CA2550294A1 - Canine probiotic lactobacilli - Google Patents

Abstract

According to the invention there is provided a strain of lactic acid bacteria of the genus Lactobacilli obtainable by isolation from resected and washed canine gastrointestinal tract having a probiotic activity in animals. Methods of use and compositions comprising the Lactobacilli of the present invention are also provided.

Description

Canine Probiotic Lactobacilli Technical Field The present invention relates to the field of probiotic micro-organisms, more specifically canine probiotic lactic acid bacteria and methods of use.
Background The defense mechanisms to protect the mammalian gastrointestinal (GI) tract from colonisation by bacteria are highly complex. The GI tract of most mammals are colonised by native microflora, and invasive pathogenic micro-organisms. In a healthy state, these competing microflora are in a state of equilibrium. Modification of the intestinal microflora equilibrium may lead to or prevent many GI disorders, both in humans, and other mammalian species, such as companion animals including cats, dogs and rabbits. The well being of companion animals is closely related to their feeding and GI health, and maintenance of the intestinal microflora equilibrium in these animals may result in healthier pets.
The number and composition of the intestinal microflora tend to be stable, although age and diet may modify it. Gastric acidity, bile, intestinal peristalsis and local immunity are factors thought to be important in the regulation of bacterial flora in the small intestine of human beings and various other mammals. Often pet GI disorders, including those found in canines and felines, are linked to bacterial overgrowth and the production of enterotoxins by pathogenic bacteria.
These factors disrupt the intestinal microflora equilibrium and can promote inflammation and aberrant immune responses.
During the last few years, research has begun to highlight some valuable strains of bacteria and their potential use as probiotic agents. Probiotics are considered to be preparations of bacteria, either viable or dead, their constituents such as proteins or carbohydrates, or purified fractions of bacterial ferments that promote mammalian health by preserving the natural microflora in the GI tract, and reinforcing the normal controls on aberrant immune responses. It is believed by some that probiotic bacteria are more effective when derived from the species, or closely related species, intended to be treated. Therefore, there is a need for probiotic strains derived from companion animals to be used for companion animals, that are different to those derived from humans.
WO 01/90311 discloses probiotic micro-organisms isolated from faecal samples obtained from cats and dogs having probiotic activity. However, these bacteria were obtained from faecal

2 samples, and may not form part of the natural intestinal microflora present in the upper portion of the GI tract.
Consequently, there is a need to provide strains of bacteria obtainable by isolation from the natural intestinal microflora present in the upper portion of the GI tract that are particularly adapted for companion animals, and have been selected for their probiotic properties and ability to survive processing, and to incorporate these strains into compositions that are suitable for their use.
Summary According to the invention there is provided a strain of lactic acid bacteria of the genus Lactobacilli obtainable by isolation from resected and washed canine gastrointestinal tract having a probiotic activity in animals. The lactic acid bacterial strain is preferably selected from the species Lactabacillus mus-inuslruminus.
In a preferred embodiment, the lactic acid bacterial strain is a Lactobacillus rnur°inuslr-urninus having a 16s-23s spacer region DNA sequence having at least 93% homology to SEQ. ID NO. 1, SEQ. ID NO. 2, SEQ. ID N0. 3 OR SEQ. ID NO. 4.
In a further preferred embodiment, the lactic acid bacterial strain is selected from the group comprising Lactobacillus murinus AHC 1222 (NCIMB 41194); Lactobacillus murinus AHC 3133 (NCIMB 41195); Lactobacillus murinus AHC 5323 (NCIMB 41196);
Lactobacillus murinus AHC 6331 (NCIMB 41197) and mixtures thereof.
Furthermore, the present invention is directed towards providing uses of lactic acid bacteria obtainable by isolation from resected and washed canine gastrointestinal tract for maintaining and improving pet health, and compositions comprising the lactic acid bacteria.
These and other features, aspects, and advantages of the present invention will become evident to those skilled in the art from a reading of the present disclosure.
Brief Description of the Figures Figure 1 demonstrates the inhibition of the growth iya vitro of Salmonella typhimuriur~a by the Lactobacilli bacteria of the present invention according to methodology set out in example 2.
Figure 2 demonstrates the inhibition of the growth ih vitro of Listen°ia monocytogert.es by the Lactobacilli bacteria of the present invention according to methodology set out in example 2.
Figure 3 demonstrates the inhibition of the growth ira vitro of Listeria iranocua by the Lactobacilli. bacteria of the present invention according to methodology set out in example 2.
Figure 4 demonstrates the inhibition of the growth ih vitro of Eschericlzia coli 0157H45 by the Lactobacilli bacteria of the present invention according to methodology set out in example 2.

3 Figure 5 demonstrates the in vitro acid stability of the Lactobacilli bacteria of the present invention according to methodology set out in example 3.
Figure 6 demonstrates the growth characteristics of the Lactobacilli bacteria of the present invention in the presence of 0.5%, 1% and 5% porcine bile salts.
Figure 7 demonstrates the ifZ vitro ability of the Lactobacilli bacteria of the present invention to adhere to HT-29 gut epithelial cells.
Sequences SEQ. ID NO. 1 - 16s-23s intergenic spacer nucleotide sequence from Lactobacillus murinus AHC
1222 (NCIMB 41194).
SEQ. ID NO. 2 -16s-23s intergenic spacer nucleotide sequence from Lactobacillus murinus AHC
3133 (NCIMB 41195).
SEQ. ID NO. 3 - 16s-23s intergenic spacer nucleotide sequence from Lactobacillus murinus AHC
5323 (NCIMB 41196).
SEQ. ID NO. 4 -16s-23s intergenic spacer nucleotide sequence from Lactobacillus murinus AHC
6331 (NCIMB 41197).
SEQ. ID NO. 5 -16s-23s PCR primer sequences for sequence analysis.
Bacterial Deposit Numbers The table below indicates Lactobacillus species and strain number for strains that are examples of the present invention. The bacterial strains are deposited with the National Collections of Industrial Food and Marine Bacteria (NCIMB), Aberdeen, UI~.
Strain Deposit Number 16 s-23s Sequence Lactobacillus murinus AHC NCIMB 41194 SEQ. ID NO.

Lactobacillus murinus AHC NCIMB 41195 SEQ. ID NO.

Lactobacillus murinus AHC NCIMB 41196 SEQ. ID NO.

Lactobacillus murinus AHC NCIMB 41197 SEQ. ID NO.

Detailed Description All weights, measurements and concentrations herein are measured at 25°C on the composition in its entirety, unless otherwise specified.
Unless otherwise indicated, all percentages of compositions referred to herein are weight percentages and all ratios are weight ratios.
Unless otherwise indicated, all molecular weights are weight average molecular weights.
Unless otherwise indicated, the content of all literature sources referred to within this text are incorporated herein in full by reference.

4 Except where specific examples of actual measured values are presented, numerical values referred to herein should be considered to be qualified by the word "about".
Within the following description, the abbreviation CFU ("colony-forming unit") designates the number of bacterial cells revealed by microbiological counts on agar plates, as will be commonly understood in the art.
As used herein, the term "mutants thereof ' includes derived bacterial strains having at least 88% homology, preferably at least 90% homology, more preferably 95%
homology to the 16s-23s intergenic spacer polynulceotide sequence of a referenced strain, but otherwise comprising DNA mutations in other DNA sequences in the bacterial genome.
As used herein, the term "DNA mutations" includes natural or induced mutations comprising at least single base alterations including deletions, insertions, transversions, and other DNA modifications known to those skilled in the art, including genetic modification introduced into a parent nucleotide or amino acid sequence whilst maintaining at least 50% homology to the parent sequence. Preferably, the sequence comprising the DNA mutation or mutations has at least 60%, more preferably at least 75%, more preferably still 85% homology with the parental sequence. As used herein, sequence "homology" can be determined using standard techniques known to those skilled in the art. For example, homology may be determined using the on-line homology algorithm "BLAST" program, publicly available at http://www.ncbi.nlm.nih.~ov/BLAST/.
As used herein "genetic modification" includes the introduction of exogenous and/or endogenous DNA sequences into the genome of an organism either by insertion into the genome of said organism or by vectors including plasmid DNA or bacteriophage as known by one skilled in the art, said DNA sequence being at least two deoxyribonucleic acid bases in length.
As used herein, "companion animal" means a domestic animal. Preferably, "companion animal" means a domestic canine, feline, rabbit, ferret, horse, cow, or the like. More preferably, "companion animal" means a domestic canine or feline.
Lactic Acid Lactobacilli Strains The first aspect of the present invention comprises a strain of lactic acid bacteria of the genus Lactobacilli obtainable by isolation from resected and washed canine gastrointestinal tract having probiotic activity in animals. Probiotics are micro-organisms, either viable or dead, processed compositions of micro-organisms, their constituents such as proteins or carbohydrates, or purified fractions of bacterial ferments that beneficially affect a host.
The general use of probiotic bacteria is in the form of viable cells. However, it can be extended to non-viable cells such as killed cultures or compositions containing beneficial factors expressed by the probiotic bacteria. This may include thermally killed micro-organisms, or micro-organisms killed by exposure to altered pH or subjected to pressure. For the purpose of the present invention, "probiotics" is further intended to include the metabolites generated by the micro-organisms of the present invention during fermentation, if they are not separately indicated. These metabolites may be released to the medium of fermentation, or they may be stored within the micro-organism.
As used herein "probiotic" also includes bacteria, bacterial homogenates, bacterial proteins, bacterial extracts, bacterial ferment supernatants, and mixtures thereof, which perform beneficial functions to the host animal when given at a therapeutic dose.
It has been found that lactic acid bacteria of the genus Lactobacilli obtainable by isolation directly from resected and washed GI tract of mammals are adherent to the GI
tract following feeding of viable bacterial cells, and are also significantly imrnunomodulatory when fed to animals in viable, non-viable or fractionated form. Without being bound by theory, it is believed that Lactobacilli obtainable by isolation from resected and washed GI tract closely associate with the gut mucosal tissues. Without further being bound by theory, this is believed to result in the probiotic Lactobacilli of the present invention generating alternative host responses that result in its probiotic action. It has been found that probiotic bacteria obtainable by isolation from resected and washed GI tract can modulate the host's immune system via direct interaction with the mucosal epithelium, and the host's immune cells. This immunomodulation, in conjunction with the traditional mechanism of action associated with probiotic bacteria, i.e.
the prevention of pathogen adherence to the gut by occlusion and competition for nutrients, results in the Lactobacilli of the present invention being highly efficacious as a probiotic organism.
The Lactobacilli of the present invention, obtainable by isolation from resected and washed canine GI tract, have in vitro anti-microbial activity against a number of pathogenic bacterial strainslspecies. Without being bound by theory, it is believed that this in vitro anti-microbial activity is indicative of potential probiotic activity zn vivo in animals, preferably companion animals such as canines and felines. The lactic acid bacteria of the present invention preferably have in vitro anti-microbial activity against Salrr~orzella typhimuriuzn, Listeria nzonocytogenes, Listeria innocua or Esclzez°icia coli, more preferably a mixture of these strains, more preferably still, all of these strains.
Without being bound by theory, it is believed that the anti-microbial activity of the lactic acid bacteria of the present invention may be the result of a number of different actions by the lactic acid bacteria herein. It has previously been suggested in the art that several strains of bacteria isolated from faecal samples exert their probiotic effect in the GI
tract following oral consumption by preventing the attachment of pathogenic organisms to the gut mucosa by occlusion. This requires oral consumption of "live" or viable bacterial cells in order for a colony of bacteria to be established in the gut. However, it is believed that the Lactobacilli of the present invention, obtainable by isolation from resected and washed canine GI tract, whilst exerting some probiotic effect due to occlusion if given in a viable form, may deliver a substantial probiotic effect in either the viable or non-viable form due to the production during fermentation in vitro of a substance or substances that either inhibit the growth of or kill pathogenic micro-organisms, and/or alter the host animal's immune competence. This form of probiotic activity is desirable, as the bacteria of the present invention can be given as either viable or non-viable cultures or purified fermentation products and still deliver a beneficial therapeutic effect to the host animal.
Preferably, the lactic acid bacteria of the present invention are able to maintain viability following transit through the GI tract. This is desirable in order for live cultures of the bacteria to be taken orally, and for colonisation to occur in the intestines and bowel following transit through the oesophagus and stomach. Colonisation of the intestine and bowel by the lactic acid bacteria of the present invention is desirable for long-term probiotic benefits to be delivered to the host.
Oral dosing of non-viable cells or purified isolates thereof induces temporary benefits, but as the bacteria are not viable, they are not able to grow, and continuously deliver a probiotic effect ifa situ. As a result this may require the host to be dosed regularly in order to maintain the health benefits. In contrast, viable cells that are able to survive gastric transit in the viable form, and subsequently colonise by adhering to and proliferating on the gut mucosa are able to deliver probiotic effects continuously in sitz~.
Therefore, it is preferable that the lactic acid bacteria of the present invention maintain viability after suspension in a media having a pH of 2.5 for 1 hour. As used herein, "maintain viability" means that at least 25% of the bacteria initially suspended in the test media are viable using the plate count method known to those skilled in the art. Preferably, "maintain viability"
means that at least 50% of the bacteria initially suspended are viable. It is desirable for the lactic acid bacteria of the present invention to maintain viability following exposure to low pH as this mimics the exposure to gastric juices in the stomach and upper intestine in vivo following oral consumption in animals.
Furthermore, it is preferable that the lactic acid bacteria of the present invention have a growth of at least 66% whenin the presence of at least 0.5% porcine bile salts. Growth, as used herein is described in further detail in example 3. More preferably, the bacteria of the present invention have a growth of at least 33% when in the presence of at least 1%
porcine bile salts.
More preferably still, the bacteria of the present invention have a growth of 100% in the presence of 0.5% porcine bile salts. Without being bound by theory it is believed that the lactic acid bacteria of the present invention, capable of maintaining viability in the presence of at least 0.5%
porcine bile salts, are able to survive the conditions present in the intestine. This is thought to be a result of the addition of porcine bile to the culture medium mimicking the conditions of the intestine.
Further still, it is preferable that the lactic acid bacteria of the present invention have significant adhesion to gut epithelial cells izz vitro. As used herein, "significant adhesion" means at least 0.2% of the total number of lactic acid bacteria co-incubated with the epithelial cells in vitro adhere to the epithelial cells. More preferably, at least 0.3% of bacterial cells co-incubated adhere to epithelial cells in vitro. Without wishing to be bound by theory, it is believed that gut epithelial cell adherence in vitro is indicative of the lactic acid bacteria's ability to colonise the GI
tract of an animal in vivo.
Preferably, the strain of lactic acid bacteria according to the present invention is of a species selected from the group comprising Laet~bacillus murizzuslruzycinus, Lactobacillzzs crispatus, Lactobacillus acidophilus, Lactobacillus fernzentunz, Lactobacillus buchizeri, Lactobacillus reuteri, Lactobacillus lactis, or mixtures thereof, more preferably Lactobacillus murinuslruminus.
The 16s-23s intergenic polynucelotide sequence is known to those skilled in the art as the sequence of DNA in the bacterial genome that can be used in order to identify different species and strains of bacteria. This intergenic polynucelotide sequence can be determined by the method detailed below in example 4.
In a preferred embodiment of the present invention, the strain of lactic acid bacteria of the genus Lactobacilli, has a 16s-23s intergenic polynucleotide sequence that has at least 88%, preferably at least 90%, more preferably at least 95% homology with the polynucleotide sequence according to SEQ. ID NO. 1. More preferably, the strain of lactic acid bacteria according to the present invention has a 16s-23s polynucleotide sequence according to SEQ. ID
NO. 1. More preferably still, the strain of lactic acid bacteria according to the present invention is Lacotbacilli zzzurinuslrumizzus strain NCIMB 41194 (AHC1222,), or a mutant thereof.
In another preferred embodiment of the present invention, the strain of lactic acid bacteria of the genus Lactobacilli, has a 16s-23s intergenic polynucleotide sequence that has at least 88%, preferably at least 90%, more preferably at least 95% homology with the polynucleotide sequence according to SEQ. ID NO. 2. More preferably, the strain of lactic acid bacteria according to the present invention has a 16s-23s polynucelotide sequence according to SEQ. ID
NO. 2. More preferably still, the strain of lactic acid bacteria according to the present invention is Lacotbacilli znurinuslruminus strain NCIMB 41196 (AHC532,3), or a mutant thereof.
In another preferred embodiment of the present invention, the strain of lactic acid bacteria of the genus Lactobacilli, has a 16s-~3s intergenic polynucleotide sequence that has at least 88%, preferably at least 90%, more preferably at least 95% homology with the polynucleotide sequence according to SEQ. ID NO. 3. More preferably, the strain of lactic acid bacteria according to the present invention has a 16s-23s polynucelotide sequence according to SEQ_ ID
NO. 3. More preferably still, the strain of lactic acid bacteria according to the present invention is Lacotbacilli rnurinuslrurninus strain NCIMB 41197 (AHC6331), or a mutant thereof.
In another preferred embodiment of the present invention, the strain of lactic acid bacteria of the genus Lactobacilli, has a 16s-23s intergenic polynucleotide sequence that has at least 88%, preferably at least 90%, more preferably at least 95% homology with the polynucleotide sequence according to SEQ. ID NO. 4. More preferably, the strain of lactic acid bacteria according to the present invention has a 16s-23s polynucleotide sequence according to SEQ. ID
NO. 4. More preferably still, the strain of lactic acid bacteria according to the present invention is Lacotbacilli murinuslracnainus strain NCIMB 41195 (AHC3133), or a mutant thereof.
The strain of lactic acid bacteria of the genus Lactobacilli obtainable by isolation from resected and washed canine gastrointestinal tract can be used to deliver probiotic benefit following oral consumption in animals, preferably companion animals or humans.
This probiotic benefit generally maintains and improves the overall health of the animal. Non-limiting elements of animal health and physiology that benefit, either in therapeutically relieving the symptoms of, or disease prevention by prophylaxis include inflammatory disorders, immunodeficiency, inflammatory bowel disease, irritable bowel syndrome, cancer (particularly those of the gastrointestinal and immune systems), diarrhoeal disease, antibiotic associated diarrhoea, appendicitis, autoimmune disorders, multiple sclerosis, Alzheimer's disease, amyloidosis, rheumatoid arthritis, arthritis, joint mobility, diabetes mellitus, insulin resistance, bacterial infections, viral infections, fungal infections, periodontal disease, urogenital disease, surgical associated trauma, surgical-induced metastatic disease, sepsis, weight loss, weight gain, excessive adipose tissue accumulation, anorexia, fever control, cachexia, wound healing, ulcers, gut barrier infection, allergy, asthma, respiratory disorders, circulatory disorders, coronary heart disease, anaemia, disorders of the blood coagulation system, renal disease, disorders of the central nervous system, hepatic disease, ischaemia, nutritional disorders, osteoporosis, endocrine disorders, and epidermal disorders. Preferred are treatment of the gastrointestinal tract, including treatment or prevention of diarrhoea; immune system regulation, preferably the treatment or prevention of autoimmune disease and inflammation; maintaining or improving the health of the skin and/or coat system, preferably treating or preventing atopic disease of the skin;
ameliorating or reducing the effects of aging, including mental awareness and activity levels; and preventing weight loss during and following infection.
The treatment of the disorders disclosed above may be measured using techniques known to those skilled in the art. For example, inflammatory disorders including autoimmune disease and inflammation may be detected and monitored using in vivo immune function tests such as lymphocyte blastogenesis, natural killer cell activity, antibody response to vaccines, delayed-type hypersensitivity, and mixtures thereof. Such methods are briefly described herein, but well known to those skilled in the art.
1. Lymphocyte blastogenesis: This assay measures the proliferative response nz vatro of lymphocytes isolated from fresh whole blood of test and control animals to various mitogens and is a measure of overall T- and B-cell function. Briefly, peripheral blood mononucleocytes (PBMC) are isolated from whole blood by Ficoll-Hypaque density centrifugation methods known to those skilled in the art. The isolated PBMCs are washed twice in RPMI 1640 cell media supplemented with HEPES, L-glutamine and penicillin/streptomycin. The washed cells are resuspended in RPMI 1640, counted, and the cell density adjusted appropriately. The 2x105 cells are exposed to a range of concentrations (O.lpg/ml to 100~g/ml) of various mitogens, some examples of which include pokeweed mitogen (Gibco), phytohaemagglutinin (Gibco) and conconavalin A
(Sigma) in triplicate for 72 hours at 37°C and 5% COZ with 10% foetal bovine serum (Sigma). At 54 hours the cells are pulsed with 1 ~,Ci 3H-thymidine, and the cells harvested and scintillation counts read on a TopCount NXT at 72 hours.
2. Natural killer cell activity: As described in US6,310,090, this assay measures the an vitro effector activity of natural killer cells isolated from fresh whole blood of test and control animals. Natural killer cells are a component of the innate immune function of a mammal. Canine thyroid adenocarcinoma cells were used as target cells in assessing NK
cell cytotoxic activity. This cell line was previously shown to be susceptible to killing by canine NK cell. Target cells were cultured in a T75 flask with 20 mL minimum essential medium (MEM; Sigma Chem. Co., St. Louis, Mo.) supplemented with 10% fetal calf serum (FCS), 100 U/mL of penicillin and 100 pg/mL of streptomycin. When confluent, target cells were trypsinized, washed 3 times and resuspended to 5x105 cellslmL in complete medium (RPMI-1640+10% FCS+100 U/mL of penicillin+100 pg/mL of streptomycin). Triplicate 100 .p.L aliquots of the target cells were pipetted into 96-well U-bottom plates (Costar, Cambridge, Mass.) and incubated for 8 hours to allow cell adherence. Lymphocytes (effector cells; 100 .pL) isolated by Ficoll-Hypaque separation (as described above) were then added to the target cells to provide an effector/target cell (E:T) ratio of 10:1. After 10 hours of incubation at 37°C., 20 .~1 of a substrate containing .pg of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was added.
The mixture was incubated for 4 hours at 37°C. after which the unmetabolized MTT was removed by aspiration. The formazan crystals were dissolved by adding 200 ~,L
of 95%
ethanol. Optical density was measured at 570 nm using a microplate reader. The percentage of NK cell-specific lysis was calculated as follows:
Specific Cytotoxicity (%) = 100 x { 1- [(OD of target cells and effector cells - OD of effector cells)/(OD of target cells)]}
3. Antibody response to vaccines: The test subjects are given an array (up to

5) of vaccines after at least 12 weeks of probiotic or control feeding. The vaccines may be a mixture of novel and redundant vaccines. Non-limiting examples of vaccine arrays that may be used include mixtures of vaccines prepared by Fort Dodge Animal Health. Non-limiting examples of vaccines suitable for use herein include Canine distemper, adenovirus, coronavirus, parainfluenza, and parvovirus. The test subject's vaccine history will determine the vaccines to be used. The specific antibodies to the vaccines given are measured in blood for 3 weeks and the length and strength of response in control and probiotic feeding groups compared.
4. Delayed-type hypersensitivity: An irz vivo, non-invasive method of assessing immune system status. This test comprises an intradermal injection of the polyclonal mitogen Phytohemmaglutinin (PHA) in combination with sheep red blood cells a multivalent vaccine, histamine (100p.L of 0.0275 g/L Histamine Phosphate; Greer, Lenoir, NC), or PBS (100~,L of Phosphate Buffered Saline, 8.5 g/L; Sigma). The immune response to the antigen is recorded as skinfold thickness using calipers at time intervals of 0, 24, 48 and 72 hours post-injection. An increase in skinfold thickness is indicative of a greater hypersensitivity response that should be decreased by treatment with the bacteria of the present invention.
Additional methods for determining the effect of the Lactobacilli bacteria of the present invention are described in US6,133,323 and US6,310,090.
Furthermore, ameliorating the effects of age may be determined using dual x-ray absorptometry or CT scan for measuring body composition, including body fat mass, fat-free mass and bone mineral content. Similarly, this method may be used to determine anatomy changes such as weight loss or bone density in subjects following infection.
The Lactobacilli of the present invention may also be used in a method for reducing stress levels in companion animals. Concentrations of blood stress hormones including epineplrine, norepinephrine, dopamine, cortisol and C-reactive protein may be measured to determine stress levels and their reduction or maintenance. These hormones are recognized biomarkers of stress and can be readily measured using techniques known to those skilled in the art.

Further still, maintenance or improvement of the health of the skin and/or coat system of companion animals, including atopic disease of the skin, may be measured using skin and coat assessments conducted by two trained individuals. Examples of criteria examined during such assessments include:
a) Shedding index: A shedding index is assigned to each test subject by collecting hair produced during a standardized brushing session. The hair is retained and weighed, and control and test subjects compared.
b) Subjective skin/coat evaluations: Trained panelists subjectively evaluate skin and coat condition by assessing shedding, dander, shine, uniformity, softness and density.
c) Skin functional assessment: The barrier function of the skin may be assessed by wiping the skin surface with an acetone-soaked gauze. This technique effectively disrupts the skin barrier by removing single cell layers and associated lipid fractions of the stratum corneum. Barrier disruption is quantified by measuring the increase in transepidernzal water loss (TEWL) and the degree of redness of the insulted site using methods known to those skilled in the art. Redness (erythema) scores are obtained using the previously described camera and lighting system. TEWL readings and redness scores are obtained immediately before and after disruption, and at five and 24-hour endpoints to assess the protective and healing properties of skin.
The treatment or prevention of diarrhoea in companion animals may be measured using stool scores. Stools scores may be recorded daily according to the following guidelines and control and test groups compared before and after feeding with the bacteria according to the present invention.
Score:5 Extremely This stool is hard and does not stick to surfaces. Stool will roll when pushed. No indentations are made when stool is picked up. Stool is often defecated in groups of individual stools instead of one complete unit. The stool maintains original shape after collection.
Score: 4 Firm (Ideal stool) This stool is firm, well shaped, and cylindrical. This stool does not break apart easily when picked up. This stool may leave residue on surfaces and gloves. This stool is often defecated as one unit. The stool maintains original shape after collection.
Score: 3 Soft, with shape This stool is soft, however there are definite shapes. This stool will break apart easily and will definitely leave residue on surfaces and gloves. The stool often loses original shape after collection. This stool is often present with another score but can comprise whole stool sample.

Score: 2 Soft, without shape This stool is soft and will have no cylindrical shape. The shap a often associated with a "2" is a "cow patty" shape. This stool will lose the original shape when collected and will definitely leave residue on surfaces and gloves. This stool score is often present with another score but can comprise the whole stool sample. This stool sample may spread over an area of several inches.
Score: 1 Liquid This stool score will always resemble liquid and there may or may not be particulate matter present. This stool will often be defecated in groups of pilcs instead of one complete unit.
Mucous is often present with this stool sample. This stool sarriple is very difficult to collect and residue is always left on surfaces and gloves. This stool sample may spread over an area of several inches.
In addition, other observations are also recorded, including: blood in stool;
foreign object in stool; or mucous in stool.
Furthermore, the treatment of gastrointestinal infection in companion animals may comprise improving microbial ecology of companion animals. Improving the microbial ecology of companion animals preferably comprises reducing the levels of pathogenic bacteria in the faeces of companion animals. The levels of pathogenic bacteria present in the faeces of companion animals may be enumerated using the standard plate count method known to those skilled in the art. More preferably, the pathogenic bacteria are selected from the group consisting of Clostridia, Esclzericlzia, Salzzzozzella, bacteriodes and mixtures thereof.
Non-limiting examples of suitable strains of pathogenic bacteria include C. pe~friszg-ens, C.
difficile, Esclaericia coli, Salzzzozzella typhimurium and mixtures thereof.
The method of use of the bacteria of the present inventi on may also include the treatment, either prophylactic or therapeutic of the urinary tract of mammals, preferably companion animals.
Non-limiting examples of urinary tract treatment include treatment or prevention of urinary tract infections, treatment or prevention of kidney disease, including kidney stones, treatment or prevention of bladder infections and the like. Without being bound by theory, it is believed that the Lactobacilli bacteria of the present invention are useful in preventing these ailments as a result of their ability to degrade oxalic acid, as demonstrated azz VatYO. Oxalic acid is a by-product of urinary metabolism that can form insoluble precipitates that result in lcidney, bladder and other urinary tract infections. By degrading oxalic acid, and therefore potentially preventing its.
precipitation and build up in the urinary tract, the bacteria of the present invention may treat and prevent infections and other ailments of the urinary tract. Oxalic acid degradation may be measured ire vitro using the Oxalic acid test lcit cat # 755699 commercially available from Boehringer Mannheim/R-Biopharm.

The Lactobacilli of the present invention may be used in a method for improving or maintaining the health of companion animals comprising improving fibre digestion. Improving fibre digestion is desirable as it promotes the growth of said probiotic bacteria, as well as beneficial endogenous microflora, which aid in the suppression of some potentially pathogenic bacteria. In addition, a decrease in the amount of toxic metabolites and detrimental enzymes that result from colonic fermentation has been documented in humans (Tomomatsu, H.
"Health effects of oligosaccharides", (1994) Food Technol, 48, 61-65). Fibre digestion may be determined using the method described in Vickers et al. (2001), "Comparison of fermentation of selected fructooligosaccharides and othe rfiber substrates by canine colonic microflora", AnZ. J. Uet. Res.
61 (4), 609-615, with the exception that instead of inoculating using diluted fecal samples each experiment used pure cultures of the bacterial strains of interest.
The method of use of the lactic acid bacteria of the present invention typically involves oral consumption by the animal. Oral consumption may take place as part of the normal dietary intake, or as a supplement thereto. The oral consumption typically occurs at least once a month, preferably at least once a week, more preferably at least once per day. The lactic acid bacteria of the present invention may be given to the companion animal in a therapeutically effective amount to maintain or improve the health of the animal, preferably a companion animal. As used herein, the term "therapeutically effective amount" with reference to the lactic acid bacteria, means that amount of the bacteria sufficient to provide the desired effect or benefit to a host animal in need of treatment, yet low enough to avoid adverse effects such as toxicity, irritation, or allergic response, commensurate with a reasonable benefit/rislc ratio when used in the manner of the present invention. The specific "therapeutically effective amount" will vary with such factors as the particular condition being treated, the physical condition of the user, the duration of the treatment, the nature of concurrent therapy (if any), the specific dosage form to be used, the carrier employed, the solubility of the dose form, and the particular dosing regimen.
Preferably, the lactic acid bacteria are given to the companion animal at a dose of from 1.OE+04 to 1.OE+14 CFU per day, more preferably from 1.OE+06 to 1.OE+12 CFU
per day. The composition preferably may contain at least 0.001% of from 1.OE+04 to 1.OE+12 CFUIg of the lactic acid bacteria of the genus Lactobacilli obtainable by isolation from resected and washed canine GI tract. The lactic acid bacteria can be given to the animal in either viable form, or as killed cells, or distillates, isolates or other fractions of the fermentation products of the lactic acid bacteria of the present invention, or any mixture thereof.
Preferably, the lactic acid bacteria, or a purified or isolated fraction thereof, are used to prepare a composition intended to maintain or improve the health of an animal.
As indicated above, the composition may be part of the normal dietary intake, or a supplement. Where the composition comprises part of the normal dietary intake, the composition may be in the form of a dried animal food such as biscuits or kibbles, a processed grain feed, a wet animal food, yoghurts, gravies, chews, treats and the like.
Such compositions may comprise further components. Other components are beneficial for inclusion in the compositions used herein, but are optional for purposes of the invention. For example, food compositions are preferably nutritionally balanced. In one embodiment, the food compositions may comprise, on a dry matter basis, from about 20% to about 50%
crude protein, preferably from about 22% to about 40% crude protein, by weight of the food composition. The crude protein material may comprise any material having a protein content of at least about 15%
by weight, non-limiting examples of which include vegetable proteins such as soybean, cotton seed, and peanut, animal proteins such as casein, albumin, and meat tissue.
Non-limiting examples of meat tissue useful herein include fresh meat, and dried or rendered meals such as fish meal, poultry meal, meat meal, bone meal and the like. Other types of suitable crude protein sources include wheat gluten or corn gluten, and proteins extracted from microbial sources such as yeast.
Furthermore, the food compositions may comprise, on a dry matter basis, from about 5%
to about 35% fat, preferably from about 10% to about 30% fat, by weight of the food composition. Further still, food compositions comprising the lactic acid bacteria of the present invention may also comprise from about 4% to about 25% total dietary fibre.
The compositions may also comprise a multiple starch source as described in W099/51108.
The compositions of the present invention may further comprise a source of carbohydrate.
Grains or cereals such as rice, corn, milo, sorghum, barley, alfalfa, wheat, and the like are illustrative sources. In addition, the compositions may also contain other materials such as dried whey and other dairy by products.
The compositions comprising the bacteria of the present invention may also comprise a prebiotic. "Prebiotic" includes substances or compounds that are fermented by the intestinal flora of the pet and hence promote the growth or development of lactic acid bacteria in the gastro-intestinal tract of the pet at the expense of pathogenic bacteria. The result of this fermentation is a release of fatty acids, in particular short-chain fatty acids in the colon.
This has the effect of reducing the pH value in the colon. Non-limiting examples of suitable prebiotics include oligosaccharides, such as inulin and its hydrolysis products commonly known as fructooligosaccharides,galacto- oligosaccarides, xylo-oligosaccharides or oligo derivatives of starch. The prebiotics may be provided in any suitable form. For example, the prebiotic may be provided in the form of plant material which contains the fiber. Suitable plant materials include asparagus, artichokes, onions, wheat or chicory, or residues of these plant materials. Alternatively, the prebiotic fiber may be provided as an inulin extract, for example extracts from chicory are suitable. Suitable inulin extracts may be obtained from Orafti SA of Tirlemont 3300, Belgium under the trade mark "Raftiline". For example, the inulin may be provided in the form of Raftiline (g) ST which is a fine white powder which contains about 90 to about 94% by weight of inulin, up to about 4% by weight of glucose and fructose, and about 4 to 9% by weight of sucrose.
Alternatively, the fiber may be in the form of a fructooligosaccharide such as obtained from Orafti SA of Tirlemont 3300, Belgium under the trade mark "Raftilose". For example, the inulin may be provided in the form o Raftilose (g) P95. Otherwise, the fructooligosaccharides may be obtained by hydrolyzing inulin, by enzymatic methods, or by using micro-organisms.
For dried pet foods a suitable process is extrusion cooking, although baking and other suitable processes may be used. When extrusion cooked, the dried pet food is usually provided in the form of a kibble. If a prebiotic is used, the prebiotic may be admixed with the other ingredients of the dried pet food prior to processing. A suitable process is described in European patent application No 0850569. If a probiotic micro-organism is used, the organism is best coated onto or filled into the dried pet food. A suitable process is described in European patent publication Number EP 0 862 863.
For wet foods, the processes described in US patents 4,781,939 and 5,132,137 may be used to produce simulated meat products. Other procedures for producing chunk type products may also be used; for example cooking in a steam oven. Alternatively, loaf type products may be produced by emulsifying a suitable meat material to produce a meat emulsion, adding a suitable gelling agent, and heating the meat emulsion prior to filling into cans or other containers. Typical wet food compositions may comprise from about 5% to about 15% protein, from about 1% to about 10% fat, and from about 1% to about 7% fibre. Non-limiting ingredients that may be used in wet food compositions include chicken, turkey, beef, whitefish, chicken broth, turkey broth, beef broth, chicken liver, brewers rice, corn grits, fish meal, egg, beet pulp, chloride, flax meal, Iamb, beef by-products, chicken by-products and mixtures thereof.
In another embodiment, supplement compositions such as biscuits, chews, and other treats may comprise, on a dry matter basis, from about 20% to about 60%
protein, or from about 22% to about 40% protein, by weight of the supplement composition. As another example, the supplement compositions may comprise, on a dry matter basis, from about 5% to about 35% fat, or from about 10% to about 30% fat, by weight of the supplement composition.
Food and supplement compositions intended for use by canines or felines are commonly known in the art.
The pet foods may contain other active agents such as long chain fatty acids and zinc.
Suitable long chain fatty acids include alpha-linoleic acid, gamma linolenic acid, linoleic acid, eicosapentanoic acid, and docosahexanoic acid. Fish oils are a suitable source of eicosapentanoic acids and docosahexanoic acid.
Borage oil, blackcurrent seed oil and evening primrose oil are suitable sources of gamma linolenic acid. Safflower oils, sunflower oils, corn oils and soy bean oils are suitable sources of linoleic acid. These oils may also be used in the coating substrates referred to above. Zinc may be provided in various suitable forms, for example as zinc sulfate or zinc oxide.
Further, many ingredients commonly used in pet foods are sources of fatty acids and zinc. It has been observed that the combination of chicory, as a source of prebiotic, with a linoleic-acid rich oil, such as soy bean oil, provides unexpected benefits, suggestive of a synergistic effect.
Where the composition is in the form of a gravy, the composition preferably comprises at least 10% of a broth, or stock, non-limiting examples of which include vegetable beef, chicken or ham stock. Typical gravy compositions may comprise from about 0.5% to about 5%
crude protein, from about 2% to about 5% crude fat, and from about 1% to about 5%
fibre.
Further non-limiting examples of supplements suitable for use herein include powders, oil suspensions, milk-based suspensions cheeses, and pills or capsules. Where the composition is in the form of a pill, suitable binding agents are required to maintain the pill in a solid, pressed form.
Non-limiting examples of suitable binding agents include the natural gums such as xanthan gum, pectins, lecithins, alginates and others known to those skilled in the art.
Where the composition is in the form of a capsule, the composition is preferably encapsulated using technologies known to those skilled in the art. Non-limiting examples of suitable encapsulation materials include polyvinyl alcohol (PVA), polyvinylpyrrolidone (PVP), alginates, and gelatin.
Yoghurt-based compositions may comprise from about 1% to about 5% protein, from about 10% to about 20%
carbohydrate, from about 1% to about 5% fibre, from about 1% to about 5% fat and from about 50% to about 90% liquid carrier such as milk.
Examples The following examples are provided to illustrate the invention and are not intended to limit the scope thereof in any manner.
Example 1: Isolation of Lactic Acid bacteria from canine GI tracts Canine intestinal samples were obtained from healthy dogs presenting at the local veterinarians for owner initiated and approved euthanasia. All animals were healthy and disease-free. The colon, mid-colon, caecum and ileum of each dog were dissected in order to expose the mucosa.
Supernatants were removed following agitation of the mucosal tissue (vortexed for 1 minute) and following mechanical homogenisation of the tissue. Each supernatant was plated on de Mann Rogosa Sharpe (MRS) agar. These were incubated anaerobically, using the Anerocult GasPak system, for 48 hours at 37°C. Isolated colonies from the plates were re-streaked onto either MRS and again grown anaerobically under the same conditions. Isolated colonies were re-streaked a further 4 times in order to purify a single strain. Colony morphology and m>ECroscopic appearance were assessed. Suitable isolates were tested for Gram reaction and catalase activity.
Identification of gram positive, catalase negative rods was performed using API testing (API
SOCHL, BioMerieux). Harvested cells were washed twice with O.OSM phosphate buffer (pH 6.5) and cysteine-HCl (500 mg/1) followed by sonication. Centrifugation removed cellular debris.
Supernatants were incubated with NaF (6 mg/ml) and Na iodoacetate (10 mg/ml) for 3 0 minutes at 37°C. The reaction was stopped by incubation with hydroxylamine HCl (pH6.5) for 1 0 minutes at room temperature. Colour development was monitored following the addition of HCl (4M), FeC13.6H20 (5% (w/v) in O.1M HCl) and fructose-6-phosphate (Na salt).
Formation of acetyl phosphate from fructose-6-phosphate was evidenced by the reddish colour formed by the ferric chelate of its hydroxymate.
Fifty-eight (58) lactic acid bacterial strains were isolated from resected and washed canine GI tract, of which twenty-two (22) were found to be of the genus Lactobacilli.
Example 2: Screening for Anti-Microbial Activity Each of the isolated lactic acid bacterial strains was incubated anaerobically in MRS
broth. 2p1 of each culture were spotted onto MRS agar plates and incubated ana.erobically overnight. Salmonella typhimuriunZ, Listeria nZOnocytogenes, Listeria iranocua and ~schericia coli 0157H45 were pre-grown overnight and 100p.1 inoculated into molten agar (1% v/v). This indicator culture was poured onto the surface of the inoculated MRS plates.
Following overnight incubation, zones of inhibition around the probiotic colony were measured. All experiments were performed in duplicate on three separate occasions. In addition, incorporating the buffer 2%
betaglycerophosphate into the agar enabled assessment of the contribution of acid pro duction to the observed pathogen inhibition in vitro.
The data presented in figures l, 2, 3 and 4 clearly demonstrate that the lactic acid bacteria strains of the present invention obtainable by isolation from resected and washed canine GI tract have significant anti-microbial activity in vitro, indicative of potential probiotic activity_ Example 3: ha Vitro Measures of Survival and Colonisation pH Tolerance Bacterial cells were harvested from overnight cultures, washed twice in phosphate buffer (pH 6.5) and resuspended in MRS/TPY broth adjusted with 1M HCl to pH 2.5. The cells were incubated anaerobically at 37°C and their survival measured at intervals of 0, 30, 60, 12 0, 240 and 360 minutes using the plate count method known to those skilled in the art.

Figure 5 clearly demonstrates that nine strains were not pH 2.5 resistant over 1 hour, and the 49 strains were resistant to pH 2.5 over 1 hour. Table 2 summarises this data per strain.
Strain designationStarting Conc.Conc. After Viability (%) hours AHC 1211 2.60E+08 2.OOE+08 76.92 AHC 1212 4.20E+08 S.OOE+08 119.05 AHC1221 3.50E+08 3.10E+08 88.57 AHC1213 9.50E+08 3.OOE+08 31.58 AHC 1222 2.3 OE+09 1.3 OE+08 5.65 AHC2321 1.20E+08 1.70E+04 0.01 AHC2322 2.OOE+07 1.40E+04 0.07 AHC2121 4.70E+08 4.OOE+05 0.09 AHC2211 2.3 OE+08 4.1 OE+04 0.02 AHC2212 2.80E+08 3.80E+04 0.01 AHC3131 2.70E+08 2.70E+08 100.00 AHC3132 4.OOE+08 4.50E+08 112.50 AHC3133 3.00E+08 2.70E+08 90.00 AHC3231 2.60E+08 2.OOE+08 76.92 AHC3311 2.50E+08 2.70E+08 108.00 AHC3312 2.20E+08 3. l0E+08 140.91 AHC3313 9.OOE+07 2E+08 222.22 AHC4221 2.10E+08 1 0.00 AHC5113 1. l0E+09 1.OOE+08 9.09 AHC5121 6.OOE+08 3.SOE+08 58.33 AHC5122 2.30E+09 9.OOE+08 39.13 AHC5123 9.50E+08 5.50E+08 57.89 AHC5131 4.50E+08 4.OOE+08 66.7 AHC5211 S.OOE+08 S.OOE+08 40 AHC5212 8.50E+08 6.OOE+08 52.9 AHC5213 6.50E+08 4.OOE+08 35.4 AHC5222 l .00E+08 1.OOE+03 0.000001 AHC5223 l.lOE+09 l.lOE+09 77.3 AHC5241 6.OOE+08 3.OOE+08 25 AHC5243 2.50E+08 2.60E+08 68 AHC5323 8.OOE+08 3.50E+08 10 AHC5331 3.OOE+08 2.OOE+08 28.3 AHC5333 9.50E+08 3.40E+08 13.7 AHC5342 4.OOE+08 3.OOE+08 42.5 AHC6211 S.OOE+08 8.50E+08 38 AHC6212 2.20E+08 2.OOE+05 4.5E-07 AHC6241 l .50E+08 8.OOE+07 40 AHC6311 2.80E+08 4.OOE+08 85.7 AHC6312 S.OOE+08 6.50E+08 32 AHC6321 3.50E+08 4.OOE+08 200 AHC6322 1.OOE+08 6.OOE+08 350 AHC6331 4.50E+08 4.OOE+08 3.8 AHC6332 S.OOE+08 9.OOE+08 50 AHC6341 6.OOE+08 2.OOE+08 40 Table 2 Bile Resistance The bacterial strains were streaked onto MRS agar supplemented with porcine bile (Sigma) at 0.5%, 1% and 5% (w/v). Plates were incubated at 37°C under anaerobic conditions and the growth recorded after 48 hours. Growth was compared with control plates by an experienced observer, and the growth of colonies described as:
Negative (0) - no growth;
+ (1) - Hazy translucent growth (<33% control-plates with 0% bile);
++ (2) - Definite growth but not as good as controls (>33% but <66%);
+++ (3) - Growth equivalent to controls (>66%).
Once the growth of the colonies in the presence of bile salts is compared with the controls, the growth descriptors are given numerical values of 0, 1, 2 or 3 (-; +; ++, -I-H-respectively), and then expressed as a percentage, where 3 represents 100%.
Figure 6 demonstrates that the Lactobaeillus of the present invention clearly demonstrate a resistance to bile salts, being able to grow and forni colonies at a level of at least 66% in most instances when exposed to 0.5% bile salts.
Gut Epithelial Cell Adhesion The human epithelial cell line, HT-29, was used to assess the adhesion properties of selected strains. Epithelial cells were routinely cultured as a monolayer in 75 cm2 tissue culture flasks at 37oC in a humidified atmosphere containing 5% COZ in Dulbecco's Minimal Essential Media (DMEM) containing 10% foetal calf serum (FCS), pen/strep, glutamine and fungizone. For experimental purposes, the epithelial cells were seeded at a concentration of 5 x 105 cells/ml (3 mls total volume) per well in 6 well culture plates (Sarstedt). Following incubation for 7 days, to allow differentiation, the epithelial monolayers were washed with antibiotic-free medium containing 10% FCS. Bacterial suspensions plus/in antibiotic-free DMEM were added to each well and the cells incubated for 90 minutes at 37°C. Following incubation, the monolayers were washed three times with PBS. The epithelial cells were lysed in deionised H20 and the number of adherent bacteria enumerated using the plate count method known to those skilled in the art.
Adhesion was expressed as a percentage of the number of bacteria initially plated.
As can be seen from Figure 7, the Lactobacilli strains deposited with the NCIMB under deposition numbers NCIMB 41194, NCIMB 41195, NCIMB 41196 and NCIMB 41197 adhere to HT-29 gut epithelial cells at levels of at least 0.2%.
Example 4: 16s-23s Intergenic Polynucleotide Sequencing Lactobacilli colonies were picked from an Agar plate and resuspended in IX PCR
buffer, heated at 96°C for 5 minutes, frozen at -70°C for 5-10 minutes, thawed and an aliquot was added to a PCR eppendorf tube. PCR was performed using the intergenic spacer (IGS) primers, IGS L:
5'-GCTGGATCACCTCCTTTC-3' and IGS R: 5'-CTGGTGCCAAGGCATCCA-3'. The cycling conditions were 96°C for 1 min (1 cycle), 94°C for 30 sec, 53°C for 30 sec, 72°C for 30 sec (28 cycles). The PCR reaction contained 5 ~1 of DNA, PCR buffer (Bioline, UK), 0.2 mM
dNTPs (Roche, UK), 0.4 ~M IGS L and R primer (150ng/50 p,l) (MWG Biotech, Germany) and Bioline Taq polymerase (0.6 units). The PCR reactions were performed on a Hybaid thermocycler. The PCR products (8 ~1) were ran alongside a molecular weight marker 0X174 Hae III, Promega) on a 2 % agarose EtBr stained gel in TAE, to determine their IGS profile.
Using the same primers as above, the intergenic spacer (IGS) DNA was sequenced for the 4 canine Lactobacilli strains using methods known to those skilled in the art.
Following sequencing, the obtained sequences for the four deposited strains were compared with the on-line sequence database "BLAST", available at http://www.ncbi.nlm.nih.~ov/BLAST/ for homology with other deposited bacterial 16s-23s sequences. The closest matches for AHC 1222, 3133, 5323 and 6331 (NCIMB 41194, 41195, 41196 and 41197 respectively) was the strain Lactobacillus ruminis AF080103.
However several major differences between the AHC strains and the Lactobacillus f°mrainis strain exist at the spacer region, resulting in a homology score of 87%, and a BLAST score of at least 170.
Example 5: Example Compositions Examples 1 to 4 are examples of dried kibble compositions comprising the probiotic Lactobacilli of the present invention.
Ingredient Percentage on a weight Basis Ex.l Ex.2 Ex.3 Ex.4 Cereal grains To 100 To 100 To 100 To 100 Poultry by-product 43.5 40 45 35 meal Poultry fat 1.28 1.02 1.16 1.35 Egg product 2.4 2.1 2.5 2.2 Chicken liver meal 1.0 1.0 1.0 1.0 Brewer's dried yeast 1.0 1.0 1.0 1.0 Monosodium phosphate 1.0 1.0 1.0 1.0 Calcium carbonate 0.8 0.8 0.8 0.8 Potassium chloride 0.6 0.6 0.6 0.6 Vitamins 0.4 0.4 0.4 0.4 Choline chloride 0.3 0.3 0.3 0.3 Minerals 0.3 0.3 0.3 0.3 DL-Methionine 0.1 0.1 0.1 0.1 Sodium Chloride 0.03 0.03 0.03 0.03 Probiotic (1 x 10' 1 0.5 - 0.6 cfu/g NCIMB
41194 in sunflower oil) Probiotic (1 x 101 - 0.5 1 0.4 cfu/g NCIMB
41197 in sunflower oil) Examples 5 to 7 are examples of wet pet food compositions comprising the probiotic Bifidobacteria globosunz of the present invention.
Ingredient Percentage on a weight Basis Ex. 5 Ex. 6 Ex. 7 Water To 38 To 47 To 50 Poultry Liver To 25 To 20 To 15 Poultry Products 25 20 20 Brewers Rice 5 7 10 Egg Product 3 2.5 1.5 Poultry Fat 2.9 3.0 3.2 Chicken Stock 0.6 0.7 0.9 Taurine 0.1 0.1 0.1 Vitamins 0.05 0.1 0.1 Minerals 0.05 0.1 0.1 Probiotic (1 x 10' 4 5 6 cfu/g NCIMB
41195) Examples 8 to 10 are examples of yoghurt supplement compositions comprising the probiotic Bifidobacteria globosunz of the present invention.
Ingredient Percentage on a weight Basis Ex. 8 Ex. 9 Ex. 10 Milk 38 42 48 Sugar 12 12 10 Modified Starch 1.0 0.8 O.S

Prebiotic 0.25 0.3 0.5 Probiotic (1 x 10~ 4 5 6 cfu/g NCIMB
41196) While particular embodiments of the present invention have been illustrated and described, it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

P149& Lacto Sequences.ST25 SEQUENCE LISTING
<110> The IAMS CompanY
Alimentary Health Ltd Boileau, Thomas ceddia, Michael Collins, john Davenport, Gary Kiely, Barry 0'Mahony, Loam Sunvold, Greg Tetrick, Mark Vickers, Robert <120> Canine Probiotic Lactobacilli <130> P149&
<140> Not yet assigned <141> 2004-12-19 <160> 6 <170> Patentln version 3.1 <210> 1 <211> 231 <212> DNA
<213> Lactobacillus murinus <220>
<221> misc_feature <222> (230)..(230) <223> n is a, g, c or t <400> 1 atcgaccgcc ttttcgtgaa ctttgtttag ttttgagag g tctactctca aacttgttct 60 ttgaaaacta gataatatct tttatttctt tgttaattaa aataaccgag aacaccgcgt 120 tttaaagagt ttaaaacatt aatgtttaat cgctaaact c ataaccatta tcgtaagata 180 atataggtta agttattaag ggcgcatggt ggatgcctt g gccaccagan a 231 <210> 2 <211> 234 <212> DNA
<213> Lactobacillus murinus <220>
<221> misc_feature <222> (7)..(7) <223> n is a, g, c or t <400>

atttcgnaccgccttttcgtaaactttgtttagttttgagaggtctactctcaaacttgt 60 tctttgaaaactagataatatcttttatttctttgttaattaaaataaccgagaacaccg 120 cgttttaaagagtttaaaacattaatgtttaatcgctaaactcataaccattatcgtaag 180 ataatataggttaagttattaagggcgcatggtggatgc ttggccaccagaga 234 c <210> 3 P149& Lacto Sequences.5T25 <211> 234 <212> DNA
<213> Lactobacillus murinus <220>
<221> misc_feature <222> (233)..(233) <223> n is a, g, c or t <400> 3 atttcgaccg cctttaccgt gaactttgtt tagttttgag aggtctactc tcaaacttgt 60 tctttgaaaa ctagataata tcttttattt ctttgttaat taaaataacc gagaacaccg 120 cgttttaaag agtttaaaac attaa~tgttt aatcgctaaa ctcataacca ttatcgtaag 180 ataatatagg ttaagttatt aaggg c gcat ggtggatgcc ttggccacca gana 234 <210> 4 <211> 235 <212> DNA
<213> Lactobacillus murinus <220>
<221> misc_feature <222> (226)..(226) <223> n is a, g, c or t <220>
<221> misc_feature <222> (234)..(234) <223> n is a, g, c or t <400>

atttcgaaccgcctttaccgtgaactttgtttagttttgagaggtctact ctcaaacttg60 ttctttgaaaactagataatatcttttatttctttgttaattaaaataac cgagaacacc120 gcgttttaaagagtttaaaacattaatgtttaatcgctaaactcataacc attatcgtaa180 gataatataggttaagttattaaggg tggtggatgccttggncacc agana 235 cgca <210> 5 <211> 18 <212> DNA
<213> Artificial <220>
<223> artificial <400> 5 gctggatcac ctcctttc 18 <210> 6 <211> 18 <212> DNA
<213> Artificial <220>
<223> artificial Z

P149& Facto Sequences.ST25 <400> 6 ctggtgccaa gg catcca 18

Claims (45)

1. A strain of lactic acid bacteria of the genus Lactobacilli obtainable by isolation from resected and washed canine gastrointestinal tract having probiotic activity.

2. The strain according to claim 1 having the ability to survive and colonise the gastrointestinal tract of a companion animal.

3. The strain according to claims 1 or 2 having at least 66% growth when cultured in the presence of 0.5% bile salts.

4. The strain according to any one of claims 1 to 3 able to maintain viability following 1 hour at pH 2.5.

5. The strain according to any one of the preceding claims wherein the strain is a species selected from the group consisting of the species Lactobacillus murinus/ruminus, Lactobacillus crispatus, Lactobacillus acidophilus, Lactobacillus fermentum, Lactobacillus buchneri, Lactobacillus reuteri, Lactobacillus lactis, or mixtures thereof.

6. The strain according to claim 5 wherein the strain is of the species Lactobacillus murinus/ruminus.

7. The strain according to any one of the preceding claims having a 16s-23s intergenic polynucleotide sequence having at least 88% homology with a sequence selected from SEQ ID NO. 1, SEQ. ID NO. 2, SEQ. ID NO. 3, or SEQ. ID NO. 4.

8. The strain according to claim 7, wherein said strain is selected from Lactobacillus murinus/ruminus strain AHC1222, Lactobacillus murinus/ruminus strain AHC5323, Lactobacillus murinus/ruminus strain AHC6331, Lactobacillus murinus/ruminus strain AHC3133 or a mutant thereof.

9. The strain according to claim 8 wherein the mutant is a natural, genetically modified or induced mutant.

10. The strain according to claim 2 wherein the companion animal is a dog or a cat.

11. A strain of the genus Lactobacilli obtainable by isolation from resected and washed canine gastrointestinal tract for maintaining or improving the health of a companion animal.

12. The strain according to claim 11 wherein the strain is selected for the ability to survive and colonise the gastrointestinal tract of companion animals.

13. The strain according to claims 11 or 12 wherein the strain has at least 66% growth when cultured in the presence of 0.5% bile salts.

14. The strain according to any one of claims 11 to 13 wherein the strain is able to maintain viability following 1 hour at pH 2.5.

15. The strain according to any one of claims 11 to 14 wherein the strain is selected from the group consisting of the species Lactobacillus murinus/ruminus, Lactobacillus crispatus, Lactobacillus acidophilus, Lactobacillus fermentum, Lactobacillus buchneri, Lactobacillus reuteri, Lactobacillus lactis, or mixtures thereof.

16. The strain according to claim 15 wherein the strain is of the species Lactobacillus murinus/ruminus.

17. The strain according to any one of the claims 11 to 16 having a 16s-23s intergenic polynucleotide sequence having at least 88% homology with a sequence selected from SEQ ID NO. 1, SEQ. ID NO. 2, SEQ. ID NO. 3, or SEQ. ID NO. 4.

18. The strain according to claim 17, wherein said strain is selected from Lactobacillus murinus/ruminus strain AHC1222, Lactobacillus murinus/ruminus strain AHC5323, Lactobacillus murinus/ruminus strain AHC6331, Lactobacillus murinus/ruminus strain AHC3133 or a mutant thereof.

19. The strain according to claim 18 wherein the mutant is a natural, genetically modified or induced mutant.

20. The strain according to any one of claims 11 to 19 for treating conditions selected from the regulation of the immune system of companion animals, maintaining or improving the health of the skin and/or coat system of companion animals, ameliorating or reducing the effects of aging in companion animals, preventing weight loss during and following infection in pets, treating or preventing gastrointestinal infection in companion animals, treating or preventing urinary tract ailments in companion animals, or mixtures therof.

21. The strain according to claim 20 for the regulation of the immune system of companion animals comprising treating or preventing autoimmune disease in companion animals, treating or preventing inflammation in companion animals, or mixtures thereof.

22. The strain according to claim 20 for maintaining or improving the health of the skin and/or coat system of companion animals comprising treating or preventing atopic disease of the skin of companion animals.

23. The strain according to claim 20 for treating or preventing gastrointestinal infection in companion animals comprising improving microbial ecology of companion animals, reducing the levels of pathogenic bacteria in the faeces of companion animals or mixtures thereof.

24. The strain according to claim 23 wherein said pathogenic bacteria are selected from the group consisting of Clostridia, Escherichia, Salmonella, or mixtures thereof.

25 25. The strain according to claim 20 for treating or preventing urinary tract ailments in companion animals wherein said urinary tract ailment comprises urinary tract infection, kidney stones or mixtures thereof.

26. The strain according to claim 25 wherein said probiotic Lactobacilli increase the degradation of oxalic acid in vitro.

27. The strain according to claim 11 for increasing fibre digestion in companion animals.

28. The strain according to claim 11 for reducing stress levels in companion animals.

29. The strain according to claim 28 wherein said stress levels are measured by determining the level of stress hormones selected from the group consisting of epinephrine, norepinephrine, dopamine, cortisol, C-reactive protein and mixtures thereof.

30. The strain according to any one of claims 11 to 29 wherein the strain is fed to an animal in any amount from 1.0E+04 to 1.0E+12 CFU/animal per day.

31. The strain according to any one of claims 11 to 30 wherein the companion animal is a dog or a cat.

32. A composition comprising a strain of lactic acid bacteria of the genus Lactobacilli obtainable by isolation from resected and washed canine gastrointestinal tract having probiotic activity and a carrier.

33. The composition according to claim 32 wherein the strain is selected for the ability to survive and colonise the gastrointestinal tract of pets.

34. The composition according to claims 32 or 33 wherein the strain has at least 66% growth when cultured in the presence of 0.5% bile salts.

35. The composition according to any one of claims 32 to 34 wherein the strain is able to maintain viability following 1 hour at pH 2.5.

36. The composition according to any one of claims 32 to 35, wherein the strain is a species selected from the group consisting of the species Lactobacillus murinus/ruminus, Lactobacillus crispatus, Lactobacillus acidophilus, Lactobacillus fermentum, Lactobacillus buchneri, Lactobacillus reuteri, Lactobacillus lactis, and mixtures thereof.

37. The composition according to claim 36 wherein the strain is of the species Lactobacillus murinus/ruminus.

38. The composition according to any one of claims 32 to 37 wherein the strain has a 16s-23s intergenic polynucleotide sequence having at least 88% homology with a sequence selected from SEQ ID NO. 1, SEQ. ID NO. 2, SEQ. ID NO. 3, or SEQ. ID NO. 4.

39. The composition according to any one of claims 32 to 38, wherein said strain is Lactobacillus murinus/ruminus strain AHC1222, Lactobacillus murinus/ruminus strain AHC5323, Lactobacillus murinus/ruminus strain AHC6331, Lactobacillus murinus/ruminus strain AHC3133 or a mutant thereof.

40. The composition according to claim 39 wherein the mutant is a natural, genetically modified or induced mutant.

41. The composition according to any one of claims 32 to 40 wherein the companion animal is a dog or a cat.

42. The composition according to any one of claims 32 to 41 wherein said composition is a companion animal food, preferably a cat food or a dog food.

43. The composition according to any one of claims 32 to 42 wherein the composition is a wet animal food, a dry animal food, a kibble, a chew a biscuit, a companion animal food supplement, a gravy, a yoghurt, cheese or other dairy produce, a capsule, a tablet, or a pill.

44. The composition according to any one of claims 32 to 43 comprising at least 0.001% of from about 1.0E+04 CFU/g to about 1.0E+12 CFU/g of the lactic acid bacteria.

45. The composition according to any one of claims 32 to 44 wherein the lactic acid bacteria are in the form of viable cells, non-viable cells, or the constituent active fractions thereof.