CA2413237A1 - Alteration of cell membrane for new functions - Google Patents

Abstract

Methods and compositions are provided for the persistent modification of cell membranes with exogenous proteins so as to alter the function of the cell to achieve effects similar to those of gene therapy, without the introduction of exogenous DNA. DNA sequences, the proteins and polypeptides embodying these sequences are disclosed for modulating the immune system. The modulations include down-regulation, up-regulation and apoptosis.

Description

ALTERATION OF CELL MEMBRANE FOR NEW FUNCTIONS
FIELD OF THE INVENTION
This invention relates to the persistent modification of cell membranes so as to alter the function of the cells. The compositions and methods of this invention achieve effects similar to those of gene therapy without the introduction of exogenous DNA. A useful alteration of cell function is the induction of apoptosis.
BACI~GROLTND OF THE INVENTION
It has long been the goal of experimental biology and medicine to induce cells to behave in predictable ways and to alter the behavior of cells in ways that are beneficial to a subject. For example, if undesired cells could be induced to alter their behavior to undergo apoptosis while normal cells retain normal function, subj ects with a disease caused by proliferation of undesired cells would obtain relief from the disease. Similarly, if tissue-rej ecting cells can be eliminated or their behavior changed, transplantation with tissues foreign to the subj ect can be successful.
Gene therapy has been proposed for selected diseases in order to correct or modify pathological or physiological processes. In gene therapy as it is generally termed, specific DNA is introduced into a tissue and organ, where it is produces various proteins that will correct or ameliorate the condition. It is an unpredictable therapy, depending on potentially dangerous expression vectors and the uncertain efficiency of delivery, which is often low. Moreover, gene therapy is considered to have dangerous side effects, such as sustained expression in desired cells or tissues past the desired duration of therapy, or the introduction of genetic modifications in undesired tissues or cells. Because of such adverse effects, as discovered in human clinical trials, much caution is advised before gene therapy is put in practice.
DNA-based gene therapy has been the subject of intense studies during the past few decades because of the tremendous potential it offers for the treatment of inherited diseases and other pathologic conditions for which the expression of selected proteins may offer treatment. For example, gene therapy can be used for immunomodulation either to enhance the capacity of the immune response to deal with infections or tumors, or to down-regulate the immune response for the prevention of autoimmunity or foreign graft rejection.
Despite vast efforts in the past two decades, the safe and effective application of gene therapy to the treatment of diseases has been extremely limited. Among the apparent drawbacks of gene therapy are the possibility of causing permanent change in the DNA complement of the host; uncertain tissue specificity;
expression of the encoded protein beyond the intended duration of therapy; and high cost. It would therefore be extremely beneficial if cells and tissues could be modified to express proteins of interest in a short period of time without the introduction of foreign DNA.
Whereas gene therapy has generally focused on the problem of delivering nucleic acids into cells, much fundamental knowledge concerning the important role of cell surface molecules has been gained through studies of signal transduction in cells of the immune response, which are readily accessible and have well-understood functions. The immune response is regulated by the interaction of several different cell types, which react to the presence of foreign antigens. The adaptive immune response is critical to the survival of vertebrates in an environment full of pathogenic microorganisms. Individuals who, due to inborn genetic defects, exposure to chemotherapeutic agents or infection by such viruses as human immunadeficiency virus (HIV), lack a fully functional immune response are susceptible to infections that an individual with a healthy immune response would readily withstand. However, the immune system does not always function in ways that are beneficial to the organism. Its dysregulation leads to autoimmunity and tumors. The immune system also serves as a barrier to the transplantation of foreign grafts, such as cells taken from an individual other than the transplant recipient. Transplantation permits the replacement of failed cells, tissues, or organs in otherwise terminal diseases, while bone marrow transplantation can treat hematopoietic disorders, malignancies, autoimmune disorders, and other diseases. For transplantation to be successful, it is necessary either to suppress the adaptive immunity or to "teach" the recipient's immune system to accept these foreign antigens as native.

The immune response to foreign antigens is initiated by naive T cells that use clonally-expressed T cell receptors (TCRs) to recognize antigens such as peptides presented by self major histocompatibility complex (NITIIC) molecules.
This recognition reaction, when accompanied by costimulatory signals provided by antigen-presenting cells (APCs), has been thought to result in full T cell activation. A productive T-cell response is now seen as requiring three distinct signals. Signal 1 is generated by T-cell receptor interaction with the major histocompatibility complex (MHC) antigen/peptide on antigen-presenting cells (APCs). Signal 2 is mediated by the engagements of costimulatory molecules, such as B7/CD28 and CD40/CD40L, on T cells and APCs. Signal 3 is transduced via cytolcines elaborated by T cells and APCs that have received both Signal 1 and 2. The transduction of these 3 signals drives T cells and APCs to proliferation and differentiation into effectors for the generation of a productive immune response. The Iack of any of these signals during the T-cell response results in T-cell anergy and immune nonresponsiveness. For example, tumors evade the immune system by preventing the transduction of one of these signals.
Upon activation, T cells proliferate and differentiate into effector cells that evoke immunological mechanisms responsible for the clearance of antigens from the system. A period of death then follows during which most of the activated T cells undergo apoptosis-mediated "activation-induced cell death"
(AICD) and effector activity subsides. Apoptosis is a complex process that involves a series of extra- and intracellular signals that converge on the activation of enzymes called caspases that commit the cell to apoptosis.
Transplantation of foreign cells (such as bone marrow and stem cells), tissues (such as pancreatic islets), and organs (such as kidneys, hearts, livers) has become an important and effective therapeutic alternative for patients with selected terminal diseases. The transplantation of foreign grafts between genetically different patients (allografts between members of the same species or xenografts between members of different species) is, however, limited by the ability to control the immunological recognition and rejection of the graft by the recipient.

Bone marrow (BM) transplantation has been viewed as an extraordinarily promising treatment for hematopoietic and autoirnmune disorders and for certain cancers. One obstacle to bone marrow transplantation is the possibility of rejection of the transplanted tissue, mediated by the host's T cells and NK
cells.
Graft-versus-host-disease (GvHD) is another possible adverse consequence of bone marrow transplantation. Donor T cells in the transplanted tissue can mount an immune response against the host's vital organs, often leading to death of the host. Host-versus-graft reactions and GvHD therefore limit the clinical use of bone marrow transplantation, which might otherwise be widely used to treat various diseases and to prevent foreign graft rejection.
Pharmacological agents that cause immunosuppression are now a mainstay of regimens for the control of allograft rejection. Although such drugs are effective in reducing the severity of rejection episodes, they are nonspecific and fail to create a state of permanent graft-specific tolerance. Continuous exposure of the recipient to these immunosuppressive agents is therefore associated with a significantly increased risk of opportunistic infections and malignancies. The need remains to develop more selective and long-lasting methods to prevent BM rejection.
Additionally, these nonspecific immunosuppressive agents can induce serious and undesirable side effects in the host. These adverse effects often outweigh the benefits for patients with diseases in which the body identifies certain parts of itself as "foreign" and launches an adaptive immune attack that results in autoimmunity, such as is observed in Type I diabetes, arthritis, lupus, and multiple sclerosis. It would be very desirable to be able to "teach" the immune system to tolerate the "foreign" self antigen.
It would also be very desirable to be able to "teach" the immune system to rid the organism of tumor cells. T cell-mediated cellular immunity is the most critical acquired response against tumors. A series of experimental studies has provided evidence that tumors evade T-cell-mediated immunity by several different mechanisms. These mechanisms include: i) lack of Signal 1, due to inefficient display of MHC/tumor antigen bimolecular complexes on tumor cells or defects in the transduction of this signal; ii) absence of Signal 2, due to the absence of costimulatory molecules on tumor cells; iii) induction of anergy in T
cells; and iv) physical elimination of effector T cells via apoptosis.
Although all of these mechanisms may be operative in patients with a large tumor burden, the lack of costimulation is believed to play the most critical role.
The need therefore remains to develop more rapid, selective and long-lasting methods to modulate cell function without the introduction of nucleic acids into cells for therapeutic purposes. The need also remains to develop a means of accomplishing the end of gene therapy without many of the risks attendant to the introduction of exogenous nucleic acids into an organism.
Since much cell function is controlled through the transduction of signals at the cell surface, a generally applicable method of attaching an agent to a surface would be useful. Among the uses of such a method would be: the modulation of cell function without the introduction of nucleic acids into the cell; the accomplishment of the end of gene therapy by alternative and potentially preferable means; and the manipulation of an organism's immune response in order to diminish that response, as to treat autoimmunity or to forestall graft-versus-host disease, or to increase that response, as to treat tumors or infections.
SUMMARY OF THE INVENTION
The present invention provides a method of modifying a surface, the method comprising: (1) contacting a surface with one member of a binding pair which binds to the surface to form a decorated surface; and subsequently (2) contacting the decorated surface with a composition comprising the second member of the binding pair operably linked to an agent capable of modifying the surface and the function thereof. The binding pair may be avidinlbiotin, streptavidin/biotin or antigenlantibody. By "avidin" is meant avidin and any fragment or derivative of avidin which retains strong binding to biotin. By "streptavidin" is meant streptavidin and any fragment or derivation of streptavidin which retains strong binding to biotin. Conversely, by "biotin"
is meant any fragment or derivative of biotin which retains strong binding to avidin and streptavidin.

When the surface is a cell surface, the agent may be any compound inducing apoptosis; any agent down-regulating the immune system; any agent up-regulating the immune system; any adhesion molecule for cell tracking; any growth factor; or an antibody ligated to a toxin such as ricin or phytotoxin.
When the surface is a cell surface, the contact of step 1 produces a "decorated cell."
When the agent is selected to induce apoptosis, the agent may be a death-inducing molecule such as Fast, mFasL, TRAIL, TNF-a, TWEAK and the like.
When the agent is selected to down-regulate the immune system, the agent may be an anti-inflammatory cytokine such as IL-4, IL-10, TGF-~3 and the like.
When the agent is selected to up-regulate the immune system, the agent may be a costimulatory molecule such as B7, CD40L and the lilce or a pro-inflammatory cytokine such as IL-2, IL-12, IL-15, lymphotactin and chemokine.
In a preferred embodiment, the first member of the binding pair is biotin, the second member of the binding pair is a chimeric protein comprising streptavidin and a death-inducing molecule and the surface comprises target cells, tissues, organs or tumors.
In a more preferred embodiment, the first member of the binding pair is Sulfo-NHS-LC-biotin, the second member of the binding pair is SA-mFasL and the surface comprises a cell displaying the Fas receptor. In constructing the second member of the binding pair, streptavidin is fused to the extracellular portion of Fast through recombinant gene technology and the clumeric protein SA-mFasL is produced.
This construct is used in a method to modulate the immune system wherein a subject to be treated is first administered biotin to form decorated cells, followed by administration of SA-mFasL to form chimeric decorated cells.
Only those cells in the tissue, organ or tumor which are biotinylated and express Fas will undergo apoptosis. In general, these cells include those cells which cause immuno-mediated injuries.
In another aspect of the invention, a subject who will benefit from dowxn-regulation of the immune system is first administered biotin to form decorated cells and is then administered a construct comprising avidin or streptavidin and a down-regulating molecule. Subjects who will benefit from down-regulation of the immune system include subjects suffering from autoimmunity, graft-versus-host disease, allergies, septic shocl~ and vascular diseases. Subjects undergoing tissue or organ grafts also benefit from the down-regulation of the immune system.
In another aspect of the invention, a subject who will benefit from up-regulation of the immune system is first administered biotin to form decorated cells and is then administered a construct comprising avidin or streptavidin and an up-regulating molecule. Subjects who will benefit from an up-regulation of the immune system include subjects suffering from neoplasia or infectious disease.
In another aspect of the invention, systemic effects are avoided by biotinylating the cells ex vivo by isolation of the target or selection of a target that can be treated topically, followed by reintroduction of the decorated cells into the subject with subsequent second contact.
In another aspect of the invention, the members of the binding pair form a covalent bond with each other. In a preferred aspect, the first member of a binding pair comprises a cysteine residue and the second member of the binding pair comprises a cysteine residue. The two members are first placed together under conditions disfavoring the formation of a disulfide bond between the first member of the binding pair and the second member of the binding pair. In a subsequent step, the two members are placed under conditions favoring the formation of a disulfide bond between the first member of the pair and the second member of the pair.
In another aspect of the invention, the first member of a binding pair contacts a cell surface, a virus, the surface of a glass particle, the surface of a polysaccharide particle or the surface of a plastic particle to form a decorated surface. The decorated surface is then contacted with the second member of the binding pair, to form a second decorated surface. The cell, virus or particle comprising the second decorated surface is contacted with a cell or cell component of an organism either in vitYO or in vivo, for the purpose of therapy, diagnosis, cell sorting or identification.

A recombinant nucleic acid is provided comprising the extracellular portion of Fast fused with streptavidin (SA-inFasL). Gene product is provided which is then attached to the cell surface, previously biotinylated ih vivo.
Methods are taught for the use of gene products for long-lasting elimination of Fas expressing cells.
The methods of this invention can be modified to cause persistent binding of any protein to targeted cells, to mimic the result of DNA gene therapy without modification of the cell genetic material. This persistent binding of a protein to a targeted cell can be considered to be gene therapy at the protein level.
DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic representation of the method to modify cell membrane for the expression of exogenous proteins for new functions.
Figure 2 shows the restriction fragment analysis of the expression vector containing the indicated clones.
Figure 3 shows biotin expression iya vivo.
Figure 4 shows the in vitro expression of SA-mFasL on the surface of splenocytes.
Figure 5 shows SA-mFasL expression on the surface of bone marrow cells.
Figure 6 shows donor clumerism in lethally irradiated animals.
Figure 7 shows a graphic summary of allogeneic cells decorated with SA-mFasL blocl~ing in vivo alloreactive responses.
Figure 8 shows a pancreatic islet cell expressing Fast (red) and streptavidin (B) compared to a control islet (A).
Figure 9 shows T cells modified to express SA-mFasL, activated by ConA.
Figure I O shows expression of SA-CD40L on splenocytes.
DETAILED DESCRIPTION OF THE INVENTION

Because of the noted problems associated with gene therapy as it is commonly used, that is, the introduction and integration of foreign DNA into the genome, a method was sought for the accomplishing the results of gene therapy, that is, long lasting modification of cell function, without the limitations of DNA
introduction. The question was raised as to whether the benefits of gene therapy could be obtained by the delivery of exogenous proteins, rather than nucleic acids, to the cells. A method that would safely permit modification of the cell membrane to achieve transient or long-lasting display of therapeutic molecules could have wide-spread application in the clinic. As disclosed in the present application, Applicant has discovered and here discloses such a method, which has the added advantage of rapid cell surface expression.
Because of the thermodynamically favored association of avidin or streptavidin with biotin, the complex formed can modify cell properties for a period that can rival or surpass the duration of the effect elicited by gene therapy that requires the introduction of nucleic acids. The present invention teaches a method of attaching an agent to a surface. Such an agent can be, by way of example and not of limitation, any of a series of immunomodulatory molecules such as death ligands, costimulatory molecules and cytokines. It is useful to attach such agents to surfaces, especially the cell surface, since such agents can be used to physically or fwctionally eliminate autoreactive, alloreactive, xenoreactive and inflammatory cells to prevent allograft and xenograft rejection, graft-versus-host disease and to treat autoiimnunity, septic shock, inflammation, allergies, infections, neoplasias, and vascular diseases. Furthermore, this method can be used to display proteins with defined function on the surface of cells for i~ vivo trafficlcing as for the homing of selected hematopoietic cells for therapeutic purposes.
Definitions:
For the purposes of the present application, the following terms have these definitions:

"Agent" means a composition which elicits a measurable biological response or which is useful in the diagnosis, prevention or treatment of a disease or in the sorting or identification of cells, cell components or viruses.
"Binding pair" means two compositions that readily bind to each other;
that have affinity for one another; or whose association is thermodynamically and kinetically favored.
"Cell surface" has its normal meaning in the art, comprising the phospholipid bilayer of a cell membranes and the molecules directly or indirectly associated with the bilayer.
"Decorated surface" means a surface to which a member of a binding pair has become bound.
"Expression" means, in addition to its conventional meaning in the art, the placement of a functional protein on or within a cell.
"Plastic" means polystyrene, polypropylene, polyethylene or any other polymer capable of being formed into a solid surface.
"Protein" means a protein or polypeptide that is native, non-native, synthetic or modified as by covalent binding.
"Surface" means a cell surface, the surface of a particle, the surface of a phospholipid bilayer or the surface of a solid matrix.
"Target cell" means a cell targeted for apoptosis, that is, a cell in which it is desired to induce apoptosis.
An important application of regulation of the imrnwe response is the induction of tolerance to alloantigens, xenoantigens and autoantigens to prevent foreign graft rejection, treat or prevent autoimmunity and GVHD. T cells are the most critical cells of adaptive immunity, which requires three distinct signals (Signal 1, 2 and 3) for a productive response. Signal 1 is generated by T-cell receptor interaction with the MHC/peptide complex on APCs. Signal 2 is mediated by the engagements of costimulatory molecules, such as B7/CD2~ and CD40/CD40L on T cells and APCs. Signal 3 is transduced via cytokines elaborated by T cells and APCs that have received both Signal 1 and 2. The lack of any of these signals during T-cell response to antigens may serve as one of the most effective mechanisms by which tolerance is induced. Upon activation, T
cells undergo a state of antigen-driven proliferation that allows up to a 1200-fold clonal expansion. A period of death then ensues during which more than 95% of the activated T cells undergo apoptosis (programmed cell death) while the remaining cells differentiate into memory cells as the amount of antigen in the system declines.
Apoptosis or "programmed cell death" plays a central role in both the development and homeostasis of multicellular organisms. Apoptosis can be induced by multiple independent signaling pathways that converge upon a final effector mechanism consisting of multiple interactions between several "death receptors" and their ligands, which belong to the tumor necrosis factor (TNF) receptor/ligand superfamily. The best characterized death receptors are CD95 ("Fas"), TNFRl (p55), death receptor 3 (DR3 or Apo3/TRAMO), DR4 and DRS
(apo2-TRAIL-R2). A final effector mechanism is mediated by the caspase group of proteins.
In copending International Application PCT.USO1/02256, the teachings of wluch are incorporated by reference, it is disclosed that Fas-/Fast-induced apoptosis plays a central role in protecting immunologically privileged sites, such as the central nervous system, testes and eyes from immune attack.
Allogeneic and xenogeneic tissues transplanted into these sites, for instance, are resistant to rejection. Of great importance is the major role apoptosis plays in maintaining homeostasis in the immune system via activation-induced cell death (AICD). AICD is primarily mediated by apoptopic signals transduced by the Fas/FasL interaction. Fas is a 45 l~Da, type I, cell surface protein consisting of a cysteine-rich extracellular domain, which transduces a death signal. Fas mediates effector function by interacting with Fast, a type II membrane protein of about 40 kDa. T cells axe the primary cell type in the body that express Fast, upon activation. The expression of this molecule makes the activated T cells susceptible to apoptosis, which is induced in an autocrine fashion as Fas engages with Fast on the same cell. Fas on an activated T cell may also interact in a paxacrine fashion with Fast on another activated cell. These two pathways of apoptopic T cell death mediated by the Fas/FasL system serve as a homeostatic mechanism for controlling the size of antigen-stimulated T cell clones.
Deregulation of this system results in immunological disorders.
The molecular mechanism of Fas/FasL-mediated apoptosis has been studied in great detail. Binding of three Fast molecules with Fas induces trimerization of Fas receptor via c-terminus death domains (dds), which in turn recruit an adapter protein FADD (Fas-associated protein with death domain) and Caspase-8. The oligomerization of this trimolecular complex, Fas/FADD/caspase-8 results in proteolytic cleavage of proenzyme caspase-8 into active caspase-8 that, in turn, initiates the apoptosis process by activating other downstream caspases through proteolysis, including caspase-3.
Apoptosis of activated T cells results in tolerance to allografts and xenografts, including bone marrow and other organ and cellular transplantation.
Purging of activated T cells also relieves the symptoms of allergies and other immune-induced diseases. Included in the latter are auto-immune disorders such as multiple sclerosis, Iupus erythematosus, sarcoidosis and rheumatoid arthritis.
Many disorders, including some tumors, are dependent on lymphocyte functions that lead to persistence of the disorder. Many hematological disorders could be treated with bone marrow stem cell transplants if the immune response could be regulated so as to induce tolerance to the foreign stem cells. Among these disorders are leukemias, lymphomas, aplastic anemia, siclcle cell and Cooley's anemia and the life. All of these disorders may be controlled permanently or temporarily by apoptosis of activated immune cells, including T cells.
Strategies axe provided for immunomodulation using rapid cell-surface display of proteins, which comprise the construction of chimeric cDNAs encoding the functional portions of an immunoregulatory protein with one member of a binding pair. Table 1 is a summary of such constructs. Choice of constructs may be based on factors such as: the nature of the foreign antigen provol~ing adaptive immunity; whether the relief to be sought is temporary or permanent; whether a commitment to death is desired or additional downstream regulation of apoptosis is preferred. It is to be understood that the constructs listed below are representative of the invention only and are not limitations.
For example, the contracts have been made using core streptavidin (CSA).

Fragments and derivatives of streptavidin as well as the entire streptavidin molecule can be as readily used to make equivalent constructs. Therefore, in the specification, SA is generally used to mean whole, fragmented or derivatized streptavidin. Those slcilled in the art can readily, without undue experimentation, follow the teachings of this invention to make constructs comprising a first member of a binding pair and a second member of a binding pair ligated to a known immunomodulatory molecule.

SEQ
Vector Insert ID # Function Application pCSA- 6His-RS-CSA- 1 Apoptosis Induce apoptosis in immune mFasL SRIPE-Extracellular reactive cells, smooth muscle portion of Fast cells for the treahnent of immune-based disorders (GVHD, rejection of foreign grafts, autoimmunity, inflammation, allergies, septic shock and likes) and vascular diseases.
pCSA- 6His-RS-CSA- 7 Apoptosis Induce apoptosis in immune-TNFa SRIPE -Extracellular reactive cells, smooth muscle portion of TNFa cells for the treatment of immune-based disorders (GVHD, rej ection of foreign grafts, autoimmunity, inflammation, allergies, septic shock and likes) and vascular diseases.
pIL-4- Mature portion of IL- Immune Down-regulate immune-CSA 4-6His-RS-CSA- down- reactive cells for the SRIPE regulation treatment of immune-based disorders (GVHD, rejection of foreign grafts, autoimmunity, inflammation, and likes).

SEQ
Vector Insert ID Function Application #

pIL-10- Mature portion 5 Immune Down-regulate immune-of IL-CSA 10-6His-RS-CSA- down- reactive cells for the SRIPE regulationtreatment of immune-based disorders (GVHD, rejection of foreign grafts, autoirnrnunity, inflammation, and likes).

pTGF~3- Active portion 3 Immtule Down-regulate immune-of CSA TGF-~i-6His-RS- down- reactive cells for the CSA-SRIPE regulationtreatment of immune-based disorders (GVHD, rejection of foreign grafts, autoimmunity, inflammation, allergies, septic shock, and likes).

pCyto- Active portion Irmnune Down-regulate immune-of CSA other down- reactive cells for the immunoregulatory regulationtreahnent of immune-based cytokines-6His-RS- disorders (GVHD, rej ection CSA-SRIPE of foreign grafts, autoimmtuuty, inflammation, allergies, septic shock, and likes).

pIL-2- Mature portion 4 Immune Up-regulate immune-reactive of IL- up-CSA 2-6His-RS-CSA- regulationcells for the treatment of SRIPE infections and cancers.

pB7-CSA Extracellular portionImmune up- Up-regulate immune-reactive of B7-6His-RS-CSA- regulation cells for the treatment of SRIPE infections and cancers.

pCSA- 6His-RS-CSA- 6 hnmune up- Up-regulate immune-reactive CD40L SRIPE -Extracellular regulation cells for the treatment of portion of CD40L infections and cancers.

padhesion-Active portion of Immune Down-regulate immune-CSA adhesion molecules down- or reactive cells for - the 6His-RS-CSA- upregulationtreatment of immune-based SRIPE disorders (GVHD, rejection of foreign grafts, autoimmunity, inflammation, allergies, septic shock, and likes).

Up-regulate immune-reactive cells for the treatment of infections and cancers.

SEQ

Vector Insert ID # Function Application pchemokin Active portion Immune Down-regulate immune-of es-CSA immunoregulatory down- or reactive cells for the chemokines-6His- upregulation treatment of immune-based RS-CSA-SRIPE. disorders (GVHD, rejection of foreign grafts, autoimmunity, inflammation, allergies, septic shock, and likes).
Up-regulate immune-reactive cells for the treatment of infections and cancers.
A preferred production cell for the production of chimeric compositions encoded by the DNA constructs is the Drosophila system that is commercially available. However, those skilled in the art of producing chimeric compositions will recognize that many other expression systems and vectors are suitable for production of the chimeric compositions of this invention. Included in these other systems are Escherichia coli, yeast and mammalian cell cultures.
The inventions disclosed in copending international application PCT/LTS00/34554, the teachings of which are hereby incorporated by reference, are directed to the apoptosis of lymphocytes and tumor cells. The present invention discloses an improved method of expressing ixmnunomodulatory molecules with therapeutic interest on the surface of cells via binding pair coupling. Avidin or streptavidin/biotin is an example of a binding pair useful in the present invention. A modified Fast protein is described in detail as an example of such a composition. Bone marrow cells, endothelial cells, splenocytes, tissues such as pancreatic islets and organs such as hearts are examples of cells amenable to cell surface alteration. It has now been found that this method can be used to down-regulate or up-regulate immune responses to antigens. This method, therefore can be used for the prevention of foreign graft rej ection, for the prevention or treatment of autoimmunity and the up-regulation of immune response to tumors and infections. Additionally, it is provided that proteins other than those with immunoregulatory functions can be bound to cells without causing systemic side effects.

The invention will now be described with specific examples. The experimental procedures described herein are representative of compositions and methods for persistent binding "expression" of agents to cells, tissues or organs.
One embodiment specifically described is a chimeric composition, SA-mFasL, produced by fusion of DNA coding for core streptavidin protein with that of DNA coding for Fast and expressing the chimeric composition (SEQ#1) in a suitable production cell.
The target cells are first biotinylated ex vivo or in vivo and then SA-mFasL is administered in order to cause apoptosis, resulting in, for example, induction of donor-specific long-term survival and/or tolerance. Another example that is described in detail is the transplantation of pancreatic islet cells along with immune cells treated according to the methods of this invention, with subsequent enduring pancreatic insulin production. Another example is the long teen survival of ectopic heart transplants. Others examples are also provided.
Following the teachings of the following examples, one slcilled in the art can readily apply these to alter the membrane function of other cells.
Altenlatively, the DNA encoding such chimeric compositions may be applied ex vivo or in vivo, leading to permanent changes such as the apoptosis of activated T cells.
The following examples are disclosed in order to illustrate the present invention as it is applied in practice and do not limit the scope of the appended claims.
Example 1. Cloning of core streptavidin for the generation of chimeric proteins.
The present invention discloses technology for cell-surface modifications to express exogenous proteins without the introduction of nucleic acids into cells and comprises: i) generation of a clumeric molecule consisting of core streptavidin and functional domains of a desired protein, ii) modification of the cell membrane with biotin, and iii) decoration of the biotinylated cells with the chimeric molecule (Fig. 1). To accomplish this, genomic DNA encoding streptavidin was cloned from S. avidinii using specific primers in PCR. 5' and 3' primers were designed to incorporate sequences for selected restriction enzyme sites and amino acids that allow three dimensional flexibility, proper folding and function. The gene was cloned into the TA cloning vector, sequenced and subcloned into the pMTBip/V5-HisA vector for expression in a high-yield insect expression system (DES ~", Invitrogen).
Example 2. Construction of chimeric genes for expression in production cells.
Total RNA was prepared from human cell lines or peripheral blood cells and 2 ng of this RNA was reverse transcribed into the first strand of DNA
using oligo (dT)18 as a primer for reverse transcriptase. One-tenth of this cDNA
preparation was then amplified, using three sets of sense and antisense primers specific for human IL-2, IL-4, IL-10, TGF-Vii, FasL, TNF-a, B7.1, and CD40L in 8 separate PCR amplifications. The 5' and 3' primers were designed to include restriction enzyme sites for cloning and several amino acid residues to facilitate the proper folding of the product. These primers amplified DNA bands of expected sizes for all these genes of interest. These PCR products were then cloned into the TA cloning vector (Invitrogen, San Diego, CA) and a library prepared from this material was screened using the same oligonucleotide primers in PCR amplifications. The positive clones were digested with appropriate restriction enzymes, leading to the release of expected size of fragment for each gene (Fig. 2) shown in Table 1. All indicated clones were sequenced and found to have the expected characteristics. These clones were then fused to CSA in the pMTBip/V5-HisA vector either as N-terminus or C-terminus proteins to facilitate correct three dimensional structure and function (see SEQ IDs in Table 1).
Chimeric proteins were subcloned in frame with the Drosoph.ila BiP
secretion signal in the pMTBip/V5-HisA vector for expression in a high-yield insect expression system (DES ~", Invitrogen). Recombinant vectors were transiently transfected into Drosophila S2 cells using calcium phosphate.
Cells were then pulsed with copper sulfate to activate the inducible metallothionein promoter driving the expression of chimeric proteins. Culture medium was collected at various times post-activation, dialyzed to remove the copper sulfate, and analyzed for chimeric proteins using ELISA and Western blot.
Example 3. Biotinylation of cells, expression of recombinant proteins, and time kinetics of expression in vitro The therapeutic use of this protein-based approach requires successful biotinylation of cells, tissues, or organs under physiological conditions and attachment to these cells chimeric proteins consisting of CSA and molecules with therapeutic potential (Fig. 1).
The optimum conditions for biotinylation were first determined. Single cell suspensions were prepared from spleen or bone marrow of the rat. One million cells were incubated in various concentrations, ranging from 1.5 to ~,M, of EZ-Link biotin (trade name of Sulfo-NHS-LC-biotin, Pierce, Rockford, Il) in saline at room temperature for 30 minutes. After extensive washing to remove free biotin, cells were either cultured or used for staining with fluorescein (APC)-labeled streptavidin in order to assess the level of biotinylation. 100% of the cells were positive for biotin at 5 ~M biotin concentration (data not shown).
To determine how long biotin persists on actively dividing cells and the optimum dose of biotin (15~,M), biotinylated splenocytes were cultured in the presence of a T cell mitogen, concanavalin A (ConA), to stimulate T-cell proliferation. ConA-stimulated and unstimulated cells were harvested at various times post culture and stained with APC-streptavidin and analyzed by flow cytometry. Splenocytes without streptavidin and splenocytes with biotin alone served as background staining. Over 50% of the cells maintained biotin on the surface for 20 days, the longest time point tested. A significant portion (>35%) of actively dividing cells also expressed biotin at this time period. It was next tested to determine whether biotinylation interferes with the proliferation of splenocytes. Splenocytes were activated with 2.5 ~g/ml ConA for various days in 96-titer plates. Cultures were pulsed with tritiated thymidine, harvested, and analyzed for DNA-associated radioactivity as an indication of proliferation.
Biotinylated splenocytes proliferated in response to ConA activation with similar 1~

kinetics and levels as compared with munanipulated splenocytes, suggesting that biotinylation at concentrations ranging between 1.5-15 ~,M does not have a significant effect on the proliferative function of the cells (data not shown).
Biotinylated vascular endothelial cells in culture were tested to determine the time kinetics of biotin on the cell surface. The rationale for this set of experiments is to test how long biotin persists on the surface of differentiated cells with minimal turnover in tissues such as heart vasculature. Monolayer cultures of rat aortic endothelial cells were treated with 15 ~M concentration of biotin in six-well plates for 30 min at room temperature. Cells were extensively washed and one well of the culture was digested with trypsin at different times post biotinylation, single cell suspension was prepared and analyzed in flow cytometry using APC-streptavidin. A significant portion of endothelial cells (>15%) expressed biotin 20 days in culture, the longest time point tested.
Splenocytes were tested for the expression of one of the recombinant proteins with immunomodulatory function, the extracellular portion of Fast fused with core streptavidin (SA-mFasL). Splenocytes were biotinylated as stated above, incubated with 100 ng SA-mFasL for 20 min, and maintained in a 37°C incubator for defined periods of time at which cells were stained.with an anti-Fast antibody. Almost all the cells expressed SA-mFasL on day 5 and significant number of cells (>25%) expressed SA-mFasL on day 10, the last time point analyzed (Fig. 4).
One of the obj ectives of the proposed protein-based gene therapy to use immunomodulatory molecules such as SA-mFasL to facilitate the engraftment of BM cells in a foreign environment. Therefore, BM cells were tested for biotinylation and expression of Fast at the protein level. BM cells were harvested from femurs and tibia of rats using standard protocols. Single cells suspension was prepared and then biotinylated under the above conditions.
After extensive washing to remove biotin, BM cells were treated with SA-mFasL (50 ng/million cells) for 20 min on ice. Cells were then washed extensively to remove the free SA-mFasL and stained with an antibody against Fast (PE-MFL4) in flow cytometry. As shown in Fig. 5, 100% of the BM cells expressed SA-mFasL.

Example 4. Time kinetics of expression izz vivo Splenocytes were labeled with a lipophilic dye (CFSE), which incorporates and persists in the cell membrane for an extended period of time in vivo, modified to express biotin or SA-mFasL, and injected into syngeneic animals intravenously. Splenocytes were harvested at various times post injection and stained with APC-streptavidin or anti-Fast antibody for analysis in flow cytometry. As shown in Fig. 3, biotin was detected on the surface of 40%
of CFSE positive cells 10 days after in vivo injection, the latest time point tested.
Similarly, CFSE positive cells modified to express SA-mFasL were positive (26%) for the expression of this molecule 5 days after injection. Taken together, these data clearly demonstrate that this approach allows for the expression of proteins for an extended period of times izz vivo to perform function of interest.
Example 5. Blocking of alloreactive immune response ih vitYO using, et cells ex ressin~ immunomodulatory molecules To test whether cells modified to express immunomodulatory proteins of interest using this approach can be used to prevent alloreactive responses, allogeneic splenocytes were modified to express SA-mFasL and used as targets in i>2 vit>"o proliferation assays. Briefly, splenocytes from F344 rats were biotinylated, treated with culture supernatants or purified SA-mFasL.
Supernatant from cells transfected with a nonfunctional construct served as control and are referred to as S2 supernatant throughout this application.
These cells were then irradiated and used as stimulators for alloreactive responses in a standard five-day mixed lymphocyte culture. Lymphocytes harvested from the lymph nodes of PVG.ILT rats were used as responders. Targets expressing SA-mFasL completely blocked the proliferative response of lymphocytes as compared to culture without SA-mFasL. These data demonstrate that biotinylated splenocytes can serve as antigen-presenting cells and that SA-mFasL expressed on the surface of splenocytes bloclc an alloreactive immune response izz vitro. Additionally, these data demonstrate that biotinylation does not interfere with the antigen-presenting function of cells since cells decorated with biotin and treated with S2 control supernatants did not interfere with their capacity to stimulate lymphocytes. These data, therefore, demonstrate that expression of the proteins on the surface of cells does not interfere with the function of cells nor the expressed molecules. This is a critical step in validating protein-based expression as a means of immune regulation.
EXamble 6. Toxicity of SA-mFasL protein.
In general, most cells that express Fas are activated, such as activated lymphocytes, or fast-dividing, such as hepatocytes, or undesirable, such as tumor cells. However, it had to be asked whether SA-mFasL might be toxic. It has been shown that antibodies against Fas induce fulminant liver damage in selected mouse strains when injected intravenously or intraperitoneally. This is believed to be due to the expression of Fas on hepatocytes. In order to ascertain whether the chimeric protein of this invention was likewise toxic, rats were injected intraperitoneally or intravenously with 2 x 10' splenocytes bearing biotin-SA-mFasL or 8 x 10' bone marrow cells bearing biotin-SA-mFasL
intravenously. The animals were closely monitored for 10 days and then sacrificed for gross pathological and anatomical analysis. No noticeable pathology was found in animals injected with cell-biotin-SA-mFasL as shown in Table 2.

Group Number Cells Route of inj ection Side effects I 3 2x10' splenocytes-bio intraperitoneal none II 3 2x10' sp.-bio-SA-mFasL intraperitoneal none III 3 8x10' bone-marrow-bio intravenous none IV 3 8x10' bone-marrow-bio-SA- intravenous none mFasL

Example 7. Fast expressing BM cells rescue lethally irradiated rats The major premise of this approach is to use protein-based expression as an alternative to DNA-based gene therapy. Prevention of BM cell rejection by this approach of modifying BM cells for immune evasion will suffice for this condition. Bone marrow cells were harvested from PVG.R8 or ACI rats, modified to express biotin or SA-mFasL, and administered i.v. at 0.7-1x10$
cells/animal into lethally (950 cGy) irradiated rats. Irradiated animals receiving no cells served as controls. All the animals receiving no cells expired within 9 days (n=6) whereas all the animals (n=12) receiving BM cells manipulated to express bio or SA-mFasL were 100% chimeric (Fig. 6) and survived indefinitely (>100 days). These data clearly demonstrate that BM cells are safely manipulated by this novel approach to express proteins of interest for therapeutic purposes without affecting their long-term engraftment capacity.
Example 8. SA-mFasL expressin gLBM cells blocl~ alloreactive responses ih vivo BM cells expressing an immunomodulatory molecule such as SA-mFasL
were used to induce allotolerance as target cells ih vivo. PVG.lU or WF rats were administered i.v. with 0.7-2x10$ PVG.R8 or ACI BM cells, respectively, expressing Fast or biotinylated cells treated with control S2 supernatant.
Mesenteric lymph nodes were harvested 60 days after injection and used as responders to PVG.RB or ACI cells in a standard mixed lymphocyte assay. There was a complete absence of response to donor antigens. This iya vivo immune nonresponsiveness was donor specific as the response to third party antigens was intact. This effect was SA-mFasL-specific as animals receiving PVG.RB cells treated with control S2 supernatant generated a normal response to donor as well as third party antigens as compared with the response of naive animals (Fig.
7).
These data validates the ifa vitro bloclcing observation and provide direct evidence for the immunomodulatory effect of this approach in vivo.
Example 9. Modification of heart to express CSA-protein on vascular endothelium The methods of the present invention have been applied to effect protein-based expression on organs. Modification of organs, rather than the host, ex vivo to express proteins of interest presents a desired therapeutic approach in selected settings. Ex vivo manipulation avoids complications that may arise if the host were treated, and which may include, but are not limited to, undesirable side effects. Therefore, the heart was used as a test system to express biotin, streptavidin, and SA-mFasL in ACI rats and B10.BR mice at 37°C.
Briefly, the aortas of excised hearts were cannulated and perfused in a Langendorff retrograde perfusion system at a pressure of 96 mmHg with modified Krebs-Henseleit solution (KH). Cardiac contraction force was monitored with a latex balloon introduced into the left ventricle. The perfusion protocol for rat hearts was: 20 min with KH to allow stabilization of cardiac function; 20 min KH
containing 5 ~,g/ml EZ-Link Sulfo-NHS-Biotin (Pierce); 10 min I~H for biotin washout; 20 min KH containing 0.5 ~.g/ml of either Streptavidin-FITC (Zymed) or SA-mFasL; 10 min KH for streptavidin washout. Control hearts were perfused with I~H solution only. Left ventricular pressure decreased during 80 min of perfusion from 98+7 to 916 nnnHg in all three groups (n=5/group).
Coronary flow did not decrease significantly from baseline values of 10.40.6 ml/min (n=15). These data indicate that endothelial biotinylation and decoration with SA-mFasL have no short-term detrimental effect on cardiac function and that Fast is not directly toxic to the coronary arteries.
It was next determined whether biotinylated endothelial lining of the coronary arteries can be "decorated" with SA-mFasL at 4°C. This temperature is widely used in the clinical setting for extracorporeal cardiac preservation before transplantation. Mouse (B 1 O.BR) and rat (ACI) hearts were arrested with a magnesium cardioplegic solution (KH+16 mM MgS04) and were perfused at 4°C according to the protocol delineated above (biotin, I~H, streptavidin-FITC or SA-mFasL, KH). Biotin on vascular endothelium was detected by streptavidin-FITC whereas SA-mFasL was detected using antibodies against streptavidin (Zymed) and Fast (MFL4) as primary and FITC-labeled proper secondary antibodies. Hearts were removed and frozen at -80°C on the stage of a modified microtome (Polycut S, Reichert-Jung). Sequential cryosections 0200 micron) were performed and the presence of FITC-labeled streptavidin or antibodies was determined with an Axiopan microscope (C. Zeiss). The stage of the microscope was modified to accept the cooling block of the microtome. Images of cardiac sections were acquired at a magufication of 10x. Fluorescence was detected in cardiac vasculature, demonstrating the feasibility of biotin and streptavidin conjugation to vascular endothelium under hypothermic conditions, in a preservation medium widely used in clinical practice. The presence of SA-mFasL in the graft endothelium perfused with SA-mFasL, but not control S2 supernatant, was verified using FITC-MFL4 mAb. These data show that SA-mFasL can be introduced into coronary arteries via biotinylation in conditions of extracorporeal organ preservation. Manipulation of the graft as described above is performed within 10-60 min, at 4°C, using a standard preservation solution.
Thus, this approach meets the requirements of temperature, duration, and conditions used in the clinic.
Example 10 Hearts modified to express biotin or SA-mFasL survived indefinitely when transferred into s~ngeneic host.
The question arose whether this protein-based modification of organs affects the function. Hearts modified to express bio or SA-mFasL were heterotopically transplanted into syngeneic recipients. Graft survival was assessed by daily abdominal palpation of the grafted heart. As shown in Table 3, there was no detectable difference between the survival of graft recipients transplanted with syngeneic hearts decorated with SA-mFasL (n=4; >56 days) or KH-perfused control syngeneic hearts (n=4; >74days).
Table Survival of heart grafts 3. expressing SA-mFasL

GroupRecipientN Donor Treatment Rej ection time (days)MST

A BALB/c 5 BALB/c - ~ >100,>100,>100,>100,>100>100 B BALB/c 4 BALB/c Perfusion >74, >74, >88, >88 >74 C BALB/c 4 BA.LB/c Perfusion >56, >56, >68, >68 >56 + SA-Example 11: Chimeric decorated islet cells.
Pancreatic islet transplantation is widely contemplated for the correction of diabetes. To test whether the methods of this invention can be effective for the prevention of rejection of islet allografts, diabetes was induced in BALBIc recipients by intraperitoneal injection of streptozin (260 mg/kg). Animals demonstrating blood glucose levels >450 mg/dl for at least three consecutive days were used as recipients of minor+major histocompatibility antigens-disparate C57BL/10 islets. Islets were harvested from C57BL/10 mice and isolated on a Ficoll gradient according to standard protocol. Splenocytes were harvested from C57BL/10, biotinylated (lSiM), decorated with Fast or control supernatant, and irradiated (2000 rads). One million of splenocytes were cotransplanted with 400 islet cells under the kidney capsule of diabetic Balb/c mice. Survival and function of the islets were assessed by monitoring blood glucose levels starting three days after transplantation. Fast-decorated splenocytes prolonged the survival of alI allogeneic islets beyond nine days, the date at which the glucose levels of control mice had risen to near the pretransplantation level. Figure 8 shows a pancreatic cell expressing Fast and streptavidin.
In a further example of this technique, mouse pancreatic islets were harvested by digestion with collagenase and purified using Ficoll gradients.
Islets were cultured overnight and then modified with biotin (S~,M) and decorated with SA-mFasL (~100mng/ml) or-S2 supernatant as control.
Inspection of islets by confocal microscopy showed high levels of biotin and SA-mFasL. Islets decorated with SA-mFasL remained viable in culture for over 10 days as determined by visual inspection and trypan blue exclusion.
Taken together, these data clearly demonstrate that cells, tissues, and complex organs, such as hearts, can be modified with biotin to display proteins chimeric with streptavidin for extended periods of time without detectable toxicity.

Example 12. Prevention of GVHD.
Bone marrow transplantation (BMT) has the potential to treat a variety of genetically inherited and acquired hematological disorders, induce tolerance to autoimmune antigens and foreign grafts. BMT is, therefore, perceived as a natural way of performing gene therapy. The major complication is, however, graft-versus-host disease, which is fatal in most instances. T cells are considered to be the most important cells to cause GVHD. A method allowing specific elimination of T cells in the BM inoculum that cause GVHD has wide-spread clinical application. Conventional gene therapy has been used to introduce "suicide" genes into T cells. Once GVHD occurred, the suicide machinery was activated to eliminate these cells. The obstacles of conventional gene therapy, however, are major problems for routine use of this approach in clinics. A
more "noninvasive" approach is needed to achieve this "suicide" approach.
This methods of the present invention are well suited for the "suicide"
approach or immune down-regulation. Display of apoptotic (death ligands) or down-regulatory molecules (anti-inflammatory cytokines; CSA-IL-4, IL-10, TGF-Vii) in bone marrow cells (including mature T cells) are anticipated to physically or functionally eliminate these cells upon their recognition of host antigens and activation. As a proof of concept, it was shown that T cells in splenocytes modified to display SA-mFasL did not generate a proliferative response when stimulated with T-cell mitogens (Fig.lO). In contrast, unmodified splenocytes generated a vigorous proliferative response, demonstrating that T
cells responding to mitogens expressed Fas and died upon the interaction of Fast with Fas on the same cell (suicide). It was further demonstrated that rats receiving bone marrow cells and mature lymphocytes developed GVHD within 17-20 days. Treatment of these animals with syngeneic splenocytes expressing Fast resulted in the prevention of GVHD, strong ih vivo data that this approach is superior to other treatment regimens that are used in the clinic.
Example 13. Immune down-regulation using immunomodulatory molecules.
The methods of the present invention of expressing exogenous proteins on the cells, tissues, and organs are made particularly effective in down-regulating the immune system for therapeutic purposes when several of these molecules are expressed simultaneously. Therefore, a combination of death ligands (SA-mFasL, -TNFa, -TRAIL and likes) and anti-inflammatory molecules (CSA-IL-4, -IL-10, -TGF-~3 and likes) are expressed on the surface of cells, tissues, and organs as a therapeutic approach to prevent/treat autoimmune disease, foreign graft rejection, and other immune-based disorders. This method shows down-regulation of the immune system.
Example 14. Vaccination against tumors.
Tumors may evade the immune system by down-regulating the signals that provoke a T-cell response. An effective T-cell response requires three distinct signals: Signal 1,2, and 3. Signal 1 is generated by T-cell receptor interaction with the major histocompatiblity complex (MHC) anti-peptide on antigen-presenting cells (APCs). Signal 2 is mediated by the engagements of costimulatory molecules, such as B7/CD28 and CD40/CD40L, on T cells and APCs. Signal 3 is transduced via cytokines elaborated by T cells and APCs that have received both Signal 1 and 2. The transduction of these three signals drives T cells and APCs to proliferation and differentiation into effectors for the generation of a productive immune response. The lack of any of these signals during T cell response to tumors may serve as one the most effective mechanisms by which tumors evade the immune system. The present invention provides methods and compositions to modify cell surface for the expression of exogenous proteins. This approach is aimed at converting any cells into professional antigen-presenting cells for the generation of an effective immune response.
A chimeric protein composed of CSA and extracellular portion of CD40L with engineered synthetic residues for structural flexibility (CSA-CD40L) was produced in Drosophila production cells. This molecule was then used for expression on the surface of splenocytes. Almost all the splenocytes were positive for CSA-CD40L as shown by an antibody against CD40L in flow cytometry (Fig. 11). Splenocytes expressing CD40L were much more effective than regular splenocytes at inducing antigen-specific responses when used as APCs. This clearly demonstrates the feasibility of our approach to express exogenous proteins on the cell surface for therapeutic purposes.
This concept is tested in a lung carcinoma animal model. Two lung carcinoma lines of mouse origin, Lewis and Line 1 and the C58 tumor cells (rat lymphoma) will be used for the purpose of vaccination against tmnors.
Chimeric proteins produced from nucleic acids comprising the nucleic acids of CSA fused to the nucleic acids of B7.1 (SEQ. ID No. 2), CD40L (SEQ.
ID No. 6), or IL2 (SEQ. ID No. 4) will be used for display on the surface of these tumor cells and the cells will be used for vaccination of mice and rats against tumors. Briefly, tumor cells (2 x 10' ) will be biotinylated as above.
After several washes with PBS, the biotinylated cells will be incubated with chimeric proteins as above to bind the chimeric protein to the biotinylated cells.
The chimera-decorated cells will be irradiated at 5-10,000 cGy and injected into tumor bearing animals to serve as a vaccine. Tumor regression is monitored.
Based on the results as shown in the above examples, it is expected that this method will show up-regulation of the immune system.
It can be easily seen that other tumor systems and chimeric proteins can be identified, and the methods of this invention applied to provide other tumor vaccines and vaccines against infections.
This invention has been described in various preferred embodiments.
Those skilled in the art will readily recognize that modifications, deviations or substitutions of the compounds or methods here disclosed may be made without departing from the spirit and scope of this invention. All such modifications, deviations and substitutions are considered to be within the scope of the claims of this invention.

SEQUENCE LISTING
<110> University of Louisville Research Foundation, Inc.
Shirwan, Haval <120> Methods and Compositions for~Altering Cell Membrane Function.
<130> 1160.015W01 <150> US 60/215,580 <151> 2000-06-30 <160> 7 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 1247 20<212> DNA
<213> Artificial Sequence <220>

<223> SA-FasL

<400> 1 cgaacgaaag acccgtgtgtaaagccgcgtttccaaaatgtataaaaccgagagcatctg 60 gccaatgtgc atcagttgtggtcagcagcaaaatcaagtgaatcatctcagtgcaactaa 120 aggggggatc cgatctcaatatgaagttatgcatattactggccgtcgtggcctttgttg 180 30gcctctcgctcgggagatctcatcatcaccatcaccatatcaccggcacctggtacaacc 240 agctcggctc gaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacg 300 agtcggccgt cggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccc 360 cggccaccga cggcagcggcaccgccctcggttggacggtggcctggaagaataactacc 420 gcaacgccca ctccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgagga 480 35tcaacacccagtggctgctgacctccggcaccaccgaggccaacgcctggaagtccacgc 540 tggtcggcca cgacaccttcaccaaggtgaagccgtccgccgcctcaagccgaattcctg 600 aaaccaaaaa gccaaggagtgtggcccacttaacagggaacccccgctcaaggtccatcc 660 ctctggaatg ggaagacacatatggaactgctttgatctctggagtgaagtataagaaag 720 gcggccttgt gatcaatgaggctgggttgtacttcgtatattccaaagtatacttccggg 780 40gtcagtcttgcaacagccagcccctaagccacaaggtctatatgaggaactttaagtatc 840 ctggggatct ggtgctaatggaggagaagaagttgaattactgcactactggccagatat 900 gggeccacagcagctacctaggggcagtatttaatcttaccgttgctgaccatttatatg 960 tcaacata:~tcaactctctctgatcaattttgaggaatctaagaccttttttggcttat 1020 ataagctt::aaaggaaaaagcattttagaatgatctattattctttatcatggatgccag 1080 gaatattgtcttcaatgagagtcttcttaagaccaattgagccacaaagaecacaaggtc 1140 5caacaggtcagctaccctgaattctgcagatatecagcacagtggeggccgctcgagtct 1200 agagggccettcgaaggtaagcctatccctaacectctcctcggtet 1247 <210> 2 <211> 1542 10<2l2> DNA
<213> Artificial Sequence <220>
<223> B7.1-SA
<400> 2 cgaacgaaagacccgtgtgtaaagccgcgtttccaaaatgtataaaaccgagagcatctg 60 gccaatgtgcatcagttgtggtcagcagcaaaatcaagtgaatcatctcagtgcaactaa 120 aggggggatccgatctcaatatgaagttatgcatattactggccgtcgtggcctttgttg 180 20gcctctcgctcgggggtaagagatctatccacgtgaccaaggaagtgaaagaagtggcaa 240 cgctgtcctgtggtcacaatgtttctgttgaagagctggcacaaactcgcatctactggc 300 aaaaggagaagaaaatggtgctgactatgatgtctggggacatgaatatatggcccgagt 360 acaagaaccggaccatctttgatatcactaataacctetccattgtgatcctggctetgc 420 gcccatctgacgagggcacatacgagtgtgttgttctgaagtatgaaaaagacgctttca 480 25agcgggaacacetggctgaagtgacgttatcagtcaaagctgacttccctacacetagta 540 tatctgactttgaaattccaacttctaatattagaaggataatttgctcaacctctggag 600 gttttccagagcctcacctctcctggttggaaaatggagaagaattaaatgccatcaaca 660 caacagtttcccaagatcctgaaactgagctetatgctgttagcagcaaactggatttca 720 atatgacaaccaaccacagcttcatgtgtctcatcaagtatggacatttaagagtgaatc 780 30agaccttcaactggaatacaaccaagcaagagagatctagatctcatcatcaccatcacc 840 atatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggegccg 900 acggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcc 960 tgaccggtcgttacgacagcgecccggccaccgacggcagcggcaccgccctcggttgga 1020 cggtggcetggaagaataactacegcaacgeccactccgcgaccacgtggagcggccagt 1080 35acgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccaceg 1140 aggccaacgcctggaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgt 1200 cegccgcctccgaattctgcagatatccagcacagtggcg,gccgctcgagtctagagggc 1260 ccttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtc 1320 atcatcaccatcaccattgagtttaaacccgctgatcagcctcgactgtgccttctaagg 1380 40cctgagctcgctgatcagcctcgatcgaggatccagacatgataagatacattgatgagt 1440 ttggacaaac cacaactaga atgcagtgaa aaaaatgctt tatttgtgaa atttgtgatg 1500 ctattgcttt atttgt.:~acc attataagct gcaataaaca ag 1542 <210> 3 5<211> 1266 <212> DNA
<213> Artificial Sequence <220>
10<223> TGF-B-SA
<400> 3 cgaacgaaag acc:cgtgtgt~aaagccgcgt ttccaaaatgtataaaaccgagagcatctg 60 gccaatgtgc atcagttgtggtcagcagcaaaatcaagtgaatcatctcagtgcaactaa 120 l5aggggggatccgatctcaatatgaagttatgcatattactggccgtcgtggcctttgttg 180 gcctctcgct cgggggtaagagatctgccctggacaccaactattgcttcagctccacgg 240 agaagaactg ctgcgtgcggcagctgtacattgacttccgcaaggacctcggctggaagt 300 ggatccacga gcccaagggctaccatgccaacttctgcctcgggccctgcccctacattt 360 ggagcctgga cacgcagtacagcaaggtcctggccctgtacaaccagcataacccgggcg 420 20cctcggcggcgccgtgctgcgtgccgcaggcgctggagccgctgcccatcgtgtactacg 480 tgggccgcaa gcccaaggtggagcagctgtccaacatgatcgtgcgctcctgcaagtgca 540 gcagatctca tcatcaccatcaccatatcaccggcacctggtacaaccagctcggctcga 600 ccttcatcgt gaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcg 660 gcaacgccga gagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacg 720 25gcagcggcaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccact 780 ccgegaccac gtggagcggccagtacgtcggcggcgecgaggegaggatcaacacccagt 840 ggctgctgac ctccggcaccaccgaggccaacgcctggaagtccacgctggtcggccacg 900 acaccttcac caaggtgaagccgtccgccgcctccgaattctgcagatatccagcacagt 960 ggcggccgct cgagtctagagggcccttcgaaggtaagcctatccctaaccctctcctcg 1020 30gtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgat 1080 cagcctcgac tgtgccttctaaggcctgagctcgctgatcagcctcgatcgaggatccag 1140 acatgataag atacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaat 1200 gctttatttg tgaaatttgtgatgctattgctttatttgtaaccattataagctgcaata 1260 aacaag 1266 <210> 4 <211> 1329 <212> DNA
<213> Artificial Sequence <220>
<223> IIr-2-SA
<400> 4 5cgaacgaaagacccgtgtgtaaagccgcgtttccaaaatgtataaaaccgagagcatctg60 gccaatgtgcatcagttgtggtcagcagcaaaatcaagtgaatcatctcagtgcaactaa120 aggggggatccgatctcaatatgaagttatgcatattactggccgtcgtggcctttgttg180 gcctctcgctcgggagatctccagcacctacttcaagttctacaaagaaaacacagctac240 aactggagcatttactgctggatttacagatgattttgaatggaattaataattacaaga300 l0atcccaaactcaccaggatgctcacatttaagttttacatgcccaagaaggccacagaac360 tgaaacatcttcagtgtctagaagaagaactcaaacctctggaggaagtgctaaatttag420 ctcaaagcaaaaactttcacttaagacccagggacttaatcagcaatatcaacgtaatag480 ttctggaactaaagggatctgaaacaacattcatgtgtgaatatgctgatgagacagcaa540 ccattgtagaatttctgaacagatggattaccttttgtcaaagcatcatctcaacactaa600 l5ctggtagatctcatcatcaccatcaccatatcaccggcacctggtacaaccagctcggct660 cgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccg720 tcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccg780 acggcagcggcaccgccctcggttggacggtggcctggaagaataactaccgcaacgccc840 actccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacaccc900 20agtggctgctgacctccggcaccaccgaggccaacgcctggaagtccacgctggtcggcc960 acgacaccttcaccaaggtgaagccgtccgccgcctccgaattctgcagatatccagcac1020 agtggcggccgctcgagtctagagggcccttcgaaggtaagcctatccctaaccctctcc1080 tcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgct1140 gatcagcctcgactgtgccttctaaggcctgagctcgctgatcagcctcgatcgaggatc1200 25cagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaa1260 aatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgca1320 ataaacaag 1329 <210> 5 30<211>

<212> DNA

<213> Artificial Sequence <220>
35<223> IT~-10-SA
<400> 5 cgaacgaaag acccgtgtgt aaagccgcgt ttccaaaatg tataaaaccg agagcatctg 60 gccaatgtgc atcagttgtg gtcagcagca aaatcaagtg aatcatctca gtgcaactaa 120 40aggggggatc cgatctcaat atgaagttat gcatattact ggccgtcgtg gcctttgttg 180 gdctctcgctcgggggtaagagatcttctgagaacagctgcacccacttcccaggcaacc240 tgcctaacatgcttcgagatctccgagatgc~ttcagcagagtgaagactttctttcaaa300 tgaaggatcagctggacaacttgttgttaaaggagtccttgctggaggactttaagggtt360 acctgggttgccaagccttgtctgagatgatccagttttacctggaggaggtgatgcccc420 5aagctgagaaccaagacccagacatcaaggcgcatgtgaactcectgggggagaacctga480 agaccctcaggctgaggctacggcgctgtcatcgatttcttccctgtgaaaacaagagca540 aggccgtggagcaggtgaagaatgcctttaataagctccaagagaaaggcatctacaaag600 ccatgagtgagtttgacatcttcatcaactacatagaagcctacatgacaatgaagatac660 gaaacagatctagatctcatcatcaccatcaccatatcaccggcacctggtacaaccagd720 lOtcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagt780 cggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccgg840 ccaccgacggcagcggcaccgccctcggttggacggtggcctggaagaataactaccgca900 acgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatca960 acacccagtggctgctgacctccggcaccaccgaggccaacgcctggaagtccacgctgg1020 l5tcggccacgacaccttcaccaaggtgaagccgtccgccgcctccgaattctgcagatatc1080 cagcacagtggcggccgctcgagtctagagggcccttcgaaggtaagcctatccctaacc1140 ctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaa1200 cccgctgatcagcctcgactgtgccttctaaggcctgagctcgctgatca~gcctcgatcg1260 aggatccagacatgataagatacattgatgafitttggacaaaccacaactagaatgcagt1320 20gaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataa1380 gctgcaataa acaag 1395 <210> 6 <211> 1566 25<212> DNA
<213> Artificial Sequence <220>

<223> SA-CD40L

<400> 6 cgaacgaaagacccgtgtgtaaagccgcgtttccaaaatgtataaaaccgagagcatctg60 gccaatgtgcatcagttgtggtcagcagcaaaatcaagtgaatcatctcagtgcaactaa~

aggggggatccgatctcaatatgaagttatgcatattactggccgtcgtggcctttgttg180 35gcctctcgctcgggggtaagagatctcatcatcaccatcaccatatcaccggcacctggt240 acaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaa300 cctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgaca360 gcgccccggccaccgacggcagcggcaccgccctcggttggacggtggcctggaagaata420 actaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgagg480 40cgaggatcaacacccagtggctgctgacctccggcaccaccgaggccaacgcctggaagt540 ccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccgaattct600 tggacaagatagaagatgaaaggaatcttcatgaagattt.tgtattcatgaaaacgatac660 agagatgcaacacaggagaaagatccttatccttactgaactgtgaggagattaaaagcc720 agtttgaaggctttgtgaaggatataatgttaaacaaagaggagacgaagaaagaaaaca780 5gctttgaaatgcaaaaaggtgatcagaatcctCaaattgcggcacatgtcataagtgagg840 ccagcagtaaaacaacatctgtgttacagtgggctgaaaaaggatactacaccatgagca900 acaacttggtaaccctggaaaatgggaaacagctgaccgttaaaagacaaggactctatt960 atatctatgcccaagtcaccttctgttccaatcgggaagcttcgagtcaagctccattta1020 tagccagcctctgcctaaagtcccccggtagattcgagagaatcttactcagagctgcaa1080 l0atacccacagttccgccaaaCcttgcgggcaacaatccattcacttgggaggagtatttg1140 aattgcaacaaggtgcttcggtgtttgtcaatgtgactgatccaagccaagtgagccatg1200 gcactggcttcacgtcctttggcttaetcaaactcgaattctgcagatatccagcacagt1.260 ggcggccgctcgagtctagagggcccttcgaaggtaagcctatccctaaccctctcctcg1320 gtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgat1380 l5cagcctcgactgtgccttctaaggcctgagctcgctgatcagcctcgatcgaggatccag1440 acatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaat1500 gctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaata1560 aacaag 1566 20<210> 7 <211> 702 <212> DNA
<213> Artificial Sequence 25<220>
<223> SA-TNFa <400> 7 ccagggctcc aggcggtgct tgttcctcag cctcttctcc ttcctgatcg tggcaggcgc 60 30caccacgctc ttctgcctgc tgcactttgg agtgatcggc ccccagaggg aagagtcccc 120 cagggacctc tctctaatca gccctctggc ccaggcagtc agatcatctt ctcgaacccc 180 gagtgacaag cctgtagccc atgttgtagc aaaccctcaa gctgaggggc agctccagtg 240 gctgaaccgccgggccaatgccctcctggccaatggcgtggagctgagagataaccagct 300 ggtggtgccatcagagggcctgtacctcatctactcccaggtcctcttcaagggccaagg 360 35ctgcccctccacccatgtgctcctcacccacaccatcagccgcatcgccgtctcctacca 420 gaccaaggtcaacctcctctctgccatcaagagcccctgccagagggagaccccagaggg 480 ggctgaggccaagccctggtatgagcccatctatctgggaggggtcttccagctggagaa 540 gggtgaccgactcagcgctgagatcaatcggcccgactatctcgactttgccgagtctgg 600 gcaggtctactttgggatcattgccctgtgaggaggacgaacatccaaccttcccaaacg 660 40CCtCCCCtgCCCCaatCCCtttattaCCCCCtCCttCagaCa 702

Claims (20)

1. A method of modifying a surface comprising (1) contacting the surface with one member of a binding pair that binds to the surface to form a decorated surface; and (2) subsequently contacting the surface with a composition comprising the second member of the binding pair operably linked to an agent capable of modifying the surface, wherein the function of the surface is altered.

2. The method of claim 1 wherein the surface is a cell surface, the surface of a virus, the surface of a glass particle, the surface of a polysaccharide particle or the surface of a plastic particle.

3. The method of claim 1 wherein the members of the binding pair are covalently linked.

4. The method of claim 1 wherein the first member of the binding pair is biotin and the second member of the binding pair is avidin or streptavidin.

5. The method of claim 1 wherein the first member of the binding pair comprises an antibody or fragment and the second member of the binding pair comprises an antibody or fragment thereof.

6. The method of claim 4 or 5 wherein the surface is a cell surface and the agent is an adhesion molecule, a cell growth factor, a cell toxin, or a composition that induces apoptosis, down-regulation of the immune system or up-regulation of the immune system.

7. The method of claim 6 wherein the altered function is apoptosis and the agent is a death ligand.

8. The method of claim 4 or 5 wherein the surface is a cell surface and the altered function is down-regulation of the immune system and the agent is an anti-inflammatory cytokine.

9. The method of claim 4 or 5 wherein the surface is a cell surface and the altered function is up-regulation of the innnune system and the agent is a pro-inflammatory cytokine.

10. A method of modulating the immune response of a subject comprising (1) contacting the T cell surfaces of the subject with biotin; and (2) subsequently contacting the T cell surfaces with avidin or streptavidin ligated to a death ligand, wherein the T cell undergoes apoptosis.

11. A method of modulating the immune response of a subject comprising (1) contacting the T cell surfaces of the subject with biotin; and (2) subsequently contacting T cell surfaces with avidin or streptavidin operably linked to an anti-inflammatory cytokine.

12. The method of claim 11 wherein the subject suffers from autoimmunity, graft rejection, graft-versus-host disease, allergies, septic shock, or vascular disease.

13. The method of claim 13 wherein the graft comprises a stem cell or pancreatic islet cell.

14. A method of modulating the immune response comprising (1) contacting T cell surfaces with biotin; and (2) subsequently contacting the T
cell surfaces with avidin or streptavidin operably linked to a pro-inflammatory cytokine.

15. The method of claim 14 wherein the subject suffers from neoplasia or infection.

16. The method of claims 10, 11 or 14 wherein the T cells are contacted in vivo.

17. The method of claims 10, 11 or 14 wherein the T cells are contacted with biotin ex vivo, reintroduced into the subject from which they were removed and contacted with avidin or streptavidin in vivo.

18. A chimeric composition selected from Table 1.

19. An isolated nucleic acid having the sequence of SEQ ID No 1, 2, 3,4,5,6,or7.

20. The product produced by expression in a production cell of SEQ
ID No 1, 2, 3, 4, 5, 6, or 7.