separation of the input and reacted oligonucleotides on the basis of charge. The term "charge-balanced" does not imply that the modified or balanced oligonucleotide has a net neutral charge (although this can be the case).
Charge-balancing refers to the design and modification of an oligonucleotide such that a specific reaction product generated from this input oligonucleotide can be separated on the basis of charge 1 from the input oligonueleotide..
For example, in an lnvaderT"'-directed cleavage -assay in which the probe oligonucleotide bears the sequence: 5'-TTCTT'ITCACCAGCGAGACGGG-3' (i.e.; SEQ
ID
NO:50 without the modified bases) and cleavage of the probe occurs between the second and third residues, one possible charge-balanced version of this oligonucleotide would be:
5'-Cy3-AminoT-Amino-TCTT'ITCACCAGCGAGAC GGG-3'. This modified oligonucleotide bears a net negative charge. After cleavage, the following oligonucleotides are generated: 5'-Cy3-AminoT-Amino-T-3'and 5'-CT"TTTCACCAGCGAGACGGG-3' (residues 3-22 of SEQ ID NO:50). 5'-Cy3-AminoT-Amino-T-3' bears a detectable moeity (the positively-charged Cy3 dye) and two amino-modified bases. The amino-modified bases and the Cy3 dye contribute positive. charges in excess of the negative charges contributed by the phosphate groups and thus the 5'-Cy3-AminoT-Amino-T-3'oligonucleotide has a net positive charge. The other, longer cleavage fragment, like the input probe, bears 'a net negative charge. Because the 5'-Cy3-AminoT-Amino-T-3'fragment is separable on the basis of charge from the input probe (the.charge-balanced oligonucleotide), it is referred to as a charge-unbalanced oligonucleotide. The longer cleavage product cannot be separated on the basis of charge from the input oligonucleotide as both oligonucleotides bear a'net negative charge; thus, the longer cleavage-product: is. not a-charge-unbalanced oligonucleotide.
The term "net neutral charge" when used in reference to an oligonucleotide;
including modified. oligonucleotides, indic.ates~ thatAhe sum of the charges present (f:
e, R-h1H3+'groups on thymidines, the N3 nitrogen.of cytosine, presence or absence or phosphate groups, ete.) under the desired reaction conditions is essentially zero. An oligonucleotide-having ~anet neutral charge would not migrate in an electrical field.
The term "net positive charge" when used in reference to an oligonucleotide;
including modified oligonucleotides, indicates that-the sum. of the charges present (i.
e, R-NH3+ groups on thymidines, the. N3 nitrogen of ;cytosine, presence or absence or phosphate groups, etc.) under- the -desired reaction conditions is +l: or greater: An oligonucleotide having a-net positive charge would migrate toward the negative electrode in an electrical field:
The term "net negative charge" when used in reference to an okgonucleotide, -including modified oligonucleotides, indicates that the sum of the charges present (i, e, R-NH'+
groups on thymidines, the N3 nitrogen of cytosine, presence or absence or phosphate groups, etc.) under the desired reaction conditions is -1-or ~lower. An oligonucleotide having a net negative charge would migrate toward the positive electrode in an electrical;
field:` ' =
The term "polymerization means": refers to -any agent capable- of facilitating the addition of nucleoside triphosphates to an oligonucleotide. Preferred polymer'ization means ,<comprise-DNA polymerases:.

The term "ligation means" refers to any agent capable of facilitating the ligation (i.e., the formation of a phosphodiester bond between a 3'-OH and a 5'-P located at the termini of two strands of nucleic acid). Preferred ligation means comprise DNA ligases and RNA
ligases.
The term "reactant" is used herein in its broadest sense. The reactant can comprise an enzymatic reactant, a chemical reactant or ultraviolet light (ultraviolet light, particularly short wavelength ultraviolet light is known to break oligonucleotide chains). Any agent capable of reacting with an oligonucleotide to either shorten (i.e.; cleave) or elongate the oligonucleotide is encompassed within the term "reactant."
The term "adduct" is used herein in its broadest sense to indicate any compound or element which can be added to an oligonucleotide. An adduct may be charged (positively or negatively) or may be charge neutral. An adduct may be added to the oligonucleotide via covalent or non-covalent linkages. Examples of adducts, include but are not iimited to indodicarbocyanine dyes (e.g., Cy3 and Cy5), amino-snbstittited nucleotides, ethidium bromide, ethidium homodimer, (1,3-propanediamino)propidium, (diethylenetriamino)propidium,-thiazole orange, (NN'-tetramethy1-1;3-pr6panedianiiiio)propyl thiazole orange, (N-N'-tetramethyl-1,2-ethanediatnino)propyl thiazole orange, thiazole orange-thiazole orange homodimer (TOTO), thiazole orande-thiazole blue heterodimer (TOTAB), thiazole orange-ethidium heterodimer 1(TOEDI), thiazole orange-ethidium heterodimer 2 (TOED2) and florescien-ethidium heterodimer (FED), psoralens, biotin, streptavidin, avidin, etc:
Where a first oligonucleotide is complementary to a region of a target nucleic acid and a second <oligonucleotide has complementary to the same region (or a portion of this region) a "region of overlap" exists along the target nucleic acid. The Aegree of overtap will vary depending upon the nature of the complementarity (See e.g., region "X" inFigs.
25 and 56 and the accompanying discussions).
As used herein, the term "purified" or "to purify" -refers to the removal of contaminants from a sample. Forexample, recombinant CleavaseO -nucleases are expressed in. bacterial host cells and the nucleases are purified by the removal of host cell proteins; the = ~
percent. of these recombinant nucleases is thereby increased in the sample.
The term "recombinant DNA molecule" as used herein refers to aDNA- molecule which is comprised of segments of DNA joined together by means-of molecular biological techniques.

The term "recombinant protein" or "recombinant. polypeptide" as used herein refers to a protein molecule which is expressed from a recombinant DNA molecule.
As used herein the term "portion" when in reference to a protein (as in "a portion of a given protein") refers to fragments of that protein. The fragments may range in size from , four amino acid residues to the entire amino acid sequence minus one amino acid.
"Nucleic acid sequence" as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof; and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand. Similarly, "amino acid sequence" as used herein refers to peptide or protein sequence.
"Peptide nucleic acid" ("PNA") as used herein refers to a molecule which comprises an oligomer to which an amino acid residue, such as lysine, and an amino group have been added, These small molecules, also designated anti-gene agents, stop transeript elongation by binding to their complementary strand ofnucleie acid (Nielsen et al., Anticaneer Drug Des.
8:53-63 [1993].) As used herein, the terms "purified". or "substantially purified" refer to molecules, either nucleic or amino acid sequences, that are ;removed from their natural environment, isolated or..separated, and are at least 60o free, preferably 75% free, and most preferably 90% free_from other- components with which they are naturally associated: An "isola'ted polynucleotide" or "isolated oligonucleotide" is therefore a substantially purified polynucleotide.
An isolated oligonucleotide (or polynucleotide) -encoding a Pyrococcus woesei -(Pwo) F.EN-1 endonuclease_ having a region capable of hybridizing to :SEQ ID NO:80 is an oligonuclcotide containiiig sequences eneoding at least the- amino-terminal portion-of Pwo FEN-1 endonuclease. An isolated oligonucleotide (or polynucleotide) encoding a Pwo FEN-1 endonuclease having a region capable of hybridizing to SEQ ID: NO:8t is an oligotiucleotide containing sequences encoding at least the carboxy-terminal portion of Pwo FEN-endonuclease. An isolated oligonucleotide (or polynucleotide) encoding a Pwo endonuclease having a region capable of hybridizing to SEQ ID NOS:82 and 83 is an oligonucleotide containing sequences encoding at least portions of Pwo FEN-1 endonuclease protein located internal to either the amino or carboxy-termini*of the Pwo FEN=1 -.
endonuclease protein.
As used herein, the-term.,"fusion protein" refers to a chimeric protein containing the . .-protein of interest (i.e., Cleavase BN/thrombin nuclease and portions or fragments thereof) -- ~
WO 98142873 PCT/US98/05809:
joined to an exogenous protein fragment (the fusion partner which consists of a non-Cleavase BN/thrombin nuclease protein). The fusion partner may enhance solubility of recombinant chimeric protein (e.g., the Cleavase BN/thrombin nuclease) as expressed in a host cell, may provide an affinity tag (e.g., a his-tag) to allow purification of the recombinant fusion protein from the host cell or culture supernatant, or both. If desired, the fusion protein may be removed from the protein of interest (e.g., Cleavase BN/thrombin nuclease or fragments thereof) by a variety of enzymatic or chemical means known to the art.
The term "purified Pfu FEN-1 endonuclease having a'molecular weight of about 38.7 kilodaltons" refers to a FEN-1 endonuclease isolated from Pyrococcus woesei which has a molecular weight on SDS-PAGE gels of about 38.7 kDa when the SDS-PAGE is conducted under the conditions described in Ex. 28. Those skilled in the art understand that the same protein preparation applied to separate gels of apparently the same composition can yield estimated molecular weights which vary somewhat from one another'(approximately 5-15%).
The term "continuous strand of nucleic acid" as used herein is means a strand of nucleic acid that has a continuous, covalently linked, backbone structure, without nicks or other disruptions. The disposition of the base 'portion of each-nucleotide, whether base-paired, single-stranded or mismatched, is not an element in the definition of acontinuous strand. The backbone of the continuous strand is not limited to the ribose-phosphate or deoxyribose-phosphate compositions that are found in naturallyoccurring, unmodified nucleic acids. A nucleic acid of the present invention may comprise modifications in the 'structure of - the backbone, including but not limited to phosphorothioate residues, phosphoriate residues. 2' substituted ribose residues (e.g., 2'-O-methyl ribose) and alternative sugar (e.g., arabinose) containing . residues.
The term "continuous -duplex" as used herein refers to a region of double stranded nucleic acid in which there is no disruption in the -progression of basepairs within the duplex (i.e., the base pairs along the duplex are not distorted to accommodate a gap, bulge or mismatch with the confines of the region of continuousduplex). As used herein the term refers only to the arrangement of the basepairs within the duplex, without implication of continuity in the backbone portion of the nucleic acid strand: Duplex nucleic acids with uninterrupted basepairing, but with, nicks in one or both -strands' are within`the defmition of a continuous duplex.
The term "duplex" refers to the state of nucleic - acids in which the base portions of the nucleotides on one strand are bound through hydrogen bonding the their complementary bases '.. ^a ' = . , arrayed on a second strand. The condition of being in a duplex form reflects on the state of the bases of a nucleic acid. By virtue of base pairing, the strands of nucleic acid also generally assume the tertiary structure of a double helix, having a major and a minor groove.
The assumption of the helical form is implicit in the act of becoming duplexed. 5 The term "duplex dependent protein binding" refers to the binding of proteins to nucleic acid that is dependent on the nucleic acid being in a duplex,or helical form.
The term "duplex dependent protein binding sites or regions" as used herein refers to discrete regions or sequences within a nucleic acid that are bound with particular affmity by specific duplex-dependent nucleic acid binding proteins. This is in contrast to the generalized duplex-dependent binding of proteins that are not site-specific, such as the histone proteins that bind chromatin with little reference. to specific sequences or sites:
The term "protein binding region" as used herein refers to a nucleic acid region identified by a sequence or structure as binding to a particular protein or class of proteins. It is within the scope of this definition to include those regions that contain sufficient genetic information to allow identifications of the region by comparison to known sequences; but which might not have the requisite structure for actual binding (e.g., a singie-strand=of a duplex.-depending; nucleic acid binding-protein site). As used herein "protein b'tndingregion"
excludes restriction endonuclease binding regions.
The term "complete double stranded protein binding region" as used herein refers to the minimum region of continuous duplex required to allow binding or other activity of a duplex-dependent protein... This;-defuution is intended to-encompass the observation that some duplex dependent nucleic acid binding proteins can interact with full activity with regions of duplex that may be shorter than a canonical protein binding region as observed in one or the other of the two single strands. In other words, one or more nucleotides in the region may be allowed to remain unpaired without suppressing binding. As used here in, the term "complete double stranded. binding region" refers to the minimum sequence that will accommodate the binding function. Because some such regions can tolerate non-duplex sequenees in multiple places, although not necessarily simultaneously, a single protein binding region, might have several shorter sub-regions that, when duplexed, will be fully competent for protein binding. =
The term, "template",. ; refers to a strand of nueteie acid on whieh- a complementary copy is built from nucleoside triphosphates through the activity of a template-dependent nucleic acid polymeraSe., Within a duplex the template: strand is, by,convention, depicted = _~ ~ --~~
`..: =

and described as the "bottom" strand. Similarly, the non-template strand is often depicted and described as the "top" strand.
The term "template-dependent RNA polymerase" refers to a nucleic acid polymerase that creates new RNA strands through the copying of a template strand as described above and which does not synthesize RNA in the absence of a template. This is in contrast to the activity of the template-independent nucleic acid polymerases that synthesize or extend nucleic acids without reference to a template, such as terminal deoxynucleotidyl transferase, or Poly A polymerase.
. The term "ArrestorTM" refers to an agent added to or included in an invasive cleavage reaction in order to stop one or more reaction components from participating in a subsequent action or reaction. This may be done by sequestering or inactivating some reaction component (e.g., by binding or base-pairing a nucleic acid component, or by binding to a protein component). The term "ArrestorT"' oligonucleotide" refers to an oligonucleotide included in an invasive cleavage reaction in order to stop or arrest one or more aspects of any reaction (i.e., the first reaction and/or any subsequent reactions or actions;
it is not intended that the ArrestorTM oligonucleotide be limited to any particular reaction or reaction step):
This may be done by sequestering some reaction component (e.g., base-pairing to another nucleic acid, or binding to a protein component). However, it is not intended that the term be so limited as to just situations in which a reaction component is sequestered.
-DESCRIPTION OF THE INVENTION
The present invention relates to methods and compositions fortreating nucleic acid, and in.particular, methods and compositions foudetection and characterization of nucleic acid sequences and sequence changes.
The present invention relates to means for cleaving a nucleic acid cleavage structure in a site-specific manner. In particular, the present invention relates to a cleaving enzyme having 5' nuclease activity without interfering nucleic acid synthetic ability.
This invention provides 5' nucleases derived from thermostable DNA polymerases which exhibit altered DNA synthetic activity from that of native thermostable DNA
polymerases. The 5' nuclease activity of the polymerase is retained while the synthetic activity, is reduced or absent. Such 5' nucleases are capable of catalyzing the structure-specific cleavage of nucleic acids, in=the absence:of interfering synthetic activity. The lack of synthetic activity during a cleavage reaction results in nucleic acid cleavage products of uniform size.
The novel properties of the nucleases of the invention form the basis of a method of detecting specific nucleic acid sequences. This method relies upon -the amplification of the detection molecule rather than upon the amplification of the target sequence itself as do existing methods of detecting specific target sequences. =_ DNA polymerases (DNAPs), such as those isolated from E. coli or from thermophilic bacteria of the genus Thermus, are enzymes that synthesize new DNA strands.
Several of the known DNAPs contain associated nuclease activities in addition to the synthetic activity of the enzyme. -Some DNAPs are known to remove nucleotides from the 5' and 3' ends of DNA
chains (Kornberg, DNA Replication, W.H. Freeman and Co., San Francisco, pp.

[1980]). These nuclease activities are usually referred to ias 5' exonuclease and 3' exonuclease activities, respectively. For, example; the 5' exonuclease activity located in the N-terminal domain of = several, DNAPs participates in the removal of RNA
primers during lagging. strand: synthesis during DNA replication and the removal of damaged nucleotides during repair. Some DNAPs, such as the E. coli DNA polymerase (DNAPEcl), also have a 3' exonuclease activity responsible for proof-reading during DNA synthesis (Kornberg, supra).
A DNAP isolated from Thermus aquaticus, termed Taq DNA polymerase (DNAPTaq);
has a 5' exonuclease activity, but -laeks a funetionai =3'~=exonucleolytic domain (Tirrdafl and Kunkell, Biochem., 27:6008 [1988]). Derivatives :of DNAPEcI and DNAPTaq;
respectively called the Klenow and Stoffel fragments, lack 5' exonuclease domains as aresult of -enzymatic or genetic manipulations (Brutlag et al., Biochem. Biophys. Res.
Commun. 37:982 [1969]; Erlich et aL, Science 252:1643 [1991]; Setlow and Kornberg, J. Biol.
Chem. 247:232 [19721).
The 5' exonuclease activity of DNAPTaq was reported to require concurrent synthesis (Gelfand, in PCR Technology - Principles and Applications for DNA
Amplifrcation Erlich, (Ed.), Stockton Press, New York, p. 19 [1989]). Although mononucleotides predorninate among the digestion products of the 5' exonucleases of DNAPTaq and DNAPEc1, short oligonucleotides (_ 12 nucleotides) can also be observed implyitig'that, these so-called 5' exonucleases can fimction endonucleolyticalIy- (Setlow, supra; Holland et`al:;
Proc.- Natl.
Acad. Sci. USA 88:7276 [1991]).

In WO 92/06200, Gelfand et al. show that the preferred substrate of the 5' exonuclease activity of the thermostable DNA polymerases is displaced single-stranded DNA.
Hydrolysis of the phosphodiester bond occurs between the displaced single-stranded DNA and the double-helical DNA with the preferred exonuclease cleavage site being a phosphodiester bond in the double helical region. Thus, the 5' exonuclease activity usually associated with DNAPs is a structure-dependent single-stranded endonuclease and is more properly referred to as a 5' nuclease. Exonucleases are enzymes which cleave nucleotide molecules from the ends of the nucleic acid molecule. Endonucleases, on the other hand, are enzymes which cleave the nucleic acid molecule at internal rather than terminal sites. The nuclease activity associated with some thermostable DNA polymerases cleaves endonucleolytically but this cleavage requires contact with the 5' end of the molecule being cleaved.
Therefore, these nucleases are referred to as 5' nucleases.
When a 5' nuclease activity is associated with a eubacterial Type A DNA
polymerase, it is found in the one-third N-terminal region of the protein as an independent functional domain. The C-terminal two-thirds of the molecule constitute the polymerization domain which is responsible for the synthesis of DNA. Some Type A DNA polymerases also have a 3' exonuclease activity associated with the two-third C-terminal region of the molecule., The 5' exonuclease activity and the polymerization activity of DNAPs have been separated by proteolytic cleavage or genetic manipulation of the polymerase molecule. To date thermostable DNAPs have been modified to remove or reduce the amount of 5' nuclease activity while _leaving the. pol_ymerase- activity intact.
The Klenow or large proteolytic cleavage fragment of DNAPEc1 contains the polymerase and 3' exonuclease activity but lacks the 5' nuclease activity. The Stoffel fragment of DNAPTaq (DNAPStf) lacks the 5' nuclease activity due to a genetic manipulation which deleted the N-terminal 289 amino acids of the polymerase molecule (Erlich et al., Science 252:1643 [1991]). WO 92/06200 describes a thermostable DNAP with an altered level of 5' to 3' exonuclease. U.S. Patent No. 5,108,892 describes a Thermus aquaticus DNAP without a 5' to 3' exonuclease. However, the art of molecular biology lacks a thermostable DNA polymerase with a lessened amount of synthetic activity.
The present invention provides 5' nucleases derived from thermostable Type A
DNA
polymerases that retain 5' nuclease activity but have reduced or absent synthetic activity. The ability to uncouple the synthetic activity of the enzyme- from the 5' nuclease activity proves that the 5' nuclease activity does not require concurrent DNA synthesis as was previously reported (Gelfand, PCR Technology, supra).
The description of the invention is divided into: I. Generation of 5' Nucleases Derived From Thermostable DNA Polymerases; II. Detection of Specific Nucleic Acid Sequences Using 5' Nucleases in an InvaderTM-Directed Cleavage Assay; III. A
Comparison Of Invasive Cleavage And Primer-Directed Cleavage; IV. Fractionation Of Specific Nucleic .
Acids By Selective Charge Reversal; V. InvaderTM-Directed Cleavage Using Miniprobes And Mid-Range Probes; VI. Signal Enhancement By Tailing Of Reaction Products In The InvaderTM-Directed Cleavage Assay; VII. Improved Enzymes For Use In InvaderTM-Directed Cleavage Reactions; VIII. Signal Enhancement By Completion Of An Activated Protein Binding Site; IX. Signal Enhancement By Incorporating The Products Of An Invasive Cleavage Reaction Into A Subsequent Invasive Cleavage Reaction; X. Detection of Human Cytomegalovirus Viral DNA By Invasive Cleavage; and XI. Effect of ArrestorTM
Oligonucleotides on Signal and Background in Sequential Invasive Cleavage Iteactions.
1. GeneraNon Of 5' Nucleases From Thermostable DNA Polymerases The,.genes encoding Type A DNA polymerases share about 85% homology to each other on the DNA sequence. level. Preferred examples of thermostable polymerases include those isolated from. Thermus aquaticus, Thermus fiavus, and_ Thermus thermophilus.
However, other,thermostable Type.A polymerases which have 5' nuclease activity are.~also suitable. Figs. 1 and 2 compare the- nucleotide and- amino acid -sequences of the-three- above mentioned :polymerases. In Figs. 1 and 2, :the consensus or majority sequence derived from a comparison; of the nucleotide (Fig. 1) or amino acid (Fig. 2) sequence of the three thermostable DNA polynierases is shown on the top line. A dot appears in the sequences of each of these three polymerases whenever an amino acid residue in a given sequence is identical to that contained in the consensus amino acid sequence. Dashes are used to introduce gaps in order to, maximize alignment between the displayed sequences. When no consensus nucleotide or amino acid is present at a given position, :an "X" is placed in the consensus sequence. SEQ ID NOS:1-3 display the nucleotide sequences and SEQ ID
NOS:4- =
display.,the amino acid sequences of the three wild-type polymerases.= SEQ ID
NO:1 corresponds, to the. nucleic acid sequence of the wild type Thermus,aquaticus DNA ... =-polymerase gene isolated from the YT-I strain (Lawyer et al:; J. Biol. Chem., 264:6427 [1989]). SEQ ID. NO:2 corresponds to the nucleic acid sequence of the wild type Thermus flavus DNA polymerase gene (Akhmetzjanov and Vakhitov, Nucl. Acids Res., 20:5839 [1992]). SEQ ID NO:3 corresponds to the nucleic acid sequence of the wild type Thermus thermophilus DNA polymerase gene (Gelfand et al., WO 91/09950 [1991]). SEQ ID
NOS:7-8 depict the consensus nucleotide and amino acid sequences; respectively for the above three DNAPs (also shown on the top row in Figs. 2 and 3).
The 5' nucleases of the invention derived from thermostable polymerases have reduced synthetic ability, but retain substantially the same 5' exonuclease activity as the native DNA
polymerase. The term "substantially the same 5' nuclease activity" as used herein means that the 5' nuclease activity of the modified enzyme retains the ability to function as a structure-dependent single-stranded endonuclease but not necessarily at the same rate of cleavage as compared to the unmodified enzyme. Type A DNA polymerases may also be modified so as to produce an enzyme which has increases 5' nuclease activity while having a reduced level of synthetic activity. Modified enzymes having reduced synthetic activity and increased 5' nuclease activity are also envisioned by the present invention.
By the term "reduced synthetic activity" as used herein it is meant that the modified enzyme has less than the level of synthetic activity found in the umnodified or "native"
enzyme. The modified enzyme may have no synthetic activity remaining ormay have that level of synthetic activity that will not interfere with the use of the modified enzyme in the detection assay described below. The 5' nucleases of the present invention are advanfageous in situations where the cleavage activity of the polymerase is desired, but the synthetic ability is not (such as in the detection assay of the invention).
As noted above, it is not intended that the invention be limited by the nature of the alteration necessary to render the polymerase synthesis deficient. The present invention contemplates a variety of methods, including but not limited to: 1) proteolysis; 2) recombinant constructs (including mutants); and 3) physical and/or chemical modification and/or inhibition.

1. Proteolysis Thermostable DNApolymerases having a reduced level of synthetic activity are produced by physically cleaving the unmodified enzyme with proteolytic enzymes to produce fragments.of the enzyme that are deficient in synthetic activity but retain 5' nuclease activity.
Following proteolytic digestion, the resulting fragments are separated by standard chromatographic techniques and assayed for the ability to synthesize DNA and to act as a 5' ... l .

WO 98/42873 PCT/US98/05809' nuclease. The assays to determine synthetic activity and 5' nuclease activity are described below.

2. Recombinant Constructs The examples below describe a preferred method for creating a construct encoding a 5' nuclease derived from a thermostable DNA polymerase. As the Type A DNA
polymerases -=
are similar in DNA sequence, the cloning strategies employed for the Thermus aquaticus and flavus polymerases are applicable to other thermostable Type A polymerases. In general, a thermostable DNA polymerase is cloned by isolating genomic DNA using molecular biological methods from a bacteria containing a thermostable Type A DNA
polymerase. This genomic DNA is exposed.to primers which are capable of amplifying the polymerase gene by PCR.
This amplified polymerase sequence is then subjected to standard deletion processes to delete the polymerase portion of the gene. 1 Suitable.deletion processes are' described lbelow in the examples.
The example below discusses-the strategyusedto determine whick portions"of the DNAPTaq polymeraSe domain could be removed without eluninating'the 5' nuclease activity.
Deletion of amino acids from, the protein-can:be done either by deletion of=the eneoding genetic material, or by introduction of a translational stop -codon by rnutation or frathe shift.
In addition, proteolytie ueatment of the protein molecule can be performed to=
temv`ve segments of the protein.
ln the examples be:low, specific alterations of the Taq gene' were, n'deletion between nucleotides 1601 and 2502 {the end- of the coding region), =a 4 nucleotide inserC~oir at'position 2043, and deletions between- nucleotides : L614 and 1848, and between nucleotides 875 - arid 1778 (numbering is as in SEQ ID NO:1). These modified sequences are-described below in the examples and at SEQ ID NOS:9-12.
Those slcilled in the art understand that single base pair changes can be innocuous in terms of enzyme structure and function. Similarly, small additions aiid deletions can be present without substantially changing the exonuclease or polymerase~
funetion{of these 30 _ enzymes. : = -Other deletions are also suitable tocreate the 5' nucleases of the present-invention. It is preferable that the, deletion decrease -the polymerase activity of"the 5' riuclegses to a level at which synthetic activity: will not interfere with the use of the = 5' nuclease in the detection assay of the invention. Most preferably, the synthetic ability is absent.
Modified polymerases are tested for the presence of synthetic and 5' nuclease activity as in assays described below. Thoughtful consideration of these assays allows for the screening of candidate enzymes whose structure is heretofore as yet unknown. In other words, construct "X" can be evaluated according to the protocol described below to determine whether it is a member of the genus of 5' nucleases of the present invention as defined functionally, rather than structurally.
In the example below, the PCR product of the amplified Thermus aquaticus genomic DNA did not have the identical nucleotide structure of the native genomic DNA
and did not have the same synthetic ability of the original clone. Base pair changes which result due to the infidelity of DNAPTaq during PCR amplification of a polymerase gene are also a method by which the synthetic ability of a polymerase gene may be inactivated. The examples below and Figs. 3A and 4A indicate regions in the native Thermus aquaticus and flavus DNA
polymerases likely to be important for synthetic ability. There are other base pair'- changes and substitutions that will likely also inactivate the polymerase.
It is not necessary, however, that one start out the process of producing w5' nuclease from a DNA polymerase with such, a mutated amplified product. This is themethod by which the examples below were performed to generate the synthesis-deficientDNAPTaq mutants, but it is understood by those skilled in the art that a wild-type DNA
polymerase sequence may be used as the starting material for the introductionof deletions; insertion and substitutions to produce a 5' nuclease. For example, to generate the synthesis-deficient DNAPTfl mutant, the primers listed in SEQ ID NOS:13-14 were used to amplify the wild type DNA polymerase gene from Thermus flavus strain AT-62. The amplified polymerase gene was then subjected to restriction enzyme digestion to delete a large portion of the domain encoding the synthetic activity.
The present invention contemplates that the nucleic acid construct of the present invention be capable of expression in a suitable host. Those in the art know methods for attaching various promoters and 3' sequences to a gene structure to achieve efficient expression. The examples below disclose two suitable vectors and six suitable vector constructs. Of course, there are other promoter/vector combinations that would be suitable.
It is. not necessarythat a host organism. be used for the expression of the nucleic acid constructs of the invention. For example, expression of the protein.encoded by a nucleic acid construct may be achieved. through the use of a cell-free in vitro transcription/translation system. An example of such a cell-free system is the commercially available TnTTM Coupled Reticulocyte Lysate System (Promega).
Once a suitable nucleic acid construct has been made, the 5' nuclease may be produced from the construct. The examples below and standard molecular biological teachings enable one to manipulate the construct by different suitable methods.
Once the 5' nuclease has been expressed, the polymerase is tested for both synthetic and nuclease activity as described below.

3. Pbysical And/Or Cbemical Modification And/Or Inbibition The synthetic activity of a thermostable DNA polymerase may be reduced by chemical and/or physical means. In one embodiment, the cleavage reaction catalyzed by the 5' nuclease activity of the polymerase is run under conditions which preferentially inhibit the synthetic activity of the polymerase. The level of synthetic activity need only be reduced to that level of activity which does not interfere with cleavage reactions requiring no significant synthetic activity. As shown in the examples below, concentrations of MC
greater than 5 mM inhibit the polymerization activity of the native DNAPTaq. The ability of the 5' nuclease to function under conditions where synthetic activity is inhibited is tested by running the assays for synthetic and 5' nuclease activity, described below, in the presence of a range of Mg'"
concentrations (5 to ] 0 mM). The effect of a given concentration of Mg" is determined by quantitation of the amount of synthesis and cleavage in the test reaction as compared to the standard reaction for each assay.
The inhibitory effect of other ions, polyamines, denaturants,.such as urea, formamide, * *
dimethylsulfoxide, glycerol and non-ionic detergents (Triton X-100 and Tween-20), nucleic acid binding chemicals such as, actinomycin D, ethidium bromide and psoralens, are tested by their addition to the standard reaction buffers for the synthesis and 5' nuclease assays. Those compounds having a preferential inhibitory effect on the synthetic activity of a thermostable polymerase are then used to create reaction conditions under which 5' nuclease activity (cleavage) is retained while synthetic activity is reduced or eliminated.
Physical means may be used to preferentially inhibit the synthetic activity of a polymerase. For example, the synthetic activity of thermostable polymerases is destroyed by exposure of the polymerase to extreme heat (typically 96 to 100 C) for extended periods of *Trade-mark time (greater than or equal to 20 minutes). While these are minor differences with respect to the specific heat tolerance for each of the enzymes, these are readily determined.
Polymerases are treated with heat for various periods of time and the effect of the heat treatment upon the synthetic and 5' nuclease activities is determined.
II. Detection Of Specific Nucleic Acid Sequences Using 5' Nucleases In An InvaderTM-Directed Cleavage Assay The present invention provides means for forming a nucleic acid cleavage structure which is dependent upon the presence of a target nucleic acid and cleaving the nucleic acid cleavage structure so as to release distinctive cleavage products. 5' nuclease activity is used to cleave the target-dependent cleavage structure and the resulting cleavage products are indicative of the presence of specific target nucleic acid. sequences in the sample.
The present invention further provides assays in which the target nucleic acid is reused or recycledduring multiple rounds of.hybridization with oligonucleotide probes and cleavage without the need to use temperature cycling (i.e:; for periodic denaturation of target nucleic acid strands) or nucleic acid synthesis (i.e., for the displacement of target`nucleic acid strands). Through the interaction of the cleavage means (e.g:, a 5' nuclease) an upstream oligonucleotide, the cleavage means can be made to cleave a downstream oligonucleotide at an internal site in such a way that the resulting fragments of the downstream oligonucleotide dissociate from the target nucleic acid, thereby making that region of the target nucleic acid available for hybridization to another, uncleaved copy of the dowiistream oligonucleotide.
As illustrated in Fig. 25, the methods of the present invention employ' at least a pair of oligonucleotides that interact with a target nucleic acid to form a cleavage structure 'for a structure-specific nuclease., More specifically, the cleavage structure comprises: i) a target nucleic acid that may be either single-siranded or double-stranded (when a double-stranded target nucleic acid is employed; it may be rendered single stranded (e.g., by heating); ii) a first oligonucleotide, termed the "probe," which defines a first region of the target nucleic acid sequence by being the complement of that region (regions X and Z of the target as shown in Fig. 25); and iii) a second oligonucleotide, termed the "InvaderTm;"
the 5' part of which defines a second region of the same target nucleic acid sequence (regions Y and X in Fig. 25), adjacent to and downstream of the first target region (regions X and Z), and the second part of which overlaps into the region defined by the first oligonucleotide (region X
depicts the region of overlap). The resulting structure is diagrammed in Fig.
25.

. _ _ ...."'~_~ .

While not limiting the invention or the instant discussion to any particular mechanism of action, the diagram in Fig. 25 represents the effect on the site of cleavage causedby this type of arrangement _of a. pair of oligonucleotides. The design of such a pair of oligonucleotides is described below in detail. In Fig. 25, the 3' ends of the nucleic acids (i.e., the target and the oligonucleotides) are indicated by the use of the arrowheads on the ends of the lines depicting the strands of -the nucleic: acids (and where space permits, these ends are =
also labelled '3 "'). It is readily appreciated that the two oligonucleotides (the InvaderTM and the probe) are arranged in a parallel orientation relative to one another, while the target nucleic acid strand is arranged in an: anti-parallel orientation relative to the two oligonucleotides. Further it is clear that the InvaderT"' oligonucleotide is located upstream of the probe oligonucleotide and that with respect to the target nucleic acid strand, region Z is upstream of region X and region X is upstream of region Y (that is region Y is downstream of region.X_ and region. X. is downstream of region Z). Regions of complementarity between the opposing strands.are indicated by the short vertical line& Wle not interided "to indicate the precise location of the site(s) of cleavage, the area to which the site of'cleavage within the probe oligonucleotide is shifted by. the presence of the InvaderTM
bligonucleotide is ` indicated by the solid vertical arrowhead. An alternative representation of the target/InvaderTm/probe cleavage structure.is.shown in Fig. 28C. Neither diagram (i.e.; Fig. 25 or Fig: 28C) is intended to. represent the actual mech.anism of action or physical arrangement of the cleavage structure and further it is not intended that the method of the present invention, be liniited to any particular meahanism of action.
It can be considered that the binding of these oligonucleotides divides the target ,nucleic acid into three distinct regions: one region that has,complementarity to only the probe (shown.as "Z"); one region that has complementarity on1y to the InvaderTm (shown as "Y"); and, one region that has complementarity to both oligonucleotides (shown as "X").
Design of these oligonucleotides (Le., the InvaderTM:and the probe) is accomplished using practices which are standard in the art. For example, sequences that have self complementarity, such that the resulting oligonucleotides would either fold upori themselves, or hybridize to, each other at the expense of binding to the target nucleic aeid,= are generally avoided.
One. consideration:in choosing a length for these oligonucleotides is the complexity of the sample containing the target nucleic aci& For, example, the human genoma is --approximately 3 x 109 basepairs in length. Any 10 _ nucleotide sequence will, appear with a frequency of 1:410, or 1:1048,576 in a random string of nucleotides, which would be approximately 2,861 times in 3 billion basepairs. Clearly an oligonucleotide of this length would have a poor chance of binding uniquely to a 10 nucleotide region within a target having a sequence the size of the human genome. If the target sequence were within a 3 kb plasmid, however, such an oligonucleotide might have a very reasonable chance of binding uniquely. By this same calculation it can be seen that an oligonucleotide of 16 nucleotides (i.e., a 16-mer) is the minimum length of a sequence which is mathematically likely to appear once in 3 x 109 basepairs.

A second consideration in choosing oligonucleotide length is the temperature range in which the oligonucleotides will be expected to function. A 16-mer of average base content (50% G-C basepairs) will have a calculated T. (the temperature at which 50% of the sequence is dissociated) of about 41 C, depending on, among other things; the concentration of the oligonucleotide and its target, the salt content of the reaction and the precise order of the nucleotides. As a practical matter, longer oligonucleotides are usually chosen -to enhance the specificity of hybridization. Oligonucleotides 20 to 25 nucleotides in'length are often used as they are highly likely to be specific if used in reactions conducted at temperatures which are near their Tms (within about 5 of the T,,). In addition, with calculated Tms in the range of 50 to 70 C, such oligonucleotides (i.e, 20 to 25-mers) are appiopriately used in reactions catalyzed by thermostable enzymes, which often display optimal activity near this temperature range.
The maximum length of the oligonucleotide chosen is also based on the desired specificity. One must avoid choosing sequences that are so longthat they' are either at a high risk of binding, stably to partial complements, or that they cannot easily be dislodged when desired (e.g., failure to disassociate from the target once cleavage has occurred). ' The first step of design and selection of the oligonucleotides for the InvaderTM-directed cleavage is in accordance with these sample general principles. Considered as sequence-specific probes individually, each oligonucleotide may be selected according to the guidelines listed above. That is to say, each oligonucleotide will generally be long enough to be reasonably expected to hybridize only to the intended target sequence within a complex sample, usually in the 20 to 40 nucleotide range. Alternatively, because the InvaderTM-directed cleavage assay depends upon the concerted action of these oligonucleotides, the composite length of the 2 oligonucleotides which span/bind to the X, Y, Z
regions may be selected to fall within:this-range, with each of the individual oligonucleotides being in -~ -~
WO 98/42873 PCT/US98/05809 `=
approximately the 13 to 17 nucleotide range. Such a design might be employed if a non-thermostable cleavage means were employed in the reaction, requiring the reactions to be conducted at a lower temperature than that used when thermostable cleavage means are employed. In some instances, it may be desirable to have these oligonucleotides bind multiple times within a target nucleic acid (e.g., which bind to multiple variants or multiple similar sequences within a target): It is not-intended that the method of the present invention '-be limited to any particular size of the probe or InvaderTM oligonucleotide.
The second step of designing an oligonucleotide pair for this assay is 'to choose the degree to which the upstream "InvaderTM" oligonucleotide sequence will overlap into the downstream "probe" oligonucleotide sequence, and consequently, the sizes into which the probe will be cleaved. A key feature of this assay is that the probe oligonucleotide can be made to "turn over," that is to say cleaved probe can be made to depart to allow the binding and cleavage of other copies of the probe molecule, without the requirements of thermal denaturation or dxsplacement .by polymerization. While in one embodimcnt of this "assay . probe turnover may be-facilitated by an exonucleolytic digestion by the cleavage'ia'gent;' it is central to the present. invention that the :turnover; does not re guire this exonucleolytic gctivity.
Choosing The Amount Of Overlap (Length Of The X;Region) One way of accomplishing such turnover can be envisioned: -by considering the diagram in Fig. 25. It can be seen that the T. of each oligonucleotide, will be a functien of the, full length of that oligonueleotide (Y. e., the T~, of the InvaderTM =
Tw,r,.X); and the Tm of the,:probe = TõoX+Y) for the probe).k When the probe is cleaved the X region is relea-sed;
leaving the Z section. If the T,~ of.Z- is less than,the reaction temperature, and the reaction temperatureis less than the TkX,zr, then cleavage of the probe will IYead to the departiire of Z, thus allowing a new (X+Z) to =hybridize. It-can be seen fromt this example that the X region must be sufficiently long that ;the release of X will drop the Tm of the remaining~, probe section below the reaction temperature: a G-C rich X section may be much shorter than an A-T rich X section and still accomplish this stability shifft.

Designing Oligonucleotides Which Interact With The Y And Z Regioas_ If the binding of the InvaderTM oligonucleotide to the target is more stable thatt the binding of the probe (e.g, if ,it- is long, or is rich in G-C basepairs in the Y regionl; then the copy of X associated with the InvaderTM may be favored -in the competition for binding to the -~, ` i X region of the target, and the probe may consequently hybridize inefficient~, and the assay may give low signal. Alternatively, if the probe binding is particularly strong in the Z region, the InvaderT"' will still cause internal cleavage, because this is mediated by the enzyme, but portion of the probe oligonucleotide bound to the Z region may not dissociate at the reaction temperature, turnover may be poor, and the assay may again give low signal.
It is clearly beneficial for the portions of the oligonucleotide which interact with the Y
and Z regions so be similar in stability (i.e., they must have similar melting temperatures).
This is not to say that these regions must be the same length. As noted above, in addition to length, the melting temperature will also be affected by the base content and the specific sequence of those bases. The specific stability designed into the InvaderTM
and probe sequences will depend on the temperature- at which one desires to perform the reaction.
This discussion is intended to illustrate that (within the basic guidelines for oligonucleotide specificity discussed above) it is 'the balance achieved between the stabilities of the probe and InvaderTM sequences and their X and Y component sequences, rather than the absolute values of these stabilities, that is the chief consideration in the selection 'of the probe and InvaderT"i sequences.

Design Of The Reaction Conditions Target nucleic acids that may be analyzed using the methods of -the present invention which employ a 5' nuclease as the cleavage means include many types of both RNA and DNA. Such nucleic acids may be obtained using standard molecular biological techniques.
For example, nucleic acids (RNA or DNA) may be isolated -from a tissue sample (e.g, a biopsy specimen), tissue culture cells, samples containing bacteria and/or viruses (including cultures of bacteria and/or viruses), etc. The target nucleic acid may also be transcribed in vitro from a DNA template or may be chemically synthesized or generated in a PCR.
Furthermore, nucleic. acids may be isolated from an organism,'either as genomic material or as a plasmid or similar extrachromosomal DNA, or they` may be a fragment of such material generated by treatment with a restriction endonuclease orother cleavage agents or it may be synthetic.
Assembly of the target, probe, and InvaderT"' nucleic acids into the cleavage reaction of the present invention uses principles commonly used in the design of oligonucleotide base enzymatic assays, such as dideoxynucleotide sequencing and polymerase chain reaction (PCR). As is done in these assays, the oligonucleotides are provided in sufficient excess that , ~.

4_.. = .

the rate of hybridization to the target nucleic acid is very rapid. These assays are commonly performed with 50 fmoles to 2 pmoles of each oligonucleotide per l of reaction mixture. In the Examples described herein, amounts of oligonucleotides ranging from 250 fmoles to 5 pmoles per l of reaction volume were used. These values were chosen for the purpose of ease in demonstration and are not intended to limit the performance of the present invention to these concentrations. Other (e.g., lower) oligonucleotide concentrations commonly used in other molecular biological reactions are also contemplated.
It is desirable that an lnvader''"' oligonucleotide be immediately available to direct the cleavage of each probe oligonucleotide that hybridizes to a target nucleic acid. For this reason, in the Examples described herein, the InvaderTM oligonucleotide is provided in excess over the probe oligonuclcotide; often this excess is 10-fold. While this is -an effective,ratio, it is not intended that the practice of the present invention be liniited to any particular ratio of InvaderTM-to-probe (a ratio of 2- to 100-fold is cQntemplated).
Buffer conditions,must be chosen that will he compatible with both thc oligonucleotide/target hybr.idiza.tion: and ;with the activity of the cleavage agent. - The optimal buffer conditions for nucleic acid modification enzymes, =and ;particularly DNA modification enzymes, generally included enough mono- and di-valent salts to allow association of nucleic acid strands by base-pairing. If the method : of, the= present invention is performed using an enzymatic cleavage agent other than those specifically described here, the reactions may generally be;performedinany such buff, er,repprted to>be optimal for the nuclease Rinction of the cleavage agent. In general, to test the utility of any cleavage agent in this method, test reactions are perfonned wherein the cleavage agent of interest is tested - in the 1v1OPS/MnC12/KCl buffer,. or Mg-containing buffers described herein and in whatever buffer has been reported to be suitable for use with #hat agent, in a manufacturer's data sheet, a journal article, or in personal communication.
The products of the InvaderTM-dire,cted cleavage reaction are fragments generated by structure-specific cleavage of the input oligonucleotides. The resulting cleaved and/or uncleaved oligonucleotidesmay be analyzed and resolved by a number of methods including electrophoresis (on a variety of supports including acrylamide or agarose gels, paper, etc.), =
chromatography, fluorescence polarization, mass spectrotnetry: and chip hybridization. The invention is illustrated using electrophoretic separation for the analysis of the products of the cleavage reactions. However, it is noted that the resolution of the cleavage , products is not limited to electrophoresis. Electrophoresis is chosen to illustrate ;the method.of the invention because electrophoresis is widely practiced in the art and is easily accessible to the average practitioner.
The probe and InvaderTM oligonucleotides may contain a label to aid in their detection following the cleavage reaction. The label may be a radioisotope (e.g., a 32P
or 35S-labelled nucleotide) placed at either the 5' or, 3' end of the oligonucleotide or alternatively, the label may be distributed throughout the oligonucleotide (i.e., a uniformly labelled -oligonucleotide).
The label may be a nonisotopic detectable moiety, such as a fluorophore, which can be detected directly,or a reactive group which permits specific recognition by a secondary agent.
For example, biotinylated oligonucleotides may be detected by probing with a streptavidin molecule which is coupled to an indicator (e.g., alkaline phosphatase or a fluorophore) or a hapten such as digoxigenin may be detected using a specific antibody coupled to a similar indicator.

Optimization Of Reaction Conditions The InvaderTM-directed cleavage reaction is usefultodetect the presence of specific nucleic acids. In addition to the considerations listed above for the selection and design of the InvaderT"' and probe oligonucleotides; the conditions under which the reaction is to be performed may be optimized for detection of a specific target sequence.
One objective in optimizing the- InvaderTM=directed cleavage assay is to allow'specific detection-of the fewest copies of atarget nucleic -acid: To achieve this end, it is desirable that the combined elements of the reaction interact with the maximum efficiency, so that I the rate of the reaction (e.g., the number of cleavage events'per-minute) is maximized.
Elements-contributing to the overall efficiency of-the reaction include the rate of hybridization,'the rate of cleavage, and the efficiency of the release of the cleaved -probe.
The rate of cleavage will be a function of the cleavage means chosen, and may be made optimal according to the manufacturer's instruetions when using commercial preparations of enzymes or as described in the examples fierein: The other elements (rate of hybridization, efficiency of release) depend upon the execution of the reaction, and optimization of these elements is discussed below.
Three elements of the cleavage reaction that significantly affect the- rate of nucleic acid hybridization are.the concentration of the nucleic acids, the temperature at which the cleavage reaction is performed and the concentration -of salts and/or other charge-shielding ions in the reaction solution.

-. --~, The concentrations at which oligonucleotide probes are used in assays of this type are well known in the art, and are discussed above. One example of a common approach to optimizing an oligonucleotide concentration is to choose a starting amount of oligonucleotide for pilot tests; 0.01 to 2 M is a concentration range used in many oligonucleotide-based assays. When initial cleavage reactions are performed, the following questions may be asked of the data: Is the reaction performed in the absence of the target nucleic acid substantially free of the cleavageproduct?; Is the site of cleavage specifically shifted in accordance with the design of the InvaderTM oligonucleotide?; Is the specific cleavage product easily detected in the presence of the uncleaved probe (or is the amount of uncut material overwhelming the chosen visualization method)?
A negative answer to any of these questions would suggest that the probe concentration is too high, and that a set of reactions using serial dilutions of the probe should be performed until the appropriate amount is identified. Once identified for a givcn target nucleic acid in a give sample type (e.R.; purified genomic DNA, body fluid extract, lysed bacterial extract), it should not need to be re-optimized. The sample type is important because the complexity of the material -present may infiuenceAhe probe optimutri:
Cpnversely, if the,chosen initial. probeooncentration is too low, the reaction may be slow, due to inefficient hybridization. Tests,with increasing quantities of the probe will identify the point at which the concentration exceeds the optimum. Since the hybridization will be facilitated by excess of probe, it is desirable, but not required, that the reaction be performed using probe concentrations just below this point.
The concentration of InvaderTM oligonucleotide dan be chosen based on the design considerations discussed. above. In a preferred embodiment, the InvaderTm oligonucleotide is in-excess-of the probe oligonucleotide. In a particularly preferred embodiment, the InvaderTm is approximately 10-fold more abundant than the probe.
. Temperature is also an important factor in the hybridization _of oligonucleotides. The .range of temperature tested .will depend in large part, on the design of the oligonucleotides, as discussed above. In a preferred embodiment, the reactions are performed at temperatures slightly below the T. of the least stable oligonucleotide in the reaction.
Melting temperatures for the oligonucleotides and for their component regions (X, Y and Z, Fig.
25), can be -.
estimated through the use of computer software or, for a more rough approximation, by assigning the value of 2 C per A-T basepair, and 4 C per G=C basepair, and taking : the sum across an expanse of nucleic acid. The latter method may be used for oligonucleotides of = ~ ' ~ ~ .

approximately 10-30 nucleotides in length. Because even computer prediction of the T. of a nucleic acid is only an approximation, the reaction temperatures chosen for initial tests should bracket the calculated Tm. While optimizations are not limited to this, 5 C
increments are convenient test intervals in these optimization assays.
When temperatures are tested, the results can be analyzed for specificity (the first two of the questions listed above) in the same way as for the oligonucleotide concentration determinations. Non-specific cleavage (i.e., cleavage of the probe at many or all positions along its length) would indicate non-specific interactions between the probe and the. sample material, and would suggest that a higher temperature -should be employed.
Conversely, little or no cleavage would suggest that even the intended hybridization is being prevented, and would suggest the use of lower temperatures. By testing several temperatures, it is possible to identify anapproximate temperature optimum, at which the rate of specific cleavage of the probe is highest. If the oligonucleotides have been designed as described above, the T. of the Z-region of the probe oligonucleotide should be belowthis temperature; so that-turnover is assured.
A. third determinant of ;hybridization efficiency :is - the salt concentration of the reaction.
.In large part, the choice of solution conditions will depend=on the requirements ofthe cleavage;agent, and for reagents obtained commercially, the manufacturer's instructions are a resource for- this information. When developing an assay utilizing any -particular" cleavage ,agent, the oligonucleotide and. temperature optimizations,described above should be performed in the buffer conditions best suited to that cleavage agent.
A "no enzyme". control allows the assessment of the stability of the= labeled ..oligonucleotides under particular reaction conditions, or in the presence of the sample to be tested (i.e., in assessing the sample for contaminating nucleases). In this manner; the substrate and oligonucleotides are placed in a tube containing all reaction components, except the enzyme and treated the same as the enzyme-containing reactions. Other controls may also be included. For example, a reaction with all of the components except the target nucleic acid will serve to confirm the dependence of the cleavage on the presence -of the target sequence.

_ --~
- ~

Probing For Multiple Alleles The InvaderTM-directed cleavage reaction is also useful in the detection and quantification of individual variants or <alleles in a mixed sample-population. By way of example, such a need exists in the analysis of tumor material for mutations in genes associated with cancers. Biopsy material from a tumor can have a significant complement of normal cells, so it is desirable to detect mutations even when present in fewer than 5% of the copies of the target nucleic acid in a sample. In this case, it is also desirable to measure what fraction of the population carries the mutation. Similar analyses may also be done to examine allelic variation in other gene systems, and it is not intended that the method of the present invention by limited to the analysis of tumors.
As demonstrated below, reactions can be performed under conditions that prevent the cleavage of probes bearing even a single-nucleotide difference mismatch within the region of the target nucleic acid termed :"Z" in Fig. 25, but that permit cleavage of a similar probe that is.completely complementary. to the target in this region. Thus, the assay riiay,be,used to quantitate individual variants or alleles within a mixed sample.
The use of multiple, differently labelled, probes in' such, --an assay ~is ~also contemplated.
To assess tlte~representation of different variants or alleies in- a satnple, one wouid ptovide a mixture of probes stich that each allele or variant to- 'be detected- would have - a sQecific probe (i.e.:perfectly:matched to the Z region.of the target'sequence) with a unique 1abeV(e:g, no two variant;probes with the sarnelabel would -beus+edlin a single feaction):
Theseprobes would be characterized in advance to ensure that under a single set of reaction conditions, they cottlcl be znade to give. the same rate of signal aceumulation, When mixed with their re5pective target nucieic,acids. Assembly. of acleavage reaction comprising the mixed probe set; a corresponding InvaderTM oligonucleotide, the target nucleic acid sample, and the appropriate- cleavage agent; along with performance of the cleavage reaction:
under conditions such that only the matched probes would cleave, would allow independent quantification of each of the species present, and would therefore indicate their, relative representation in the target sample. .

III. A Comparison Of Invasive Cleavage And Primer-Directed Cleavage As discussed herein, the terms "invasive" or "InvaderTm-directed" cleavage specifically denote the use of a first, upstream oligonucleotide, as defined below, to cause specific --cleavage at a site within a second, downstream sequence. To effect such a direction of .WO 98/42873 PCT/US98/05809 cleavage to a region within a duplex, it is required that the first and second oligonucleotides overlap in sequence. That is to say, a portion of the upstream oligonucleotide, termed the "InvaderTM", has significant homology to a portion of the downstream "probe"
oligonucleotide, so that these regions would tend to basepair with the same complementary region of the target nucleic acid to be detected. While not limiting the present invention to any particular mechanism, the overlapping regions would be expected to alternate in their occupation of the shared hybridization site. When the probe oligonucleotide fullv anneals to the target nucleic acid, and thus forces the 3' region of the InvaderTM to remain unpaired, the structure so formed is not a substrate for. the 5' nucleases of.the present invention: By contrast, when the inverse is true, the structure so formed is substrate for these enzymes, allowing cleavage and release of the portion of the probe oligonucleotide that is displaced by the InvaderTM oligonucleotide. The. shifting of the cleavage site to a region the probe oligonucleotide that would otherwise be basepaired to the target sequence is one hallmark of the, invasive cleavage assay (i. e., the InvaderTM-directed -cleavage assay) of the : present invention.
It is beneficial at this point to contrast the invasive cleavage as described above with two other fonns of. prole; cleavage that may lead to internal cleavage of a probe~ :t oligonucleotide, but which do not comprise invasive cleavage. In the first case; a hybridized probe may be subject to duplex-dependent 5' to 3' exonuclease "=nibbling, "
su&that the oligonucleotide is shortened from the 5' end until it cannot remain bound to the'target (see, e.g., Examples 5-7 and Figs. 26-28). The site at which such nibbling stops can appear to be discrete, and, depending on-the difference between the melting=temperature. of the full-length probe and the temperature of the reaction, this stopping point- may -be 1 or several ;nueleotides into the probe oligonucleotide sequence. Such "nibbling" is often indicated by the presence of a "ladder" of longer products ascending size up to that of the full length of the probe, but this is not always the case. While any one of the products of such a nibbling reaction may be made to match in size and cleavage site the products of an invasive cleavage reaction, the creation of these nibbling products would be highly dependent on the temperature of the reaction and the nature of the cleavage agent, but would be independent of the action of an upstream oligonucleotide, and thus could not be construed to involve invasive cleavage.
A second cleavage structure that may be considered is one in which a probe oligonucleotide has several regions of complementarity with the target nucleic acid, interspersed with one or more regions or nucleotides of noncomplementarity.
These _ ---=

noncomplementary regions may be thought of as "bubbles" within the nucleic acid duplex.
As temperature is elevated, the regions of complementarity can be expected to "melt" in the order of their stability, lowest to highest. When a region of lower stability is near the end of a segment of duplex, and the next region of complementarity along the strand has a higher melting temperature, a temperature can be found that will cause the terminal region of duplex to melt first, opening the first bubble, and thereby creating a preferred substrate structure of the cleavage by the 5' nucleases of the present invention (Fig. 36A). The site of such cleavage would be expected to be on the 5' arm, within 2 nucleotides of the junction between the single and double-stranded regions (Lyamichev et al., supra. and U.S.
Patent No.
5,422,253) An additional oligonucleotide could be introduced to basepair along the target nucleic acid would have a similar effect of opening this bubble for subsequent cleavage of the unpaired 5' arm (Fig. 36B and Fig. 6). Note in this case, the 3' terminal nucleotides of the upstrearn oligonucleotide anneals along the target nucleic acid sequence in such a manner that the 3' end is located within the "bubble" region. Depending on the precise locatiori of the 3' end of this oligonucleotide, the cleavage site may be along the newly unpaired 5' arm, or at the site expected for the .thermally opened bubble structure as described above. 'In the former case the cleavage is not within a duplexed region, and is thus not invasive cleavage; while in the latter the oligonucleotide is merely an aide in inducing cleavage at a site that might otherwise be exposed through -the use :of temperature alone (i.e., in the absence of the additional oligonucleotide), and is thus not considered to be invasive cleavage:
In summary, any arrangement:of oligonucleotides used for the cleavage-based detection of a target sequence can be analyzed to determine if the an,angement is an invasive cleavage. struoture as contemplated herein. An invasive cleavage structure supports cleavage of the probe in a region that, in the absence of an upstream oligonucleotide, would be expected to= be basepaired to the target nucleic acid.
Example 26 below provides further guidance for the design and execution of a experiments which allow the determination of whether a given arrangement of a pair of upstream and downstream (i.e:,the probe) oligonucleotides when annealed along a=target nucleic acid would form an invasive cleavage structure.

.74667-130 IV. Fractionation Of Specific Nucleic Acids By Selective Charge Reversal Some nucleic acid-based detection assays involve the elongation -and/or shoriening of oligonucleotide probes. For example, as described herein, the primer-directed, primer-independent, and lnvaderTm-directed cleavage assays, as well as the "nibbl'mg"
assay all involve the cleavage (i.e., shortening) of oligonucleotides as a means for detecting the presence of a target nucleic sequence. Examples of other detection assays which involve the shortening of an oligonucleotide probe include the "TaqMan" or nick-ttanslation PCR assay described in U.S. Patent No. 5,210,015 to Gelfand el the assays described in U.S. Patent Nos. 4,775,619 and 5,118,605 to Urdea, the catalytic hybridization amplification assay described in U.S. Patent No. 5,403,711 to Walder and Walder, and the cycling probe assay described in U.S. Patents Nos. 4,876,187 and 5,011,769 to Duck et al.
Examples of detection assays which involve the elongation of an oligonucleotide probe (or primer) include the polymerase chain reaction (PCR) described in U.S. Patent Nos. 4,683,195 and 4,683,202 to Mullis and Mullis et al. and the ligase chain reaction (LCR) described in U.S. Patent Nos, 5,427,930 and 5,494,810 to Birkenmeyer et al. and Barany et al. The above examples are intended to be illustrative of nucleic acid-based detection assays that involve the elongation and/or shortening of oligonucleotide probes and do not provide an exhaustive list.

Typically, nucleic acid-based detection assays that involve -the elongation and/or shoriening of oligonucleotide probes require post-reaction analysis to detect the products of the reaction. It is common that, the specific reaction product(s) must be separated from the other reaction components, including the input or unreacted oligonucleotide probe. One detection technique involves the electrophoretic separation of the reacted and unreacted oligonucleotide probe. When the assay involves the cleavage or shortening of the probe, the unreacted product will be longer than the reacted or cleaved product. When the assay involves the elongation of the probe (or primer), the reaction products will be greater in length than the input. Gel-based electrophoresis of a sample containing nucleic acid molecules of different lengths separates these fragments primarily on the basis of size. This is due to the fact that in solutions having a neutral or alkaline pH, nucleic acids having l 4... .

widely different sizes (i.e., molecular weights) possess very similar charge-to-mass ratios and do not separate (Andrews, Electrophoresis, 2nd Edition, Oxford University Press (1986), pp.
153-154]. The gel matrix acts as a molecular sieve and allows nucleic acids to be separated on the basis of size and shape (e.g., linear, relaxed circular or covalently closed supercoiled circles).
Unmodified nucleic acids have a net negative charge due to the presence of negatively charged phosphate groups contained within the sugar-phosphate backbone of the nucleic acid.
Typically, the sample is applied to gel near the negative pole and the nucleic acid fragments migrate into the gel toward the positive pole with the smallest fragments moving fastest through the gel.
The present invention provides a novel means for fractionating nucleic acid fragments on the basis of charge. This novel separation technique is related to the observation that positively charged adducts ; can affect the electrophoretic behavior of smali oligonucleotides because the charge of the adduct. is significant relative to charge of the whole complex. In addition, to the use of positively charged adducts (e.g., Cy3 and Cy5 fluorescent dyes,, the positively :charged heterodimeric DNA-binding dyes shown in Fig. 66, etc.), the oligonucleotide may; contain amino acids (particularly useful amino aeids are the charged amino acids: lysine, arginine, asparate, glutamate), modified bases, such as amino-modified bases, and/or a phosphonate backbone (at all or a subset of the positions). In addition as discussed.further below, a neutral dye or detection moiety (e.g., biotin, streptavidin, etc.) may be employed in place of a positively charged. adduct in conjunction with the use of amino-modified bases and/or a complete or partial phosphonate backbone.
This observed effect is of particular utility in assays based on the cleavage of DNA
molecules. Using the assays described herein as an example, when an oligonucleotide is shortened through the- action of -a Cleavase enzyme or other cleavage agent, the positive charge can be made to not only significantly reduce the net negative charge, but to actually override it, effectively "flipping" the net charge of the labeled entity. This reversal of charge allows the products of target-specific cleavage to be partitioned from uncleaved probe by extremely simple means. For example, the products of cleavage can be made to migrate towards a negative electrode placed at any point in a reaction vessel, for focused detection --without gel-based electrophoresis; Example 24 provides examples of devices suitable for focused detection without gel-based electrophoresis. When a slab gel is used, sample wells can be positioned in the center of the gel, so that the cleaved and uncleaved probes can be .WO 98/42873 PCT/US98/05809 observed to migrate in opposite directions. Alternatively, a traditional vertical gel can be used, but with the electrodes reversed relative to usual DNA gels (i.e., the positive electrode at the top and the negative electrode at the bottom) so that the cleaved molecules enter the gel, while the uncleaved disperse into the upper reservoir of electrophoresis buffer.
An important benefit of this type of readout is the absolute nature of the partition of products from substrates (i.e., the separation is virtually 100%). This means that an abundance of uncleaved probe can be supplied to drive the hybridization step of the probe-based assay, yet the unconsumed (i.e., unreacted) probe can, in essence, be subtracted from the result to reduce background by virtue of the fact that the unreacted probe will not migrate to the same pole as the specific reaction product.
Through the use of multiple positively charged adducts, synthetic molecules can be constructed, with sufficient modification that the normaliy negatively charged strand is made nearly neutral. When so constructed,` the presence or absence of a single phosphategroup can mean the difference between a net negative or a net`positive' charge.
I'hisobservation has: ., partieular utility when one objective is to discriminate between ~
enzyrnatically generated fragments of DNA, which lack a 3' phosphate, and the prod'ucts ofthermaP
de'gradation, which retain a 3' -phosphate (and thus two adrlitional= negati've -charges).
Examples 22 and. .23 demonstrate the ability to separate positively'charged'reaction products from anet negatively charged substrate oligonucleotide. As discutssed in these examples;
oligonucleotides ~rnay be transfonmed from net negative to netpositively charged compounds:' In Example 23,'the positively charged dye, Cy3 was incorporated at the 5' end of a' 22-mer (SEQ
ID NO:50) which also contained two amino-substituted residues at the 5':"end of'the oligonucldotide; this oligonucleotide probe carries a net negative charge. After cleavage, -which occurred 2 nucleotides into the probe, the following labelled oligonucleotide %was released: 5'-Cy3-AminoT-AminoT-3' (as well as the remaining 20 nucleotides -of SEQ ID -N0:50):
This short fragment bears a net positive charge while the remainder of the cleaved oligonucleotide and the unreacted or input oligonucleotide bear net negative; charges.
The present invention contemplates embodiments wherein the specific reaction product produced by any cleavage of any oligonucleotide can- be designedto carry a net positive charge while the unreacted probe is charge neutral or carries a net negative charge: The present invention also contemplates embodiments where the released product may be designed to carry a net negative charge while the input nucleic acid carries a net positive charge.
Depending on the length of the released product to be detected, positively charged dyes may ~ - ~

be incorporated at the one end of the probe and modified bases may be placed along the oligonucleotide such that upon cleavage, the released fragment containing the positively charged dye carries a net positive charge. Amino-modified bases may be used to balance the . charge of the released fragment in cases where the presence of the positively charged adduct (e.g., dye) alone is not sufficient to impart a net positive charge on the released fragment. In addition, the phosphate backbone may be replaced with a phosphonate backbone at a level -sufficient to impart a net positive charge (this is particularly useful when the sequence of the oligonucleotide is not amenable to the use of amino-substituted" bases); Figs.
45 and 46 show the structure of short oligonucleotides containing a phosphonate group on the second T
residue). An oligonucleotide containing a fully phosphonate-substituted backbone would be charge neutral (absent the presence-of modified charged residues bearing a charge or the presence of a charged adduct) due to the absence of the negatively charged phosphate groups.
Phosphonate-contaiping nucleotides (e,g,; methylphosphonate-coritaining`nucleotides are readily available and can be incorporated at any position of an oligonucleotide during synthesis using techniques which are well known in the art.
In essence, the invention contemplates the use of charge-based separation to permit the separation of specific reaction products. from the input oligonucleotides in nucleic acid-based detection assays. The foundation of this novel, separation technique is the design and use of oligonucleotide probes (typically termed "primers" in the case of PCR) "which are "charge balanced" so that upon eitheF cleavage or elongation of the probe it becomes "charge unbalanced," and the specific reaction products may be separated from the input reactants on -the basis of the net charge.
In the context of assays which involve the elongation of an oligonucleotide probe (i.e., a~ primer), such as is.the case in PCR, the: input primers are designed to carry a net }positive charge. Elongation of the short oligonucleotide primer during polymerization will generate PCR products which now carry a net negative charge. The specific reaction products may then easily be separated and concentrated away from the input primers using the charge-based separation technique described herein;(the electrodes will be reversed relative to the description in Example 23 as the product to. be separated and concentrated after a pCR will carry a negative charge). - 72 -. ~ .

V. InvaderTM-Directed Cleavage Using Miniprobes And Mid-Range Probes As discussed in Section III above, the InvaderTM-directed cleavage assay may be performed using InvaderTM and probe oligonucleotides which have a length of about 13-25 nucleotides (typically 20-25 nucleotides). It is also conterriplated that the oligonucleotides that span the X, Y and .Z regions (see Fig. 25), the InvaderTM and probe oligonucleotides, may themselves be composed of shorter oligonucleotide sequences that align along a target strand but that are not covalently linked. This is to say that there is a nick in the sugar-phosphate backbone of the composite oligonucleotide, but that there is no disruption in the progression of base-paired nucleotides in the resulting duplex. When short strands of nucleic acid align contiguously along a longer strand the hybridization of each is stabilized by the hybridization of the neighboring fragments because the basepairs can stack along the helix as though.the backbone was in fact uninterrupted. This cooperativity ofbinding can give each segment a stability of : interacti n- in excess of what - would be expected for the segment hybridizing to the longer nucleic acid alone. One application of this observation has been to assemble primers for DNA sequencing, typically about 18 nucleotides long, from sets of three hexamer oligonucleotides that are designed to hybridize in this way (Kotler et al. Proc. Natl.
Acad. Sci. USA 90:4241 [1993]). The resulting doubly-nicked primer can be extended, enzymatically in reactions performed at temperatures that might be expected to disrupt the hybridization of hexamers, but not of 18-mers. ' The- use of composite or:splii oligonuceotides is applied with suceess in the InvaderTM-directed cleavage assay. The probe oligonucleotide may.be split into two o..ligonueleotides which anneal in a contiguous and adjacent manner along a target oligonucleotide as diagrammed in Fig. 57- In this Figure, the downstream oligonucleotide (analogous to the probe of Fig. 25) is assembled from two smaller pieces: a short segment of 6-10 nts (termed the "miniprobe"), that is to be cleaved in the course of the detection reaction, and an oligonucleotide that hybridizes immediately downstream of the miniprobe (termed the "stacker"), which serves to stabilize the hybridization of the probe. To -form the cleavage structure, an upstream oligonucleotide (the "InvaderTM" oligo) is' provided to direct the cleavage activity to the desired region of the miniprobe. Assembly of the probe from non-linked pieces of nucleic acid :(i, e., the miniprobe and the stacker) allows regions of sequences to be changed without requiring the re-synthesis of the entire proven sequence, thus improving the cost and flexibility of the detection system. In addition, the use of unlinked WO 98/42873 PCT/t7S98/0580y composite oligonucleotides makes the system more stringent in its requirement of perfectly matched hybridization to achieve signal generation, allowing this to be used as a sensitive means of detecting mutations or changes in the target nucleic acid sequences.
As illustrated in Fig. 57, in one embodiment, the methods of the present invention employ at least three oligonucleotides that interact with a target nucleic acid to form a cleavage structure for a structure-specific nuclease. More specifically, the cleavage structure .
comprises i) a target nucleic acid that may be either single=stranded or double-stranded (when a double-stranded target nucleic acid, is employed, it may be rendered single-stranded, e.g., by heating); ii) a first oligonucleotide, termedthe "stacker,"
whichdefines a first region -of the target nucleic acid sequence bybeing the complementof that region (region W of the target as shown in Fig. 57);, iii) a second oligonucleotide, termed the ."miniprobe," which defines a second region of the target nucleic acid sequence by being the complement of that region (regions X and Z of the target as; shown in Fig. 57); iv) a third oligonucleotide; termed the "InvaderTM," ihe-5' part of whichdefines -a. third: region of the same. -target nualeic acid sequence (regions Y and X in Fig, 57); ;adjaeent to and. downstream of the second target region,(regions. X and- Z),-and= the;-second or- 3' part;of which overlaps intothe region- defined by the second oligonucleotide (region K depicts the region::of overlap). The resulting structure is diagrammed in Fig. 5:7.
While not limiting the iavention. or the instant discussion to any particular-mechanism of action, the diagram in Fig. 57 represents the effect on the site of cleavage-caused ~by this -=-type .of ,arrangement of ;three .oligoaucleo.tides. The; design of these three oligonucleotides is described below in detail. In Fig. 57, the; 3'. ends of the :nucleic acids (i_e.,Alie target and the oligonucleotides) are indicated by,the use of the arrowheads on the ends of the lines depicting the strands of the nucleic acids (and where space.permits, these ends are also 'labelled "3 It is readily appreciated that thethree oligonucleotides (the InvaderTM, the:miniprobe and the stacker) are arranged.in a parallel orientation relative to: one another, while the target -nucleic acid strand is arranged in an anti-parallel orientation relative to the three oligonucleotides.
Further it is clear that the InvaderTm oligonucleotide is located upstream of the miniprobe oligonucleotide and that the miniprobe olignuceotide is located upstream of the stacker oligonucleotide and that with, respect to the target nucleic acid strand, region W-is upstream of region Z, region Z is upstream of upstream of region X and region X, is upstream of region Y (that is region Y. is downstream. of region, X,: region X is downstream of regiom Z and region Z is downstream of region.,W). Regions of complementarity between the opposing '~.
= .~~ = ~ '.

strands are indicated by the short vertical lines. While not intended to indicate the precise location of the site(s) of cleavage, the area to which the site of cleavage within the miniprobe oligonucleotide is shifted by the presence of the InvaderTM oligonucleotide is indicated by the solid vertical arrowhead. Fig. 57 is not intended to represent the actual mechanism of action or physical arrangement of the cleavage structure and further it is not intended that the method of the present invention be limited to any particular mechanism of action.
It can be considered that the binding of these oligonucleotides divides the target nucleic acid into four distinct regions: one -region that has complementarity to only the stacker (shown as "W"); one region that has complementarity to only the miniprobe (shown as "Z"); one region that has complementarity only to the InvaderTM oligo (shown as "Y"); and one region that has complementarity to both the InvaderTM and miniprobe oligonuclebtides _ (shown as "X").
In addition to the benefits cited above, the use of a composite design -for the oligonucleotides which form the cleavage structure allows more latitude in the design of the reaction conditions for: performing the InvaderTM-directed cleavage assay.
When a longer probe (e.g., 16-25 nt), as described in Section III above, is used for detection iri reactions,that are performed at temperatures below the T. of that probe, the cleavage of the probe may play a significant role in destabilizing the duplex of which it is a part, thus allowing turnover and reuse of the recognition site on the target nucleic acid. In contrast, with miniprobes, reaction temperatures that are at or above the T.; of the probe mean that the probe molecules are hybridizing and releasing from the target quite rapidly even without cleavage of the probe.
When an upstream InvaderTM oligonucleotide and -a cleavage means are provided the miniprobe will be specifically cleaved, but the cleavage, will not be necessary =to the turnover of the miniprobe. If a long probe (e.g., 16-25 nt) were to be used in this-way the , temperatures required to achieve this state would be quite high, around 65 to 70 C for a 25-*
mer of average base composition. Requiring the use of such elevated temperatures limits the choice of cleavage agents to those that are very thermostable, and may contribute to background in the reactions, depending of the means of detection, through thermal degradation of the probe oligonucleotides. Thus, the shorter probes are preferable for use in this. way.
The miniprobe of the present invention may vary in size depending on the desired application. ::In one embodiment, the. probe may be relatively short compared to a standard probe (e.g., 16-25 nt), in the range of 6 to 10 nucleotides. When such a`short probe is used reaction conditions can be chosen that prevent hybridization of the miniprobe in the absence of the stacker oligonucleotide. In this way a short probe can be made to assume the statistical specificity and selectivity of a longer sequence. In. the event of a perturbation in the cooperative binding of the miniprobe.and stacker nucleic acids, as might be caused by a =
mismatch within the short sequence (i.e., region "Z" which is the region of the miniprobe which does not overlap with the InvaderTM) or at the junction between the contiguous duplexes, this cooperativity. can be lost, dramatically reducing the stability of the shorter oligonucleotide (i.e., the miniprobe), and thus reducing the level of cleaved product in the assay of the present invention.
It is also contemplated that probes of intermediate size may be used. Such probes, in the 11 to 15.nucleotide range, may blend some of the features associated with the longer probes as originally described, these features including the ability to hybridize and be cleaved absent the, help of a stacker oligonucleotide. At temperatures below the expected T. of such probes, the mechanisms of turnover may be as discussed above for probes in the 20 nt range, and be: dependent on the removaL of the;:sequence in: the 'X' region for destabilization and cycling. : .
The mid-range probes may also be used' at elevated temperatures, at or above their expected. Tm, to allow melting rather than cleavage to promote probe tumover: -In contrast to the :longer probes described above, however, the temperatures required to allow the use of such a thermally driven;turnover are much lower (about 40 to 60 C), thus preserving both the ;cleavage means :and the nucleic acids in. the reaction from thermal deggradation. In this way, the.; mid-range probes may perform in some instances like the miniprobes.
described above. In a further similarity to the miniprobes, the accumulation of cleavage signal from a mid-range probe. may be helped under some reaction -conditions by the presence `of a stacker.= -To summarizey a standard long probe usually does not benefit from the presence of a stacker oligonucleotide downstream (the exception being cases where such an oligonucleotide may also, disrupt structures in the target nucleic: acid that interfere with the probe binding), and it is usually used in conditions requiring several nucleotides to be removed to allow the oligonucleotide to release from the target efficiently.
The miniprobe is very short and performs optimally in the presence of-a downstream'j-stacker oligonucleotide. _ The miniprobes are well suited to reactions conditions that use the temperature,of the reaction tadrive rapid. exchange of the-probes on the target regardless of whether any bases have been cleaved. In reactions with sufficient amount of the cleavage means, the probes that do bind will be rapidly cleaved before they melt off.
The mid-range or midiprobe combines features of these probes and can be used in reactions like those designed long probes, with longer regions of overlap ("X"
regions) to drive probe turnover at lower temperature. In a preferred embodiment, the midrange probes are used at temperatures sufficiently high that the probes are hybridizing to the target and releasing rapidly regardless of cleavage. This is known to be the behavior of oligonucleotides at or near their melting temperature. This mode of turnover is more similar to that used with miniprobe/stacker combinations than with long probes. The mid-range probe may have enhanced performance in the presence of a stacker under some circumstances.
For example, with a probe in the lower end ofthe mid-range (e.g., 1-1 nt), or one with exceptional A/T
content, in a reaction performed well in excess of the T. of the probe (e.g., >10 C above) the presence of a stacker would be likely to enhance the performance of the probe, while at a more moderate temperature the probe may be indifferent to a stacker.
The distinctions between the mini-, midi- (Le., mid-range) and long probes are not contemplated to be inflexible and based only on.length. The performance of any given probe may vary with its specific sequence, the choice of solution conditions, the choice of temperature and the selected cleavage means.
It is shown in Example 18 that the assemblage of, oligonucleotides that comprises the cleavage.structure of the present invention is sensitive to mismatches between the probe and the target. The site of the mismatch used in Ex. 18 provides one example and is not intended to be a limitation in location of a mismatch affecting cleavage. It is also contemplated that a mismatch between the InvaderTM oligonucleotide and the target may be used to distinguish related target sequences. In the 3-oligonucleotide system, comprising an InvaderTM, a probe and a stacker oligonucleotide, it is contemplated that mismatches may ~be located within any, of the regions of duplex formed between these oligonucleotides and the target sequence. In a preferred embodiment, a mismatch to bedetected is located in the probe. In a particularly preferred embodiment, the mismatch is in the probe, at the basepair immediately upstream (i.e., 5') of the site that is cleaved when the probe is not mismatched to the target.
In another preferred embodiment, a mismatch to be detected is located within the region 'Z' defined by the hybridization of a miniprobe. = In a particularly preferred embodiment, the mismatch is inahe miniprobe, at the basepair immediately upstream (i.e., 5') of the site that is cleaved when the miniprobe is not mismatched to the target.

It is also contemplated that different sequences may be detected in a single reaction.
Probes specific for the different sequences may be differently labeled. For example, the probes may have different dyes or other detectable moieties, different lengths, or they may have differences in net charges of the products -after cleavage. When differently labeled in one of these ways, the contribution of each specific target sequence to final product can be tallied.
This has application in detecting the quantities of different versions of a gene within a -.
mixture. Different. genes in a mixture to be detected and quantified may be wild type and mutant genes (e.g.; as may be found in a tumor sample, such as a biopsy). In this embodiment, one might design the probes to precisely the same site, but one to match the wild-type sequence and one to match the mutant. Quantitative detection of the products of cleavage from a reaction performed for a set amount of time will reveal the ratio of the two genes in the mixture. Such analysis may also be performed on unrelated genes in-a mixture.
This type of analysis is not intended .to be limited to two genes. Many variants within a mixture may be similarly measured. 15 Alternatively, different sites on- a single gene may be monitored- and quantified to verify the measurement of that gene. -In this embodiment, the siguai from each probe would be expected to be the same.
It is also contemplated that multiple probes may be used that are not differently labeled, such that the aggregate signal is measured. This may be desirable when using many probes designed to detect a single gene to boost the signal from that gene:
This configuration may also be used for detecting unrelated sequences within a mix. For example, in' biood banking it is desirable to know if any one of a host of infectious agents is present in ;a sample -of .blood. Because the blood is discarded regardless of which agent is present; different signals on the probes would not be required in such an application of the present invention, and may actually be undesirable for reasons of confidentiality.
Just as described for the two-oligonucleotide system, above; the specificity of the detection reaction will be influenced by the aggregate length of the target =nucleic acid sequences involved in the hybridization of the complete set of the detection oligonucleotides.
For example, there may be -applications in which it is desirable to detect a single region within a complex genome. In such a case the set of oligonucieotides friay be chosen to require accurate recognition by hybridization of a longer segment -of a target nucleie acid, often in-the range of 20 to 40, nucleoddes. In other instances -it may be ~desirable to -have the set of oligonucleotides inte,ract with multiple sites within a target=sample:.
In-these cases one 1~ e approach would be to use a set of oligonucleotides that recognize a smaller, and thus statistically more common, segment of target nucleic acid sequence.
In one preferred embodiment, the InvaderTM and stacker oligonucleotides may be designed to be maximally stable, so that they will remain bound to the target sequence for extended periods during the reaction.- This may be accomplished through any one of a number of measures well known to those skilled in the art, such as adding extra hybridizing sequences to the length of the oligonucleotide (up to about 50 nts in total length), or by using residues with-reduced negative charge, such as phosphor-othioates or peptide-nucleic acid residues, so that the complementary strands do not repel each other to degree that natural strands do. Such modifications may also serve to make these flanking oligonucleotides resistant to contaminating nucleases, thus further ensuring their continued presence on the target strand during the course of the reaction. In addition, the InvaderTM
and stacker oligonuclcotidcs may be covalently attached to the target (e.g., through the use of psoralen cross-linking).
,. The use of the reaction temperatures at or near the T. of the probe oligonucleotide, rather than that used for cleavage, to drive the turnover of the probe oligonueleotide in- `these detection reactions means that the amount of the probe oligonucleotide cleaved off may be substantially reduced without adversely affecting the turnover rate. IVhas been determined that the relationship between the 3' end of the upstream oligonucleotide and the desired site of cleavage on the probe must be carefully designed. It 'is known that the preferred site-of cleavage for the types of structure specific endonucleases employed herein is one basepair into a duplex (Lyamichev et al, supra): It was previously believed that the presence of an upstream oligonucleotide or primer allowed the cleavage site to be shifted away from ~ this preferred site, into the single stranded region of the 5' ann (Lyan-ichev et-al., supra and U.S.
Patent No. 5,422,253). In contrast to this previously proposed mechanism, and while not limiting the present invention to any particular mechanism, it is believed that the nucleotide immediately 5', or upstream of the cleavage site orr the probe (including miniprobe and mid-range probes) must be able to basepair with the target for efficient cleavage to occur. In the case. of the present invention, this would be the nucleotide in the probe sequence immediately upstream of the intended cleavage site. In addition, as described herein, it has been observed that in- order-to direct cleavage to that same site in the probe, the upstreatri oligonucleo6de must have its 3' base (i.e., nt) immediately upstream of the intended cleavage site ;of the probe, This places the 3' terminal nucleotide of the upstream oligonucleotide and the base of the probe oligonucleotide 5' of the .cleavage site in competition for pairing with the corresponding nucleotide of the target strand.
To examine the outcome of this competition- (i.e. which base is paired during a successful cleavage event), substitutions were.made in the probe and InvaderT"
oligonucleotides such that either the probe or the Invader'm oligonucleotide were mismatched with the target sequence at this position. The effects of both arrangements on the rates of cleavage were examined. When the InvaderTm oligoriucleotide is unpaired at the 3' end, the rate of cleavage was not reduced. If this base was removed, however, the cleavage site was shifted upstream of the intended site. In contrast, if the probe oligonucleotide was not base-paired to the target just upstream of the site to which the InvaderTM
oligonucleotide was directing, cleavage, the rate of cleavage was dramatically reduced, suggesting that when a competition exists, the probe oligonucleotide was the molecule to be base-paired in this position.
It appears that the 3' end of the upstream Invader''m oligonucleotide is unpaired during cleavage, and yet is required for accurate positioning of the cleavage. To examine which part(s) of the.3' terminal nucleotide- are required for the positioning of cleavage, InvaderT"' oligonucleotides were designed that terminated on this end with nucleotides that were altered in.a variety of ways. Sugars examined, included 2' deoxyribose ,with a 3' .phosphate -group, a dideoxyribose, 3' deoxyribose, 2' 0-methyl ribose, arabinose and arabinose with' a 3-'~
phosphate. Abasic ribose, with and without 3' phosphate were tested. Synthetic "universal"
bases such at 3-nitropyrrole and 5-3nitroindole on ribose sugars were tested:
Finally, a base-..Iikearomatic ring structure, acridine, linked to the 3' end the previous nucleotide without a ,sugar group was tested. The results obtained support the conclusion that the aromatic:ring of -_the_base (at the 3' end of the InvaderTM oligon:uceotide) is the required moiety forY
accomplishing the direction of cleavage to the desired site within the downstream probe.

VI. Signal Enhancement By Tailing Of Reaction Products In The InvaderTM- =
Dir.ected Cleavage Assay. -It has been determined that when oligonucleotide probes are used in cleavage detection , assays at elevated temperature, some fraction of the truncated probes will have been shortened' by nonspecific thermal degradation, and that such breakage products `can make the analysis of the target-specific cleavage data -moredifficult. The:therrnal degradation that creates a background ladder of bands when the probes of the present invention are'treated at=high _ -~
WO 98/42873 PCr/US98/05809 temperature for more than a few minutes occursas a two step process. In the first step the N-glycosyl bond breaks, leaving an abasic site in the DNA strand. At the abasic site the DNA chain is weakened and undergoes spontaneous cleavage through a beta-elimination process. It has been determined that purine bases are `about 20 times more prone to breakage than pyrimidine bases (Lindahl, Nature 362:709 [1993]).- This suggests that one way of reducing background in methods using oligonucleotides at elevated temperatures is to select target sequences that allow the use of pyrimidine-rich probes. It is preferable, where possible, to use oligonucleotides that are entirely composed of pyrimidine residues. If only one or a few purines are used, the background breakage will appear primarily at the corresponding sites, and these bands (due to thermal breakdown) may be mistaken for the, intended 'cleavage products if care is not taken in the data analysis (i: e., proper controls must be run).
; Background cleavage due to thermal breakdown of probe oligonucleotides ' can, when not resolved from specific cleavage products, reduce the accuracy of quantitation of target nucleic acids: based on the amount-of accutnulated product in- a set timefi-ame.~ One means of distinguishing the specific from the nonspecific, products is disclosed above, and is based on partitioning the products of these reactions by' differences -in the net charges carried by ttie different molecular species in the reaction: :As was noted in that discussion, thethermal breakage products usually retain 3' phosphates after breakage, while the enzyme=cleaved products do not: The two negative charges on the phosphate facilitate charge=based partition of the products:
The absence of a 3' phosphate on the desired =subset of 1he probe, fragments 'may be used. to advantage in enzymatic assays as well. Nucleic acid polymerases, both non-templated (e:g.; - terminal deoxynucleotidyttransferase, polyA polymerase) and template-deperirlen't (e.g., Pol I type DNA polymerases), require an available 3' hydroxyl by which tor attach:- further nucleotides. This enzymatic selection of 3' end structure may be used as =an ,effective ~means of partitioning specific from non-specific proaucts:
'In addition to the benefits of the partitioning described above, the addition of nucleotides to the end of the specifie product of an InvaderTM-specific cleavage offers an opportunity to either add label to the products, to add capturable tails to-facilitate solid-support based readout systems, or to do both of these things at the same -time: Some possible embodiments of 'this concept are illustrated in Fig: 56.
In Fig: 56, an' InvaderTh' cleavage struture,comprising an InvaderTM"oligonUclotide containing a blocked or non-extendible 3'-end (e.g., a 3' dideoxynucleotide) and a probe WO.98/42873 PCT/US98/05809~
oligonucleotide containing a blocked or non-extendable 3' end (the open circle at the 3' end of the oligonucleotides representsa. non-extendible nucleotide) and a target nucleic acid is shown; the probe oligonucleotide may contain a 5' end label such as a biotin or a fluorescein (indicated by. the,stars) label (cleavage structures which employ a 5' biotin-labeled probe or a =
5' fluorescein-labeled probe are shown below the, large diagram of the cleavage structure to the left and the right, respectively). Following, cleavage of the probe (the site of cleavage is indicated by. the: large arrowhead), the, cleaved biotin-labeled probe is extended using a template-independent polymerase (e.g., TdT) and fluoresceinated nucleotide triphosphates.
. The fluorescein tailed. cleaved probe molecule. is then captured by binding via its 5' biotin ,:label to streptavidin and the fluroescence is, then measured. Alternatively, following; cleavage of a 5'-fluoresceinated probe, the cleaved probe is extended using a template-independent polymernse (e.g., TdT) and dATP.: The polyadenylated (A-tailed) cleaved probe molecule is then captured, by binding via the. polyA tail to oligo dT attached to a solid support:
The examples described;in Fig. =56: are based on the use of .TdT to tail- the specific products. of InvaderT'"-directed cleavage. The- descriptiom of the use of:
this particular, enzyme is presented by way. of example- andis not. intended _as a limitation (indeed, when probe oligos comprising RNA are employed, cleaved RNA probes may be extended using. polyA ;
polymer,.ase).. . It.,,is contemplated. that an assay. of this type could be~
configured to-use a template-dependent polymerase, as, described above. While this would require the presence of a suitable copy template distinct from the target nucleic acid, on which the truncated oligonucleotide could prime synthesis, it can be envisaged that a probe which before cleavage would be unextendible, due to either mismatch or modification of the 3' end, could be ,w; xactivated. as a prinjer..when . cleaved, by an, InvaderT"! directed cleavage. A template directed tailing reaction also has the advantage of allowing-greater selection and control of the nucleotides inco.rporated.
The use of nontemplated tailing does not require the presence of any-additional nucleic acids in_ the detection reaction, avoiding one step of assay development and troubleshooting.
In addition, the use. of non templated synthesis eliminated the step of hybridization, potentially speeding up the assay. Furthermore, the-.TdT enzyme is fast; able to add at least >700 nucleptides to. substrate oligonucleotides in a 15 minute reaction.
As mentioned above, the tails added can be used- in a number of ways: It can=
be used as a straight-forward. way of addinglabeled moieties to the cleavage product to increase -signal from each cleavage event. . Such a reaction: is..depicted in the; left side,of Fig.; 66. The . ^~ . ~ .
,WO 98142873 PCT/US98/05809 labeled moieties may be anything that can, when attached to a nucleotide, be added by the tailing enzyme, such as dye molecules, haptens such as digoxigenin, or other binding groups such as biotin.
In a preferred embodiment the assay includes a means of specifically capturing or partitioning the tailed InvaderTM-directed cleavage products in the mixture.
It can be seen that target nucleic acids in the mixture may be tailed during- the reaction.
'If a label is added, it is desirable to partition the tailed InvaderT"i-directed cleavage products from these other labeled molecules to avoid background in the results. This is easily done if only thecleavage product is capable of being captured. For example, consider a cleavage assay of the present invention in which the probe used has a biotin on the' 5' end and is blocked from extension on the 3' end, and in which a dye is added during tailing. Consider' further that the products are to be captured onto a support via the biotin moeity; and-the captured dye measured to assess the preseace of the targetnucleie acid. - When the label +s added by'tailing, only the specifically cleaved probes will be labeled. The residual uncut probes can sti11' bind in the fitial capture,step, but they will not contribute to the signal: In the same reactioii,`nicks and cuts in the target nucleic acid may -be tailed by the -enzyme; and thus`become dieTabeled. In the final capture these labeled targets will not bind to the support and thus, though labeled, they will not contribute to the signal. If the fmal specific product is `considered to consist of two portions, the probe-derived portion and the tail portion, can be seen from thi~ `disCUSSion that>it. is particularly -preferred that when the probe-derived portion is used for specific' capture,, whether by hybridization, biotin/streptavidin, or -other method;
that the label be associated with the tail portion.- eonversely;,if a label is attached to the' probe-derived portion, then. the tail portion may be made suitable for capture, as-depicted -on, the 'right' side 'of Fig.
66. =Tails may be captured in a number of ways, including hybridization, biotin incorporation with streptavidin capture, or by virtue if the fact that the longer molecules bind more predictably and efficiently to a number of nucleic acid minding matrices, such as nitrocellulose, nylon, or glass, in membrane, paper, resin, or other form.
While not required for this assay, this separation of functions allows effective exclusion from signal` of both unreacted probe and tailed target nucleic acid.
In addition to the supports decribed above, the tailed products may be captured onto any: support that contains a suitable capture moiety. For example, biotinylated products are generally captured with avidin-treated surfaces. These 'avidin surfaces may be iri nucrotitre plate wells, on beads, on dipsticks, to name just a few of the possibilities.
Such surfaces can also be modified to contain specific oligonucleotides, allowing capture of product by hybridization. Capture surfaces as described here are generally known to those skilled in the art and include nitrocellulose dipsticks (e.g., GeneComb'''"', BioRad, Hercules, CA).

VII. Improved Enzymes For Use In InvaderTMDirected Cleavage Reactions A cleavage structure is defined herein as a structure which is formed by the interaction of a probe oligonucleotide and a target nucleic acid to form a duplex, the resulting structure being cleavable by a cleavage means, including but not limited to an enzyme. The cleavage structure is furtherdefined as a substrate for specific cleavage by the cleavage means :.:. . in contrast to a nucleic..acid molecule. which is a substrate for nonspecific cleavage by agents such as phosphodiesterases. Examples of some possible cleavage structures are shown in Fig.
15.., In considering improvements to enzymatic cleavage means, one may-consider: the action of said enzymes on.any of these structures, and on any other structures that fall within the definition of , a: cleavage structure. -. The . cleavagesites, indicated on the structures in Fig. 15 are,,presented by way of example. Specific'cleavage at-any site.withrn such a structare is contemplated.
Improvements in an enzyme may be m increased or decreased rate of cleavage of one or;moretyp.es of, structures.. Improvements may also result in- more or fewer sites of cleavage on one or more of said-cleavage.structures. In developing a library of new structure-specific ' nucleases for use in nucleic acid cleavage assays, improvements may have many different embodiments, each related to the specific <substrate-structure used in a particular assay.
As.an example;,one embodiment of the - InvaderT"'-directed, cleavage assayof the .:.::. present invention may :be considered. In the InvaderTM directed cleavage. assay,. the -accumulation of cleaved material is influenced by. several features of the enzyme behavior.
Not surprisingly, the turnover._ rate, or the number of <structures thati can be cleaved by a single enzyme molecule in a set amount. of time, is very important in determining the amount of material processed during the course of an assay reaction. If an enzyme takes a long time to recognize a substrate (e.g., if it is presented with a.less-than-optimal ,structure); or if it takes a long time. to execute, cleavage, the rate of product -accumulation is lower than if these steps proceeded quickly. If these steps are quick, yet the ,enzyme: "holds on". to the cleaved structure, and does not imxnediately,proceed to another uncut :structure,~.
the rate w"tllr be negatively -affected.

Enzyme turnover is not the only way in which enzyme behavior can negatively affect the rate of accumulation of product: When the means used to'visualize or measure pioduct is specific for a precisely defined product, products that deviate from that definition may escape detection, and thus the rate of product accumulation may appear to be lower than it is. For example, if one had a sensitive detector for trinucleotides that could not see di- or tetranucleotides, or any sized oligonucleotide other that 3 residues, in the InvaderTM-directed cleavage assay of the present invention any errant cleavage would reduce 'the detectable signal proportionally. It can be seenfrom the cleavage data presented here that, while there is usually one site within a probe that is favored for cleavage, there are often products that arise from cleavage one or more nucleotides away from the primary cleavage site.
Theseare products that are target dependent, and are thus not non-specific background. Nevertheless, if a subsequent visualization system can detect onlythe primary product; these represent a loss of signal. One example of such a selective visualization system is the chacge reversal readout presented.herein, in which #he balance of positive and negative charges determines "the behavior of the <products: In such a system the presence"of an' extra nucleotide orthe absence of an expected nucleotide can excluded a legitimate cleavage product from ultfmaie'-detection by leaving that product with the wrong balance of charge. It can be easily seen that any assay that can sensitively distinguish the nucleotide content of an oligonucleotitie; 'such as standard stringent hybridization, suffers in sensitivity when some fraction of the legitimate `product isznot eligible for successful detection by that assay:
These discussions suggest two highly desirable `traits" in any enzyme to' be ttsed in the method of the present invention. First, the morerapidly the~enzyme executes an entire -cleavage reaction; including recognition, cleavage and release,'the more signal it may potentially created in theInvaderTM-directed cleavage assay: Second,'the"
mor'e successful an enzyme-is at focusing on a single cleavage site within a structdfe, the more'of the' cleavage product can be successfully detected in a selective'read-out.
The rationale cited above for making improvements in erizymes to be used in the InvaderTM-directed cleavage assay are meant to serve as an exaniple of one direction in which improvements might be sought, but not as a limit on either the 'nature or the applications of improved enzyme activities. As another direction of activitychange that would"be appropriately considered improvement, the DNAP=associated 5' nucleases may be used as an example. In creating some of the polymerase-deficient `5" nucleases described herein' it was found that the those that were created by deletion of substantial portions of the polymerase domain, as depicted in Fig. 4, assumed activities that were weak or absent in the parent proteins. These activities included the ability to cleave the non-forked structure shown in Fig.
15D, a greatly enhanced ability to exonucleolytically remove nucleotides from the 5' ends of duplexed strands, and a nascent ability to cleave circular molecules without benefit of a free =
5' end.
In addition to the 5' nucleases derived from DNA polymerases, the present invention also contemplates the use of structure-specific nucleases that are not derived from DNA
polymerases. For example, a class of.eukaryotic and archaebacterial endonucleases have been identified which have a similar substrate-specificity to 5' nucleases of Pol I-type DNA
Polymerases. These are the.FEN 1(Flap EndoNuclease), RAD2, and )PG (Xeroderma .P.igmentosa-complementation group G) proteins. These proteins are involved in DNA repair, and have been shown.to favor the cleavage of structures that resemble a 5' arm that has been displaced by an extending primer during polymerization, similar to the model depicted in Fig.
I 5B.. Similar DNA rep.ur, enzymes have been isolated; from single cell and,hrgher' eukaryotes and from archaea, and, there are related DNA. repair ,proteins in eubacteria.
Similar 5' nucleases have atso b.e;associated with bacteriophage such-as-T5 and-'F'1:
Recently, the 3-dimensional structures of DNAPTaq and T5 phage 5'-exonuclease (Fig..58) were determined by:..X-ray diffraction (Kim et al., Nature:376:612 [1995]; ;and Ceska et al., Nature 382:90- [1995]): The two enzymes have very similar 3-dimensional structures despite limited amino acid sequence similarity. The most striking feature of the T5 5'-exonuclease structureis the existence of a triangular hole formed by the active site of the ..~protein and two alpha helices (Fig. 58).- This. same regionof DNAPTaq is disordered in the ,crystal structure, indicating .that this region is flexible, and thus -is novshown in the~ published .3-dimensional structure. However, the 5' nuclease domain of DNAPTaq is likeiylo have the same structure, based, its overall-37dimensional;similarttyto T-5 5'-exonuclease, and that the' amino acids in the disordered region of the DNAPTaq protein are those associated with alpha helix formation.. The existence. of such a hole or groove in the 5' nuclease domain of DNAPTaq was predicted based on its substrate specificity (Lyamichev =et al.;
supra).
It has been suggested that the 5' arm of a cleavage structure_must-thread through the helical arch described above to position-said structure correctly for-cleavage (Ceska et ad., supra). One of the modifications of 5, nucleases described herein opened up the helical arch portion of the protein to allow improved cleavage of structures that cut poorly or not at all (e.g., structures on circular DNA targets that. would =preelude such threading of a 5'- arm).

The gene construct that was chosen as a model to test this approach was the one called Cleavase BN, which was derived from DNAPTaq but does not contain the polymerase domainn (Ex. 2). It comprises the entire 5' nuclease domain of DNAP Taq, and thus should be very close in structure to the T5 5' exonuclease. This 5' nuclease was chosen to demonstrate the principle of such a physical modification on proteins of this type. The arch-opening modification of the present invention is not intended to be limited to the 5' nuclease domains of DNA polymerases, and is contemplated for use on any structure-specific nuclease which includes such an =aperture as a limitation on cleavage activity. The present invention contemplates the insertion of a thrombin cleavage site into the helical arch of DNAPs derived from the genus Thermus as well as 5' nucleases derived from DNAPs derived from the genus Thermus. The specific example shown- herein using the Cleavase BN/thrombin-nuclease merely illustrates the concept of opening the helical arch located within a nuclease domain. As the amino acid sequence of DNAPs derived from the genus Thermus are highly conserved, the teachings of the present invention enable the insertion of a=thrombin site into the helical arch present in these DNAPs and 5' nucleases derived from'these 'DNAPs.
The opening of the helical arch was accomplished by insertion of a protease 'site in the arch. This, allowed post-translational digestion of the expressed protein with the appropriate protease to open the arch at its apex. Proteases of this type recognize' shortstretches of specific amino acid sequence. Such proteases include thrombin and factor Xa.
Cleavage of a protein with. such a protease depends on both the presence of that site in the amino acid sequence of the proteim and the accessibility of that site on the folded intact' protein: Even with a crystal structure it can be difficult to predict the susceptibility of any particular region of a protein to protease cleavage. .=Absent=a crystal- structure- it must be deterinined empirically.
In selecting a protease for a site-specific cleavage of a protein that has`
been -modified' to contain a protease cleavage site, a first step is to test the unmodified protein for cleavage at alternative sites. For example, DNAPTaq and Cleavase(D BN nuclease were both incubated under protease cleavage conditions with factor Xa and thrombin proteases. Both nuciease proteins were, cut with factor Xa within the 5' nuclease domain, but neither nuclease was digested with large amounts of thrombin: Thus, thrombin was chosen for initial tests on opening the arch of the Cleavase BN enzyme.
,= - In the protease/Cleavase4D =modifications described herein- the factor Xa protease cleaved strongly in an unacceptable position in the unmodified nuclease protein, in a region A

likely to compromise the activity of the end product. Other unmodified nucleases contemplated herein may not be sensitive to the factor Xa, but may be sensitive to thrombin or other such proteases. Alternatively,they, may be sensitive to these or other such proteases at sites. that are immaterial to the function of the nuclease sought to be modified. In approaching any protein for modification by addition of a protease cleavage site, the unmodified protein should be tested with the proteases under consideration to determine which proteases give acceptable levels of cleavage in other regions.
Working with the cloned.segm.ent of DNAPTaq from which the CleavaseOD BN
protein is expressed, nucleotides. encoding a thrombin cleavage site were introduced in-frame near the , sequence encoding amino acid 90 of the nuclease gene. This position was determined to be at or, near the apex of the helical arch by reference to both the 3-dimensional structure of DNAPTaq, and the structure ,of T5 5' exonuclease. The encoded amino acid sequence, LVPRGS, was inserted. into the apex of the helical arch by site-directedmutagenesis of the nuclease, gene. The proline (P) in the-thrombin cleavage site was positioned to replace a proline. normally in this;position in Cleayase .BN because proline is an alpha helix-breaking amino. acid, and may be.,important:for :the 3-dimensional structure of this arch. This construct was expressed, purified and then digested with thrombin. : The digested enzyme was tested for its ability to.cleave a target nucieic acid, bacteriophage M 13 genomic DNA;
that does not provide free 5' ends to facilitate cleavage by the -threading model.
While the helical arch in this nuclease was opened by protease cleavage, it is contemplated that a number of other techniques could be used to achieve the same end. For example, the nucleotide sequence could be rearranged such that, upon expression, the :
resulting protein would be.configured so that the top of the helical arch (amino acid 90) would be at the amino terminus of the protein, the natural carboxyl and amino termini of the protein sequence would. be joined, and the new carboxyl terminus would lie at natunal amino . acid 89. This approach has the benefit that no foreign sequences are introduced and the enzyme is a single amino acid chain, and -thus may be more stable that the cleaved 5' nuclease. In the crystal structure of DNAPTaq, the amino and carboxyl ternzini of the 5'-exonuclease domain lie in close proximity to : each other, which suggeststhat the ends may be directly. joined without the use of a flexible linker peptide sequence as is -sometimes necessary. Such a rearrangement of the gene, with subsequent cloning and expre$sion could be accomplished by standard PCR recombination and cloning techniques known to those skilled in the art.

~O 98/42873 PCT/US98/05809 The present. invention also contemplates the use of nucleases isolated from a organisms that grow under a variety of conditions. T-he genes for the FEN-1/XPG class of enzymes are found in organisms ranging from bacteriophage to humans to the extreme thermophiles of Kingdom Archaea. For assays in which high temperature is to be used, it is contemplated that enzymes isolated from extreme thermophiles may exhibit the thermostability required of such an assay. For assays in which it might be desirable to have peak enzyme activity at moderate temperature or in which it might be desirable to destroy the enzyme with elevated temperature; those enzymes from organisms that favor moderate temperatures for growth may be of particular value.
An alignment of a collection of. FEN-1 proteins sequenced by others is shown -in Figs.
59A-E (SEQ ID NOS:135-145). It can be seen from this alignment that there are some regions of conservation in this class of proteins, suggesting that they are related in- function, and possibly =in structure. ; Regions of similarity at the amino acid sequence level can be used to design primers for in vitro. amplification :(PCR) by a process of back translatingg the amino acid sequence to the possible nucleic acid sequences, then choosing prizhers withttie fewest possible variations within the sequences. These can be used in low stringency PCR'to search for related DNA sequences. This approach permits the amplification of DNA
encoding a FEN-1 nuclease without advance knowledge of the actual DNA sequence.
It can also be seen from this alignment that there are regions in the sequences that are not-completely.conserved. The degree of difference observed suggests that the proteins may have subtle or distinct differences is substrate specificity. In other words, they may have different levels of cleavage activity on the cleavage struetures of the present invention. When a particular structure is cleaved at a higher rate than the others, this is referred to a- preferred substrate, while a structure that is cleaved slowly is considered a less' preferred substrate. The designation of preferred or less preferred substrates in this' context is _not intended to be a limitation of the present invention. It is contemplated that some embodiments the present invention will make use of the interactions of an enzyme with a less preferred substrate.
Candidate enzymes are tested for suitability in the cleavage assays of the present invention using the assays described below.
1... . Structure -Specific Nuclease Assay Testing candidate nucleases for structure-specific activities in these assays is done in much the same way as described for testing modified DNA polymerases in Example 2, but with the use of a different library of model structures. In addition to assessing the enzyme performance in primer-independent and primer-directed cleavage, a set of synthetic hairpins are used to examine the length of duplex downstream of the cleavage site preferred by the enzyme.
The FEN-1 and XPG 5' nucleases used in the present invention must be tested for activity in the assays in which they are intended to be used, including but not limited to the Invader''"'-directed cleavage detection assay of the present invention aind the. CFLPID lpethod of charaetecizing nucleic acids (the CFLP method is described in U.S. Patents Nos. 5,843,654 and 6,372,424).
l 0 The InvaderTM assay uses a mode of cleavage that has been termed "primer directed" of "primer dependent" to reflect the influence of the an oligonucleotide hybridized to the target nucleic acid upstream of the cleavage site.
In contrast, the CFLP reaction is based on the cleavage of folded structure, or hairpins, within the target nucleic acid, in the absence of any hybridized oligonucleotide. The tests described herein are not intended to be limited to the analysis of nucleases with any particular site of cleavage or mode of recognition of substrate structures. It* is contemplated that enzymes may be described as 3' nucleases, utilizing the 3' end as a reference point to recognize structures, or may have a yet a different mode of recognition.
Further, the use of the term 5' nucleases is not intended to limit consideration to enzymes that cleave the cleavage structures at any particular site. It refers to a general class of enzymes that require some reference or access to a 5' end to effect cleavage of a structure.
A set of model cleavage structures have been created to allow the cleavage ability of unknown enzymes on such structures to be assessed. Each of the model structures is constructed of one or more synthetic oligonucleotides rnade by standard DNA
synthesis chemistry. " Examples of such synthetie model substrate structures are shown in Figs. 26 and 60. These are intended only to represent the general folded configuration desirable is such test structures. While a sequence that would assume such a structure is indicated in the Figures, there are numerous other sequence arrangements of nucleotides that would be expected to fold in such ways. The essential features to be designed into a set of oligonucleotides to perform the tests described herein are the presence or absence of=a sufficiently long 3' arm to allow hybridization of an additional nucleic acid to test cleavage in a"primer-directed" mode, and the length of the duplex region. In the set depicted in Fig. 60, the duplex lengths of the S-33 and the 11-8-0 structures are 12 and 8 basepairs, respectively.

:~ _ '~ = .
-vVO 98/42873 PCTlUS98/05809 This difference in length in the test molecules facilitates detection of discrimination by -the candidate nuclease between longer and shorter duplexes. Additions to this series expanding the range of duplex molecules presented to the enzymes, both shorter and longer, may be used. The use of a stabilizing DNA tetraloop (Antao et at, Nucl. Acids Res., 19:5901 [19911) or triloop (Hiraro et al., Nuc. Acids Res., 22:576 [19941) at the closed end of the duplex helps ensure formation of the expected structure by the oligonucleotide.
The model substrate for testing primer directed cleavage, the "S-60 hairpin"
(SEQ ID
NO:40) is described in Example 11. In the absence of a primer this hairpin is usually cleaved to release 5' arm fragments of 18 and 19 nucleotides length. An oligonucleotide, termed P-14 (5'-CGAGAGACCACGCT-3'; SEQ ID NO:108), that extends to the base of the duplex when hybridized to the 3' arm of the S-60 hairpin gives cleavage products of the same size, but at a higher rate of cleavage.
To test invasive cleavage a different primer is used, termed P-15 (5'-CGAGAGACCACGCTG-3'; SEQ,ID NO:30). In a successful invasive cleavage the presence of this primer shifts the site of cleavage of S-60 into the duplex region, usually releasing products of 21 and 22 nucleotides 1ength.
The S-60 hairpin may also be used to test the effects of modifications of the"cleavage structure on either primer-directed or invasive cleavage. Such modifications include, but are not limited to, use of mismatches or base analogs in the hairpin duplex at one, a few or all positions, similar disruptions or modifications in the duplex between the primer and the 3' arm of the S-60, chemical or other modifications to one or both ends of the primer sequence, or attaehment of moieties to, or other modifications of the 5' `arm of the structure. In all of the analyses using the S-60 or a similar hairpin described~ herein, activity with and without a primer may be compared using the same hairpin structure.
The assembly of these test reactions, including appropriate amounts of hairpin, primer and candidate nuclease are described in Example 2. As cited therein, the presence of cleavage products is indicated by the presence of molecules which migrate at a lower molecular weight than does the uncleaved test structure. When tfie reversal of charge of a label is used the products will carry a different net charge than the uncleaved material. Any of these cleavage products indicate that the candidate nuclease has the desired structure-specific nuclease activity. By "desired structure-specific nuclease activity" it is meant only that the candidate nuclease cleaves one or more test molecules. It is not necessary that the candidate nuclease cleave at any particular rate or site of cleavage to be considered successful cleavage.

VIII. Signal Enhancement By Completion Of An Activated Protein Binding Site .
In addition to the DNA polymerase tailing reaction described above, the present invention also contemplates the use of the products of the invasive cleavage reaction to form activated protein binding sites, such as RNA polymerase promoter duplexes, thereby allowing the interaction of the completed,site to be used as an indicator of the presence of the nucleic acid that is the target of the invasive cleavage reaction. By way of example, when an RNA
polymerase promoter duplex is activated by being made complete (f.e., double-stranded over that portion of the.promoter region required for polymerase binding) through the hybridization of the oligonucleotide product of the invasive cleavage reaction, the synthesis of RNA can be used as such an indicator.
It is not intended.that the transcription reaction of the present invention be limited to .the use of any particular RNA polymerase or RNA polymerase promoter region. ' Promoter sequences are well characterized for several bacteriophage, including bacteriophage SPS, T7 and T3. In addition, promoter. sequences have been well characterized for a number of both eukaryotic and prokaryotic RNA. polymerases. In a preferred embodiment, the promoter used enables transcription from one of the bacteriophage RNA polymerases. In a particularly preferred.:embodiment, the promoter used enables transcription by T7 RNA
polymerase.
Means. of performing transcription in vitro are well known in the art and commercial kits are available for perfonning transcription with =karyotic, prokaryotic or bacteriophage RNA
polynierases (e.g., from Promega).
The protein binding regions of the present invention are not limited to the bacteriophageRNA polymerase promoters described above. Other promoter sequences that are contemplated are those of prokaryotes and eukaryotes. For example, many=strains of bacteria and fungi are used for the expression of heterologous proteins. The minimal' promoters required for. transcription by the RNA polymerases of organisms such as yeast and other fungi, eubacteria, nematodes, and cultured mammalian cells are well described in the literature and in the catalogs of commercial suppliers of DNA vectors for the expression of foreign proteins, in these organisms..
The binding sites for other types of nucleic acid (e.g., DNA) binding proteins, 'are contemplated for use in the present invention. For example, proteins involved in the W.0 98/42873 PCT/US98/05809 regulation of genes exert their effects by binding to the DNA in the vicinity of the promoter from which the RNA from that gene is transcribed. The lac operator of E. coli is one example of a particularly well characterized and commonly used gene regulation system in which the. lac repressor protein binds to specific sequences that overlap, and thus block, the promoter for the genes under the repressor's control (Jacob and Monod, Cold Spring Harbor Symposium on Quantitative Biol. XXVI:193-211 [1961]). Many similar systems have been described in. bacteria, including the trp and AraC regulatory systems. Given the large amount of information available about bacterial promoters, the steps described below for the design of suitable partial promoters for the bacteriophage RNA polymerases can be readily adapted to the design of detection systems based on these other promoters.
As noted above, many of the bacterial promoters are under the control of a repressor pr other regulatory protein. It is considered to be within the scope of the present invention to include the creation of composite binding sites for these regulatory proteins through the provision, of a nucleic acid fragment (e.g., a non-target cleavage product generated in an invasive cleavage reaction). The binding of the. regulatory protein to the completed. protein binding region (e.g.,. the. composite binding region), can be assessed by any one -of a ntimber of means, including slowed electrophoretic, nugration of eitherthe protein or the DNA
fragrnent,.or by aconfonnational change in the protein or DNA upon binding.
4naddition, transcription from a downstream promoter can be monitored for up- or down-regulation- as a result ;of . the binding of the regulatory protein to the completed protein binding region.
In addition to the bacterial systems described above, many genes in eukaryotic systems have also been found to be under the control;of specific proteins that -bind w specific regions of duplex DNA. Examples include, but are not limited to, the 'OCT-1-,: OCT-2 and AP-4 proteins, in mammals and the GAL4 and GCN4 proteins in yeast. Such, regulatory proteins usually have a structural motif associated with duplex nueleic acid binding, such as a-helix-turn-helix, a= zinc finger or a leucine zipper [for review, see, Molecular and Cellular Biology, Wolfe (Ed.), Wadsworth Publishing Co:, Belmont, CA, pp. 694-715 [1993]).
For simplicity the test reaction described here will refer to T7 RNA
polymerase, and its promoter. This is not intended to limit the invention to the use of this RNA polymerase, and those skilled in the art of molecular biology would,be able to readily adapt this described test to the examination of any of the DNA binding proteins, RNA polymerases and their binding or promoter sites discussed above.

~ ---~
i i It. is known in the art that active T7 promoters can be formed by the hybridization of =
two oligonucleotides, each comprising either the top or bottom strand of the promoter sequence, such that a complete un-nicked duplex promoter is formed (Milligan et al., Nucl.
Acids Res., 15:21, 8783-8798 (1987)]. The present invention shows that one way of making the initiation of transcription dependent on the products of an invasive cleavage reaction is to design the probe for the cleavage reaction such that a portion of an RNA
polymerase =.
promoter is released as product: The remaining DNA piece or pieces required to assemble a promoter duplex may either be provided as elements in the reaction mixture, or they may be produced by other invasive cleavage events. If the oligonucleotide pieces are designed to comprise appropriate regions of complementarity they may base pair to form a complete promoter duplex composed of three or more nucleic acid fragments, as depicted in Fig. 88B.
A promoter assembled in this way will have nicks in the backbone of one or both strands. In one: embodiment, these nicks may be covalently closed through the use of a DNA
ligase enzyme. In a preferred embodiment, the nicks are positioned such that transcription can proceed without ligation. - Inselecting the site of a nick created by the assembly of tlie partial promoter fragment, at least one nick should be within the recognized promoter regiori' for the Rb1.A polymerase to be used. When a bacteriophage promoter is used; a riick should be :betvveen nucleotides-17 and -1,tmeasured from the site of transcription initiation at +i. In a preferred embodiment, a nick will-be between nucleotides -13 and -8. In a particularly preferred embodiment, a nick will be between nucleotides -12 and -10 on the non-template :strand of the bacteriophage promoter.
When nicks are;to be left unrepaired (i:e., not covalently closed with a DNA- -Tigase) it is :important to assess the effect of ahe nick location on the level of transcription fromthe assembled promoter. A simple test, is to ,cornbine the oligonucleotides thatcomprise the separateportions of the promoter wifih an oligonucleotide that comprises one entire strand of the promoter to be assembled, thereby forming a duplex promoter with a nick in one `strand.
If the nick is in the top, or non-template strand of the promoter, then the oligonucleotide that comprises the complete promoter is made to include additional non-promoter sequence on its 5' end to serve as a template to be copied in the transcription. This arrangement is depicted in. Fig. 88B., Alternatively, if the nick is to be in =the bottom, or template strand' of the promoter, then the partial promoter oligonucleotide that covers the + 1 position; the ' transcription start site, will include the additional template sequence: This amangement is =_ depicted in Figs. 95A-D (this Figure shows several different embodiments in which a cut probe or non-target cleavage product is used to form a composite promoter which contains one .or more nicks on the template strand). In either case, the separate oligonucleotides are combined to form the complete promoter, and the assembly is used in a transcription reaction to create RNA.
To measure the effect of the nick, a substantially identical promoter fragment is created by hybridization of two oligonucleotides that each comprise one strand of the full-length promoter to create an un-nicked version of the same promoter.
These two molecular assemblies are tested in parallel transcription reactions and the amount of the expected RNA that is produced in each reaction is measured for both size and yield_ A
preferred method of assessing the size of the RNA- is by electrophoresis with subsequent visualization. If a labeled nucleotide (e.g., 32P- GTP, or fluorescein-UTP) is used in the transcription, the RNA can be detected,and quantitated by autoradiography, fluorescence imaging or, by transfer to support membrane with subsequent detection (e.g., by antibody or hybridization probing). Alternatively,- if :urilabeled RNA is produced the amounts may be determined by. other methods known in the art,: such as by spectrophotometryor by electrophoresis with subsequent staining and comparison to known standards.
If the - size of the,RNA is as predicted by the template sequence, or if it matches that produced from the control promoter, it can, be presumed to have initiated transcription at the same site in the complex, and to have produced essentially the same RNA
product. If ithe product- is much shorter then transcription is. either initiating at an internal site or is terminating prematurely (Schenborn and Mierendorf, Nucl. Acids Res., 13:17, 6223 [085];
and,.Milligan et al:, supra.). VJhile this does not indicate that-the assembly tested is completely unsuitable for the assay, the partial transeripts will ieduce the gross amount of RNA. created, perhaps compromising the signal from the assay, and such products would , require further characterization (e.g., fmger printing or sequencing) to identify the nucleotide content of the product. It is preferred that the size of the RNA produced matches that of the RNA produced in the control reaction.
The yield of the reaction is :also examined. It is not necessary that the level of transcription matches that of the controY reaction. In some instances (see Ex.
41, below) the nicked promoter may. have an enhanced rate of transcription, while in other arrangements transcription may be reduced (relative to the rate from the un-nicked promoter assembly). It is only- required that the amount of product be within the detection limits of the method to be usedwith the test promoter.

- -- ~ j It is reported that transcription from a bacteriophage promoter can produce 200- to 1000 copies of each transcription template (template plus active promoter) in a reaction.
These levels of transcription are not required by the present invention.
Reactions in which one RNA is produced for each template are also contemplated.
The test described above will allow a promoter with a nick in any position to be assessed for utility in this assay. It is an objective of this invention to provide one or more of =.
the, oligos which comprise a partial promoter region through invasive cleavage event(s)_ In this embodiment, the partial promoter sequences are attached to the probe oligonucleotide in the invasive cleavage assay, and are released by cleavage at specific site, as directed by the InvaderTM oligonucleotide. It is also intended that transcription be very poor or nonexistent in' the Absence of the correctly cleaved probe. To assess the success of any oligonucleotide designat meeting these objectives, several transcription reaction tests can be performed.
For a promoter assembly. that will= have a nick on the non-template stTand, several partial assemblies that should be tested are shown in Figs. 86 A-D. By way of example, but not by way.of limitationthis Figure depicts the tests for a-nicked-promoter in which:lhe upstream, or_5'; portion:of the non-template strand is to b.e-provided by the invasive-cleavage assay.. This fragment is- seen in - Fig. 86A labeled. as_ "cut probe".
Transcription reactions -incubated in. the presence of the duplex shown in Fig. 86A will test the ability of>the`-upstream partial promoter to allow -initiation, of transcription when hybridized to-a bottom strand, termed a "copy template." Similarly, a reaction performed in the presence of the duplex depicted in Fig., 86$ will test the ability of the partial promoter fragment nearest the initiation site (the l site, as indicated in Fig. 85B) to support transcription of the copy template. It is an important feature of the present invention that neither of these partial pramoter duplexes be able to support transcription at the same level as would by seen'in tcanscription froman: intact promoter as depicted in Fig. 85B: It is-preferred that neither of these partial. promoters be sufficient to initiate detectable transcription in the time course of an average transcription reaction (Le., within about an hour of incubation).
Figs. 86C and 86D depict two other duplex arrangements designed,to test the effect of uncut probe within the transcription reaction. Fig. 86C depicts the duplex formed between only the uncutprobe and the copy template, while Fig. 86D includes the other portion of the promoter. The 3' region of the probe is not complementary to the promoter=
sequence and ; therefore produces an unpaired branch-in~ the middle of the promoter. Itis animportant feature of the present invention that neither of these branched promoter duplexes be able to support transcription at the same level as would by seen in transcription from an intact promoter as depicted in Fig. 85B. It is preferred that neither of these branched promoters be sufficient to initiate detectable transcription in the time course of an average transcription reaction (i.e., within about an hour of incubation).
In one embodiment of the transcription system of the present invention, the initiation of transcription from the copy template in the absence of a complete promoter, or in the presence of a branched promoter, is prevented by the judicious placement of the nick or nicks in the composite promoter. For example, as shown in the examples below, placement of a nick between the -12 and -11 nucleotides of the non-template strand of the bacteriophage T7 promoter allows transcription to take place only when the probe has been successfully cut, as in an invasive cleavage reaction. However, in some instances where the invasive cleavage reaction is to ,provide the upstream portion of the non-template strand of the promoter (e.g., as depicted in Fig. = 88B) it -may be necessary or desirable to- place the nick on that strand in a particular position for reasons other than providing an optimal composite promoter (i. e.. , one that is inactive in the absence of any one of the promoter pieces). It may be necessary or desirable to place the nick in such a way that the creation of a brariched complete promoter (Fig: 86D) has an undesirable level of transcription, reducing dependence of RNA production on: the: succ:ess of the invasive cleavage step. It is shown in the examples belovr~r~ that transcription from such a branched promoter can be suppressed by a modificationof the downstream non-template promoter piece, shown as the "Partial Promoter Oligonucleotide" in Figs. 86, 88, 90 and 95D. As depicted in Fig. 90, the partial promoter oiigonucleotid'e can be provided with a 5' "tail" of nucleotides that are not complementary to the template strand of the promoter; but which are complementary to tlie 3' portion of the probe oligonucleotide that would be removed in the invasive cleavage reaction: When uncut probe hybridizes to'the -:copy template with the bound 5' tailed partial promoter oligonucleotide, the 5' tail can basepair to the 3' region of the probe, forming a three-way junction as depicted in Fig. 90A.
This can effectively shut off transcription, as shown below. When a cut probe hybridizes, as shown in Fig. 90B, a promoter with a small- branch is formed, and it is shown herein that such a branched promoter can initiate transcription. Furthermore, if care is taken in 'selecting the sequence of the 5' tail (i.e., if the first unpaired base is the same nucleotide at the 3' nucleotide of the cut probe, so that they compete for hybridization to the same template strand base), the resulting branched structure may also be cleaved by one of the structure specific nucleases of the present invention, creating the un-branched promoter depicted in Fig.
90C, in some instances enhancing transcription over that seen with the Fig.
90B promoter.
The promoter duplex that is intended to be created, in this embodiment, by the successful execution of the InvaderTM directed cleavage assay will include both the "cut probe" and the. partial promoter oligonucleotide depicted in Figs. 86A and B, aligned on a single copy template nucleic acid. The testing of the efficiency of transcription of such a .
nicked promoter segment in comparison to the intact promoter is described above. All of the oligonucleotides described for these test molecules may be created using standard synthesis chemistries.
The set of test molecules depicted in Fig. 86 is designed to assess the transcription capabilities of the variety of structures that may be present in reactions in which the 5' portion of the non-template strand. of the promoter is to be supplied by the InvaderTM directed cleavage. It is also.envisioned that a different portion of partial promoter may be supplied by the. invasive cleavage reaction (e.g., the downstream segment of the non-template strand of the, promoter), as is shown in.Fig., 94: Portions of the template strand nf'the protnoter may alsQ. be provided by.the cut probe, as shown in Figs. 95A-D. An =analogo.us set of test molecules, including "cut": and uncut versions of the probe to be used in the.
invasive 'cleavage assay may be created to :test any alternative design, whether the nick is to be located on the template or non template strand of the promoter.
The transcription-based visualization methods of the present invention may also be used,in a multiplex fashion. Reactions can be constructed such that the presence of one particular target leads to transcription from one type of promoter, while the presence of a different target sequence (e.g., a mutant or variant) or another target suspected of being present, may lead to transcription from a different (i. e:, a second) type of promoter; In such an..embodiment, the identity of the promoter from which transcription was initiated could be deduced from the type or size of the RNA produced.

By way of example, but not by way of limitation, the bacteriophage promoters can be compared with such an application. in :view. The promoters for the phage T7, T3 and SP6 are quite similar, each being about 15 to 20 basepairs long, and sharing about 45%
identity between -17 and -1.nucleotides, relative to the start of transcription.
Despite-these similarities,. the. RNA polymerases from.these phage are highly specific for their-cognate promoters, such that the other promoters may be present in a reaction, :but will not, be ,_.
transcribed (Chamberlin and Ryan, Enzymes XV:87-108 [19821). Because these promoters ---,, ~
~...
~W0 98/42873 PCTlUS98/05809 are similar in size and in the way in which they are recognized by their polymerases (Li et al., Biochem: 35:3722 .[1996]) similar nicked versions of the promoters may be designed for use in the methods of the present invention by analogy to the examples described herein which employ the T7 promoter. Because of the high degree of specificity of the RNA
polymerases, these nicked promoters may be used together to detect multiple targets in a single reaction. There are many instances in which it would be highly desirable to detect multiple nucleic acid targets =in a single sample, including cases in which multiple infectious agents may be present, or in: which variants of a single type of target may need to be identified. Alternatively, it is often desirable to use a combination of probes to detect both a target sequence and an internal control sequence, to gauge the effects of sample contaminants on the output: of the assay. The use of multiple promoters allows ~the reaction to be assessed :for: both.the efficiency. of the invasive cleavage and the robustness of the transcription.
As stated above, the phage promoters were described in detail as an example of suitable protein _binding regions (e.g., which. can be used to generate a compositepromoter) for use,in .the methods of the present invention. The invention is not limited to the use of phage RNA polycrierase:-promoter. regions, in particular, and RNA polymerase pibinater regions, in geqeral. .Suitably-specific, well characterized promoters -are also found,in both prokaryotic and eukaryotic systems.
The RNA that is >produced in a manner that is dependent of the successful detection of the .target nucleic acid in the invasive cleavage reaction may be detected in any of several ways. If.a labeled nucleotide is incorporated into the RhiA
during,transcription,'the RNA may be detected directly after fractionation (e:g.; by.electrophoresis or, chromatography). The labeled RNA may also be captured onto=a solid support, such as a microtitre-platc, a bead or a dipstick (e. g:,, by hybridization, antibody capture,, or through an affinity interaction such as that between biotin and avidin). Capture may facilitatethe measuring of incorporated label, or it may be an intermediate step before probe hybridization or similar detection means. If the maximum amount of label is desired to be incorporated into each transcript, it is preferred that the copy template be very long, around 3 to 10 kilobases, so that each RNA molecule will carry many labels. Alternatively, it may be desired that a single site or a limited number of sites within the transcript be specifically labeled. In this case, it may be--desirable to have a short copy template,with only one or a few residues that would allow incorporatiow of the labeled nucleotide: .

W0 98/42873 PCT/US98/0580;
The copy template may also be selected to produce RNAs that perform specified functions. In a simple case, if an duplex-dependent intercalating fluorophore is to be used to detect the RNA product, it may be desirable to transcribe an RNA that is known to form duplexed secondary structures, such as a ribosomal RNA or a tRNA. In another embodiment, the RNA may be designed to interact specifically, or with particular affinity, with a different substance. It has been shown that a process of alternating steps of selection (e.g., by binding to,a target substance) and in vitro amplification (e.g., by PCR) can be used to identify nucleic acid ligands with novel and useful properties (Tuerk and Gold, Science 249:505 [1990]).
This system has been. used to identify RNAs, termed ligands or aptamers, that bind tightly and. specifically to proteins and to other types of molecules, such as antibiotics (Wang et al., Biochem. 35:12338 [1996]) and hormones. RNAs can even be selected to bind to other RNAs through non-Watson-Crick interactions (Schmidt et al., Ann. N.Y. Acad.
=Sci. 782:526 [1996]). A ligand RNA may be used to either inactivate or enhance the activity of a molecule to which it binds. , Any. RNA segment identified through such a pzocess`may also be produced by the methods of the ; present invention, so that the observation of the activity of the RNA ligand way,beused as a,specific sign of the presence of the Wget materi'al'in the invasive. cleavage., reaction. - The ligand binding to its specific partner.
;may also be used as another way of capturing a readout signal to a solid support.
The product RNA might also be designed to have: a catalytic function (e.g., to act as a ribozyme), allowing: cleavage another molecule to be indicative of the success of the=primary`
invasive cleavage reaction (UhleAbeck, Nature 328:596 [1987]). In yet another, embodiment, the:RNA. may.be,made to encode; a peptide sequence. When coupled to an fn vitro translation system (e.g., tbe S-30 systern derived from E. coli [Lesley, Methods Mol.
Biol., 37:265 (1985)], or a rabbit reticulocyte lysate.system [Dasso and Jackson; Nucleic A-cids Res:
17:3129 (1989)], available from Promega), the-production of the appropriate -protein may be detected. In a preferred embodiment, the proteins produced include those that :allow either colorimetric or luminescent detection,,such as beta-galactosidase (lac.Z) or luciferase, respectively.
The. above discussion focused on the use of the present transeription visualization methods in .the context qf the InvaderTM=directed cleavage assay (i.e., the non-target cleavage products produced in -the InvaderTM assay were used to complete and activate a protein binding region, such as a promoter region). However, the transcriptiori visualization methods are not limited to this context. Any assay which produces an oligonucleotide product having relatively discrete ends can be used in conjunction with the present transcription visualization methods. For example, the homogenous assay described in U.S. Patent No.
5,210,015, particularly when conducted under conditions where polymerization cannot occur, produees short oligonucleotide fragments as the result of cleavage of a probe. If this assay is conducted under conditions where polymerase occurs, the site of cleavage of the probe may be focused through the use of nucleotide analogs that have uncleavable linkages at particular positions within the probe. These short oligonucleotides can be employed in a manner analogous to the cut probe or non-target cleavage products produced in the invasive cleavage reactions of the present invention. Additional assays which generate suitable oligonucleotide products are known to the art. For example, the non-target cleavage products produced in assays such as the "Cycling Probe Reaction" (Duck et al., BioTech., 9:142 [1990] and U.S.
Patents Nos. 4,876,187 and 5,011,769, in which shorter oligonucleotides are released from longer oligonucleotides afier hybridization to a target sequence would be suitable, as would short restriction fragments released in assays where a probe is designed to be cleaved when successfully hybridized to an appropriate restriction recognition sequence (U.S. Patent No. 4,683,194).
Assays which generate sbort oligonucleotides having "ragged" (i.e., not discrete) 3' ends can also be employed with success in the transcription reactions of the present invention when the oligonucleotide provided by this non-transcription reaction are used to provide a portion of the promoter region located downstream of the other oligonucieotide(s) which are required to complete the promoter region (that is a 3' tail or unpaired extension can be tolerated when the oligo is being used as the "Cut Probe" is in Figs. 94 and 95A).

IX. Signal Enbancement By Incorporating The Products Of An Invasive Cleavage Reaction Into A Subsequent Invasive Cleavage Reaction As noted above, the oligonucleotide product released by the invasive cleavage can be used subsequently in any reaction or read-out method that uses oligonucleotides in the siu range of a cleavage product. In addition to the reactions involving primer extension and transcription, described above, another enzymatic reaction that makes use of oligonucleotides is the invasive cleavage reaction. The present invention provide means of using the oligonucleotide released in a primary invasive cleavage reaction as a component to complete a cleavage structure to enable a secondary invasive cleavage reaction. One possible configuration of a primary cleavage reaction supplying a component for a secondary cleavage . ~ `

= WO 98/42873 PCT/US98/05809 structure is diagrammed in Fig. 96. Is not intended that the sequential use of the invasive cleavage product be limited to a single additional step. It is contemplated that many distinct invasive cleavage reactions may be performed in sequence.
The. polymerase chain reaction uses a DNA replication method to create copies of a targeted segment of nucleic acid at a logarithmic rate of accumulation. This is made possible by the fact that when the strands of DNA are separated, each individual strand contains sufficient information to allow assembly of a new complementary strand. When the new strands are synthesized the number of identical molecules has doubled. Within 20 iterations of this process, the original may be copied I million-fold, making very rare sequences easily detectable. The mathematical power of a doubling reaction has been incorporated into a number of amplification assays, several of which are cited in Table 1.
By performing multiple, sequential invasive cleavage reactions the method of the present invention captures an exponential mathematical advantage without producing additional copies of the target analyte. In a simple invasive cleavage reaction the yield, Y, is simply the turnover rate, K, multiplied by,:the time of the reaction, t(i:e., Y=(K)(t)). If Y is used to represent the yield of a simple reaction, then the yield of a compound (i:e.; a multiple,:sequential_reaction), assuming that each of the individual invasivecleavage steps has the same turnover rate, can be simply represented as Y ; -where n is the nuinber of irivasive cleavage reactions that have been performed in the series. If the yields of each step differ the ultimate yield can be represented as the product of the multiplication of the yields. of each individual reaction in the series. For example, if a primary invasive cleavage reaction can produce one thousand products in 30 minutes, and each of those products can in turn participate in 1000 additional reactions, there will be 10002 copies (1000 x 1000) of the ultimnte _ product in a second reaction. If a third reaction is added to the series, then the theoretical yield will be 10003 (1000 x 1000 x1000): In the methods of the.present invention the exponent comes from the number of invasive cleavage reactions in the cascade. This can be contrasted. to the amplification methods described above (e.g., PCR) in which Y=is limited =
to 2 by the number of strands in duplex DNA, and the exponent n is the number of cycles performed, so xhat many iterations are necessary to aceumulate large,amounts of product.
To distinguish the,exponential amplifications described above from those of the present..invention, the former. can be _consider reciprocating reactions because the. products the reaction feed back into the same reaction (e.g., event one leads to some number of events 2, and each event 2 leads back to some number of events 1). In contrast; the events of the vdO 98/42873 PCT/US98/05809 present invention are sequential (e.g., event I leads to some number of events 2; each event 2 leads to some number of events 3, etc., and no event can contribute to an event earlier in the chain).
The sensitivity of the reciprocating methods is also one of the greatest weaknesses when these assays are used to determine if a target nucleic acid sequence is present or absent in a sample. Because the product of these reactions is detectable copy of the starting material, contamination of a new reaction with the products of an earlier reaction can lead to false positive results, (i.e., the apparent detection of the target nucleic acid in samples that do not actually contain any of that target analyte). Furthermore, because the concentration of the product in each positive reaction is so high, amounts of DNA sufficient to create a strong false positive signal can be communicated to new reactions very easily either by contact with contaminated instruments or by aerosol. In contrast to the reciprocating methods, the most concentrated product of the sequential reaction (i.e., the product released in the ultimate invasive cleavage event, is not capable of initiating a like reaction or cascade if carried over to, a fresh test sample). This is a marked advantage over the exponential amplification methods ;described above because the reactions of the present invention may be pe7rfornied without the costly eontainment arrangements (e.g., either by specialized instrumentsor by separate ` laboratory space) required by any reciprocating reaction. While the products of a penultimate event may be inadvertently transferred to produce a background of the ultimate product in the absence of the a target analyte, the contamination would need to be of much greater volume to give an equivalent risk of a false positive result.
-When the termsequential is used it is not: intended to limit=the invention to configurations in which that one invasive cleavage reaction or assay must be completed before the initiation of a subsequent reaction forinvasive cleavage of a different probe.
Rather, the term refers to ithe order of events as would occur if only single copies of each of the oligonueleotide species were used in an assay. The primary invasive cleavage reaction .
refers to that which occurs first, in response to the formation of the cleavage structure on the target nucleic acid. Subsequent reactions may be referred to as secondary, tertiary and so forth, and may involve artificial "target" strands that serve only to support assembly of a cleavage structure, and which are unrelated to the nueleic acid analyte of interest.. While the complete assay may, if desired, be configured with each step of invasive cleavage separated either in space (e.g., in different reaction vessels) or in time (e.g., using a shift in reaction conditions, such, as temperature, enzyme identity or solution condition, to enable the later .^y + =
' WO 98/42873 PCT/US98/0580y cleavage events), it is also contemplated that all of the reaction components may be mixed so that secondary reactions may be initiated as soon as product from a primary cleavage becomes available. In such a format, primary, secondary and subsequent cleavage events involving different copies of the cleavage structures may take place simultaneously.
Several levels of this sort of linear amplification can be envisioned, in which each successive round of cleavage produces an oligonucleotide that can participate in the cleavage of a different probe in subsequent rounds. The primary reaction would be specific for the analyte of interest with secondary (and tertiary, etc.) reactions being used to generate signal while still being dependent on the primary reaction for initiation.
. The released product may perform in several capacities in the subsequent reactions.
One of the possible variations are shown in Fig. 96, in which the product of one invasive cleavage reaction becomes the InvaderTM.oligonucleotide to direct the specific cleavage of another probe in a second reaction. In Fig. 96, the first invasive cleavage structure-is fonsned by the annealing of the. Invader TM oligonucleotide ("Invader") and the probe ~oligonucleotide ("Probe :1 ") to. the first target nucleic, acid ("Target A "). The target nucleic -acid is divided into three regions.based-upon;which portions of the Invader T"t: and probe _oligonucleotides are capable of hybridizing -to the.target (as discussed above and as showri in:
Fig: 25) = Region 1 (region. Y in Fig. 25) of the,target has complementarity to only-tthe Invader TM : =.
oligonucleotide; region 3 (region Z in Fig. 25) of the target has complementarity to only the probe; and region 2 (region X in Fig. 25) of the target has complementarity to=both the Invader TM and probe oligonucleotides. It is noted that the sequential, invasive cleavage reaction diagrammed in Fig. 96 employs an InvaderT"' and a:probe oligonucleotide; the sequential cleavage :reaction is not limited to the use of -such a first, cleavage structure. The first cleavage structure in the sequential reaction may also employ an.
InvaderT"' oligonucteotide, a mini probe and a stacker oligonucleotide as discussed in Section V. above:
In Fig. 96, cleavage ,of Probe l releases the "Cut Probe 1" (indieated.by the hatched line in both the cleaved and uncleaved Probe 1 in Fig. 96). The. released Probe I is then used as the Invader T"' oligonucleotide in second cleavage. The second cleavage structure is formed by the annealing of the,Cut Probe 1, a second probe oligonucleotide ("Probe 2") and a second. target nucleic acid ("Target 2"). Probe 2. may be labelled (indicated by the star in Fi~g. ,.
96) and. detection of cleavage of the second cleavage structure. may be accomplished by detecting the labelled cut Probe, 2; the label may a radioisotope (e. g., 3zP, 'sS); a - fluorophore (e.g., fluorescein), a reactive group capable of detection by a secondary agent(e.g., WO 98/42873 PCTlUS98/05809' biotin/streptavidin), a positively charged adduct which permits detection by'selective charge reversal (as discussed in Section IV above), etc. Alternatively, the cut Probe 2 may used in a tailing reaction (as discussed in Section VI above) or may used to complete or activate a protein binding site (as discussed in Section VIII above).
Another possible configuration for performing a sequential invasive' cleavage reaction is diagrammed in Fig. 97. In this case, probe oligonucleotides that are cleaved in the primary reaction can be designed to fold back on themselves (i. e., they contain a region of self-complementarity) to create a molecule that can serve as both the target and InvaderTM
oligonucleotide (termed here an "IT" complex). The IT complex then enables cleavage of a different probe present in the secondary reaction. Inclusion of an excess of the secondary probe molecule ("Probe 2"), allows- each IT molecule to serve as the platform for the generation of multiple copies of cleaved secondary probe. In Fig. 97, the regions of self-complementarity contained within the 5' portion of the InvaderTM
oligonucleotide is indicated by the hatched ovals; the arrowbetween these two -ovals indicates that these two regions can self-pair, (as shown in the "Cut Probe 1"). The target nucleic acid is divided into'three`-regions based upon which portions of the Invader TM and probe oligonucleotides arercapable of hybridizing to ;the target (as discussed above and it is noted that ~the -target- may b.e: divided into -four regions if-.a: staeker oligonucleotide is employed). The second cleavageYstructure is formed by the- annealing of the second probe ("Probe 2") to the fragment of Probe "Iz Mut Probe 1that was released by cleavage of the first cleavage- structure. The Cut Probe 1 forms a hairpin or stem/loop structure near its 3' terminus by virtue of the annealing of the regions of self-complementarity- contained within Cut Probe 1.(this self-annealed Cut Probe 1 forms the IT complex). The IT complex (Cut Probe 1) -is divided-into`three regions. Region 1 of the. IT.-complex , has complementarity to the 3' portion of Probe 2;
region 2 has complementarity to both the 3' end of Cut Probe I and to the 5"portion of Probe 2, (analogous to the region of overlap "X" shown in Fig. 25); and region 3 contains the region of self-comp.lementarity (i.e., region 3 is complementary to the 3' portion of the Cut Probe 1).
Note that with regard to the IT complex (i. e., Cut Probe 1), region I is located upstream of region ~ 2 and region 2 is located upstream of region 3.
; The cleavage products of the secondary invasive cleavage reaction =(i.e., Cut Probe 2) '' can either be detected, or .can in turn be -designed to constitute yet another integrated InvaderTM-target.complex tobeused with a third probe molecule; again unrelated to the preceding targets.

. j _ W O: 98/42873 PCT/US98/05804,' The present invention is not limited to the configurations diagrammed in Figs.
96 and 97. It is envisioned that the oligonucleotide product of a primary cleavage reaction may fill the role of any of the oligonucleotides described herein (e.g., it may serve as a target strand without an attached InvaderTM oligonucleotide-like sequence, or it may serve as a stacker =
oligonucleotide, as described above), to enhance the turnover rate seen in the secondary reaction by stabilizing the probe hybridization through coaxial stacking.
In a preferred embodiment, each subsequent reaction is enabled by (i.e., is dependent upon) the product of the previous, cleavage, so that the presence of the ultimate product may serve as an indicator of the presence of the target analyte. However, cleavage in the second reaction need not be depexident upon the presence of the product of the primary cleavage reaction; the product of the. primary cleavage reaction may merely measurably enhance the rate of the second cleavage reaction.
In summary, the InvaderTM assay cascade (i.e., sequential invasive cleavage reactions) of the present invention is acombination of two or more linear assays that allow the accumulation of the ultimate product at an exponential rate, but without signifcant'risk of carryover, contamination.
The sequential invasive cleavage amplification of the present invention can `be'used as an intermediate boost.to any of the detection methods (e.g., gel based analysis by either standard or by charge reversal), polymerase tailing, and incorporation into a protein binding region, described herein. , When used is such combinations the increased production-.of a specific cleavage _ product in, the invasive cleavage assay reduces the burdens of sensitivity and specificity: on the read-out. systems, thus facilitating their use:
In :addition to enabling a variety of detection platforms, the cascade strategyis suitable for- multiplex analysis of individual analytes (;: e:, -individual target nucleic- acids) in. a single reaction. The multiplex format can be categorized into two types., In one case; it is=`desirable -to know the identity (and amount) of each of the analytes that canbe present iri a clinical sample, or the identity of each of the analytes as well as an internal control.= To identify the =
presence of multiple individual analytes in a single sample, several distinct secondary-amplification systems may be included. Each.probe cleaved in response to the presence of a particular target sequence (or< interilal -control) can be designed to trigger a different cascade coupled to different detectable moieties, such as different sequences to be extended by DNA
polymerase or different dyes: in an FET format. The contributionof each specific target WO 98/42873 PCTIUS98/05809, sequence to final product can thereby be tallied, allowing quantitative detection of different genes or alleles in a sample containing a mixture of genes/alleles.
In the second configuration, it is desirable to determine if any of several analytes are present in a sample, but the exact identity of each does not need to be known.
For example, in blood banking it is desirable to know if any one of a host of infectious`
agents is present in a sample of.blood. Because the blood is discarded regardless of which agent is present, different signals on the probes 'would not be required in such an application of the present invention, and may actually be undesirable for reasons of confidentiality. In this case, the 5' arms (i.e.; the 5' portion which will be released upon cleavage) of the different analyte-specific probes would be identical and would therefore trigger the same secondary signal cascade. A similar configuration would permit multiple probes complementary to a single gene to be used to boost the signal from that gene or to ensure inclusivity when there are numerous alleles.of a gene to be detected.
In the primary InvaderTM reaction, there are two potential sources of background. The first, is : from InvaderT"t-independent cleavage of probe annealed to the target, t64 tself, or to one.of the other oligonucleotides present in the reaction. It can lie seen`by consideration of Figs. 96 and 97. that the probes of the primary cleavage reactions depicted ar'e designed to ;have regions of complementarity to the other oiigonucleotides involved in the subsequent reactions, and, as depicted in Fig. 97, to other regions of the same molecule.
The use of an enzyme that cannot efficiently cleave a structure that lacks a primer (e.g., that cannot cleave the struetures diagrammed in Fig. 16A or 16 D) is preferred for this reason:
As sHown in Figs. 99 and 100, the enzyme Pfu FEN-1 gives no detectable tleavage in the absence of the upstream oligonucleotide or even in the presence of an upstream oligonucleotide that fails to invade the probe-target complex. This indicates thatthe`Pfu'FEN-1 endonuclease isa suitable enzyme for use in the methods of the present invention.
Other structure-specific nucleases may be suitable as a well. As discussed in the first example, some 5' nucleases can be used in conditions that significantly reduce this primer -independent cleavage. For example, it has been shown tliat when the 5' nuelease of DNAPTaq is used to cleave hairpins the primer-independent cleavage is markedly reduced by -the inclusion-of a monovalent salt in the reaction (Lyamichev, et at., (19931; supra).

' - . _ . - . - .. ' . . . - 3 . . .. . . . .

= ,~.
-~ 3 4=

Test For InvaderTM Oligonucleotide-Independent Cleavage A simple test can be performed for any enzyme in combination with any reaction buffer to gauge the amount of InvaderTM oligonucleotide-independent cleavage to be expected =
from that combination. A small hairpin-like test molecule that can be used with or without a =
primer hybridized to a 3' arm, the S-60 molecule, is depicted in Fig. 30. The S-60 and the oligonucleotide P15 are a convenient set of molecules for testing the suitability of an.enzyme for_ application in the present invention and conditions for using these molecules are described in Example 11. Other similar hairpins may be used, of a cleavage structure may be assembled from separate oligonucleotides as diagrammed in Figs 99a-e.
Reactions using these structures to examine the activity of the Pfu FEN-1 enzyme in the presence or absence of::an upstream overlapping oligonucleotide are described in Example 45 and the results are displayed in Fig. 100. To test any particular combination of enzyme and cleavage conditions, similar reactions can be assembled. Outside of the variables of reaction conditions to be tested for any particular enzyme (e.g., salt sensitivities, divalent catiori requirements) the test.
reactions, should accommodate any known limitations of the test en2yrne. For example, the test reactions should be performed at a temperature that is within the operating temperature range of the, candidate enzyme, if known:
It is not necessary that multiple lengths of overlap be: demonstrated for -each `ciandidate etlzyme, but the activity of the enzyme in the absence of an upstream oligonucleotide (as shown in Fig. 99a) and. in the presence of an oligonucleotide that does not overlap(Fig. 99b) should be assessed. It is preferable that structures -lacking an upstream oligonucleotide be cleaved.at less. than one half of. the rate seen in the presence of an _ upstream overlapping oligonucleotide. It is more preferable that these structures be cleaved at less than abaut on tenth the rate of the invasive cleavage structure. It is most preferred that cleavage. of these structures occur at less than one percent the rate of the, invasive cleavage structure.
If the, cleaved product is to serve as an upstream oiigonucleotide in a subsequent cleavage reaction, as diagrammed in Fig. 96, the most rapid reaction will be achieved-if the other components of the second cleavage structure (i.e., Target 2 and= Probe 2 in, Fig. 96) are provided in excess so that cleavage may proceed immediately after the upstream' 30 oligonucleotide (i. e, Cut Probe 1 in Fig. 96) is made availabie.' To provide an abundance of the second target strand (Target 2 in Fig. 96) one may use an isolated natural nucleic acid, such as bacteriophage M13 DNA, or one may use a synthetic oligonucleotide: If a-synthetic oligonucleotide is chosen as the second target sequence, the sequence employed must be ._ l ^....~ ..

examined for regions of self-complementarity (similar considerations apply to short isolated natural nucleic acids such as restriction enzyme fragments or PCR products;
natural nucleic acid targets whose 3' end is located ? 100 nucleotides downstream of the probe binding site on the target strand are sufficiently long enough to obviate the design considerations discussed below). Specifically, it must be determined that the 3' end of the synthetic oligonucleotide may not hybridize to the target strand (i.e., intra-strand hybridization) upstream of the probe, triggering unintended cleavage. Simple examination of the sequence of the synthetic oligonucleotide should reveal if the 3' end has sufficient complementarity to the region of the target upstream of the probe binding site to pose a problem (i. e, it would reveal whether the synthetic oligonucleotide can form a hairpin at its 3' end which could act as an invading oligonucleotide to cause cleavage of the probe in the absence of the hybridization of the intended InvaderTM oligonucleotide (Le., the cleavage product from the first invasive cleavage reaction). If 3 or more of the last 4 to 7 nucleotides (the 3' terminal region) of the synthetic target can basepair upstream of the probe such that there is an invasion into the probe-target duplex, or such that the duplexes formed by the synthetic target strand with its own 3' terminal region and with the probe abut without a gap and the 3' terminal region has an additional 1 or 2 nucleotides unpaired at the extreme 3' end of the synthetic target, then the sequence of the synthetic target oligonucleotide should be modified.
The sequence may be changed to disrupt the interaction of the 3' terminal region orto increase the distance between the probe binding site and the regions to which the 3' terminus is binding. Alternatively, the 3' end may be modified to reduce its abilityto direct cleavage (e.g., by adding a,3' phosphate during synthesis) (see Ex. 35, Table 3) or by adding several additional nucleotides that will not basepair in a.self-complementary manner (i. e., they will not participate in the formation of a hairpin structure).
When the product of a first invasive cleavage reaction is designed to form a target which can fold on itself to direct cleavage of a second probe, the IT complex as diagrammed in Fig. 97, the design of the sequence used to form the stem/loop of the IT
complex must be considered. To be factored into the design of such a probe are 1) the length of the region of self-complementarity, 2) the length of the region of overlap (region "X " in Fig. 25) and 3) the. stability of the hairpin or stem/loop= structure as predicted by both Watson-Crick base pairing and by the presence or absence of a particularly stable loop sequence (e.g., a tetraloop [Tinoco et al., supra], or a triloop [Hirao et al.; supra]). It is desirable that this sequence have nucleotides that can base pair (intrastrand), so that the= second round of invasive cleavage _ "'...~ ' .

may occur, but that the structure not be so strong that its presence will prevent the cleavage of the probe in the primary reaction (i.e., Probe I in Fig. 96). As shown herein, the presence of a secondary structure in the 5' arm of a cleavage structure cleaved by a structure-specific nuclease may inhibit cleavage by some structure-specific nucleases (Ex. 1).
The length of the region of self-complementarity within Probe I determines the length of the region of the duplex upstream of Probe 2 in the second cleavage structure (see Fig.
97). Different enzymes have different length requirements for this duplex to effect invasive cleavage efficiently. For example, the Pfu FEN-1 and Mja FEN-1 enzymes have been tested for the effect of this duplex length using the set of target/InvaderTM
oligonucleotide molecules depicted in Fig. 98 (e.e., SEQ ID NOS:118, 119, -147-151). The invasive cleavage reactions were performed as described in Example 38, using 1 pM IT3 (SEQ ID NO:118), 2 gM probe PRl (SEQ ID NO:119) for 5 min, and the rates of cleavage are shown in Table 2.

Lengthrof Duplex : Pfu-<p:EN=1 Turnover; per~min. MJa:FEN`i'.Turnover;:per min.

4 1a 57 The data shown in Table 2 demonstrate that the Pfu FEN-1 enzyme can be used with stems of 3 or 4 bases, but that the rate of cleavage is maximized whpn the stem is greater than-4 basepairs in length. Table 2 shows that the Mja FEN-1 enzyme can cleave efficiently using shorter stems; however, as this enzyme.can also cleave, a probe in the absence of an upstream oligonucleotide, Mja FEN-1 is not preferred for use in the methods of the present invention.
A similar test can be performed using any candidate enzyme to determine how much self-complementarity may be designed into the Probe 1. The use of a shorter stem means that the overall probe may be shorter. This is beneficial because shorter probes are less costly to synthesize, and because shorter probes will have fewer sequences that might form unintended intrastrand structures. In assessing the activity of a candidate enzyme on the structures such as those shown in Fig. 98 it is not required that the stem length chosen allow the maximum rate of cleavage to occur. For example, in considering the case of Pfu FEN-1, the advantages ~~ =~ ~

of using a 4 basepair stem (e.g., cost or sequence limitations), with a cleavage rate of 10 cleavages per minute, may outweigh the rate advantage of using a longer 6 basepair stem (44 cleavages/min.), in the context of a particular experiment. It is within the scope of the present invention that some elements chosen for use in the assay be sub-optimal for performance of that particular element, if the use of a sub-optimal design benefits the objectives of that particular experiment as a whole.
In designing oligonucleotides to be employed as a probe that once cleaved forms a stem-loop structure as diagrammed in Fig. 97 (i.e., Probe I in Fig: 97), it has been found that the stability of the loop is not a factor in the efficiency of cleavage of either Probe 1 or Probe 2. Loops tested have included stable triloops, loops of 3-and 4 nucleotides that were not predicted to be particularly stable (i.e., the stability is determined'by the duplex`sequence and not by additional stabilizing interactions within the loop), and large loops of up to about 25 nucleotides.

X. Detection of Human Cytomegalovirus Viral DNA By lnvasive Cleavage Human cytomegalovirus (HCMV) causes, or is associated with, a wide variety of <. ;.. . .:
diseases in humans (Table 3). More than 90% of bone marrow or kidney transplant recipients (immunocompromised hosts) develop HCMV infections, most of which are due to reactivation of latent virus by immunosuppressive drugs, as well as transmission of virus by latently infected donor tissue or blood (Ackerman et al., Transplant. Proc., 20(S 1):468 [ 1988]; :
and Peterson et al.. Medicine 59:283 [1980]).

Diseases Caused By Human Cytomegalovirus cytomegalic inclusion heterophil-negative disease in neonates mononucleosis interstitial pneumonia pneumonitis retinitis hepatitis pancreatitis meningoencephalitis gastrointestinal disease disseminated infection WO 98/42873 PCTlUS98/05809 There are instances in which rapid, sensitive, and specific diagnosis of HCMV
disease is imperative. In recent years, the number of patients undergoing organ and tissue transplantations has increased markedly. HCMV is the most frequent cause of death in immunocompromised transplant recipients, thereby confirming the need for rapid and reliable laboratory diagnosis. Lymphocytes, monocytes, and possibly arterial endothelial or smooth muscle cells, are sites of HCMV latency. Therefore, prevention of HCMV
infections in immunocompromised individuals (e.g., transplant recipients) includes use bf HCMV-negative blood products and organs. Additionally, HCMV can be spread transplacentally, and to newborns by contact with infected cervical secretions during birth. Thus, a rapid, serisitive, and specific assay. for detecting HCMV in body fluids or secretions may be desirable as a means to monitor infection, and consequently, determine the necessity of cesareaii'section.
Diagnosis of HCMV infection may be performed by conventional cell culture using human fibroblasts; shell vial centrifugation culture utilizing monoclonal antibodies and immunofluorescent staining techniques; serological methods; the HCMV
antigenemia assay which employs a monoclonal antibody to detect HCMV antigen in peripheral blood leukocytes (PBLs); or by nucleic acid hybridization assays. These various methods have their advantages and limitations. Conventional cell culture is sensitive but slow, as cytopathic effect (CPE) may take 30 or more days to develop. Shell vial centrifugation is more _rapid but still requires 24-48 hours for initial results. Both culture methods, are affected by antiviral therapy. In immunoeompromised patients, the ability to mount IgG and/or IgM
antibody responses to HCMV infection are impaired, and serological methods are thus not reliable in this setting. Alternatively, IgM antibodies may be persistent for mpnths after infection is resolved, and thus their presence may not be indicative of active irifection.
The HCMV
antigenemia assay is labor intensive and is not applicable to specimens other than PBLs.
Recent advances in molecular biology have spurred the use of DNA probes in attempts to provide a more rapid, sensitive and specific assay for detecting HCMV in clinical specimens. For example, radiolabeled DNA probes have been used to hybridize to tissue cultures infected with or by HCMV, or in clinical samples suspected of containing HCMV
("hybridization assays"). However, probing of tissue cultures requires at least 18-24 hours for growth to amplify the antigen (HCMV),to be detected, if present, and additional time for development of autoradiographic detection systems. Using hybridization assays for assaying clinical specimens for HCMV may lack sensitivity, depending upon the titer of virus and the clinical sample assayed. Detection of HCMV in clinical samples has been reported using the polymerase chain reaction (PCR) to enzymatically amplify HCMV DNA. Methods using PCR compare favorably with virus isolation, in situ hybridization assays, and Southern blotting; See, e.g., Bamborschke et al,. J. Neurol., 239:205 [1992]; Drouet et al., J. Virol.
Meth., 45:259 [1993]; Einsele el al., Blood 77:1104-1110 [1991]; Einsele et al., Lancet 338:1170 [ 1991 ]; Lee et al., Aust. NZ J. Med., 22:249 [19921; Miller et al., J. Clin.
Microbiol., 32:5 [1994]; Rowley et al., Transplant. 51:1028 [1991]; Spector et al. J. Clin.
Microbiol., 30:2359 [1992]; and Stanier et al., Mol. Cell. Probes 8:51 [1992]). Others, comparing the HCMV antigenemia assay with PCR methods, have found PCR methods as efficient or slightly, more efficient in the detection of HCMV (van Dorp et al. (1992) Transplant. 54:661; Gerna et al. (1991) J. Infect. Dis. 1*64:488; Vleiger et al. (1992) Bone Marrow Transplant. 9:247; Zipeto et al. (1992) J. Clin. Microbiol. 30:527]. ln addition, PCR
methods have exhibited great sensitivity when specimens other than PBLs are assayed (Natori et al., Kansenshogaku Zasshi 67:1011 [1993]; Peterson et a1., Medicine 59:283 [1980]; Prosch ]).
et al., J. Med. Virol., 38:246 [1992]; Ratnamohan et al., J. Med'. Viro1:
38:252' [1992 However, because of the dangers of false positive reactions, these"PCR-based".p`rocedures require rigid controls to prevent contamination and carry over (Eliirlich et al., =in )iCR=Based Diagnostics in Infectious Diseases, Ehrlich and Greenberg (eds), Blackwell Scientif c Publications, [1994], pp.3-18). Therefore, there exists a need for a rapid, sensitive; and specific assay for HCMV that has a reduced risk of false positive result due to contamination by reaction product carried over from other samples.
As shown herein, the InvaderTM-directed cleavage assay is rapid, `sensitive and specific.
Because the accumulated`products do not contribute to the further accumulation of signal, reactionproducts carried over from one standard (i.e., non-sequential) InvaderT"1=directed cleavage assay to another cannot promote false positive results. ' The use of multiple sequential InvaderT"'-directed cleavage assays will further boost the sensitivity of HCMV
de'tection without sacrifice of'these advantages.

XI. Effect of ArrestorTM Oligonucleotides on Signal and Background in Sequential Invasive Cleavage Reactions As'described above, and deinonstrated in Example 36, theconcentration of the probe , that is cleaved can be used to increase the rate of signal'accumulation, with higher concentrations of probe yielding higher final signal. However, the presence of large amounts of residual uncieaved probe can present problems for subsequent use of the cleaved products for detection or for further amplification. If the subsequent step is a simple detection (e.g., by gel resolution), the excess uncut material may cause background by streaking or scattering of signal, or by overwhelming a detector (e:g., over-exposing a film in the case of radioactivity, or exceeding the quantitative detection limits of a fluorescence imager). This can be overcome by partitioning the product from the uncut probe (e.g., by using the charge reversal method described in Example 22).
In more complex detection methods, the cleaved product may be intended to interact with another entity to indicate cleavage. As noted above, the cleaved product can be used in any reaction that makes use of oligonucleotides, such as hybridization, primer extension, ligation, or the direction of invasive cleavage. In each of these cases, the fate of the residual uncut probe must be considered in the design of the reaction. In a primer, extension reaction, the uncut probe can hybridize to a template for extension. If cleavage is required to reveal the correct 3' end for extension, the hybriktiized uncut probe will not be=
extended. It will, however, compete with the cleaved product for the template. If the template is in excess of the combination of cleaved and uncleaved, probe, then both of the latter should be able to find a copy of template for binding. If, however,;the template is limiting, the competition reduces the portion of the cleaved probe that can find successfully bind to the available ternplate. If a vast excess of probe was used to drive the initial reaction, the remainder may alsci be in vast excess over the cleavage product,. and thus may provide a very effeetive competitor, thereby reducing the amount of the final reaction (e.g., extensiwn) product for ultimate detection.
The participation of the uncut probe. material in a secondary reaction,can also contribute to: background in these reactions. While the presentation of a cleaved probe.
for a-subsequent reaction may represent _ an ideal. substrate for the enzyme to be used in the next step, some enzymes may also be able to act, albeit, inefficiently, on the uncut probe as well. It was . shown in Example 43 that transcription.can be promoted frorn a nicked promoter even when' one side of the nick has.additional unpaired nucleotides (termed a"branche.d promoter" in this Example). Similarly, when the subsequent reaction is to be an invasive cleavage structure, the uncleaved probe may bind to the elements intended to form the second cleavage structure with the cleaved probe. Two of the possible configurations are shown schematically in Figs.
105 and 106. The right hand structure in the- second step in each Figure shows a possible configuration formed by the secondary reaction elements (e.g., secondary targets and/or probes) and the uncleaved primary probe., In each of these cases, it was found - that the 5' nucleases -described herein c.an direct some measure of cleavage of these defective structures.

Even at a low level, this aberrant cleavage can be misinterpreted as positive target-specific cleavage signal.
With these negative effects of the surfeit of uncut probe considered, there is clearly'a need for some method of preventing these interactions. As noted above, it is possible to partition the cleaved product from the uncut probe after the primary reaction by traditional methods. However, these methods are oflen time consuming, may be expensive (e.g., disposable columns, gels, etc.), and may increase the risk for sample mishandling or contamination. It is far preferable to configure the sequential reactions such that the original sample need not be removed to a new vessel for subsequent reaction.
The present invention provides a method for reducing the interactions between the primary probe and any subsequent reactants. This method provides a means of specifically diverting the uncleaved probes from participation in the subsequent reactions.
The diversion is accomplished by the inclusion in the next reaction step an agent designed to specifically interact with the uncleaved primary probe. While the primary probe in an invasive cleavage reaction is discussed for reasons of convenience, it is contemplated that the ArrestorsTm. may be used at any reaction step within a chain of invasive cleavage steps, as needed or desired for the design of an assay. It is not intended that the Ar,restorsTM of the present invention be limited to any particular step.
Tle method of diverting the residual uncut probes from a primary reaction makes use of agents that can be specifically designed or selected to bind to the uncleaved probe molecules with greater affinity than to the cleaved probes, thereby allowing the cleaved probe species to effectively compete for the elements of the subsequent reaction, even when the uncut probe is present in vast excess. These agents have been termed "ArrestorsTm," due to their function of stopping or arresting the primary probe from participation in the later reaction. In various Examples below, an oligonucleotide is provided as an AnestorTM in an invasive cleavage assay. It can be appreciated that any molecule or chemical that can discriminate between the full-length uncut probe and the cleaved probe, and that can bind or otherwise disable the uncleaved probe preferentially may be configured to act as an ArrestorTM within the meaning of the present invention. For example, antibodies can be derived with such specificity, as can the "aptamers" that can be selected through multiple steps of in vitro amplification (e.g., "SELEX," U.S. Patent Nos. 5,270,163 and 5,567,588) and specific rounds of capture or other selection means.

--~
w0 98/42873 PCT/US98/05809' In one embodiment, the ArrestorTM is an oligonucleotide. In another embodiment the oligonucletide ArrestorTM is a composite oligonucleotide, comprising two or more short olignucleotides that are not covalently linked, but that bind cooperatively and are stabilized by co-axial stacking. In a preferred embodiment,. the oligonucleotide is modified to reduce interactions with the cleavage agents of the present invention. When an oligonucleotide is used as an AnestorTM, it is intended that it not participate in the subsequent reactive step.
Consideration of the schematic diagrams in Figs. 105 and 106, particularly the right-most Figure in step 2b of each Figure, will show that the binding of the ArrestorTM
to the primary probe may, either with the participation of the secondary target, or without such participation, create a bifurcated structure that is a substrate for cleavage by the 5' nucleases used in some' embodiments of the methods of the present invention. Formation of such structures would lead to some. level of unintended cleavage that could contribute to background, reduce specific signal or compete for the enzyme. It is pxeferable to provide ArrestorsTM that will not create such cleavage structures. One method of doing this is to add to the ArrestorTM
such modifications as have been found to reduce the activity of InvaderTM
oligonucleotides, as the InvaderTM oligonucleotides occupy a similar positiori within a cleavage structure (i.e., the 3' end of the InvaderTM oligonucleotide positions the - site of cleavage of an unpaired 5' arm).
Modification of the 3' end of the InvaderTM oligonucleotides was examined for tihe'effects on cleavage in Example 35;a number of the modifications tested were found to be significantly debilita,ting to the function of the InvaderTM oligonucleotide. Other modifications not described herein may be easily characterized by performing such a test using the cleavage enzyme to be used in the reaction for which the ArrestorTKis intended.
In a preferred embodiment, the backbone of an oligonucleotide ArrestorTM is modified.
This may be done to increase the resistance. to degradation by nucleases or temperature, or to provide duplex structure that is a less favorable substrate for the enzyme to be used (e.g., A-form duplex vs. B-form duplex). .In particularly preferred embodiment, the backbone modified oligonucleotide further comprises a 3' terminal modification. In a preferred embodiment, the modifications comprise 2' 0-methyl substitution of the nucleic acid backbone, while in. a particularly preferred embodiment, the 2' 0-methyl modified oligonucleotide further comprises a 3' terminal amane group.
The purpose of the,. ArrestorTM is to allow the minority population of cleaved probe to effectively compete with the uncleaved. probe for binding whatever elements are to be ~ used in the next step. While an ArrestorTM that can discriminate between the two probe species .~~~ '..

absolutely (i.e., binding only to uncut and never to cut) may be'of the greatest benefit in some embodiments, it is envisioned that in many applications, including the sequential InvaderT"' assays described herein, the ArrestorsTM of the present invention may perform the intended function with only partial discrimination. When the AnestorTM has some interaction with the cleaved probe, it may prevent detection of some portion of these cleavage products, thereby reducing the absolute level of signal generated from a given amount of target material. If this same ArrestorTM has the simultaneous effect of reducing the background of the reaction (i.e., from non-target specific cleavage) by a factor that is greater than the factor of reduction in the specific signal, then the significance of the signal (i.e., the ratio of signal to background), is increased, even with the lower amount of absolute signal.
Any potential ArrestorTM design may be tested in a simple fashion by comparing the levels of background and specific signals from reactions that lack ArrestorsTM to the levels of background and specific signal from similar reactions that include ArrestorsTM. Each of the reactions described in Examples 49-53 demonstrate the use of such comparisons, and these"can easily be adapted by those skilled in the art to other ArrestorTM and target embodiments.: `What constitutes an acceptable level of tradeoff of absolute signal for specificity will Vary for f>' different applications (e:g., target levels; read-out sensitivity, etc.), and can be determined by any individual user using the methods of the present invention:
EXPERIMENTAL
The following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting,the scope thereof.
In the disclosure which follows, the following ablireviations apply: Afu (Archaeoglobus fulgidus); Mth (Methanobacterium thermoautotrophicum); Mja (Methanococcus jannaschii); 'Pfu (Pyrocoecus furiosus); Pwo (Pyrococcus woesei); Taq (Thermus aquaticus); Taq DNAP, DNAPTaq, and Taq Pol I(T. aquaticus DNA
polymerase I); DNAPStf (the Stoffel fragment of DNAPTaq); DNAPEc1 (E coli DNA polymerase 1);
Tth (Thermus thermophilus); Ex. (Example); Fig. (Figure); C (degrees Centigrade); g (gravitational field); hr (hour); min (minute); olio (oligonucleotide); rxn (reaction); vol (volume); w/v (weight to volume); v/v (volume to volume); BSA (bovine serum albumin);
CTAB (cetyltrimethylammoniucn bromide); HPLC (high pressure Iiquid chromatography);
DNA (deoxyribonucleic acid); p-(plasmid); l (mieroliters); mI (milliliters);
g (micrograms);
mg (milligrams); M (molar); mM (milliMolar); M (microMolar); pmoles (picomoles);

amoles (attomoles); zmoles (zeptomoles); nm (nanometers); kdal (kilodaltons);
OD (optical density); EDTA (ethylene diamine tetra-acetic acid); FITC (flauorescein isothiocyanate); SDS
(sodium dodecyl sulfate); NaPO4 (sodium phosphate); NP-40 (Nonidet P-40); Tris (tris(hydroxymethyl)-aminomethane); PMSF (phenylmethylsulfonylfluoride); TBE
(Tris-Borate-EDTA, i.e., Tris buffer titrated with boric acid rather than HCl and containing EDTA); PBS (phosphate buffered saline); PPBS (phosphate buffered saline containing 1 mM
PMSF); PAGE (polyacrylamide gel electrophoresis); Tween (polyoxyethylene-sorbitan);
ATCC (American Type Culture Collection, Rockville, MD); DSMZ (Deutsche Sammiung von Mikroorganismen und Zellculturen, Braunschweig, Germany); Ambion (Ambion, Inc., Austin, TX); Boehringer (Boehringer Mannheim Biochemical, Indianapolis, IN);
MJ Research (MJ Research, Watertown, MA; Sigma (Sigma Chemical Company, St. Louis, MO);
Dynal (Dynal A.S., Oslo, Norway); Gull (Gull Laboratories,.Salt Lake City, UT);
Epicentre (Epicentre Technologies, Madison, WI); MJ Research (MJ Research, Watertown,MA);
National Biosciences (National Biosciences, Plymouth, MN); NEB (New England Biolabs, Beverly, MA); Novagen (Novagen, Inc., Madison, WI); Perkin Elmer (Perkin-Elmer/ABI, Norwalk, CT); Promega (Promega, Corp., Madison, WI); Stratagene (Stratagene Cloning Systems, La Jolla, CA); Clonetech (Clonetech, Palo Alto, CA) Pharmacia (Pharmacia, Piscataway, NJ); Milton Roy (Milton Roy, Rochester, NY); Amersham (Amersham International, Chicago, IL); and USB (U.S. Biochemical, Cleveland, OH).

Charactcristics Of Native Thermostable DNA Polymerases A. 5' Nuclease Activity Of DNAPTaq During the polymerase chain reaction (PCR) (Saiki et al., Science 239:487 [1988];
Mullis and Faloona, Meth. Enzymol., 155:335 [1987]), DNAPTaq is able to amplify many, but not all, DNA sequences. One sequence that cannot be amplified using DNAPTaq is shown in Fig. 5 (Hairpin structure is SEQ ]D NO:15, Fig. 5 also shows a primer: SEQ ID
NO:17.) This DNA sequence has the distinguishing characteristic of being able to fold on itself to form a hairpin with two single-stranded arms, which correspond to the primers used in PCR
To test whether this failure to amplify is due to the 5' nuclease activity of the enzyme, the abilities of DNAPTaq and DNAPStf to amplify this DNA sequence during 30 cycles of PCR were compared. Synthetic oligonucleotides were obtained from The Biotechnology *Trade-mark . -"'.

Center at the University of Wisconsin-Madison. The DNAPTaq and DNAPStf were from Perkin Elmer (i.e., AmplitaqTM DNA polymerase and the Stoffel fragment of AmplitaqTM
DNA polymerase). The substrate DNA comprised the hairpin structure shown in Fig. 6 cloned in a double-stranded form into pUC 19. The primers used in the ainplification are listed as SEQ ID NOS:16-17. Primer SEQ ID NO:17 is shown annealed to the 3' arm of the hairpin structure in Fig. 5. Primer SEQ ID NO:16 is shown as the first 20 nucleotides in bold on the 5' arm of the hairpin in Fig. 5.
Polymerase chain reactions comprised 1 ng of supercoiled plasmid target DNA, 5 pmoles of each primer, 40 M each dNTP, and 2.5 units of DNAPTaq or DNAPStf, in a 50 l solution of 10 mM Tris=Cl pH 8.3. The DNAPTaq reactions included 50 mM KCI
and 1.5 mM MgCIZ. The temperature profile was 95 C for 30 sec., 55 C for 1 min. and 72 C for 1 min., through 30 cycles. Ten percent of each reaction was analyzed by gel electrophoresis through 6% polyacrylamide (cross-linked 29:1) in a buffer of 45 mM
Tris=IIorate, pH 8.3, 1.4 mM EDTA.
The results are shown in Fig. 6. The expected product was made by DNAPStf (indicated simply as "S") but not by DNAPTaq (indicated as "T"). It was concluded that the 5' nuclease activity of DNAPTaq is responsible for the lack of amplification of this DNA
sequence.
To test whether the 5' unpaired nucleotides in the substrate region of this structured DNA are removed by DNAPTaq, the fate of the end-labeled 5' arm during four cycles of PCR was compared using the same two polymerases (Fig. 7). The hairpin templates, such as the one described in Fig. 5, were made using DNAPStf and a 32P-5'-end-labeled primer. The 5'-end of the DNA was released as a few large fragments by DNAPTaq but not by DNAPStf.
The sizes of these fragments (based on their mobilities) show that they contain most or all of the unpaired 5' arm of the DNA. Thus, cleavage occurs at or near the base of the bifurcated duplex. These released fragments terminate with 3' OH groups, as evidenced by direct sequence analysis, and the abilities of the fragments to be extended by terminal deoxynucleotidyl transferase.
Figs. 8-10 show the results of experiments designed to characterize the cleavage reaction catalyzed by DNAPTaq. Unless otherwise specified, the cleavage reactions cotnprised 0.01 pmoles of heat-denatured, end-labeled hairpin DNA (with the unlabeled complementary strand also present), l pmole primer (complementary to the 3' arm) and 0.5 units of DNAPTaq (estimated to be 0:026 pmoles) in a total volume of 10g1 of 10 mM Tris-- ->. .
W0.98/42873 PCTlUS98105849. ;

~=
Cl, ph 8.5, 50 mM KC1 and 1.5 mM MgC1,. As indicated, some reactions had different concentrations of KCI, and the precise times and temperatures used in each experiment are indicated in the individual Figures. The reactions ihat included a primer used the one shown in Fig. 5 (SEQ ID NO: 17). In some instances, the primer was extended to the junction site by providing polymerase and selected nucleotides.
Reactions were initiated at the final reaction temperature by the addition of either the MgCIZ or enzyme. Reactions were stopped at their incubation temperatures by the addition of 8 l of 95% _formamide with 20 mM.EDTA and 0.05% marker dyes. The T.
calculations listed were made using the OiigoTM primer analysis software from National Biosciences, Inc.
These were determined using 0.25 M as the DNA concentration, at either 15 or 65 mM total salt (the 1.5 mM MgCl2 in all reactions was given the value of 15: mM salt for..thew calculations).

Fig. 8 is an autoradiogram containing the results of a set of experiments and conditions on the cleavage site. Fig. 8A is a determination of reaction components that enable cleavage. Incubation of 5'.-end-labeled hairpin DNA. was for 30 xninutes at 55 C, with' the indicated components. The products were, resolved by denaturing polyacryiamide gel electrophoresis and the lengths of the products, in nucleotides, are indicated.: Fig;<;$B
describes the effect of temperature on the site of cleavage in the absence of added;primer.
Reactions were incubated in the absence of KCI for 10 minutes at the indicated temperatures.
The lengths of the products, in nucleotides, are indicated. :..
Surprisingly, cleavage by.DNAPTaq requires neithcr a primer nor dNTPs (See Fig.
8A). Thus, the. 5' nuclease activity can be uncoupled from polymerization..
Nuclease~activity requires magnesium ions, 'though manganese ions can be substituted, albeit.
with potential changes in specificity and activity.. Neither zinc nor, calcium ions support ihe cleavage reaction. The reaction occurs over a broad temperature range, from 25 C to 85 C, with the rate of cleavage increasing at higher temperatures.
Still referring to Fig. 8, the primer is not elongated in the absence of added dNTPs.
However, the primer influences both the site and the rate of cleavage. of the, hairpin. The change in the site of cleavage (Fig. 8A) apparently results from disruption of a short duplex formed between the arms of the DNA substrate. In the absence; of primer, the sequences indicated by underlining in Fig. 5 could pair, forming an extended duplex.
Cleavage. at the end of the extended duplex would release the 11 nucleotide fragment seen on:the.Fig.-.8A
lanes with no added primer. Addition of excess..primer (Fig., 8A, Yanes,3 and 4) or:incubation at an elevated temperature (Fig. 8B) disrupts the short extension of the duplex and results in a longer 5' arm and, hence, longer cleavage products.
The location of the 3' end of the primer can influence the precise site of cleavage.
Electrophoretic analysis revealed that in the absence of primer (Fig. 8B), cleavage occurs at the end of the substrate duplex (either the extended or shortened form, depending on the temperature) between the first and second base pairs. When the primer extends up to the base of the duplex, cleavage also occurs one nucleotide into the duplex. However, when a gap of four or six nucleotides exists between the 3' end of the primer and the substrate duplex, the cleavage site is shifted four to six nucleotides in the 5' direction.
Fig. 9 describes the kinetics of cleavage in the presence (Fig. 9A) or absence (Fig. 9B) of a primer. oligonucleotide. The reactions were run at 55 C with either 50 mM
KCl (Fig.
9A) or 20 mM KCl (Fig. 9B). The reaction products were resolved by denaturing polyacry. lamide gel electrophoresis and the lengths of the products, in nucleotides, are indicated. "M", indticating a marker, is a 5'- end-labeled 19-nt oligonucleotide. Under these salt eonditions, Figs. 9A and 9B indicate that the reaction-appearstobe about twenty times faster in the presence of primer than in the absence of primer. This-effect on the 'ifficiency may be attributable to proper alignment and stabilization of the enzyme on the substrate.
The relative influence of primer on cleavage rates becomes much greater when both reactions are run in 50 mM KCI. In the presence of primer, the rate of cleavage increases with KCI concentration, up to about 50 mM. However, inhibition of -this reaction in the presence of primer is apparent at 100 mM and is complete at 150 mM KCI. In contrast, in . the absence of pr.imer: the rate is enhanced by concentration of KCl up to 20 mM, but it is reduced at concentrations above 30 mM: =At 50, thM KCI, the reaction i-s almost completely inhibited. The inhibition of cleavage by KCI in the absence of primer is affected by .25 temperature, being more pronounced at lower temperatures.
Recognition of the 5' end of the arm to be cut appears to be an important feature of substrate recognition., Substrates that lack a free 5' end, such as circular M13 DNA, cannot be cleaved under any conditions tested. Even with substrates having defined 5' arms, the rate of cleavage by DNAPTaq is influenced by the length of the arm. In the presence of primer and 50 mM KCI, cleavage of a 5' extension that is 27 nucleotides long is esseritially 'complete within 2.minutes at 55 C. In contrast, cleavages of molecules with 5' arms of 84 and 188 nucleotides are only about 90%o and 40% complete after 20 minutes. Incubation at higher temperatures reduces the inhibitory effects= of long extensions indicating that secondary ,.., WO-98/42873 PCTlUS98/05809' structure in the 5' arm or a heat-labile structure in the enzyme may inhibit the reaction. A
mixing experiment, run under conditions of substrate excess, shows that-the molecules with long arms do not preferentially tie up the available enzyme in non-productive complexes.
These results may indicate that the 5' nuclease domain gains access to the cleavage site at the =
end of the bifurcated duplex by moving down the 5' arm -from one end to the other. =Longer 5' arms would be expected to have more adventitious secondary structures (particularly when KC( concentrations are high), which would be likely to impede this movement.
Cleavage does not appear to be inhibited by long 3' : arms of either the substrate strand target molecule or pilot nucleic acid, at least up to 2 kilobases. , At the other extreme, 3' arms of the pilot nucleic acid as short as one nucleotide can support cleavage in a primer-independent reaction, albeit inefficiently.. Fully paired oligonucleotides do notelicit cleavage of DNA templates during primer extension.
The ability of DNAPTaq. to cleave molecules even when the -complementary =strand contains only one. unpaired 3' nucleotide :may be useful in optimizing allele-specif c PCR
PCR primers that have unpaired 3' ends could act as.pilot oligonucleotides to direct selective cleavage of unwanted templates during preincubation of potential teinplate-primer` complexes with DNAPTaq in. the absence of nucleoside triphosphates.

B. 5' Nuclease Activities Of :Other DNAPs To deterrnine whether other 5' nucleases in other DNAPs would.~be suitable for the present invention, an array of enzymes, several of which were reported in the iiterature to be free;pf apparent 5' nuclease activity,. were examined. .The -ability of -these other enzymes to cleave nucleic acids in a structure-specific manner was tested using the hairpin substrate shown in Fig. 5 under conditions reported to be optimal for synthesis by each enzyme.
DNAPEcI and DNAP Klenow were obtained from Promega; the DNAP= of Pyrococcus furious ("Pfu", Bargseid et al., Strategies.4:34 [19.91]) was from Stratagene;
the DNAP of Thermococcus litoralis ("Tli", VeutTM(exo-), Perler et al., Proc. Natl. Acad.
Sci: USA 89:5577 =
[1952] was from New England Biolabs; the DNAP of Thermus.ftavus {"Tfl", Kaledin et al., Biokhimiya 46:1576 [1981] was from Epicentre Technologies; and the DNAP of Thermus thermophilus ("Tth", Carballeira et al, Biotechn., 9:276 [19901; Myers et al., Biochem., 30:7661 (1991)] was-from U.S.- Biochemicals.

0.5 units of each DNA polymerase was assayed in a 20 l' reaction; using either the buffers supplied by. the manufacturers, for the: primer-dependent reactions, or. 10 1m1VI Tris=Cl, pH 8.5, 1.5 mM MgC1Z, and 20mM KC1. Reaction mixtures were at held 72 C before the addition of enzyme.
Fig. 10 is an autoradiogram recording the results of these tests. Fig. l0A
demonstrates reactions of endonucleases of DNAPs of several thermophilic bacteria. The reactions were incubated at 55 C for 10 minutes in the presence of primer or at 72 C for 30 minutes in the absence of primer, and the products were resolved by denaturing polyacrylamide gel electrophoresis. The lengths of the products, in nucleotides, are indicated.
Fig. lOB
demonstrates endonucleolytic cleavage-by the 5' nuclease of DNAPEcI. The DNAPEcI and DNAP Klenow reactions were incubated for 5 minutes at 37 C. Note the light band of cleavage products of 25 and 11 nucleotides in the DNAPEcI lanes (made in the presence and absence of primer, respectively). Fig. 8A also demonstrates DNAPTaq reactions iri the presence (+) or absence (-) of primer. These reactions were run in 50 mM and 20 mM KCI, respectively, and were incubated at 55OC for 10 minutes:
Referring to Fig: 10A, DNAPs from the eubacteria Thermus _ thermophilus and Thermus flavus cleave the substrate at the sarne place as DNAPTaq, both in the preserice and absence of primer. In contrast, DNAPs from the archaebacteria Pyrococcus furiosus and Thermococcus litoralis are unable to cleave thesubstrates endonucleolytically:
The DNAPs ÃromPyroeoccus furfvus and Thermococcus litoralis share little sequence`homology with eubacterial enzymes (Ito et a1., Nuc1. Acids Res. 19:4045 (1991); Mathur et al., Nucl. Acids.
Res. 19:6952 (1991); see also Perler et al.). Referring'to Fig. IUB, DNAPEc1 also cleaves the substrate, but the resulting cleavage products are difficult to detect unless the 3' exonuclease is inhibited. The amino acid sequences of the 5' nuelease domains of DNAPEcI
and DNAPTaq are about 38% homologous (Gelfand, =supra).
The 5',nuclease domain of DNAPTaq also shares about 19% homology with the 5' exonuclease encoded by gene 6 of bacteriophage T7 (Dunn et al., J. Mol.
13io1.,166:477 [1983]). This nuclease, which is not covalently attached to a DNAP
polymerization. domain, is also able to cleave DNA endonucleolytically, at a site similar `or identical to the site that is cut by the 5' nucleases described above, in the absence- of added primers.

C. Transcleavage The ability of a 5' nuclease to be directed to cleave` efficiently at any specific sequence was demonstrated in the following experiment. A partially complementary oligonucleotide termed-a "pilot oligonucleotide" was hybridized to sequences at the desired . . .-.. , -~ .
WO 98/42873 PCT/US98/0580g point of cleavage. The non-complementary part of the pilot oligonucleotide provided a structure analogous to the 3' arm of the template (see Fig. 5), whereas the 5' region of the substrate. strand became the 5' arm. A primer was provided by designing the 3' region of the pilot so that it would fold on itself creating a short hairpin with a stabilizing tetra-loop (Antao et aL, Nucl. Acids Res. 19:5901 [1991 ). Two pilot oligonucleotides are shown in Fig. 11A.
Oligonucleotides 19-12 (SEQ ID NO:18), 30-12 (SEQ ID NO:19) and 30-0 (SEQ ID
NO:20) are_31, 42 or 30 nucleotides long, respectively. However, oligonucleotides 19-12 (SEQ ID
NO:18) and 34-19 (SEQ. ID NO:19) have only 19 and 30 nucleotides, respectively, that are complementary to different sequences in the substrate strand. The pilot oligonucleotides are calculated to melt.off their complements. at about 50 C (19-12) and about 75 C
(30-12).
Both pilots have 12 nucleotides at their 3' ends, which act as,3' arms with base-paired, ~
primers attached.
To demonstrate that cleavage could be directed by a pilot oligonucleotide, a single-stranded target DNA with DNAP Taq was incubated in the presence of two-potential pilot oligonucleotides. The, transcleavage reactions, where the target and pilot nucleic acids are not covalently linked, includes 0.01 pmoles of single end-labeled substrate. DNA, 1 unit of DNAPTaq and 5 pmoles. of pilot: oligonucleotide in a volume,of 20 l - of Ahe sanne buflkrs.
These components were combined during a one minute incubationat>95 C, to denature-the PCR ; generated double-stranded substrate DNA, and the temperatures of the reactions were then reduced to their final incubation temperatures. Oligonucleotides 30-12 and -19-12 can hybridize to regions of the substrate DNAs that are 85 and 27 nucleotides from the 5' ~end of the, targeted strand, Fig. 19 shows the coxnplete 206-mer sequence. (SEQ ID NO:27):. The 206-mer was generated by PCR . The M 13/pUC 24-mer reverse sequencing (-48) primer and the M13/pUC sequencing (-47) primer from NEB (catalogue nos: 1233 and 1224 respectively) were used (50 pmoles each). with the pGEM3z(f+) plasmid vector. (Promega) as template (10 ng) containing the target sequences. The conditions for PCR were as follows:
50: M .of =
each dNTP and 2.5 units of Taq DNA polymerase in 100 l of 20 mM :Tris-Cl,. pH
8:3, 1.5 mM MgCl2, 50 mM KCI with 0.05% Tween-20 and 0.05% NP-40. Reactions were cycled times through .95 C for 45 seconds, 63 C- for 45 seconds, then: 72 C for.,75 seconds. After cycling, reactions were finished off with an incubation at 72 C for_ 5 minutes. The resulting fragment was purified by electrophoresis through a 6%polyacrylamide gel (29:1 cross, link) in a buffer of 45 mM Tris-Borate, pH. 8.3, ;,1.4 mM EDTA,-: visualized by :ethidiunlbromide staining or autoradiography, excised from the gel, eluted by passive diffusion, and concentrated by ethanol precipitation.
Cleavage of the substrate DNA occurred in the presence of'the pilot oligonucleotide 19-12 at 50 C (Fig. 11B, lanes I and 7) but not at 75 C (lanes 4 and 10). In the presence of oligonucleotide 30-12 cleavage was observed "at both temperatures. Cleavage did not occur in the absence of added oligonucleotides (lanes 3, 6 and 12) or at about 80 C
even though at 50 C adventitious structures in the substrate allowed primer-independent cleavage in the absence of KCI (Fig. 11 B, lane 9). A non-specific oligonucleotide with no complementarity to the substrate DNA did not direct cleavage at 50 C, either in the absence or presence of 50 mM KCI (lanes 13 and 14). Thus, the specificity of the cleavage reactions can be controlled by the extent of complementarity to the substrate and by the conditions of incubation:

D. Cleavage Of RNA
A shortened RNA version of the sequence used in the transcleavage experiments discussed above was tested for its ability to serve as a substrate in the reaction.`'The RNA is cleaved at the expected place, in a reaction that is dependent upon thepresence of the pilot oligonucleotide. The RNA substrate, made by T7 RNA polymerase inthe presence of (a-32P)UTP, corresponds to a truncated, version of the DNA substrate used in Fig 11B: Reaction conditions were similar to those in used for the DNA substrates described above, with 50 mM
KCI; incubation was for 40 minutes at 55 C:, The pilot oligonucleotide used'is termed 30-0 .(SEQ ID NO:20) and is shown in Fig. 12A.
The results of the cleavage,reaction'is shown in Fig. 13B. The reaction was run either in the presence or absence of DNAPTaq or pilot oiigonucleotide as indicated in Fig. 12B.
Strikingly, in. the" case of RNA cleavage, a 3' arrri is not required for the pilof oligonucleotide. It is very unlikely that this cleavage is due to previously described RNaseH, which would be expected to cut the RNA in several places alorlg the 30 base-pair long RNA-DNA duplex. The 5' nuclease of DNAPTaq is a structure-specific RNaseH that' cleaves the RNA at a single site near the 5' end of the heteroduplexed region.
It is surprising that an oligonucleotide lacking a 3' arm is able to act' as a piiotin directing efficient cleavage of an RNA target because sueh oligonucleotides are unable"to direct efficient cleavage of DNA targets using native DNAPs However,'some 5' nucleases of the present invention (for example; clones E; F and G of Fig: 4) can cleave DNA in the absence of aT arm. In other words, a non-extendable cleavage structure is not required for --- ~~ ~
= WO 98/42873 PCT/US98/05809 specific cleavage with some 5' nucleases of the present invention derived from thermostable DNA polymerases.
Tests were then conducted to determine whether cleavage of an RNA template by DNAPTaq in the presence of a fully complementary primer could help explain why DNAPTaq is unable to extend a DNA oligonucleotide on an RNA, template, in a reaction resembling that of reverse transcriptase. Another thermophilic DNAP, DNAPTth, is able to use RNA as a template, but only in the presence of Mn++, so it was predicted that this enzyme would not cleave..RNA in the presence of this cation. Accordingly, an RNA

molecule was incubated with an appropriate pilot oligonucleotide in the presence of DNAPTaq or DNAPTth, in buffer containing either Mg++ or Mn++. As expected, both enzymes cleaved, the. RNA in: the presence of Mg++.. However; DNAPTaq, but not ''"
DNAPTth, degraded the RNA in the presence of Mn++. It was concluded that the 5' nuclease activities of many DNAPs may contribute to their inability to use RNA
as, templates.

EXAMPLE ,2 Generation Of 5' Nucleases: From Thermostable ::DNA Polymerases Thermostable. DNA polymerases were ; generated which have reduced synthetic,activity, -:, an activity that is an undesirable side-reaction during DNA cleavage in thedetection assay of the invention, yet have maintained thermostable. nuclease activity. The result is a thermostable polymerase which cleaves nucleic acids DNA with extreme specificity.
Type A DNA polymerases from eubacteria of the genus Thermus;share `extensive {arotein- sequence identity (90%o in the polymeri zation domain, using the Lipman-Pearson method in the DNA analysis software from DNAStar, WI) and behave, similarly in both polymerization and nuclease assays. Therefore, thegenes for the DNA polymerase of Thermus aquaticus (DNAPTaq) and Thermus Jlavus (DNAPTfl) are used as representatives of this class. Polymerase genes, from other eubacterial organisms, such as Thermus thermophilus, Thermus_sp,, Thermotoga maritima,- Thermosipho africanus and BacilFus :
stearothermophilus are equally, suitable. The DNApolymerases from these thermophilic organisms are capable of surviving and performing. at elevated temperatures,-and can thus be used in reactions in which teiuperatqre is used. as a selection against non-specific hybridization of nucleic acid strands._ The restriction sites used for deletion mutagenesis, described below, -were chosen for convenience. Different sites situated with similar convenience are available.
in the Thermus thermophilus gene and can be used to make similar constructs with other Type A
polymerase genes from related organisms.

A. Creation Of 5' Nuclease Constructs 1. Modified DNAPTaq Genes The first step was to place a modified gene, for the Taq DNA polymerase on a plasmid under control of an inducible promoter. The modified Taq polymetase gene was isolated as follows: The Taq DNA polymerase gene was amplified by polymerase chain reaction from genomic DNA from Thermus aquaticus, strain YT-1 (Lawyer et al., supra), using as primers theoligonucleotides described in SEQ ID NOS:13-14' The resulting fragment of DNA has a recognition sequence for the restriction endonuclease ~ EcoRl at the 5' end of the coding sequence and a Bgll1 sequence at the 3' end. Cleavage with BgIII leaves a 5' overhang or "sticky end" that is compatible with the end generated by 1iamI-II. The PCR-amplified DNA
was digested with EcoRI and BamHI. The 2512 bp fragment containing the coding.
region for the polymerase gene was gel purified and then ligated into a plasmid which contains an inducible promoter.
In one embodiment of the invention, the pTTQ18vector, which contains'the hybrid trprlac (tac) promoter, was used (Stark, Gene 5:255 [19871) and shown in Fig 13 The tac promoter is under the control of the E. coli lac repressor. Repression allows the synthesis of the gene product to be suppressed until the desired level of bacterial growth has' been achieved, at which point repression is removed by addition of a specific inducer, isopropyl-(3-D-thiogalactopyranoside (IPTG). Such a system ailows the expression of foreign proteins that rnay slow or prevent growth of transformants.
Bacterial promoters, such as tac, may not be adequately suppressed when ttiey are present on a multiple copy plasmid. If a highly toxic protein is placed under control'of such a promoter, the small amount of expression leaking through can beharmful to the bacteria:
In another embodiment of the invention, another option for repressing synthesis of a cloned gene product was used. The non-bact.erial promoter, from bacteriophage T7, found in the plasmid vector series pET-3 was used toiexpress the cloned mutant Taq polymerase genes (Fig. 15; Studier and Moffatt, J. Mol. Biol., 189:113 ,[ 19861). This promoter initiates transcription only by T7 RNA polymerase. In a suitable strain, 'such as BL21(DE3)pLYS, the gene for this RNA polymerase is carried on the bacterial genome under control of the lac operator: This arrangement has the advantage that expression of the- multiple copy gene (on --~

the plasmid) is completely dependent on the expression of T7 RNA polymerase, which is easily suppressed because it is present in a single copy.
For ligation into the pTTQ18 vector (Fig. 13), the PCR product DNA containing the Taq polymerase coding region (mutTaq, clone 4B, SEQ ID NO:21) was digested with EcoRI
and Bglll and this fragment was ligated under standard "sticky end" conditions (Sambrook et al. Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp. 1.63-[1989]) into the EcoRl and BamHI sites of the plasmid vector pTTQ 18.
Expression of 1.69 this construct yields a translational fusion product in which the first two residues of the native protein (Met-Arg) are replaced by three from the vector (Met-Asn-Ser), but the remainder of the natural protein would not change. The construct was transformed into the JM109 strain of E. coli and the transformants were plated under incompletely repressing conditions that do not permit growth of bacteria expressing the native protein. These plating conditions allow the isolation of genes containing pre-existing.mutations, such as those that result frotn the infidelity of Taq polymerase during the amplification process.
Using this amplification/selection protocol, a clone (depicted in Fig. 3B) containing a mutated Taq polymerase gene (mutTaq, clone 3B) was isolated. The mutant. was firstr detected by its phenotype, in which temperature-stable 5' nuclease. activity in a crude cell extract was normal, but polymerization activity was almost absent (approximately less than 1% of wild type Taq polymerase activity).
DNA sequence analysis of the recombinant gene showed that it had changes in the polymerase domain resulting in two amino acid substitutions: an A to G
change,=at nucleotide _,position 1394 causes a Glu to Gly change _at amino acid :position 465 (nutnbered, according to .the natural nucleic and amino acid sequences, SEQ ID NOS:1 and 4). and another A to G
change at nucleotide position 2260 causes a Gin to Arg change at amino acid position 754.
Because the Gin to Gly mutation is at a nonconserved position and because the Glu to Arg mutation alters an amino acid that is conserved in virtually all.of the known.Type A
polymerases, this latter mutation is most likely the one.responsible for curtailing the synthesis activity of this protein._ The nucleotide sequence for the Fig. 3B construct is given in SEQ ID
NO:21. The enzyme encoded by this sequence is referred to as Cleavase A/L'i.
Subsequent derivatives of DNAPTaq constructs were made, from the mutTaq gene, thus, they all bear these amino acid substitutions in addition to their other alterations, unless these,, particular regions were deleted. These- mutated sites are indicated by biack boxes at these locations in the diagrams in Fig. 3. In Fig. 3, -the designation. "3' Exo" is. used >to indicate the location of the 3' exonuclease activity associated with Type A
polymerases which is not present in DNAPTaq. All constructs except the genes shown in Figs. 3E, F and G
were made in the pTTQ18 vector.
The cloning vector used for the genes in Figs. 3E and F was from the commercially available pET-3 series, described above. Though this vector series has only a BamHI site for cloning downstream of the T7 promoter, the series contains variants that allow cloning into any of the three reading frames. For cloning'of the PCR product described above, the variant called pET-3c was used (Fig. 14). The vector was digested with BamHI, dephosphorylated with calf intestinal phosphatase, and the sticky ends were filled in using the Klenow fragment of DNAPEcI and.dNTPs. The gene for the mutant-Taq DNAP shown in Fig. 3B
(mutTaq, clone 3B) was released from pTTQ18 by digestion with EcoRI and SaII, and the "sticky ends" were filled in as was done with the vector. Thefragment was ligated -to the vector under standard blunt-end conditions (Sambrook et at.; Molecuiar Cloning, supra), the construct was transformed into the BL21(DE3)pI:YS strain of E. cali; and isolates 'were screened to ideritify those that were ligated withthe gene in the proper orientatioti relative to the promoter. , This construction yields another, ,translational fusion product; in wbich he first two amino acids of DNAPTaq (Met-Arg) are replaced by 13 from the vector plus' two from -the PCR prjmer(Met-Aia-Ser-Met-Thr-Gly-G1y-Gln-Gln'Met-Gly-Arg-Ile-Asn-Ser) (SEQ ID
NO:24).
In these experiments, the goal was to generate enzymes 'that lackedthe'ability to synthesize DNA, but retained the ability to cleave nucleic acids with a 5' nuclease activity.
The act of primed,.templated synthesis of DNA~ is aCtually a coordinated series of events, so it is possible to. disable DNA: synthesis by disrupting one event while not affecting theothers.
These steps include, but are not limited to, primer recognition andbinding, dNTP binding and catalysis. of the inter-nucleotide phosphodiester bond. Some of the amino acids in the polymerization domain of DNAPEcI have been linked to these functions, but the precise mechanisms are as yet poorly defined.
One way of destroying the polymerizing ability of a DNA polymerase is to delete all or part of the gene segment that encodes that domain for the protein, or to otherwise render the gene incapable of making a complete polymerization domain:, Individual mutant enzymes may differ from.each other in stabilityand solubility both inside and outside cells. For instance, in contrast to the 5' nuciease domain of DNAPEcI, which can be released in an . active form from the polymerization domain by gentle proteolysis (Setlow and Kornberg, J.

WO 98/42873 PCT/US98/05809-, = ~.
Biol. Chem., 247:232 [19721), the Thermus nuclease domain, when treated similarly, becomes less soluble and the cleavage activity is often lost.
Using the mutant gene shown in Fig. 3B as starting material, severai deletion constructs were created. All cloning technologies were standard (Sambrook et al., supra) and are summarized briefly, as follows:
Fig. 3C: The mutTaq construct was digested with Pstl, which cuts once `within the polymerase coding region, as indicated, and cuts inunediately downstream of the gene in the multiple cloning site of the vector. After release of the fragment between these tviro sites, the vector was re-ligated, creating an= 894-nucleotide deletion, and bringing into frame a stop codon 40 nucleotides downstream of the junction. The nucleotide sequence of this 5' nuclease (clone 4C) is. given in SEQ ID NO:9.
Fig. 3D: The mutTaq construct was digested with Nhel, which- cuts once in the gene at. position 2047. The resulting four-nucleotide 5' overhanging ends were filled in,'as described. above, and the blunt, ends were re=ligated. The resulting four-nncleotide insertion changes the readingframeandcauses~terrnination of translation ten amino acids downstream of themutation. The nucleotide sequence of this 5', nuclease (cione.3fi}) is g:iven-tn SEQ ID
NO.1Q. . . - .:
Fig. 3E: The entiremutTaq gene wa& cut from pTTQ18 usingEcoRIand`Sall and cloned into pET-3c, as described above. This clone was digested with BstXI and XemI, at unique , sites. that are situated as shown , in Fig. 3E. = The DNA was treated with the Kienow fragment of DNAPEeI and dNTPs, which resulted:in the 3' overhangs of both sites'being .-trimmed to blunt,ends. These blunt ends were ligated together, resulting in an. out of frame deletion of 1540 nucleotides. An in-frame termination codon occurs 1S triplets past -the junction site. The.nucleotide sequence. of this 5' nuclease (clone 3E) is given:in SEQ ID
NO:11, with the appropriate leader sequence given in :SEQ ID NO:25. Ivis also referred to as Cleavase@ BX.
Fig. 3F: The entire mutTaq gene was cut from pTTQlB using EcoRI and SaII and cloned into pET-3c, as described above. This clone was digested with BstXI'and BamHI, at unique sites that are situated as shown in the diagram. The DNA was treated with the Klenow fragment of DNAPEcI. and dNTPs, which resulted in the 3' overhang of the'BstXI
site being trimmed to a blunt end, while the 5' overhang of the BamHI site was filled in to make a blunt end. These ends were ligated: together, resulting in an in-frame deletion of 903 nucleotides. The nucleotide sequence of the 5' nuclease (clone 3F) is given in SEQ ID
NO:12. It is also referred to as Cleavase BB.
Fig. 3G: This polymerase is a variant of that shown in Fig. 4E. It was cloned in the plasmid vector pET-21 (Novagen): The non-bacterial promoter from bacteriophage T7, found in this vector, initiates transcription only by T7 RNA polymerase. See Studier and Moffatt, supra. In a suitable strain, such as (DES)pLYS, the gene for this RNA
polymerase is carried on.the bacterial genome under control of the lac operator. This arrangement has the advantage that expression of the multiple copy gene (on the plasrriid) is completely dependent on the expression of T7 RNA polymerase, which is easily suppressed because it is present in a single copy. Because the expression of these mutant genes is under this tightly 'controlled promoter, potential problems of toxicity of the expressed proteins to the host cells are less of a concem.
The pET-21 vector also features a"His*Tag , a stretch of six consecutive histidine residues thatare added on the carboxy terminus of the expressed proteins. The resulting proteins can then be purified in a single step by metal chelation chromatographp, using a commercially..available (Novagen) column resin with immobilized Ni' ions. The 2:5 ml columns are reusable, and can bind up to 20 mg of the target protein under native or denaturing (guanidine*HCI. or urea) conditions.
E. coli (DES)pLYS cells are transformed with the constructs described above using standard transformation techniques, and used to inoculate a standard growth medium (e.g., Luria-Bertani broth). Production of T7 RNA polymerase is :induced during log phase growth by addition of=IPTG and:incubated for a further 12 to 17 hours. Aliquots of culture are removedboth before and after induction and theproteins areexaminedby SDS=PAGE.
Staining with Coomassie Blue allows visualization of the foreign proteins if theyaccount for about 35% of the cellulat protein and do not co-migrate with any of the major protcin bands:
Proteins that co-migrate with major host protein must be expressed as more than 10% of the total protein to be seen at this stage of analysis.
Some mutant proteins are sequestered by the cells into inclusion bodies. These are granules that form in the cytoplasm when bacteria are made to'express high levels of a foreign protein, and they can be purified from a crude lysate, and analyzed by SDS-PAGE to deteccnnine their protein content. if the cloned protein is found'in the inclusion bodies, it must be released to. assay the cleavage and polymerase activities. Different methods of solubilization may be appropriate for different proteins, and a variety of methods are known (See e.g., Builder & Ogez, U.S. Patent No. 4,511,502 (1985); Olson, U.S.
Patent No.
4,518,526 (1985); Olson & Pai, U.S. Patent No. 4,511,503 (1985); and Jones et al., U.S.
Patent No. 4,512,922 (1985) .
The solubilized protein is then purified on the Ni' column as described above,.
following the manufacturers instructions (Novagen). The washed proteins are eluted from the column by a combination of imidazole competitor (1 M) and high salt (0.5 M
NaCI), and dialyzed to exchange the buffer and to allow denature proteins to refold:
Typical recoveries result in approximately 20 pg of specific protein per ml of starting culture.
The DNAP
.mutant is referred to as the Cleavase(D BN nuclease and the sequence is given in SEQ ID
NO:26 (the amino acid sequence of the Cleavase BN nuclease is obtained by translating the ,.DNA sequence of SEQ ID NO:26).

2. Modified DNAPTiI Gene The DNA polymerase gene of Thermusflavus was isolated from the 'T. flavus" AT-strain obtained from the American Type Tissue Collection (ATCC 33923). This strain has a different restriction map then does the T.1lavus strain used to generate the sequence published by Akhmetzjanov and Vakhitov, supra. The published sequence is listed as SEQ
ID NO:2.
No sequence data has been published for the DNA polymerase gene from the AT-62 strain of T. flavus.
Genomic DNA from T. flavus was amplified using the same primers used to amplify the T. aquaricus DNA polymerase gene (SEQ ID NOS:13-14). The approximately 2500 base .pair PCR fragment was digested with EcoRI and BamHI. The over-hanging ends were made :blunt with the Klenow fragment of DNAPEcl and dNTPs. The resulting approximately 1800 :base pair fragment containing the coding region for the N-terminus was ligated into pET-3c, as described above. This construct, clone 4B, is depicted in Fig. 4B. The wild type T. flavus DNA polymerase gene is depicted in Fig. 4A. The 4B clone has the same leader amino acids as do the DNAPTaq clones 4E and F which were cloned into pET-3c; it. is not known precisely where translation termination occurs, but the vector has a strong transcription termination signal immediately downstream of the cloning site.
B. Growth And Induction Of Transformed Cells Bacterial cells were transfonned with the constructs described above using standard transformation techniques and used to inoculate 2 mis of a standard growth mediurn (e.g., ~
S ' \ 1 .v0 98/42873 PCT/US98/05809 Luria-Bertani broth). The resulting cultures were incubated as appropriate for the particular strain used, and induced if required for a particular expression system. For all of the constructs depicted in Figs. 3 and 4, the cultures were grown to an optical density (at 600nm wavelength) of 0.5 OD.
To induce expression of the cloned genes, the cultures were brought to a fmal concentration of 0.4 mM IPTG and the incubations were continued for 12 to 17 hours. Then, 50 ltl aliquots of each culture were removed both before and after induction and were combined with 20 l of a standard gel loading buffer for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Subsequent staining with Coomassie Blue (Sambrook et al., supra) allows visualization of the foreign proteins if they account for about 3-5% of the cellular protein and do not co-migrate with any of the major E.
coli protein bands. Proteins that do co-migrate with a major host protein must be expressed as more than 10% of the total protein to be seen at this stage of analysis.

C. Heat Lysis And Fractionation Expressed thermostable proteins (i.e., the 5' nucleases), were isolated by heating crude bacterial cell extracts to cause denaturation and precipitation of the less stableE. coli proteins.
The precipitated E. coli proteins were then, along with other cell debris, removed by centrifugation. Then, 1.7 mis of the culture were pelleted by microcentrifugation at 12,000 to 14,000 rpm for 30 to 60 seconds. After removal of the supernatant, the cells were resuspended in 400 l of buffer A (50 mM Tris-HCI, pH 7.9, 50 mM dextrose, 1 mM
EDTA), re-centrifuged, then resuspended in 80 l of buffer A with 4 mg/ml lysozyme. The cells were incubated at room -temperature for 15 minutes, then combined with 80 l of buffer B (10 mM Tris-HC1, pH 7.9, 50 mM KCI, 1 mM EDTA, 1 mM PMSF, 0.5% Tween-20, 0.5% Nonidet-P40).
This mixture was incubated at 75 C for 1 hour to denature and precipitate the host proteins. This cell extract was centrifuged at 14,000 rpm for 15 minutes at 4 C, and the supernatant was transferred to a fresh tube. An aliquot of 0.5 to 1 1 of this supernatant was used directly in each test reaction, and the protein content of the extract was determined by subjecting 7 l to electrophoretic analysis, as above. The native recombinant Taq DNA
polymerase (Engelke, Anal. Biochem., 191:396 [1990]), and the double point mutation protein shown in Fig. 3B are both soluble and active at this point.

WO 98/42873 PCT/US9810580~r The foreign protein may not be, detected after the heat treatments due to sequestration of the foreign protein by the cells into inclusion bodies. These are granules that form in the cytoplasm when bacteria are made to express high levels of a foreign protein, and they can be purified from a crude lysate, and analyzed SDS PAGE to determine their -protein content.
Many methods have been described in the literature, and one approach is described below.
D. Isolation And Solubilization Of Inclusion Bodies A small culture was grown and induced as described above. A 1.7 ml aliquot was pelleted by brief centrifugation, and the bacterial cells were resuspended in 100 1 of Lysis buffer (50 mM Tris-HC1, pH 8.0,.1 mM EDTA, 100 mM NaCI). Then, 2.5 l,of 20`mM
PMSF were added for a final concentration of 0.5 mM, and lysozyme was added to a concentration of 1.0 mg/ml. The cells were incubated. at room temperature =for 20 minutes, deoxycholic acid was added to l mg/ml (1 141 of 100 mg/mi solution), and the nzixture was further incubated at 37 C for about 15 minutes or until viscous. DNAse I was added to 10 g/ml and the mixture was incubated at room temperature for: about 30 minutes or, until it was -no longer viscous.
From this mixture the inclusion bodies were collectedby centrifugation at 14;000 rpm for 15 minutes at 4 C, and the supernatant was discarded. - The pellet was resuspended in 100 l of lysis buffer with 10 mM EDTA (pH 8.0) and 0.5% Triton X-100. Afcer 5 minutes at room temperature, the inclusion bodies were pelleted as before, and the supernatan.t-was saved for later analysis. The inclusion bodies were resuspended. in 50 l of distilled water, and 5 1 was combined with SDS gel loading buffer (which dissolves the inclusion bodies) and analyzed electrophoretically, along with an aliquot of the supernatant. -If the cloned protein is found in the inclusion bodies, it may be released to assay the cleavage and polymerase activities and the method of solubilization must be compatible with the particular activity. Different methods of solubilization may be appropriate for different proteins, and a variety of methods are discussed in Molecular ,Cloning (Sambrook et al., supra). The following is. an adaptation used for several of the isolates used -inthe -development of the present invention.
Twenty l of the inclusion body-water suspension were pelleted by centrifugation at 14,000 rpm. for 4 minutes at room temperature,, and the supernatant,was discarded. To further wash the inclusion bodies, the pellet was resuspended in.20 l of lysis buffer with 2M urea, and incubated at room temperature for one hour. The washed inclusion bodies were then vJ0 98/42873 PCT/US98/05809 resuspended in 2 l of lysis buffer with 8 M urea; the solution clarified visibly as the inclusion bodies dissolved. Undissolved debris was removed by centrifugation at 14,000 rpm for 4 minutes at room temperature, and the extract supernatant was transferred to a fresh tube.
To reduce the urea concentration, the extract was diluted into KH2PO4. A fresh tube was prepared containing 180 l of 50 mM KH2P04, pH 9.5, 1 mM EDTA and 50 mM
NaCI.
A 2 l aliquot of the extract was added and vortexed briefly to mix. This step was repeated until all of the extract had been added for a total of 10 additions. The mixture was allowed to sit at room temperature for 15 minutes, during which time some precipitate often forms.
Precipitates were removed by centrifugation at 14,000 rpm, for 15 minutes at room temperature, and the supernatant was transferred to a fresh tube. - To the 200 l of protein in the KH,PO4 solution, 140-200 l of saturated (NH4)2SO4 were added, sothat the resulting mixture was about 41% o to 50% saturated (NH4)ZSO4. The mixture was chilled on ice for 30 minutes to allow the protein to precipitate, and the protein was then collected by centrifugation at 14,000 rpm, for 4 minutes at room temperature. The supernatant was discarded, and the pellet was dissolved in 20 l Buffer C (20 mM- HEPES, pH
7.9; F mM
EDTA, 0.5% PMSF, 25 mM KCI and 0.5 % o each of Tween-20 and Nonidet P 40).
`T'he protein solution was centrifuged again for 4 minutes to pellet insoluble materials, and the supernatant was removed to a fresh tube. The protein contents of=extracts prepared urthis manner were visualized by resolving 1-4 i by SDS-PAGE; 0.5 to 1 l of extract was tested in the. cleavage and polymerization assays as described.

E. Protein Analysis For Presence Of Nuclease And ;Synthetic Activity The 5' nucleases described above and shown in Figs: 3 and 4 were analyzed by the following methods.
1. Structure Specific Nuclease Assay A candidate modified polymerase is tested for 5' nuclease activity by examining its ability to catalyze structure-specific cleavages. By the term "cleavage structure" as used herein, is meant a nucleic acid structure which is a substrate for cleavage by the 5' nuclease activity of a DNAP.
The polymerase is exposed to test complexes that have the structures shown in Fig.
15. Testing ,for 5' nuclease activity involves three reactions: 1) a primer-directed cleavage (Fig. 15B) is performed because it is relatively insensitive to variations in the salt concentration of the reaction and can, therefore, be performed in whatever solute conditions the modified enzyme requires for activity; this is generally the same conditions preferred by unmodified polymerases; 2) a similar primer-directed cleavage is performed in a buffer which permits primer-independent cleavage(i.e., a low- salt buffer), to demonstrate that the enzyme is viable under these conditions; and 3) a primer-independent cleavage (Fig.
15A) is performed in the same low salt buffer.
The bifurcated duplex is formed between a substrate strand and a template strand as shown in Fig.: 15. By the term "substrate strand" as used herein, is meant that strand of nucleic acid in which the cleavage mediatedby the 5' nuclease activity occurs.
The substrate strand is always depicted as the top strandin the bifurcated complex which serves as a substrate, for.5' nuclease cleavage (Fig..15); By the terrn "template strand"
as used herein, is meant the strand of nucleic acid which is at :least partially complementary to the substrate strand and which anneals to the substrate strand to form the cleavage structure. The template strand is_always depicted as the>bottom:strand of the bifurcated cleavage structure:(Fig. 15).
If a primer (ashort oligonuGcleotideof 19 to 30 nucleotides in length) is added to the -complex, as -when pximer-dependent cleavage is to be' tested, it is designed to anneal to the 3' arm of the :template $trand (Fig. 15B). =Such a primer would be extended'along>the template strand, if the polymerase used in the reaction has synthetic. activity:
The cleavage structure may be, made as a single hairpin moiecule, with the 31~
end of the target and the 5' end_ of the pilot joined as a~ loop as shown in Fig.
15E. A pritner oligonucleotide complementary to the 3' arm is also required for these tests so that the enzype's sensitivity tQ. the presence of aprimer may be tested.
Nucleic acids to be used to form test cleavage structures can be' chemically synthesized, or can be generated by standard recombinant DNA techniques. By the latter method, the hairpin portion of the molecule can be created by inserting into a cloning vector duplicate copies of a short DNA segment, adjacent to each other but in opposing orientation.
The double-stranded fragment encompassing this inverted repeat,= and-including enough flanking sequence to give short (about 20 nucleotides) unpaired 5' and 3' arms, can then be released from the vector, by restrictionenzyme digestion, or by PCR performed with an enzyme lacking a 5' exonuclease (e.g., the Stoffel fragment of AmplitaqTM
DNA~pol-ymerase, VentTM DNA polymerase). . : ,. .
The test DNA can be labeled on either end, or internally, with either a radioisotope, or with a non-isotopic tag. Whether the, hairpin DNA is a synthetic single strand or a~ cloned = 136 -= ~~ 0 WO 98/42873 PCT/i3S98/05809 double strand, the DNA is heated prior to use to melt all duplexes. When cooled on ice, the structure depicted in Fig. 16E is formed, and is stable for sufficient time to perform these assays.
To test for- primer-directed cleavage (Reaction 1), a' detectable quantity of the test molecule (typically 1-100 fmol of 32P-labeled hairpin -molecule) and a 10 to 100-fold molar excess of primer are placed ~in a buffer known to be compatible with- the test enzyme. For Reaction, 2, where primer-directed cleavage is performed under condition' which allow primer-independent cleavage, the same quantities of molecules are placed in a solution that is the same as the buffer used in Reaction I regarding pH, enzyme'stabilizers (e.g., 'bovine serum albumin; nonionic detergents, gelatin) and reducing agents (e.g., dithiothreitol, 2-mercaptoethanol) but that replaces- any monovalent cation, salt with 20 mM
KCI; 20 mM
KCl is the demonstrated optimum for primer-independent cleavage. Bttffers 'for enzymes, such as IDNAPEc1, that usually- operate in the absence of salt are not supplemented to achieve this, concentration. To test for ;primer-independent cleavage (Reaction 3) the same qtiantity of the, test molecule, but no primer, are combined under the same buffer conditions used'''for _ ..., , , Reaction 2 All three test reactions are then exposed to enciugli of the 'enzyrne that `the' moibr ratio of enzyme to test complex is approximately 1:1: The -reactions -are incubatedat a r~ige of temperatures up to, but not exceeding, the temperature allowed by either the enzyme' stability or. the complex stability, whichever is lower, :up to 80 C for enzymes from 'thermophiles, for a time sufficient to allow cleavage -(10 to 60 minutes). The products of Reactions 1; 2 and 3 are resolved by denaturing polyacrylamide gel eleetrophoresis;and visuali2edby autoradiography or by a comparable method appropriate to -the labeling systern used.
Additional labeling systems include chemiluminescence detection, silver or other stains, blotting and probing and= the like. The presence of cleavage products is indicated by the presence of molecules which migrate at a lower molecUlar weight than does 'the uncleaved test structure. ' These cleavage products<indicate that the candidate polymerase has structure-specific 5' nuclease activity.
To determine whether a modified DNA polymerase has substantially the same 5' nuclease activity as that of the native DNA polymerase, the'results of the above=deseribed tests are contpared with the results obtained from these tests performed with the native DNA
polymerase. By: "substantially the same 5' nuclease activity" it`is meant that the modified polymerase and the native polymerase will both cleave test molecules in the satne manner. It is not necessary that the modified polymerase cleave at the same rate as the native DNA
polymerase.
Some enzymes or enzyme preparations may have other associated or contaminating =
activities that may be functional under the cleavage conditions described above and that may interfere with 5' nuclease detection. Reaction conditions can be modified in consideration of these other activities, to avoid destruction of the substrate, .ot other masking ofthe 5' nuclease .
cleavage and its products. For example, the DNA polymerase I of E. cooli (Po1 I), in 'addition to its polymerase and 5' nuclease activities, has a 3' exonuclease that `can degrade DNA in a 3' to 5' direction. Consequently, when the molecule in Fig. 15E is exposed to this polymerase under the conditions described above, the 3' exonuclease quickly removes the unpaired3' arm; destroying the bifurcated structure required of a substrate for the-5'-exonuclease cleavage and no cleavage is detected. The true ability of Pol I to cleave the structure can: be revealed if the T exonuclease is inhibited by a change f -conditions (e.g., pH),- mutation,~or by addition of a competitor for the activity., Addition of'500 pnioles of a single-stranded competitor oligonucleotide; unrelated:to the Fig. 15E
structure, to the cleavage reaction with Pol I effectively inhibits the digestion of the 3' arm of the Fig.' 15E structure without interfering with, the 5' exonuclease release of.the %5' arm. . The concentration of the competitor is not critical; but should be ;high enough to occupy 'the 3' exonuclease fori the duration of the reaction.
Similar destruction of the, test molecule may be caused by ; contanunants in-the candidate polymerase preparation. Several sets of the. structure specific nuclease reactions may be performed to determine. the purity of the candidate nuclease and to find the window between under and over exposure of the test molecule: to:.:the polymerase preparation being investigated.
The; above described modified polymerases were tested for 5' nuclease activity as follows: . Reaction 1 was performed in a buffer of :10 mM Tris-Cl, pH % 8:5 at,20 C; 1,5 mM
MgCIZ and 50 mM KCI and in Reaction 2 the KCI concentration was reduced to 20 mM. In Reactions 1 and 2, 10 fmoles of the test substrate molecule shown in Fig. 15E
were combined with 1 pmole of the indicated primer and 0.5 to 1.0 l of extract containing the modified 30 polymerase (prepared as described above). This mixture was then= incubated for 10-=minutes at 55 C. For all of the mutant polymerases tested- these conditions were sufficient to give complete cleavage. When the molecule shown in Fig.-15E was -labeled at the 5' end;! the released 5' . fragment, 25 nucleotides' long;.was conveniently resolved on a 20%

vVO 98/42873 PCT/US98/05809 polyacrylamide gel (19:1 cross-linked) with 7 M urea in a buffer containing 45 mM Tris-borate pH 8.3, 1.4 mM EDTA. Clones 3C-F and 4B exhibited structure-specific cleavage comparable to that of the unmodified DNA polymerase. Additionally, clones 3E, 3F and 3G
have the added ability to cleave DNA in the absence of a 3' arm as discussed above.
Representative cleavage reactions are shown in Fig. 16.
For the reactions shown in Fig. 16, the mutant polymerase 'clones 3E (Taq mutant) and 4B .(TJI mutant) were examined for their ability to cleave the hairpin substrate molecule shown in Fig. 15E. The substrate molecule was labeled at the 5' terminus with'ZP. Ten fmoles of heat-denatured, end-labeled substrate DNA and 0.5 units of DNAPTaq (lane 1) or 0.5 l of 3E or 4B extract (Fig. 16, lanes 2-7, extract was prepared as described above) were mixed together in a buffer containing 1`0 mM Tris-Cl, pH 8.5, 50 'mM KCI and 1.5 mM
MgCIZ. The final reaction volume was 10 l. Reactions shown in lanes 4 and 7 contain in addition 50 M of each dNTP. Reactions shown in lanes 3, 4, 6' and 7 contain 0.2 M of the primer oligonucleotide (complementary to the 3' arm of the substrate and shown in,Fig. 15E).
Reactions were incubated at 55 0 for 4 minutes. Reactions were stopped by the addition of 8 l of 95% formanude contauiing 20 mM EDTA and 0.05% marker dyes per 10 ,. gI
ieaction volume. -Samples were then applied to 12% denaturing acrylamide gels.
Following electrophoresis, the gels were autoradiographed. Fig. 16 shows tliat clones 3E
snd-4B'"exhibit cleavage activity similar to that of the native DNAPTaq. Note that some cleavage occurs in these reactions in the absence of the primer. `When long hairpin structuie, such as the one used -here (Fig. -15E), are used in cleavage reactions performed in buffers containing 50 mM
KCI a low level of primer-independent cleavage is seen. Higher concentrations of KCl suppress, but do4ot eliminate, this primer-ihdependent`cleavage under these conditions.

- 2. Assay For Synthetic`Activity The ability of the modified 'enzyme or proteolytic fragments is assayed by adding the modified enzyme to an assay system in which a primer is annealed to a template and DNA
synthesis is catalyzed by the added enzyme. Many standard laboratory"
techniques employ such an assay. For example, nick translation and enzymatic sequencing involve extension of a pri3ner along a=DNA template by a polymerase molecule.
In a preferred assay for determining the synthetic activity of a modified enzyme an oligonucleotide primer is annealed to a single-stranded DNA template (e.g:, bacteriophage M13 DNA), and the primer/template duplex is incubated in the presence of the modified ....
--- j WO_98/42873 PCTlUS98/05809.
polymerase in question, deoxynucleoside triphosphates (dNTPs) and the buffer and salts known to be appropriate for the unmodified or native enzyme. Detection of either primer extension (by denaturing gel electrophoresis) or dNTP incorporation (by acid precipitation or chromatography) is indicative of an active polymerase. A label, either isotopic or non-isotopic, is preferably included on either the primer or as a dNTP to facilitatedetection of polymerization products. Synthetic activity is quantified as the amount of free nucleotide incorporated into the growing DNA chain and is expressed as amount incorporated per unit of time under specific reaction conditions.
Representative results of an assay for synthetic activity is shown in Fig. 17.
The synthetic activity of the mutant DNAPTaq clones 3B-F was tested as follows: A
master mixture of the following buffer was made: 1.2X PCR buffer (1X PCR
buffer.contains 50 mM KCI, 1.5. mM MgC121 10 mM Tris-Cl, pH 8.5 and 0.05% each _Tween 20 and:
Nonidet =
P40), 50 M each of dGTP, dATP and dTTP, 5 M dCTP and 0.125 M a 32P-dCTP at Ci/mmol. Before adjusting this mixture_to.its fmal volume,;it wasdividedint<i:two equal aliquots. One received distilled water up to a volumeof 50 l,to.give the concentrations above. The other received.5 g of single-stranded M13mp18 DNA :(approximately ;2.5 pmol or 0.05 M final concentration) and 250 pmol of. M13 sequencing prixner (5 M4 ;final concentration) and distilled., water to a final-volume of. 50 l.. Each cocktail was warmed to 75 C for 5 minutes and then cooled to room temperature. This allowed the primers:to.anneal to the DNA in the DNA-containing mixtures. ;;,= ;. ;
For each, assay, 4. 1 of the cocktail with the DNA was combined with <:1 1, of: the mutant polymerase, prepared as described, or 1 unit ofDNAPTaq (Perkin Elmer)in l. l of dH2O. A "no DNA" control was done in tbe presence of the DNAPTaq (Fig. 17;
lane 1), and a "no enzyme" control was done using water in place of the enzyme (lane 2).
Each reaction was mixed, then incubated at room temperature (approx. 22 C) for 5 minutes, then at 55 C
for 2 minutes, then at. 72 C for 2 minutes. This step incubation was done to detect polymerization in any mutants that might have optimal temperatnres lower than .72 C: After the final incubation, the tubes were spun briefly to collect any condensation and were, placed on ice. One l of each reaction was spotted.at an origin 1.5 cm from the bottom edge of a polyethyleneimine (PEI) cellulose thin layer chromatography plate and allowed-to dry. The ~.
chromatography plate was. run inØ75 M NaH2P04, pH 3.5, until the: buffer front, had run approximately 9 cm from the origin. = The plate was dried, wrapped in: plastic wrap, marked with luminescent ink, and exposed to X-ray film. Incorporation was detected as. counts that -~

stuck where originally spotted, while the unincorporated nucleotides were carried by the salt solution from the origin.
Comparison of the locations of the counts with the two control lanes confirmed the lack of polymerization activity in the mutant preparations. Among the modified DNAPTaq clones, only clone 3B retains any residual synthetic activity as shown in Fig.
17.

5' Nucleases Derived From Thermostable DNA
Polymerases Can Cleave *ShortHairpin Structures With Specificity The ability of the 5' nucleases to cleave hairpin structures to generate a cleaved hairpin structure suitable as a detection molecule was examined: The structure and sequence of the. hairpin test molecule is shown in -Fig. 18A (SEQ ID NO:15). The oligoriucleotide (labeled "primer" in Fig. 18A, SEQ ID NO:22) is shown annealed to its complementary sequence on the 3' arm of the ;hairpin test molecule. The" hairPirt test molecule was single-end labeled = with 32P using a labeled T7 promoter primer in a polymerase chain redCtion. The label is present on the 5' arm of the hairpin test molecule- and is represented by the''~tar in Fig. 18A.
The cleavage reaction was performed by adding 10 fmoles of heat-denatured;
erid-labeled hairpin test molecule, 0.2 M of the primer oligonucleotide (complementay "to the 3' arm of the hairpin), 50 gM of each dNTP and 0.5 units of DNAPTaq (Perkin Elmer) or 0:5 gl of extract containing a S' nuclease (prepared as described above) in a total volume of 10 l. in a buffer containing 10 mM Tris-Cl, pH 8.5, 50 mM KCI and' 1.5 mM MgCI,.
Reactions shown in lanes 3, 5 and 7 were run in-the absenceof dNTPs.
Reactions were incubated at 55 C for 4 minutes. Reactions were stopped at' 55 C by the addition of 8 gl of 95% formamide with 20 mM EDTA and 0.05% marker dyes per 10 l reaction volume. Samples were not heated before"loading onto denaturing polyacrylamide . gels (10% polyacrylamide, 19:1 crosslinking, 7 M urea, 89 mM Tris-borate, pH
8.3; "2.8 mM
EDTA). The samples were not heated to allow for the resolution of single=stranded and re-duplexed uncleaved hairpin molecules.
Fig. 18B shows that altered polymerases lacking any detectable synthetic activity cleave a hairpin structure when an oligonucleotide is annealed to the single-stranded 3' arm of the hairpin toyield a single species of cleaved product (Fig. 18B, lanes 3 and 4): 5' nucleases, such as clone 3D, shown in lanes 3 and 4, produce a single cleaved product even WO 98l42873 PCT/US98l05809' in the presence of dNTPs. 5' nucleases which retain a residual amount of synthetic activity (less than 1% of wild type activity) produce multiple cleavage products as the polymerase can extend.the oligonucleotide annealed to the 3' arm of the hairpin thereby moving the site of cleavage (clone 3B, lanes 5 and 6). Native DNATaq produces even more species of cleavage products than do mutant polymerases retaining residual synthetic activity and additionally converts the hairpin structure to a double-stranded form in the presence of dNTPs due to the --high level of synthetic activity in the native polymerase (Fig. 18B, lane 8).

Cleavage Of Linear Nucleic Acid Substrates From the above, it. should be clear that native (i.e., "wild type") thermostable DNA
polymerases are capable of cleaving hairpin structures in a specific manner and that this discovery can be applied-with success to a detection assay. In this example, the mutant DNAPs of the present invention are tested against three different cleavage<:structures :shown in Fig; 20A. Structure 1 in Fig. 20A is =simply single stranded 206-mer (the preparation'and sequence information for which was discussed in Example 1 C). Structures 2'-and 3 are duplexes; structure 2 is the same hairpin structure as shown in Fig. 11A
(bottom), while structure 3 has the hairpin portion ~df structure 2 removed.
The cleavage reactions comprised 0.01 pmoles of the resulting substrate DNA, and I
pmole of pilot oligonucleotide in a total volume of 10 1 of 10 mM Tris-Cl, pH
8.3; 100 mM
KCI, 1 mM MgC12. Reactions were: incubated for 30 minutes at 55 C, and stopped `by the addition of 8 1 of 95% o formamide with 20 mM EDTA and 0.05% marker dyes.
Samples were heated to 75 C for 2 minutes immediately before electrophoresis through a I0% =
polyacrylamide gel (19:1 cross link); with 7M urea, in a buffer of 45 mM Tris-Borate, pH
8.3,. 1:4 mM EDTA. /
The results were visualized byautoradiography and are shown in Fig. 20B with the enzymes indicated as follows: I is native Taq DNAP; II is native Tf! DNAP; III
is Cleavase BX shown in Fig. 3E; IV is Cleavase@ BB shown in Fig. 3F; V is the mutant shown in Fig.
4B; and VI is Cleavase BN shown in Fig. 3G.
Structure 2 was used to "normalize" the comparison. For example, it was found that it took 50. ng of Taq DNAP and 300 ng .of Cleavase BN to give similar amounts of cleavage of Structure 2 in thirty (30) minutes. Under these conditions native Taq DNAP
=is unable to -cleave Structure 3 to any significant degree. Native Tfl DNAP cleaves Structure 3 in a manner that creates multiple products.
By contrast, all of the mutants tested cleave the linear duplex of Structure 3. This finding indicates that this- characteristic of the mutant DNA polymerases is consistent of thermostable polymerases across thermophilic species.

5' Exonucleolytic Cleavage ("Nibbling") By Thermostable DNAPs It has been found that thermostable. DNAPs, including those of the present invention, have a true 5' exonuclease capable of nibbling the 5' end of a linear duplex nucleic acid structures.- In this Example, the 206 base pair DNA duplex substrate is again employed (See, Example 1C). In this case, it was produced by the use of one'ZP-labeled primer and one unlabeled ;primer in a polymerase chain reaction. The cleavage reactions comprised 0.01 pmoles of heat-denatured; end-labeled substrate DNA (with the unlabeled strand also "present), 5õpmoles of pilot oligonucleotide (see pilot oligos in Fig. I IA) and 0.5 units ofDNAPTaq or 0.5 of Cleavase BB in the E. coli extract (see above), in a total volume of 10 l4"of I0 mM Tris=Cl, pH 8:5; 50 mM KCI, 1:5 mM MgCIT:
-Reactions were initiated at 65 C by the addition of pre-warmed enzyme, then shifted to the ftnal:incubation temperature for 30 minutes. The results are -shown in Fig. 21A.
Samples in lanes 1-4 are the results with native Tcrq DNAP,while lanes 5-8shown the results with CleavaselD 13B: The reactions for Ianes 1, 2, 5, and 6 were performed at 65 C and reactions for lanes 3, =4, 7, and 8 were performed at 50 C and all were stopped at temperature by the addition of 8 l of 95% formamide with 20 mM EDTA and 0.05% marker dyes.
Samples were heated to 75 C for 2 minutes immediately before electrophoresis through a 10% acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of 45 mM
Tris=Borate, pH 8:3, 1.4 mM EDTA. The expected product in reactions 1, 2, 5, and 6 is 85 nucleotides long; in reactions 3 and 7, the expected product is 27 nucleotides long.
Reactions 4 and 8 were performed without pilot, and should remain at 206 nucleotides. The faint band seen at 24 nucleotides is residual end-labeled primer from the PCR.
The surprising result is that Cleavase BB under these conditions causes all of the label to appear in a very small species, suggesting the possibility that the enzyme completely hydrolyzed the substrate. To determine the composition of the fastest-migrating band seen in lanes 5-8 (reactions performed with the deletion mutant), samples of the 206 base pair duplex `~ . .
WO:98l42873 PCTNS98/058W
were treated with either T7 gene 6 exonuclease (USB) or with calf intestine alkaline phosphatase (Promega), according to manufacturers' instructions, to produce either labeled mononucleotide (lane a of Fig. 21B) or free 'ZP-labeled inorganic phosphate (lane b of Fig.
21B), respectively. These products, along with the-products seen in lane 7 of panel A were resolved by brief electrophoresis through a 20% acrylamide gel (19:1 cross-link), with 7 M
urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. Cleavase BB is thus capable of converting the substrate to mononucleotides.

EXA.MPLE 6 . Nibbling Is Duplex Dependent ,;The; nibbling by Cleavase BB is duplex dependent. In this Example, interna'lly labeled, single:strands of the:206-mer were produced by.15 cycles of primer extension incorporating a.-'?P. labeled dCTP combined with all four unlabeled dNTPs,.
'using an -unlabeled 20( )bp .fr-agment.as.a. template. Single and double stranded products- were resolved by eleptrophoresis through a non-denaturing 6%-polyacrylamide: gel (29:1 ~cross-link) in a buffer..of 4.5mM,:T,ris=Borate, pH8.3, J.4 nzM. EDTA, visualized by autoradiography, excised from the gel, eluted by passive diffasion, and <concentrated by ethanol precipitation.
The,_cleavage :reactions comprised 0.04 pmoles_ of substrate DNA, and2 1 of CleavaseOD BB (in an E. cQli extract as described above) in a total volume of 40 L of 10 mM
Tris-Cl, pH:8:5,50 mM KCI, 1.5 mM MgC12. =Reactions- were initiated.by the addition of pre- warmed enzyme; 10 l aliquots were removed. at 5, 10, 20, and 30 minutes, and -transferred to prepared tubes containing 8 l of 95% fornlamide with- 30 mM
EDTA and 0.05%:<marker dyes. ,.Samples were heated to 75 C for 2 minutes inunediately before electXophoresis. through a 10% acrylamide ,gel (19:1 cross-linked), with 7 M
urea, in a buffer of, 45i mM T.ris-Borate, pH 8.3, 1.4 mM EDTA. Results were visualized by autoradiography as shown.in. Fig., 22. : Clearly, the cleavage by CleavaseO BB depends on a duplex structure;
no cleavage of the single strand.structure is detected whereas cleavage of the 206-mer: duplex is complete;

Nibbling Can Be Target Directed The nibbling activity of the DNAPs of the present invention can be employed with success in a detection assay. One embodiment of such an assay is shown in Fig.
23. In this assay, a labelled oligo is employed that is specific for a target sequence.
The oligo is in excess of the target so that hybridization is rapid. In this embodiment, the oligo contains two fluorescein labels whose proximity on the oligo causes their emission to be quenched. When the DNAP is permitted to nibble the oligo the labels separate and are detectable. The shortened duplex is destabilized and, disassociates. Importantly, the target is now free to react with an intact labelled oligo. The reaction can continue until the desired level of detection is achieved. An analogous, although different, type of cycling assay` has been described employing lambda exonuclease. See C.G. Copley and C. Boot, BioTechniques 13:888 (1992).:
The success of such an assay depends on specificity. In other words,`the oligo must hybridize to the specific target. It is also preferred that the assay be sensitive; the"aligo ideally should be able to detect small amounts of target. Fig. 24A shows a 5'4nd432p=
labelled primer bound to a plasmid target sequence. In this case, the plasmid was pUC 19 (commercially:available) which was heat denatured by boiling two (2) minutes and then quick chilling. The primer is a 21-mer (SEQ ID NO:28). The enzyme employed was'Cfiavase BX (a dilution equivalent to 5 x 10'3 l extract) in 100 mM KCI, 10 mM Tris-Cl;" pH 8.3, 2 mM MnC12. The reaction was performed at 55 C for sixteen (16) hours with-or without genomic background DNA (from chicken blood). The reaction was stopped by the addition of 8 l of 95%o Ãormamide with 20 mM EDTA and marker dyes.
The products of the reaction were resolved by PAGE (10% polyacrylamide, 19:1 cross link, 1X TBE) as seen in Fig. 24B. Lane "M" contains the labelled 21-mer:
Lanes 1-3 contain> no specific target, although Lanes 2 and 3 contain 100 ng and 200 ng -ofgenomic DNA, respectively. Lanes 4, 5 and 6 all contain specific target with either 0 ng, 100 ng, or 200 ng of genomic DNA, respectively. It is clear that conversion to mononucleotides occurs in Lanes 4, 5 and 6 regardless of the presence or amount of background DNA.
Thus, the nibbling can be target directed and specific.

WO 98/42873 PCTIUS98/0580y Cleavase Purification As noted above, expressed ,thermostable proteins (i. e., the 5' nucleases), were isolated by crude.bacterial cell extracts. The precipitated E. coli proteins were then, along with other cell debris, removed by centrifugation. In this Example, cells expressing the BN clone were cultured and collected (500 grams). For each gram (wet weight) of E. coli, 3 ml of lysis buffer (50 mM Tris-HCI, pH 8.0, 1 mM EDTA, 100 M NaCI) was added: The cells -were lysed with 200 g/ml lysozyme at room temperature for 20 minutes. Thereafter dooxycholic acid was added to make a 0.2% final concentration and the mixture was incubated 15 minutes at;,:room temperature.
The lysate was sonicated for approximately.6-8 minutes at 0 C. The precipitate was removed by centrifugation (39,000g for 20 minutes). Polyethyleneimine was added (0.5%) to the supernatant and the mixture was incubated on ice for .15 minutes:
The mixture was centrifuged (5,000g for 15 minutes) and. the; supernatant was retained. This was heated.for .30 minutes at 60 C and then centrifuged again ;(5;000g for ~
15 minutes) and the supematant was again retained.
The supematant was precipitated with 35% ammonium sulfate at 4 C for:15 minutes.
The mixture was then centrifuged (5,000g-for 15 minutes) and the supernatdnt'was removed.
The precipitate was then dissolved in 0.25M KCI, 20 Tris pH 7:6, 0.2% Tween and'0:1 EDTA) and then dialyzed against Binding Buffer (8X Binding Buffer:comprises:?
40mM
imidazole, 4M NaCI, 160mM Tris-HCI, pH 7.9).
The solubilized protein is then purified on the Ni" column (Novagen)~ The Binding Buffer is allows to drain to the top of the column bed and load the column with the prepared extract. A flow rate of about 10 column volumes per hour is optimal for.efficient.
purification. If the flow rate is too fast, more impurities will contaminate the: eluted fraction.
The column is washed with 25 ml (10 volumes) of 1X Binding Buffer and then washed with 15 ml. (6 volumes) of IX Wash Buffer (8X Wash Buffer comprises:
480mM
imidazole, 4 M NaCI, 160 mM Tris-HCI, pH 7.9). The bound protein was eluted -with 15 ml (6 volumes) of 1X Elute Buffer (4X Elute Buffer comprises: 4mM imidazole, 2 M
NaCI, 80 mM Tris-HCI, pH 7.9). Protein is then reprecipitated with 35% ammonium sulfate as above:
The precipitate was then dissolved and dialyzed against: 20 mM Tris, 100 mM
KCI, 1 mM
EDTA). The solution was brought up to 0.1% each of Tween 20 and NP-40 and stored at 4 C.

The Use Of Various Divalent Cations In The Cleavage Reaction Influences The Nature Of The Resulting Cleavage Products In comparing the 5' nucleases generated by the modification and/or deletion of the C-terminal polymerization domain of Thermus aquaticus DNA polymerase (DNAPTaq),as diagrammed in Fig. 3B-G, significant differences in the strength of the interactions of these proteins with the 3' end of primers located upstream of the cleavage site (as depicted in Fig.
5) were noted. In describing the cleavage of these structures by Pol I-type DNA polymerases (See, Example 1, and Lyamichev et al., Science 260:778 [1993]), it was observed that in the absence of a primer, the location of the junction between the double-stranded region and the single-stranded 5' and 3' arms detennined the site of cleavage, but in the presence of a primer, the location of the 3' end of the primer became the determining factor for the' site of cleavage. It was postulated that this affinity for the 3' end was in accord with the synthesizing function of the DNA polymerase.
Structure 2, shown in Fig. 20A, was usedto test the effects of a 3' end proxin4al to the cleavage site in cleavage reactions comprising several different solutions (e g, solntions containing different salts [KCI -or NaCI], different divalent cations [IVInz`
or -Mg2']; etc.) as .well asthe use of different temperatures for the cleavage reaction. - When the reaction conditions were such that the-binding of the enzyme (e:g., a DNAP comprising a`5' nuclease, a<modified DNAP or a 5' nuclease) to the 3' end (of the piiot-iDligonucleotide) near the cleavage site was strong, the structure shown is cleaved at the site indicated in Fig. 20A.
This :cleavage releases the unpaired 5' arm and leaves a nickbetween the remaining portion of the target nucleic acid and the folded 3' end'of the pilot oligonucleotide.
In contr"ast, when the reaction conditions are such that the binding of the DNAP (comprising a 5' nuclease) to the 3' end was weak, the initial cleavage was as described above, but after the release of the 5.' arm, the remaining duplex, is digested bythe exonuclease function of the DNAP:
One way of weakening the binding of the DNAP to the 3' end is to remove all or part of the domain to which at least some of this function has been attributed.
Some of 5' nucleases created by deletion of the polymerization domain of DNAPTaq have enhanced true exonuclease function, as demonstrated in Example 5.
The affinity of these types of enzymes (i.e., 5' nucleases associated with or derived from DNAPs) for recessed 3' ends may also be affected by the identity of the divdlent cation present in the cleavage re.action. It was demonstrated by Longley et al.
(Nucl. Acids Res., WO 98/42873 PCT/US98/05809' 18:7317 [1990]) that the use of MnCI2 in a reaction with DNAPTaq enabled the polymerase to remove nucleotides from the 5' end of a primer annealed to a template, albeit inefficiently.
Similarly, by examination of the cleavage products generated using Structure 2 from Fig. =
20A, as described above, in a reaction containing either DNAPTaq or the =Cleavaseo¾l BB
nuclease, it was observed that the substitution of MnC12 for MgC12 in the cleavage reaction resulted in the exonucleolytic "nibbling" of the duplex downstream of the initial cleavage site.
While not limiting the invention to any particular mechanism, it is thought that the substitution of MnCIZ for MgCl2 in the cleavage reaction lessens the affmity of these enzymes for recessed 3' ends.
In all cases, the use of MnCI2 enhances the 5' nuclease function, and in the case of the Cleavase BB nuclease, a 50- to 100-fold stimulation of the 5' nuclease =function is seen.
Thus, while the exonuclease activity of these enzymes wa~ demonstrated above in the presence of MgC121 the assays, described below show a comparable amount of exonuclease activity using 50 to 100-fold less enzyme when. MnCl7 is used in place of MgC12.z= Wlien these reduced amounts of enzyme are used in a reaction mixture containing MgC12, the nibbling or exonuclease activity is .much: less apparent than that seen in Examples 5=7:
Similar effects are observed-in the performance of the nucleic acid detection assay described in Examples.10-39 below when reactions;performed in the presenceof eitlier MgCI, or MnCIZ are compared: In the. presence: of either divalent cation, the presence of the-I nvaderT"' oligonucleotide (described below) forces the site of cleavage into the prob.e duplex;~
but in the presence of MnCI,.the probe duplex can be further nibbled producing a ladder of products that are visible when a 3' end label ispresent-on the probe oligonucl+eotide.. = When the InvaderTM oligonucleotide is omitted from a reaction containing Mn2+; the probe is nibbled from the 5' end. MgZ;-based reactions display, minimal nibbling of.the probe oligonucleotide.
In any of these cases, the digestion of theprobe. is dependent upon the presence of the target nucleic acid. In the examples below, the ladder produced by the enhanced nibbling activity observed in the presence of Mn2+,is used as a positive indicator that the probe oligonucleotide has. hybridized to the target sequence. - 148-~.... .

Invasive 5' Endonucleolytic Cleavage By Thermostable 5' Nucleases In The Absence of Polymerization As described in the Examples above, 5' nucleases cleave near the junction between single-stranded and base-paired regions in a bifurcated duplex, usually about one base pair into the base-paired region. In this Example, it is shown that thermostabie 5' nucleases, including those of the present invention (e.g., Cleavase BN nuclease, Cleavase A/G
nuclease), have the ability to cleave a greater distance into the base paired region'when provided with an upstream oligonucleotide bearing a 3' region that is homologous to a 5' region of the subject duplex, as shown in Fig. 26.
Fig. 26 shows a synthetic oligonucleotide which was designed to fold upon itself which consists of the following sequence: 5'-GTTCTCTGCTCTCTGGTCGCTG
TCTCGCTTGTGAAACAAGCGAGACAGCGTGGTCTCTCG -A' (SEQ ID NO:29). This oligonucleotide is referred to as the "S-60 Hairpin." The 15 basepair hairpin fornied by this -oligonucleotide is further stabilized by a"tri-loop" sequence in the loop end (i e;'three nucleotides form the loop portion of the hairpin) (Hiraro et a1.; Nucleic Acids Res:;` 22(4):576 [1994]). Fig. 26 also show the sequence of the P-15 oligonucleotide and the location of the region of cornplementarity shared by the P-15 and S-60 hairpin o ligonucleotides: 'The sequence of the P-15 oligonucleotide is 5'-CGAGAGACCACGCTG-3' (SEQ ID NO:30).
As discussed in detail below, the solid black arrowheads shown in Fig. 26 indicate the sites of cleavage of the S-60 hairpin in the absence of the P-15 oligonucleotide and the hollow arrow heads indicate the sites of cleavage in the presence of the P-15 oligonucleotide. The size of the arrow head indicates the relative utilization of a particular site:
The S-60 hairpin molecule was labeled on its 5' end with biotin for subsequent detection. The S-60 hairpiur was incubated =in the presence of a thermostable 5' nuclease in the presence or the absence of the P-15 oligonucleotide. The presence of the full duplex which can be formed by the S-60 hairpin is demonstrated by cleavage with the Cleavase BN
5' nuclease, in a primer-independent fashion (i.e., in the absence of the P-15 oligonucleotide).
The release of 18 and' 19-nucleotide fragments from the 5' end of the S-60 hairpin molecule showed that the cleavage occurred near the junction between the single and double stranded regions when nothing is hybridized to the 3' arm of the S-60 hairpin (Fig. 27, lane 2).
The reactions shown in Fig. 27 were conducted as follows. Twenty fmole of the 5' biotin-labeled hairpin DNA (SEQ ID NO:29) was combined with 0.1 ng of Cleavase BN

WO.98l42873 PCTlUS9810580y-enzyme and 1 l of 100 mM MOPS (pH 7.5) containing 0.5% each of Tween-20 and in a total volume of 9 l_ In the reaction shown in lane 1, the enzyme was omitted and the volume was made up by addition,of distilled water (this -served as the uncut or no enzyme control). The reaction shown in lane 3 of Fig. 27 also included 0.5 pmole of the P15 oligonucleotide (SEQ ID NO:30), which can hybridize to the unpaired 3' arm of the S-60 hairpin (SEQ ID NO:29), as diagrammed in Fig. 26.
The reactions were overlaid with a drop of mineral oil, heated to 95 C for 15 seconds, then cooled to 37 C, and the reaction was started by the addition of I l of 10 mM MnC12 to each tube. After S. minutes, the reactions were stopped by the addition of 6 l of 95%
formamide containing 20 mM EDTA and 0.05% marker dyes.. Samples were heated to for,2 minutes immediately before etectrophoresis through a 15% acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of 45 mM Tris-Borate, pH 8:3, 1.4 mM
EDTA.
Afterelectrophoresis, the gel plates were separated allowing the gel to remain flat on one.plate.. A 0.2 mrn-por.e. positively-charged .nylon membrane (NYTRAN, Schleicher and Schuell, Keene, NH), pre-wetted.in HZO, was laid on top of the, exposed gei. -All air- bubbles were removed. Two -pieces of ;3MM filter; paper (Whatman) were then placed on top of the membrane,, the other glass plate was replaced, and the. sandwich was clamped with binder clips. Transfer was allowed to,proceed overnight. After; transfer, -the -rnembrane was carefiilly peeled from the gel and allowed to air dry. After. complete drying, the membrane was washed in 1,2X .Sequenase, Images.Blocking;Buffer (United States Biochemical) using 0.3. ml of buff. er/cm2 of membrane. The wash was performed for 30 minutes at-room temperature.. A streptavidin-alkaline phosphatase conjugate.(SAAP, United States Biochemical) was added to a 1:400.0 dilution directly to the blocking, solution, and agitated for,:;iS_ minutes. The. membrane was rinsed. br-iefly: with fi30 and, then washed.three times for 5 minutes per wash using 0.5 ml/cm? of lX SAAP buffer (1 OO: rnM :Tris-HC1, pH
10,=50 mM
NaCI) with 0.1% sodium. dodecyl sulfate (SDS). The membrane was rinsed briefly with H20 between, each wash. The membrane was then washed once in 1X SAAP buffer containing 1 tnM MgC 1 z without, SDS,, drained thoroughly and placed in -a plastic heat-sealable bag.
Using a ster-ile pipet, 5 mis of CDP-StarTM (Tropix,: Bedford, MA) chemiluminescent substrate for alkaline.phosphatase were, added to the bag and distributed over the.,entire, membrane for 2-3 minutes. The CDP-StarTM-treated membrane was exposed to XRP X-ray film (Kodak) for an initial,exp.osure of 10 minutes,, -v1O 98/42873 PCT/US98/05809 The resulting autoradiograph is shown in Fig. 27. In Fig. 27, the lane labelled "M"
contains the biotinylated P-15 oligonucleotide which served as a marker. The sizes (in nucleotides) of the uncleaved S-60 hairpin (60 nuc; lane 1), the marker (15 nuc; lane "M") and the cleavage products generated by cleavage of the S-60 hairpin in the presence (lane 3) or absence (lane 2) of the P-15 oligonucleotide are indicated.
Because the complementary regions of the S-60 hairpin are located on the same molecule, essentially no lag time should be needed to allow hybridization (i.e., to form the duplex region of the, hairpin). This hairpin structure would be expected to form long before the enzyme could locate and cleave the molecule. As expected, cleavage in the absence of the primer oligonucleotide was at or near the junction between the duplex and single-stranded regions, releasing the; unpaired 5' arm(Fig. 27, lane 2). The resulting cleavage products were 18 and 19 nucleotides in length.
It was expected that stability of the S-60 hairpin with the tri-loop would prevent the P-oligonucleotide from promoting cleavage in the "primer-directed" -manner described in 15 Example -1 above, because the,3' end of the "primer" would remain unpaired.
Surprisingly, it was found: that the enzyme seemed to mediate an "invasion" by the P-15 primer`
into1he'~
duplex region of the S-60 hairpin, as evidenced by the shifting of the cleavage site 3 to 4 basepairs fuxther,into the duplex region, releasing the larger products (22 and 21 nuc )E
observed in lane 3 of Fig. 27.
The precise sites of cleavage of the S=60 hairpin are diagrammed on the structure in Fig. 26, with the solid black arrowheads indicating the sites of cleavage in the absence of the P-15 oligonucleotide -and the hollow arrow heads indicating the sites of cleavage in the presence of-P-15.
These data show that the presence on the 3' arm of an oligonucleotide- having some . sequence homology-withthe first several bases of the similarly oriented strand of the downstream duplex can be a dominant: factor in determining the site of cleavage by 5' nucleases. Because the oligonucleotide which shares some sequence homology with the first several bases of the sim3larly oriented strand of the downstream duplex appears to invade the duplex, region of the hairpin, it is. referred to as an" InvaderTM"
oligonucleotide. As shown in 30, the Examples below, an InvaderTM oligonucleotide appears to invade (or displace) a region of duplexed nucleic acid regardless of whether the duplex region is present ori the same molecule (i.e., a hairpin) or whether the duplex is formed between two separate nucleic acid strands.

WO 98/42873 PCT/US98/0580y EXAMPLE ll The InvaderTM Oligonucleotide Shifts The Site Of Cleavage -In A Pre-Formed Probe/Target Duplex In Exanlple 10, it was demonstrated that an InvaderTM oligonucleotide could shift the site at which a 5' nuclease cleaves a duplex region present on a hairpin molecule. In this Example, the ability of an InvaderTM oligonucleotide to shift the site of cleavage within a duplex region formed between two separate strands of nucleic acid "molecules was examined.
A single-stranded targetDNA comprising the single-stranded circular M13mp19 molecule and a labeled (fluorescein) probe oligonucleotide were mixed in the presence of the reaetion. buffer containing salt (KCI) and divalent cations (Mg2+ or Mn2') to promote duplex formation. The probe oligonucleotide refers to a labelled oligonucleotide which is complementary to a region along the target molecule (e.g., M13mp19). A second oligonucleotide (unlabelled):was added to the reaction after the probe and target had been allowed to anneal, . The second oligonucleotide binds to a region of the target v duich is located downstream of the region to which the probe oligonucleotide binds.
This second oligonucleotide contains sequences which are complementary to a second -region of the target molecule. .,. If the second oligonucleotide contains a region which is -complementacy to .a portion.ofthe sequences:along.the target to which the probeoligdnucleotide also binds, this second oligonucleotide is referred to as an InvaderT"' oligonucleotide (see -Fig.- 28c):~
Fig. 32 depicts th:e annealing of two oligonucleotides- to regions along the M13mp19 target molecule (bottom strand in. all three structures shown): In Fig. 28 only a 52 nucleotide portion of. the M13mp=i 9. molecule is shown; this 52 nucleotide sequence is listed in SEQ ID
N0;31. The probe oligonucleotide contains a fluorescein label at the 3' end;
the sequence of the-probe is 5'-AGAAAGGAAGGGAAGAAAGCGAAAGG-3~ (SEQ ID NO:32). In Fig. 28, sequences comprising the second oligonucleotide, including the InvaderTM
oligonucleotide are underlined.. In Fig. 28a, the second oligonucleotide, which has the sequence 5'-GACGGGGAAAGCCGGCGAACG-3' (SEQ ID NO:33), is eomplementary: to a different and downstream region of the target molecule than is the probe oligonucleotide (labeled with fluorescein or "Fluor"); there is a gap between the second, upstr=eam oligonucleotide and the probe for the structure shown:in:Fig. 28a.. In Fig..28b, the second,,upstream oligonueleotide, which has the sequence 5'-GAAAGCCGGCGAACGTGGCG-3' (SEQ ID NO:34), is :
complementary to a different region of the target molecule than is the probe oligonucleotide, but in this case, the second oligonucleotide and the probe oligonucleotide.abut one another =~ , ;

'WO 98/42873 PCT/US98/05809 (that is the 3' end of the second, upstream oligonucleotide is immediately adjacent to the 5' end of the probe such that no gap exists between these two oligonucleotides).
In Fig. 28c, the second, upstream oligonucleotide (5'-GGCGAACGTGGCGAGAAAGGA-3' [SEQ ID
NO:35]) and the probe oligonucleotide share a region of complementarity with the target molecule. Thus, the upstream oligonucleotide has a 3' arm which has a sequence identical to the first several bases of the downstream probe. In this situation, the up"strearri oligonucleotide is referred to as an "InvaderTM" oligonucleotide.
The effect of the presence of an LnvaderTM oligonucleotide upon the pattern of cleavage in a probe/target duplex formed prior to the addition of the InvaderTM was examined.
The InvaderTM oligonucleotide and the enzyme were added after the probe was allowed to anneal to the target and the position- and extent of cleavage of the probe were examined to determine a) if the InvaderTM was able to shift the cleavage site to a specific internal region of the probe, and b), if the reaction could au;umulate speCific cleavage products over time, even in the absence of thermal cycling, polymerization, or exonucleaseremovalof the probe 'sequence.
The reactions were carried out as follows: Twenty l each of two enzyme mixtures were prepared,' containing 2 l of Cleavase(D A/G nuclease extract (prepared asdescribed in Example 2), :with or without 50 pmole of the InvaderTM oligonucleotide (SEQ
ID'N0;15), as indicated, per 4 l of the mixture. For each of the eight reactions shown in Fig. 29;1'50 fmole of M 13mp 19 single-stranded DNA (available from Life Technologies, Inc.) was combined with 5 pmoles of fluorescein' labeled probe (SEQ ID NO:32),' to create the `stnicture shown in Fig. 28c, but without the InvaderTM oligonucleotide present (the probe/tar"get mixture). One half (4 tubes), of theprobeltarget mixtures- were combined with I l of 100 mM MOPS, pH 7.5 with 0.5% each of Tween-20 and NP-40; 0.5 i of 1= M KCl and 0.25 l of 80 mM MnCIZ, and distilled water to a volume of 6 1. The second set 'of prohe/target mixtures were combined with 1 l of 100 mM MOPS, p)'-I 7:5 vi-ith 0.5% each of Tween-20 and NP-40, 0.5 l of I M KCI and 0.25 91 of 80 mM MgCl2: The, second set of isiixtures therefore contained MgCIZ in place of the MnC12 present in the first set of mixtures`.
The mixtures (containing the probe/target with buffer, KCI and divalent cation) were covered with a drop of ChillOutOD evaporation barrier and were brought to 60 C
for 5 minutes to allow annealing. Four l of the above enzyme mixtures without the InWaderTM
oligonucleotide was added to reactions whose products are shown in laiies 1, 3-, 5 and 7 of Fig. 29. Reactions whose products are shown lanes 2, 4; 6, and' 8 of Fig. 29 received the --- a .,... .
WO 98/42873 PCT/US98/05803~

same amount of enzyme mixed with the InvaderTm oligonucleotide (SEQ ID NO:35).
Reactions 1, 2, 5 and 6 were incubated for 5 minutes at 60 C and reactions 3, 4, 7 and 8 were incubated for 15 minutes at 60 C.
All reactions were stopped by the addition of 8 l of 95% formamide with 20 mM
EDTA and 0.05% marker dyes. Samples were heated to 90 C for 1 minute immediately before electrophoresis through a 20% acrylamide gel (19:1 cross-linked);
containing 7 M urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. Following electrophoresis, the reaction products and were visualized bythe use of an Hitachi FMBIO
fluorescence imager, the output of which is seen in Fig. 29. The very. low molecular weight fluorescent material seen in all lanes at or near the salt front in Fig. 29 and other fluoro-imager Figures is , observed when fluorescently-labeled oligonucleotides are electrophoresed and imaged on a fluoro-imager. This material is not a product of the cleavage=reaction.
The. use of MnCl2 in these reactions (lanes 1-4) stimulates thetrue exonuclease or "nibbling" activity, of the .CleavaseO enzyme, -as described in Example 6,: as i& clearly-seen in lanes 1 and 3 of Fig. 29. This nibbling of the probe oligonucleotide (SEQ ID
NO:32) ~in the absence of InvaderTM oligonucleotide (SEQ-ID NO:35) confirms that the probe oligonucleotide is forming a duplex with; the target, sequence. The ladder-like products produced by this nibbling reaction may be difficult to differentiate from degradation of the probe by nucleases that might be present in a clinical specimen. In contrast, introduction of the_ InvaderTM oligonucleotide (SEQ ID NO;35) caused, a distinctive shift in the cleavage of the probe, pushing the site of cleavage b to 7 bases into the probe, confirming the annealing of both oligonucleotides. In presence of 1VInClZ1 the exonuclease. "nibbling"
may occur after the InvaderTM-directed cleavage event, until the residual. duplex is destabilized and falls apart.
In. a magnesium based cleavage reaction (lanes 5-8); the nibbling or true-exonuclease function of the, Cleavase A/G is enzyme suppressed (but the endonucleolytic function of the enzyme is essentially unaltered), so the probe oligonucleotide is not degraded in the absence of the.InvaderT" (Fig. 29, lanes 5 and 7). When the InvaderTM is added, it is clear that the InvaderTM oligonucleotide can promote a shift in the site of the endonucleolytic cleavage of the annealed probe. Comparison of the products of the 5 and.15 minute reactions with , InvaderT"' (lanes 6 and 8 in Fig. 29), shows that additional probe hybridizes to the target and is cleaved. The calculated melting temperature (Tm) of the portion of probe-that is not invaded (i.e., nucleotides.9-26 of SEQ ID NQ:32) is- 56 C, so the observed turnover (as .evidenced by the accumulation of cleavage products with increasing. reaction tinle) suggests - 154--^j '.. .

that the full length of the probe molecule, with a calculated T. of 76 C, is must be involved in the subsequent probe annealing events in this 60 C reaction.

The Overlap Of The 3' InvaderTM Oligonucleotide Sequence With The 5' Region Of The Probe Causes A Shift In The Site Of Cieavage In Example 11, the ability of an InvaderTM oligonucleotide to cause a shift in the site of cleavage of a probe annealed to a target molecule was demonstrated. In this Example, experiments were conducted to examine whether the presence of an oligonucleotide upstream from the probe was sufficient to cause a shift in the cleavage site(s) along the probe or' whether the presence of nucleotides on the 3' end of the InvaderTM
oligonucleotide which have the same sequence as the first several nucleotides at the 5' end of the probe oligonucleotide were required to promote the shift in,cleavage.
To examine this point, the products of cleavage obtained from three different arrangements of target-specific oligonucleotides are `eompared. A diagram of these~ `"' oligonucleotides and the way in which they hybridize to-a test nucleic'acid;
MI3mp19, is shown in;Fig. 28. In Fig. 28a, the 3' end of the upstream oligonueleotide (SEQ
ID NO:33) is located.upstream of the 5' end .of the downstream "probe" oligonucleotide-'(SEQ ID NO:32) such that a region of the M13 target which is not paired to either oligonucleotide is present.
In Fig. 28b, the sequence of the upstream oligonucleotide (SEQ ID NO:34) is immediately upstream of the probe (SEQ ID NO:32), having neither a gap nor an overlap betweenthe sequences. Fig. 28c diagratns the arrangement of the substrates used in the assay of the present invention, showing that the upstream "InvaderTw:wligonucleotide {SEQ
ID` NO:35) has the. same sequence on a portion of its 3' region = as that -present in the 5' region of the downstream probe (SEQ ID NO:32). That is to say,= these regions will eompete=w hybridize to the same segrnent of the M13 target nucleic acid:
In these experiments, four enzyme mixtures were prepared as follows (planning 5 l per digest): Mixture 1 contained 2.25 l of CleavaseO A/G nuclease extract (prepared as described in .Example 2) per 5 l of mixture, in 20 mM MOPS,- pH 7.5 with 0.1 % each of Tween 20 and NP-40, 4 mM 1VInClZ and 100 mM KC1. - Mixture 2 contained 11.25 units of Taq DNA polymerase (Promega) per 5 l of mixturein 20 3nM MOPS, pH 7:5 with 0.1 %
each of Tween 20:and NP-40, 4 mM MnC1z and -100 mM KCt: Mixture 3=contained 2.25 l of CleavasedD. A/G_ nuclease extract per 5 l of mixture in 20-mM Trig-HC1, pH
8.5,-4 mM

~

MgC12 and 100 mM KCI. Mixture 4 contained 11.25 units of Taq DNA polymerase per 5 l of mixture in 20 mM Tris-HCI, pH 8.5, 4 mM MgC12 and 100 mM KCI.
For each reaction, 50 fmole of M13mp19 single-stranded DNA (the target nucleic acid) was combined with 5 pmole of _the probe .oligonucleotide (SEQ ID NO:32 which contained a fluorescein label at the 3' end) and 50 pmole of one of the three upstream oligonucleotides diagrammed in Fig. 28 (i.e., one of SEQ ID NOS:33-35), in a total volume of 5 l of distilled water. The reactions were overlaid with a drop of ChillOutTM evaporation barrier and warmed to 62 C. The cleavage reactions were started by the addition of 5 l of an enzyme mixture to. each tube, and the reactions were incubated at 62 C for 30 min. The reactions shown in lanes 1-3of Fig..30 received Mixture 1; reactions 4-6 received Mixture 2;
_reactions 7-9 received Mixture 3 and reactions 10-12 received Mixture 4.
After 30 minutes at 62 C, the reactions were stopped by the addition of -8 l of 95%
formamide, with 20 mM EDTA and 0.05% marker dyes. Samples were heated to 75 C
for 2 minutes immediately before electrophoresis through a 20% acrylamide -gel-(19:1 cross-linked), with :7 M urea, in abuffer of 45 mM.Tris-Borate, pH 8.3, 1.4 mM EDTA.
Following electrophoresis, the products of the reactions were visualized by the use of an Hitachi FMBIO fluorescence imager, the output of which is seen in Fig. 30:
= The reaction products shown in lanes 1, 4, 7 and 10 of Fig. 30 were from reactions which contained SEQ
ID NO:33 as the upstream oligonucleotide (see Fig. 28a). The reaction products shown in lanes 2, 5, 8 and 11 of Fig. .30 were from reactions which contained SEQ ID
NO:34 as the upstream oligonucleotide (see Fig.-28b). The reaction products shown in lanes 3, 6, 9 and 12 ,,of Fig. 30 were from reactions which -contained SEQ ID NO:35, theInvaderTM
.oligonucleotide, as the upstream oligonucleotide (see Fig. 28c).
, Examination of the MnZ+ based reactions using either Cleavase@ A/G nuclease or DNAPTaq as the cleavage agent (lanes I through 3 and 4 through 6, respectively) shows that both enzymes have active exonuclease function in these buffer conditions: The use of a 3' label on the probe oligonucleotide allows the products of the nibbling activity to remain labeled, and therefore visible. in this assay. The ladders seen in lanes 1, 2, 4 and 5 confirm that _the probe hybridize to, the target DNA as intended. These lanes also show that the location of the non-invasive oligonucleotides have little effect. on the products generated. The uniform ladder created by, these. digests would be difficult- to distinguish from a ladder causes by a contaminating nuclease, as one might fmd in a clinical specimen, In contrast, the products displayed in lanes 3 and 6, where an InvaderTM oligonucleotide was provided to N

direct the cleavage, show a very distinctive shift, so that the primary cleavage product is smaller than those seen in the non-invasive cleavage. This product is then subject to further nibbling in these conditions, as indicated by the shorter products in these 'lanes. These InvaderTM-directed cleavage products would be easily distinguished from a background of non-specific degradation of the probe oligonucleotide.
When Mg2+ is used as the divalent cation the results are even more distinctive. In lanes 7, 8, 10 and I1 of Fig. 30, where the upstream oligonucleotides were not invasive, minimal nibbling is observed. The products in the DNAPTaq reactions show some accumulation of probe that has been shortened on the 5' end by one or two nucleotides consistent with previous examination of the action of this enzyme on nicked substrates (Longley et al., supra). When the upstream oligonucleotide is invasive, however, the appearance of the distinctively shifted probe band is seen. These data clearly indicated that it is the invasive 3' portion of the upstream oligonucleotide that- is responsible for fixiitg the site of cleavage of the downstream probe.
Thus, the above results demonstrate that it is the presence of the free'or initially non-annealed nucleotides at the 3' end of the InvaderTM oligonucleotide which mediate tl~e shift in the cleavage site, not just the presence of an oligonucleotide arinealed upstream of the 'probe.
Nucleic acid detection assays which employ the use of an invaderTM
oligonucleotide termed "InvaderTM-directed cleavage" assays.
. : . ._ -InvaderTM-Directed Cleavage Recognizes Single And Double Stranded Target Molecules In A Background Of Non-Target DNA Molecules For a nucleic acid detection method to be broadly useful, it must be able to detect a specific target in a sample that may contain large amounts of other DNA, (e.g.; bacterial or human chromosomal DNA). The ability of the InvaderTM directed cleavage assay to recognize and cleave either single- or double-stranded target niolecules in the presence of large amounts of non-target DNA was examined. In these experiments a model target nucleic acid, M13, in either single or double stranded form (single-siranded M13mp18 is available from Life Techriologies, Inc and double-stranded M13mp19 is available from NEB), was combined with human genomic DNA (Novagen) and then utilized in InvaderTM-direct.ed cleavage reactions. Before the start of the cleavage reaction; the DNAs were heated to 95 C
for 15 minutes to completely, denature the -samples, as is standard practice in assays, such as WO 98/42873 1'CT/US98/05809 polymerase chain reaction or enzymatic DNA sequencing, which involve solution hybridization of oligonucleotides to double-stranded target molecules.
For each of the reactions shown in lanes 2-5 of Fig. 31, the target DNA (25 fmole of the ss DNA or 1 pmole of the ds DNA) was combined with 50 pmole of the InvaderTM
oligonucleotide (SEQ ID NO:35); for the reaction shown in lane 1 the target DNA was omitted. Reactions 1, 3 and 5 also contained 470 ng of human genomic DNA.
These mixtures were brought to a volume of 10 i with distilled water, overlaid with a drop of ChillOutT"' evaporation barrier, and brought to 95 C for 15 minutes. After this incubation period, and still at 95 C, each tube received 10 1 of a mixture comprising 2.25 l of Cleavase A/G nuclease extract- (prepared as described in Example 2) and 5 pmole of the probe oligonucleotide (SEQ ID NO:32), in 20. mM MOPS, pH 7.5 with 0.1 % each of Tween and NP-40, 4 mM MnC12 and 100. mM KCI. The reactions were brought to 62 C for minutes and stopped by the addition of 12 I of 95% formamide with 20 mM EDTA
and 0.05% marker dyes. Samples were heated to 75 C for 2 minutes immediately before 15 electrophoresis through a 20% acrylamide gel (19:1 cross-linked), with 7 M
urea, in a buffer of 45 mM Tris-Borate; pH $.3, 1.4 mM EDTA. The products of the reactions were visualized by the use of. an Hitachi FMBIO fluorescence imager. The results are displayed in Fig. 31.
In Fig. 31, lane 1 contains the products of the reaction containing the probe (SEQ ID
20 NO:32), the InvaderT"i oligonucleotide (SEQ ID NO:35) and human genomic DNA.
Examination of lane 1 shows that the probe and Invaderm oligonucleotides are specific for the .target sequence, and that the presence of genomic DNA does not cause any significant background cleavage.
- In Fig.31, lanes 2 and 3 contain reaction products from reactions containing the single-stranded target DNA (M13mp18), the probe (SEQ ID NO:32) and the InvaderTM
oligonucleotide (SEQ ID NO:35) in the absence or presence of human genomic DNA, respectively. Examination of lanes 2 and 3 demonstrate that the InvaderTM
detection assay may be used to detect the presence of a specif c sequence on a single-stranded target molecule in the presence or absence of a large excess of competitor DNA (human genomic DNA).
In Fig. 31, lanes 4 and 5 contain reaction products from reactions containing the double-stranded target DNA (M 13mp 19), the probe (SEQ. ID NO:32) and: the InvaderTM
oligonucleotide (SEQ ID NO:35) in the absence or presence of human .genomic DNA, respectively. Examination of,lanes 4 and 5 show that double stranded target molecules are a = ~ _ eminently suitable for InvaderT'"-directed detection reactions. The success of this reaction using a short duplexed molecule, M13mp19, as the target in a background of a large excess of genomic DNA is especially noteworthy as it would be anticipated that the shorter and less complex M13 DNA strands would be expected to find their complementary strand more easily than would the strands of the more complex human genomic DNA. If the reannealed before the probe and/or InvaderTM oligonucleotides could bind to the target sequences along the M13 DNA, the cleavage reaction would be prevented. In addition, because the denatured genomic DNA would potentially contain regions complementary to the probe and/or InvaderTM oligonucleotides: it was possible that the presence of the genomic DNA would inhibit the reaction by binding these oligonucleotides thereby preventing their hybridization to the M13 target. The above results demonstrate that these theoretical concerns are not a problem under the reaction conditions employed above.
In addition to demonstrating that the InvaderTM detection assay may be used to detect sequences present in a double-stranded target, these data also show that the presence of a large: amount of non-target: DNA (470 ng/20 l reaction) does not lessen the specificity'of the cleavage. While this amount of DNA does show some impact on the rate of produ&
accumulation, probably by binding a portion of the enzyme, the nature of the target sequence, whether single- or double-stranded nucleic acid, does not limit the application of this assay.

Signal Accumulation In The InvaderTM-Directed Cleavage Assay -As A Function - Of Target,Concentration -To investigate whether the InvaderTM-directed cleavage assay could be used to indicate the amount of target nucleic acid in-a sample, the following experiment was performed.
Cleavage reactions were assembled which contained an InvaderTM oligonucleotide (SEQ ID
NO:35), a labelled probe (SEQ ID NO:32) and a target nucleic acid, M13mp19. A
series of reactions, which contained smaller and smaller amounts of the M13 target DNA, was employed in order to examine whether the cleavage products would accumulate in a manner that reflected the amount of target DNA present in the reaction.
The reactions were'conducted as follows. A master mix containing enzyme and buffer was assembled. Each 5 l oflhe master mixture contained 25 ng of Cleavase BN
nuclease in 20 mM MOPS (pH 7.5) with 0.:1 % each of Tween 20 and NP-40, 4 mM MnCI, -and 100 mM KCI. For each of the cleavage reactions shown in lanes 4-13 of Fig. 32, a DNA mixture WO 98/42873 PCT/US98/05809;
was generated which contained 5 pmoles .of the fluorescein-labelled probe oligonucleotide (SEQ ID NO:32), 50 pmoles of the InvaderTM oligonucleotide (SEQ ID NO:35) and 100, 50, 10, 5, 1, 0.5, 0.1, 0.05, 0.01 or 0.005 fmoles of single-stranded M13mp19, respectively, for every 5 l of the DNA niixture. The DNA solutions were covered with a drop of ChillOut evaporation barrier and brought to 61 C. The cleavage reactions were started by the addition ' of 5 l of the enzyme mixture to each of tubes (final reaction volume was 10 1). After 30 minutes at 61 C, the reactions were terminated by the addition of 8 i of 95%
formamide with 20 mM EDTA and 0.05%. marker dyes. Samples were heated to 90 C for 1 minute .immediately beforeelectrophoresis through a 20% denaturi.ng acrylainide gel (19:1 cross-,linked) with..7 M:urea, in a buffer containing 45. mM Tris-Borate (pH 8.3), 1.4 mM EDTA.
. To provide reference (i.e.,;standards), 1.0, 0.1 and 0.01 pmole aliquots of fluorescein-labelled probe oligonucleotide (SEQ ID NO;32) were diluted- with the above formamide -solution to a fmal volume of -1$ l. These -r.eference= markers= were loaded into lanes 1-3, respectively of the ge1. The products. of:the cleavage reactions (as well as the reference standards) were 15, visualized. following; electrophoresis by the use: of a Hitachi FMBIO
fluorescence imager.
The. results are displayed in Fig. 32.
In Fig. 32, boxes appear, around fluorescein-containing nucleic acid (i.e the>-cleaved and uncleaved probe molecules)- and the amount of fluorescein contained within each box is indicated under the box. The background fluorescence of the gel (see box labelled "background") was subtracted by the- fluoro-imager to generate each value displayed under a box containing cleaved or uncleaved probe products (the boxes are numbered 1-14 at top left ;with a. V followed by a nuniber -beelowthe box).- The lane marked "M"
contains ;fluor.esceinated oligonucleotides: which served as: markers.
The results shown in Fig. 32, demonstrate that the accumulation of cleaved probe molecules in a fixed-length incubation period reflects'the amount of target DNA present in the reaction. The results also demonstrate that the cleaved probe products accumulate in excess of the copy number of the target. This is clearly demonstrated by comparing the results shown in lane 3, in which 1.0 fmole (0.01 pmole) of uncut probe are displayed with the results shown in 5, where the products which accumulated in response to the presence of .10. fna.ole of target.DNA are displayed. -These results show ~that the reaction can cleave hundreds of probe oligonucleotide molecules for each target molecule present,:
dramaflcally amplifying the target-specific signal generated in.the InvaderTm-directed, cleavage reaction. _ Effect Of Saliva Extract On The InvaderTM-Directed Cleavage Assay For a nucleic acid detection method to be useful in a medical (i. e., a diagnostic) setting, it must not be inhibited by materials and contaminants likely to be found in a typical clinical specimen. To test the susceptibility of the InvaderTM-directed-cleavage assay to various materials, including but not limited to nucleic acids, glycoproteins and carbohydrates, likely to be found in a clinical sample, a sample of human saliva was prepared in a manner consistent with practices in the clinical laboratory and the resulting saliva extract was added to the InvaderTM-directed cleavage assay. The effect of the saliva extract upon the inhibition of cleavage and upon the specificity of the cleavage reaction was-examined:
One and one-half milliliters of human saliva were C'ollected and extracted once with an equal volume of a mixture containing phenol:chloroform:isoamyl alcohol (25:24:1): The resulting mixture was centrifuged in a microcentrifuge to separate the aqueous and organic phases. The upper, aqueous phase was transferred to a fresh tube. One-tenth volutnes of 3 M NaOAc were added and the contents of the tube were mixed. Two volumes oP100%
ethyl alcohol were added to the mixture and the sample was mixed and incubated atroorri texnperature for 15 minutes to allow a precipitate to form. The sample wascentrifuged in a microcentrifuge at 13,000 rpm for 5 minutes and the supernatant was removed and' di'karded.
A milky pellet was easily visible. The pellet was rinsed once with 70%
ethanol, dried under vacuum and dissolved in 200 l of 10 mM Tris-HCI, pH 8.0, 0.1 mM EDTA (this constitutes the saliva extract). Each l of the saliva extract was equivalent to- 7.5 gl.
of saliva. Analysis of ihe saliva-extract by scanning ultraviolet -spectrophotometry =showed-a'peak absorbance at about 260 nm and indicated the presence of approximately 45 ng of total nucleic acid= per l of, extract.
The effect of the presence of saliva extract upon the following enzymes was examined: Cleavaseg BN nuclease, CleavaselD A/G nuclease and three different lots'of DNAPTaq: AmpliTaq {Perkin Elmer; a recombinant=fortn of DNAPTaq), AmpliTaq LD
(Perkin=Elmer; a recombinant DNAPTaq preparation containing very low levels of DNA) and -Taq DNA polymerase (Fischer): For each enzyme'tested, ~an enzymelprobe mixture was made comprising the chosen amount of enzyme with 5 pmole of the probe oligonucleotide (SEQ ID
NO:32) in 10 g1 of 20 mM MOPS (pH 7.5) containing 0.4 % each' of Tween 20 and NP-40, 4 mMMnC12-; 100 mM,KCI and 100 glml BSA: The- following amounts of enzyme were used: 25 ng of Cleavase BN prepared as described in Example 8; 2 g1 of Cleavase A/G

WO 98/42873 PCT/US98/05809"
nuclease extract prepared as described in Example 2; 2.25 l (11.25 polymerase units) the following DNA polymerases: AmpliTaq DNA polymerase (Perkin Elmer); AmpliTaq DNA polymerase LD (low DNA; from Perkin Elmer); Taq DNA polymerase (Fisher Scientific).
For each of the reactions shown in Fig.. 33, except for that shown in lane 1, the target DNA (50 fmoles of single-stranded M13mp19 DNA) was combined with 50 pmole of the InvaderTM oligonucleotide (SEQ ID NO:35) and 5 pmole of the probe oligonucleotide (SEQ
ID NO:32); target DNA was omitted in reaction 1(lane 1). Reactions 1, 3, 5, 7, 9 and 11 included 1.5 l of saliva extract. These mixtures were brought to a volume of 5}.tl with distilled water, overlaid with a drop of ChillOut evaporation barrier and brought to 95 C for 1.0 minutes. The cleavage reactions were then started by the addition of 5 l of the desired enzyme/probe mixture; reactions 1, 4 and 5 received Cleavase A/G nuclease.
Reactions 2 and 3 received. Cleavase _ BN; reactions 6 and 7 received Ampli"I'aq@;
reactions 8 and 9 received AmpliTaq LD; and.reactions 10 and 11 received Taq DNA Polymerase from Fisher Scientific.
The reactions were incubated at 63 C for 30 minutes and were stopped by the-addition of 6 l of 95% formamide with 20 mM EDTA and 0.05% marker dyes. : Samples were heated to 75 C for 2 minutes immediately before electrophoresis through a 20%
acrylamide gel (19:1 cross-linked), with _7 M urea, in a buffer of 45 mM Tris-Borate, pH
'8:3, :1:4 nilVl EDTA. The products of the reactions were visualized by the use of an- Hitachi FMBIO
fluorescence imager, and the_ results are displayed in Fig. 33.
A pairwise comparison of the lanes shown in Fig.. 33 without and with the saliva extract, treated with each of-the enzymes, shows that, the saliva extract has different effects on each of the enzymes. While the Cleavase BN nuclease and the AmpliTaq are significantly inhibited from cleaving in these conditions;.the CleavaseMA/G nuclease and AmpliTaq LD
display little difference in the yield of cleaved probe. The preparation of ?.'aq'DNA
polymerase from Fisher:Scientific shows an intermediate response, with a partial reduction in the yield of cleaved product. From the standpoint of polymerization, the three DNAPTaq variants should be equivalent; these should be the same protein with the same amount 'of synthetic activity.. It is possible that the -differences observed=could -be due to.variations in the amount of nuclease activity present in each preparation caused by different.handling. during purification, or by different purification protocols. I,n any case, quality control.asssFys :
designed to assess polymerization activity in commercial DNAP: preparations would be _162-'WO 98/42873 PCT/US98/05809 unlikely to reveal variation in the amount of nuclease activity present. If preparations of DNAPTaq were screened for full. 5' nuclease activity (i.e., if the 5' nuclease activity was specifically quantitated), it is likely that the preparations would display sensitivities (to saliva extract) more in line with that observed using Cleavase A/G nuclease, from which DNAPTaq differs by a very few amino acids.
It is worthy of note that even in the slowed reactions of Cleavase BN and the DNAPTaq variants there is no noticeable increase in non-specific cleavage of the probe oligonucleotide due to inappropriate hybridization or saliva-borne nucleases;

Comparison Of Additional 5' Nucleases' In The lnvaderTM-Directed Cleavage Assay.
A number of eubacterial Type A DNA polymerases (i.e., Pol I type DNA
polymerases) have been shown to function as structure specific endonucleases (See;-Example 1, and Lyamichev et al., supra). In this Example, it was demonstrated that the enzyines of this class can also be made to catalyze the invaderTM-directed cleavage of the present invention, albeit not as efficiently as the Cleavase enzymes. =
Cleavase BN nuclease and Cleavase A/G nuclease were tested along side=three different thermostable DNA polymerases: Thermus aquaticus DNA polymerase (Promega), Thermus thermophilus and Thermus flavus DNA polymerases (Epicentre). The enzyme mixtures used in the reactions shown in lanes 1-11 of Fig: 34 contained the following; each in a volume of 5 l: Lane 1: 20 mM MOPS (pH 7.5) with 0.1% each of Tween 20 and NP-40, 4 mM MnCI., 100 mM KCI; Lane 2: 25 ng of Cleavase BN nuclease in the same solution described for lane 1; Lane 3: 2.25 l of Cleavase A/G nuclease extract (prepared as described in Example 2), in the samesolution described for lane'1; Lane 4:
2.25 l of Cleavase A/G nuclease extract in 20 mM Tris-Cl, (pH 8.5), 4 mM MgC12 and 100 mM
KCI; Lane= 5: 11.25 polymerase units 'of Taq DNA polymerase in- the same buffer "described for lane 4; Lane 6: 1.1.25 polymerase units of Tth DNA polymerase in the same buffer described for lane 1; Lane 7: 11.25 polymerase units of Tth DNA polynmerase in a 2X
concentration of the buffer supplied by the manufacturer, supplemented with.=
4 mM MnC12;
Lane 8: 11.25 polymerase units of Tth DNA polymerase in a 2X concentration of the buffer supplied by,the manufacturer, supplemented with 4 mM MgC12; `Lane 9: 2.25 polymerase units of Tfl DNA polymerase in the same buffer described for lane 1; Lane 10:
2.25 polymerase units of Tfl polymerase in a 2X concentration of the buffer supplied by the manufacturer, supplemented with 4 mM MnC12; Lane 11: 2.25 polymerase units of Tfl DNA
polymerase in a 2X concentration of the buffer supplied by the manufacturer, supplemented with 4 mM MgC12.
Sufficient target DNA, probe and InvaderTM for all 1 I reactions was combined into a master mix. This mix contained 550 fmoles of single-stranded Ml3mpl9 target DNA, 550 pmoles of the lnvaderTM oligonucleotide (SEQ ID NO:35) and 55 pmoles of the probe oligonucleotide (SEQ ID NO:32), each as depicted in Fig. 28c, in 55 l of distilled water.
Five l of the DNA rrmixture was dispensed into each of 11 labeled tubes and overlaid with a drop of ChillOut evaporation barrier. The reactions were brought to 63 C and cleavage was started by the addition of.5, 1 of the appropriate enzyme mixture. The reaction mixtures were then incubated at 63 C temperature for 15 minutes. The reactions were stopped by the addition of 8 l of 95% formamide with 20 mM EDTA and 0.05% marker dyes.
Samples were heated to 90 C -for. l minute immediately~ before electrophoresis through a 20%`
acrylamide gel (19:1 cross-linked), with 7 M. urea, in a buffer of.45 mM Tris-Borate= (pH
8.3), 1.4 mM EDTA: Following electrophoresis, the products of the reactions were visualized by the use of an Hitachi FMBIO fluorescence -imager, and the results are displayed- in Fig. 34.
Examination of the results shownin Fig. - 34 demonstrates that all of the 5' nucleases tested have the ability to catalyze InvaderTm-direeted cleavage in at least one of the buffer systems tested - Although not optimizred- here, these cleavage agents .are suitable for: use in the methods of the present invention. :

The InvaderTM-Directed Cleavage Assay Can Detect :
Single..Base: Differences In Target Nucleic Acid Sequences The ability of the. InvaderTM-directed cleavage assay to detect single base mismatch mutations was examined.. Two target nucleic acid sequences containing Cleavase& enzyme-resistant phosphorothioate backbones were chemically synthesized and purified by polyacrylamide gel electrophoresis.. Targets comprising phosphorothioate backbonese were used to prevent exonucleolytic nibbling of the target when duplexed with an:
oligonucleotide.
A target oligonucleotide, which ;provides a target sequence that is completely complementary to the InvaderTM oligonucleotide (SEQ ID NO:35) and;the probe oligonucleotide.(SEQ ID
NO:32), contained the following sequence:

_ . --~

5'-CCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGC-3' (SEQ ID NO:36). A
second target sequence containing a single base change relative to SEQ ID
NO:36 was `
synthesized: 5' -CCTITCGCTCTCTTCCCTTCCTTTCTCGCC ACGTTCGCCGGC-3 (SEQ
ID NO:37; the single base change relative to SEQ ID NO:36 is shown using bold and underlined type). The consequent mismatch occurs within the "Z" region of the target as represented in Fig. 25.
To discriminate between two target sequences which differ by the presence of a single mismatch), InvaderTM'-directed cleavage reactions were conducted using two different reaction temperatures (55 C and 60 C). Mixtures containing 200 fmoles of either SEQ ID
NO:36 or SEQ ID NO:37, 3 pmoles of fluorescein-labelled probe oligonucleotide (SEQ ID
NO:32), 7.7' pmoles of InvaderT'" oligonucleotide (SEQ ID NO:35) and 2* 1 of Cleavase A/G
nuclease extract (prepared as described in Example 2) in 9 l of 10 mM MOPS (pH 7.4) with 50 mM
KCl were assembled, covered with a drop of ChillOue evaporation barrier and brought to the appropriate reaction temperature. The cleavage reactions were initiated by the ad'dition of 1 }il of 20'mlvt MgCl2: After 30 minutes at either 55 C or-60 C, t0 I of 95%0 1ormainide with mM EDTA and 0.05% marker dyes was added to stop the reacti'ons. The reaefidi~
mixtures where then heated to 90 C for one minute prior to loading 4 l onto 20% denaturing polyacrylamide gels. The resolved reaction, products were visualized using a Hitachi"FMBIO
fluorescence imager. The resulting image is shown in Fig. 35.
20 In Fig. 35, lanes I and 2 show-the-'products from reactions conducted at 55 C; lanes 3 and 4 show the products from reactions conducted at 60 C: 'Lanes 1 and 3 contained products from reactions containing SEQ ID NO:36 (perfect match to probe) as the target.
Lanes 2 and 4 contained products from reactions containing SEQ ID NO:37 (single base mis-match with probe) as the target. The target that does not have a perfect hybridization match (i.e., complete complementarity) with the probe will not bind as 'strongly (i.e., the T. of that duplex will be lower than the T. of the same region if perfectly matched). -The results presented here show that reaction conditions can be varied to either accommodate the mis-match (e. g. , by lowering the temperature of the reaction) or to exclude the binding of the mis-matched sequence (e.g., by raising the reaction temperature):
The results shown in Fig. 35'demonstrate that the specific cleavage event which occurs in InvaderTM-directed cleavage reactions can =be eliminated by the presence of a single base mis-mat& between the probe oiigonuoleotide and the target sequence. Thus, "reaction conditions can be chosen so as to exclude the :hyliridization of mis-matched InvaderT"'-, WO 98/42873 PCT/US98/05809 ~
directed cleavage probes thereby diminishing or even eliminating the cleavage of the probe.
In an extension of this assay system, multiple cleavage probes, each possessing a separate reporter molecule (i.e., a unique label), could also be used in a single cleavage reaction, to simultaneously probe for two or more variants in the same target region. The products of such a reaction would allow not only the detection of mutations which exist within a target molecule, but would also allow a determination of the relative concentrations of each sequence (i.e., mutant and wild type or multiple.different mutants) present within samples containing a mixture of target sequences. When provided in equal amounts, but in a vast excess (e.g., at least a 100-fold molar excess; typically at least I pmole of each probe oligonucleotide would be used when the target sequence was present at about 10 fmoles or :;.:iess) over the target and used in optimized conditions. As discussed above; any differences in the relative amounts of the target variants will not affect the kinetics of hybridization, so the amounts of cleavage of each probe will reflect the relative amounts of each variant present in the reaction.
The results shown in the Example- clearly demonstrate that the InvaderTM-directed cleavage reaction can be used to detect single base difference between target nucleic acids.

The InvaderTM-Directed Cleavage Reaction Is Insensitive To LargeChanges In Rea¾tion Conditions The, results shown above demonstrated thatthe InvaderTM-directed cleavage reaction ,an be used for the detection of. target nucleic acid sequences and that this assay can be used detect single base difference between target ;nucleic acids. These results demonstrated that ~'. nucleases (e.g., Cleavase BI`1, CleavaseA.l:G; DNAPTaq, DNAPTth, DNAPTf1).
could be used in conjunction with a. pair of overlapping oligonucleotides as an efficient way to :
recognize nucleic acid targets. In the experiments below it is demonstrated that invasive cleavage reaction is relatively insensitive to large changes in conditions thereby making the method suitable for practice in clinical laboratories.
The effects of varying the conditions of the cleavage reaction were examined=
for their 30, effect(s) on the specificity of the invasive cleavage and the on the amount of signal accumulated in the course of the reaction. , To compare variations in the cleavage.r.eaction a "standard", InvaderTM cleavagereaction ;was first defined. In each instance, unless specifically stated to be otherwise, the indicated .parameter of the reaction was varied, while the invariant . ~ . =

aspects of a particular test were those of this standard reaction. The results of these tests are either shown in Figs. 38-40, or the results described below.

a) The Standard InvaderT"M-Directed Cleavage Reaction The standard reaction was defined as comprising 1 fmole of M13mp18 single-stranded target DNA (NEB), 5 pmoles of the labeled probe oligonucleotide (SEQ ID
NO:38), 10 pmole of the upstream InvaderTM oligonucleotide (SEQ ID NO:39) and 2 units of Cleavase A/G in 10 i of 10 mM MOPS, pH 7.5 with 100 mM KCI, 4 mM MnC1Z, and 0.05% each Tween-20 and Nonidet-P40. For each reaction, the buffers, salts and enzyme were combined in a volume of 5 l; the DNAs (target and two oligonucleotides) were combined in 5 l of dH2O and overlaid.with a drop of ChillOut evaporation barrier. When multiple reactions were performed with the same reaction constituents, these formulations were expanded proportionally.
Unless otherwise stated, the sample tubes with the DNA mixtures were warmed to 61 C, and the reactions were started by the addition of 5 l of the enzyme mixture: ~;-After 20 minutes at this temperature, the reactions were stopped by the addition of 8 l of I5%o formamide with 20 mM EDTA and 0.05% marker dyes. Samples were heated to 75 C
for 2 minutes immediately before electrophoresis through a 20% acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. The products of the reactions were visualized by the use of an Hitachi FMBIO fluorescence imager. In each case, the uncut probe material was visible as an intense black band or blob, usually in the top half of the .panel,>while the desired products of InvaderTM specific cleavage were visible as .one or two narrower black bands, usually in the bottom half of-the panel.
Under some reaction conditions; particularly those with elevated salt concentrations, a secondary cleavage product: is also visible (thus generating a doublet). Ladders of lighter grey bands generally indicate either exonuclease nibbling of the probe oligonucleotide or heat-induced, non-specific breakage of the probe.
Fig. 37 depicts the annealing of the probe and InvaderTM oligonucleotides to regions along the M13mp18 target molecule (the bottom strand). In Fig. 37 only a 52 nucleotide portion of the M13mp18 molecule is shown; this 52 nucleotide sequence islisted in SEQ ID
NO:31 (this sequence is identical in both Ml3mp18 and M13mp19). The probe -oligonucleotide. (top strand) contains a Cy3 amidite label at the 5' end; the sequence of the probe is 5'-AGAAAGGAAGGGAAGAAAGCGAAAGGT-3' (SEQ ID NO:38. The bold -- = " `y type indicates the presence of a modified base (2'-O-CH3). Cy3 amidite (Pharmacia) is a indodicarbocyanine dye amidite which can be incorporated at any position during the synthesis of oligonucleotides; Cy3 fluoresces in the yellow region (excitation and emission maximum of 554 and 568 nm, respectively). The InvaderTM oligonucleotide (middle strand) has the following sequence: 5'-GCCGGCGAACGTGGCGAGAAAGGA-3' (SEQ ID
NO:39):

b) KCI Titration Fig. 38 shows the results of varying the KC1 concentration in combination with the .use of 2 mM MnC12, in an otherwise standard reaction. The reactions were performed in duplicate for confirmation of observations; the reactions shown in lanes I and 2 contained no added KCI, lanes 3 and 4 contained KCI at 5 mM, lanes 5 and 6 contained-25 nzh!1 KCI, lanes 7 and 8 contained 50 mM KCI, lanes 9 and 10 contained 100 mM KCI and lanes 11 and 12 contained 200. mM KCI. These results show that the inclusion of KCI allows the generation of a specific cleavage product. - While the strongest signal is observed at the 100 nthri `KCl concentration, the specificity> of;signal in the other.reactions with KCI at or above 25 mM
indicates #hat concentrations in the full range (i.e., 25-200. mM) may be chosen if it is so desirable for. any particular reaction conditions.
As shown in Fig. 38, the InvaderTM-directed cleavage reaction requires the presence of salt (e.g., KC1) for effective cleavage to occur. In other reactions, it has been found that KCI
can inhibit the activity of certain Cleavase enzymes when: present at concentrations above about 25 mM. For example, in c.leavage- reactions using- the S-60 oligonucleotide shown in F3tg. 2i6, in the absence of primer, the Cleavase BN enzyme loses approximately 50 fo of its activity in 50 mM KCI. Therefore, the use of alternative salts in the InvaderTM-directed cleavage reaction was examined. In these experiments, the potassium ion was replaced with either Na+ or Li' or the chloride ion was replaced with giutamic acid. The replacement of KCI with alternative salts is described below in Sections c-e.

c) NaCI Titration NaCI=was used in place of KCI at 75, 100, 150 or 200 mM, in combination with the use 2 mM MnClZ, in. an otherwise standard reaction. These results showed that' NaCI can be used as a replacement for KC1 in = the InvaderTM-directed cleavage reaction, with like .t `
vPO 98142873 PCT/US98/05809 concentration giving like results, (i.e., the presence of NaCI, like KCI, enhances product accumulation).

d) LiCI Titration LiCI was used in place of KCI in otherwise standard reactions. Concentrations tested were 25, 50, 75, 100, 150 and 200mM LiCI. The results demonstrated that LiCI
can be used as a suitable replacement for KCl in the InvaderTM-directed cleavage reaction (i. e. , the presence of LiCI, like KCI, enhances product accumulation), in concentrations of about 100 mM or higher.
e) KGIu Titration The results of using a glutamate salt of potassium (KGIu) in place of the more commonly used chloride salt (KCI) in reactions performed over a range of temperatures were examined. KGIu has been shown to be a highly effective salt source for some enzymatic reactions, showing a broader range of concentrations which permit maximum enzymatic activity (Leirmo et al., Biochem., 26:2095 [1987]). The ability of KGlu to facilithte `the annealing of the probe and InvaderT"I oligonucleotides to the target nucleic acid was compared to that of LiCI. In these experiments, the reactions were run for 15 rninutes, rather than the standard 20 minutes, in standard reactions that replaced KC1200 mM;
300'mM or 400 mM KGIu. The reactions were run at 65 C, 67 C, 69 C or 71 C. The results showed demonstrated that KG1u was very effective as a salt in the invasive cleavage reactions,' with full activity apparent even at 400 mM KGIu, though at the lowest temperature cleavage was reduced by about 30% at 300 mM KGIu, and -by about 90!/o to 400 mM KGIu.

fp MnC12 And MgC12 Titration And Ability To Replace MnC12 With MgC12 In some instances it may be desirable to perform the invasive cleavage reaction in the presence of Mg2+, either in addition to, or in place of MnZ+ as the necessary divalent cation required for activity of the enzyme employed. For example, some common methods of preparing DNA from bacterial cultures or tissues use MgCIZ in solutions which are used to facilitate the collection of DNA by precipitation. In addition, elevated concentrations (i.e., greater than 5 mM) of divalent cation can be used to facilitate hybridization of nucleic acids, in the same way that the monovalent salts were used above, thereby enhancing the invasive --\ i WO 98l42873 PCTlUS98L0580~

cleavage reaction. In this experiment, the tolerance of the invasive cleavage reaction was examined for 1) the substitution of MgC12 for MnCIZ and for the ability to produce specific product in the presence of increasing concentrations of MgC12 and MnCI,.
Fig. 39 shows the results of either varying the concentration of MnCI2 from 2 mM to 8 mM, replacing the MnC12 with MgC12 at 2 to 4 mM, or of.using these components in combination in an otherwise standard reaction. The reactions analyzed in lanes 1 and 2 contained 2 mM each MnCIZ and MgCI2, lanes 3 and 4 contained , 2 mM MnCI, only, lanes 5 and 6 contained 3 mM MnC12, lanes 7 and 8 contained 4 mM MnCl21 lanes 9 and 10 contained 8 mM MnCI2. The reactions analyzed in lanes 11 and 12 contained 2 mM
:MgC1, and lanes 13 and 14 contained 4 mM MgC12. These results show that both MnCI, and MgC12 can be used as the necessary divalent cation to enable the cleavage activity of the Cleavase A1G enzyme in these reactions, and that the invasive cleavage reaction can tolerate a broad range of concentrations of these components.
In addition to examining the effects of the salt environment on the rate of product accumulation in the invasive. cleavage reaction, the use of reaction constituents shown to be effective in enhancing, nucieic acid hybridization in either standard hybridization assays (e.g., blot hybridization) or in ligation reactions was examined. These components may act- as volume excluders, increasing the. effective concentration of the, nucleic aeids.: of interest. and thereby enhancing hybridization, or they may act as charge-shielding agents to minimize repulsion between the highly. charged backbones of the nucleic acids strands.
The results of .;
these experiments are described in Sections g. and h below.

g) Effect Of CTAB Addition The polycationic detergent cetyltrietheylammonium bromide (CTAB) has been shown to dramatically enhancehybridization of.nucleic acids. (Pontius and Berg, Proe. Natl. Acad.
Sci. USA 88:8237 [1991]). The effect of adding the detergent CTAB in concentrations from 100 mM to l mM to invasive cleavage reactions in which 150 mM LiCi was used in place of the KCI in otherwise standard reactions was also investigated. These results showed that 200 mM CTAB may have a very moderate enhancing. effect under, these reaction;, conditions, and the presence of CTAB in _excess of about 500 M was inhibitory to.the.accumulation of specific cleavage product.

h) Effect Of PEG Addition The effect of adding polyethylene glycol (PEG) at 4.8 or 12% (w/v) concentrations to otherwise standard reactions was also examined. The effects of increasing the reaction temperature of the PEG-containing reactions was examined by performing duplicate sets of PEG titration reactions at 61 C and 65 C. The results-showed that at all percentages tested, and at both temperatures tested, the inclusion of PEG substantially eliminated the production of specific cleavage product.
In addition to, the presence of 1X Denhardts in the"reaction mixture was found to have no adverse effect upon the cleavage reaction (50X Denhardts contains per 500 ml: 5 g Ficoll, 5 g polyvinylpyrrolidone, 5 g BSA). 'Further , the presence of each component of Denhardt's was examined individually (i.e., Ficoll alone;
polyvinylpy'rrolidone alone, BSA
alone) for the effect upon the InvaderTM=directed cleavage reaction; no adverse effect was observed.

. i) Effect Of The Addition Of Stabilizing Agents Another approach to enhancing the 'output` of the`invasive cleavage` reactiAis to enhance the activity of the enzyme employed, either by increasing its -stability in thie reaction environment or by increasing its turnover rate: Without regard to the precise rimechaiusm by which various agents operate in the invasive cleavage reaction, a nuinber of agentsicommonly used to stabilize-enzymes during prolonged storage were tested for the ability to enhance the accumulation of specific cleavage product in the invasive cleavage reaction.
The effects of adding glycerol at 15%. and of adding the detergents Tween-20 and Nonidet-P40 at 1.5%, alone or in combination, in `otherwise standard' reactions were also examined. The results demonstrated that under these conditions these 'adducts had little or no effect on the accumulation of specific cleavage' product:
The effects of adding gelatin to reactions in which the salt identity and coricentration were varied from the standard reaction were also investigated. The results d'emonstrated that in the absence of salt the gelatin had a moderately enhancing effect on the accumulation of specific cleavage product, but when either salt (KCI or LiCI) was added"to reactions performed under these conditions, increasing amounts of gelatin reduced the product accumulation. -171-. , =~ J ~{ : ===;

WO 98/42873 PCT1US98/05809 j) Effect Of Adding Large Amounts Of Non-Target Nucleic Acid In detecting specific nucleic acid sequences within samples, it is important to determine if the. presence of additional genetic material (i.e., non-target nucleic acids) will have a negative effect on the specificity of the assay. In this experiment, the effect of including large amounts of non-target nucleic acid, either DNA or RNA, on the specificity of _ the invasive cleavage reaction was examined. The data was examined for either an alteration in the expected site of cleavage, or for an increase in the nonspecific degradation of the probe oligonucleotide.
Fig. 40 shows the effects of adding non-target nucleic acid (e.g., genomic DNA
or tRNA) to an invasive cleavage reaction performed at 65 C, with 150 mM LiCI in place of the KC1 in the standard reaction. The reactions assayed in lanes 1 and 2 contained' 235 and 470 ng of genomic DNA, respectively. The reactions analyzed in lanes 3, 4, 5 and 6 contained 100 ng, 200 ng, 500 ng and I g of tRNA, respectively. Lane 7 represents a control reaction which contained no added nucleic acid beyond the -amounts used in the staiidard reaction.
The results shown in Fig. 40 demonstrate that the,inclusion of non=target nucleic acid in large amounts could visibly slow. the accumulation, of specific cleavage product (while not limiting the invention to any particular mechanism, it is thought that the additional nueleic acid competes for binding of the enzyme with the specific reaction components). In additional experiments it was found that the effect of adding,large amounts of non=target nucleic acid can be compensated for, by increasing the enzyme in the reaction. The data shown in` Fig. 40 also_demonstrate that a key feature of the invasive cleavage reaction, the.specificity of the detection, was not compromised by the presence of large amounts of non-target nucleic acid.
In. addition to the data presented above, invasive cleavage reactions were run with succinate buffer at pH 5.9 in place of the MOPS buffer used in the "standard"
reaction; no adverse effects were observed.
The data shown in Figs: 38-40 and described above demonstrate that the invasive cleavage reaction can be performed using a wide variety of reaction conditions and is therefore suitable for practice in clinical laboratories. 30 'W0 98/42873 PCT/US98/05809 Detection Of RNA Targets By InvaderTM-Directed Cleavage In addition to the clinical need to detect specific DNA sequences for infectious and genetic diseases, there is a need for technologies that can quantitatively detect target nucleic acids that are composed of RNA. For example, a number of viral agents, such as hepatitis C
virus (HCV) and human immunodeficiency virus (HIV) have RNA genomic material, the quantitative detection of which can be used as a measure of viral load in a patient sample.
Such information can be of critical diagnostic or prognostic value.
Hepatitis C virus (HCV) infection is the predominant cause of post-transfusion non-A, non-B (NANB) hepatitis around the world. In addition, HCV is the major etiologic agent of hepatocellular carcinoma (HCC) and chronic liver disease world wide. The genome of HCV
is a small (9.4 kb) RNA molecule. In studies of transmission of HCV by blood transfusion it has been found the presence of HCV antibody, as measured in standard immunological tests, does not always correlate with the infectivit,y of the sample, while the presence of HCV RNA
in a blood sample strongly correlates with infectivity. Conversely, serological tests niay remain negative in imnmunosuppressed infected individuals, while HCV RNA may' be easily detected (Cuthbert, Clin. Microbiol. Rev., 7:505 [1994]). The need for and the value of developing a probe-based assay for the detection the HCV RNA is clear. The polymerase chain reaction has been used to detect HCV'in clinical samples, but the problems associated with carry-over contaminatiori of samples has been a concern. Direct detection of the viral RNA without the need to perform either reverse transcription or amplification would allow the elimination of several of the points at which existing assays may fail.
The ~ genome of the positiveystranded RNA hepatitis C viras comprises several regions including 5' and 3' noncoding regions (i. e., 5' and 3' untransiated regions) and a polyprotein coding region which encodes the core protein (C), two envelope glycoproteins (El and E2/NS l) and six nonstructural glycoproteins (NS2-NS5b). Molecular biological analysis of the HCV genome has showed that some regions of the genome-are very highly conserved between isolates, while other regions are fairly rapidly changeable. The 5' noncoding region (NCR) is the most highly conserved region in the HCV. These analyses have allowed these viruses to be divided into six basic genotype groups, and then further classified into over a dozen sub-types (the nomenclature and division of HCV genotypes is evolving;
see Altamirano et al., J. Infect. Dis., 171:1034 (1995) for a recent classification scheme).

In order to develop a rapid and accurate method of detecting HCV present in infected individuals, the ability of the InvaderTM-directed cleavage reaction to detect HCV RNA was examined. Plasmids containing DNA derived from the conserved 5'-untranslated region of six different HCV RNA isolates were used to generate templates for in vitro transcription.
The HCV sequences contained within these six plasmids represent genotypes I
(four sub-types represented; I a, 1 b, 1 c, and O 1 c), 2, and 3. The nomenclature of the HCV genotypes used herein is that of Simmonds et al. (as described in Altamirano et al., supra). The Ale subtype was used in the model detection reaction described below.

"10 . a) Generation Of Plasmids Containing HCV Sequences Six DNA fragments derived from HCV were generated by RT-PCR using RNA
extracted from serum samples of blood donors; these PCR fragments were a gift of Dr. M.
Altamirano.(University of British Columbia, Vancouver). These PCR fragments represent HCV sequences. derived from HCV genotypes 1 a, 1 b, 1 c, A 1 c, 2c and 3a.
The RNA extraction, reverse transcription and PCR were performed using standard techniques=(Altamiranoet aL, supra). Briefly, RNA was extracted from 100 1 of serum using guanidine isothiocyanate, sodium lauryl sarkosate and phenol-chloroform (Inchauspe et al., Hepatol., 14:595 [1991]). Reverse transcription was performed according to the manufacturer's instructions using a GeneAmp rTh reverse transcriptase RNA PCR
kit (Perkin-Elmer) in the presence of an external antisense primer, HCV342. The sequence of the HCV342 primer is 5'-GGTT'IT'TCTTTGAGGTTTAG-3' (SEQ ID NO:40). Following termination of the RT reaction, the sense.primer HCV7 (5'-GCGACACTCCACCATAGAT-3' [SE.Q. ID NO:41 ]) and magnesium were added and a first PCR was performed.
Aliquots of the -dirst PCR products were used in a second (nested) PCR in the presence of primers HCV46 (5'-CTGTCTTCACGCAGAAAGC-3' [SEQ ID NO:42]) and HCV308 [5'-GCACGGT
CTACGAGACCTC-3' [SEQ ID NO.:43]). The PCRs produced a 281 bp product which corresponds to a conserved 5' noncoding region (NCR) region of HCV between positions -284 and -4 of the HCV genome (Altramirano et al., supra).
The six 281 bp PCR fragments were used directly for cloning or they were subjected to an additional amplification step using a 50 l PCR comprising approximately 100 fmoles . of DNA, the HCV46 and HCV308 primers at 0.1 M, 100 M of all four dNTPs and 2.5 units of Taq DNA polymerase in a buffer containing 10 mM Tris-HC1, pH 8.3, 50 mM KCI, 1.5 mM MgC12 and 0.1% Tween 20. The PCRs were cycled 25 times at 96 C for 45 sec., wO 98/42873 PCT/US98/05809 550C for 45 sec. and 720C for 1 min. Two microliters of either the original DNA samples or the reamplified PCR products were used for cloning in the linear pT7Blue T-vector (Novagen) according to manufacturer's protocol. After the PCR products were ligated to the pT7Blue T-vector, the ligation reaction mixture was used to transform competent JM109 cells (Promega). Clones containing the pT7Blue T-vector with an insert were selected by the presence of colonies having a white color on LB plates containing 40 pg/ml X-Gal, 40 g/ml IPTG and 50 g/ml ampicillin. Four colonies for each PCR sample were picked and grown overnight in 2 ml LB media containing 50 pg/mi carbenicillin. Plasmid DNA was isolated using the following alkaline miniprep protocol. Cells from 1.5 ml of the overnight culture were collected by centrifugation for 2 min. in a microcentrifuge (14K rpm), the supernatant was discarded and thecell pellet was resuspended in 50 l TE buffer with 10 g/ml RNAse A (Pharmacia). One hundred microliters of a solution containing 0.2 N NaOH, 1%
SDS was added and the cells were-lysed for 2 min. The lysate was gently mixed with 100 pl of 1.32 M potassium acetate, pH 4.8, and the mixture was centrifuged for 4 min. in a microcentrifuge (14K rpm); the pellet comprising cell debris, was discarded. Plasmid DNA was precipitated from the supernatant with 200 l ethanol and pelleted by centrifugation a microcentrifuge (14K rpm). The DNA pellet was air dried for 15 min. and was then redissolved in 50 l TE
buffer (10 mM Tris-HCI, pH 7.8, 1 mM EDTA).

b) Reamplification- Of -HCV Clones To Add The Phage T7 Promoter For Subsequent In Vitro Transcription To ensure thatthe RNA product of transcription. had a discrete 3' end it was necessary to create linear transcription templates which stopped :at the end of the HCV
sequence.= These fragments were conveniently produced using the PCR: to reamplify the segment of the plasmid containing the phage promoter_ sequence. and the HCV insert. For these studies, the clone of HCV type Oic was reamplified using a primer that hybridizes to the T7 promoter -sequence:
5'-TAATACGACTCACTATAGGG-3' (SEQ ID NO:44; "the T7 promoter primer") (Novagen) in combination with the 3' terminal HCV-specific primer HCV308- (SEQ
ID
NO:43). For these reactions, l l of plasmid DNA (approximately 10 to 100 ng) was reamplified in a 200 1 PCR using the T7 and HCV308 primers as described abovewith the exception that 30 cycles of amplification were employed. The resulting amplicon was;354 bp in length. After amplification the PCR -mixture was transferred to a fresh 1.5 ml microcentrifuge tube, the mixture was brought to a fmal concentration of 2 M
NH4OAc, and ~= ` _i .
WO 98/42873 PGT/US98l05801 the products were precipitated by the addition of one volume of 100%
isopropanol.
Following a 10 min..incubation at room temperature; the precipitates were collected by centrifugation, washed once with 80% ethanol and dried under vacuum. The collected material was dissolved in 100 i nuclease-free distilled water (Promega).
Segments of RNA were produced from this amplicon by in vitro transcription using the RiboMAXT'" Large Scale RNA Production System (Promega) in accordance with the manufacturer's instructions, using 5.3 g of the amplicon described above in a reaction. The transcription reaction was incubated for 3.75 hours, after which the DNA
template was destroyed by the addition of 5-6 gl of RQ I RNAse-free DNAse (1 unit/ l) according to the RiboMAXTM kit instructions: The reaction was extracted twice with :phenollchloroform/isoamyl alcohol (50:48:2) and the aqueOus phase was transferred to a fresh microcentrifuge tube. The RNA was then collected by the addition of 10 }ti of 3M NH4OAc, pH 5.2 and 110 I of 100% isopropanol. Following a 5 min. incubation at 4 C, the precipitate was collected bycentrifugation; washed once with 80% ethanol and dried under vacuum. The sequence of the resulting RNA transcript (HCV 1:1 transcript) is listed in SEQ
ID NO:45.

c) Detection Of The HCV1.1 Tmnscript In The InvaderTM=
Directed Cleavage Assay Detection of the! HCV 1.1 1transcript was tested in the InvaderTM-directed cleavage assay using an HCV-specific probe oligonueleotide (5'-CCGGTCGTCCTGGCAAT XCC-3' [SEQ
-..--.-=ID NO:46)); X indicates the presence of afluorescein dye on an abasic linker) and an HCV-specific InvaderTM oligonucleotide (5'-GTTTATCCAAGAAAGGAC CCGGTC-3' [SEQ ID
NO:47]) that causes a 6-nucleotide invasive cleavage of the probe.
Each 10 l of reaction mixture comprised 5 prnole of the probe oligonucleotide (SEQ
ID NO:46) and 10 pmole of the InvaderTM oligonucleotide (SEQ ID NO:47) in a buffer of 10 mM MOPS, pH 7.5 with 50 mM KCI, 4 mM MnC12, 0.05% each Tween-20 and Nonidet-and 7.8 units RNasin ribonuclease inhibitor (Promega). The cleavage agents employed were CIeavase A/G (used at 5.3 ng/10 l reaction) or DNAPTth (used at 5 polymerase units/10 l reaction). The amount of RNA target was varied as indicated below: When RNAse treatment is indicated, the target RNAs were pre-treated with 10 g of RNase A
(Sigma) at 37 C for 30 min. to demonstrate that the detection was specific for the RNA in the reaction _ 4, .
74667-13a and not due to the presence of any residual DNA template from the transcription reaction.
RA'ase-treated aliquots of the HCV RNA were used directly without intervening purification.
For each reaction, the target RNAs were suspended in the reaction solutions as described above, but lacking the cleavage agent and the MnCl2 for a final volume of 10 l, with the lnvaderTm and probe at the concentrations listed above. The reacdotts were warmed to 46 C and the reactions were started by the addition of a mixture of the appropriate enzyme with MnC12. After incubation for 30 min. at 46 C, the reactions were stopped by the addition of 8 l of 95% formamide, 10 mM EDTA and 0.02% methyl violet (methyl violet loading buffer). Samples were then resolved by electrophoresis through a 15%
denaturing polyacrylamide gel (19:1 cross-linked), containing 7 M urea, in a buffer of 45 mM
Tris-Borate, pH 8.3, 1.4 mM EDTA. Following electrophoresis, the labeled reaction products were visualized using the FMBI 0-100 Image Analyzer (Hitachi), with the resulting imager scan shown in Fig. 41.
In Fig. 41, the samples analyzed in lanes 1-4_ contained I pmole of the RNA
target, the reactions shown in lanes 5-8 contained 100 fmoles of the RNA target and the reactions shown in lanes 9-12 contained 10 fmoles of the RNA target. All odd-numbered lanes depict reactions performed using Cleavase A/G enzyme and all even-numbered lanes -depict reactions performed using DNAPTth. The reactions analyzed in lanes 1, 2, 5, 6, 9 and. 10 contained RNA that had been pre-digested with RA'ase A. These data demonstrate that the invasive cleavage reaction efficiently detects RNA targets and further, the absence of any specific cleavage signal in the RNase-treated samples confirms that the specific cleavage product seen in the other lanes is dependent upon the presence of input RNA.

The Fate Of The Target RNA In The lnvader'''"-Directed Cleavage Reaction In this Example, the fate of the RNA target in the I nvaderTm- directed cleavage reaction was examined. As shown above in Example 1D, when RNAs are hybridized to DNA oligonucleotides, the 5' nucleases associated with DNA polymerases can be used to cleave the RNAs; such cleavage can be suppressed when the 5' arm is long or when it is highly structured (Lyamichev et ol., Science 260:778 [1993], and U.S. Patent No. 5,422,253).
In this experiment, the extent to which the RNA target would be cleaved by the cleavage agents when hybridized to the W0 98/42873 PCT/E3S98/05809 detection oligonucleotides (i.e., the probe and InvaderTM oligonucleotides) was examined using reactions similar to those described in Example 20, performed using fluorescein-labeled RNA as a target.
Transcription reactions were performed as described in Example 19 with the exception that 2% of the UTP in the reaction was replaced with fluorescein-l2-UTP
(Boehringer Mannheim) and 5.3 g of the amplicon was used in a 100 i reaction. The transcription reaction was incubated for 2.5 hours, after which the DNA template was destroyed by the addition of 5-6 l of RQ 1 RNAse-free DNAse (1 unit/ i) according to the RiboMAXTM kit instructions. The organic extraction was omitted and the RNA was collected by the addition ..,<-of 10 l of 3M NaOAc, pH 5.2 and 1l0 l of 100% isopropanol. Following a 5 min.
incubation at 4 C, the precipitate was collected by centrifugation, washed once with 80%
ethanol and dried under vacuum. The resulting RNA was dissolved in 100 1 of nuclease-free water. Half (i.e., 50%) of the sample was purified by electrophoresis through a 8%
denaturing polyacrylamide gel (19:1 cross-linked), containing 7 M urea,-in a buffer of 45 mM
Tris-Borate,, pH 8.3, 1.4. mM EDTA. The gel slice containing the full-length material was excised and the RNA was eluted by soaking the slice overnight at 4 C in 200 l bf 10 mM
Tris-Cl, pH 8.0, 0.1 mM EDTA and 0.3 M NaOAc. The RNA was then precipitated by the addition of 2.5 volumes of 100% ethanol. After incubation at -20 C for 30 min., the precipitates were recovered by centrifugation, washed once with 80% ethanol and dried under vacuum. The RNA was dissolved in 25 l of nuclease-free water and then quantitated by UV
absorbance at 260 nm.
Samples of the purified RNA target were incubated for 5 or 30 min. in reactions that -_::duplicated the Cleavase A/G and DNAPTth InvaderTm reactions described in Example 20 t,with the exception that the reactions lacked :probe and InvaderTM
oligonucleotides.
Subsequent analysis of the products showed that the RNA was very stable, with a very slight background of non-specific degradation, appearing as a gray background in the gel lane. The background was not dependent on the presence of enzyme in the reaction.
InvaderT"' detection reactions using the purified RNA target were performed using the probe/InvaderTM pair described in Example 19 (SEQ ID NOS:46 and 47). Each reaction included 500 finole of the target.RNA, 5 pmoles of the fluorescein-labeled probe and 10 pmoles of the InvaderTM oligonucleotide in a buffer of 10 mM MOPS, pH 7.5 with 150 mM
LiCI,. 4 mM MnC121 0.05% each Tween-20 and Nonidet-P40 and 39 units RNAsin (Promega). These components were combined and warnied to 504C and the reactions were started by the addition of either 53 ng of Cleavase A/G or 5 polymerase units of DNAPTth.
The final reaction volume was 10 l. After 5 min at 50 C, 5 l aliquots of each reaction were removed to tubes containing 4 l of 95% formamide, 10 mM EDTA and 0.02%
methyl violet. The remaining aliquot receiveda drop of ChillOut evaporation barrier and was incubated for an additional 25 min. These reactions were then stopped by the addition of 4 l of the above formamide solution. The products of these reactions were resolved by electrophoresis through separate 20% denaturing polyacrylamide gels (19:1 cross-linked), containing 7 M urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA.
Following electrophoresis, the labeled reaction products were visualized using the FMBIO-100 Image Analyzer (Hitachi), with the resulting imager scans shown in Figs. 42A (5 min reactions) and 42B (30 min. reactions).
In Fig. 53 the target RNA is seen very near the top of each lane, while the labeled probe and its cleavage products are seen just below the middle of each panel.
The FMBIO-100 Image Analyzer was used to quantitate the fluorescence signal in the probe bands. In each panel, lane 1 contains products from reactions performed in the absence of a, cleavage agent, lane 2 contains products from reactions perfotmed using Cleavase A/G
an& lane 3 contains products from reactions performed using DNAPTth.
Quantitation of the fluorescence signal in the probe barids revealed that after a 5 min.
incubation, 12% or 300 fmole of the probe was cleaved by the Cleavase A/G and 29%o or 700 fmole was cleaved by the DNAPTth. After a 30 min. incubation, Cleavase A/G had cleaved 32% of the probe molecules and DNAPTth had cleaved 70% of the probe molecules.
(The images shown in Figs. 42A and 42B were printed with the intensity adjusted to show the small amount of background from the RNA degradation, so the bands containing strong signals are saturated and therefore these images do not accurately reflect the differences in measured fluorescence) The data shown in Fig. 42 clearly shows that, under invasive cleavage conditions, RNA molecules are sufficiently stable to be detected as a target and that each RNA molecule can support many rounds of probe cleavage.

Titration Of Target RNA In The Invader''M-Directed Cleavage Assay One of the primary benefits of the InvaderTM-directed cleavagi assay as a means for detection of the presence of specific target nucleic acids is the correlation between the amount of cleavage product generated in a set amount of time and the quantity of the nucleic acid of interest present in the reaction. The benefits of quantitative detection of RNA sequences was discussed in Example 19.. In this Example, the quantitative nature of the detection assay was demonstrated through the use of various amounts of target starting material.
In addition to = demonstrating the correlation between the amounts of input target and output cleavage ;; _-product, these data graphically show the degree to which the RNA target can be recycled in this assay The RNA target used in these reactions was the fluorescein-labeled material described in. Example 20 (i.e., SEQ ID NO:45). Because the efficiency of incorporation:
of the fluorescein-l2-UTP. by the, T7 RNA polymerase was not known, the concentration of the RNA was determined by -cneasurement of absorbance at 260 nm, not by'fluorescence intensity. Each reaction comprised 5. pmoles of the fluorescein-labeled probe (SEQ ID
NO:46) and 10 pmoles of the InvaderTM oligonucleotide (SEQ ID NO:47) in a buffer of 10 mM MOPS, pH 7.5 with 150 mM LiCI, 4 mM MnCl21 0.05% each Tween-20 and Nonidet-P40 and 39 units of RNAsin (Prornega). The amount of target RNA was varied from' 1 to 100 fmoles, as indicated below. These components were combined, overlaid with ChiliOut evaporation barrier and warmed to 50 C; the reactions were started by the addition of either :;:;53 ng of Cleavase A/G or 5 polymerase units of DNAPTth, to a final reaction volume of 10 After 30 minutes at 50 C, reactions were stopped by the addition of 8 l of 95%
formamide, 10 mM EDTA and 0.02% methyl violet. The unreacted markers in lanes I and 2 were diluted in the same total volume (18 1). The samples were heated to 90 C
for 1 minute and 2.5 1 of each. of these reactions were resolved by electrophoresis through a 20%
denaturing polyacrylamide gel (19:1 cross link) with 7M urea in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA, and the labeled reaction products were visualized using the 30 FMBIO-100 Image Analyzer (Hitachi), with the resulting imager scans shown in Fig. 43.

In Fig. 43, lanes I and 2 show 5 pmoles of uncut probe and 500 fmoles of untreated RNA, respectively. The probe is the very dark signal near the middle of the panel, while the RNA is the thin line near the top of the panel. These RNAs were transcribed with a 2% - 180 -'vVO 98/42873 PCT/US98/05809 substitution of fluorescein-12-UTP for natural UTP in the transcription reaction. The resulting transcript contains 74 U residues, which would give an average of 1.5 fluorescein labels per molecule. With one tenth the molar amount of RNA loaded in lane 2, the signal in lane 2 should be approximately one seventh (0.15X) the fluorescence intensity of the probe in lane 1. Measurements indicated that the intensity was closer to one fortieth, indicating an efficiency of label incorporation of approximately 17%. Because the RNA
concentration was verified by A260 measurement this does not alter the experimental observations below, but it should be noted that the signal from the RNA and the probes does not accurately reflect the relative amounts in the reactions.
. The reactions analyzed in lanes 3 through 7 contained 1, 5, 10, 50 and 100 fmoles of target, respectively, with cleavage of the probe accomplished by Cleavase A/G. The reactions analyzed in lanes 8 through 12 repeated the same array of target amounts, with cleavage of the probe accomplished by DNAPTth. The boxes seen surrounding the product bands show the area of the scan in which the fluorescence was measured for each -reaction.
The number of fluorescence units detected within each box is indicated below each box;
background florescence was also measured.
It canbe seen by comparing the detected fluorescence in each lane that the amount of product formed in these 30 minute reactions can be correlated to the amount of target material; The accumulation of product under these conditions is slightly enhanced when DNAPTth is used as the cleavage agent, but the correlation with the amount of target present remains. This demonstrates that the InvaderTM assay can be used as a means of measuring the amount of target RNA within a sample.
Comparison of the fluorescence intensity of the input. RNA with that of the cleaved product shows that the InvaderTM-directed cleavage-assay creates signal in excess of the amount of target, so that the signal visible as cleaved probe is far more intense than that representing the target RNA. This further confirms the results described in Example 20, in which it was demonstrated that each RNA molecule could be used many times.

W0.98/42873 PCT/US98/05805 Detection Of DNA By Charge Reversal The detection of specific targets is achieved in the InvaderTM-directed cleavage assay by the cleavage of the probe oligonucleotide. In addition to the methods described in the preceding Examples, the cleaved probe may be separated from the uncleaved probe using the charge reversal technique described below. This novel separation technique is related to the observation that positively charged adducts can affect the. electrophoretic behavior of small oligonucleotides because the charge of the adduct is significant relative to charge of the whole complex. Observations of aberrant mobility due to charged adducts have been reported in the literature, but in all cases found, the applicationspursued by other scientists have involved making oligonucleotides larger by enzymatic extension. As the negatively charged nucleotides are added on, the positive influence of the adduct is reduced to insignificance. As a result, the effects of positively charged adducts, have been dismissed and have received infmitesunal notice in the existing literature.
This observed effect is of particular utility in; assays based on the cleavageof DNA
molecules. When an oligonucleotide is shortened through the action of a Cleavase enzyme or other cleavage agent, the positive charge can be made to not only, significantly reduce the net negative charge, but to actually override it, effectively `.`flipping" the net charge . of the labeled entity. This .reversal of charge allows the products of target-specific cleavage to be _ , ..
partitioned from uncleaved probe by extremely simple meaus. For example, the products of cleavage can be made to migrate towards a, negative electrode,placed at any point in, a;
reaction vessel, for focused detection without gel-based electrophoresis.
VJhen. a slab gel is used, sample wells can be positioned in the center of the gel, so, that thecleaved and uncleaved probes can be observed to migrate in opposite directions.
Alternatively, a traditional vertical gel can be used, but with the electrodesreversed relative to usual DNA
gels (i.e., the positive electrode at the top and the negative electrode at the bottom)so that the cleaved molecules enter the gel, while the uncleaved disperse into the. upper reservoir of electrophoresis buffer.
An additional benefit of this type of readout is that the absolute nature of the partition of products from substrates means that an abundance of uncleaved probe can be supplied to drive the hybridization step of the probe-based assay, yet the unconsumed probe can be subtracted from the result to reduce background.

ll Through the use of multiple positively charged adducts, synthetic molecules can be constructed with sufficient modification that the normally negatively charged strand is made nearly neutral. When so constructed, the presence or absence of a single phosphate group can mean the difference between a net negative or a net positive charge. This observation has particular utility when one objective is to discriminate between enzymatically generated fragments of DNA, which lack a 3' phosphate, and the products of thermal degradation, which retain a 3' phosphate (and thus two additional negative charges).

a) Characterization Of The Products Of Thermal Breakage Of DNA Oligonucleotides Thermal degradation of DNA probes results in high background which can obscure signals generated by specific enzymatic cleavage, decreasing the signal-to-noise ratio. To better understand the nature of DNA thermal degradation products, the 5' tetrachloro-fluorescein (TET)-labeled oligonucleotides 78 (SEQ ID NO:48) and 79 (SEQ ID
NO:49) (100 pmole each) were incubated ~in 50 l 10 mM NaCO3 (pH 10.6), 50 m1vlr NaC1 at 90 C for 4 hours. - To prevent evaporation of the samples, the reaction mixttm-was, overlaid with 50 l of ChillOut liquid wax. The reactions were then divided in two equal -aliquots (A and B).
Aliquot A was mixed with 25 gl of methyl violet loading'buffer and Aliquot'B
was dephosphorylated by addition of 2.5 l of 100 mM MgC12 and I 1 of I unit/ l Calf Intestinal Alkaline Phosphatase (CIAP) (Promega), with incubation" at 37 C for 30 min. after which 25 gl of methyl violet loading buffer was added. One microliter of each sample was resolved by electrophoresis through a 12% polyacrylamide denaturing gel and imaged as described in Example 21; a 585 nm filter was used with the FMBIO Image Analyzer. The resulting imager scan is shown in Fig. 44.
In Fig. 44, lanes 1-3 contain the TET-labeled oligonucleotide 78 and lanes 4-6 contain the TET-labeled oligonucleotides 79. Lanes 1 and 4 contain products of reactions which were not heat treated. Lanes 2 and 5 contain products from reactions which were heat treated and lanes 3 and 6 contain products from reactions which were heat treated and subjected to phosphatase treatment.
- As shown in Fig. 44, heat treatment causes significant~breakdown of the 5'=TET-labeled DNA, geneFating a ladder of degradation products (Fig. 44, lanes 2, 3, 5and 6).
Band intensities correlate with purine and pyrimidine base positioning in the oligonucleotide sequences, indicating that backbone hydrolysis may occur through formation of abasic intermediate products that have faster rates for purines than for pyrimidines (Lindahl and Karlstrom, Biochem., 12s5151 [1973]).
Dephosphorylation decreases the mobility of all products generated by the thermal degradation process, with the most pronounced effect observed for the shorter products (Fig.
44, lanes 3 and 6). This demonstrates that thermally degraded products possess a 3' end terminal phosphoryl group which can be removed by dephosphorylation with CIAP.
Removal of the phosphoryl group decreases the overall negative charge by 2. Therefore, shorter products which have a small number of negative charges are influenced to a greater degree upon the removal of two charges. This leads to a larger mobility shift in the shorter products than that observed for the larger species.
The fact that the majority of thermally degraded DNA products contain 3' end phosphate groups and Cleavase enzyme-generated products do not allovtred the'development of simple, isolation. methods for products generated in the lnvaderTM-directed cleavage assay.
The extra two charges found in thermal breakdown products do not exist in the specific cleavage. products:., Therefore, if one-designs assays that produce specific-products'which contain a net positive: charge of one or two,< then similar thenYial=-breakdowri products` will either be negative or neutral. The difference can be used to isolate specific products by reverse charge niethods as shown >below.

b) Dephosphorylation Of Short AminaModified Oligonucleotides Can Reverse The Net Charge Of The Labeled Product To demonstrate how oligonucleotides can be transformed from net negative to net positively charged compounds, the four short amino-modified oligonucleotides labeled 70, 74, 75 and 76. and shown in Figs. 45-47 were synthesized (Fig. 45 shows both oligonucleotides 70 and 74). All four modified oligonucleotides possess Cy-3 dyes positioned at the 5'=end which individually are positively charged under reaction and isolation conditions described in this Example. Compounds 70 and 74 contain two amino modified thymidines that, under reaction conditions, display positively charged R NH3' groups attached at the C5 position through a C10 or C6 linker, respectively. Because compounds70 and 74 are 3'-end phosphorylated, they consist of four negative charges and three positive charges. -Compound 75 differs from 74 in that the intenzal C6.amino modified thymidine, phosphate in 74 is replaced by a thymidine methyl phosphonate. The phosphonate backbone is uncharged and so V~'O 98/42873 PCT/US98%05809 there are a total of three negative charges on compound 75: This gives compound 75 a net negative one charge. Compound 76 differs from 70 in that the internal amino modified thymidine is replaced by an internal cytosine phosphonate. The pK, of the N3 nitrogen of cytosine can be from 4 to 7. Thus, the net charges of this compound, can be from -1 to 0 depending on the pH of the solution. For the simplicity of analysis, each group is assigned a whole number of charges, although it is realized that, depending on the pICa of each chemical group and ambient pH, a real charge may differ from the whole number assigned.
It is assumed that this difference is not significant over the range of pHs used in the enzy'matic reactions studied here.
Dephosphorylation of these compounds, or the removal of the 3' end terminal phospharyl group, results in elimination of two negative charges and generates products that have a net positive charge of one. In this experiment, the method of isoelectric focusing (IEF) was used to demonstrate a change from one negative to one positive net charge for the described substrates during dephosphorylation.
Substrates 70, 74, 75 and 76 were synthesized by standard phosphoramidite'4 -chemistries and deprotected for 24,hours at 22 C in ~14 M aqueous anmmornutn hydr'oxide solution, after which the solvent was removed in vacuo: The dried powders were rescispended in 200 l of H20 and filtered through 0.2 m filters. The concentration of the stock solutions was estimated by UV-absorbance at 261 nm of samples diluted 200-fold in H20 using a spectrophotometer (Spectronic Genesys 2, Milton Roy, Rochester, NY).
Dephosphorylation of compounds 70 and 74, 75 and 76 was accomplished by treating 10 l of the crude stock solutions (ranging in concentration fr= approximately 0.5 to 2 mM) with 2 units of CIAP in 100 l of CIAP buffer (Promega) at 37 C for I hour:
The reaet'tons were then heated to 75 C for 15 min. in order to inactivate the CIAP. For clarity;
dephosphorylated compounds are designated 'dp'. For example, after dephosphorylation,' substrate 70 becomes 70dp.
To -prepare samples for IEF experiments, the- concentration of the stock solutions of substrate and dephosphorylated product were adjusted to a uniform absorbance of `&.5 x 10' at 532 mn by -dilution with water. Two microliters of each sample were analyzed by IEF using a PhastSystem electrophoresis unit (Pharmacia) and PhastGel IEF 3-9 media (Pharmacia) according to the manufacturer's protocol: Separation was performed at 15 C
with the following program: pre-run; 2,000 V, 2.5 mA, 3.5 W, 75 Vh; load; 200 V, 2.5 mA, 3.5 W, 15 Vh; run; 2,000 V; 2.5 mA; 3.5 W, 130 Vh. After separation, samples were visualized by using the FMBIO Image Analyzer (Hitachi) fitted with a 585 nm filter. The resulting imager scan is shown in Fig. 48.
Fig. 48 shows results of IEF separation of substrates 70, 74, 75 and 76 and their dephosphorylated products. The arrow labeled "Sample Loading Position"
indicates a loading line, the '+' sign shows the position of the positive electrode and the '-' sign indicates the position of the negative electrode.
The results shown in Fig. 48 demonstrate that substrates 70, 74, 75 and 76 migrated toward the positive electrode, while the dephosphorylated products 70dp, 74dp, 75dp and 76dp migrated toward negative electrode. The observed differences in mobility direction was in accord with predicted net charge of the substrates (minus one) and the products (plus one).
Small perturbations in the mobilities of the phosphorylated compounds indicate that the overall pls vary. This was also true for the dephosphorylated compounds. The presence of the cytosine in 76dp, for instance, moved this compound fiuther toward the negative electrode which was indicative of a higher overall pI relative to the other dephosphorylated compounds. It is important to note that additional positive charges can be obtained by using a combination of natural amino modified bases (70dp and 74dp) along with uncharged methylphosphonate bridges (products 75dp and 76dp).
The results shown above demonstrate that the removal of a single phosphate group can flip the net charge of an oligonucleotide to cause reversal in an electric field, allowing easy separation of products, and that the precise base composition of the oligonucleotides affect absolute mobility but not the charge-flipping effect.

Detection Of Specific Cleavage Products In The InvaderTM-Directed Cleavage Reaction By Charge Reversal In this Example the ability to isolate products generated in the InvaderTM-directed cleavage assay from all other nucleic acids present in the reaction cocktail was demonstrated using charge reversal. This experiment utilized the following Cy3-labeled oligonucleotide:
5'-Cy3-AminoT-AminoT-CTTTTCACCAGCGAGACGGG-3' (SEQ ID NO:50; termed "oligo 61 "). Oligo 61 was designed to release upon cleavage a net positively charged labeled product. To test whether or not a net positively charged 5'-end labeled product would be recognized by the Cleavase enzymes in the InvaderT"'-directed cleavage assay format, probe oligo 61 (SEQ ID NO:50) and invading oligonucleotide 67 (SEQ ID NO:51) were chemically synthesized on a DNA synthesizer (ABI 391) using standard phosphoramidite chemistries and reagents obtained from Glen Research (Sterling, VA).
Each assay reaction comprised 100 fmoles of M13mp18 single stranded DNA, 10 pmoles each of the probe (SEQ ID NO:50) and InvaderTM (SEQ ID NO:51) oligonucleotides, and 20 units of Cleavase A/G in a 10 1 solution of 10 mM MOPS, pH 7.4 with 100 mM
KCI. Samples were overlaid with mineral oil to prevent evaporation. The samples were brought to either 50 C, 55 C, 60 C, or 65 C and cleavage was initiated by the addition of I
l of 40 mM MnCl2. Reactions were allowed to proceed for 25 minutes and then were terminated by the addition of 10 l of 95% formamide containing 20 mM EDTA and 0.02%
methyl violet. The negative control experiment lacked the target M13mp18 and was run at 60 C. Five microliters of each reaction were loaded into separate wells of a 20% denaturing polyacrylamide gel (cross-linked 29:1) with 8 M urea in a buffer containing 45 mM Tris-Borate (pH 8.3) and 1.4 mM EDTA. An electric field of 20 watts was appliedfor ininutes, with the electrodes oriented as indicated in Fig. 49B (i.e., in reverse orientation).
The products of these reactions were visualized using the FMBIO fluorescence imager and the resulting imager scan is shown in Fig. 49B.
Fig. 49A provides a schematic illustration showing an alignment of the InvaderTM `
(SEQ ID NO:50) and probe (SEQ ID NO:51) along the target M13mp18 DNA;'only 53 bases of the M13mp18 sequence is shown (SEQ ID NO:52). The sequence of the InvaderTM
20 oligonucleotide is displayed under the M13mp18 target and an arrow is used above the M13mp18 sequence to indicate the position of the InvaderTM relative to the probe and target.
As shown in Fig. 49A, the InvaderTM and probe oligonucleotides share a 2 base region of overlap.
In Fig. 49B, lanes 1-6 contain reactions performed at 50 C, 55 C, 60 C, and 65 C, respectively; lane 5 contained the control reaction (lacking target). In Fig.
49B, the products of cleavage are seen as dark bands in the upper half of the panel; the faint lower band seen appears in proportion to the amount of primary product produced and, while not limiting the invention to a particular mechanism, may represent cleavage one nucleotide into the duplex.
The uncleaved probe does not enter the gel and is thus not visible. The control lane showed no detectable signal over background (lane 5). As expected in an invasive cleavage reaction, the rate of accumulation of specific cleavage product was temperature-dependent. Using these particular oligonucleotides and target, the fastest rate of accumulation of product was observed at 55 C (lane 2) and very little product observed at 65 C (lane 4).

. - ~ ~ , = ;.
dVO 98/42873 PCT/US98/05809 When incubated for extended periods at high temperature, DNA probes can break non-specifically (i.e., suffer thermal degradation) and the resulting fragments contribute an interfering background to the analysis. The products of such thermal breakdown are distributed from single-nucleotides up to the full length probe. In this experiment, the ability of charge based separation of cleavage products (i.e., charge reversal) would allow the sensitive separation of the specific products of target-dependent cleavage from probe fragments generated by thermal degradation was examined.
To test the sensitivity limit of this detection method, the target M13mp18 DNA
was serially diluted ten fold over than range of 1 fmole to 1 amole. The InvaderTM
and probe oligonucleotides were those described above (i.e., SEQ ID NOS:50 and 51). The invasive cleavage reactions were run as described above with the following modifications: the reactions were performed at 55 C, 250 mM or 100 mM KGIu was used in place of the 100 mM KCl and only 1 pmole of the InvaderTM oligonucleotide was added. The reactions were initiated as described above and allowed to progress for 12.5 hours. A
negative control reaction which lacked added M13m18 target DNA was also run. The reactions were terminated by the addition of 10 l of 95% formamide containing 20 mM EDTA and 0.02%
methyl violet, and 5 l of these mixtures were electrophoresed and visualized as described above. The resulting imager scan is shown in Fig. 50.
In Fig. 50, lane I contains the negative control; lanes 2-5 contain reactions performed using 100 mM KGlu; lanes 6-9 contain reactions performed using 250 mM KGIu.
The reactions resolved in lanes 2 and 6 contained 1 fmole of target DNA; those in lanes 3 and 7 contained 100 amole of target; those in lanes 4 and 8 contained 10 amole of target and those in lanes 5 and 9 contained I amole of target. The results shown in Fig. 50 demonstrate that the detection limit using charge reversal to detect the production of specific cleavage products in an invasive cleavage reaction is at or below l attomole or approximately 6.02 x 105 target molecules. No detectable signal was observed in the control lane, which indicates that non-specific hydrolysis or other breakdown products do not migrate in the same direction as enzyme-specific cleavage products. The excitation and emission maxima for Cy3 are 554 and 568, respectively, while the FMBIO Imager Analyzer excites at 532 and detects at 585.
Therefore, the limit of detection of specific cleavage products can be improved by the use of more closely matched excitation source and detection filters.

Devices And Methods For The Separation And Detection Of Charged Reaction Products This Example is directed at methods and devices for isolating and concentrating specific reaction products produced by enzymatic reactions conducted in solution whereby the reactions generate charged products from either a charge neutral substrate or a substrate bearing the opposite charge borne by the specific reaction product. The methods and devices of this Example allow isolation of, for example, the products generated by the InvaderTM-directed cleavage assay of the present invention.
The methods and devices of this Example are based on the principle that when an electric field is applied to a solution of charged molecules; the migration of the molecules toward the electrode of the opposite charge occurs very rapidly. If a matrix or other inhibitory material is introduced between the charged molecules and the electrode of opposite charge such that this rapid migration is dramatically slowed, the first molecules to- reach the matrix. will be nearly, . stopped, thus allowing the lagging molecules to catch up. In this-way a dispersedpopulation of charged molecules in solution can be effectively concentratedinto a smaller volume. By tagging the molecules with a detectable moiety(e:g., a fluorescent dye), detection is facilitated by both the.concentration and the localization of the analytes. ``Tlus Example illustrates two embodiments of devices contemplated by the present invention; of course, variations of these devices will be -apparent to those skilled in the art and are within the spirit and scope of the present invention.
Fig; 5,1 depicts one embodiment of a device for concentrating the positively-charged products generated using the methods of the present invention. As shown in :
Fig. 51; the device comprises a reaction tube (10) which contains the reaction solution (11). One end of . each. of two thin capillaries (or other tubes with a hollow core) (13A and 1311) - are submerged in, the =reaction solution (11). The capillaries (13A and 13B) may be suspended in the reaction solution (11) such that they are not in contact with the reaction tube itself; one appropriate method of suspending the capillaries is to hold them in place with clamps (not shown). Alternatively, the capillaries may be suspended in the reaction solution (11) such that they are in contact with the reaction tube itself. Suitable capillaries include glass capillary tubes commonly available from scientific supplycompanies (e.g., Fisher Scientific or VWR Scientific) or from medical supply houses that carry materials for blood drawing and analysis. Though the present invention is not limited to capillaries of any particular inner diameter, tubes with inner diameters of up to about 1/8 inch (approximately 3 mm) are particularly preferred for use with the present invention; for example, Kimble No. 73811-99 tubes (VWR Scientific) have an inner diameter of 1. 1 mm and are a suitable type of capillary tube. Although the capillaries of the device are commonly composed,of glass, any nonconductive tubular material, either rigid or flexible, that can contain either a conductive material or a trapping material is suitable for use in the present invention.
One example of a suitable flexible tube is Tygon clear plastic tubing (Part No: R3603; inner diameter = 1/16 inch; outer diameter = 1/8 inch).
As illustrated in Fig. 51, capillary 13A is connected to the positive electrode of a power supply (20) (e.g., a controllable power supply available through the laboratory suppliers listed above or through electronics supply houses like Radio Shack) and capillary 13B is connected to the negative electrode of the power supply (20).
Capiilary= 13B is filled with-a trapping material (14) capable of trapping the positively-charged reaction products by allowing minimal: migration of products that have entered the trapping material (14).: Suitable trapping materials include; but are not limited to, high percentage (e:g., about 20%) acrylamide polymerized in a~ high salt buffer (0;5 M or hi'gher, sodium acetate or siinilar salt);
such a high percentage polyacrylamide matrix dramatically siows, the migration of -the -positively-charged reaction products. Alternatively; the trapping 'matcrial may comprise a solid, negatively-charged matrix, such as negatively-charged latex beads, that can bind. the incoming positively-charged products. It should be noted that any amount of trapping material- (14) capable of inhibiting any concentrating the positively-charged -reaetion products may-be used, Thus, while the capillary 13B in Fig. 51 only contains trapping -material in the lower, submerged portion of the tube, the trapping. material (14) can be present in the entire capillary (.13B); similarly, less trapping material (14) could be present than= that shown in Fig.
51 because the positively-charged reaction products generally accumulate within a very-small portion of the bottom of the capillary (13B). The amount of trapping- material-need -only be sufficient to make contact with the reaction solution (11) and have the capacity to` collect the reaction products. When capillary 13B is not completely filled with the trapping rnaterial, the remaining space is filled with any, conductive material- (15); suitable conductive materials are discussed below.

By comparisorl, the capillary (13A).:connected to the positive electrode of thepower supply 20 may be filled with any conductive material (15; indicated by the hatched lines in Fig. 51). This may be the sample reaction buffer (e.g., 10'mM MOPS, pH 7.5 with 150 mM -190-. -~ <~ ..
WO 98/42873 PCT/[1S98105809 LiCI, 4 mM MnC1Z), a standard electrophoresis buffer (e.g., 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA), or the reaction solution.(11) itself. The conductive material (15) is frequently a liquid, but a semi-solid material (e.g., a gel) or other suitable material might be easier to use and is within the scope of the present invention. Moreover, that trapping material used in the other capillary (i.e., capillary 13B) may also be used as the conductive material: - Conversely, it should be noted that the same conductive material used in the capillary (13A) attached to the. positive electrode may also be used in capillary 13B to fill the space above the region containing the trapping material (] 4) (see Fig. 51).
The top end of each of the capillaries (13A and 13B) is connected to the appropriate electrode of the power supply (20) by electrode wire (18) or other suitable material. Fine platinum wire (e.g,, 0.1 to 0.4 mm, AesarJohnson.Matthey, Ward Hill,`MA) is commonly used as conductive wire because it does not corrode under electrophoresis conditions. The electrode wire (18): can be attached to the capillarim: (13A and :13B) by a~
nonconductive adhesive (not shown), such as the. silicone adhesives that ate commonly sold in-fiaidware stores = for sealing plumbing fixtures. .If the capillaries are constructed of - a flexible material, the electrode wire (18) can -be secured with a small "hose clamp, or constricting Mri'r'e' "(not shown) to compress the opening ofthe ,capillaries around the electrode wire:`
If the conducting material (15) is a gel, an electrode wire (18) can be embedded'directly^lin the gel within the capillary.
The cleavage reaction is assembled in the reaction- tube, (10) and allowed to proceed therein as described in proeeeding Examples (e.g., Examples 22-23). Though not limited to any paracular volume of reaction solution (11), a preferred volume is iess than 10 mi'and more preferably less than 0.1 ml. The volume need only be sufficient ito permitcontact with both capillaries. After the cleavage reaction is compieted, an eiectric` field is applied `to the capillaries by turning on the power source (20). . As a result, the positively-charged products generated in the course of the InvaderTM-directed cleavage reaction~wluch employs ai oligonucleotide, which when cleaved, generates a positively charged fragment (described in Ex. 23) but when uncleaved bears a net negative charge, migrate to the negative capillary, where their migration is slowed or:stopped by the trapping material (14); and the negatively-charged uncut and thermally degraded probe molecules migratetoward the positive electrode. Through the useof this, or -a similar device, the positively-charged products of the invasive cleavage reaction are separated from the other material (i.e., uncut and thertnally degraded probe) and concentrated from a large volume. Concentration of the product in a small amount of trapping material (14) allows for simplicity of detection, with a much higher signal-to-noise ratio than possible with detection in the original reaction volume. Because the concentrated product is labelled with a detectable moiety like a fluorescent dye, a commercially-available fluorescent plate reader (not shown) can be used to ascertain the amount of product. Suitable plate readers include both top and bottom laser readers.
Capillary 13B can be positioned with the reaction tube (10) at any desired position so as to accommodate use with either a top or a bottom plate reading device.
In the alternative embodiment of the present invention depicted in Fig: 52, the procedure described above is accomplished by utilizing only a single capillary (13B). The capillary. (13B) contains the trapping material (14) described above and is connected to an electrode wire(18), which im turn is attached to the negative electrode of a power supply (20). The reaction tube (10) has an electrode (25) embedded into its surface such thatone surface of the electrode is exposed to the interior of the reaation tube (10) and another surface is. eacposed. to the exterior ;of: the reaction tube. The surface of the electrode (25) on the exterioz, of -the reaction tube is in, contact with a conductive surfaee (26) ,corinectEd to the positive elecirode of the power supply: (20) : through an elettrode wire (18).
"Vartations of the arrangement depicted-:in Fig. 51:are also contemplated by the present irivention. 'For' example, the electro.de. (25)::may be in: contact with the reaction solution (11) throughthe use of a small hole in the reaction tube (10); furthermore, the electrode wire (18) can be -directly attached to the electrode wire (18); thereby eliminating the, conductive surface (26).
As ,irudicated in Fig. 52, ahe electrode (25) is embedded in the bottom of a reaction tube (10) such that;one, or more reaction tubes may be set on the conductive surface (26).
This conductive surface could serve as a negative - electrode for multiple reaction tubes; such a surface with appropriate contacts could be applied through the use of metal foils (e.g:; copper or platinum, Aesar;Johnson Matthey, Ward Hill, MA) in much the same way contacts are applied to circuit boards. Because such a surface contact would not be eXposed to tfie reaction sample,,directly, less expensive metals, such as the copper could be used `to make the electTical connections. =

The above devices,and methods are not limited to separation and concentration of positively; charged oligonucleotides. As will be apparent to,those skilied in the art, negatively charged reaction products: may b.e.. separated from neutral or positively charged reactants using the above device and methods with the exception that capillary 13B is`attached to the positive WO 98/42873 PCT/US98/05809 electrode of the power supply (20) and capillary 13A or alternatively, electrode 25, is attached to the negative electrode of the power supply (20).

Primer-Directed And Primer Independent Cleavage Occur At The Same Site When The Primer Extends To The 3' Side Of A Mismatched "Bubble" In The Downstream Duplex As discussed above in Exampie 1, the presence of a primer upstream of a bifurcated duplex can influence the site of cleavage, and the existence of a gap between the 3' end of the primer and the base of the duplex can cause a shift of the cleavage site up the unpaired 5' arm of the structure (see also Lyamichev et al., supra and U.S. Patent No.
5,422,253). The resulting non-invasive shift of the cleavage site in response to a primer is demonstrated in Figs. 8, 9 and 10, in which the primer used left a 4-niicleotide gap (relative ta the base of the duplex).- In Figs. 8-10, all of the "primer-directed" cleavage reactions yielded a-21 nucleotide , pro.duct, while the primer-independent cleavage reactions yielded a 25 nucleotide product.
The site of cleavage obtained when the primer was extended to the base of the duplex;', leaving no gap was examined. The-results are shown in Fig: 53% (Fig: 53 is a reproduction of Fig. 2C in Lyamichev et al. These data were derived from the cleavage of the structure shown in Fig. 5, as described in Example 1. Unless otherwise specified, the cleavage reactions comprised 0.01 pmoles of heat-denatured, end-labeled hairpin DNA
(with the unlabeled complementary strand also present); 1 pmole primer (complementary to the 3' arm shown in Fig. 5 and having the sequence: 5'-GAATTCGATTTAGGTGACAC
TATAGAATACA [SEQ ID NO:53]) and 0.5 units of DNAPTaq (estimated to ~ be 0.026 pmoles) in a total volume of 10 l :of 10:mM Tris-Cl, pH 8.5, and 1.5 mM MgC12 and50 mM KCI. The primer was omitted from the reaction shown in the first lane of Fig. 53 and included in lane 2. These reactions were incubated at 55 C for 10 minutes.
Reactions were initiated at-the final reaction temperature by the addition of either the MgCl2 or enzyme.
Reactions were stopped at their incubation temperatures by the addition of ~ 8 l of 95%
formamide with 20 mM EDTA and 0.05% marker dyes.
Fig. 53 is an autoradiogram that indicates the effects on the site of cleavage of a bifurcated duplex structure in the presence of a primer that extends to the base of the hairpin duplex:~.: The size of the released cleavage product is shown to-the left (i.e.; 25 nucleotides).

!-~

WO 98/42873 PCTlUS98105809 A dideoxynucleotide sequencing ladder of the cleavage substrate is shown on the right as a marker (lanes 3-6).
These data show that the presence of a primer that is adjacent to a downstream duplex (lane 2) produces cleavage at the same site as seen in reactions performed in the absence of the primer (lane 1). (See Figs. 8A and B, 9B and l0A for additional comparisons). When the 3' terminal nucleotides of the upstream oligonucleotide can base pair to the template strand but are. not homologous to the displaced strand in the region immediately upstream of the_ cleavage site (i.e., when the upstream oligonucleotide is opening up a"bubble" in the duplex), the site to which cleavage is apparently shifted is not wholly dependent on the presence of an upstream oligonucleotide.
As discussed above in -the Background, and in Table 1, the requirement that two independent sequences be recognized in an assay provides a highly -desirable level of specificity.. In the invasive cleaval;e reactions of the present invention, the InvaderTMand probe oligonucleotides must hybridize to -the target nucleic, acidwith the correct orientation and spacing to enable the production of the correct cleavage product. When the'distinetive patt ern of cleavage-:is not, dependent on the successful alignment of both oligonucleotides in the-detection, system these advantages of independent recognition are lost.

Invasive Cleavage And Primer-Directed Cleavage When There. Is Only Partial Homology In The "X" Overlap Region While not limiting the present invention to any particular mechanism, invasive' cleavage: occurs when the site of cleavage is shifted to a site within the duplex = formed between:ihe probe and the target nucleic acid in a manner that -is dependent on the presence of an upstr.eam oligonucleotide which -shares a region of overlap with the downstream probe oligonucleotide. In some instances, the 5' region of the downstream oligonucleotide may not be completely complementary to the target nucleic acid. In these instances, cleavage of the probe may occur at an internal site within the probe even in the absence of-an upstream oligonucleotide (in contrast to the base-by-base nibbling seen when aTully paired probe is used without an InvaderTu). Invasive cleavage is characterized by ari apparent shifting of cleavage to a site within a downstream duplex that is dependent on the -preserice of the InvaderT"' oligonucleotide.

A comparison between invasive cleavage and primer-directed cleavage may be illustrated by comparing the expected cleavage sites of a set of probe oligonucleotides having decreasing degrees of complementarity to the target strand in the 5' region of the probe (i.e., the region that overlaps with the InvaderTM). A simple test, similar to that performed on the hairpin substrate above (Ex. 25), can be performed to compare invasive cleavage with the non-invasive primer-directed cleavage described above. Such a set of test oligonucleotides is diagrammed in Fig. 54. The structures shown in Fig. 54 are grouped in pairs, labeled "a", "b", "c", and "d". Each pair has the same probe sequence- annealed to the target strand (SEQ
ID NO:54), but the, top structure of each pair is drawn without, an upstream oligonucleotide;
while.the bottom structure includes this oligonucleotide (SEQ ID NO:55). The sequences of the probes shown. in Figs. 54a-54d are l:isted. in SEQ ID NOS:32; 56, 57 and 58, respectively.
Probable sites of cleavage are indicated by the black arrowheads. (It is noted that the precise site of. cleavage on each of these structures may vary depending oii the chuice of cleavage wnt and other experimental variables. - These pardculax.:sites are provided for illustrative , .. purposes, on,ly.) To conduet this test, the site of cleavage of each probe is determined bothin' the presence and the absence of the upstream oligonucleotide, in reaction conditions such as those described in Example 18. The products of each pair of reactions are then be compared to determine whether the fragment released from the, 5' end of the probe increases in size when 20. the upstream oligonucleotide is included in the reaction:
The arrangement shown in Fig. 54a, in which the .probe molecule is completely complementary to the target strand, is similar to that shown in Fig. 28.
Treatment of the top structure with the 5' nuclease of a DNA polymerase would cause ~exonucleolytic nibbling of the probe (i.e., in the absence of the upstream oligonucleotide). In contrast, inclusion of an ,InvaderTM oligonucleotide would cause a distinctive cleavage- shift similar, to those observed inFig.- 29. .
The arrangements shown in Figs. 54b and 54c have some amount of unpaired sequence at ,the 5' .terminus of the probe ( 3 and 5 bases, respectively).
These small 5' arms are suitable cleavage, substrate for the 5' nucleases and would be cleaved within. 2 nucleotide's of the junction between the, single stranded regionand the duplex.: In these arrangements, the 3' end of the-upstream oligonucteotide shares identity with a portion of the 5' region of the probe which is complementary to the target sequence(that is the 3' end of the InvaderTM has to compete for binding to the target with a pordon of the 5' end of the probe). Therefore, when the upstream oligonucleotide is included it is thought to mediate a shift in the site of cleavage into the downstream duplex (although the present invention is not limited to any particular mechanism of action), and this would, therefore, constitute invasive cleavage. If the extreme 5' nucleotides of the unpaired region of the probe were' able 'to hybridize to the target strand, the cleavage site in the absence of the InvaderTM might change but the addition of the InvaderTM oligonucleotide would still shift the cleavage site to the proper position.
Finally, in the arrangement shown in Fig. 54d, the probe and upstream oligonucleotides share no significant regions of homology, and the presence of the upstream oligonucleotide would not compete for binding to the target with the probe.
Cleavage of the structures shown in Fig. 54d would occur at the same site with or without the upstreatm oligonucleotide, and is thus would not- constitute invasive cleavage:- - `
..; By examining any upstream oligonucleotidelprobe pair in this way, it can easily be determined whether the resulting cleavage is invasive or tnerely prinier-directed. Such analysis is particularly useful when the probe is not fully complementary to -the target nucleic acid, , so ahat the expected result : may~. not be - obvious by aimple _inspection of the sequences.
.__ .:.. . . >_,._ . . .
.: j. . . ' - ..: --.- - . . :` . -EXAMPL;E 27 Modified -Cleavase Enzymes In order to develop nucleases having useful activities for- the cleavage of nucleic acids"
the following modified nucleases were produced.

a) Cleavase BN/t6rombin Nuclease i)- , Cloning and Expression: of Cleavase8"BN/thrombin Nuclease Site directed mutagenesis was used to introduce a protein sequence recogiiized'by the protease thrombin into the region of the Cleavase BN nuclease which is thought to form the helical arch of the protein thro.ugh: which the single-stranded DNA that is cleaved must presumably pass. Mutagenesis was carried out using=the TransformerTMmutagenesis kit (Clonetech, Palo Alto, CA) according to manufacturer's protocol using the mutagenic oligonucleotide 5'-GGGAAAGTCCTCGCAGCCGCGCG GGACGAGCGTGGGGGCCCG
(SEQ, ID NO:59). After mutagenesis, -the DNA was sequenced to verify the,insertion of the thrombin -cleavage site. The DNA sequence encoding the Cleavase&BN/thrombin' nuclease is provided in SEQ ID NO:60; the amino acid sequence of Cleavase BN/thrombin nuclease is provided in SEQ ID NO:61.
A large scale preparation of the thrombin mutant (i.e., Cleavase BN/thrombin) was done using E. cQli cells overexpressing the Cleavase BN/thrombin riuclease as described in Example 28.

ii) Thrombin Cleavage of Cleavase BN/thrombin Six point four (6.4) mg of the purified Cleavase BNlthrombin nuclease was digested with 0.4 U of thrombin (Novagen) for= 4 hours at 23 C or 37 C: Complete digestion was verified by electrophoresis on a 15% SDS polyacrylamide ge1 followed by staining -with Coomassie Brilliant Blue R. Wild-type Cleavase BN nuclease was also digested with thrombin as a control. The resulting gel is shown in Fig. 61:
In Fig. 61, lane 1 contains molecular weight markers (Low-Range Protein Molecular Weight Markers; Promega), lane 2 contains undigested Cleavase BN/throbin nuclease, lanes 3 and 4 contain Cleavase4D BN/thrombin nuclease digested with thrombin at 23 C16U2 and 4 hours, respectively, and lanes 5 and 6contain CleavaseQD BN/thrombin nuclease -digdi,'Wd' with thrombin at = 37 C for 2;>and 4 hours, respectively. These xesults fshow that the CleaVase BN/thrombin nuclease has man apparent molecular weight of 36:5 ` kilodaltorls and `dembnstrate that CleavaseO.BN/thrombin nuclease is efficiently cleaved by thronmbin. In addition, the thrombin cleavage products have approximate molecular weights of 27 kilodaltons and 9 kilodaltons, the size expected based upon the position of the inserted thrombin site in the Cleavaseg BN/thrombin nuclease.
To dotermine the level of hairpin cleavage activity in' digested, and undigested Cleavase BN/thrombin nuclease, dilutions were made andused to cleave a test hairpin containing a 5' #luoroscein label. Varying amounts of digested `and undigested Cleavase BN/thrombin nuclease were incubated with 5 M oligonucleotide S-60 hairpin (SEQ ID
NO:29; see Fig. 26) in 10 mM MOPS (pH 7:5), 0.05%-Tween-20, 0:05% NP=40, and 1 mM
MnCI2 for 5 minutes at 60 C. The digested mixture was electrophoresed on a' 20%
acrylamide= gel and_visualized on a Hitachi FMBIO 100 fluoroimager. The resulting image is shown in Fig. 62.
In Fig. 62, lane-l contains the no enzyme control, lane 2 contains reaction products produced using 0.01 ng of Cleavase BN nuclease, lanes 3, 4, and 5 contain reaction products produced using 0.01 ng, 0.04 ng, and 4 ng of undigested Cleavase 'BN/thrombin nuclease, respectively, and lanes 6, 7, and 8 contain reaction products produced using 0.01 ng, 0.04 ng, and 4 ng of thrombin-digested Cleavase BN/thrombin nuclease, respectively.
The results shown in Fig. 62 demonstrated that the insertion -of the thrombin cleavage site reduced cleavage activity ~about 200-fold (relative to the activity of Cleavase BN nuclease), but that digestion with thrombin did not reduce the activity significantly.
M13 single-stranded DNA was used as a substrate for cleavage by Cleavase BN
nuclease and digested and undigested Cleavase BN/thrombin nuclease. Seventy nanograms of single-stranded M13 DNA (NEB) was incubated in 10 mM MOPS, pH 7.5, 0.05%
Tween-20, 0.05% NP-40, 1 mM MgC12 or 1 mM MnCi21 with 8 ng of Cleavase(& BN
nuclease, undigested Cleavase@ BN/thrombin nuclease, or digested Cleavase BN/thrombin nuclease for 10 minutes at 50 C. Reaction mixtures were electrophoresed on a 0.8%
agarose gel and then stained with a solution containing Ø5 g/ml ethidium bromide (EtB`r) to visualize DNA
bands. A negative image of the EtBr-stained gel is shown in Fig. 63.
In Fig 63;:iane - 1 contains =the no cnzyme control, lane 2-contains reaction-prmducts produced using CleavaseO =BN:: nualease,and:1 mlvi MgC1z, lane3 contains reactiow products produced using Cleavase , BN nuclease and 1 mM MnC12; lane 4 contains reaetioriproducts produced : using undigested Cleavase BN/thrombin nuclease and 1 mM MgC12;
lriiie A 5 contains reaction products produced using undigested CleavaseO ' BN/thrombin nuelease and I
mM MnC121 lane 6 contains reaction products produced using thrombin-digested Cleavase BN/thrombin nuclease and,1 mM MgC12, and lane 7 contains reaction products produced using thrombin-digested Cleavase BN/thrombin nuclease and ImM MnClz. The results shown in Fig. 63 demonstrated that the Cleavase BN/thrombin nuclease had an enhanced ability to cleave circular DNA (and thus a reduced requirement for the prescnce of a free 5' end) as compared to the CleavaselD.BN nuclease:
It can be seen from these data that the helical arch of these proteins can be opened without destroying the enzyme or its ability to specifically recognize cleavage structures. The Cleavase4D BN/thrombin mutant has an increased ability=to cleave without reference to a 5' end, as discussed above. The ability to cleave such structures will allow the cleavage of long molecules, such as genomic DNA that, while often not circular, may present`
many desirable cleavage sites that are at a far removed from any available 5' end. Cleavage stru+ctures may be.made at such sites either by folding of the strands (i.e., CFLP
cleavage)'or by the introduction of structure-forming oligonucleotides -(U.S. Patent No.
5,422,253). 5'~ dnds of nucleic acids can also be made unavailable because of bindirig of a substance too large to thread through the helical arch. Such binding moieties may include proteins suchas streptavidin or antibodies, or solid supports such as beads or the walls of a reaction vessel. A
cleavage enzyme with an opening in the loop of the helical arch will be able to cleave DNAs that are configured in this way, extending the number of ways in which reactions using such enzymes can be formatted.

b) Cleavase DN Nuclease i) Construction and Expression of Cleavase DN Nuclease A polymerization deficient mutant of Taq DNA polymerase, termed Cleavase DN
nuclease, was constructed. Cleavase DN nuclease contains an asparagine residue in place of the wild-type aspartic acid residue at position 785 (D785N).
DNA encoding the Cleavase DN nuclease was constructed from the geneencoding for Cleavase A/G {mutTaq, Ex. 2) . in two rounds of ~site-directed mutagenesis: First, the G
at position 1397 and the G at position 2264 of. the Cleavase A/G gene (SEQ _ ID NO2 1) were changed to A.at each position to recreate a vrild-type DNAPTaq gene: ' As a seeond round of;mutagenesis, the wild type DNAPTaq gene. was converted=to the' CleavaseWDN
gene.by changing the G. at position 2356,to A. These manipulations were performed'as follows. ; . : , .
. . .. t .. .. . . DNA encoding the CleavaseOD A/G nuclease was recloned from pTTQ18 plasri#id (Ex.

, 2) ; into the: pTrc99A plasmid (Pharmacia) in a two step procedure: ' First, the pTrc99A vector was modified by removing the G at position - 270 of ~the pTrc99A
map, creating the, pTrc99G. cloning vector. To this end, pTrc99A plasmid DNA
was cut with NcoI and the recessive 3' end&were filled-in using the Klenow fragment of E.coli `polymerase I in the presence of all four dNTPs at 37 C for 15 min. After inactivation of the Klenow fragment by incubation at 65 C for .10 min, the plasmid DNA was cut with EcoRI, the ends were again, filled-in using the Klenow fragment in the presence ofall four dNTPs at 37 C for 15 min. The- Klenow fragment was then inactivated by incubation at 65 C for 10 min. The plasmid DNA was ethanol precipitated, recircularized by ligationl~ and used to transform E.coli JM109.-cells (Promega): Plasmid DNA was isolated from single eolonies and tieletion of the G at position 270 of the pTrc99A map was confirmed by.DNA sequencing. -As a second step, DNA encoding the Cleavase A/G nuclease was removed from the pTTQ18 plasmid using EcoRl and SaII and the DNA fragment carrying the Cleavase A/G
nuclease gene was separated on a 1% agarose gel and isolated with Geneclean II
Kit (Bio 101, Vista, CA). The purified. fragment was ligated into the pTrc99G vector which had been cut with EcoRl and SalI. The ligation mixture was used to transform competent E.coli JM109 cells (Promega). Plasmid DNA was isolated from single colonies and insertion of the Cleavase@ A/G nuclease -gene.was confirmed by restriction analysis using EcoR1 and SalI.
Plasmid DNA pTrcAG carrying the Cleavase A/G nuclease gene cloned into the pTrc99A vector was purified from 200 ml of 3M109 overnight culture using QIAGEN
Plasmid Maxi kit (QIAGEN, Chatsworth,CA) according to manufacturer's protocol.
pTrcAG
plasmid DNA was mutagenized using two mutagenic primers, E465 (SEQ ID NO:62) (Integrated DNA Technologies, Iowa) and R754Q (SEQ ID NO:63) (Integrated DNA
Te.chnologies)., and the selection, primer Trans Oligo AIwNI/Spel (Clontech, Palo Alto, CA, catalog #6488-1) according, to. TransformerTM Site-Directed Mutagenesis Kit protocol (Clontech) to produce a restored wild-type. DNAPTaq gene (pTrcWT).
pTrcWT piasmid DNA carrying the wild-type DNAPTaq gene cloned into the pTrc99A veccor was purifiedfrom 200 ml of JM 109 overnight culture using =QIAGEN' Plasmid Maxi kit (QIAGEN, Chatsworth, CA) according to manufacturer's protocol:
pTrcWT was then..mulagenized using the mutagenic primer D785N3(SEQ ID NO:64) (Integrated DNA Technologies) and the selection prlmer Switch -Oligo' Spel/AlwNI (Clontech, catalog #6373-1) according to TransformerTm Site-Directed Mutagenesis Kit protocol-(Clontech) to create a plasmid containing. DNA encoding the CleavaseOD DN
nuclease. The DNA sequence encoding the CleavaseOD DN nuclease is provided in SEQ ID NO:65;
the amino ..acid sequence:; of Cleavase(ID DN nuclease is provided in SEQ ID
NO:66.
A large scale preparation of the Cleavase DN nuclease was done using E.coli cells overexpressing the.-Cleavaseg; DN nucleaseas described in Example 28.

c): Cleavase DA IVucleaseand;Cleavaseg DV Nuclease-Two polymerization, deficient mutants of Taq DNA polymerase, termed Cleavase DA nuclease and Cleavase DV nuclease, were constructed. The CleavaseO DA-nuclease contains a. alanine residue in place of the wild-type aspartic acid residue at position 610 (D785A). The Cleavase4D DV. nuclease contains: a. valine residue -in -place, of:the wild-type aspartic acid residue at position, 610 (D61OV).

i) Construction and Expression of the Cleavase DA and Cleavase DV Nucleases To construct vectors encoding the Cleavase DA and DV nucleases, the Cleavase A/G nuclease gene contained within pTrcAG was mutagenized with two mutagenic primers, R754Q (SEQ ID NO:63) and D610AV (SEQ ID NO:67) and the selection primer Trans Oligo A1wNI/Spel (Clontech, catalog #6488-1) according to the TransformerTM Site-Directed Mutagenesis Kit protocol (Clontech,) to create a plasmid containing DNA
encoding the Cleavase DA nuclease or Cleavase DV nuclease. The D610AV oligonucleotide was synthesized to have a purine, A or G, at position 10 from the 5' end of the oligonucleotide.
Following mutagenesis, plasmid DNA was isolated from single colonies and'the type of mutation present, , DA or DV,was determined by DNA sequencing. The DNA
sequence encoding the Cleavase DA nuclease is provided in SEQ ID NO:68; the amino acid sequence-of, CleavaseOD DA nuclease is provided in SEQ ID NO:69.- The DNA sequence encoding the Cleavase@ DV nuclease is provided 4n SEQ ID NO:70-; the amino acid sequence of =
Cleavase@ DV nuclease is provided in SEQ ID NO:71.
Large scale preparations of the ,Cleavase DA and Cleavase DV nubleases#awas done using E. .coli cells overexpressing the Cleavase DA nuclease or, the CleavaseO DV nuclease as described in Example 28.

Cloning. And Expression of Thermostable FEN-1 Endonucleases Sequences encoding ihermostable FEN-1 proteins derived from three Archaebacterial species were cloned and overexpressed in E. coli. This Example involved a) cloning and expression of a FEN-1 endonuclease from Methanococcus jannaschii; b) cloning and expression of a FEN-1 endonuclease from Pyrococcus furiosus; c) cloning and expression of a FEN-1 endonuclease from Pyrococcus woesei; d) cloning and expression of a' FEN-endonuclease from Archaeoglobus fulgidus; e) large scale preparation of recombinant thermostable FEN-1 proteins; and f) activity assays using FEN-1 endonucleases:' : . . . , . _ a) Cloning and Expression Of A FEN-1 Endonuclease From Methanococcus jannaschii DNA encoding the FEN-1 endonuclease from Methanococcus jannaschii (M.
jannaschii) was isolated from M. jannaschii cells and inserted into a plasmid under the transcriptional control of an inducible promoter as follows. Genomic DNA was prepared from I vial of live M. jannaschii bacteria (DSMZ, Deutsche Samrnlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany # 2661) with the DNA XTRAX kit (Gull Laboratories, Salt Lake City, UT) according to the manufacturer's protocol.
The final DNA
pellet was resuspended in 100 l of TE (10 mM Tris HCI, pH 8.0, 1 mM EDTA).
One microliter of the DNA solution was employed in a.PCR using the AdvantageT"' cDNA PCR
kii (Clonetech); the PCR was conducted aecording to manufacturer's reeommendations. The 5'-end>.primer-.(SEQ ID NO:72) iscomplementar3+ to-the 5' end of the Mja FEN-l open .. reading fratne with a one base substitution to create an Ncol restriction site (a -fragment of the M. jannaschii genome:whiQh contains the gene encoding M.jannaschii (Mja)'IFEN-I is available from GenBank as accession * U67585).-` The 3'=end primer (SEQ ID
NO:73) is ,nomplementary to a sequence about 15 -basepairs downstream from the 3' end of the Mja FEN-1x open reading frame with 2 base substitutions to create :a ScrlI
restriction enzyme site.
The sequences of the 5'-end and 3'-end primers are: 5'-GGGATACCA
TGGGAGTGCAGTTTGG-3' (SEQ ID NO:72) and 5'-GGTAAATTTITCTCGTCGA
CATCCCAC-3' (SEQ ID NO:73), respectively. The PCR reaction resulted in the amplification (i,e.,. production).of a single rnajor band about `1 kilobase in length. The open reading frame (ORF) encoding the Mja FEN-I endonuclease is provided in SEQ ID
NO:74;
the anzino-,acid: sequence. encoded by this ORF is provided in SEQ ID NO:75.
~: . i?ollowing.the. PCR amplification; the entire reaction was electrophoresed om= a 1.0%
agarose gel and the major band was excised from: the gel and purified using the Geneclean 11 kit (Bio101, Vista, CA) according to manufacturer's instructions., Approximately -1 g of the gel-purified -Mja FEN-1 PCR product was digested with NcoI and Sall. After digestion, the DNA was purified using the Geneclean II kit according to manufacturer's instructions. One microgram of the pTrc99a vector (Pharmacia) was digested with Ncol and Sall in preparation for ligation with the digested PCR product. One hundred nanograms of digested pTrc99a vector and 250 ng of digested Mja FEN-1 PCR product were combined and ligated to create pTrc99-MJFENI. pTrc99-M7FEN1 was used to transform competent E. coli JM109 cells (Promega) using standard techniques.

= ~ , ~ .

b) Cloning and Expression Of A FEN-1 Endonuclease From Pyrococcus furiosus DNA encoding the Pyrococcus furiosus (P. furiosus) FEN-1 endonuclease was obtained by PCR amplification using a plasmid containing DNA encoding the P.
furiosus (Pfu) FEN-1 endonuclease (obtained from Dr. Frank Robb, Center of Marine Biotechnology, Baltimore, MD). DNA sequences encoding a portion of the Pftt FEN-1 endonuclease can be obtained from GenBank as accession Nos. AA113505 and. W36094. The amplified Pfu FEN-1 gene was inserted into the pTrc99a expression vector (Pharmacia) to place the Pfu FEN-1 gene under the transcriptional control of the inducible tre promoter. The PCR
amplification was conducted as follows. One hundred microliter reactions contained 50 mM
Tris HCI, pH
9.0, 20 mM (NH4)ZSO4, 2 mM MgC12, 50 M dNTPs; 50 pmole each primer, I U Tfl polymerase (Epicentre Technologies, Madison, WI) and 1 ng of FEN-l gene-containing "
plasmid DNA. The 5'.-end primer (SEQ ID. NO:76) is complementary- to the 5' end of the Pfu FEN-1 open reading frame but with two substitutions to create an Ncolsi'te. and,the 3'-end primer (SEQ IDNO:77), is complementary to a region located about 30 base pairs downstream= of the FEN-1 open reading frame ,with two substitutioris to create a-PstI'site.
The sequences.of the 5'-end an.d. 3'.-end primers are: 5'-GAGGTGATACCATG
GGTGTCC-3' (SEQ ID,NO:76) and 5'-GAAACTCTGCAGCGCGTCAG-3' (SEQ ID
NO:77), respectively. The PCR reaction resulted in the amplification of a single major band about l. kilobase in length: The open reading frame (ORF) encoding the Pf u FEN- I' endonuclease is provided in SEQ ID NO:78; the amino acid sequence encoded by this ORF is provided,in SEQ ID NO;79.
Following the PCR amplification, the entire reaction was electrophoresed on a-1.0%
agarose gel and the major band was excised from the gel::and .purified using the Geneclean II
. kit (Bio 101) according to manufacturer's instructions. Approximately 1 g of gel purified Pfu FEN-1 _PCR product was digested with Ncol and PstI. After digestion, the DNA was purified using the Geneclean II kit according to manufacturer's instructions.
One microgram of the pTrc99a vector was_ digested with Ncol and Pstl prior to ligation withthe digested PCR product. One hundred nanograms of digested pTrc99a and 250 ng of digested Pfu FEN-1 PCR product were combined and ligated to create pTrc99-PFFENI. pTre99-PFFEN
1 was used to transform competent E. coli JM109 cells (Promega) using standard techniques.

= . _'. ~"~? . .

,=
c) Cloning and Expression Of A FEN-1 Endonuclease From Pyrococcus woesei For the cloning of DNA encoding the Pyrococcus woesei (Pwo) FEN-1 endonuclease, DNA was prepared from lyophilized P. woesei bacteria (DSMZ # 3773) as' described (Zwickl et al., J. Bact., 172:4329 [1990]) with several' changes. Briefly, one vial of P. woesei bacteria was rehydrated and resuspended in 0.5 ml of LB (Luria broth). The cells were centrifuged at 14,000 x g for '1 min and the cell. pellet was resuspended in 0.45 ml of TE:
Fifty microliters of 10% SDS was added and the mixture was incubated at RT for 5 min. The cell lysate was then extracted three time with-1:1 phenol:chloroform and three times virith chloroform. Five hundred microliters of isopropanol was added to the extracted lysate and- the DNA was pelleted by centrifugation- at 14,000 x g for 10 min. The DNA peliet was washed in 0.5 ml of 70% ethanol and the DNA was pelleted again by~centrifugation at 14,000 x g for '5 min.
The DNA pellet was dried and resuspended in 100 l of TE and used for PCR
reactions without,further purification.
To generate a P. woesei FEN-1 gene fragment for clonirig into an expression vector, low stringency PCR was.attempted,with primers"eomplertientary to the ends"of=theP: furiosus FEN-1 gene~open reading- frame. ~ The sequences of the 5'~=end and'3'-end primers a`re 5'-GATACCATGGGTGTCCCAATTGGTG-3"(SEQ ID N0:80) and 5'=TCGACGTCGACTTATCTCTTGAACCAACTTTCAAGGG-3' (SEQ ID NO:81)"

respectively. The high level of sequence similarity of proteiri homologs (i:
e:, profeins other than FEN-1 proteins) from P. furiosus and P. woesei suggested tltat there Was a high' -probability that the P. woesei FEN-1 gene could be amplified using primers containing sequences complementary to the P. furiosus FEN-1 gene. ~However, this' approach was unsuccessful under ' several different PCR conditions.
The- DNA sequenceof FEN-1 genes from P. furiosus and M. jannaschii were aligned and blocks of sequence identity between the two genes were identified. These blocks were used to design internal primers, (i.e., complementary to -sequences located internal to the 5' and 3' ends of the ORF) for the FEN-1 gene that are coniplementary to the P.
furiosus FEN- -1 gene in those conserved regions. " The sequences of'the 5'-=
and 3'internal primers are 5'-AGCGAGGGAGAGGCCCAAGC-3' (SEQ ID NO:82)'and 5'-GCCTATGCCCTTTATTCCTCC-3' (SEQ ID NO:83), respectively: A"'PCR`employing these internal primers was conducted using the AdvantageTM PCR kit and resulted in production of a major band of -300 bp. -...=-WO 98/42873 PCTIUS98/05809 - Since the PCR with the internal primers was successful, reactions were vtempted which contained mixtures of the internal (SEQ ID NOS:82 and 83) and external (SEQ ID
NOS:80 and 81) primers. A reaction containing the 5'-end external primer (SEQ
ID NO:80) and 3'-end internal primer (SEQ ID NO:83) resulted in the production of a 600' bp band and a reaction containing the 5'-end intemal primer (SEQ ID NO:82) and 3'-end extemal'primer (SEQ ID NO:81) resulted in the production of a 750 bp band. These overlapping DNA
fragments were gel-purified and combined with the external primers (SEQ ID
NOS:80 and 81) in a PCR reaction. This reaction generated a I kb DNA fragment containing the entire Pwo. FEN-1 gene open reading frame. The resulting PCR product` was gel=purified; digested, and ligated exactly as deseribed above for the Mja FEN-1 'gene PCR product.
The resulting plasmid was termed pTrc99-PV-FEN1. pTrc99-PWFEN1 was used to transform competent E.
coli JM109 cells (Promega) using standard techniques:

d) Cloning and Expression Of A FEN-1 Endonuclease Froin Archaeoglobus fulgidus The -preliminary Archaeoglobus fulgidus.(Afiz) chroiriosome'sequence of'2 2"
inillion bases was downloaded from the TIGR (The Institute `for Genomic'Research) world wide web site, and imported into a software program (MacDNAsis), used to analyze aad' manipulate DNA and=protein sequences. The unannotated sequence was translated into all 6 of'die possible reading frames, each comprising approximately 726,000 aniino acids:
Each frame was searched individually for the presence of the amino acid sequence ''VFDG"
(valine, phenylalanine, aspartic acid, glycine), a sequence which is conserved in the FEN-1 family.
The amino acid sequence was found in an open reading frame that' contained tither, atnino acid sequences conserved in the FEN-1 genes and which was approximately the same sizeas the other FEN-1 genes. The ORFDNA sequence is showii in-SEt2-ID,NO:164, while the ORF protein sequence is shown in SEQ ID NO:165. Based on the position of this amino' acid sequence within the reading frame, the DNA sequence encoding a putative FEN-1 gene was identified.
The sequence information was used to design:oligonucleotide primers which were used for PCR amplification of the FEN-1-like sequence from A. fiilgidus genomic DNA. Genomic DNA was prepared from A. fulgidus as described in Ex: 29a for M janaschii;' except that one vial (approximately 5 ml of culture) of live A. fulgidus ~bacteria from DSMZ
(DSMZ #4304) was used. One microliter of the genomic DNA was used for PCR reaction as described in ^^y ""~

Ex. 29a. The 5' end primer is complementary to the 5' end of the Afu FEN-1 gene except it has a I base pair substitution to create an Nco I site. The 3' end primer is complentary to the 3' end of the Afu FEN-1 gene downstream from the FEN-1 ORF except it contains a 2 base substitution to create a Sal I site. The sequences of the 5' and 3' end primers are 5'-CCGTCAACATTTACCATGGGTGCGGA-3' (SEQ ID NO:166) and 5'-CCGCCACCTCGTAGTCGACATCCTTTTCGTG (SEQ ID NO: 167), respectively.
Cloning of the resulting fragment was as described for the PfuFENI gene, above, to create the plasmid pTrc99-AFFEN 1. The pTrcAfuHis=plasmid was constructed by modifying pTrc99-AFFEN 1, by adding a histidine tail to facilitate purification. To add this histidine tail, standard PCR primer-directed mutagenesis methods were used to insert the coding sequence for six histidine residues between the last amino acid codon of the pTrc99-AFFEN 1 coding region and the stop codon. The resulting plasmid was termed pTrcAfuHis.
The protein was then expressed as described in Exampie 28(e), and purified by binding to a Ni++
affinity column, as described in Example 8::
e) ;. Large S.cale;Prepaxation of.Recombinant Thermostable FEN-1 Ptoteins The Mja, Pwo and Pfu; FEN-1 proteins were purified by the following technique which is derived from a Taq DNA polymerase preparation protocol (Engelke et al., Anal.
, Biochem., 191:396 [1990]) as follows. E. coli cells (strain JM109) containing =either, pTrc99-PFFENI, pTrc99-PWFENI, or pTrc99-MJFENI were inoculated into 3 rril-of LB
(Luria Broth) containing 100 g/m1 ampicillin and -grown for 16 hrs at 37 C: "
The '=entire overnight culture,was inoculated into 200 ml or 350 m1 of LB containing==100 g/ml~
ampicillin and grown at 37 C with vigorous shaking to an A. of 0.8. IPTG (1 ~~: M= stock solution) was added to a=final concentration of .1 mM and growth was continued for 16 hrs at 37 C.
The induced cells were pelleted and the cell pellet was weighed. An equal volume of 2X DG buffer (100 mM Tris-HCI, pH 7.6, 0.1 mM EDTA) was added and the pellet was resuspended by agitation. Fifty mg/mi lysozyme (Sigma; St. Louis, MO) was added to I

mg/mi fmal concentration and the cells were incubated at room temperature for 15 min.
Deoxycholic acid (10% solution) was added dropwise to a final concentration of 0.2 % while vortexing. =One volume of H20 and 1 volume of 2X DG buffer was added and the resulting mixture was sonicated for 2 minutes, on ice to reduce the viseosity of the mixture. After sonication. 3 M(NH4)2SO4 was added to a fmal concentration of 0.2 M and the lysate was centrifuged at 14000 x g for 20 min at 4 C. The supernatant was removed and incubated at 70 C for 60 min at which time 10% polyethylimine (PEI) was added to 0.25%.
After incubation on ice for 30 min., the mixture was centrifuged at 14,000 x g- for 20 niiri at 4 C.
At this point, the supernatant was removed and the FEN-1 proteins was precipitated by the addition of (NH4)ZSO4 as follows.
For the Pwo and the Pfu FEN-1 preparations, the FEN-1 protein was precipitated by the addition of 2 volumes of 3 M (NH4)2S04. The mixture was incubated overnight at room temperature for 16 hrs and the protein was centrifuged at 14,000 x g for 20 min at 4 C. The protein pellet was resuspended in 0.5 ml of Q buffer (50 mM Tris-HCI, pH 8.0;
0.1 mM
EDTA, 0.1% Tween 20). For the Mja FEN-.1 preparation, solid (NH;)ZSO4 was added to a final concentration of 3. M(-75%o saturated), the mixture was incubated on ice for 30 min, and the protein was spun down and resuspended as described above. ~
The resuspended protein preparations were quantitated by determination of the A, and aliquots containing 2-4 g of total protein were electrophoresed on a 10 %
SDS
polyacrylamide gel,(29:1 acrylatnide: -bis-acrylamide) in standard`L.aenimli buffers fL='aenmmli, Nature 277:680 [1970]) and stained with Coornassie Brilliant; Blue. R; _rthe results are, shown in 64: . . . _~ , ...
Fig , In Fig. 64, lane 1 contains molecular weight markers (Mid-Range Protein Molecular Weight Markers; Promega); the size of the marker proteins is indicated to the left of the gel.
Lane 2 contains purified Cleavase BN nuclease; lanes 3-5 contain extracts prepared from E.
coli expressing the Pfu, Pwo and Mja FEN-1 nucleases,. respectively. The calculated (i.e., using a translation of the DNA sequence encoding the nuclease) molecular weight of the Pfu FEN-1 nuclease is 38,714 daltons and the calculated molecular weight`for the Mja FEN-1 nuclease is 37,503 Daltons. The Pwo and Pfu FEN-1 proteins co-migrated onthe SDS-PAGE gel and therefore, the molecular weight of the Pwo FEN-1 'nuclease was estimated to be 38.7 kDa.

f) Activity Assays Using FEN-1 Endonucleases . i) Mixed Hairpin Assay The Cleavase BN nuclease has an approximately 60-fold greater affinity for a base pair stem-loop structure than an 8 base pair stem-loop DNA structure. As a test for activity differences between the Cleavase BN nuclease and the FEN-1 I
nucleases, a mixture of oligonucleotides having either a 8 or a 12 bp stem-loop (see Fig. 60 which depicts the S-33 and 11-8-0 oligonucleotides) was incubated with an extract prepared from E.
coli cells overexpressing the Mja FEN-1 nuclease (prepared as described above). Reactions contained Ø05 M of oligonucleotides S-33 (SEQ ID NO:84) and 11-8-0 (SEQ ID NO:85) (both oligonucleotides contained 5'-fluorescein labels); 10 mM MOPS, pH 7.5, 0.05%
Tween-20, 0.05% NP-40, 1 mM MnCI,. Reactions were heated to 90 C for 10 seconds, cooled to 55 C, then I l of crude extract (Mja FEN-1) or purified enzyme (Cleavase BN
nuclease) was added and the mixtures were incubated at 55 C for 10 minutes; a no enzyme control was also run. The reactions were stopped by the addition of formamide/EDTA, the samples were electrophoresed on a denaturing 20% acrylamide gel and visualized on a Hitachi fluoroimager. The resulting image is shown in Fig. 65.
In Fig. 65, lane I contains the reaction products generated by the Cleavase BN
nuclease, lane 2 contains the reaction products from the no enzyme control reaction and lane 3 contains the-reaction products generated by the Mja FEN=1-nuclease: The data shown in Fig. 76 detnonstrates that the Cleavase BN nuclease strongly prefers the S33 structure (12 bp-stem-l op) 4hile the:Mja FEN-i nuclease cleaves strtictures having either an 8 or a 12 bp stem-loop with approximately the same :efficiency. This shows that the Mja FEN=1 ' nuclease has a different substrate specificity than the Cleavase BN nuclease, a useful feature for I.nvaderTM assays or CFLP analysis as discussed in the Description of the Invention.

Terminal Deoxynucleotidyl Transferase Selectively Extends The Products Of InvaderTM-Directed Cleavage The: majority of thermal degradation products of DNA probes will -have a phosphate at the 3'-end. To investigate if the template-independent DNA polymerase, terminal deoxynucleotide transferase (TdT) can tail or polymerize the aforementioned 3'.-end phosphates (i.e., add nucleotide triphosphates to the 3' end) the following experiment was performed. To create a sample containing a large percentage of therinal degradation products, the 5' fluorescein-labelled oligonucleotide 34-078-01 (SEQ ID NO:86) (200 pmole) was incubated in 100 l 10 mM NaCO3 (pH 10.6), 50 mM NaCI at 95 C for 13 hours. To prevent evaporation, the reaction mixture was overlaid with 60 l ChillOutTM
14 liquid wax.
The reaction mixture was then divided into two equal aliquots (A and B).
Aliquot A was mixed with one-tenth volume 3M NaOAc followed by three volumes ethanol and stored at -20 C. Aliquot B was dephosphorylated by the addition of 0.5 41 of 1 M MgC12 and I l of lunit/ l Calf Intestine Alkaline Phosphatase (CIAP) (Promega), with incubation at 37 C for 30 minutes. An equal volume of phenol:chloroform: isomayl alcohol (24:24: P) was added to the sample followed by vortexing for one minute and then centrifugation 5 minutes at maximum speed in a microcentrifitge to separate the phases. The aqueous phase was removed to a new tube, to which one-tenth volume 3M NaOAc, and three volumes ethanol was added followed by storage at -20 C for 30 minutes. Both aliquots (A and B) were then centrifuged for 10 minutes at maximum speed in a microcentrifuge to pellet the DNA. The pellets were then washed two times each with 80% ethanol and then desiccated to dryness.
The dried pellets were then dissolved in 70: l ddHZO each.
The TdT, reactions were conducted as follows. Six mixes were assembled, all mixes contained.10 :mM TrisOAc (pH 7.5), 10 mM MgOAc,- 50 mM KCI, and 2 mM dATP.
Mixes .1: and 2 contained one pmole ef, untreated 34-078-01 (SEQ. ID -N0:86); mixes 3- and 4 contained .2 g1 of aliquot A (above), mixes 5 and 6 contained 2 l of`aliquot B, (above). To each 9 l of-mixes 1;3: and 5,~ 1~ l- ddH2O was added, to each 9, l of mixes 2 4;~and'6, I g1 of 20 units/ l; TdT (Promega) was added. The mixes were incuhated at 37 C
for=1 hour and then the r.e,action:9vas terminated by the addition of 5 l 95% formamide with I0 mM "EDTA
and 0.05% marker dyes. Five microliters of each mixture was resolved by electrophoresis through a 20% denaturing acrylamide gel (19:1 cross-linked) with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 8.3), 1.4 mM EDTA, and imaged using with the FMBIO
image Analyzer with a 505 nm -filter. The resulting imager scari is shown in Fig. 66.
In.Fig. 66,1anes1, 3 and 5 contain untreated 34-078-01>(SEQ ID NO:86), heat-degraded 34,078-01, and heat-degraded, 'dephosphorylated; 34-078-01 ;
respectively .25 incubated in the.absence of TdT. Lanes 2, 4. and 6 contain, untreated 34-078-01, heat-degraded 34-078-01, and heat-degraded, dephosphorylated, 34-078-01, respectively incubated in the presence of TdT.
As shown in Fig. 66, lane 4, TdT was unable to extend thermal degradation products which contain a Y-end phosphate group, and selectively >extends molecules which have a 3'-end hydrotcyl =group.

.---. -~ ,~

Specific TdT Tailing Of The Products Of InvaderTM-Directed Cleavage With Subsequent Capture And Detection On Nitrocellulose Supports When TdT.. is,used to extend the specific products of cleavage, one means; of detecting the tailed products is, to selectively capture the extension products on a solid support before visualization.. This Example demonstrates that the cleavage products can be selectively tailed by the use of TdT and deo:xynucleotide triphosphates, and that the tailed products can be visualized by capture using a complementary oligonucleotide bound to a nitrocellulose support.
To extend the cleavage-product produced in an InvaderTM-directed cleavage-reaction, the following experiment was performed. Three reaction: mixtures were assembled, each in a buffer of 10 mM MES (pH . 6.5), 0.5%Tween-20, 0:5% o NP-40. The . first mixture contained 5"
fmols of target DNA-M13mp18, 10 pmols, of probe oligo 32-161-2.(SEQ ID NO:87;
this probe oligonucleotidet contains 3' ddC and a Cy3 a;nidite :group near the=3' end), and 5 pmols of InvaderTM, oligonucleotide, 32.. :161-1 (SEQ ID NO:88; this oligo contains a3' =ddC). The second mixture contained-the-probe, and 4nvaderM. oligonucleotides, without target DNA.
The_third,mixture,was_the:sam.e::as the first mixture, and contained the sameprobe sequence, but.with a.5' -fluorescein label .(oligo 32461-4 [SEQ ID:NO:89;A:this oligoo contains a>3': ddC, .S' fl.uorescein-label,.,and a,,Cy3.dye group near the 3'-end]), so that the-lnvaderT!"-directed cleavage products. eould,b.e detected before and after, cleavage by fluorescence imaging.- The probe.anly control sample, contained 10 pmols of oligo 32-161-2 (SEQ ID
NO:87). . Each 3 l of;enzyme mix contained 5:.ng of Cleavase DN nuclease in 7.5 mM MgC12.. .
The TdT
mixture (per each 4 1) contained; IOU of TdT (Promega), 1 mM CoC12; 50 mM
KCI, and 100. lvl of dTTP: The Invaderm cieavage reaction mixtures described above-were assembled in thin wall tubes, and the reactions were,initiated by the addition of 3. l of CleavaseOD DN
enzyme mix. The reactions were incubated at 65 C for 20 min. After cooling to 37 C; 4 l of the TdT mix was added and the samples were incubated for 4 min at 37 C, .
Biotin-16-dUTP was then added to 100 1VI and the samples were incubated for 50 min at 37 .C. . The reactions were terminated by= the addition of 1 1 of 0.5 M EDTA.
- To test the efficiency of tailing the products were run on an acrylamide gel. Four microliters of each reaction mixture was mixed with 2.6 l of 95% formamide, 10 mM
EDTA and 0.05% methyl violet and heated to 90 C for I min, and 3 1 were loaded on a 20% denaturing acrylamide gel (19:1 cross-linked ) with 7 M urea, in buffer containing 45 ~ -~ -mM Tris-Borate (pH 8.3), 1.4 mM EDTA. A marker ((DX174-Hinfi [fluorescein labeled]) also was loaded. After electrophoresis, the gel was analyzed using a FMBIO-100 Image Analyzer (Hitachi) equipped with a 505 nm filter. The resulting scan is shown in Fig. 67.
In Fig. 67, lane 1 contained the probe 32=161-2 only, without any treatment.
Lanes 2 and 3 contained the products of reactions run without target DNA, without or with subsequent TdT tailing, respectively. Lanes 4 and 5 contained the products of reactions run with target DNA, probe oligo 32-161-2 (SEQ ID NO:87) and InvaderTm oligo 32-161-1 (SEQ ID
NO:88), without or with subsequent TdT tailing, respectively. Lanes 6 and 7 show the products of reactions containing target DNA, probe oligo 32-161-4 (SEQ ID
NO:89) and InvaderT"I oligo 32-161-1 (SEQ ID NO:88), without or with subsequent TdT
tailing, respectively. Lane M contains the marker (DX174-Hinfi. -The reaction products in lanes 4 and 5 are the same as those seen in lanes 6 and 7, except that the absence of a 5' fluorescein on the probe prevents detection of the relased 5' product (indicated as "A" near the bottom of the gel) or the TdT extended 5' product' (indicated as "B", near the top of the gel). The Cy3-labeled 3' portion-of the cleaved probe is visible in all of these reactions (indicated as "C'"; just below the center of-the To demonstrate detection of target-dependent InvaderTM-directed cleeLvage products on a solid support, the reactions from Ianes 3 and 5 were tested on the Universal Geneconib (Bio-Rad) -which is a standard nitrocellulose matrix on a rigid nylon backing styled in a comb format, as depicted in Fig. 68. Following the manufacturer's protocol, with one -modification: `
10 l of the InvaderT*''-directed cleavage reactions were used instead the recommended` 10%
of a PCR. To capture the cleavage products, 2.5 pmols of the capture oligo 59-28-1 (SEQ ID
NO:90) were spotted on each tooth. The capturc and visualization -steps were conducted according to the manufacturer's directions. The results are shown in Fig. 68.
' . .In Fig. 68, teeth numbered 6 and 7 show the capture results of reactions performed without and with target DNA present. Tooth 8 shows the kit positive control.
The darkness of the spot seen on tooth 7, when compared to tooth 6, clearly indicates that products of InvaderTM-directed cleavage assays may be specifically detected on solid supports. While the Universal Genecomb was used to demonstrate solid support -capture in this instance, other support capture methods known to those skilled in the art would be equally. suitable. For example, beads or the surfaces of reaction vessels may easily be coated with capture oligonucleotides so that-they can then be used in this step.
Alternatively, similar solid supports may easily be coated with streptavidin or antibodies for the capture of biotin-WO 98/42873 PCT%1J998/05809 or hapten-tagged.products of the cleavage/tailing reaction. In any of these embodiments, the products may be appropriately visualized by detecting the resulting fluorescence, chemiluminescence, colorimetric changes, radioactive emissions, optical density change or any other distinguishable feature of the product.

Comparison Of The Effects Of Invasion Length and 5' Label Of The Probe On InvaderTM-Directed Cleavage By The Cleavase A/G and Pfu FEN-1 Nucleases To investigate the effect of the length of invasion as well as the effect of the type of dye on ability of Pfu FEN- I and the Cleavase A/G nuclease to cleave 5' arms, the following experiment was performed. - Three probes of similar sequences labeled with either fluorescein, TET, or Cy3, were assembled in reactions with three InvaderTM
oligonucleotides which created overlapping target hybridization regions -of eight, `five, and three bases along the target nucleic ,acid, M13mpl8.
The reactions were conducted as follows. All conditions were performed in duplicate.
Enzyme mixes for Pfu: FEN-1 and the CleavaseID A/G nuclease were assemb1ed- ' Each 2 l of>the:Pfu .FEN-1 >mix contained 100-ng of Pfu FEN-1 (prepared as describedin Ex. 28) and 7.5 mM MgCIZ. ; Each 2 l of the CleavaseO A/G tnix contained 5.3 ng of the Cleavase A/G nuclease and 4.0 mM MnCIZ: Six master mixes containing buffer, M13inp18, 'and InvaderTM oligonucleotides were assembled. Each 7 i of mixes 1-3 contained 1 finol -M13mp18, 10 pmoles InvaderTM oligonucleotide:(34-078-4 [SEQ ID NO:39], 24-181-2 [SEQ
ID..NO:91], or 24-181-1 [SEQ ID NO:92], in 10 mM MOPS (pH 7:5), 150 mM LiCI.
Each 7 l, of mixes 4-6 contained 1 fmol of 1vI13mp18, 10 pmoles of InvaderTM
oligonucleotide [34-078-4 (SEQ ID NO:39), 24-181-2 (SEQ ID NO:91), or 24-181-1 (SEp,ID NO:92)]
in 10 mM Tris (pH 8.0). Mixtures 1-6 were then divided into three mixtures each, to which was added either the fluorescein-labeled probe (oligo 34-078-01; SEQ ID NO:86), the Cy3=labeled probe (oligo 43-20; SEQ ID NO:93) or the TET-labeled probe (oligo 90; SEQ ID
NO:32 containing; a 5' TET label). Each 7 l of all mixtures contained 10 pmoles of corresponding probe. The DNA solutions described above were covered-with 10 l of ChillOuAV
evaporation barrier and brought to 68 C:
The reactions made from mixes 1-3 -were started with 2 l of the Cleavase -nuclease mix, and the reactions made from mixes 4-6 were started with 2 1 of the Pfu FEN-1 mix. After 30 minutes at 68 C, the reactions were terminated by the addition of 8 l of _~ ---i WO 98l42873 PCT/1JS98l05809 95% formamide with 10 mM EDTA and 0.05% marker dyes. Samples were heated to 90 C
for 1 minute immediately before electrophoresis through a 20% denaturing acrylamide gel (19:1 cross-linked) : with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 8.3), 1.4 mM EDTA. The products of the cleavage reactions were visualized following electrophoresis by the use of a Hitachi FMBIO fluorescence imager. Results from the fluorescein-labeled probe are shown in Fig. 69, results from the Cy3-labeled probe in Fig. 70, and results from the TET-labeled probe in Fig. 71. In each of these Figures, the products of cleavage by CleavaseV A/G are shown in lanes 1-6 and the products of cleavage by PfuFEN-1 are shown in lanes 7-12. In each.in case the uncut material appears as a very darkband near the top of the gel, indicated by a "U" on the left. The products of-cleavage directed by InvaderTM
oligonucleotides. with 8, 5 or 3 bases of overlap (i.e., -the "X" region was 8, .5, or 3 nt long) are shown in ;the first, second and third pair of lanes- in each set;
respectively and the released' labeled 5'. ends from these reactions are indicated by the numbers 8, 5, and 3 on the left.
Note that in the cleavage reactions shown in Fig. 70 the presence of the positively, charged Cy3 dye causesthe shorter, products tomigrate more slowly than the largei='products .~ These products. do not contain any additional positive charges (e:g:, amino modifieation as''used in Example. 23), and. thus still car .ry< &net, negative char.ge,>:and-rnigrate towards tlie-positive electrode in a standard electrophoresis run:
It.can be seen fromthese data that the Cleavase@ A/G and Pfa -FEN-1 structure-specific nucleases respond differently to both dye. identit:y: and to the size : of the piece to be cleaved from the probe. The Pfu FEN-1 nuclease showedmuch less variability in response to dye identity than;did the CleavaseO A/G nuclease; showing that any dye wold be suitable for use with this enzyme. In contrast, the.amount- of cleavage_ catalyzei by -the Cleavase A/G
nuclease. varied substantially, with dye identity: :-: Use of 'the..
fluorescein dye gave results very . close to those -seen with the Pfu FEN-l nuclease; ~- while the use: of either Cy3 or TET gave dramatically, reduc,ed signal when compared to the Pfu FEN-1: reactions. The one exception.
,to this was in the.cleavage of the 3 nt product carrying.a.TET dye (lanes 5 and 6, Fig. 71), in which the Cleavase A/G nuclease gave cleavage at the same;rate as the Pfu FEN-1; nuclease.
These-data indicate that; while CleavaseOD A!G-:m ay be used to cleave probes labeled= with these other dyes, the Pfu FEN-1 nuclease is a preferred- nuclease for cleavage of Cy3-and TET-labeled probes.

EXAMPLE` 32 Examination Of The Effects Of A 5' Positive Charge On The Rate Of Invasive Cleavage Using The Cleavase A/G Or Pfu FEN-1 Nucleases-To investigate whether the positive charges on 5' end of probe oligonucleotides containing a positively charged= adduct(s) (i.e., charge reversal technology or CRT probes as described in Ex. 23 and 24 have an effect on the ability of the Cleavase(O A/G
or Pfu FEN-1 nucleases to cleave the 5' arm of=the probe, the following experiment wasperformed: Two probe oligonucleotides having the following sequences were utilized inIrivaderTM

reactions: Probe 34-180-1: (N-Cy3)Tr,u2T,H2CCAGAGCCTAATTTGCC
AGT(N-fluorescein)A, where N represents a spacer- containing either the Cy3 oi fluorescein group (SEQ ID NO:94) and Probe 34-180-2: 5'-(N=TET)TTCCAGAGCC
TAATTTGCCAGT-(N-fluorescein)A, where N, represents a, spacer contairiing either the TET
or, fluorescein group (SEQ ID NO:95). Probe 34-180-1 has ainino-modifiers on the two 5' end T residues and a Cy3 label on the 5' end, creating extra positive charges'on the 5' end.
1.5_ Prob.e.34-180-2 has a TET label on~the5' end, with noextrapositive 6harges: The' ' #luorescein label on the 3' end. of probe 344-80=1 enables'the'visualization of ttie 3' -cleaved products.anduncieaved probes together on an aerylamid& gel run in'ttie standard direetion (i.e., with the DNA migrating toward the positive electrode) The 5',=clcaved productof probe;34-180-1:has a net positive.eharge and will not miigrate-in the same`direction as the uncleaved probe,. and is=thus visualized by resolution on a gel run,in the opposite direction (i.e.;. with this DNA migrating toward. the negative electrode):
= The cleavage: reactions were conducted as follows. All conditions were performed in duplicate. Enzynte mixes for the Pfu FEN-1 and-Cleavaseg A/G nucleases were assembled.
Each 2gl of the -Pf u.-:FEN-1 nwc contamed 100 ng of Pfiz FEN-1 `(prepared as described in Ex. 28) and 7.5 mM MgC12: Each 2 l:c-f the Cleavaseg A/G nucleawmix contained 26.5 ng .of Cleavaseg A/G nuclease and 4.0 mM MnC12: Four master mixes containing buffer, M13cnp18, and InvaderTM oligonucleotides were assembled. Each 7 l of mix 1 contained 5 fmol_Ml3rnp18, 10.pmoles InvaderTM oligonucleotide 123 (SEQ ID NO:96) in 10 mM
HEPES (pH 7.2).. Each 7 l of mix.2 contained m1=fmo1 M13mp18, TO pmoles`
InvaderTM
oligonucleotide 123 in 10 mM- HEPES (pH 7.2). - Each 7 l of iriix 3 contained '5 fiii61 M13mp18, 10 pmoles InvaderTM oligonucleotide 123 in 10 mM HEPES (pH 7.2), 250' mM
KGIu. Each 7 1 of mix 4 contained I fmol M13mp18, 10 pmoles InvaderTM
oligonucleotide 123 in 10 mM HEPES (pH 7.2), 250 mM KGIu. For every 7" l of each mix, 10 pmoles of .v O 98/42873 PCT/US98/058.09 either probe 34-180-1 (SEQ ID NO:94) or probe 34-180-2 (SEQ IDNO:95) was added. The DNA solutions described above were covered with 10 l of ChillOut evaporation barrier and brought to 65 C. The reactions made from mixes 1-2 were started by the addition of 2 l of the Pfu FEN-1 mix, and the reactions made from,mixes 3.-4 were started by the addition of 2 1 of the CleavaseO A/G nuclease mix. After 30 minutes at;65 C, the reactions were terminated by the addition of 8 l of 95% formamide containing.10 mM EDTA.
Samples were heated to 90 C for 1 minute immediately before electrophoresis through a 20%
denaturing acrylamide gel (19:1 cross-linked) with,7 M urea, in a buffer;
containing 45 mM
Tris-Borate (pH 8.3), 1.4 mM EDTA and a 20% native acrylamide gel (29:1 cross-linked) in a buffer containing 45 mM Tris-Borate (pH 8.3),. 1.4 mM, EDTA.
The products of the cleavage reactions were visualized following electrophoresis by the use of a Hitachi.FMBIO fluorescence imager. The resulting iinages. are shown in Fig. 72. =
Fig. 72Aõ shows the _ denaturing: gel which was run in the standard electrophor.esis ; direction, and Fig. ,72B sho.ws the,native gel which was runq in, the reverse;dire.ction.::: The-.r.eaction products produced,, by Pfu FEN-1 and, Cleavaseg A/G nucleases are,=,shown : in lanes 1-:8 -and 9-16, res .p.ectively. . The p.roducts from the 5, &no1,M13mp1$ and ;~ ;fmot.
M1;3mpl~reactions are shown in lanes: I 4, .9-12.:(5, finol) and 5-8, 13-16,;(1 frnol), :
P,;obe;34-1$Ol ,isJnaaties 1-2, 5-6, .9-10, .13-14. and, probe. 34-180-2 is. in lanes 3-4,.: 7-8, .1;1 12,:;.1,5 .16 ;_ The fluorescein-labeled 3' end fragments from all cleavage :reactions are:=shQwm in Fig.
. 72A, indicated by a"3"' mark at the left. The 3 nt 5' TET-labeled proeiucts are,not,visible in'.
this Figure, while: the 5' ,Cy3-iabeled products are shown in -Fig. 72B..
The 3'. end, bands in. Fig. 72A can be. used, to compare.the rates..of cleavage by the different. enzymes, in the presence of the different 5' end labels. It; can :be seen _from :this band that regardless ofthe am.ount of target nucleicacid,present,,botix _the Pfu FEN-;1 and the . Cleavase A/G.nucleases. show more product frorn the; 5': TET-1.abeled ,;probe. ..; With: the Pfu FEN-1nuclease this . preference is modest, with only an approximately 25.: to :40 ~0 ~ increase in signal. In the .case of the Cleavase A/G nuclease, however; there is a strong preference for the 5' TET label. Therefore, although when the charge.reversal ;method . is used to resolve the products, a, substantial amount of product is observed from theCleavaseWA/G
nuclease-catalyzed reactions, the;Pfu FEN-1 nuclease is apreferred enzyme for eleavage,:of. Cy.3-labeled,.probes.
, _ .

--~ -' ~
.. ` ~

The Use Of Universal Bases In The Detection Of Mismatches By InvaderTM Directed Cleavage The term "degenerate base" refers to a base on a nucleotide that does not hydrogen bond in a standard "Watson-Crick" fashion to a specific base complement (i.e., A to T and G
to C). For example, the inosine base can be made to pair via one or two hydrogen bonds to all of the natural bases (the "wobble" effect) and thus is called degenerate.
Alternatively, a degenerate base may not pair at all; this type of base has beenreferred to as a universal"
base because it can be -placed opposite any nucleotide in a duplex and, white it cannot i 0 contribute stability by base-pairing, it does not actively destabilize by crowding the opposite base. Duplexes using these universal bases are stabilized by stacking -interactions only. Two examples of universal bases, 3-nitropyrrole and 5-nitroindole, are shown in Fig. -73. In hybridization, placement of a 3-nitropyrrole three bases from a mismatch position enhances the.differential recognition of'one base mistnatches: The enhanced discrimination `seems to come from the destabilizing effect `of the unnatural base '(i. e., an altered T. in close proximity :::. . .
to the: mistriatch): 'fo,test this sanie principle as a way "of sensitively detect'tiig mismatches <.::using the InvaderT4-directed cleavage assay; lnvaderTM oligonucleotides were designed using the universal=bases'shown in Fig: 73;in the presence or'absence of a natural mismatch: In these ,experlments; =the use of single nitropynrole bases or paiisof nitroindole bases that flank - . . :.
the. site of the mismatch were examined.
The target, probe and InvaderTM oligonucleotides used in these assays are shown in Fig. 74. A 43 nueleotide oligonucleotide (oligo 109; SEQ ID N0:97) was used as the target.
The probe oligonucleotide (oligo 61; SEQ ID NO:50) releases a net 'positively charged -labeled =product upon cleavage. In Fig. -74, the InvaderTu oligonucleotide is`shown - schematically above the target oligonucleotide as an ar'row; the farge arrowhead indicates the location of themismatch =betwem the InvaderTM oligos and the target. Under the target oligonucleotide, the completely complementary, all natural (i.e., no universal ' bases) InvaderTM
oligo (oligo 67; SEQ ID NO:51) and a composite of InvaderTM oligos containing uni`versal bases ("X") on either side of the mismatch ("M") are shown. 'The folIovving'invaderTm oligos were employed: oligo 1.14'(SEQ ID NO:98) which contains a-single-nt mismatch;
oligo 115' .(SEQ ID NO:99) which contains two 5-nitroindole bases and no mismatch; oligo 116 (SEQ

ID NO:100) which contains two 5-nitroindole bases a nd a single nt mismatch;
oligo 112 (SEQ ID NO:101) which containsone 3-nitropyrrole base and no mismatch; oligo 113 (SEQ

WO 98/42873 PCT/US98/05809' ID NO:102) which contains one 5-nitropyrrole base and a single nt mismatch;
and oligo 67 (SEQ ID NO:51) which is completely complementary to the target.
The InvaderTm-directed cleavage reactions were carried out in 10 l of 10 mM
MOPS
(pH 7.2), 100 mM KCI, containing 1 M of the appropriate invading oligonucleotide (oligos 67, 112-116), 10 nM synthetic target 109, 1 M Cy-3 labeled probe 61 and 2,units of Cleavase DV (prepared as described in Ex. 27). The reactions were overlayed with Chill-Out liquid wax; brought to the appropriate reaction temperature, 52 C, 55 C, or 58 C and initiated with the addition of I 1 of 40 mM MnC12. Reactions were allowed to proceed for 1 hour and were stopped by the addition of 10 l formamide. One fourth of the total volume of each reaction was loaded onto 20% non-denaturing polyacrylamide gels which were electrophoresed in the reverse direction. The products were visualized - using an Hitachi FMBIO-100 fluorescent scanner, using a 585 nm filter. The resulting images are shown in Figs. 75A-C. In each panel, lanes 1-6 contain reactions Products from reactions using InvaderTu oligo 67, 114, 115, 116, 112 and 113, respectively: Reactions run at-S2 C,' `55 C
and 58 C are shown in Panels A, B and C, respectively.
....
These data show that two flanking 5-nitroindoles display a significantly greater differentiation then does the one 3-nitropyrrole system,- o'r the all natural base - hybridization, and,thisincreased sensitivity is not temperature dependent.~ This demonstrates ttiat the use of universal bases is a useful means of sensitively detecting single base mismatches-between the target nucleic acid and the complex of detection oligonucleotides of the present invention.

Detection Of Point Mutations in The Human Ras Oncogene Using A Miniprobe It is demonstrated herein that very short probes can be used for seinsitive detection of : target nucleic acid sequences (Ex. 37). In this Example, it is demonstrated that the short probes work very poorly when mismatched to the target, and thus can be used to distinguish a given nucleic acid-sequence from a close relative with only a single base difference.` To test this system synthetic human ras oncogene target sequences were created that varied from each other at one position. Oligonucleotide 166'(SEQ ID NO:103) provided the wild=typeAras target sequence. Oligonucleotide 165 (SEQ ID NO: 104) provided the mutant ras target sequence. The sequence of these oligonucleotides are shown in Fig. 76, and the site of the sequence variation in the site corresponding to codon 13 of the ras gene is indicated. The InvaderTM oligonucleotide (oligo 162) has the sequence:

~ 4~ =' .

5'-GSCSTSCSAsASGSGsCSACTCTTGCC TACGA-3' (SEQ ID NO: 105), where the "S"
indicates thiol linkages (i.e., these are 2'-deox}mucleotide-5'-O-(1-thiomonophates)). The miniprobe (oligo 161) has the sequence: 5'-(N-Cy3) TNH2TmUCACCAG-3' (SEQ ID
NO:106) and is designed to detect the mutant ras target sequence (i.e., it is completely complementary to oligo 165). The stacker oligonucleotide (oligo 164) has the sequence: 5'-CSTsCSCsASASCs TSASCCACAAGTTTATATTCAG-3' (SEQ ID NO:107). A schematic showing the assembly of these oligonucleotides into a cleavage structure is depicted in. Fig. 76.
Each cleavage reaction contained 100 nM of both the invading (oligo 162) and stacking (oligo 164) oligonucleotides, 10 M Cy3-labeled probe (oligo 161) and 100 pM of either oligo 165 or oligo 166 (target DNA) in 10% l of 10 mM. HEPES (pH 7.2), 250 mM
KGIu, 4 mM MnC12. The DNA mixtures were overlaid with mineral oil, heated to 90 C for sec then brought to a reaction temperature- of 47 , 50 , 53 or 56 C.
Reactions were initiated by the addition of 1 1 of 100 ng/ 1 Pfu FEN-1. Reactions were allowed to proceed for 3 hours and stopped by the addition of 10 l formamide. One fourth of the total volume 15 od each reaction was loaded onto a 20%0 non-denaturing polyacry. lamide, gel -whioh was electrophoresed in the reverse direction. The gel was scanned using an Hitachi fluorescent scanner fitted. with a 585 nm filter, and the resulting image is shown in Fig. 77.
In Fig. 77, for each reaction temperature tested, the products from reactions :containing either the mutant ras target sequence (oligo 165) or the wild-type (oligo 166) are shown.
These data demonstrate that the miniprobe can be, used to sensitively discriminate between sequences that differ -by a single nucleotide. The miniprobe was cleaved to produce a strong signal in the presence ofthe mutant target sequence, but little or no miniprobe was cleavedIn the presence of the wild-type target sequence. Furthermore, the discrimination between closely related targets is effective over a temperature range of at least 10 C, which is a much broader range of temperature. than can usually be. tolerated when the selection is based on hybridization alone (e:g.,:hybridization with ASOs). This suggests that the enzyme<may be a factor in the discrimination, with the perfectly matched miniprobe being the preferred substrate when compared to the mismatched miniprobe. Thus, this system provides sensitive and specific detection of target nucleic acid sequences.

WO 98/42873 PCr/US98/05809 Effects of 3' End Identity On Site Of Cleavage Of A Model Oligonucleotide Structure As described in the Examples above, structure-specific nucleases cleave near the junction between single-stranded and base-paired regions in a bifurcated duplex, usually about one base pair into the base-paired region. It was shown in Example 10 that thermostable 5' nucleases, including those of the present invention (e.g., Cleavase BN
nuclease, Cleavase A/G nuclease), have the.ability to cleave a greater distance into the -base paired region when provided with an upstream oligonucleotide bearing a 3' region that is homologous to a 5' region of the subject duplex, as shown in Fig. 26. It has also been determined that the 3' terminal nucleotide of the InvaderTm oligonucleotide may be unpaired to the target nucleic acid, and still shift cleavage the same distance into the down stream duplex as when paired.
It is shown in this Example that it is the base component of the nucleotide, not the sugar or phosphate, that- is necessary to shift cleavage.
Figs. 78A and B shows a synthetic oligonucleotide which was designed to fold-upon itself which consists, of the following sequence: 5'-GTTCTCTGCTCTCTGGTC
GCTGTCTCGCTTGTGAAACAAGCGAGACAGCGTGGTCTCTCG-3' (SEQ ID NO:29).
Tlus;:oligonucleotide is referred to as the "S-60 Hairpin." 'The 15 basepair hairpin <formed by thisoligonucleotide is further stabilized by a"tri-loop" sequence in the loop end (r.e:; three nucleotides form the loop portion of the hairpin) (Hiraro et al, Nucleic Acids Res.; 22(4):
576 [19941). Fig. 78B shows the sequence of the P-15 oligonucleotide (SEQ ID
NO:30) and the location of the region of complementarity shared by the P-15 and S-60 hairpin oligonucleotides. In addition to the P-15 oligonucleotide shown, cleavage was also tested in the presence of the P-1,4 oligonucleotide (SEQ ID NO:108) (P=14 is one base, shorter on the 3' end ascompared to P-15), the P-14 with an abasic sugar (P-14d; SEQ
IDNO:=109) and the P14 with an abasic sugar with a 3' phosphate (P-14dp; SEQ ID NO:110). A-P-15 oligo with a 3' phosphate, P-15p (SEQ ID NO:111) was also examined. The black arrows 'shown in Fig. 78 indicate the sites of cleavage of the S-60 hairpin in the absence-(top structure; A) or presence (bottom structure; B) of the P-15 oligonucleotide.
The S-60 hairpin molecule was labeled on its 5' end with fluorescein for subsequent detection. The S-60 hairpin was incubated in the presence of a thermostable 5' nuclease in the presence or the absence of the P-15 oligonucleotide.. The presence of the full duplex which can be formed by the S-60 hairpin is demonstrated by cleavage with the Cleavase BN

5' nuclease, in a primer-independent fashion (i.e., in the absence of the P-15 oligonucleotide).
The release of 18 and 19-nucleotide fragments from the 5' end of the S-60 hairpin molecule showed that the cleavage occurred near the junction between the single and double stranded regions when nothing is hybridized to the 3' arm of the S-60 hairpin (Fig. 27, lane 2).
The reactions shown in Fig. 78C were conducted in 10 gl 1X CFLP buffer with 1 mM
MnC12 and 50 mM K-Glutamate, in the presence of 0.02 M S-60, 0.5 gM InvaderTM
oligonucleotide and 0.01 ng per l Cleavase BN nuclease. Reactions were incubated at 40 C for 5 minutes and stopped by the addition of 8 l of stop buffer (95%
formamide, 20 mM EDTA, 0.02% methyl violet). Samples were heated to 75 C for 2 min immediately before electrophoresis through a 15% acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. Gels were then analyzed with a FMBIO-100 Image Analyzer (Hitachi) equipped with 505 nm filter. The resulting image is shown in Fig. 78C.
In Fig. 78C lane I contains products from the no enzyme control; lane 2 contains products from a reaction run in the absence of an InvaderTM oligo; lanes 3-6 contain products from reactions run the presence of the P-14d, P-14dp, P-15 and P-15p InvaderTM
oligos, respectively.
From the data shown in Fig. 78C, it can be seen that the use of the P-15 InvaderTM
oligonucleotide produces a shift in the cleavage site, while the P14 InvaderTM
oligonucleotide with either a ribose (Pl4d) or a phosphorylated ribose (Pl4dp) did not This indicates that the 15th residue of the InvaderTM oligonucleotide must have the base group attached to promote the shift in cleavage. Interestingly, the addition of phosphate to the 3' end of the P15 oligonucleotide apparently reversed the shifting of cleavage site. The cleavage in this lane may in fact be cleavage in the absence of an InvaderTM oligonucleotide as is seen in lane 2.
In experiments with 5' dye-labeled InvaderTM oligonucleotides with 3' phosphate groups these oligonucleotides have been severely retarded in gel migration, suggesting that either the enzyme or another constituent of the reaction (e.g., BSA) is able to bind the 3' phosphate irrespective of the rest of the cleavage structure. If the InvaderTM
oligonucleotides are indeed being sequestered away from the cleavage structure, the resulting cleavage of the S-60 hairpin would occur in a "primer-independent' fashion, and would thus not be shifted.
In addition to the study cited above, the effects of other substituents on the 3' ends of the InvaderTM oligonucleotides were investigated in the presence of several different enzymes, and in the presence of either Mn++ or Mg++. The effects of these 3' end modifications on the generation of cleaved product are summarized in the following table. All of modifications were made during standard oligonucleotide synthesis by the use of controlled pore glass (CPG) synthesis columns with the listed chemical moiety provided on the support as the synthesis starting residue. All of these CPG materials were obtained from Glen Research Corp. (Sterling, VA).
Fig. 79 provides the structures for the 3' end substituents used in these experiments.

Modification Studies At 3' End Of InvaderTM Oligo 3.'=EndModification Extension:.By Effect:on.InvaderTM'Rxn. (As.:InvaderTTM) Terminal-Transferase EnzymesEondition - Effect 3' phosphate no A:5 - inhibits reaction, no detectable activity Glen part # 20-2900-42 3' acridine yes, poorly A:5 - decrease in activity, <10%
Glen part # 20-2973-42 B:5 - decrease in activity ,< 10%
B:4 - decrease in,, activity, < 10%
C:1 -decrease in 'activity, <l0%
C:2 - decrease in activity, * -~20%
C:4 - decrease in activity, - 50%
C:3 - decrease in'activity, <5%
3' carboxylate no A:1 - decrease in activity , -50%
Glen part # 20-4090-02 activity shift in cleavage site C:3 - reduces rate, <l0%'activity 3' nitropyrole yes A:5 - increase in activity, -2X
Glen part # 20-2143-42 3' nitroindole yes A:5 - decrease in activity, -33% activity Glen part # 20-2144-42 3' arabinose yes A:5 - decrease in activity, -50% activity Glen part # 10-4010-90 3'dideoxyUTP- no A:5 - decrease in activity, -40%.activity flourescein 3'-3' linkage no A:1 - equivalent cleavage Glen part # 20-0002-01 activity shift in cleavage site C:3 - decrease in activity, -25% activity 3' glyceryl yes, very poorly C:3 - decrease in activity, --30% activity Glen part # 20-2902-42 loss of specificity of cleavage (2 sites) 3' amino modifier C7 yes C:3 - decrease in activity, -30% activity loss Glen part # 20-2957-42 of specificity, multiple sites 3'deoxy, 2'OH yes, very poorly A:5 - decrease in activity, <20% activity Glen part # 20-2104-42 B:5 - decrease in activity, <20% acavity B:3 - decrease in activity, <20% activity C:1 - equivalent activity C:2 - equivalent activity C:4 - ? increase in activity C:3 - decrease in activity, -40% activity Enrymes:
A) Cleavase DVnuclease B) Cleavase BN nuclease C) Pfu FEN-1 Condition:
1) 4mM MnC12, 150mM LiCI
2) 4mM MnCl2, 50mM KCl 3) 7.5mM MgClz, no monovalent 4) 4mM MgC12i 50mM KCI
5) lOmM MgOAc, 50mM KCI

It can be seen from these data that many different modifications can be used on the 3' end of the InvaderT"! oligonucleotide without detriment. In various embodiments of the present invention, such 3' end modifications may be used to block, facilitate;
or otheiwise alter;:the hybridization characteristics of the InvaderT"'' oligonucleotide;
(e.g., to increase discrimination against mismatches, or to increase tolerance of mismatches, or to tighten the association between the InvaderTM oligonucleotide and the target nucleic acid). Some substituents may be used to alter the behavior of the eniyme in recognizing and cleaving within the assembled complex.
Altered 3' ends may also be used to prevent extensian of the InvaderTM
oligonucleotide by either template-dependentortemplate-independent nucleic acid polyrnerases.,. The use of otherwise unmodified dideoxynucleotides (i: e., without iattached dyes or other moieties) are a particularly preferred means of blocking ektensiorr of InvaderTM
oligonucleotides, because they do not decrease.cleavage activity, and they are absolutely unextendable.

Effect Of Probe Coricentration, Temperature And A Stacker Oligonucleotide On The. Cleavage Of Miniprobes By InvaderTM-Directed Cleavage The stacker oligonucleotides employed to form cleavage% structures may serve two purposes in the detection of a nucleia acid target using a miniprobe. The stacker oligonucleotide may help stabilize the, interaction of the .-miniprobe with the target nucleic acid, leading to greater accumulation of cleaved probe. In addition, the presence of this oligo in the complex elongates the duplex downstream of the cleavage site, which may enhance the cleavage activity of some of the enzymes of the present invention. An example of different preferences for the length of this duplex by= different structure-specific nucleases is seen in the comparison of the Cleavase BN nuclease and the Mja FEN-1 nuclease cleavage of 8 bp and 12 bp duplex regions in Fig. 65. Increased affinity of the enzyme for the cleavage structure also results in increased accumulation of cleaved probe during reactions done for a set amount of time.
The amount of miniprobe binding to the target is also affected by the concentration of the miniprobe in the reaction mixture. Even when a miniprobe is only marginally likely to hybridize (e.g., when the reaction is performed at temperatures in excess of the expected melting temperature of the probe/target duplex), the amount of probe on the target at any given time can be increased by using high concentrations of the miniprobe.
The need for a stacker oligonucleotide to enhance cleavage of the miniprobe was examined at both low and high probe concentrations. The reactions were carried out in 10 l of 10 mM HEPES (pH 7.2), 250 mM KGIu, 4 mM MnCl21 containing 100 nM of both the invading (oligo 135; SEQ ID NO:112) and stacking oligonucleotides (oligo 147;
SEQ ID
NO:113) and 100 pM ssM13 DNA. The reactions were overlayed with mineral oil, heated to 90 C for 15 sec then brought to the reaction temperature. Reactions were performed at 35 , 40 , 45 , 50 , 55 , 60 , and 65 C. The cleavage reactions were initiated by the addition of 1 l of 100 ng/ 1 Pfu FEN-I, and.1 l of varying concentrations of Cy-3 labeled 142 miniprobe oligonucleotide (SEQ ID NO,:1,14): Reactions were allowed to proceed for 1 hour and stopped by, the addition of10 l formaldehyde. One fourth of the total volume of each reaction was loaded onto 20% non-denaturing polyacrylamide gels which were electrophoresed in the reverse direction. Gels were visualized using an Hitachi FMBIO-100 fluorescent scanner. using a 585 nm filter. The fluorescence in each product band was measured and the graph shown in Fig. 80 was created using a Microsoft Excel spreadsheet.
The data summarized in Fig. 80 showed that the concentration of the miniprobe had a significant effect on the final measure of product, showing dramatic increases as the concentration was raised. Increases in the concentration of the miniprobe also shifted the optimum reaction temperature upward. It is known in the art that the concentration of the.
complementary strands in a hybridization will affect the apparent T. of the :duplex formed = between them. More significantly to the methods and compositions of the present invention is the fact that the presence of the stacker oligonucleotide has a profound influence on the cleavage rate of the miniprobe at all probe concentrations.. At each of the probe concentrations the presence of the stacker as much as doubled the signal from thc cleavage product. This demonstrated the utility of using the stacker,oligonucleotide in combination with the miniprobes described herein.

, The Presence of A Mismatch In The InvaderTM Oligonucleotide Decreases The Cleavage Activity Of The Cleavase A/G Nuclease In any nucleic acid,detection assay it is of additional benefit if the assay can be made to sensitively detect minor differences between related nucleic acids. In the following experiment, model cleavage substrates were used that were identical except for the presence or absence of a mismatch near the 3' end of the InvaderTM oligonucleotide when hybridized to the model target nucleic acid. The effect of a mismatch in this region on the accumulation of cleaved probe was then assessed.
To demonstrate -the effect of the presence of a mismatch in the InvaderTM
oligonucleotide on the ability of the Cleavase A/G nuclease to cleave the probe oligonucleotide in an InvaderTl" assay the following experiment was conducted.
Cleavage of`
the test oligonucleotide IT-2 (SEQ ID NO:115) -in the presence of InvaderTM
oligonucleotides IT-1, (SEQ ID NO:116) and IT-lA4 (SEQ ID NO:117). Oligonucleotlde IT-1 is fuliy complementary to the 3' arm of IT-2, whereas oligonucleotide IT-lA4 has a T->A
substitution;at position 4 from the 3' end that results in an A/A mismatch in the InvaderTM-target duplex: Both the matched and mismatched InvaderTM
oligonucleotides would be expected to hybridize at the temperature at which the following reaction was performed. Fig. 81 provides a schematic showing IT-1 annealed to the folded IT-2 structure and showing IT-1A4 annealed to the folded IT-2 structure.
The reactions were conducted as follows. Test oligonueleotide IT-2 (0.1 gM), labeled at-the5' end with fluorescein (Integrated DNA Technologies); was incubated with 0.26 ng/gl CleavaseOD AG in 10 gl of CFLP buffer v,iith 4 nmU MgC121 in 'the presence of I gM IT-1 or-IT-1A4 at 40 C for 10 min, a no enzyme control was also run. Samples were overlaid - with 15 l Chill-OuAD liquid wax to prevent evaporation. Reactions were'stopped by addition of 4 l stop buffer (95% fortnamide, 20 mM EDTA, 0.02% methyl violet). The cleavage products were separated on a 20% denaturing polyacrylamide gel and analyzed with the FMBIO-100 Image Analyzer (Hitachi) equipped with 505 nm filter. The resulting image is shown in Fig. 82.
In Fi& 82, lane l contains reaction products from the no enzyme control= and shows the migration of the uncut IT-2 oligo; lanes 2-4 contain products from reactions containing no InvaderTM oligo, the IT-1 Invaderm oligo and the IT-1A4 InvaderTM oligo, respectively.

~

These data show that cleavage is markedly reduced by the presence of the mismatch, even under conditions in which the mismatch would not be expected to disrupt hybridization.
This demonstrates that the Invaderm.oligonucleotide binding region is one of the regions within the: complex in which can be used for mismatch-detection; as revealed=by a drop in the cleavage rate.

Comparison Of ,The Activity Of The Pfu FEN-1 And Mja EN-1 Nucleases in the InvaderTM Reaction:
To.compare the activity of the Pfu FEN-1 and the.Mja:,FEN=1 nucleases in Invader'rm reaction the following experiment was performed. A- test oligonucle~otide IT3 (SEQ ID
NO:118) that forms an InvaderTM-Target hairpin structure and probe oligonucleotide PRI
(SEQ ID NO:119) labeled -at the .5' end with fluorescein (Integrated. DNR
Technologies) were employed in InvaderTm assa3+s.using either the, Pfu FEN4 . or the- Mja FEN-I, =nucleases.
The assays were conducted as follows. Pfu ;FEN-1 (13 ng/ l) =and Mja FEN4 (10 ng/ l), (prepared as described in Ex. 28) were incubated- with`the IT3 =(0.1 nM) an&PR l (2 and 5.-~M) oligonucleotides-in 10 ttL CFLP buffer, 4-mM MgC1Z; 20mglml tRNA-i:at 55 C
for.:41- mimSamples were overlaid with 15 l Chill-Out -evaporation barrier toP prevent evaporation: , Reactions were stopped by addition of 70 i stop buffer (95"/o formaYnide, 20 mM PDTA, 0.02%, methyl violet)~_ ; Reaction products (l lt.l ) were-sepa -ratezl: on a,-20%
denaturing polyacrylamide gel, visualized using. a fluroimager and the bands corresponding to the probe and the product,were quantitiated. The, resulting image is shown~%in Fig. 83. In ;Fig. 83,; the turnover. rate, per:=target per minute is shown below the :image :for each:nuclease at each concentration.of probe-and target tested.
It was demonstrated in Example 32 that the use of the Pfu -FEN=1 = structure-specific nuclease in. the InvaderTM-directed : cleavage reaction result.ed in a faster rate of product accumulation than did the use of the Cleavase A/G. The data presented here demonstrates that the use of Mja: FEN-1 nuclease with the fluorescein:labeled probe further increases the amount of product generated by an average of about 50*/*; demonstrating that, = in= addition to the Pfu- FEN-I nuclease, the: Mja FEl!d-1 nuclease is a preferred structure-specific nuclease for the detection of nucleic acid targets by the method of the present invention:

Detection Of RNA Target Nucleic Acids Using Miniprobe And Stacker Oligonucieotides In addition to the detection of the' M13 DNA target, material-described above, a miniprobe/stacker system was designed to detect the HCV-derived RNA sequences described in Example 19. A probe of intermediate length, either a long mid-range or a short standard probe, was also tested. The miniprobe used (oligo 42-168-1) has the sequence:
5'-TET-CCGGTCGTCCTGG-3' (SEQ ID NO:120),'the stacker oligonucleotide used (oligo 32-085) with this miniprobe has the sequence: - 5'-CAATTCCGGTGTACTACCGGTTCC-3' (SEQ ID
NO:121). The slightly longer probe, used without a stacker (oligo 42-088), has the sequence:
5'-TET-CCGGT!CGTCCTGGCAA-3'. (SEQ ID NO:122): The InvaderTm oligonuci-eotide used with both probes has the sequence: 5'-GTTTATCCAAGAAAGGACCCGGTC-3'(SEQ ID
NO:47). The reactions included 50 fmole of target 1tNA; 10 =pmole of the InvaderTM
oligonucleotide ;and .5. ptnole of: the niiniprobe oligonucleotide= in 10 l`
of -buffer ~containing 10 m1vl IvIES, pH 6.5 with 150: rnM LiCI, 4~ mM MnC12 0:05%0 ~each-Tween~26, and NP-40, an.d 39 units-,of RNAsin:(-Promega). VVhhen used, 10 pmolesof1hc:stacker, oligonucleotide was.added;. These_-components were combined, over-laid`with: Cluflout :evaporatibn barrier, and warmed: to:50 C; the:reactions werestarted by the addition,,of 5=polymerase units'bf DNAPTth;~ xo a final reaction volume of 10 ~ 1. After 30 minutes at 50 C;
reactions=were stopped by~ the.;addi.tion of 8 l of 95% formamide, 10 mM EDTA and 0:02% -methyl 'violet.
The samples were heated to. 90 C for I minute and 2.5 l ,of each of these reactions` were resolved by -ele-etrophoresis through a 20% denaturingpolyacrylarnide (19;1-crosslink) with 7M urea in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 tnM EDTA, and the labeled reaction products were visualized using the FMBIO=100 Image Analyzer (Hitachi). The resutting image is shown in Fig: 84. >..
-In Fig. 84, lanes 1 and 2 show the products of reactions containing-fihe HCV
InvaderTm oligonucleotide and the longer probe (oligo 42-088); without and with the-target RNA preserit,> respectively. Lanes 3, 4, and 5 show the products of reactions containing the InvaderTM oligonucleotide and:.the shorter probe (oligo 42-168-1). - Lane 3is a control' reactionwithQut target,RNA present, while lanes 4 and.5 have the-,target, but are without or with the staclEer.oligonucleotide, respectively.
Under these conditions the slightly longer (16 nt) probe oligonucleotide was cleaved quite easily without the help of a stacker oligonucleotide. In contrast, the shorter probe (13 " ~~ ..
' W O 98/42873 PCT/US98/05809 nt) required the presence of the stacker oligonucleotide to produce detectable levels of cleavage. These data show that the miniprobe system of target detection by InvaderrM-directed cleavage is equally applicable to the detection of RNA and DNA
targets. In addition, the comparison of the cleavage performance of longer and shorter probes in the absence of a stacker oligonucleotide give one example of the distinction between the performance of the miniprobe/stacker system, and the performance of the mid-range and long probes in the detection of nucleic acid targets.

. EXAMPLE 40 Effect Of An Unpaired 3' Tail On Transcription From A Complete (Un-Nicked) Promoter In designing the method oftranscription-based visualization of the products of InvaderTM-directed cleavage, it.was first necessary" to assess the effect of a 3' tail on the efficiency of transcription from a full length promoter. .The duplexes tested in this: Example are shown at the bottom of Fig. 93, and,are shown schematically in Figs:.~85A-C.
Transcription reactions were.performed using the MEGAshortscriptTM system from Ambion, I.nc, (Austin, TX), in. accordance with the manufacturer's-instructions withsthe-exceptionthat a fluorescein labeled ribonucleotide was added: ~, Each DNA
sample was assembled in 4 l of RNAse-free dH2O. Reactions 1-3 each contained 10 pmole af the copy template oligo 15.0 (SEQ ID NO:123); reaction 2 contained 10 pmole of the-promotervligo 151 (SEQ ID NO:124); sample 3 eontained 1 Q pmole of ahe 3' tailed -:promoter,oligo 073-065 (SEQ ID NO: 125);.sample 4 had no added DNA. To each sample,: 6 l of a solution containing.1 l of lOX Transcription Buffer, 7.5mM each rNTP, 0.125mM
fluorescein- 12-UTP (Boehringer) and 1.. l T7 MEGAshortscriptT"t Enzyme Mix was added.
The samples were then incubated at 37'C for 1 hour. One microliter of RNase-free DNase 1 (2U/ l) was added to each sample and the samples were incubated an additiona1-15 minutes at 37 C. The reactions were then stopped by the addition of 10 : 1 of a solution of 95%
formamide, 5mM Na,EDTA, with loading dyes. All samples were heated to 95 C for minutes and 4 l of- each sample were resolved by electrophoresis through a 20% denaturing acrylamide gel (19:1 cross-linked) with 7M urea, in a buffer containing 45mMTris-Borate (pH 8.3), 1.4mM EDTA. The gel was analyzed with a FMBIO II fluorescence image analyzer, and the resulting image is shown in Fig. 93. The RNA produced by successful transcription appears near the middle of the panel, as indicated ("RNA").

Examination of the products of transcription shown in lanes 2 and 3 show that the presence of the 3' tail on the full-length promoter has an adverse affect on the efficiency of transcription, but does not shut it off completely. Because the objective of the transcription-based visualization assays of the present invention is to discriminate between uncieaved probe and the shorter products of the invasive cleavage assay (cut probe), these data indicate that production of a full-length promoter in the cleavage reaction would be difficult to resolve from the background created by transcription from promoters containing the uncleaved probe if no other oligonucleotides were included in the assay. Means of suppressing transcription from such a branched promoter are discussed in the Description of the Invention and discussed below in Ex. 43.

Examination Of The Influence Of The Position Of The Nick On The Efficiency Of Transcription From Partial And Complete Composite Bacteriophage T7 Promoters In the ~Description of the invention,- the procedure for testing prospective promoter pieces for::suitability in an invasive cleavage-linked assay is described. One aspect of the test':is to examine the effect'a chosen nick site has'on the effciency of transcrnption from the final composit;e-promoter. In addition, the individual pieces of nicked promoter are tested for transcription activity i the presence of the full-length un-nicked strand. ` In this experi;nent, a comparison on these points is made between a composite promoter having a nick..in the non-template strand between nucleotides =11 and -10 relative to the~ initiation site (+1), and a promoter having a nick on the same strand, but positioned between nucleotides -8 and -7. The Figure numbers for the schematic representations of the contents of each reaction are indicated below each lane (e.g., 85A = Fig. 85A). The site where the nick would be in a fully assembled composite promoter using the reaction oligonucleotides is also indicated below each lane ("-11/-10" and "-80") =Transcription reactions were performed using the MEGAshortscriptTM system, in =
accordance withthe manufacturer's instructions, but with the exception that a fluorescein labeled ribonucleotide was added. Each DNA sample was assembled in 4 l of RNAse-free dHZO. Reaction 1 had no -added DNA. Reactions 2-9 each contained 10 pmole of the copy template oligo 150 (SEQ ID NO: 123). Reactions 3 and 4 contained 10 pmole of the 4 l "cut" probe (oligo 073-061-01; SEQ ID NO:127) or 20 pmole of the -10 partial promoter , q -oligo 073-061-02 (SEQ ID NO:130), respectively, and reaction 5 contained both.
Reactions 6 and 7 contained either the 10 pmole of the -8 "cut" probe (oligo 073-062-01;
SEQ ID
NO:126) or 20 pmoles of the -7 partial promoter oligo 073-062-02 (SEQ ID
NO:129), respectively, and reaction 8 contained them both. Reaction 9 contained 10 pmole of the intact promoter oligo 151 (SEQ ID NO:124).
The transcription reactions were initiated, incubated, terminated and the reaction products were resolved and imaged as described in Ex. 40. The resulting image is shown in Fig. 92. The reaction numbers correspond to the lane numbers above the image.
The RNA
created by successful transcription appears in the upper third of the image.
Comparison to the positive control reaction (rxn. 9) shows that the full-length RNA produced by each of the composite promoters is the same size as that produced in the control reaction;
indicated that transcription initiated at the same site in each reaction.
In Fig. 92, lanes 3, 4, and 5 coinpare transcription from the two species of partially assembled promoters (see schematics in Figs. 86A and : B) and the fully assembled composite promoter (Fig. 88B) having a nick between nucleotides -11 and -10 relative, to the: start of transcription,. It can be seen from.these data that neither partial promoter (lanes,11and ,4) is able to.support transcription of the copy.template,. but that the composite promoter :(lane 5) with this nick site is strongly transcribed., Surprisingly,. comparison to the control reaction (lane 9).shows that the presence of a nick at this site (-11/-10) actually enhances transcription.
While. not limiting the present invention to any particular mechanism, it.is believed that the enhancement of transcription is a result of both suppressing the formation of the shorter abortive xranscripts and by allowing greater accumulation of the full length product. This result is highly reproducible.
In Fig. 92, lanes 6, 7, and 8 compare transcription a similar set of partial and complete promoters; in which the nick is shifted 3 residues closer to the transcription start site.
Examination of lane 6 shows that the presence of 3 extra bases on the -8"cut"
probe (compared to the -11 "cut" probe in lane 3) allow this partial promoter to initiate transcription. This indicates that the -8/-7 site would be a poor choice. for use in this embodiment of the present invention.
. This experiment demonstrates the process for determining the suitable placement of a nick within a promoter assembly to uchieve the desiredresult. Similar tests can easily be designed for testing other nicks within the bacteriophage T7 ;promoter tested in this Example, 4..

or for testing suitable nick placement in any desired phage, prokaryotic or eukaryotic promoter.

Detection Of The Products Of InvaderTM-Directed Cleavage Through Transcription From A Composite Promoter The Examples described above indicate that a small oligonucleotide can be used to complete assembly of a composite T7 promoter, thereby enabling transcription from that promoter. Earlier Examples demonstrate- that the invasive cleavage reaction can be used release specific small oligonucleotide products from longer probe oligonucleotides. In this Example, it is demonstrated that these two observations can, be combined, and that the products of the invasive cleavage reaction can be used to complete a promoter and enable 'subseqUent transcription. The schematic representations of tlle composite promoters tested in this Example are shown in Fig. 88.
Two invasive cleavage reactions were set up, one without (rxn. 1) and one with (rxn.
2) input target DNA. The reactions (1 and 2) comprised 10mM MOPS (pH 7.5), 0.05%
Tween-20, 0.05% NP-40 and 20 pmoles probe oligo 073-067=01 '(SEQID NO:132) and pmoles InvaderT"'t-oligo 073-073-02 (SEQ ID NO: 134) in awolanid'cif I4 }A.;' Reaction 2 also included 100 fmoles M13mp18 ssDNA. The samples were'p`laced'at `60 C and 6 l-of a' solution containing 20 ng of Mja FEN-1 and 40mM Mg2C1 were added to each sample to start the reactions. The samples were incubated at 60 C for 30 minutes and stopped by the addition of 3 l of 2.5M NaOAc, 83mM Na2EDTA (pH 8.0).' Each sample was transferred to a 1.5 ml microcentrifuge tube and then the DNAs were precipitated: by the addition of 60 l of chilled 100% ethanol, and were stored at -20 C for 20 minutes. The pellets were collected by microcentrifugation, washed once with 8001o ethanol to remove excess salt, then dried under vacuum. The product of this invasive cleavage reaction is a 12 nt oligonucleotide having the sequence: 5'-CGAAATTAATAC-3' (SEQ ID NO:128), termed the -12 cut probe (same sequence as oligo 073-073-03).
For transcription, the dried samples were each dissolved in 4" l of a solution containing I pmole copy template oligo 150 and 2 pmoles -I I partial promoter oligo 073-073-012 (SEQ ID NO:131). Control samples 3 and 4 each contained 1 pmole of the copy template oligo 150; sample 3 also contained I pmole probe oligo 073-067-01 (SEQ ID
NO:132) and 2 pmoles -11 partial promoter oligo 073-073-012 (see structure 88A); sample 4 contained I pmole -12 "cut" probe oligo 073-073-03 (SEQ ID NO: 128) and 2 pmoles -11 partial promoter oligo 073-073-012 (see structure 88B). These are the structures that would be expected to exist in the transcription reactions from the two invasive cleavage reactions described above.
The transcription reactions were initiated, incubated, terminated and the products were resolved and imaged as described in Ex. 40. The resulting image is shown in the right half of Fig. 89 (lanes 6-9). Samples 3 and 4 appear in lanes 6 and 7, respectively, and the reactions 1 and 2 from the invasive cleavage reaction products (indicated by the use of the lower case "i"), appear in lanes 8 and 9, respectively. The number of the Fig.
showing the schematic representation of the expected promoter structure in each reaction'is indicated above each lane, and the placement of the nick is also indicated. The uppercase letters indicate which structure in the particular Figure to examine for each reaction. The lowercase . . ~ - , ->
"i" above lanes 8 and 9 indicate that these transcnptions weie' derived"from`
actVah ihvasive oleavage reactions. These products are compared to the RNA
produced`'iWfhecontrol' reaction in lane 5, the procedure for which is described in Ex. 44. The RNA
created by successful transcription appears in the upper third of the panel (indicated by "RNA").
The reaction shown in lane 6 shows no transcription.' This demonstr'etes that a nick between nucleotides -12 and -11 in the on-template strand of tlie T7 promoter eliminates transcription if the promoter is assembled from uncut probe'such as'the 3"end of the probe forms a branch within the promoter sequence. This is in coiitrast tot he results seen with the -111-10 nick examined below. Further, the transcript apparefit in lane 7 shows that an unbranched promoter with a nick at the same site (-12/-11) producesthecorrect RNA, with few abortive initiation products (see lanes 2 and 5 of Fig. 89; described in Ex: 44). The reactions in lanes 8 and 9 demonstrate that the same effect is observed when the invasive-cleavage reaction is the sole source of the upstream piece (=12 cut probe) of tht`f7-pronioter.
It is worthy of note that the promoter that is transcribed in Yane 8.is made complete by the presence of 1 pmole of a synthetic "cut" probe oligo, without any uncut probe in the mixture, while the promoter that is transcribed in lane 9 is completed by the product of an invasive cleavage reaction that had only 100 fmole of target DNA in it. This reaction also included the residual uncut probe (up to approx. 10 pmoles), which may compete for binding at the same site. Nonetheless, the transcriptions from the invasive cleavage reaction products are only slightly reduced in efficiency, and are just as free of background as is the "no target"
sample (lane 8). This Example clearly demonstrates that the cleavage products from the ~ N

invasive cleavage reaction can be used in combination with a partial promoter oligo to promote the production of RNA, without background transcription generated by the presence of the uncut probe. This RNA product is clearly dependent on the presence of the target material in the invasive cleavage reaction.

Shutting Down Transcription From A "Leaky" Branched T7 Composite Promoter Through The Use Of A Downstream Partial Promoter Oligonucleotide Having A 5' Tail The previous Example demonstrated that placement of a nick in the non-template strand of a bacteriophage T7 promoter between the -12 and -1 l nucleotides, relative to the transcription start site, prevents transcription of the branched promoter while allowing transcription when the composite promoter is assembled using the cut probe.
When the nick is placed in other locations in the T7 promoter, transcription may be initiated from either promoter, although it is usually less efficient from the branched promoter.
This Example demonstrates that the addition of a 5' tail that can base pair to the uncut probe (Fig. 90A) to the downstream partial promoter piece effectively blocks transcription from that promoter, but does not prevent transcription when a cut probe completes the promoter (Fig.
90B).
Two invasive cleavage reactions were set up, one without (rxn. 7) and one with trxn.
8) input target DNA. The reactions (7 and 8) comprised 10mM MOPS (pH 7.5), 0.05%
Tween-20, 0.05% NP-40 and 20 pmoles probe oligo 073-067-01 (SEQ ID NO:132)and pmoles InvaderT"' oligo 073-067-02 (SEQ ID NO:133) in a volume of 14 l.
Reaction 8 also included 100 fmoles M13mp18 ssDNA. The samples were placed at 60 C and 6 l of a solution containing 20 ng of Mja FEN-1 and 40mM Mg2C1 were added to each sample to start the reactions. The samples were incubated at 60 C for 30 minutes and then stopped by the addition of 3 l of 2.5M NaOAc, 83mM Na2EDTA (pH.8.0). Each sample was transferred to a 1.5 ml microcentrifuge tube and the DNAs were precipitated, washed and dried as described in Ex. 42. The product of this invasive cleavage reaction is 13 nt oligonucleotide sequence, 5'-CGAAATTAATACG-3' (SEQ ID NO:127), termed the -11 cut probe (same sequence as oligo 073-061-01 which is referred to as the -11 "cut"
probe to indicate it was not generated in an invasive cleavage reaction). In the transcription reactions, all of the DNAs were dissolved in 4 l of RNase-free dH2O. Sample 1 had no added DNA, samples 2-8 contained 1 pmole of the copy template =

oligo 150 (SEQ ID NO:123). In addition, sample 3 contained 1 pmole of -I
1"cut" probe oligo 073-061-01.(SEQ ID NO:127) and 2 pmoles of -10 partial promoter oligo (SEQ ID NO:130), sample 4 contained I pmole of probe oligo 073-067-01 and 2 pmoles of -partial promoter oligo 073-061-02. Control sample 5 contained I pmole of probe oligo 5 073-067-01 and 2 pmoles of partial promoter w/5' tail oligo 073-074 (5'-TACTGACTCACTATAGGGTCTTCTATGGAG GTC-3' (SEQ ID NO:146) (see structure in Fig. 90A) and sample 6 contained 1 pmole of -11 "cut" probe oligo 073-061-01 and 2 pmoles of partial promoter w/5' tail oligo 073-074 (see structure in Fig. 90B). These are the structures (i.e., 90A and 90B) that would be expected to exist. in the transcription reactions 10 from the two invasive cleavage reactions described above.
The dried samples 7 and 8 from the invasive cleavage (above) were each dissolved in 4 l of dH2O containing 1 pmole copy template oligo 150 and 2 pmoles partial promoter w/5' tail oligo 073-074. The transcription reactions were initiated, incubated, terminated and the reaction products were resolved and imaged as described in Ex. 40. The resulting image is shown in Fig. 91.
In Fig. 91 the lane numbers correspond to the sample numbers; = the number of the Figure showing the schematic representation of the expected promoter structure in-each reaction is indicated above each lane ("88" and '90"); and the placement of the nick, is also indicated ("-11l-10"). The upper-case letters indicate which structure in the particular Figure to examine for each reaction. The lower case "i". above lanes 7 and 8 indicates that, these transcriptions were derived from, actual invasive cleavage reactions. The RNA -created by successful transcription appears in the upper third of the panel, as indicated ("RNA").
The control reactions in lanes 1 and 2, having either no DNA or having the only the copy template, produced no RNA as expected. The product in lane 4 demonstrates that the branched T7 promoter with a nick in the non-template strand between nucleotides -11 and -10 can support transcription, albeit not as efficiently as the un-branched promoter_ with the nick at the same site (lane 3). Examination of lane 5 shows that the use of a partial promoter oligonucleotide with a short 5' tail that can basepair to the uncut probe as depicted in Fig.
90A, effectively suppresses this transcription but allows transcription when the probe does not have a 3' tail (lane 6; schematic Fig. 90B). The reactions in lanes Tand 8 demonstrate that the same effect as observed when the invasive cleavage reaction is the sole source of the upstream piece (-11 cut probe, SEQ ID NO:127) of the T7 promoter. It. is worthy of note that the promoter that is transcribed in sample 6 is made complete by the presence of 1 pmole .. ... ~ ~

of a synthetic "cut probe", without any uncut probe in the mixture, while the promoter that is transcribed in sample 8 is completed by the product of an invasive cleavage reaction that had only 100 fmole of target DNA in it. This reaction also included the residual uncut probe (up to approximately 19 pmoles), which may compete for binding at the same site.
Nonetheless, the transcriptions from the invasive cleavage reaction products are just as strong and just as free of background in the "no target" samples.

This Example clearly demonstrates that the cleavage products fromthe invasive cleavage reaction can be used in combination with a partial promoter oligonucleotide having a 5' tail to promote the production of RNA, without background transcription generated by the uncut probe. This RNA product is clearly dependent on the presence of the target material in the.invasive cleavage reaction.

Creation Of A Complete Bacteriophage 17 Promoter By DNA Polymerase-Mediated Extension Of A Cut Probe Comprising A Partial 17 Promoter As demonstrated in the Examples above, transcription cannot occur from the T7 promoter unless a complete promoter region is present. In the -above ~Exauiples; a-'complete promoter containing a-nick in one -strand was created by; annealing a'cut probe generated from an invasive cleavage -reaction to a copy template which' was annealed to a partial promoter oligo. -- A.n alternative means of creating a complete promoter in a manner dependent upon detection of a target sequence in an invasive cleavage reaction is to anneal the cut probe to a copy template devoid- of a partial promoter oligo. The 3'-OH present at the end of the annealed cut probe is then extended by a DNA polymerase to create a complete and un-nicked promoter which is transcription-competent In this Example, the promoter was made complete through the use of primer extension, rather that by the co-hybridization of another oligonucleotide.' The reaction steps are diagrammed schematically in Fig. 87. Two invasive cleavage reactions were set up, one without (rxn. 1) and one with (rxn. 2) input target DNA. The reactions (1 and-2) comprised 10mM MOPS (pH 7.5), 0.05% Tween-20, 0.05% NP-40 and 20 pmoles probe oligo .073-067-01 (SEQ ID NO:132) and 10 pmoles InvaderTM oligo 073-073-02 (SEQ ID
NO:134) in a volume -of 14 . 1. Reaction 2 also included 100 fmoles M13mp18 ssDNA. --The samples were placed at 60 C and 6 l of a solution containing 20ng of Mja FEN-1 and 40mM Mg2CI

were added to each sample to start the reactions. The samples were incubated at 60 C for 30 -234-. . ~

minutes and stopped by the addition of 3 l of 2.5M NaOAc, 83mM Na2EDTA (pH
8.0).
Each sample was transferred to a 1.5 ml microcentrifuge tube and then the DNAs were precipitated, washed and dried as described in Ex. 42. The product of this invasive cleavage reaction is the 12 nt oligonucleotide sequence: 5'-CGAAATTAATAC-3' (SEQ ID
NO:128), termed the -12 cut probe (same sequence as oligo 073-073-03 which is referred to as the -12 "cut" probe to indicate it was not generated in an invasive cleavage reaction).
To allow extension of these products using a template-dependent DNA
polymerase, a 20 1 solution containing 20mM Tris-HCI(pH 8.5), 1.5mM MgZCI, 50mMKCI, 0.05%
Tween-20, 0.05% NP-40, 25 M each dNTP, 0.25 units Taq DNA polymerase (Boehringer) and 2 M. copy template oligo 150 (SEQ ID NO:123) was -added to each of the dried cleavage samples. The samples were incubated at 30 C for 1 hr. The primer extension~
reactions were stopped by the addition of 3 l of 2.5M NaOAc with 83mM Na2EDTA
(pH
8.0)/sample. Each sample was transferred to a 1.5 ml microcentrifuge tube and the DNAs were precipitated, -washed and, dried as described in Ex. 42.
Samples 1; and, 2 were then dissolved in 4 l RNase-free dH2O. Samples 3, : 4 and 5 are control reactions: sample 3 was 4 l of RNase-free dH2O without added DNA;=sample 4 contajtned 1, pmole of the copy. template oligo 150 (SEQ ID NO:123) in 4 l.of_RNase-free dH2O,.,and sa.mple 5 contained I pmole of the same copy template-and -1prnole:of the. -, complete promoter oligo 151 (SEQ ID NO:124) in RNase-free dHZO.
..Transcription reactions were performed using the MEGAshortscriptT"i system,-th accor,dance with the manufacturer's instructions, but with the addition of a;fluorescein labeled ribonucleotide. To each sample, 6 l of a solution containing 1 l of 10X-Transcription Buffer, 7.5mM each rNTP, 0.125mM fluorescein-12-UTP (Boehringer).and 1 l T7 =
-MEGAshortscriptTM Enzyme Mix was added. The samples_ were incubated at-37 C
for 1 hour. One l of RNase-free DNase 1(2U/ l) was added to each sample andthey were incubated an additional 15 minutes at 37 C. The reactions were stopped by the `addition 'of l0 . l of a solution of 95% formamide, 5mM NaEDTA, with loading dyes.. All samples, were heated to 95 C for 2 minutes and four l of each sample were resolved by electrophoresis through a 20% denaturing acrylamide gel, (19:1 cross-linked) with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 8.3); 1.4mM EDTA. The -results were imaged using, the Molecular Dynamics Fluoroimager 595, with excitation at 488 iun and, emission detected at 530 nm.

= = WO 98/42873 PCT/US98/05809 The resulting image is shown in lanes I through 5 of Fig. 89; the lane numbers correspond to the sample numbers. The Figure numbers corresponding to the schematic representations of the promoters transcribed in each reaction as indicated above the lanes.
The RNA product from successful transcription appears in the upper third of the panel, as indicated ("RNA"). Unincorporated labeled nucleotide appears as a dense signal near the bottom ("NTPs"). Short transcription products caused by aborted initiation events (Milligan and Uhlenbeck, Methods Enzymol., 180:51 [1989]) appear as bands just above the free nucleotide in the lanes showing active transcription (i.e., lanes 2 and 5).
It can clearly be seen from the data in lanes 1 and 2 that the transcription is dependent on the presence of the target material in the invasive cleavage reaction. It is shown elsewhere (see lane 3, Fig. 92) that the product of the cleavage reaction is not in itself sufficient to allow transcription from the copy template. Thus, the action of the DNA
polymerase in extending the hybridized cut probe across the promoter is a, necessary 'step in enabling the transcription in this embodiment. These data clearly demorisirate 31iat both template-dependent extension by DNA polymerase, and extension followed by transcription are suitable methods of visualizing the products of the invasive cleavage assay: ' A
discussed- in the :
Description of the Invention, the products of thermal brealtdbwn thatpossess:
3' terminal, phosphates would not be extended, and would thus be preCIuded itom 'coiitribiiting to '..
background transcription.

Test For The Dependence Of An Enzyme On The Presence Of An Upstream Oligonucleotide When choosing a structure-specific nuclease for use in a sequential invasive cleavage reaction it is preferable that the enzyme have little ability to cleave a probe 1) in the absence of an upstream oligonucleotide, and 2) in the absence of overlap between t.he upstream oligonucleotide and the downstream labeled probe oligonucleotide. Figs. 99a-e depicts the several structures that can be used to examine the activity of an enzyme that is confronted with each of these types of structures. The structure a(Fig: 99a) shows the alignment of a probe oligonucleotide with a target site on bacteriophage M13 DNA (M13 sequences shown in Fig. 99 are provided in SEQ ID NO:163) in the absence'of an upstream oligonucleotide.
Structure b (Fig. 99b) is provided with an upstream oligonucleotide that does not contain a region of overlap with the labeled probe (the label is indicated by the star).
In structures c, d and e (Figs. 99c-e) the upstream oligonucleotides have overlaps of 1, 3 or 5 nucleotides, respectively, with the downstream probe oligonucleotide and each of these structures represents a suitable invasive cleavage structure. The enzyme Pfu FEN-1 was tested for activity on each of these structures and all reactions were performed in duplicate.
Each reaction comprised 1 M 5' TET labeled probe oligonucleotide 89-15-1 (SEQ
ID NO:152), 50 nM upstream oligonucleotide (either oligo 81-69-2 [SEQ ID
NO:153], oligo 81-69-3 [SEQ ID NO:154], oligo 81-69-4 [SEQ ID NO:155], oligo 81-69-5 [SEQ ID
NO:156], or no upstream oligonucleotide), I fmol M13 target DNA, 10 mg/ml tRNA
and 10 ng of Pfu FEN-1 in 10 l of 10 mM MOPS (pH 7.5), 7.5 mM MgCIZ with 0.05% each of Tween 20 and Nonidet P-40.
All of the components except the enzyme and the MgC12 were assembled in a final volume of 8 l and were overlaid with 10 gl of Chill-OutTM liquid wax. The samples were heated to the ieaction temperature of 69 C. The reactions were started by the'addition -of the Pfu FEN-1 and MgC12, in a2 l volume. After incubation at 69 C 'for 30 riiinntes, the reactions were stopped with 10 l of 95% formamide, 10 iiiM EDTA, 0.02 lo-methyl violet.
Samples were heated to 90 C for 1 min immediately before electrophoresisthtough a 20%
denaturing acrylamide gel (19:1 cross-linked), with 7 M urea; in at' bitff6r of 45 mM
Tris-Borate, pH 8.3, 1.4 mM EDTA. Gels were then anal"yied with?a 'FMBI0-100 Hitac(ii F1VIBIO fluorescence imager. The resulting image is displayed iri Fig: 100:
In Fig. 100, lanes labeled "a" contain the products generated froni reactions conducted without an upstream oligonucleotide (structure a), lanes labelled "b" contain an upstream oligonucleotide which does not invade the probe/target duplex (structure b).
Lanes labelled "c", "d" and "e" contain the products generated from reactions conducted using an upstream oligonucleotide that invades the probe/target duplex by 1, 3 or 5 bases, respectively. The size (in nucleotides) of the uncleaved probe and the cleavage products is indicated to the left of the image in Fig. 100.
As shown in Fig. 100, cleavage of the probe was not detectable when structures a and b were utilized. In contrast, cleavage products were generated when invasive cleavage structures were utilized (structures c-e). These data show that the Pfu FE1V=1 enzyme requires an overlapping upstream oligonucleotide for specific cleavage of the probe.
Any enzyme may be examined for its suitability for. use in a sequential invasive cleavage reaction by examining the ability of the test enzyme to cleave structures a-e (it is understood by those in the art that the specific oligonucleotide sequences shown in Figs. 99a-, ,. =.

e need not be employed in the test reactions; these structures are merely illustrative of suitable test structures). Desirable enzymes display little or no cleavage of structures a and b and display specific cleavage of structures c-e (i. e:, they generate cleavage products of the size expected from the degree of overlap between the two oligonucleotides empioyed to form the invasive cleavage structure).

EXAMPLE 46 Use Of The Products Of A First Invasive Cleavage Reaction To Enable A Second Invasive Cleavage Reaction With A Net Gain In Sensitivity As discussed in the Description of The Invention above, the detection sensitivity of the invasive cleavage reaction can be increased by the performing a second round of invasive cleavage using the products of the first reaction to complete the cleavage structure in the second reaction (shown schematically in Fig. 96). In this Example, the use of a probe which when cleaved in a first invasive cleavage reaction forms an integrated InvaderTM oligo and target molecule for use in a second invasive cleavage reaction is illustrated (shown schematically in Fig. 97).
A first probe was designed to contain some internal complementarity so that when cleaved in a first invasive cleavage reaction the product ("Cut Probe 1") could form a target strand comprising an integral InvaderTM oligonucleotide, as depicted in Fig.
97. A second probe was provided in the reaction that would be cleaved at the intended site when hybridized to the newly formed target/InvaderTM (Fig. 97). To demonstrate the gain in signal due to the performance of sequential invasive cleavages, a standard invasive cleavage assay, as described above, was performed in parallel.
. All reactions were performed in duplicate. Each standard (i.e., non-sequential) invasive cleavage reaction comprised 1 M 5' fluorescein-labeled probe oligo 073-182 (5' Fl-AGAA.AGGAAGGGAAGAAAGCGAA-3'; SEQ ID NO:157), 10 nM upstream oligo 81-69-4 (5'-CTTGACGGGGAAAGCCGGCGAACGTGGCGA-3'; SEQ ID NO:155), 10 to 100 attomoles of M 13 target DNA, 10 mg/ml tRNA and 10 ng of Pfu FEN-1 in 10 l of 10 mM MOPS (pH 7.5), 8 mM MgClZ with 0.05% each of Tween 20 and Nonidet P-40. All of the components except the enzyme and the MgC1z were assembled in a volume of 7 l and were overlaid with 10 l of Chill-OutT"' liquid wax. The samples were heated to the reaction temperature of 62 C. The reactions were started by the addition of the Pfu FEN-1 and 'WO 98/42873 PCT/US98/05809 MgC1Z1 in a 2 l volume. After incubation at 62 C for 30 minutes, the reactions were stopped with 10 l of 95% formamide, 10 mM EDTA, 0.02% methyl violet.
Each sequential invasive cleavage reaction comprised I M 5' fluorescein-labeled oligonucleotide 073-191 (the first probe or "Probe 1", 5' Fl-TGGAGGTCAAAACATCG
ATAAGTCGAAGAAAGGAAGGGAAGAAAT-3'; SEQ ID NO:158), 10 nM upstream oligonucleotide 81-69-4 (5'- CTTGACGGGGAAA GCCGGCGAACGTGGCGA-3'; SEQ ID
N0:155), 1 M of 5' fluorescein labeled oligonucleotide 106-32 (the second probe or "Probe 2", 5' Fl-TGTTTTGACCT CCA-3'; SEQ ID NO:159), 1 to 100 amol of M13 target DNA, mg/ml tRNA and 10 ng of Pfu FEN-1 in 10 l of 10 mM MOPS (pH 7.5), 8 mM MgCl2 with 0.05% each of Tween 20 and Nonidet P-40. All of the components except the enzyme and the MgC12 were assembled in a volume of 8 l and were overlaid with 10 l of Chi11-OutTM liquidwax. The samples were heated to the reaction temperature of 62 C (this =
temperature is the optimum temperature for annealing of Probe 1 to the first target). The reactions were started by-the addition of Pfu FEN-1 and MgClx; in a 2 l volume. After incubationat 62 C for 15 minutes, the temperature was lowered to 58 C (this temperature is the optimum temperature for annealing of Probe 2 to -the second target) and the satnptes were incubated for another 15 min. Reactions were stopped by the addition of 10 ~ l of 95%
formamide, 20 mM EDTA, 0A2% ,methyl violet Samples from both the standard and the sequential invasive cleavage reactions were heated,to 901 C. for 1 min immediately before electrophoresis through a 20%
denaturing acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. The gel was then analyzed with a Molecular Dynamics Fluorlmager 595.
The resulting image is displayed in Fig. lOla. A graph showing measure of fluorescence intensity for each of the product bands is shown in Fig. IOIb.
In Fig. lOla, lanes 1-5 contain the products generated in standard invasive cleavage reactions that contained either no target (lane 1), 10 amol of target (lanes 2 and 3) or with .100 amol of target (lanes 4 and 5). The uncleaved probe is seen as a dark band in each lane about half way down the panel and the cleavage products appear as a smaller black band near the bottom of the panel, the position of the cleavage product is indicated by an arrow head to the left of Fig. 101a. The gray ladder of bands seen in lanes .1-5 is due to the thermal degradation of the probe as discussed above and is not related to the presence or absence of the.target DNA. The remaining lanes display products generated in sequential invasive cleavage reactions that contained l amol of target (lanes 6 and 7), 10 amol of target (lanes 8 and 9) and 100 amol of target (lanes 10 and 11). The uncleaved first probe (Probe 1; labeled "1 uncut") is seen near the top of the panel, while the cleaved first probe is indicated as "1:
cut". Similarly, the uncleaved and cleaved second probe are indicated as "2:
uncut" and 2:
cut," respectively.
The graph shown in Fig. 101b compares the amount of product generated from the standard reaction ("Series 1") to the amount of product generated from the second step of the sequential reaction ("Series 2"). The level of background fluorescence measured from a reaction that lacked target DNA was subtracted from each measurement. It can be seen from the table located below the graph that the signal from the standard invasive cleavage assay that contained 100 attomoles of target DNA was nearly identical to the signal from the sequential invasive cleavage assay in which I attomole of target was present, indicating that the inclusion of a second cleavage structure increases the sensitivity, of the assay 100 to =
200-fold. This boost in signal allows easy detection of target nucleic acids at the sub attomole level using the.sequential invasive cleavage assay, while the standard assay, when performed using this enzyme for only 30 minutes, does not generate detectable product in the presence of:10.attomoies of target.
When;the amount of target was:decreased,by 10 or 100 fold <in the sequential invasive cleavage assay, the intensity of the signal was decreased by the same proportion. This indicates #hat_ the, quaAtitative capability of the invasive cleavage assay is retained even when reactions are performed in series, thus providing anucleic acid detection method that is both sensitive: and quantitative.
While in this Example, the two probes used had different optimal-hybridization temperatures (i.E., the temperature empiracally determined to give the greatest turnover rate in the given reaction conditions), the probes may also be seleeted (i: e., designed) to have lhe same optiimal hybridization temperature so that a temperature shift during incubation is not necessary.

EXAMPLE 47 =
The Products Of A Completed Sequential Invasive Cleavage Reaction Cannot Cross Contaminate Subsequent Similar Reactions As discussed in the Description of the Invention, the serial nature of the multiple invasive cleavage events that occur in the:sequential invasive cleavage reaction, in contrast to the reciprocating nature of the polymerase chain reaction and similar doubling assays, means ~ ~ .

that the sequential invasive cleavage reaction is not subject to contamination by the products of like reactions because the products of the first cleavage reaction do not participate in the generation of new signal in the second cleavage reaction. If a large amount of a completed reaction were to be added to a newly assembled reaction, the background that would be produced would come from the amount of target that was also carried in, combined with the amount of already-cleaved probe that was carried in. In this Example, it is demonstrated that a very.lazge portion of a primary reaction must be introduced into the secondary reaction to create significant signal..
A first or primary sequential invasive cleavage reaction was performed as described above using 100 amol; of target DNA. A second set of 5 reactions were assembled as described in, Ex. 46 .with the exception that portions of the first reaction were introduced and no additional target_ DNA was included. These secondary. reactions were initiated and incubated as described above, and included 0, 0.01, 0.1, 1, or 10% of the*first reaction material. A control reaction including 100 amol of target was included inthe second set also.
The reactions were stopped, resolved by electrophoresis and visualized as described~ above, and the resulting image-is-displayed in Fig. 402. The primaryprobe, uncut second=`0robe and the cut 2nd probe are =indicated, on the'left as "1: cut", 2: uncut"`,and 2r cut", iespectively.
3n. Fig-102, lane;1 shows .the results -of the first reaction with the accumulated product at the bottom-of the panel, and lane 2 show;a 1:10 dilution of the same reaction, to' demonstrate the level of signal that could be expected from that:level of contamination, without further amplification. Lanes 3 through 7 show the results of the secondary cleavage reactions that contained 0, 10, 1, 0.1 or 0.01% of the first reaction material added as contaminant, respectively and lane 8 shows a control react'ion that had 100 amol of target DNA added to verify the activity of the system,in the =secondary reaction. The signal level in lane 4 is as would be expected when 10 /a of the pre-cleaved ~material :is transferred (as in lane 2) and 10% of the transferred target material from the lane I reaetion is allowed, to, further amplify. At all levels of further dilution the signal is not readily distinguished from background. These data demonstrate that while a large-scale-transfer from one reaction to another may be detectable, cross contamination by the minute quantities -that would be expected from aerosol or from equipment contamination would not be easily, mistaken = for a false positive.result. These data also demonstrate thatwhen:the products:of one reaction are deliberately carried over, into a fresh sample, these products do not 1 participate in the new reaction, and thus do not affect the level of target-dependent signal that may be generated in that reaction.

Detection of Human Cytomegalovirus Viral DNA by Invasive Cleavage The previous Example demonstrates the ability of the invasive cleavage reaction to detect minute quantities of viral DNA in the presence of human genomic DNA. In this Example, the probe and InvaderTM oligonucleotides were designed to target the region of the major immediate early gene of human cytomegalovirus (HCMV) as shown in Fig. 103. In Fig. 103, the InvaderTM oligo (89-44; SEQ ID NO:160) and the fluorescein (Fl)-labeled probe oligo (89-76; SEQ ID NO:161) are shown annealed along a region of the HCMV genome corresponding to nucleotides 3057-3110 of the viral DNA (SEQ ID
NO: 162).
The probe used in this Example is a poly-pyrimidine probe and as'shbwnf'fierern'the u'se' of?a poly-pyrimidine probe reduces background signal generated by the thermal breakage of probe oligos.
The genomic viral DNA was purchased from Advanced Biotechnologies, Incorporated (Columbia, MD). The DNA was estimated (but not certified) by peisonhel at`'Advanced Biotechnologies to be at a'concentration of 170 amoT (1 x 10S copies) per inicroliter: The reactions were performed in quadruplicate. Each reaction Comprised 1' M,3-''flubrescein labeled probe oligonucleotide 89-76 (SEQ ID NO:161), 100( nM InvaderTm oligonucleotide 89-44 (SEQ ID NO:160), 1 ng/ml human genomic DNA, and one of five concentrations of target HCMV DNA in the amounts indicated above each lane in Fig: 104,"and 1O,ng of Pfu' FEN-1 in 10 i of 10 mM MOPS (pH 7.5), 6 mM MgC12 with 0.05% each of Tweeri 20 and Nonidet P-40. All of the components except the labeled probe, enzytne and 1VIgCli were assembled in a final volume of 7 l and were overlaid with 10 I of Chi1l=OutrM liquid waz.
The sainples were heated to 95 C for 5 min, then reduced to 62 C. The reactions were "
started by the addition of probe, Pfu FEN-1 and MgC121 in a 3 l volume. After incubation at 62 C for 60 minutes, the reactions were stopped with 10 l of 95%
formamide, 10 mM
EDTA, 0.02% methyl violet. Samples were heated to 90 Cfor 1 rnin immediately before electrophoresis through a 20% acrylamide gel (19:1 cross-linked), with 7 M
urea; in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. Gels were then analyzed with a Molecular Dynamics Fluorlmager 595.

The resuiting image is displayed in Fig. 104. The replicate reactions were run in groups of four lanes with the target HCMV DNA content of the reactions indicated above each set of lanes (0-170 amol). The uncleaved probe is seen in the upper third of the panel ("Uncut 89-76") while the cleavage products are seen in the lower two-thirds of the panel ("Cut 89-76"). It can be seen that the intensity of the accumulated cleavage product is proportional to the amount of the target DNA in the reaction. Furthermore, it can be clearly seen in reactions that did not contain target DNA ("no target") that the probe is not cleaved, even in a background of human genomic DNA. While 10 ng of human genomic DNA
was included in each of the reactions shown in Fig. 104, inclusion of genomic DNA
up to 200 ng has slight impact on the amount of product accumulated. The data did not suggest that 200 ng per 10 l of reaction mixture represented the maximum amount of genomic DNA
that could be tolerated without a significant reduction in signal accumulation. For reference, this amount of DNA exceeds what might be found in 0.2 ml of &ine' (a comindnly tested amount for HCMV in neonates) and is equivalent to the amount that would-lie fouiid' in about 5` l of whole blood.
These results demonstrate that the standard (i.e., non-'sequential) invasive cleavage reaction is a sensitive, specific and reproducible means of detecting viial DNA: It aan also be geen fr'oni these data that the use of a poly-pyrimidine prolie reduce!f the'background frtini thermal bieakage of the probe, as discussed in Example 22: ` Defection of 1.7 amol of target ., .
is roughly equivalent to detection of 106 copies of the virus. ` This is -equivalent to the nurriber of viral genomes that might be found in 0.2 mis of urine from a dongenitally infected neonat'e (10Z to 106 genome equivalents per 0.2 mls; Stagno et al., J_'Infect. -Dis:;
132.568 '[1975]):
Use of the sequential invasive cleavage assay would permitdetection of eveii fewer viral DNA molecules, facilitating detection in blood (10' to 105 viral particles per ml; Pector et al., J. Clin. Microbiol., 30:2359 [1992]) which carries a much larger amourit'of lieterologous DNA.
From the above it is clear that the invention provides reagents and methods to permit the detection and characterization of nucleic acid sequences and variations in nucleic acid sequences. The InvaderT"'-directed cleavage reaction and the sequentialInvaderTM-directed cleavage reaction of the present invention provide ideal direct detection methods that combine the advantages of the direct detection assays (e.g., easy quantification and minimal risk of carry-over contamination) with the specificity provided by a dual or tri oligonucleotide hybridization assay.

As indicated in the Description of the Invention, the use of sequential invasive cleavage reactions can present the problem of residual uncut first, or primary, probe interacting with the secondary target, and either competing with the cut probe for binding, or creating background through low level cleavage of the resulting structure.
This is shown diagramatically in Figs. 105 and 106. In Fig. 105, the reaction depicted makes use of the cleavage product from the first cleavage structure to form an InvaderTM
oligonucleotide for a second cleavage reaction. The structure formed between the secondary target, the secondary probe and the uncut primary probe is depicted in Fig. 105, as the right hand structure shown in step 2a. This structure is recognized and cleaved by the 5' nucleases, albeit very inefficiently (i.e., at less than about 1% in most reaction conditions).
Nonetheless, the resulting product is indistinguishable from the specific product, and thus may lead to a false positive result. The same effect can occur when the cleaved primary probe creates and integrated lnvaderTM/target (IT) molecule, as described in Example 46; the formation of the undesirable complex is depicted schematically in Fig. 106, as the right hand structure shown in step 2a.
The improvements provided by the inclusion of ArrestorTM oligonucleotides of various compositions in each of these types of sequential InvaderTM assays are demonstrated in the -following Examples. These ArrestorsTM are configured to bind the residual uncut probe from the first cleavage reaction in the series, thereby increasing the efficacy of and reducing the non-specific background in the subsequent reaction(s).

"ArrestorTM" Oligonucleotides Improve Sensitivity of Multiple Sequential Invasive Cleavage Assays In this Example, the effect of including an ArrestorTm oligonucleotide on the generation of signal using the IT probe system depicted in Figs. 97 and 106 is demonstrated.
The ArrestorTM oligonucleotide hybridizes to the primary probe, mainly in the portion that recognizes the target nucleic acid during the first cleavage reaction. In addition to examining the effects of adding an ArrestorT"', the effects of using ArrestorTM
oligonucleotides that extended in complementarity different distances into the region of the primary probe that composes the secondary IT structure were also investigated. These effects were compared in reactions that included the target DNA over a range of concentrations, or that lacked target 'vVO 98/42873 PCT/US98/05809 DNA, in order to demonstrate the level of nonspecific (i.e., not related to target nucleic acid) background in each set of reaction conditions.
The target DNA for these reactions was a fragment that comprised the full length of the hepatitis B genome from strain of serotype adw. This material was created using the polymerase chain reaction from plasmid pAM6 (ATCC #45020D). The PCRs were conducted using a vector-based forward primer, oligo # 156-022-001 (5'-ggcgaccacacccgtcctgt-3'; SEQ ID NO:168) and a reverse primer, oligo #156-022-02 (5'-ccacgatgcgtccggcgtag-3'; SEQ ID NO:169) to amplify the full length of the HBV
insert, an amplicon of about 3.2kb. The cycling conditions included a denaturation of the plasmid at 95 C for 5 minutes, followed by 30 cycles of 95 C, 30 seconds;: 60 C, 40 seconds; and 72 C, 4 minutes. This was followed by a final extension at 72 C for 10 minutes. The resulting amplicon, termed pAM6#2, was adjusted to 2 M NH4OAc, and collected by precipitation wiht=
isopropanol. After drying in vacuo, DNA was dissolved in 10 mM Tris pH .0, 0.1 mM
EDTA. . The, concentration was determined by OD200 measarement, and by Invaderm assay with comparison to astandard of known concentration.
The. InvaderT'" reactions were conducted as follows. Five. master rnixes, termed "A,"
"B," ".C," and were assembled; all mixes contained .12.5 mMMOPS, pH 7.5, 500 fmoles primary InvaderTM oligo #218-55-05. (SEQ ID NO:171), 10 ng human genomic DNA
(Novagen) and 30 ng AfuFENI enzyme, for every 8 l of mix. -Mix A contained no. added HBV genomic amplicon DNA;: mix B contained 600 molecules of HBV genomic arnplicon DNA pAM6 #2; mix C contained 6,000 molecules pAM6 #2; mix D contained 60,000 molecules pAM6 #2; and mix E contained 600,000 molecules pAM6 #2. The mixes were aliquotted to the reaction tubes, 8 l/tube: inix A to tubes 1, 2, 11, 12, 21 and 22; mix B to tubes 3, 4, 13, 14, 23 and 24; mix C to tubes 5, 6, 15, 16, 25 and 26; mix D
to tubes 7, 8, 17, 18, 27 and 28;, and. mix E to tubes 9, 10, 19, 20, 29 and 30. The samples were incubated at 95 C for 4 minutes to denature the HBV genomic amplicon DNA. The reactions were then cooled to 67 C, and 2 l of a mix containing 37.5 mM MgC1Z and 2.5 pmoles = (SEQ ID NO: 183) for every 2 l, was added to each sample. The samples were incVbated at 67 C for 60 minutes. Three secondary reaction master, mixes were prepared,:
alLmixes contained 10 pmoles of secondary probe oligonucleotide #228-48-04 (SEQ ID
NO:173) for every 2 l. of mix. Mix 2A contained no additional oligonucleotide,. mix 2B
contained .5pmoles "ArrestorTM" oligo # 218-95-03 (SEQ ID NO:184) and mix 2C contained 5 pmoles of "ArrestorTM" oligo # 218-95-01 (SEQ ID NO:174). After the 60 minute incubation at WO 98142873 PCT/tIS98/U5809 -67 C (the primary reaction described above), 2 l of the secondary reaction mix was added to each sample: Mix 2A was added to samples #1-10; Mix 2B was added to samples #11 -20;
and Mix 2C was added to samples #21-30. The temperature was adjusted to 52 C
and the samples wereincubated for 30 minutes at 52 C. The reactions were then stopped by the addition of 10 l of a solution of 95% o formamide, 5 mM EDTA and 0.02%
crystal violet.
All samples were heated to 95 C for 2 minutes; and 4 l` of each sample were resolved by electrophoresis through 20% denaturing acrylarnide gel (19:1 cross-linked) with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH8.3) and 1.4 mM EDTA. The results were imaged using the Molecular Dynamics Fluoroimager 595, `excitation 488, emission 530.
The resulting images are shown in Fig. 107.
In Fig. 107, Panel A shows the results of the target titration whea no ArrestorTM
oligonucleotide was included in the secondary reaction; Panel B shows the results of the same' target titration using-an ArrestorTM that extended 2 nt into the~ non-target complementary .-region of the primary probe; and. Panel C shows #he results of the same target titration_ using an ArrestorTM oligonucleotide that extended 4 nt ~ inta~ the non-target complementiary region of _ . ~_.. ....
the, priinary probe. - The product, of -the secondary cleavage reaction -is seun 'as a band near the bottom of each panel. ~. The. first two: laries of -eacli panel=(i: I and 2;
11 -and -12, 21 ` and 22) lacked -target DNA, and ahe signalthe .co-migrates' withthe product band represents the nonspecific -background under each set of conditions.
lt =can ~be -seen by visual -inspection of1hese panels that the -background signal is both reduced, and:made more predictable, by the inclusion of either species of ArrestorT"t oligonucleotides. In addition to.reducing the background in `the no-target control laxes, the background reduction in the reactions that had~ the more dilute amounts of target included is reduced, leading to a signal that is a moce -accttrate reflection -of the target contained within the reaction, thus improving, the quantitative range 'of the multiple, sequential inva'sive cleavage reaction.
To quantify the impact of including the ArrestorTM oligonuckeotide in the secondary cleavage -reaction under these conditions, the average product band signal from the reactions having the largest amount of target (i.e.; averages. of the signals fromlanes 9 and 10, lanes 19 and 20, and lanes 29 and 30), were compared to the averaged signal from,the no-target contol lanes for each panel, determine the "fold over background," the- factor of signal amplifieation over background, under` each set of conditions. For the reactions without the ArrestorTM, Panel A, the fold over` background was 5.3; for Panel B, the fold over background =~ . ~ =

was 12.7; and for Panel C, the fold over background was 13.4, indicating that in ;this system inclusion of any ArrestorTm at least doubled the specificity of the signal over the ArrestorTM-less reactions, and that the ArrestorTM that extended slightly farther into the non-target complementary region may be slightly more effective; at least in this embodiment of the system. This clearly shows the benefits of using an ArrestorTM to enhance the specificity of these reactions, an advantage that is of particular benefit at low levels of target nucleic acid.

"ArrestorTM" Oligonucleotides Allow use 'of Higher Concentratiotis of Primary Probe Without Increasing Ba+ckground'Signal It was demonstrated in Example 36, that increasing the concentration of the probe in the_ invasive cleavage reaction could dramatically increase the amount of signal generated for a given amount of target DNA. While not intending to limit the explanation to any specific mechanism, this is believed to be caused by the fact that -increased concentration of probe15 increases the rate at which the cleaved probe is supplanted by an uncleaved copy, thereby increasing the apparent turnover rate -of the cleavage reaction, Unfortunately, this effectxcould not hereto#'ore be applied in the primary cleavage reaction of a multiple sequential IrivaderT"' assay.because the residual uncleaved primary .probe-can hybridize to the secondary-target, in competition with the cleaved molecules, thereby reducing the efficacy of the secondary reaction. . Elevated concentrations of primary probe exacerbate this problem.
Further, the resulting complexes, as described above, can be cleaved at a low level, contributing to background. Therefore, increasing the primary probe can have the double negative effect of both slowing the secondary reaction and increasing the level of this form of non target-specific background. The use of an ArrestorT"'' to sequester or neutralize the residual primary probe allows this concentration-enhancing effect to be applied to these sequential reactions.
To demonstrate this effect, two sets of reactions were conducted. In the first set of reactions, the reactions were conducted using a range of primary probe concentrations, but no ArrestorTM oligonucleotide was supplied in the secondary reaction. In the second set of reactions, the same probe concentrations were used, but an ArrestorTM: was added for the secondary reactions.
All reactions were performed in duplicate. Primary InvaderTM- reactions were done in a final volume of 10 l and contained: .10 mM MOPS, pH,7.5, .7.5 mM MgC12, 500 fm of primary InvaderTM (218-55-05; SEQ ID NO:171); 30 ng of AfuFENI enzyme and 10 ng of . = , ^i .~

WO 98/42873 PCT/US98105809"
human genomic DNA. 100 zeptomoles of HBV pAM6 #2 amplicon was included in all even numbered reactions (by reference to Figs. I08A and B). Reactions included 10 pmoles, 20 pmoles, 50 pmoles, 100 pmoles or 150 pmoles of primary probe (218-55-02; SEQ
ID
NO: 170). MOPS; target and InvaderT"f oligonucleotides were combined to a final volume of =
7 l. Samples were heat denatured at 95 C for 5 minutes, then cooled to 67 C.
During the 5 minute denaturation, MgC1Z1 probe and enzyme were combined. The primary InvaderTm reactions were initiated by the addition of 3 l of MgC121 probe and enzyme mix, to the final concentrations indicated above. Reactions were incubated for 30 minutes at 67 C. The reactions were then cooled to 52 C, and each primary InvaderT'" reaction received the following secondary reaction components in a total volume of'4 l: 2.5`pmoles secondary target (oligo number 218-95-04; SEQ ID NO: 172); 10 pmoles secondary = probe (oligo number 228-48-!04; SEQ ID NO:173). The reactions_ that included the ArrestorTM
oligonucleotide had either 40 pmoles, 80 pmoles, 200 pmoles, 400 pmoles or 600 pmoles of=ArrestorTM (oligo number 218-15-01; SEQ ID NO:174), added at &4-foldmolarexcess over the pritrii;zy probe amount for each reaction, with this mix. Reactions- were then incubated at -52 C for 30 minutes. The reactions were stopped by the'addition of 10 1-of a solution of 95 Yo formarnide, : 1.0 mM EDTA- and 0.02% crystal violet. = All samples were heated- to '95 C % for 1 minute, and 4 l of. each sample were resolved by electtophoresis -Ahrough 200/=denaturing acrylamide gel (19:1 cross-linked) witli 7 M urea, in -a- buffer containing 45 inM Tris=Borate (pH8.3) and 1.4 mM EDTA. The results were imaged using the Molecular Dynamics Fluoroimager 595, excitation 488, emission 530. The resulting images for `the reactions' either without or with an ArrestorTM oligonucleotide are shown in Figs. 108A and 108B, respectively. The products of cleavage of the secondary probe are seen as aband near the bottom of each panel.
In Fig. 108A, lane sets- 1 and 2 show results with 10 pmoles of primary probe;
3 and 4 had 20 pmoles; 5 and 6 had 50 pmoles; 7 and 8 had 100 pmoles; and 9 and 10 had 150 pmoles. It can be seen by visual examination, that the increases in the amount of primary probe have the combined effect of slightly increasing the background in the no-target lanes (odd numbers) while reducing the specific signal in the presence of target (even numbered lanes), and therefore the reducing the specificity of the reaction- if viewed as the meesuie of "fold over baekground,."-demonstrating that-the approach of increasing- signal by`increasing probe- cannot be applied in these sequentiat reaetions.
. . , WO 98/42873 PCT/US98l05809 In Fig. 108B, lane sets I and 2 show results with 10 pmoles of primary probe;
while 3 and 4 had 20 pmoles; 5 and 6 had 50 pmoles; 7 and 8 had 100 pmoles; and 9 and 10 had 150 pmoles. In addition, each reaction included 4-fold molar excess of the ArrestorTM
oligonucleotide added before the secondary cleavage reaction: It can be seen by visual examination that the background in the no-target lanes (odd numbers) is lower in all cases, while the specific signal in the presence of target (even numbered lanes) increases with increased amounts of primary probe, leading to a greater "fold over background" sensitivity at this target level.
To quantitatively compare these effects, the fluorescence signal from the products of both non-specific and specific cleavage were measured. The results are depicted graphically in Fig. 108C, graphed as a measure of the percentage of the secondary probe cleaved during the reaction, compared to the amount of primary probe used. Examination of the plots from =
the no-target reactions confirms that the background in the absence of the ArrestorTM is, in general, roughly two-fold -.higher, and :that both increase slightly: with the increasing probe amounts. The specific signals however, diverge between the two sets of reaction more dramatically. While the signal in: the no-ArrestorTm reactions decreases steadily as-primary probe was increased, the signal in the AriestorTM:reactions continued -to increase. At the highest prinmary probe concentrations tested, the no-ArrestorT"t reactions liad specific~signal that was only.1.7 fold over background, while the ArrestorTM reactions detected the 100 zmoles (60,000 copies) of target with a signal 6.5 fold over background, thus denioristrating the.. improvement in the: sequential invasive cleavage reaction when an ArrestorT"t oligonucleotide is included.

. Modified Backbones Improve Performance of ArrestorTM Oligonucleotides All Natural KArrestorTM" Oligo With No 3'-Amine The reactions described in the previous two Examples used ArrestorTm = oligonucleotides that were constructed using 2' 0-methyl ribose backbone, and which included a positively charged amine group on the 3' terminal nucleotide. The modifications were made specifically~ to reduce enzyme interaction with the primary probe/ArrestorTM
complex. During the development of the present invention, it was determined that the 2' 0-methy modified oligonucleotides are somewhat resistant to cleavage by the 5' nucleases, just w0 98/42873 PCT/[JS98/05809-as they. are slowly degraded by nucleases when used in antisense applications (See e.g., Kawasaki et al., J. Med. Chem., 36:831 [19931).
Further, as demonstrated in Example 35, the presence of an amino group on the 3' end of an oligonucleotide reduces its ability to direct invasive cleavage: To reduce the possibility that the ArrestorTM oligonucleotide would form a cleavage structure in this way, an amino group was included in the design of the experiments described in this and other Examples.
Initial designs of the ArrestorTM oligonucleotides (sometimes referred to as "blockers") did not include these modifications, and these molecules were found to provide no benefit in reducing background cleavage in the sequential invasive cleavage assay and, in fact, sometimes contributed to background by inducing cleavage at an unanticipated site, presumably by providing some element to an alternative cleavage structure. The effects of natural and modifed ArrestorT"ss on the background noise in these reactions are examined in this Exarnple.
The efficacy of an "all-natural ArrestorTM (i.e., an ArrestorT-M that did not contain any base analogs or :modifications) was examined by comparison to an identical-reactions- =that lacked,.ArrestorsTM_ ,All, reactions were-perfonmed in duplicate; and were condueted-as follows. . Two master mixes were assembled, each containing :12.5 mM MOPS, pH
7.5, 500 : fmoles prhmary lnvaderTM oligonucleotide #218-55-05 (SEQ~ID-NO;171), 10 ng~human genomic DNA (Novagen) and 30 ng AfuFEN I enzyme for every '8' i of mix. Mix A-contained no added HBV; genomic amplicon DNA, Ynix B. eontained 600,000 molecules of HBV genomic amplicon DNA, pAM6 #2. The mixes were distributed to=the reaction tubes, in aliquots of 8 l/tube as follows: mix A to tubes 1, 2, 5 and 6; and mix B
to tubes 3, 4, 7 and -8. The samples were incubated at 95 C for 4 minutes to denature the HBV
genomic amplicon DNA. The reactions were then cooled to 67 C and 2ul of a mix containing 37.5 mM MgC12 and 10 pmoles 218-55-02B (SEQ ID NO:185) for every 2 l; was added to each sample. The samples were then incubated at 67 C for 30 minutes. Two secondary reaction master mixes were prepared, each containing 10 pmoles of secondary probe oligo #228-48-04N (SEQ ID N0:178) and 2.5 pmoles of secondary target oligonucleotide #218-95-04 (SEQ
ID NO:172) for every 3 l of mix. Mix 2A contained noadditional oligonucleotide; while mix 2B contained.50 pmoles of the natural "ArrestorTM" oligonucleotide #241-62-02 (SEQ ID
NO:186). After the initial 30 minute incubation..at .67 C, the temperature was adjusted- to 52 C, and 3 l of a secondary reaction mix- was added to each sample, as follows: Mix 2A
was added to samples #1-4; and Mix 2B was added to samples #5-8. The samples were then vJ0 98/42873 PCT/US98/05809 incubated for 30 minutes at 52 C. The reactions were then stopped by the addition-of 10 111 of a solution of 95% formamide, 10 mM EDTA and 0.02% crystal violet.
All of the samples were heated to .95 C for 2 minutes, and 4 l of each sample were resolved by electrophoresis through a 20% denaturing acrylamide gel (19:1 cross-linked) with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH8.3) and 1.4 mM EDTA.
The results were imaged using the Molecular Dynamics Fluoroimager 595, excitation 488, emission 530.
The resulting image is shown in Fig. 109A.
To compare the effects of the various modifications made to the ArrestorsTM, reactions were performed using ArrestorsTM having all natural bases, but including a 3' terminal amine;
ArrestorsTM having the 3' portion composed of 2'. 0-methyl nucleotides, plus the 3' terminal amine; and ArrestorsTM composed entirely of 2' 0-methyl nucleotides, plus the 3' terminal amine. These were compared to reactions performed without an ArrestorTM. The reactions were conducted as follows. Two master mixes were assembled, all mixes contained 14.3 mM
MOPS, pH 7.5, 500 fmoles primary .InvaderTM oligo #218-55-05 (SEQ ID N0:171) and 10 ng human genomic DNA (Novagen) for every 7 l :of mix. : MixA contained no~
added HBV
genomic amplicon DNA, mix B contained 600,000 molecules of HBV genomic aniplieon DNA, pAM6 #2. The mixes were distributed to the reaction tubes, `at -7 l/tube: mix''A to tubes 1, 2,.5, 6, 9, 10, 13 and .14; and mix B to tubes 3, 4, 7, 8, 11, 12, 15 and 16:''~The samples were warmed to 95 C for 4 minutes to denature the HBV DNA. The reactions were then cooled, to 67 C and 3 gl of a mix containing 25 mM MgCI2; 25 pmoles 218-(SEQ ID NO:185) and 30 ng AfuFENI enzyme per 3 l, were added to each sample.
The samples were then incubated at 67 C for 30 minutes. Four secondary reaction master"mixes were prepared;.all mixes contained 10 pmoles of secondary probe oligonucleotide #228-48-04B (SEQ ID N0:190) and 2.5 pmoles of secondary target oligonucleotide #218-95-04 (SEQ
ID N0:172) for every 3 l of mix. Mix 2A contained no additional oligonucleotide; while mix 2B contained 100 pmoles of the natural+amine ArrestorTM oligonucleotide #

(SEQ ID NO;187), mix 2C contained 100 pmoles of partially 0-methyl+amine = oligonucleotide # 241-62-03 (SEQ ID N0:188) and mix 2D contained 100 prnoles of all 0-methyl+amine oligonucleotide # 241-64-01 (SEQ ID N0:189). After the initial 30 minute incubation at 67 C, the temperature was adjusted to 52 C and 3 1 of a-secondary reaction mix was added to, each sample, as follows: mix 2A was added to samples #1-4;
mix 2B was added to samples #5-8; mix 2C was added to samples #9-12; -and mix 2D was added to --~
. . - . . ^ 1 - s WO 98/42873 PCT/US98/05809 samples #13-16. The samples were incubated for 30 minutes at 52 C, then stopped by the addition of 10 l of a solution of 95% formamide, 10 mM NaEDTA, and 0.2%
crystal violet.
All.samples were heated to 95 C for 2 minutes, and 4 l of each sample were resolved by electrophoresis through a 20% denaturing acrylamide gel (19:1 cross-linked) with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH8.3) and 1.4 mM EDTA.
The results were imaged using the Molecular Dynamics Fluoroimager 595, excitation 488, emission 530.
The resulting image is shown in Fig. 109B.
In Fig. 109A, the left hand panel shows the reactions that lacked an ArrestorTM, while the right hand panel shows the data from reactions that included the all natural ArrestorTM
oligonucleotide. The first two lanes of each panel are from no-target controls, the second set of.lanes contained target. Theproducts of cleavage are visible in the bottom one/fourth of each panel. The position at which the specific reaction products should run is indicated by arrows on left and right.
It can be seen by examination of tliese data, that: the -reactions run in the absence of ArrestorTm show reproducible. quality, between the replicates; and show significant cleavage only when tar-get is present. In:,rontrast, the addition of another unmodifed oligonucleotide into the reactions causes great variation between the replicate lanes (e.g., lanes 5 and 6 were :provided with the same reactants,-=but produced markedly`different results):
The introduction of the all natural ArrestorT" produced, rather than reduced, background in these no-target lanes, and increased cleavage at other sites (i.e., the bands other that those indicated by the arrowsflanking the panels). For these reasons the modifications which are described 'above, the;.effects of-which are shown on Fig. 109B, were incorporated.
The first 4 lanes of F.ig: 109B show the products of duplicate reactions without an ArrestorTM; plus or minus the i3BV target (lanes 1, 2, and lanes 3, 4, respectively); The next 4 lanes, 5, 6 and 7, 8 used a natural ArrestorTM oligonucleotide having a 3' terminal amine;
lanes 9, 10 and 11, 12 used the ArrestorTm with a 3' portion composed of 2' O-methyl nucleotides, and liaving a 3' terminal amine; lanes 13, 14 and 15; 16 used the ArrestorTm composed entirely of 2' 0-methyl nucleotides and having a 3' terminal amine.
The products of cleavage of the secondary probe are visible in the lower one third of each panel.
Visual inspection of these data-shows that the addition of the 3' terminal amine to the natural ArrestorTm suppresses the:aberrant cleavage seen in Fig. 109A, but this ArrestorT"t does not improve the perforrnance of the reaction, as compared to- the no-ArrestorTM controls.
In contrast, the use of the 2' O-methyl, nucleotides in the body of the Arrestorrm oligonucleotide does reduce background, whether partially or completely substituted. To quantify the relative effects of these modifications, the fluorescence from each of the co-migrating product bands was measured, the signals from the duplicate lanes were averaged and the "fold over background" was calculated for each reaction containing target nucleic acid.
When ArrestorTM was omitted, the target specific signal (lanes 3, 4) was 27-fold over the no target background; the natural ArrestorTM+amine gave a signal of 17-fold over background; the partial 2' 0-methyl+ amine gave a signal of 47-fold over background; and the completely 2' 0-methyl+ amine gave a signal of 33 fold over background.
, These. Figures show that -both modifications can have a beneficial effect on the specificity of the multiple, sequential' invasive cleavage assay. They also show that the use of the 2' O-methyl. substituted backbone, either partial or entire, markedly improves the =
specificity of these reactions. It is intended that in various embodiments of the present inventon, that any number of modifications that make either the ArrestorTM or the complex it forms -with the primary target resistant to nucleases will provide similar enhancement:
,~..,...
EXAMPLE 52 Effect of ArrestorTM Length on< Signal Enhancement in Multiple Sequential Invasive Cleavage Assays As noted in the Description of the Invention, the optimal length for an.ArrestorTM
oligonucleotide depends upon the design of the other nucleic acid elements of the InvaderTM
reaction, particularly on the design of the primary . probe. In this Example, the effects of varying the length of the Arre.storTM oligonucleotide were explored in systems using two different secondary probes. A schematic diagram showing these ArrestorsTM
aligned as they would hybridize to the primary probe oligonucleotide is -provided in Fig.
110C. In this Figure, the region of the primary probe that recognizes the target nucleic acid is shown underlined; the non-underlined portion, plus the first underlined base, is the portion that is released by the first cleavage, and goes on to participate in the second or subsequent cleavage structure.
All reactions were performed in duplicate. The InvaderTm reactions were done in a final volume of 10 l final volume containing 10 mM MOPS, pH 7.5, mM MgC12, fmoles of primary InvaderTM 241-95-01, (SEQ ID NO:176); 25 pmoles of primary probe 241-95-02 (SEQ ID N0:175),: 30 ng of AfuFEN1 enzyme, and 10 ng of human genomic DNA, and if included, I amoles of HBV amplicon pAM 6 #2. MOPS, target DNA, and InvaderTM
oligonucleotides.were combined to a final volume of 7 l. Samples were heat denatured at 95 C for 5 minutes, then cooled to 67 C. During the 5 minute denaturation, MgC12, probe and enzyme were combined. The primary InvaderTM reactions were initiated by the addition of 3 91 of MgC121 probe and enzyme mix, to the final concentrations indicated above.
Reactions were incubated for 30 minutes at 67 C. The reaction were then cooled to 52 C, and each primary InvaderTM reaction received the following secondary reaction components in a total volume of 3 l: 2.5 pmoles secondary target 241-95-07 (SEQ ID NO:177), 10 pmoles of either secondary probe 228-48-04 (SEQ ID NO:173), . or 228-48-04N (SEQ ID
NO:178) and 100 pmoles of an ArrestorTM oligonucleotide, either 241-95-03 (SEQ ID
NO:179), 241-95-04 (SEQ ID NO:180), 241-95-05 (SEQ ID NO:181) or 241-95-06 (SEQ ID NO:1$2).
The ArrestorsTM were omitted from some reactions as controls. for ArrestorT*4 effects.
The reactions were incubated at 52 C for 34 minutes, and were then stopped by the addition of .10 l of,95% formamide, 10 mM EDTA, and 0.02 ~ : crystal-violet: All samples were heated to 95 C for.1 minute, and 4. lof each sample, were resolved by electrophoresis through 20% denaturing acrylamide gel (19:1 cross-linked) with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH8.3) and -1.4: mM EDTA. The results were imaged using the Molecular Dynamics Fluoroimager 595,; LLcxwitation 488; emission,530. The resulting images for the reactions with: the shorter and longer secondary probes are shown in Figs.
110A and 110B, .respectively.
In each, Figure, the products of cleavage are, visible as bands in the bottom half of each lane.>.-.The first 4 lanes. of each Figure show the products of duplicate reactions without an ArrestQrM, plus or minus the HBV target (lanes sets 1 and 2 respectively);
in the next 4 lanes, sets:3 and 4 used the shortest ArrestorTM 241-95-03 (SEQ ID NO:179);
lanes 5 and 6 used 241-95-04 (SEQ ID NO:180); lanes 7 and 8 used 241-95-05 (SEQ:ID NO:181);
and lanes 9 and 10 used 241-95-06 (SEQ ID NO:182).
The principal background of concern is the band that appears in the "no target" control lanes (odd numbers; this band co-migrates with the target-specific signal near the bottom of each gel panel). Visual inspection shows that the shortest ArrestorTM was the least. effective at suppressing this background, and that the efficacy was increa.sed when the ArrestorT'"
extended; further into the portion that participates in the. subsequent.
cleavage reaction. Even with this difference in effect, it can be seen from these data that there is much latitude in the design of the ArrestorTM oligonucleotide. The choice of lengths will be influenced by the _ ` ,~ = -temperature at which the reaction making use of the ArrestorTM is perforcned, the lengths of the duplexes formed between the primary probe and the target, the primary probe and the secondary target, and the relative concentrations of the different nucleic acid species in the reactions.

Effect of ArrestorTM Concentration on Signal Enhancement in Multiple Sequential Invasive Cleavage Assays In examining the effects of including ArrestorTM oligonucleotides in these cleavage reactions, it was of interest to determine if the concentration of the ArrestorTM in excess of the primary probe concentration would have an effect on yields of either non-specific or specific signal, and. if the length of the ArrestorTM would be a factor. These two variable were investigated in the following Example.
All reactions were performed in duplicate. The primary InvaderTM reactions were done in a. final volume of 10 i and contained 10 mM MOPS; pH 7.5; -7:5 mM -MgClZ, 500 fmoles of primary InvaderTM 241-95-01. (SEQ ID NO:176),, 25Pmoles of p.
runaty~. ~~ rbbe 241-. .
95-02 (SEQ ID NO:175), 3.O,ng of AfuFENI -enzyme, and 10 ngof human genomic-~DNA.
Where includ.ed, the target DNA was1 amole of HBV amplicon ;pAM 6#2;
as==desoribed above. MOPS,, target and:Inv.aderTm were combined to a final, volume of 7 l.
The`4samples were heat denatured at 95 C for 5 minutes, then cooled ta 67 C. During the 5 minute denaturation, MgCIb probe and enzyme were combined. The primary: InvaderT..m reactions were initiateld. by the addition of 3, l of MgC12, .probe and: enzyme mix..
The reactions were incubated for 3.0; minutes at 67 C. The reactions were, then cooled to 52 C
and each ?primary InvaderT"' reaction received the, following. secondary reaction components: -2.5 pmoles secondary target,241-95-07 (SEQ ID NO:177), 10 pmoles secondary probe 228=48-04 (SEQ
ID NO:173); and, if included, 50, 100 or 200 pmoles of either ArrestorTM 241-95-03 (SEQ ID
NO:179) or 241-95-05 (SEQ ID NO:181), in a total volume of 3 pl. Reactions were then incubated at 52 C for 35 minutes. Reactions were stopped by the addition of 10 l of 95%
formamide,10 mM EDTA, and 0.02% crystal violet. All of the samples were heated to 95 C
for l minute,. and.4 pl of each sample were resolved by eleetrophoresis through 20% -denaturing acrylamide gel (19:1; cross-linked) with .7 M urea, in- a buffer containing 45 mM
Tris-Borate (pH8.3), and.1.4 mM EDTA.The results were imaged using the Molecular _ ,--~
WO 98/42873 PCT/US98/0580'9 Dynamics Fluoroimager 595, excitation 488, emission 530. The resulting images are shown as a composite image in Fig. 111.
Each of the duplicate reactions were loaded on the gel in adjacent lanes and are labeled with a single lane number. All odd numbered lanes were no-target controls. Lanes I
and 2 had no ArrestorTm oligonucleotide added; lanes 3-8 show results from reactions containing the shorter ArrestorT'", 241-95-03 (SEQ ID NO:179); lanes 9-14 show results from reactions containing the longer ArrestorTM, 241-95-05 (SEQ ID NO:181). The products of cleavage from the secondary reaction are visible in the bottom one third of each panel.
Visual inspection of these data (i.e., comparison of the specific products to the background bands) shows. that both ArrestorsTM have some beneficial effect at all concentration.
To quantify the relative effects of ArrestorTM length and concentration, the fluorescence from each of the co-migrating product bands was measured, the signals from the duplicate lanes were averaged and the "fold over background"
(signal+target/signal-target) was calculated for each reaction containing target nucleYc acid.' The reaction'l"acking an Arrestorm yielded a signal approximately 27=fold over background: , Inciitsiori of tlie shorter ArrestorTm at 50, 100 or .200 pmoles produced products at 42,51" and. 60-f6iri. over background, -respectively. This shows" that wluie the short arrestr at the towest concentration seems to be less effective than the ilanger Arrestorsm (See, previous.ExatiipYe) this can be compensated for by increasing the concentration of ArrestorT"t; andthereby the ArrestorTM:primary probe ratio.
In contrast, inclusion of the longer ArrestorTM at 50, 100 or 200 pmoles produeed products at 60, 32 and 24 fold over background, respectively. At the lowest concentration, the efficacy of this longer ArrestorTm relative to the shorter ArrestorTM` is consistent'with the previous Example. Increasing the concentration, however, decreased the yield of specific product, suggesting a competition effect with some element of the secondary cleavage reaction.
These data show that the ArrestorT"' oligonucleotides can be used to advantage in a number of specific reaction designs. The choice of concentration will' be influenced by the temperature at which the reaction making use of the ArrestorTm is performed, the lengths of the duplexes formed between the primary probe and the target, the primary probe and the secondary target, and between the primary probe and the ArrestorTm.
Selection of oligonucleotides for target nucleic acids other thanthe HBV shown here, (e.g., oligonucleotide composition and length), and the optimization of cleavage reaction conditions in accord with the models provided here follow routine methods and conunon practice well known to those skilled in the methods of molecular biology.

Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.

CECI EST LE TOME DE `2 NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.

JUMBO APPLICATIONS / PATENTS

THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.

THIS IS VOLUME OF _2 NOTE: For additional volumes please contact the Canadian Patent Office.

Claims (26)

1 A kit, comprising:

a) a first oligonucleotide comprising a 3' portion and a 5' portion, said 3' portion completely complementary to an entire first region of a target nucleic acid, and said 5' portion non-complementary to said target nucleic acid; and b) a second oligonucleotide comprising a 3' portion and a 5' portion, said 5' portion completely complementary to an entire second region of said target nucleic acid downstream of and contiguous to said first region; and c) a thermostable structure-specific 5'-nuclease.

2. The kit of Claim 1, wherein said non-complementary 5' portion of said first oligonucleotide is less than 10 nucleotides in length.

3. The kit of Claim 1, wherein said non-complementary 5' portion of said first oligonucleotide is between 10 and 20 nucleotides in length.

4. The kit of Claim 1, wherein said non-complementary

5' portion of said first oligonucleotide is greater than 20 nucleotides in length.

5. The kit of any one of Claims 1 to 4, wherein said first and second regions of said target nucleic acid are longer than one nucleotide in length.

6. The kit of any one of Claims 1 to 5, wherein said 3' portion of said second oligonucleotide comprises a 3' terminal nucleotide not complementary to said target nucleic acid.

7. The kit of any one of Claims 1 to 5, wherein said 3' portion of said second oligonucleotide consists of a single nucleotide not complementary to said target nucleic acid.

8. The kit of any one of Claims 1 to 7, wherein said thermostable structure-specific 5'-nuclease comprises a Flap-endonuclease.

9. The kit of Claim 8, wherein said Flap-endonuclease comprises a FEN-1 endonuclease.

10. The kit of any one of Claims 1 to 9, further comprising a polymerase.

11. The kit of any one of Claims 1 to 10, further comprising a ligase.

12. The kit of any one of Claims 1 to 11, wherein a portion of said structure-specific 5'-nuclease is homologous to a portion of a thermostable DNA polymerase derived from a thermophilic organism.

13. The kit of Claim 12, wherein said thermophilic organism is selected from the group consisting of Thermus aquaticus, Thermus flavus, and Thermus thermophilus.

14. The kit of any one of Claims 1 to 13, wherein said kit further comprises a solid support.

15. The kit of Claim 14, wherein said first oligonucleotide is attached to said solid support.

16. The kit of Claim 14, wherein said second oligonucleotide is attached to said solid support.

17. The kit of any one of Claims 1 to 16, further comprising a buffer solution.

18. The kit of Claim 17, wherein said buffer solution comprises a source of divalent cations.

19. The kit of Claim 18, wherein said divalent cation is selected from the group consisting of Mn2+ and Mg2+ ions.

20. The kit of any one of Claims 1 to 19, further comprising a third oligonucleotide complementary to a third portion of said target nucleic acid upstream of said first portion of said target nucleic acid.

21. The kit of any one of Claims 1 to 20, further comprising said target nucleic acid.

22. The kit of any one of Claims 1 to 21, further comprising a second target nucleic acid.

23. The kit of Claim 22, further comprising a third oligonucleotide comprising a 5' portion complementary to a first region of said second target nucleic acid.

24. The kit of Claim 23, wherein said 3' portion of said third oligonucleotide is covalently linked to said second target nucleic acid.

25. The kit of Claim 23, wherein said second target nucleic acid further comprises a 5' portion, wherein said 5' portion of said second target nucleic acid is said third oligonucleotide.

26. The kit of any one of Claims 1 to 25, further comprising a competitor oligonucleotide configured to bind said first oligonucleotide, and not bind said second oligonucleotide.