CA2506127A1

CA2506127A1 - Methods of generating high-production of antibodies from hybridomas created by in vitro immunization

Info

Publication number: CA2506127A1
Application number: CA002506127A
Authority: CA
Inventors: Luigi Grasso; Shaohong Liang; Nicholas E. Nicolaides; Philip M. Sass
Original assignee: Individual
Current assignee: Eisai Inc
Priority date: 2002-11-15
Filing date: 2003-11-14
Publication date: 2004-06-03
Anticipated expiration: 2023-11-14
Also published as: US20040214288A1; DE60329526D1; AU2003295576A1; JP4555089B2; US20100311169A1; US8445229B2; WO2004046330A2; JP2006526983A; WO2004046330A3; EP1572971A2; CA2506127C; EP1572971A4; EP1572971B1; AU2003295576B2; ATE444359T1; US7754450B2

Abstract

The invention provides methods for generating high titers of high-affinity antibodies from hybridoma cells produced by fusing myeloma cells with in vitro immunized donor cells. The hybridoma cells or mammalian expression cells with cloned antibody genes from the hybridomas producing the high-affinity antibodies may be mismatch repair defective due to defects of endogenous mismatch repair subunits of through expression of a dominant negative allele of a mismatch repair gene which allows the hybridoma cell to be hypermutable, may be rendered hypermutable by chemical means, or may be naturally mismatch repair deficient. High-affinity antibodies and high titer producer cells producing antibodies may be prepared by the methods of the invention.

Description

METHODS OF GENERATING HIGH-PRODUCTION OF ANTIBODIES FROM
HYBRIDOMAS CREATED BY IN VITRO IMMUNIZATION
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This Application claims the benefit of U.S. Provisional Application No.
60/427,165 filed November 15, 2002 and U.S. Provisional Application No. 60/501,650 filed September 10, 2003, the disclosures of which are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION

[0002] The invention relates to the generation of hybridoma cells that produce high-affinity antibodies in high titers. More specifically, the invention relates to the use of an ih vit~~o immunization method in conjunction with hybridoma technology using dominant negative mismatch repair genes or chemical inhibitors of mismatch repair to produce high titers of antigen specific antibodies of the IgG subclass, that bind to the antigen with high affinity.
BACKGROUND OF THE RELATED ART

[0003] The use of antibodies to block the activity of foreign and/or endogenous polypeptides provides an effective and selective strategy for treating the underlying cause of disease. In particular is the use of monoclonal antibodies (MAb) as effective therapeutics such as the FDA
approved ReoPro (Glaser, (I996) Nat. Biotechhol. 14:1216-1217), an anti-platelet MAb from Centocor; Herceptin (Weiner, (1999) Semite. Ohcol. 26:43-51), an anti-Her2/neu MA.b from Genentech; and Synagis (SaezLlorens, et al. (1998) Fediat. Infect. Dis. J.
17:787-791), an anti-respiratory syncytial virus MAb produced by Medimmune.

[0004] Standard methods for generating MAbs against candidate protein targets are known by those skilled in the art. Briefly, rodents such as mice or rats are injected with a purified antigen in the presence of adjuvant to generate an immune response (Shield, et al. (1996) Am.
J. Kidney Dis. 27: 855-864). Rodents with positive immune sera are sacrificed and splenocytes are isolated. Isolated splenocytes are fused to melanomas to produce immortalized cell lines that are then screened for antibody production.
Positive lines are isolated and characterized for antibody production. The direct use of rodent MAbs as human therapeutic agents were confounded by the fact that human anti-rodent antibody (HARA) responses occurred in a significant number of patients treated with the rodent-derived antibody (Khazaeli, et al., (1994) Immuzzotlzer. 15:42-52). In order to circumvent the problem of HARA, the grafting of the complementarity determining regions (CDRs), which are the critical motifs found within the heavy and light chain variable regions of the immunoglobulin (Ig) subunits making up the antigen binding domain, onto a human antibody backbone found these chimeric molecules are able to retain their binding activity to antigen while lacking the HARA response (Emery and Harris, "Strategies for humanizing antibodies" In:
ANTIBODY
ENGINEERING, C.A.K. Borrebaeck (Ed.) Oxford University Press, NY, 1995. pp.
159-183. A
common problem that exists during the "humanization" of rodent-derived MAbs (referred to hereafter as HAb) is the loss of binding affinity due to conformational changes in the three-dimensional structure of the CDR domain upon grafting onto the human Ig backbone (U. S.
Patent No. 5,530,101 to Queen et al.). To overcome this problem, additional HAb vectors are usually needed to be engineered by inserting or deleting additional amino acid residues within the framework region and/or within the CDR coding region itself in order to recreate high affinity HAbs (U. S. Patent No. 5,530,101 to Queen et al.). This process is a very time consuming procedure that involves the use of expensive computer modeling programs to predict changes that may lead to a high affinity HAb. In some instances the affinity of the HAb is never restored to that of the MAb, rendering them of little therapeutic use.

[0005) Another problem that exists in antibody engineering is the generation of stable, high yielding producer cell lines that is required for manufacturing of the molecule for clinical materials. Several strategies have been adopted in standard practice by those skilled in the art to circumvent this problem. One method is the use of Chinese Hamster Ovary (CHO) cells transfected with exogenous Ig fusion genes containing the grafted human light and heavy chains to produce whole antibodies or single chain antibodies, which are a chimeric molecule containing both light and heavy chains that form an antigen-binding polypeptide (Reff, M. E.
(1993) Cu>"r. Opizz. Biotechzzol. 4:573-576). Another method employs the use of human lymphocytes derived from transgenic mice containing a human grafted immune system or transgenic mice containing a human Ig gene repertoire. Yet another method employs the use of monkeys to produce primate MAbs, which have been reported to lack a human anti-monkey response (Neuberger and Gruggermann (1997) Natu>~e 386:25-26). ' In all cases, the generation of a cell line that is capable of generating sufficient amounts of high affinity antibody poses a major limitation for producing sufficient materials for clinical studies.
Because of these _2_ limitations, the utility of other recombinant systems such as plants are currently being explored as systems that will lead to the stable, lugh-level production of humanized antibodies (Fiedler and Conrad (1995) BiolTechnology 13:1090-1093).

[0006] One strategy to overcome the problem of human reactions against foreign antibodies is to stimulate human ixnmunoglobulin-producing cells ih vitro. Various attempts to stimulate human antibody production ih vitro typically have resulted in low affinity antibodies of the IgM subclass (Zafiropoulos et al. (1997) J. Imfnuhological Methods 200:181-190).

[0007] A method for generating diverse antibody sequences within the variable domain that results in HAbs and MAbs with high binding affinities to antigens would be useful for the creation of more potent therapeutic and diagnostic reagents respectively.
Moreover, the generation of randomly altered nucleotide and polypeptide residues throughout an entire antibody molecule.will result in new reagents that are less antigenic and/or have beneficial pharmacokinetic properties. The invention described herein is directed to the use of random genetic mutation throughout an antibody structure in vitro by blocking the endogenous mismatch repair (MMR) activity of a host cell producing immunoglobulins that encode biochemically active antibodies. The invention also relates to methods for repeated in vitro genetic alterations and selection for antibodies with enhanced binding and pharmacokinetic profiles.

[0008] In addition, the ability to develop genetically altered host cells that are capable of secreting increased amounts of antibody also will provide a valuable method for creating cell hosts for product development. The invention described herein is fixrther directed to the creation of genetically altered cell hosts with increased antibody production via the bloclcade of MMR. The invention facilitates the generation of high affinity antibodies and the production of cell lines with elevated levels of antibody production derived from hybridoma cells. The invention described herein provides methods for generating antigen-specific monoclonal antibodies (mAbs). Other advantages of the present invention are described in the examples and figures described herein.
SUMMARY OF THE INVENTION

[0009] The invention provides methods for producing hybridoma cells producing high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising imrnunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells express a dominant negative allele of a mismatch repair gene; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; thereby producing hybridoma cells producing high-affinity antibodies.

[0010] In some embodiments, the dominant negative allele of a mismatch repair gene comprises a truncation mutation of the PMS2 gene (e.g., a PMS2-134 gene). In some embodiments of the method of the invention, antibodies are screened using an ELISA-based assay or other assays that can measure antibody-antigen binding. In some embodiments, the screening assays screen for hypermutated hybridomas that produce higher affinity antibodies than those produced by the parental hybridomas. In other embodiments, the screening assays screen for hypermutated hybridomas that produce antibodies in higher titers than the parental hybridomas.

[0011] In some embodiments of the method of the invention, the method fizrther comprises inactivation of the dominant negative allele of the mismatch repair gene, thereby stabilizing the genome of said hypermutated hybridoma.

[0012] In some embodiments of the method of the invention, the dominant negative mismatch repair gene is introduced into the hybridoma cell after the fusion of said myeloma with the immunoglobulin-producing cells. In other embodiments, the dominant negative mismatch repair gene is introduced into the myeloma cell prior to the fusion with the immunoglobulin-producing cells.

[0013] The invention also comprises antibodies produced by the hybridoma cells.

[0014] The invention also comprises methods for producing hybridoma cells that produce high titers of antibodies from in vit~~o immunized immunoglobulin-producing cells comprising: (a) combining donor blood cells comprising immunoglobulin-producing cells with an immunogenic antigen ih vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells express a dominant negative allele of a mismatch repair gene; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen of the hypermutated hybridoma cells for antigen-specific antibodies produced in higher titers than that produced by the parental hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce higher titers of antibodies than that produced by the parental hybridoma cells.

[0015] In some embodiments, the dominant negative allele of a mismatch repair gene comprises a truncation mutation of the PMS2 gene (e.g., a PMS2-134 gene). In some embodiments of the method of the invention, antibodies are screened using an ELISA-based assay. In some embodiments, the screening assays screen for hypermutated hybridomas that produce higher affinity antibodies than those produced by the parental hybridomas. In other embodiments, the screening assays screen for hypermutated hybridomas that produce antibodies in higher titers than the parental hybridomas.

[0016] In some embodiments of the method of the invention, the method further comprising inactivation of the dominant negative allele of the mismatch repair gene, thereby stabilizing the genome of said hypermutated hybridoma.

[0017] In some embodiments of the method of the invention, the dominant negative mismatch repair gene is introduced into the hybridoma cell after the fusion of said myeloma with the irnmunoglobulin-producing cells. In other embodiments, the dominant negative mismatch repair gene is introduced into the myeloma cell prior to the fusion with the immunoglobulin-producing cells.

[0018] In some embodiments of the method of the invention, the dominant negative allele of the mismatch repair gene is subsequently inactivated in order to restabilize the genome of the cell.

[0019] The dominant negative allele of the mismatch repair gene may be introduced into the myeloma cell prior to fusion with the immunoglobulin producing cells. Thus, the resulting hybridoma cells express the same dominant negative allele of the mismatch repair gene as the myeloma cells. Alternatively, the dominant negative allele of the mismatch repair gene may be introduced into the hybridoma cells.

[0020] The invention also comprises antibodies produced by the hybridoma cells.

[0021] The invention further provides recombinant myeloma cells comprising a polynucleotide sequence encoding a dominant negative mismatch repair protein.
The dominant negative mismatch repair protein may be a dominant negative form of, for example, a PMS2, PMS 1, PMSR3, PMSR2, PMSR6, MLHl, GTBP, MSH3, MSH2, MLH3, or MSH1, and PMSR proteins encoded by homologs of the PMSR genes as described in Nicolaides et al.
(1995) Gehomics 30:195-206 and Horii et al. (1994) Biochem. Biophys. Res.
Comnauh.
204:1257-1264. In some embodiments, the recombinant myeloma cell expresses a polynucleotide encoding a dominant negative allele of a PMS2 gene (e.g., a truncation mutation of the PMS2 gene, such as the PMS2-134 gene).

[0022] In some embodiments, the recombinant myeloma cell is a human cell. In other embodiments, the recombinant myeloma cell does not express immunoglobulin genes and/or Epstein-Barn virus. In other embodiments, the myeloma cells are HAT sensitive.

[0023] The invention also provides a method for producing mammalian expression cells that produce high titers of high-affinity antibodies from ih vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ih vitro; (b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) performing a screen for binding of antibodies produced from said hybridoma cells to antigen; (d) cloning immunoglobulin genes from said hybridoma into a mammalian expression cell, wherein said mammalian expression cell expresses a dominant negative allele of a mismatch repair gene; (e) performing a screen for mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from said hybridoma cells; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells.

[0024] In some embodiments, the dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell prior to introduction of the immunoglobulin genes. In other embodiments, the dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell after introduction of said immunoglobulin genes. In other embodiments, the dominant negative allele of a mismatch repair gene is introduced into the mammalian expression cell with the immunoglobulin genes simultaneously.

[0025] The invention also comprises antibodies produced by the mammalian expression cells.

[0026] The invention also provides a method for producing mammalian expression cells that produce high titers of high-affinity antibodies from ih vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen iya vitro; (b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells, wherein said hybridoma cells express a dominant negative allele of a mismatch repair gene; (c) incubating said parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from said hypermutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for said antigen than antibodies produced by said parental hybridoma cells;
(fJ cloning immunoglobulin genes from said hybridoma into a mammalian expression cell;
thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from ira vitro immunized human immunoglobulin-producing cells.

[0027] In some embodiments, the dominant negative allele of a mismatch repair gene is present in the myeloma cell prior to cell fusion. In other embodiments, the dominant negative allele of the mismatch repair gene is introduced into the hybridoma cell after cell fusion.

[0028] The invention also comprises antibodies produced by the mammalian expression cells.

[0029] The invention also provides a method for producing mammalian expression cells that produce high titers' of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) performing a screen for binding of antibodies produced from the hybridoma cells to antigen; (d) cloning immunoglobulin genes from the hybridoma into a parental mammalian expression cell, wherein the mammalian expression cell expresses a dominant negative allele of a mismatch repair gene; (e) incubating the parental mammalian expression cell to allow for mutagenesis, thereby forming hypermutated mammalian expression cells; (f) performing a screen of hypermutable mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from the hybridoma cells; and (g) performing a screen of hypermutable mammalian expression cells that secrete higher titers of antibodies than parental mammalian expression cells; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from iya vitro immunized immunoglobulin-producing cells.

[0030] In some embodiments, the dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell prior to introduction of the immunoglobulin genes. In other embodiments, the dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell after introduction of said immunoglobulin genes. In other embodiments, the dominant negative allele of a mismatch repair gene is introduced into the mammalian expression cell with the immunoglobulin genes simultaneously.

[0031] The invention also provides antibodies produced by the mammalian expression cells.

[0032] The invention also provides recombinant, hypermutable mammalian expression cells comprising a polynucleotide sequence encoding a dominant negative mismatch repair protein.

[0033] The mismatch repair gene may be a dominant negative mismatch repair gene, including, but not limited to a dominant negative form of PMS2, PMSl , PMSR3, PMSR~, PMSR6, MLHI , GTBP, MSH3, MSH2, MLH3, or MSHl, and homologs of PMSR genes as described in Nicolaides et al. (1995) Gehomics 30:195-206 and Horii et al.
(1994) Biochem.
Biophys. Res. Commun. 204:1257-1264. A non-limiting example includes a dominant negative truncation mutant of PMS2 (e.g., a PMS2-134 gene).

[0034] The invention also provides methods for producing hybridoma cells producing high-affinity antibodies from ifa vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells; (c) incubating the parental hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair, thereby forming hypermutated hybridoma cells; (d) performing a screen for antigen binding for antibodies produced from the hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for.the antigen than antibodies produced by said parental hybridoma cells;
thereby producing hybridoma cells producing high-affinity antibodies.

[0035] The invention also comprises antibodies produced by the hybridoma cells.

[0036] The invention also provides methods for producing hybridoma cells that produce high titers of antibodies from ira vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitf°o; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells; (c) incubating the parental hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair, thereby forming hypermutated hybridoma cells; (d) performing a screen of the hypermutated hybridoma cells for antigen-specific antibodies produced in higher titers than that produced by the parental hybridoma cells;
and (e) selecting hypermutated hybridoma cells that produce higher titers of antibodies than that produced by said parental hybridoma cells; thereby producing hybridoma cells producing high titers of antibodies.

[0037] In some embodiments of the method of the invention, the hypermutated hybridoma cells also are screened for the production of higher titers of antibodies than that produced by the parental hybridomas. The screening may be using an ELISA-based assay, or any other means to measure antibody-antigen binding.

[0038] The invention also comprises antibodies produced by the hybridoma cells.

[0039] The invention also provides methods for producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ifz vitro; (b) fusing the immunoglobulin-producing cells _g_ with myeloma cells to form hybridoma cells; (c) performing a screen for antigen binding of antibodies produced from the hybridoma cells; (d) cloning immunoglobulin genes from the hybridoma cells into a mammalian expression cell; (e) incubating the mammalian expression cell in the presence of at least one chemical inhibitor of mismatch repair;
(f) performing a screen for mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from the hybridoma cells; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells.

[0040] In some embodiments of the method of the invention the method may further comprise the removal of the chemical inhibitor from the hypermutated mammalian expression cells, thereby stabilizing the genome of said hypermutated mammalian expression cells.

[0041] The invention also comprises antibodies produced by the mammalian expression cells

[0042] The invention also provides methods for producing mammalian expression cells that produce high titers of high affinity antibodies to a selected antigen from in vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ih vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) incubating the hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair to form hypermutated hybridoma cells; (d) performing a screen for antigen binding for antibodies produced from the hypermutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for the antigen than antibodies produced by the parental hybridoma cells; (f) cloning immunoglobulin genes from the hypermutated hybridoma cells into a mammalian expression cell, thereby forming parental mammalian expression cells; thereby producing manunalian expression cells that produce high titers of high-affinity antibodies from if2 vitro immunized immunoglobulin-producing cells.

[0043] In some embodiments, the parental mammalian expression cell is further incubated in the presence of at least one chemical inhibitor of mismatch repair, thereby forming a hypermutated mammalian expression cell; and the hypermutated mammalian expression cells are screened for higher production of antibodies than that of the parental mammalian expression cells.

[0044] In some embodiments of the method of the invention the method may further comprise the removal of the chemical inhibitor from the hypermutated hybridoma and/or hypermutated mammalian expression cells, thereby stabilizing the genome of said hypermutated hybridoma cells and/or hypermutated mammalian expression cells.

[0045] The invention also comprises antibodies produced by the mammalian expression cells.

[0046] The invention also provides a method for producing mammalian expression cells that produce high titers ~of high-affinity antibodies from iya vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ih vitro; (b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) performing a screen for binding of antibodies produced from said hybridoma cells to antigen; (d) cloning immunoglobulin genes from said hybridoma into a mammalian expression cell; (e) incubating said mammalian expression cell in the presence of at least one chemical inhibitor of mismatch repair, thereby forming a hypermutated mammalian expression cell; (f) performing a screen for hypermutated mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from said parental mammalian expression cells;
and (g) performing a second screen for hypennutated mammalian expression cells that produce higher titers of antibodies than that produced by parental mammalian expression cells; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from iya vitro immunized immunoglobulin-producing cells.

[0047] In some embodiments of the method of the invention the method may fiuther comprise the removal of the chemical inhibitor from the hypermutated hybridoma and/or hypermutated mammalian expression cells, thereby stabilizing the genome of said hypermutated hybridoma cells and/or hypermutated mammalian expression cells.

[0048] The invention also comprises antibodies produced by the mammalian expression cells.

[0049] In another embodiment, the invention comprises a method for producing hybridoma cells that produce high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen irz vitro, wherein the donor cells are derived from a donor that is naturally deficient in mismatch repair; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; thereby producing hybridoma cells producing high-affinity antibodies.

[0050] The method may further comprise introducing a wild-type gene for mismatch repair into said selected hypermutated hybridoma cell to complement the mismatch repair deficiency, thereby restabilizing the genome of said selected hypermutated hybridoma cell.

[0051] The invention also comprises antibodies produced by the hybridoma cells.

[0052] In another embodiment, the invention comprises a method for producing hybridoma cells that produce high-affiuty antibodies from in vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells, wherein the myeloma cells are naturally deficient in mismatch repair, thereby forming parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; thereby producing hybridoma cells producing high-affinity antibodies.

[0053] The method may further comprise introducing a wild-type gene for mismatch repair into said selected hypermutated hybridoma cell to complement the mismatch repair deficiency, thereby restabilizing the genome of said selected hypermutated hybridoma cell.

[0054] The invention also comprises antibodies produced by the hybridoma cells.

[0055] In another embodiment, the invention comprises a method for producing hybridoma cells that produce high-affinity antibodies from ih vitro immunized immunoglobulin-producing cells in high titers comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro, wherein the donor cells are derived from a donor that is naturally deficient in mismatch repair;
(b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; (f) performing a second screen for hypermutated hybridoma cells that produce increased titers of antibodies as compared with parental hybridoma cells; (g) selecting hypermutated hybridoma cells that produce antibodies in higher titers than produced by the parental hybridoma cells; thereby producing hybridoma cells producing high titers of high-affinity antibodies.

[0056] The method may further comprise introducing a wild-type gene for mismatch repair into said selected hypermutated hybridoma cell to complement the mismatch repair deficiency, thereby restabilizing the genome of said selected hypermutated hybridoma cell.

[0057] The invention also comprises antibodies produced by the hybridoma cells.

[0058] In another embodiment, the invention comprises a method for producing hybridoma cells that produce high-affinity antibodies from in vitro immunized immunoglobulin-producing cells in high titers comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells, wherein the myeloma cells are naturally deficient in mismatch repair, thereby forming parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; (f) performing a second screen for hypermutated hybridoma cells that produce increased titers of antibodies as compared with parental hybridoma cells; (g) selecting hypermutated hybridoma cells that produce antibodies in higher titers than produced by the parental hybridoma cells;
thereby producing hybridoma cells producing high titers of high-affinity antibodies.

[0059] The method may further comprise introducing a wild-type gene for mismatch repair into said selected hypermutated hybridoma cell to complement the mismatch repair deficiency, thereby restabilizing the genome of said selected hypermutated hybridoma cell.

[0060] The invention also comprises antibodies produced by the hybridoma cells.

[0061] In another embodiment, the invention comprises a method for producing mammalian expression cells that produce high-affinity antibodies in high titers from in vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ira vitro, wherein the donor cells are derived from a donor that is naturally deficient in mismatch repair;
(b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the -12.-hypennutated hybridoma cells; (e) selecting hypennutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; (f) cloning immunoglobulin genes from said hypermutated hybridoma into a mammalian expression cell; thereby producing a mammalian expression cell that produces high titers of high-affinity antibodies in high titer from ih vitro immunized immunoglobulin-producing cells.

[0062] In some embodiments, the parental mammalian expression cell is further incubated in the presence of at least one chemical inhibitor of mismatch repair, thereby forming a hypermutated mammalian expression cell; and the hypermutated mammalian expression cells are screened for higher production of antibodies than that of the parental mammalian expression cells.

[0063] In some embodiments of the method of the invention the method may further comprise the removal of the chemical inhibitor from the hypennutated mammalian expression cells, thereby stabilizing the genome of said hypermutated mammalian expression cells.

[0064] The invention also comprises antibodies produced by the mammalian expression cells.

[0065] In another embodiment, the invention comprises a method for producing mammalian expression cells that produce high-affinity antibodies in high titer from ifa vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen iya vitro; (b) fixsing the immunoglobulin-producing cells with myeloma cells, wherein the myeloma cells are naturally deficient in mismatch repair, thereby forming parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypennutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells;
and (f) cloning immunoglobulin genes from said hypermutated hybridoma cell into a mammalian expression cell; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from ih vitro immunized immunoglobulin-producing cells.

[0066] In some embodiments, the parental mammalian expression cell is further incubated in the presence of at least one chemical inhibitor of mismatch repair, thereby forming a hypermutated mammalian expression cell; and the hypermutated mammalian expression cells are screened for higher production of antibodies than that of the parental mammalian expression cells.

[0067] In some embodiments of the method of the invention the method may further comprise the removal of the chemical inhibitor from the hypermutated mammalian expression cells, thereby stabilizing the genome of said hypermutated mammalian expression cells.

[0068] The invention also comprises antibodies produced by the hybridoma cells.

[0069] In some embodiments of the methods of the invention, the immunoglobulin-producing cells are mammalian cells, including but not limited to, mouse cells, rat cells, goat cells, cow cells, horse cells, dog cells, cat cells, rabbit cells, bird cells, monkey cells and human cells. In preferred embodiments, the cells are human cells.

[0070] In some embodiments the dominant negative allele of a mismatch repair gene is a dominant negative allele ofPMS2, PMSl, PMSR3, PMSR2, PMSR6, MLHl, GTBP, MSH3, MSH2, MLH3, or MSHI , and homologs of PMSR genes as described in Nicolaides et al.
(1995) Gehomics 30:195-206 and Horii et al. (1994) Biochem. BioplZys. Res.
Commun.
204:1257-1264. However, the mismatch repair genes are not limit to these examples.

[0071] In some embodiments of the method of the invention, the immunogenic antigen is conjugated to a mitogenic polypeptide comprising at least a portion of a polypeptide including, but not limited to tetanus toxoid, ovalbumin, bovine serum albumen, thyroglobulin, diptheria toxoid, BCG, and cholera toxin. In some embodiments, the antigen is generated by denaturing the mature protein.

[0072] In some embodiments of the method of the invention, the antibodies produced have an affinity of at least about 1 x 107 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 108 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 109 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 101° M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 1011 M-1.
In other embodiments, the antibodies have an affinity of at least about 1 x 1012 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 1013 M-1.
In other embodiments, the antibodies have an affinity of at least about 1 x 1014 M-1.

[0073] In some embodiments, the antibodies are produced in a higher titer than the parental cell lines, such as in an amount of at least about 1.5 fold higher than the parental cell line. In other embodiments, the titer is at least about 1.5-3 fold higher than the parental cell line. In other embodiments, the titer is at least about 3-5 fold higher than the parental cell line. In other embodiments, the titer is at least about S-7 fold higher than the parental cell line. In other embodiments, the titer is at least about 7-9 fold higher than the parental cell line. In other embodiments, the titer is at least about 9-10 fold higher than the parental cell line.

[0074] In some embodiments of the method of the invention, mutation rates are further enhanced by incubating the hybridoma cells with a chemical mutagen, such as, but not limited to N-ethyl-N-nitrosourea, N-methyl-N-nitrosourea, procarbazine hydrochloride, chlorambucil, cyclophosphamide, methyl methanesulfonate, ethyl methanesulfonate, diethyl sulfate, acrylamide monomer, triethylene melamin, melphalan, nitrogen mustard, vincristine, dimethylnitrosamine, N-methyl-N'-vitro-nitrosoguanidine, 7,12 dimethylbenz (a) anthracene, ethylene oxide, hexamethylphosphoramide, and bisulfan.

[0075] The chemical inhibitors of mismatch repair used in certain embodiments of the methods of the invention include, but are not limited to, at least one of an anthracene, an ATPase inhibitor, a nuclease inhibitor, an RNA interference molecule, a polymerase inhibitor and an antisense oligonucleotide that specifically hybridizes to a nucleotide encoding a mismatch repair protein. In some embodiments, the chemical inhibitor is an anthracene having the formula:
R 8 1. 9 ( 1 ~2 R / ~ ~ ~ ~R3 Rs Ri~ R4 wherein Rl-Rlo are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, axylalkyl, alkylaryl, allcylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups; wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alk5myl, substituted aryl, and substituted heteroaryl are halogen, CN, N02, lower alkyl, aryl, heteroaryl, aralkyl, aralkoxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and wherein said amino groups are optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups. In certain embodiments, RS and R6 are hydrogen. In other embodiments, Rl-Rlo are independently hydrogen, hydroxyl, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, phenyl, tolyl, hydroxymethyl, hydroxypropyl, or hydroxybutyl. Non-limiting examples of the anthracenes include 1,2-dimethylanthracene, 9,10-dimethylanthracene, 7,8-dimethylanthracene, 9,10-duphenylanthracene, 9,10-dihydroxymethylanthracene, 9-hydroxymethyl-10-methylanthracene, dimethylanthracene-1,2-diol, 9-hydroxymethyl-10-methylanthracene-1,2-diol, 9-hydroxymethyl-10-methylanthracene-3,4-diol, and 9,10-di-m-tolylanthracene.

[0076] The chemical inhibitor may be introduced into the growth medium of the cells. In some embodiments, the chemical inhibitor may be withdrawn from the hypermutated hybridoma cells in order to re-stabilize the genome of the cells.

[0077] The invention also comprises a method for ih vitro production of antigen-specific immunoglobulin-producing cells comprising: (a) isolating donor cells from an animal; (b) treating said cells with L-leucyl-L-leucine methy ester hydrobromide; (c) incubating said donor cells with an immunogenic antigen ih vitro, at 25-37°C, 5-10%
C02, in medium supplemented with 5-15% serum, and a growth promoting cytokine for 4 days; (d) washing said cells in medium; and (e) culturing said cells in medium supplemented with 5-15% serum an additional 8 days; thereby stimulating the production of antigen-specific immunoglobulin-producing cells.

[0078] In some embodiments, the immunoglobulin-producing cells are human cells.

[0079] In some embodiments of the method of the invention, the immunogenic antigen is conjugated to a mitogenic polypeptide comprising at least a portion of a polypeptide including, but not limited to tetanus toxoid, ovalbumin, bovine serum albumen, thyroglobulin, diptheria toxoid, BCG, and cholera toxin. In some embodiments, the antigen is generated by denaturing the mature protein.

[0080] In some embodiments of the method of the invention, the antibodies produced have an affinity of at least about 1 x 107 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 108 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 109 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 101° M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 1011 M-1.
In other embodiments, the antibodies have an affinity of at least about 1 x 1012 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 1013 M-1.
In other embodiments, the antibodies have an affinity of at least about 1 x 1014 M-1.

[0081] In some embodiments, the antibodies are produced in a higher titer than the parental cell lines, such as in an amount of at least about 1.5 fold higher than the parental cell line. In other embodiments, the titer is at least about 1.5-3 fold higher than the parental cell line. In other embodiments, the titer is at least about 3-5 fold higher than the parental cell line. In other embodiments, the titer is at least about 5-7 fold higher than the parental cell line. In other embodiments, the titer is at least about 7-9 fold higher than the parental cell line. In other embodiments, the titer is at least about 9-10 fold higher than the parental cell line.

[0082] In some embodiments of the method of the invention, mutation rates are further enhanced by incubating the hybridoma cells and/or mammalian expression cells with a chemical mutagen, such as, but not limited to N-ethyl-N-nitrosourea, N-methyl-N-nitrosourea, procarbazine hydrochloride, chlorambucil, cyclophosphamide, methyl methanesulfonate, ethyl methanesulfonate, diethyl sulfate, acrylamide monomer, triethylene melamin, melphalan, nitrogen mustard, vincristine, dimethylnitrosamine, N-methyl-N'-vitro-nitrosoguanidine, 7,12 dimethylbenz (a) arithracene, ethylene oxide, hexamethylphosphoramide, and bisulfan.

[0083] The mammalian expression cells used in the methods of the invention may include, but are not limited to, Chinese Hamster Ovary, baby hamster kidney cells, human embryonic kidney line 293, normal dog kidney cell lines, normal cat kidney cell lines, monkey kidney cells, African green monkey kidney cells, COS cells, and non-tumorigenic mouse myoblast G8 cells, fibroblast cell lines, myeloma cell lines, mouse NIH/3T3 cells, LMTK31 cells, mouse sertoli cells, human cervical carcinoma cells, buffalo rat liver cells, human lung cells, human liver cells, mouse mammary tumor cells, TRI cells, MRC 5 cells, and FS4 cells.

[0084] These and other embodiments are described more fully in the next section and include certain non-limiting examples.
BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Figure 1 shows the immune response of PBMCs to antigen stimulation.
PBMCs were cultured in the presence or absence of TT for 4 days then washed with medium and cultured in the presence or absence of TT for an additional eight days. Culture supernates were collected and tested for the presence of antibody reactive to TT. Antibodies bound to TT
pre-coated on the solid phase were detected with HRP-labeled goat anti-human IgG, or HRP-labeled goat anti-human IgM.

[0086] Fig. 2A shows reactivity of donor serum to TT by detection of donor anti-TT IgG.
Fig. 2B shows reactivity of donor serum to TT by detection of donor anti-TT
IgM.

[0087] Figure 3 shows the frequency of the anti-TT response of PBMCs upon in vitro immunization with TT, or with TT in combination with IL-2, or CD40L.

[0088] Figure 4 shows the intensity of the response of PBMCs upon iya vitro immunization with TT, or with TT in combination with IL-2, or CD40L.

[0089] Figure 5 shows the response of hybridomas expressing anti-TT
antibodies.

[0090] Fig. 6A shows the reactivity of unstimulated PBMCs to EGFR. Fig. 6B
shows the reactivity of PBMCs to EGFR after immunization with EGFR-TT. Fig. 6C shows the reactivity of unstimulated PBMCs to EGFR-TT. Fig. 6D shows the reactivity of PBMCs to EGFR-TT after immunization with EGFR-TT.

[0091] Figure 7 shows the response of hybridomas expressing antibodies against human EGFR. Antibodies bound to EGFR or BSA (control) pre-coated on the solid phase were detected with HRP-labeled goat anti-human IgG or HRP-labeled goat anti-human IgM.

[0092] Figure 8 shows the IgG and IgM responses of cells immunized with tumor cells ih vitro.

[0093] Figure 9 shows reactivity of clones to GM-CSF, chick ovalbumin (CAB), or keyhole limpet hemocyanin.
[0100] Figure 10 shows inhibitory effect of anti-GM-CSF antibodies on proliferation of TF-1 cells. Shown are the effects of a GM-CSF-specific, blocking antibody; a GM-CSF-specific, non-blocking antibody; and a non-specific antibody.
DETAILED DESCRIPTION OF THE INVENTION
[0101] The referenced patents, patent applications, and scientific literature, including accession numbers to GenBank database sequences, referred to herein are hereby incorporated by reference in their entirety. Any conflict between any reference cited herein and the specific teachings of this specification shall be resolved in favor of the latter.
Likewise, any conflict between an art-understood definition of a word or phrase and a definition of the word or phrase as specifically taught in this specification shall be resolved in favor of the latter.
[0102] Standard reference works setting forth the general principles of recombinant DNA
technology known to those of skill in the art include, but are not limited to Ausubel et al.
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York (1998);
Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, 2D ED., Cold Spring Harbor Laboratory Press, Plainview, New York (1989); Kaufinan et al., Eds., HANDBOOK
OF
MOLECULAR AND CELLULAR METHODS IN BIOLOGY AND MEDICINE, CRC Press, Boca Raton (1995); McPherson, Ed., DIRECTED MUTAGENESIS: A PRACTICAL APPROACH, 1RL Press, Oxford (1991).
[0103] The invention provides various embodiments of a method for producing antibody-producing cells and antibodies from ih vitro immunized cells with high affinity, and/or increased production. In some embodiments, the cells that produce the antibodies are hybridoma cells, formed by fusing myeloma cells with the lymphoid cells that have been immunized against an antigen in vitro. In other embodiments, the cells that produce the antibodies are mammalian cells that have been transfected with immunoglobulin genes cloned from lymphoid cells that have been immunized against an antigen ih vitro. In some embodiments, the method employs both hybridoma cells and mammalian cells. Some basic embodiments of the method of the invention may be described as follows.
[0104] In one embodiment, the invention provides a method for generating hybridoma cells producing high-affinity antibodies from in vitro immunized, immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ifz vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells express a dominant negative allele of a mismatch repair gene; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for the antigen than antibodies produced by the parental hybridoma cells; thereby producing hybridoma cells producing high-affinity antibodies.
[0105] In another embodiment, the invention provides methods of producing hybridoma cells that produce lugh titers of antibodies from ira vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells express a dominant negative allele of a mismatch repair gene; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells;
(d) performing a screen of the hypermutated hybridoma cells for antigen-specific antibodies produced in higher titers than that produced by the parental hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce higher titers of antibodies than that produced by the parental hybridoma cells; thereby producing hybridoma cells that produce high titers of antibodies.
[0106] In another embodiment, the invention provides a method for producing hybridoma cells that produce high titers of high-affinity antibodies from ira vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) performing a screen for binding of antibodies produced from said hybridoma cells to antigen; (d) cloning immunoglobulin genes from said hybridoma into a mammalian expression cell, wherein said mammalian expression cell expresses a dominant negative allele of a mismatch repair gene;
and (e) performing a screen for mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from said hybridoma cells; thereby producing hybridoma cells that produce high titers of high-affinity antibodies from ira vitro immunized immunoglobulin-producing cells.
[0107] In another embodiment, the invention provides a method for producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro irmnunized immunoglobulin-producing cells are produced by: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ih vitro; (b) fusing said immmioglobulin-producing cells with myeloma cells to form hybridoma cells, wherein said hybridoma cells express a dominant negative allele of a mismatch repair gene;
(c) incubating said parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from said hypermutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for said antigen than antibodies produced by said parental hybridoma cells; and (f) cloning immunoglobulin genes from said hybridoma into a mammalian expression cell; thereby producing high titers of high-affinity antibodies from iiz vitro immunized immunoglobulin-producing cells.
[0108] In yet another embodiment, the invention provides mammalian expression cells that produce high titers of high-affinity antibodies from iya vitro immunized immunoglobulin-producing cells are produced by: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen iya vitr~; (b) fusing the immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) performing a screen for binding of antibodies produced from the hybridoma cells to antigen; (d) cloning irnmunoglobulin genes from the hybridoma into a paxental mammalian expression cell, wherein the mammalian expression cell expresses a dominant negative allele of a mismatch repair gene; (e) incubating the parental mammalian expression cell to allow for mutagenesis, thereby forming hypermutated mammalian expression cells; (f) performing a screen of hypermutable mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from the hybridoma cells; and (g) performing a screen of hypermutable mammalian expression cells that secrete higher titers of antibodies than parental mammalian expression cells; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells.
[0109] In yet another embodiment, the invention provides a method of producing hybridoma cells that produce high-affinity antibodies from ih vitro immunized immunoglobulin-producing cells are produced by: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells; (c) incubating the parental hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair, thereby forming hypermutated hybridoma cells; (d) perfoi~ning a screen for antigen binding for antibodies produced from the hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for the antigen than antibodies produced by said parental hybridoma cells; thereby producing hybridoma cells that produce high-affinity antibodies.
[0110] In still another embodiment, the invention provides a method of producing hybridoma cells that produce high titers of antibodies from ih vitro immunized immunoglobulin-producing cells are produced by: (a) combining donor cells comprising imrnunoglobulin-producing cells with an immunogenic antigen ih vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells; (c) incubating the parental hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair, thereby forming hypermutated hybridoma cells; (d) performing a screen of the hypermutated hybridoma cells for antigen-specific antibodies produced in higher titers than that produced by the parental hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce higher titers of antibodies than that produced by said parental hybridoma cells; thereby producing hybridoma cells producing high titers of antibodies.
[0111] In another embodiment, the invention provides methods for producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells are produced by: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) performing a screen for antigen binding of antibodies produced from the hybridoma cells;
(d) cloning immunoglobulin genes from the hybridoma cells into a mammalian expression cell; (e) incubating the mammalian expression cell in the presence of at least one chemical inhibitor of mismatch repair; and (f) performing a screen for mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from the hybridoma cells; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from ifz vitro immunized immunoglobulin-producing cells.
[0112] In yet another embodiment, the invention provides a method for producing mammalian expression cells that produce high affinity antibodies to a selected antigen from in vitro immunized immunoglobulin-producing cells are produced in high titers by: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen iyZ
vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) incubating the hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair to form hypermutated hybridoma cells; (d) performing a screen for antigen binding for antibodies produced from the hypennutated hybridoma cells; (e) selecting hypennutated hybridoma cells that produce antibodies with greater affinity for the antigen than antibodies produced by the parental hybridoma cells; and (f) cloning immunoglobulin genes from the hypermutated hybridoma cells into a mammalian expression cell, thereby forming parental mammalian expression cells; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from ih vitro immunized immunoglobulin-producing cells.
[0113] In yet another embodiment, the invention also provides methods for producing mammalian expression cells that produce high titers of high-affinity antibodies from iya vitro immunized immurioglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro; (b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells; (c) performing a screen for binding of antibodies produced from said hybridoma cells to antigen; -(d) cloning immunoglobulin genes from said hybridoma into a mammalian expression cell; (e) incubating said mammalian expression cell in the presence of at least one chemical inhibitor of mismatch repair, thereby forming a hypennutated mammalian expression cell; (f) performing a screen for hypermutated mammalian expression cells that secrete antibodies with higher affnuty for antigen as compared to antibodies produced from said parental mammalian expression cells; and (g) performing a second screen for hypermutated mammalian expression cells that produce higher titers of antibodies that produced by parental mammalian expression cells; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells.
[0114] In another embodiment, the invention comprises a method for producing hybridoma cells that produce high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ih vitro, wherein the donor cells are derived from a donor that is naturally deficient in mismatch repair; (b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; thereby producing hybridoma cells producing high-affinity antibodies.
[0115] In another embodiment, the invention comprises a method for producing hybridoma cells that produce high-affinity antibodies from ih vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ifZ vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells, wherein the myeloma cells are naturally deficient in mismatch repair, thereby forming parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; thereby producing hybridoma cells producing high-affinity antibodies.
[0116] In another embodiment, the invention comprises a method for producing hybridoma cells that produce high-affinity antibodies from ira vitro immunized immunoglobulin-producing cells in high titers comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an ixmnunogenic antigen iya vitro, wherein the donor cells are derived from a donor that is naturally deficient in mismatch repair;
(b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; (f) performing a second screen for hypermutated hybridoma cells that produce increased titers of antibodies as compared with parental hybridoma cells; and (g) selecting hypermutated hybridoma cells that produce antibodies in higher titers than produced by the parental hybridoma cells; thereby producing hybridoma cells producing high titers of high-affinity antibodies.
[0117] In another embodiment, the invention comprises a method for producing hybridoma cells that produce high-affinity antibodies from ih vitro immunized immunoglobulin-producing cells in high titers comprising: (a) combining donor cells comprising imrnunoglobulin-producing cells with an immunogenic antigen iya vitf°o;
(b) fusing the immunoglobulin-producing cells with myeloma cells, wherein the myeloma cells are naturally deficient in mismatch repair, thereby forming parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; (f) performing a second screen for hypermutated hybridoma cells that produce increased titers of antibodies as compared with parental hybridoma cells; and (g) selecting hypermutated hybridoma cells that produce antibodies in higher titers than produced by the parental hybridoma cells; thereby producing hybridoma cells producing high titers of high-affinity antibodies.
(0118] In another embodiment, the invention comprises a method for producing mammalian expression cells that produce high-affinity antibodies in high titers from in vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen ih vitro, wherein the donor cells are derived from a donor that is naturally deficient in mismatch repair;
(b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to~allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; (e) selecting hypennutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; and (f) cloning immunoglobulin genes from said hypermutated hybridoma into a mammalian expression cell; thereby producing a mammalian expression cell that produce high titers of high-affinity antibodies in high titer from ifa vitYO
immunized immunoglobulin-producing cells.

[0119] In another embodiment, the invention comprises a method for producing mammalian expression cells that produce high-affinity antibodies in high titer from ih vitro immunized immunoglobulin-producing cells comprising: (a) combining donor cells comprising i_m_m__unoglobulin-producing cells with an immunogenic antigen i>z vitro; (b) fusing the immunoglobulin-producing cells with myeloma cells, wherein the myeloma cells are naturally deficient in mismatch repair, thereby forming parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair; (c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells; (d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells; (e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells;
and (f) cloning immunoglobulin genes from said hypermutated hybridoma cell into a mammalian expression cell; thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from izz vitro immunized immunoglobulin-producing cells.
[0120] The invention also provides hybridoma cells, expression cells produced by any of the methods of the invention, as well as antibodies produced by any of the hybridoma cells and expression cells of the invention.
[0121] In still another embodiment, antigen-specific immunoglobulin-producing cells are produced by: (a) isolating donor cells from an animal; (b) treating said cells with L-leucyl-L-leucine methy ester hydrobromide; (c) incubating said donor cells with an immunogenic antigen iyz vitro, at 25-37°C, 5-10% COa, in medium supplemented with 5-15% serum, and a growth promoting cytokine for 4 days; (d) washing said cells in medium; and (e) culturing said cells in medium supplemented with 5-15% serum an additional 8 days; thereby stimulating the production of antigen-specific immunoglobulin-producing cells.
[0122] The blood cells used in the methods of the invention may be derived from any animal that produces antibodies. Preferably, the donor cells are derived from mammals, including, but not limited to humans, monkeys, mice, rats, guinea pigs, hamsters, gerbils, birds, rabbits, sheep, goats, pigs, horses, and cows. The source of blood is not necessarily limited, but may be whole blood or fractions containing lymphocytes. The blood may be donor or cord blood, for example. In some embodiments, the blood cells are preferably human donor cells.
[0123] The myeloW a cells used to create the hybridoma cells in the method of the invention may be derived from any species known to have suitable myeloma cells. For example, but not by way of limitation, the myeloma cells may be conveniently derived from humans or mice.
Suitable examples of myeloma cells include, but are not limited to the HUNS 1 myeloma as described in U.S. Patent No. 4,720,459 to Winkelhake, and deposited with the American Type Culture Collection (ATCC) as CRL 8644; GM4672; RPMI 8226; and marine myeloma cell lines (e.g., P3-NS1/1-Ag4-1; P3-x63-Ag8.653; Sp2/O-Agl4; NS/O, NS/1, SP2 and 5194).
[0124] The mammalian expression cells suitable for use in certain embodiments of the method of the invention include, but are not limited to Chinese Hamster Ovary cells (CHO cells, Urlaub and Chasin (1980) Proc. Natl. Acad. Sci. USA, 77: 4216), baby hamster kidney (BHK
cells), human embryonic kidney line 293 (HeLa cells, Graham et al., (1977) J.
Gen Tirol., 36:
59), normal dog kidney cell line (e.g., MDCK, ATCC CCL 34), normal cat kidney cell line (CRFK cells), monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587), COS (e.g., COS-7) cells, and non-tumorigenic mouse myoblast G8 cells (e.g., ATCC CRL 1246), fibroblast cell lines (e.g., human, marine or chicken embryo fibroblast cell lines), myeloma cell lines, mouse NIHl3T3 cells, LMTK3i cells, mouse sertoli cells (TM4, Mather, (1980) Biol. Reprod., 23:243-251);
human cervical carcinoma cells (HELA, ATCC CCL 2); buffalo rat liver cells (BRL 3A, ATCC CRL
1442);
human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065);
mouse mammary tumor cells (MMT 060562, ATCC CCL51), TRI cells (Mather et al. (1982) Anfzals N. Y. Acad. Sci. 383:44-68); MRC 5 cells; FS4 cells; and the human hepatoma line (Hep G2).
[0125] As an alternative to mammalian expression cells, other non-mammalian cells may be used to express the cloned immunoglobulin genes. Such non-mammalian cells include, but are not limited to insect cells (e.g., Spodoptera frugiperda cells and the like).
Vectors and non-mammalian host cells are well known in the art and are continually being optimized and developed. Any host cell system capable of expressing antibodies may be used in the methods of the invention.
[0126] As used herein, "dominant negative allele of a mismatch repair gene"
refers to an allele of a mismatch repair gene that, when expressed, exerts a dominant phenotype in the cell or organism that leads to an inhibition of the mismatch repair system, even in the presence of a wild-type allele. Cells expressing a dominant negative allele of a mismatch repair gene are hypennutable and accumulate mutations at a higher rate than wild-type cells.
Examples of nucleic acid sequences encoding mismatch repair proteins useful in the method of the invention include, but are not limited to the following: PMSl (SEQ ID NO:1);
PMS2 (SEQ DJ
N0:3); PMS2-134 (SEQ ID NO:S); PMSR2 (SEQ ID N0:7); PMSR3 (SEQ ID NO:9); MLHl (SEQ ID NO:l 1); MLH3 (SEQ ID NO:13); MSH2 (SEQ ID NO:15); MSH3 (SEQ ID
N0:17);
MSH4 (SEQ ID NO:19); MSHS (SEQ ID N0:21); MSH6 (SEQ ID N0:23); PMSR6 (SEQ ID
NO:25); PMSL9 (SEQ ID NO:27); yeast MLHl (SEQ ID N0:29); mouse PMS2 (SEQ ID

NO:31); mouse PMS2-134 (SEQ ID N0:33); Ai"abidopsis thaliana PMS2 (SEQ ID
N0:35); A.
thaliaha PMS2-134 (SEQ ID N0:37) A. thaliaha PMSI (SEQ ID N0:39); A. thaliana (SEQ ID N0:41) A. thaliaha MSH2 (SEQ ID N0:43); A. thaliaha MSH3 (SEQ ID
N0:45); A.
thaliana MSH6-1 (SEQ ID N0:47); and ~ryza satvia MLHI (SEQ ID N0:49). The corresponding amino acid sequences for the listed nucleic acid sequences are:
PMS 1 (SEQ ID
N0:2); PMS2 (SEQ ID N0:4); PMS2-134 (SEQ ID N0:6); PMSR2 (SEQ ID N0:8); PMSR3 (SEQ ID NO:10); MLH1 (SEQ ID N0:12); MLH3 (SEQ ID N0:14); MSH2 (SEQ ID
N0:16); MSH3 (SEQ ID N0:18); MSH4 (SEQ ID N0:20); MSHS (SEQ ID N0:22); MSH6 (SEQ ID N0:24); PMSR6 (SEQ ID N0:26); PMSL9 (SEQ ID N0:28); yeast MLH1 (SEQ ID
N0:30); mouse PMS2 (SEQ ID N0:32); mouse PMS2-134 (SEQ ID NO:34); A~abidopsis thaliana PMS2 (SEQ ID N0:36); A. thalia>za PMS2-134 (SEQ ID N0:38); A.
thaliatta PMS1 (SEQ ID N0:40); A. tl2aliatta MSH7 (SEQ ID N0:42) A. thaliarta MSH2 (SEQ ID
N0:44); A.
thaliafza MSH3 (SEQ ID N0:46); A. thaliatta MSH6-1 (SEQ ID N0:48); and O~yza satvia MLH1 (SEQ ID NO:50).
[0127] As used herein, "high titer" refers to an titer of at least about 1.5 fold higher than the parental cell line. In some embodiments, the titer is at least about 1.5-3 fold higher, 3-5 fold higher, 5-7 fold higher, 7-9 fold higher, or 9-10 fold lugher than the parental cell line.
[0128] As used herein, "high affinity" refers to a high antibody binding affinity, that may be calculated according to standard methods by the formula Ka = 8/3 (It-Tt) where "It" is the total molar concentration of inhibitor uptake at 50% tracer and "Tt" is the total molar concentration of tracer. See Muller (1980) J. Immunol. Meth. 34:345-352. , Binding affinity may also be calculated using the formula B/T = ri NAb~WI~g [(V-V",)K+Q'W] (See Antoni and Mariani (1985) J. Immuttol. Meth. 83:61-68). As used herein, "high affinity" is at least about 1 x 107 M-1. In some embodiments, the antibodies have an affinity of at least about 1 x 108 M'1. In other embodiments, the antibodies have an affinity of at least about 1 x 109 M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 101°
M-1. In other embodiments, the antibodies have an affinity of at least about 1 x 1011 M-1.
In other embodiments, the antibodies have an affinity of at least about 1 x 1012 M-1.
In other embodiments, the antibodies have an affinity of at least about 1 x 1013 M-1.
In other embodiments, the antibodies have an affinity of at least about 1 x 1014 Mu.
[0129] As used herein, "antigen-specific" refers to an interaction between the CDR regions of the immunoglobulin molecule with an epitope of the antigen wherein the CDR
regions of the immunoglobulin molecule binds to the epitope.

[0130] As used herein, "cured" refers to a state of the cells wherein the dominant negative mismatch repair gene has been eliminated from the cell or wherein the expression of the dominant negative allele has been turned off, leading to a stabilized genome, producing stable biological products such as immunoglobulins.
[0131] In some embodiments of the methods of the invention, mismatch repair is inhibited by introducing a dominant negative allele of a mismatch repair gene into a cell.
[0132] In other embodiments of the methods of the invention, mismatch repair is inhibited by exposing cells that express an antibody to a compound that inhibits mismatch repair. In some embodiments, the compound is an ATPase inhibitor. Suitable ATPase inlubitors include, but not limited to ATP analogs that are capable of blocking the ATPase activity necessary for mismatch repair in the cell. Examples of ATP analogs that may be used in the methods of the invention, include, but are not limited to non-hydrolyzable forms of ATP, such as AMP-PNP
and ATPyS, which block mismatch repair activity (Galio et al. (1999) Nucl.
Acids Res.
27:2325-2331; Allen et al. (1997) EMB~ J. 16:4467-4476; Bjornson et al. (2000) Biochena.
39:3176-3183). Other suitable ATPase inhibitors may be identified using mismatch repair reporter cells that may be screened with candidate ATPase inhibitors to identify those compounds which effectively block ATPase activity in the cells.
[0133] In other embodiments of the methods of the invention, mismatch repair is inhibited by exposing cells that express an antibody to a nuclease inhibitor. The nuclease inhibitors are capable of blocking exonuclease activity in the mismatch repair biochemical pathway.
Mismatch repair reporter cells may be screened with candidate nuclease inhibitors to identify compounds that effectively block the exonuclease activity of the mismatch repair system.
Suitable nuclease inhibitors which may be used in the methods of the invention include, but are not limited to analogs of N-ethylinaleimide, an endonuclease inhibitor (Huang et al. (1995) Arch. Biochem. Biophys. 316:485); heterodimeric adenosine-chain-acridine compounds, exonuclease III inhibitors (Belinont et al. (2000) Bioo~g. Med. Ghern Lett.
10:293-295); as well as antibiotic compounds such as heliquinomycin, which have helicase inhibitory activity (Chino et al. (1998) J. Antibiot. (Tokyo) 51:480-486). Other suitable nuclease inhibitors may be identified using mismatch repair reporter cells that may be screened with candidate nuclease inhibitors to identify those compounds which effectively block nuclease activity in the cells.
[0134] In other embodiments of the methods of the invention, mismatch repair is inhibited by exposing the cells producing antibodies to DNA polyrnerase inhibitors. DNA
polymerase inhibitors are capable-of blocking the polymerization of DNA which is required for functional mismatch repair. Examples of suitable DNA polymerise inhibitors include, but are not limited to actinomycin D (Ma~.-tin et al. (1990) J. Irnmunol. 145:1859); aphidicolin (Kuwakado et al.
(1993) Biochem. PhaYmacol. 46:1909); 1-(2'-deoxy-2'-fluoro-beta-L-arabinofuranosyl)-5-methyluracil (L-FMAU) (I~ukhanova et al. (1998) Biochena. Pharmacol. 55:1181-1187); and 2'3'-dideoxyribonucleoside 5'-triphosphates (ddNTPs) (Ono et al. (1984) Bionaed.
Pha~macothen. 38:382-389). Other suitable DNA polymerise inhibitors may be identified using mismatch repair reporter cells that may be screened with candidate DNA
polymerise inhibitors to identify those compounds which effectively block DNA polymerise activity in the cells.
[0135] In other embodiments of the methods of the invention, mismatch repair is inhibited by exposing the cells producing antibody to an anthracene. As used herein the term "anthracene"
refers to the compound anthracene. However, when referred to in the general sense, such as "anthracenes," "an anthracene" or "the anthracene," such terms denote any compound that contains the fused triphenyl core structure of anthracene, i.e., regardless of extent of substitution. The anthracene may be substituted or unsubstituted.
[0136] As used herein, "alkyl" refers to a hydrocarbon containing from 1 to about 20 carbon atoms. Alkyl groups may straight, branched, cyclic, or combinations thereof.
Alkyl groups thus include, by way of illustration only, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, cyclopentyl, cyclopentylinethyl, cyclohexyl, cyclohexylinethyl, and the like.
Also included within the definition of "alkyl" are fused and/or polycyclic aliphatic cyclic ring systems such as, for example, adamantine. As used herein the term "alkenyl" denotes an alkyl group having at least one carbon-carbon double bond. As used herein the term "alkynyl"
denotes an alkyl group having at least one carbon-carbon triple bond.
[0137] In some preferred embodiments, the alkyl, alkenyl, alkynyl, aryl, aryloxy, and heteroaryl substituent groups described above may bear one or more further substituent groups; that is, they may be "substituted". In some preferred embodiments these substituent groups can include halogens (for example fluorine, chlorine, bromine and iodine), CN, NO2, lower alkyl groups, aryl groups, heteroaryl groups, aralkyl groups, aralkyloxy groups, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino groups. In addition, the alkyl and aryl portions of aralkyloxy, arylalkyl, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, and aryloxycarbonyl groups also can bear such substituent groups. Thus, by way of example only, substituted alkyl groups include, for example, alkyl groups fluoro-, chloro-, bromo- and iodoalkyl groups, aminoalkyl groups, and hydroxyalkyl groups, such as hydroxymethyl, hydroxyethyl, hydroxypropyl, hydroxybutyl, and the like. In some preferred embodiments such hydroxyalkyl groups contain from 1 to about 20 carbons.
[0138] As used herein the term "aryl" means a group having 5 to about 20 carbon atoms and which contains at least one aromatic ring, such as phenyl, biphenyl and naphthyl. Preferred aryl groups include unsubstituted or substituted phenyl and naphthyl groups.
The term "aryloxy" denotes an aryl group that is bound through an oxygen atom, for example a phenoxy group.
(0139) In general, the prefix "hetero" denotes the presence of at least one hetero (i.e., non-carbon) atom, which is in some preferred embodiments independently one to three O, N, S, P, Si or metal atoms. . Thus, the term "heteroaryl" denotes an aryl group in which one or more ring carbon atom is replaced by such a heteroatom. Preferred heteroaryl groups include pyridyl, pyrimidyl, pyrrolyl, furyl, thienyl, and imidazolyl groups.
[0140] The term "aralkyl" (or "arylall~yl") is intended to denote a group having from 6 to 15 carbons, consisting of an alkyl group that bears an aryl group. Examples of aralkyl groups include benzyl, phenethyl, benzhydryl and naphthylinethyl groups.
[0141] The term "alkylaryl" (or "alkaryl") is intended to denote a group having from 6 to 15 carbons, consisting of an aryl group that bears an alkyl group. Examples of aralkyl groups include methylphenyl, ethylphenyl and methylnaphthyl groups.
[0142] The term "arylsulfonyl" denotes an aryl group attached through a sulfonyl group, for example phenylsulfonyl. The term "allcylsulfonyl" denotes an alkyl group attached through a sulfonyl group, for example methylsulfonyl.
[0143] The term "alkoxycarbonyl" denotes a group of formula -C(=O)-O-R where R
is alkyl, alkenyl, or alkynyl, where the alkyl, alkenyl, or alkynyl portions thereof can be optionally substituted as described herein.
[0144] The term "aryloxycaxbonyl" denotes a group of formula -C(=O)-O-R where R is aryl, where the aryl portion thereof can be optionally substituted as described herein.
[0145] The terms "arylalkyloxy" or "aralkyloxy" are equivalent, and denote a group of formula -O-R~-R~~, where R~ is R is alkyl, alkenyl, or alkynyl which can be optionally substituted as described herein, and wherein R» denotes a aryl or substituted aryl group.
[0146] The terms "alkylaryloxy" or "alkaryloxy" are equivalent, and denote a group of formula -O-Rr-R~~, where R~ is an aryl or substituted aryl group, and R~~ is alkyl, alkenyl, or alk5myl which can be optionally substituted as described herein.

[0147] As used herein, the term "aldehyde group" denotes a group that bears a moiety of formula -C(=O)-H. The term "ketone" denotes a moiety containing a group of formula -R-C(=O)-R=, where R and R-- are independently alkyl, alkenyl, alk3myl, aryl, heteroaryl, aralkyl, or alkaryl, each of which may be substituted as described herein.
[0148] As used herein, the term "ester" denotes a moiety having a group of formula -R-C(=O)-O-R= or -R-O-C(=O)-R= where R and R= are independently alkyl, alkenyl, allll~ynyl, aryl, heteroaryl, aralkyl, or alkaryl, each of which may be substituted as described herein.
[0149] The term "ether" denotes a moiety having a group of formula -R-O-R= or where R and R= are independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, or alkaryl, each of which may be substituted as described herein.
(0150] The term "crown ether" has its usual meaning of a cyclic ether containing several oxygen atoms. As used herein the term "organosulfur compound" denotes aliphatic or aromatic sulfur containing compounds, for example thiols and disulfides. The term "organometallic group" denotes an organic molecule containing at least one metal atom.
(0151] The term "organosilicon compound" denotes aliphatic or aromatic silicon containing compounds, for example alkyl and aryl silanes.
[0152] The term "carboxylic acid" denotes a moiety having a carboxyl group, other than an amino acid.
[0153] Suitable anthracenes that may be used in the method of the invention comprise compounds having the formula:
g ~9 1 R7 ~
/~ ~ ~ \

Rs Rlo R4 wherein Rl-Rlo are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alk5myl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NOZ, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups; wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, N02, lower alkyl, aryl, heteroaryl, aralkyl, aralkoxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and wherein said amino groups are optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups. In some embodiments, the RS and R6 are hydrogen. In other embodiments, Rl-Rlo are independently hydrogen, hydroxyl, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, phenyl, tolyl, hydroxymethyl, hydroxypropyl, or hydroxybutyl. Suitable anthracenes for use in the methods of the invention include, but are not limited to 1,2-dimethylanthracene, 9,10-dimethylanthracene, 7, 8-dimethylanthracene, 9,10-duphenylanthracene, 9,10-dihydroxymethylanthracene, 9-hydroxymethyl-10-methylanthracene, dimethylanthracene-1,2-diol, 9-hydroxymethyl-10-methylanthracene-1,2-diol, 9-hydroxymethyl-10-methylanthracene-3,4-diol, and 9,10-di-m-tolylanthracene.
[0154] Other suitable anthracenes may be identified using mismatch repair reporter cells that may be screened with candidate anthracenes to identify those compounds which effectively block mismatch repair activity in the cells. In some embodiments, the chemical inhibitor of mismatch repair is an RNA interference molecule that is homologous to a mismatch repair gene of the invention. The technique for generating sequence-specific RNA
interference molecules is well-known in the art and may be found in, for example, Sharp et al. (2000) Scieface 287:2431-2433; Marx (2000) Science 288:1370-1372; Grishok et al.
(2001) SciefZCe 287:2494-2497; and Fire et al. (1998) Nature 391:806-811, the disclosures of which are specifically incorporated by reference in their entirety.
[0155] In other embodiments of the method of the invention, mismatch repair is inhibited by exposing the cells producing antibody to "antisense compounds" which specifically hybridize with one or more nucleic acids encoding a mismatch repair gene. As used herein, the terms "target nucleic acid" and "nucleic acid encoding a mismatch repair gene"
encompass DNA
encoding a mismatch repair gene, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an antisense compound with its target nucleic acid interferes with the normal function of the nucleic acid, such as replication and transcription. The functions of RNA
disrupted by antisense compounds include such functions as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, and splicing of the RNA to yield one or more mRNA species. The antisense compound thereby inhibits the expression or function of a mismatch repair gene.

[0156] It is preferred to target specific nucleic acids for antisense inhibition of mismatch repair in order to reversibly disrupt the function of a given mismatch repair gene. "Targeting"
an antisense compound to a particular nucleic acid, in the context of this invention, is a multistep process, beginning with the identification of a nucleic acid sequence whose function is to be modulated. As disclosed herein, there are several mismatch repair genes that may be targeted by an antisense strategy. Among the various mismatch repair genes that may be targeted are PMS2, PMSl, PMSR3, PMSR2, PMSR6, MLHl, GTBP, MSH3, MSH2, MLH3, or MSHI, and homologs of PMSR genes as described in Nicolaides et al. (1995) Genomics 30:195-206 and Horii et al. (1994) Biochem. Biophys. Res. Commun. 204:1257-1264, including DNA or RNA. The next step of targeting involves the determination of a site or sites within this gene for the antisense interaction to occur, such that inhibition of the function of the mismatch repair gene occurs. In one embodiment, an intragenic site is targeted. An "intragenic site" is a region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon," the "start codon" or the "AUG start codon." A minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine in eukaryotes. It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. W the context of the invention, "start codon"
and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding a mismatch repair gene, regardless of the sequences) of such codons.
[0157] It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start codon region" and "translation initiation codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon. Similarly, the terms "stop codon region" and "traszslation termination codon region" refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon.
[0158] The open reading frame (ORF) or "coding region," which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, amd thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene. The 5' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage.
The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap. The 5' cap region may also be a preferred target region.
[0159] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated.
The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. mRNA splice sites, i.e., intron-exon junctions, may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA
splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA
or pre-mRNA.
[0160] Once one or more target sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
[0161] In the context of this invention, "hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
"Complementary," as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA
molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. Complementarity of the antisense oligonucleotide is preferably 100%, however, degeneracy may be introduced into the oligonucleotide such that the complementarity, in some embodiments, is 80-85%, 85-90%, 90-95% or 95-100%.
[0162] Antisense and other compounds of the invention which hybridize to the target and inhibit expression of the target are identified through experimentation, and the sequences of these compounds are herein below identified as preferred embodiments of the invention. The target sites to which these preferred sequences are complementary comprise the region of PMS2, for example, which inhibits the translation of the C-terminal portion of the PMS2 protein, effectively forming a truncation mutant. The region targeted comprises a portion of the PMS2 gene that encodes the 134 amino acid of PMS2, for example.
[0163] In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
[0164] While antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below. The antisense compounds in accordance with this invention preferably comprise from about 8 to about 50 nucleobases (i.e., from about 8 to about 50 linked nucleosides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 30 nucleobases. Antisense compounds include ribozymes, external guide sequence (EGS) oligonucleotides (oligozymes), and other short catalytic RNAs or catalytic oligonucleotides which hybridize to the target nucleic acid and modulate its expression. In some embodiments, the oligonucleotides are at least about 15 nucleotides in length and may be at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides in length.
[0165] In some embodiments, the antisense oligonucleotides comprise a sequence that is complementary to a portion of the mismatch repair sequence shown in SEQ ID
NO:1; SEQ ID
NO:3; SEQ ID NO:S; SEQ ID NO:7; SEQ ID NO:9; SEQ ~ NO:11; SEQ ID NO:13; SEQ ID
N0:15; SEQ ID N0:17; SEQ ID N0:19; SEQ ID N0:21; SEQ ID N0:23; SEQ ID NO:25;
SEQ ID N0:27; SEQ ID N0:29; SEQ ID NO:31; SEQ ID NO:33; SEQ ID NO:35; SEQ ID
N0:37; SEQ ID N0:39; SEQ ID N0:41; SEQ ID NO:43; SEQ ID NO:45; SEQ ID N0:47;
or SEQ ID N0:49. In certain embodiments, the oligonucleotide is at least 15-50 nucleotides in length with 85-100% complementarity.
[0166] As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA
and DNA is a 3' to 5' phosphodiester linkage.

[0167] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
[0168] Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphoroditlvoates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-allcylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage, i.e., a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
(0169] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos.
3,687,808;
4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677;
5,476,925;
5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361;
5,194,599;
5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, each of which is herein incorporated by reference.
[0170] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and allcyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugax portion of a nucleoside);
siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thiofonnacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
[0171] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,5.06;
5,166,315;
5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257;
5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,610,289;
5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
5,677,437;
5,792,608; 5,646,269 and 5,677,439, each of which is herein incorporated by reference.
[0172] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
Representative United States patents that teach the preparation of PNA
compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., (1991) Scieyace 254:1497-1500.
[0173] Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH2 --NH--O--CH2--, --CHZ--N(CH3)--O--CHZ-- [known as a methylene (methylimino) or MMI backbone], --CH2--O--N(CH3)--CH2 --, --CH2--N(CH3)--N(CH3)--CHZ
-- and --O--N(CH3)--CH2 --CH2-- [wherein the native phosphodiester backbone is represented as --O--P--O--CH2 --] of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No.
5,034,506.
[0174] Modified oligonucleotides may also contain one or more substituted sugar moieties.
Preferred oligonucleotides comprise one of the following at the 2' position:
OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-allcynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alk5myl may be substituted or unsubstituted C1 to Clo alkyl or CZ
to Clo alkenyl and alkynyl. Particularly preferred are O[(CH2)n O]mCH3, O(CH2)"OCH3, O(CH2)"NH2, O(CH2)"CH3, O(CHZ)"ONH2, and O(CH2)"ON[(CH2)"CH3)]2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2' position: C1 to Cio lower alkyl, substituted lower alkyl, alkenyl, all~myl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, S02 CH3, ONOa, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic,properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2' -methoxyethoxy (2'-O--CHaCHZOCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al. (1995) Helv. Chim.
Acta 78:486-504) i.e., an alkoxyalkoxy group. A fiuther preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH2)20N(CH3)2 group, also lmown as 2'-DMAOE, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2 --O--CH2--N(CHz)2, also described in examples hereinbelow.
[0175] A further preferred modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methelyne (--CH2--)" group bridging the 2' oxygen atom and the 3' or 4' carbon' atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
[0176] Other preferred modifications include 2'-methoxy (2'-O--CH3), 2'-aminopropoxy (2'-OCHZCH2CH2NH2), 2'-allyl (2'-CHZ--CH=CH2), 2'-O-allyl (2'-O--CH2--CH=CHa) and 2'-fluoro (2'-F). The 2'-modification may be in the arabino (up) position or ribo (down) position.
A preferred 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide.
Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos.
4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;
5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265;
5,658,873;
5,670,633; 5,792,747; and 5,700,920, each of which is herein incorporated by reference in its entirety.

[0177] Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (I~. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other allcyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (--C=C--CHa) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in THE
CONCISE
ENCYCLOPEDIA OF POLYMER SCIENCE AND ENGINEERING, Kroschwitz, (Ed.) John Wiley &
Sons, 1990, pages 858-859, those disclosed by Englisch et al. (1991) Ahgewa~cdte Chefnie (International Edition) 30:613, and those disclosed by Sanghvi, ANTISENSE
RESEARCH AND
APPLICATIONS, Crooke and Lebleu (Eds.), CRC Press, 1993, pages 289-302.
Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C. (Sanghvi, ANTISENSE RESEARCH AND
APPLICATIONS, Crooke and Lebleu (Eds.), CRC Press, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0178] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302;
5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908;
5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985;
5,750,692;
5,830,653; 5,763,588; 6,005,096; and 5,681,941, each of which is herein incorporated by reference in its entirety.
[0179] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. The compounds of the invention can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA.
Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/LTS92/09196, filed Oct. 23, 1992 the entire disclosure of which is incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al. (1989) Py~oc.
Natl. Acid. Sci. USA 86:6553-6556), cholic acid (Manoharan et al. (1994) Bioorg. Med.
Chena. Let. 4:1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al. (1992) Ann.
N. Y. Acid. Sci. 660:306-309; Manoharan et al. (1993) Bioorg. Med. Chem. Let.
3:2765-2770), a thiocholesterol (Oberhauser et al. (1992) Nucl. Acids Res. 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al. (1991) EMBO J.
10:1111-1118; Kabanov et al. (1990) FEBSLett. 259:327-330; Svinarchuk et al. (1993) Biochimie 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al. (1995) Tet~ahed~on Lett. 36:3651-3654; Shea et al. (1990) Nucl. Acids Res. 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al. (1995) Nucleosides & Nucleotides 14:969-973), or adamantine acetic acid (Manoharan et al. (1995) Tet~ahed~oh Lett. 36:3651-3654), a palinityl moiety (Mishra et al. (1995) Biochim. Biophys. Acta 1264:229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al. (1996) J. Pha~macol. Exp. Ther.
277:923-937.
[0180] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979;
4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731;
5,591,584;
5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718;
5,608,046;
4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263;
4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963;
5,214,136;
5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;
5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552;
5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference in its entirety.
[0181] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes antisense compounds which are chimeric compounds. "Chimeric"
antisense compounds or "chimeras," in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex.
Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region.
Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0182] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos.
5,013,830; 5,149,797;
5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355;
5,652,356; and 5,700,922, each of which is herein incorporated by reference in its entirety.
[0183] As used herein "donor cells comprising immunoglobulin-producing cells"
or "donor cells comprising immunoglobulin-producing cells" sometimes referred to simply as "donor cells" or "donor blood cells" refers to cells that are capable of producing antibodies when immunized with an antigenic compound. Examples of sources of such donor cells suitable for use in the invention include, but are not limited to spleen cells, lymph node cells, bone marrow cells, and immortalizing tumor infiltrating lymphocytes.
[0184] As used herein, the teen "amino acid" denotes a molecule containing both an amino group and a caxboxyl group. In some preferred embodiments, the amino acids are a-, [3-, y- or 8-amino acids, including their stereoisomers and racemates. As used herein the term "L-amino acid" denotes an a-amino acid having the L configuration around the a-carbon, that is, a carboxylic acid of general formula CH(COOH)(NH2)-(side chain), having the L-configuration.
The term "D-amino acid" similarly denotes a carboxylic acid of general formula CH(COOH)(NH2)-(side chain), having the D-configuration around the a-carbon.
Side chains of L-amino acids include naturally occurring and non-naturally occurring moieties. Non-naturally occurring (i.e., unnatural) amino acid side chains are moieties that are used in place of naturally occurring amino acid side chains in, for example, amino acid analogs. See, for example, Lehninger, BIOCHEMISTRY, Second Edition, Worth Publishers, Inc., 1975, pages 72-77 (incorporated herein by reference). Amino acid substituents may be attached through their carbonyl groups thxough the oxygen or carbonyl carbon thereof, or through their amino groups, or through functionalities residing on their sidechain portions.
[0185] As used herein "polynucleotide" refers to a nucleic acid molecule and includes genomic DNA cDNA, RNA, mRNA and the like.
[0186] As used herein "inhibitor of mismatch repair" refers to an agent that interferes with at least one function of the mismatch repair system of a cell and thereby renders the cell more susceptible to mutation.
[0187] As used herein "hypermutable" refers to a state in which a cell in vitro or ih vivo is made more susceptible to mutation through a loss or impairment of the mismatch repair system.

[0188] As used herein "agents," "chemicals," and "inhibitors" when used in connection with inhibition of M1VIR refers to chemicals, oligonucleotides, RNA interference molecules, analogs of natural substrates, and the like that interfere with normal function of M1VIF2.
[0189] As used herein, "about" refers to an amount within a range of +/- 10%
of the cited value.
[0190] As used herein, "mitogenic polypeptide" refers to a polypeptide when in combination with the antigen provides stimulation of appropriate cells to increase the immune response against the subject antigen.
[0191] As used herein, "hybridoma" refers to the result of a cell fusion between an immunoglobulin-producing cell and a transformed cell, such as a myeloma cell.
[0192] As used herein, "IgG subclass" refers to a category of immunoglobulins comprising IgGl, IgG2, IgG2a, IgG2b, IgG3, and IgG4.
[0193] As used herein, "mismatch repair gene" refers to a gene that encodes one of the proteins of the mismatch repair complex. Although not wanting to be bound by any particular theory of mechanism of action, a mismatch repair complex is believed to detect distortions of the DNA helix resulting from non-complementary pairing of nucleotide bases.
The non-complementary base on the newer DNA strand is excised, and the excised base is replaced with the appropriate base which is complementary to the older DNA strand. In this way, cells eliminate many mutations that occur as a result of mistakes in DNA
replication. Dominant negative alleles cause a mismatch repair defective phenotype even in the presence of a wild-type allele in the same cell. A non-limiting example of a dominant negative allele of a mismatch repair gene is the human gene hPMS2-134, which carries a truncation mutation at codon 134. The mutation causes the product of this gene to abnormally terminate at the position of the 134th amino acid, resulting in a shortened polypeptide containing the N-terminal 133 amino acids. Such a mutation causes an increase in the rate of mutations which accumulate in cells after DNA replication. Thus, expression of a dominant negative allele of a mismatch repair gene results in impairment of mismatch repair activity, even in the presence of the wild-type allele.
[0194] As used herein, "HAT-sensitive" refers to a lethal effect on cells when cultured in medium containing hypoxanthine, aminopterin and thymidine.
[0195] As used herein, "EBV-negative" refers to lack of infection of Epstein-Barr virus in a cell as measured by production of EBNA protein, or detection of EBV nucleic acids.
[0196] As used herein, "Ig-negative" refers to lack of production in a cell of any light or heavy chains of immunoglobulins.

[0197] As used herein, "screening" refers to an assay to assess the genotype or phenotype of a cell or cell product including, but not limited to nucleic acid sequence, protein sequence, protein function (e.g., binding, enzymatic activity, blocking activity, cross-blocking activity, neutralization activity, and the like). The assays include ELISA-based assays, Biacore analysis, and the like.
[0198] As used herein, "isolated" refers to a nucleic acid or protein that has been separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.. In some embodiments, the nucleic acid or protein is purified to greater than 95% by weight of protein. In other embodiments, the nucleic acid or protein is purified to greater than 99% by weight of protein. Determination of protein purity may be by any means known in the art such as the Lowry method, by SDS-PAGE under reducing or non-reducing conditions using a stain such as a Coomassie blue or silver stain.
Purification of nucleic acid may be assessed by any known method, including, but not limited to spectroscopy, agarose or polyacrylamide separation with fluorescent or chemical staining such as methylene blue, for example.
[0199] The invention provides an in vitro immunization method for obtaining antigen-specific immunoglobulin producing cells wherein the cells produce immunoglobulins of the IgG
subclass, and cells produced by this method. The ih vitro immunization procedure comprises combining donor cells with an immunogenic antigen in culture. In one embodiment, the buffy coat of donor cells is used. The donor may be from any source, including, but not limited to cord blood, venous blood, and the like. The source of the blood cells may be from any animal producing immune cells, particularly mammals. Non-limiting examples of blood cell sources include, mice, rats, humans, monkeys, dogs, cats, horses, pigs, sheep, goats, rabbits, birds, cows, guinea pigs and fish. The blood or buffy coat may be further enriched for lymphocytes by any known method, such as, but not limited to differential centrifugation, filtration, and the like.
[0200] Donor cells such as peripheral blood mononuclear cells (PBMC) may be incubated in L-leucyl-L-lysine methyl ester hydrobromide (LLOMe). While not wishing to be bound by any particular theory of operation, LLOme is believed to lysosomotropic and specifically kills cytotoxic cells in the PBMC pool such as NIA cells, cytotoxic T cells, and CD8+ suppressor T
cells, while not having an effect on B cells, T helper cells accessory cells and fibroblasts (Borrebaeck (1988) Immunol. Today 9(11):355-359). Generally, the PBMCs may be incubated with LLOMe for a period of 1-30 minutes. In some embodiments, the incubation is performed for 10-20 minutes. In other embodiments, the incubation is performed for 15 minutes. The LLOMe is generally a component of culture medium, such as, for example, RPMI 1640, and is provided in a concentration of about 0.10 to lmM. In some embodiments, LLOMe is provided in an amount of about 0.10 to 0.50 mM. In other embodiments, LLOMe is provided in an amount of about 0.25 mM.
[0201] The antigen may be any antigen provided that it is immunogenic. Whole proteins or peptides may be used. In addition, one may use, for example, membrane preparations (including those from tumors), lymphoma cells, whole cells, single cells, homogenized cells, pathogens, inclusion bodies, cell lysates, protein preparations, and minced tissue (including tumor tissue). Whole proteins may be in native or denatured conformation.
Peptides may be conjugated to carrier molecules to provide immunogenicity. While not wishing to be bound by any particular theory of operation, carrier molecules may provide additional T cell epitopes which may be useful in stimulating a more robust iya vitro antibody response.
Examples of carriers that are suitable for use in the method of the invention include tetanus toxoid, diptheria toxin, thyroglobulin, cholera toxin, BCG, bovine serum albumen (BSA), ovalbumin (OVA), and the like. These Garners are referred to herein as "mitogenic polypeptides."
[0202] Antigens may be conjugated to mitogenic polypeptides in any way known in the art.
For example, fusion proteins may be generated by expressing a polypeptide in a recombinant expression system comprising the polynucleotide encoding at least a portion of the antigen joined in-frame to a polynucleotide encoding at least a portion of the mitogenic polypeptide.
The fusion protein may have the mitogenic polypeptide joined at either the amino- or carboxy terminus of the antigen. In some embodiments, more that one antigen may be expressed as a fusion protein in combination with a mitogenic polypeptide. In other embodiments, more than one mitogenic polypeptide may be expressed as a fusion protein with the antigen or antigens.
In other embodiments, more than one mitigenic polypeptide and more than one antigen may be expressed together as a single fusion protein.
[0203] In an alternative embodiment, at least a portion of the mitogenic polypeptide is conjugated to at least a portion of the antigen using chemical cross-linkers.
Examples of chemical cross-linkers include, but are not limited to gluteraldehyde, formaldehyde, 1,1-bis (diazoacetyl)-2-phenylethane, N-hydroxysuccinimide esters (e.g., esters with 4-azidosalicylic acid, homobifunctional imidoesters including disuccinimidyl esters such as 3,3'-dithiobis (succinimidyl-propionate), and bifunctional maleimides such as bis-N-maleimido-1,8-octane).
Derivatizing agents such as methyl-3-[(p-azido-phenyl)dithio] propioimidate yield photoactivatable intermediates which are capable of forming cross-links in the presence of light. Alternatively, for example, a lysine residue in the mitogenic polypeptide or antigen may be coupled to a C-terminal or other cysteine residue in the antigen or mitogenic polypeptide, respectively, by treatment with N-y-maleimidobutyryloxy-succinimide (Kitagawa and Aikawa (1976) J. Biochem. 79, 233-236). Alternatively, a lysine residue in the mitogenic polypeptide or antigen may be conjugated to a glutamic or aspartic acid residue in the antigen or mitogenic polypeptide, respectively, using isobutylchloroformate (Thorell and De Larson (1978) RADIOI1VEVIUNOASSAY AND RELATED TECHNIQUES: METHODOLOGY AND CLIT1ICAL
APPLICATIONS, p. 288). Other coupling reactions and reagents have been described in the literature.
[0204] The conditions for the in vitro immunization procedure comprise incubating the cells at about 25-37°C, (preferably 37°C ) supplied with about 5-10% C02.
In some embodiments, the incubation is performed with between about 6-9% CO2. In other embodiments the incubation is performed in about 8% C02. The cell density is between about 2.5 to 5 x 106 cells/ml in culture medium. In some embodiments, the culture medium is supplemented with about 2-20% FBS. In other embodiments, the culture medium is supplemented with about 5-15%
FBS. In other embodiments, the culture medium is supplemented with about 7-12%
FBS. In other embodiments, the culture medium is supplemented with about 10% FBS.
[0205] The in vitro stimulation culture medium is supplemented with cytokines to stimulate the cells and increase the immune response. In general IL-2 is supplied in the culture medium.
However, other cytokines and additives may also be included to increase the immune response. Such cytokines and factors may include, for example, IL-4 and anti-antibodies.
[0206] The fusion of myeloma cells with the immunoglobulin-producing cells may be by any method known in the art for the creation of hybridoma cells. These methods include, but are not limited to; the hybridoma technique of Kohler and Milstein, (1975, Nature 256:495-497;
and U.S. Patent No. 4,376,110) (see also, Brown et al. (1981) J. Immunol.
127:539-546;
Brown et al. (1980) J. Biol. Chem. 255 (11):4980-4983; Yeh et al. (1976) Proc.
Natl. Acad.
Sci. USA 76:2927-2931; and Yeh et al. (1982) Int. J. Cancer 29:269-275), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc.
Natl. Acad. Sci. USA 80:2026-2030), and the EBV-hybridoma technique (Cole et al., 1985, MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96). The hybridoma producing the mAb of this invention may be cultivated in vitro or in vivo.

[0207] The technology for producing monoclonal antibody hybridomas is well-known to those of skill in the art and is described, for example in Kenneth, in MONOCLONAL
ANTIBODIES: A
NEW DIIVVIENSION IN BIOLOGICAL ANALYSES, Plenum Publishing Corp., New York, N.Y.
(1980); Lerner (1981) Yale J. Biol. Med., 54:387-402; Galfre et al. (1977) Nature 266:55052;
and Gefter et al. (1977) Soynatic Cell Genet. 3:231-236). However, many variations of such methods are possible and would be appreciated by one of skill in the art.
Thus, the techniques for generation of hybridomas is not limited to the disclosures of these references.
[0208] Any myeloma cell may be used in the method of the invention.
Preferably, the myeloma cells are human cells, but the invention is not limited thereto or thereby. In some embodiments, the cells are sensitive to medium containing hypoxanthine, aminopterin, an thymidine (HAT medium). In some embodiments, the myeloma cells do not express iimnunoglobulin genes. In some embodiments the myeloma cells are negative for Epstein-Barr virus (EBV) infection. In preferred embodiments, the myeloma cells are HAT-sensitive, EBV negative and Ig expression negative. Any suitable myeloma may be used. An example of such a myeloma is that described in U.S. Patent No. 4,720,459 to Winkelhake, and deposited with the American Type Culture Collection (ATCC) as CRL 8644. Marine hybridomas may be generated using mouse myeloma cell lines (e.g., the P3-NSl/1-Ag4-1, P3-x63-Ag8.653 or Sp2/O-Agl4 myeloma lines). These marine myeloma lines are available from the ATCC.
[0209] In some embodiments of the method of the invention, the hybridoma cells and/or mammalian expression cells may be rendered hypermutable by the introduction of a dominant negative allele of a mismatch repair gene. The dominant negative allele of the mismatch repair gene may be introduced into the hybridoma cell (i.e., after the fusion of immunoglobulin-producing cells with the myeloma cells) or may be introduced into the myeloma cell prior to the fusions. The invention, therefore, also provides hypermutable myeloma cells for use in the generation of hybridoma cells. The dominant negative allele may also be introduced into the mammalian expression cells.
[0210] The dominant negative allele of the mismatch repair gene is in the form of a polynucleotide which may be in the form of genomic DNA, cDNA, RNA, or a chemically synthesized polynucleotide. The polynucleotide can be cloned into an expression vector containing a constitutively active promoter segment (such as, but not limited to, CMV, SV40, EF-1 Dor LTR sequences) or to inducible promoter sequences such as those from tetracycline, or ecdysone/glucocorticoid inducible vectors, where the expression of the dominant negative mismatch repair gene can be regulated. The polynucleotide can be introduced into the cell by transfection.
[0211] Transfection is any process whereby a polynucleotide is introduced into a cell. The process of transfection can be carried out izz vitz~o, e.g., using a suspension of one or more isolated cells in culture. The cell can be any immortalized cell used for creating hybridomas for the production of monoclonal antibodies, or the cell may be the hybridoma itself. The hybridomas may be heterohybridoma cells (e.g. human-mouse cell fusions) or homohybridoma cells (e.g., human-human hybridoma cells and mouse-mouse hybridoma cells).
[0212] In general, transfection will be carried out using a suspension of cells, or a single cell, but other methods can also be applied as long as a sufficient fraction of the treated cells or tissue incorporates the polynucleotide so as to allow transfected cells to be grown and utilized.
The protein product of the polynucleotide may be transiently or stably expressed in the cell.
Techniques for transfection are well known. Available techniques for introducing polynucleotides include but are not limited to electroporation, transduction, cell fusion, the use of calcium chloride, and packaging of the polynucleotide together with lipid for fusion with the cells of interest. Once a cell has been transfected with the mismatch repair gene, the cell can be grown and reproduced in culture. If the transfection is stable, such that the gene is expressed at a consistent level for many cell generations, then a cell line results.
[0213] The dominant negative allele of the mismatch repair gene may be derived from any known mismatch repair gene including, but not limited to PMS2, PMSl, PMSR3, PMSR2, PMSR6, MLHl, GTBP, MSH3, MSH~, MLH3, or MSHl, and homologs of PMSR genes as described in Nicolaides et al. (1995) Genoznics 30:195-206 and Horii et al.
(1994) Biochezn.
Biophys. Res. Coznmun. 204:1257-1264 and the like. "Dominant negative alleles"
as used herein, refers to the ability of the allele to confer a hypermutable status to the cell expressing the allele. Any allele which produces such effect can be used in this invention. The dominant negative alleles of a mismatch repair gene can be obtained from the cells of humans, animals, yeast, bacteria, or other organisms. Dominant negative alleles of mismatch repair genes that are suitable for use in the invention have certain functional characteristics associated with structural features. A non-limiting example of a dominant negative mismatch repair gene is the PMS2 truncation mutant, PMS2-134. This gene contains a mutation which truncates the PMS2 protein after amino acid 133. The lack of the C-terminus in the PMS2 protein is believed to interfere with the binding of PMS2 with Screening cells for defective mismatch repair activity can identify such alleles. Cells from animals or humans with cancer can be screened for defective mismatch repair. Cells from colon cancer patients may be particularly useful. Genomic DNA, cDNA, or mRNA from any cell encoding a mismatch repair protein can be analyzed for variations from the wild type sequence. Dominant negative alleles of a mismatch repair gene can also be created artificially, for example, by producing variants of the hPMS2-134 allele or other mismatch repair genes. Various techniques of site-directed mutagenesis can be used. The suitability of such alleles, whether natural or artificial, for use in generating hypermutable cells or animals can be evaluated by testing the mismatch repair activity caused by the allele in the presence of one or more wild-type alleles, to determine if it is a dominant negative allele.
[0214] Dominant negative alleles of such genes, when introduced into cells or transgenic animals, increase the rate of spontaneous mutations by reducing the effectiveness of DNA
repair and thereby render the cells or animals hypermutable. This means that the spontaneous mutation rate of such cells or aumals is elevated compared to cells or animals without such alleles. The degree of elevation of the spontaneous mutation rate can be at least 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 200-fold, 500-fold, or 1000-fold that of the normal cell or animal. The hypermutable hybridoma cells will accumulate new mutations in genes) to produce new output traits within the hybridoma. The hybridoma cells can be screened for desired characteristics and cell lines bearing these characteristics may be expanded.
Furthermore, the hybridoma cells may be "cured" of the mismatch repair defect by eliminating the dominant negative mismatch repair gene in the cell or by turning of its expression, leading to stable biological products consisting of altered genes, RNAs, or polypeptides.
[0215] The dominant negative alleles of the mismatch repair gene may be introduced as part of a vector. The polynucleotide encoding the dominant negative mismatch repair protein allele may be operably linked to a promoter that functions in the cell to drive expression of the dominant negative allele of the mismatch repair gene. Other elements of the vector may include an origin of replication, one or more selectable markers, such as a drug resistance gene that allows the cells to grow in the presence of a growth inhibitory compound.
[0216] In embodiments of the invention that utilize myeloma cells or donor immunoglobulin-producing cells that axe naturally deficient in mismatch repair, the invention may further comprise the step of restoring genetic stability of the hybridoma by introducing a wild-type mismatch repair gene into the cell to complement the deficiency and restore genetic stability.
[0217] Another aspect of the invention is the use of cells lacking MMR (either due to defects in endogenous mismatch repair genes, or due to the introduction of a dominant negative MMR
gene) and chemical mutagens to cause an enhanced rate of mutations in a host's genome. The lack of MMR activity has been known to make cells more resistant to the toxic effects of DNA
damaging agents. This invention comprises making proficient MMR cells mismatch repair defective via the expression of a dominant negative MMR gene allele and then enhancing the genomic hypermutability with the use of a DNA mutagen. Chemical mutagens are classifiable by chemical properties, e.g., alkylating agents, cross-linking agents, etc.
The following chemical mutagens are useful, as axe others not listed here, according to the invention and may be used to further enhance the rate of mutation in any of the embodiments of the method of the invention: N-ethyl-N-nitrosourea (ENLI), N-meth 1-N-nitrosourea y (MNU), procarbazine hydrochloride, chlorambucil, cyclophosphamide, methyl methanesulfonate (MMS), ethyl methanesulfonate (EMS), diethyl sulfate, acrylamide monomer, triethylene melamin (TEM), melphalan, nitrogen mustard, vincristine, dimethylnitrosamine, N-methyl-N'-nitro-nitrosoguanidine (MNNG), 7,12 dimethylbenz (a) anthracene (DMBA), ethylene oxide, hexamethylphosphoramide, bisulfan. In a preferred aspect of the invention, a mutagenesis technique is employed that confers a mutation rate in the range of 1 mutation out of every 100 genes; 1 mutation per 1,000 genes. The use of such combination (MMR deficiency and chemical mutagens will allow for the generation of a wide array of genome alterations (such as but not limited to expansions or deletions of DNA segments within the context of a gene's coding region, a gene's intronic regions, or 5'or 3' proximal and/or distal regions, point mutations, altered repetitive sequences) that are preferentially induced by each particular agent.
[0218] Mutations can be detected by analyzing for alterations in the genotype of the cells or animals, for example by examining the sequence of genomic DNA, cDNA, messenger RNA, or amino acids associated with the gene of interest. Mutations can also be detected by screening the phenotype of the gene. An altered phenotype can be detected by identifying alterations in electrophoretic mobility, spectroscopic properties, or other physical or structural characteristics of a protein encoded by a mutant gene. One can also screen for altered function of the protein ih situ, in isolated form, or in model systems. One can screen for alteration of any property of the cell or animal associated with the function of the gene of interest, such as but not limited to measuring protein secretion, chemical-resistance, pathogen resistance, etc.
[0219] In some embodiments of the method of the invention, inducible vectors that control the expression of a dominant negative and normally functioning MMR gene are used.
This strategy restores DNA stability once a host cell or organism exhibiting a new output trait, altered gene, RNA or polypeptide has been generated via trait selection with or without the combination of chemical mutagens to establish a genetically stable version of this cell or organism. In the case of MMR defective cells as a result of ectopically expressing a dominant negative MMR gene allele, the MMR activity is decreased or completely eliminated by removing the inducer molecule from the cell culture or organism's environment.
In addition, the expression of a dominant negative MMR gene can be suppressed by knocking out the MMR gene allele using methods that are standard to those skilled in the art of DNA knockout technology in germ or somatic cells (Waldman et al. (1995) Cancer Res. 55:5187-5190).
[0220] The chiral position of the side chains of the anthracenes is not particularly limited and may be any chiral position and any chiral analog. The anthracenes may also comprise a stereoisomeric form of the anthracenes and include any isomeric analog.
[0221] Examples of hosts are but not limited to cells or whole organisms from human, primate, mammal, rodent, plant, fish, reptiles, amphibians, insects, fungi, yeast or microbes of prokaryotic origin.
[0222] A more detailed disclosure of particular embodiments of the invention follows in the specific examples, however, the invention is not limited thereto or thereby.
EXAMPLES
Example 1: Generation of Hybridomas Secreting Human Monoclonal Antibodies to Tetanus Toxin (TT) A. Generation and Assaying of TT-specific B lymphocytes [0223] Isolation of lymphocytes from Donor. Lymphocytes were isolated from whole blood by centrifugation through Ficoll-Paque according to the manufacturer's instructions. Isolated lymphocytes were incubated with 0.25mM Leu-Leu methyl ester hydrobromide (LLOMe) prepared in RPMI 1640 medium containing 2% fetal bovine serum (FBS) for 15 minutes at room temperature. The cells were then washed three times with culture medium.
[0224] Ih vitro stimulation of isolated lymphocytes. The cells were incubated at 37°C in a incubator, supplied with 8% C02, at a density between 2.5 to 5 x 106 cells/ml in culture medium supplemented with 10% FBS and TT and IL-2 at various concentrations.
After four days of culture, the cells were washed four times with medium and the culture was continued for additional eight days.
[0225] Measurement of the B cell response. Lymphocyte culture supernatants were collected on day 12 of the culture and tested in an ELISA for the presence of anti-TT
antibodies. Briefly, TT or BSA at 0.5 wg/ml in 0.05 M carbonate-bicarbonate buffer was immobilized onto an EIA plate. After blocking with 1 % bovine serum albumin (BSA) in PBS
containing 0.05% Tween 20, the supernatant was added to the wells. Antibodies bound to TT

were detected with peroxidase-labeled goat anti-human IgG or anti-human IgM.
TMB was used for color development. The plate was read using a Microplate reader with a 450 rim filter. A supernatant sample that had antibody bound to TT, but not to BSA, and in which the signal was two times the assay background was considered positive. The positive cells were pooled, and used for hybridoma production (Fig. 1).
[0226] Notably, peripheral blood mononuclear cells (PBMCs) from some donors contain a fraction of B cells that secret TT-specific antibodies in culture. This is due to the fact that about 90% of the population in the United States has been vaccinated against TT. Such sera also has a titer of higher than 1000 (Fig. 2). However, the percentage of positive events is greatly increased when PBMCs are immunized iya vitro with TT (Fig. 3). The intensity of the PBMC response is also enhanced with the stimulation of TT alone or in combination with IL-2 or CD40L (Fig. 4): Similar effects were observed with other antigens (data not shown).
[0227] Generation of hybridomas secreting human antibodies. To prepare activated lymphocytes, cells were pooled and cultured in T flasks at 0.5 -1 x 106 cells/ml in culture medium supplemented with 10% FBS one day prior to the fusion. To prepare the fusion partner, mouse myeloma NSO cells were transfected with human PMS2-134 expression vector as described in Nicolaides et al. (1998) Mol. Cell. Biol. 18(3):1635-1641. The cells were cultured in RPMI 1640 supplemented with 10% FBS and 2 mM glutamine (Complete Medium) and the culture was kept in log phase.
[0228] Next, lymphocytes were harvested and counted. An equal number of myeloma cells was harvested. Both types of cells were combined and washed three times with medium. Polyethylene glycol (PEG) was added dropwise to the loosened cell pellet, and the PEG was subsequently diluted out slowly with 25 ml of RPMI medium in a course of 2.5 minutes. After diluting out the PEG, fused cells were suspended in Complete Medium supplemented with HAT and 20% FBS, and seeded onto 96-well plates.
[0229] Screening and characterization of antigen-specific hybridoma clones.
When the hybridoma cells grew to semi-confluence, supernatants were collected and subjected to an ELISA for antigen-specific reactivity. As an example, hybridomas derived from TT-immunized lymphocytes were tested. Briefly, TT or BSA at 0.5 uglml in 0.05 M
carbonate-bicarbonate buffer was immobilized onto the EIA plate. After blocking with 1%
bovine serum albumen in PBS containing 0.05% Tween 20, the cell culture supernate was added to the wells. Antibodies bound to TT were detected with peroxidase-labeled goat anti-human IgG or anti-human IgM. TMB was used for color development. The plate was read in the Microplate reader with a 450 nm filter. A cell clone that showed reactivity to TT but not to BSA was considered positive (Fig. S). Positive clones were expanded and subcloned by limiting dilution to generate monoclonal cells.
Example 2: Generation of hybridomas secreting human monoclonal antibodies to epidermal growth factor receptor (EGFR) (self antigen) A. Generation of EGFR-specific B lymphocytes [0230] Preparation of Antigen. Human epidermal growth factor receptor (EGFR), purified from A431 cells, was purchased from Sigma. Previous studies found that immune responses to this antigen were very weak, most likely due to tolerance. In order to enhance immunization, we conjugated the EGFR to tetanus toxin C (EGFR-TT) and the conjugate was used as immunogen for iya vitro immunization in order to overcome any immunotolerance.
[0231] Preparation of EGFR-TT conjugate. 100 ug of purified EGFR was reconstituted in 100 ul of sterile MilliQ-grade water. 1 mg of purified, lyophilized recombinant tetanus toxin C fragment (TT-C) was dissolved in sterile MilliQ-grade water to yield a 2 mg/ml TT-C
solution. Crosslinking was performed in 50 mM sodium carbonate buffer pH 9.0 at equimolar ratios of EGFR to TT-C, using glutaraldehyde at a final concentration of 0.5%
for 3 hours at room temperature, followed by 4°C ovenught. Glutaraldehyde was quenched by addition of a fresh 100 mg/ml solution of sodium borohydride in 50 mM sodium carbonate pH
9.0, under open atmosphere for 1 hour at 4°C. Crosslinked products were dialyzed against Ca2+-, Mg2-~--free phosphate-buffered saline overnight at 4°C, using 3.SK 1VIWC0 Slide-A-Lyzer cassettes.
The reaction was monitored by Western blotting, using commercial anti-EGFR
(mAb-15) and anti-TT-C (Roche) monoclonal antibodies. By this method, greater than 70% of the components are crosslinked, and appear as immunoreactive species of greater MW
than the starting material (data not shown).
[0232] hZ vitro stimulation of peripheral blood mononuclear cells (PBMC).
LLOMe-pretreated PBMC were incubated at a density of 3 x 106 cells/ml in culture medium supplemented with 10% FBS and a stimuli mixture. The stimuli mixture was composed of EGFR-TT at a concentration of 50 ng/ml with or without recombinant human IL-2 at 20 IU, mouse anti-human CD40 antibody as CD40L at 0.5 ug/ml (used to enhance IgG
class switching). After four days of culture, the cells were re-fed with complete medium, in the absence of added stimulus, every three or four days. Culture supernatants were collected on days 12-18 and tested for EGFR-specific antibodies.
[0233] Detection of EGFR-specific antibody response. The PBMC response to the stimulation was examined in a EGFR-specific ELISA. Briefly, EGFR, TT, or BSA
at 0.5 ug/ml in 0.05 M carbonate-bicarbonate buffer, pH 9.6, was immobilized onto EIA
plates.

After blocking the plates with 5% non-fat dry milk in PBS containing 0.05%
Tween 20, the supernatant was added to the wells. Antibodies from the supernatant bound to immobilized antigens were detected with peroxidase-labeled goat anti-human IgG+IgM (H+L).
TMB
substrate kit was used for color development. The plates were read in a Microplate reader with a 450 run filter. A supernatant sample containing antibody that bound to EGFR, but not to TT and BSA, was considered positive. A robust response was observed in cultures immunized to the EGFR-TT as compared to controls. While anti-EGFR responses were observed in PBMCs for a small fraction of donors, the percentage of positive clones was greatly increased when PBMCs were immunized in vitro with EGFR complexed with TT (Fig.
6). Positive cells were pooled and used for hybridoma production.
[0234] Generation of Hybridomas. To prepare activated lymphocytes, cells were pooled and cultured in T flasks at 0.5 -1 x 10~ cells/ml in culture medium supplemented with 10% FBS
one day prior to the fusion. To prepare the fusion partner, mouse myeloma NSO
cells were transfected with human PMS2-134 expression vector as described in Nicolaides et al. (1995) Mol. Cell. Biol. l~(3):1635-1641. The cells were cultured in RPMI 1640 supplemented with 10% FBS and 2 mM glutamine (Complete Medium) and the culture was kept in log phase.
[0235] Screening and characterization of antigen-specific hybridoma clones.
When the hybridoma cells grew to semi-confluence, supernatants were collected and subjected to an ELISA for antigen-specific reactivity. As an example, hybridomas derived from EGFR-immunized lymphocytes were tested. Briefly, EGFR, TT TNFRl or BSA at 0.5 ug/ml in 0.05 M carbonate-bicarbonate buffer was immobilized onto the EIA plate. After blocking with 1 bovine serum albumen in PBS containing 0.05% Tween 20, the cell culture supernate was added to the wells. Antibodies bound were detected with peroxidase-labeled goat anti-human IgG or anti-human IgM. TMB was used for color development. Normal human IgG
(nhIgG) and IgM (nhIgM) were used as controls. The plate was read in the Microplate reader with a 450 nm filter. A cell clone that showed reactivity to EGFR, but not to BSA was considered positive (Fig. 7).
Example 3 A. Isolation of PBMC from whole blood (0236] Approximately 200m1 of whole blood mixed with 200m1 PBS-- was centrifuged through Ficoll-Paque at 2000rpm for 30min. Serum was aspirated, the interface layer containing lymphocytes was collected and diluted 1:3 with PBS-~- and centrifuged at 2000 rpm for l Omin. The supernatant fluid was aspirated and the pellet was resuspended in 10 ml PBS-~-. The cell suspension was split into two 50 ml conical tubes and PBS--was added to each tube to adjust the volume to 35 ml each. The tubes were centrifuged at 800 rpm for 7 minutes to remove the platelets. After aspirating the supernatant fluid, the pellet was resuspended in 10 ml ACK Lysing Buffer and incubated for 5 minutes at room temperature.
Following lysis, 35 ml PBS-- was added to the tubes and the tubes were centrifuged at 1000 rpm for 7 minutes. The cells were then washed with 45 ml RPMI medium.
B. Preparation of Dendritic Cells [0237] Cells were centrifuged at 1000 rpm for 7 minutes and resuspended at 1 x 10$ cells per 40 ml cRPMI for a density of 2.5 x 106 cells/ml. The cells were incubated at 37°C/8% COa for 2 hours. Non-adherent cells were removed for further treatment (see Step C), and the adherent cells were carefully rinsed twice with PBS--. Adherent cells were cultured in cRPMI
supplemented with 400 IU/ml IL-4 and 50 ng/ml GM-CSF.
C. LLOMe treatment and cryopreservation of non-adherent culture [0238] The non-adherent cell culture was centrifuged at 1000 rpm for 7 minutes. The supernatant fluid was aspirated and the pellet was resuspended in 10 ml RPMI
supplemented with 2% FBS and freshly thawed 85 ~g/ml LLOMe. The cells were incubated for 15 minutes at room temperature. The cells were washed twice with cRPMI and resuspended in 45 ml cRPMI. The cells were transferred to an upright T25 flask at a density of 5 x 106 cells/ml in cRPMI supplemented with 2 ~g/ml PHA and incubated at 37°C/8% C02 for 24 hours. The non-adherent cells were harvested, centrifuged at 1000 rpm for 7 minutes, and the cell pellet was resuspended in 5 ml cold cRPMI/5%DMSO. The tubes containing the cells were wrapped in paper towels and stored at -80°C until needed.
D. Tumor Immunization [0239] On day 6 of the procedure for isolation of dendritic cells, tumor cells were thawed in 2.5 ml pre-waxmed medium at 37°C. The flask of dendritic cells was rinsed twice with 10 ml PBS--. The dendritic cells were incubated with gentle rocking in 5 ml Cell Dissociation Buffer (Invitrogen Cat. No. 13151-014), and the solution was collected (scraping the remaining cells from the flask. The flask was rinsed with 10 ml cRPMI and the medium was collected. The cells were centrifuged at 1000 rpm for 7 minutes and the pellet was resuspended at 4 x 106 cells/ml cRPMI. Cells were distributed in a culture plate at a density of 1 x 106 cells/well. A tumor sample was chopped into fine pieces of approximately 1-3 mm3.

An aliquot of the tumor suspension was transferred to all but 1 well, titrating the amount of tumor per well. An aliquot of 0.25 ml cRPMI was added to the control well. The total volume in the wells was O.SmI/well. The dendritic cells and tumor cells were co-cultured at 37°C/8%
C02 for 24 hours.
E. Co-culture of PBMC with DC
[0240] Frozen PBMC were thawed by adding 40 ml cRPMI/30 ILJ/ml IL-2/600 IU/ml IL-4/0.75 ~g/ml CD-40L pre-warmed to 50°C to the frozen cells. When thawed, the cells were incubated for 1-2 hours at 37°C. The cells were centrifuged at 1000 rpm for 7 minutes and the pellet was resuspended in 5 ml of a 2X cocktail of cRPMI/ 60 lU/ml IL-2/1200 IU/ml IL-4/1.5~.g/ml CD-40L. The cell suspension was divided among wells in a tissue culture plate at 0.5 ml/well of suspension and diluted with 0.5 ml medium for a final concentration of 30 IU/ml IL-2, 600 IU/ml IL-4, and 0.75 ~g/ml CD-40L. Cells were fed with cRPMI
supplemented with 20 IU/ml IL-2, 400 IU/ml IL-4, 100 IU/ml IL-10, and O.S~,g/ml CD-40L.
F. Fusion [0241] Tumor-immunized PBMCs were then fused with A6 myeloma cells to generate hybridomas. Briefly, lymphocytes were harvested from 75% tumor and 100% tumor wells, rinsed with 1 ml RPMI, transfer to conical tubes, and the volume was adjusted to 5 ml with cRPMI. The cells were centrifuged through Ficoll-Paque, and the supernatant fluid was aspirated. Interfaces containing cells from all tubes were combined and the cells were rinsed with cRPMI. The cells were then resuspended in 7.5 ml cRPMI. Viable cells were assessed by trypan blue exclusion. A6 cell viability was also assessed by trypan blue exclusion. A6 cells and tumor-immunized lymphocytes were centrifuged separately at 1200 rpm for lOminutes. The supernatant fluids were aspirated and the cells were washed with lOml DPBS
-'/tube. Each cell line was washed three times with 2 ml cold Mannitol Fusion Medium (1VIF'M) (0.3M Mannitol, 0.18mM MgCla, 0.18mM CaCla, 1mM Hepes) and the cells were combined and resuspended in MFM at a density of 3 x 106 A6 cells and 3 x 106 PBMCs in 200 ~,l for a total of 6 x 106 cells in 200 ql. BTX 450 microslides were sterilized with 65~,L 100%
EtOH and pre-wetted with 65,1 MFM. A 40w1 aliquot of cell suspension was distributed evenly onto a BTX 450-1 microslide. To fuse the cells, the ECM 2001 conditions were set as follows: alignment conditions, 20V for 30 seconds; pulse conditions, 150V for 30 ,seconds (1X); compression conditions, 20V for 9 seconds. After fusion, the cells were transferred to one well of a 24 well plate containing 1 ml phenol red-free cRPMI. The fusion steps were repeated for the remaining cell suspensions, rinsing slide between fasions with 65 ~,L MFM.
The culture plate containing fused cell cultures was incubated overnight at 37°C/8%C02. The fused cells were cloned and assessed by ELISA for IgG and IgM production. The results are shown in Fig. 8.
Example 4: Ih vitro immunization Purified GM-CSF from a commercial source is administered i~z vitro to peripheral blood mononuclear cells (PBMC).
A. Generation and Assaying of GM-CSF-specific B lymphocytes Isolation of lymphocytes from Peripheral Blood.
[0242] Lymphocytes are isolated from whole blood by centrifugation through Ficoll-Paque according to the manufacturer's instructions. Isolated lymphocytes are incubated with 0.25 mM Leu-Leu methyl ester hydrobromide (LLOMe) prepared in ltPMI 1640 medium containing 2% fetal bovine serum (FBS) for 15 minutes at room temperature: The cells are then washed three times with culture medium.
Ih vitro stimulation of isolated lymphocytes.
[0243] The cells are incubated at 37~C in an incubator, supplied with 8% C02, at a density between 2.5 to 5 x 106 cells/ml in culture medium supplemented with 10% FBS
and GM-CSF
and IL-2 at various concentrations. After four days of culture, the cells are washed four times with medium and the culture was continued for additional eight days.
Measurement of the B cell response.
[0244] Lymphocyte culture supernatants are collected on day 12 of the culture and tested in an ELISA for the presence of anti-GM-CSF antibodies. Briefly, GM-CSF or BSA at 0.5 p,g/ml in 0.05 M carbonate-bicarbonate buffer is immobilized onto an EIA plate. After blocking with 1% bovine serum albumin (BSA) in PBS containing 0.05% Tween 20, the supernatant is added to the wells. Antibodies bound to GM-CSF are detected with peroxidase-labeled goat anti-human IgG or anti-human IgM. TMB is used for color development. The plate is read using a Microplate reader with a 450 mn filter. A supernatant sample that had antibody bound to GM-CSF, but not to BSA, and in which the signal was two times the assay background is considered positive. The positive cells are pooled, and used for hybridoma production.
Generation of hybridomas secreting human antibodies.
[0245] To prepare activated lymphocytes, cells are pooled and cultured in T
flasks at 0.5 - 1 x l OG cells/ml in culture medium supplemented with 10% FBS one day prior to the fusion. To prepare the fusion partner, mouse myeloma NSO cells are transfected with human expression vector as described in Nicolaides et al. (1998) Mol. Cell. Biol.
18(3):1635-1641.
The cells are cultured in RPMI 1640 supplemented with 10% FBS and 2 mM
glutamine (Complete Medium) and the culture is kept in log phase.
[0246] Next, lymphocytes are harvested and counted. An equal number of myeloma cells is harvested. Both types of cells are combined and washed three times with RPMI

medium. Polyethylene glycol (PEG) is added dropwise to the loosened cell pellet, and the PEG is subsequently diluted out slowly with 25 ml of RPMI medium in a course of 2.5 minutes. After diluting out the PEG, fused cells are suspended in Complete Medium supplemented with HAT and 20% FBS, and seeded onto 96-well plates.
Screening and characterization of antigen-specific hybridoma clones.
[0247] When the hybridoma cells grew to semi-confluence, supernatants are collected and subjected to an ELISA for antigen-specific reactivity. As an example, hybridomas derived from TT-immunized lymphocytes are tested. Briefly, TT or BSA at 0.5 ug/ml in 0.05 M
carbonate-bicarbonate buffer is immobilized onto the EIA plate. After blocking with 1%
bovine serum albumin in PBS containing 0.05% Tween 20, the cell culture supernate is added to the wells. Antibodies bound to GM-CSF are detected with peroxidase-labeled goat anti-human IgG or anti-human IgM. TMB is used for color development. The plate is read in the Microplate reader with a 450 nm filter. A cell clone that showed reactivity to GM-CSF but not to BSA is considered positive. Positive clones are expanded and subcloned by limiting dilution to generate monoclonal cells.
Example 5: Generation of hybridomas secreting human monoclonal antibodies to GM-CSF-KLH
A. Generation of GM-CSF-specific B lymphocytes Preparation of Antigen.
[0248] Human GM-CSF was purchased from a vendor. In order to enhance immunization, GM-CSF was conjugated to keyhole limpet hemocyanin (KLH) (GM-CSF-KLH) and the conjugate was used as immunogen for in vitro immunization in order to overcome any immunotolerance.
Preparation of GM-CSF-KLH conjugate.
[0249] Purified GM-CSF was reconstituted in sterile MilliQ-grade water to yield a lmg/ml solution. Purified, lyophilized recombinant KLH was dissolved in sterile MilliQ-grade water to yield a 1 mg/ml KLH solution. A 0.2% solution of glutaraldehyde in PBS was prepared.
Crosslinking was performed by combining 25 ul of 1 mg/ml KLH, 25 ul of 1 mg/ml GM-CSF, and 50 ul 0.2% glutaraldehyde in a microcentrifuge tube wrapped in aluminum foil at room temperature, with shaking for 1 hour. Following cross-linking, 25 ul of 1 M
glycine was added to the tube and the solution was incubated an additional 1 hour at room temperature with shaking. Crosslinked products were dialyzed against three changes of 300 ml PBS. The reaction was monitored by Western blotting, using a commercial anti-GM-CSF and anti-KLH
monoclonal antibodies. By this method, greater than 80% of the components are crosslinked, and appeared as immunoreactive species of greater MW than the starting material (data not shown).
hz vitro stimulation of peripheral blood mononuclear cells (PSMC).
[0250] LLOMe-pretreated PBMC were incubated at a density of 3 x 106 cells/ml in culture medium supplemented with 10% FBS and a stimuli mixture. The stimuli mixture was composed of GM-CSF-I~LH at a concentration of 50 ng/ml with or without recombinant human IL-2 at 20 IU, mouse anti-human CD40 antibody as CD40L at 0.5 ug/ml (used to enhance IgG class switching). After four days of culture, the cells were re-fed with complete medium, in the absence of added stimulus, every three or four days. Culture supernatants were collected on days 12-18 and tested for GM-CSF-specific antibodies.
Detection of GM-CSF-specific antibody response.

[0251] The PBMC response to the stimulation was examined in a GM-CSF-specific ELISA.
Briefly, GM-CSF, KLH, or chick ovalbumin (CAB) at 0.5 ug/ml in 0.05 M
carbonate-bicarbonate buffer, pH 9.6, was immobilized onto EIA plates. After blocking the plates with 1% BSA containing 0.05% Tween 20, the supernatant were added to the wells.
Antibodies from the supernatant bound to immobilized antigens were detected with peroxidase-labeled goat anti-human IgG+IgM (H+L). TMB substrate kit was used for color development. The plates were read in a Microplate reader with a 450 nm filter. A supernatant sample containing antibody that bound to GM-CSF, but not to KLH and CAB, was considered positive. There was a robust response observed in cultures immunized to the GM-CSF-KLH as compared to controls. While anti-GM-CSF responses were observed in PBMCs for a small fraction of donors, the percentage of positive clones was greatly increased when PBMC were immunized in vitro with GM-CSF complexed with KLH. Positive cells were pooled and used for hybridoma production.
Generation of Hybridomas.
[0252] To prepare activated lymphocytes, cells were pooled and cultured in T
flasks at 0.5 -1 x 106 cells/ml in culture medium supplemented with 10% FBS one day prior to the fusion. To prepare the fixsion partner, mouse myeloma NSO cells were transfected with human PMS2-134 expression vector as described in Nicolaides et al. (1998) Mol. Cell. Biol.
18(3):1635-1641.
The cells were cultured in RPMI 1640 supplemented with 10% FBS and 2 mM
glutamine (Complete Medium) and the culture was kept in log phase.
Screening and characterization of antigen-specific hybridoma clones.
[0253] When the hybridoma cells grew to semi-confluence, supernatants were collected and subjected to an ELISA for antigen-specific reactivity. As an example, hybridomas derived from GM-CSF-immunized lymphocytes were tested. Briefly, GM-CSF, KLH, or CAB at 0.5 ug/ml in 0.05 M carbonate-bicarbonate buffer was immobilized onto the EIA
plate. After blocking with 1% bovine serum albumin in PBS containing 0.05% Tween 20, the cell culture supernate was added to the wells. Antibodies bound were detected with peroxidase-labeled goat anti-human IgG or anti-human IgM. TMB was used for color development.
Normal human IgG (nhIgG) and IgM (nhIgM) were used as controls. The plate is read in the Microplate reader with a 450 nm filter. A cell clone that showed reactivity to GM-CSF, but not to CAB was considered positive. The results are shown in Fig. 9.
Example 6 Inhibition of Proliferation Assays [0254] TF-1 cells were seeded at 0.2 x 106/ml in RPMI supplemented with 10%
FBS and 0.5 ng/ml recombinant human GM-CSF. TF-1 cells were serum starved for 24 hours in medium containing 0.5% BSA, without rhGM-CSF. Cells were then cultured in the presence of 0.275ng/ml of GM-CSF for 3 days, with or without 4 ug/ml of various antibodies. Cell proliferation was measured using the ATPLite assay (Perkin Eliner). In this assay, ATP was released by lysis of viable cells and utilized by the enzyme luciferase to convert luciferin into oxyluciferin. Light was emitted (luminescence) as a result of the reaction, and the intensity of the emission was ultimately proportional to the ATP content and thus to the cell number.
Counts per second (CPS) were obtained by reading the reactions with a luminometer and the percentage of inhibition was calculated according to the formula: 100 - (CPS
no Ab : CPS
with Ab) x 100%. The results are shown in Fig. 10.
[0255] The foregoing examples are merely illustrative of the invention and are not to be construed to limit the scope of the invention in any way. The scope of the invention is defined by the appended claims.

MOR0252.ST25.txt SEQUENCE LISTING
<110> Morphotek Inc.
Grasso, Luigi Liang, Shaohong Nicolaides, Nicholas C.
Sass, Philip M.
<120> METHODS OF GENERATING HIGH-PRODUCTION OF ANTIBODIES FROM
HYBRIDOMAS CREATED BY IN VITRO IMMUNIZATION
<130> MOR-0252 <150> US 60/427,165 <151> 2002-11-15 <150> US 60/501,650 <151> 2003-09-10 <160> 50 <170> Patent2n version 3.2 <210> 1 <211> 3063 <212> DNA
<213> Homo sapiens <400> 1 ggcacgagtg gctgcttgcggctagtggatggtaattgcctgcctcgcgctagcagcaag60 ctgctctgtt aaaagcgaaaatgaaacaattgcctgcggcaacagttcgactcctttcaa120 F' ..
gttctcagat catcacttcggtggtcagtgttgtaaaagagcttattgaaaactccttgg180 atgctggtgc cacaagcgtagatgttaaactggagaactatggatttgataaaattgagg240 tgcgagataa cggggagggtatcaaggctgttgatgcacctgtaatggcaatgaagtact300 acacctcaaa aataaatagtcatgaagatcttgaaaatttgacaacttacggttttcgtg360 gagaagcctt ggggtcaatttgttgtatagctgaggttttaattacaacaagaacggctg420 ctgataattt tagcacccagtatgttttagatggcagtggccacatactttctcagaaac480 cttcacatct tggtcaaggtacaactgtaactgctttaagattatttaagaatctacctg540 taagaaagca gttttactcaactgcaaaaaaatgtaaagatgaaataaaaaagatccaag600 atctcctcat gagctttggtatccttaaacctgacttaaggattgtctttgtacataaca660 aggcagttat ttggcagaaaagcagagtatcagatcacaagatggctctcatgtcagttc720 tggggactgc tgttatgaacaatatggaatcctttcagtaccactctgaagaatctcaga780 tttatctcag tggatttcttccaaagtgtgatgcagaccactctttcactagtctttcaa840 caccagaaagaagtttcatcttcataaacagtcgaccagtacatcaaaaagatatcttaa900 agttaatccgacatcattacaatctgaaatgcctaaaggaatctactcgtttgtatcctg960 ttttctttctgaaaatcgatgttcctacagctgatgttgatgtaaatttaacaccagata1020 aaagccaagtattattacaaaataaggaatctgttttaattgctcttgaaaatctgatga1080 cgacttgttatggaccattacctagtacaaattcttatgaaaataataaaacagatgttt1140 ccgcagctgacatcgttcttagtaaaacagcagaaacagatgtgctttttaataaagtgg1200 aatcatctggaaagaattattcaaatgttgatacttcagtcattccattccaaaatgata1260 Page MOR0252.ST25.txt tgcataatgatgaatctggaaaaaacactgatgattgtttaaatcaccagataagtattg1320 gtgactttggttatggtcattgtagtagtgaaatttctaacattgataaaaacactaaga1380 atgcatttcaggacatttcaatgagtaatgtatcatgggagaactctcagacggaatata1440 gtaaaacttgttttataagttccgttaagcacacccagtcagaaaatggcaataaagacc1500 atatagatgagagtggggaaaatgaggaagaagcaggtcttgaaaactcttcggaaattt1560 ctgcagatgagtggagcaggggaaatatacttaaaaattcagtgggagagaatattgaac1620 ctgtgaaaattttagtgcctgaaaaaagtttaccatgtaaagtaagtaataataattatc1680 tl caatccctgaacaaatgaatcttaatgaagattcatgtaacaaaaaatcaaatgtaatag1740 ataataaatctggaaaagttacagcttatgatttacttagcaatcgagtaatcaagaaac1800 ccatgtcagcaagtgctctttttgttcaagatcatcgtcctcagtttctcatagaaaatc1860 ctaagactagtttagaggatgcaacactacaaattgaagaactgtggaagacattgagtg1920 aagaggaaaaactgaaatatgaagagaaggctactaaagacttggaacgatacaatagtc1980 aaatgaagagagccattgaacaggagtcacaaatgtcactaaaagatggcagaaaaaaga2040 taaaacccaccagcgcatggaatttggcccagaagcacaagttaaaaacctcattatcta2100 atcaaccaaaacttgatgaactccttcagtcccaaattgaaaaaagaaggagtcaaaata2160 ttaaaatggtacagatccccttttctatgaaaaacttaaaaataaattttaagaaacaaa2220 acaaagttgacttagaagagaaggatgaaccttgcttgatccacaatctcaggtttcctg2280 atgcatggctaatgacatccaaaacagaggtaatgttattaaatccatatagagtagaag2340 aagccctgctatttaaaagacttcttgagaatcataaacttcctgcagagccactggaaa2400 agccaattatgttaacagagagtctttttaatggatctcattatttagacgttttatata2460 aaatgacagcagatgaccaaagatacagtggatcaacttacctgtctgatcctcgtctta2520 cagcgaatggtttcaagataaaattgataccaggagtttcaattactgaaaattacttgg2580 aaatagaaggaatggctaattgtctcccattctatggagtagcagatttaaaagaaattc2640 ttaatgctatattaaacagaaatgcaaaggaagtttatgaatgtagacctcgcaaagtga2700 taagttatttagagggagaagcagtgcgtctatccagacaattacccatgtacttatcaa2760 aagaggacatccaagacattatctacagaatgaagcaccagtttggaaatgaaattaaag2820 agtgtgttcatggtcgcccattttttcatcatttaacctatcttccagaaactacatgat2880 taaatatgtt taagaagatt agttaccatt gaaattggtt ctgtcataaa acagcatgag 2940 tctggtttta aattatcttt gtattatgtg tcacatggtt attttttaaa tgaggattca 3000 ctgacttgtt tttatattga aaaaagttcc acgtattgta gaaaacgtaa ataaactaat 3060 aac 3063 <210> 2 <211> 932 <212> PRT
<213> Homo Sapiens <400> 2 MOR0252.ST25.txt Met Lys Gln Leu Pro Ala Ala Thr Val Arg Leu Leu Ser Ser Ser Gln Tle Ile Thr Ser Val Val Ser Val Val Lys G1u Leu Ile Glu Asn Ser Leu Asp Ala Gly Ala Thr Ser Val Asp Val Lys Leu Glu Asn Tyr Gly Phe Asp Lys Ile Glu Val Arg Asp Asn Gly G1u Gly Ile Lys Ala Val Asp Ala Pro Val Met Ala Met Lys Tyr Tyr Thr Ser Lys Ile Asn Ser His Glu Asp Leu Glu Asn Leu Thr Thr Tyr Gly Phe Arg Gly Glu A1a Leu Gly Ser Tle Cys Cys Ile Ala Glu Val Leu Ile Thr Thr Arg Thr Ala Ala Asp Asn Phe Ser Thr Gln Tyr Val Leu Asp Gly Ser Gly His Ile Leu Ser Gln Lys Pro Ser His Leu Gly Gln Gly Thr Thr Val Thr A1a Leu Arg Leu Phe Lys Asn Leu Pro Val Arg Lys Gln Phe Tyr Ser Thr Ala Lys Lys Cys Lys Asp Glu Ile Lys Lys Ile Gln Asp Leu Leu Met Ser Phe Gly Ile Leu Lys Pro Asp Leu Arg Ile Val Phe Val His Asn Lys Ala Val Ile Trp Gln Lys Ser Arg Val Ser Asp His Lys Met Ala Leu Met Ser Val Leu Gly Thr Ala Val Met Asn Asn Met Glu Ser Phe Gln Tyr His Ser Glu Glu Ser Gln Ile Tyr Leu Ser Gly Phe Leu Pro Lys Cys Asp Ala Asp His Ser Phe Thr Ser Leu Ser Thr Pro Glu Arg Ser Phe Ile Phe Ile Asn Ser Arg Pro Val His Gln Lys Asp Ile Leu Lys Leu Ile Arg His His Tyr Asn Leu Lys Cys Leu Lys Glu Ser MOR0252.ST25.txt Thr Arg Leu Tyr Pro Val Phe Phe Leu Lys Ile Asp Val Pro Thr Ala Asp Val Asp Val Asn Leu Thr Pro Asp Lys Ser Gln Val Leu Leu Gln Asn Lys Glu Ser Val Leu Ile Ala Leu Glu Asn Leu Met Thr Thr Cys Tyr Gly Pro Leu Pro Ser Thr Asn Ser Tyr Glu Asn Asn Lys Thr Asp Val Ser Ala Ala Asp Ile Val Leu 5er Lys Thr Ala Glu Thr Asp Val Leu Phe Asn Lys Val Glu Ser Ser Gly Lys Asn Tyr Ser Asn Val Asp Thr Ser Val Ile Pro Phe Gln Asn Asp Met His Asn Asp Glu Ser Gly Lys Asn Thr Asp Asp Cys Leu Asn His Gln Ile Ser Tle Gly Asp Phe Gly Tyr Gly His Cys Ser Ser Glu Ile Ser Asn I1e Asp Lys Asn Thr Lys Asn Ala Phe Gln Asp Ile Ser Met Ser Asn Val Ser Trp Glu Asn Ser Gln Thr Glu Tyr Ser Lys Thr Cys Phe Ile Ser Ser Val Lys His Thr Gln Ser Glu Asn Gly Asn Lys Asp His Ile Asp G1u Ser Gly Glu Asn Glu Glu Glu Ala Gly Leu Glu Asn Ser Ser Glu 21e Ser Ala Asp 485 ~ 490 495 Glu Trp Ser Arg Gly Asn Ile Leu Lys Asn Ser Val Gly Glu Asn Ile Glu Pro Val Lys Ile Leu Val Pro Glu Lys Ser Leu Pro Cys Lys Val Ser Asn Asn Asn Tyr Pro Ile Pro Glu Gln Met Asn Leu Asn Glu Asp Ser Cys Asn Lys Lys Ser Asn Val Ile Asp Asn Lys Ser Gly Lys Val MOR0252.ST25.txt Thr Ala Tyr Asp Leu Leu Ser Asn Arg Val Ile Lys Lys Pro Met Ser Ala Ser Ala Leu Phe Val Gln Asp His Arg Pro Gln Phe Leu Ile Glu Asn Pro Lys Thr Ser Leu Glu Asp Ala Thr Leu Gln Ile Glu Glu Leu Trp Lys Thr Leu Ser Glu Glu Glu Lys Leu Lys Tyr Glu Glu Lys Ala Thr Lys Asp Leu Glu Arg Tyr Asn Ser Gln Met Lys Arg Ala Ile Glu Gln Glu Ser Gln Met Ser Leu Lys Asp Gly Arg Lys Lys Ile Lys Pro Thr Ser Ala Trp Asn Leu Ala Gln Lys His Lys Leu Lys Thr Ser Leu Ser Asn Gln Pro Lys Leu Asp Glu Leu Leu Gln Ser Gln Ile Glu Lys Arg Arg Ser Gln Asn Ile Lys Met Val Gln Ile Pro Phe Ser Met Lys Asn Leu Lys Ile Asn Phe Lys Lys Gln Asn Lys Val Asp Leu Glu Glu Lys Asp Glu Pro Cys Leu Ile His Asn Leu Arg Phe Pro Asp Ala Trp Leu Met Thr Ser Lys Thr Glu Val Met Leu Leu Asn Pro Tyr Arg Val Glu Glu Ala Leu Leu Phe Lys Arg Leu Leu G1u Asn His Lys Leu Pro Ala Glu Pro Leu Glu Lys Pro Ile Met Leu Thr Glu Ser Leu Phe Asn Gly Ser His Tyr Leu Asp Val Leu Tyr Lys Met Thr Ala Asp Asp Gln Arg Tyr Ser Gly Ser Thr Tyr Leu Ser Asp Pro Arg Leu Thr Ala Asn Gly Phe Lys Ile Lys Leu Ile Pro Gly Val Ser Ile Thr Glu Asn Tyr Leu Glu Ile Glu Gly Met Ala Asn Cys Leu Pro Phe Tyr Gly Val Ala MOR0252.ST25.txt Asp Leu Lys Glu Ile Leu Asn Ala Ile Leu Asn Arg Asn Ala Lys Glu Val Tyr Glu Cys Arg Pro Arg Lys Val Ile Ser Tyr Leu Glu Gly Glu Ala Val Arg Leu Ser Arg Gln Leu Pro Met Tyr Leu Ser Lys Glu Asp Ile Gln Asp Ile Ile Tyr Arg Met Lys His Gln Phe Gly Asn Glu Ile Lys G1u Cys Val His Gly Arg Pro Phe Phe His His Leu Thr Tyr Leu Pro Glu Thr Thr <210> 3 <211> 2771 <212> DNA
<213> Homo sapiens <400>

cgaggcggatcgggtgttgcatccatggagcgagctgagagctcgagtacagaacctgct60 aaggccatcaaacctattgatcggaagtcagtccatcagatttgctctgggcaggtggta120 ctgagtctaagcactgcggtaaaggagttagtagaaaacagtctggatgctggtgccact180 aatattgatctaaagcttaaggactatggagtggatcttattgaagtttcagacaatgga240 tgtggggtagaagaagaaaacttcgaaggcttaactctgaaacatcacacatctaagatt300 caagagtttgccgacctaactcaggttgaaacttttggctttcggggggaagctctgagc360 tcactttgtgcactgagcgatgtcaccatttctacctgccacgcatcggcgaaggttgga420 actcgactgatgtttgatcacaatgggaaaattatccagaaaaccccctacccccgcccc480 agagggaccacagtcagcgtgcagcagttattttccacactacctgtgcgccataaggaa540 tttcaaaggaatattaagaaggagtatgccaaaatggtccaggtcttacatgcatactgt600 atcatttcagcaggcatccgtgtaagttgcaccaatcagcttggacaaggaaaacgacag660 cctgtggtatgcacaggtggaagccccagcataaaggaaaatatcggctctgtgtttggg720 cagaagcagttgcaaagcctcattccttttgttcagctgccccctagtgactccgtgtgt780 gaagagtacggtttgagctgttcggatgctctgcataatcttttttacatctcaggtttc840 atttcacaatgcacgcatggagttggaaggagttcaacagacagacagtttttctttatc900 aaccggcggccttgtgacccagcaaaggtctgcagactcgtgaatgaggtctaccacatg960 tataatcgacaccagtatccatttgttgttcttaacatttctgttgattcagaatgcgtt1020 gatatcaatgttactccagataaaaggcaaattttgctacaagaggaaaagcttttgttg1080 gcagttttaaagacctctttgataggaatgtttgatagtgatgtcaacaagctaaatgtc1140 MOR0252.ST25.txt agtcagcagccactgctggatgttgaaggtaacttaataaaaatgcatgcagcggatttg1200 gaaaagcccatggtagaaaagcaggatcaatccccttcattaaggactggagaagaaaaa1260 aaagacgtgtccatttccagactgcgagaggccttttctcttcgtcacacaacagagaac1320 aagcctcacagcccaaagactccagaaccaagaaggagccctctaggacagaaaaggggt1380 atgctgtcttctagcacttcaggtgccatctctgacaaaggcgtcctgagacctcagaaa1440 gaggcagtgagttccagtcacggacccagtgaccctacggacagagcggaggtggagaag1500 gactcggggcacggcagcacttccgtggattctgaggggttcagcatcccagacacgggc1560 agtcactgcagcagcgagtatgcggccagctccccaggggacaggggctcgcaggaacat1620 gtggactctcaggagaaagcgcctgaaactgacgactctttttcagatgtggactgccat1680 tcaaaccaggaagataccggatgtaaatttcgagttttgcctcagccaactaatctcgca1740 accccaaacacaaagcgttttaaaaaagaagaaattctttccagttctgacatttgtcaa1800 aagttagtaaatactcaggacatgtcagcctctcaggttgatgtagctgtgaaaattaat1860 aagaaagttgtgcccctggacttttctatgagttctttagctaaacgaataaagcagtta1920 catcatgaagcacagcaaagtgaaggggaacagaattacaggaagtttagggcaaagatt1980 tgtcctggagaaaatcaagcagccgaagatgaactaagaaaagagataagtaaaacgatg2040 tttgcagaaatggaaatcattggtcagtttaacctgggatttataataaccaaactgaat2100 gaggatatcttcatagtggaccagcatgccacggacgagaagtataacttcgagatgctg2160 cagcagcacaccgtgctccaggggcagaggctcatagcacctcagactctcaacttaact2220 gctgttaatgaagctgttctgatagaaaatctggaaatatttagaaagaatggctttgat2280 tttgttatcgatgaaaatgctccagtcactgaaagggctaaactgatttccttgccaact2340 agtaaaaactggaccttcggaccccaggacgtcgatgaactgatcttcatgctgagcgac2400 agccctggggtcatgtgccggccttcccgagtcaagcagatgtttgcctccagagcctgc2460 cggaagtcggtgatgattgggactgctcttaacacaagcgagatgaagaaactgatcacc2520 cacatgggggagatggaccacccctggaactgtccccatggaaggccaaccatgagacac2580 atcgccaacctgggtgtcatttctcagaactgaccgtagtcactgtatggaataattggt2640 tttatcgcagatttttatgttttgaaagacagagtcttcactaaccttttttgttttaaa2700 atgaaacctgctacttaaaaaaaatacacatcacacccatttaaaagtgatcttgagaac2760 cttttcaaacc 2771 <210> 4 <211> 932 <212> PRT
<213> Homo sapiens <400> 4 Met Lys Gln Leu Pro Ala Ala Thr Val Arg Leu Leu Ser Ser Ser Gln Ile Ile Thr Ser Val Val Ser Val Val Lys Glu Leu Ile Glu Asn Ser MOR0252.ST25.txt Leu Asp Ala Gly Ala Thr Ser Val Asp Val Lys Leu Glu Asn Tyr Gly Phe Asp hys Ile Glu Val Arg Asp Asn Gly Glu Gly Ile Lys Ala Val Asp Ala Pro Val Met Ala Met Lys Tyr Tyr Thr Ser Lys Ile Asn Ser His Glu Asp Leu Glu Asn Leu Thr Thr Tyr Gly Phe Arg Gly Glu Ala Leu Gly Ser Ile Cys Cys Ile Ala Glu Val Leu Ile Thr Thr Arg Thr Ala Ala Asp Asn Phe Ser Thr Gln Tyr Val Leu Asp Gly Ser Gly His Ile Leu Ser Gln Lys Pro Ser His Leu Gly Gln Gly Thr Thr Val Thr Ala Leu Arg Leu Phe Lys Asn Leu Pro Val Arg Lys Gln Phe Tyr Ser Thr Ala Lys Lys Cys Lys Asp Glu Ile Lys Lys Ile G1n Asp Leu Leu Met Ser 'Phe Gly Ile Leu Lys Pro Asp Leu Arg Ile Val Phe Val His Asn Lys Ala Val Ile Trp Gln Lys Ser Arg Val Ser Asp His Lys Met Ala Leu Met Ser Val Leu Gly Thr Ala Val Met Asn Asn Met Glu Ser Phe Gln Tyr His Ser Glu Glu Ser Gln Ile Tyr Leu Ser Gly Phe Leu Pro Lys Cys Asp Ala Asp His Ser Phe Thr Ser Leu Ser Thr Pro Glu Arg Ser Phe Ile Phe Ile Asn Ser Arg Pro Val His Gln Lys Asp Ile Leu Lys Leu Ile Arg His His Tyr Asn Leu Lys Cys Leu Lys Glu Ser Thr Arg Leu Tyr Pro Val Phe Phe Leu Lys Ile Asp Val Pro Thr Ala MOR0252.ST25.txt Asp Val Asp Val Asn Leu Thr Pro Asp Lys Ser Gln Val Leu Leu Gln Asn Lys Glu Ser Val Leu Ile Ala Leu Glu Asn Leu Met Thr Thr Cys Tyr Gly Pro Leu Pro Ser Thr Asn Ser Tyr Glu Asn Asn Lys Thr Asp Val Ser Ala Ala Asp Ile Val Leu Ser Lys Thr Ala Glu Thr Asp Val Leu Phe Asn Lys Val Glu Ser Ser Gly Lys Asn Tyr Ser Asn Val Asp Thr Ser Val Ile Pro Phe Gln Asn Asp Met His Asn Asp Glu Ser Gly Lys Asn Thr Asp Asp Cys Leu Asn His Gln Ile Ser Ile Gly Asp Phe Gly Tyr Gly His Cys Ser Ser Glu Ile Ser Asn Tle Asp Lys Asn Thr Lys Asn Ala Phe Gln Asp Ile Ser Met Ser Asn Val Ser Trp Glu Asn Ser Gln Thr G1u Tyr Ser Lys Thr Cys Phe Ile Ser Ser Val Lys His Thr Gln Ser Glu Asn Gly Asn Lys Asp His Ile Asp Glu Ser Gly Glu Asn Glu Glu Glu Ala Gly Leu Glu Asn Ser Ser Glu Ile Ser Ala Asp Glu Trp Ser Arg Gly Asn Ile Leu Lys Asn Ser Val Gly Glu Asn Ile Glu Pro Val Lys Tle Leu Val Pro Glu Lys Ser Leu Pro Cys Lys Val Ser Asn Asn Asn Tyr Pro Ile Pro Glu Gln Met Asn Leu Asn Glu Asp Ser Cys Asn Lys Lys Ser Asn Val Ile Asp Asn Lys Ser Gly Lys Val Thr Ala Tyr Asp Leu Leu Ser Asn Arg Val Ile Lys Lys Pro Met Ser Ala Ser Ala Leu Phe Val Gln Asp His Arg Pro Gln Phe Leu Ile Glu MOR0252.ST25.txt Asn Pro Lys Thr Ser Leu Glu Asp Ala Thr Leu Gln Ile Glu Glu Leu Trp Lys Thr Leu Ser Glu Glu Glu Lys Leu Lys Tyr Glu Glu Lys Ala Thr Lys Asp Leu Glu Arg Tyr Asn Ser Gln Met Lys Arg Ala Ile Glu Gln Glu Ser Gln Met Ser Leu Lys Asp Gly Arg Lys Lys Ile Lys Pro Thr Ser Ala Trp Asn Leu Ala Gln Lys His Lys Leu Lys Thr Ser Leu Ser Asn Gln Pro Lys Leu Asp Glu Leu Leu Gln Ser Gln Ile Glu Lys Arg Arg Ser Gln Asn Ile Lys Met Val Gln Ile Pro Phe Ser Met Lys 690 695 ~ 700 Asn Leu Lys Ile Asn Phe Lys Lys Gln Asn Lys Val Asp Leu Glu Glu Lys Asp Glu .Pro Cys Leu Ile His Asn Leu Arg Phe Pro Asp Ala Trp Leu Met Thr Ser Lys Thr Glu Val Met Leu Leu Asn Pro Tyr Arg Val Glu Glu Ala Leu Leu ,Phe Lys Arg Leu Leu Glu Asn His Lys Leu Pro Ala Glu Pro Leu Glu Lys Pro Ile Met Leu Thr Glu Ser Leu Phe Asn Gly Ser His Tyr Leu Asp Val Leu Tyr Lys Met Thr Ala Asp Asp Gln Arg Tyr Ser Gly Ser Thr Tyr Leu 5er Asp Pro Arg Leu Thr Ala Asn Gly Phe Lys Ile Lys Leu Ile Pro Gly Val Ser Ile Thr Glu Asn Tyr Leu Glu Ile Glu Gly Met Ala Asn Cys Leu Pro Phe Tyr Gly Val Ala Asp Leu Lys Glu Ile Leu Asn Ala Ile Leu Asn Arg Asn Ala Lys Glu MOR0252.ST25.txt Val Tyr Glu Cys Arg Pro Arg Lys Val Ile Ser Tyr Leu Glu Gly Glu Ala Va1 Arg Leu Ser Arg Gln Leu Pro Met Tyr Leu Ser Lys Glu Asp Ile Gln Asp Ile Ile Tyr Arg Met Lys His Gln Phe Gly Asn Glu Ile Lys Glu Cys Val His Gly Arg Pro Phe Phe His His Leu Thr Tyr Leu Pro Glu Thr Thr <210>

<211>

<212>
DNA

<213> Sapiens Homo <400>

cgaggcggatcgggtgttgcatccatggagcgagctgagagctcgagtacagaacctgct60 aaggccatcaaacctattgatcggaagtcagtccatcagatttgctctgggcaggtggta120 ctgagtctaagcactgcggtaaaggagttagtagaaaacagtctggatgctggtgccact180 aatattgatctaaagcttaaggactatggagtggatcttattgaagtttcagacaatgga240 tgtggggtagaagaagaaaacttcgaaggcttaactctgaaacatcacacatctaagatt300 caagagtttgccgacctaactcaggttgaaacttttggctttcggggggaagctctgagc360 tcactttgtgcactgagcgatgtcaccatttctacctgccacgcatcggcgaaggttgga420 acttga 426 ' <210> 6 <211> 133 <212> PRT
<213> Homo Sapiens <400> 6 Met Lys Gln Leu Pro Ala Ala Thr Val Arg Leu Leu Ser Ser Ser Gln Ile Ile Thr Ser Val Val Ser Val Val Lys Glu Leu Ile Glu Asn Ser Leu Asp Ala Gly Ala Thr Ser Val Asp Val Lys Leu Glu Asn Tyr Gly Phe Asp Lys Ile Glu Val Arg Asp Asn Gly Glu Gly Ile Lys Ala Val Asp Ala Pro Val Met Ala Met Lys Tyr Tyr Thr Ser Lys Ile Asn Ser MOR0252.ST25.txt His Glu Asp Leu Glu Asn Leu Thr Thr Tyr Gly Phe Arg G1y Glu Ala Leu Gly Ser Ile Cys Cys Ile Ala Glu Val Leu Ile Thr Thr Arg Thr Ala Ala Asp Asn Phe Ser Thr Gln Tyr Val Leu Asp Gly Ser Gly His l15 120 125 Ile Leu Ser Gln Lys <210> 7 <211> 1408 <212> DNA
<213> Homo Sapiens <400>

ggcgctcctacctgcaagtggctagtgccaagtgctgggccgccgctcctgccgtgcatg60 ttggggagccagtacatgcaggtgggctccacacggagaggggcgcagacccggtgacagl20 ggctttacctggtacatcggcatggcgcaaccaaagcaagagagggtggcgcgtgccaga180 caccaacggtcggaaaccgccagacaccaacggtcggaaaccgccaagacaccaacgctc240 ggaaaccgccagacaccaacgctcggaaaccgccagacaccaaggctcggaatccacgcc300 aggocacgacggagggcgactacctcccttctgaccctgctgctggcgttcggaaaaaac360 gcagtccggtgtgctctgattggtccaggctctttgacgtcacggactcgacctttgaca420 gagccactaggcgaaaaggagagacgggaagtattttttccgccccgcccggaaagggtg480 gagcacaacgtcgaaagcagccgttgggagcccaggaggcggggcgcctgtgggagccgt540 ggagggaactttcccagtccccgaggcggatccggtgttgcatccttggagcgagctgag600 aactcgagtacagaacctgctaaggccatcaaacctattgatcggaagtcagtccatcag660 atttgctctgggccggtggtaccgagtctaaggccgaatgcggtgaaggagttagtagaa720 aacagtctggatgctggtgccactaatgttgatctaaagcttaaggactatggagtggat780 ctcattgaagtttcaggcaatggatgtggggtagaagaagaaaacttcgaaggctttact840 ctgaaacatcacacatgtaagattcaagagtttgccgacctaactcaggtggaaactttt900 ggctttcggggggaagctctgagctcactttgtgcactgagtgatgtcaccatttr_tacc960 tgccgtgtatcagcgaaggttgggactcgactggtgtttgatcactatgggaaaatcatc7.020 cagaaaaccccctacccccgccccagagggatgacagtcagcgtgaagcagttattttct1080 acgctacctgtgcaccataaagaatttcaaaggaatattaagaagaaacgtgcctgcttc1140 cccttcgccttctgccgtgattgtcagtttcctgaggcctccccagccatgcttcctgta1200 cagcctgtagaactgactcctagaagtaccccaccccacccctgctccttggaggacaac1260 gtgatcactgtattcagctctgtcaagaatggtccaggttcttctagatgatctgcacaa1320 atggttcctctcctccttcctgatgtctgccattagcattggaataaagttcctgctgaa1380 aatccaaaaaaaaaaaaaaaaaaaaaaa 1408 MOR0252.ST25.txt <210> 8 <211> 389 <212> PRT
<213> Homo Sapiens <400> 8 Met Ala Gln Pro Lys Gln Glu Arg Val Ala Arg Ala Arg His Gln Arg Ser Glu Thr Ala Arg His Gln Arg Ser Glu Thr Ala Lys Thr Pro Thr Leu Gly Asn Arg Gln Thr Pro Thr Leu Gly Asn Arg Gln Thr Pro Arg Leu Gly Tle His Ala Arg Pro Arg Arg Arg Ala Thr Thr Ser Leu Leu Thr Leu Leu Leu Ala Phe Gly Lys Asn Ala Val Arg Cys Ala Leu Ile 65 ~70 75 80 Gly Pro Gly Ser Leu Thr Ser Arg Thr Arg Pro Leu Thr Glu Pro Leu Gly Glu Lys Glu Arg Arg Glu Val Phe Phe Pro Pro Arg Pro Glu Arg Val Glu His Asn Val Glu Ser 5er Arg Trp Glu Pro Arg Arg Arg Gly Ala Cys Gly Ser Arg Gly Gly Asn Phe Pro Ser Pro Arg Gly Gly Ser Gly Val Ala Ser Leu Glu Arg Ala Glu Asn Ser Ser Thr Glu Pro Ala Lys Ala Ile Lys Pro Ile Asp Arg Lys Ser Val His Gln Ile Cys Ser Gly Pro Val Val Pro Ser Leu Arg Pro Asn Ala Val Lys Glu Leu Val Glu Asn Ser Leu Asp Ala Gly Ala Thr Asn Val Asp Leu Lys Leu Lys Asp Tyr Gly Val Asp Leu Ile Glu Va1 Ser Gly Asn Gly Cys Gly Val Glu Glu Glu Asn Phe Glu Gly Phe Thr Leu Lys His His Thr Cys Lys Ile Gln Glu Phe Ala Asp Leu Thr Gln Val Glu Thr Phe Gly Phe Arg MOR0252.ST25.txt Gly Glu Ala Leu Ser Ser Leu Cys Ala Leu Ser Asp Val Thr Ile Ser Thr Cys Arg Val Ser Ala Lys Val Gly Thr Arg Leu Val Phe Asp His Tyr Gly Lys Ile Ile Gln Lys Thr Pro Tyr Pro Arg Pro Arg Gly Met Thr Val Ser Val Lys Gln Leu Phe Ser Thr Leu Pro Val His His Lys Glu Phe Gln Arg Asn Ile Lys Lys Lys Arg Ala Cys Phe Pro Phe Ala Phe Cys Arg Asp Cys G1n Phe Pro Glu Ala Ser Pro Ala Met Leu Pro Val Gln Pro Val Glu Leu Thr Pro Arg Ser Thr Pro Pro His Pro Cys Ser Leu Glu Asp Asn Val Ile Thr Val Phe Ser Ser Val Lys Asn Gly Pro Gly Ser 5er Arg <210>

<211>

<212>
DNA

<213> sapiens Homo <400>

tttttagaaactgatgtttattttccatcaaccatttttccatgctgcttaagagaatat60 gcaagaacagcttaagaccagtcagtggttgctcctacccattcagtggcctgagcagtg120 gggagctgcagaccagtcttccgtggcaggctgagcgctccagtcttcagtagggaattg180 ctgaataggcacagagggcacctgtacaccttcagaccagtctgcaacctcaggctgagt240 agcagtgaactcaggagcgggagcagtccattcaccctgaaattcctccttggtcactgc300 cttctcagcagcagcctgctcttctttttcaatctcttcaggatctctgtagaagtacag360 atcaggcatgacctcccatgggtgttcacgggaaatggtgccacgcatgcgcagaacttc420 ccgagccagcatccaccacattaaacccactgagtgagctcccttgttgttgcatgggat480 ggcaatgtccacatagcgcagaggagaatctgtgttacacagcgcaatggtaggtaggtt540 aacataagatgcctccgtgagaggcgaaggggcggcgggacccgggcctggcccgtatgt600 gtccttggcggcctagactaggccgtcgctgtatggtgagccccagggaggcggatctgg660 gcccccagaaggacacccgcctggatttgccccgtagcccggcccgggcccctcgggagc720 agaacagccttggtgaggtggacaggaggggacctcgcgagcagacgcgcgcgccagcga780 Pa ge 14 MOR0252.ST25.txt cagcagccccgccccggcctctcgggagccggggggcagaggctgcggagccccaggagg840 gtctatcagccacagtctctgcatgtttccaagagcaacaggaaatgaacacattgcagg900 ggccagtgtcattcaaagatgtggctgtggatttcacccaggaggagtggcggcaactgg960 accctgatgagaagatagcatacggggatgtgatgttggagaactacagccatctagttt1020 ctgtggggtatgattatcaccaagccaaacatcatcatggagtggaggtgaaggaagtgg1080 agcagggagaggagccgtggataatggaaggtgaatttccatgtcaacatagtccagaac1140 ctgctaaggccatcaaacctattgatcggaagtcagtccatcagatttgctctgggccag1200 tggtactgagtctaagcactgcagtgaaggagttagtagaaaacagtctggatgctggtg1260 ccactaatattgatctaaagcttaaggactatggagtggatctcattgaagtttcagaca1320 atggatgtggggtagaagaagaaaactttgaaggcttaatctctttcagctctgaaacat1380 cacacatgtaagattcaagagtttgccgacctaactgaagttgaaactttcggttttcag1440 ggggaagctctgagctcactgtgtgcactgagcgatgtcaccatttctacctgccacgcg1500 ttggtgaaggttgggactcgactggtgtttgatcacgatgggaaaatcatccaggaaacc1560 ccctacccccaccccagagggaccacagtcagcgtgaagcagttattttctacgctacct1620 gtgcgccataaggaatttcaaaggaatattaagaagacgtgcctgcttccccttcgcctt1680 i ctgccgtgattgtcagtttcctgaggcctccccagccatgcttcctgtacagcctgcaga1740 actgtgagtcaattaaacctcttttcttcataaattaaaaaaaaa 1785 <210> 10 <211> 264 <212> PRT
<213> Homo Sapiens <400> 10 Met Cys Pro Trp Arg Pro Arg Leu Gly Arg Arg Cys Met Val Ser Pro Arg Glu Ala Asp Leu Gly Pro Gln Lys Asp Thr Arg Leu Asp Leu Pro Arg Ser Pro Ala Arg Ala Pro Arg Glu Gln Asn Ser Leu Gly Glu Val Asp Arg Arg Gly Pro Arg Glu Gln Thr Arg Ala Pro Ala Thr Ala Ala Pro Pro Arg Pro Leu Gly Ser Arg Gly Ala Glu Ala Ala Glu Pro Gln Glu Gly Leu Ser Ala Thr Val Ser Ala Cys Phe Gln Glu Gln Gln Glu Met Asn Thr Leu Gln Gly Pro Val Ser Phe Lys Asp Val Ala Val Asp 100 105 l10 MOR0252.ST25.txt Phe Thr Gln Glu Glu Trp Arg Gln Leu Asp Pro Asp Glu Lys Ile Ala Tyr Gly Asp Val Met Leu Glu Asn Tyr Ser His Leu Val Ser Val Gly Tyr Asp Tyr His Gln Ala Lys His His His Gly Val Glu Val Lys Glu Val Glu Gln Gly Glu Glu Pro Trp Ile Met Glu Gly Glu Phe Pro Cys Gln His Ser Pro Glu Pro Ala Lys Ala Ile Lys Pro Ile Asp Arg Lys Ser Val His Gln Tle Cys Ser Gly Pro Val Val Leu Ser Leu Ser Thr Ala Val Lys Glu Leu Val Glu Asn Ser Leu Asp Ala Gly Ala Thr Asn Ile Asp Leu Lys Leu Lys Asp Tyr G1y Val Asp Leu Ile Glu Val Ser Asp Asn Gly Cys Gly Val Glu G1u Glu Asn Phe Glu Gly Leu Ile Ser Phe Ser Ser Glu Thr Ser His Met <210>

<211>

<212>
DNA

<213>
Homo Sapiens <400>

atgtcgttcgtggcaggggttattcggcggctggacgagacagtggtgaaccgcatcgcg60 gcgggggaagttatccagcggccagctaatgctatcaaagagatgattgagaactgttta120 gatgcaaaatccacaagtattcaagtgattgttaaagagggaggcctgaagttgattcag180 atccaagacaatggcaccgggatcaggaaagaagatctggatattgtatgtgaaaggttc240 actactagtaaactgcagtcctttgaggatttagccagtatttctacctatggctttcga300 ggtgaggctttggccagcataagccatgtggctcatgttactattacaacgaaaacagct360 gatggaaagtgtgcatacagagcaagttactcagatggaaaactgaaagcccctcctaaa420 ccatgtgctggcaatcaagggacccagatcacggtggaggaccttttttacaacatagcc480 acgaggagaaaagctttaaaaaatccaagtgaagaatatgggaaaattttggaagttgtt540 ggcaggtattcagtacacaatgcaggcattagtttctcagttaaaaaacaaggagagaca600 gtagctgatgttaggacactacccaatgcctcaaccgtggacaatattcgctccatcttt660 ggaaatgctgttagtcgagaactgatagaaattggatgtgaggataaaaccctagccttc720 Pa ge 16 MOR0252.ST25.txt aaaatgaatggttacatatccaatgcaaactactcagtgaagaagtgcatcttcttactc780 ttcatcaaccatcgtctggtagaatcaacttccttgagaaaagccatagaaacagtgtat840 gcagcctatttgcccaaaaacacacacccattcctgtacctcagtttagaaatcagtccc900 cagaatgtggatgttaatgtgcaccccacaaagcatgaagttcacttcctgcacgaggag960 agcatcctggagcgggtgcagcagcacatcgagagcaagctcctgggctccaattcctcc1020 aggatgtacttcacccagactttgctaccaggacttgctggcccctctggggagatggtt1080 aaatccacaacaagtctgacctcgtcttctacttctggaagtagtgataaggtctatgcc1140 caccagatggttcgtacagattcccgggaacagaagcttgatgcatttctgcagcctctg1200 agcaaacccctgtccagtcagccccaggccattgtcacagaggataagacagatatttct1260 agtggcagggctaggcagcaagatgaggagatgcttgaactcccagcccctgctgaagtg1320 gctgccaaaaatcagagcttggagggggatacaacaaaggggacttcagaaatgtcagag1380 aagagaggacctacttccagcaaccccagaaagagacatcgggaagattctgatgtggaa1440 atggtggaagatgattcccgaaaggaaatgactgcagcttgtaccccccggagaaggatc1500 attaacctcactagtgttttgagtctccaggaagaaattaatgagcagggacatgaggtt1560 ctccgggagatgttgcataaccactccttcgtgggctgtgtgaatcctcagtgggccttg1620 gcacagcatcaaaccaagttataccttctcaacaccaccaagcttagtgaagaactgttc1680 taccagatactcatttatgattttgccaattttggtgttctcaggttatcggagccagca1740 ccgctctttgaccttgccatgcttgccttagatagtccagagagtggctggacagaggaa1800 gatggtcccaaagaaggacttgctgaatacattgttgagtttctgaagaagaaggctgag1860 atgcttgcagactatttctctttggaaattgatgaggaagggaacctgattggattaccc1920 cttctgattgacaactatgtgccccctttggagggactgcctatcttcattcttcgacta1980 gccactgaggtgaattgggacgaagaaaaggaatgttttgaaagcctcagtaaagaatgc2040 gctatgttctattccatccggaagcagtacatatctgaggagtcgaccctctcaggccag2100 i cagagtgaagtgcctggctccattccaaactcctggaagtggactgtggaacacattgtc2160 tataaagccttgcgctcacacattctgcctcctaaacatttcacagaagatggaaatatc2220 ctgcagcttgctaacctgcctgatctatacaaagtctttgagaggtgttaa 2271 <210> 12 <211> 2484 <212> PRT
<213> Homo sapiens <400> 12 Cys Thr Thr Gly Gly Cys Thr Cys Thr Thr Cys Thr Gly G1y Cys Gly Cys Cys Ala Ala Ala Ala Thr Gly Thr Cys Gly Thr Thr Cys Gly Thr Gly Gly Cys Ala Gly Gly Gly Gly Thr Thr Ala Thr Thr Cys Gly Gly MOR0252.ST25.txt Cys Gly Gly Cys Thr Gly Gly Ala Cys Gly Ala Gly A1a Cys Ala Gly Thr Gly Gly Thr Gly Ala Ala Cys Cys Gly Cys Ala Thr Cys Gly Cys Gly Gly Cys Gly Gly Gly Gly Gly Ala A1a Gly Thr Thr Ala Thr Cys Cys Ala Gly Cys Gly Gly Cys Cys Ala Gly Cys Thr Ala Ala Thr Gly l00 105 110 Cys Thr Ala Thr Cys Ala Ala Ala Gly Ala Gly Ala Thr Gly Ala Thr 1l5 120 125 Thr Gly Ala Gly Ala Ala Cys Thr Gly Thr Thr Thr Ala Gly Ala Thr Gly Cys Ala Ala Ala Ala Thr Cys Cys Ala Cys Ala Ala Gly Thr Ala Thr Thr Cys Ala Ala Gly Thr Gly Ala Thr Thr Gly Thr Thr Ala A1a 165 l70 175 Ala Gly Ala G1y Gly Gly Ala Gly Gly Cys Cys Thr Gly Ala Ala Gly l80 185 190 Thr Thr Gly A1a Thr Thr Cys Ala Gly Ala Thr Cys Cys Ala Ala Gly Ala Cys Ala Ala Thr Gly Gly Cys Ala Cys Cys Gly Gly Gly Ala Thr 210 2l5 220 Cys Ala Gly Gly Ala Ala Ala Gly Ala Ala Gly Ala Thr Cys Thr Gly Gly Ala Thr Ala Thr Thr Gly Thr Ala Thr Gly Thr Gly Ala Ala A1a Gly Gly Thr Thr Cys Ala Cys Thr Ala Cys Thr Ala Gly Thr Ala Ala Ala Cys Thr Gly Cys Ala Gly Thr Cys Cys Thr Thr Thr Gly Ala Gly Gly Ala Thr Thr Thr Ala Gly Cys Cys Ala Gly Thr Ala Thr Thr Thr Cys Thr Ala Cys Cys Thr A1a Thr Gly Gly Cys Thr Thr Thr Cys Gly MOR0252.ST25.txt Ala Gly Gly Thr Gly Ala Gly Gly Cys Thr Thr Thr Gly Gly Cys Cys A1a Gly Cys Ala Thr Ala Ala Gly Cys Cys Ala Thr Gly Thr Gly Gly Cys Thr Cys Ala Thr Gly Thr Thr Ala Cys Thr Ala Thr Thr Ala Cys Ala A1a Cys Gly Ala Ala Ala Ala Cys Ala Gly Cys Thr Gly Ala Thr Gly Gly Ala Ala Ala Gly Thr Gly Thr Gly Cys Ala Thr Ala Cys Ala Gly A1a Gly Cys Ala Ala Gly Thr Thr Ala Cys Thr Cys Ala Gly Ala Thr Gly Gly Ala Ala Ala Ala Cys Thr Gly Ala Ala Ala Gly Cys Cys Cys Cys Thr Cys Cys Thr Ala Ala Ala Cys Cys Ala Thr Gly Thr Gly Cys Thr Gly Gly Cys Ala Ala Thr Cys Ala Ala Gly Gly Gly Ala Cys Cys Cys Ala Gly Ala Thr Cys Ala Cys Gly Gly Thr Gly Gly Ala Gly Gly Ala Cys Cys Thr Thr Thr Thr Thr Thr Ala Cys Ala Ala Cys Ala Thr Ala Gly Cys Cys Ala Cys Gly Ala Gly Gly Ala Gly Ala Ala Ala Ala Gly Cys Thr Thr Thr Ala Ala Ala Ala Ala Ala Thr Cys Cys Ala Ala Gly Thr Gly Ala Ala Gly Ala Ala Thr Ala Thr Gly Gly G1y Ala Ala Ala Ala Thr Thr Thr Thr Gly Gly Ala Ala Gly Thr Thr Gly Thr Thr Gly Gly Cys Ala Gly Gly Thr Ala Thr Thr Cys Ala Gly Thr Ala Cys Ala Cys Ala Ala Thr Gly Cys Ala Gly Gly Cys Ala Thr Thr Ala Gly Thr Thr Thr Cys Thr Cys Ala Gly Thr Thr Ala Ala Ala Ala Ala MOR0252.ST25.txt Ala Cys Ala Ala Gly Gly Ala Gly Ala Gly Ala Cys Ala Gly Thr Ala Gly Cys Thr Gly Ala Thr Gly Thr Thr Ala Gly Gly Ala Cys Ala Cys Thr Ala Cys Cys Cys Ala Ala Thr Gly Cys Cys Thr Cys Ala Ala Cys Cys Gly Thr Gly Gly Ala Cys Ala Ala Thr Ala Thr Thr Cys Gly Cys Thr Cys Cys Ala Thr Cys Thr Thr Thr Gly Gly Ala Ala Ala Thr Gly Cys Thr Gly Thr Thr Ala Gly Thr Cys Gly Ala Gly Ala Ala Cys Thr Gly Ala Thr Ala Gly Ala Ala Ala Thr Thr Gly Gly Ala Thr Gly Thr Gly Ala Gly Gly Ala Thr Ala Ala Ala Ala Cys Cys Cys Thr Ala Gly Cys Cys Thr Thr Cys Ala Ala Ala Ala Thr Gly Ala Ala Thr Gly Gly Thr Thr Ala Cys Ala Thr Ala Thr Cys Cys Ala Ala Thr Gly Cys Ala Ala Ala Cys Thr~Ala Cys Thr Cys Ala Gly Thr Gly Ala Ala Gly Ala Ala Gly Thr Gly Cys Ala Thr Cys Thr Thr Cys Thr Thr Ala Cys Thr Cys Thr Thr Cys Ala Thr Cys Ala Ala Cys Cys Ala Thr Cys Gly Thr Cys Thr Gly Gly Thr Ala Gly Ala Ala Thr Cys Ala A1a Cys Thr Thr Cys Cys Thr Thr Gly Ala~Gly Ala Ala Ala Ala Gly Cys Cys Ala Thr Ala Gly Ala Ala Ala Cys Ala Gly Thr Gly Thr Ala Thr Gly Cys Ala Gly Cys Cys Thr Ala Thr Thr Thr Gly Cys Cys Cys Ala Ala Ala Ala MOR0252.ST25.txt Ala Cys Ala Cys Ala Cys Ala Cys Cys Cys Ala Thr Thr Cys Cys Thr Gly Thr Ala Cys Cys Thr Cys Ala Gly Thr Thr Thr Ala Gly Ala Ala Ala Thr Cys Ala Gly Thr Cys Cys Cys Cys Ala Gly Ala Ala Thr Gly 915 920 , 925 Thr Gly Gly Ala Thr Gly Thr Thr Ala Ala Thr Gly Thr Gly Cys Ala Cys Cys Cys Cys Ala Cys Ala A1a Ala Gly Cys Ala Thr Gly Ala Ala Gly Thr Thr Cys Ala Cys Thr Thr Cys Cys Thr Gly Cys Ala Cys Gly Ala Gly Gly Ala Gly Ala Gly Cys Ala Thr Cys Cys Thr Gly Gly Ala Gly Cys Gly Gly Gly Thr Gly Cys Ala Gly Cys Ala Gly Cys Ala Cys Ala Thr Cys Gly Ala Gly Ala Gly Cys Ala Ala Gly Cys Thr Cys Cys Thr Gly Gly Gly Cys Thr Cys Cys Ala Ala Thr Thr Cys Cys Thr Cys Cys Ala Gly Gly Ala Thr Gly Thr Ala Cys Thr Thr Cys Ala Cys Cys Cys A1a Gly Ala Cys Thr Thr Thr Gly Cys Thr Ala Cys Cys Ala Gly Gly Ala Cys Thr Thr Gly Cys Thr Gly G1y Cys Cys Cys Cys Thr Cys Thr Gly Gly G1y Gly Ala Gly Ala Thr Gly Gly Thr Thr Ala Ala Ala Thr Cys Cys Ala Cys Ala Ala Cys Ala A1a Gly Thr Cys Thr Gly Ala Cys Cys Thr Cys Gly Thr Cys Thr Thr Cys Thr Ala Cys Thr Thr Cys Thr Gly Gly Ala Ala Gly Thr Ala Gly Thr Gly Ala Thr Ala Ala Gly Gly Thr Cys Thr Ala Thr MOR0252.ST25.txt Gly Cys Cys Cys Ala Cys Cys Ala Gly Ala Thr Gly Gly Thr Thr Cys Gly Thr Ala Cys Ala Gly Ala Thr Thr Cys Cys Cys Gly Gly Gly Ala Ala Cys Ala Gly Ala Ala Gly Cys Thr Thr Gly A1a Thr Gly Cys Ala Thr Thr Thr Cys Thr Gly Cys Ala Gly Cys Cys Thr Cys Thr Gly Ala Gly Cys Ala Ala Ala Cys Cys Cys Cys Thr Gly Thr Cys Cys Ala Gly Thr Cys Ala Gly Cys Cys Cys Cys Ala Gly 1235 ~ 1240 1245 Gly Cys Cys Ala Thr Thr Gly Thr Cys Ala Cys Ala Gly Ala Gly Gly Ala Thr Ala Ala Gly Ala Cys Ala Gly Ala Thr Ala Thr Thr Thr Cys Thr Ala Gly Thr Gly Gly Cys Ala Gly Gly Gly Cys Thr Ala G1y Gly Cys Ala Gly Cys Ala Ala Gly A1a Thr Gly Ala Gly Gly Ala Gly Ala Thr Gly Cys Thr Thr Gly Ala Ala Cys Thr Cys Cys Cys Ala. Gly Cys Cys Cys Cys Thr Gly Cys Thr Gly Ala Ala Gly Thr Gly Gly Cys Thr Gly Cys Cys Ala Ala Ala Ala Ala Thr Cys Ala Gly Ala Gly Cys Thr Thr Gly Gly Ala Gly Gly Gly Gly Gly Ala Thr Ala Cys Ala Ala Cys Ala Ala Ala Gly Gly G1y Gly Ala Cys Thr Thr Cys Ala Gly Ala Ala Ala Thr Gly Thr Cys Ala Gly Ala Gly Ala Ala Gly Ala Gly A1a Gly G1y Ala Cys Cys Thr MOR0252.ST25.txt Ala Cys Thr Thr Cys Cys Ala Gly Cys Ala Ala Cys Cys Cys Cys Ala Gly Ala Ala Ala Gly Ala Gly Ala Cys Ala Thr Cys Gly Gly Gly A1a Ala Gly A1a Thr Thr Cys Thr Gly Ala Thr Gly Thr Gly Gly Ala Ala Ala Thr Gly Gly Thr Gly Gly Ala Ala Gly Ala Thr Gly Ala Thr Thr Cys Cys Cys Gly Ala Ala Ala Gly Gly Ala Ala Ala Thr Gly Ala Cys Thr Gly Cys Ala Gly Cys Thr Thr Gly Thr Ala Cys Cys Cys Cys Cys Cys Gly Gly A1a Gly Ala Ala Gly Gly Ala Thr Cys Ala Thr Thr Ala Ala Cys Cys Thr Cys Ala Cys Thr Ala Gly Thr Gly Thr Thr Thr Thr Gly Ala Gly Thr Cys Thr Cys Cys Ala Gly Gly Ala A1a Gly Ala Ala Ala Thr Thr Ala Ala Thr Gly Ala Gly Cys Ala Gly Gly G1y Ala Cys Ala Thr Gly Ala Gly Gly Thr Thr Cys Thr ,Cys Cys Gly Gly Gly Ala Gly Ala Thr Gly Thr Thr Gly Cys Ala Thr Ala Ala Cys Cys Ala Cys Thr Cys Cys Thr Thr Cys Gly Thr Gly Gly Gly Cys Thr Gly Thr Gly Thr Gly Ala Ala Thr Cys Cys Thr Cys Ala Gly Thr Gly Gly Gly Cys Cys Thr Thr G1y Gly Cys Ala Cys Ala Gly Cys Ala Thr Cys Ala Ala Ala Cys Cys Ala Ala G1y Thr Thr A1a Thr Ala Cys Cys Thr Thr Cys Thr Cys Ala Ala Cys Ala Cys Cys Ala Cys Cys Ala Ala Gly MOR0252.ST25.txt Cys Thr Thr Ala Gly Thr Gly A1a Ala Gly Ala Ala Cys Thr Gly Thr Thr Cys Thr Ala Cys Cys Ala G1y Ala Thr Ala Cys Thr Cys Ala Thr Thr Thr Ala Thr Gly Ala Thr Thr Thr Thr Gly Cys Cys Ala Ala Thr Thr Thr Thr Gly Gly Thr Gly Thr Thr Cys Thr Cys Ala Gly Gly Thr Thr Ala Thr Cys Gly Gly Ala Gly Cys Cys Ala Gly Cys Ala Cys Cys Gly Cys Thr Cys Thr Thr Thr Gly Ala Cys Cys Thr Thr Gly Cys Cys Ala Thr Gly Cys Thr Thr Gly Cys Cys Thr Thr Ala Gly Ala Thr Ala Gly Thr Cys Cys Ala Gly Ala Gly Ala Gly Thr Gly Gly Cys Thr Gly Gly Ala Cys A1a Gly Ala Gly Gly Ala Ala Gly Ala Thr Gly Gly Thr Cys Cys Cys Ala Ala Ala Gly Ala Ala Gly Gly Ala Cys Thr Thr Gly Cys Thr Gly Ala Ala Thr Ala Cys Ala Thr Thr Gly Thr Thr Gly Ala Gly Thr Thr Thr Cys Thr Gly Ala Ala Gly Ala Ala Gly Ala Ala Gly Gly Cys Thr Gly Ala Gly Ala Thr Gly Cys Thr Thr Gly Cys Ala Gly Ala Cys Thr Ala Thr Thr Thr Cys Thr Cys Thr Thr Thr Gly Gly Ala Ala Ala Thr Thr G1y A1a Thr Gly Ala Gly Gly Ala Ala Gly Gly Gly Ala Ala Cys Cys Thr Gly Ala Thr Thr Gly Gly Ala Thr Thr Ala MOR0252.ST25.txt Cys Cys Cys Cys Thr Thr Cys Thr Gly Ala Thr Thr Gly Ala Cys Ala Ala Cys Thr Ala Thr Gly Thr Gly Cys Cys Cys Cys Cys Thr Thr Thr Gly Gly Ala Gly Gly Gly Ala Cys Thr Gly Cys Cys Thr Ala Thr Cys Thr Thr Cys Ala Thr Thr Cys Thr Thr Cys Gly Ala Cys Thr Ala Gly Cys Cys Ala Cys Thr Gly Ala Gly Gly Thr Gly Ala Ala Thr Thr Gly Gly Gly Ala Cys Gly Ala Ala G1y Ala Ala Ala Ala Gly Gly Ala Ala Thr Gly Thr Thr Thr Thr Gly Ala Ala Ala Gly Cys Cys Thr Cys Ala Gly Thr Ala Ala Ala Gly Ala Ala Thr Gly Cys Gl~,Cys Thr Ala Thr Gly Thr Thr Cys Thr Ala Thr Thr Cys Cys Ala Thr Cys Cys Gly Gly Ala Ala Gly Cys Ala G1y Thr Ala Cys Ala Thr Ala Thr Cys Thr G1y Ala Gly Gly Ala Gly Thr Cys Gly Ala Cys Cys Cys Thr Cys Thr Cys Ala Gly Gly Cys Cys Ala Gly Cys Ala Gly Ala Gly Thr Gly Ala Ala Gly Thr Gly Cys Cys Thr Gly Gly Cys Thr Cys Cys Ala Thr Thr Cys Cys Ala Ala Ala Cys Thr Cys Cys Thr Gly Gly Ala Ala Gly Thr Gly Gly Ala Cys Thr Gly Thr Gly Gly Ala Ala Cys Ala Cys Ala Thr Thr Gly Thr Cys Thr Ala Thr Ala Ala Ala Gly Cys Cys Thr Thr Gly Cys Gly Cys Thr Cys Ala Cys Ala Cys Ala Thr Thr Cys Thr Gly MOR0252.ST25.txt Cys Cys Thr Cys Cys Thr Ala Ala Ala Cys Ala Thr Thr Thr Cys Ala Cys Ala Gly Ala Ala Gly Ala Thr Gly Gly Ala Ala Ala Thr Ala Thr Cys Cys Thr Gly Cys Ala Gly Cys Thr Thr Gly Cys Thr Ala Ala Cys Cys Thr Gly Cys Cys Thr Gly Ala Thr Cys Thr Ala i Thr Ala Cys Ala Ala Ala Gly Thr Cys Thr Thr Thr Gly Ala Gly Ala Gly Gly Thr Gly Thr Thr Ala Ala Ala Thr Ala Thr Gly Gly Thr Thr Ala Thr Thr Thr Ala Thr Gly Cys Ala Cys Thr Gly Thr Gly Gly Gly Ala Thr Gly Thr Gly Thr Thr Cys Thr Thr Cys Thr Thr Thr Cys Thr Cys Thr Gly Thr Ala Thr Thr Cys Cys Gly Ala Thr Ala Cys A1a Ala Ala Gly Thr Gly Thr Thr Gly Thr Ala Thr Cys Ala Ala Ala Gly Thr Gly Thr Gly Ala Thr Ala Thr Ala Cys Ala A1a Ala Gly Thr Gly Thr Ala Cys Cys Ala Ala Cys Ala Thr Ala Ala Gly Thr Gly Thr Thr Gly Gly Thr Ala Gly Cys Ala Cys 2390 2395 , 2400 Thr Thr Ala Ala Gly Ala Cys Thr Thr Ala Thr Ala Cys Thr Thr Gly Cys Cys Thr Thr Cys Thr Gly Ala Thr Ala Gly Thr Ala Thr Thr Cys Cys Thr Thr Thr Ala Thr Ala Cys Ala Cys Ala Gly Thr Gly Gly A1a Thr Thr Gly Ala Thr Thr Ala Thr Ala Ala Ala Thr MOR0252.ST25.txt Ala Ala Ala Thr Ala Gly Ala Thr Gly Thr Gly Thr Cys Thr Thr Ala Ala Cys Ala Thr Ala <210> 13 <211> 4895 <212> DNA
<213> Homo Sapiens <400> 13 gtcggcgtcc gaggcggttg gtgtcggaga atttgttaag cgggactcca ggcaattatt 60 tccagtcaga gaaggaaacc agtgcctggc attctcacca tctttctacc taccatgatc 120 aagtgcttgt cagttgaagt acaagccaaa ttgcgttctg gtttggccat aagctccttg 180 ggccaatgtg ttgaggaact tgccctcaac agtattgatg ctgaagcaaa atgtgtggct 240 gtcagggtga atatggaaac cttccaagtt caagtgatag acaatggatt tgggatgggg 300 agtgatgatg tagagaaagt gggaaatcgt tatttcacca gtaaatgcca ctcggtacag 360 gacttggaga atccaaggtt ttatggtttc cgaggagagg ccttggcaaa tattgctgac 420 atggccagtg ctgtggaaat ttcgtccaag aaaaacagga caatgaaaac ttttgtgaaa 480 ctgtttcaga gtggaaaagc cctgaaagct tgtgaagctg atgtgactag agcaagcgct 540 gggactactg taacagtgta taacctattt taccagcttc ctgtaaggag gaaatgcatg 600 gaccctagac tggagtttga gaaggttagg cagagaatag aagctctctc actcatgcac 660 ccttccattt ctttctcttt gagaaatgat gtttctggtt ccatggttct tcagctccct 720 aaaaccaaag acgtatgttc ccgattttgt caaatttatg gattgggaaa gtcccaaaag 780 ctaagagaaa taagttttaa atataaagag tttgagctta gtggctatat cagctctgaa 840 gcacattaca acaagaatat gcagtttttg tttgtgaaca aaagactagt tttaaggaca 900 aagctacata aactcattga ctttttatta aggaaagaaa gtattatatg caagccaaag 960 aatggtccca ccagtaggca aatgaattca agtcttcggc accggtctac cccagaactc~ 1020 tatggcatat atgtaattaa tgtgcagtgc caattctgtg agtatgatgt gtgcatggag 1080 ccagccaaaa ctctgattga atttcagaac tgggacactc tcttgttttg cattcaggaa 1140 ggagtgaaaa tgtttttaaa gcaagaaaaa ttatttgtgg aattatcagg tgaggatatt 1200 aaggaattta gtgaagataa tggttttagt ttatttgatg ctactcttca gaagcgtgtg 1260 acttccgatg agaggagcaa tttccaggaa gcatgtaata atattttaga ttcctatgag 1320 atgtttaatt tgcagtcaaa agctgtgaaa agaaaaacta ctgcagaaaa cgtaaacaca 1380 cagagttcta gggattcaga agctaccaga aaaaatacaa atgatgcatt tttgtacatt 1440 tatgaatcag gtggtccagg ccatagcaaa atgacagagc catctttaca aaacaaagac 1500 agctcttgct cagaatcaaa gatgttagaa caagagacaa ttgtagcatc agaagctggt 1560 gaaaatgaga aacataaaaa atctttcctg gaacgtagct ctttagaaaa tccgtgtgga 1620 accagtttag aaatgttttt aagccctttt cagacaccat gtcactttga ggagagtggg 1680 MOR0252.ST25.txt caggatctag aaatatggaa agaaagtact actgttaatg gcatggctgc caacatcttg 1740 aaaaataata gaattcagaa tcaaccaaag agatttaaag atgctactga agtgggatgc 1800 cagcctctgc cttttgcaac aacattatgg ggagtacata gtgctcagac agagaaagag 1860 aaaaaaaaag aatctagcaa ttgtggaaga agaaatgttt ttagttatgg gcgagttaaa 1920 ttatgttcca ctggctttat aactcatgta gtacaaaatg aaaaaactaa atcaactgaa 1980 acagaacatt catttaaaaa ttatgttaga cctggtccca cacgtgccca agaaacattt 2040 ggaaatagaa cacgtcattc agttgaaact ccagacatca aagatttagc cagcacttta 2100 agtaaagaat ctggtcaatt gcccaacaaa aaaaattgca gaacgaatat aagttatggg 2160 ctagagaatg aacctacagc aacttataca atgttttctg cttttcagga aggtagcaaa 2220 aaatcacaaa cagattgcat attatctgat acatccccct ctttcccctg gtatagacac 2280 gtttccaatg atagtaggaa aacagataaa ttaattggtt tctccaaacc aatcgtccgt 2340 aagaagctaa gcttgagttc acagctagga tctttagaga agtttaagag gcaatatggg 2400 aaggttgaaa atcctctgga tacagaagta gaggaaagta atggagtcac taccaatctc 2460 agtcttcaag ttgaacctga cattctgctg aaggacaaga accgcttaga gaactctgat 2520 gtttgtaaaa tcactactat ggagcatagt gattcagata gtagttgtca accagcaagc 2580 , cacatccttg actcagagaa gtttccattc tccaaggatg aagattgttt agaacaacag 2640 atgcctagtt tgagagaaag tcctatgacc ctgaaggagt tatctctctt taatagaaaa 2700 cctttggacc ttgagaagtc atctgaatca ctagcctcta aattatccag actgaagggt 2760 tccgaaagag aaactcaaac aatggggatg atgagtcgtt ttaatgaact tccaaattca 2820 gattccagta ggaaagacag caagttgtgc agtgtgttaa cacaagattt ttgtatgtta 2880 tttaacaaca agcatgaaaa aacagagaat ggtgtcatcc caacatcaga ttctgccaca 2940 caggataatt cctttaataa aaatagtaaa acacattcta acagcaatac aacagagaac 3000 tgtgtgatat cagaaactcc tttggtattg cccta.taata attctaaagt taccggtaaa 3060 gattcagatg ttcttatcag agcctcagaa caacagatag gaagtcttga ctctcccagt 3120 ggaatgttaa tgaatccggt agaagatgcc acaggtgacc aaaatggaat ttgttttcag 3180 agtgaggaat ctaaagcaag agcttgttct gaaactgaag agtcaaacac gtgttgttca 3240 gattggcagc ggcatttcga tgtagccctg ggaagaatgg tttatgtcaa caaaatgact 3300 ggactcagca cattcattgc cccaactgag gacattcagg ctgcttgtac taaagacctg 3360 acaactgtgg ctgtggatgt tgtacttgag aatgggtctc agtacaggtg tcaacctttt 3420 agaagcgacc ttgttcttcc tttccttccg agagctcgag cagagaggac tgtgatgaga 3480 caggataaca gagatactgt ggatgatact gttagtagcg aatcgcttca gtctttgttc 3540 tcagaatggg acaatccagt atttgcccgt tatccagagg ttgctgttga tgtaagcagt 3600 ggccaggctg agagcttagc agttaaaatt cacaacatct tgtatcccta tcgtttcacc 3660 aaaggaatga ttcattcaat gcaggttctc cagcaagtag ataacaagtt tattgcctgt 3720 ttgatgagca ctaagactga agagaatggc gaggcagatt cctacgagaa gcaacaggca 3780 MOR0252.ST25.txt caaggctctg gtcggaaaaa attactgtct tctactctaa ttcctccgct agagataaca 3840 gtgacagagg aacaaaggag actcttatgg tgttaccaca aaaatctgga agatctgggc 3900 cttgaatttg tatttccaga cactagtgat tctctggtcc ttgtgggaaa agtaccacta 3960 tgttttgtgg aaagagaagc caatgaactt cggagaggaa gatctactgt gaccaagagt 4020 attgtggagg aatttatccg agaacaactg gagctactcc agaccaccgg aggcatccaa 4080 gggacattgc cactgactgt ccagaaggtg ttggcatccc aagcctgcca tggggccatt 4140 aagtttaatg atggcctgag cttacaggaa agttgccgcc ttattgaagc tctgtcctca 4200 tgccagctgc cattccagtg tgctcacggg agaccttcta tgctgccgtt agctgacata 4260 gaccacttgg aacaggaaaa acagattaaa cccaacctca ctaaacttcg caaaatggcc 432 0 caggcctggc gtctctttgg aaaagcagag tgtgatacaa ggcagagcct gcagcagtcc 4380 atgcctccct gtgagccacc atgagaacag aatcactggt ctaaaaggaa caaagggatg 4440 ttcactgtat gcctctgagc agagagcagc agcagcaggt accagcacgg ccctgactga 4500 atcagcccag tgtccctgag cagcttagac agcagggctc tctgtatcag tctttcttga 4560 gcagatgatt cccctagttg agtagccaga tgaaattcaa gcctaaagac aattcattca 4620 tttgcatcca tgggcacaga aggttgctat atagtatcta ccttttgcta cttatttaat 4680 gataaaattt aatgacagtt taaaaaaaaa aaaaaaaaaa attatttgaa ggggtgggtg 4740 atttttgttt ttgtacagtt ttttttcaag cttcacattt gcgtgtatct aattcagctg 4800 atgctcaagt ccaaggggta gtctgccttc ccaggctgcc cccagggttt ctgcactggt 4860 cccctctttt cccttcagtc ttcttcactt ccctt 4895 <210> 14 <211> 1429 <212> PRT
<213> Homo Sapiens <400> 14 Met Ile Lys Cys Leu Ser Val Glu Val Gln Ala Lys Leu Arg Ser Gly l 5 10 15 Leu Ala Ile Ser Ser Leu Gly Gln Cys Val Glu Glu Leu A1a Leu Asn Ser Ile Asp Ala Glu Ala Lys Cys Val Ala Val Arg Val Asn Met Glu Thr Phe Gln Val Gln Val Ile Asp Asn Gly Phe Gly Met Gly Ser Asp Asp Val G1u Lys Val Gly Asn Arg Tyr Phe Thr Ser Lys Cys His Ser Val Gln Asp Leu Glu Asn Pro Arg Phe Tyr Gly Phe Arg Gly Glu Ala MOR0252.ST25.txt Leu Ala Asn Ile Ala Asp Met Ala Ser Ala Val Glu Ile Ser Ser Lys l00 l05 110 Lys Asn Arg Thr Met Lys Thr Phe Val Lys Leu Phe Gln Ser Gly Lys Ala Leu Lys Ala Cys Glu Ala Asp Val Thr Arg Ala Ser Ala Gly Thr 130 135 l40 Thr Val Thr Val Tyr Asn Leu Phe Tyr Gln Leu Pro Val Arg Arg Lys Cys Met Asp Pro Arg Leu Glu Phe Glu Lys Val Arg Gln Arg Ile Glu Ala Leu Ser Leu Met His Pro Ser Ile Ser Phe Ser Leu Arg Asn Asp 180 185 l90 Val Ser Gly Ser Met Val Leu Gln Leu Pro Lys Thr Lys Asp Val Cys Ser Arg Phe Cys Gln Ile Tyr Gly Leu Gly Lys Ser Gln Lys Leu Arg 210 2l5 220 Glu Ile Ser Phe Lys Tyr Lys G1u Phe Glu Leu Ser Gly Tyr Tle Ser Ser Glu Ala His Tyr Asn Lys Asn Met Gln Phe Leu Phe Val Asn Lys Arg Leu Val Leu Arg Thr Lys Leu His Lys Leu Ile Asp Phe Leu Leu Arg Lys Glu Ser Ile Ile Cys Lys Pro Lys Asn Gly Pro Thr Ser Arg Gln Met Asn Ser Ser Leu Arg His Arg Ser Thr Pro Glu Leu Tyr Gly Ile Tyr Val Ile Asn Val Gln Cys Gln Phe Cys G1u Tyr Asp Val Cys Met Glu Pro Ala Lys Thr Leu Ile Glu Phe Gln Asn Trp Asp Thr Leu Leu Phe Cys Ile Gln Glu Gly Vai Lys Met Phe Leu Lys Gln G1u Lys Leu Phe Val Glu Leu Ser G1y Glu Asp Ile Lys Glu Phe Ser Glu Asp Asn Gly Phe Ser Leu Phe Asp Ala Thr Leu Gln Lys Arg Val Thr Ser MOR0252.ST25.txt Asp Glu Arg Ser Asn Phe Gln Glu Ala Cys Asn Asn Ile Leu Asp Ser Tyr Glu Met Phe Asn Leu Gln Ser Lys Ala Val Lys Arg Lys Thr Thr Ala Glu Asn Val Asn Thr Gln Ser Ser Arg Asp Ser Glu Ala Thr Arg Lys Asn Thr Asn Asp Ala Phe Leu Tyr Ile Tyr Glu Ser Gly Gly Pro Gly His Ser Lys Met Thr Glu Pro 5er Leu Gln Asn Lys Asp Ser Ser Cys Ser Glu Ser Lys Met Leu Glu Gln Glu Thr Ile Val Ala Ser Glu Ala Gly Glu Asn Glu Lys His Lys Lys 5er Phe Leu Glu Arg Ser Ser Leu Glu Asn Pro Cys Gly Thr Ser Leu Glu Met Phe Leu Ser Pro Phe Gln Thr Pro Cys His Phe Glu Glu Ser Gly Gln Asp Leu Glu Ile Trp Lys Glu Ser Thr Thr Val Asn Gly Met Ala Ala Asn Ile Leu Lys Asn Asn Arg Ile Gln Asn Gln Pro Lys Arg Phe Lys Asp Ala Thr Glu Val Gly Cys Gln Pro Leu Pro Phe Ala Thr Thr Leu Trp Gly Va1 His Ser Ala Gln Thr Glu Lys Glu Lys Lys Lys Glu Ser Ser Asn Cys Gly Arg Arg Asn Val Phe Ser Tyr G1y Arg Val Lys Leu Cys Ser Thr Gly Phe Ile Thr His Val Val Gln Asn Glu Lys Thr Lys Ser Thr Glu Thr Glu His Ser Phe Lys Asn Tyr Val Arg Pro Gly Pro Thr Arg Ala Gln Glu Thr Phe Gly Asn Arg Thr Arg His Ser Val Glu Thr Pro Asp Ile Lys MOR0252.ST25.txt Asp Leu Ala Ser Thr Leu Ser Lys Glu Ser Gly Gln Leu Pro Asn Lys Lys Asn Cys Arg Thr Asn Ile Ser Tyr Gly Leu Glu Asn Glu Pro Thr Ala Thr Tyr Thr Met Phe Ser Ala Phe Gln Glu Gly Ser Lys Lys Ser Gln Thr Asp Cys Ile Leu Ser Asp Thr Ser Pro Ser Phe Pro Trp Tyr 705 710 7l5 720 Arg His Val Ser Asn Asp Ser Arg Lys Thr Asp Lys Leu Ile Gly Phe Ser Lys Pro Ile Val Arg Lys Lys Leu Ser Leu Ser Ser Gln Leu Gly Ser Leu Glu Lys Phe Lys Arg Gln Tyr Gly Lys Val Glu Asn Pro Leu Asp Thr Glu Val G1u Glu Ser Asn Gly Val Thr Thr Asn Leu Ser Leu Gln Val Glu Pro Asp Ile Leu Leu Lys Asp Lys Asn Arg Leu Glu Asn Ser Asp Val Cys Lys Ile Thr Thr Met Glu His Ser Asp Ser Asp Ser Ser Cys Gln Pro Ala Ser His Ile Leu Asp Ser Glu Lys Phe Pro Phe Ser Lys Asp Glu Asp Cys Leu Glu Gln Gln Met Pro Ser Leu Arg Glu Ser Pro Met Thr Leu Lys Glu Leu Ser Leu Phe Asn Arg Lys Pro Leu Asp Leu G1u Lys Sex Ser Glu Ser Leu Ala Ser Lys Leu Ser Arg Leu Lys Gly Ser Glu Arg Glu Thr Gln Thr Met Gly Met Met Ser Arg Phe Asn Glu Leu Pro Asn Ser Asp Ser Ser Arg Lys Asp Ser Lys Leu Cys Ser Val Leu Thr Gln Asp Phe Cys Met Leu Phe Asn Asn Lys His Glu Lys Thr Glu Asn Gly Val Ile Pro Thr Ser Asp Ser Ala Thr Gln Asp MOR0252.ST25.txt Asn Ser Phe Asn Lys Asn Ser Lys Thr His Ser Asn Ser Asn Thr Thr Glu Asn Cys Val Ile Ser Glu Thr Pro Leu Val Leu Pro Tyr Asn Asn Ser Lys Val Thr Gly Lys Asp Ser Asp Val Leu Ile Arg Ala Ser Glu Gln Gln Ile Gly Ser Leu Asp Ser Pro Ser Gly Met Leu Met Asn Pro Val Glu Asp Ala Thr Gly Asp Gln Asn Gly Ile Cys Phe Gln Ser Glu Glu Ser Lys Ala Arg Ala Cys Ser Glu Thr Glu G1u Ser Asn Thr Cys Cys Ser Asp Trp Gln Arg His Phe Asp Val Ala Leu Gly Arg Met Val Tyr Val Asn Lys Met Thr Gly Leu Ser Thr Phe Ile Ala Pro Thr Glu Asp Ile Gln Ala Ala Cys Thr Lys Asp Leu Thr Thr Val Ala Va1 Asp Val Val Leu Glu Asn Gly Ser Gln Tyr Arg Cys G1n Pro Phe Arg Ser Asp Leu Va1 Leu Pro Phe Leu Pro Arg Ala Arg Ala Glu Arg Thr Val Met Arg Gln Asp Asn Arg Asp Thr Va1 Asp Asp Thr Val Ser Ser Glu Ser Leu Gln Ser Leu Phe Ser Glu Trp Asp Asn Pro Val Phe Ala Arg Tyr Pro Glu Val Ala Val Asp Val Ser Ser Gly Gln Ala Glu Ser Leu Ala Val Lys Ile His Asn I1e Leu Tyr Pro Tyr Arg Phe Thr Lys Gly Met Ile His Ser Met Gln Val Leu Gln Gln Val Asp Asn Lys Phe Ile Ala Cys Leu MOR0252.ST25.txt Met Ser Thr Lys Thr Glu Glu Asn Gly Glu Ala Asp Ser Tyr Glu Lys Gln Gln Ala Gln Gly Ser Gly Arg Lys Lys Leu Leu Ser Ser Thr Leu I1e Pro Pro Leu Glu Ile Thr Val Thr G1u Glu Gln Arg Arg Leu Leu Trp Cys Tyr His Lys Asn Leu Glu Asp Leu Gly Leu Glu Phe Val Phe Pro Asp Thr Ser Asp Ser Leu Val Leu Val Gly Lys Val Pro Leu Cys Phe Val Glu Arg Glu Ala Asn Glu Leu Arg Arg Gly Arg Ser Thr Val Thr Lys Ser Ile Val Glu Glu Phe Ile Arg Glu Gln Leu Glu Leu Leu Gln Thr Thr Gly Gly Ile Gln Gly Thr Leu Pro Leu Thr Val Gln Lys Val Leu Ala Ser Gln Ala Cys His Gly Ala Ile Lys Phe Asn Asp Gly Leu Ser Leu Gln Glu Ser Cys Arg Leu Ile G1u Ala Leu Ser Ser Cys G1n Leu Pro Phe Gln Cys Ala His Gly Arg Pro Ser Met Leu Pro Leu Ala Asp Ile Asp His Leu' Glu Gln Glu Lys Gln Ile Lys Pro Asn Leu Thr Lys Leu Arg Lys Met Ala Gln Ala Trp Arg Leu Phe Gly Lys Ala Glu Cys Asp Thr Arg Gln Ser Leu Gln Gln Ser Met Pro Pro Cys Glu Pro Pro <210> 15 <211> 3145 <212> DNA
<213> Homo sapiens MOR0252.ST25.txt <400>

ggcgggaaacagcttagtgggtgtggggtcgcgcattttcttcaaccaggaggtgaggag60 gtttcgacatggcggtgcagccgaaggagacgctgcagttggagagcgcggccgaggtcg120 gcttcgtgcgcttctttcagggcatgccggagaagccgaccaccacagtgcgccttttcg180 accggggcgacttctatacggcgcacggcgaggacgcgctgctggccgcccgggaggtgt240 tcaagacccagggggtgatcaagtacatggggccggcaggagcaaagaatctgcagagtg300 ttgtgcttagtaaaatgaattttgaatcttttgtaaaagatcttcttctggttcgtcagt360 atagagttgaagtttataagaatagagctggaaataaggcatccaaggagaatgattggt420 atttggcatataaggcttctcctggcaatctctctcagtttgaagacattctctttggta480 acaatgatatgtcagcttccattggtgttgtgggtgttaaaatgtccgcagttgatggcc540 agagacaggttggagttgggtatgtggattccatacagaggaaactaggactgtgtgaat600 tccctgataatgatcagttctccaatcttgaggctctcctcatccagattggaccaaagg660 aatgtgttttacccggaggagagactgctggagacatggggaaactgagacagataattc720 aaagaggaggaattctgatcacagaaagaaaaaaagctgacttttccacaaaagacattt780 atcaggacctcaaccggttgttgaaaggcaaaaagggagagcagatgaatagtgctgtat840 tgccagaaatggagaatcaggttgcagtttcatcactgtctg,cggtaatcaagtttttag900 aactcttatcagatgattccaactttggacagtttgaactgactacttttgacttcagcc960 agtatatgaaattggatattgcagcagtcagagcccttaacctttttcagggttctgttg1020 aagataccactggctctcagtctctggctgccttgctgaataagtgtaaaacccctcaag1080 gacaaagacttgttaaccagtggattaagcagcctctcatggataagaacagaatagagg1140 agagattgaatttagtggaagcttttgtagaagatgcagaattgaggcagactttacaag1200 aagatttacttcgtcgattcccagatcttaaccgacttgccaagaagtttcaaagacaag1260 cagcaaacttacaagattgttaccgactctatcagggtataaatcaactacctaatgtta1320 tacaggctctggaaaaacatgaaggaaaacaccagaaattattgttggcagtttttgtga1380 ctcctcttactgatcttcgttctgacttctccaagtttcaggaaatgatagaaacaactt1440 tagatatggatcaggtggaaaaccatgaattccttgtaaaaccttcatttgatcctaatc1500 tcagtgaattaagagaaataatgaatgacttggaaaagaagatgcagtcaacattaataa1560 gtgcagccagagatcttggcttggaccctggcaaacagattaaactggattccagtgcac1620 agtttggatattactttcgtgtaacctgtaaggaagaaaaagtccttcgtaacaataaaa1680 actttagtactgtagatatccagaagaatggtgttaaatttaccaacagcaaattgactt1740 ctttaaatgaagagtataccaaaaataaaacagaatatgaagaagcccaggatgccattg1800 ttaaagaaattgtcaatatttcttcaggctatgtagaaccaatgcagacactcaatgatg1860 tgttagctcagctagatgctgttgtcagctttgctcacgtgtcaaatggagcacctgttc1920 catatgtacgaccagccattttggagaaaggacaaggaagaattatattaaaagcatcca1980 ggcatgcttgtgttgaagttcaagatgaaattgcatttattcctaatgacgtatactttg2040 aaaaagataaacagatgttccacatcattactggccccaatatgggaggtaaatcaacat2100 Page MOR0252.ST25.txt atattcgacaaactggggtgatagtactcatggcccaaattgggtgttttgtgccatgtg2160 agtcagcagaagtgtccattgtggactgcatcttagcccgagtaggggctggtgacagtc2220 aattgaaaggagtctccacgttcatggctgaaatgttggaaactgcttctatcctcaggt2280 ctgcaaccaaagattcattaataatcatagatgaattgggaagaggaacttctacctacg2340 atggatttgggttagcatgggctatatcagaatacattgcaacaaagattggtgcttttt2400 gcatgtttgcaacccattttcatgaacttactgccttggccaatcagataccaactgtta2460 ataatctacatgtcacagcactcaccactgaagagaccttaactatgctttatcaggtga2520 agaaaggtgtctgtgatcaaagttttgggattcatgttgcagagcttgctaatttcccta2580 agcatgtaatagagtgtgctaaacagaaagccctggaacttgaggagtttcagtatattg2640 gagaatcgcaaggatatgatatcatggaaccagcagcaaagaagtgctatctggaaagag2700 agcaaggtgaaaaaattattcaggagttcctgtccaaggtgaaacaaatgccctttactg2760 aaatgtcagaagaaaacatcacaataaagttaaaacagctaaaagctgaagtaatagcaa2820 agaataatagctttgtaaatgaaatcatttcacgaataaaagttactacgtgaaaaatcc2880 cagtaatggaatgaaggtaatattgataagctattgtctgtaatagttttatattgtttt2940 atattaaccctttttccatagtgttaactgtcagtgcccatgggctatcaacttaataag3000 atatttagtaatattttactttgaggacattttcaaagatttttattttgaaaaatgaga3060 gctgtaactgaggactgtttgcaattgacataggcaataataagtgatgtgctgaatttt3120 ataaataaaatcatgtagtttgtgg 3145 <210> 16 <211> 934 <212> PRT
<213> Homo Sapiens <400> 16 Met Ala Val Gln Pro Lys Glu Thr Leu Gln Leu Glu Ser Ala Ala Glu Val Gly Phe Va1 Arg Phe Phe G1n Gly Met Pro Glu Lys Pro Thr Thr Thr Val Arg Leu Phe Asp Arg Gly Asp Phe Tyr Thr Ala His Gly Glu Asp Ala Leu Leu Ala Ala Arg Glu Val Phe Lys Thr Gln Gly Val Ile Lys Tyr Met Gly Pro Ala Gly Ala Lys Asn Leu Gln Ser Val Val Leu Ser Lys Met Asn Phe Glu Ser Phe Val Lys Asp Leu Leu Leu Val Arg Gln Tyr Arg Val Glu Val Tyr Lys Asn Arg Ala Gly Asn Lys Ala Ser MOR0252.ST25.txt Lys Glu Asn Asp Trp Tyr Leu Ala Tyr Lys Ala Ser Pro Gly Asn Leu Ser Gln Phe Glu Asp Ile Leu Phe Gly Asn Asn Asp Met Ser Ala Ser Ile G1y Val Val Gly Val Lys Met Ser Ala Val Asp Gly Gln Arg Gln Val Gly Val Gly Tyr Val Asp Ser Ile Gln Arg Lys Leu Gly Leu Cys Glu Phe Pro Asp Asn Asp Gln Phe Ser Asn Leu Glu Ala Leu Leu I1e 180 185 l90 Gln Ile Gly Pro Lys Glu Cys Val Leu Pro Gly Gly Glu Thr Ala G1y Asp Met Gly Lys Leu Arg Gln Ile Ile Gln Arg Gly Gly Ile Leu Ile Thr Glu Arg Lys Lys Ala Asp Phe Ser Thr Lys Asp Ile Tyr Gln Asp Leu Asn Arg Leu Leu Lys Gly Lys Lys Gly Glu Gln Met Asn Ser Ala Val Leu Pro Glu Met Glu Asn Gln Val Ala Val Ser Ser Leu Ser Ala Val Ile Lys Phe Leu Glu Leu Leu Ser Asp Asp Ser Asn Phe Gly Gln Phe Glu Leu Thr Thr Phe Asp Phe Ser Gln Tyr Met Lys Leu Asp Ile Ala Ala Val Arg Ala Leu Asn Leu Phe Gln Gly Ser Va1 Glu Asp Thr Thr Gly Ser Gln Ser Leu Ala Ala Leu Leu Asn Lys Cys Lys Thr Pro Gln Gly Gln Arg Leu Val Asn Gln Trp Ile Lys Gln Pro Leu Met Asp Lys Asn Arg Ile Glu Glu Arg Leu Asn Leu Val Glu Ala Phe Val Glu Asp Ala Glu Leu Arg Gln Thr Leu Gln Glu Asp Leu Leu Arg Arg Phe MOR0252.ST25.txt Pro Asp Leu Asn Arg Leu Ala Lys Lys Phe Gln Arg Gln Ala Ala Asn Leu Gln Asp Cys Tyr Arg Leu Tyr Gln Gly Ile Asn Gln Leu Pro Asn Val Tle Gln Ala Leu Glu Lys His Glu Gly Lys His Gln Lys Leu Leu Leu Ala Val Phe Val Thr Pro Leu Thr Asp Leu Arg Ser Asp Phe Ser Lys Phe G1n Glu Met Ile Glu Thr Thr Leu Asp Met Asp Gln Val Glu Asn His Glu Phe Leu Val Lys Pro Ser Phe Asp Pro Asn Leu 5er Glu Leu Arg Glu Ile Met Asn Asp Leu Glu Lys Lys Met Gln Ser Thr Leu Ile Ser Ala A1a Arg Asp Leu G1y Leu Asp Pro Gly Lys Gln Ile Lys Leu Asp Ser Ser Ala Gln Phe Gly Tyr Tyr Phe Arg Val Thr Cys Lys Glu Glu Lys Val Leu Arg Asn Asn Lys Asn Phe Ser Thr Val Asp Ile Gln Lys Asn Gly Val Lys Phe Thr Asn Ser Lys Leu Thr Ser Leu Asn Glu Glu Tyr Thr Lys Asn Lys Thr Glu Tyr Glu Glu Ala Gln Asp Ala Ile Val Lys Glu Ile Val Asn Ile Ser Ser Gly Tyr Val Glu Pro Met Gln Thr Leu Asn Asp Val Leu Ala Gln Leu Asp Ala Val Val Ser Phe Ala His Val Ser Asn Gly Ala Pro Val Pro Tyr Val Arg Pro Ala Ile Leu Glu Lys Gly Gln Gly Arg Ile Ile Leu Lys Ala Ser Arg His Ala ' Cys Val Glu Val Gln Asp Glu Ile Ala Phe Tle Pro Asn Asp Val Tyr Phe Glu Lys Asp Lys Gln Met Phe His Ile Ile Thr Gly Pro Asn Met MOR0252.ST25.txt Gly Gly Lys Ser Thr Tyr Ile Arg Gln Thr Gly Val Ile Val Leu Met Ala Gln Ile Gly Cys Phe Val Pro Cys Glu Ser Ala Glu Val Ser Ile 690 ' 695 700 Val Asp Cys Tle Leu Ala Arg Val Gly Ala Gly Asp Ser Gln Leu Lys Gly Val Ser Thr Phe Met Ala Glu Met Leu Glu Thr Ala Ser Ile Leu Arg Ser Ala Thr Lys Asp Ser Leu Ile Ile Ile Asp Glu Leu Gly Arg Gly Thr Ser Thr Tyr Asp Gly Phe Gly Leu Ala Trp Ala Ile Ser Glu Tyr Ile Ala Thr Lys Ile Gly Ala Phe Cys Met Phe Ala Thr His Phe His Glu Leu Thr Ala Leu Ala Asn Gln Ile Pro Thr Val Asn Asn Leu His Val Thr Ala Leu Thr Thr Glu Glu Thr Leu Thr Met Leu Tyr Gln Val Lys Lys Gly Val Cys Asp Gln Ser Phe Gly Ile His Val Ala Glu Leu Ala Asn Phe Pro Lys His Val Ile Glu Cys Ala Lys Gln Lys Ala Leu Glu Leu Glu Glu Phe Gln Tyr Ile Gly Glu Ser Gln Gly Tyr Asp Ile Met Glu Pro Ala Ala Lys Lys Cys Tyr Leu Glu Arg Glu Gln Gly Glu Lys Ile Ile Gln Glu Phe Leu Ser Lys Val Lys Gln Met Pro Phe Thr Glu Met Ser Glu Glu Asn Ile Thr Ile Lys Leu Lys Gln Leu Lys Ala Glu Val Ile Ala Lys Asn Asn Ser Phe Val Asn Glu Ile Ile Ser Arg Ile Lys Val Thr Thr MOR0252.ST25.txt <210>

<211>

<212>
DNA

<213>
Homo Sapiens <400>

gggcacgagccctgccatgtctcgccggaagcctgcgtcgggcggcctcgctgcctccag60 ctcagcccctgcgaggcaagcggttttgagccgattcttccagtctacgggaagcctgaa120 atccacctcctcctccacaggtgcagccgaccaggtggaccctggcgctgcagcggccgc180 agcgcccccagcgcccgccttcccgccccagctgccgccgcacgtagctacagaaattga240 cagaagaaagaagagaccattggaaaatgatgggcctgttaaaaagaaagtaaagaaagt300 ccaacaaaaggaaggaggaagtgatctgggaatgtctggcaactctgagccaaagaaatg360 tctgaggaccaggaatgtttcaaagtctctggaaaaattgaaagaattctgctgcgattc420 tgcccttcctcaaagtagagtccagacagaatctctgcaggagagatttgcagttctgcc480 aaaatgtactgattttgatgatatcagtcttctacacgcaaagaatgcagtttcttctga540 agattcgaaacgtcaaattaatcaaaaggacacaacactttttgatctcagtcagtttgg600 atcatcaaatacaagtcatgaaaatttacagaaaactgcttccaaatcagctaacaaacg660 gtccaaaagcatctatacgccgctagaattacaatacatagaaatgaagcagcagcacaa720 agatgcagttttgtgtgtggaatgtggatataagtatagattctttggggaagatgcaga780 gattgcagcccgagagctcaatatttattgccatttagatcacaactttatgacagcaag840 tatacctactcacagactgtttgttcatgtacgccgcctggtggcaaaaggatataaggt900 gggagttgtgaagcaaactgaaactgcagcattaaaggccattggagacaacagaagttc960 actcttttcccggaaattgactgccctttatacaaaatctacacttattggagaagatgt1020 gaatcccctaatcaagctggatgatgctgtaaatgttgatgagataatgactgatacttc1080 taccagctatcttctgtgcatctctgaaaataaggaaaatgttagggacaaaaaaaaggg1140 caacatttttattggcattgtgggagtgcagcctgccacaggcgaggttgtgtttgatag1200 tttccaggactctgcttctcgttcagagctagaaacccggatgtcaagcctgcagccagt1260 agagctgctgcttccttcggccttgtccgagcaaacagaggcgctcatccacagagccac1320 atctgttagtgtgcaggatgacagaattcgagtcgaaaggatggataacatttattttga1380 atacagccatgctttccaggcagttacagagttttatgcaaaagatacagttgacatcaa1440 aggttctcaaattatttctggcattgttaacttagagaagcctgtgatttgctctttggc1500 tgccatcataaaatacctcaaagaattcaacttggaaaagatgctctccaaacctgagaa1560 ttttaaacagctatcaagtaaaatggaatttatgacaattaatggaacaacattaaggaa1620 tctggaaatcctacagaatcagactgatatgaaaaccaaaggaagtttgctgtgggtttt1680 agaccacactaaaacttcatttgggagacggaagttaaagaagtgggtgacccagccact1740 ccttaaattaagggaaataaatgcccggcttgatgctgtatcggaagttctccattcaga1800 atctagtgtgtttggtcagatagaaaatcatctacgtaaattgcccgacatagagagggg1860 actctgtagcatttatcacaaaaaatgttctacccaagagttcttcttgattgtcaaaac1920 Page MOR0252.ST25.txt tttatatcac ctaaagtcag aatttcaagc aataatacct gctgttaatt cccacattca 1980 gtcagacttg ctccggaccg ttattttaga aattcctgaa,ctcctcagtc cagtggagca 2040 ttacttaaag atactcaatg aacaagctgc caaagttggg gataaaactg aattatttaa 2100 agacctttct gacttccctt taataaaaaa gaggaaggat gaaattcaag gtgttattga 2160 cgagatccga atgcatttgc aagaaatacg aaaaatacta aaaaatcctt ctgcacaata 2220 tgtgacagta tcaggacagg agtttatgat agaaataaag aactctgctg tatcttgtat 2280 accaactgat tgggtaaagg ttggaagcac aaaagctgtg agccgctttc actctccttt ,2340 tattgtagaa aattacagac atctgaatca gctccgggag cagctagtcc ttgactgcag 2400 tgctgaatgg cttgattttc tagagaaatt cagtgaacat tatcactcct tgtgtaaagc 2460 agtgcatcac ctagcaactg ttgactgcat tttctccctg gccaaggtcg ctaagcaagg 2520 agattactgc agaccaactg tacaagaaga aagaaaaatt gtaataaaaa atggaaggca 2580 ccctgtgatt gatgtgttgc tgggagaaca ggatcaatat gtcccaaata atacagattt 2640 atcagaggac tcagagagag taatgataat taccggacca aacatgggtg gaaagagctc 2700 ctacataaaa caagttgcat tgattaccat catggctcag attggctcct atgttcctgc 2760 agaagaagcg acaattggga ttgtggatgg cattttcaca aggatgggtg ctgcagacaa 2820 tatatataaa ggacggagta catttatgga agaactgact gacacagcag aaataatcag 2880 aaaagcaaca tcacagtcct tggttatctt ggatgaacta ggaagaggga cgagcactca 2940 tgatggaatt gccattgcct atgctacact tgagtatttc atcagagatg tgaaatcctt 3000 aaccctgttt gtcacccatt atccgccagt ttgtgaacta gaaaaaaatt actcacacca 3060 ggtggggaat taccacatgg gattcttggt cagtgaggat gaaagcaaac tggatccagg 3120 cgcagcagaa caagtccctg attttgtcac cttcctttac caaataacta gaggaattgc 3180 agcaaggagt tatggattaa atgtggctaa actagcagat gttcctggag aaattttgaa 3240 gaaagcagct cacaagtcaa aagagctgga aggattaata aatacgaaaa gaaagagact 3300 caagtatttt gcaaagttat ggacgatgca taatgcacaa gacctgcaga agtggacaga 3360 ggagttcaac atggaagaaa cacagacttc tcttcttcat taaaatgaag actacatttg 3420 tgaacaaaaa atggagaatt aaaaatacca actgtacaaa ataactctcc agtaacagcc 3480 tatctttgtg tgacatgtga gcataaaatt atgaccatgg tatattccta ttggaaacag 3540 agaggttttt ctgaagacag tctttttcaa gtttctgtct tcctaacttt tctacgtata 3600 aacactcttg aatagacttc cactttgtaa ttagaaaatt ttatggacag taagtccagt 3660 aaagccttaa gtggcagaat ataattccca agcttttgga gggtgatata aaaatttact 3720 tgatattttt atttgtttca gttcagataa ttggcaactg ggtgaatctg gcaggaatct 3780 atccattgaa ctaaaataat tttattatgc aaccagttta tccaccaaga acataagaat 3840 tttttataag tagaaagaat tggccaggca tggtggctca tgcctgtaat cccagcactt 3900 tgggaggcca aggtaggcag atcacctgag gtcaggagtt caagaccagc ctggccaaca 3960 tggcaaaacc ccatctttac taaaaatata aagtacatct ctactaaaaa tacgaaaaaa 4020 MOR0252.ST25.txt ttagctgggcatggtggcgcacacctgtagtcccagctactccggaggctgaggcaggag4080 aatctcttgaacctgggaggcggaggttgcaatgagccgagatcacgtcactgcactcca4140 gcttgggcaacagagcaagactccatctcaaaaaagaaaaaagaaaagaaatagaattat4200 caagcttttaaaaactagagcacagaaggaataaggtcatgaaatttaaaaggttaaata4260 ttgtcataggattaagcagtttaaagattgttggatgaaattatttgtcattcattcaag4320 taataaatatttaatgaatacttgctataaaaaaaaaaaaaaaaaaaaaaaaaa 4374 <210> 18 <211> 1128 <212> PRT
<213> Homo Sapiens <400> 18 Met Ser Arg Arg Lys Pro Ala Ser Gly Gly Leu Ala Ala Ser Ser Ser 1 5 l0 15 Ala Pro Ala Arg Gln Ala Val Leu Ser Arg Phe Phe Gln Ser Thr Gly Ser Leu Lys Ser Thr Ser Ser Ser Thr Gly Ala Ala Asp Gln Val Asp Pro Gly Ala Ala Ala Ala Ala Ala Pro Pro Ala Pro Ala Phe Pro Pro Gln Leu Pro Pro His Val Ala Thr Glu Ile Asp Arg Arg Lys Lys Arg Pro Leu Glu Asn Asp Gly Pro Va1 Lys Lys Lys Va1 Lys Lys Val Gln Gln Lys Glu Gly Gly Ser Asp Leu Gly Met Ser Gly Asn Ser Glu Pro Lys Lys Cys Leu Arg Thr Arg Asn Val Ser Lys Ser Leu Glu Lys Leu Lys Glu Phe Cys Cys Asp Ser Ala Leu Pro Gln Ser Arg Val Gln Thr Glu Ser Leu Gln Glu Arg Phe Ala Val Leu Pro Lys Cys Thr Asp Phe Asp Asp Ile Ser Leu Leu His Ala Lys Asn Ala Val Ser Ser Glu Asp Ser Lys Arg Gln Ile Asn Gln Lys Asp Thr Thr Leu Phe Asp Leu Ser Gln Phe Gly Ser Ser Asn Thr Ser His Glu Asn Leu Gln Lys Thr Ala MOR0252.ST25.txt Ser Lys Ser Ala Asn Lys Arg Ser Lys 5er Ile Tyr Thr Pro Leu G1u Leu Gln Tyr Ile Glu Met Lys Gln Gln His Lys Asp Ala Val Leu Cys Val Glu Cys Gly Tyr Lys Tyr Arg Phe Phe Gly Glu Asp Ala Glu Ile A1a Ala Arg Glu Leu Asn Ile Tyr Cys His Leu Asp His Asn Phe Met Thr Ala Ser Ile Pro Thr His Arg Leu Phe Val His Val Arg Arg Leu Val Ala Lys Gly Tyr Lys Val Gly Val Val Lys Gln Thr Glu Thr Ala Ala Leu Lys Ala Ile Gly Asp Asn Arg Ser Ser Leu Phe Ser Arg Lys Leu Thr Ala Leu Tyr Thr Lys Ser Thr Leu Ile Gly Glu Asp Val Asn ' 325 330 335 Pro Leu Ile Lys Leu Asp Asp Ala Val Asn Val Asp Glu Ile Met Thr Asp Thr Ser Thr Ser Tyr Leu Leu Cys Ile Ser Glu Asn Lys Glu Asn Val Arg Asp Lys Lys Lys Gly Asn Ile Phe Ile Gly Ile Val Gly Val Gln Pro Ala Thr Gly Glu Val Val Phe Asp Ser Phe Gln Asp Ser Ala Ser Arg Ser Glu Leu Glu Thr Arg Met Ser Ser Leu G1n Pro Va1 Glu Leu Leu Leu Pro Ser Ala Leu Ser Glu Gln Thr Glu Ala Leu Ile His Arg Ala Thr Ser Val Ser Val Gln Asp Asp Arg Ile Arg Val Glu Arg Met Asp Asn Ile Tyr Phe Glu Tyr Ser His Ala Phe Gln Ala Val Thr Glu Phe Tyr Ala Lys Asp Thr Val Asp Ile Lys Gly Ser Gln Ile Ile MOR0252.ST25.txt Ser Gly Ile Val Asn Leu Glu Lys Pro Val Ile Cys Ser Leu Ala Ala Ile Ile Lys Tyr Leu Lys Glu Phe Asn Leu Glu Lys Met Leu Ser Lys Pro Glu Asn Phe Lys Gln Leu Ser Ser Lys Met Glu Phe Met Thr Ile Asn Gly Thr Thr Leu Arg Asn Leu Glu Ile Leu Gln Asn Gln Thr Asp Met Lys Thr Lys Gly Ser Leu Leu Trp Val Leu Asp His Thr Lys Thr Ser Phe Gly Arg Arg Lys Leu Lys Lys Trp Val Thr Gln Pro Leu Leu Lys Leu Arg Glu Ile Asn Ala Arg Leu Asp Ala Val 5er Glu Val Leu His Ser Glu Ser Ser Va1 Phe Gly Gln Ile Glu Asn His Leu Arg Lys Leu Pro Asp Ile Glu Arg Gly Leu Cys Ser Ile Tyr His Lys Lys Cys Ser Thr Gln Glu Phe Phe Leu Ile Val Lys Thr Leu Tyr His Leu Lys Ser Glu Phe Gln Ala Ile Ile Pro Ala Val Asn Ser His Ile Gln Ser Asp Leu Leu Arg Thr Val Ile Leu Glu Ile Pro Glu Leu Leu Ser Pro Val Glu His Tyr Leu Lys Ile Leu Asn Glu Gln Ala Ala Lys Val Gly Asp Lys Thr Glu Leu Phe Lys Asp Leu Ser Asp Phe Pro Leu Ile Lys Lys Arg Lys Asp Glu Ile Gln Gly Val Ile Asp Glu Ile Arg Met His Leu Gln Glu Tle Arg Lys Ile Leu Lys Asn Pro Ser Ala Gln Tyr Val Thr Val Ser Gly Gln Glu Phe Met Ile Glu Ile Lys Asn Ser Ala Val Ser Cys Ile Pro Thr Asp Trp Val Lys Val G1y Ser Thr Lys Ala Val MOR0252.ST25.txt Ser Arg Phe His Ser Pro Phe Ile Val Glu Asn Tyr Arg His Leu Asn Gln Leu Arg Glu Gln Leu Val Leu Asp Cys Ser Ala Glu Trp Leu Asp 785 790 795 ' 800 Phe Leu Glu Lys Phe Ser Glu His Tyr His Ser Leu Cys Lys Ala Val His His Leu Ala Thr Val Asp Cys Ile Phe Ser Leu Ala Lys Val Ala Lys Gln Gly Asp Tyr Cys Arg Pro Thr Val Gln Glu Glu Arg Lys Ile Val Ile Lys Asn Gly Arg His Pro Val Tle Asp Val Leu Leu Gly Glu Gln Asp Gln Tyr Val Pro Asn Asn Thr Asp Leu Ser Glu Asp Ser Glu Arg Val Met Ile Ile Thr Gly Pro Asn Met Gly Gly Lys Ser Ser Tyr Ile Lys Gln Val Ala Leu Ile Thr Ile Met Ala Gln Ile Gly Ser Tyr Val Pro Ala Glu Glu Ala Thr Ile Gly Ile Val Asp Gly Ile Phe Thr Arg Met Gly Ala Ala Asp Asn Ile Tyr Lys Gly Arg Ser Thr Phe Met Glu Glu Leu Thr Asp Thr Ala Glu Ile Ile Arg Lys Ala Thr Ser Gln Ser Leu Val Ile Leu Asp Glu Leu Gly Arg Gly Thr Ser Thr His Asp Gly I1e Ala Ile Ala Tyr Ala Thr Leu Glu Tyr Phe Ile Arg Asp Val i Lys Ser Leu Thr Leu Phe Val Thr His Tyr Pro Pro Val Cys Glu Leu Glu Lys Asn Tyr Ser His Gln Val Gly Asn Tyr His Met Gly Phe Leu Val Ser Glu Asp Glu Ser Lys Leu Asp Pro Gly Ala Ala Glu MOR0252.ST25.txt Gln Va1 Pro Asp Phe Val Thr Phe Leu Tyr Gln Ile Thr Arg Gly Ile Ala Ala Arg Ser Tyr Gly Leu Asn Val Ala Lys Leu Ala Asp Val Pro Gly Glu Ile Leu Lys Lys Ala Ala His Lys Ser Lys G1u Leu Glu Gly Leu Ile Asn Thr Lys Arg Lys Arg Leu Lys Tyr Phe Ala Lys Leu Trp Thr Met His Asn Ala Gln Asp Leu Gln Lys Trp Thr Glu Glu Phe Asn Met Glu Glu Thr Gln Thr Ser Leu Leu His <210> 19 <211> 3095 <212> DNA
<213> Homo sapiens <400>

cagaaacctcatacttctcgggtcagggaaggtttgggaggatgctgaggcctgagatct60 catcaacctcgccttctgccccggcggtttcccccgtcgtcggagaaacccgctcacctc120 agggtccccgctacaatttcggactccaggagactccacagagccgcccttcggtccagg180 tggtctctgcatccacctgtcctggcacgtcaggagctgcgggcgaccggagcagcagca240 gcagcagccttccctgccccgcgccaaactcccggccagctcaaggttcatactttggaa300 acaaaagagcttatgcagaaaacacagttgcatcaaattttacttttggtgcaagctcat360 cttctgcacgagatactaattatcctcaaacacttaaaactccattgtctactggaaatc420 ctcagagatcaggttataagagctggacaccacaagtgggatattcagcttcatcctcat480 ctgcgatttctgcacactccccatcagttattgtagctgttgtagaagggagaggacttg540 ccagaggtgaaataggaatggcaagtattgatttaaaaaacccccaaattatactatccc600 agtttgcagacaacacaacatatgcaaaggtgatcactaaacttaaaattttatcacctt660 tggaaataataatgtcaaatactgcttgtgctgtggggaattccaccaagttgttcactc720 tgatcacagaaaatttcaagaatgttaatttcactactatccaaaggaaatacttcaatg780 aaacaaaaggattagagtacattgaacagttatgcatagcagaattcagcactgtcctaa840 tggaggttcagtccaagtattactgccttgcagctgttgcagctttgttaaaatatgttg900 aatttattcaaaattcagtttatgcaccaaaatcactgaagatttgtttccagggtagtg960 aacagacagccatgatagattcatcatcagcccaaaaccttgaattgttaattaataatc1020 aagactataggaataatcacactctctttggtgttctaaattatactaagactcctggag1080 ggagtagacgacttcgttctaatatattagagcctctagttgatattgaaaccattaaca1140 tgcgcttagattgtgttcaagaactacttcaagatgaggaactattttttggacttcaat1200 Page MOR0252.ST25.txt cagttatatcaagatttcttgatacagagcagcttctttctgttttagtccaaattccag1260 agcaagacacggtcaatgctgctgaatcaaagataacaaatttaatatacttaaaacata1320 ccttggaacttgtggatcctttaaagattgctatgaagaactgtaacacacctttattaa1380 gagcttactatggttccttggaagacaagaggtttggaatcatacttgaaaagattaaaa1440 cagtaattaatgatgatgcaagatacatgaaaggatgcctaaacatgaggactcagaagt1500 gctatgcagtgaggtctaacataaatgaatttcttgacatagcaagaagaacatacacag1560 agattgtagatgacatagcaggaatgatatcacaacttggagaaaaatatagtctacctt1620 taaggacaagtcttagctctgttcgaggatttttcatccagatgactacagattgtatag1680 ccctacctagtgatcaacttccttcagaatttattaagatttctaaagtgaaaaattctt1740 acagctttacatcagcagatttaattaaaatgaatgaaagatgccaagaatctttgagag1800 aaatctatcacatgacttatatgatagtgtgcaaactgcttagtgagatttatgaacata1860 ttcattgcttatataaactatctgacactgtgtcaatgctggatatgctactgtcatttg1920 ctcatgcctgcactctttctgactatgttcgaccagaatttactgatactttagcaatca1980 aacagggatggcatcctattcttgaaaaaatatctgcggaaaaacctattgccaacaata2040 cctatgttacagaagggagtaattttttgatcataactggaccaaacatgagtggaaaat2100 ccacatatttaaaacagattgctctttgtcagattatggcccagattggatcatatgttc2160 cagcagaatattcttcctttagaattgctaaacagatttttacaagaattagtactgatg2220 atgatatcgaaacaaattcatcaacatttatgaaagaaatgaaagagatagcatatattc2280 tacataatgctaatgacaaatcgctcatattaattgatga~acttggcaga ggtactaata2340 cggaagaaggtattggcatttgttatgctgtttgtgaatatctactgagcttaaaggcat2400 ttacactgtttgctacacatttcctggaactatgccatattgatgccctgtatcctaatg2460 tagaaaacatgcattttgaagttcaacatgtaaagaatacctcaagaaataaagaagcaa2520 ttttgtatacctacaaactttctaagggactcacagaagagaaaaattatggattaaaag2580 ctgcagaggtgtcatcacttccaccatcaattgtcttggatgccaaggaaatcacaactc2640 aaattacgagacaaattttgcaaaaccaaaggagtacccctgagatggaaagacagagag2700 ctgtgtaccatctagccactaggcttgttcaaactgctcgaaactctcaattggatccag2760 acagtttacgaatatatttaagtaacctcaagaagaagtacaaagaagattttcccagga2820 ccgaacaagttccagaaaagactgaagaataatcacaattctaatgtaataatatatctt2880 aattcaaggaacctagaatttatttttctccttagagataaggaaaataacatttgccaa2940 atttcatattttaattgaaaattacattatattaacatcacaattgtcatctatatattc3000 tatatgaaaaatatttattataacttaacaaatgagaactacttaaaggaatggttttta3060 tgttaggaga aaatacaata caccacaaaa aaaaa 3095 <210> 20 <211> 936 <212> PRT
<213> Homo Sapiens MOR0252.ST25.txt <400> 20 Met Leu Arg Pro Glu Ile Ser Ser Thr Ser Pro Ser Ala Pro Ala Val Ser Pro Va1 Val Gly Glu Thr Arg Ser Pro Gln G1y Pro Arg Tyr Asn Phe Gly Leu Gln Glu Thr Pro Gln Ser Arg Pro 5er Val Gln Val Val Ser Ala Ser Thr Cys Pro Gly Thr Ser Gly Ala Ala Gly Asp Arg Ser Ser Ser Ser Ser Ser Leu Pro Cys Pro Ala Pro Asn Ser Arg Pro Ala Gln Gly Ser Tyr Phe Gly Asn Lys Arg Ala Tyr Ala Glu Asn Thr Val Ala Ser Asn Phe Thr Phe Gly A1a Ser Ser Ser Ser Ala Arg Asp Thr Asn Tyr Pro Gln Thr Leu Lys Thr Pro Leu Ser Thr Gly Asn Pro Gln Arg Ser Gly Tyr Lys Ser Trp Thr Pro Gln Val Gly Tyr Ser Ala Ser Ser Ser Ser Ala Ile Ser Ala His Ser Pro Ser Val Ile Val Ala Val Val Glu Gly Arg Gly Leu Ala Arg Gly Glu Ile Gly Met Ala Ser Ile Asp Leu Lys Asn Pro Gln Ile Ile Leu Ser Gln Phe Ala Asp Asn Thr Thr Tyr Ala Lys Val Ile Thr Lys Leu Lys Ile Leu Ser Pro Leu Glu Ile Ile Met Ser Asn Thr Ala Cys A1a Val Gly Asn Ser Thr Lys Leu Phe Thr Leu Ile Thr Glu Asn Phe Lys Asn Val Asn Phe Thr Thr Ile Gln Arg Lys Tyr Phe Asn Glu Thr Lys G1y Leu Glu Tyr Ile G1u G1n Leu Cys Ile Ala Glu Phe Ser Thr Val Leu Met Glu Val Gln Ser Lys MOR0252.ST25.txt Tyr Tyr Cys Leu Ala A1a Val Ala A1a Leu Leu Lys Tyr Val Glu Phe Ile Gln Asn Ser Val Tyr Ala Pro Lys Ser Leu Lys Ile Cys Phe Gln Gly Ser Glu Gln Thr Ala Met Ile Asp Ser Ser Ser Ala Gln Asn Leu Glu Leu Leu Ile Asn Asn Gln Asp Tyr Arg Asn Asn His Thr Leu Phe Gly Val Leu Asn Tyr Thr Lys Thr Pro Gly Gly Ser Arg Arg Leu Arg Ser Asn Ile Leu Glu Pro Leu Val Asp Tle Glu Thr Ile Asn Met Arg Leu Asp Cys Val Gln Glu Leu Leu Gln Asp Glu G1u Leu Phe Phe Gly Leu Gln Ser Val Ile Ser Arg Phe Leu Asp Thr Glu Gln Leu Leu Ser Val Leu Val Gln Tle Pro Glu Gln Asp Thr Val Asn Ala Ala Glu Ser Lys Ile Thr Asn Leu Ile Tyr Leu Lys His Thr Leu Glu Leu Val Asp Pro Leu Lys Ile Ala Met Lys Asn Cys Asn Thr Pro Leu Leu Arg Ala Tyr Tyr Gly Ser Leu Glu Asp Lys Arg Phe Gly Ile Ile Leu Glu Lys Tle Lys Thr Val Ile Asn Asp Asp Ala Arg Tyr Met Lys Gly Cys Leu Asn Met Arg Thr Gln Lys Cys Tyr Ala Val Arg Ser Asn Ile Asn Glu Phe Leu Asp Ile Ala Arg Arg Thr Tyr Thr Glu Ile Val Asp Asp Ile Ala GTy Met Ile Ser Gln Leu Gly Glu Lys Tyr Ser Leu Pro Leu Arg Thr Ser Leu Ser Ser Val Arg Gly Phe Phe Ile Gln Met Thr Thr Asp Cys Ile A1a Leu Pro Ser Asp Gln Leu Pro Ser Glu Phe Ile Lys Ile MOR0252.ST25.txt Ser Lys Val Lys Asn Ser Tyr Ser Phe Thr Ser Ala Asp Leu Ile Lys Met Asn Glu Arg Cys Gln Glu Ser Leu Arg Glu Ile Tyr His Met Thr Tyr Met Ile Val Cys Lys Leu Leu Ser Glu Ile Tyr G1u His Ile His Cys Leu Tyr Lys Leu Ser Asp Thr Va1 Ser Met Leu Asp Met Leu Leu Ser Phe Ala His Ala Cys Thr Leu Ser Asp Tyr Val Arg Pro Glu Phe Thr Asp Thr Leu Ala Ile Lys Gln Gly Trp His Pro Ile Leu Glu Lys Ile Ser Ala Glu Lys Pro Ile Ala Asn Asn Thr Tyr Val Thr Glu Gly Ser Asn Phe Leu Ile Ile Thr Gly Pro Asn Met Ser Gly Lys Ser Thr Tyr Leu Lys Gln Ile Ala Leu Cys Gln Ile Met Ala Gln Ile Gly Ser Tyr Val Pro Ala Glu Tyr Ser Ser Phe Arg Tle Ala Lys Gln Ile Phe Thr Arg Ile Ser Thr Asp Asp Asp Ile Glu Thr Asn Ser Ser Thr Phe Met Lys Glu Met Lys Glu Ile Ala Tyr Ile Leu His Asn Ala Asn Asp Lys Ser Leu Ile Leu Ile Asp G1u Leu Gly Arg Gly Thr Asn Thr Glu Glu Gly Ile Gly Ile Cys Tyr Ala Val Cys Glu Tyr Leu Leu Ser Leu Lys Ala Phe Thr Leu Phe Ala Thr His Phe Leu Glu Leu Cys His Ile Asp Ala Leu Tyr Pro Asn Val Glu Asn Met His Phe Glu Val Gln His Val Lys Asn Thr Ser Arg Asn Lys Glu Ala Ile Leu Tyr Thr Tyr Lys MOR0252.ST25.txt i Leu Ser Lys Gly Leu Thr Glu Glu Lys Asn Tyr Gly Leu Lys Ala Ala Glu Val Ser Ser Leu Pro Pro Ser Ile Val Leu Asp Ala Lys Glu Ile Thr Thr Gln Ile Thr Arg Gln Ile Leu Gln Asn Gln Arg Ser Thr Pro 865 870 875 ~ 880 Glu Met Glu Arg Gln Arg Ala Val Tyr His Leu Ala Thr Arg Leu Val Gln Thr Ala Arg Asn 5er Gln Leu Asp Pro Asp Ser Leu Arg Ile Tyr Leu Ser Asn Leu Lys Lys Lys Tyr Lys Glu Asp Phe Pro Arg Thr Glu Gln Val Pro Glu Lys Thr Glu Glu <210> 21 <211> 2726 <212> DNA
<213> Homo Sapiens <400>

gcggtcggtcagcggggcgttctcccacctgtagcgactcagagcctccaagctcatggc60 ctccttaggagcgaacccaaggaggacaccgcagggaccgagacctggggcggcctcctc120 cggcttccccagcccggccccagtgccgggccccagggaggccgaggaggaggaagtcga180 ggaggaggaggagctggccgagatccatctgtgtgtgctgtggaattcaggatacttggg240 cattgcctactatgatactagtgactccactatccacttcatgccagatgccccagacca300 cgagagcctcaagcttctccagagagttctggatgagatcaatccccagtctgttgttac360 gagtgccaaacaggatgagaatatgactcgatttctgggaaagcttgcctcccaggagca420 cagagagcctaaaagacctgaaatcatatttttgccaagtgtggattttggtctggagat480 aagcaaacaacgcctcctttctggaaactactccttcatcccagacgccatgactgccac540 tgagaaaatcctcttcctctcttccattattccctttgactgcctcctcacagttcgagc600 acttggagggctgctgaagttcctgggtcgaagaagaatcggggttgaactggaagacta660 taatgtcagcgtccccatcctgggctttaagaaatttatgttgactcatctggtgaacat720 agatcaagacacttacagtgttctacagatttttaagagtgagtctcacccctcagtgta780 caaagtggccagtggactgaaggaggggctcagcctctttggaatcctcaacagatgcca840 ctgtaagtggggagagaagctgctcaggctatggttcacacgtccgactcatgacctggg900 ggagctcagttctcgtctggacgtcattcagttttttctgctgccccagaatctggacat960 ggctcagatgctgcatcggctcctgggtcacatcaagaacgtgcctctgattctgaaacg1020 catgaagttgtcccacaccaaggtcagcgactggcaggttctctacaagactgtgtacag1080 Pa ge 57.

MOR0252.ST25.txt tgccctgggcctgagggatgcctgccgctccctgccgcagtccatccagctctttcggga1140 cattgcccaagagttctctgatgacctgcaccatatcgccagcctcattgggaaagtagt1200 ggactttgagggcagccttgctgaaaatcgcttcacagtcctccccaacatagatcctga1260 aattgatgagaaaaagcgaagactgatgggacttcccagtttccttactgaggttgcccg1320 caaggagctggagaatctggactcccgtattccttcatgcagtgtcatctacatccctct1380 gattggcttccttctttctattccccgcctgccttccatggtagaggccagtgactttga1440 gattaatggactggacttcatgtttctctcagaggagaagctgcactatcgtagtgcccg1500 aaccaaggagctggatgcattgctgggggacctgcactgcgagatccgggaccaggagac1560 gctgctgatgtaccagctacagtgccaggtgctggcacgagcagctgtcttaacccgagt1620 attggaccttgcctcccgcctggacgtcctgctggctcttgccagtgctgcccgggacta1680 tggctactcaaggccgcgttactccccacaagtccttggggtacgaatccagaatggcag1740 acatcctctgatggaactctgtgcccgaacctttgtgcccaactccacagaatgtggtgg1800 ggacaaagggagggtcaaagtcatcactggacccaactcatcagggaagagcatatacct1860 caaacaggtaggcttgatcacattcatggccctggtaggcagctttgtgccagcagagga1920 ggccgaaattggggcagtagacgccatcttcacacgaattcatagctgcgaatccatctc1980 ccttggcctctccaccttcatgatcgacctcaaccagcaggtggcgaaagcagtgaacaa2040 tgccactgcacagtcgctggtccttattgatgaatttggaaagggaaccaacacggtgga2100 tgggctcgcgcttctggccgctgtgctccgacactggctggcacgtggacccacatgccc2160 ccacatctttgtggccaccaactttctgagccttgttcagctacaactgctgccacaagg2220 gcccctggtgcagtatttgaccatggagacctgtgaggatggcaacgatcttgtcttctt2280 ctatcaggtttgcgaaggtgttgcgaaggccagccatgcctcccacacagctgcccaggc2340 tgggcttcctgacaagcttgtggctcgtggcaaggaggtctcagacttgatccgcagtgg2400 aaaacccatcaagcctgtcaaggatttgctaaagaagaaccaaatggaaaattgccagac2460 attagtggataagtttatgaaactggatttggaagatcctaacctggacttgaacgtttt2520 catgagccaggaagtgctgcctgctgccaccagcatcctctgagagtccttccagtgtcc2580 tccccagcctcctgagactccggtgggctgccatgccctctttgtttccttatctccctc2640 agacgcagagtttttagtttctctagaaattttgtttcatattaggaataaagtttattt2700 tgaagaaaaaaaaaaaaaaaaaaaaa 2726 <210> 22 <211> 835 <212> PRT
<213> Homo Sapiens <400> 22 Met Ala 5er Leu Gly Ala Asn Pro Arg Arg Thr Pro Gln Gly Pro Arg Pro Gly Ala Ala Ser Ser Gly Phe Pro Ser Pro Ala Pro Val Pro Gly MOR0252.ST25.txt Pro Arg Glu Ala Glu Glu Glu Glu Val Glu Glu Glu Glu Glu Leu Ala Glu Ile His Leu Cys Val Leu Trp Asn Ser Gly Tyr Leu Gly Ile Ala Tyr Tyr Asp Thr Ser Asp Ser Thr I1e His Phe Met Pro Asp Ala Pro Asp His Glu Ser Leu Lys Leu Leu Gln Arg Val Leu Asp Glu Ile Asn Pro Gln Ser Val Val Thr Ser Ala Lys Gln Asp Glu Asn Met Thr Arg Phe Leu Gly Lys Leu Ala Ser Gln Glu His Arg Glu Pro Lys Arg Pro Glu Ile Ile Phe Leu Pro Ser Val Asp Phe Gly Leu Glu Ile Ser Lys Gln Arg Leu Leu Ser Gly Asn Tyr Ser Phe Ile Pro Asp Ala Met Thr Ala Thr Glu Lys Ile Leu Phe Leu Ser Ser Ile I1e Pro Phe Asp Cys Leu Leu Thr Val Arg Ala Leu Gly Gly Leu Leu Lys Phe Leu Gly Arg 180 l85 190 Arg Arg Ile Gly Val Glu Leu Glu Asp Tyr Asn Val Ser Val Pro Ile Leu Gly Phe Lys Lys Phe Met Leu Thr His Leu Val Asn Ile Asp Gln Asp Thr Tyr Ser Val Leu Gln Ile Phe Lys Ser Glu Ser His Pro Ser Val Tyr Lys Val Ala Ser Gly Leu Lys Glu Gly Leu Ser Leu Phe Gly Ile Leu Asn Arg Cys His Cys Lys Trp Gly Glu Lys Leu Leu Arg Leu Trp Phe Thr Arg Pro Thr His Asp Leu Gly Glu Leu Ser Ser Arg Leu Asp Val Ile Gln Phe Phe Leu Leu Pro Gln Asn Leu Asp Met A1a Gln MOR0252.ST25.txt Met Leu His Arg Leu Leu Gly His 21e Lys Asn Val Pro Leu Ile Leu Lys Arg Met Lys Leu Ser His Thr Lys Val Ser Asp Trp Gln Val Leu Tyr Lys Thr Val Tyr Ser Ala Leu Gly Leu Arg Asp Ala Cys Arg Ser Leu Pro G1n Ser Ile G1n Leu Phe Arg Asp Ile Ala Gln Glu Phe Ser Asp Asp Leu His His Ile Ala Ser Leu Ile Gly Lys Val Val Asp Phe Glu Gly Ser Leu Ala Glu Asn Arg Phe Thr Val Leu Pro Asn Ile Asp Pro Glu Ile Asp Glu Lys Lys Arg Arg Leu Met Gly Leu Pro Ser Phe Leu Thr Glu Val Ala Arg Lys Glu Leu Glu Asn Leu Asp Ser Arg Ile Pro Ser Cys Ser Val Ile Tyr Ile Pro Leu Ile Gly Phe Leu Leu Ser Ile Pro Arg Leu Pro Ser Met Val Glu Ala Ser Asp Phe Glu Ile Asn Gly Leu Asp Phe Met Phe Leu Ser Glu Glu Lys Leu His Tyr Arg Ser Ala Arg Thr Lys Glu Leu Asp Ala Leu Leu Gly Asp Leu His Cys Glu Ile Arg Asp Gln Glu Thr Leu Leu Met Tyr Gln Leu Gln Cys Gln Val Leu Ala Arg Ala Ala Val Leu Thr Arg Val Leu Asp Leu A1a Ser Arg Leu Asp Val Leu Leu Ala Leu Ala Ser Ala Ala Arg Asp Tyr Gly Tyr Ser Arg Pro Arg Tyr Ser Pro Gln Val Leu Gly Val Arg Ile Gln Asn Gly Arg His Pro Leu Met Glu Leu Cys Ala Arg Thr Phe Val Pro Asn Ser Thr Glu Cys Gly Gly Asp Lys Gly Arg Val Lys Val Ile Thr Gly MOR0252.ST25.txt Pro Asn Ser Ser Gly Lys Ser Ile Tyr Leu Lys Gln Val Gly Leu Ile Thr Phe Met Ala Leu Val Gly Ser Phe Val Pro Ala Glu Glu Ala Glu Ile Gly Ala Val Asp Ala Ile Phe Thr Arg Ile His Ser Cys Glu Ser Ile Ser Leu Gly Leu Ser Thr Phe Met Ile Asp Leu Asn Gln Gln Val Ala Lys Ala Val Asn Asn Ala Thr Ala Gln Ser Leu Val Leu Ile Asp Glu Phe Gly Lys Gly Thr Asn Thr Val Asp Gly Leu Ala Leu Leu Ala Ala Val Leu Arg His Trp Leu Ala Arg Gly Pro Thr Cys Pro His Ile Phe Val Ala Thr Asn Phe Leu Ser Leu Val Gln Leu Gln Leu Leu Pro Gln Gly Pro Leu Val Gln Tyr Leu Thr Met Glu Thr Cys Glu Asp Gly Asn Asp Leu Val Phe Phe Tyr Gln Val Cys Glu Gly Val Ala Lys Ala Ser His A1a Ser His Thr Ala Ala Gln Ala Gly Leu Pro Asp Lys Leu Val Ala Arg Gly Lys Glu Va1 Ser Asp Leu Ile Arg Ser Gly Lys Pro Ile Lys Pro Val Lys Asp Leu Leu Lys Lys Asn Gln Met Glu Asn Cys Gln Thr Leu Val Asp Lys Phe Met Lys Leu Asp Leu Glu Asp Pro Asn Leu Asp Leu Asn Val Phe Met Ser Gln Glu Val Leu Pro Ala Ala Thr Ser Ile Leu <210> 23 <211> 4264 <212> DNA

MOR0252.ST25.txt <213> Homo Sapiens <400> 23 atttcccgcc agcaggagcc gcgcggtaga tgcggtgctt ttaggagctc60 cgtccgacag aacggttggg ccttgccggc tgtcggtatg tcgcgacaga gcaccctgta120 cagcttcttc cccaagtctc cggcgctgag tgatgccaac aaggcctcgg ccagggcctc180 acgcgaaggc ggccgtgccg ccgctgcccc cggggcctct ccttccccag gcggggatgc240 ggcctggagc gaggctgggc ctgggcccag gcccttggcg cgatccgcgt caccgcccaa300 ggcgaagaac ctcaacggag ggctgcggag atcggtagcg cctgctgccc ccaccagttg360 tgacttctca ccaggagatt tggtttgggc caagatggag ggttacccct ggtggccttg420 tctggtttac aaccacccct ttgatggaac attcatccgc gagaaaggga aatcagtccg480 tgttcatgta cagttttttg atgacagccc aacaaggggc tgggttagca aaaggctttt540 aaagccatat acaggttcaa aatcaaagga agcccagaag ggaggtcatt tttacagtgc600 aaagcctgaa atactgagag caatgcaacg tgcagatgaa gccttaaata aagacaagat660 taagaggctt gaattggcag tttgtgatga gccctcagag ccagaagagg aagaagagat720 ggaggtaggc acaacttacg taacagataa gagtgaagaa gataatgaaa ttgagagtga780 agaggaagta cagcctaaga cacaaggatc taggcgaagt agccgccaaa taaaaaaacg840 aagggtcata tcagattctg agagtgacat tggtggctct gatgtggaat ttaagccaga900 cactaaggag gaaggaagca gtgatgaaat aagcagtgga gtgggggata gtgagagtga960 aggcctgaac agccctgtca aagttgctcg aaagcggaag agaatggtga ctggaaatgg1020 ctctcttaaa aggaaaagct ctaggaagga aacgccctca gccaccaaac aagcaactag1080 catttcatca gaaaccaaga atactttgag agctttctct gcccctcaaa attctgaatc1140 ccaagcccac gttagtggag gtggtgatga cagtagtcgc cctactgttt ggtatcatga1200 aactttagaa tggcttaagg aggaaaagag aagagatgag cacaggagga ggcctgatca1260 ccccgatttt gatgcatcta cactctatgt gcctgaggat ttcctcaatt cttgtactcc1320 tgggatgagg aagtggtggc agattaagtc tcagaacttt gatcttgtca tctgttacaa1380 ggtggggaaa ttttatgagc tgtaccacat ggatgctctt attggagtca gtgaactggg1440 gctggtattc atgaaaggca actgggccca ttctggcttt cctgaaattg catttggccg1500 ttattcagat tccctggtgc agaagggcta taaagtagca cgagtggaac agactgagac1560 tccagaaatg atggaggcac gatgtagaaa gatggcacat atatccaagt atgatagagt16,20 ggtgaggagg gagatctgta ggatcattac caagggtaca cagacttaca gtgtgctgga1680 aggtgatccc tctgagaact acagtaagta tcttcttagc ctcaaagaaa aagaggaaga1740 ttcttctggc catactcgtg catatggtgt gtgctttgtt gatacttcac tgggaaagtt1800 tttcataggt cagttttcag atgatcgcca ttgttcgaga tttaggactc tagtggcaca1860 ctatccccca gtacaagttt tatttgaaaa aggaaatctc tcaaaggaaa ctaaaacaat1920 tctaaagagt tcattgtcct gttctcttca ggaaggtctg atacccggct cccagttttg1980 ggatgcatcc aaaactttga gaactctcct tgaggaagaa tattttaggg aaaagctaag2040 tgatggcatt M0R0252.ST25.txt ggggtgatgt taccccaggt gcttaaaggt atgacttcag agtctgattc cattgggttg 2100 acaccaggag agaaaagtga attggccctc tctgctctag gtggttgtgt cttctacctc 2160 aaaaaatgcc ttattgatca ggagctttta tcaatggcta attttgaaga atatattccc 2220 ttggattctg acacagtcag cactacaaga tctggtgcta tcttcaccaa agcctatcaa 2280 c aat t c to at ca t , g gg g g g g gacattaaac aacttggaga tttttctgaa tggaacaaat 2340 ggttctactg aaggaaccct actagagagg gttgatactt gccatactcc ttttggtaag 2400 cggctcctaa agcaatggct ttgtgcccca ctctgtaacc attatgctat taatgatcgt 2460 ctagatgcca tagaagacct catggttgtg cctgacaaaa tctccgaagt tgtagagctt 2520 ctaaagaagc ttccagatct tgagaggcta ctcagtaaaa ttcataatgt tgggtctccc 2580 ctgaagagtc agaaccaccc agacagcagg gctataatgt atgaagaaac tacatacagc 2640 aagaagaaga ttattgattt tctttctgct ctggaaggat tcaaagtaat gtgtaaaatt 2700 atagggatca tggaagaagt tgctgatggt tttaagtcta aaatccttaa gcaggtcatc 2760 tctctgcaga caaaaaatcc tgaaggtcgt tttcctgatt tgactgtaga attgaaccga 2820 tgggatacag cctttgacca tgaaaaggct cgaaagactg gacttattac tcccaaagca 2880 ggctttgact ctgattatga ccaagctctt gctgacataa gagaaaatga acagagcctc 2940 ctggaatacc tagagaaaca gcgcaacaga attggctgta ggaccatagt ctattggggg 3000 attggtagga accgttacca gctggaaatt cctgagaatt tcaccactcg caatttgcca 3060 gaagaatacg agttgaaatc taccaagaag ggctgtaaac gatactggac caaaactatt 3120 gaaaagaagt tggctaatct cataaatgct gaagaacgga gggatgtatc attgaaggac 3180 tgcatgcggc gactgttcta taactttgat aaaaattaca aggactggca gtctgctgta 3240 gagtgtatcg cagtgttgga tgttttactg tgcctggcta actatagtcg agggggtgat 3300 ggtcctatgt gtcgcccagt aattctgttg ccggaagata cccccccctt cttagagctt 3360 aaaggatcac gccatccttg cattacgaag actttttttg gagatgattt tattcctaat 3420 gacattctaa taggctgtga ggaagaggag caggaaaatg gcaaagccta ttgtgtgctt 3480 gttactggac caaatatggg gggcaagtct acgcttatga gacaggctgg cttattagct 3540 gtaatggccc agatgggttg ttacgtccct gctgaagtgt gcaggctcac accaattgat 3600 agagtgttta ctagacttgg tgcctcagac agaataatgt caggtgaaag tacatttttt 3660 gttgaattaa gtgaaactgc cagcatactc atgcatgcaa cagcacattc tctggtgctt 3720 gtggatgaat taggaagagg tactgcaaca tttgatggga cggcaatagc aaatgcagtt 3780 gttaaagaac ttgctgagac tataaaatgt cgtacattat tttcaactca ctaccattca 3840 ttagtagaag attattctca aaatgttgct gtgcgcctag gacatatggc atgcatggta 3900 gaaaatgaat gtgaagaccc cagccaggag actattacgt tcctctataa attcattaag 3960 ggagcttgtc ctaaaagcta tggctttaat gcagcaaggc ttgctaatct cccagaggaa 4020 gttattcaaa agggacatag aaaagcaaga gaatttgaga agatgaatca gtcactacga 4080 ttatttcggg aagtttgcct ggctagtgaa aggtcaactg tagatgctga agctgtccat 4140 MOR0252.ST25.txt aaattgctga ctttgattaa ggaattatag actgactaca ttggaagctt tgagttgact 4200 tctgaccaaa ggtggtaaat tcagacaaca ttatgatcta ataaacttta ttttttaaaa 4260 atga 4264 <210> 24 <211> 1360 <212> PRT
<213> Homo Sapiens <400> 24 Met Ser Arg Gln Ser Thr Leu Tyr Ser Phe Phe Pro Lys Ser Pro Ala Leu Ser Asp Ala Asn Lys Ala Ser Ala Arg Ala Ser Arg Glu Gly Gly Arg Ala Ala Ala Ala Pro Gly Ala Ser Pro Ser Pro Gly Gly Asp Ala Ala Trp Ser G1u A1a Gly Pro Gly Pro Arg Pro Leu Ala Arg Ser Ala Ser Pro Pro Lys Ala Lys Asn Leu Asn Gly Gly Leu Arg Arg Ser Val Ala Pro Ala Ala Pro Thr Ser Cys Asp Phe Ser Pro Gly Asp Leu Val Trp Ala Lys Met Glu Gly Tyr Pro Trp Trp Pro Cys Leu Val Tyr Asn His Pro Phe Asp Gly Thr Phe Ile Arg Glu Lys Gly Lys Ser Val Arg Val His Val Gln Phe Phe Asp Asp Ser Pro Thr Arg Gly Trp Val Ser Lys Arg Leu Leu Lys Pro Tyr Thr Gly Ser Lys Ser Lys G1u Ala Gln Lys Gly Gly His Phe Tyr Ser Ala Lys Pro Glu Ile Leu Arg Ala Met Gln Arg Ala Asp Glu Ala Leu Asn Lys Asp Lys Ile Lys Arg Leu Glu Leu Ala Val Cys Asp Glu Pro Ser Glu Pro Glu Glu Glu Glu Glu Met Glu Val Gly Thr Thr Tyr Val Thr Asp Lys Ser Glu Glu Asp Asn Glu MOR0252.ST25.txt Ile Glu Ser Glu Glu Glu Val Gln Pro Lys Thr Gln Gly Ser Arg Arg Ser Ser Arg Gln Ile Lys Lys Arg Arg Val Ile Ser Asp Ser Glu Ser Asp Ile Gly Gly Ser Asp Val Glu Phe Lys Pro Asp Thr Lys Glu Glu Gly Ser Ser Asp Glu Ile Ser Ser Gly Val Gly Asp Ser Glu Ser Glu Gly Leu Asn Ser Pro Val Lys Val Ala Arg Lys Arg Lys Arg Met Val Thr Gly Asn Gly Ser Leu Lys Arg Lys Ser Ser Arg Lys Glu Thr Pro Ser Ala Thr Lys Gln Ala Thr Ser Ile Ser Ser Glu Thr Lys Asn Thr Leu Arg Ala Phe Ser Ala Pro Gln Asn Ser Glu Ser Gln Ala His Val Ser Gly Gly Gly Asp Asp Ser Ser Arg Pro Thr Val Trp Tyr His Glu Thr Leu Glu Trp Leu Lys Glu G1u Lys Arg Arg Asp Glu His Arg Arg Arg Pro Asp His Pro Asp Phe Asp A1a 5er Thr Leu Tyr Val Pro Glu Asp Phe Leu Asn Ser Cys Thr Pro Gly Met Arg Lys Trp Trp Gln Ile Lys Ser Gln Asn Phe Asp Leu Val Ile Cys Tyr Lys Val Gly Lys Phe Tyr Glu Leu Tyr His Met Asp Ala Leu Ile Gly Val Ser Glu Leu Gly Leu Val Phe Met Lys Gly Asn Trp Ala His Ser Gly Phe Pro Glu Ile Ala Phe Gly Arg Tyr Ser Asp Ser Leu Val Gln Lys Gly Tyr Lys Val Ala Arg Val Glu Gln Thr Glu Thr Pro Glu Met Met Glu Ala Arg Cys Arg Lys Met Ala His Ile Ser Lys Tyr Asp Arg Val Val Arg Arg Glu MOR0252.ST25.txt Ile Cys Arg Ile Ile Thr Lys Gly Thr Gln Thr Tyr Ser Val Leu Glu Gly Asp Pro Ser Glu Asn Tyr Ser Lys Tyr Leu Leu Ser Leu Lys Glu Lys Glu Glu Asp Ser Ser Gly His Thr Arg Ala Tyr Gly Val Cys Phe Val Asp Thr Ser Leu Gly Lys Phe Phe I1e Gly Gln Phe Ser Asp Asp Arg His Cys Ser Arg Phe Arg Thr Leu Val Ala His Tyr Pro Pro Val Gln Val Leu Phe Glu Lys Gly Asn Leu Ser Lys Glu Thr Lys Thr Ile Leu Lys Ser Ser Leu Ser Cys Ser Leu Gln Glu Gly Leu Ile Pro Gly Ser Gln Phe Trp Asp Ala 5er Lys Thr Leu Arg Thr Leu Leu Glu Glu Glu Tyr Phe Arg Glu Lys Leu Ser Asp Gly Ile Gly Val Met Leu Pro Gln Val Leu Lys Gly Met Thr 5er Glu Ser Asp Ser Tle Gly Leu Thr Pro Gly Glu Lys Ser Glu Leu A1a Leu Ser Ala Leu Gly Gly Cys Val Phe Tyr Leu Lys Lys Cys Leu Tle Asp Gln Glu Leu Leu Ser Met Ala 690 695 700, Asn Phe Glu Glu Tyr Ile Pro Leu Asp Ser Asp Thr Val Ser Thr Thr Arg Ser Gly Ala Ile Phe Thr Lys Ala Tyr G1n Arg Met Val Leu Asp Ala Val Thr Leu Asn Asn Leu G1u Ile Phe Leu Asn Gly Thr Asn Gly Ser Thr Glu Gly Thr Leu Leu Glu Arg Val Asp Thr Cys His Thr Pro Phe Gly Lys Arg Leu Leu Lys Gln Trp.Leu Cys Ala Pro Leu Cys Asn MOR0252.ST25.txt His Tyr Ala Ile Asn Asp Arg Leu Asp Ala Ile Glu Asp Leu Met Val Val Pro Asp Lys Ile Ser Glu Val Val Glu Leu Leu Lys Lys Leu Pro Asp Leu Glu Arg Leu Leu Ser Lys Ile His Asn Val Gly Ser Pro Leu Lys Ser Gln Asn His Pro Asp Ser Arg Ala Ile Met Tyr Glu Glu Thr Thr Tyr Ser Lys Lys Lys Ile Ile Asp Phe Leu Ser Ala Leu Glu Gly Phe Lys Val Met Cys Lys Ile Ile Gly Tle Met Glu Glu Val Ala Asp Gly Phe Lys Ser Lys Ile Leu Lys Gln Val Ile Ser Leu Gln Thr Lys Asn Pro Glu Gly Arg Phe Pro Asp Leu Thr Val Glu Leu Asn Arg Trp Asp Thr Ala Phe Asp His Glu Lys Ala Arg Lys Thr Gly Leu Ile Thr Pro Lys Ala Gly Phe Asp Ser Asp Tyr Asp Gln Ala Leu Ala Asp Ile Arg Glu Asn Glu Gln Ser Leu Leu Glu Tyr Leu Glu Lys G1n Arg Asn Arg Ile Gly Cys Arg Thr Tle Val Tyr Trp Gly Ile Gly Arg Asn Arg Tyr Gln Leu Glu I1e Pro Glu Asn Phe Thr Thr Arg Asn Leu Pro Glu Glu Tyr Glu Leu Lys Ser Thr Lys Lys Gly Cys Lys Arg Tyr Trp Thr Lys Thr Ile Glu Lys Lys Leu Ala Asn Leu Ile Asn Ala Glu Glu Arg Arg Asp Val Ser Leu Lys Asp Cys Met Arg Arg Leu Phe Tyr Asn Phe Asp Lys Asn Tyr Lys Asp Trp Gln Ser Ala Val Glu Cys Ile Ala Val Leu Asp Val Leu Leu Cys Leu Ala Asn Tyr Ser Arg MOR0252.ST25.txt Gly Gly Asp Gly Pro Met Cys Arg Pro Val Ile Leu Leu Pro Glu Asp Thr Pro Pro Phe Leu Glu Leu Lys Gly Ser Arg His Pro Cys Ile Thr Lys Thr Phe Phe Gly Asp Ash Phe Ile Pro Asn Asp Ile Leu Ile Gly Cys Glu Glu Glu Glu Gln Glu Asn Gly Lys Ala Tyr Cys Va1 Leu Val Thr Gly Pro Asn Met Gly Gly Lys Ser Thr Leu Met Arg Gln Ala Gly Leu Leu Ala Val Met Ala Gln Met Gly Cys Tyr Val Pro Ala Glu Val Cys Arg Leu Thr Pro Ile Asp Arg Val Phe Thr Arg Leu Gly Ala Ser Asp Arg Ile Met Ser Gly G1u Ser Thr Phe Phe Val G1u Leu Ser Glu Thr Ala Ser Ile Leu Met His Ala Thr Ala His Ser Leu Va1 Leu Val Asp Glu Leu Gly Arg Gly Thr Ala Thr Phe Asp Gly Thr Ala Ile Ala Asn Ala Val Val Lys Glu Leu Ala Glu Thr Ile Lys Cys Arg Thr Leu Phe Ser Thr His Tyr His Ser Leu Val Glu Asp Tyr Ser Gln Asn Val Ala Val Arg Leu Gly His Met Ala Cys Met Va1 Glu Asn Glu Cys Glu Asp Pro Ser Gln Glu Thr Ile Thr Phe Leu Tyr Lys Phe Ile Lys Gly Ala Cys Pro Lys Ser Tyr Gly Phe Asn Ala Ala Arg Leu Ala Asn Leu Pro Glu Glu Val Ile Gln Lys Gly His Arg Lys Ala Arg Glu Phe 1310. 1315 1320 MOR0252.ST25.txt Glu Lys Met Asn Gln Ser Leu Arg Leu Phe Arg Glu Val Cys Leu Ala Ser Glu Arg Ser Thr Val Asp Ala Glu Ala Val His Lys Leu Leu Thr Leu Ile Lys Glu Leu <210> 25 <211> 1445 <212> DNA
<213> Homo sapiens <400>

tttttttttttgatgttctccagtgcctcagtggcagcagaactggccctgtatcaggcc60 gctaccgccactccatgaccaacctccctgcatacccccccccccagcacccctcccaca120 ggaccgcttctgtgtttgggacccaccaggcctttgcaccatacaacaaaccctcactct180 ccggggcccggtctgcgcccaggctgaacaccacgaacgcctgggacgcagctcctcctt240 ccctggggagccagcccctctaccgctccagcctctcccacctgggaccgcagcacctgc300 ccccaggatcctccacctccggtgcagtcagtgcctccctccccagcggtccctcaagca360 gcccaggcgagcgtccctgccactgtgcccatgcagatgccaagccagcagagtcagcag420 gcgctcgctggagcgacccgaagccagagcagagcagag~aggtcataaaactacacgga480 agagctgaaagtgcccccagatgaggactgcatcatctgcatggagaagctgtccgcagc540 gtctggatacagcgatgtgactgacagcaaggcaatggggcccctggctgtgggctgcct600 caccaagtgcagccacgccttccacctgctgtgcctcctggccatgtactgcaacggcaa660 taagggccctgagcaccccaatcccggaaagccgttcactgccagagggtttcccgccag720 tgctaccttccagacaacgccagggccgcaagcctccaggggcttccagaacccggagac780 actggctgacattccggcctccccacagctgctgaccgatggccactacatgacgctgcc840 cgtgtctccggaccagctgccctgtgacgaccccatggcgggcagcggaggcgcccccgt900 gctgcgggtgggccatgaccacggctgccaccagcagccacgtatctgcaacgcgcccct960 ccctggccctggaccctatcgtacagaacctgctaaggccatcaaacctattgatcggaa1020 gtcagtccatcagatttgctctgggccagtggtactgagtctaagcactgcagtgaagga1080 gttagtagaaaacagtctggatgctggtgccactaatattgatctaaagcttaaggacta1140 tggaatggatctcattgaagtttcaggcaatggatgtggggtagaagaagaaaacttcga1200 aggcttaatgatgtcaccatttctacctgccacgtctcggcgaaggttgggactcgactg1260 gtgtttgatcacgatgggaaaatcatccagaagaccccctacccccaccccagagggacc1320 acagtcagcgtgaagcagttattttctacgctacctgtgcgccataaggaatttcaaagg1380 aatattaagaagaaacatgctgcttccccttcgccttctgccgtgattgtcagttttaac1440 cggaa 1445 <210> 26 <211> 270 <212> PRT
<213> Homo Sapiens <400> 26 MOR0252.ST25.txt Met Glu Lys Leu Ser Ala Ala Ser Gly Tyr Ser Asp Val Thr Asp Ser 1 ~ 5 10 15 Lys Ala Met Gly Pro Leu Ala Val Gly Cys Leu Thr Lys Cys Ser His Ala Phe His Leu Leu Cys Leu Leu Ala Met Tyr Cys Asn Gly Asn Lys Gly Pro Glu His Pro Asn Pro Gly Lys Pro Phe Thr Ala Arg Gly Phe Pro Ala Ser Ala Thr Phe Gln Thr Thr Pro Gly Pro Gln Ala Ser Arg Gly Phe Gln Asn Pro Glu Thr Leu Ala Asp Ile Pro Ala Ser Pro Gln Leu Leu Thr Asp Gly His Tyr Met Thr Leu Pro Val Ser Pro Asp Gln l00 105 110 Leu Pro Cys Asp Asp Pro Met Ala Gly Ser Gly Gly Ala Pro Val Leu Arg Val Gly His Asp His Gly Cys His Gln Gln Pro Arg Ile Cys Asn Ala Pro Leu Pro Gly Pro Gly Pro Tyr Arg Thr Glu Pro Ala Lys A1a Ile Lys Pro Ile Asp Arg Lys Ser Val His Gln Ile Cys Ser Gly Pro 1C~5 170 175 Val Val Leu Ser Leu Ser Thr Ala Val Lys Glu Leu Val Glu Asn Ser Leu Asp Ala Gly Ala Thr Asn Ile Asp Leu Lys Leu Lys Asp Tyr Gly Met Asp Leu Ile Glu Val Ser Gly Asn Gly Cys Gly Val Glu Glu Glu Asn Phe Glu Gly Leu Met Met Ser Pro Phe Leu Pro Ala Thr S'er Arg Arg Arg Leu Gly Leu Asp Trp Cys Leu Ile Thr Met Gly Lys Ser Ser MOR0252.ST25.txt Arg Arg Pro Pro Thr Pro Thr Pro Glu Gly Pro Gln Ser Ala <210> 27 <211> 795 <212> DNA
<213> Homo sapiens <400>

atgtgtccttggcggcctagactaggccgtcgctgtatggtgagccccagggaggcggat60 ctgggcccccagaaggacacccgcctggatttgccccgtagcccggcccgggcccctcgg120 gagcagaacagccttggtgaggtggacaggaggggacctcgcgagcagacgcgcgcgcca180 gcgacagcagccccgccccggcctctcgggagccggggggcagaggctgcggagccccag240 gagggtctatcagccacagtctctgcatgtttccaagagcaacaggaaatgaacacattg300 caggggccagtgtcattcaaagatgtggctgtggatttcacccaggaggagtggcggcaa360 ctggaccctgatgagaagatagcatacggggatgtgatgttggagaactacagccatcta420 gtttctgtggggtatgattatcaccaagccaaacatcatcatggagtggaggtgaaggaa480 gtggagcagggagaggagccgtggataatggaaggtgaatttccatgtcaacatagtcca540 gaacctgctaaggccatcaaacctattgatcggaagtcagtccatcagatttgctctggg600 ccagtggtactgagtctaagcactgcagtgaaggagttagtagaaaacagtctggatgct660 ggtgccactaatattgatctaaagcttaaggactatggagtggatctcattgaagtttca720 gacaatggatgtggggtagaagaagaaaactttgaaggcttaatctctttcagctctgaa780 acatcacacatgtaa 795 <210> 28 <211> 260 <212> PRT
<213> Homo Sapiens <400> 28 Met Cys Pro Trp Arg Pro Arg Leu Gly Arg Arg Cys Met Val Ser Pro Arg Glu Ala Asp Leu Gly Pro Gln Lys Asp Thr Arg Leu Asp Leu Pro Arg Ser Pro Ala Arg Ala Pro Arg Glu Gln Asn Ser Leu Gly Glu Val Asp Arg Arg Gly Pro Arg Glu Gln Thr Arg Ala Pro A1a Thr Ala Ala Pro Pro Arg Pro Leu G1y Ser Arg Gly Ala Glu Ala Ala Glu Pro Gln Glu Gly Leu Ser Ala Thr Val Ser Ala Cys Phe Gln Glu Gln Gln Glu MOR0252.ST25.txt Met Asn Thr Leu Gln Gly Pro Val Ser Phe Lys Asp Val Ala Val Asp Phe Thr Gln Glu Glu Trp Arg Gln Leu Asp Pro Asp Glu Lys Ile Ala Tyr Gly Asp Val Met Leu Glu Asn Tyr Ser His Leu Val Ser Val Gly Tyr Asp Tyr His Gln Ala Lys His His His Gly Val Glu Val Lys Glu Val Glu Gln Gly Glu Glu Pro Trp Ile Met Glu Gly Glu Phe Pro Cys Gln His Ser Pro Glu Pro Ala Lys Ala Ile Lys Pro Ile Asp Arg Lys Ser Val His~Gln Ile Cys Ser Gly Pro Val Val Leu Ser Leu Ser Thr Ala Val Lys Glu Leu Val G1u Asn Ser Leu Asp Ala Gly Ala Thr Asn Ile Asp Leu Lys Leu Lys Asp Tyr Gly Va1 Asp Leu Tle Glu Val Ser Asp Asn Gly Cys Gly Val Glu Glu Glu Asn Phe Glu Gly Leu Ile Ser Phe Ser Ser Glu <210> 29 <211> 3218 <212> DNA
<213> Saccharomyces cerevisiae <400>

aaataggaatgtgataccttctattgcatgcaaagatagtgtaggaggcgctgctattgc60 caaagacttttgagaccgcttgctgtttcattatagttgaggagttctcgaagacgagaa120 attagcagttttcggtgtttagtaatcgcgctagcatgctaggacaatttaactgcaaaa180 ttttgatacgatagtgatagtaaatggaaggtaaaaataacatagacctatcaataagca240 atgtctctcagaataaaagcacttgatgcatcagtggttaacaaaattgctgcaggtgag300 atcataatatcccccgtaaatgctctcaaagaaatgatggagaattccatcgatgcgaat360 gctacaatgattgatattctagtcaaggaaggaggaattaaggtacttcaaataacagat420 aacggatctggaattaataaagcagacctgccaatcttatgtgagcgattcacgacgtcc480 aaattacaaaaattcgaagatttgagtcagattcaaacgtatggattccgaggagaagct540 ttagccagta tctcacatgt ggcaagagtc acagtaacga caaaagttaa agaagacaga 600 MOR0252.ST25.txt tgtgcatgga gagtttcata tgcagaaggt aagatgttgg aaagccccaa acctgttgct 660 ggaaaagacg gtaccacgat cctagttgaa gacctttttt tcaatattcc ttctagatta 720 agggccttga ggtcccataa tgatgaatac tctaaaatat tagatgttgt cgggcgatac 780 gccattcatt ccaaggacat tggcttttct tgtaaaaagt tcggagactc taattattct 840 ttatcagtta aaccttcata tacagtccag gataggatta ggactgtgtt caataaatct 900 gtggcttcga atttaattac ttttcatatc agcaaagtag aagatttaaa cctggaaagc 960 gttgatggaa aggtgtgtaa tttgaatttc atatccaaaa agtccatttc attaattttt 1020 ttcattaata atagactagt gacatgtgat cttctaagaa gagctttgaa cagcgtttac 1080 tccaattatc tgccaaaggg cttcagacct tttatttatt tgggaattgt tatagatccg 1140 gcggctgttg atgttaacgt tcacccgaca aagagagagg ttcgtttcct gagccaagat 1200 gagatcatag agaaaatcgc caatcaattg cacgccgaat tatctgccat tgatacttca 1260 cgtactttca aggcttcttc aatttcaaca aacaagccag agtcattgat accatttaat 1320 gacaccatag aaagtgatag gaataggaag agtctccgac aagcccaagt ggtagagaat 1380 tcatatacga cagccaatag tcaactaagg aaagcgaaaa gacaagagaa taaactagtc 1440 agaatagatg cttcacaagc taaaattacg tcatttttat cctcaagtca acagttcaac 1500 tttgaaggat cgtctacaaa gcgacaactg agtgaaccca aggtaacaaa tgtaagccac 1560 tcccaagagg cagaaaagct gacactaaat gaaagcgaac aaccgcgtga tgccaataca 1620 atcaatgata atgacttgaa ggatcaacct aagaagaaac aaaagttggg ggattataaa 1680 gttccaagca ttgccgatga cgaaaagaat gcactcccga tttcaaaaga cgggtatatt 1740 agagtaccta aggagcgagt taatgttaat cttacgagta tcaagaaatt gcgtgaaaaa 1800 gtagatgatt cgatacatcg agaactaaca gacatttttg caaatttgaa ttacgttggg 1860 gttgtagatg aggaaagaag attagccgct attcagcatg acttaaagct ttttttaata 1920 gattacggat ctgtgtgcta tgagctattc tatcagattg gtttgacaga ctt,cgcaaac 1980 tttggtaaga taaacctaca gagtacaaat gtgtcagatg atatagtttt gtataatctc 2040 ctatcagaat ttgacgagtt aaatgacgat gcttccaaag aaaaaataat tagtaaaata 2100 tgggacatga gcagtatgct aaatgagtac tattccatag aattggtgaa tgatggtcta 2160 gataatgact taaagtctgt gaagctaaaa tctctaccac tacttttaaa aggctacatt 2220 ccatctctgg tcaagttacc attttttata tatcgcctgg gtaaagaagt tgattgggag 2280 gatgaacaag agtgtctaga tggtatttta agagagattg cattactcta tatacctgat 2340 atggttccga aagtcgatac actcgatgca tcgttgtcag aagacgaaaa agcccagttt 2400 ataaatagaa aggaacacat atcctcatta ctagaacacg ttctcttccc ttgtatcaaa 2460 cgaaggttcc tggcccctag acacattctc aaggatgtcg tggaaatagc caaccttcca 2520 gatctataca aagtttttga gaggtgttaa ctttaaaacg ttttggctgt aataccaaag 2580 tttttgttta tttcctgagt gtgattgtgt ttcatttgaa agtgtatgcc ctttccttta 2640 acgattcatc cgcgagattt caaaggatat gaaatatggt tgcagttagg aaagtatgtc 2700 MOR0252.ST25.txt agaaatgtatattcggattgaaactcttctaatagttctgaagtcacttg gttccgtatt2760 gttttcgtcctcttcctcaagcaacgattcttgtctaagcttattcaacg gtaccaaaga2820 cccgagtccttttatgagagaaaacatttcatcatttttcaactcaatta tcttaatatc2880 attttgtagtattttgaaaacaggatggtaaaacgaatcacctgaatcta gaagctgtac2940 cttgtcccataaaagttttaatttactgagcctttcggtcaagtaaacta gtttatctag3000 ttttgaaccgaatattgtgggcagatttgcagtaagttcagttagatcta ctaaaagttg3060 tttgacagcagccgattccacaaaaatttggtaaaaggagatgaaagaga cctcgcgcgt3120 aatggtttgcatcaccatcggatgtctgttgaaaaactcactttttgcat ggaagttatt3180 aacaataagactaatgattaccttagaataatgtataa 3218 <210> 30 <211> 769 <212> PRT
<213> Saccharomyces cerevisiae <400> 30 Met Ser Leu Arg Ile Lys Ala Leu Asp Ala Ser Val Val Asn Lys Ile Ala Ala Gly Glu Ile Ile Ile Ser Pro Val Asn Ala Leu Lys Glu Met Met Glu Asn Ser Ile Asp Ala Asn Ala Thr Met Il.e Asp Tle Leu Val Lys Glu Gly Gly Ile Lys Val Leu Gln Ile Thr Asp Asn Gly Ser Gly Ile Asn Lys Ala Asp Leu Pro Ile Leu Cys Glu Arg Phe Thr Thr Ser Lys Leu Gln Lys Phe Glu Asp Leu Ser Gln Ile Gln Thr Tyr Gly Phe Arg Gly Glu Ala Leu Ala Ser Ile Ser His Val Ala Arg Val Thr Val Thr Thr Lys Val Lys Glu Asp Arg Cys Ala Trp Arg Val Ser Tyr Ala Glu Gly Lys Met Leu Glu Ser Pro Lys Pro Val Ala Gly Lys Asp Gly Thr Thr Ile Leu Val Glu Asp Leu Phe Phe Asn Ile Pro Ser Arg Leu Arg Ala Leu Arg Ser His Asn Asp Glu Tyr Ser Lys Ile Leu Asp Val MOR0252.ST25.txt Val Gly Arg Tyr Ala Ile His Ser Lys Asp Ile Gly Phe Ser Cys Lys Lys Phe Gly Asp Ser Asn Tyr Ser Leu Ser Val Lys Pro Ser Tyr Thr Val G1n Asp Arg Ile Arg Thr Val Phe Asn Lys Ser Val Ala Ser Asn 210 2l5 220 Leu I1e Thr Phe His Ile Ser Lys Val Glu Asp Leu Asn Leu Glu Ser Val Asp Gly Lys Va1 Cys Asn Leu Asn Phe Ile Ser Lys Lys Ser Ile Ser Leu Ile Phe Phe Ile Asn Asn Arg Leu Val Thr Cys Asp Leu Leu Arg Arg Ala Leu Asn Ser Val Tyr Ser Asn Tyr Leu Pro Lys Gly Phe Arg Pro Phe Ile Tyr Leu Gly Ile Val Ile Asp Pro Ala Ala Val Asp Val Asn Val His Pro Thr Lys Arg Glu Val Arg Phe Leu Ser Gln Asp Glu Ile Ile Glu Lys Ile A1a Asn Gln Leu His Ala Glu Leu Ser Ala Ile Asp Thr Ser Arg Thr Phe Lys Ala Ser Ser T1e Ser Thr Asn Lys Pro Glu Ser Leu Ile Pro Phe Asn Asp Thr Ile Glu Ser Asp Arg Asn Arg Lys Ser Leu Arg Gln Ala Gln Val Val Glu Asn Ser Tyr Thr Thr Ala Asn Ser Gln Leu Arg Lys Ala Lys Arg Gln Glu Asn Lys Leu Va1 Arg I1e Asp Ala Ser Gln Ala Lys Ile Thr Ser Phe Leu Ser Ser Ser Gln Gln Phe Asn Phe Glu Gly Ser Ser Thr Lys Arg Gln Leu Ser Glu Pro Lys Val Thr Asn Val Ser His Ser Gln Glu Ala Glu Lys Leu Thr Leu Asn Glu Ser Glu Gln Pro Arg Asp Ala Asn Thr Ile Asn Asp Asn MOR0252.ST25.txt Asp Leu Lys Asp Gln Pro Lys Lys Lys Gln Lys Leu Gly Asp Tyr Lys Val Pro Ser Ile Ala Asp Asp Glu Lys Asn Ala Leu Pro Ile Ser Lys Asp Gly Tyr Ile Arg Val Pro Lys Glu Arg Val Asn Val Asn Leu Thr Ser Ile Lys Lys Leu Arg Glu Lys Val Asp Asp Ser Ile His Arg Glu Leu Thr Asp Ile Phe Ala Asn Leu Asn Tyr Val Gly Val Val Asp Glu Glu Arg Arg Leu A1a Ala Tle Gln His Asp Leu Lys Leu Phe Leu Ile Asp Tyr Gly Ser Val Cys Tyr Glu Leu Phe Tyr Gln Ile G1y Leu Thr Asp Phe Ala Asn Phe Gly Lys Ile Asn Leu Gln Ser Thr Asn Val Ser Asp Asp Ile Val Leu Tyr Asn Leu Leu Ser Glu Phe Asp Glu Leu Asn Asp Asp Ala Ser Lys Glu Lys Ile Ile Ser Lys Ile Trp Asp Met Ser Ser Met Leu Asn Glu Tyr Tyr Ser Ile Glu Leu Val Asn Asp G1y Leu Asp Asn Asp Leu Lys Ser Val Lys Leu Lys Ser Leu Pro Leu Leu Leu Lys Gly Tyr Ile Pro Ser Leu Val Lys Leu Pro Phe Phe Ile Tyr Arg Leu Gly Lys G1u Val Asp Trp Glu Asp Glu Gln Glu Cys Leu Asp Gly Ile Leu Arg Glu Ile Ala Leu Leu Tyr Ile Pro Asp Met Val Pro Lys Val Asp Thr Leu Asp Ala Ser Leu 5er Glu Asp Glu Lys Ala Gln Phe Ile Asn Arg Lys Glu His Ile Ser Ser Leu Leu Glu His Val Leu Phe MOR0252.ST25.txt Pro Cys Ile Lys Arg Arg Phe Leu Ala Pro Arg His Ile Leu Lys Asp Val Val Glu Tle Ala Asn Leu Pro Asp Leu Tyr Lys Val Phe Glu Arg Cys <210>

<211>

<212>
DNA

<213> musculus Mus <400>

gaattccggtgaaggtcctgaagaatttccagattcctgagtatcattggaggagacaga60 taacctgtcgtcaggtaacgatggtgtatatgcaacagaaatgggtgttcctggagacgc120 gtcttttcccgagagcggcaccgcaactctcccgcggtgactgtgactggaggagtcctg180 catccatggagcaaaccgaaggcgtgagtacagaatgtgctaaggccatcaagcctattg240 atgggaagtcagtccatcaaatttgttctgggcaggtgatactcagtttaagcaccgctg300 tgaaggagttgatagaaaatagtgtagatgctggtgctactactattgatctaaggctta360 aagactatggggtggacctcattgaagtttcagacaatggatgtggggtagaag,aagaaa420 actttgaaggtctagctctgaaacatcacacatctaagattcaagagtttgccgacctca480 cgcaggttgaaactttcggctttcggggggaagctctgagctctctgtgtgcactaagtg540 atgtcactatatctacctgccacgggtctgcaagcgttgggactcgactggtgtttgacc600 ataatgggaaaatcacccagaaaactccctacccccgacctaaaggaaccacagtcagtg660 tgcagcacttattttatacactacccgtgcgttacaaagagtttcagaggaacattaaaa720 aggagtattccaaaatggtgcaggtcttacaggcgtactgtatcatctcagcaggcgtcc780 gtgtaagctgcactaatcagctcggacaggggaagcggcacgctgtggtgtgcacaagcg840 gcacgtctggcatgaaggaaaatatcgggtctgtgtttggccagaagcagttgcaaagcc900 tcattccttttgttcagctgccccctagtgacgctgtgtgtgaagagtacggcctgagca960 cttcaggacgccacaaaaccttttctacgtttcgggcttcatttcacagtgcacgcacgg1020 cgccgggaggagtgcaacagacaggcagtttttcttcatcaatcagaggccctgtgaccc1080 agcaaaggtctctaagcttgtcaatgaggttttatcacatgtataaccggcatcagtacc1140 catttgtcgtccttaacgtttccgttgactcagaatgtgtggatattaatgtaactccag1200 ataaaaggcaaattctactacaagaagagaagctattgctggccgttttaaagacctcct1260 tgataggaatgtttgacagtgatgcaaacaagcttaatgtcaaccagcagccactgctag1320 atgttgaaggtaacttagtaaagctgcatactgcagaactagaaaagcctgtgccaggaa1380 agcaagataactctccttcactgaagagcacagcagacgagaaaagggtagcatccatct1440 ccaggctgagagaggccttttctcttcatcctactaaagagatcaagtctaggggtccag1500 agactgctgaactgacacggagttttccaagtgagaaaaggggcgtgttatcctcttatc1560 Page MOR0252.ST25.txt cttcagacgtcatctcttacagaggcctccgtggctcgcaggacaaattggtgagtccca1620 cggacagccctggtgactgtatggacagagagaaaatagaaaaagactcagggctcagca1680 gcacctcagctggctctgaggaagagttcagcaccccagaagtggccagtagctttagca1740 gtgactataacgtgagctccctagaagacagaccttctcaggaaaccataaactgtggtg1800 acctggactgccgtcctccaggtacaggacagtccttgaagccagaagaccatggatatc1860 aatgcaaagctctacctctagctcgtctgtcacccacaaatgccaagcgcttcaagacag1920 aggaaagaccctcaaatgtcaacatttctcaaagattgcctggtcctcagagcacctcag1980 cagctgaggtcgatgtagccataaaaatgaataagagaatcgtgctcctcgagttctctc2040 tgagttctctagctaagcgaatgaagcagttacagcacctaaaggcgcagaacaaacatg2100 aactgagttacagaaaatttagggccaagatttgccctggagaaaaccaagcagcagaag2160 atgaactcagaaaagagattagtaaatcgatgtttgcagagatggagatcttgggtcagt2220 ttaacctgggatttatagtaaccaaactgaaagaggacctcttcctggtggaccagcatg2280 ctgcggatgagaagtacaactttgagatgctgcagcagcacacggtgctccaggcgcaga2340 ggctcatcacaccccagactctgaacttaactgctgtcaatgaagctgtactgatagaaa2400 atctggaaatattcagaaagaatggctttgactttgtcattgatgaggatgctccagtca2460 ctgaaagggctaaattgatttccttaccaactagtaaaaactggacctttggaccccaag2520 atatagatgaactgatctttatgttaagtgacagccctggggtcatgtgccggccctcac2580 gagtcagacagatgtttgcttccagagcctgtcggaagtcagtgatgattggaacggcgc2640 tcaatgcgagcgagatgaagaagctcatcacccacatgggtgagatggaccacccctgga2700 actgcccccacggcaggccaaccatgaggcacgttgccaatctggatgtcatctctcaga2760 actgacacaccccttgtagcatagagtttattacagattgttcggtttgcaaagagaagg2820 ttttaagtaatctgattatcgttgtacaaaaattagcatgctgctttaatgtactggatc2880 catttaaaagcagtgttaaggcaggcatgatggagtgttcctctagctcagctacttggg2940 tgatccggtgggagctcatgtgagcccaggactttgagaccactccgagccacattcatg3000 agactcaattcaaggacaaaaaaaaaaagatatttttgaagccttttaaaaaaaaa 3056 <210> 32 <211> 859 <212> PRT
<213> Mus musculus <400> 32 Met Glu Gln Thr Glu Gly Va1 Ser Thr G1u Cys Ala Lys Ala Ile Lys Pro Ile Asp Gly Lys Ser Val His Gln Ile Cys Ser Gly Gln Val I1e Leu Ser Leu Ser Thr Ala Val Lys Glu Leu Ile Glu Asn Ser Val Asp MOR0252.ST25.txt Ala Gly Ala Thr Thr Ile Asp Leu Arg Leu Lys Asp Tyr Gly Val Asp Leu Ile Glu Val Ser Asp Asn Gly Cys Gly Val Glu Glu Glu Asn Phe Glu Gly Leu Ala Leu Lys His His Thr Ser Lys Ile Gln Glu Phe Ala Asp Leu Thr Gln Val Glu Thr Phe Gly Phe Arg Gly Glu Ala Leu Ser Ser Leu Cys Ala Leu Ser Asp Val Thr Ile Ser Thr Cys His Gly Ser A1a Ser Val Gly Thr Arg Leu Val Phe Asp His Asn Gly Lys Ile Thr Gln Lys Thr Pro Tyr Pro Arg Pro Lys Gly Thr Thr Val Ser Val Gln His Leu Phe Tyr Thr Leu Pro Val Arg Tyr Lys Glu Phe G1n Arg Asn Ile Lys Lys Glu Tyr Ser Lys Met Val Gln Val Leu Gln Ala Tyr Cys Tle Ile Ser Ala Gly Val Arg Val Ser Cys Thr Asn Gln Leu Gly G1n Gly Lys Arg His Ala Val Val Cys Thr Ser Gly Thr Ser Gly Met Lys Glu Asn Ile Gly Ser Val Phe Gly Gln Lys Gln Leu Gln Ser Leu Ile Pro Phe Val G1n Leu Pro Pro Ser Asp Ala Val Cys Glu Glu Tyr Gly Leu Ser Thr Ser Gly Arg His Lys Thr Phe Ser Thr Phe Arg Ala Ser Phe His Ser Ala Arg Thr Ala Pro Gly Gly Val Gln Gln Thr Gly Ser Phe Ser Ser Ser Ile Arg Gly Pro Val Thr Gln Gln Arg Ser Leu Ser Leu Ser Met Arg Phe Tyr His Met Tyr Asn Arg His Gln Tyr Pro Phe Val Val Leu Asn Val Ser Val Asp Ser Glu Cys Va1 Asp Ile Asn Val MOR0252.ST25.txt Thr Pro Asp Lys Arg Gln Ile Leu Leu Gln Glu Glu Lys Leu Leu Leu Ala Va1 Leu Lys Thr Ser Leu Ile Gly Met Phe Asp Ser Asp Ala Asn Lys Leu Asn Val Asn Gln Gln Pro Leu Leu Asp Val Glu Gly Asn Leu Val Lys Leu His Thr Ala Glu Leu Glu Lys Pro Val Pro Gly Lys Gln Asp Asn Ser Pro 5er Leu Lys Ser Thr Ala Asp Glu Lys Arg Val Ala Ser Ile Ser Arg Leu Arg Glu Ala Phe Ser Leu His Pro Thr Lys Glu Ile Lys Ser Arg Gly Pro Glu Thr Ala Glu Leu Thr Arg Ser Phe Pro Ser Glu Lys Arg Gly Val Leu Ser Ser Tyr Pro Ser Asp Val Ile Ser Tyr Arg Gly Leu Arg G1y Ser Gln Asp Lys Leu Val Ser Pro Thr Asp Ser Pro Gly Asp Cys Met Asp Arg Glu Lys Ile Glu Lys Asp Ser Gly Leu Ser Ser Thr Ser Ala Gly Ser Glu Glu Glu Phe Ser Thr Pro Glu Val Ala Ser Ser Phe Ser Ser Asp Tyr Asn Val Ser Ser Leu Glu Asp Arg Pro Ser Gln Glu Thr Ile Asn Cys Gly Asp Leu Asp Cys Arg Pro Pro Gly Thr Gly G1n Ser Leu Lys Pro Glu Asp His Gly Tyr Gln Cys Lys Ala Leu Pro Leu Ala Arg Leu Ser Pro Thr Asn Ala Lys Arg Phe Lys Thr Glu Glu Arg Pro Ser Asn Val Asn Ile Ser Gln Arg Leu Pro Gly Pro Gln Ser Thr Ser Ala Ala Glu Val Asp Val Ala Ile Lys Met MOR0252.ST25.txt Asn Lys Arg Ile Val Leu Leu Glu Phe Ser Leu Ser Ser Leu Ala Lys Arg Met Lys Gln Leu Gln His Leu Lys Ala Gln Asn Lys His Glu Leu Ser Tyr Arg Lys Phe Arg Ala Lys Ile Cys Pro Gly Glu Asn Gln Ala Ala Glu Asp Glu Leu Arg Lys Glu Ile Ser Lys 5er Met Phe Ala Glu Met Glu Tle Leu Gly Gln Phe Asn Leu Gly Phe Ile Val Thr Lys Leu Lys Glu Asp Leu Phe Leu Val Asp Gln His Ala Ala Asp Glu Lys Tyr Asn Phe Glu Met Leu Gln Gln His Thr Val Leu Gln Ala Gln Arg Leu Ile Thr Pro Gln Thr Leu Asn Leu Thr Ala Val Asn Glu Ala Val Leu Ile Glu Asn Leu Glu Ile Phe Arg Lys Asn Gly Phe Asp Phe Val Ile Asp Glu Asp Ala Pro Val Thr Glu Arg Ala Lys Leu Tle Ser Leu Pro Thr Ser Lys Asn Trp Thr Phe Gly Pro Gln Asp Ile Asp Glu Leu I1e Phe Met Leu Ser Asp Ser Pro Gly Val Met Cys Arg Pro Ser Arg Val Arg Gln Met Phe Ala Ser Arg Ala Cys Arg Lys Ser Val Met Ile Gly Thr A1a Leu Asn Ala Ser Glu Met Lys Lys Leu I1e Thr His Met Gly Glu Met Asp His Pro Trp Asn Cys Pro His Gly Arg Pro Thr Met Arg His Val Ala Asn Leu Asp Val Ile Ser Gln Asn <210> 33 <211> 399 <212> DNA
<213> Mus musculus MOR0252.ST25.txt <400>

atggagcaaaccgaaggcgtgagtacagaatgtgctaaggccatcaagcc tattgatggg60 aagtcagtccatcaaatttgttctgggcaggtgatactcagtttaagcac cgctgtgaag120 gagttgatagaaaatagtgtagatgctggtgctactactattgatctaag gcttaaagac180 tatggggtggacctcattgaagtttcagacaatggatgtggggtagaaga agaaaacttt240 gaaggtctagctctgaaacatcacacatctaagattcaagagtttgccga cctcacgcag300 gttgaaactttcggctttcggggggaagctctgagctctctgtgtgcact aagtgatgtc360 actatatctacctgccacgggtctgcaagcgttgggact 399 <210> 34 <211>, 133 <212> PRT
<213> Mus musculus <400> 34 Met Glu Gln Thr Glu Gly Val Ser Thr Glu Cys Ala Lys Ala Ile Lys Pro Ile Asp Gly Lys Ser Val His Gln Ile Cys Ser Gly Gln Val Ile Leu Ser Leu Ser Thr Ala Val Lys Glu Leu Ile Glu Asn Ser Val Asp Ala Gly Ala Thr Thr Ile Asp Leu Arg Leu Lys Asp Tyr Gly Val Asp Leu I1e Glu Val Ser Asp Asn Gly Cys Gly Val Glu Glu Glu Asn Phe Glu Gly Leu Ala Leu Lys His His Thr Ser Lys Ile Gln G1u Phe Ala Asp Leu Thr Gln Val Glu Thr Phe Gly Phe Arg Gly Glu Ala Leu Ser Ser Leu Cys Ala Leu Ser Asp Val Thr Ile Ser Thr Cys His Gly Ser Ala Ser Val Gly Thr <210> 35 <211> 3099 <212> DNA
<213> Arabidopsis thaliana <400> 35 gtcttcttct tcatccttgt ctcaccttcg attttggcgg caaaacataa accctaaggg 60 ttttctcact ctctctctct cttctcacac acacagtccc agagtacggt ggtgttgatt 120 cgattgagga gattcatctg tttatagggt ttagcaaatg caaggagatt cttctccgtc 180 MOR0252.ST25.txt tccgacgactactagctctcctttgataagacctataaacagaaacgtaattcacagaat240 ctgttccggtcaagtcatcttagacctctcttcggccgtcaaggagcttgtcgagaatag300 tctcgacgccggcgccaccagtatagagattaacctccgagactacggcgaagactattt360 tcaggtcattgacaatggttgtggcatttccccaaccaatttcaaggttcttgcacttaa420 gcatcatacttctaaattagaggatttcacagatcttttgaatttgactacttatggttt480 tagaggagaagccttgagctctctctgtgcattgggaaatctcactgtggaaacaagaac540 ' aaagaatgagccagttgctacgctcttgacgtttgatcattctggtttgcttactgctga600 aaagaagactgctcgccaaattggtaccactgtcactgttaggaagttgttctctaattt660 acctgtacgaagcaaagagtttaagcggaatatacgcaaagaatatgggaagcttgtatc720 tttattgaacgcatatgcgcttattgcgaaaggagtgcggtttgtctgctctaacacgac780 tgggaaaaacccaaagtctgttgtgctgaacacacaagggaggggttcacttaaagataa840 tatcataacagttttcggcattagtacctttacaagtctacagcctgtaagtatatgtgt900 , atcagaagattgtagagttgaagggtttctttccaagcctggacagggtactggacgcaa960 tttagcagatcgacagtatttctttataaatggtcggcctgtagatatgccaaaagtcag1020 caagttggtgaatgagttatataaagatacaagttctcggaaatatccagttaccattct1080 ggattttattgtgcctggtggagcatgtgatttgaatgtcacgcccgataaaagaaaggt1140 gttcttttctgacgagacttctgttatcggttctttgagggaaggtctgaacgagatata1200 ttcctccagtaatgcgtcttatattgttaataggttcgaggagaattcggagcaaccaga1260 taaggctggagtttcgtcgtttcagaagaaatcaaatcttttgtcagaagggatagttct1320 ggatgtcagttctaaaacaagactaggggaagctattgagaaagaaaatccatccttaag1380 ggaggttgaaattgataatagttcgccaatggagaagtttaagtttgagatcaaggcatg1440 tgggacgaagaaaggggaaggttctttatcagtccatgatgtaactcaccttgacaagac1500 acctagcaaaggtttgcctcagttaaatgtgactgagaaagttactgatgcaagtaaaga1560 cttgagcagccgctctagctttgcccagtcaactttgaatacttttgttaccatgggaaa1620 aagaaaacatgaaaacataagcaccatcctctctgaaacacctgtcctcagaaaccaaac1680 ttctagttatcgtgtggagaaaagcaaatttgaagttcgtgccttagcttcaaggtgtct1740 cgtggaaggcgatcaacttgatgatatggtcatctcaaaggaagatatgacaccaagcga1800 aagagattctgaactaggcaatcggatttctcctggaacacaagctgataatgttgaaag1860 acatgagagagaacatgaaaagcctataaggtttgaagaaccaacatcagataacacact1920 caccaagggggatgtggaaagggtttcagaggacaatccacggtgcagtcagccactgcg1980 atctgtggccacagtgctggattccccagctcagtcaaccggtcctaaaatgttttccac2040 attagaatttagtttccaaaacctcaggacaaggaggttagagaggctgtcgagattgca2100 gtccacaggttatgtatctaaatgtatgaatacgccacagcctaaaaagtgctttgccgc2160 tgcaacattagagttatctcaaccggatgatgaagagcgaaaagcaagggctttagctgc2220 agctacttctgagctggaaaggctttttcgaaaagaggatttcaggagaatgcaggtact2280 Page MOR0252.ST25.txt cgggcaattcaatcttgggttcatcattgcaaaattggagcgagatctgttcattgtgga2340 tcagcatgcagctgatgagaaattcaacttcgaacatttagcaaggtcaactgtcctgaa2400 ccagcaacccttactccagcctttgaacttggaactctctccagaagaagaagtaactgt2460 gttaatgcacatggatattatcagggaaaatggctttcttctagaggagaatccaagtgc2520 tcctcccggaaaacactttagactacgagccattccttatagcaagaatatcacctttgg2580 agtcgaagatcttaaagacctgatctcaactctaggagataaccatggggaatgttcggt2640 tgctagtagctacaaaaccagcaaaacagattcgatttgtccatcacgagtccgtgcaat2700 gctagcatcccgagcatgcagatcatctgtgatgatcggagatccactcagaaaaaacga2760 aatgcagaagatagtagaacacttggcagatctcgaatctccttggaattgcccacacgg2820 acgaccaacaatgcgtcatcttgtggacttgacaactttactcacattacctgatgacga2880 caatgtcaatgatgatgatgatgatgatgcaaccatctcattggcatgaacactcaaaag2940 tcttaacgtatttagatgtgagaatccttaagattaacattgaggaacactcggttataa3000 ctacaatcgtaaatgtaaattgtcttagtctatatgatctttttggtcacaacaggtaat3060 ttcattttcctttgattacttctcgtgaaaaaacaaatt 3099 <210> 36 <211> 923 <212> PRT
<213> Arabidopsis thaliana <400> 36 Met Gln Gly Asp Ser Ser Pro Ser Pro Thr Thr Thr Ser Ser Pro Leu Ile Arg Pro Ile Asn Arg Asn Val Ile His Arg Ile Cys Ser Gly Gln Val Ile Leu Asp Leu Ser Ser Ala Val Lys G1u Leu Val Glu Asn Ser Leu Asp Ala Gly Ala Thr Ser Ile Glu Ile Asn Leu Arg Asp Tyr Gly Glu Asp Tyr Phe Gln Va1 Ile Asp Asn G1y Cys Gly Ile Ser Pro Thr Asn Phe Lys Val Leu Ala Leu Lys His His Thr Ser Lys Leu Glu Asp Phe Thr Asp Leu Leu Asn Leu Thr Thr Tyr Gly Phe Arg Gly Glu Ala Leu Ser Ser Leu Cys Ala Leu G1y Asn Leu Thr Val Glu Thr Arg Thr Lys Asn Glu Pro Val Ala Thr Leu Leu Thr Phe Asp His Ser Gly Leu MOR0252.ST25.txt Leu Thr Ala Glu Lys Lys Thr Ala Arg Gln Ile Gly Thr Thr Val Thr Val Arg Lys Leu Phe Ser Asn Leu Pro Val Arg Ser Lys Glu Phe Lys Arg Asn Ile Arg Lys Glu Tyr Gly Lys Leu Val Ser Leu Leu Asn Ala Tyr Ala Leu Ile A1a Lys Gly Val Arg Phe Val Cys Ser Asn Thr Thr Gly Lys Asn Pro Lys Ser Val Val Leu Asn Thr Gln Gly Arg Gly Ser Leu Lys Asp Asn Ile Tle Thr Val Phe Gly Ile Ser Thr Phe Thr Ser Leu Gln Pro Val Ser Ile Cys Val Ser Glu Asp Cys Arg Val Glu Gly Phe Leu Ser Lys Pro Gly Gln Gly Thr Gly Arg Asn Leu Ala Asp Arg Gln Tyr Phe Phe Ile Asn Gly Arg Pro Val Asp Met Pro Lys Val Ser Lys Leu Val Asn Glu Leu Tyr Lys Asp Thr Ser Ser Arg Lys Tyr Pro Val Thr Ile Leu Asp Phe Ile Val Pro Gly Gly Ala Cys Asp Leu Asn Val Thr Pro Asp Lys Arg Lys Val Phe Phe Ser Asp Glu Thr Ser Val Ile Gly Ser Leu Arg Glu Gly Leu Asn Glu Ile Tyr Ser Ser Ser Asn Ala Ser Tyr Ile Val Asn Arg Phe Glu Glu Asn Ser Glu Gln Pro Asp Lys Ala Gly Val Ser Ser Phe Gln Lys Lys Ser Asn Leu Leu Ser Glu Gly Ile Val Leu Asp Val Ser Ser Lys Thr Arg Leu Gly Glu Ala Ile Glu Lys Glu Asn Pro Ser Leu Arg Glu Val Glu Ile Asp Asn Ser Ser MOR0252.ST25.txt Pro Met Glu Lys Phe Lys Phe Glu Ile Lys Ala Cys Gly Thr Lys Lys Gly Glu Gly Ser Leu Ser Val His Asp Val Thr His Leu Asp Lys Thr Pro Ser Lys Gly Leu Pro Gln Leu Asn Val Thr Glu Lys Val Thr Asp Ala Ser Lys Asp Leu Ser Ser Arg Ser Ser Phe Ala Gln Ser Thr Leu Asn Thr Phe Val Thr Met G1y Lys Arg Lys His Glu Asn Ile Ser Thr Ile Leu Ser Glu Thr Pro Val Leu Arg Asn Gln Thr Ser Ser Tyr Arg Val Glu Lys Ser Lys Phe Glu Val Arg Ala Leu Ala Ser Arg Cys Leu Val Glu Gly Asp Gln Leu Asp Asp Met Val Ile Ser Lys Glu Asp Met Thr Pro Ser Glu Arg Asp Ser Glu Leu Gly Asn Arg 21e Ser Pro Gly Thr Gln Ala Asp Asn Val Glu Arg His G1u Arg Glu His Glu Lys Pro Ile Arg Phe G1u Glu Pro Thr 5er Asp Asn Thr Leu Thr Lys Gly Asp Val Glu Arg Val Ser Glu Asp Asn Pro Arg Cys Ser Gln Pro Leu Arg Ser Val Ala Thr Val Leu Asp Ser Pro Ala Gln Ser Thr Gly Pro Lys Met Phe Ser Thr Leu Glu Phe Ser Phe Gln Asn Leu Arg Thr Arg Arg Leu Glu Arg Leu Ser Arg Leu Gln Ser Thr Gly Tyr Val Ser Lys Cys Met Asn Thr Pro Gln Pro Lys Lys Cys Phe Ala Ala Ala Thr Leu Glu Leu Ser Gln Pro Asp Asp Glu Glu Arg Lys Ala Arg Ala Leu Ala Ala Ala Thr Ser Glu Leu Glu Arg Leu Phe Arg Lys Glu Asp Phe Arg Arg M0R0252.ST25.txt Met Gln Val Leu Gly Gln Phe Asn Leu Gly Phe Ile Ile Ala Lys Leu Glu Arg Asp Leu Phe Ile Val Asp Gln His Ala Ala Asp Glu Lys Phe Asn Phe Glu His Leu Ala Arg Ser Thr Val Leu Asn G1n G1n Pro Leu Leu Gln Pro Leu Asn Leu Glu Leu Ser Pro Glu Glu Glu Val Thr Val Leu Met His Met Asp Ile Ile Arg Glu Asn Gly Phe Leu Leu G1u Glu Asn Pro Ser Ala Pro Pro Gly Lys His Phe Arg Leu Arg Ala Ile Pro Tyr Ser Lys Asn Ile Thr Phe Gly Val Glu Asp Leu Lys Asp Leu Ile Ser Thr Leu Gly Asp Asn His Gly Glu Cys Ser Val Ala Ser Ser Tyr Lys Thr Ser Lys Thr Asp Ser Ile Cys Pro Ser Arg Val Arg Ala Met Leu Ala Ser Arg Ala Cys Arg Ser Ser Val Met Ile Gly Asp Pro Leu Arg Lys Asn Glu Met Gln Lys Ile Val Glu His Leu Ala Asp Leu Glu Ser Pro Trp Asn Cys Pro His Gly Arg Pro Thr Met Arg His Leu Val Asp Leu Thr Thr Leu Leu Thr Leu Pro Asp Asp Asp Asn Val Asn Asp Asp Asp Asp Asp Asp Ala Thr Ile Ser Leu Ala <210> 37 <211> 399 <212> DNA
<213> Arabidopsis thaliana <400> 37 atgcaaggag attcttctcc gtctccgacg actactagct ctcctttgat aagacctata 60 aacagaaacg taattcacag aatctgttcc ggtcaagtca tcttagacct ctcttcggcc 120 gtcaaggagc ttgtcgagaa tagtctcgac gccggcgcca ccagtataga gattaacctc 180 MOR0252.ST25.txt cgagactacg gcgaagacta ttttcaggtc attgacaatg gttgtggcat ttccccaacc 240 aatttcaagg ttcttgcact taagcatcat acttctaaat tagaggattt cacagatctt 300 ttgaatttga ctacttatgg ttttagagga gaagccttga gctctctctg tgcattggga 360 aatctcactg tggaaacaag aacaaagaat gagccagtt 399 <210> 38 <211> 133 <212> PRT
<213> Arabidopsis thaliana <400> 38 Met Gln Gly Asp Ser Ser Pro Ser Pro Thr Thr Thr Ser Ser Pro Leu Ile Arg Pro Tle Asn Arg Asn Val Ile His Arg Il.e Cys Ser Gly Gln Val Ile Leu Asp Leu Ser Ser Ala Val Lys Glu Leu Val Glu Asn Ser Leu Asp Ala Gly Ala Thr Ser Ile Glu Ile Asn Leu Arg Asp Tyr Gly Glu Asp Tyr Phe Gln Val Ile Asp Asn Gly Cys Gly Ile Ser Pro Thr Asn Phe Lys Val Leu Ala Leu Lys His His Thr Ser Lys Leu Glu Asp Phe Thr Asp Leu Leu Asn Leu Thr Thr Tyr Gly Phe Arg Gly Glu Ala Leu Ser Ser Leu Cys Ala Leu Gly Asn Leu Thr Val Glu Thr Arg Thr Lys Asn Glu Pro Val <210> 39 <211> 2772 <212> DNA
<213> Arabidopsis thaliana <400>

atgcaaggagattcttctccgtctccgacgactactagctctcctttgataagacctata60 aacagaaacgtaattcacagaatctgttccggtcaagtcatcttagacctctcttcggcc120 gtcaaggagcttgtcgagaatagtctcgacgccggcgccaccagtatagagattaacctc180 cgagactacggcgaagactattttcaggtcattgacaatggttgtggcatttccccaacc240 aatttcaaggttcttgcacttaagcatcatacttctaaattagaggatttcacagatctt300 ttgaatttgactacttatggttttagaggagaagccttgagctctctctgtgcattggga360 Page MOR0252.ST25.txt aatctcactgtggaaacaagaacaaagaatgagccagttgctacgctcttgacgtttgat420 cattctggtttgcttactgctgaaaagaagactgctcgccaaattggtaccactgtcact480 gttaggaagttgttctctaatttacctgtacgaagcaaagagtttaagcggaatatacgc540 aaagaatatgggaagcttgtatctttattgaacgcatatgcgcttattgcgaaaggagtg600 cggtttgtctgctctaacacgactgggaaaaacccaaagtctgttgtgctgaacacacaa660 gggaggggttcacttaaagataatatcataacagttttcggcattagtacctttacaagt720 ctacagcctgtaagtatatgtgtatcagaagattgtagagttgaagggtttctttccaag780 cctggacagggtactggacgcaatttagcagatcgacagtatttctttataaatggtcgg840 cctgtagatatgccaaaagtcagcaagttggtgaatgagttatataaagatacaagttct900 cggaaatatccagttaccattctggattttattgtgcctggtggagcatgtgatttgaat960 gtcacgcccgataaaagaaaggtgttcttttctgacgagacttctgttatcggttctttg1020 agggaaggtctgaacgagatatattcctccagtaatgcgtcttatattgttaataggttc1080 gaggagaattcggagcaaccagataaggctggagtttcgtcgtttcagaagaaatcaaat1140 cttttgtcagaagggatagttctggatgtcagttctaaaacaagactaggggaagctatt1200 gagaaagaaaatccatccttaagggaggttgaaattgataatagttcgccaatggagaag1260 tttaagtttgagatcaaggcatgtgggacgaagaaaggggaaggttctttatcagtccat1320 gatgtaactcaccttgacaagacacctagcaaaggtttgcctcagttaaatgtgactgag1380 aaagttactgatgcaagtaaagacttgagcagccgctctagctttgcccagtcaactttg1440 aatacttttgttaccatgggaaaaagaaaacatgaaaacataagcaccatcctctctgaa1500 acacctgtcctcagaaaccaaacttctagttatcgtgtggagaaaagcaaatttgaagtt1560 cgtgccttagcttcaaggtgtctcgtggaaggcgatcaacttgatgatatggtcatctca1620 aaggaagatatgacaccaagcgaaagagattctgaactaggcaatcggatttctcctgga1680 acacaagctgataatgttgaaagacatgagagagaacatgaaaagcctataaggtttgaa1740 gaaccaacatcagataacacactcaccaagggggatgtggaaagggtttcagaggacaat1800 ccacggtgcagtcagccactgcgatctgtggccacagtgctggattccccagctcagtca1860 accggtcctaaaatgttttccacattagaatttagtttccaaaacctcaggacaaggagg1920 ttagagaggctgtcgagattgcagtccacaggttatgtatctaaatgtatgaatacgcca1980 cagcctaaaaagtgctttgccgctgcaacattagagttatctcaaccggatgatgaagag2040 cgaaaagcaagggctttagctgcagctacttctgagctggaaaggctttttcgaaaagag2100 gatttcaggagaatgcaggtactcgggcaattcaatcttgggttcatcattgcaaaattg2160 gagcgagatctgttcattgtggatcagcatgcagctgatgagaaattcaacttcgaacat2220 ttagcaaggtcaactgtcctgaaccagcaacccttactccagcctttgaacttggaactc2280 tctccagaagaagaagtaactgtgttaatgcacatggatattatcagggaaaatggcttt2340 cttctagaggagaatccaagtgctcctcccggaaaacactttagactacgagccattcct2400 tatagcaagaatatcacctttggagtcgaagatcttaaagacctgatctcaactctagga2460 Pa ge 83 MOR0252.ST25.txt gataaccatggggaatgttcggttgctagtagctacaaaaccagcaaaacagattcgatt2520 tgtccatcacgagtccgtgcaatgctagcatcccgagcatgcagatcatctgtgatgatc2580 ggagatccactcagaaaaaacgaaatgcagaagatagtagaacacttggcagatctcgaa2640 tctccttggaattgcccacacggacgaccaacaatgcgtcatcttgtggacttgacaact2700 ttactcacattacctgatgacgacaatgtcaatgatgatgatgatgatgatgcaaccatc2760 tcattggcat ga 2772 <210> 40 <211> 923 <212> PRT
<213> Arabidopsis thaliana <400> 40 Met Gln Gly Asp Ser Ser Pro Ser Pro Thr Thr Thr Ser Ser Pro Leu Ile Arg Pro Ile Asn Arg Asn Val Ile His Arg Ile Cys Ser Gly Gln Val Ile Leu Asp Leu Ser Ser Ala Val Lys Glu Leu Val Glu Asn Ser Leu Asp Ala Gly Ala Thr Ser Ile Glu Ile Asn Leu Arg Asp Tyr Gly Glu Asp Tyr Phe Gln Val Ile Asp Asn Gly Cys Gly Ile Ser Pro Thr Asn Phe Lys Val Leu Ala Leu Lys His His Thr Ser Lys Leu G1u Asp Phe Thr Asp Leu Leu Asn Leu Thr Thr Tyr Gly Phe Arg Gly Glu Ala Leu Ser Ser Leu Cys Ala Leu Gly Asn Leu Thr Val Glu Thr Arg Thr Lys Asn Glu Pro Val Ala Thr Leu Leu Thr Phe Asp His Ser Gly Leu Leu Thr Ala Glu Lys Lys Thr Ala Arg Gln Ile Gly Thr Thr Val Thr Val Arg Lys Leu Phe Ser Asn Leu Pro Val Arg Ser Lys Glu Phe Lys Arg Asn Ile Arg Lys Glu Tyr Gly Lys Leu Val Ser Leu Leu Asn Ala Tyr Ala Leu Ile Ala Lys Gly Val Arg Phe Val Cys Ser Asn Thr Thr MOR0252.ST25.txt Gly Lys Asn Pro Lys Ser Val Val Leu Asn Thr Gln G1y Arg Gly Ser Leu Lys Asp Asn Ile Ile Thr Val Phe Gly Tle Ser Thr~Phe Thr Ser Leu Gln Pro Val Ser Ile Cys Val Ser Glu Asp Cys Arg Val Glu Gly Phe Leu Ser Lys Pro Gly Gln Gly Thr Gly Arg Asn Leu Ala Asp Arg Gln Tyr Phe Phe Ile Asn Gly Arg Pro Val Asp Met Pro Lys Val Ser Lys Leu Val Asn Glu Leu Tyr Lys Asp Thr Ser Ser Arg Lys Tyr Pro Val Thr Ile Leu Asp Phe Ile Val Pro Gly Gly Ala Cys Asp Leu Asn Val Thr Pro Asp Lys Arg Lys Val Phe Phe Ser Asp Glu Thr Ser Val Ile Gly Ser Leu Arg Glu Gly Leu Asn Glu Tle Tyr Ser Ser Ser Asn Ala Ser Tyr Ile Val Asn Arg Phe Glu Glu Asn Ser Glu Gln Pro Asp Lys Ala Gly Val Ser Ser Phe Gln Lys Lys Ser Asn Leu Leu Ser Glu Gly Ile Val Leu Asp Val Ser Ser Lys Thr Arg Leu Gly Glu Ala Ile Glu Lys Glu Asn Pro Ser Leu Arg Glu Val Glu Ile Asp Asn Ser Ser Pro Met Glu Lys Phe Lys Phe Glu Ile Lys Ala Cys Gly Thr Lys Lys Gly Glu Gly Ser Leu Ser Val His Asp Val Thr His Leu Asp Lys Thr Pro Ser Lys Gly Leu Pro Gln Leu Asn Val Thr Glu Lys Val Thr Asp Ala Ser Lys Asp Leu Ser Ser Arg Ser Ser Phe Ala Gln Ser Thr Leu MOR0252.ST25.txt Asn Thr Phe Val Thr Met Gly Lys Arg Lys His Glu Asn Ile Ser Thr Ile Leu Ser Glu Thr Pro Val Leu Arg Asn Gln Thr Ser Ser Tyr Arg Val Glu Lys Ser Lys Phe Glu Val Arg Ala Leu Ala Ser Arg Cys Leu Val Glu Gly Asp Gln Leu Asp Asp Met Val Ile Ser Lys Glu Asp Met Thr Pro Ser Glu Arg Asp Ser Glu Leu Gly Asn Arg Ile Ser Pro Gly Thr Gln Ala Asp Asn Val Glu Arg His Glu Arg Glu His Glu Lys Pro Ile Arg Phe Glu Glu Pro Thr Ser Asp Asn Thr Leu Thr Lys Gly Asp Val Glu Arg Val Ser Glu Asp Asn Pro Arg Cys Ser Gln Pro Leu Arg Ser Val Ala Thr Val Leu Asp Ser Pro Ala Gln Ser Thr Gly Pro Lys Met Phe Ser Thr Leu Glu Phe Ser Phe Gln Asn Leu Arg Thr Arg Arg Leu Glu Arg Leu Ser Arg Leu Gln Ser Thr Gly Tyr Val Ser Lys Cys Met Asn Thr Pro Gln Pro Lys Lys Cys Phe Ala Ala Ala Thr Leu G1u Leu Ser Gln Pro Asp Asp Glu Glu Arg Lys Ala Arg Ala Leu Ala Ala Ala Thr Ser Glu Leu Glu Arg Leu Phe Arg Lys Glu Asp Phe Arg Arg Met Gln Val Leu Gly G1n Phe Asn Leu G1y Phe Ile Ile Ala Lys Leu Glu Arg Asp Leu Phe Ile Val Asp Gln His Ala Ala Asp Glu Lys Phe Asn Phe Glu His Leu Ala Arg Ser Thr Val Leu Asn Gln Gln Pro Leu Leu Gln Pro Leu Asn Leu Glu Leu Ser Pro Glu Glu Glu Val Thr Val MOR0252.ST25.txt Leu Met His Met Asp Ile Tle Arg Glu Asn Gly Phe Leu Leu Glu Glu Asn Pro Ser Ala Pro Pro Gly Lys His Phe Arg Leu Arg Ala Ile Pro Tyr Ser Lys Asn Ile Thr Phe Gly Val Glu Asp Leu Lys Asp Leu Ile Ser Thr Leu G1y Asp Asn His Gly Glu Cys Ser Val Ala Ser Ser,Tyr Lys Thr Ser Lys Thr Asp Ser Ile Cys Pro Ser Arg Val Arg Ala Met Leu Ala Ser Arg Ala Cys Arg Ser Ser Val Met Ile Gly Asp Pro Leu Arg Lys Asn Glu Met Gln Lys Ile Val Glu His Leu A1a Asp Leu Glu Ser Pro Trp Asn Cys Pro His Gly Arg Pro Thr Met Arg His Leu Val Asp Leu Thr Thr Leu Leu Thr Leu Pro Asp Asp Asp Asn Val Asn Asp Asp Asp Asp Asp Asp A1a Thr Ile Ser Leu Ala 915 920 .
<210> 41 <211> 3466 <212> DNA
<213> Arabidopsis thaliana <400>

ttcgaattctctcagctcaaaacatcgtttctctctcactctctctcacaattccaaaaa60 atgcagcgccagagatcgattttgtctttcttccaaaaacccacggcggcgactacgaag120 ggtttggtttccggcgatgctgctagcggcgggggcggcagcggaggaccacgatttaat180 gtgaaggaaggggatgctaaaggcgacgcttctgtacgttttgctgtttcgaaatctgtc240 gatgaggttagaggaacggatactccaccggagaaggttccgcgtcgtgtcctgccgtct300 ggatttaagccggctgaatccgccggtgatgcttcgtccctgttctccaatattatgcat360 aagtttgtaaaagtcgatgatcgagattgttctggagagaggagccgagaagatgttgtt420 ccgctgaatgattcatctctatgtatgaaggctaatgatgttattcctcaatttcgttcc480 aataatggtaaaactcaagaaagaaaccatgcttttagtttcagtgggagagctgaactt540 agatcagtagaagatataggagtagatggcgatgttcctggtccagaaacaccagggatg600 cgtccacgtgcttctcgcttgaagcgagttctggaggatgaaatgacttttaaggaggat660 Page MOR0252.ST25.txt aaggttcctgtattggactctaacaaaaggctgaaaatgctccaggatccggtttgtgga720 gagaagaaagaagtaaacgaaggaaccaaatttgaatggcttgagtcttctcgaatcagg780 gatgccaatagaagacgtcctgatgatcccctttacgatagaaagaccttacacatacca840 cctgatgttttcaagaaaatgtctgcatcacaaaagcaatattggagtgttaagagtgaa900 tatatggacattgtgcttttctttaaagtggggaaattttatgagctgtatgagctagat960 gcggaattaggtcacaaggagcttgactggaagatgaccatgagtggtgtgggaaaatgc1020 agacaggttggtatctctgaaagtgggatagatgaggcagtgcaaaagctattagctcgt1080 ggatataaagttggacgaatcgagcagctagaaacatctgaccaagcaaaagccagaggt1140 gctaatactataattccaaggaagctagttcaggtattaactccatcaacagcaagcgag1200 ggaaacatcgggcctgatgccgtccatcttcttgctataaaagagatcaaaatggagcta1260 caaaagtgttcaactgtgtatggatttgcttttgttgactgtgctgccttgaggttttgg1320 gttgggtccatcagcgatgatgcatcatgtgctgctcttggagcgttattgatgcaggtt1380 tctccaaaggaagtgttatatgacagtaaagggctatcaagagaagcacaaaaggctcta1440 aggaaatatacgttgacagggtctacggcggtacagttggctccagtaccacaagtaatg1500 ggggatacagatgctgctggagttagaaatataatagaatctaacggatactttaaaggt1560 tcttctgaatcatggaactgtgctgttgatggtctaaatgaatgtgatgttgcccttagt1620 gctcttggagagctaattaatcatctgtctaggctaaagctagaagatgtacttaagcat1680 ggggatatttttccataccaagtttacaggggttgtctcagaattgatggccagacgatg1740 gtaaatcttgagatatttaacaatagctgtgatggtgtccttcagggacccttgaacaaa1800 tatcttgaaaactgtgttagtccaactggtaagcgactcttaaggaattggatctgccat1860 ccactcaaagatgtagaaagcatcaataaacggcttgatgtagttgaagaattcacggca1920 aactcagaaagtatgcaaatcactggccagtatctccacaaacttccagacttagaaaga1980 ctgctcggacgcatcaagtctagcgttcgatcatcagcctctgtgttgcctgctcttctg2040 gggaaaaaagtgctgaaacaacgagttaaagcatttgggcaaattgtgaaagggttcaga2100 agtggaattgatctgttgttggctctacagaaggaatcaaatatgatgagtttgctttat2160 aaactctgtaaacttcctatattagtaggaaaaagcgggctagagttatttctttctcaa2220 ttcgaagcagccatagatagcgactttccaaattatcagaaccaagatgtgacagatgaa2280 aacgctgaaactctcacaatacttatcgaactttttatcgaaagagcaactcaatggtct2340 gaggtcattcacaccataagctgcctagatgtcctgagatcttttgcaatcgcagcaagt2400 ctctctgctggaagcatggccaggcctgttatttttcccgaatcagaagctacagatcag2460 aatcagaaaacaaaagggccaatacttaaaatccaaggactatggcatccatttgcagtt2520 gcagccgatggtcaattgcctgttccgaatgatatactccttggcgaggctagaagaagc2580 agtggcagcattcatcctcggtcattgttactgacgggaccaaacatgggcggaaaatca2640 actcttcttcgtgcaacatgtctggccgttatctttgcccaacttggctgctacgtgccg2700 tgtgagtcttgcgaaatctccctcgtggatactatcttcacaaggcttggcgcatctgat2760 Pa ge 88 MOR0252.ST25.txt agaatcatgacaggagagagtacctttttggtagaatgcactgagacagcgtcagttctt2820 cagaatgcaactcaggattcactagtaatccttgacgaactgggcagaggaactagtact2880 ttcgatggatacgccattgcatactcggtttttcgtcacctggtagagaaagttcaatgt2940 cggatgctctttgcaacacattaccaccctctcaccaaggaattcgcgtctcacccacgt3000 gtcacctcgaaacacatggcttgcgcattcaaatcaagatctgattatcaaccacgtggt3060 tgtgatcaagacctagtgttcttgtaccgtttaaccgagggagcttgtcctgagagctac3120 ggacttcaagtggcactcatggctggaataccaaaccaagtggttgaaacagcatcaggt3180 gctgctcaagccatgaagagatcaattggggaaaacttcaagtcaagtgagctaagatct3240 gagttctcaagtctgcatgaagactggctcaagtcattggtgggtatttctcgagtcgcc3300 cacaacaatgcccccattggcgaagatgactacgacactttgttttgcttatggcatgag3360 atcaaatcctcttactgtgttcccaaataaatggctatgacataacactatctgaagctc3420 gttaagtcttttgcttctctgatgtttattcctcttaaaaaatgcg 3466 <210> 42 <211> 1109 <212> PRT
<213> Arabidopsis thaliana <400> 42 Met Gln Arg Gln Arg Ser Ile Leu Ser Phe Phe Gln Lys Pro Thr Ala Ala Thr Thr Lys Gly Leu Val Ser Gly Asp Ala Ala Ser Gly Gly Gly Gly Ser Gly Gly Pro Arg Phe Asn Val Lys Glu Gly Asp Ala Lys Gly Asp Ala Ser Val Arg Phe Ala Val Ser Lys Ser Val Asp Glu Val Arg Gly Thr Asp Thr Pro Pro Glu Lys Val Pro Arg Arg Val Leu Pro Ser Gly Phe Lys Pro Ala Glu Ser Ala Gly Asp Ala Ser Ser Leu Phe Ser Asn Ile Met His Lys Phe Val Lys Val Asp Asp Arg Asp Cys Ser Gly Glu Arg Ser Arg Glu Asp Val Val Pro Leu Asn Asp Ser Ser Leu Cys Met Lys Ala Asn Asp Val Ile Pro Gln Phe Arg Ser Asn Asn Gly Lys Thr Gln Glu Arg Asn His Ala Phe Ser Phe Ser Gly Arg Ala Glu Leu MOR0252.ST25.txt Arg Ser Val Glu Asp Ile Gly Val Asp Gly Asp Val Pro Gly Pro Glu Thr Pro Gly Met Arg Pro Arg Ala Ser Arg Leu Lys Arg Val Leu Glu Asp Glu Met Thr Phe Lys Glu Asp Lys Val Pro Val Leu Asp Ser Asn Lys Arg Leu Lys Met Leu Gln Asp Pro Val Cys Gly Glu Lys Lys Glu Val Asn Glu Gly Thr Lys Phe Glu Trp Leu Glu Ser Ser Arg Ile Arg Asp Ala Asn Arg Arg Arg Pro Asp Asp Pro Leu Tyr Asp Arg Lys Thr Leu His Ile Pro Pro Asp Val Phe Lys Lys Met Ser Ala Ser Gln Lys Gln Tyr Trp Ser Val Lys Ser Glu Tyr Met Asp I1e Val Leu Phe Phe Lys Val Gly Lys Phe Tyr Glu Leu Tyr Glu Leu Asp Ala Glu Leu Gly His Lys Glu Leu Asp Trp Lys Met Thr Met Ser Gly Val Gly Lys Cys Arg Gln Val Gly Ile Ser Glu Ser Gly Tle Asp Glu Ala Val Gln Lys Leu Leu Ala Arg G1y Tyr Lys Val Gly Arg Ile Glu Gln Leu Glu Thr Ser Asp Gln Ala Lys Ala Arg Gly Ala Asn Thr 21e Ile Pro Arg Lys Leu Val Gln Val Leu Thr Pro Ser Thr Ala Ser G1u Gly Asn Ile Gly Pro Asp Ala Val His Leu Leu Ala Ile Lys Glu Ile Lys Met Glu Leu Gln Lys Cys Ser Thr Val Tyr Gly Phe Ala Phe Val Asp Cys Ala Ala Leu Arg Phe Trp Val Gly Ser Tle Ser Asp Asp Ala Ser Cys Ala Ala MOR0252.ST25.txt Leu Gly Ala Leu Leu Met Gln Val Ser Pro Lys Glu Val Leu Tyr Asp Ser Lys Gly Leu Ser Arg Glu Ala Gln Lys Ala Leu Arg Lys Tyr Thr Leu Thr Gly Ser Thr Ala Val Gln Leu Ala Pro Val Pro Gln Val Met Gly Asp Thr Asp Ala Ala Gly Val Arg Asn Ile Ile Glu Ser Asn Gly Tyr Phe Lys Gly Ser Ser Glu Ser Trp Asn Cys Ala Val Asp Gly Leu Asn Glu Cys Asp Val Ala Leu Ser Ala Leu Gly Glu Leu Ile Asn His Leu Ser Arg Leu Lys Leu Glu Asp Val Leu Lys His Gly Asp Ile Phe Pro Tyr Gln Va1 Tyr Arg Gly Cys Leu Arg Ile Asp Gly Gln Thr Met Val Asn Leu Glu Ile Phe Asn Asn Ser Cys Asp Gly Val Leu Gln Gly Pro Leu Asn Lys Tyr Leu Glu Asn Cys Val Ser Pro Thr Gly Lys Arg Leu Leu Arg Asn Trp Ile Cys His Pro Leu Lys Asp Val G1u Ser Ile Asn Lys Arg Leu Asp Val Val Glu Glu Phe Thr Ala Asn Ser Glu Ser Met Gln Ile Thr Gly Gln Tyr Leu His Lys Leu Pro Asp Leu Glu Arg Leu Leu Gly Arg Ile Lys Ser Ser Val Arg Ser Se,r Ala Ser Val Leu Pro Ala Leu Leu Gly Lys Lys Val Leu Lys Gln Arg Val Lys Ala Phe Gly Gln Ile Val Lys Gly Phe Arg Ser Gly Ile Asp Leu Leu Leu Ala Leu Gln Lys Glu Ser Asn Met Met Ser Leu Leu Tyr Lys Leu Cys Lys Leu Pro Ile Leu Val Gly Lys Ser Gly Leu Glu Leu Phe Leu Ser Gln MOR0252.ST25.txt Phe Glu Ala Ala Ile Asp Ser Asp Phe Pro Asn Tyr Gln Asn Gln Asp 725 730 ' 735 Val Thr Asp Glu Asn Ala Glu Thr Leu Thr Ile Leu Ile Glu Leu Phe Ile Glu Arg Ala Thr Gln Trp Ser Glu Val Ile His Thr Ile Ser Cys Leu Asp Val Leu Arg Ser Phe Ala Ile Ala Ala Ser Leu Ser Ala Gly Ser Met Ala Arg Pro Val Ile Phe Pro Glu Ser Glu Ala Thr Asp Gln Asn Gln Lys Thr Lys Gly Pro Ile Leu Lys Ile Gln Gly Leu Trp His Pro Phe Ala Val Ala Ala Asp Gly Gln Leu Pro Val Pro Asn Asp Ile Leu Leu Gly Glu Ala Arg Arg Ser Ser G1y Ser Ile His Pro Arg Ser Leu Leu Leu Thr Gly Pro Asn Met Gly Gly Lys Ser Thr Leu Leu Arg Ala Thr Cys Leu Ala Val Ile Phe Ala Gln Leu Gly Cys Tyr Val Pro Cys Glu Ser Cys Glu Ile Ser Leu Val Asp Thr Ile Phe Thr Arg Leu Gly Ala Ser Asp Arg Ile Met Thr G1y Glu Ser Thr Phe Leu Val Glu Cys Thr Glu Thr Ala Ser Val Leu Gln Asn Ala Thr Gln Asp Ser Leu Val Ile Leu Asp Glu Leu Gly Arg Gly Thr Ser Thr Phe Asp Gly Tyr Ala Ile Ala Tyr Ser Val Phe Arg His Leu Val Glu Lys Val Gln Cys Arg Met Leu Phe Ala Thr His Tyr His Pro Leu Thr Lys G1u Phe Ala Ser His Pro Arg Val Thr Ser Lys His Met Ala Cys Ala Phe Lys Ser MOR0252.ST25.trt Arg 5er Asp Tyr Gln Pro Arg Gly Cys Asp Gln Asp Leu Val Phe Leu Tyr Arg Leu Thr Glu Gly Ala Cys Pro Glu Ser Tyr Gly Leu Gln Val Ala Leu Met Ala Gly Ile Pro Asn Gln Val Val Glu Thr Ala 1025 1030 j 1035 Ser Gly Ala Ala Gln Ala Met Lys Arg Ser Ile Gly Glu Asn Phe Lys Ser Ser Glu Leu Arg Ser Glu Phe Ser Ser Leu His Glu Asp Trp Leu Lys Ser Leu Val Gly Tle Ser Arg Val Ala His Asn Asn Ala Pro Ile Gly Glu Asp Asp Tyr Asp Thr Leu Phe Cys Leu Trp His Glu 21e Lys Ser Ser Tyr Cys Val Pro Lys <210> 43 <211> 5307 <212> DNA
<213> Arabidopsis thaliana <400> 43 aaagataagt tcatacgact tttgtggctc atcaaaggcc atcatcgtcc tctatataca 60 atttagtgct ttatagtaca aaaccttcca cttccctttg tccaaagttt tccaatttaa 120 , tttataaacaggaataatattatctatataataaagtgaaaaataactatcattgtccaa180 ataatttggtcgttgatcatgttactacaaagaaatgaaatccttagtagaagtatatat240 atatatatatttgtaacacactcaaaatggtaggtgttgttacagacagatgttcgttag300 cccagtaagcccaatatgagatttaatgggccttgatattttatagaccaaacattgaaa360 cattgcacgcctggtctcaaagaacgttaatacacgcgccgccggttgccgccaatccgc420 tttcccgccaaattcgacaccataaatttcttctagtcgctttcgattccagttccactg480 aaaaaccacgaaagaagaacatttgcaccgtagttgcagaaggtaggtgaaggatttagc540 tttctctatcttccaatggagggtaatttcgaggaacagaacaagcttccggagctgaaa600 ttgggtaatgttaaaccctagttttttttttctttctcattttcgtattcgatttcccaa660 ttgggtttatgggttttgtaaaaggtctgatatttgttatgcattttttttttaattttt720 ggaagatgcaaagcaagctcaagggtttctctcgttctacaaaaccctaccaaatgtaag780 ttctcgttttctttcgatttctgggagaagttagagcttgtacagtgcctctaattgcaa840 taaataacaccaattctagtcggaaagtagatgctttaaaattagggtttgaagcaattg900 tagacattttgttcattgggaagcgaattaggaaaaaaggcttaagattttttagcaatt960 Page MOR0252.ST25.txt tctcgatctt tgcttatgtg ggttttgatt gttctttgct tcaggatacg agagctgtta 1020 gattctttga tcgcaaggtg agttcattgt tctcaaatgg tctagacttt ggttgtttaa 1080 atgtcgtcat tgatttatgg aaattttttg aatgcatttg caggattatt atacagctca 1140 tggtgaaaat tcagttttca ttgcaaagac ttattatcat acaaccactg ctctacgtca 1200 gctcgggagt ggttcaaatg ctctttcaag cgtaagcatt agtaggaaca tgttcgaaac 1260 gattgctagg gatcttctcc tggagcgtaa tgatcatact gtagaacttt atgaaggaag 1320 cggatcgaat tggagacttg tgaaaacagg ttctcctgga aacattggaa gctttgaaga 1380 tgttttgttt gcaaacaatg aaatgcagga cacaccagtt gttgtctcca tatttccaag 1440 ttttcacgat ggcagatgcg ttattgggat ggcctatgtt gatctgacta ggcgagttct 15'00 tggactagct gagtttcttg atgatagccg cttcaccaat ctggagtctt cgttgattgc 1560 tctaggcgca aaagaatgca tttttccagc tgaatccggc aaatccaatg aatgcaaaag 1620 cctgtatgat tccctggaga ggtgtgccgt gatgataaca gagaggaaga aacacgagtt 1680 caaaggaaga gatttagatt cagatcttaa gagattggtg aaggggaata ttgagcctgt 1740 tagagatttg gtatccgggt ttgaccttgc gactcctgct ctaggtgcat tactctcgtt 1800 ttctgaactt ctctcaaatg aggataacta tgggaacttc acaatccgca gatatgatat 1860 tggcggattc atgagacttg actctgcagc tatgagggcg ttgaatgtga tggagagcaa 1920 aactgatgct aataagaatt tcagtttgtt tggtctcatg aacagaacat gtaccgcagg 1980 gatgggtaag agactgcttc atatgtggct gaagcaaccc ctcgtggatt tgaatgagat 2040 taagacgaga ttagatatag ttcagtgctt tgttgaagaa gctgggttaa ggcaggatct 2100 tagacagcat ctgaagcgaa tctcagatgt tgagaggctt ttgcgcagtc tcgagagaag 2160 aagaggtggg ttacagcaca ttattaaact ctatcaggta ctttccgcac ttcaatctgc 2220 ttctctcaat gttaacaaaa ttgcattttc attgtcctaa atgtgtttat gcaactctga 2280 agttataggt atgttattaa gttcattact aattaagtct tcatcttttc tctgcagtca 2340 gctataaggc ttcccttcat caaaacagct atgcaacagt acaccggaga attcgcatca 2400 ctcatcagcg agaggtacct gaaaaagctt gaggctttat cagatcaaga tcaccttgga 2460 aagttcatcg atttggttga gtgctctgta gatcttgacc agctagaaaa tggagaatac 2520 atgatatctt caaactacga caccaaattg gcatctctga aagatcagaa agaattgctg 2580 gagcagcaga ttcacgaatt gcacaaaaag acagcgatag aacttgatct tcaggtcgac 2640 aaggctctta aacttgacaa agcagcgcaa tttgggcatg tcttcaggat cacgaagaag 2700 gaagagccaa agatcaggaa gaagctgacg acacagttta tagtgctgga gactcgcaaa 2760 gacggagtga agttcacaaa cacaaagcta aaaaaactgg gcgaccagta ccaaagtgtt 2820 gtggatgatt ataggagctg tcaaaaggag ctcgttgatc gtgtagttga gactgttacc 2880 agcttctctg aggtatgttt agttattcat attaagcatt ggactgttac agaattggtt 2940 gtttaaaatc atagtaaact atatgtggaa tttatatgta tattgtatgg ttataggtat 3000 ttgaggactt agctgggtta ctttctgaaa tggatgtttt gttaagcttt gctgatttgg 3060 MOR0252.ST25.txt ctgccagttg ccctactcca tactgtaggc cagaaatcac ctctttggtt agtacaatct 3120 caagttgatt attttgttct gaaaatgaat agttttttct ttccaagttt atgacataat 3180 gttgagagca cggttaataa attgtaggat gctggagata ttgtactaga aggaagcaga 3240 catccatgtg tagaagctca agattgggtg aatttcatac caaatgattg cagactcgta 3300 agtattgaat gtggtaaata aactgagacg tctttgtttt tcttgtttcc cttttgactt 3360 gaacaaatac ttgtttgccc tttactgttc tttgaaatca gatgagaggg aagagttggt 3420 ttcaaatagt aacagggcct aacatgggag ggaagtccac tttcatccgc caggtatgat 3480 gatttcctct agttcagttt tgcttcatag acgtatgact aaagtcggtt tccggccatt 3540 ataaatccca ggttggtgtg attgtgctga tggctcaagt tggttccttt gttccttgtg 3600 ataaagcatc aatttccata agagactgca tctttgcccg tgtaggagca ggcgattgcc 3660 aagtgagttt aagtttagcc ctcaatgaac gaaaaactgc tgatatcctg aacaccctta 3720 ttccaacttt ttttcctttg gtgtgttagc tgcgtggagt gtcaactttt atgcaagaaa 3780 tgcttgaaac cgcatcgata ttgaaaggcg ctactgataa gtcactgata attatcgatg 3840 aacttggtcg tggaacatca acttatgatg gttttggtta gtttctctgc aatttctctt 3900 ctttcatttg gatgttttta gtaagttttc tattatatat tcatttttat ggtcatatgt 3960 gagatttcag tgctcttgac atcatcgtgg tgaatatatc aggtttagct tgggctatat 4020 gtgagcatct ggttcaagtg aaaagagcac caactctgtt tgctactcac ttccatgaac 4080 ttactgcctt ggctcaagca aactctgagg tctctggtaa cactgttggt gtggcaaact 4140 tccatgtcag cgctcacatt gacactgaaa gccgcaaact caccatgctt tacaaggtct 4200 ggtttataaa ttaaaaaatt gctgatctgt tgcagttaaa agtgtctctg tttttatgtt 4260 taatctaaat tacttatttg attttcttac aaagatgaaa ttgaaattaa ttttgtgtgg 4320 tgtgttgttt gtctggttag gttgaaccag gggcctgtga ccagagcttt gggattcatg 4380 tggcggaatt tgccaacttc cctgaaagcg tcgtggccct cgcaagagag aaagctgcag 4440 agctggaaga tttctctccc tcctcgatga taatcaacaa tgaggtcttg attcatttcc 4500 ccctttgttt ttggttgatg atggaatcat tctatcattc acccattctg cagtttatgc 4560 tatattatta taaatctatg tgacaaagat ttaattctcg tattgttgtt tgcaggagag 4620 tgggaagaga aagagcagag aagatgatcc agatgaagta tcaagagggg cagagcgagc 4680 tcacaagttt ctgaaagagt ttgcagcgat gccacttgat aaaatggagc ttaaagattc 4740 acttcaacgg gtacgtgaga tgaaagatga gctagagaaa gatgctgcag actgccactg 4800 gctcaggcag tttctgtgaa gaacccctga cgttttttgg tttttggttt tgtaaatagc 4860 ttaaatcggt tcttgtagtt gtggtcgttg cttgggatga aactaaatga gggcaaaaac 4920 ataattctac attttttgtt agtaaagctc gttaatttac tccctagtgc tatcaattat 4980 tttgcctatt ataattgttg atcaagtact tagagcaacc ccaatggttt ctaaacataa 5040 gtttcttatt ttatagagag aaattttatt ataaaaaaat gtgtgggttt cttgattagt 5100 gaagaaacca tctccaaaat accttatatt cttatataag gtattttgga gagaatttct 5160 MOR0252.ST25.txt aactattcaa gaaacttaca taattaaata ctattatttt tattgtttta atgttaagaa 5220 acttatattt aaaaaccacc aatggaattg ctcttagcta ccatacaaat aattataaaa 5280 atatatcgaa aagtagaaga gccattt 5307 <210> 44 <211> 937 <212> PRT
<213> Arabidopsis thaliana <400> 44 Met Glu Gly Asn Phe Glu Glu Gln Asn Lys Leu Pro Glu Leu Lys Leu 1 5 10 l5 Asp Ala Lys Gln Ala Gln Gly Phe Leu Ser Phe Tyr Lys Thr Leu Pro Asn Asp Thr Arg Ala Val Arg Phe Phe Asp Arg Lys Asp Tyr Tyr Thr Ala His Gly Glu Asn Ser Val Phe Ile Ala Lys Thr Tyr Tyr His Thr Thr Thr Ala Leu Arg Gln Leu Gly Ser Gly Ser Asn Ala Leu Ser Ser Val Ser Tle Ser Arg Asn Met Phe Glu Thr Tle Ala Arg Asp Leu Leu Leu Glu Arg Asn Asp His Thr Val Glu Leu Tyr Glu Gly Ser Gly Ser Asn Trp Arg Leu Val Lys Thr Gly Ser Pro Gly Asn Ile Gly Ser Phe G1u Asp Val Leu Phe Ala Asn Asn Glu Met Gln Asp Thr Pro Val Val Val Ser Ile Phe Pro Ser Phe His Asp Gly Arg Cys Val Ile Gly Met Ala Tyr Val Asp Leu Thr Arg Arg Val Leu Gly Leu Ala Glu Phe Leu Asp Asp Ser Arg Phe Thr Asn Leu Glu Ser Ser Leu Ile Ala Leu Gly Ala Lys Glu Cys Ile Phe Pro Ala Glu Ser Gly Lys Ser Asn Glu Cys Lys Ser Leu Tyr Asp Ser Leu Glu Arg Cys Ala Val Met Ile Thr Glu MOR0252.ST25.txt Arg Lys Lys His Glu Phe Lys Gly Arg Asp Leu Asp Ser Asp Leu Lys Arg Leu Val Lys Gly Asn Ile Glu Pro Val Arg Asp Leu Val Ser Gly Phe Asp Leu Ala Thr Pro Ala Leu Gly Ala Leu Leu Ser Phe Ser Glu Leu Leu Ser Asn Glu Asp Asn Tyr Gly Asn Phe Thr Ile Arg Arg Tyr Asp Ile Gly G1y Phe Met Arg Leu Asp Ser Ala Ala Met Arg Ala Leu Asn Val Met Glu Ser Lys Thr Asp Ala Asn Lys Asn Phe Ser Leu Phe Gly Leu Met Asn Arg Thr Cys Thr Ala Gly Met Gly Lys Arg Leu Leu His Met Trp Leu Lys Gln Pro Leu Val Asp Leu Asn Glu Ile Lys Thr Arg Leu Asp Ile Val Gln Cys Phe Val G1u Glu Ala Gly Leu Arg Gln Asp Leu Arg Gln His Leu Lys Arg Ile Ser Asp Val Glu Arg Leu Leu Arg Ser Leu Glu Arg Arg Arg Gly Gly Leu Gln His Ile Ile Lys Leu Tyr Gln Ser Ala Ile Arg Leu Pro Phe Ile Lys Thr Ala Met Gln Gln Tyr Thr Gly Glu Phe Ala Ser Leu Ile Ser Glu Arg Tyr Leu Lys Lys Leu Glu Ala Leu Ser Asp Gln Asp His Leu Gly Lys Phe I1e Asp Leu Val Glu Cys Ser Val Asp Leu Asp Gln Leu Glu Asn Gly Glu Tyr Met Ile Ser Ser Asn Tyr Asp Thr Lys Leu Ala Ser Leu Lys Asp Gln Lys G1u Leu Leu Glu Gln Gln Ile His Glu Leu His Lys Lys Thr Ala Ile Glu Leu Asp Leu Gln Val Asp Lys Ala Leu Lys Leu Asp Lys Ala Ala MOR0252.ST25.txt Gln Phe Gly His Val Phe Arg Ile Thr Lys Lys Glu Glu Pro Lys Ile Arg Lys Lys Leu Thr Thr Gln Phe Ile Val Leu Glu Thr Arg Lys Asp Gly Val Lys Phe Thr Asn Thr Lys Leu Lys Lys Leu Gly Asp Gln Tyr Gln Ser Val Val Asp Asp Tyr Arg Ser Cys Gln Lys Glu Leu Va1 Asp Arg Val Val Glu Thr Val Thr Ser Phe Ser Glu Val Phe Glu Asp Leu Ala Gly Leu Leu Ser Glu Met Asp Val Leu Leu Ser Phe Ala Asp Leu Ala Ala Ser Cys Pro Thr Pro Tyr Cys Arg Pro Glu Ile Thr Ser Leu Asp Ala Gly Asp 21e Val Leu Glu Gly Ser Arg His Pro Cys Val Glu Ala Gln Asp Trp Val Asn Phe Ile Pro Asn Asp Cys Arg Leu Met Arg Gly Lys Ser Trp Phe Gln Ile Val Thr Gly Pro Asn Met Gly Gly Lys Ser Thr Phe Ile Arg Gln Val Gly Val Tle Val Leu Met Ala G1n Val Gly Ser Phe Val Pro Cys Asp Lys Ala Ser Ile Ser Ile Arg Asp Cys Ile Phe Ala Arg Val Gly Ala Gly Asp Cys Gln Leu Arg Gly Val Ser Thr Phe Met Gln Glu Met Leu Glu Thr Ala Ser Ile Leu Lys Gly Ala Thr Asp Lys Ser Leu Ile Ile Ile Asp Glu Leu Gly Arg Gly Thr Ser Thr Tyr Asp Gly Phe Gly Leu Ala Trp Ala Ile Cys Glu His Leu Val Gln Val Lys Arg Ala Pro Thr Leu Phe Ala Thr His Phe His Glu Leu MOR0252.ST25.txt Thr Ala Leu Ala Gln Ala Asn Ser Glu Val Ser Gly Asn Thr Val Gly Val Ala Asn Phe His Val Ser Ala His Ile Asp Thr Glu Ser Arg Lys Leu Thr Met Leu Tyr Lys Val Glu Pro Gly Ala Cys Asp Gln Ser Phe Gly Tle His Val A1a Glu Phe Ala Asn Phe Pro Glu Ser Val Val Ala Leu Ala Arg Glu Lys Ala Ala Glu Leu Glu Asp Phe Ser Pro Ser Ser Met Ile Ile Asn Asn Glu Glu Ser Gly Lys Arg Lys Ser Arg Glu Asp Asp Pro Asp Glu Val Ser Arg Gly Ala Glu Arg Ala His Lys Phe Leu Lys Glu Phe Ala Ala Met Pro Leu Asp Lys Met Glu Leu Lys Asp Ser Leu Gln Arg Val Arg Glu Met Lys Asp Glu Leu Glu Lys Asp Ala Ala Asp Cys His Trp Leu Arg Gln Phe Leu <210> 45 <211> 3521 <212> DNA
<213> Arabidopsis thaliana <400>

ctaagaaagcgcgcgaaaattggcaacccaagttcgccatagccacgaccacgaccttcc60 atttctcttaaacggaggagattacgaataaagcaattatgggcaagcaaaagcagcaga120 cgatttctcgtttcttcgctcccaaacccaaatccccgactcacgaaccgaatccggtag180 ccgaatcatcaacaccgccaccgaagatatccgccactgtatccttctctccttccaagc240 gtaagcttctctccgaccacctcgccgccgcgtcacccaaaaagcctaaactttctcctc300 acactcaaaacccagtacccgatcccaatttacaccaaagatttctccagagatttctgg360 aaccctcgccggaggaatatgttcccgaaacgtcatcatcgaggaaatacacaccattgg420 aacagcaagtggtggagctaaagagcaagtacccagatgtggttttgatggtggaagttg480 gttacaggtacagattcttcggagaagacgcggagatcgcagcacgcgtgttgggtattt540 acgctcatatggatcacaatttcatgacggcgagtgtgccaacatttcgattgaatttcc600 atgtgagaagactggtgaatgcaggatacaagattggtgtagtgaagcagactgaaactg660 cagccattaagtcccatggtgcaaaccggaccggcccttttttccggggactgtcggcgt720 Page MOR0252.ST25.txt tgtataccaa agccacgctt gaagcggctg aggatataag tggtggttgt ggtggtgaag 780 aaggttttgg ttcacagagt aatttcttgg tttgtgttgt ggatgagaga gttaagtcgg 840 agacattagg ctgtggtatt gaaatgagtt ttgatgttag agtcggtgtt gttggcgttg 900 aaatttcgac aggtgaagttl gtttatgaag agttcaatga taatttcatg agaagtggat 960 tagaggctgt gattttgagc ttgtcaccag ctgagctgtt gcttggccag cctctttcac 1020 aacaaactga gaagtttttg gtggcacatg ctggacctac ctcaaacgtt cgagtggaac 1080 gtgcctcact ggattgtttc agcaatggta atgcagtaga tgaggttatt tcattatgtg 1140 aaaaaatcag cgcaggtaac ttagaagatg ataaagaaat gaagctggag gctgctgaaa 1200 aaggaatgtc ttgcttgaca gttcatacaa ttatgaacat gccacatctg actgttcaag 1260 ccctcgccct aacgttttgc catctcaaac agtttggatt tgaaaggatc ctttaccaag 1320 gggcctcatt tcgctctttg tcaagtaaca cagagatgac tctctcagcc aatactctgc 1380 aacagttgga ggttgtgaaa aataattcag atggatcgga atctggctcc ttattccata 1440 atatgaatca cacacttaca gtatatggtt ccaggcttct tagacactgg gtgactcatc 1500 ctctatgcga tagaaatttg atatctgctc ggcttgatgc tgtttctgag atttctgctt 1560 gcatgggatc tcatagttct tcccagctca gcagtgagtt ggttgaagaa ggttctgaga 1620 gagcaattgt atcacctgag ttttatctcg tgctctcctc agtcttgaca gctatgtcta 1680 gatcatctga tattcaacgt ggaataacaa gaatctttca tcggactgct aaagccacag 1740 agttcattgc agttatggaa gctattttac ttgcggggaa gcaaattcag cggcttggca 1800 taaagcaaga ctctgaaatg aggagtatgc aatctgcaac tgtgcgatct actcttttga 1860 gaaaattgat ttctgttatt tcatcccctg ttgtggttga caatgccgga aaacttctct 1920 ctgccctaaa taaggaagcg gctgttcgag gtgacttgct cgacatacta atcacttcca 1980 gcgaccaatt tcctgagctt gctgaagctc gccaagcagt tttagtcatc agggaaaagc 2040 tggattcctc gatagcttca tttcgcaaga agctcgctat tcgaaatttg gaatttcttc 2100 aagtgtcggg gatcacacat ttgatagagc tgcccgttga ttccaaggtc cctatgaatt 2160 gggtgaaagt aaatagcacc aagaagacta ttcgatatca tcccccagaa atagtagctg 2220 gcttggatga gctagctcta gcaactgaac atcttgccat tgtgaaccga gcttcgtggg 2280 atagtttcct caagagtttc agtagatact acacagattt taaggctgcc gttcaagctc 2340 ttgctgcact ggactgtttg cactcccttt caactctatc tagaaacaag aactatgtcc 2400 gtcccgagtt tgtggatgac tgtgaaccag ttgagataaa catacagtct ggtcgtcatc 2460 ctgtactgga gactatatta caagataact tcgtcccaaa tgacacaatt ttgcatgcag 2520 aaggggaata ttgccaaatt atcaccggac ctaacatggg aggaaagagc tgctatatcc 2580 gtcaagttgc tttaatttcc ataatggctc aggttggttc ctttgtacca gcgtcattcg 2640 ccaagctgca cgtgcttgat ggtgttttca ctcggatggg tgcttcagac agtatccagc 2700 atggcagaag tacctttcta gaagaattaa gtgaagcgtc acacataatc agaacctgtt 2760 cttctcgttc gcttgttata ttagatgagc ttggaagagg cactagcaca cacgacggtg 2820 MOR0252.ST25.txt tagccattgcctatgcaacattacagcatctcctagcagaaaagagatgtttggttcttt2880 ttgtcacgcattaccctgaaatagctgagatcagtaacggattcccaggttctgttggga2940 cataccatgtctcgtatctgacattgcagaaggataaaggcagttatgatcatgatgatg3000 tgacctacctatataagcttgtgcgtggtctttgcagcaggagctttggttttaaggttg3060 ctcagcttgcccagatacctccatcatgtatacgtcgagccatttcaatggctgcaaaat3120 tggaagctgaggtacgtgcaagagagagaaatacacgcatgggagaaccagaaggacatg3180 aagaaccgagaggcgcagaagaatctatttcggctctaggtgacttgtttgcagacctga3240 aatttgctctctctgaagaggacccttggaaagcattcgagtttttaaagcatgcttgga3300 agattgctggcaaaatcagactaaaaccaacttgttcattttgatttaatcttaacatta3360 tagcaactgcaaggtcttgatcatctgttagttgcgtactaacttatgtgtattagtata3420 acaagaaaagagaattagagagatggattctaatccggtgttgcagtacatcttttctcc3480 acccgcataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3521 <210> 46 <211> 1081 <212> PRT
<213> Arabidopsis thaliana <400> 46 ' Met Gly Lys Gln Lys Gln Gln Thr Ile Ser Arg Phe Phe Ala Pro Lys 1 5 , 10 15 Pro Lys Ser Pro Thr His Glu Pro Asn Pro Val Ala Glu Ser Ser Thr Pro Pro Pro Lys Ile Ser Ala Thr Val Ser Phe Ser Pro Ser Lys Arg Lys Leu Leu Ser Asp His Leu Ala Ala Ala Ser Pro Lys Lys Pro Lys Leu Ser Pro His Thr Gln Asn Pro Val Pro Asp Pro Asn Leu His Gln Arg P.he Leu Gln Arg Phe Leu Glu Pro Ser Pro Glu Glu Tyr Val Pro Glu Thr Ser Ser Ser Arg Lys Tyr Thr Pro Leu Glu Gln Gln Val Val Glu Leu Lys Ser Lys Tyr Pro Asp Val Val Leu Met Val Glu Val Gly Tyr Arg Tyr Arg Phe Phe Gly Glu Asp Ala Glu Ile Ala Ala Arg Val Leu Gly Ile Tyr Ala~His Met Asp His Asn Phe Met Thr Ala Ser Val MOR0252.ST25.txt Pro Thr Phe Arg Leu Asn Phe His Val Arg Arg Leu Val Asn Ala Gly Tyr Lys Ile Gly Val Val Lys G1n Thr Glu Thr Ala Ala Ile Lys Ser His Gly Ala Asn Arg Thr Gly Pro Phe Phe Arg Gly Leu Ser Ala Leu Tyr Thr Lys Ala Thr Leu Glu Ala Ala Glu Asp Ile Ser Gly Gly Cys Gly Gly Glu Glu Gly Phe Gly Ser Gln Ser Asn Phe Leu Va1 Cys Val Val Asp Glu Arg Val Lys Ser Glu Thr Leu Gly Cys Gly Ile Glu Met Ser Phe Asp Val Arg Val Gly Val Val Gly Val Glu Ile Ser Thr Gly i Glu Val Val Tyr Glu Glu Phe Asn Asp Asn Phe Met Arg Ser Gly Leu Glu A1a Val Ile Leu Ser Leu Ser Pro Ala Glu Leu Leu Leu Gly G1n Pro Leu Ser Gln Gln Thr Glu Lys Phe Leu Val Ala His Ala Gly Pro Thr Ser Asn Val Arg Val Glu Arg Ala Ser Leu Asp Cys Phe Ser Asn Gly Asn Ala Val Asp Glu Va1 Ile Ser Leu Cys Glu Lys Ile Ser Ala Gly Asn Leu Glu Asp Asp Lys Glu Met Lys Leu Glu Ala Ala Glu Lys Gly Met Ser Cys Leu Thr Val His Thr Ile Met Asn Met Pro His Leu Thr Val Gln A1a Leu Ala Leu Thr Phe Cys His Leu Lys Gln Phe Gly Phe Glu Arg Ile Leu Tyr Gln Gly Ala Ser Phe Arg Ser Leu Ser Ser 405 ; 410 415 Asn Thr Glu Met Thr Leu Ser Ala Asn Thr Leu Gln Gln Leu Glu Val MOR0252.ST25.txt Val Lys Asn Asn Ser Asp Gly Ser Glu Ser Gly Ser Leu Phe His Asn Met Asn His Thr Leu Thr Val Tyr Gly Ser Arg Leu Leu Arg His Trp Val Thr His Pro Leu Cys Asp Arg Asn Leu Ile Ser Ala Arg Leu Asp Ala Val Ser Glu Ile Ser A1a Cys Met Gly Ser His Ser Ser Ser G1n Leu Ser Ser Glu Leu Val Glu Glu Gly Ser Glu Arg Ala Ile Val Ser Pro Glu Phe Tyr Leu Val Leu Ser Ser Val Leu Thr Ala Met Ser Arg Ser Ser Asp Ile Gln Arg Gly Ile Thr Arg Ile Phe His Arg Thr Ala Lys Ala Thr Glu Phe Ile Ala Val Met Glu Ala Ile Leu Leu Ala Gly Lys Gln Ile Gln Arg Leu Gly Tle Lys Gln Asp Ser Glu Met Arg Ser Met Gln Ser Ala Thr Val Arg Ser Thr Leu Leu Arg Lys Leu Ile Ser Val Ile Ser Ser Pro Val Val Val Asp Asn Ala Gly Lys Leu Leu Ser Ala Leu Asn Lys Glu Ala Ala Val Arg Gly Asp Leu Leu Asp Tle Leu Ile Thr Ser Ser Asp Gln Phe Pro Glu Leu Ala Glu Ala Arg Gln Ala Val Leu Val Ile Arg G1u Lys Leu Asp Ser Ser Ile Ala Ser Phe Arg Lys Lys Leu Ala Ile Arg Asn Leu Glu Phe Leu Gln Val Ser Gly Ile Thr His Leu Ile Glu Leu Pro Val Asp Ser Lys Val Pro Met Asn Trp Val Lys Val Asn Ser Thr Lys Lys Thr Ile Arg Tyr His Pro Pro Glu Ile Val Ala Gly Leu Asp Glu Leu Ala Leu Ala Thr Glu His Leu Ala Page l03 MOR0252.ST25.txt Ile Val Asn Arg Ala Ser Trp Asp Ser Phe Leu Lys Ser Phe Ser Arg Tyr Tyr Thr Asp Phe Lys Ala Ala Val Gln Ala Leu Ala Ala Leu Asp Cys Leu His Ser Leu Ser Thr Leu Ser Arg Asn Lys Asn Tyr Val Arg Pr_o Glu Phe Val Asp Asp Cys Glu Pro Val G1u Ile Asn Ile Gln Ser Gly Arg His Pro Val Leu Glu Thr Tle Leu Gln Asp Asn Phe Val Pro Asn Asp Thr Tle Leu His Ala Glu Gly Glu Tyr Cys Gln Tle Ile Thr Gly Pro Asn Met Gly Gly Lys Ser Cys Tyr Tle Arg Gln Val Ala Leu Ile Ser Ile Met Ala Gln Val Gly Ser Phe Val Pro Ala Ser Phe Ala Lys Leu His Val Leu Asp Gly Val Phe Thr Arg Met G1y Ala Ser Asp Ser Ile Gln His Gly Arg Ser Thr Phe Leu Glu Glu Leu Ser Glu Ala Ser His Ile Ile Arg Thr Cys Ser Ser Arg Ser Leu Val Tle Leu Asp Glu Leu Gly Arg Gly Thr Ser Thr His Asp Gly Val Ala Tle A1a Tyr A1a Thr Leu Gln His Leu Leu Ala Glu Lys Arg Cys Leu Val Leu Phe Val Thr His Tyr Pro Glu Ile Ala Glu Ile Ser Asn Gly Phe Pro Gly Ser Val Gly Thr Tyr His Val Ser Tyr Leu Thr Leu Gln Lys Asp Lys Gly Ser Tyr Asp His Asp Asp Val Thr Tyr Leu Tyr Lys Leu Val Arg Gly Leu Cys Ser Arg Ser Phe Gly Phe Lys Val Ala Gln'Leu Ala G1n MOR0252.ST25.txt Ile Pro Pro Ser Cys Ile Arg Arg Ala Tle Ser Met Ala Ala Lys Leu Glu Ala Glu Val Arg Ala Arg Glu Arg Asn Thr Arg Met Gly Glu Pro Glu Gly His Glu Glu Pro Arg Gly A1a Glu Glu Ser Ile Ser Ala Leu Gly Asp Leu Phe Ala Asp Leu Lys Phe Ala Leu Ser Glu Glu Asp Pro Trp Lys Ala Phe Glu Phe Leu Lys His Ala Trp Lys Ile Ala Gly Lys Il.e Arg Leu Lys Pro Thr Cys Ser Phe <210> 47 <211> 7080 <212> DNA
<213> Arabidopsis thaliana <400>

ctcttcgccgactgtttcactccccttctctctcactctctgtgcgctttattccactct60 ccgatggctccgtctcgccgacagatcagcggaagatctccgttggtgaaccagcagcgt120 caaatcacctccttctttgggaaatctgcttcatcatcttcttctccgtctccatctcct180 tcaccatctctctccaataagaaaacccccaaatctaacaaccctaaccctaaatctccg240 tctccgtcaccatctccgcctaagaaaacccccaaattgaaccctaaccctagttctaat300 cttcctgctcgtagtcctagccctggtcctgatactccttctcctgtacagtccaagttt360 aagaagccccttctcgtcatcggacagacaccttcgcctcctcaatcggtggtaattact420 tacggtgacgaggtggtggggaagcaagttagggtttattggcctttggataaaaaatgg480 tatgatgggagcgtgacgttttatgataagggtgagggtaagcatgtggttgagtatgaa540 gatggggaagaagagtctttggatttgggaaaggagaagactgagtgggtggttggggaa600 aaatcaggagataggtttaatcgattgaaacgaggcgcttcggctttgagaaaagttgtg660 acggatagtgatgatgatgtggagatgggtaatgtggaagaagataaaagtgacggtgat720 gattctagcgatgaggattggggaaagaatgttgggaaggaggtttgtgagagtgaagaa780 gatgatgtggagttggttgatgagaatgaaatggatgaagaagagttggtggaagagaaa840 gatgaagaaacttctaaagttaatagagtatccaaaactgactctagaaagcggaagact900 agtgaagtaacgaaatcaggtggtgagaagaaaagcaagactgatacaggcactatcttg960 aaaggttttaaggcttctgttgtggagcctgcgaagaagattggacaaggtaaaccgaag1020 agtctcttgttgtaatcatatgcttgtatttgcattgttttagtttgtggtatgtctctt1080 gcactgacttttgtttcagatagtgtatgttgttggttgcttaatattatttgtgtctta1140 ctacagctgatagggtggtcaagggtttggaagataacgtgttggatggggatgctcttg1200 Pa ge 105 MOR0252.ST25.txt ctagatttggtgctcgtgattctgagaaattccgctttttgggagtgtaagtctttcaca1260 aaaaaaattccatcttagaggctatttgctacggtggttaggagtagagaatgtaaattt1320 gtgtcttaagcaatattgacttctctactggcaggagcatctctggttttcttttatctt1380 catgatgtattagtaggctgcatgatccctattctagctaagttagttctgttaattatt1440 tttggtgaacagagaccgaagggatgctaaaaggagacgccctactgatgagaattatga1500 tccgaggacactctacctccctcctgattttgtgaaaaaattaactggaggccaggtcag1560 aagagcgcatggaaatctggttcaggatttttggtgaagctaatcaactttcacttatat1620 gattttgtggccttttttcagagacaatggtgggagtttaaagcaaagcatatggacaaa1680 gttgtattcttcaaggtagaacgataattacttatttcgttataacttatttattgatgg1740 gagattctaggataaatggtcttcttttgtggcaagcagatgggtaaattctatgagctt1800 tttgagatggatgcacatgtcggagctaaggaactggatatacaatacatgaaggtaact1860 gtttgttatgactcataactaggtgatgcatttgaagacatctgttaaaaatgttaaaaa1920 accgaaaatttggcatcagattatgctaaaagggttcttttcattggtgttacattacaa1980 atttctcctgtattgtctctaatgtatctctctttacaagcccctgacatatgcatttat2040 tttgtagggagagcaacctcattgtggatttccggagaagaatttttctgtaaacattga2100 gaaattagttagaaaggtttgtttccagaaatatagcaactccagttcaagcgtgatcta2160 tttcttgttacgtgtagagaaattacattcatggcaaatgctgtactttgggtagaaata2220 aagttgattgaattgaatggaacagggctatcgggttttagttgtcgaacaaacagaaac2280 acctgatcagctggagcaacgccgaaaagagacaggttccaaggataaagtatgtcccac2340 tatgaatctaatttagttggcattatcagttcaagtcaatttgtttgctcttgaaactaa2400 aatttgttcactttgggtgatgcctatgtagaaaaattatgatagggagggctcatagtg2460 acagaacttctgtttttataggttgtgaagcgcgaagtatgtgcagttgttacaaaaggc2520 acgctgacagatggggagatgctattaactaatccggatgcatcttatctaatggccttg2580 actgaaggaggagaaagtttaactaatcctacagcagagcacaattttggtgtatgtttg2640 gttgatgttgcgacacagaagataatactgggccaggtgagttctagttgatgaatggta2700 cctggttgcacttatacgtaacatttctcggtgtatattgatggcatttttttttcattc2760 gtaccagtttaaggatgatcaagattgcagtgcattatcttgcctgctatctgagatgag2820 gccggtggaaattattaaaccagctaaggtgttgagttatgcaacagagagaacaatagt2880 tagacaaaccagaaatcccttagtaaataatctcgttccactttctgaattttgggattc2940 ggagaagaccatatatgaagttggaattatctacaagcgaatcaattgtcaaccgtcttc3000 tgcttattctagtgagggaaagattctaggtgatggttcaagctttcttccaaaaatgtt3060 gtctgaattagcaactgaagataagaatggtagcctggcactctctgctcttggtggtgc3120 catttactacctgcgacaagcattcttggatgagagtctgcttagatttgcaaagtttga3180 atccctgccttactgtgatttcagcaacgttaatgagaagcagcacatggttcttgatgc3240 tgctgctcttgaaaaccttgagatatttgaaaacagtagaaatggaggctattcagggta3300 MOR0252.ST25.txt aagtttctctatcttaccatgtattattaaacataattgatgtgttctaaatctagagtg3360 ttgtcttttgaagaacgctgtatgctcaactgaatcaatgtatcactgcatctgggaaac3420 ggttactgaaaacatggctggcaagacctttatataatacggaactgatcaaggaacgac3480 aagatgctgtagcaattctgcgggtgagtctttcaacaagttgtttgactttgctgctgt3540 catttctctgtctctcaactagacaataacttggcatcttggtttcacatttgatcattt3600 ttcatgtctgtttcgctatccatggatctctcctcagaattacactatttccccattatg3660 ggtgttcaagaccatttttgccactgtttcactggcaaagatgatgttttcctatgcgtt3720 caactaaccatctatttctagaacttattccctaagattataaaacttactctgcttctt3780 cagcatgtcaaggctttcgtttacactatccatctgacaatgtattatggtactgtccct3840 tccctcagggtgaaaatcttccgtactcactggaattccggaagtcgttgtccagacttc3900 cagacatggaacggttgattgcacgtatgttttctagcatgtaagggattagctagattg3960 agatgttaattcttacattatatgtttataccaaagacttactaaacatatttgttaaac4020 .

ttgtgttacgtgttatagtgaagctagtggaagaaatggcgataaagtggtgctatatga4080 agatacagctaagaagcaggtacaggaattcatatcaactctacgtggttgtgaaacaat4140 ggcagaagcatgctcttctctccgtgctatcttgaagcatgatacatccaggcggctgct4200 i tcatttactaactcctggtataatcaatttgctccatattcacattcttatactggcaaa4260 ttgcacagcatctcatatcatttctctgccaggtcaaagtcttccaaatatatcatcctc4320 cataaagtatttcaaggatgcttttgactgggtagaagctcacaattctggacgtgtaat4380 accccatgaaggagcagatgaagagtatgattgtgcctgcaaaacagtagaagaatttga4440 gtccagtttgaaaaaacatctgaaagagcaacggaaattactcggagatgcatcagtgag~4500 aattacttcactatttttttttactccttaaatggctaatcaaccgagggttttctgatc4560 agatctttggtgctcttttgtcttcttatccagataaactatgttacagttggaaaagat4620 gaatacctcttggaagttcctgaaagtttaagtgggagtgttcctcatgattatgaatta4680 tgctcatcgaaaaaggtaaaagttgtaccaagtttcacattctaaagaaattggcatttc4740 gctttcgtcataacaagtcgatagtcttctcgtaattgctgtctgctgatatatttacta4800 tatagagacccttaattttaaacatgagattttcttactttttactctctttcagggtgt4860 ctctcgatat'tggactcctaccataaagaaattattaaaagagctatcacaagcaaaatc4920 tgaaaaagagtcggccctgaagagcatttcacagagattgattggacgtttctgcgagca4980 tcaagaaaaatggagacaattggtttctgcaacagctggtatggacaagttcatgtttta5040 aaaaaaaaaaattgtttaaggaattttcagcatcttccttcagaatatgtatcttgctta5100 tccaattcctgttaattactgtcacccagtgttagctttgtgggtcgtcgcttggaccct5160 tttcgttgtgaacatttgttgagctagttagaattgagtttgatcccacactttatagat5220 tgagttagaagtaggcatgcagaagaaaatgaatcttaggcagacgtatagttcaatcac5280 atcttataagcaagaggtttcttgggtggaagattgttttatagaattaggcatgcaaac5340 aactttgcacttagacctttatgtggatacatttttgacatgaattctttctattgcaga5400 MOR0252.ST25.txt gctggacgtg ttgatcagcc tcgcttttgc aagtgattct tatgaaggag taagatgccg 5460 cccagtaata tctggttcta catctgatgg tgttccacac ttgtctgcca ctggtctagg 5520 gcatccagtt ctaaggggtg attcgttagg cagaggctct tttgtaccaa ataatgtaaa 5580 gataggtggt gctgagaaag ccagtttcat cctcctcaca ggccctaata tgggtggaaa 5640 atcaaccctt cttcgccaag tttgcttggc tgtaatcttg gctcaggtaa gctatcattt 5700 gaaaaaactt tgtaggcaat gggctttgac ccgtttaatt ttgatgaaag aaactcaagc 5760 aatgatgatc ttttcacaga ttggagcaga tgtcccagca gaaacctttg aggtttcgcc 5820 tgttgacaaa atttgtgtcc ggatgggtgc aaaagatcat atcatggcag gacaaagcac 5880 gtttttaaca gaactttcag aaactgcggt aatgttggta agtaatgttc attctgtttg 5940 tcaaattgat tacatgaagc tttctaagat aaatgtgaaa cttgccacag tggttaccct 6000 tttgagagtt ggtcacaggc tttgttaaac tatgcgaatg ccaacaaacg cactgataga 6060 atgttttata ttaataatat gcagacatca gccacccgaa actcgctggt ggtgctagat 6120 gagcttggac gaggaacagc cacatcagat gggcaagcca ttgcgtatgt tgaatcaatt 6180 attgcgtatc atgttttttg ggacttactg ttattgttca ctttatctaa aatatcttaa 6240 ctatttacag ggaatccgta cttgagcact tcatagaaaa ggtgcagtgt agaggattct 6300 tctctactca ttatcatcgt ctctctgtgg attatcaaac caatccaaag gtattgtgaa 6360 aagtgtctgc ttcagtttct gggtttgaaa gacttgagaa ctatcaataa taatctgatt 6420 gtttgtgtac attctgaaac ttgtcaaaaa ccgatcagtc ttgaatattt gtttggatag 6480 gtctcacttt gccatatggc atgtcaaata ggagaaggaa tcggtggagt agaagaagtt 6540 acatttctct atagattgac tcctggtgca tgtcctaaaa gttatggagt taacgttgct 6600 cggttagctg gtaagaacac tgaattctct actccatcac ctctactcag ttaaacagaa 6660 gcagtcactc atcaaattgt tttggtttta atctccatag gtcttccaga ttacgtactc 6720 cagagagccg tgataaaatc ccaagaattc gaggctttgt acggtaaaaa ccatagaaaa 6780 accgatcata aattagcagc aatgataaag cagatcatca gcagtgttgc atcagattct 6840 gattactcag cttcaaagga ctcattgtgt gagctacact ccatggccaa tacatttctc 6900 cggttaacca actaatttaa cagctctacg cctttccggt ttgtcgttct tcttgtaact 6960 ctttaaccaa ggtcaatcca cgagcttcgt cgtgtcaaat actaaaacct gagtcagcct 7020 gaaactaaac tcctgagtag agactcagtt ttgaggtgtg ggtttagctt ctgagtcttt 7080 <210> 48 <211> 1324 <212> PRT
<213> Arabidopsis thaliana <400> 48 Met Ala Pro Ser Arg Arg Gln Ile Ser Gly Arg Ser Pro Leu Val Asn Gln Gln Arg Gln Ile Thr Ser Phe Phe Gly Lys Ser Ala Ser Ser Ser MOR0252 . ST25 . t~tt Ser Ser Pro Ser Pro Ser Pro Ser Pro Ser Leu Ser Asn Lys Lys Thr Pro Lys Ser Asn Asn Pro Asn Pro Lys Ser Pro Ser Pro Ser Pro Ser Pro Pro Lys Lys Thr Pro Lys Leu Asn Pro Asn Pro Ser Ser Asn Leu Pro Ala Arg Ser Pro Ser Pro Gly Pro Asp Thr Pro Ser Pro Val Gln Ser Lys Phe Lys Lys Pro Leu Leu Val Ile Gly Gln Thr Pro Ser Pro Pro Gln Ser Val Val Tle Thr Tyr Gly Asp Glu Val Val Gly Lys Gln Val Arg Val Tyr Trp Pro Leu Asp Lys Lys Trp Tyr Asp Gly Ser Val Thr Phe Tyr Asp Lys Gly Glu Gly Lys His Val Val Glu Tyr Glu Asp l45 150 155 160 Gly Glu Glu Glu Ser Leu Asp Leu Gly Lys Glu Lys Thr Glu Trp Val Val Gly Glu Lys Ser Gly Asp Arg Phe Asn Arg Leu Lys Arg Gly Ala l80 185 190 Ser Ala Leu Arg Lys Val Val Thr Asp Ser Asp Asp Asp Val Glu Met l95 200 205 Gly Asn Val Glu Glu Asp Lys Ser Asp Gly Asp Asp Ser Ser Asp Glu Asp Trp Gly Lys Asn Val Gly Lys Glu Val Cys Glu Ser Glu Glu Asp Asp Val Glu Leu Val Asp Glu Asn Glu Met Asp Glu G1u Glu Leu Val Glu Glu Lys Asp Glu Glu Thr Ser Lys Val Asn Arg Val Ser Lys Thr Asp Ser Arg Lys Arg Lys Thr Ser Glu Val Thr Lys Ser Gly Gly Glu Lys Lys Ser Lys Thr Asp Thr Gly Thr Ile Leu Lys Gly Phe Lys Ala MOR0252.ST25.txt Ser Val Val Glu Pro Ala Lys Lys Ile Gly Gln Ala Asp Arg Val Val Lys Gly Leu Glu Asp Asn Val Leu Asp Gly Asp Ala Leu Ala Arg Phe Gly Ala Arg Asp Ser Glu Lys Phe Arg Phe Leu Gly Val Asp Arg Arg Asp Ala Lys Arg Arg Arg Pro Thr Asp G1u Asn Tyr Asp Pro Arg Thr Leu Tyr Leu Pro Pro Asp Phe Val Lys Lys Leu Thr Gly Gly Gln Arg Gln Trp Trp Glu Phe Lys Ala Lys His Met Asp Lys Val Val Phe Phe Lys Met Gly Lys Phe Tyr Glu Leu Phe Glu Met Asp Ala His Val Gly Ala Lys Glu Leu Asp Ile Gln Tyr Met Lys Gly Glu Gln Pro His Cys Gly Phe Pro Glu Lys Asn Phe Ser Val Asn Ile Glu Lys Leu Val Arg Lys Gly Tyr Arg Val Leu Val Val G1u Gln Thr Glu Thr Pro Asp Gln 450 , 455 460 Leu Glu Gln Arg Arg Lys Glu Thr Gly Ser Lys Asp Lys Val Val Lys Arg Glu Val Cys Ala Val Val Thr Lys Gly Thr Leu Thr Asp Gly Glu Met Leu Leu Thr Asn Pro Asp Ala Ser Tyr Leu Met Ala Leu Thr Glu Gly Gly Glu Ser Leu Thr Asn Pro Thr Ala Glu His Asn Phe Gly Val Cys Leu Val Asp Val Ala Thr Gln Lys Ile I1e Leu Gly Gln Phe Lys Asp Asp Gln Asp Cys Ser Ala Leu Ser Cys Leu Leu Ser Glu Met Arg Pro Val Glu Ile Ile Lys Pro Ala Lys Val Leu Ser Tyr Ala Thr Glu Arg Thr Ile Val Arg Gln Thr Arg Asn Pro Leu Val Asn Asn Leu Val MOR0252.ST25.txt Pro Leu 5er Glu Phe Trp Asp Ser Glu Lys Thr Ile Tyr Glu Val Gly Ile Ile Tyr Lys Arg Ile Asn Cys Gln Pro 5er Ser Ala Tyr Ser Ser Glu Gly Lys Ile Leu Gly Asp Gly Ser Ser Phe Leu Pro Lys Met Leu Ser Glu Leu Ala Thr Glu Asp Lys Asn Gly Ser Leu Ala Leu 5er Ala Leu Gly Gly Ala Ile Tyr Tyr Leu Arg Gln Ala Phe Leu Asp Glu Ser Leu Leu Arg Phe Ala Lys Phe Glu Ser Leu Pro Tyr Cys Asp Phe Ser Asn Val Asn Glu Lys Gln His Met Val Leu Asp Ala Ala Ala Leu Glu Asn Leu Glu Ile Phe Glu Asn Ser Arg Asn Gly Gly,Tyr Ser Gly Thr Leu Tyr Ala Gln Leu Asn Gln Cys Ile Thr Ala Ser Gly Lys Arg Leu Leu Lys Thr Trp Leu Ala Arg Pro Leu Tyr Asn Thr Glu Leu Ile Lys Glu Arg Gln Asp Ala Val Ala Ile Leu Arg Gly Glu Asn Leu Pro Tyr Ser Leu Glu Phe Arg Lys Ser Leu Ser Arg Leu Pro Asp Met Glu Arg Leu Ile Ala Arg Met Phe Ser Ser Ile Glu Ala Ser Gly Arg Asn Gly Asp Lys Val Val Leu Tyr Glu Asp Thr Ala Lys Lys Gln Val Gln G1u Phe Ile Ser Thr Leu Arg Gly Cys Glu Thr Met Ala Glu Ala Cys Ser Ser Leu Arg Ala Tle Leu Lys His Asp Thr Ser Arg Arg Leu Leu His Leu Leu Thr Pro Gly Gln Ser Leu Pro Asn Ile Ser Ser Ser Ile Lys MOR0252.ST25.txt Tyr Phe Lys Asp Ala Phe Asp Trp Val Glu Ala His Asn Ser Gly Arg Val Tle Pro His Glu Gly Ala Asp Glu Glu Tyr Asp Cys Ala Cys Lys Thr Val Glu Glu Phe Glu Ser Ser Leu Lys Lys His Leu Lys Glu Gln Arg Lys Leu Leu Gly Asp Ala Ser Ile Asn Tyr Val Thr Val Gly Lys Asp Glu Tyr Leu Leu Glu Val Pro Glu Ser Leu Ser Gly Ser Val Pro His Asp Tyr Glu Leu Cys Ser Ser Lys Lys Gly Va1 Ser Arg Tyr Trp Thr Pro Thr Ile Lys Lys Leu Leu Lys Glu Leu Ser Gln Ala Lys Ser G1u Lys Glu Ser Ala Leu Lys Ser Ile Ser Gln Arg Leu Ile Gly Arg Phe Cys Glu His Gln Glu Lys Trp Arg Gln Leu Val Sex Ala Thr Ala Glu Leu Asp Va1 Leu Ile Ser Leu Ala Phe Ala Ser Asp Ser Tyr Glu Gly Val Arg Cys Arg Pro Val Ile Ser Gly Ser Thr Ser Asp Gly Val Pro His Leu Ser Ala Thr Gly Leu Gly His Pro Val Leu Arg Gly Asp Ser Leu Gly Arg Gly Ser Phe Val Pro Asn Asn Val Lys Ile Gly Gly Ala Glu Lys Ala Ser Phe Ile Leu Leu Thr Gly Pro Asn Met Gly Gly Lys Ser Thr Leu Leu Arg Gln Val Cys Leu Ala Val Ile Leu Ala Gln Ile Gly Ala Asp Val Pro Ala Glu Thr Phe Glu Val Ser Pro Val Asp Lys Ile Cys Val Arg Met Gly Ala Lys Asp His Ile Met Ala Gly Gln Ser Thr Phe Leu Thr Glu Leu MOR0252.ST25.txt Ser Glu Thr Ala Val Met Leu Thr Ser Ala Thr Arg Asn Ser Leu Val Val Leu Asp Glu Leu Gly Arg Gly Thr Ala Thr Ser Asp Gly Gln Ala Ile Ala Glu Ser Val Leu Glu His Phe Ile Glu Lys Val Gln Cys Arg Gly Phe Phe Ser Thr His Tyr His Arg Leu Ser Val Asp Tyr Gln Thr Asn Pro Lys Val Ser Leu Cys His Met Ala Cys Gln Ile Gly Glu Gly Ile Gly Gly Val Glu Glu Val Thr Phe Leu Tyr Arg Leu Thr Pro Gly Ala Cys Pro Lys Ser Tyr Gly Val Asn Val Ala Arg Leu Ala Gly Leu Pro Asp Tyr Val Leu Gln Arg Ala Val Ile Lys Ser Gln Glu Phe Glu A1a Leu Tyr Gly Lys Asn His Arg Lys Thr Asp His Lys Leu Ala Ala Met Ile Lys Gln Ile Ile Ser Ser Val Ala Ser Asp Ser Asp Tyr Ser Ala Ser Lys Asp Ser Leu Cys. Glu Leu His Ser Met Ala Asn Thr Phe Leu Arg Leu Thr Asn <210>

<211>

<212>
DNA

<213> a sativa Oryz <400>

cggcacgagattttgcagtctcctctcctcctccgctcgagcgagtgagtcccgaccacg60 tcgctgccctcgcctcaccgccggccaaccgccgtgacgagagatcgagcagggcggggc120 atggacgagccttcgccgcgcggaggtgggtgcgccggggagccgccccgcatccggagg180 ttggaggagtcggtggtgaaccgcatcgcggcgggggaggtgatccagcggccgtcgtcg240 gcggtgaaggagctcatcgagaacagcctcgacgctggcgcctccagcgtctccgttgcg300 Page MOR0252.ST25.txt gtgaaggacg gtggcctcaa gctcatccag gtctccgatg acggccatgg catcaggttt 360 gaggatttgg caatattgtg cgaaaggcat actacctcaa agttatctgc atacgaggat 420 ctgcagacca taaaatcgat ggggttcaga ggggaggctt tggctagtat gacttatgtt 480 ggccatgtta ccgtgacaac gataacagaa ggccaattgc acggctacag ggtttcttac 540 agagatggtg taatggagaa tgagcctaag ccttgcgctg cggtgaaagg aactcaagtc 600 atggttgaaa atctatttta caacatggta gcccgcaaga aaacattgca gaactccaat 660 gatgactacc ccaagatcgt agacttcatc agtcggtttg cagtccatca catcaacgtt 720 accttctctt gcagaaagca tggagccaat agagcagatg ttcatagtgc aagtacatcc 780 tcaaggttag atgctatcag gagtgtctat ggggcttctg tcgttcgtga tctcatagaa 840 ataaaggttt catatgagga tgctgcagat tcaatcttca agatggatgg ttacatctca 900 aatgcaaatt atgtggcaaa gaagattaca atgattcttt tcataaatga taggcttgta 960 gactgtactg ctttgaaaag agctattgaa tttgtgtact ctgcaacatt gcctcaagca 1020 tccaaacctt tcatatacat gtccatacat cttccatcag aacacgtgga tgttaatata 1080 cacccaacca agaaagaggt tagccttttg aatcaagagc gtattattga aacaataaga 1140 aatgctattg aggaaaaact gatgaattct aatacaacca ggatattcca aactcaggca 1200 ttaaacttat cagggattgc tcaagctaac ccacaaaagg ataaggtttc tgaggccagt 1260 atgggttctg gaacaaaatc tcaaaaaatt cctgtgagcc aaatggtcag aacagatcca 1320 cgcaatccat ctggaagatt gcacacctac tggcacgggc aatcttcaaa tcttgaaaag 1380 aaatttgatc ttgtatctgt aagaaatgtt gtaagatcaa ggagaaacca aaaagatgct 1440 ggtgatttgt caagccgtca tgagctcctt gtggaaatag attctagctt ccatcctggc 1500 cttttggaca ttgtcaagaa ctgcacatat gttggacttg ccgatgaagc ctttgctttg 1560 atacaacaca atacccgctt ataccttgta aatgtggtaa atattagtaa agaacttatg 1620 taccagcaag ctttgtgccg ttttgggaac ttcaatgcta ttcagctcag tgaaccagct 1680 ccacttcagg agttgctggt gatggcactg aaaga.cgatg aattgatgag tgatgaaaag 1740 gatgatgaga aactggagat tgcagaagta aacactgaga tactaaaaga aaatgctgag 1800 atgattaatg agtacttttc tattcacatt gatcaagatg gcaaattgac aagacttcct 1860 gttgtactgg accagtacac ccctgatatg gaccgtcttc cagaatttgt gttggcttta 1920 ggaaatgatg ttacttggga tgacgagaaa gagtgcttca gaacagtagc ttctgctgta 1980 ggaaacttct atgcacttca tcccccaatc cttccaaatc catctgggaa tggcattcat 2040 ttatacaaga aaaatagaga ttcaatggct gatg'aacatg ctgagaatga tctaatatca 2100 gatgaaaatg acgttgatca agaacttctt gcggaagcag aagcagcatg ggcccaacgt 2160 gagtggacca ttcagcatgt cttgtttcca tccatgcgac ttttcctcaa gcccccgaag 2220 tcaatggcaa cagatggaac gtttgtgcag gttgcttcct tggagaaact ctacaagatt 2280 tttgaaaggt gttagctcat aagtgagaaa atgaaggcag agtaagatca tgattcatgg 2340 agtgtttttg aaaatgtgta taatttcacc gtattatgta ctttgatagt gtctgtagaa 2400 MOR0252.ST25.txt actgaagaaa gaaagatggc tttacttctg aattgaaagt taacgatgcc agcaattgta 2460 tattctgatc aaccaaaaaa aaaaaaaaaa aaaaaaaaaa a 2501 <210> 50 <211> 724 <212> PRT
<213> ~ryza sativa <400> 50 Met Asp Glu Pro Ser Pro Arg Gly Gly Gly Cys Ala Gly Glu Pro Pro Arg Ile Arg Arg Leu Glu Glu Ser Val Val Asn Arg I1e Ala Ala Gly Glu Val Ile Gln Arg Pro Ser Ser Ala Val Lys Glu Leu Ile Glu Asn Ser Leu Asp Ala Gly Ala Ser Ser Val Ser Val Ala Val Lys Asp Gly Gly Leu Lys Leu Ile Gln Val Ser Asp Asp Gly His Gly Ile Arg Phe ' Glu Asp Leu Ala Ile Leu Cys Glu Arg His Thr Thr Ser Lys Leu Ser ' Ala Tyr Glu Asp Leu Gln Thr Ile Lys Ser Met Gly Phe Arg Gly Glu Ala Leu Ala Ser Met Thr Tyr Val Gly His Val Thr Val Thr Thr Ile Thr Glu Gly Gln Leu His Gly Tyr Arg Val Ser Tyr Arg Asp Gly Val Met Glu Asn Glu Pro Lys Pro Cys Ala Ala Val Lys Gly Thr Gln Val Met Val Glu Asn Leu Phe Tyr Asn Met Val Ala Arg Lys Lys Thr Leu Gln Asn Ser Asn Asp Asp Tyr Pro Lys Ile Val Asp Phe Ile Ser Arg Phe Ala Val His His Ile Asn Val Thr Phe Ser Cys Arg Lys His Gly 195 ~ 200 205 Ala Asn Arg Ala Asp Val His Ser Ala Ser Thr Ser Ser Arg Leu Asp Ala Ile Arg Ser Val Tyr Gly Ala Ser Val Val Arg Asp Leu Ile Glu MOR0252.ST25.txt Ile Lys Val Ser Tyr Glu Asp Ala Ala Asp Ser Ile Phe Lys Met Asp Gly Tyr Ile Ser Asn Ala Asn Tyr Val Ala Lys Lys Ile Thr Met Ile Leu Phe Tle Asn Asp Arg Leu Val Asp Cys Thr Ala Leu Lys Arg Ala Ile Glu Phe Val Tyr Ser Ala Thr Leu Pro Gln Ala Ser Lys Pro Phe Ile Tyr Met Ser Ile His Leu Pro Ser Glu His Val Asp Val Asn Ile His Pro Thr Lys Lys Glu Val Ser Leu Leu Asn Gln Glu Arg Ile Ile Glu Thr Ile Arg Asn Ala Ile Glu Glu Lys Leu Met Asn Ser Asn Thr Thr Arg Ile Phe Gln Thr Gln Ala Leu Asn Leu Ser Gly Ile Ala Gln Ala Asn Pro Gln Lys Asp Lys Val Ser Glu Ala Ser Met Gly Ser Gly v Thr Lys Ser Gln Lys Ile Pro Val Ser Gln Met Val Arg Thr Asp Pro Arg Asn Pro Ser Gly Arg Leu His Thr Tyr Trp His Gly Gln Sex Ser 405 410 4l5 Asn Leu Glu Lys Lys Phe Asp Leu Val Ser Val Arg Asn Val Val Arg Ser Arg Arg Asn Gln Lys Asp Ala Gly Asp Leu Ser Ser Arg His Glu Leu Leu Val Glu Ile Asp Ser Ser Phe His Pro Gly Leu Leu Asp Ile Val Lys Asn Cys Thr Tyr Val Gly Leu Ala Asp G1u Ala Phe Ala Leu Ile Gln His Asn Thr Arg Leu Tyr Leu Val Asn Val Val Asn Ile Ser Lys Glu Leu Met Tyr Gln Gln Ala Leu Cys Arg Phe Gly Asn Phe Asn MOR0252.ST25.txt Ala Ile Gln Leu Ser Glu Pro Ala Pro Leu Gln Glu Leu Leu Val Met Ala Leu Lys Asp Asp G1u Leu Met Ser Asp Glu Lys Asp Asp Glu Lys Leu Glu Ile Ala Glu Val Asn Thr Glu Ile Leu Lys Glu Asn Ala Glu Met Ile Asn Glu Tyr Phe Ser Ile His Ile Asp Gln Asp Gly Lys Leu Thr Arg Leu Pro Va1 Val Leu Asp Gln Tyr Thr Pro Asp Met Asp Arg Leu Pro Glu Phe Val Leu Ala Leu Gly Asn Asp Val Thr Trp Asp Asp Glu Lys Glu Cys Phe Arg Thr Val Ala Ser Ala Val Gly Asn Phe Tyr 610 6l5 620 Ala Leu His Pro Pro Ile Leu Pro Asn Pro Ser Gly Asn Gly Ile His Leu Tyr Lys Lys Asn Arg Asp 5er Met Ala Asp Glu His Ala Glu Asn Asp Leu Ile Ser Asp Glu Asn Asp Val Asp Gln Glu Leu Leu Ala Glu Ala Glu Ala Ala Trp Ala Gln Arg Glu Trp Thr Ile Gln His Val Leu Phe Pro Ser Met Arg Leu Phe Leu Lys Pro Pro Lys Ser Met Ala Thr Asp Gly Thr Phe Val Gln Val Ala Ser Leu Glu Lys Leu Tyr Lys T1e 705 710 7l5 720 Phe Glu Arg Cys

Claims

1.~A method for producing hybridoma cells producing high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein said hybridoma cells express a dominant negative allele of a mismatch repair gene;
(c) incubating said parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells;
(d) performing a screen for binding of antibodies to antigen for antibodies produced from said hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for said antigen than antibodies produced by said parental hybridoma cells;
thereby producing hybridoma cells producing high-affinity antibodies.

2. ~The method of claim 1 wherein said dominant negative allele of a mismatch repair gene comprises a dominant negative allele of a gene selected from the group consisting of PMS2, PMS1, PMSR3, PMSR2, PMSR6, MLH1, GTBP, MSH3, MSH2, MLH3, or MSH1, and homologs of PMSR genes.

3. ~The method of claim 1 wherein said dominant negative allele of a mismatch repair gene comprises a dominant negative allele of a PMS2 gene.

4. ~The method of claim 1 further comprising a screen for hypermutated hybridomas that also produce antibodies in higher titers than said parental hybridomas.

5. ~The method of claim 1 further comprising inactivation of said dominant negative allele of said mismatch repair gene, thereby stabilizing the genome of said hypermutated hybridoma.

6. ~The method of claim 4 further comprising inactivation of said dominant negative allele of said mismatch repair gene, thereby stabilizing the genome of said hypermutated hybridoma.

7. ~The method of claim 1 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1 x 10 14 M-1.

8. ~The method of claim 4 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

9. ~The method of claim 1 or 4 further comprising the step of inactivating said dominant negative allele of a mismatch repair gene by knocking out said dominant negative allele or removing an inducer of said dominant negative allele.

10. ~The method of claim 1 further comprising incubating said parental hybridoma cells with a chemical mutagen.

11. ~The method of claim 1 wherein the dominant negative mismatch repair gene is introduced into said hybridoma cell after the fusion of said myeloma with said immunoglobulin-producing cells.

12. ~The method of claim 1 wherein said myeloma cells express a dominant negative mismatch repair gene which is also expressed in said hybridoma cells.

13. ~A hybridoma cell producing high affinity antibodies produced by the method of claim 1,4,5,6,7, or 10.

14. ~An antibody produced by a hybridoma cell of claim 13.

15. ~A method for producing hybridoma cells that produce high titers of antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein said hybridoma cells express a dominant negative allele of a mismatch repair gene;
(c) incubating said parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells;

(d) performing a screen of said hypermutated hybridoma cells for antibodies produced in higher titers than that produced by said parental hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce higher titers of antibodies than that produced by said parental hybridoma cells;
thereby producing hybridoma cells that produce high titers of antibodies.

16. ~The method of claim 15 wherein said dominant negative allele of a mismatch repair gene is selected from the group consisting of a dominant negative allele of PMS2, PMS1, PMSR3, PMSR2, PMSR6, MLH1, GTBP, MSH3, MSH2, MLH3, or MSH1, and homologs of PMSR.

17. ~The method of claim 15 wherein said dominant negative allele of a mismatch repair gene comprises a dominant negative allele of a PMS2 gene.

18. ~The method of claim 15 further comprising inactivation of said dominant negative allele of said mismatch repair gene, thereby stabilizing the genome of said hypermutated hybridoma.

19. ~The method of claim 15 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

20. ~The method of claim 18 wherein said dominant negative allele of a mismatch repair gene is inactivated by knocking out said dominant negative allele or removing an inducer of said dominant negative allele.

21. ~The method of claim 15 further comprising incubating said parental hybridoma cells with a chemical mutagen.

22. ~The method of claim 15 wherein the dominant negative mismatch repair gene is introduced into said hybridoma cell after the fusion of said myeloma with said immunoglobulin-producing cells.

23. ~The method of claim 15 wherein said myeloma cells express a dominant negative mismatch repair gene which is also expressed in said hybridoma cells.

24. A hybridoma cell producing high affinity antibodies produced by the method of claim 15, 18, or 21.

25. An antibody produced by a hybridoma cell of claim 24.

26. A recombinant myeloma cell comprising a polynucleotide sequence encoding a dominant negative mismatch repair protein.

27. The recombinant myeloma cell of claim 26 wherein said mismatch repair protein is selected from the group consisting of PMS2, PMS1, PMSR3, PMSR2, PMSR6, MLH1, GTBP, MSH3, MSH2, MLH3, or MSH1, and homologs of PMSR genes.

28. The recombinant myeloma cell of claim 26 wherein said dominant negative allele of a mismatch repair gene comprises a dominant negative allele of a PMS2 gene.

29. The recombinant myeloma cell of claim 26 wherein said myeloma cell does not express immunoglobulin genes.

30. The recombinant myeloma cell of claim 29 wherein said myeloma cell is HAT
sensitive.

31. The recombinant myeloma cell of claim 30 wherein said myeloma cell is EBV-negative.

32. A method for producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells;
(c) performing a screen for binding of antibodies produced from said hybridoma cells to antigen;

(d) cloning immunoglobulin genes from said hybridoma into a mammalian expression cell, wherein said mammalian expression cell expresses a dominant negative allele of a mismatch repair gene;
(e) performing a screen for mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from said hybridoma cells;
thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized human immunoglobulin-producing cells.

33. The method of claim 32 wherein said dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell prior to introduction of said immunoglobulin genes.

34. The method of claim 32 wherein said dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell after introduction of said immunoglobulin genes.

35. The method of claim 32 wherein said dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell simultaneously said immunoglobulin genes.

36. The method of claim 32 wherein said mismatch repair gene is selected from the group consisting of PMS2, PMS1, PMSR3, PMSR2, PMSR6, MLH1, GTBP, MSH3, MSH2, MLH3, or MSH1, and homologs of PMSR genes.

37. The method of claim 32 wherein said dominant negative allele of a mismatch repair gene comprises a dominant negative allele of a PMS2 gene.

38. The method of claim 32 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1× 10 14 M-1.

39. A mammalian expression cell produced by the method of claim 32.

40. An antibody produced by a mammalian expression cell of claim 39.

41. ~A method for producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells, wherein said hybridoma cells express a dominant negative allele of a mismatch repair gene;
(c) incubating said parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells;
(d) performing a screen for binding of antibodies to antigen for antibodies produced from said hypermutated hybridoma cells;
(e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for said antigen than antibodies produced by said parental hybridoma cells;
(f) cloning immunoglobulin genes from said hybridoma into a mammalian expression cell;
thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells.

42. The method of claim 41 wherein said dominant negative allele of a mismatch repair gene is expressed in said myeloma cell and in said hybridoma cell.

43. The method of claim 41 wherein said dominant negative allele of a mismatch repair gene is introduced into said hybridoma cell after said fusion.

44. The method of claim 41 wherein said mismatch repair gene is selected from the group consisting ofPMS2, PMS1, PMSR3, PMSR2, PMSR6, MLH1, GTBP, MSH3, MSH2, MLH3, or MSH1, and homologs of PMSR genes.

45. The method of claim 41 wherein said dominant negative allele of a mismatch repair gene comprises a dominant negative allele of a PMS2 gene.

46. The method of claim 41 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1 × 10 14 M-1.~

47. ~A mammalian expression cell produced by the method of claim 41.

48. ~An antibody produced by a mammalian expression cell of claim 47.

49. ~A method for producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells;
(c) performing a screen for binding of antibodies produced from said hybridoma cells to antigen;
(d) cloning immunoglobulin genes from said hybridoma into a parental mammalian expression cell, wherein said mammalian expression cell expresses a dominant negative allele of a mismatch repair gene;~
(e) incubating said parental mammalian expression cell to allow for mutagenesis, thereby forming hypermutated mammalian expression cells;
(f) performing a screen of hypermutable mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from said hybridoma cells; and (g) performing a screen of hypermutable mammalian expression cells that secrete higher titers of antibodies than parental mammalian expression cells;
thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells.

50. The method of claim 49 wherein said dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell prior to introduction of said immunoglobulin genes.

51. The method of claim 49 wherein said dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell after introduction of said immunoglobulin genes.

52. The method of claim 49 wherein said dominant negative allele of a mismatch repair gene is introduced into said mammalian expression cell simultaneously said immunoglobulin genes.

53. The method of claim 49 wherein said mismatch repair gene is selected from the group consisting of PMS2, PMS1, PMSR3, PMSR2, PMSR6, MLH1, GTBP, MSH3, MSH2, MLH3, or MSH1, and homologs of PMSR genes.

54. The method of claim 49 wherein said dominant negative allele of a mismatch repair gene comprises a dominant negative allele of a PMS2 gene.

55. The method of claim 49 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1 × 10 14 M-1.

56. The method of claim 49 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

57. Mammalian expression cells produced by the method of claim 49.

58. Antibodies produced by the mammalian expression cells of claim 57.

59. A recombinant, hypermutable mammalian expression cell comprising a polynucleotide sequence encoding a dominant negative mismatch repair protein.

60. The recombinant, hypermutable mammalian expression cell of claim 59 wherein said mismatch repair protein is selected from the group consisting of PMS2, PMS1, PMSR3, PMSR2, PMSR6, MLH1, GTBP, MSH3, MSH2, MLH3, or MSH1, and homologs of PMSR
genes.

61. The recombinant, hypermutable mammalian expression cell of claim 59 wherein said dominant negative allele of a mismatch repair gene comprises a dominant negative allele of a PMS2 gene.

62. ~A method for producing hybridoma cells producing high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells;
(c) incubating said parental hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair, thereby forming hypermutated hybridoma cells;
(d) performing a screen for binding of antibodies to antigen for antibodies produced from said hypermutated hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for said antigen than antibodies produced by said parental hybridoma cells;
thereby producing hybridoma cells producing high-affinity antibodies.

63. ~The method of claim 62 wherein said chemical inhibitor of mismatch repair is selected from the group consisting of an anthracene, ATPase inhibitor, a nuclease inhibitor, an RNA
interference molecule, a polymerase inhibitor and an antisense oligonucleotide that specifically hybridizes to a nucleotide encoding a mismatch repair protein.

64. ~The method of claim 62 wherein said inhibitor is an anthracene having the formula:
wherein R1-R10 are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;

wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkoxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and wherein said amino groups are optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups.

65. ~The method of claim 64 wherein R1-R10 are independently hydrogen, hydroxyl, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, phenyl, tolyl, hydroxymethyl, hydroxypropyl, or hydroxybutyl.

66. ~The method of claim 62 further comprising a screen for hypermutated hybridomas that also produce antibodies in higher titers than said parental hybridomas.

67. ~The method of claim 62 further comprising the step of removing said chemical inhibitor from said growth medium following hypermutation, thereby stabilizing the genome of said hypermutated hybridoma.

68. The method of claim 66 further comprising the step of removing said chemical inhibitor from said growth medium following hypermutation, thereby stabilizing the genome of said hypermutated hybridoma.

69. The method of claim 62 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1 × 10 14 Mu.

70. ~The method of claim 66 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

71. ~A hybridoma cell produced by the method of claim 62, 66, 67, or 68.

72. ~An antibody produced by a hybridoma cell of claim 71.

73. ~A method for producing hybridoma cells that produce high titers of antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells;
(c) incubating said parental hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair, thereby forming hypermutated hybridoma cells;
(d) performing a screen of said hypermutated hybridoma cells for antigen-specific antibodies produced in higher titers than that produced by said parental hybridoma cells; and (e) selecting hypermutated hybridoma cells that produce higher titers of antibodies than that produced by said parental hybridoma cells;
thereby producing hybridoma cells that produce high titers of antibodies.

74. ~The method of claim 73 wherein said chemical inhibitor is selected from the group consisting of an anthracene, ATPase inhibitor, a nuclease inhibitor, an RNA
interference molecule, a polymerase inhibitor and an antisense oligonucleotide that specifically hybridizes to a nucleotide encoding a mismatch repair protein.

75. ~The method of claim 74 wherein said inhibitor is an anthracene having the formula:
wherein R1-R10 are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;

wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkoxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and wherein said amino groups are optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups.

76. ~The method of claim 75 wherein R1-R10 are independently hydrogen, hydroxyl, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, phenyl, tolyl, hydroxymethyl, hydroxypropyl, or hydroxybutyl.

77. ~The method of claim 73 further comprising the step of removing said chemical inhibitor from said growth medium following hypermutation, thereby stabilizing the genome of said hypermutated hybridoma.

78. ~The method of claim 73 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

79. ~A hybridoma cell produced by the method of claim 73 or 77.

80. ~An antibody produced by a hybridoma of claim 79.

81. ~A method for producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells;
(c) performing a screen for binding of antibodies produced from said hybridoma cells to antigen;
(d) cloning immunoglobulin genes from said hybridoma into a mammalian expression cell;

(e) incubating said mammalian expression cell in the presence of at least one chemical inhibitor of mismatch repair;
(f) performing a screen for mammalian expression cells that secrete antibodies with higher affinity for antigen as compared to antibodies produced from said hybridoma cells;
thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells.

82. The method of claim 81 wherein said chemical inhibitor of mismatch repair is selected from the group consisting of an anthracene, ATPase inhibitor, a nuclease inhibitor, an RNA
interference molecule, a polymerase inhibitor and an antisense oligonucleotide that specifically hybridizes to a nucleotide encoding a mismatch repair protein.

83. The method of claim 82 wherein said inhibitor is an anthracene having the formula:
wherein R1-R10 are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;
wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkoxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and wherein said amino groups axe optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups.

84. The method of claim 83 wherein R1-R10 are independently hydrogen, hydroxyl, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, phenyl, tolyl, hydroxymethyl, hydroxypropyl, or hydroxybutyl.

85. The method of claim 81 further comprising screen, prior to collection of said antibodies from said hypermutated hybridoma cells, for hypermutated hybridomas that also produce antibodies in higher titers than said parental hybridomas.

86. The method of claim 81 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1 × 10 14 M-1.

87. The method of claim 81 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

88. The method of claim 81 further comprising removing said chemical inhibitor, thereby stabilizing the genome of said hypermutated mammalian expression cells.

89. A mammalian expression cell produced by the method of claim 81, 85, or 88.

90. An antibody produced by a mammalian expression cell of claim 89.

91. A method for producing mammalian expression cells that produce high titers of high affinity antibodies to a selected antigen from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells to form hybridoma cells;
(c) incubating said hybridoma cells in the presence of at least one chemical inhibitor of mismatch repair to form hypermutated hybridoma cells;
(d) performing a screen for binding of antigen for antibodies produced from said hypermutated hybridoma cells;

(e) selecting hypermutated hybridoma cells that produce antibodies with greater affinity for said antigen than antibodies produced by said parental hybridoma cells;
(f) cloning immunoglobulin genes from said hypermutated hybridoma cells into a mammalian expression cell, thereby forming parental mammalian expression cells;
thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in vitro immunized immunoglobulin-producing cells.

92. The method of claim 91 wherein said chemical inhibitor of mismatch repair is selected from the group consisting of an anthracene, ATPase inhibitor, a nuclease inhibitor, an RNA
interference molecule, a polymerase inhibitor and an antisense oligonucleotide that specifically hybridizes to a nucleotide encoding a mismatch repair protein.

93. The method of claim 91 wherein said inhibitor is an anthracene having the formula:
wherein R1-R10 are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;
wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkoxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and wherein said amino groups are optionally substituted with an aryl group, or 1 to 3 aryl or lower alkyl groups.

94. ~The method of claim 92 wherein R1-R10 are independently hydrogen, hydroxyl, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, phenyl, tolyl, hydroxymethyl, hydroxypropyl, or hydroxybutyl.

95. ~The method of claim 91 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1 × 10 14 M-1.

96. ~The method of claim 91 further comprising the steps of:~
incubating said mammalian expression cell in the presence of at least one chemical inhibitor of mismatch repair, thereby forming a hypermutated mammalian expression cell; and screening for hypermutated mammalian expression cells that produce a higher titer of antibodies that said parental mammalian expression cells.

97. ~The method of claim 91 further comprising removing said chemical inhibitor, thereby stabilizing the genome of said hypermutated hybridoma cells.

98. ~The method of claim 96 further comprising removing said chemical inhibitor, thereby stabilizing the genome of said hypermutated mammalian expression cells.

99. ~The method of claim 96 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

100. A mammalian expression cell produced by the method of claim 91, 95, 96, or 97.

101. An antibody produced by a mammalian expression cell of claim 100.

102. A method for producing hybridoma cells that produce high-affinity antibodies from in vitro immunized immunoglobulin-producing cells in high titers comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro, wherein said donor cells are derived from a donor that is naturally deficient in mismatch repair;

(b) fusing said immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein said parental hybridoma cells are deficient in mismatch repair;
(c) incubating the said parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells;
(d) performing a screen for binding of antibodies to antigen for antibodies produced from said hypermutated hybridoma cells;
(e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by said parental hybridoma cells;
(f) performing a second screen for hypermutated hybridoma cells that produce increased titers of antibodies as compared with said parental hybridoma cells;
(g) selecting hypermutated hybridoma cells that produce antibodies in higher titers than produced by said parental hybridoma cells;
thereby producing hybridoma cells producing high titers of high-affinity antibodies.

103. The method of claim 102 further comprising the step of introducing a wild-type gene for mismatch repair into said selected hypermutated hybridoma cell to complement the mismatch repair deficiency, thereby restabilizing the genome of said selected hypermutated hybridoma cell.

104. The method of claim 102 further comprising incubating said parental hybridoma cells with a chemical mutagen.

105. A hybridoma cell produced by the method of claim 102, 103, or 104.

106. An antibody produced by a hybridoma cell of claim 105.

107. A method for producing hybridoma cells that produce high-affinity antibodies from in vitro immunized immunoglobulin-producing cells in high titers comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing said immunoglobulin-producing cells with myeloma cells, wherein the myeloma cells are naturally deficient in mismatch repair, thereby forming parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair;

(c) incubating said parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells;
(d) performing a screen for binding of antibodies to antigen for antibodies produced from said hypermutated hybridoma cells;
(e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by said parental hybridoma cells;
(f) performing a second screen for hypermutated hybridoma cells that produce increased titers of antibodies as compared with parental hybridoma cells;
(g) selecting hypermutated hybridoma cells that produce antibodies in higher titers than produced by said parental hybridoma cells;
thereby producing hybridoma cells producing high titers of high-affinity antibodies.

108. The method of claim 107 further comprising introducing a wild-type gene for mismatch repair into said selected hypermutated hybridoma cell to complement the mismatch repair deficiency, thereby restabilizing the genome of said selected hypermutated hybridoma cell.

109. The method of claim 107 further comprising incubating said parental hybridoma cells with a chemical mutagen.

110. The method of claim 107 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1 × 10 14 M-1.

111. The method of claim 107 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

112. A hybridoma cell produced by the method of claim 107, 108, or 109.

113. An antibody produced by a hybridoma cell of claim 112.

114. A method for producing mammalian expression cells that produce high-affinity antibodies in high titers from in vitro immunized immunoglobulin-producing cells comprising:

(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro, wherein the donor cells are derived from a donor that is naturally deficient in mismatch repair;
(b) fusing the immunoglobulin-producing cells with myeloma cells to form parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair;
(c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells;
(d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells;
(e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells;
(f) cloning immunoglobulin genes from said hypermutated hybridoma into a mammalian expression cell;
thereby producing a mammalian expression cell that produce high titers of high-affinity antibodies in high titer from in vitro immunized immunoglobulin-producing cells.

115. The method of claim 114 wherein said high affinity antibodies have an affinity of at least about 1 × 10 7 M-1 to about 1 × 10 14 M-1.

116. The method of claim 114 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

117. The method of claim 114 further comprising the steps of:
incubating the mammalian expression cells in the presence of at least one chemical inhibitor of mismatch repair, thereby forming hypermutated mammalian expression cells; and screening said hypermutated mammalian expression cells for higher production of antibodies than that of the parental mammalian expression cells.

118. The method of claim 117 wherein said chemical inhibitor of mismatch repair is selected from the group consisting of an anthracene, ATPase inhibitor, a nuclease inhibitor, an RNA interference molecule, a polymerase inhibitor and an antisense oligonucleotide that specifically hybridizes to a nucleotide encoding a mismatch repair protein.

119. The method of claim 117 wherein said inhibitor is an anthracene having the formula:

wherein R1-R10 are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alknyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;
wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkoxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and wherein said amino groups are optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups.

120. The method of claim 119 wherein R1-R10 are independently hydrogen, hydroxyl, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, phenyl, tolyl, hydroxymethyl, hydroxypropyl, or hydroxybutyl.

121. The method of claim 117 further comprising the step of removing said chemical inhibitor of mismatch repair from the hypermutated mammalian expression cells, thereby stabilizing the genome of said hypermutated mammalian expression cells.

122. A mammalian expression cell produced by the method of claim 114, 117, 118, or 121.

123. An antibody produced by a mammalian expression cell of claim 122.

124. A method for producing mammalian expression cells that produce high-affinity antibodies in high titer from in vitro immunized immunoglobulin-producing cells comprising:
(a) combining donor cells comprising immunoglobulin-producing cells with an immunogenic antigen in vitro;
(b) fusing the immunoglobulin-producing cells with myeloma cells, wherein the myeloma cells are naturally deficient in mismatch repair, thereby forming parental hybridoma cells, wherein the hybridoma cells are deficient in mismatch repair;
(c) incubating the parental hybridoma cells to allow for mutagenesis, thereby forming hypermutated hybridoma cells;
(d) performing a screen for binding of antibodies to antigen for antibodies produced from the hypermutated hybridoma cells;
(e) selecting hypermutated hybridoma cells that produce antibodies with enhanced affinity for the antigen than antibodies produced by the parental hybridoma cells; and (f) cloning immunoglobulin genes from said hypermutated hybridoma cell into a mammalian expression cell;
thereby producing mammalian expression cells that produce high titers of high-affinity antibodies from in 'vitro immunized immunoglobulin-producing cells.

125. The method of claim 124 wherein said high affinity antibodies have an affinity of at least about 1 x 10~ M-1 to about 1 x 1014 Mn.

126. The method of claim 124 wherein said higher titer of said antibodies is at least about 1.5-8 fold greater that the titer produced by said parental hybridoma cell.

127. The method of claim 124 further comprising the steps of:
incubating the mammalian expression cells in the presence of at least one chemical inhibitor of mismatch repair, thereby forming hypermutated mammalian expression cells; and screening said hypermutated mammalian expression cells for higher production of antibodies than that of the parental mammalian expression cells.

128. The method of claim 127 wherein said chemical inhibitor of mismatch repair is selected from the group consisting of an anthracene, ATPase inhibitor, a nuclease inhibitor, an RNA interference molecule, a polymerase inhibitor and an antisense oligonucleotide that specifically hybridizes to a nucleotide encoding a mismatch repair protein.

129. The method of claim 127 wherein said inhibitor is an anthracene having the formula:
wherein R1-R10 are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;
wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkoxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and wherein said amino groups are optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups.

130. The method of claim 129 wherein R1-R10 are independently hydrogen, hydroxyl, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, phenyl, tolyl, hydroxymethyl, hydroxypropyl, or hydroxybutyl.

131. The method of claim 127 further comprising the step of removing said chemical inhibitor of mismatch repair from the hypermutated mammalian expression cells, thereby stabilizing the genome of said hypermutated mammalian expression cells.

132. A mammalian expression cell produced by the method of claim 124, 127, or 131.

133. An antibody produced by a mammalian expression cell of claim 132.

134. A method for in vitro production of antigen-specific immunoglobulin-producing cells comprising:
(a) isolating donor cells from an animal;
(b) treating said cells with L-leucyl-L-leucine methy ester hydrobromide;
(c) incubating said donor cells with an immunogenic antigen in vitro, at 25-37°C, 5-10% CO2, in medium supplemented with 5-15% serum, and a growth promoting cytokine for 4 days;
(d) washing said cells in medium; and (e) culturing said cells in medium supplemented with 5-15% serum an additional days;
thereby stimulating the production of antigen-specific immunoglobulin-producing cells.

135. The method of claim 62, 73, 81, 91, 117, or 127 wherein said chemical inhibitor of mismatch repair is an antisense molecule comprising at least 15 consecutive nucleotides of a sequence encoding a protein selected from the group consisting of SEQ ID NO:2;
SEQ ID
NO:4; SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:10; SEQ ID NO:12; SEQ ID NO:14; SEQ
ID NO:16; SEQ ID NO:18; SEQ ID NO:20; SEQ ID NO:22; SEQ ID NO:24; SEQ ID
NO:26;
SEQ ID NO:28; SEQ ID NO:30; SEQ ID NO:32; SEQ ID NO:34; SEQ ID NO:36; SEQ ID
NO:38; SEQ ID NO:40; SEQ ID NO:42; SEQ ID NO:44; SEQ ID NO:46; SEQ ID NO:48;
and SEQ ID NO:50.

136. The method of claim 62, 73, 81, 91, 117, or 127 wherein said chemical inhibitor of mismatch repair is an antisense molecule comprising at least 15 consecutive nucleotides of a sequence selected from the group consisting of SEQ ID NO:1; SEQ ID NO:3; SEQ
ID NO:5;
SEQ ID NO:7; SEQ ID NO:9; SEQ ID NO:11; SEQ ID NO:13; SEQ ID NO:15; SEQ ID
NO:17; SEQ ID NO:19; SEQ ID NO:21; SEQ ID NO:23; SEQ ID NO:25; SEQ ID NO:27;

SEQ ID NO:29; SEQ ID NO:31; SEQ ID NO:33; SEQ ID NO:35; SEQ ID NO:37; SEQ ID
NO:39; SEQ ID NO:41; SEQ ID NO:43; SEQ ID NO:45; SEQ ID NO:47; and SEQ ID
NO:49.

137. A hybridoma cell producing high affinity antibodies produced by the method of claim 9.

138. An antibody produced by a hybridoma cell of claim 137.