CA2524883A1 - Potassium-chloride cotransporter kcc2 modulation for treatment of pain - Google Patents

Abstract

Methods and products for the attenuation or treatment of pain and the reduction of nociception are described. The methods and products are based o n the modulation of CNS intracellular chloride levels. The methods and product s may also relate to modulation of the activity and/or expression of a chlorid e transporter, such as the KCC2 potassium-chloride cotransporter. Also describ ed herein are commercial packages and uses based on such modulation. Related methods for identifying or characterizing a compound for the treatment of pain, the reduction of nociception and the diagnosis and prognostication of pain are also described.

Description

2 PCT/CA2004/000726 CNS CHLORIDE MODULATION AND USES THEREOF
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit, under 35 U.S.C.
~ 119(e), of United States provisional patent application Serial No. 60/470,885 filed May 16, 2003, which is hereby incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
The invention relates to the modulation of anion levels in a central nervous system (CNS) neural cell, and particularly relates to the modulation of CNS intracellular chloride levels and uses thereof for treating, preventing, diagnosing and prognosticating pain.
BACKGROUND OF THE INVENTION
The need for new and improved methods and agents for pain.treatment is a significant ongoing concern in medicine. Acute pain, e.g. related to injury or disease, can be severe and have critical effects on patient recovery. An even greater concern is chronic pain, which affects a large proportion of the population, causing not only significant discomfort, but can result in low self=esteem, depression, anger, and can interfere with or completely prevent a sufferer from typical daily activities.
Tnlhile a number of studies have been done in this area, many mechanisms and pathways involved in pain sensation remain poorly understood. As in the case of the sensation of various stimuli, it has been suggested that pain sensation is related to altered neuronal excitability.
Ion cotransport has in some cases been thought to play a role in the processing of certain stimuli. For example, Howard et al. (28) have demonstrated that mice generated with a targeted deletion of the Slc12a6 gene, which encodes the KCC3 exporter, exhibit features of agenisis of the corpus callosum, including a locomotor deficit, peripheral neuropathy and a sensorimotor gating deficit.
Sung et al. (29) .report that in mice where~there is a disruption of the Slc12a2 gene, which encodes the NKCC1 cotransporter, sensitivity to thermal stimulus is greatly reduced, compared to both wild-type and heterozygous (NKCC1+~-) mice.
There remains a need to better define the mechanisms involved in pain sensation to provide new strategies of therapeutic intervention in this regard.
SUI~ARY OF THE INVENTION
This invention relates to pain and methods of treating, preventing, diagnosing and prognosticating such pain. This invention also relates to pain associated with neuropathic pain and CNS dysfunction. This invention also relates to methods. of decreasing an intracellular chloride level in a central nervous system (CNS) neural cell.
According to one aspect, the invention provides a method of treating or preventing pain in a subject, the method comprising decreasing an intracellular chloride level in a central nervous system (CNS) neural cell of the subject.
In an embodimewt, the method comprises modulating the activity or expression of a chloride transporter in,the CNS
cell, thereby to decrease the chloride level. In a further embodiment, the chloride transporter is KCC2 the method comprises increasing KCC2 activity or expression. In another embodiment, the CNS neural cell is a spinal cord neural cell.
In yet another embodiment, the signal of the pain originates in a peripheral nervous system (PNS) cell or sensory fiber

3 transsynaptiC to the CNS neural cell. In still another embodiment, the pain is neuropathic pain, and in further embodiments the neuropathic pain is associated with a nerve or tract injury or is selected from the group consisting of somatic and visceral pain. In yet another emlaodiment, the pain is selected from the group consisting of chronic inflammatory pain, pain associated with arthritis, fibromyalgia, back pain, cancer-associated pain, pain associated with digestive disease, pain associated with Crohn's disease, pain associated with autoimmune disease, pain associated with endocrine disease, pain associated with diabetic neuropathy, phantom limb pain, spontaneous pain, chronic post-surgical pain, chronic temporomandibular pain, causalgia, post-herpetic neuralgia, AIDS-related pain, complex regional pain syndromes type I and II, trigeminal neuralgia, chronic back pain, pain associated with spinal cord injury and recurrent acute pain.
In an embodiment, the method comprises administering to the subject a compound capable of decreasing the intracellular chloride level in the CNS cell. In yet another embodiment, the compound is capable of modulating the aotivity~or expression of a chloride transporter in the CNS
cell. In yet a further embodiment, the chloride transporter is KCC2, and yet further, the compound is capable of increasing KCC2 activity or expression. In another embodiment, the compound is an inhibitor of TrkB, such as K-252a or an anti-TrkB antibody. In another embodiment, the compound is an inhibitor of cyclic AMP-dependent kinase (PKA) (e.g. H-89). In another embodiment, the compound is an inhibitor of calmodulin-dependant kinase (CAM kinase), and further, it is KN-93. In an embodiment, KCC2 comprises an amino acid sequence substantially identical to a sequence

4 selected from the group consisting of SEQ ID N0: 2, 4, 6 and a fragment thereof.
According to another aspect of the present invention, there is provided a composition for the treatment or the preventioh of pain in a subject, the composition comprising a compound capable of decreasing an intracellular chloride level in a CNS neural'~cell; and a pharmaceutically acceptable carrier. In an embodiment, the compound is capable of modulating the activity or expression of a chloride transporter in the CNS neural cell. In a further embodiment, the chloride transporter is KCC2, and further, ' the compound is capable of increasing KCC2 activity or expression.
According to still another aspect of the, invention, there is provided a commercial package comprising the composition described herein together with instructions for its use in the treatment or prevention of pain.
According to yet another aspect of the invention, there is provided a commercial package comprising a compound capable of decreasing an intracellular chloride level in a CNS neural cell together with instructions for its use the treatment or prevention of pain. In an embodiment,~the compound is capable of modulating the activity or expression of a chloride transporter in said CNS neural cell.. In a further embodiment, the chloride transporter is KCC2, and further, the compound is capable of increasing said KCC2 activity or expression. , According to a further aspect of the present invention, there is provided use of the composition described herein for the treatment or prevention of pain and/or for the 'preparation of a medicament for the treatment or prevention of pain.

According to yet a further aspect of the present invention, there is provided use of a compound capable of decreasing an intracellular chloride level in a CNS neural cell for the treatment or prevention of pain and/or for the

5 preparation of a medicament for the treatment or prevention of pain. In an embodiment, the compound is capable of modulating the activity ox expression of a chloride transporter in said CNS cell. In a further embodiment, the chloride transporter is KCC2, and further, the compound is capable of increasing KCC2 activity or expression. In another embodiment, the compound is an inhibitor of TrkB, and further, it is selected from the group consisting of K-252a and an anti-TrkB antibody, In another embodiment, the compound is an inhibitor of cyclic AMP-dependent kinase (PKA), and further, it is H-89. In another embodiment, the compound is an inhibitor of calmodulin-dependant kinase, and further, it is KN-93.
According to still a further aspect of the invention, there is provided a method of identifying or characterizing a compound for treatment or prevention of pain, the method comprising contacting a test compound with a CNS-derived cell; and determining whether the intracellular chloride level is decreased in the presence of the test compound; wherein the decrease is an indication that the test compound may be used for treatment or prevention of pain.
According to another aspect of the present invention, there is provided a method of identifying or characterizing a compound for treatment or prevention of pain, the method comprising contacting a test compound with a CNS-derived cell expressing a chloride transporter; and determining. whether activity or expression of the chloride transporter is modulated in the presence of the test compound in such a way that the level intracellular chloride is

6 decreased; wherein the modulation is an indication that the test compound may be used for treatment or prevention of pain. Tn an embodiment, the chloride transporter is KCC2, and further, the method comprises determining whether said KCC2 expression or activity is increased in the presence of the test compound and the modulation is an increase. In another embodiment, KCC2 activity is determined by measuring a parameter selected from the group consisting of potassium transport, chloride transport, intracellular chloride level and anion reversal potential. In still another embodiment, the pain is selected from the group consisting of chronic inflammatory pain; pain associated with arthritis, fibromyalgia, back pain, cancer-associated pain, pain associated with digestive disease, pain associated with Crohn's disease, pain associated with autoimmune disease, pain associated with endocrine disease, pain associated with diabetic neuropathy, phantom limb pain, spontaneous pain, chronic post-surgical pain, chronic temporomandibular pain, causalgia, post-herpetic neuralgia, AIDS-related pain, complex regional pain syndromes type I and II, tri.geminal neuralgia, chronic back pain, pain associated with spinal cord injury and recurrent acute pain.
According to yet another aspect of the present invention, there is provided a method of identifying or 35 characterizing a compound for treatment or prevention of pain, said method comprising contacting a test compound with.
a CNS-derived cell comprising a first nucleic acid comprising a transcriptionally regulatory element normally associated with a chloride transporter gene, operably linked to a second nucleic acid comprising a reporter gene capable of encoding a reporter protein; and determining whether reporter gene expression or reporter protein activity is modulated in the presence of the test compound; wherein the modulation in

7 reporter gene expression or reporter protein activity being an indication that the test compound may be used for treatment or prevention of pain. In a further embodiment, the chloride transporter is KCC2, and further, the reporter gene expression or reporter protein activity is increased in the presence of the test compound.
According to one aspect of the present invention, there is provided a method for decreasing nociception in a subject, the method comprising decreasing intracellular chloride in a CNS neural cell of the subject. In an embodiment, the method comprises modulating chloride transporter activity or expression in the CNS neural cell.
In a further embodiment, the chloride transporter is KCC2, and further, the method comprises increasing KCC2 activity or expression. In another embodiment, the method further comprises contacting the CNS neural cell with a compound capable of increasing KCC2 activity or expression. In yet another embodiment, the compound is an inhibitor of TrkB, and further, it is selected from the group consisting of K-252a and an anti-TrkB antibody. In still another embodiment, the compound is an inhibitor of cyclic AMP-dependent kinase (PKA), and further, it is H-89. In yet another embodiment, the compound is an inhibitor of calmodulin-dependant kinase, and further, it is KN-93. In still another embodiment, KCC2 comprises an amino acid sequence substantially identical to a sequence selected from the group consisting of SEQ ID N0: 2, 4, 6 and a fragment thereof.
According to another aspect of the invention, there is provided a method for diagnosing or prognosticating pain associated with CNS dysfunction in a subject experiencing pain, the method comprising determining whether a test CNS
intracellular chloride level is increased relative to a corresponding control chloride level; wherein the increase is

8 an indication that the subject is experiencing pain associated with CNS dysfunction. In an embodiment, the method further comprise s determining whether CNS chloride transporter activity or expression is modulated relative to a .control transporter activity or expression. In another embodiment, the chloride transporter is KCC2, and further, the method comprises determining whether KCC2 activity or expression is decreased relative to the control activity or expression. In still another embodiment, the control intracellular chloride level is selected from the group consisting of an established standard; a corresponding intracellular chloride level determined in.the subject at an earlier time; a corresponding intracellular chloride level determined in the subject when the subject is experiencing less pain or substantially no pain; and a corresponding intracellular chloride level determined in a control subject experiencing less pain or substantially no pain. In yet another embodiment, the control activity or expression is selected from the group consisting of an established standard ~of KCC2 activity or expression; a corresponding level of KCC2 activity or expression determined in the subject at an earlier time; a corresponding level of KCC2 activity or expression determined in the subject when the subject is experiencing less pain or substantially no pain; and a corresponding level of KCC2 activity or expression determined in a control subject experiencing less pain or substantially no pain. In a further embodiment, KCC2 activity is determined by measuring a parameter selected from the group consisting of potassium transport, chloride transport, intracellular chloride level and anion reversal potential.
In still a further embodiment, the intracellular chloride level is determined by administering an indicator compound indicative of chloride level to the subject such that it is

9 contacted with a CNS neural cell of the subject; and assessing an in v.ivo signal associated with the indicator compound. In yet another embodiment, the pain associated with CNS dysfunction is neuropathic pain. In still yet another embodiment, the indicator compound is a radionuclide, and further, it is selected from the group consisting of 2oiTl, g9Tcm-tetrofosmin, 99Tcm-MIBI, 99Tcm-HMPAO and 36C1. In still another embodiment, the in vivo signal is assessed by an imaging technique. In yet still another embodiment, the in vivo signal is the retention index of the indicator compound. In a further embodiment, the imaging technique is selected from the group consisting of single photon emission computed tomography, positron emission tomography and magnetic resonance imaging. In yet a further embodiment, the indicator compound is indicative of KCC2 expression, and further, it is an antibody directed against~KCC2.
According to yet another aspect of the invention, there is provided a method of treating pain associated with CNS dysfunction in a subject, the method comprising 2f diagnosing or prognosticating, according to the methods descrilaed herein, pain associated with CNS dysfunction in the subj ect; and decreasing a~n intracellular chloride level in a CNS cell of the subject.
In an embodiment, the above-mentioned subject is a mammal, in a further embodiment, a human.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1: Peripheral nerve injury (PNI) induced a collapse of the anion in Zamina I (ZI ) neurons in the ipsilateral superficial dorsal horn (SDH). a) Chronic constriction injury of the sciatic nerve (n'= 23), but not sham surgery~(n - 11), caused a significant reduction in the 50% nociceptive withdrawal threshold to mechanical stimulation of the hindpaw in rats (p < 0.01) . b) Ranges of Ea"ion recorded from LI
neurons of naYve (0) and PNI (o) rats. Solid symbol = mean Eanion ~ SEM. c) All classes of LI neurons (i.e. with phasic 5 (P), single-spike (SS) and tonic (T) firing properties [19]~) showed a shift in Eanion in response to PNI. Scale bar is 50 mV
(y), 150 ms (x). d) Mean peak current measured in LI neurons from naive (1) and PNI (~) rats in response to applied GABA
at various Vm. Horizontal standard error bars represent

10 inter-neuron differences in recording pipette offset. Inset:
Representative traces from one neuron. Scale bar is 0.6 nA
(Y) . 1.. 0 s (x) .
Figure 2: Switch from GlyR(receptor)-only to mixed GABAAR- and GlyR-mediated miniature postsynaptic currents (mPSCs) following PNI in LI neurons. a) Raw traces of outward (left) and inward (right) miniature synaptic events from a naive rat LI neuron. All outward mPSCs were abolished by strychnine, while all inward mPSCs (recorded in the presence of strychnine and bicuculline) were abolished by the GluR
antagonist CNQX. HP - Holding Potential. Scale bar is 20 pA
(y), 300 ms (x). b) Raw traces of inward (left) and outward (right) miniature synaptic events recorded from a PNI rat LI
neuron. Unlike in naYve rats, both strychnine and bicuculline were required to abolish all outward mPSCs. Inward mPSCs remained completely sensitive to CNQX. Scale bar is 20 pA
(y), 300 ms (x). c) left - Superimposed individual mPSCs recorded from PNI rat LI neurons. GlyR-only and GABAAR-only and mixed GABAAR/Glyr-mediated,were clearly identifiable by their sensitivity to strychnine and/or bicuculline. Right -Averages of > 100 GlyR- and GABAAR-mediated mPSCs recorded from a PNI rat LI neuron. Scale bar is 15 pA (y), 20 ms (x).
d) Mean peak conductance of mPSCs recorded from naive (N; n =

11 for GlyR; n = 5 for GluR) and PNI (P; n = 9 for GlyR; n =
8 for GluR) LI neurons. P(B) indicates GlyR-mediated mPSCs recorded in PNI rat LI neurons (n = 12) at 0 mV in the presence of bicuculline. e) Net charge carried by GlyR-5 mediated mPSCs in naive rats (n = 6), by bicuculline-isolated GlyR-mediated mPSCs in PNI rats [PNI(Bic); n = 4], and by mixed GABAAR/GlyR-mediated mPSCs in PNI rat LI neurons (PNI; n

- 12). f) Cumulative probability plot illustrating the difference between the GlyR-only mPSC inter-event interval 10 (I.E.I.) in naive LI neurons and that of bicuoulline-isolated GlyR-only mPSCs in PNI rat LI neurons [PNI(Bic)], both recorded at Eanion= 0 mV. The addition of the GABAAR-mediated mPSCs (PNI) compensated the GlyR-only mPSC frequency decrease. Inset - No effect of PNI on.the frequency of GluR-mediated mPSCs.
Figure 3: PNI-induced downregulation of KCC2 in SDH lamina I
neurons ipsilateral to PNI led to GlyR/GABAAR-mediated excitation. a) Brief GABA application (30 ms pressure puff) caused a tetrodotoxin (TTX) and bicuculline-sensitive rise in [Ca2+] i in a LI neuron from a fura-2-am (Ca2~ indicator) loaded slices of a PNI rat. b) KC1 application, but not GABA
application (up to 250 ms-long pressure puffs) caused no change in [Ca2+]i in a naive rat LI neuron. In the presence of the KCC2-specific antagonist DIOA, GABA application did elicit a rise in [Ca2+]i in a naive, rat Lh neuron. Scale bar is 0.02 (y), 10 s (x). c) Percentage of LI n.eurons displaying a GABA-evoked. increase in [Ca2+]i. The proportion was significantly higher in PNI rats (x2 corrected = 3.91) and in the presence of DIOA in naYve rats (x2 corrected - 4.43) . d) Representative trace confirming that exogenous GABA could repeatedly elicit action potentials in a lamina I neuron.
Upper scale bar is 5 mV (y), 200 ms (x). Lower scale bar is 30 mV (y), 4 s (x). Inset - response to a depolarizing pulse confirming this was a single-spike neuron (19). Scale bar is 20 mV (y), 300 ms (x). e) Similarly, focal stimuli (in the presence of glutamate receptor blockers) elicited bicuculline-sensitive monosynaptic depolarizing postsynaptic potentials thar could evoke action potentials in a lamina I
neuron from PNI rats. Scale bar is 5 mV (y), 250 ms (x).
Inset - response to a depolarizing pulse confirming this was a phasic neuron (19). Scale bar is 20 mV (y), 300 ms (x).
f) Left - Immunoblotting revealed that KCC2 levels were decreased in the lumbar SDH lying ipsilateral (Ipsi), but not contralateral (Con), to the site of the PNI. Right - Average intensities (~SEM) of KCC2 protein (normalized to actin) measured from immunoblots (n = 4) as in left (Ipsi normalized to Con).
Figure 4: Selective blockade or knock-down of the postsynaptic KCC2 exporter in the SDH significantly reduced nociceptive threshold. a) Tactile nociceptive withdrawal threshold as a function of time after intrathecal injections of DIOA (n = 5) or vehicle (n = 3). b) Thermal nociceptive withdrawal latency as a function of time after intrathecal injections of DIOA (n = 3) or vehicle (n = 3). Upon withdrawal, the rats also often licked their paw indicating nociception. c) Spontaneous mPSCs recorded with a CsCl (cesium chloride) pipette (to clamp Eanion at OmV) in a LI
neuron in the presence and absence of DIOA. Scale bar is 20 pA (y), 300 ms (x). d) Cumulative probability plot (n = 4 neurons X 50 mPSCs) demonstrating that DIOA neither affected the peak conductance of synaptic events (p> 0.5), nor GABA-evoked responses (n = 5; p > 0.5, Inset) and therefore does not act on GlyRs nor GABAARs. Gpeak = peak conductance. e) Local lumbar spinal (intrathecal) administration of a KCC2

13 antisense oligodeoxynucleotide (each 12 h) caused a' significant decrease in the tactile nociceptive withdrawal threshold in naive rats (n = 8), compared to those that received the scrambled oligodeoxynucleotide (n = 7). Inset, Decrease in spinal KCC2 protein levels (measured by immunoblots) following antisense (AS, 12h or 36h) or scrambled (S, 36h) oligodeoxynucleotide treatrilent. f) Lack of KCC2 immunoreactivity in dorsal root ganglia (DRG) in a naive rat, compared to SDH. g) Electron micrograph illustrating the selective expression of KCC2 in SDH
dendrites (D), but not synaptic boutons (B) (for quantitative details see Fig. 6). Arrows point to synapses. Scale bar is 0.2 Vim.
Figure 5: Computer simulations of in vivo synaptic conditions confirmed that sensitization of Lamina I neurons occurred as a function of the shift in the Eanion. a) Left - Computer simulations using a model neuron (see Examples) demonstrate how PNI-induced changes to GlyR- and GABAAR-mediated PSCs [PNI(GlyR+GABAAR)] affect the output firing frequency of LI
neurons as a function of GluR-mediated PSC frequency. Also shown is the result in LI neurons after PNI if only considering the effect of GlyR- mediated [PNI(GlyR-only)] or GABAAR-mediated [PNI(GABAAR-only)] synaptic events. Right -Same data as shown in the left panel, but expressed in terms of firing frequency ratio, which was calculated as the quotient of a specific data set divided by the No Inhibition data set (i.e., a firing frequency ratio of one is equivalent to no inhibition). While the normally hyperpolarizing GlyR-mediated PSCs (mean Eanion = -~2-8 mV in naive rats) had a net inhibitory effect on the output firing frequency (fo"t).
depolarizing GlyR-mediated PSCs (mean Eanion = -49.0 mV in PNI
rats), enhanced fo"t beyond that predicted to result with no

14 inhibition, demonstrating a net excitatory effect. This excitatory effect was more prevalent when the GABAAR component was incorporated due to the increased charge carried by GABAAR-mediated PSCs. b) Zeft~ - Effect of different values of Eanion (over the range observed in our study) on the firing frequency of a LI neuron after PNI. Right - Same data as left panel expressed in terms of firing frequency ratio (as above). ' Figure 6: KCC2 exporter expression is restricted to dorsal horn neurons, not sensory fibres. Although the KCC2 levels are below detection by immunoblotting from DRG (Fig. 4f), we verified whether KCC2 could be preferentially shuttled away from cell bodies to central terminals of primary afferents.
a) Electron micrograph illustrating the presence of KCC2 on dendrites (D) in lamina I of the dorsal horn. Membrane-delimited immunogold staining on the soma (S) of a lamina I
neuron is also shown (arrowheads). In contrast, no KCC2 immunostaining was observed in any of the randomly selected synaptic profiles examined (n = 171). b) KCC2 immunoreactivity was also absent from central boutons (n = 42 randomly selected central boutons) of synaptic glomeruli in laminae I and II (type I: CI; left; type II: CIA; right;
arrows indicate excitatory synapses, D: dendrite) that unequivocally correspond to central terminals of primary afferents (A- and C- fibres [34,35]). Scale bars: a: 2 Vim; b;
0.5 ~m (left), 0.2 ~m (right).
a Figure 7: Effect of various treatments on anion (bicarbonate and chloride) reversal potential (Eanion) recorded from lamina I neurons of naive and PNI rats.

Figure 3: Intrathecal administration of the receptor tyrosine kinase inhibitor K-252a (6 nM) resulted in an.increase in the threshold for tactile nociceptive withdrawal.
5 Figure 9: DNA (SEQ ID N0: 1) and polypeptide (SEQ ID N0: 2) sequences of human KCC2.
Figure 10: DNA (SEQ ID N0: 3) and polypeptide (SEQ ID N0: 4) sequences of mouse KCC2.
Figure 11: DNA (SEQ ID NO: 5) and polypeptide (SEQ ID N0: 6) sequences of rat KCC2.
Figure 12: Comparison of the anion (chloride and bicarbonate) reversal potential (Eanion) measured from lamina I neurons in slices, taken from naive rats, perfused with BDNF, NGF or regular artificial cerebrospinal solution (ACSF; "control" in Figure). PNI - peripheral nerve injury.
Figure 13: Comparison of Eanio" measured in slices containing lamina I neurons taken from PNI rats treated, by bath application, with an antibody directed against TrkB
(P/TrkBIgG), H-89 (P/H89), K-252a (P/K252a) and KN-93 (P/KN93). PNI - peripheral nerve injury.
Figure 14: Comparison between the nociceptive threshold for tactile stimulation of rats treated with an adenovirus transducing BDNF (~) and rats treated with an adenovirus transducing the green fluorescent protein (O).
Figure 15: Comparison between the nociceptive threshold for tactile stimulation of rats treated with human recombinant NGF (1Q ~g/day x 6. days) (~) and rats treated with saline vehicle(O).
Figure 16: Comparison between the nociceptive threshold for tactile stimulation of rats treated with the neutralizing anti-TrkB antibody (anti-TrkB-IgG 12 ~g/2 hrs x 3) (~) and rats treated with vehicle only (O).
Figure 17: Comparison between the nociceptive threshold for mechanical stimulation of rats treated with the PKA inhibitor H-89 (380 nmol) (~) and rats treated with vehicle only (O)..
DETAINED DESCRIPTION OF THE INVENTION
Described herein is a novel mechanism of disinhibition following peripheral nerve injury. It involves a transsynaptic disruption of anion homeostasis in neurons of lamina I of the superficial dorsal horn (SDH), one of the main spinal nociceptive output pathways (7). The resulting shift in the transmembrane anion gradient is shown herein to cause normally inhibitory anionic synaptic currents to be excitatory, substantially driving up the net excitability of lamina I neurons. As shown herein, peripheral nerve injury is sensed by transmission of a signal transynaptically resulting in an increase in intracellular chloride levels in central nervous system (CNS) neurons. Further, the studies described herein demonstrate that decreasing CNS neuronal chloride levels can reverse this phenomenon, as shown via local blockade or knock-down of the spinal KCC2 exporter in intact rats which markedly reduced nociceptive threshold, confirming that the reported disruption of anion homeostasis in lamina I
neurons was sufficient to cause neuropathic pain.

Therefore, the studies described herein have investigated the mechanism of pain sensation via the study of downstream events following peripheral nerve injury. As such, it iswshown herein that such events are transmitted transsynaptically (e. g. by a peripheral nervous system (PNS
cell or a sensory fiber) to central nervous system (CNS) neurons, in an embodiment, to spinal cord neurons. Further studies herein demonstrate that transmission of the nociceptive signal and sensation of pain is ultimately effected by a modulation of intracellular chloride level (e.g. modulated by a chloride transporter such as the potassium-chloride cotransporter KCC2) in a CNS tissue.
KCC2 .(see (37) for a review) is a potassium-chloride cotransporter which has been identified in rat, mouse and human (for human KCC2 see for example US Patent application Serial No. 20030027983 of Mount et al.; published February 6, 2003). Studies of homozygous and heterozygous disruptions of the KCC2 gene in mouse revealed a seizure phenotype, suggesting a possible role for KCC2 in epilepsy (38). The precise role of KCC2 in CNS function is not yet completely understood. .
Applicants demonstrate herein a correlation between the intracellular chloride level (e.g. by virtue of the activity/expression of a chloride transporter such as KCC2) in a CNS cell or tissue, and the sensation of pain. As shown in the examples below, peripheral nerve injury (PNI) results in the hyperexcitation.or sensitization of CNS neurons, e.g.
of the spinal cord, e.g. lamina I (LI) neurons of the superficial dorsal horn (SDH). Such hyperexcitability occurs transsynaptically (i.e. downstream from the injured peripheral neuron), a phenomenon which has not been described prior to applicants' studies herein. Such hyperexcitability results in a reduction of the nociceptive threshold.

As shown herein, the hyperexcitability noted above correlates with an increase in intracellular chloride levels (e. g. modulation [e. g. decrease] in chloride transporter [such as KCC2] activity and/or expression) in the SDH. The role of KCC2 in this regard was oonfirmed via administration of the KCC2 blocker DIOA or a KCC2 antisense oligonucleotide to spinal tissue, both resulting in a rapid decrease in the threshold for pain sensitivity. Therefore, a reduction in KCC2 activity and/or expression, if it results in increased CNS neuronal chloride levels, may result in a decrease in the threshold for pain sensitivity, and, conversely, an increase or induction of KCC2 activity and/or expression, if it results in a decrease in CNS neuronal chloride, may result in an increase in the threshold for pain sensitivity thus providing for prevention and treatment~of pain. On 'the other hand, it has been reported that under certain pathophysiological conditions, e.g. where [K+]o is elevated, KCC2 may accumulate Cl- in neurons, thereby enhancing neuronal excitability (42). Under such conditions, it is envisioned that KCC2 would have the opposite effect on CNS neuronal chloride, and thus result in an increase in CNS neuronal chloride and in turn decreased nociceptive threshold and increased pain sensation. As such, modulation of the activity and/or expression of ~CC2 may, depending on the directionality of the flux of chloride ion, contribute to or alleviate a pain sensation.
'Therefore, in a first aspect, the invention relates to methods and materials for the treatment of pain, based on the modulation of CNS intracellular chloride level and further the modulation of the activity and/or expression of a chloride transporter, e.g. the KCC2 potassium-chloride cotransporter. As used herein, a "chloride transporter" is defined as a polypeptide/protein or complex thereof associated with the cell membrane that is able to effect the passage of chloride anions across the cell membrane.
"Export(er)" refers to a net passage from the inside to the outside of the cell, and "import(er)" refers to a net passage from the outside to the inside of the cell.
Therefore, in an embodiment, the present invention relates to methods for treating pain by decreasing the intracellular chloride level in a cell, e.g. a CNS neural cell. In a further embodiment, modulators of a chloride transporter (e. g. KCC2) can be used to decrease intracellular chloride levels. In an embodiment, the invention relates to the application, systemic or local, of compounds or drugs that decrease the intracellular level of chloride in a CNS
neural cell as a means to attenuate pain. In order achieve this result, the above-mentioned compounds or drugs may modulate the function or expression of the chloride transporter (e.g. KCC2 cotransporter) in CNS neurons. In yet a further embodiment, the compounds or drugs may increase the expression or activity of the chloride transporter or KCC2.
In an embodiment, the CNS neural cell in which the intracellular chloride levels are being modulated can be located in the superficial dorsal horn or the spinal cord.
In addition, the cell may also be transsynaptic to a peripheral nerve cell or sensory fiber from which a signal for pain originates.
In an embodiment, the invention also relates to the treatment of acute and chronic pain, more specifically to the treatment of neuropathic pain. "Neuropathic pain", as used herein, refers to chronic pain associa ed with nerve injury (e. g. following crush, transection or compression of nerves or following nerve degeneration resulting from disease). In an embodiment, neuropathic pain is associated with a nerve or tract injury. In a further embodiment, the neuropathic pain is associated with visceral and/or somatic pain. The invention further relates to decreasing CNS neuronal. chloride levels (e.g. via modulation of chloride transporter [such as KCC2] activity and/or expression) to reduce nociception.
5 "Nociception" as used herein refers to the sensory component of pain. Pain may be the result of various stimuli, including but not limited to pressure, injury, thermal stimuli or chemical (e. g. ionic) stimuli. In embodiments, the pain may be associated with many conditions such as 10 chronic inflammatory pain, pain associated with arthritis, fibromyalgia, back pain, cancer-associated pain, pain associated with digestive disease, pain associated with Crohn's disease, pain associated with autoimmune disease, pain associated with endocrine disease, pain associated with

15 diabetic neuropathy, phantom limb pain, spontaneous .pain, chronic post-surgical pain, chronic temporomandibular pain, causalgia, post-herpetic neuralgia, AIDS-related pain, complex regional pain syndromes type I and II, trigeminal neuralgia, chronic back pain, pain associated with spinal 20 cord injury and/or recurrent acute pain. The invention also relates to methods of diagnosis and prognostication to assess pain associated with CNS dysfunction. In an embodiment, such diagnosis/prognostication may be performed prior to the method of treatment described herein, or during a treatment regimen, to further characterize the nature of the pain or its progression, and thus provide information which may be used e.g. to select a course of treatment for such pain in accordance with the results obtained from such diagnosis/prognostication. As used herein, "pain associated with CNS dysfunction" relates toVa pain.sensation that is caused by an alteration in ion (e.g. anion) homeostasis in a CNS tissue. In an embodiment, the anion is a chloride ion.
In a further embodiment, the alteration is an increase in an intracellular chloride level in a CNS cell. In .yet another embodiment, the activity or expression of a chloride transporter may be modulated (e.g. KCC2 activity or expression may be modulated [e. g. decreased]) when a subject experiences pain associated with a CNS dysfunction.
"KCC2" as used herein refers to a particular type of potassium-chloride cotransporter expressed in neurons. In embodiments, KCC2 comprises the sequence of the polypeptide of SEQ ID'NOs: 2 (human KCC2; see also Figure 9), 4 (mouse KCC2; see also Figure 10) or 6 (rat KCC2; see also Figure 11), fragments thereof or sequences substantially identical thereto. In further embodiments, KCC2 is encoded by the nucleic acid sequences capable of encoding the polypeptides of SEQ ID N0: 2, 4 or 6, or fragments thereof or sequences substantially identical thereto or related by hybridization criteria (see below). In further embodiments, such nucleic acid sequences comprise of SEQ ID N0: l (human KCC2 DNA; see also Figure 9), 3 (mouse KCC2 DNA; see also Figure 10) or 5 (rat KCC2 DNA; see also Figure 11), fragments thereof or sequences substantially identical thereto or related by hybridization criteria (see below).
"Chloride transporter) activity" as used herein refers to the transport of chloride, across the cell membrane. Such transport activity may be measured by direct or indirect means using various methods known in the art, examples of which are described herein. "KCC2 activity" as used herein refers to any detectable phenotype associated with KCC2., In an embodiment, KCC2 activity includes, but is not limited to potassium transport, chloride transport, which may, for example, be determined by assessing levels (either directly or indirectly) of potassium and/or chloride inside and/or outside the cell using, for example, reversal potential measurements with patch clamping methods, chloride/potassium sensitive dyes (see for example Haugland, R.P., Handbook of Fluorescent Probes and Research Products, ninth ed., 2002, Molecular Probes, Inc., Eugene, OR, USA) electrodes, etc. In addition, KCC2 activity may also affect the neural cell's anion reversal potential (Eanion). The anion reversal potential may be determined, for example, by using gramicidin-perforated patch clamp recording.
"Chloride transporter expression" (e. g. KCC2 expression) relates both to production of a chloride transporter transcript (e. g. a KCC2 transcript.) or a chloride transporter polypeptide or protein (e. g. a KCC2 polypep~tide or protein). Chloride transporter expression (e. g. KCC2 expression)-may therefore, in.embodiments, be determined by assessing protein levels directly (e.g., by immunocytochemistry and/or westernaanalysis) or a level of a chloride transporter-encoding nucleic acid (e. g. chloride transporter-encoding nucleic acid such as chloride transporter mRNA levels) that may be determined by using, for example, methods such as reverse-transcriptase polymerase chain reaction [RT-PCR] methods" micro-array-based methods or by Northern analysis).
Compounds capable of decreasing intracellular.
chloride level in a CNS neural cell may, for example, modulate chloride transporter activity and expression (e. g.
1KCC2 activity and expression). In an embodiment, the chloride transporter activity or expression (e. g. KCC2 activity or expression) may be increased. In an embodiment, these compounds can be administered in a way such that they contact a CNS tissue or a CNS cell. The compounds that can be used include, but are not limited to, those which directly or indirectly modify~the activity of the protein and those which modulate the production and/or stability of the preotein (e. g. at the level of transcription, translation, maturation, post-translationnal modification, phosphorylation and degradation).
One class of such compounds are those that act via modulation of phosphorylation of one or more sites on KCC2.
Upon cloning KCC2 (2~0), it has been reported that KCC2 does not contain consensus phosphorylation sites for PKA, yet does contain five for PKC (Thr34y Ser~28, Thr~B~, Ser99° & Serlos4) .
One consensus site was identified for tyrosine protein phosphorylation (Tyrloal) in the carboxyl-terminal. This tyrosine kinase consensus phosphorylation site is not present in the KCCl or KCC4 isoforms, yet it is conserved in the KCC3 protein (21). As such, compounds capable of upregulating or increasing KCC2 activity include, but are not limited to, protein kinases inhibitors (e. g. N-ethylmaleimide (23-25), staurosporine (29), and receptor tyrosine kinase inhibitors such as K-252a); antibodies or antibody fragments generated against certain kinases or kinase phosphorylation sites on KCC2, or compounds which interfere more directly (e. g.
oligopeptides capable of competing with phosphorylation sites o'n KCC2) or less directly (e. g. compounds which modulate kinase activity and/or expression) with KCC2 phosphorylation.
In an embodiment, such a compound may act at the level of phosphorylation-mediated signaling pathways and ultimately affect KCC2 phosphorylation. In another embodiment, TrkB may be modulated to affect KCC2 phosphorylation and ultimately modulate KCC2 activity. Thus, In an embodiment,~compounds that inhibit TrkB activity may, for example, be used in this regard. Such compounds may include, but are not limited to, K-252a (commercially available from Calbiochem) or a neutralizing antibody against TrkB (anti-TrkB antibody [e. g.
IgG])(commercially available from BD Transduction Laboratories). In yet another embodiment, modulation, e.g.
inhibition, of.cyclic AMP-dependant kinase or PKA may be useful in modulating KCC2 phosphorylation and ultimately be used in the treatment or prevention of pain. For example, the PKA inhibitor H-89 (commercially available from EMD
Biosciences) may be used in this regard. In a further embodiment, modulation, e.g. inhibition, of calmodulin-dependant kinase (CAM kinase, e.g. II and IV) may alleviate or prevent pain in a subject by modulating KCC2 activity, e.g. phosphorylation. Compounds capable of inhibiting such a kinase include, but are not limited to, KN-93 (commercially available from EMD Biosciences). In yet another embodiment, modulators, e.g.inhibitors, of other members of the TrkB
pathway, e.g. phosphatidylinositol-specific phospholipase C
or phosphatidylcholine-specific phospholipase C, e.g.
phospholipase C gamma (PLCy), may be used to decrease intracellular chloride levels in a CNS neural cell. Such compounds include, but are not limited to, tricyclodecan-9-yl-xanthogenate, 1-0-octadecyl-2-0-methyl-rac-glycero-3-phosphorylcholine, neomycin sulfate, spermine tetrahydrochloride, 1-[6-((l7beta-3-methoxyestra-1,3,5(10)-trim-17-yl)amino)hexyl]-1H-pyrrole-2,5-dione, or 1-[6-.
((l7beta-3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl]-2,5-pyrrolidinedione.
Further, modulation of KCC2 expression may also arise from modulation (e.g. mediated by phosphorylation) of transcription factors which regulate KCC2 expression.
In a further aspect, the invention provides a method for treating pain or preventing./decreasing nociception in a subject or animal, comprising modulating, in embodiments reducing or decreasing, intracellular chloride levels in a CNS neuron or tissue. In an embodiment, such decrease in intracellular chloride levels is achieved by modulating, e.g.
decreasing, activity or expression of a chloride transporter (e.g. KCC2) in a CNS neuron or tissue of the subject. In a further embodiment, the subject is a vertebrate. In another embodiment, the subject is a mammal, in a yet further embodiment, a human. In an embodiment, the CNS tissue is spinal cord tissue and the neural cell is a spinal cord 5 neural cell.
Accordingly, the invention therefore provides methods of treating pain comprising administering a compound capable of modulating, in an embodiment, decreasing or reducing intracellular chloride levels in CNS tissue (e.g. a 10 CNS neural cell) in a subject. In an embodiment, the modulation, e.g. increase, in chloride transporter (e. g.
KCC2) activity and/or expression effects the decrease in intracellular chloride level in the subject. In an embodiment, the~CNS tissue is spinal cord tissue and the 15 neural cell is a spinal cord neural cell.
In an embodiment, KCC2 comprises an amino acid sequence substantially identical to a sequence set forth in SEQ ID N0: 2, 4, 6 or a fragment thereof. In another embodiment, KCC2 may be encoded by a nucleic acid 20 substantially identical to a nucleotide sequence capable of encoding SEQ ID N0: 2, 4, 6 or a fragment thereof, such as a sequence substantially identical to the sequence set forth in SEQ ID N0: 1, 3, 5 or a fragment thereof.
As noted above, a homolog, variant and/or fragment 25 of a KCC2 which retains activity may also be used in the methods of the invention. Homologs include protein sequences which are substantially identical to the amino acid sequence of a KCC2, sharing significant structural and functional homology with a KCC2. Variants include, but are not limited to, proteins or peptides which differ from a KCC2 by any modifications, and/or amino acid substitutions, deletions or additions. Modifications can occur anywhere including the polypeptide backbone, (i.e. the amino acid sequence), the amino acid side chains and the amino or carboxy termini. Such substitutions, deletions or additions may involve one or more amino acids. Fragments include a fragment~or a portion of a KCC2 or a fragment or a portion.of a homolog or variant of a KCC2.
With regard to increasing or upregulating expression of KCC2 in a cell, various methods of introducing KCC2-encoding nucleic acids into the cell may be used, examples of which are described below. Methods such as the gene therapy methods discussed below may be used in this regard. Examples of KCC2-encoding nucleic acids include nucleic acids capable of encoding a polypeptide of SEQ ID N0:
2, 4 or 6 (e.g. the nucleic acids of SEQ ID N0: l, 3 and 5), or nucleic acids substantially identical thereto. The method may also comprise administering to an area or neural tissue, e.g. CNS tissue, a cell comprising such a KCC2-encoding nucleic acid, via for example transplantation or introduction of a neural cell or precursor thereto (e.g. a stem yell) comprising such a KCC2-encoding nucleic acid. Further, the method may entail administering to the subject a compound capable of modulating, e.g. unpregulating or increasing, expression of a KCC2. Such a compound may for example be identified and characterized by the screening methods described below. Such a compound may further be provided as a composition comprising the compound and a pharmaceutically, acceptable carrier. In an embodiment, the composition is formulated for or adapted for administration to the CNS.
Such a compound or composition may be provided in a commercial package together with instructions for its use.
"Homology" and "homologous" refers to sequence similarity between two peptides or two nucleic acid molecules. Homology. can be determined by comparing each position in the aligned sequences. A degree of homology between nucleic acid or between amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared~by the sequences. As the term is used herein, a nucleic acid sequence is "homologous"
to another sequence if the two sequences are substantially identical and the functional activity of the sequences is conserved (as used herein, the term "homologous" does not infer evolutionary relatedness). Two nucleic acid sequences are considered substantially identical if, when optimally aligned (with gaps permitted), they share at least about 500 sequence similarity or identity, or if the sequences share defined functional motifs. In alternative embodiments, sequence similarity in optimally aligned substantially identical sequences may be at least 600, 700, 750, 80%, 850, 900 or 950. As used herein, a given percentage of homology between sequences denotes the degree of sequence identity in optimally aligned sequences. An "unrelated" or "non-homologous" sequence shares less than 40o.identity, though preferably less than about 25 o identity, with any of SEQ ID
N0: 1 to 6.
Substantially complementary nucleic acids, are nucleic acids in which the "complement" of one molecule is substantially identical to the other molecule. Optimal alignment of sequences for comparisons of identity may be 25, conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman, 1981, Adv. Appl.
Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl.
Acad. Sci. USA 85: 2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA
in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, WI, U.S.~A.). Sequence identity may also be determined using the BLAST algorithm, described in Altschul et al., 1990, J. Mol. Biol. 215:403-10 (using the published default settings). Software for performing BLAST analysis may be available through the National Center for Biotechnology Information (through the Internet at http://www.ncbi.nlm.nih.gov/). The BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is~ referred to as the neighbourhood word score threshold. Initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs. The word hits are extended in~both directions along each sequence for as far as the cumulative alignment score can be increased.
Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the a accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program may use as defaults a word length (W) of 11, the BLOSUM62 scoring 2,5 matrix (Henikoff and Henikoff, 1992, Proc. Natl. Acad. Sci.
USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10 (or 1 or 0.1 or O.Ol or 0.001 or 0.0001), M=5, N=4, and a comparison of both strands. One measure of the statistical similarity between two sequences using the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. In alternative embodiments of the invention, nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
An alternative indication that two nucleic acid sequences are substantially~complementary is that the two sequences hybridize to each other under moderately stringent, or preferably stringent, conditions. Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPO~, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing, in 0.2~x SSC/0.1o SDS at 42°C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). Alternatively, hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHP09, 7o SDS, 1 mM EDTA at 65°C, and washing in 0.1~ x SSC/0.1o SDS at 68°C (see Ausubel, et al.
(eds), 1989, supra). Hybridization conditions may be modified in accordance with known methods depending on the sequence.of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology -- Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
According to a further aspect, the invention also provides a method for decreasing nociception in a subject.
In an embodiment, this method comprises modulating, e.g.
decreasing, intracellular chloride levels in a cell, e.g. a CNS cell, in a subject. In a further embodiment, the method also comprises modulating, e.g. increasing, chloride transporter activity or expression, e.g. KCC2 activity or expression. In yet another embodiment, the method also 5 comprises contacting the CNS neural cell with a compound capable of modulating chloride transporter activity. Such compounds include, but are not limited to a TrkB inhibitor (such as K-25~a or anti-TrkB antibody), a PKA inhibitor (such as H-89) or a CAM kinase inhibitor (such as KN-93).
10 The invention further provides a composition for the prevention and/or treatment of pain comprising a compound capable of modulating, e.g. decreasing, intracellular chloride levels in admixture with a pharmaceutically acceptable carrier. In an embodiment, such composition may 15 modulate, e.g. increase or upregulate, chloride transporter activity, e.g. KCC2,~activity and/or expression. In an embodiment, such a composition is suitable for or adapted for administration to a CNS neural cell or tissue, such as spinal cord tissue or cell. In yet a further embodiment, such a 20 composition may .be an inducer of KCC2 expression or activity.
As used herein, an "inducer" is a compound that upregulates or enhances directly or indirectly the expression of the KCC2 gene, stability of the KCC2 mRNA, translation of the KCC2 mRNA, maturation of the KCC2 polypeptide, transport, e.g.
25 recycling, of the KCC2 polypeptide to the cell membrane, or transporter activity of the KCC2 polypeptide. In an embodiment, the "inducer" can also down-regulate or inhibit KCC2 inhibitors.
The invention further provides a use of the above-30 mentioned composition or the above-mentioned compound, capable of modulating, e.g. decreasing, intracellular chloride levels for the treatment or prevention of pain. The invention also provides a use of the above-mentioned composition or the above-mentioned compound, capable of modulating, e.g. decreasing, intracellular chloride levels for the preparation of a medicament for treatment or prevention of pain. In an embodiment, the compound or composition modulates, e.g. increases or upregulates, chloride transporter (e. g. KCC2) activity and/or expression.
In yet another embodiment, the compound or composition may comprise a TrkB inhibitor (such as K-252a or anti-TrkB
antibody), a PKA inhibitor (such as H-89) or a CAM kinase inhibitor (such as KN-93). In yet another embodiment, the medicament may be formulated for administration to a CNS
tissue, e.g. CNS cell, of a subject. Further, the compound may be, for example, an inducer of KCC2 expression or activity.
The invention further provides commercial packages comprising a compound capable of modulating, e.g. decreasing, intracellular chloride levels or the above-described composition together with instructions for its use in the treatment or prevention of pain. In an embodiment, the compound may modulate, e.g. increase or upregulate, chloride transporter or KCC2 activity and/or expression.
In various embodiments, a compound capable of modulating, e.g. decreasing, intracellular chloride levels in a CNS cell may be used therapeutically in formulations or medicaments to treat pain. The compound may, for example, modulate, e.g. increase or upregulate chloride transporter (e. g. KCC2) activity and/or expression. The invention also provides corresponding methods of medical treatment, in which a therapeutic dose of a compound capable of modulating, in an embodiment decreasing, intracellular chloride levels, is administered in a pharmacologically acceptable formulation.
Accordingly, the invention also provides therapeutic compositions comprising a compound capable of modulating, in an embodiment decreasing intracellular chloride levels, and a pharmacologically acceptable excipient or carrier. The therapeutic composition may be soluble in an aqueous solution at a physiologically acceptable pH.
In an embodiment, a compound of the invention is.
administered such that it comes into comact with.a CNS
tissue or a CNS neuron. As used herein, the "central nervous system'° or CNS is the portion of the nervous system comprising the brain and the spinal cord (e. g. in the lumbar region). By contrast, the "peripheral nervous system" or PNS
is the portion of the nervous system other than the brain and the spinal cord. In an embodiment, the CNS tissue is the superficial dorsal horn, in a further embodiment, a lamina I
neuron. As such,, in embodiments a compound of the invention can be administered to treat CNS cells in vivo via direct intracranial or intrathecal injection or injection into the cerebrospinal fluid. Alternatively, the compound can be administered systemically (e.g. intravenously, or orally) in a form capable of crossing the blood brain barrier and entering the CNS. "Neural" and "neuronal" are used herein interchangeably and both relate to neurons and the nervous system.
The invention also provides pharmaceutical compositions (medicaments) comprising a compound capable of modulating, in an embodiment decreasing intracellular chloride levels in a CNS cell. In an embodiment, such compositions include the compound, in a therapeutically or prophylactically effective amount sufficient to treat or attenuate pain, and a pharmaceutically acceptable carrier. A
"therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as reduction of pain. A therapeutically effective amount of a compound capable of modulating, in an embodiment decreasing, intracellular chloride levels in a CNS cell, may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the compound to elicit a desired response in the individual. Dosage, regimens may be adjusted to provide the optimum therapeutic response.
A therapeutically effective amount is also one in which any toxic or detrimental effects of the compound are outweighed by the therapeutically beneficial effects. A
"prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as preventing or inhibiting onset of pain or increases in the severity of pain. A prophylactically effective amount can be determined as described above for the therapeutically effective amount.
For any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the professional judgement of the person administering or supervising the administration of the compositions.
As used herein "pharmaceutically acceptable carrier" or "excipient" includes any and all solvents, dispersion~media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. In one embodiment, the carrier is suitable for parenteral administration.
Alternatively, the carrier can be suitable for intravenous, intraperitoneal, intramuscular, intracranial, intrathecal, sublingual or oral administration. Pharmaceutically acceptable carriers.include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar~as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be incorporated into the compositions.
Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage.
The composition can be formulated as a solution, microemulsion, liposome~ or other ordered structure suitable to high drug concentration. The carrier can be a solvent~or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol,.propylene glycol, and liquid polyethylene glycol, and the like), and suitable.mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin. Moreover, the compound capable of modulating, in an embodiment increasing or upregulating, KCC2 activity and/or expression, can be administered in a time release formulation,~for example in a composition which includes a slow release polymer. The active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation; including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid and polylactic, polyglycolic copolymers (PLG). Many methods for the preparation of such formulations are patented or generally known to those skilled in the art.
Sterile injectable solutions can be prepared by 5 incorporating the active compound (e.g. a compound capable of modulating, in an embodiment decreasing, intracellular chloride levels in a CNS cell) in the required amount in an.
appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered 10, sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable 15 solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. In accordance with an alternative aspect of the invention, a compound 20 capable of modulating, in an embodiment decreasing, intracellular chloride levels in a CNS cell, may be formulated with one or more additional compounds that enhance its solubility.
In accordance with another aspect of the invention, 25 therapeutic compositions of the present invention, comprising a compound capable of modulating, in an embodiment decreasing, intracellular chloride levels in a CNS cell, may be provided in containers or commercial packages which further comprise instructions for their use for the treatment 30 of pain.
Given that a decreased intracellular chloride level in a cell is associated with a modulation, e.g. an increase, in level/activity of chloride transporter (KCC2), which further correlates with a decrease in pain sensation as described herein, a further aspect of the present invention is the treatment of pain by administering to a subject (e. g.
to CNS tissue) a nucleic acid molecule encoding a KCC2, or a variant or fragment thereof which retains KCC2 activity.
Suitable methods of administration include gene therapy methods.
A nucleic acid of the invention may be delivered to cells in vivo using methods such as direct injection of DNA, receptor-mediated DNA uptake, viral-mediated transfection or non-viral transfection and lipid based transfectiori, all of which may involve the use of gene therapy vectors. Direct injection has been used to introduce naked DNA into cells in vivo (see e.g., Acsadi et al. (1991) Nature 332:815-818; Wolff et al. (1990) Science 247:1465-1468). A delivery apparatus (e.g., a "gene gun") for injecting DNA into cells in vivo may be'used. Such an apparatus may be commercially available (e. g., from BioRad).
Naked DNA may also be introduced into cells by complexing the DNA to a ration, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G.
and Wu, C. H. (1988) J. Biol. Chem. 263:14621; Wilson e1 al.
(1992) J. Biol. Chem. 267:963-967; and U.S. Pat. No.
5,166,320). Binding of the DNA-ligand complex to the receptor may facilitate uptake of the DNA by receptor-mediated endocytosis. A DNA-ligand complex linked to adenovirus capsids which disrupt endosomes, thereby releasing material into the cytoplasm, may be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel e1 al. (1991) Proc. Natl. Acad. Sri. USA 88:8850;.Cristiano et al. (1993) Proc. Natl. Acad. Sri. USA 90:2122-2126).
Defective retroviruses are well characterized for use as gene therapy vectors (for a review see Miller, A. D. (1990) Blood 76:271). Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals.
Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art.
Examples of suitable packaging virus lines include .psi.Crip, .psi.Cre, .psi.2 and .psi.Am. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad.
Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad.
Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl.
Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl.
Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl.
Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad.
Sci. USA 89:7640-7644; Kay et al. (1992),Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA
89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115;
U.S. Pat. No. 4,868,116; U.S. Pat. No. 4,980,286; PCT
Application WO 89/071361; PCT Application WO 89/02468; PCT
Application WO 89/05345; and PCT Application WO 92/07573).
For use as a gene therapy vector, the genome of an adenovirus may be manipulated so that it encodes and expresses a polypeptide compound of the invention, but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See for example Berkner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431=
434; and Rosenfeld et al. (1992) Cell 68:143-155. Suitable adenoviral vectors derived from the adenovirus strain Ad type d1324 or other strains of adenovirus (e.g., Ad2, Ad3, Ad7 etc.) are well known to those skilled in the art. Recombinant adenoviruses are advantageous in that they do not require 5 dividing cells to be effective gene delivery vehicles and can be used to infect a wide variety of cell types, including airway epithelium (Rosenfeld et al. (1992) cited supra), endothelial cells (Lemarchand-et al. (1992) Proc. Natl. Acad.
Sci. USA 89:6482-6486), hepatocytes (Herz and Gerard (1993) Proc. Natl. Acad. Sci. USA 90:2812-2816) and muscle cells (Quantin e1 al. (1992) Proc. Natl. Acad. Sci. USA 89:2581-2584 ) .
Adeno-associated virus (AAV) may be used as a gene therapy vector for delivery. of DNA for gene therapy purposes.
AAV is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle (Muzyczka et al. Curr. Topics in Micro. and Immunol.
(1992) 158:97-129). AAV may be used to integrate DNA into non-dividing cells (see for example Flotte et al. (1992) Am.
. J. Respir. Cell. Mol. Biol. 7:349-356; Samulski et al. (1989) J. Virol. 63:3822-3828; and McLaughlin et al. (1989) J.
Virol. 62:1963-1973). An AAV vector such as that described in Tratschin et al. (1985) Mol. Cell. Biol. 5:.3251-3260 may be used to introduce DNA into cells (see for example Hermonat et al. (1984) Proc. Natl. Acad. Sci. USA 81:6466-6470 Tratschin et al. (1985) Mol. Cell. Biol. 4:2072-2081; Wondisford et al.
(1988) Mol. Endocrinol. 2:32-39;' Tratschin et al. (1984) J.
Virol. 51:611-619 and Flotte et al. (1993) J. Biol. Chem.
268:3781-3790). Lentiviral gene therapy vectors may also be adapted for use in the invention.
General methods for gene therapy are known in the art. See for example, U.S. Pat. No. 5,399,346 by Anderson et al. A biocompatible capsule for delivering genetic material is described in PCT Publication WO 95/05452 by Baetge et al.
Methods of gene transfer into hematopoietic cells have also previously been reported (see Clapp, D. W., et al., Blood 78:
1132-1139 (1991); Anderson, Science 288:627-9 (2000); and Cavazzana-Calvo et al., Science 288:669-72 (2000)).
The invention further relates to transplantation methods, to introduce into a subject a cell comprising a nucleic acid capable of encoding a KCC2, or to introduce into a subject a cell which has been treated in vitro or ex vivo with a compound capable of decreasing intracellular chloride levels (e. g. by culturing the cell in an appropriate medium comprising the compound). In an embodiment, such a cell is a neural cell or a precursor thereof, e.g. a stem cell capable of developing/differentiating into a neural cell (neuron progenitor~cell). Methods relating to neural stem cell isolation, proliferation, characterization and/or transplantation are described in for example US patents 5,851,832; 5,968,829; 5,411,883; 5,750,376; 6,040,180;
5,753,506 and 6,001,654. The nucleic acid may be present in a vector as described above, the vector being introduced into the cell in vitro, using for example. the methods described above. In an embodiment, the cell is autologous, and is obtained from the subject. In embodiments, the cell is allogeneic or xenogeneic.
Given the correlation between intracellular chloride levels in a CNS cell and pain, compounds which are capable of modulating, e.g. decreasing, intracellular chloride levels in a CNS cell can be used for the prevention and treatment of pain. In an embodiment, compounds that modulate, e.g. increase or upregulate, chloride transporter, such as KCC2, activity/expression can be used for decreasing intracellular chloride levels and ultimately. prevent or treat pain. Therefore, the invention further relates to screening methods for the identification and characterization of compounds capable of modulating intracellular chloride levels and/or chloride transporter activity and/or expression.
5 Therefore, the invention further provides a method of determining whether a candidate compound is capable of modulating intracellular chloride levels in a cell, and in turn is useful for the prevention and treatment of pain. In an embodiment, the method comprises contacting a CNS-derived 10 cell with said candidate compound and determining whether the intracellular chloride level has decreased in the presence of the test compound. A decrease in intracellular chloride level is indicative that the test compound may be used for the treatment or the prevention of pain. As used herein, a 15 "CNS-derived cell" is a cell isolated or derived from a CNS
tissue, and in embodiments includes both primary neuronal cultures, immortalized neuronal cell lines, as well as accepted in vitro neuronal model systems (e. g. cells differentiated into neurons in vitro). In an embodiment, the 20 above-mentioned cell possesses a chloride transporter or KCC2 activity. In yet a further embodiment, the cell endogenously expresses a chloride transporter (e. g. KCC2). In a further embodiment the above-mentioned cell has been genetically engineered to express a chloride transporter gene or a KCC2 25 gene. In an embodiment, the cell may be an appropriate host cell comprising an exogenously introduced source of a chloride transporter, such as KCC2. Such a host cell may be prepared by the introduction of nucleic acid sequences encoding a chloride transporter or KCC2 into the host cell 30 and providing conditions for the expression of such nucleic acid. In an embodiment, such a nucleic acid is DNA. Such host cells may be eukaryotic, such as amphibian or mammalian cells. In an embodiment, such host cells are human.

The invention also provides another method for the identification or characterization of compounds useful for the treatment and prevention of pain. In an embodiment, the method comprises contacting a CNS-derived cell with the candidate compound and determining whether chloride transporter activity has been modulated in the presence of the test compound. A modulation, e.g. increase, in chloride transporter activity is indicative that the test compound may be used for the treatment or the prevention of pain. In an embodiment, the chloride transporter is KCC2. KCC2 activity may be determined, for example, by measuring, potassium transport, chloride transport, intracellular chloride levels and anion reversal potential.
The above-mentioned methods may be employed either with a single test compound or a plurality or library (e.g. a combinatorial library) of test compounds. In the latter case, synergistic effects provided by combinations of compounds may also be identified and characterized. The above-mentioned compounds may be used for prevention and/or treatment of pain, or may be used as lead compounds for the development and testing of additional compounds having improved specificity, efficacy and/or pharmacological (e. g.
pharmacokinetic) properties. In an embodiment the compound may be a prodrug which is altered into its active form at the appropriate site of action, e.g. in CNS tissue (e.g. in the spinal cord). In certain embodiments, one or a plurality of the steps of the screening/testing methods of the invention may be automated.
~As noted above, the invention further relates to methods for the identification and characterization of compounds capable of modulating, in an embodiment increasing, chloride transporter , e.g. KCC2, gene expression. Such a method may comprise assaying chloride transporter, e.g. KCC2, gene expression in the presence versus the absence of a test compound. Such gene expression may be measured by detection of the corresponding RNA or protein, or via the use of a suitable reporter construct comprising a transcriptional regulatory elements) normally associated with such chloride transporter or KCC2 gene, operably-linked to a reporter gene.
A first nucleic acid sequence may "operably-linked" with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional.relationship with the second nucleic acid sequence. For instance, a promoter is operably-linked to a coding sequence if the promoter affects the transcription or expression of the coding sequences.
Generally, operably-linked DNA sequences are contiguous and, where necessary to join two~protein c~ding regions, in reading frame. However, since, for example, enhancers generally function when separated from the promoters by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably-linked but not contiguous. "Transcriptional regulatory element" is a generic term that refers to DNA sequences, such as initiation and termination signals, enhancers, and promoters, splicing signals, polyadenylation signals which induce or control transcription of protein coding sequences with which they are operably-linked. The expression of such a reporter gene may be measured on the transeriptional~or translational level, e.g. by the amount of RNA or protein produced. RNA
may be detected by for example Northern analysis or by the .
reverse transcriptase-polymerase chain reaction (RT-PCR) method (see for example Sambrook et al (1989) Molecular Cloning: A Laboratory Manual (second edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA).
Protein levels may be detected either directly using affinity reagents (e. g. an antibody or fragment thereof [for methods, see for example Harlow, E. and Lane, D (1988) Antibodies: A
.Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY]; a ligand which binds the protein) or by other properties (e. g. fluorescence in the case of green fluorescent protein) or by measurement of the protein's activity, which may entail enzymatic activity to produce a detectable product (e. g. with altered spectroscopic properties) or a detectable phenotype (e.g. alterations in cell growth). Suitable reporter genes include but are not limited to chloramphenicol acetyltransferase, beta-D
galactosidase, luciferase, or green fluorescent protein.
In an embodiment, a candidate compound may further be assayed to determine if it is capable of modulating a chloride transporter-mediated process (e.g. KCC2-mediated process) or.
chloride transporter activity (e.g. KCC2 activity). In an embodiment, such chloride transporter-mediated process is ion transport, e.g. potassium or chloride transport, as determined by for example by assessing potassium and/or chloride levels (e. g. intracellularly) or by measuring anion reversal potential (electrophysiologically), membrane potential, for example as described in the examples below.
The invention also relates to the diagnosis and prognostication of pain. In an embodiment, the pain is caused by an alteration in ion, e..g. anion or chloride, homeostasis in the nervous system, e.g. central nervous system, of a subject. Without wishing to being bound to any particular theory, a reduced capacity of potassium and chloride export from neurons in the central nervous system (CNS) may lead to persistent neuronal hyperexcitability and ultimately pain.
The invention thus provides a method for diagnosing or prognosticating pain associated with CNS dysfunction. As used herein, "CNS dysfunction" is an alteration in neuronal ionic homeostasis in the CNS. In an embodiment, the pain associated with such CNS dysfunction is neuropathic pain. In an embodiment, the method comprises determining an intracellular chloride level in a CNS neural cell and comparing the chloride level to a corresponding control level. In this particular method, an increase in the test level relative to a control level is an indication that the subject is experiencing pain associated with CNS dysfunction.
In an embodiment, the method may comprise determining whether CNS chloride transporter activity or expression (e. g. KCC2 activity or expression) is modulated, e.g. upregulated or increased, relative to a control activity or expression. In yet another embodiment, the control chloride level can be selected from an established standard, a corresponding chloride level determined in the subj ect at an earlier time;
a corresponding chloride level determined in said subject when the subject is experiencing less pain (relative to the current sensation of pain noted above) or substantially no pain; or a corresponding chloride level determined in a control subject experiencing less pain (relative to the current sensation of pain in the test subject noted above) or substantially no pain. In an embodiment, a subject or control subject experiencing less pain or substantially no pain presents no evident.lesions to his central or peripheral nervous system (e. g. neuropathic pain) or persistent pain.
In yet another embodiment, the control activity or expression can be selected amongst an established standard of KCC2 activity or expression; a corresponding level of KCC2 activity or expression determined in the subject at an earlier time; a corresponding level of KCC2 activity or expression determined in the subject when the subject is experiencing less pain (as above) or substantially no pain;
or a corresponding level of KCC2 activity or expression determined in a control subject experiencing less pain (as above) or substantially no pain. In an embodiment, the KCC2 activity may be determined as described above.
For example, intracellular chloride levels may be 5 determined by administering, to a subject, an indicator compound (such as a compound indicative of chloride level) that is capable of contacting a CNS neural cell of that subject. Following the administration of the indicator compound, assessment of the in vivo signal associated with 10 such indicator compound may be performed. In an embodiment, an indicator compound, such as a radionuclide (e. g. Thallium-201 (201T1) , 99Tcm-tetrofosmin, 99Tcm-MIBI or 99mTc-HMPAO or chloride conjugates thereof) or a compound indicative of KCC2 expression (such as an immunodetection-based reagent (e. g.
15 antibody, single chain antibody or Fab fragment directed against the KCC2 polypeptide)) may be employed. In yet another embodiment, the indicator compound, upon intravenous injection, may cross the blood-brain-barrier and accumulate in neurons of the CNS analogously to potassium, i.e. to 20 reflect potassium levels. In another embodiment, the dose of such radionuclide (e. g. ~°1T1) may be about 100 MBq (3mCi).
In yet another embodiment, the radionuclide (e.g. 2°1T1) may . be injected 15-20 minutes prior to SPELT imaging. Following injection of the indicator compound, an imaging technique may 25 be performed to assess the in vivo signal associated with the indicator compound. Such imaging techniques include, but are not limited to, single photon emission computed tomography (SPELT), positron emission tomography and/or magnetic resonance imaging. The imaging technique may enable the 30 assessment of the in vivo signal of the indicator compound, such as the neural potassium gradient. Images can be obtained, for example, using gamma camera equipped with a high-resolution (5-7 mm) collimator and interfaced with a dedicated computer system. In an embodiment, serial projection images can be aquired over a 180° arc. In yet another embodiment, the radionuclide (e.g. 2°1T1) retention by neurons can be expressed as a retention index (RI). The "retention index" as described herein is defined as:
Delayed retention-early retention x 100 Early retention In an embodiment, the "retention" of the retention index is herein defined as the amount of indicator compound (e. g. tracer or radionuclide) retained by a specific tissue at a certain time. In a further embodiment, the early retention is assessed before the delayed retention. In a further embodiment, the retention index is measured in a CNS
tissue.
In an embodiment, the methods of diagnosis/prognostication noted above may be performed in conjunction with the therapeutic/prophylactic methods noted above, for preventing or treating pain associated with CNS
dysfunction in a subject. Such a method thus comprises the diagnosis or prognostication of pain associated with CNS
dysfunction and, in accordance with the diagnosis/prognosis, decreasing intracellular chloride levels in a CNS cell of the subject thereby to prevent or treat pain.
Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way.. Numeric ranges are inclusive of the numbers defining the~range. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". The following examples are illustrative of various aspects of the invention, and do not limit the broad aspects of the invention as disclosed herein.
Throughout this application, various references are referred to describe more fully the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.
EXAMPLES
Example 1: Methods Nerve Injury. Briefly, peripheral nerve injury was induced by surgically implanting a polyethylene cuff (~2 mm long, 0.7 mm inner diameter) around the sciatic nerve of adult, male, Spague-Dawley rats as previously described (16). A group of rats also received sham surgery. Only animals that showed a gradual decrease in mechanical threshold (over 14-17 days) down to 2.0 g or less were used for further experiments.
Behavioural Testing. Thermal and mechanical threshold for nociceptive withdrawal reflexes were tested as previously described (17).
Slice preparation. Parasagittal slices (300-350 um) of spinal cord were prepared from~adult (>50 days old) male rats as previously described (9). Slices were continually superfused (2-3 ml~min-i) with artificial cerebrospinal fluid (ACSF) containing (in mM): 126 NaCl, 2.6 NaHC03, 10 glucose, 2.5 KCl, 2 CaCl2, 2 MgClz, 1.25 NaH2P09, 0.001 TTX (bubbled with 95% 02 - 5o C02, pH~7.4); when measuring GABAA/GlyR- mediated currents, 10 uM 6-cyano-7-nitroquinoxaline-2,3-dione (CN~X) and 40 uM D2-amino-5-phosphonovaleric acid (APV) were added to block fast glutamatergic transmission.
Recordings. For perforated patch recordings, the pipette tip was filled with a solution containing (in mM): 130 cesium gluconate (CsGluc), 5 CsCl, 2 MgCl2, 11 BAPTA Calcium chelator (buffer), 1 CaCl2, 4 ATP, 0.4 GTP, 10 HEPES (pH~7.4). The pipette was back-filled with this same solution supplemented with 25 ~g/ml gramioidin D (gramicidin stock was at 10 mg/ml in DMSO). Recordings in this mode were selected when access resistance was stable between 25-45 MS2. For whole-cell voltage-clamp recordings, pipettes were filled with the above solution without gramicidin D. Similarly, whole-cell current-clamp recordings were performed using pipettes filled with the same intracellular.solution as with voltage-clamp, except potassium methyl sulfate (KMeS09) was used to replace CsGluc. To clamp Eanion at 0 mV, CsGluc was replaced with 110 mM CsCl in the intracellular solution. All whole-cell recordings at Eanion = 0 mV were made at Vm = -60 mV in the presence of GluR-blockers. GABA was applied locally for 30- ' 250 ms by pressure ejection through a patch micropipett.e.
Data acquisition and analysis of PSCs was performed as previously described (9). All measurements are given as means ~ SEM, except where indicated. Statistical significance was tested using Student's t-tests for comparison of mean values, chi-square tests for contingency tables, and mixed design ANOVAs (post-hoc - Tukey's HSD) for repeated measures.
Calcium Imaging. Slices were prepared from PNI and naive rats as detailed above for electrophysiological analysis.

After 15 min incubation in ACSF, slioes were loaded with pM Fura-2-AM (a fluorometric calcium indicator, AM =
acetoxymethyl) in HEPES-buffered saline (+10o DMSO) for 1 hour. Slices were washed for ~15 min with ACSF before being 5 mounted in the recording chamber, where they continued to be superfused by ACSF (2-3 ml~min-1) . [Ca2+]i was fluorometrically measured using a Zeiss Axioscope equipped with epifluorescence optics. Images were acquired using a TILL-Photonics monochromator coupled to a CCD camera and regions 10 of interest (for ratioing) were drawn on clearly distinct neuronal cell bodies. .
Immunoblotting. Horizontal slices (150 ~Zm) of the SDH were made from the lumbar enlargement of both PNI and naive adult rats. Tissue extracts were prepared by homogenizing the slices with a Teflon pestle in a buffer containing 0.32 M
sucrose, 0.5 mM Tris-HCl, pH 7.5, 2 mM
ethylenediaminetetracetic acid (EDTA), 2.5 mM (3-mercaptoethanol, and a cocktail of protease inhibitors (CompleteTM, Roche Diagnostics). Supernatants from 3,000 g (20 min) and 10,000 g (30 min) centrifugations were collected. Equal amounts of proteins,(20 ~g/lane) diluted in sample buffer were preheated at 37°C for 30 min, resolved by SDS-PAGE, and electroblotted onto nitrocellulose membranes.
Membranes were blocked 30 min in 5% nonfat dry milk in TBST
buffer (150 mM NaCl, 10 niM Tris-HC1, pH 7.4, 0.050 Tween-20) and incubated overnight at 4°C with a rabbit anti-KCC2 antibody (1:1000, Upstate Biotechnology). After several washes in TBST, membranes were incubated for 30 min at room temperature with peroxidase-labeled goat anti-rabbit antibody (1:2000). Chemiluminescent bands were detected using Super Signal FemtoTM (Pierce Biotechnology). Digital images were a 5~
captured with the VersaDocTM imaging system (BioRad) and data were analysed with Quantity OneTM software (BioRad).
Oligodeoxynucleotides. KCC2 antisense and scrambled oligodeoxynucleotides, phosphorothioated at all positions were designed as previously described (18): antisense, 5'-TCTCCTTGGGATTGCCGTCA-3' (SEQ ID N0: 7; +59 relative to the ATG starting signal); scrambled, 5'-TCTTCTTGAGACTGCAGTCA-3' (SEQ ID N0: 8). °
Intrathecal Injections. At least three days prior to drug administration, rats were anaesthetized with sodium pentobarbital (65 mg kg-i) and a lumbar spinal catheter was inserted into the intrathecal space, as previously described (11). Briefly, a small opening was created at the cisterna magna, and a catheter was inserted into the.subarachnoid space and caudally directed ~8 cm to the lumbar enlargement of the spinal cord. Upon r-ecovery from surgery, lower body paralysis was induced via i.t. (intrathecal) lidocaine (20, 30 ~l) injection to confirm proper catheter localization.
Only animals exhibiting appropriate, transient paralysis to lidocaine, as well a lack of motor deficits were used for behavioural testing.. Following drug/vehicle administration, animals were sacrificed and their vertebral column dissected to visually confirm correct placement of the catheter. Drugs included DIOA (10-30 fig, in 0.9% NaCl, 10 o DMSO) and oligodeoxynucleotides (single doses of 2 ~g at Oh; 12h & 24h;
0.9o NaCl). Behavioural testing was performed as above;
normal (~15 g) mechanical threshold for withdrawal responses was confirmed in~nalve rats prior to receiving drug or vehicle. At the doses used, none of the compounds produced motor disturbances or sedation as assessed by grasping, righting and placing reflexes and behavioral observations (17) .
Computer simulations. (see Figure 5) All simulations were performed with NEURON 4.3.1 using a compartment model of a generic spinal lamina I fusiform neuron with morphology and passive membrane properties based on (19). Dendrites bifurcated up to fourth order and an ax~n similar to that described in (19) were attached to the soma. Fast Na+ and delayed rectifier K+ currents based on (30) were inserted at 0.1 and 0.01 S/cm2, respectively, in the soma and axon initial segment and nodes; voltage threshold for spiking was -49 mV.
Two sets of inhibitory synapses were distributed randomly in , the perisomatic region and four sets of excitatory synapses were more distal; each set was driven by an independent Poisson process at rates extrapolated from (31) and (32).
Electron microscopy. (see Figure 6) Tissue was prepared for ultrastructural analysis as previously described (35).
Briefly, rats were perfused through the aortic arch with 0.90 N,aCl followed by a fixative solution containing 40 paraformaldehyde (Sigma-Aldrich, Germany). After perfusion, spinal cords were removed, coronal blocks were dissected, then 60 um thin sections were cut cryoprotected and freeze-thawed over'liquid nitrogen and rinsed several times in phosphate buffer before incubation in the primary antiserum.
After incubation in blocking solution containing 2o bovine serum albumin ~(BSA), sections were incubated in rabbit anti-KCC2 (1:500, Upstate Biotechnology, USA) for 48 hours at 4°C.
After extensive washing, sections were incubated with 1 nm gold-conjugated anti-rabbit secondary antibody (1:250, Aurion) for 12 hours at 4°C followed by silver intensification (SE-EM, Aurion). Sections were treated with' 0.5o Os04 (20 min), dehydrated in graded ethanol, then in propylene oxide and embedded in Durcupan ACM (Fluka). After ultra-sectioning (UltracutTM UCT, Leica, Germany), specimens .were examined using an electron microscope (Philips Tecnai 12, equipped with MegaViewTM CCD camera). Non-consecutive (spacing> 3 Vim) ultrathin sections were analyzed in the electron microscope. Boutons with synaptic profiles were randomly selected and analyzed in laminae I & II and white matter for the expression of the KCC2 protein (36).
Intrathecal administration of K-252a. (see Figure 8) K-252a was prepared in 25 ul,of 0.90 NaCl solution containing 100 DMSO. Intrathecal catheterization was performed by creating a small opening at the cisterna magna, and inserting P10 polyethylene tubing into the subarachnoid space -- caudally directed ~8 cm to the lumbar enlargement of the spinal cord.
Example 2: Results Peripheral neuropathy was induced in rats by chronically constricting the sciatic nerve (Fig. 1a). To test whether the hyperexcitability (sensitization) of SDH
neurons that follows peripheral nerve injury (PNI) is associated with modification of the anion gradient (anion).
anion reversal potential (Eanion) was measured using gramicidin-perforated patch clamp recording. This technique avoids disrupting the intracellular anion concentration (8).
Responses to exogenous GABA application showed that the anion reversal potential (Ea"ion) of lamina I (LI) neurons taken from PNI rats was -49.0 ~ 2.3 mV (range: -40 to -62.2 mV, n = 9) compared to -72.6 ~ 3.5 mV (range: -63.0 to -79.9 mV, n = 5;
p < 0.005) in ~LI neurons from naive rats (Fig. 1b-d). Resting membrane potential was not significantly different between PNI (-62 ~ 4 mV, n = 7) and naive rat LI neurons (-61 ~ 2 mV, n = 16; p> 0.1). Spontaneous and evoked postsynaptic currents (PSCs), recorded from PNI rat LI neurons in the presence of fast glutamate receptor (GluR) blockers were also inward (depolarizing from rest), their mean reversal potential increasing by 16.1 mV relative to that in lamina I
neurons from naive rats (n = 6, PNI; n =4, naive).
It was then investigated whether other properties of synaptic transmission were altered in the SDH after PNI. Inhibitory miniature PSCs (mPSCs) in LI neurons from naive rats are mediated by glycine receptors (GlyRs) alone despite GABA and glycine corelease from local inhibitory interneurons (9;
Fig.2a). While GluR-mediated mPSCs were unaffected by PNI
(Fig.2b), in all cells tested from PNI rats, a population of outward mPSCs at 0 mV persisted in the presence of the GlyR
antagonist strychnine (up to 1 Vim; n = 4). These remaining mPSCs were mediated by GABAARS, as they were blocked by bicuculline (10 ~M) and displayed prolonged decay kinetics compared .to the GlyR-mediated component (iDccASAAR> - 34 . 0 ~ 2. 9 ms, n = 5, vs. iD(GlyR) - 11..3 ~ 1.3 ms, n = 6;p < 0.01; Fig.
2C).
Kinetic analysis further revealed that the decay phase of 36.9 ~ 2.30 of mPSCs followed a dual exponential function (iD1 = 7.5 ~ 2.0 ms and iD2 = 51.3 ~ 7. 9 ms; n = 6;
Fig.2c). These events possessed both a GABAAR and a GlyR-mediated component, as either strychnine or bicuculline could lead to the abolition of their respective components (n = 4).
Therefore, in parallel with the collapsed ~anion~ PNI caused reorganization at LI synapses thereby unmasking GABAAR-only and mixed GABAAR/GlyR-mediated mPSCs, in addition to those mediated by GlyRs alone. This synaptic organization is similar to that observed in immature LI-II neurons (9). The net effect of this synaptic switch is that it yielded a population of quantal synaptic events with significantly longer decay kinetics.
To examine the function of the PNI-induced GABAAR-mediated contribution to mPSCs, we analysed both the peak conductance and the frequency of mPSCs. This was performed using CsCl-filled pipettes to clamp the Eanion at 0 mV in both LI neurons taken from PNI and naive rats to prevent biased detection of mPSCs resulting from changes in driving force.
Peak conductance of GlyR-only mPSCs recorded in LI neurons taken from PNI rats was significantly smaller (~2-fold) than that recorded from naive rat LI neurons (Fig. 2d). The addition of GABAAR-mediated events in the PNI condition, however, partially compensated the~decrease in GlyR-only conductance. The peak conductance of GluR-mediated quantal events was not significantly different between LI neurons taken from naive and PNI rats (Fig.2d).
Factoring together the changes in peak conductance, kinetics, and driving force, the net charge carried by GlyR-only mPSCs at resting membrane potential in LI neurons taken from PNI rats was nearly 3-fold smaller than that in naive rats (Fig. 2e). With the contribution of GABAARs, however, the net charge carried by mPSCs in PNI rats rose back to that mediated by GlyRs in naYve rats. This result suggests that, although equivalent in magnitude, hyperpolarizing charge in naYve LI neurons was carried by GlyR-mediated mPSCs alone,.
whereas depolarizing charge was transferred predominantly via GABAARs in PNI rat LI neurons, due to the prolonged decay kinetics of GABAAR-mediated mPSCs.
The frequency of GlyR-only mPSCs recorded in LI
neurons from PNI rats was observed to be significantly less (0.13 ~ 0.04 Hz, n = 5) than that for GlyR-only mPSCs in naive rat LI neurons (0.18 ~ 0.04 Hz, n = 6;p <0.05; Fig.
2f). As with peak conductance, however, the addition of the GABAAR-mediated mPSCs compensated the PNI-induced decrease in frequency (0.22 ~ 0.10 Hz, n = 4, for all GABAAR and/or GlyR-mediated events combined; p > 0.5).' In contrast,,there was no significant change in the frequency of GluR-mediated events 5 in LI neurons isolated from PNI rats (1.51 ~ 0.90 Hz, n = 9) compared to LI neurons from naive rats (0.82 ~ 0.40 Hz, n =
S; p> 0.3; Fig.2f).
If depolarizing GABAAR/GlyR-mediated postsynaptic currents exert a net excitatory influence in PNI LI neurons, 10 they should directly evoke action potentials, and consequently lead to Ca2+ influx . To test this hypothesis, we employed Ca2+-imaging using fura-2-am loaded LI neurons in slice to obtain a large data set. Administration of exogenous GABA to neuronal somata caused a significant increase in the 15 concentration of intracellular Ca~+ ([Ca2+]i) in 190 of LI
neurons (n = 53; Fig. 3a,c) lying ipsilateral to the site of PNI. This represents a seven-fold increase compared to LI
neurons found in naive and/or contralateral dorsal horn, where an increase in [Caz+]i to GABA application was observed 20 in only 1 of 37 neurons tested (Fig. 3b, c). These responses were blocked by bicuculline (10 ~M; n = 5) and by the voltage sensitive sodium channel blocker tetrodotoxin (TTX; 1 uM;w =
31). We then further confirmed electrophysiologically that applied GABA and synaptically elicited anionic postsynaptic 25 potentials can directly evoke action potentials (Fig. 3d, e).
These results indicate that postsynaptic anion fluxes can cause net excitation in lamina I neurons in PNI rats.
We then compared KCC2 protein levels by immunoblotting on horizontal slices of SDH. The KCC2 expression level in the 30 lumbar SDH ipsilateral to the PNI was significantly reduced (>2-fold) relative to the side contralateral to the injury (Fig. 3f). In naive rats, there was no significant difference between the two sides (n = 3).

If a decrease in the expression of the KCC2 exporter leads to an increase in neuronal [C1-]i and, in turn, GABAAR-mediated depolarization, a pharmacological blockade of the KCC2 exporter in .LI neurons from naive rats should have the same effect. To test for this possibility, we bath applied the selective KCC2 blocker DIOA (30 ~M) to naive spinal slices. As in the PNI condition, GABA application in the presence of DIOA caused an increase in [Ca2~]i in 30o of naive LI neurons tested (Fig. 3b, c).
To assess whether the empirically determined.changes in GABAAR/GlyR-mediated postsynaptic control were sufficient to account for the central sensitization which follows PNI, we simulated in vivo conditions using a biophysically-realistic neuron model (Fig. 5).'The simulation confirmed that, after PNI, the extent of LI neuronal sensitization varied as a function of their Eanion~ ranging from slight disinhibition to a net hyperexcitation.
To test whether this hyperexcitability (sensitization) would result in a decrease in the stimulus threshold to evoke a nociceptive withdrawal reflex, we administered DIOA (15-30 fig) directly to the lumbar enlargement of the spinal cord in intact rats via an intrathecal catheter. DIOA caused a rapid and reversible decrease in nociceptive threshold to both mechanical and thermal stimuli (Fig. 4a-b). A similar decrease in wociceptive threshold was further obtained via selective knock-down of the exporter using spinal administration of an antisense oligodeoxynucleotide against KCC2 mRNA (Fig. 4e), further confirming the functional impact of KCC2 dowregulation.
As shown in Figure 7, we demonstrate that in lamina I neurons taken from rats with peripheral neuropathy, the transmembrane anion reversal potential (Eanion) is significantly more depolarized than that in lamina I neurons taken from naive rats. The anion (bicarbonate and chloride) reversal potential (Ea"ion) of recorded from lamina I neurons taken from naive rats was significantly less than that recorded from the lamina I neurons of rats that had received a peripheral nerve injury (PNI). Bath application of both BDNF (50 ng/ml; N/BDNF) and NGF (50 ng/ml; N/NGF) caused the Eanion recorded from naive rat lamina I neurons to become' significantly depolarized, indicating a collapse of the transmembrane anion gradient. Alternatively, bath application of the TrkB antagonist K-252a (200 nM; P/K252a) to lamina I neurons taken from a PNI rat caused a hyperpolarization of the Eanion to a level similar to that observed in lamina I neurons taken from naive rats. All Ea"ion values were confirmed using gramicidin-D perforated-patch voltage-clamp recordings. This depolarized Eanion is the result of a decreased expression of the KCC2 cotransporter in the lamina I neurons taken from neuropathic rats, as noted above. In lamina I neurons from naive rats, it is further shown herein that the Eanion may be depolarized significantly via the perfusion of the growth factors NGF and BDNF, suggesting that these growth factors may decrease the function and/or expression of the KCC2 protein in the superficial dorsal horn. Alternatively, blocking the BDNF
receptor, TrkB, in lamina I neurons taken from neuropathic rats using the protein kinase inihibitor K-252a,, is shown herein to reverse the depolarization of the Eanionr returning this value to a level similar to that observed in lamina I
neurons taken from naive rats. Further, as shown in Figure 8, intrathecal administration of the receptor tyrosine kinase inhibitor K-252a (6 nM) (but not vehicle injection alone) resulted in an increase in the threshold for tactile nociceptive withdrawal in rats that had received peripheral nerve injury. K-252a can thus reverse the hyperalgesiaJallodynia after its development following peripheral nerve injury. K-252a did not produce any motor disturbances or sedation as assessed by grasping, righting and placing reflexes and behavioral observations. It is envisioned that this inhibitor reactivates the KCC2 cotransporter in lamina I neurons taken from neuropathic rats by blocking phosphorylation, perhaps at a protein tyrosine kinase site on the transporter or on its transcription factors (or other regulatory substrate).
The results herein show that the painful'neuropathy that follows PNI can be explained by a downregulation of the KCC2 exporter and the resultant shift in the union in spinal hI neurons. They also demonstrate that such a modification of union in adult animals can occur in a neuron transsynaptic to an injury site. Previous efforts to identify a substrate underlying the hyperexcitability characteristic of peripheral neuropathy have focussed on measuring changes in number of GABAergic interneurons, GABA content or GABAAR expression. The results have been contradictory (3-6). The findings presented herein provide a new avenue to understand such mechanisms of disinhibition. The conversion of the GABAAR/GlyR-mediated postsynaptic action via a shift in union provides a mechanistic basis for central sensitization, including increases in neuronal responsiveness and number of excitatory inputs.
A critical feature of the spinal cord is that it employs two very distinct GABAergic inhibitory mechanisms:
GABAergic control of the central terminals of sensory fibres already involves a depolarizing mechanism (39), in contrast to dorsal horn cells where GABAergic inhibition involves hyperpolarization. Thus, the change in KCC2 expression reported here affects the polarity of GABA action in only one of the two inhibitory mechanisms controlling sensory input.
This is confirmed by the fact that primary afferents lack expression of KCC2 (Fig.4f, g; see also Fig. 6).
GABA/glycine-mediated depolarization may also serve as a gating mechanism to enable excitation via voltage sensitive Ca2+ channels (VSCCs) and NMDA receptor/channels (10). Ca2+
influx via these channels is thought to be critical for the sensitization of spinal neurons (11). Indeed, blocking these Ca2+ channels in humans by drugs such as gabapentin and ketamine has proven highly efficacious in the treatment of neuropathic pain (12-14). However, use of Ca2~ channel blockers, particularly ketamine and other NMDA antagonists, is associated with many undesirable side effects (14, 15).
Example 3 - In vitro TrkB-dependent modulation of KCC2 Parasaggital slices (250-300 microm) were made from the dorsal horn of naive rats or PNI rats. Slices were continually perfused with an oxygenated Ringer's solution and were permitted to equilibrate for at least 1.5 hours prior to manipulation. Unless otherwise specified, slices were further perfused with 10 microM CNQX, a blocker of non-NMDA
ionotropic glutamate receptors. Recordings were made from visually-identified lamina~I neurons using gramicidin-D
perforated-patch or whole-cell voltage-clamp recordings. In both cases, pipettes were filled with an intracellular solution containing either potassium methyl sulphate or cesium gluconate as the major ionic species. Eanion was measured by applying a series of brief (5-10 ms) applications of exogenous GABA to the soma of the neurons of interest; by manipulating the membrane potential of the neuron, the point at which GABA elicited neither an inward nor an outward anion current was taken as union. All measurements of membrane S

potential were corrected for liquid junction potential, pipette offset, and resistances.
As shown in Figure 12, both brain-derived neurotrophic factor- (BDNF; 50 ng/ml in bath) mediated 5 activation of TrkB and nerve growth factor- (NGF; 50 ng/ml in bath) mediated activation of TrkA caused a significant depolarization of the anion reversal potential (Eanion) in lamina I neurons taken from naive rats.
Using slices taken from peripheral nerve injured 10 (PNI) rats, where the Eanion is chronically depolarized, application of various inhibitors of components of an intracellular pathway coupled to TrkB receptors were shown to cause a significant hyperpolarization of the Eanion (bicarbonate and chloride), to levels similar to that 15 observed in slices taken from naive rats (Figure 13). Agents that rendered this effect included, but are not limited to, an antibody directed against TrkB, (anti-TrkB-IgG 1 ~g/ml in bath); K-252a, an inhibitor of TrkA/B autophosphorylation (200 nM in bath); H-89, a membrane-permeable inhibitor of 20 cyclic AMP-dependent kinase (PKA); 15 ~M in bath); and KN-93, a membrane permeable inhibitor of calmodulin-dependent kinase II and IV (5 ~M in bath).
Example 4 - TrkB-dependent modulation of nociceptive 25 threshold in vivo.
All drugs used for local spinal delivery via intrathecal catheter were dissolved in 0.9o NaCl with or without 10o v/v DMSO. Intrathecal catheterization was 30 performed by creating a small opening at the cisterna magna, and inserting a short P10 polyethylene tube into the subarachnoid space, caudally directed ~ 8 cm to the lumbar enlargement (Z4-5) of the spinal cord. No drug administered produced motor disturbances or sedation, as assessed via analysis of grasping, righting and placing reflexes and other behavioral observations. Von Frey testing was used to assess the 50o withdrawal threshold to mechanical stimulation as previously described (41). All experiments were performed on intact, adult Sprague-Dawley rats.
Local spinal delivery of various agents using an intrathecal catheter led to the identification of several compounds that either effect a reduction of nociceptive threshold for tactile stimulation in naive rats, or raise the nociceptive threshold in PNI rats.
Local spinal delivery of either an adenovirus transducing BDNF (Figure-14) or human recombinant BDNF
(10 ~,g/day'x 6 days), but not of an adenovirus transducing the green-fluorescent protein, caused a significant decrease in the nociceptive threshold for mechanical.stimulation in naYve rats. Likewise, intrathecal delivery of human recombinant NGF (Figure 15; 10 ~g/day x 6 days) to naive rats caused a very similar decrease in the said nociceptive threshold.
Qn the other hand, serial administration of antibody directed against TrkB (anti-TrkB-IgG 12 ~g/2 hrs x 3) via intrathecal catheter to PNI rats effected a significant increase in nociceptive threshold to mechanical stimulation (Figure 16). Local spinal delivery of the PKA
inhibitor H-89 (380 nmol) also caused an increase in the nociceptive threshold (Figure 17).
Throughout this application, various references are cited, which describe more fully the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

REFERENCES

1. Melzack,R. & Wall,P.D. (1965) Science 150:971-979.
2. Woolf,C.J. & Salter,M.W. (2000) Science 288:1765-1769.
3. Kontinen,V.K., et al. (2001) Anesthesiology 94:333-339. .
4. Moore,K.A. et al. (2002) J. Neurosci 22:6724-6731.
5. Somers,D.L. & Clemente,F.R. (2002) Neurosci Lett 323:171-174.
6. Polgar,E., a1. Soc Neurosci Abstr 28, 655.3. 6-11-2002.
et 7. Light,A.R. e initial processing of pain. Karger, Basel Th (1992) .

8. Ebihara,S., t al. (1995) J Physiol 484 (Pt 1), 77-86.
e 9. Keller,A.F., et al. (2001) J Neurosci 21:7871-7880.

10. Staley,K.J., et al. (1995) Science 269:977-981.

11. Coderre,T.J. & Melzack,R. (1992) J Neurosci 12:3665-3670.

12. Serpell,M.G. (2002) Pain 99:557-566.

13. Rabben,T., al. (1999) J. Pharmacol. Exp. Ther.
et 289:1060-1066.

14. Martin,T.J. Eisenach,J.C. (2001) J. Pharmacol. Exp.
&

Ther.
299:811-817.

15. Farber,N.B., et al. (2002) Mol. Psychiatry 7:726-733.

16. Mosconi,T. Kruger,L. (1996) Pain 64:37-57.
&

17: Coderre,T.J. & Van, E., I. (1994) Pain 59:345-352.

18. Rivera,C. al. (1999) Nature 397:251-255.
et

19. Prescott,S.A.& de Koninck,Y. (2002) J Physiol 539:817-836.

20. Payne,J.A., et al. (1996) J. Biol. Chem. 271:16245-16252.

21. Mount,D.B. et al. (1999) J. Biol. Chem. 274:16355-16362.

22. Kelsch,W. et al. (2001) J Neurosci 21:8339-8347.

23. Strange, K. , et al. (2000 ) Am. J. Physiol Cell Physiol 279:C860-C867.

24. Shen,M.R. et al. (2001) Proc. Natl. Acad. Sci. U.
S. A 98:14714-14719.

25. Gulyas,A.I., et al. (2001) Eur. J. Neurosci.
13:2205-2217.

26. Payne,J.A. (1997) Am. J. Physiol 273:C1516-C1525.

27. Flatman, P.W., et al. (1996) Am. J. Physiol 271:C255-C263.

28. Howard,H.C. et al. (2002) Nat. Genet. 32:384-392.

29. Sung,K.W., et al. (2000) J. Neurosci. 20:7531-7538:

30. Mainen,Z.F., et al. (1995)Neuron 15:1427-1439.

31. Traub,R.J. & Miles,R. Neuronal Networks of the Hippocampus. Cambridge, Cambridge, U.K. (1991).

32. Narikawa,K., et al. (2000) J Neurophysiol 84:2171-2174.

33. Furue,H., et al. (1999) J Physiol 521:529-535.

34. ~ Ribeiro-da-Silva, A. & Coimbra,A. (1982) J. Comp Neurol. 209, 176-186.

35. Ribeiro-da-Silva,A. The Rat Nervous System.
Paxinos,G. (ed.), pp. 47-59 (Academic Press, Sydney, Australia, 1995).

36. Sik,A., et al. (2000) Neuroscience 101, 51-65.

37. Gulyas,A.I., et al. (2001) Eur. J. Neurosci. 13, 2205-22 17.

38. Delpire, E. & Mount, D.B. (2002) Annu. Rev.
Physiol. 64:803-403.

39. Woo, N-S., et al. (2002) Hippocampus 12:258-268.

40. Rudomin,P. & Schmidt,R.F. (1999) Exp Brain Res 129:1-37.

41. Chaplan et al., (1994) J. Neuroscience Methods 53:55-63.

42. Jarolimek at al. (1999) J. Neuroscience 19: 4695-704.

SEQUENCE LISTING
<110> Universite Laval De Koninck, Yves De Koninck, Paul Coull, Jeffrey <120> CNS chloride modulation and uses thereof <130> 85409-2f <150> US 60/470,885 <151> 2003-05-16 <160> 8 <l70> Patentln version 3.2 <210> 1 -<21l> 5907 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (l)..(3351) <400> 1 atg ccc aac aac ctg acg gac tgc gag gac ggc gat ggg gga gcc aac 48 Met Pro Asn Asn Leu Thr Asp Cys Glu Asp Gly Asp Gly Gly Ala Asn ccg ggt gat ggc aac ccc aag gaa agc agt ccc ttc atc aac agc acc 96 Pro G1y Asp Gly Asn Pro Lys Glu Ser Ser Pro Phe Ile Asn Ser Thr gac aca gag aag gga aag gag tat gat ggc aag aac atg gcc ttg ttt 144 Asp Thr Glu Lys Gly Lys Glu Tyr Asp Gly Lys Asn Met Ala Leu Phe gag gag gag atg gac acc agc cct atg gtg tcc tcc ttg ctc agt ggc 192 Glu Glu Glu Met Asp Thr Ser Pro Met Val Ser Ser Leu Leu Ser G1y 50 ~ 55 60 ctg gcc aac tac acc aac ctg ccc cag gga agt agg gag cat gaa gag 240 Leu Ala Asn Tyr Thr Asn Leu Pro Gln G1y Ser Arg Glu His Glu G1u gca gaa aac aat gag ggt gga aaa aag aag ccg gtg cag gcc cca cgc 288 Ala Glu Asn Asn Glu Gly Gly Lys Lys Lys Pro Val Gln Ala Pro Arg 85 90 ~ 95 atg ggc acc ttc atg ggc gtg tac ctg ccg tgc ctg cag aac atc ttt 336 Met Gly Thr Phe Met Gly Val Tyr Leu Pro Cys Leu Gln.Asn Ile Phe ggc gtc atc ctc ttc ctg cgg ctc acc tgg gtg gtg ggc att gca ggc 384 Gly Val Tle Leu Phe Leu Arg Leu Thr Trp Val Val Gly Ile Ala Gly atc atg gag tcc ttc tgc atg gtg ttc atc tgc tgc tcc tgt acg atg 432 Ile Met Glu Ser Phe Cys Met Val Phe Ile Cys Cys Ser Cys Thr Met ctc acg gcc atc tcc atg agt gca att gca acg aat ggt gtt gtg cct 480 Leu Thr Ala I1e Ser Met Ser Ala Ile Ala Thr Asn Gly Val Val Pro 145 150 155 ~ 160 get ggt ggc tcc tac tac atg att tcc agg tct ctg ggc cca gag tt.t 528 Ala Gly Gly Ser Tyr Tyr Met Ile Ser Arg Ser Leu Gly Pro Glu Phe ggg ggt gcc gtg ggc ctc,tgc ttc tac ctg ggc act acc ttt gca gga 576 Gly Gly Ala Val Gly Leu Cys Phe Tyr Leu Gly Thr Thr Phe Ala Gly gcc atg tac atc ctg ggc acc atc gaa atc ctg ctg get tac ctc ttc 624 Ala Met Tyr Ile Leu Gly Thr Ile Glu Ile Leu Leu Ala Tyr Leu Phe cca gcc atg gcc atc ttc aag gca gaa gat gcc agt ggg gag gca gca 672 Pro Ala Met Ala Ile Phe Lys Ala Glu Asp Ala Ser Gly Glu Ala Ala gcc atg ctg aac aac atg cgt gtt tac ggc acc tgt gtg ctc acc tgc 720 Ala Met Leu Asn Asn Met Arg Val Tyr Gly Thr Cys Val Leu Thr Cys atg gcc act gtg gtg ttt gtg ggt gtc aag tat gtc aac aag ttt gcc 768 Met Ala Thr Val Val Phe Val Gly Val Lys Tyr Val Asn Lys Phe Ala ctt gtc ttc ctg ggt tgt gtc atc ctc tcc atc ctg gcc atc tat get 816 Leu Val Phe Leu Gly Cys Val Ile Leu Ser Ile Leu Ala Ile Tyr Ala ggg gtc atc aag tct gcc ttc gac cca ccc aac ttc ccg atc tgc ctc ~ 864 Gly Val Ile Lys Ser Ala Phe Asp Pro Pro Asn Phe Pro Ile Cys Leu ctg ggt aac cgc acg ctg tct cgc cat ggc ttt gat gtc tgt gcc aag 912 Leu Gly Asn Arg Thr Leu Ser Arg His Gly Phe Asp Val Cys Ala Lys ctg get tgg gaa gga aat gag,acg gtg acc aca cgg cta tgg ggc ctt 960 Leu Ala Trp Glu Gly Asn Glu Thr Val Thr Thr Arg Leu Trp Gly Leu ttc tgc tcc tct cgc ttc ctc aac gcc acc tgt gat gaa tac t'tc acc 1008 Phe Cys Ser Ser Arg Phe Leu Asn Ala Thr Cys Asp Glu Tyr Phe Thr cga aacaatgtc acagagatccag ggcatccct ggtgetgcc agtggc 1056 Arg AsnAsnVal ThrGluIleGln GlyIlePro GlyAlaAla SerGly ~ctcatcaaagag aacctctggagc tcctacctg accaagggc gtgatt ll04 Leu IleLysGlu AsnLeuTrpSer SerTyrLeu ThrLysGly ValIle 355 360' 365 gtg gagaggagt gggatgacctcg gtgggcctg gccgatggc actcct 1152 Val GluArgSer GlyMetThrSer ValGlyLeu AlaAspGly ThrPro atc gacatggac cacccttatgtc ttcagtgat atgacctcc tacttc 1200 Ile AspMetAsp HisProT,yrVal PheSerAsp MetThrSer TyrPhe acc ctgctggtt ggcatctacttc ccctcagtc acagggatc atgget 1248 Thr LeuLeuVal GlyIleTyrPhe ProSerVal ThrGlyIle MetAla 405 410 . 415 ggt tctaaccgc tctggggacctg agggatgcc cagaagtca atcccc 1296 Gly SerAsnArg SerGlyAspLeu ArgAspAla GlnLysSer IlePro act ggcaccatc ctggccatCgCC aCCaCCtCt gCtgtCtaC atCagC 1344 Thr G1yThrIle LeuAlaIleAla ThrThrSer AlaVa1Tyr IleSer tcc gttgttctg tttggggcctgc attgagggg gtcgtcctg cgggac 13.92 Ser ValValLeu PheGlyAlaCys IleGluGly ValValLeu ArgAsp aagtttggc gaagetgtg aatggcaac ctcgtggtg ggcactctg gcc 1440 LysPheGly GluAlaVal AsnGlyAsn LeuValVal GlyThrLeu Ala tggccatct ccatgggta attgtcatc ggatccttc ttctccaCC tgt 1488 TrpProSer ProTrpVal TleValTle GlySerPhe PheSerThr Cys ggggetggg ctgcagagc ctcacgggg gccccacgc ctgctgcag gcc 1536 GlyA1aGly LeuGlnSer LeuThrGly AlaProArg LeuLeuGln Ala atctcgagg gatggcatt gtgcccttc ctgcaggtc tttggccat ggc 1584 IleSerArg AspGlyIle ValProPhe LeuGlnVal PheG1yHis G1y aaggccaat ggagagccg acctgggcc ctgctcctg actgcctgc atc 1632 LysAlaAsn GlyGluPro ThrTrpAla LeuLeuLeu ThrAlaCys Ile tgcgagatt ggcatcctc attgcatcc ctcgacgag gtggccccc atc 1680 CysGluIle GlyIleLeu IleAlaSer LeuAspGlu ValAlaPro Ile ctctctatgttc ttcctgatg tgctacatg tttgtgaatctg'gcctgt 1728 LeuSerMetPhe PheLeuMet CysTyrMet PheValAsnLeu AlaCys gcagtgcagacg ctgctgagg acacccaac tggaggccacgc tttcga 1776 AlaValGlnThr LeuLeuArg ThrProAsn TrpArgProArg PheArg tattaccactgg accctctcc ttcctgggc atgagcctctgc ctggcc 1824 TyrTyrHisTrp ThrLeuSer PheLeuGly MetSerLeuCys LeuAla ctcatgttcatc tgctcctgg tattatgca ctggtagccatg ctcatt 1872 LeuMetPheIle CysSerTrp TyrTyrAla LeuValAlaMet LeuIle 610 615 ~ 620 getggactcatc tacaagtac attgagtac cgtggggcagag aaggag 1920 AlaGlyLeuIle TyrLysTyr IleGluTyr ArgGlyAlaGlu LysGlu tggggcgatggg atacgaggt ctgtctctc agtgcggetcgc tatgcc 1968 TrpGlyAspGly IleArgGly LeuSerLeu SerAlaAlaArg TyrAla ctcttacgcctg gaggaaggg cccccacac accaagaactgg aggcca 2016 LeuLeuArgLeu GluGluGly ProProHis ThrLysAsnTrp ArgPro cagctg.'ctggtg ctggtgcgt gtggaccaa gaccagaatgtg gtgcac 2064 GlnLeuLeuVal LeuValArg ValAspGln AspGlnAsnVal ValHis ccccagctgctc tcactgacc tcccagctg aaggcagggaag ggcctg 2112 ProGlnLeuLeu SerLeuThr SerGlnLeu LysAlaGlyLys GlyLeu accatcgtgggc tctgtcctt gagggcacc tttctggaaaat catcca 2160 ThrIleValGly SerValLeu GluGlyThr PheLeuGluAsn HisPro caggcccagcgg gcagaagag tctatcagg cgcctgatggag gcagag 2208 GlnAlaGlnArg AlaGluGlu SerIleArg ArgLeuMetGlu AlaGlu aaggtgaagggc ttctgccag gtggtgatc tcctccaacttg cgtgat 2256 LysValLysGly PheCysGln ValValIle SerSerAsnLeu ArgAsp ggcgtgtcccat ctgatccag tccgggggc ctcggggggctg cagcac 2304 GlyValSerHis LeuIleGln SerGlyGly LeuGlyGlyLeu GlnHis aacactgtgctt gttggctgg ccccgcaac tggcgccagaag gaagat 2352 AsnThrValLeu ValGlyTrp ProArgAsn TrpArgGlnLys GluAsp cat cag acg tgg agg aac ttc att gag ctg gtc cgg gaa acc aca get 2400 His Gln Thr Trp Arg Asn Phe Ile Glu Leu Val Arg Glu Thr Thr A1a ggc cac tta gcc ctg ctg gtc acc aag aac gtt tcc atg ttt cct ggg 2448 Gly His Leu Ala Leu Leu Val Thr Lys Asn Val Ser Met Phe Pro Gly aac cct gag cgc ttc tct gag ggc agc atc gac gtt tgg tgg att gtg 2496 Asn Pro Glu Arg Phe Ser Glu Gly Ser,Ile Asp Val Trp Trp I1e Val cacgatgga ggcatgctc atgctgctg cccttcctg ctgcggcaccac 2544 HisAspGly GlyMetLeu MetLeuLeu ProPheLeu LeuArgHisHis aaggtctgg cggaagtgc aagatgcgt atcttcact gtggcccagatg 2592 LysValTrp ArgLysCys LysMetArg IlePheThr ValAlaGlnMet gatgacaat agcatccag atgaagaag gatctgacc acatttctgtat 2640 AspAspAsn SerIleGln MetLysLys AspLeuThr ThrPheLeuTyr catttacgc atcactgcg gaggtcgag gtggtggag.atgcatgagagc 2688 HisLeuArg IleThrAla GluValGlu ValValGlu MetHisGluSer 885. 890 895 gacatctca gettacacc tatgagaag acgttggtg atggagcagcgt 2736 AspIleSer AlaTyrThr TyrGluLys ThrLeuVal MetGluGlnArg tcccagatc ctcaaacag atgcattta accaagaat gagcgggagcgg 2784 SerGlnIle LeuLysGln MetHisLeu ThrLysAsn GluArgGluArg gagatccag agtatcaca gatgagtca cgaggctca atccggagaaag 2832 G1uIleGln SerIleThr AspGluSer ArgGlySer IleArgArgLys aatccagcc aacacgcgg ctccgc.ctg aacgtccca gaagagacgget 2880 AsnProAla AsnThrArg LeuArgLeu AsnValPro GluGluThrAla ggtgacagt gaagagaag ccagaggag gaggtgcag ctg'atccacgat 2928 GlyAspSer GluGluLys ProGluGlu GluValGln LeuIleHisAsp cagagtget cccagctgc cccagcagc tccccgtcc ccaggggaggag 2976 GlnSerAla ProSerCys ProSerSer SerProSer ProGlyGluGlu cctgagggg gaaggggag acagatccg gagaaggtg catctc 3024 acc tgg ProGluGly GluGlyGlu ThrAspPro GluLysVal HisLeu Thr Trp acc aag gac aag tcg gtg gca gag aag aat aag ggc ccc agt cct 3069 Thr Lys Asp Lys Ser Val Ala Glu Lys Asn Lys Gly Pro Ser Pro gto tcc tct gag ggc atc aag gac ttc ttc agc atg aag ccg gag 3114 Val Ser Ser Glu Gly Ile Lys Asp Phe Phe Sex Met Lys Pro Glu tgg gag aac ttg aac cag tcc aac gtg cgg cgc atg cac acg gcc 3159 Trp Glu Asn Leu Asn Gln Ser Asn Val Arg Arg Met His Thr Ala gtg cgg ctg aac gag gtc atc gtg aag aaa tcc cgg gac gcc aag 3204 Val Arg Leu Asn Glu Val Tle Val Lys Lys Ser Arg Asp Ala Lys ctt gtt ttg ctc aac atg cct ggg cct ccc cgc aac cgc aat ggt 3249 Leu Val Leu Leu Asn Met Pro Gly Pro Pro Arg Asn Arg Asn G1y gat gaa aac tac atg gag ttt ctc gag gtc ctc aca gag cac ctg 3294 Asp Glu Asn Tyr Met Glu Phe Leu Glu Val Leu Thr Glu His Leu gac cgg gtg atg ctg gtc cgc ggt ggt ggc cga gag gtc atc acc 3339 Asp Arg Val Met Leu Val Arg Gly Gly Gly Arg Glu Val Ile Thr atc tac tcc tga gaaccaggtc ctgccacccg ggcccgagcg cgcccggccc 3391 Ile Tyr Ser gcggctccgg agccctcgcc gcgccccccg ccgctgtcac cgtttacata cagaccctgt 3451 gcccgtgtcc tggcccctta ccccgctgcc tgaagcccgg aggccacgcc tgttggggct 3511 gattcggaga gggcgccccg ccgcgcagag accagagctc ctcagtgcca gtttggcccc 3571 tgggtcttcg ctgccctttt tctaagcccg gcctcgtctc gccggaggag acgctgcaat 3631 aaaggttgggagaaggcgcggaaaggagaggagctggggccttggggacccccaggtagt3691 CCatgCggCCCattCCtCCCCttCCC3CtCCCgCCgCggtCCtCgCtCtgCCJCtCCtCCg3751 gcgctgctccctggctcccggcggcccggaggcccgcggggtgggaaggccgcgcttgcc3811 gtctccgccgccccttctcgccgagccgtggggcgcgggcggccgagcctatacatagtg3871 tacaggagacatcgcgtgtatttttaacgtccccatatttatgtgactagaagcgcaaca3931 gacttctcgccatagtcgagctctcccgctgggggcactgcggggaggcgaggcctcggg3991 aagctgaattttccttgacgtccaagagtttgagagcgaaagtgctttaggcccaggcgg4051 gggtcgtggcctcgttccctcgacacctccgtcctgctctcgcctcttcgccctttccgc4111 gcgcccttggcttcccaccctcctctccagtccttttccgagatgaggtgagacaagggt4171 ccaacttttc ctggattcgc ctcccagcgg acgtgagctt ccactgcggc tgcagagacg 4231 cgagcaacct cttctcatcg gctcttatgc aagttggggc caggataggg gaggggtgct 4291 cctcaagagg aagaaaccga gaggcccgcg ccccaccgag gaagccccgc cccggtgcct 4351 tcgctgggga gcaggcgtct ctcctcagtc ggcttgtcgc ctgctccccg tatcccatgg 4411 ctcctcgcca aagactgaaa ttgtggagct ggagggcgcc ccctccccgg agtttcctcc 4471 ctgggacaag tgagggagga gggggccgat tctggtttag gggccggacc cactgagagg 4531 ccccagagcc gcccgtgatg ttcctccccc gtccccatct ggcagctcct gtctcgcctg 4591 agggacccag ccgccttctc cgtgctctgg ggccgggcct cgctgcttag cagcggcctc 4651 tagctccgtc tcccggggac ctgggcctga gggagggctg gagtcagcac gcgctttgtc 4711 cttagcgcct gtctgctctc ctctaactag gacccagggc ctttggcttc cccagctcat 4771 ccttggccct tccgctccac cagcctggtc tgaggcgtgc tctgtcctta gagaaggcgc 4831 ggtggccggg ttcccttccc ctagggcaca ttactaaggg ggtcaggcac tgcatgctcg 4891 ttccagcacc atctgggact gggtacagta cctccagccc cagggccctg acctgcgcac 4951 ctagcttgac atctcacgca cctcccagag ctggcgccac tgagtaatcc ggacctcacc 5011 acctcttttcctttgagcccaaggcagagctagagctggagctggcgccacccagacagc5071 gtcaggtgtggctggggtaggtttggaggtctgccagttacgccaagtcccctctgagat5131 tcgatcaggggactggatagattctttcaggtactcaatcaggaagctggaggtgttaga5191 caccagccccctgcatccttcagtagacctccctctgaacaccacagccaggtcctgcct5251 tctgggggcctgaatattccagagctgatgtgatgggctgtgcagaagggggctgtatca5311 acatcaattagggaaccaaagttgcactatctgggcccagattgtctggttggcaagagc5371 aaagtttccgttgatgaaac,agacatcccacaacaaaaacccaagttttctgtgctacat5431 gtgcaatatttgttatgaatgttatcacaagtcattcatcaagttatctttataatcact5491 gtagttagatgtttcatgtccattcaagtgacttttattctgagtgcaatatttcaatag5551 ccttgtagtgataactagtgttgcttttgtttagatgatctatgtgcagggcaatgcaat5611 gaagttgaaaccccttggtaataggagaggttgcaaaccaaatcaagagtatttattact5671 attactgctattattattaggcctgcctttaattttcagtgtaagtgttcagtatgccgc5731 atcctgcctcagtattgatcttgtgttctttgtgccaatatgaaaaggagagggttggtt5791 ctttcctttattgttgaatgctcccatttaatgctttatggcttttactgtattactttt5851 ttagactccc gtctgcacaa aatgcaataa aaataatttt attataaaaa aaaaaa <210> 2 <211> 1116 <212> PRT
<213> Homo sapiens <400> 2 Met Pro Asn Asn Leu Thr Asp Cys Glu Asp Gly Asp Gly Gly Ala Asn 1 5. 10 15 Pro Gly Asp Gly Asn Pro Lys Glu Ser Ser Pro Phe Ile Asn Ser Thr Asp Thr Glu Lys Gly Lys Glu Tyr Asp Gly Lys Asn Met A1a Leu Phe Glu Glu Glu Met Asp Thr Ser Pro Met Val Ser Ser Leu Leu Ser Gly Leu Ala Asn Tyr Thr Asn Leu Pro Gln Gly Ser Arg Glu His Glu Glu 65 ~ 70 75 80 Ala G1u Asn Asn Glu Gly Gly Lys Lys Lys Pro Val Gln Ala Pro Arg Met Gly Thr Phe Met Gly Val Tyr Leu Pro Cys Leu Gln Asn Ile Phe Gly Va1 Ile Leu Phe Leu Arg Leu Thr Trp Val Val Gly I1e Ala Gly Ile Met Glu Ser Phe Cys Met Val Phe Ile Cys Cys Ser Cys Thr Met Leu Thr Ala Ile Ser Met Ser Ala Ile Ala Thr Asn Gly Val Val Pro 145 150 155 ' 160 Ala Gly Gly Ser Tyr Tyr Met Ile Ser Arg Ser Leu Gly Pro Glu Phe Gly Gly Ala Val Gly Leu Cys Phe Tyr Leu Gly Thr Thr Phe Ala Gly Ala Met Tyr Ile Leu Gly Thr Ile Glu Ile Leu Leu Ala Tyr Leu Phe Pro Ala Met Ala Ile Phe Lys Ala Glu Asp Ala Ser Gly G1u Ala Ala Ala Met Leu Asn Asn Met Arg Val Tyr Gly Thr Cys Val Leu Thr Cys Met Ala Thr Val Val Phe Val Gly Val Lys Tyr Val Asn Lys Phe Ala Leu Val Phe Leu Gly Cys Val Ile Leu Ser Tle Leu Ala Ile Tyr Ala Gly Val Ile Lys Ser Ala Phe Asp Pro Pro Asn Phe Pro Ile Cys Leu 275 280 ~ 285 Leu Gly Asn Arg Thr Leu Ser Arg His Gly Phe Asp Va1 Cys Ala Lys Leu Ala Trp Glu Gly Asn Glu Thr Val Thr Thr Arg Leu Trp Gly Leu Phe Cys Ser Ser Arg Phe Leu Asn Ala Thr Cys Asp Glu Tyr Phe Thr Arg Asn Asn Val Thr Glu Ile Gln Gly Ile Pro Gly Ala Ala Ser Gly Leu Ile Lys Glu Asn Leu Trp Ser Ser Tyr Leu Thr Lys Gly Val Ile Val Glu Arg Ser Gly Met Thr Ser Va1 Gly Leu Ala Asp Gly Thr Pro 370 . 375 380 Ile Asp Met Asp His Pro Tyr Val Phe Ser Asp Met Thr Ser Tyr Phe Thr Leu Leu Val Gly Ile Tyr Phe Pro Ser Val Thr Gly Ile Met Ala Gly Ser Asn Arg Ser Gly Asp Leu Arg Asp Ala Gln Lys Ser Ile Pro Thr Gly Thr Ile Leu Ala Ile Ala Thr Thr Ser Ala Val Tyr Ile Ser 435 , 440 445 Ser Va1 Val Leu Phe Gly Ala Cys,Ile G1u Gly Val Val Leu Arg Asp Lys Phe Gly Glu Ala Val Asn Gly Asn Leu Val Val Gly Thr Leu Ala Trp Pro Ser Pro Trp Val Ile Val Ile Gly Ser Phe Phe Ser Thr Cys Gly Ala Gly Leu Gln Ser Leu Thr Gly Ala Pro Arg Leu Leu Gln A1a Ile Ser Arg Asp Gly Ile Val Pro Phe Leu Gln Val Phe Gly His Gly Lys Ala Asn Gly Glu Pro Thr Trp Ala Leu Leu Leu Thr Ala Cys Ile Cys Glu Ile Gly Tle Leu Ile Ala Ser Leu Asp Glu Val Ala Pro Ile Leu Ser Met Phe Phe Leu Met Cys Tyr Met Phe Val Asn Leu Ala Cys Ala Val Gln Thr Leu Leu Arg Thr Pro Asn Trp Arg Pro Arg Phe Arg Tyr Tyr His Trp Thr Leu Ser Phe Leu Gly Met Ser Leu Cys Leu Ala Leu Met Phe Ile Cys Ser Trp Tyr Tyr Ala Leu'Val A1a Met Leu I1e 610 ~ 615 620 Ala Gly Leu Ile Tyr Lys Tyr Ile Glu.Tyr Arg Gly Ala G1u Lys Glu Trp Gly Asp Gly Ile Arg Gly Leu Ser Leu Ser Ala Ala Arg Tyr A1a Leu Leu Arg Leu Glu Glu Gly Pro Pro His Thr Lys Asn Trp Arg Pro Gln Leu Leu Val Leu Val Arg Val Asp Gln Asp Gln Asn Val Val His Pro Gln Leu Leu Ser Leu Thr Ser Gln Leu Lys A1a G1y Lys Gly Leu Thr Ile Val Gly Ser Va1 Leu Glu Gly Thr Phe Leu Glu Asn His Pro 705 710 7l5 720 Gln Ala Gln Arg Ala Glu Glu Ser Ile Arg Arg Leu Met G1u Ala Glu Lys Val Lys G1y Phe Cys Gln Val Val I1e Ser Ser Asn Leu Arg Asp Gly Val Ser His Leu Ile Gln Ser Gly Gly Leu Gly Gly Leu Gln His Asn Thr Val Leu Val Gly Trp Pro Arg Asn Trp,Arg Gln Lys Glu Asp His Gln Thr Trp Arg Asn Phe Ile Glu Leu Val Arg Glu Thr Thr Ala Gly His Leu Ala Leu Leu Val Thr Lys Asn Val Ser Met Phe Pro Gly Asn Pro Glu Arg Phe Ser Glu Gly Ser Ile Asp Val Trp Trp Ile Val His Asp G1y Gly Met Leu Met Leu Leu Pro Phe Leu Leu Arg His His Lys Val Trp Arg Lys Cys Lys Met Arg Ile Phe Thr Val Ala Gln Met Asp Asp Asn Ser Ile Gln Met hys Lys Asp Leu Thr Thr Phe Leu Tyr His Leu Arg Ile Thr Ala Glu Val Glu Val Val Glu Met His Glu Ser Asp Ile Ser Ala Tyr Thr Tyr Glu Lys Thr Leu Val Met Glu Gln Arg Ser Gln Ile Leu Lys G1n Met His Leu Thr Lys Asn Glu Arg Glu Arg Glu Ile Gln Ser Ile Thr Asp Glu Ser Arg Gly Ser Ile Arg Arg Lys Asn Pro Ala Asn Thr Arg Leu Arg Leu Asn Val Pro Glu Glu Thr Ala Gly Asp Ser Glu Glu Lys Pro Glu Glu Glu Val Gln Leu Ile His Asp 965 970 . 975 Gln Ser Ala Pro Ser Cys Pro Ser Sex Ser Pro Ser Pro Gly Glu Glu Pro Glu Gly Glu Gly Glu Thr Asp Pro Glu Lys Val His Leu Thr Trp Thr Lys Asp Lys Ser Val Ala Glu Lys Asn Lys G1y Pro Ser Pro Val Ser Ser Glu Gly Ile Lys Asp Phe Phe Ser Met Lys Pro Glu Trp Glu Asn Leu Asn Gln Ser Asn Val Arg Arg Met His Thr Ala Val Arg Leu Asn Glu Val Ile Va1 Lys Lys Ser Arg Asp Ala Lys Leu Val Leu Leu Asn Met Pro Gly Pro Pro Arg Asn Arg Asn Gly Asp Glu Asn Tyr Met Glu Phe Leu Glu Val Leu Thr Glu His Leu Asp Arg Val Met Leu Val Arg G1y Gly Gly Arg Glu Val Ile Thr Ile Tyr Ser <210>

<211>

<212>
DNA

<213>
Mus musculus <220>

<221>
CDS

<222> .(3433) (86).

<400>

gagcaagcga gaggggcgcg ggcgaagcgg 60 gcgagcggag cgcagccatc~
aaggcgggca ccgagcccgg atgctcaacaac ctgacggac tgcgag 112 cgccgcgcag ccacc MetLeuAsnAsn LeuThrAsp CysGlu gac ggc ggg ggagccaac cccggtgatggc aaccccaaa gagagc 160 gat Asp Gly Gly GlyAlaAsn ProGlyAspGly AsnProLys GluSer Asp 15 20 2.5 agt ccc atc aacagcacg gacacggagaag ggcagagag tacgat 208 ttc Ser Pro Ile AsnSerThr AspThrG1uLys GlyArgGlu TyrAsp , Phe ggc agg atg gccctgttt gaggaggagatg gacaccagc cccatg 256 aac Gly Arg Met AlaLeuPhe GluGluGluMet AspThrSer ProMet Asn gta tcc ctg ctcagtggg ctggccaactac accaaccta ccccag 304 tcc Val Ser Leu LeuSerGly Leu~AlaAsnTyr ThrAsnLeu ProGln Ser gga agt gag catgaagaa gcagaaaataat gagggtgga aaaaag 352 aga Gly Ser Glu HisGluGlu AlaGluAsnAsn GluGlyGly LysLys Arg aag ccg cag getcctcga atgggcaccttc atgggtgtg tacctg 400 gtg Lys Pro Gln AlaProArg MetGlyThrPhe MetGlyVal TyrLeu Val ccg tgc ctg cag aac atc ttt ggt gtc atc ctc ttc ctg cgg ctc acg 448 Pro Cys Leu Gln Asn Ile Phe Gly Val Ile Leu Phe Leu Arg Leu Thr tgggtggtgggc atcgcgggc atcatggag tccttctgt atggtcttc' 996 TrpValValGly IleAlaG1y IleMetG1u SerPheCys MetValPhe l25 130 135 atttgctgctcc tgtacgatg ctcacagcc atttccatg agtgcaatc 544 I1eCysCysSer CysThrMet LeuThrAla I1eSerMet SerAIaIle gcaaccaatggt gttgtgcct getggtggc tcgtactac atgatttcc 592 AlaThrAsnGly ValValPro AlaGlyGly SerTyrTyr MetI1eSer 155 '160 165 aggtctctgggc ccggagttt gggggcgcc gtgggcctc tgcttctac 640 ArgSerLeuGly ProGluPhe GlyGlyAla ValGlyLeu CysPheTyr 170 175 180 . l85 ctgggcaccacc tttgetggg getatgtac atccttggc acgatcgag 688 LeuGlyThrThr PheAlaGly AlaMetTyr IleLeuGly ThrIleGlu atcctgctgget tatctcttc ccagetatg gccatcttc aaggcagaa 736 IleLeuLeuAla TyrLeuPhe ProAlaMet AlaIlePhe LysAlaGlu gatgccagtggg gaggcggcc gccatgctg aacaacatg cgggtgtat 784 AspAlaSerGly GluAlaAla AlaMetLeu AsnAsnMet ArgValTyr ggcacctgtgtg ctcacctgc atggccacc gttgtcttt gtgggtgtc 832 GlyThrCysVal LeuThrGys MetAlaThr ValValPhe ValGlyVal aagtacgtcaac aagtttgcc ttggtcttc ctgggttgc gtcatcctg 880 LysTyrValAsn LysPheAla LeuVal.PheLeuGlyCys ValIleLeu tccatcctg,gccatctatgca ggggtcatc aagtctgcc ttcgaccca 928 SerTleLeuAla IleTyrAla Gly,ValIle LysSerAla PheAspPro cccaatttcccg atctgcctc ctggggaac cgcacgctg tctcgccat 976 ProAsnPhePro IleCysLeu LeuG1yAsn ArgThrLeu SerArgHis ggctttgatgtc tgtgccaag ctggettgg gaaggaaat gagacagtg 1024 GlyPheAspVal CysAlaLys LeuAlaTrp GluGlyAsn GluThrVal accacacggctc tggggcctt tt'ctgctcc tcccgcctc ctcaatgcc 1072 ThrThrArgLeu TrpGlyLeu PheCysSer SerArgLeu LeuAsnAla acctgtgatgag tacttcacc cgaaacaat gtcacagag atccagggc 1120 ThrCysAspGlu TyrPheThr ArgAsnAsn ValThrGlu IleGlnGly att cct ggtgetgcc agtggtctc atcaaagag aacctgtggagt tct 1168 Ile Pro GlyAlaAla SerGlyLeu IleLysGlu AsnLeuTrpSer Ser tac ctg accaaaggg gtg.attgtc gagaggcgt gggatgccctct gtg 1216 Tyr Leu ThrLysGly ValIleVa1 GluArgArg GlyMetProSer Val ggc ctg gcagacggt acccccgta gacatggac cacccctatgtc ttc 1264 Gly Leu AlaAspGly ThrProVal AspMetAsp HisProTyrVal Phe agt gat atgacctcc tacttcacc ctgctcgtt ggtatctacttc ccc 1312 Ser Asp MetThrSer TyrPheThr LeuLeuVal GlyIleTyrPhe Pro tca gtc acagggatc atggetggc tcaaaccga tctggagacctg cgg 1360 Ser Val ThrGlyIle MetAlaGly SerAsnArg SerGlyAspLeu Arg gat gcc cagaagtct atccctact ggaactatc ctggccattget acc 1408 Asp Ala GlnLysSer IleProThr GlyThrIle LeuAlaIleAla Thr acc tct getgtctac atcagctct gttgttctg tttggagcctgc atc 1456 Thr Ser AlaValTyr IleSerSer ValValLeu PheGlyAlaCys Ile gag ggg gtcgtctta cgggacaag tttggggaa getgtgaatggc aac 1504 Glu Gly ValValLeu ArgAspLys PheGlyGlu AlaValAsnGly Asn ttg gtg gtgggcacc ctggcctgg ccttctccc tgggtcatcgtc ata 1552 Leu Val ValGlyThr LeuAlaTrp ProSerPro TrpVa1I1eVal I1e ggc tct ttcttctct acctgtggg getggatta cagagcctcaca ggg 1600 Gly Ser PhePheSer ThrCysGly AlaGlyLeu GlnSerLeuThr Gly gcc cca cgtctgctg caggccatc tcccgggat ggcatagtgccc ttc 1648 Ala Pro ArgLeuLeu GlnAlaIle SerArgAsp GlyIleValPro Phe ctg cag gtctttggc catggcaaa getaatgga gagccaacctgg gcg 1696 Leu Gln ValPheGly HisGlyLys AlaAsnGly GluProThrTrp Ala ctg ctg ctgactgcc tgcatctgt gagatcggc atcctcatagcc tcc' 1744 Leu Leu LeuThrAla CysIleCys GluIleGly IleLeuIleAla Ser ctg gat gaggtcgcc cctatactt tccatgttc ttcctaatgtgt tac 1792 Leu Asp GluValAla ProIleLeu SerMetPhe PheLeuMetCys Tyr atgttt gtgaacttg gettgtgcg gtgcagacgctg ctgaggaca ccc 1840 MetPhe ValAsnLeu AlaCysAla ValG1nThrLeu LeuArgThr Pro aactgg aggccacga tttcgctat taccactggact ctctccttc ctg 1888 AsnTrp ArgProArg PheArgTyr TyrHisTrpThr LeuSerPhe Leu ggcatg agcctctgc ctggccctc atgttcatttgc tcctggtac tac 1936 GlyMet SerLeuCys LeuAlaLeu MetPheIleCys SerTrpTyr Tyr gcactg gtggccatg ctcattgcc ggactcatttat aagtacatc gag 1984 AlaLeu ValAlaMet LeuIleAla GlyLeuZ1eTyr LysTyrIle Glu taccgg ggggcggag aaggagtgg ggggatggaatc cgaggcctg tct 2032 TyrArg G1yAlaGlu LysGluTrp G1yAspGlyIle ArgGlyLeu Ser cteagt gcagcacge tatgetctcttg cgcctggag gaaggacct ccg 2080 LeuSer A1aAlaArg TyrAlaLeuLeu ArgLeuGlu GluG1yPro Pro catacg aagaactgg aggccccagctg ctggtgctg gtgcgtgtg gac 2128 HisThr LysAsnTrp ArgProGlnLeu LeuVa1Leu ValArgVal Asp caggat cagaacgtg gtgcatccgcag ctgctctcc ctgacctcc cag 2176 GlnAsp GlnAsnVal ValHisProG1n LeuLeuSer LeuThrSer Gln ctcaag gcagggaag ggcctgaccatt gtgggctcc gtccttgag ggc 2224 LeuLys AlaGlyLys GlyLeuThrIle ValG1ySer ValLeuGlu Gly accttt ctggacaac catccacagget cagcgggca gaggagtet atc 2272 ThrPhe LeuAspAsn HisProGlnAla GlnArgAla GluGluSer Ile aggCCJCCtgatggag getgagaaggtg aagggette tgccaggta gtg 2320 ArgArg LeuMetGlu A1aG1uLysVa1 LysGlyPhe CysGlnVa1 Val 730 ~ 735 740 745 at.ctcc tccaacctg cgtgatggtgtg tcccacctg atccagtct ggg 2368 IleSer SerAsnLeu ArgAspGlyVa1 SerHisLeu IleGlnSer Gly ggcctc gggggattg caacacaatacc gtgctggtg ggctggcct cgc 2416 GlyLeu GlyGlyLeu GlnHisAsnThr ValLeuVal GlyTrpPro Arg aactgg aggcagaag gaggatcatcag acatggagg aacttcatc gaa 2464 AsnTrp ArgGlnLys GluAspHisGln ThrTrpArg AsnPheIle Glu ctggtc cgggaaact acagccggccac ctcgccctg ctggtcacc aag 2512 LeuVal ArgGluThr ThrAlaGlyHis LeuA1aLeu LeuValThr Lys aatgtt tccatgttt cccgggaaccct gagcgcttc tcggagggc agc 2560 AsnVal SerMetPhe ProGlyAsnPro GluArgPhe SerGluGly Ser attgac gtgtggtgg attgtgcacgac gggggcatg ctcatgctg ctg 2608 IleAsp ValTrpTrp IleValHisAsp GlyGlyMet LeuMetLeu Leu cccttc ctgctgcga caccacaaggtc tggaggaaa tgcaaaatg cgg 2656 ProPhe LeuLeuArg HisHisLysVal TrpArgLys CysLysMet Arg atcttc accgtggcc cagatggacgat aacagtatc cagatgaag aag 2704 IlePhe ThrValAla GlnMetAspAsp AsnSerIle GlnMetLys Lys gacctg accacgttt ctgtaccac ttacgcattact gcagaggtg gag 2752 AspLeu ThrThrPhe LeuTyrHis LeuArgIleThr AlaGluVal Glu ,875 880 885 gtggtg gagatgcat gagagcgac atctcggcatac acctacgag aag 2800 ValVal GluMetHis GluSerAsp .TleSerAlaTyr ThrTyrGlu Lys acatta gtaatggag caa~cgatct cagatcctcaaa cagatgcac ctc 28.48 ThrLeu ValMetGlu GlnArgSer GlnIleLeuLys GlnMetHis Leu accaag aacgagcgg gaacgggag atccagagcatc acagacgag tct 2896 ThrLys AsnGluArg GluArgGlu TleGlnSerIle ThrAspGlu Ser cggggc tccattcgg aggaagaat ccagccaacccc cggctccgc ctc 2944 ArgGly SerIleArg ArgLysAsn ProAlaAsnPro ArgLeuArg Leu 940 ~ 945 950 aatgtt cccgaagag acagcgtgt gacaatgaggag aagccagag gag 2992 AsnVal ProGluGlu ThrAlaCys AspAsnGluGlu LysProGlu Glu gaggtg cagctgatc catgaccag agtgetcccagc tgccetagc agc 3040 GluVal GlnLeuIle HisAspGln SexAlaProSer CysProSer Ser tcgcca tctcca.ggg gaggagccc gagggggagagg gagacagac cca 3088 SerPro SerProGly GluGluPro GluGlyGluArg GluThrAsp Pro gag gtg cat ctt acc tgg acc aag gat aag tca gtg gca gag aag 3133 Glu Val His Leu Thr Trp Thr Lys Asp Lys Ser Val Ala Glu Lys aat aaa ggc ccc agt ccc gtc tcc tcc gag ggc atc aag gac ttc 3178 Asn Lys Gly Pro Ser Pro Val Ser Ser Glu Gly Ile Lys Asp Phe ttc agc atg aag ccg gag tgg gaa aac ttg aac cag tcc aat gta 3223 Phe Ser Met Lys Pro Glu Trp Glu Asn Leu Asn Gln Ser Asn Val cgg cgc atg cac aca get gtg cgg ctg aac gag gtc atc gtg aat 3268 Arg Arg Met His Thr Ala Val Arg Leu Asn Glu Val Ile Val Asn aaa cgggat gcc aag gtt ttg ctc atg ccc cct 3313 tct cta aac ggg Lys ArgAsp Ala Lys Val Leu Leu Met Pro Pro Ser Leu Asn Gly ccc aaccgc aat ggg gaa aac tac gaa ttc gag 3358 cgc gat atg ttg Pro AsnArg Asn Gly Glu Asn Tyr Glu Phe Glu Arg Asp Met Leu gtc ctc act gag caa ctg gac cgg gtg atg ctg~gtc cgc ggt ggc 3403 Val Leu Thr Glu Gln Leu Asp Arg Val Met heu Val Arg Gly Gly ggc cga gag gtc atc acc atc tac tcc tga aggccaggac ctgccactcc 3453 Gly Arg Glu Val Ile Thr Ile Tyr Ser ggcccgagcg cgcccggccc gcggccccca gagccctcgc cgcgcctccc cgccgctgtc 3513 aCCgtttaCa taagacccag ttgcccatgc CCtggCCCCt ttCCttCCCg ctgcctgcag 3573 ccctgaggcc ttgcccgtcg gggctgaccc gcagggcggc ccgtgaggcc ccttttctga 3633 gcctggcctc gccccgccgg agc 3656 <210> 4 <211> 1115 <212> PRT
<213> Mus musculus <400> 4 Met Leu Asn Asn Leu Thr Asp Cys Glu Asp Gly Asp G1y Gly Ala Asn Pro Gly Asp Gly Asn Pro Lys Glu Ser Ser Pro Phe Ile Asn Ser Thr Asp Thr~Glu Lys Gly Arg Glu Tyr Asp Gly Arg Asn Met Ala Leu Phe Glu Glu Glu Met Asp Thr Ser Pro Met Val Ser Ser Leu Leu Ser Gly 50 55 ' 60 Leu Ala Asn Tyr Thr Asn Leu Pro Gln Gly Ser Arg Glu His Glu Glu Ala Glu Asn Asn Glu Gly Gly Lys Lys Lys Pro Val Gln Ala Pro Arg Met G1y Thr Phe Met Gly Val Tyr Leu Pro Cys Leu G1n Asn Ile Phe Gly Val Ile Leu Phe Leu Arg Leu Thr Trp Val Val Gly Ile Ala G1y 115 120 ' 125 Ile Met Glu Ser Phe Cys Met Val Phe Ile Cys Cys Ser Cys Thr Met Leu Thr Ala Ile Sex Met Ser Ala Ile Ala Thr Asn Gly Val Val Pro 145 150 ~ 155 160 Ala Gly Gly Ser Tyr Tyr Met Ile Ser Arg Ser Leu Gly Pro Glu Phe Gly Gly Ala Val Gly Leu Cys Phe Tyr Leu Gly Thr Thr Phe Ala Gly Ala Met Tyr Ile Leu Gly Thr Ile Glu Ile Leu Leu Ala Tyr Leu Phe Pro Ala Met Ala Ile Phe Lys Ala Glu Asp Ala Ser Gly Glu Ala Ala Ala Met Leu Asn Asn Met Arg Val Tyr Gly Thr Cys Val Leu Thr Cys Met Ala Thr Val Val Phe Val Gly Val Lys Tyr Val Asn Lys Phe Ala Leu Val Phe Leu Gly Cys Val Ile Leu Ser Ile Leu Ala Ile Tyr Ala Gly Val Ile Lys Ser Ala Phe Asp Pro Pro Asn Phe Pro Tle Cys Leu Leu Gly Asn Arg Thr Leu Ser Arg His Gly Phe Asp Val Cys Ala Lys Leu Ala Trp Glu Gly Asn Glu Thr Val Thr Thr Arg'Leu Trp Gly Leu Phe Cys Ser Ser Arg Leu Leu Asn Ala Thr Cys Asp Glu Tyr Phe Thr Arg Asn Asn Val Thr Glu Ile Gln Gly Ile Pro Gly Ala Ala Ser Gly Leu Ile Lys Glu Asn Leu Trp Ser Ser Tyr Leu Thr Lys Gly Val Ile Val Glu Arg Arg Gly Met Pro Ser Val Gly Leu Ala Asp Gly Thr Pro Val Asp Met Asp His Pro Tyr Val Phe Ser Asp Met Thr Ser Tyr Phe Thr Leu Leu Va.1 Gly Ile Tyr Phe Pro Ser Val Thr Gly Ile Met Ala Gly Ser Asn Arg Ser G1y Asp Leu Arg Asp Ala Gln Lys Ser Ile Pro Thr Gly Thr Ile Leu Ala Ile Ala Thr Thr Ser Ala Val Tyr Ile Ser Ser Val Val Leu Phe Gly Ala Cys Ile Glu Gly Val Va1 Leu Arg Asp 450 ~ 455 460 Lys Phe Gly Glu Al.a Val Asn Gly Asn Leu Val Val Gly Thr Leu Ala 465 470 . 475 480 Trp Pro Ser Pro Trp Val Ile Val Ile Gly.Ser Phe Phe Ser Thr Cys Gly Ala Gly Leu G1n Ser Leu Thr Gly Ala Pro Arg Leu Leu Gln Ala Ile Ser Arg Asp Gly Ile Val Pro Phe Leu Gln Va1 Phe Gly His Gly Lys Ala Asn Gly Glu Pro Thr Trp Ala Leu Leu Leu Thr Ala Cys Ile Cys Glu Ile Gly Ile Leu Ile Ala Ser Leu Asp Glu Val Alae Pro Ile Leu Ser Met Phe Phe Leu Met Cys Tyr Met Phe Val Asn Leu Ala Cys Ala Val Gln Thr Leu Leu Arg Thr Pro Asn Trp Arg Pro Arg Phe Arg Tyr Tyr His Trp Thr Leu Ser Phe Leu Gly Met Ser Leu~Cys Leu Ala Leu Met Phe Ile Cys Ser Trp Tyr Tyr Ala Leu Val Ala Met Leu Ile A1a Gly Leu Ile Tyr Lys Tyr Ile Glu Tyr Arg Gly A1a Glu Lys Glul Trp Gly Asp Gly Ile Arg Gly Leu Ser Leu Ser Ala Ala Arg Tyr Ala 645 650 ' 655 Leu Leu Arg Leu Glu Glu Gly Pro Pro His Thr Lys Asn Trp Arg Pro Gln Leu Leu Val Leu'Val Arg Val Asp Gln Asp Gln Asn Val Val His Pro Gln Leu Leu Ser Leu Thr Ser Gln Leu Lys Ala Gly Lys Gly Leu Thr Ile Val Gly Ser Val Leu Glu.Gly Thr Phe Leu Asp Asn His Pro Gln Ala Gln Arg Ala Glu Glu Ser Ile Arg Arg Leu Met G1u Ala Glu Lys Va1 Lys Gly Phe Cys Gln Val Val Ile Ser Ser Asn Leu Arg Asp Gly Val Ser His Leu Ile Gln Ser Gly Gly Leu Gly Gly Leu Gln His Asn Thr Val Leu Val Gly Trp Pro Arg Asn Trp Arg Gln Lys Glu Asp His Gln Thr Trp Arg Asn Phe Ile Glu Leu Val Arg Glu Thr Thr Ala Gly His Leu A1a Leu Leu Val Thr Lys Asn Val Ser Met Phe Pro Gly Asn Pro G1u Arg Phe Ser Glu Gly Ser Ile Asp Val Trp Trp Ile Val His Asp Gly Gly Met Leu Met Leu Leu Pro Phe Leu Leu Arg His His Lys Val Trp Arg Lys Cys Lys Met Arg Ile Phe Thr Va1 A1a Gln Met Asp Asp Asn Ser I1e Gln Met Lys Lys Asp Leu Thr Thr Phe Leu Tyr His Leu Arg Ile Thr Ala Glu Val Glu Val Val Glu Met His Glu Ser Asp Ile Ser Ala Tyr Thr Tyr G1u Lys Thr Leu Val Met Glu Gln Arg Ser Gln Ile Leu Lys Gln Met His Leu Thr Lys Asn Glu Arg Glu Arg G1u Ile Gln Ser Ile Thr Asp Glu Sex Arg Gly Ser Ile Arg Arg Lys Asn Pro Ala Asn Pro Arg Leu Arg Leu Asn Val Pro Glu Glu Thr Ala Cys Asp Asn Glu Glu Lys Pro Glu Glu Glu Val Gln Leu Ile His Asp Gln Ser Ala Pro Ser Cys Pro Ser Ser Ser Pro Ser Pro Gly Glu Glu Pro Glu Gly Glu Arg Glu Thr Asp Pro Glu Val His Leu Thr Trp Thr Lys Asp Lys Ser Val A1a Glu Lys Asn Lys Gly Pro Ser Pro Val Ser Ser Glu Gly Ile Lys Asp Phe Phe Ser Met Lys Pro Glu Trp Glu Asn Leu Asn Gln Ser Asn Val Arg Arg Met His Thr Ala Val Arg Leu Asn Glu Va1 Ile Val Asn Lys Ser Arg Asp Ala Lys Leu Val Leu Leu,Asn Met Pro Gly Pro Pro Arg Asn Arg Asn Gly Asp G1u Asn Tyr Met G1u Phe Leu Glu Val Leu Thr Glu Gln Leu Asp Arg Val Met Leu Val Arg Gly Gly Gly Arg Glu Val Ile Thr Ile Tyr Ser <210> 5 <211> 5566 <212> DNA
<213> Rattus norvegicus <220>
<221> CDS
<222> (116) . . (3466) <400> 5 ccgctccacg gagagcaagc gacagagctc gagcaagcga gcgagcggcg aaggcgggca 60 gaggggcgcg ggcgaagagg cgcagccatc ccgagcccgg cgccgcgcag ccacc atg 118 Met ctc aac aac ctg acg gac tgc gag gac ggc gat ggg gga gcc aac ccg 106 Leu Asn Asn Leu Thr Asp Cys Glu Asp Gly Asp Gly Gly Ala Asn Pro 1.0 15 ggt gac ggc aat ccc aag gag agc agc ccc ttc atc aac agc acg gac 214 Gly Asp Gly Asn Pro Lys Glu Ser Ser Pro Phe Ile Asn Ser Thr Asp acg gag aag ggg aga gag tat gat ggc agg aac atg gcc ctg ttt gag 262 Thr Glu Lys G1y Arg Glu Tyr Asp Gly Arg Asn Met Ala Leu Phe Glu gag gag atg gac acc agc ccc atg gta tcc tcc ctg ctc agt ggg ctg 310 Glu G1u Met Asp Thr Ser Pro Met Val Ser Ser Leu Leu Ser Gly Leu gcc aac tac acc aac ctg cct cag gga agc aaa gag cac gaa gaa gca 358 Ala Asn Tyr Thr Asn Leu Pro Gln Gly Ser Lys Glu His Glu Glu Ala gaa aac aat gag ggc gga aag aag aag ccg gtg cag gcc cca cgc atg 406 G1u Asn Asn Glu Gly Gly Lys Lys Lys Pro Val Gln Ala Pro Arg Met ggc acc ttc atg ggc gtg tac ctc ccg tgc ctg cag aac atc ttt ggt 454 Gly Thr Phe Met Gly Val Tyr Leu Pro Cys Leu Gln Asn Ile Phe Gly gtt atc Ctc ttt ctg cgg ctc act tgg gtg gtg gga atc gca ggc atc 502 Val Ile Leu Phe Leu Arg Leu Thr Trp Val Val Gly Ile Ala Gly Ile atg gag tcc ttc tgc atg gtc ttc atc tgc tgc tcc tgc aog atg etc 550 Met Glu Ser Phe Cys Met Val Phe Ile Cys Cys Ser Cys Thr Met Leu 130 135 l40 145 aea gce att tec atg agc gca att gca acc aat ggt gtt gtg cet get 598 Thr Ala Ile Ser Met Ser Ala Ile Ala Thr Asn Gly Val Val Pro Ala 150 155 ' 160 ggt ggc tcc tac tac atg att tcc agg tct ctg ggc ccg gag ttt ggg 646 Gly Gly Ser Tyr Tyr Met Ile Ser Arg Ser Leu Gly Pro Glu Phe Gly 165 170 . 175 ' ggc gcc gtg ggc ctc tgc ttc tac ctg ggc act acc ttt get ggg get 694 Gly Ala Val Gly Leu Cys Phe Tyr Leu Gly Thr Thr Phe.Ala Gly Ala atg tac atc ctg ggc acc atc gag atc ctg ctg get tac ctc ttc cca 742 Met Tyr Ile Leu Gly Thr Ile Glu Ile Leu Leu Ala Tyr Leu Phe Pro gcg atg gcc atc ttc aag gca gaa gat gcc agt ggg gag gca gcc gcc 790 Ala Met Ala Ile Phe Lys Ala Glu Asp Ala Ser G1y Glu Ala A1a Ala 210 215 ' 220 225 atg ttg aat aac atg cgg gtg tat ggc acc tgt gtg ctc acc tgc atg 838 Met Leu Asn Asn Met Arg Val Tyr Gly Thr Cys Val Leu Thr Cys Met 230 235 ~ 240 gcc acc gta gtc ttt gtg ggc gtc aag tac gtg aac aag ttt gcc ctg 886 Ala Thr Val Val Phe Val Gly Val Lys Tyr Val Asn Lys Phe Ala Leu gtcttcctg ggttgcgtg atcctctcc atcctggcc atctacgcaggg 934 ValPheLeu GlyCysVal IleLeuSer IleLeuAla IleTyrA1aGly gtcatcaag tctgccttc gatccaccc aatttcccg atttgcctcctg 982 ValTleLys SerAlaPhe AspProPro AsnPhePro IleCysLeuLeu gggaaccgc acgctgtct cgccatggc tttgatgtc tgt~gccaagctg 1030 GlyAsnArg ThrLeuSer ArgHisGly PheAspVal CysAlaLysLeu gettgggaa ggaaatgag acagtgacc acacggctc tggggcctattc 1078 AlaTrpGlu GlyAsnG1u ThrValThr ThrArgLeu TrpGlyLeuPhe 310 ~ 315 320 tgt tcc tcc cgc ctc ctc aat gcc acc tgt gat gag tac ttc acc cga 1126 Cys Ser Ser Arg Leu Leu Asn Ala Thr Cys Asp Glu Tyr Phe Thr Arg 325 . 330 335 .
aac aat gtc aca gag atc cag ggc att cct ggt get gca agt ggc ctc 1174 Asn Asn Val Thr Glu Ile Gln Gly Ile Pro Gly Ala Ala Ser Gly Leu atc~aaa gag aac ctg tgg agt tcc tac ctg acc aag ggg gtg atc gtg 1222 Ile Lys Glu Asn Leu Trp Ser Ser Tyr Leu Thr Lys Gly Val Ile Val gag agg cgt ggg atg ccc tct gtg ggc ctg gca gat ggt acc ccc gtt 1270 Glu Arg Arg Gly Met Pro Ser Val Gly Leu Ala Asp Gly Thr Pro Val gac atg gac cac ccc tat gtc ttc agt gat atg acc tcc tac ttc acc 1318 Asp Met Asp His Pro Tyr Val Phe Ser Asp Met Thr Ser Tyr Phe Thr ctg ctt gtt ggc atc tat ttc ccc tca gtc aca ggg~atc atg get ggc 1366 Leu Leu Val Gly Ile Tyr Phe Pro Ser Val Thr Gly Ile Met Ala Gly tcg aac cgg tcc gga gac ctg cgg~gat gcc cag aag tct atc cct act 1414 Ser Asn Arg Ser Gly Asp Leu Arg Asp Ala Gln Lys Ser Ile Pro Thr ggaactatcttg gccattget acgacctct getgtctacatc agctct 1462 GlyThrIleLeu AlaIleAla ThrThrSer AlaValTyxIle SerSer gttgttctgttc ggagcctgc atcgaaggg gtcgtcctacgg gacaag 1510 ValValLeuPhe GlyAlaCys IleGluGly ValValLeuArg AspLys tttggggaaget gtgaatggc aatctggtg gtgggcaccctg gcctgg 1558 PheGlyGluAla ValAsnGly AsnLeuVal ValGlyThrLeu AlaTrp ccttctccttgg gtcattgtc ataggctct ttcttctctacc tgcgga 1606 ProSerProTrp ValIleVal IleGlySer PhePheSexThr CysGly getggactacag agcctcaca ggggcccca cgcctgctgcag gccatc 1654 AlaGlyLeuGln SerLeuThr GlyAlaPro ArgLeuLeuGln AlaIle tcccgggatggc atagtgccc ttcctgcag gtctttggccat ggcaaa 1702 SerArgAspGly IleValPro PheLeuGln ValPheGlyHis GlyLys gccaa~cgga gagccaacctgg gcgctgctg ctgactgcc tgcatctgt 1750 AlaAsnGly GluProThrTrp AlaLeuLeu LeuThrAla CysIleCys gagatcggc atcctcatcgcc tccctggat gaggtcgcc cctatcctt 1798 Gl.uIleGly IleLeuIleAla SerLeuAsp GluValAla ProIleLeu tccatgttc ttectgatgtgt tacatgttt gtgaacttg gettgcgcg 1846 SerMetPhe PheLeuMetCys TyrMetPhe ValAsnLeu AlaCysA1a gtgcagaca ctgctgaggacg cccaactgg aggccacgc ttccgatat 1894 ValGlnThr LeuLeuArgThr ProAsnTrp ArgProArg PheArgTyr taccactgg accctctccttc ctgggcatg agcctctgc ctggccctg 1942 TyrHisTrp ThrLeuSerPhe LeuGlyMet SerLeuCys LeuAlaLeu atgttcatt tgctcctggtat tatgcgctg gtagetatg etcatcget 1990 MetPheIle CysSerTrpTyr TyrAlaLeu ValAlaMet LeuIleAla 610 615 . . 620 625 ggc ctcatctat aagtacatc gagtaccgg ggggcagag aaggagtgg 2038 Gly LeuIleTyr LysTyrIle GluTyrArg GlyAlaGlu LysGluTrp ggg gatgggatc cgaggcctg tctctcagt gcagetcgc tatgetctc 2086 Gly AspGlyIle ArgGlyLeu SerLeuSer AlaAlaArg TyrAlaLeu ttg cgtctggag gaaggaccc ccgcataca aagaactgg aggccccag 2134 Leu ArgLeuGlu GluGlyPro ProHisThr LysAsnTrp ArgProGln cta ctggtgctg gtgcgtgtg gaccaggac cagaacgtg gtgcacccg 21.82 Leu LeuVaILeu ValArgVal AspGln.Asp GlnAsnVal ValHisPro 675 &80 685 cag ctgctgtcc ttgacctcc cagctcaag gcagggaag ggcctgacc 2230 Gln LeuLeuSer LeuThrSer GlnLeuLys AlaGlyLys GlyLeuThr 690 695 700, 705 attgtgggctct gtccttgagggc acctttctg gacaaccac cctcag 2278 IleValGlySer ValLeuG1uGly ThrPheLeu AspAsnHis ProGln getcagcgggca gaggagtctatc cggcgcctg atggagget gagaag 232&

AlaGlnArgAla GluGluSerIle ArgArgLeu MetGluAla GluLys 725 730 ~ 735 gtgaagggcttc tgccaggtagtg atctcctcc aacctgcgt gacggt 2374 ValLysG1yPhe CysGlnValVal TleSerSer AsnLeuArg AspGly gtgtcccacctg atccaatccggg .ggcctcggg ggcctgcaa cacaac 2422 ValSerHisLeu IleGlnSexGly GlyLeuGly GlyLeuGln HisAsn actgtgctagtg ggctggcctcgc aactggcga cagaaggag gatcat 2470 ThrValLeuVal GlyTrpProArg AsnTrpArg GlnLysGlu AspHis 770 775 780 78.5 cagacatggagg aacttcategaa ctcgtccgg gaaactaca getggc 2518 GlnThrTrpArg AsnPheIleGlu LeuValArg GluThrThr AlaGly cacctcgccctg ctggtcaccaag aatgtttcc atgttcccc gggaac 2566 HisLeuAlaLeu LeuValThrLys AsnValSer MetPhePro GlyAsn cctgagcgtttc tctgagggcagc attgacgtg tggtggatc gt cac 2614 g ProGluArgPhe SerGluGlySer IleAspVal TrpTrpIle ValHis gacgggggcatg ctcatgctgttg cccttcctc ctgcgtcac cacaag 2662 AspGlyGlyMet LeuMetLeuLeu ProPheLeu LeuArgHis HisLys 28j36 gtc tgg agg aaa tgc aaa atg cgg atc ttc acc gtg gcg cag atg gat 2710 Val Trp Arg Lys Cys Lys Met Arg Ile Phe Thr Val Ala Gln Met Asp gac aac agc att cag atg aag aaa gac ctg acc acg ttt ctg tac cac 2758 Asp Asn Ser Ile Gln Met Lys Lys Asp Leu Thr Thr Phe Leu Tyr His ttacgaattact gcagaggtg gaagtcgtg gagatgcac gagagcgac 2806 ~

LeuArgIleThr AlaGluVal GluValVal GluMetHis GluSerAsp atctcagcatac acctacgag aagacattg gtaatggaa caacgttct 2854 IleSerAlaTyr ThrTyrGlu LysThrLeu ValMetGlu GlnArgSer cagatcctcaaa cagatgcac ctcaccaag aacgagcgg gaacgggag 2902 GlnIleLeuLys GlnMetHis LeuThrLys AsnGluArg GluArgGlu atccagagcatc acagatgaa tctcggggc tccattcgg aggaagaat 2950 IleGlnSerIle ThrAspGlu SerArgGly SerTleArg ArgLysAsn ccagccaacact cggctccgc ctcaatgtt cccgaagag acagettgt 2998 ProAlaAsnThr ArgLeuArg LeuAsnVal ProGluGlu ThrAlaCys gacaacgag~gagaagccagaa gaggaggtg cagctgatc catgaccag 3046 ' AspAsnGluGlu LysProGlu GluG1uVal GlnLeuIle HisAspGln agtgetcccagc tgccctagc agctcgccg tctccaggg gaggagcct 3094 SerAlaProSer CysProSer SerSerPro SerProGly GluGluPro gagggggag ggggag aca ccagag aaggtg ctc acctgg 3142 gac cat acc GluGlyGlu Glu Thr ProGlu Lys ThrTrp Gly Asp Val Thr His Leu aaggataag tcagcg get aagaac aaaggc agt cccgtc .3187 cag ccc LysAspLys Ser.AlaAla LysAsn LysGly Ser ProVal Gln Pro tcctcggag gggatc .aag ttcttc agcatg ccg gagtgg 3232 gac aag SexSerGlu GlyIle Lys PhePhe SerMet Pro GluTrp Asp Lys gaaaacttg aaccag tcc gtgcgg cgcatg aca getgtg 3277 aac cac GluAsnLeu AsnGln Ser ValArg ArgMet Thr AlaVal Asn His cgg ctg aac gag gtc atc gtg aat aaa tcc cgg gat gcc aag ttg 3322 Arg Leu Asn Glu Val Ile Val Asn Lys Ser Arg Asp Ala Lys Leu 1055 1060 . 1065 gtg ttg ctc aac atg ccc ggg cct ccc cgc aac cgc aat gga gat 3367 Val Leu Leu Asn Met Pro Gly Pro Pro Arg Asn Arg Asn Gly Asp gaa aac tac atg gaa ttc ctg gag gtc ctc act gag caa ctg gac 3412 Glu Asn Tyr Met Glu Phe Leu Glu Val Leu Thr Glu Gln Leu Asp cgg gtg atg ctg gtc cgc ggt ggt ggc cga gag gtc atc acc atc 3457 Arg Val Met Leu Val Arg Gly Gly Gly Arg Glu Val Ile Thr Ile tac tcc tga aggccaggac ctgccactcc ggcccgagcg agcccggncc 3506 Tyr Ser gcggccccggagccctcgccgcgcctccccgccgctgtcaccgtttacataagaccccgt3566 tgcccgtgccctggccctcttccctcccgctgcctgcggcccggaggccttgcccgtcgg3626 ggctgacccggagggcggcccgtgggccccttttctgagcccggcctcgccctgccggag3686 tagac.gttgcaataaaggtggcgaggcggcgtggagaggagcggaaccgtggtcccgggc3746 cggggagccccgagcccgtccctccccacgccccgccgcgctccccccggaccctggtcg3806 .

ctgagcccgggcgccgctcggctgcgctatacatagtgtacaggagacatcgagtgtatt3866 tttaatgtccccatatttctgtaaactagaaacgcaacggactcctcgccacggccgcgc3926 tctccccgctgcgggcgcccaggaaggcggagacccgggaagccagggttccctgcgctc3986 ccgagctgagagccaagtgctttaaggccggcgctctcctttccctttcctgtCCacggc4046 ccgg~gcttccctctcttccctccagttcttggcgaacaca,ggtgaagccctgcccggtgc4106 cttcgtggaggagcaggcgtctctcctctgttggcttgccgcctgctccccctgtcccgt4166 ggctcctcgccaaagactgaatttgtggagctggagggcacaccctccccactttccttc4226 ctgggacaggtgaggggccaatgccagtctaggggccgactcacaggaggcctcgcgcag4286 cctcttggtccccactctgcaagtcctgcctggggaccoagcccccctggtggttctggg4346 gcggagctttgctgcctagcagcaagtccttagttactgtctccagataccaggacctgg4406 agtagggaatggagtcatatgggttcagttgttcctggcgcttctctgccccctgctccc4466 cctctccccctctcgtaggacacaaggactttggctttcttaactcatccttggcgcttc4526 cgctccaccacgcccacctgtggggaggagccctcagccctagagaggcgtttggctggt4586 tcccttcccccagggcacgttactaagaggacaggcactgcatgctcctttaagcgccct4646 ctgggactgggtacagtgcctccagccccagggccctggtctgcgcacctagttagacat4706 cattgcccactccagggccagggccactagctgacctcaccacctttttccttgagccca4766 aggcagagagagctgcagctggtgccatctagacaggctcaagtgtggccagtggcaggg4826 ctcgagggccactgccctgttgcttggctcaggacctctctgagatttgatggggactgg4886 atattcttccaggtagtagccatcaagtcggaagtgttggacccaggacctgacattcct4946 tcaagactgccctcccttgctgtggttttgccttttggggcaagagaggggctgggcaaa5006 cggggaggaggcagtatcaacaccgattagggaaccaaagttgcactacctgggcccagc5066 ctctggttggcaagagcaaagtttctgttgatgaaaacaaacagcccacaacaacacccc5126 cccccccgttttctgtgctccatgtgcaatatttgttatgaaccttgtgt,cgttcaagtc5186 acctttataatcactgtagctagatgttccatgtccatccaggtgactttactctgagtg5246 caatatttcaatagcctggtagtgagaagagtgttgcttttgtttcagccgacctatgtg5306 cagggcaatgcaatgcagtccaaaacccttgtaaataggagaggttgcaagccaaatcaa5366 gagtatttatcgttattactattattattaggcctgcctttaattttagtgtttcggtat5426 ttcgcatcctgcctcggtattgatcgtgtgttctctgtgccaatatgcaaaggagaggat5486 cagttctttcctttactgttgaatgctcccatttactgctttaaggcttttactgtgttc5546 attttttagatacctgtctg 5566 <210> 6 <211> 1116 <212> PRT
<213> Rattus norvegicus <400> 6 Met Leu Asn Asn Leu Thr Asp Cys Glu Asp Gly Asp Gly'Gly Ala Asn Pro Gly Asp Gly Asn Pro Lys G1u Ser Ser Pro Phe Ile Asn Ser Thr Asp Thr Glu Lys Gly Arg Glu Tyr Asp Gly Arg Asn Met Ala Leu Phe Glu Glu Glu Met Asp Thr Ser Pro Met Va1 Ser Ser Leu Leu Ser Gly Leu Ala Asn Tyr Thr Asn Leu Pro Gln Gly Ser Lys Glu His Glu Glu 65 70 75 ~ 80 Ala Glu Asn Asn Glu Gly Gly Lys Lys Lys Pro Val Gln Ala Pro Arg Met Gly Thr Phe Met Gly Val Tyr Leu Pro Cys Leu Gln Asn Ile Phe ,100 105 110 Gly Val Ile Leu Phe Leu Arg Leu Thr Trp Val Val Gly Ile Ala Gly Tle Met Glu Ser Phe Cys Met Val Phe Ile Cys Cys Ser Cys Thr Met Leu Thr Ala Ile Ser Met Ser Ala Ile Ala Thr Asn Gly Val Val Pro Ala Gly Gly Ser Tyr Tyr Met Ile Ser Arg Ser Leu Gly Pro Glu Phe Gly Gly Ala Val Gly Leu Cys Phe Tyr Leu Gly Thr Thr Phe Ala Gly 180 l85 190 Ala Met Tyr Ile Leu Gly Thr Ile Glu Ile Leu Leu Ala Tyr Leu Phe Pro Ala Met Ala Ile Phe Lys Ala Glu Asp Ala Ser Gly Glu Ala Ala Ala Met Leu Asn Asn Met Arg Val Tyr Gly Thr Cys Val Leu Thr Cys Met Ala Thr Val Val Phe Val Gly Val Lys Tyr Val Asn Lys Phe Ala Leu Val Phe Leu G1y Cys Val Ile Leu Ser Ile Leu Ala Ile Tyr Ala Gly Val Ile Lys Ser A1a Phe Asp Pro Pro Asn Phe Pro Tle Cys Leu Leu Gly Asn Arg Thr Leu Ser Arg His Gly Phe Asp Val Cys Ala Lys Leu Ala Trp Glu Gly Asn Glu Thr Val Thr Thr Arg Leu Trp Gly heu Phe Cys Ser Ser Arg Leu Leu Asn Ala Thr Cys Asp Glu Tyr Phe Thr Arg Asn Asn Val Thr Glu Ile Gln Gly Tle Pro Gly Ala Ala Ser Gly Leu Ile Lys Glu Asn Leu Trp Ser Ser Tyr Leu Thr Lys Gly Va1 Ile Val Glu Arg Arg Gly'Met Pro Ser Val Gly Leu Ala Asp Gly Thr Pro Val Asp Met Asp His Pro Tyr Val Phe Ser Asp Met Thr Ser Tyr Phe 385 390 395' 400 Thr Leu Leu Val Gly Tle Tyr Phe Pro Ser Val Thr Gly Ile Met Ala Gly Ser Asn Arg Ser Gly Asp Leu Arg Asp Ala Gln Lys Ser Tle Pro Thr Gly Thr Ile Leu Ala Ile Ala Thr Thr Ser Ala Val Tyr I1e Ser Ser Val Val Leu Phe Gly Ala Cys Tle Glu Gly Val Val Leu Arg Asp Lys Phe Gly Glu Ala Val Asn Gly Asn Leu Val Val Gly Thr Leu Ala, Trp Pro Ser Pro Trp Val,Ile Val Ile Gly Ser Phe Phe Ser Thr Cys Gly Ala Gly Leu Gln Ser Leu Thr Gly Ala Pro Arg Leu Leu Gln Ala Tle Ser Arg Asp Gly Ile Val Pro Phe Leu Gln Val Phe Gly His Gly Lys A1a Asn Gly Glu Pro Thr Trp Ala Leu Leu Leu Thr Ala Cys Ile Cys Glu Ile Gly I1e Leu Ile Ala Ser Leu Asp Glu Val Ala Pro Ile Leu Ser Met.Phe Phe Leu Met Cys Tyr Met Phe Val Asn Leu Ala Cys Ala Val Gln Thr Leu Leu Arg Thr Pro Asn Trp Arg Pro Arg Phe Arg Tyr Tyr His Trp Thr Leu Ser Phe Leu Gly Met Ser Leu Cys Leu Ala Leu Met Phe Ile Cys Ser Trp Tyr Tyr Ala Leu Val Ala Met Leu Ile Ala Gly Leu Ile Tyr Lys Tyr Ile Glu Tyr.Arg Gly Ala Glu Lys Glu Trp Gly Asp Gly Ile Arg Gly.Leu Ser Leu Ser Ala Ala Arg Tyr Ala Leu Leu Arg Leu Glu Glu Gly Pro Pro His Thr Lys Asn Trp Arg Pro Gln Leu Leu Val Leu Val Arg Val Asp Gln Asp G1n Asn Val Val His Pro Gln Leu Leu Ser Leu Thr Ser Gln Leu Lys Ala Gly Lys Gly Leu Thr Ile Va1 Gly Ser Val Leu Glu G1y Thr Phe Leu Asp Asn His Pro 705 710 715 7.20 Gln Ala Gln Arg Ala Glu Glu Ser Ile Arg Arg Leu Met Glu Ala Glu Lys Val Lys Gly Phe Cys Gln Val Val Ile, Ser Ser Asn Leu Arg Asp Gly Val Ser His Leu Ile Gln Ser Gly Gly Leu Gly Gly Leu Gln His Asn Thr Val Leu Val Gly Trp Pro Arg Asn Trp Arg Gln Lys Glu Asp His Gln Thr Trp Arg Asn Phe Ile Glu Leu Val Arg Glu Thr Thr Ala Gly His Leu Ala Leu Leu Val Thr Lys Asn Val Ser Met Phe Pro Gly Asn Pro Glu Arg Phe Ser Glu Gly Ser Ile Asp Val Trp Trp Ile Val His Asp Gly Gly Met Leu Met Leu Leu Pro Phe Leu Leu Arg His His Lys Val Trp Arg Lys Cys Lys Met Arg Ile Phe Thr Val Ala Gln Met Asp Asp Asn Ser Ile Gln Met Lys Lys Asp Leu Thr Thr Phe Leu Tyr His Leu Arg Ile Thr Ala Glu Val Glu Val Val Glu Met His Glu Ser Asp I1e Ser Ala Tyr Thr Tyr Glu Lys Thr Leu Val Met Glu Gln Arg Ser Gln Ile Leu Lys Gln Met His Leu Thr Lys Asn Glu Arg Glu Arg Glu Ile Gln Sex Ile Thr Asp Glu Ser Arg G1y Ser Ile Arg Arg Lys Asn Pro Ala Asn Thr Arg Leu Arg Leu Asn Val Pro Glu Glu Thr Ala Cys Asp Asn Glu G1u Lys Pro Glu Glu Glu Va1 Gln Leu Ile His Asp Gln Ser Ala Pro Ser Cys Pro Ser Ser Ser Pro Ser Pro Gly Glu Glu Pro Glu Gly Glu Gly Glu Thr Asp Pro Glu Lys Val His Leu Thr Trp Thr Lys Asp Lys Ser Ala Ala Gln Lys Asn Lys Gly Pro Ser Pro Va1 Ser Ser Glu Gly Tle Lys Asp Phe Phe Ser Met Lys Pro Glu Trp Glu Asn Leu Asn Gln Ser Asn Val Arg Arg Met His Thr Ala Val Arg Leu Asn Glu Val Ile Val Asn Lys Ser Arg Asp Ala Lys Leu Val Leu Leu Asn Met Pro Gly Pro Pro Arg Asn Arg Asn GIy Asp Glu Asn Tyr Met Glu Phe Leu G1u Val Leu Thr Glu Gln Leu Asp Arg Val Met Leu Val Arg Gly Gly Gly Arg Glu Val Ile Thr Ile Tyr Ser <210> 7 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> Synthetic oligonucleotide <400> 7 tctccttggg attgccgtca 20 <210> 8 <211> 20 <212> DNA

<213> Artificial sequence <220>
<223> Synthetic oligonucleotide <400> 8 tcttcttgag actgcagtca ~0

Claims (81)

1. A method of treating or preventing pain in a subject; said method comprising decreasing an intracellular chloride level in a central nervous system (CNS) neural cell of said subject.

2. The method of claim 1, wherein said method comprises modulating the activity or expression of a chloride transporter in said CNS cell, thereby to decrease said chloride level.

3. The method of claim 2, wherein said chloride transporter is KCC2.

4. The method of claim 3, said method further comprises increasing said KCC2 activity or expression.

5. The method of claim 1, wherein said CNS neural cell is a spinal cord neural cell.

6. The method of claim 1, wherein the signal of said pain originates in a peripheral nervous system (PNS) cell or sensory fiber transsynaptic to said CNS neural cell.

7. The method of claim 1, wherein said pain is neuropathic pain.

8. The method of claim 7, wherein said neuropathic pain is associated with a nerve or tract injury.

9. The method of claim 7, wherein said neuropathic pain is selected from the group consisting of somatic and visceral pain.

10. The method of claim 1, wherein said pain is selected from the group consisting of chronic inflammatory pain, pain associated with arthritis, fibromyalgia, back pain, cancer-associated pain, pain associated with digestive disease, pain associated with Crohn's disease, pain associated with autoimmune disease, pain associated with endocrine disease, pain associated with diabetic neuropathy, phantom limb pain, spontaneous pain, chronic post-surgical pain, chronic temporomandibular pain, causalgia, post-herpetic neuralgia, AIDS-related pain, complex regional pain syndromes type I and II, trigeminal neuralgia, chronic back pain, pain associated with spinal cord injury and recurrent acute pain.

11. The method of claim 1, wherein said method comprises administering to said subject a compound capable of decreasing said intracellular chloride level in said CNS
cell.

12. The method of claim 11, wherein said compound is capable of modulating the activity or expression of a chloride transporter in said CNS cell.

13. The method of claim 12, wherein said chloride transporter is KCC2.

14. The method of claim 13, wherein said compound is capable of increasing said KCC2 activity or expression.

15. The method of claim 14, wherein said compound is an inhibitor of TrkB.

16. The method of claim 15, wherein said inhibitor is selected from the group consisting of K-252a and an anti-TrkB
antibody.

17. The method of claim 13, wherein said compound is an inhibitor of cyclic AMP-dependent kinase (PKA).

18. The method of claim 17, wherein said inhibitor is H-89.

19. The method of claim 13, wherein said compound is an inhibitor of calmodulin-dependant kinase (CAM kinase).

20. The method of claim 19, wherein said inhibitor is KN-93.

21. The method of claim 3, wherein said KCC2 comprises an amino acid sequence substantially identical to a sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, and a fragment thereof.

22. A composition for the treatment or the prevention of pain in a subject, said composition comprising:

(a) a compound capable of decreasing an intracellular chloride level in a CNS neural cell; and (b) a pharmaceutically acceptable carrier.

23. The composition of claim 22, wherein said compound is capable of modulating the activity or expression of a chloride transporter in said CNS neural cell.

24. The composition of claim 23, wherein said chloride transporter is KCC2.

25. The composition of claim 24, wherein said compound is capable of increasing said KCC2 activity or expression.

26. A commercial package comprising the composition of claim 22 together with instructions for its use in the treatment or prevention of pain.

27. A commercial package comprising a compound capable of decreasing an intracellular chloride level in a CNS neural cell together with instructions for its use the treatment or prevention of pain.

28. The commercial package of claim 27, wherein said compound is capable of modulating the activity or expression of a chloride transporter in said CNS neural cell.

29. The commercial package of claim 28, wherein said chloride transporter is KCC2.

30. The commercial package of claim 29, wherein said compound is capable of increasing said KCC2 activity or expression.

31. Use of the composition of claim 22 for the treatment or prevention of pain.

32. Use of the composition of claim 22 for the preparation of a medicament for the treatment or prevention of pain.

33. Use of a compound capable of decreasing an intracellular chloride level in a CNS neural cell for the treatment or prevention of pain.

34. Use of a compound capable of decreasing an intracellular chloride level in a CNS neural cell for the preparation of a medicament for the treatment or prevention of pain.

35: The use of claim 33, wherein said compound is capable of modulating the activity or expression, of a chloride transporter in said CNS cell.

36. The use of claim 35, wherein said chloride transporter is KCC2.

37. The use of claim 36, wherein said compound is capable of increasing said KCC2 activity or expression.

38. The use of claim 37, wherein said compound is an inhibitor of TrkB.

39. The use of claim 38, wherein said inhibitor is selected from the group consisting of K-252a and an anti-TrkB
antibody.

40. The use of claim 37, wherein said compound is an inhibitor of cyclic AMP-dependent kinase (PKA).

41. The use of claim 40, wherein said inhibitor is H-89.

42. The use of claim 37, wherein said compound is an inhibitor of calmodulin-dependant kinase.

43. The use of claim 42, wherein said inhibitor is KN-93.

44. A method of identifying or characterizing a compound for treatment or prevention of pain, said method comprising:
(a) contacting a test compound with a CNS-derived cell; and (b) determining whether said intracellular chloride level is decreased in the presence of the test compound;
wherein said decrease is an indication that said test compound may be used for treatment or prevention of pain.

45. A method of identifying or characterizing a compound for treatment or prevention of pain, said method comprising:
(c) contacting a test compound with a CNS-derived cell expressing a chloride transporter; and (d) determining whether activity or expression of said chloride transporter is modulated in the presence of the test compound in such a way that the level intracellular chloride is decreased;
wherein said modulation is an indication that said test compound may be used for treatment or prevention of pain.

46. The method of claim 45, wherein said chloride transporter is KCC2.

47. The method of claim 46, wherein said method comprises determining whether said KCC2 expression or activity is increased in the presence of the test compound and said modulation is an increase.

48. The method of claim 47, wherein said KCC2 activity is determined by measuring a parameter selected from the group consisting of potassium transport, chloride transport, intracellular chloride level and anion reversal potential.

49. The method of claim 44, wherein said pain is selected from the group consisting of chronic inflammatory pain, pain associated with arthritis, fibromyalgia, back pain, cancer-associated pain, pain associated with digestive disease, pain associated with Crohn's disease, pain associated with autoimmune disease, pain associated with endocrine disease, pain associated with diabetic neuropathy, phantom limb pain, spontaneous pain, chronic post-surgical pain, chronic temporomandibular pain, causalgia, post-herpetic neuralgia, AIDS-related pain, complex regional pain syndromes type I and II, trigeminal neuralgia, chronic back pain, pain associated with spinal cord injury and recurrent acute pain.

50. A method of identifying or characterizing a compound for treatment or prevention of pain, said method comprising:
(a) contacting a test compound with a CNS-derived cell comprising a first nucleic acid comprising a transcriptionally regulatory element normally associated with a chloride transporter gene, operably linked to a second nucleic acid comprising a reporter gene capable of encoding a reporter protein; and (b) determining whether reporter gene expression or reporter protein activity is modulated in the presence of said test compound;
wherein said modulation in reporter gene expression or reporter protein activity being an indication that said test compound may be used for treatment or prevention of pain.

51. The method of claim 50, wherein said chloride transporter is KCC2.

52. The method of claim 51, wherein said reporter gene expression or reporter protein activity is increased in the presence of said test compound.

53. A method for decreasing nociception in a subject, said method comprising decreasing intracellular chloride in a CNS
neural cell of said subject.

54. The method of claim 53, wherein said method comprises modulating chloride transporter activity or expression in said CNS neural cell.

55. The method of claim 54, wherein said chloride transporter is KCC2.

56. The method of claim 55, said method further comprises increasing said KCC2 activity or expression.

57. The method of claim 55, wherein said method further comprises contacting said CNS neural cell with a compound capable of increasing KCC2 activity or expression.

58. The method of claim 57, wherein said compound is an inhibitor of TrkB.

59. The method of claim 58, wherein said inhibitor is selected from the group consisting of K-252a and an anti-TrkB
antibody.

60. The method of claim 57, wherein said compound is an inhibitor of cyclic AMP-dependent kinase (PKA).

61. The method of claim 60, wherein said inhibitor is H-89.

62. The method of claim 57, wherein said compound is an inhibitor of calmodulin-dependant kinase.

63. The method of claim 62, wherein said inhibitor is KN-93.

64. The method of claim 55, wherein said KCC2 comprises an amino acid sequence substantially identical to a sequence selected from the group consisting of SEQ ID NO: 2, 4, 6 and a fragment thereof.

65. A method for diagnosing or prognosticating pain associated with CNS dysfunction in a subject experiencing pain, said method comprising determining whether a test CNS
intracellular chloride level is increased relative to a corresponding control chloride level; wherein said increase is an indication that said subject is experiencing pain associated with CNS dysfunction.

66. The method of claim 65, said method further comprises determining whether CNS chloride transporter activity or expression is modulated relative to a control transporter activity or expression.

67. The method of claim 66, wherein said chloride transporter is KCC2.

68. The method of claim 67, said method further comprises determining whether said KCC2 activity or expression is decreased relative to said control activity or expression.

69. The method of claim 65, wherein said control intracellular chloride level is selected from the group consisting of:
(a) an established standard;
(b) a corresponding intracellular chloride level determined in said subject at an earlier time;

(c) a corresponding intracellular chloride level determined in said subject when said subject is experiencing less pain or substantially no pain; and (d) a corresponding intracellular chloride level determined in a control subject experiencing less pain or substantially no pain.

70. The method of claim 68, wherein said control activity or expression is selected from he group consisting of: a (a) an established standard of KCC2 activity or expression;
(b) a corresponding level of KCC2 activity or expression determined in said subject at an earlier time;
(c) a corresponding level of KCC2 activity or expression determined in said subject when said subject is experiencing less pain or substantially no pain; and (d) a corresponding level of KCC2 activity or expression determined in a control subject experiencing less pain or substantially no pain.

71. The method of claim 67, wherein said KCC2 activity is determined by measuring a parameter selected from the group consisting of potassium transport, chloride transport, intracellular chloride level and anion reversal potential.

72. The method of claim 65, wherein said intracellular chloride level is determined by:
(a) administering an indicator compound indicative of intracellular chloride level to said subject such that it is contacted with a CNS neural cell of said subject;
(b) assessing an in vivo signal associated with said indicator compound.

73. The method of claim 65, wherein said pain associated with CNS dysfunction is neuropathic pain.

74. The method of claim 73, wherein the indicator compound is a radionuclide.

75. The method of claim 75, wherein the radionuclide is selected from the group consisting of 201Tl, 99Tcm-tetrofosmin, 99Tcm-MIBI, 99Tcm-HMPAO and 36Cl.

76. The method of claim 73, wherein said in vivo signal is assessed by an imaging technique.

77. The method of claim 72, wherein said in vivo signal is the retention index of said indicator compound.

78. The method of claim 76, wherein the imaging technique is selected from the group consisting of single photon emission computed tomography, positron emission tomography and magnetic resonance imaging.

79. The method of claim 73, wherein said indicator compound is indicative of KCC2 expression.

80. The method of claim 79, wherein said indicator compound is an antibody directed against KCC2.

81. A method of treating pain associated with CNS dysfunction in a subject, said method comprising:
(a) diagnosing or prognosticating, according to the method of claim 65, pain associated with CNS dysfunction in said subject;
(b) decreasing an intracellular chloride level in a CNS
cell of said subject.