CA2412701A1 - Methods for producing modified glycoproteins - Google Patents
Methods for producing modified glycoproteins Download PDFInfo
- Publication number
- CA2412701A1 CA2412701A1 CA002412701A CA2412701A CA2412701A1 CA 2412701 A1 CA2412701 A1 CA 2412701A1 CA 002412701 A CA002412701 A CA 002412701A CA 2412701 A CA2412701 A CA 2412701A CA 2412701 A1 CA2412701 A1 CA 2412701A1
- Authority
- CA
- Canada
- Prior art keywords
- host
- enzymes
- glycosylation
- enzyme
- gnt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/005—Glycopeptides, glycoproteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/2488—Mannanases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01113—Mannosyl-oligosaccharide 1,2-alpha-mannosidase (3.2.1.113), i.e. alpha-1,2-mannosidase
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/04—Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/05—Fusion polypeptide containing a localisation/targetting motif containing a GOLGI retention signal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
Abstract
Cell lines having genetically modified glycosylation pathways that allow them to carry out a sequence of enzymatic reactions, which mimic the processing of glycoproteins in humans, have been developed. Recombinant proteins expressed in these engineered hosts yield glycoproteins more similar, if not substantially identical to their human counterparts. The lower eukaryotes, which ordinarily produce high-mannose containing N-glycans, including unicellular and multicellular fungi are modified to produce N-glycans such as Man5GlcNAc2 or other structures along human glycosylation pathways. This is achieved using a combination of engineering and/or selection of strains which:
do not express certain enzymes which create the undesirable complex structures characteristic of the fungal glycoproteins, which express exogenous enzymes selected either to have optimal activity under the conditions present in the fungi where activity is desired, or which are targeted to an organelle where optimal activity is achieved, and combinations thereof wherein the genetically engineered eukaryote expresses multiple exogenous enzymes required to produce "human-like" glycoproteins.
do not express certain enzymes which create the undesirable complex structures characteristic of the fungal glycoproteins, which express exogenous enzymes selected either to have optimal activity under the conditions present in the fungi where activity is desired, or which are targeted to an organelle where optimal activity is achieved, and combinations thereof wherein the genetically engineered eukaryote expresses multiple exogenous enzymes required to produce "human-like" glycoproteins.
Description
METHODS FOR PRODUCING MODIFIED GLYCOPROTEINS
Cross Reference To Related Applications Priority is claimed to U.S. Provisional Application Serial No.
60/214,358, filed on June 28, 2000, U.S. Provisional Application Serial No.
60/215,638, filed on June 30, 2000, and U.S. Provisional Application Serial No. 60/279,997, filed on March 30, 2001.
FIELD OF THE INVENTION
The present invention is directed to methods and compositions by which fungi or other eukaryotic microorganisms can be genetically modified to produce glycosylated proteins (glycoproteins) having patterns of glycosylation similar to glycoproteins produced by animal cells, especially human cells, which are useful as human or animal therapeutic agents.
BACKGROUND OF THE INVENTION
Glycosylation Pathway De ~ovo synthesized proteins may undergo further processing in cells, known as post-translational modification. In particular, sugar residues may be added enzymatically, a process known as glycosylation. The resulting proteins bearing covalently linked oligosaccharide side chains are known as glycosylated proteins or glycoproteins. Bacteria typically do not glycosylate proteins; in cases where glycosylation does occur it usually occurs at nonspecific sites in the protein (Moms and Vanderleyden, Arch.
Microbiol. 1997 168(3):169-175).
Eukaryotes commonly attach a specific oligosaccharide to the side chain of a protein asparagine residue, particularly an asparagine which occurs in the sequence Asn-Xaa-Ser/Thr/Cys (where Xaa represents any amino acid). Following attachment of the saccharide moiety, known as an N glycan, further modifications may occur in vivo. Typically these modifications occur via an ordered sequence of enzymatic reactions, known as a cascade. Different organisms provide different glycosylation enzymes (glycosyltransferases and glycosidases) and different glycosyl substrates, so that the final composition of a sugar side chain may vary markedly depending upon the host.
For example, microorganisms such as filamentous fungi and yeast (lower eukaryotes) typically add additional mannose and/or mannosylphosphate sugars. The resulting glycan is known as a "high-mamzose" type or a mannan. By contrast, in animal cells, the nascent oligosaccharide side chain may be trimmed to remove several mannose residues and elongated with additional sugar residues that typically do not occur in the N glycans of lower eukaryotes. See R.K. Bretthauer, et al.
Biotechnology and Applied Biochemistry, 1999, 30, 193-200; W. Martinet, et al. Biotechnology Letters, 1998, 20, 1171-1177; S. Weikert, et al. Nature Biotechnology, 1999, 17, 1116-1121; M. Malissard, et al. Biochemical and Biophysical Research Communications, 2000, 267, 169-173; Jarvis, et al.
1998 Engineering N glycosylation pathways in the baculovirus-insect cell system, Current Opinion in Biotechnology, 9:528-533; and M. Takeuchi, 1997 Trends in Glycoscience arid Glycotechhology, 1997, 9, S29-535.
The N glycans that are produced in humans and animals are commonly referred to as complex N glycans. A complex N glycan means a structure with typically two to six outer branches with a sialyllactosamine sequence linked to an inner core structure Man3GlcNAca. A complex N
glycan has at least one branch, and preferably at least two, of alternating GlcNAc and galactose (Gal) residues that terminate in oligosaccharides such as, for example: NeuNAc-; NeuAca2-6GalNAca1-; NeuAca2-3Ga1(31-3GalNAca1-; NeuAca2-3/6Ga1~31-4GlcNAc~31-; GlcNAca1-4Ga1[31-(mucins only); Fucal-2Ga1(31-(blood group H). Sulfate esters can occur on galactose, GaINAc, and GIcNAc residues, and phosphate esters can occur on mannose residues. NeuAc (Neu: neuraminic acid; Ac:acetyl) can be O-acetylated or replaced by NeuGl (N glycolylneuraminic acid). Complex N
glycans may also have intrachain substitutions of bisecting GIcNAc and core fucose (Fuc).
Cross Reference To Related Applications Priority is claimed to U.S. Provisional Application Serial No.
60/214,358, filed on June 28, 2000, U.S. Provisional Application Serial No.
60/215,638, filed on June 30, 2000, and U.S. Provisional Application Serial No. 60/279,997, filed on March 30, 2001.
FIELD OF THE INVENTION
The present invention is directed to methods and compositions by which fungi or other eukaryotic microorganisms can be genetically modified to produce glycosylated proteins (glycoproteins) having patterns of glycosylation similar to glycoproteins produced by animal cells, especially human cells, which are useful as human or animal therapeutic agents.
BACKGROUND OF THE INVENTION
Glycosylation Pathway De ~ovo synthesized proteins may undergo further processing in cells, known as post-translational modification. In particular, sugar residues may be added enzymatically, a process known as glycosylation. The resulting proteins bearing covalently linked oligosaccharide side chains are known as glycosylated proteins or glycoproteins. Bacteria typically do not glycosylate proteins; in cases where glycosylation does occur it usually occurs at nonspecific sites in the protein (Moms and Vanderleyden, Arch.
Microbiol. 1997 168(3):169-175).
Eukaryotes commonly attach a specific oligosaccharide to the side chain of a protein asparagine residue, particularly an asparagine which occurs in the sequence Asn-Xaa-Ser/Thr/Cys (where Xaa represents any amino acid). Following attachment of the saccharide moiety, known as an N glycan, further modifications may occur in vivo. Typically these modifications occur via an ordered sequence of enzymatic reactions, known as a cascade. Different organisms provide different glycosylation enzymes (glycosyltransferases and glycosidases) and different glycosyl substrates, so that the final composition of a sugar side chain may vary markedly depending upon the host.
For example, microorganisms such as filamentous fungi and yeast (lower eukaryotes) typically add additional mannose and/or mannosylphosphate sugars. The resulting glycan is known as a "high-mamzose" type or a mannan. By contrast, in animal cells, the nascent oligosaccharide side chain may be trimmed to remove several mannose residues and elongated with additional sugar residues that typically do not occur in the N glycans of lower eukaryotes. See R.K. Bretthauer, et al.
Biotechnology and Applied Biochemistry, 1999, 30, 193-200; W. Martinet, et al. Biotechnology Letters, 1998, 20, 1171-1177; S. Weikert, et al. Nature Biotechnology, 1999, 17, 1116-1121; M. Malissard, et al. Biochemical and Biophysical Research Communications, 2000, 267, 169-173; Jarvis, et al.
1998 Engineering N glycosylation pathways in the baculovirus-insect cell system, Current Opinion in Biotechnology, 9:528-533; and M. Takeuchi, 1997 Trends in Glycoscience arid Glycotechhology, 1997, 9, S29-535.
The N glycans that are produced in humans and animals are commonly referred to as complex N glycans. A complex N glycan means a structure with typically two to six outer branches with a sialyllactosamine sequence linked to an inner core structure Man3GlcNAca. A complex N
glycan has at least one branch, and preferably at least two, of alternating GlcNAc and galactose (Gal) residues that terminate in oligosaccharides such as, for example: NeuNAc-; NeuAca2-6GalNAca1-; NeuAca2-3Ga1(31-3GalNAca1-; NeuAca2-3/6Ga1~31-4GlcNAc~31-; GlcNAca1-4Ga1[31-(mucins only); Fucal-2Ga1(31-(blood group H). Sulfate esters can occur on galactose, GaINAc, and GIcNAc residues, and phosphate esters can occur on mannose residues. NeuAc (Neu: neuraminic acid; Ac:acetyl) can be O-acetylated or replaced by NeuGl (N glycolylneuraminic acid). Complex N
glycans may also have intrachain substitutions of bisecting GIcNAc and core fucose (Fuc).
Human glycosylation begins with a sequential set of reactions in the endoplasmatic reticulum (ER) leading to a core oligosacchaxide structure, which is transferred onto de novo synthesized proteins at the asparagine residue in the sequence Asn-Xaa-Ser/Thr (see Figure 1A). Further processing by glucosidases and mannosidases occurs in the ER before the nascent glycoprotein is transferred to the early Golgi apparatus, where additional mannose residues are removed by Golgi-specific 1,2-mannosidases. Processing continues as the protein proceeds through the Golgi. In the medial Golgi a number of modifying enzymes including N acetylglucosamine transferases (GnT I, GnT II, GnT III, GnT IV GnT V
GnT VI), mannosidase II, fucosyltransferases add and remove specific sugar residues (see Figure 1B). Finally in the trans Golgi, the N glycans are acted on by galactosyl tranferases and sialyltransferases (ST) and the finished glycoprotein is released from the Golgi apparatus. The protein N glycans of animal glycoproteins have bi-, tri-, or tetra-antennary structures, and may typically include galactose, fucose, and N acetylglucosamine. Commonly the terminal residues of the N glycans consist of sialic acid. A typical structure of a human N glycan is shown in Figure 1B.
Sugar Nucleotide Precursors The N glycans of animal glycoproteins typically include galactose, fucose, and terminal sialic acid. These sugars are not generally found on glycoproteins produced in yeast and filamentous fungi. In humans, the full range of nucleotide sugar precursors (e.g. UDP-N acetylglucosamine, UDP-N acetylgalactosamine, CMP-N acetylneuraminic acid, UDP-galactose, GDP-fucose etc.) are generally synthesized in the cytosol and transported into the Golgi, where they are attached to the core oligosaccharide by glycosyltransferases. (Sommers and Hirschberg, 1981 J. Cell Biol. 91(2):
A406-A406; Sommers and Hirschberg 1982 J. Biol.Chem.257(18): 811-817;
Perez and Hirschberg 1987 Methods ih E~zymology 138: 709-715.
Glycosyl transfer reactions typically yield a side product which is a nucleoside diphosphate or monophosphate. While monophosphates can be directly exported in exchange for nucleoside triphosphate sugars by an antiport mechanism, diphosphonucleosides (e.g. GDP) have to be cleaved by phosphatases (e.g. GDPase) to yield nucleoside monophosphates and inorganic phosphate prior to being exported. This reaction is important for efficient glycosylation; for example, GDPase from S. cerevisiae has been found to be necessary for mannosylation. However the GDPase has 90%
reduced activity toward UDP (Berninsone et al., 1994 J. Biol. Chem.
269(1):207-211x,). Lower eukaryotes typically lack UDP-specific diphosphatase activity in the Golgi since they do not utilize UDP-sugar precursors for Golgi-based glycoprotein synthesis. Schizosaccharomyces pombe, a yeast found to add galactose residues to cell wall polysaccharides (from UDP-galactose) has been found to have specific UDPase activity, indicating the requirement for such an enzyme (Berninsone et al., 1994).
UDP is known to be a potent inhibitor of glycosyltransferases and the removal of this glycosylation side product is important in order to prevent glycosyltransferase inhibition in the lumen of the Golgi (I~hatara et al., 1974). See Berninsone, P., et al. 1995. J. Biol. Chem.270(24): 14564-14567;
Beaudet, L., et al. 1998 Abc Transpo~te~s: Biochemical, Cellular, aid Molecular Aspects. 292: 397-413.
Compartmentalization of Glycosylation Enzymes Glycosyltransferases and mannosidases line the inner (luminal) surface of the ER and Golgi apparatus and thereby provide a catalytic surface that allows for the sequential processing of glycoproteins as they proceed through the ER and Golgi network. The multiple compartments of the cis, medial, and trans Golgi and the trans Golgi Network (TGN), provide the different localities in which the ordered sequence of glycosylation reactions can take place. As a glycoprotein proceeds from synthesis in the ER to full maturation in the late Golgi or TGN, it is sequentially exposed to different glycosidases, mannosidases and glycosyltransferases such that a specific N glycan structure may be synthesized. The enzymes typically include a catalytic domain, a stem region, a membrane spanning region and an N-terminal cytoplasmic tail. The latter three structural components are responsible for directing a glycosylation enzyme to the appropriate locus.
Localization sequences from one organism may function in other organisms. For example the membrane spa.niung region of a-2,6-sialyltransferase (a-2,6-ST) from rats, an enzyme known to localize in the rat traps Golgi, was shown to also localize a reporter gene (invertase) in the yeast Golgi (Schwientek, et al., 1995). However, the very same membrane spanning region as part of a full-length of a-2,6-sialyltransferase was retained in the ER and not further transported to the Golgi of yeast (Krezdorn et al., 1994). A full length GaIT from humans was not even synthesized in yeast, despite demonstrably high transcription levels. On the other hand the transmembrane region of the same human GaIT fused to an invertase reporter was able to direct localization to the yeast Golgi, albeit it at low production levels. Schwientek and co-workers have shown that fusing 28 amino acids of a yeast mannosyltransferase (Mntl), a region containing an N-terminal cytoplasmic tail, a transmembrane region and eight amino acids of the stem region, to the catalytic domain of human GaIT are sufficient for Golgi localization of an active GaIT (Schwientek et al. 1995 J. Biol. Chem.
270(10):5483-5489). Other galactosyltransferases appear to rely on interactions with enzymes resident in particular organelles since after removal of their transmembrane region they are still able to localize properly.
Improper localization of a glycosylation enzyme may prevent proper functioning of the enzyme in the pathway. For example Aspe~gillus hidulans, which has numerous a-1,2-mannosidases (Eades and Hintz, 2000 Gene 255(1):25-34), does not add GIcNAc to Man5GlcNAc2 when transformed with the rabbit GnT I gene, despite a high overall level of GnT I
activity (Kalsner et al., 1995). GnT I, although actively expressed, may be incorrectly localized such that the enzyme is not in contact with both of its substrates: the nascent N glycan of the glycoprotein and UDP-GIcNAc.
Alternatively, the host organism may not provide an adequate level of UDP-GIcNAc in the Golgi.
Glycoproteins Used Therapeutically A significant fraction of proteins isolated from humans or other animals are glycosylated. Among proteins used therapeutically, about 70%
are glycosylated. If a therapeutic protein is produced in a microorganism host such as yeast, however, and is glycosylated utilizing the endogenous pathway, its therapeutic efficiency is typically greatly reduced. Such glycoproteins are typically immunogenic in humans and show a reduced half life in vivo after administration (Takeuchi, 1997).
Specific receptors in humans and animals can recognize terminal mannose residues and promote the rapid clearance of the protein from the bloodstream. Additional adverse effects may include changes in protein folding, solubility, susceptibility to proteases, trafficking, transport, compartmentalization, secretion, recognition by other proteins or factors, antigenicity, or allergenicity. Accordingly, it has been necessary to produce therapeutic glycoproteins in animal host systems, so that the pattern of glycosylation is identical or at least similar to that in humans or in the intended recipient species. In most cases a mammalian host system, such as mammalian cell culture, is used.
Systems for Producin T~hera_peutic Glycoproteins In order to produce therapeutic proteins that have appropriate glycoforms and have satisfactory therapeutic effects, animal or plant-based expression systems have been used. The available systems include:
1. Chinese hamster ovary cells (CHO), mouse fibroblast cells and mouse myeloma cells (Arzneimittelforschung. 1998 Aug;48(8):870-880);
2. transgenic animals such as goats, sheep, mice and others (Dente Prog.
Clin. Biol. 1989 Res. 300:85-98, Ruther et al., 1988 Cell 53(6):847-856; Ware, J., et al. 1993 Thrombosis avid Haemostasis 69(6): 1194-1194; Cole, E. S., et al. 1994 J.Cell.Biochem. 265-265);
GnT VI), mannosidase II, fucosyltransferases add and remove specific sugar residues (see Figure 1B). Finally in the trans Golgi, the N glycans are acted on by galactosyl tranferases and sialyltransferases (ST) and the finished glycoprotein is released from the Golgi apparatus. The protein N glycans of animal glycoproteins have bi-, tri-, or tetra-antennary structures, and may typically include galactose, fucose, and N acetylglucosamine. Commonly the terminal residues of the N glycans consist of sialic acid. A typical structure of a human N glycan is shown in Figure 1B.
Sugar Nucleotide Precursors The N glycans of animal glycoproteins typically include galactose, fucose, and terminal sialic acid. These sugars are not generally found on glycoproteins produced in yeast and filamentous fungi. In humans, the full range of nucleotide sugar precursors (e.g. UDP-N acetylglucosamine, UDP-N acetylgalactosamine, CMP-N acetylneuraminic acid, UDP-galactose, GDP-fucose etc.) are generally synthesized in the cytosol and transported into the Golgi, where they are attached to the core oligosaccharide by glycosyltransferases. (Sommers and Hirschberg, 1981 J. Cell Biol. 91(2):
A406-A406; Sommers and Hirschberg 1982 J. Biol.Chem.257(18): 811-817;
Perez and Hirschberg 1987 Methods ih E~zymology 138: 709-715.
Glycosyl transfer reactions typically yield a side product which is a nucleoside diphosphate or monophosphate. While monophosphates can be directly exported in exchange for nucleoside triphosphate sugars by an antiport mechanism, diphosphonucleosides (e.g. GDP) have to be cleaved by phosphatases (e.g. GDPase) to yield nucleoside monophosphates and inorganic phosphate prior to being exported. This reaction is important for efficient glycosylation; for example, GDPase from S. cerevisiae has been found to be necessary for mannosylation. However the GDPase has 90%
reduced activity toward UDP (Berninsone et al., 1994 J. Biol. Chem.
269(1):207-211x,). Lower eukaryotes typically lack UDP-specific diphosphatase activity in the Golgi since they do not utilize UDP-sugar precursors for Golgi-based glycoprotein synthesis. Schizosaccharomyces pombe, a yeast found to add galactose residues to cell wall polysaccharides (from UDP-galactose) has been found to have specific UDPase activity, indicating the requirement for such an enzyme (Berninsone et al., 1994).
UDP is known to be a potent inhibitor of glycosyltransferases and the removal of this glycosylation side product is important in order to prevent glycosyltransferase inhibition in the lumen of the Golgi (I~hatara et al., 1974). See Berninsone, P., et al. 1995. J. Biol. Chem.270(24): 14564-14567;
Beaudet, L., et al. 1998 Abc Transpo~te~s: Biochemical, Cellular, aid Molecular Aspects. 292: 397-413.
Compartmentalization of Glycosylation Enzymes Glycosyltransferases and mannosidases line the inner (luminal) surface of the ER and Golgi apparatus and thereby provide a catalytic surface that allows for the sequential processing of glycoproteins as they proceed through the ER and Golgi network. The multiple compartments of the cis, medial, and trans Golgi and the trans Golgi Network (TGN), provide the different localities in which the ordered sequence of glycosylation reactions can take place. As a glycoprotein proceeds from synthesis in the ER to full maturation in the late Golgi or TGN, it is sequentially exposed to different glycosidases, mannosidases and glycosyltransferases such that a specific N glycan structure may be synthesized. The enzymes typically include a catalytic domain, a stem region, a membrane spanning region and an N-terminal cytoplasmic tail. The latter three structural components are responsible for directing a glycosylation enzyme to the appropriate locus.
Localization sequences from one organism may function in other organisms. For example the membrane spa.niung region of a-2,6-sialyltransferase (a-2,6-ST) from rats, an enzyme known to localize in the rat traps Golgi, was shown to also localize a reporter gene (invertase) in the yeast Golgi (Schwientek, et al., 1995). However, the very same membrane spanning region as part of a full-length of a-2,6-sialyltransferase was retained in the ER and not further transported to the Golgi of yeast (Krezdorn et al., 1994). A full length GaIT from humans was not even synthesized in yeast, despite demonstrably high transcription levels. On the other hand the transmembrane region of the same human GaIT fused to an invertase reporter was able to direct localization to the yeast Golgi, albeit it at low production levels. Schwientek and co-workers have shown that fusing 28 amino acids of a yeast mannosyltransferase (Mntl), a region containing an N-terminal cytoplasmic tail, a transmembrane region and eight amino acids of the stem region, to the catalytic domain of human GaIT are sufficient for Golgi localization of an active GaIT (Schwientek et al. 1995 J. Biol. Chem.
270(10):5483-5489). Other galactosyltransferases appear to rely on interactions with enzymes resident in particular organelles since after removal of their transmembrane region they are still able to localize properly.
Improper localization of a glycosylation enzyme may prevent proper functioning of the enzyme in the pathway. For example Aspe~gillus hidulans, which has numerous a-1,2-mannosidases (Eades and Hintz, 2000 Gene 255(1):25-34), does not add GIcNAc to Man5GlcNAc2 when transformed with the rabbit GnT I gene, despite a high overall level of GnT I
activity (Kalsner et al., 1995). GnT I, although actively expressed, may be incorrectly localized such that the enzyme is not in contact with both of its substrates: the nascent N glycan of the glycoprotein and UDP-GIcNAc.
Alternatively, the host organism may not provide an adequate level of UDP-GIcNAc in the Golgi.
Glycoproteins Used Therapeutically A significant fraction of proteins isolated from humans or other animals are glycosylated. Among proteins used therapeutically, about 70%
are glycosylated. If a therapeutic protein is produced in a microorganism host such as yeast, however, and is glycosylated utilizing the endogenous pathway, its therapeutic efficiency is typically greatly reduced. Such glycoproteins are typically immunogenic in humans and show a reduced half life in vivo after administration (Takeuchi, 1997).
Specific receptors in humans and animals can recognize terminal mannose residues and promote the rapid clearance of the protein from the bloodstream. Additional adverse effects may include changes in protein folding, solubility, susceptibility to proteases, trafficking, transport, compartmentalization, secretion, recognition by other proteins or factors, antigenicity, or allergenicity. Accordingly, it has been necessary to produce therapeutic glycoproteins in animal host systems, so that the pattern of glycosylation is identical or at least similar to that in humans or in the intended recipient species. In most cases a mammalian host system, such as mammalian cell culture, is used.
Systems for Producin T~hera_peutic Glycoproteins In order to produce therapeutic proteins that have appropriate glycoforms and have satisfactory therapeutic effects, animal or plant-based expression systems have been used. The available systems include:
1. Chinese hamster ovary cells (CHO), mouse fibroblast cells and mouse myeloma cells (Arzneimittelforschung. 1998 Aug;48(8):870-880);
2. transgenic animals such as goats, sheep, mice and others (Dente Prog.
Clin. Biol. 1989 Res. 300:85-98, Ruther et al., 1988 Cell 53(6):847-856; Ware, J., et al. 1993 Thrombosis avid Haemostasis 69(6): 1194-1194; Cole, E. S., et al. 1994 J.Cell.Biochem. 265-265);
3. plants (Arabidopsis thaliaha, tobacco etc.) (Staub, et al. 2000 Nature Biotechnology 18(3): 333-338) (McGarvey, P. B., et al. 1995 Bio-Technology 13(13): 1484-1487; Bardor, M., et al. 1999 Trends in Plant Science 4(9): 376-380);
4. insect cells (Spodoptera frugiperda Sf~, Sf2l, Trichoplusia ni, etc. in combination with recombinant baculoviruses such as Autographa californica multiple nuclear polyhedrosis virus which infects lepidopteran cells) (Altmans et al., 1999 Glycoconj. J. 16(2):109-123).
Recombinant human proteins expressed in the above-mentioned host systems may still include non-human glycoforms (Raju et al., 2000 Annals Biochem. 283(2):123-132). In particular, fraction of the N glycans may lack terminal sialic acid, typically found in human glycoproteins. Substantial efforts have been directed to developing processes to obtain glycoproteins that are as close as possible in structure to the human forms, or have other therapeutic advantages. Glycoproteins having specific glycoforms may be especially useful, for example in the targeting of therapeutic proteins. For example, the addition of one or more sialic acid residues to a glycan side chain may increase the lifetime of a therapeutic glycoprotein in vivo after admininstration. Accordingly, the mammalian host cells may be genetically engineered to increase the extent of terminal sialic acid in glycoproteins expressed in the cells. Alternatively sialic acid may be conjugated to the protein of interest in vitro prior to administration using a sialic acid transferase and an appropriate substrate. In addition, changes in growth medium composition or the expression of enzymes involved in human glycosylation have been employed to produce glycoproteins more closely resembling the human forms (S. Weikert, et al., Nature Biotechnology, 1999, 17, 1116-1121; Werner, Noe, et al 1998 Arzneimittelforschung 48(8):870-880; Weikert, Papac et al., 1999; Andersen and Goochee 1994 Cur.
Opin.Biotechuol.5: 546-549; Yang and Butler 2000 Biotechhol.Bioehgiu.68(4): 370-380). Alternatively cultured human cells may be used.
However, all of the existing systems have significant drawbacks.
Only certain therapeutic proteins are suitable for expression in animal or plant systems (e.g. those lacking in any cytotoxic effect or other effect adverse to growth). Animal and plant cell culture systems are usually very slow, frequently requiring over a week of growth under carefully controlled conditions to produce any useful quantity of the protein of interest. Protein yields nonetheless compare unfavorably with those from microbial fermentation processes. In addition cell culture systems typically require complex and expensive nutrients and cofactors, such as bovine fetal serum.
Furthermore growth may be limited by programmed cell death (apoptosis).
Moreover, animal cells (particularly mammalian cells) are highly susceptible to viral infection or contamination. In some cases the virus or other infectious agent may compromise the growth of the culture, while in other cases the agent may be a human pathogen rendering the therapeutic protein product unfit for its intended use. Furthermore many cell culture processes require the use of complex, temperature-sensitive, animal-derived growth media components, which may carry pathogens such as bovine spongiform encephalopathy (BSE) prions. Such pathogens are difficult to detect and/or difficult to remove or sterilize without compromising the growth medium. In any case, use of animal cells to produce therapeutic proteins necessitates costly quality controls to assure product safety.
Transgenic animals may also be used for manufacturing high-volume therapeutic proteins such as human serum albumin, tissue plasminogen activator, monoclonal antibodies, hemoglobin, collagen, fibrinogen and others. While transgenic goats and other transgenic animals (mice, sheep, cows, etc.) can be genetically engineered to produce therapeutic proteins at high concentrations in the milk, the process is costly since every batch has to undergo rigorous quality control. Animals may host a variety of animal or human pathogens, including bacteria, viruses, fungi, and prions. In the case of scrapies and bovine spongiform encephalopathy, testing can take about a year to rule out infection. The production of therapeutic compounds is thus preferably carried out in a well-controlled sterile environment, e.g. under Good Manufacturing Practice (GMP) conditions. However, it is not generally feasible to maintain animals in such environments. Moreover, whereas cells grown in a fermenter are derived from one well characterized Master Cell Bank (MCB), transgenic animal technology relies on different animals and thus is inherently non-uniform. Furthermore external factors such as different food uptake, disease and lack of homogeneity within a herd, may effect glycosylation patterns of the final product. It is known in humans, for example, that different dietary habits result in differing glycosylation patterns.
Transgenic plants have been developed as a potential source to obtain proteins of therapeutic value. However, high level expression of proteins in plants suffers from gene silencing, a mechanism by which the genes for highly expressed proteins are down-regulated in subsequent plant generations. In addition, plants add xylose and/or a,-1,3-linked fucose to protein N glycans, resulting in glycoproteins that differ in structure from animals and are immunogenic in mammals (Altmann, Marz et al., 1995 Glycoconj. J. 12(2);150-155). Furthermore, it is generally not practical to grow plants in a sterile or GMP environment, and the recovery of proteins from plant tissues is more costly than the recovery from fermented microorganisms.
Gl~coprotein Production Using Eukaryotic Mieroor~anisms The lack of a suitable expression system is thus a significant obstacle to the low-cost and safe production of recombinant human glycoproteins.
Production of glycoproteins via the fermentation of microorganisms would offer numerous advantages over the existing systems. For example, fermentation-based processes may offer (a) rapid production of high concentrations of protein; (b) the ability to use sterile, well-controlled production conditions (e.g. GMP conditions); (c) the ability to use simple, chemically defined growth media; (d) ease of genetic manipulation; (e) the absence of contaminating human or animal pathogens; (f) the ability to express a wide variety of proteins, including those poorly expressed in cell culture owing to toxicity etc.; (g) ease of protein recovery (e.g. via secretion into the medium). In addition, fermentation facilities are generally far less costly to construct than cell culture facilities.
As noted above, however, bacteria, including species such as Esche~ichia coli commonly used to produce recombinant proteins, do not glycosylate proteins in a specific manner like eukaryotes. Various methylotrophic yeasts such as Pichia pasto~is, Pichia naethaholica, and Hansenula polymo~pha, are particularly useful as eukaryotic expression systems, since they are able to grow to high cell densities and/or secrete large quantities of recombinant protein. However, as noted above, glycoproteins expressed in these eukaryotic microorganisms differ substantially in N glycan structure from those in animals. This has prevented the use of yeast or filamentous fungi as hosts for the production of many useful glycoproteins.
Several efforts have been made to modify the glycosylation pathways of eukaryotic microorganisms to provide glycoproteins more suitable for use as mammalian therapeutic agents. For example, several glycosyltransferases have been separately cloned and expressed in S cerevisiae (GaIT, GnT I), Aspergillus nidulans (GnT I) and other fungi (Yoshida et al., 1999, I~alsner et al., 1995 Glycoconj. J. 12(3):360-370, Schwientek et al., 1995). However, N glycans with human characteristics were not obtained.
Yeasts produce a variety of mannosyltransferases e.g. 1,3-mannosyltransferases (e.g. MNN1 in S, cerevisiae) (Graham and Emr, 1991 J. Cell. Biol. 114(2):207-218), 1,2-mannosyltransferases (e.g. I~TR/KRE
family from S. cerevisiae), 1,6-mannosyltransferases (OCHl from S.
cerevisiae), mannosylphosphate transferases (MNN4 and MNN6 from S.
cerevisiae) and additional enzymes that are involved in endogenous glycosylation reactions. Many of these genes have been deleted individually, giving rise to viable organisms having altered glycosylation profiles.
Examples are shown in Table 1.
Table 1. Examples of yeast strains having altered mannosylation Strain N glycan (wild Mutation N glycan Reference type) (mutant) S. pombe Man>9GlcNAc2 OCHl Man8GlcNAc2 Yoko-o et al., 2001 FEBS Lett.
489(1):75-80 S. ce~evisiae Man>9GlcNAc2 OCH1/MNN1 Man8GlcNAc2 Nakanishi-Shindo et al,. 1993 J. Biol.
Chem.
268(35):26338-S ce~evisiae Man,9GlcNAca OCH1/MNN1/ Man8GlcNAca Chiba et al., 1998 MNN4 J. Biol. Chem. 273, In addition, Japanese Patent Application Public No. 8-336387 discloses an OCHI mutant strain of Pichia pasto~is. The OCHl gene encodes 1,6-mannosyltransferase, which adds a mannose to the glycan structure Man8GlcNAc2 to yield Man9GlcNAc2. The Man9GlcNAc2 structure is then a substrate for further mannosylation i~ vivo, leading to the hypermannosylated glycoproteins that are characteristic of yeasts and typically may have at least 30-40 mannose residue per N glycan. In the OCHl mutant strain, proteins glycosylated with Man8GlcNAc2 are accumulated and hypermannosylation does not occur. However, the structure MangGlcNAca is not a substrate for animal glycosylation enzymes, such as human UDP-GIcNAc transferase I, and accordingly the method is not useful for producing proteins with human glycosylation patterns.
Martinet et al. (Biotechnol. Lett. 1998, 20(12), 1171-1177) reported the expression of a-1,2-mannosidase from T~ichode~ma reesei in P. pastoris.
Some mannose trimming from the N glycans of a model protein was observed. However, the model protein had no N glycans with the structure Man;GlcNAca, which would be necessary as an intermediate for the generation of complex N glycans. Accordingly the method is not useful for producing proteins with human or animal glycosylation patterns.
Similarly, Chiba et al. 1998 expressed a-1,2-mannosidase from Aspergillus saitoi in the yeast Saccha~omyces ce~evisiae. A signal peptide sequence (His-Asp-Glu-Leu) was engineered into the exogenous mannosidase to promote retention in the endoplasmic reticulum. In addition, the yeast host was a mutant lacking three enzyme activities associated with hypermannosylation of proteins: 1,6-mannosyltransferase (OCHI); 1,3-mannosyltransferase (MlVNl); and mannosylphosphatetransferase (MNN4).
The N glycans of the triple mutant host thus consisted of the structure Man$GIcNAc2, rather than the high mannose forms found in wild-type S.
ce~evisiae. In the presence of the engineered mannosidase, the N glycans of a model protein (carboxypeptidase ~ were trimmed to give a mixture consisting of 27 mole % Man5GlcNAc2, 22 mole % Man6GlcNAc2, 22 mole Man7GlcNAca, 29 mole % Man8GlcNAc2. Trimming of the endogenous cell wall glycoproteins was less efficient, only 10 mole % of the N glycans having the desired Man5GlcNAc2 structure.
Since only the Man5GlcNAc2 glycans would be susceptible to further enzymatic conversion to human glycoforms, the method is not efficient for the production of proteins having human glycosylation patterns. In proteins having a single N glycosylation site, at least 73 mole % would have an incorrect structure. In proteins having two or three N glycosylation sites, respectively at least 93 or 98 mole % would have an incorrect structure.
Such low efficiencies of coversion are unsatisfactory for the production of therapeutic agents, particularly as the separation of proteins having different glycoforms is typically costly and difficult.
With the object of providing a more human-like glycoprotein derived from a fungal host, U.S. Patent No. 5,834,251 to Maras and Contreras discloses a method for producing a hybrid glycoprotein derived from Trichoderma ~eesei. A hybrid N glycan has only mannose residues on the Manal-6 arm of the core and one or two complex antennae on the Mana,l-3 arm. While this structure has utility, the method has the disadvantage that numerous enzymatic steps must be performed in vitYO, which is costly and time-consuming. Isolated enzymes are expensive to prepare and maintain, may need unusual and costly substrates (e.g. UDP-GIcNAc), and are prone to loss of activity and/or proteolysis under the conditions of use.
It is therefore an object of the present invention to provide a system and methods for humanizing glycosylation of recombinant glycoproteins expressed in Pichia pastoris and other lower eukaryotes such as Hansenula polymorpha, Pichia stiptis, Piclaia ynethauolica, Pichia sp, Kluyve~omyces sp, Ca~dida albicahs, Aspergillus hidulahs, and Ti~ichoderma reseei.
SUMMARY OF THE INVENTION
Cell lines having genetically modified glycosylation pathways that allow them to carry out a sequence of enzymatic reactions, which mimic the processing of glycoproteins in humans, have been developed. Recombinant proteins expressed in these engineered hosts yield glycoproteins more similar, if not substantially identical, to their human counterparts.The lower eukaryotes, which ordinarily produce high-mannose containing N glycans, including unicellular and multicellular fungi such as Pichia pasto~is, Hanse~ula polymo~pha, Pichia stiptis, Pichia methaholica, Pichia sp., Kluyveromyces sp., Caudida albicahs, Aspe~gillus nidulavcs, and T~ichode~ma ~eseei, are modified to produce N glycans such as Man5GlcNAc2 or other structures along human glycosylation pathways. This is achieved using a combination of engineering and/or selection of strains which: do not express certain enzymes which create the undesirable complex structures characteristic of the fungal glycoproteins, which express exogenous enzymes selected either to have optimal activity under the conditions present in the fungi where activity is desired, or which are targeted to an organelle where optimal activity is achieved, and combinations thereof wherein the genetically engineered eukaryote expresses multiple exogenous enzymes required to produce "human-like" glycoproteins.
In a first embodiment, the microorganism is engineered to express an exogenous o~ 1,2-mannosidase enzyme having an optimal pH between 5.1 and 8.0, preferably between 5.9 and 7.5. In an alternative preferred embodiment, the exogenous enzyme is targeted to the endoplasmic reticulum or Golgi apparatus of the host organism, where it trims N glycans such as Man8GlcNAc2 to yield Man5GlcNAc2. The latter structure is useful because it is identical to a structure formed in mammals, especially humans; it is a substrate for further glycosylation reactions in vivo and/or in vitro that produce a finished N glycan that is similar or identical to that formed in mammals, especially humans; and it is not a substrate for hypermannosylation reactions that occur i~ vivo in yeast and other microorganisms and that render a glycoprotein highly immunogenic in animals.
In a second embodiment, the glycosylation pathway of an eukaryotic microorganism is modified by (a) constructing a DNA library including at least two genes encoding exogenous glycosylation enzymes; (b) transforming the microorganism with the library to produce a genetically mixed population expressing at least two distinct exogenous glycosylation enzymes; (c) selecting from the population a microorganism having the desired glycosylation phenotype. In a preferred embodiment, the DNA
library includes chimeric genes each encoding a protein localization sequence and a catalytic activity related to glycosylation. Organisms modified using the method are useful for producing glycoproteins having a glycosylation pattern similar or identical to mammals, especially humans.
In a third embodiment, the glycosylation pathway is modified to express a sugar nucleotide transporter enzyme. In a preferred embodiment, a nucleotide diphosphatase enzyme is also expressed. The transporter and diphosphatase improve the efficiency of engineered glycosylation steps, by providing the appropriate substrates for the glycosylation enzymes in the appropriate compartments, reducing competitive product inhibition, and promoting the removal of nucleoside diphosphates.
DESCRIPTION OF THE FIGTJRES
Figure 1A is a schematic diagram of typical fungal N glycosylation pathway.
Figure 1B is a schematic diagram of a typical human N glycosylation pathway.
DETAILED DESCRIPTION OF THE INVENTION
The methods and recombinant lower eukaryotic strains described herein are used to make "humanized glycoproteins". The recombinant lower eukaryotes are made by engineering lower eukaryotes which do not express one or more enzymes involved in production of high mannose structures to express the enzymes required to produce human-like sugaxs. As used herein, a lower eukaryote is a unicellular or filamentous fungus. As used herein, a "humanized glycoprotein" refers to a protein having attached thereto N-glycans including less than four mannose residues, and the synthetic intermediates (which are also useful and can be manipulated further i~c vitro) having at least five mannose residues. In a preferred embodiment, the glycoproteins produced in the recombinant lower eukaryotic strains contain at least 27 mole % of the Mans intermediate. This is achieved by cloning in a better mannosidase, i.e., an enzyme selected to have optimal activity under the conditions present in the organisms at the site where proteins are glycosylated, or by targeting the enzyme to the organelle where activity is desired.
In a preferred embodiment, eukaryotic strains which do not express one or more enzymes involved in the production of high mannose structures are used. These strains can be engineered or one of the many such mutants already described in yeasts, including a hypermannosylation-minus (OCH1) mutant in Pichia pasto~is.
The strains can be engineered one enzyme at a time, or a library of genes encoding potentially useful enzymes can be created, and those strains having enzymes with optimal activities or producing the most "human-like"
glycoproteins, selected.
Lower eukaryotes that are able to produce glycoproteins having the attached N glycan Man5GlcNAc2 are particularly useful since (a) lacking a high degree of mannosylation (e.g. greater than 8 mannoses per N glycan, or especially 30-40 mannoses), they show reduced immunogenicity in humans;
and (b) the N glycan is a substrate for further glycosylation reactions to form an even more human-like glycoform, e.g. by the action of GIcNAc transferase I to form GIcNAcMan5GlcNAc2. Man5GlcNAc2 must be formed in vivo in a high yield, at least transiently, since all subsequent glycosylation reactions require Man5GlcNAc2 or a derivative thereof. Accordingly, a yield is obtained of greater than 27 mole %, more preferably a yield of 50-100 mole %, glycoproteins in which a high proportion of N glycans have Man5GlcNAca. It is then possible to perform further glycosylation reactions i~c vitro, using for example the method of U.S. Patent No. 5,834,251 to Maras and Contreras. In a preferred embodiment, at least one further glycosylation reaction is performed in vivo. In a highly preferred embodiment thereof, active forms of glycosylating enzymes are expressed in the endoplasmic reticulum and/or Golgi apparatus.
Host Microorganisms Yeast and filamentous fungi have both been successfully used for the production of recombinant proteins, both intracellular and secreted (Cereghino, J. L. and J. M. Cregg 2000 FEMSMic~obiology Reviews 24(1):
45-66; Harkki, A., et al. 1989 Bio-Technology 7(6): 596; Berka, R. M., et al.
1992 Abstr°.Pape~s Amer. Chem.Soc.203: 121-BIOT; Svetina, M., et al.
J.Biotechnol. 76(2-3): 245-251.
Although glycosylation in yeast and fungi is very different than in humans, some common elements are shared. The first step, the transfer of the core oligosaccharide structure to the nascent protein, is highly conserved in all eukaryotes including yeast, fungi, plants and humans (compare Figures 1A and 1B). Subsequent processing of the core oligosaccharide, however, differs significantly in yeast and involves the addition of several mannose sugars. This step is catalyzed by mannosyltransferases residing in the Golgi (e.g. OCH1, MNT1, MNN1, etc.), which sequentially add mannose sugars to the core oligosaccharide. The resulting structure is undesirable for the production of humanoid proteins and it is thus desirable to reduce or eliminate mannosyl transferase activity. Mutants of S. cerevisiae, deficient in mannosyl transferase activity (e.g. ochl or mnn9 mutants) have shown to be non-lethal and display a reduced mannose content in the oligosacharide of yeast glycoproteins. Other oligosacharide processing enzymes, such as mannosylphophate transferase may also have to be eliminated depending on the host's particular endogenous glycosylation pattern. After reducing undesired endogenous glycosylation reactions the formation of complex N-glycans has to be engineered into the host system. This requires the stable expression of several enzymes and sugar-nucleotide transporters. Moreover, one has to locate these enzymes in a fashion such that a sequential processing of the maturing glycosylation structure is ensured.
Targ-et Glycoproteins The methods described herein are useful for producing glycoproteins, especially glycoproteins used therapeutically in humans. Such therapeutic proteins are typically administered by injection, orally, pulmonary, or other means.
Examples of suitable target glycoproteins include, without limitation:
erythropoietin, cytokines such as interferon-a, interferon-(3, interferon-y, interferon-w, and granulocyte-CSF, coagulation factors such as factor VIII, factor IX, and human protein C, soluble IgE receptor a-chain, IgG, IgM, urokinase, chymase, and urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, azmexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1, amd osteoprotegerin.
Method for Producing Glycoproteins Co ~risina the N-:glycan ManSGlc The first step involves the selection or creation of a lower eukaryote that is able to produce a specific precursor structure of Man5GlcNAc2, which is able to accept in vivo GIcNAc by the action of a GIcNAc transferase I.
This step requires the formation of a particular isomeric structure of Man5GlcNAc2 . This structure has to be formed within the cell at a high yield (in excess of 30%) since all subsequent manipulations are contingent on the presence of this precursor. Man5GlcNAc2 structures are necessary for complex N-glycan formation, however, their presence is by no means sufficient, since Man5GlcNAca may occur in different isomeric forms, wluch may or may not serve as a substrate for GIcNAc transferase I. Most glycosylation reactions are not complete and thus a particular protein generally contains a range of different carbohydrate structures (i.e.
glycoforms) on its surface. The mere presence of trace amounts (less than 5%) of a particular structure like Man5GlcNAc2 is of little practical relevance. It is the formation of a particular, GIcNAc transferase I accepting intermediate (Structure I) in high yield (above 30%), which is required. The formation of this intermediate is necessary and subsequently allows for the ivy vivo synthesis of complex N-glycans.
One can select such lower eukaryotes from nature or alternatively genetically engineer existing fungi or other lower eukaryotes to provide the structure in vivo. No lower eukaryote has been shown to provide such structures in vivo in excess of 1.8% of the total N-glycans (Maras et al., 1997), so a genetically engineered organism is preferred. Methods such as those described in U.S. Patent No. 5,595,900, may be used to identify the absence or presence of particular glycosyltransferases, mannosidases and sugar nucleotide transporters in a target organism of interest.
Inactivation of Fun ag 1 Glycosylation Enzymes such as 1,2- a-mannosidase The method described herein may be used to engineer the glycosylation pattern of a wide range of lower eukaryotes (e.g. Hausenula polymo~pha, Pichia stiptis, Pichia methaholica, Pichia sp, Kluyve~omyces sp, Cahdida albicans, Aspe~gillus nidulans, Trichode~ma reseei etc.). Pichia pastoris is used to exemplify the required manipulation steps. Similar to other lower eukaryotes, P.pasto~is processes Man9GlcNAc2 structures in the ER with a 1,2- oc- mannosidase to yield Man8GlcNAc2. Through the action of several mannosyltransferases, this structure is then converted to hypermannosylated structures (Man,9GlcNAc2), also known as mannans. In addition, it has been found that P. pastoris is able to add non-terminal phosphate groups, through the action of mannosylphosphate transferases to the carbohydrate structure. This is contrary to the reactions found in mammalian cells, which involve the removal of mannose sugars as opposed to their addition. It is of particular importance to eliminate the ability of the fungus to hypermannosylate the existing Man8GlcNAc2 structure. This can be achieved by either selecting for a fungus that does not hypermannosylate, or by genetically engineering such a fungus.
Genes that are involved in this process have been identified in Pichia pasto~is and by creating mutations in these genes one is able to reduce the production of "undesirable" glycoforms. Such genes can be identified by homology to existing mannosyltransferases (e.g. OCHl, MNN4, MNN6, MNN1), found in other lower eukaryotes such as C. albicahs, Pichia angusta or S ce~evisiae or by mutagenizing the host strain and selecting for a phenotype with reduced mannosylation. Based on homologies amongst known mannosyltransferases and mannosylphosphate transferases, one may either design PCR primers, examples of which are shown in Table 2, or use genes or gene fragments encoding such enzymes as probes to identify homologues in DNA libraries of the target orgausm. Alternatively, one may be able to complement particular phenotypes in related organisms. For example, in order to obtain the gene or genes encoding 1,6-mannosyltransferase activity in P. pasto~is, one would carry out the following steps. OCH1 mutants of S. cerevisiae are temperature sensitive and are slow growers at elevated temperatures. One can thus identify functional homologues of OCH1 in P.pasto~is by complementing an OCH1 mutant of S. ce~evisiae with a P.pasto~is DNA or cDNA library. Such mutants of S.ce~evisiae may be found at http://genome-www.stanford.edu/Saccharomyces/ and are commercially available at http://www.resgen.com/products/YEASTD.php3. Mutants that display a normal growth phenotype at elevated temperature, after having been transformed with a P.pastoris DNA library, are likely to carry an OCH1 homologue of P.pastoris. Such a library can be created by partially digesting chromosomal DNA of P.pastoris with a suitable restriction enzyme and after inactivating the restriction enzyme ligating the digested DNA into a suitable vector, which has been digested with a compatible restriction enzyme.
Suitable vectors are pRS314, a low copy (CEN6/ARS4) plasmid based on pBluescript containing the Trpl marker (Sikorski, R. S., and Hieter, P.,1989, Genetics 122, pg 19-27) or pFL44S, a high copy (2~,) plasmid based on a modified pUCl9 containing the URA3 marker (Bonneaud, N., et al., 1991, Yeast 7, pg. 609-615). Such vectors are commonly used by academic researchers or similar vectors are available from a number of different vendors such as Invitrogen (Carlsbad, CA), Pharmacia (Piscataway, NJ), New England Biolabs (Beverly, MA). Examples are pYES/GS, 2p, origin of replication based yeast expression plasmid from Invitrogen, or Yep24 cloning vehicle from New England Biolabs. After ligation of the chromosomal DNA and the vector one may transform the DNA library into strain of S. ce~evisiae with a specific mutation and select for the correction of the corresponding phenotype. After sub-cloning and sequencing the DNA
fragment that is able to restore the wild-type phenotype, one may use this fragment to eliminate the activity of the gene product encoded by OCH1 in P. pastoris.
Alternatively, if the entire genomic sequence of a particular fungus of interest is known, one may identify such genes simply by searching publicly available DNA databases, which are available from several sources such as NCBI, Swissprot etc. For exaanple by searching a given genomic sequence or data base with a known 1,6 mannosyltransferase gene (OCH1) from S.
cerevisiae, one can able to identify genes of high homology in such a genome, which a high degree of certainty encodes a gene that has 1,6 mannosyltransferase activity. Homologues to several known mannosyltransferases from S.cer~evisiae in P.pastor~is have been identified using either one of these approaches. These genes have similar functions to genes involved in the mannosylation of proteins in S cerevisiae and thus their deletion may be used to manipulate the glycosylation pattern in P.pasto~is or any other fungus with similar glycosylation pathways.
The creation of gene knock-outs; once a given target gene sequence has been determined, is a well-established technique in the yeast and fungal molecular biology community, and can be carried out by anyone of ordinary skill in the art (R. Rothsteins, (1991) Methods in Enzymology, vol. 194, p.
281). In fact, the choice of a host organism may be influenced by the availability of good transformation and gene disruption techniques for such a host. If several mannosyltransferases have to be knocked out, the method developed by Alani and Kleckner allows for the repeated use of the URA3 markers to sequentially eliminate all undesirable endogenous mannosyltransferase activity. This technique has been refined by others but basically involves the use of two repeated DNA sequences, flanking a counter selectable marker. For example: URA3 may be used as a marker to ensure the selection of a transformants that have integrated a construct. By flanking the URA3 marker with direct repeats one may first select for transformants that have integrated the construct and have thus disrupted the target gene. After isolation of the transformants, and their characterization, one may counter select in a second round for those that are resistant to 5'FOA. Colonies that able to survive on plates containing 5'FOA have lost the URA3 marker again through a crossover event involving the repeats mentioned earlier. This approach thus allows for the repeated use of the same marker and facilitates the disruption of multiple genes without requiring additional markers.
Eliminating specific mannosyltransferases, such as 1,6 mannosyltransferase (OCHl), mannosylphosphate transferases (MNN4, MNN6, or genes complementing lbd mutants) in P. pastoris, allows for the creation of engineered strains of this organism which synthesize primarily MangGlcNAc2 and thus can be used to further modify the glycosylation pattern to more closely resemble more complex human glycoform structures.
A preferred embodiment of this method utilizes known DNA sequences, encoding known biochemical glycosylation activities to eliminate similar or identical biochemical functions in P. pasto~is, such that the glycosylation structure of the resulting genetically altered P. pasto~is strain is modified.
Table 2.
PCR primer PCR primer Ta:~et Genes). Homologues A B in P.
astoris ATGGCGAAGGCAGATTAGTCCTTCCAAC1,6- OCHl TGGCAGT TTCCTTC mannosyltransferaseS.cerevisiae, Pichia albicans TAYTGGMGNGTNGAGCRTCNCCCCANCK1,2 KTR/KRE family, RCYNGAYATHAA YTCRTA mannosyltransferaseS.cerevisiae s Legena.: M = A or C, R = A or G, W = A or T, S = C or G, Y = C or T, K = G or T, V = A or C or G, H = A or C or T, D =
$ A or G or T, B = C or G or T, N = G or A or T or C.
Incorporation of a Mannosidase into the Genetically E~ineered Host The process described herein enables one to obtain such a structure in high yield for the purpose of modifying it to yield complex N-glycans. A
successful scheme to obtain suitable Man5GlcNAc2 structures must involve two parallel approaches: (1) reducing endogenous mannosyltransferase activity and (2) removing 1,2- a,- mannose by mannosidases to yield high levels of suitable Man5GlcNAca structures. What distinguishes this method from the prior art is that it deals directly with those two issues. As the work of Chiba and coworkers demonstrates, one can reduce Man8GlcNAc2 structures to a Man5GlcNAc2 isomer in S. cer~evisiae, by engineering the presence of a fungal mannosidase from A. saitoi into the ER. The shortcomings of their approach are twofold: (1) insufficient amounts of Man5GlcNAc2 are formed in the extra-cellular glycoprotein fraction (10%) and (2) it is not clear that the ih vivo formed Man5GlcNAc2 structure in fact is able to accept GIcNAc by action of GIcNAc transferase I. If several glycosylation sites are present in a desired protein the probability (P) of obtaining such a protein in a correct form follows the relationship P=(F)°, where n equals the number of glycosylation sites, and F equals the fraction of desired glycoforms. A glycoprotein with three glycosylation sites would have a 0.1 % chance of providing the appropriate precursors for complex and hybrid N-glycan processing on all of its glycosylation sites, which limits the commercial value of such an approach.
Most enzymes that are active in the ER and Golgi apparatus of S. cerevisiae have pH optima that are between 6.5 and 7.5 (see Table 3). All previous approaches to reduce mannosylation by the action of recombinant mannosidases have concentrated on enzymes that have a pH optimum aromid pH 5.0 (Martinet et al., 1998, and Chiba et al., 1998), even though the activity of these enzymes is reduced to less than 10% at pH 7.0 and thus most likely provide insufficient activity at their point of use, the ER and early Golgi of P.pastoris and S. cerevisiae. A preferred process utilizes an a,-mannosidase ih vivo, where the pH optimum of the mannosidase is within 1.4 pH units of the average pH optimum of other representative marker enzymes localized in the same organelle(s). The pH optimum of the enzyme to be targeted to a specific organelle should be matched with the pH
optimum of other enzymes found in the same organelle, such that the maximum activity per unit enzyme is obtained. Table 3 summarizes the activity of mannosidases from various sources and their respective pH
optima. Table 4 summarizes their location.
Table 3. Mannosidases and their pH optimum.
Source Enzyme pH Reference optimum Aspe~gillus saitoi 1,2- a- mannosidase 5.0 Ichishima et al., 1999 Biochem. J. 339(Pt 3):589-597 Trichode~ma reesei 1,2- a- mannosidase 5.0 Maras et al., 2000 J.
Biotechnol. 77(2-3):255-263 Pev~icillium citrinum 1,2-a-D-mannosidase 5.0 Yoshida et al., 1993 Biochem. J. 290(Pt 2):349-354 Aspergillus nidula~cs 1,2- a- mannosidase 6.0 Eades and Hintz, Homo Sapiens 1,2- a- mannosidase 6.0 IA(Golgi) Homo sapiehs 1,2- a- mannosidase6.0 IB
(Golgi) Lepidopte~au Type I 1,2-a-Man6-6.0 Ren et al., 1995 insect cells mannosidase Biochem.
34(8):2489-2495 Homo sapieus a- D-mannosidase 6.0 Chandrasekaran et al., 1984 Cancer Res.
44(9):4059-68 Xanthomonas 1,2,3- a- mannosidase 6.0 mauihotis Mouse IB (Golgi)1,2- a- mannosidase 6.5 Schneikert and Herscovics, 1994 Glycobiology. 4(4):445-Bacillus Sp. 1,2-a-D-mannosidase 7.0 Maruyama et al., (secreted) 1994 Carbohydrate Res. 251:89-98 When one attempts to trim high mannose structures to yield Man5GlcNAc2 in the ER or the Golgi apparatus of S. cerevisiae, one may choose any enzyme or combination of enzymes that (1) has/have a sufficiently close pH optimum (i.e. between pH 5.2 and pH 7.8), and (2) is/are known to generate, alone or in concert, the specific isomeric ManSGIcNAca structure required to accept subsequent addition of GIcNAc by GnT I. Any enzyme or combination of enzymes that has/have shown to generate a structure that can be converted to GIcNAcMan5GlcNAc2 by GnT I
i~ vitro would constitute an appropriate choice. This knowledge may be obtained from the scientific literature or experimentally by determining that a potential mannosidase can convert Man8GlcNAc2-PA to Man5GlcNAc2-PA
and then testing, if the obtained Man5GlcNAc2-PA structure can serve a substrate for GnT I and UDP-GIcNAc to give GIcNAcMan5GlcNAc2 in vitro.
For example, mannosidase IA from a human or marine source would be an appropriate choice.
l, 2-Mav~~cosidase Activity in the ER ahd Golgi Previous approaches to reduce mannosylation by the action of cloned exogenous mannosidases have failed to yield glycoproteins having a sufficient fraction (e.g. >27 mole %) of N glycans having the structure Man5GlcNAc2 (Martinet et al., 1998, and Chiba et al., 1998). These enzymes should function efficiently in ER or Golgi apparatus to be effective in converting nascent glycoproteins. Whereas the two mannosidases utilized in the prior art (from A. saitoi and T. reesei) have pH optima of 5.0, most enzymes that are active in the ER and Golgi apparatus of yeast (e.g. S
cerevisiae) have pH optima that are between 6.5 and 7.5 (see Table 3). Since the glycosylation of proteins is a highly evolved and efficient process, it can be concluded that the internal pH of the ER and the Golgi is also in the range of about 6-8. At pH 7.0, the activity of the mannosidases used in the prior art is reduced to less than 10%, which is insufficient for the efficient production of Man5GlcNAc2 in vivo.
Table 4. Cellular location and pH optima of various glycosylation-related enzymes of S. ce~evisiae.
Gene Activity Location pH Authors) optimum Ktrl a,- 1,2 Golgi 7.0 Romero et al., 1997 mannosyltransferase Biochem. J. 321 (Pt 2):289-295 Mnsl a,- 1,2- mannosidase ER 6.5 CWH41 glucosidase I ER 6.8 -- mannosyltransferase Golgi 7-8 Lehele and Tanner, 1974 Biochim.
Biophys. Acta 350(1):225-235 Kre2 a,- 1,2 Golgi 6.5-9.0 Romero et al., 1997 mannosyltransferase The a-1,2-mannosidase enzyme should have optimal activity at a pH
between 5.1 and 8Ø In a preferred embodiment, the enzyme has an optimal activity at a pH between 5.9 and 7.5. The optimal pH may be determined under in vitro assay conditions. Preferred mannosidases include those listed in Table 3 having appropriate pH optima, e.g. Aspev~gillus nidulahs, Homo Sapiens IA(Golgi), Homo Sapiens IB (Golgi), Lepidopterau insect cells (IPLB-SF21AE), Homo Sapiens, mouse IB (Golgi), andXahthomohas manihotis. In a preferred embodiment, a single cloned mannosidase gene is expressed in the host organism. However, in some cases it may be desirable to express several different mannosidase genes, or several copies of one particular gene, in order to achieve adequate production of Man5GlcNAc2.
In cases where multiple genes are used, the encoded mannosidases should all have pH optima within the preferred range of 5.1 to 8.0, or especially between 5.9 and 7.5. In an especially preferred embodiment mannosidase activity is targeted to the ER or cis Golgi, where the early reactions of glycosylation occur.
Formatio~e of complex N glycans A second step of the process involves the sequential addition of sugars to the nascent carbohydrate structure by engineering the expression of glucosyltransferases into the Golgi apparatus. This process first requires the functional expression of GnT I in the early or medial Golgi apparatus as well as ensuring the sufficient supply of UDP-GIcNAc.
Integration Sites Since the ultimate goal of this genetic engineering effort is a robust protein production strain that is able to perform well in an industrial fermentation process, the integration of multiple genes into the fungal chromosome involves careful planing. The engineered strain will most likely have to be transformed with a range of different genes, and these genes will have to be transformed in a stable fashion to ensure that the desired activity is maintained throughout the fermentation process. Any combination of the following enzyme activities will have to be engineered into the fungal protein expression host: sialyltransferases, mannosidases, fucosyltransferases, galactosyltransferases, glucosyltransferases, GIcNAc transferases, ER and Golgi specific transporters (e.g. sym and antiport transporters for UDP-galactose and other precursors), other enzymes involved in the processing of oligosaccharides, and enzymes involved in the synthesis of activated oligosaccharide precursors such as UDP-galactose, CMP-N-acetylneuraminic acid. At the same time a number of genes which encode enzymes known to be characteristic of non-human glycosylation reactions, will have to be deleted.
Targeting of glycosyltransferases to specific organelles:
Glycosyltransferases and mannosidases line the inner (luminal) surface of the ER and Golgi apparatus and thereby provide a "catalytic"
surface that allows for the sequential processing of glycoproteins as they proceed through the ER and Golgi network. In fact the multiple compartments of the cis, medial, and trans Golgi and the trans-Golgi Network (TGN), provide the different localities in which the ordered sequence of glycosylation reactions can take place. As a glycoprotein proceeds from synthesis in the ER to full maturation in the late Golgi or TGN, it is sequentially exposed to different glycosidases, mannosidases and glycosyltransferases such that a specific carbohydrate structure may be synthesized. Much work has been dedicated to revealing the exact mechanism by which these enzymes are retained and anchored to their respective organelle. The evolving picture is complex but evidence suggests that stem region, membrane spanning region and cytoplasmic tail individually or in concert direct enzymes to the membrane of individual organelles and thereby localize the associated catalytic domain to that locus.
Targeting sequences are well known and described in the scientific literature and public databases, as discussed in more detail below with respect to libraries for selection of targeting sequences and targeted enzymes.
Method for Producing a Library to Produce Modified Glycosylation Pathwavs A library including at least two genes encoding exogeneous glycosylation enzymes is transformed into the host organism, producing a genetically mixed population. Transformants having the desired glycosylation phenotypes are then selected from the mixed population. In a preferred embodiment, the host organism is a yeast, especially P. pasto~is, and the host glycosylation pathway is modified by the operative expression of one or more human or animal glycosylation enzymes, yielding protein N
glycans similar or identical to human glycoforms. In an especially preferred embodiment, the DNA library includes genetic constructs encoding fusions of glycosylation enzymes with targeting sequences for various cellular loci involved in glycosylation especially the ER, cis Golgi, medial Golgi, or trans Golgi.
Examples of modifications to glycosylation which can be effected using method are: (1) engineering an eukaryotic microorganism to trim mannose residues from Man8GlcNAc2 to yield Man5GlcNAc2 as a protein N
glycan; (2) engineering an eukaryotic microorganism to add an N acetylglucosamine (GIcNAc) residue to Man5GlcNAc2 by action of GIcNAc transferase I; (3) engineering an eukaryotic microorganism to functionally express an enzyme such as an N acetylglucosamine transferase (GnT I, GnT II, GnT III, GnT IV, GnT V, GnT VI), mannosidase II, fucosyltransferase, galactosyl tranferase (GaIT) or sialyltransferases (ST).
By repeating the method, increasingly complex glycosylation pathways can be engineered into the target microorganism. In one preferred embodiment, the host organism is transformed two or more times with DNA
libraries including sequences encoding glycosylation activities. Selection of desired phenotypes may be performed after each round of transformation or alternatively after several transformations have occurred. Complex glycosylation pathways can be rapidly engineered in this manner.
DNA Libraries It is necessary to assemble a DNA library including at least two exogenous genes encoding glycosylation enzymes. In addition to the open reading frame sequences, it is generally preferable to provide each library construct with such promoters, transcription terminators, enhancers, ribosome binding sites, and other functional sequences as may be necessary to ensure effective transcription and translation of the genes upon transformation into the host organism. Where the host is Pichia pasto~is, suitable promoters include, for example, the AOXl, AOX~, DAS, and P40 promoters. It is also preferable to provide each construct with at least one selectable marker, such as a gene to impart drug resistance or to complement a host metabolic lesion. The presence of the marker is useful in the subsequent selection of transformants; for example, in yeast the URA3, HIS4, SUC2, 6418, BLA, or SHBLE genes may be used.
In some cases the library may be assembled directly from existing or wild-type genes. In a preferred embodiment however the DNA library is assembled from the fusion of two or more sub-libraries. By the in-frame ligation of the sub-libraries, it is possible to create a large number of novel genetic constructs encoding useful targeted glycosylation activities. For example, one useful sub-library includes DNA sequences encoding any combination of enzymes such as sialyltransferases, mannosidases, fucosyltransferases, galactosyltransferases, glucosyltransferases, and GIcNAc transferases. .Preferably, the enzymes are of human origin, although other mammalian, animal, or fungal enzymes are also useful. In a preferred embodiment, genes are truncated to give fragments encoding the catalytic domains of the enzymes. By removing endogenous targeting sequences, the enzymes may then be redirected and expressed in other cellular loci. The choice of such catalytic domains may be guided by the knowledge of the particular environment in which the catalytic domain is subsequently to be active. For example, if a particular glycosylation enzyme is to be active in the late Golgi, and all known enzymes of the host organism in the late Golgi have a certain pH optimum, then a catalytic domain is chosen which exhibits adequate activity at that pH.
Another useful sub-library includes DNA sequences encoding signal peptides that result in localization of a protein to a particular location within the ER, Golgi, or trans Golgi network. These signal sequences may be selected from the host organism as well as from other related or unrelated organisms. Membrane-bound proteins of the ER or Golgi typically may include, for example, N-terminal sequences encoding a cytosolic tail (ct), a transmembrane domain (tmd), and a stem region (sr). The ct, tmd, and sr sequences are sufficient individually or in combination to anchor proteins to the inner (lumenal) membrane of the organelle. Accordingly, a preferred embodiment of the sub-library of signal sequences includes ct, tmd, and/or sr sequences from these proteins. In some cases it is desirable to provide the sub-library with varying lengths of sr sequence. This may be accomplished by PCR using primers that bind to the 5' end of the DNA encoding the cytosolic region and employing a series of opposing primers that bind to various parts of the stem region. Still other useful sources of signal sequences include retrieval signal peptides, e.g. the tetrapeptides HDEL or KDEL, which are typically found at the C-terminus of proteins that are transported retrograde into the ER or Golgi. Still other sources of signal sequences include (a) type II membrane proteins, (b) the enzymes listed in Table 3, (c) membrane spanning nucleotide sugar transporters that are localized in the Golgi, and (d) sequences referenced in Table 5.
Table 5. Sources of useful compartmental targeting sequences Gene or Sequence Organism Function Location of Gene Product 111nsI S a-1,2-mannosidaseER
cerevisiae OCHI S. 1,6- Golgi (cis) cerevisiae mannosyltransferase MNN2 S. 1,2- Golgi (medial) ce~evisiae mannosyltransferase MNNI S. 1,3- Golgi (trans) cerevisiae mannosyltransferase OCHI P. pastoris1,6- Golgi (cis) mannosyltransferase 2,6 ST H. Sapiens 2,6-sialyltransferasetrans Golgi network UDP-Gal T S. pombe UDP-Gal transporterGolgi Mntl S. 1,2- Golgi (cis) cerevisiae mannosyltransferase HDEL at C- S. retrieval signalER
terminus cerevisiae In any case, it is highly preferred that signal sequences are selected which are appropriate for the enzymatic activity or activities which are to be engineered into the host. For example, in developing a modified microorganism capable of terminal sialylation of nascent N glycans, a process which occurs in the late Golgi in humans, it is desirable to utilize a sub-library of signal sequences derived from late Golgi proteins. Similarly, the trimming of Man8GlcNAca by an a-1,2-mannosidase to give Man5GlcNAc2 is an early step in complex N glycan formation in humans. It is therefore desirable to have this reaction occur in the ER or early Golgi of an engineered host microorganism. A sub-library encoding ER and early Golgi retention signals is used.
In a preferred embodiment, a DNA library is then constructed by the in-frame ligation of a sub-library including DNA encoding signal sequences with a sub-library including DNA encoding glycosylation enzymes or catalytically active fragments thereof. The resulting library includes synthetic genes encoding fusion proteins. In some cases it is desirable to provide a signal sequence at the N-terminus of a fusion protein, or in other cases at the C-terminus. In some cases signal sequences may be inserted within the open reading frame of an enzyme, provided the protein structure of individual folded domains is not disrupted.
The method is most effective when a DNA library transformed into the host contains a large diversity of sequences, thereby increasing the probability that at least one transformant will exhibit the desired phenotype.
Accordingly, prior to transformation, a DNA library or a constituent sub-library may be subjected to one or more rounds of gene shuffling, error prone PCR, or in vitro mutagenesis.
Transformation The DNA library is then transformed into the host organism. In yeast, any convenient method of DNA transfer may be used, such as electroporation, the lithium chloride method, or the spheroplast method. To produce a stable strain suitable for high-density fermentation, it is desirable to integrate the DNA library constructs into the host chromosome. In a preferred embodiment, integration occurs via homologous recombination, using techniques known in the art. For example, DNA library elements are provided with flanking sequences homologous to sequences of the host organism. In this manner integration occurs at a defined site in the host genome, without disruption of desirable or essential genes. In an especially preferred embodiment, library DNA is integrated into the site of an undesired gene in a host chromosome, effecting the disruption or deletion of the gene.
For example, integration into the sites of the OCHl, MNNl, or M1VN4 genes allows the expression of the desired library DNA while preventing the expression of enzymes involved in yeast hypermannosylation of glycoproteins. In other embodiments, library DNA may be introduced into the host via a chromosome, plasmid, retroviral vector, or random integration into the host genome. In any case, it is generally desirable to include with each library DNA construct at least one selectable marker gene to allow ready selection of host organisms that have been stably transformed.
Recyclable marker genes such as u~a3, which can be selected for or against, are especially suitable.
Selection Process After transformation of the host strain with the DNA library, transformants displaying the desired glycosylation phenotype are selected.
Selection may be performed in a single step or by a series of phenotypic enrichment and/or depletion steps using any of a variety of assays or detection methods. Phenotypic characterization may be carried out manually or using automated high-throughput screening equipment. Commonly a host microorganism displays protein N glycans on the cell surface, where various glycoproteins are localized. Accordingly intact cells may be screened for a desired glycosylation phenotype by exposing the cells to a lectin or antibody that binds specifically to the desired N glycan. A wide variety of oligosaccharide-specific lectins are available commercially (EY
Laboratories, San Mateo, CA). Alternatively, antibodies to specific human or animal N glycans are available commercially or may be produced using standaxd techniques. An appropriate lectin or antibody may be conjugated to a reporter molecule, such as a chromophore, fluorophore, radioisotope, or an enzyme having a chromogenic substrate (Guillen et al., 1998. P~oc.
Natl.Acad. Sci. USA 95(14): 7888-7892). Screening may then be performed using analytical methods such as spectrophotometry, fluorimetry, fluorescence activated cell sorting, or scintillation counting. In other cases, it may be necessary to analyze isolated glycoproteins or N glycans from transformed cells. Protein isolation may be carried out by techniques known in the art. In cases where an isolated N glycan is required, an enzyme such as endo-(3-N acetylglucosaminidase (Genzyme Co., Boston, MA) may be used to cleave the N glycans from glycoproteins. Isolated proteins or N glycans may then be analyzed by liquid chromatography (e.g. HPLC), mass spectroscopy, or other suitable means. U.S. Patent No. 5,595,900 teaches several methods by which cells with desired extracellular carbohydrate structures may be identified. Prior to selection of a desired transformant, it may be desirable to deplete the transformed population of cells having undesired phenotypes. For example, when the method is used to engineer a functional mannosidase activity into cells, the desired transformants will have lower levels of mannose in cellular glycoprotein.
Exposing the transformed population to a lethal radioisotope of mannose in the medium depletes the population of transformants having the undesired phenotype, i.e. high levels of incorporated mannose. Alternatively, a cytotoxic lectin or antibody, directed against an undesirable N glycan, may be used to deplete a transformed population of undesired phenotypes.
Methods for Providing Sugar Nucleotide Precursors to the Gobi Apparatus For a glycosyltransferase to function satisfactorily in the Golgi, it is necessary for the enzyme to be provided with a sufficient concentration of an appropriate nucleotide sugar, which is the high-energy donor of the sugar moiety added to a nascent glycoprotein. These nucleotide sugars to the appropriate compartments are provided by expressing an exogenous gene encoding a sugar nucleotide transporter in the host microorganism. The choice of transporter enzyme is influenced by the nature of the exogenous glycosyltransferase being used. For example, a GIcNAc transferase may require a UDP-GIcNAc transporter, a fucosyltransferase may require a GDP-fucose transporter, a galactosyltransferase may require a UDP-galactose transporter, or a sialyltransferase may require a CMP-sialic acid transporter.
The added transporter protein conveys a nucleotide sugar from the cytosol into the Golgi apparatus, where the nucleotide sugar may be reacted by the glycosyltransferase, e.g. to elongate an N glycan. The reaction liberates a nucleoside diphosphate or monophosphate, e.g. UDP, GDP, or CMP. As accumulation of a nucleoside diphosphate inhibits the further activity of a glycosyltransferase, it is frequently also desirable to provide an expressed copy of a gene encoding a nucleotide diphosphatase. The diphosphatase (specific for UDP or GDP as appropriate) hydrolyzes the diphosphonucleoside to yield a nucleoside monosphosphate and inorganic phosphate. The nucleoside monophosphate does not inhibit the glycotransferase and in any case is exported from the Golgi by an endogenous cellular system. Suitable transporter enzymes, which are typically of mammalian origin, are described below.
Examples The use of the above general method may be understood by reference to the following non-limiting examples. Examples of preferred embodiments are also summarized in Table 6.
Example 1: Engineering of P. pastoris with a-1,2-Mannosidase to produce insulin.
An a-1,2-mannosidase is required for the trimming of Man8GlcNAc2 to yield ManSGIcNAc~,, an essential intermediate for complex N glycan formation. An OCHI mutant of P. pasto~is is engineered to express secreted human interferon-a under the control of an aox promoter. A DNA library is constructed by the in-frame ligation of the catalytic domain of human mannosidase IB (an a-1,2-mannosidase) with a sub-library including sequences encoding early Golgi localization peptides. The DNA library is then transformed into the host organism, resulting in a genetically mixed population wherein individual transformants each express interferon-(3 as well as a synthetic mannosidase gene from the library. Individual transformant colonies are cultured and the production of interferon is induced by addition of methanol. Under these conditions, over 90% of the secreted protein includes interferon-/3. Supernatants are purified to remove salts and low-molecular weight contaminants by C18 silica reversed-phase chromatography. Desired transformants expressing appropriately targeted, active a-1,2-mannosidase produce interferon-(3 including N glycans of the structure Man5GlcNAc2, which has a reduced molecular mass compared to the interferon of the parent strain. The purified supernatants including interferon-(3 are analyzed by MALDI-TOF mass spectroscopy and colonies expressing the desired form of interferon-(3 are identified.
Example 2: Engineering of Strain to express GIcNAc Transferase I
GIcNAc Transferase I activity is required for the maturation of complex N glycans. Man5GlcNAc2 may only be trimmed by mannosidase II, a necessary step in the formation of human glycoforms, after the addition of GIcNAc to the terminal a-1,3 mannose residue by GIcNAc Transferase I
(Schachter, 1991 Glycobiology 1(5):453-461). Accordingly a library is prepared including DNA fragments encoding suitably targeted GIcNAc Transferase I genes. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g. an OCHI mutant), provides the substrate UDP-GIcNAc in the Golgi and/or ER, and provides N glycans of the structure Man5GlcNAca in the Golgi and/or ER. After transformation of the host with the DNA library, the transformants are screened for those having the highest concentration of terminal GIcNAc on the cell surface, or alternatively secrete the protein having the highest terminal GIcNAc content.
Such a screen is performed using a visual method (e.g. a staining procedure), a specific terminal GIcNAc binding antibody, or a lectin. Alternatively the desired transformants exhibit reduced binding of certain lectins specific for terminal mannose residues.
Example 3: Engineering of Strains with a Mannosidase II
In another example, it is desirable in order to generate a human glycoform in a microorganism to remove the two remaining terminal mannoses from the structure GIcNAcMan5GlcNAc2 by action of a mannosidase II. A DNA library including sequences encoding cis and medial Golgi localization signals is fused in-frame to a library encoding mannosidase II catalytic domains. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g. an OCHI mutant) and provides N glycans having the structure GIcNAcMan5GlcNAca in the Golgi and/or ER. After transformation, organisms having the desired glycosylation phenotype are selected. An i~ vitro assay is used in one method. The desired structure GIcNAcMan3GlcNAc2 (but not the undesired GIcNAcMan5GlcNAc2) is a substrate for the enzyme GIcNAc Transferase II.
Accordingly, single colonies may be assayed using this enzyme in vitro in the presence of the substrate, UDP-GIcNAc. The release of UDP is determined either by HPLC or an enzymatic assay for UDP. Alternatively radioactively labeled UDP-GIcNAc is used.
The foregoing in vitro assays are conveniently performed on individual colonies using high-throughput screening equipment.
Alternatively a lectin binding assay is used. In this case the reduced binding of lectins specific for terminal mannoses allows the selection of transformants having the desired phenotype. For example, Galantus nivalis lectin binds specifically to terminal a-1,3-mannose, the concentration of which is reduced in the presence of operatively expressed mannosidase II
activity. In one suitable method, G. nivalis lectin attached to a solid agarose support (available from Sigma Chemical, St. Louis, MO) is used to deplete the transformed population of cells having high levels of terminal a-1,3-mannose.
Example 4: Engineering of organisms to express Sialyltransferase The enzymes a2,3-sialyltransferase and a2,6-sialyltransferase add terminal sialic acid to galactose residues in nascent human N glycans, leading to mature glycoproteins. In human the reactions occur in the trans Golgi or TGN. Accordingly a DNA library is constructed by the in-frame fusion of sequences encoding sialyltransferase catalytic domains with sequences encoding trans Golgi or TGN localization signals. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g.
an OCHI mutant), which provides N glycans having terminal galactose residues in the trans Golgi or TGN, and provides a sufficient concentration of CMP-sialic acid in the trans Golgi or TGN. Following transformation, transformants having the desired phenotype are selected using a fluorescent antibody specific for N glycans having a terminal sialic acid.
Example 5: Method of engineering strains to express UDP-GIcNAc Transporter The cDNA of human Golgi UDP-GIcNAc transporter has been cloned by Ishida and coworkers. (Isluda, N., et al. 1999 J. Biochem.126(1):
68-77. Guillen and coworkers have cloned the canine kidney Golgi UDP-GIcNAc transporter by phenotypic correction of a Kluyve~omyces lactis mutant deficient in Golgi UDP-GIcNAc transport. (Guillen, E., et al. 1998).
Thus a mammalian Golgi UDP-GIcNAc transporter gene has all of the necessary information for the protein to be expressed and targeted functionally to the Golgi apparatus of yeast.
Example 6: Method of engineering strains to express GDP-Fucose Transporter.
The rat liver Golgi membrane GDP-fucose transporter has been identified and purified by Puglielli, L. and C. B. Hirschberg 1999 J. Biol.
Chem. 274(50):35596-35600. The corresponding gene can be identified using standard techniques, such as N terminal sequencing and Southern blotting using a degenerate DNA probe. The intact gene can is then be expressed in a host microorganism that also expresses a fucosyltransferase.
Example 7: Method of engineering strains to express UDP-Galactose Transporter Human UDP-galactose (UDP-Gal) transporter has been cloned and shown to be active in S. cerevisiae. (Kainuma, M., et al. 1999 Glycobiology 9(2): 133-141). A second human UDP-galactose transporter (hUGTl) has been cloned and functionally expressed in Chinese Hamster Ovary Cells.
Aoki, K., et al. 1999 J.Biochem. 126(5): 940-950. Likewise Segawa and coworkers have cloned a UDP-galactose transporter from Schizosaccharomyces pombe (Segawa, H., et al. 1999 Febs Letters 451(3):
295-298).
CMP-Sialic Acid Transporter Human CMP-sialic acid transporter (hCST) has been cloned and expressed in Lec 8 CHO cells by Aoki and coworkers (1999). Molecular cloning of the hamster CMP-sialic acid transporter has also been achieved (Eckhardt and Gerardy Schahn 1997 Eur. J. Biochem. 248(1): 187-192). The functional expression of the marine CMP-sialic acid transporter was achieved in Saccharomyces cerevisiae by Berninsone, P., et al. 1997 J.
Biol. Chem.272(19):12616-12619.
Table6. Examples of preferred embodiments of the methods for modifying glycosylation in a eukaroytic microorganism, e.g. Pichia pastoris Desired Suitable Suitable Sources of Suitable Suitable Structure Catalytic Localization Gene Transporters Activities Sequences Deletions andlor Phosphatases Man5GlcNAca a-1,2- Mnsl (N-terminus, OCH1 none mannosidase S cerevisiae) MNN4 (marine, Ochl (N-terminus, MNN6 human, S. cerevisiae, Bacillus sp., P. pastoris) A. nidulans ) Ktrl Mnn9 Mntl (S. cerevisiae) KDEL, HDEL
(C-terminus) GIcNAcManSGlc GIcNAc Ochl (N-terminus, OCH1 UDP-GIcNAc NAc2 Transferase S cerevisiae, MNN4 transporter I, (human, P. pastoris) MNN6 (human, marine, rat KTRl (N-terminus) marine, etc.) KDEL, HDEL K. lactis) (C-terminus) UDPase Mnnl (N-terminus, (human) S cerevisiae) Mntl (N-terminus, S. cerevisiae) GDPase (N-terminus, S. cerevisiae) GlcNAcMan3Glc mannosidaseKtrl OCH1 UDP-GIcNAc NAc2 II Mnnl (N-terminus,MNN4 transporter S ce~evisiae) MNN6 (human, Mntl (N-terminus, marine, S cerevisiae) K. lactic) Kre2/Mntl UDPase (S ce~evisiae) (human) Kre2 (P. pasto~is) Ktrl (S cerevisiae) Ktrl (P. pasto~is) Mnnl (S ee~evisiae) GIcNAc~2_4~ GIcNAc Mnnl (N-terminus,OCH1 UDP-GIcNAc Man3GlcNAc2 TransferaseS. cerevisiae) MNN4 transporter II, III, Mntl (N-terminus,MNN6 (human, IV, V
(human, S. ce~evisiae) marine, marine) Kre2/Mntl K.lactis) (S. ce~evisiae) UDPase Kre2 (P. pasto~is) (human) Ktrl (S. cerevisiae) Ktr1 (P. pastoris) Nlim1 (S cerevisiae) Gal~l_4~Glc (3-1,4- Mnnl (N-terminus,OCH1 UDP-Galactos NAct2_4~- Galactosyl S ce~evisiae) MNN4 a transporter ~
Man3GlcNAca transferaseMntl(N-terminus,MNN6 (human, (human) S ce~evisiae) S pombe) Kre2/Mntl (S cerevisiae) Kre2 (P. pastoris) Ktrl (S cerevisiae) Ktrl (P. pastoris) Mnnl (S. cerevisiae) NANAtI_4>- oc-2,6- KTRl OCH1 CMP-Sialic Gal~l_4~GlcNAc~2_SialyltransferMNN1 (N-terminus,MNN4 acid a~- ace (human)S cerevisiae) MNN6 transporter Man3GlcNAc2 a,-2,3- MNT1 (N-terminus, (human) SialyltransferS cerevisiae) ace Kre2/Mntl (S ce~evisiae) Kre2 (P. pasto~is) Ktrl (S. ce~evisiae) Ktrl (P. pasto~is) (S. cerevisiae) Table 7: DNA and Protein Sequence Resources 1. European Bioinformatics Institute (EBI) is a centre for research and services in bioinformatics: httb://www.ebi.ac.ul~/
2. Swissprot database: http://www.expasy.ch/spr 3. List of known glycosyltransferases and their origin.
X31,2 (GnT Il EC 2.4.1.101 4. human cDNA, Kumar et al (1990) Proc. Natl. Acad. Sci. USA
87:9948-9952 5. human gene, Hull et al (1991) Biochem. Biophys. Res. Commun.
176:608-615 6. mouse cDNA, Kumar et al (1992) Glycobiology 2:383-393 7. mouse gene, Pownall et al (1992) Genomics 12:699-704 8. marine gene (5' flanking, non-coding), Yang et al (1994) Glycobiology 5:703-712 9. rabbit cDNA, Sarkar et al (1991) Proc. Natl. Acad. Sci. USA 88:234-10. rat cDNA, Fukada et al (1994) Biosci.Biotechnol.Biochem. 58:200-1 2 (GnT II) EC 2.4.1.143 11. human gene, Tan et al (1995) Eur. J. Biochem. 231:317-328 12. rat cDNA, D'Agostaro et al (1995) J. Biol. Chem. 270:15211-15221 13. [31,4 (GnT III) EC 2.4.1.144 14. human cDNA, Ihara et al (1993) J. Biochem.l 13:692-698 15. marine gene, Bhaumik et al (1995) Gene 164:295-300 16. rat cDNA, Nishikawa et al (1992) J. Biol. Chem. 267:18199-18204 ~ 1,4 (GnT IV SEC 2.4.1.145 17. human cDNA, Yoshida et al (1998) Glycoconjugate Journal 15:1115-18. bovine cDNA, Minowa et al., European Patent EP 0 905 232 ~ (31,6 (GnT V) EC 2.4.1.155 19. human cDNA, Saito et al (1994) Biochem. Biophys. Res. Commun.
198:318-327 20. rat cDNA, Shoreibah et al (1993) J. Biol. Chem. 268:15381-15385 i1,4 Galactosyltransferase, EC 2.4.1.90 (LacNAc synthetas~ EC
2.4.1.22 (lactose synthetase) 21. bovine cDNA, D'Agostaro et al (1989) Eur. J. Biochem. 183:211-217 22. bovine cDNA (partial), Narimatsu et al (1986) Proc. Natl. Acad. Sci.
USA 83:4720-4724 23. bovine cDNA (partial), Masibay & Qasba (1989) Proc. Natl. Acad.
Sci. USA 86:5733-5377 24. bovine cDNA (5' end), Russo et al (1990) J. Biol. Chem. 265:3324 25. chicken cDNA (partial), Ghosh et al (1992) Biochem. Biophys. Res.
Commun. 12 I 5-1222 26. human cDNA, Masri et al (1988) Biochem. Biophys. Res. Commun.
157:657-663 27. human cDNA, (HeLa cells) Watzele & Berger (1990) Nucl. Acids Res. 18:7174 28. human cDNA, (partial) Uejima et al (1992) Cancer Res. 52:6158-29. human cDNA, (carcinoma) Appert et al (1986) Biochem. Biophys.
Res. Commun. 139:163-168 30. human gene, Mengle-Gaw et al (1991) Biochem. Biophys. Res.
Commun. 176:1269-1276 31. marine cDNA, Nakazawa et al (1988) J. Biochem. 104:165-168 32. marine cDNA, Shaper et al (1988) J. Biol. Chem. 263:10420-10428 33. marine cDNA (novel), Uehara & Muramatsu unpublished 34. marine gene, Hollis et al (1989) Biochem. Biophys. Res. Commun.
162:1069-1075 35. rat protein (partial), Bendiak et al (1993) Eur. J. Biochem. 216:405-2,3-Sialyltransferase, (ST3Ga1 II) (N linked~(Gal-1,3/4-GIcNAc) EC
2.4.99.6 36. human cDNA, Kitagawa & Paulson (1993) Biochem. Biophys. Res.
Commun. 194:375-3 82 37. rat cDNA, Wen et al (1992) J. Biol. Chem. 267:21011-21019 2 6-Sialyltransferase, (ST6Ga1 I) EC 2.4.99.1 38. chicken, Kurosawa et al (1994) Eur. J. Biochem 219:375-381 39. human cDNA (partial), Lance et al (1989) Biochem. Biophys. Res.
Commun. 164:225- 232 40. human cDNA, Grundmann et al (1990) Nucl. Acids Res. 18:667 41. human cDNA, Zettlmeisl et al (1992) Patent EP0475354-A/3 42. human cDNA, Stamenkovic et al (1990) J. Exp. Med. 172:641-643 (CD75) 43. human cDNA, Bast et al (1992) J. Cell Biol. 116:423-435 44. human gene (partial), Wang et al (1993) J. Biol. Chem. 268:4355-45. human gene (5' flank), Aasheim et al (1993) Eur. J. Biochem.
213:467-475 46. human gene (promoter), Aas-Eng et al (1995) Biochim. Biophys.
Acta 1261:166-169 47. mouse cDNA, Hamamoto et al (1993) Bioorg. Med. Chem. 1:141-48. rat cDNA, Weinstein et al (1987) J. Biol. Chem. 262:17735-17743 49. rat cDNA (transcript fragments), Wang et al (1991),Glycobiology 1:25-31, Wang et al (1990) J. Biol. Chem. 265:17849-17853 50. rat cDNA (5' end), O'Hanlon et al (1989) J. Biol. Chem. 264:17389-17394; Wang et al (1991) Glycobiology 1:25-31 51. rat gene (promoter), Svensson et al (1990) J. Biol. Chem. 265:20863-52. rat mRNA (fragments), Wen et al (1992) J. Biol. Chem. 267:2512-Additional methods and reagents which can be used in the methods for modifying the glycosylation are described in the literature, such as IJ.S.
Patent No. 5,955,422, U.S. Patent No. 4,775,622, U.S. Patent No. 6,017,743, U.S. Patent No. 4,925,796, U.S. Patent No. 5,766,910, U.S. Patent No.
5,834,251, U.S. Patent No. 5,910,570, U.S. Patent No. 5,849,904, U.S.
Patent No. 5,955,347, U.S. Patent No. 5,962,294, U.S. Patent No. 5,135,854, U.S. Patent No. 4,935,349, U.S. Patent No. 5,707,828, and U.S. Patent No.
5,047,335.
Appropriate yeast expression systems can be obtained from sources such as the American Type Culture Collection, Rockville, MD. Vectors are commercially available from a variety of sources.
Recombinant human proteins expressed in the above-mentioned host systems may still include non-human glycoforms (Raju et al., 2000 Annals Biochem. 283(2):123-132). In particular, fraction of the N glycans may lack terminal sialic acid, typically found in human glycoproteins. Substantial efforts have been directed to developing processes to obtain glycoproteins that are as close as possible in structure to the human forms, or have other therapeutic advantages. Glycoproteins having specific glycoforms may be especially useful, for example in the targeting of therapeutic proteins. For example, the addition of one or more sialic acid residues to a glycan side chain may increase the lifetime of a therapeutic glycoprotein in vivo after admininstration. Accordingly, the mammalian host cells may be genetically engineered to increase the extent of terminal sialic acid in glycoproteins expressed in the cells. Alternatively sialic acid may be conjugated to the protein of interest in vitro prior to administration using a sialic acid transferase and an appropriate substrate. In addition, changes in growth medium composition or the expression of enzymes involved in human glycosylation have been employed to produce glycoproteins more closely resembling the human forms (S. Weikert, et al., Nature Biotechnology, 1999, 17, 1116-1121; Werner, Noe, et al 1998 Arzneimittelforschung 48(8):870-880; Weikert, Papac et al., 1999; Andersen and Goochee 1994 Cur.
Opin.Biotechuol.5: 546-549; Yang and Butler 2000 Biotechhol.Bioehgiu.68(4): 370-380). Alternatively cultured human cells may be used.
However, all of the existing systems have significant drawbacks.
Only certain therapeutic proteins are suitable for expression in animal or plant systems (e.g. those lacking in any cytotoxic effect or other effect adverse to growth). Animal and plant cell culture systems are usually very slow, frequently requiring over a week of growth under carefully controlled conditions to produce any useful quantity of the protein of interest. Protein yields nonetheless compare unfavorably with those from microbial fermentation processes. In addition cell culture systems typically require complex and expensive nutrients and cofactors, such as bovine fetal serum.
Furthermore growth may be limited by programmed cell death (apoptosis).
Moreover, animal cells (particularly mammalian cells) are highly susceptible to viral infection or contamination. In some cases the virus or other infectious agent may compromise the growth of the culture, while in other cases the agent may be a human pathogen rendering the therapeutic protein product unfit for its intended use. Furthermore many cell culture processes require the use of complex, temperature-sensitive, animal-derived growth media components, which may carry pathogens such as bovine spongiform encephalopathy (BSE) prions. Such pathogens are difficult to detect and/or difficult to remove or sterilize without compromising the growth medium. In any case, use of animal cells to produce therapeutic proteins necessitates costly quality controls to assure product safety.
Transgenic animals may also be used for manufacturing high-volume therapeutic proteins such as human serum albumin, tissue plasminogen activator, monoclonal antibodies, hemoglobin, collagen, fibrinogen and others. While transgenic goats and other transgenic animals (mice, sheep, cows, etc.) can be genetically engineered to produce therapeutic proteins at high concentrations in the milk, the process is costly since every batch has to undergo rigorous quality control. Animals may host a variety of animal or human pathogens, including bacteria, viruses, fungi, and prions. In the case of scrapies and bovine spongiform encephalopathy, testing can take about a year to rule out infection. The production of therapeutic compounds is thus preferably carried out in a well-controlled sterile environment, e.g. under Good Manufacturing Practice (GMP) conditions. However, it is not generally feasible to maintain animals in such environments. Moreover, whereas cells grown in a fermenter are derived from one well characterized Master Cell Bank (MCB), transgenic animal technology relies on different animals and thus is inherently non-uniform. Furthermore external factors such as different food uptake, disease and lack of homogeneity within a herd, may effect glycosylation patterns of the final product. It is known in humans, for example, that different dietary habits result in differing glycosylation patterns.
Transgenic plants have been developed as a potential source to obtain proteins of therapeutic value. However, high level expression of proteins in plants suffers from gene silencing, a mechanism by which the genes for highly expressed proteins are down-regulated in subsequent plant generations. In addition, plants add xylose and/or a,-1,3-linked fucose to protein N glycans, resulting in glycoproteins that differ in structure from animals and are immunogenic in mammals (Altmann, Marz et al., 1995 Glycoconj. J. 12(2);150-155). Furthermore, it is generally not practical to grow plants in a sterile or GMP environment, and the recovery of proteins from plant tissues is more costly than the recovery from fermented microorganisms.
Gl~coprotein Production Using Eukaryotic Mieroor~anisms The lack of a suitable expression system is thus a significant obstacle to the low-cost and safe production of recombinant human glycoproteins.
Production of glycoproteins via the fermentation of microorganisms would offer numerous advantages over the existing systems. For example, fermentation-based processes may offer (a) rapid production of high concentrations of protein; (b) the ability to use sterile, well-controlled production conditions (e.g. GMP conditions); (c) the ability to use simple, chemically defined growth media; (d) ease of genetic manipulation; (e) the absence of contaminating human or animal pathogens; (f) the ability to express a wide variety of proteins, including those poorly expressed in cell culture owing to toxicity etc.; (g) ease of protein recovery (e.g. via secretion into the medium). In addition, fermentation facilities are generally far less costly to construct than cell culture facilities.
As noted above, however, bacteria, including species such as Esche~ichia coli commonly used to produce recombinant proteins, do not glycosylate proteins in a specific manner like eukaryotes. Various methylotrophic yeasts such as Pichia pasto~is, Pichia naethaholica, and Hansenula polymo~pha, are particularly useful as eukaryotic expression systems, since they are able to grow to high cell densities and/or secrete large quantities of recombinant protein. However, as noted above, glycoproteins expressed in these eukaryotic microorganisms differ substantially in N glycan structure from those in animals. This has prevented the use of yeast or filamentous fungi as hosts for the production of many useful glycoproteins.
Several efforts have been made to modify the glycosylation pathways of eukaryotic microorganisms to provide glycoproteins more suitable for use as mammalian therapeutic agents. For example, several glycosyltransferases have been separately cloned and expressed in S cerevisiae (GaIT, GnT I), Aspergillus nidulans (GnT I) and other fungi (Yoshida et al., 1999, I~alsner et al., 1995 Glycoconj. J. 12(3):360-370, Schwientek et al., 1995). However, N glycans with human characteristics were not obtained.
Yeasts produce a variety of mannosyltransferases e.g. 1,3-mannosyltransferases (e.g. MNN1 in S, cerevisiae) (Graham and Emr, 1991 J. Cell. Biol. 114(2):207-218), 1,2-mannosyltransferases (e.g. I~TR/KRE
family from S. cerevisiae), 1,6-mannosyltransferases (OCHl from S.
cerevisiae), mannosylphosphate transferases (MNN4 and MNN6 from S.
cerevisiae) and additional enzymes that are involved in endogenous glycosylation reactions. Many of these genes have been deleted individually, giving rise to viable organisms having altered glycosylation profiles.
Examples are shown in Table 1.
Table 1. Examples of yeast strains having altered mannosylation Strain N glycan (wild Mutation N glycan Reference type) (mutant) S. pombe Man>9GlcNAc2 OCHl Man8GlcNAc2 Yoko-o et al., 2001 FEBS Lett.
489(1):75-80 S. ce~evisiae Man>9GlcNAc2 OCH1/MNN1 Man8GlcNAc2 Nakanishi-Shindo et al,. 1993 J. Biol.
Chem.
268(35):26338-S ce~evisiae Man,9GlcNAca OCH1/MNN1/ Man8GlcNAca Chiba et al., 1998 MNN4 J. Biol. Chem. 273, In addition, Japanese Patent Application Public No. 8-336387 discloses an OCHI mutant strain of Pichia pasto~is. The OCHl gene encodes 1,6-mannosyltransferase, which adds a mannose to the glycan structure Man8GlcNAc2 to yield Man9GlcNAc2. The Man9GlcNAc2 structure is then a substrate for further mannosylation i~ vivo, leading to the hypermannosylated glycoproteins that are characteristic of yeasts and typically may have at least 30-40 mannose residue per N glycan. In the OCHl mutant strain, proteins glycosylated with Man8GlcNAc2 are accumulated and hypermannosylation does not occur. However, the structure MangGlcNAca is not a substrate for animal glycosylation enzymes, such as human UDP-GIcNAc transferase I, and accordingly the method is not useful for producing proteins with human glycosylation patterns.
Martinet et al. (Biotechnol. Lett. 1998, 20(12), 1171-1177) reported the expression of a-1,2-mannosidase from T~ichode~ma reesei in P. pastoris.
Some mannose trimming from the N glycans of a model protein was observed. However, the model protein had no N glycans with the structure Man;GlcNAca, which would be necessary as an intermediate for the generation of complex N glycans. Accordingly the method is not useful for producing proteins with human or animal glycosylation patterns.
Similarly, Chiba et al. 1998 expressed a-1,2-mannosidase from Aspergillus saitoi in the yeast Saccha~omyces ce~evisiae. A signal peptide sequence (His-Asp-Glu-Leu) was engineered into the exogenous mannosidase to promote retention in the endoplasmic reticulum. In addition, the yeast host was a mutant lacking three enzyme activities associated with hypermannosylation of proteins: 1,6-mannosyltransferase (OCHI); 1,3-mannosyltransferase (MlVNl); and mannosylphosphatetransferase (MNN4).
The N glycans of the triple mutant host thus consisted of the structure Man$GIcNAc2, rather than the high mannose forms found in wild-type S.
ce~evisiae. In the presence of the engineered mannosidase, the N glycans of a model protein (carboxypeptidase ~ were trimmed to give a mixture consisting of 27 mole % Man5GlcNAc2, 22 mole % Man6GlcNAc2, 22 mole Man7GlcNAca, 29 mole % Man8GlcNAc2. Trimming of the endogenous cell wall glycoproteins was less efficient, only 10 mole % of the N glycans having the desired Man5GlcNAc2 structure.
Since only the Man5GlcNAc2 glycans would be susceptible to further enzymatic conversion to human glycoforms, the method is not efficient for the production of proteins having human glycosylation patterns. In proteins having a single N glycosylation site, at least 73 mole % would have an incorrect structure. In proteins having two or three N glycosylation sites, respectively at least 93 or 98 mole % would have an incorrect structure.
Such low efficiencies of coversion are unsatisfactory for the production of therapeutic agents, particularly as the separation of proteins having different glycoforms is typically costly and difficult.
With the object of providing a more human-like glycoprotein derived from a fungal host, U.S. Patent No. 5,834,251 to Maras and Contreras discloses a method for producing a hybrid glycoprotein derived from Trichoderma ~eesei. A hybrid N glycan has only mannose residues on the Manal-6 arm of the core and one or two complex antennae on the Mana,l-3 arm. While this structure has utility, the method has the disadvantage that numerous enzymatic steps must be performed in vitYO, which is costly and time-consuming. Isolated enzymes are expensive to prepare and maintain, may need unusual and costly substrates (e.g. UDP-GIcNAc), and are prone to loss of activity and/or proteolysis under the conditions of use.
It is therefore an object of the present invention to provide a system and methods for humanizing glycosylation of recombinant glycoproteins expressed in Pichia pastoris and other lower eukaryotes such as Hansenula polymorpha, Pichia stiptis, Piclaia ynethauolica, Pichia sp, Kluyve~omyces sp, Ca~dida albicahs, Aspergillus hidulahs, and Ti~ichoderma reseei.
SUMMARY OF THE INVENTION
Cell lines having genetically modified glycosylation pathways that allow them to carry out a sequence of enzymatic reactions, which mimic the processing of glycoproteins in humans, have been developed. Recombinant proteins expressed in these engineered hosts yield glycoproteins more similar, if not substantially identical, to their human counterparts.The lower eukaryotes, which ordinarily produce high-mannose containing N glycans, including unicellular and multicellular fungi such as Pichia pasto~is, Hanse~ula polymo~pha, Pichia stiptis, Pichia methaholica, Pichia sp., Kluyveromyces sp., Caudida albicahs, Aspe~gillus nidulavcs, and T~ichode~ma ~eseei, are modified to produce N glycans such as Man5GlcNAc2 or other structures along human glycosylation pathways. This is achieved using a combination of engineering and/or selection of strains which: do not express certain enzymes which create the undesirable complex structures characteristic of the fungal glycoproteins, which express exogenous enzymes selected either to have optimal activity under the conditions present in the fungi where activity is desired, or which are targeted to an organelle where optimal activity is achieved, and combinations thereof wherein the genetically engineered eukaryote expresses multiple exogenous enzymes required to produce "human-like" glycoproteins.
In a first embodiment, the microorganism is engineered to express an exogenous o~ 1,2-mannosidase enzyme having an optimal pH between 5.1 and 8.0, preferably between 5.9 and 7.5. In an alternative preferred embodiment, the exogenous enzyme is targeted to the endoplasmic reticulum or Golgi apparatus of the host organism, where it trims N glycans such as Man8GlcNAc2 to yield Man5GlcNAc2. The latter structure is useful because it is identical to a structure formed in mammals, especially humans; it is a substrate for further glycosylation reactions in vivo and/or in vitro that produce a finished N glycan that is similar or identical to that formed in mammals, especially humans; and it is not a substrate for hypermannosylation reactions that occur i~ vivo in yeast and other microorganisms and that render a glycoprotein highly immunogenic in animals.
In a second embodiment, the glycosylation pathway of an eukaryotic microorganism is modified by (a) constructing a DNA library including at least two genes encoding exogenous glycosylation enzymes; (b) transforming the microorganism with the library to produce a genetically mixed population expressing at least two distinct exogenous glycosylation enzymes; (c) selecting from the population a microorganism having the desired glycosylation phenotype. In a preferred embodiment, the DNA
library includes chimeric genes each encoding a protein localization sequence and a catalytic activity related to glycosylation. Organisms modified using the method are useful for producing glycoproteins having a glycosylation pattern similar or identical to mammals, especially humans.
In a third embodiment, the glycosylation pathway is modified to express a sugar nucleotide transporter enzyme. In a preferred embodiment, a nucleotide diphosphatase enzyme is also expressed. The transporter and diphosphatase improve the efficiency of engineered glycosylation steps, by providing the appropriate substrates for the glycosylation enzymes in the appropriate compartments, reducing competitive product inhibition, and promoting the removal of nucleoside diphosphates.
DESCRIPTION OF THE FIGTJRES
Figure 1A is a schematic diagram of typical fungal N glycosylation pathway.
Figure 1B is a schematic diagram of a typical human N glycosylation pathway.
DETAILED DESCRIPTION OF THE INVENTION
The methods and recombinant lower eukaryotic strains described herein are used to make "humanized glycoproteins". The recombinant lower eukaryotes are made by engineering lower eukaryotes which do not express one or more enzymes involved in production of high mannose structures to express the enzymes required to produce human-like sugaxs. As used herein, a lower eukaryote is a unicellular or filamentous fungus. As used herein, a "humanized glycoprotein" refers to a protein having attached thereto N-glycans including less than four mannose residues, and the synthetic intermediates (which are also useful and can be manipulated further i~c vitro) having at least five mannose residues. In a preferred embodiment, the glycoproteins produced in the recombinant lower eukaryotic strains contain at least 27 mole % of the Mans intermediate. This is achieved by cloning in a better mannosidase, i.e., an enzyme selected to have optimal activity under the conditions present in the organisms at the site where proteins are glycosylated, or by targeting the enzyme to the organelle where activity is desired.
In a preferred embodiment, eukaryotic strains which do not express one or more enzymes involved in the production of high mannose structures are used. These strains can be engineered or one of the many such mutants already described in yeasts, including a hypermannosylation-minus (OCH1) mutant in Pichia pasto~is.
The strains can be engineered one enzyme at a time, or a library of genes encoding potentially useful enzymes can be created, and those strains having enzymes with optimal activities or producing the most "human-like"
glycoproteins, selected.
Lower eukaryotes that are able to produce glycoproteins having the attached N glycan Man5GlcNAc2 are particularly useful since (a) lacking a high degree of mannosylation (e.g. greater than 8 mannoses per N glycan, or especially 30-40 mannoses), they show reduced immunogenicity in humans;
and (b) the N glycan is a substrate for further glycosylation reactions to form an even more human-like glycoform, e.g. by the action of GIcNAc transferase I to form GIcNAcMan5GlcNAc2. Man5GlcNAc2 must be formed in vivo in a high yield, at least transiently, since all subsequent glycosylation reactions require Man5GlcNAc2 or a derivative thereof. Accordingly, a yield is obtained of greater than 27 mole %, more preferably a yield of 50-100 mole %, glycoproteins in which a high proportion of N glycans have Man5GlcNAca. It is then possible to perform further glycosylation reactions i~c vitro, using for example the method of U.S. Patent No. 5,834,251 to Maras and Contreras. In a preferred embodiment, at least one further glycosylation reaction is performed in vivo. In a highly preferred embodiment thereof, active forms of glycosylating enzymes are expressed in the endoplasmic reticulum and/or Golgi apparatus.
Host Microorganisms Yeast and filamentous fungi have both been successfully used for the production of recombinant proteins, both intracellular and secreted (Cereghino, J. L. and J. M. Cregg 2000 FEMSMic~obiology Reviews 24(1):
45-66; Harkki, A., et al. 1989 Bio-Technology 7(6): 596; Berka, R. M., et al.
1992 Abstr°.Pape~s Amer. Chem.Soc.203: 121-BIOT; Svetina, M., et al.
J.Biotechnol. 76(2-3): 245-251.
Although glycosylation in yeast and fungi is very different than in humans, some common elements are shared. The first step, the transfer of the core oligosaccharide structure to the nascent protein, is highly conserved in all eukaryotes including yeast, fungi, plants and humans (compare Figures 1A and 1B). Subsequent processing of the core oligosaccharide, however, differs significantly in yeast and involves the addition of several mannose sugars. This step is catalyzed by mannosyltransferases residing in the Golgi (e.g. OCH1, MNT1, MNN1, etc.), which sequentially add mannose sugars to the core oligosaccharide. The resulting structure is undesirable for the production of humanoid proteins and it is thus desirable to reduce or eliminate mannosyl transferase activity. Mutants of S. cerevisiae, deficient in mannosyl transferase activity (e.g. ochl or mnn9 mutants) have shown to be non-lethal and display a reduced mannose content in the oligosacharide of yeast glycoproteins. Other oligosacharide processing enzymes, such as mannosylphophate transferase may also have to be eliminated depending on the host's particular endogenous glycosylation pattern. After reducing undesired endogenous glycosylation reactions the formation of complex N-glycans has to be engineered into the host system. This requires the stable expression of several enzymes and sugar-nucleotide transporters. Moreover, one has to locate these enzymes in a fashion such that a sequential processing of the maturing glycosylation structure is ensured.
Targ-et Glycoproteins The methods described herein are useful for producing glycoproteins, especially glycoproteins used therapeutically in humans. Such therapeutic proteins are typically administered by injection, orally, pulmonary, or other means.
Examples of suitable target glycoproteins include, without limitation:
erythropoietin, cytokines such as interferon-a, interferon-(3, interferon-y, interferon-w, and granulocyte-CSF, coagulation factors such as factor VIII, factor IX, and human protein C, soluble IgE receptor a-chain, IgG, IgM, urokinase, chymase, and urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, azmexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1, amd osteoprotegerin.
Method for Producing Glycoproteins Co ~risina the N-:glycan ManSGlc The first step involves the selection or creation of a lower eukaryote that is able to produce a specific precursor structure of Man5GlcNAc2, which is able to accept in vivo GIcNAc by the action of a GIcNAc transferase I.
This step requires the formation of a particular isomeric structure of Man5GlcNAc2 . This structure has to be formed within the cell at a high yield (in excess of 30%) since all subsequent manipulations are contingent on the presence of this precursor. Man5GlcNAc2 structures are necessary for complex N-glycan formation, however, their presence is by no means sufficient, since Man5GlcNAca may occur in different isomeric forms, wluch may or may not serve as a substrate for GIcNAc transferase I. Most glycosylation reactions are not complete and thus a particular protein generally contains a range of different carbohydrate structures (i.e.
glycoforms) on its surface. The mere presence of trace amounts (less than 5%) of a particular structure like Man5GlcNAc2 is of little practical relevance. It is the formation of a particular, GIcNAc transferase I accepting intermediate (Structure I) in high yield (above 30%), which is required. The formation of this intermediate is necessary and subsequently allows for the ivy vivo synthesis of complex N-glycans.
One can select such lower eukaryotes from nature or alternatively genetically engineer existing fungi or other lower eukaryotes to provide the structure in vivo. No lower eukaryote has been shown to provide such structures in vivo in excess of 1.8% of the total N-glycans (Maras et al., 1997), so a genetically engineered organism is preferred. Methods such as those described in U.S. Patent No. 5,595,900, may be used to identify the absence or presence of particular glycosyltransferases, mannosidases and sugar nucleotide transporters in a target organism of interest.
Inactivation of Fun ag 1 Glycosylation Enzymes such as 1,2- a-mannosidase The method described herein may be used to engineer the glycosylation pattern of a wide range of lower eukaryotes (e.g. Hausenula polymo~pha, Pichia stiptis, Pichia methaholica, Pichia sp, Kluyve~omyces sp, Cahdida albicans, Aspe~gillus nidulans, Trichode~ma reseei etc.). Pichia pastoris is used to exemplify the required manipulation steps. Similar to other lower eukaryotes, P.pasto~is processes Man9GlcNAc2 structures in the ER with a 1,2- oc- mannosidase to yield Man8GlcNAc2. Through the action of several mannosyltransferases, this structure is then converted to hypermannosylated structures (Man,9GlcNAc2), also known as mannans. In addition, it has been found that P. pastoris is able to add non-terminal phosphate groups, through the action of mannosylphosphate transferases to the carbohydrate structure. This is contrary to the reactions found in mammalian cells, which involve the removal of mannose sugars as opposed to their addition. It is of particular importance to eliminate the ability of the fungus to hypermannosylate the existing Man8GlcNAc2 structure. This can be achieved by either selecting for a fungus that does not hypermannosylate, or by genetically engineering such a fungus.
Genes that are involved in this process have been identified in Pichia pasto~is and by creating mutations in these genes one is able to reduce the production of "undesirable" glycoforms. Such genes can be identified by homology to existing mannosyltransferases (e.g. OCHl, MNN4, MNN6, MNN1), found in other lower eukaryotes such as C. albicahs, Pichia angusta or S ce~evisiae or by mutagenizing the host strain and selecting for a phenotype with reduced mannosylation. Based on homologies amongst known mannosyltransferases and mannosylphosphate transferases, one may either design PCR primers, examples of which are shown in Table 2, or use genes or gene fragments encoding such enzymes as probes to identify homologues in DNA libraries of the target orgausm. Alternatively, one may be able to complement particular phenotypes in related organisms. For example, in order to obtain the gene or genes encoding 1,6-mannosyltransferase activity in P. pasto~is, one would carry out the following steps. OCH1 mutants of S. cerevisiae are temperature sensitive and are slow growers at elevated temperatures. One can thus identify functional homologues of OCH1 in P.pasto~is by complementing an OCH1 mutant of S. ce~evisiae with a P.pasto~is DNA or cDNA library. Such mutants of S.ce~evisiae may be found at http://genome-www.stanford.edu/Saccharomyces/ and are commercially available at http://www.resgen.com/products/YEASTD.php3. Mutants that display a normal growth phenotype at elevated temperature, after having been transformed with a P.pastoris DNA library, are likely to carry an OCH1 homologue of P.pastoris. Such a library can be created by partially digesting chromosomal DNA of P.pastoris with a suitable restriction enzyme and after inactivating the restriction enzyme ligating the digested DNA into a suitable vector, which has been digested with a compatible restriction enzyme.
Suitable vectors are pRS314, a low copy (CEN6/ARS4) plasmid based on pBluescript containing the Trpl marker (Sikorski, R. S., and Hieter, P.,1989, Genetics 122, pg 19-27) or pFL44S, a high copy (2~,) plasmid based on a modified pUCl9 containing the URA3 marker (Bonneaud, N., et al., 1991, Yeast 7, pg. 609-615). Such vectors are commonly used by academic researchers or similar vectors are available from a number of different vendors such as Invitrogen (Carlsbad, CA), Pharmacia (Piscataway, NJ), New England Biolabs (Beverly, MA). Examples are pYES/GS, 2p, origin of replication based yeast expression plasmid from Invitrogen, or Yep24 cloning vehicle from New England Biolabs. After ligation of the chromosomal DNA and the vector one may transform the DNA library into strain of S. ce~evisiae with a specific mutation and select for the correction of the corresponding phenotype. After sub-cloning and sequencing the DNA
fragment that is able to restore the wild-type phenotype, one may use this fragment to eliminate the activity of the gene product encoded by OCH1 in P. pastoris.
Alternatively, if the entire genomic sequence of a particular fungus of interest is known, one may identify such genes simply by searching publicly available DNA databases, which are available from several sources such as NCBI, Swissprot etc. For exaanple by searching a given genomic sequence or data base with a known 1,6 mannosyltransferase gene (OCH1) from S.
cerevisiae, one can able to identify genes of high homology in such a genome, which a high degree of certainty encodes a gene that has 1,6 mannosyltransferase activity. Homologues to several known mannosyltransferases from S.cer~evisiae in P.pastor~is have been identified using either one of these approaches. These genes have similar functions to genes involved in the mannosylation of proteins in S cerevisiae and thus their deletion may be used to manipulate the glycosylation pattern in P.pasto~is or any other fungus with similar glycosylation pathways.
The creation of gene knock-outs; once a given target gene sequence has been determined, is a well-established technique in the yeast and fungal molecular biology community, and can be carried out by anyone of ordinary skill in the art (R. Rothsteins, (1991) Methods in Enzymology, vol. 194, p.
281). In fact, the choice of a host organism may be influenced by the availability of good transformation and gene disruption techniques for such a host. If several mannosyltransferases have to be knocked out, the method developed by Alani and Kleckner allows for the repeated use of the URA3 markers to sequentially eliminate all undesirable endogenous mannosyltransferase activity. This technique has been refined by others but basically involves the use of two repeated DNA sequences, flanking a counter selectable marker. For example: URA3 may be used as a marker to ensure the selection of a transformants that have integrated a construct. By flanking the URA3 marker with direct repeats one may first select for transformants that have integrated the construct and have thus disrupted the target gene. After isolation of the transformants, and their characterization, one may counter select in a second round for those that are resistant to 5'FOA. Colonies that able to survive on plates containing 5'FOA have lost the URA3 marker again through a crossover event involving the repeats mentioned earlier. This approach thus allows for the repeated use of the same marker and facilitates the disruption of multiple genes without requiring additional markers.
Eliminating specific mannosyltransferases, such as 1,6 mannosyltransferase (OCHl), mannosylphosphate transferases (MNN4, MNN6, or genes complementing lbd mutants) in P. pastoris, allows for the creation of engineered strains of this organism which synthesize primarily MangGlcNAc2 and thus can be used to further modify the glycosylation pattern to more closely resemble more complex human glycoform structures.
A preferred embodiment of this method utilizes known DNA sequences, encoding known biochemical glycosylation activities to eliminate similar or identical biochemical functions in P. pasto~is, such that the glycosylation structure of the resulting genetically altered P. pasto~is strain is modified.
Table 2.
PCR primer PCR primer Ta:~et Genes). Homologues A B in P.
astoris ATGGCGAAGGCAGATTAGTCCTTCCAAC1,6- OCHl TGGCAGT TTCCTTC mannosyltransferaseS.cerevisiae, Pichia albicans TAYTGGMGNGTNGAGCRTCNCCCCANCK1,2 KTR/KRE family, RCYNGAYATHAA YTCRTA mannosyltransferaseS.cerevisiae s Legena.: M = A or C, R = A or G, W = A or T, S = C or G, Y = C or T, K = G or T, V = A or C or G, H = A or C or T, D =
$ A or G or T, B = C or G or T, N = G or A or T or C.
Incorporation of a Mannosidase into the Genetically E~ineered Host The process described herein enables one to obtain such a structure in high yield for the purpose of modifying it to yield complex N-glycans. A
successful scheme to obtain suitable Man5GlcNAc2 structures must involve two parallel approaches: (1) reducing endogenous mannosyltransferase activity and (2) removing 1,2- a,- mannose by mannosidases to yield high levels of suitable Man5GlcNAca structures. What distinguishes this method from the prior art is that it deals directly with those two issues. As the work of Chiba and coworkers demonstrates, one can reduce Man8GlcNAc2 structures to a Man5GlcNAc2 isomer in S. cer~evisiae, by engineering the presence of a fungal mannosidase from A. saitoi into the ER. The shortcomings of their approach are twofold: (1) insufficient amounts of Man5GlcNAc2 are formed in the extra-cellular glycoprotein fraction (10%) and (2) it is not clear that the ih vivo formed Man5GlcNAc2 structure in fact is able to accept GIcNAc by action of GIcNAc transferase I. If several glycosylation sites are present in a desired protein the probability (P) of obtaining such a protein in a correct form follows the relationship P=(F)°, where n equals the number of glycosylation sites, and F equals the fraction of desired glycoforms. A glycoprotein with three glycosylation sites would have a 0.1 % chance of providing the appropriate precursors for complex and hybrid N-glycan processing on all of its glycosylation sites, which limits the commercial value of such an approach.
Most enzymes that are active in the ER and Golgi apparatus of S. cerevisiae have pH optima that are between 6.5 and 7.5 (see Table 3). All previous approaches to reduce mannosylation by the action of recombinant mannosidases have concentrated on enzymes that have a pH optimum aromid pH 5.0 (Martinet et al., 1998, and Chiba et al., 1998), even though the activity of these enzymes is reduced to less than 10% at pH 7.0 and thus most likely provide insufficient activity at their point of use, the ER and early Golgi of P.pastoris and S. cerevisiae. A preferred process utilizes an a,-mannosidase ih vivo, where the pH optimum of the mannosidase is within 1.4 pH units of the average pH optimum of other representative marker enzymes localized in the same organelle(s). The pH optimum of the enzyme to be targeted to a specific organelle should be matched with the pH
optimum of other enzymes found in the same organelle, such that the maximum activity per unit enzyme is obtained. Table 3 summarizes the activity of mannosidases from various sources and their respective pH
optima. Table 4 summarizes their location.
Table 3. Mannosidases and their pH optimum.
Source Enzyme pH Reference optimum Aspe~gillus saitoi 1,2- a- mannosidase 5.0 Ichishima et al., 1999 Biochem. J. 339(Pt 3):589-597 Trichode~ma reesei 1,2- a- mannosidase 5.0 Maras et al., 2000 J.
Biotechnol. 77(2-3):255-263 Pev~icillium citrinum 1,2-a-D-mannosidase 5.0 Yoshida et al., 1993 Biochem. J. 290(Pt 2):349-354 Aspergillus nidula~cs 1,2- a- mannosidase 6.0 Eades and Hintz, Homo Sapiens 1,2- a- mannosidase 6.0 IA(Golgi) Homo sapiehs 1,2- a- mannosidase6.0 IB
(Golgi) Lepidopte~au Type I 1,2-a-Man6-6.0 Ren et al., 1995 insect cells mannosidase Biochem.
34(8):2489-2495 Homo sapieus a- D-mannosidase 6.0 Chandrasekaran et al., 1984 Cancer Res.
44(9):4059-68 Xanthomonas 1,2,3- a- mannosidase 6.0 mauihotis Mouse IB (Golgi)1,2- a- mannosidase 6.5 Schneikert and Herscovics, 1994 Glycobiology. 4(4):445-Bacillus Sp. 1,2-a-D-mannosidase 7.0 Maruyama et al., (secreted) 1994 Carbohydrate Res. 251:89-98 When one attempts to trim high mannose structures to yield Man5GlcNAc2 in the ER or the Golgi apparatus of S. cerevisiae, one may choose any enzyme or combination of enzymes that (1) has/have a sufficiently close pH optimum (i.e. between pH 5.2 and pH 7.8), and (2) is/are known to generate, alone or in concert, the specific isomeric ManSGIcNAca structure required to accept subsequent addition of GIcNAc by GnT I. Any enzyme or combination of enzymes that has/have shown to generate a structure that can be converted to GIcNAcMan5GlcNAc2 by GnT I
i~ vitro would constitute an appropriate choice. This knowledge may be obtained from the scientific literature or experimentally by determining that a potential mannosidase can convert Man8GlcNAc2-PA to Man5GlcNAc2-PA
and then testing, if the obtained Man5GlcNAc2-PA structure can serve a substrate for GnT I and UDP-GIcNAc to give GIcNAcMan5GlcNAc2 in vitro.
For example, mannosidase IA from a human or marine source would be an appropriate choice.
l, 2-Mav~~cosidase Activity in the ER ahd Golgi Previous approaches to reduce mannosylation by the action of cloned exogenous mannosidases have failed to yield glycoproteins having a sufficient fraction (e.g. >27 mole %) of N glycans having the structure Man5GlcNAc2 (Martinet et al., 1998, and Chiba et al., 1998). These enzymes should function efficiently in ER or Golgi apparatus to be effective in converting nascent glycoproteins. Whereas the two mannosidases utilized in the prior art (from A. saitoi and T. reesei) have pH optima of 5.0, most enzymes that are active in the ER and Golgi apparatus of yeast (e.g. S
cerevisiae) have pH optima that are between 6.5 and 7.5 (see Table 3). Since the glycosylation of proteins is a highly evolved and efficient process, it can be concluded that the internal pH of the ER and the Golgi is also in the range of about 6-8. At pH 7.0, the activity of the mannosidases used in the prior art is reduced to less than 10%, which is insufficient for the efficient production of Man5GlcNAc2 in vivo.
Table 4. Cellular location and pH optima of various glycosylation-related enzymes of S. ce~evisiae.
Gene Activity Location pH Authors) optimum Ktrl a,- 1,2 Golgi 7.0 Romero et al., 1997 mannosyltransferase Biochem. J. 321 (Pt 2):289-295 Mnsl a,- 1,2- mannosidase ER 6.5 CWH41 glucosidase I ER 6.8 -- mannosyltransferase Golgi 7-8 Lehele and Tanner, 1974 Biochim.
Biophys. Acta 350(1):225-235 Kre2 a,- 1,2 Golgi 6.5-9.0 Romero et al., 1997 mannosyltransferase The a-1,2-mannosidase enzyme should have optimal activity at a pH
between 5.1 and 8Ø In a preferred embodiment, the enzyme has an optimal activity at a pH between 5.9 and 7.5. The optimal pH may be determined under in vitro assay conditions. Preferred mannosidases include those listed in Table 3 having appropriate pH optima, e.g. Aspev~gillus nidulahs, Homo Sapiens IA(Golgi), Homo Sapiens IB (Golgi), Lepidopterau insect cells (IPLB-SF21AE), Homo Sapiens, mouse IB (Golgi), andXahthomohas manihotis. In a preferred embodiment, a single cloned mannosidase gene is expressed in the host organism. However, in some cases it may be desirable to express several different mannosidase genes, or several copies of one particular gene, in order to achieve adequate production of Man5GlcNAc2.
In cases where multiple genes are used, the encoded mannosidases should all have pH optima within the preferred range of 5.1 to 8.0, or especially between 5.9 and 7.5. In an especially preferred embodiment mannosidase activity is targeted to the ER or cis Golgi, where the early reactions of glycosylation occur.
Formatio~e of complex N glycans A second step of the process involves the sequential addition of sugars to the nascent carbohydrate structure by engineering the expression of glucosyltransferases into the Golgi apparatus. This process first requires the functional expression of GnT I in the early or medial Golgi apparatus as well as ensuring the sufficient supply of UDP-GIcNAc.
Integration Sites Since the ultimate goal of this genetic engineering effort is a robust protein production strain that is able to perform well in an industrial fermentation process, the integration of multiple genes into the fungal chromosome involves careful planing. The engineered strain will most likely have to be transformed with a range of different genes, and these genes will have to be transformed in a stable fashion to ensure that the desired activity is maintained throughout the fermentation process. Any combination of the following enzyme activities will have to be engineered into the fungal protein expression host: sialyltransferases, mannosidases, fucosyltransferases, galactosyltransferases, glucosyltransferases, GIcNAc transferases, ER and Golgi specific transporters (e.g. sym and antiport transporters for UDP-galactose and other precursors), other enzymes involved in the processing of oligosaccharides, and enzymes involved in the synthesis of activated oligosaccharide precursors such as UDP-galactose, CMP-N-acetylneuraminic acid. At the same time a number of genes which encode enzymes known to be characteristic of non-human glycosylation reactions, will have to be deleted.
Targeting of glycosyltransferases to specific organelles:
Glycosyltransferases and mannosidases line the inner (luminal) surface of the ER and Golgi apparatus and thereby provide a "catalytic"
surface that allows for the sequential processing of glycoproteins as they proceed through the ER and Golgi network. In fact the multiple compartments of the cis, medial, and trans Golgi and the trans-Golgi Network (TGN), provide the different localities in which the ordered sequence of glycosylation reactions can take place. As a glycoprotein proceeds from synthesis in the ER to full maturation in the late Golgi or TGN, it is sequentially exposed to different glycosidases, mannosidases and glycosyltransferases such that a specific carbohydrate structure may be synthesized. Much work has been dedicated to revealing the exact mechanism by which these enzymes are retained and anchored to their respective organelle. The evolving picture is complex but evidence suggests that stem region, membrane spanning region and cytoplasmic tail individually or in concert direct enzymes to the membrane of individual organelles and thereby localize the associated catalytic domain to that locus.
Targeting sequences are well known and described in the scientific literature and public databases, as discussed in more detail below with respect to libraries for selection of targeting sequences and targeted enzymes.
Method for Producing a Library to Produce Modified Glycosylation Pathwavs A library including at least two genes encoding exogeneous glycosylation enzymes is transformed into the host organism, producing a genetically mixed population. Transformants having the desired glycosylation phenotypes are then selected from the mixed population. In a preferred embodiment, the host organism is a yeast, especially P. pasto~is, and the host glycosylation pathway is modified by the operative expression of one or more human or animal glycosylation enzymes, yielding protein N
glycans similar or identical to human glycoforms. In an especially preferred embodiment, the DNA library includes genetic constructs encoding fusions of glycosylation enzymes with targeting sequences for various cellular loci involved in glycosylation especially the ER, cis Golgi, medial Golgi, or trans Golgi.
Examples of modifications to glycosylation which can be effected using method are: (1) engineering an eukaryotic microorganism to trim mannose residues from Man8GlcNAc2 to yield Man5GlcNAc2 as a protein N
glycan; (2) engineering an eukaryotic microorganism to add an N acetylglucosamine (GIcNAc) residue to Man5GlcNAc2 by action of GIcNAc transferase I; (3) engineering an eukaryotic microorganism to functionally express an enzyme such as an N acetylglucosamine transferase (GnT I, GnT II, GnT III, GnT IV, GnT V, GnT VI), mannosidase II, fucosyltransferase, galactosyl tranferase (GaIT) or sialyltransferases (ST).
By repeating the method, increasingly complex glycosylation pathways can be engineered into the target microorganism. In one preferred embodiment, the host organism is transformed two or more times with DNA
libraries including sequences encoding glycosylation activities. Selection of desired phenotypes may be performed after each round of transformation or alternatively after several transformations have occurred. Complex glycosylation pathways can be rapidly engineered in this manner.
DNA Libraries It is necessary to assemble a DNA library including at least two exogenous genes encoding glycosylation enzymes. In addition to the open reading frame sequences, it is generally preferable to provide each library construct with such promoters, transcription terminators, enhancers, ribosome binding sites, and other functional sequences as may be necessary to ensure effective transcription and translation of the genes upon transformation into the host organism. Where the host is Pichia pasto~is, suitable promoters include, for example, the AOXl, AOX~, DAS, and P40 promoters. It is also preferable to provide each construct with at least one selectable marker, such as a gene to impart drug resistance or to complement a host metabolic lesion. The presence of the marker is useful in the subsequent selection of transformants; for example, in yeast the URA3, HIS4, SUC2, 6418, BLA, or SHBLE genes may be used.
In some cases the library may be assembled directly from existing or wild-type genes. In a preferred embodiment however the DNA library is assembled from the fusion of two or more sub-libraries. By the in-frame ligation of the sub-libraries, it is possible to create a large number of novel genetic constructs encoding useful targeted glycosylation activities. For example, one useful sub-library includes DNA sequences encoding any combination of enzymes such as sialyltransferases, mannosidases, fucosyltransferases, galactosyltransferases, glucosyltransferases, and GIcNAc transferases. .Preferably, the enzymes are of human origin, although other mammalian, animal, or fungal enzymes are also useful. In a preferred embodiment, genes are truncated to give fragments encoding the catalytic domains of the enzymes. By removing endogenous targeting sequences, the enzymes may then be redirected and expressed in other cellular loci. The choice of such catalytic domains may be guided by the knowledge of the particular environment in which the catalytic domain is subsequently to be active. For example, if a particular glycosylation enzyme is to be active in the late Golgi, and all known enzymes of the host organism in the late Golgi have a certain pH optimum, then a catalytic domain is chosen which exhibits adequate activity at that pH.
Another useful sub-library includes DNA sequences encoding signal peptides that result in localization of a protein to a particular location within the ER, Golgi, or trans Golgi network. These signal sequences may be selected from the host organism as well as from other related or unrelated organisms. Membrane-bound proteins of the ER or Golgi typically may include, for example, N-terminal sequences encoding a cytosolic tail (ct), a transmembrane domain (tmd), and a stem region (sr). The ct, tmd, and sr sequences are sufficient individually or in combination to anchor proteins to the inner (lumenal) membrane of the organelle. Accordingly, a preferred embodiment of the sub-library of signal sequences includes ct, tmd, and/or sr sequences from these proteins. In some cases it is desirable to provide the sub-library with varying lengths of sr sequence. This may be accomplished by PCR using primers that bind to the 5' end of the DNA encoding the cytosolic region and employing a series of opposing primers that bind to various parts of the stem region. Still other useful sources of signal sequences include retrieval signal peptides, e.g. the tetrapeptides HDEL or KDEL, which are typically found at the C-terminus of proteins that are transported retrograde into the ER or Golgi. Still other sources of signal sequences include (a) type II membrane proteins, (b) the enzymes listed in Table 3, (c) membrane spanning nucleotide sugar transporters that are localized in the Golgi, and (d) sequences referenced in Table 5.
Table 5. Sources of useful compartmental targeting sequences Gene or Sequence Organism Function Location of Gene Product 111nsI S a-1,2-mannosidaseER
cerevisiae OCHI S. 1,6- Golgi (cis) cerevisiae mannosyltransferase MNN2 S. 1,2- Golgi (medial) ce~evisiae mannosyltransferase MNNI S. 1,3- Golgi (trans) cerevisiae mannosyltransferase OCHI P. pastoris1,6- Golgi (cis) mannosyltransferase 2,6 ST H. Sapiens 2,6-sialyltransferasetrans Golgi network UDP-Gal T S. pombe UDP-Gal transporterGolgi Mntl S. 1,2- Golgi (cis) cerevisiae mannosyltransferase HDEL at C- S. retrieval signalER
terminus cerevisiae In any case, it is highly preferred that signal sequences are selected which are appropriate for the enzymatic activity or activities which are to be engineered into the host. For example, in developing a modified microorganism capable of terminal sialylation of nascent N glycans, a process which occurs in the late Golgi in humans, it is desirable to utilize a sub-library of signal sequences derived from late Golgi proteins. Similarly, the trimming of Man8GlcNAca by an a-1,2-mannosidase to give Man5GlcNAc2 is an early step in complex N glycan formation in humans. It is therefore desirable to have this reaction occur in the ER or early Golgi of an engineered host microorganism. A sub-library encoding ER and early Golgi retention signals is used.
In a preferred embodiment, a DNA library is then constructed by the in-frame ligation of a sub-library including DNA encoding signal sequences with a sub-library including DNA encoding glycosylation enzymes or catalytically active fragments thereof. The resulting library includes synthetic genes encoding fusion proteins. In some cases it is desirable to provide a signal sequence at the N-terminus of a fusion protein, or in other cases at the C-terminus. In some cases signal sequences may be inserted within the open reading frame of an enzyme, provided the protein structure of individual folded domains is not disrupted.
The method is most effective when a DNA library transformed into the host contains a large diversity of sequences, thereby increasing the probability that at least one transformant will exhibit the desired phenotype.
Accordingly, prior to transformation, a DNA library or a constituent sub-library may be subjected to one or more rounds of gene shuffling, error prone PCR, or in vitro mutagenesis.
Transformation The DNA library is then transformed into the host organism. In yeast, any convenient method of DNA transfer may be used, such as electroporation, the lithium chloride method, or the spheroplast method. To produce a stable strain suitable for high-density fermentation, it is desirable to integrate the DNA library constructs into the host chromosome. In a preferred embodiment, integration occurs via homologous recombination, using techniques known in the art. For example, DNA library elements are provided with flanking sequences homologous to sequences of the host organism. In this manner integration occurs at a defined site in the host genome, without disruption of desirable or essential genes. In an especially preferred embodiment, library DNA is integrated into the site of an undesired gene in a host chromosome, effecting the disruption or deletion of the gene.
For example, integration into the sites of the OCHl, MNNl, or M1VN4 genes allows the expression of the desired library DNA while preventing the expression of enzymes involved in yeast hypermannosylation of glycoproteins. In other embodiments, library DNA may be introduced into the host via a chromosome, plasmid, retroviral vector, or random integration into the host genome. In any case, it is generally desirable to include with each library DNA construct at least one selectable marker gene to allow ready selection of host organisms that have been stably transformed.
Recyclable marker genes such as u~a3, which can be selected for or against, are especially suitable.
Selection Process After transformation of the host strain with the DNA library, transformants displaying the desired glycosylation phenotype are selected.
Selection may be performed in a single step or by a series of phenotypic enrichment and/or depletion steps using any of a variety of assays or detection methods. Phenotypic characterization may be carried out manually or using automated high-throughput screening equipment. Commonly a host microorganism displays protein N glycans on the cell surface, where various glycoproteins are localized. Accordingly intact cells may be screened for a desired glycosylation phenotype by exposing the cells to a lectin or antibody that binds specifically to the desired N glycan. A wide variety of oligosaccharide-specific lectins are available commercially (EY
Laboratories, San Mateo, CA). Alternatively, antibodies to specific human or animal N glycans are available commercially or may be produced using standaxd techniques. An appropriate lectin or antibody may be conjugated to a reporter molecule, such as a chromophore, fluorophore, radioisotope, or an enzyme having a chromogenic substrate (Guillen et al., 1998. P~oc.
Natl.Acad. Sci. USA 95(14): 7888-7892). Screening may then be performed using analytical methods such as spectrophotometry, fluorimetry, fluorescence activated cell sorting, or scintillation counting. In other cases, it may be necessary to analyze isolated glycoproteins or N glycans from transformed cells. Protein isolation may be carried out by techniques known in the art. In cases where an isolated N glycan is required, an enzyme such as endo-(3-N acetylglucosaminidase (Genzyme Co., Boston, MA) may be used to cleave the N glycans from glycoproteins. Isolated proteins or N glycans may then be analyzed by liquid chromatography (e.g. HPLC), mass spectroscopy, or other suitable means. U.S. Patent No. 5,595,900 teaches several methods by which cells with desired extracellular carbohydrate structures may be identified. Prior to selection of a desired transformant, it may be desirable to deplete the transformed population of cells having undesired phenotypes. For example, when the method is used to engineer a functional mannosidase activity into cells, the desired transformants will have lower levels of mannose in cellular glycoprotein.
Exposing the transformed population to a lethal radioisotope of mannose in the medium depletes the population of transformants having the undesired phenotype, i.e. high levels of incorporated mannose. Alternatively, a cytotoxic lectin or antibody, directed against an undesirable N glycan, may be used to deplete a transformed population of undesired phenotypes.
Methods for Providing Sugar Nucleotide Precursors to the Gobi Apparatus For a glycosyltransferase to function satisfactorily in the Golgi, it is necessary for the enzyme to be provided with a sufficient concentration of an appropriate nucleotide sugar, which is the high-energy donor of the sugar moiety added to a nascent glycoprotein. These nucleotide sugars to the appropriate compartments are provided by expressing an exogenous gene encoding a sugar nucleotide transporter in the host microorganism. The choice of transporter enzyme is influenced by the nature of the exogenous glycosyltransferase being used. For example, a GIcNAc transferase may require a UDP-GIcNAc transporter, a fucosyltransferase may require a GDP-fucose transporter, a galactosyltransferase may require a UDP-galactose transporter, or a sialyltransferase may require a CMP-sialic acid transporter.
The added transporter protein conveys a nucleotide sugar from the cytosol into the Golgi apparatus, where the nucleotide sugar may be reacted by the glycosyltransferase, e.g. to elongate an N glycan. The reaction liberates a nucleoside diphosphate or monophosphate, e.g. UDP, GDP, or CMP. As accumulation of a nucleoside diphosphate inhibits the further activity of a glycosyltransferase, it is frequently also desirable to provide an expressed copy of a gene encoding a nucleotide diphosphatase. The diphosphatase (specific for UDP or GDP as appropriate) hydrolyzes the diphosphonucleoside to yield a nucleoside monosphosphate and inorganic phosphate. The nucleoside monophosphate does not inhibit the glycotransferase and in any case is exported from the Golgi by an endogenous cellular system. Suitable transporter enzymes, which are typically of mammalian origin, are described below.
Examples The use of the above general method may be understood by reference to the following non-limiting examples. Examples of preferred embodiments are also summarized in Table 6.
Example 1: Engineering of P. pastoris with a-1,2-Mannosidase to produce insulin.
An a-1,2-mannosidase is required for the trimming of Man8GlcNAc2 to yield ManSGIcNAc~,, an essential intermediate for complex N glycan formation. An OCHI mutant of P. pasto~is is engineered to express secreted human interferon-a under the control of an aox promoter. A DNA library is constructed by the in-frame ligation of the catalytic domain of human mannosidase IB (an a-1,2-mannosidase) with a sub-library including sequences encoding early Golgi localization peptides. The DNA library is then transformed into the host organism, resulting in a genetically mixed population wherein individual transformants each express interferon-(3 as well as a synthetic mannosidase gene from the library. Individual transformant colonies are cultured and the production of interferon is induced by addition of methanol. Under these conditions, over 90% of the secreted protein includes interferon-/3. Supernatants are purified to remove salts and low-molecular weight contaminants by C18 silica reversed-phase chromatography. Desired transformants expressing appropriately targeted, active a-1,2-mannosidase produce interferon-(3 including N glycans of the structure Man5GlcNAc2, which has a reduced molecular mass compared to the interferon of the parent strain. The purified supernatants including interferon-(3 are analyzed by MALDI-TOF mass spectroscopy and colonies expressing the desired form of interferon-(3 are identified.
Example 2: Engineering of Strain to express GIcNAc Transferase I
GIcNAc Transferase I activity is required for the maturation of complex N glycans. Man5GlcNAc2 may only be trimmed by mannosidase II, a necessary step in the formation of human glycoforms, after the addition of GIcNAc to the terminal a-1,3 mannose residue by GIcNAc Transferase I
(Schachter, 1991 Glycobiology 1(5):453-461). Accordingly a library is prepared including DNA fragments encoding suitably targeted GIcNAc Transferase I genes. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g. an OCHI mutant), provides the substrate UDP-GIcNAc in the Golgi and/or ER, and provides N glycans of the structure Man5GlcNAca in the Golgi and/or ER. After transformation of the host with the DNA library, the transformants are screened for those having the highest concentration of terminal GIcNAc on the cell surface, or alternatively secrete the protein having the highest terminal GIcNAc content.
Such a screen is performed using a visual method (e.g. a staining procedure), a specific terminal GIcNAc binding antibody, or a lectin. Alternatively the desired transformants exhibit reduced binding of certain lectins specific for terminal mannose residues.
Example 3: Engineering of Strains with a Mannosidase II
In another example, it is desirable in order to generate a human glycoform in a microorganism to remove the two remaining terminal mannoses from the structure GIcNAcMan5GlcNAc2 by action of a mannosidase II. A DNA library including sequences encoding cis and medial Golgi localization signals is fused in-frame to a library encoding mannosidase II catalytic domains. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g. an OCHI mutant) and provides N glycans having the structure GIcNAcMan5GlcNAca in the Golgi and/or ER. After transformation, organisms having the desired glycosylation phenotype are selected. An i~ vitro assay is used in one method. The desired structure GIcNAcMan3GlcNAc2 (but not the undesired GIcNAcMan5GlcNAc2) is a substrate for the enzyme GIcNAc Transferase II.
Accordingly, single colonies may be assayed using this enzyme in vitro in the presence of the substrate, UDP-GIcNAc. The release of UDP is determined either by HPLC or an enzymatic assay for UDP. Alternatively radioactively labeled UDP-GIcNAc is used.
The foregoing in vitro assays are conveniently performed on individual colonies using high-throughput screening equipment.
Alternatively a lectin binding assay is used. In this case the reduced binding of lectins specific for terminal mannoses allows the selection of transformants having the desired phenotype. For example, Galantus nivalis lectin binds specifically to terminal a-1,3-mannose, the concentration of which is reduced in the presence of operatively expressed mannosidase II
activity. In one suitable method, G. nivalis lectin attached to a solid agarose support (available from Sigma Chemical, St. Louis, MO) is used to deplete the transformed population of cells having high levels of terminal a-1,3-mannose.
Example 4: Engineering of organisms to express Sialyltransferase The enzymes a2,3-sialyltransferase and a2,6-sialyltransferase add terminal sialic acid to galactose residues in nascent human N glycans, leading to mature glycoproteins. In human the reactions occur in the trans Golgi or TGN. Accordingly a DNA library is constructed by the in-frame fusion of sequences encoding sialyltransferase catalytic domains with sequences encoding trans Golgi or TGN localization signals. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g.
an OCHI mutant), which provides N glycans having terminal galactose residues in the trans Golgi or TGN, and provides a sufficient concentration of CMP-sialic acid in the trans Golgi or TGN. Following transformation, transformants having the desired phenotype are selected using a fluorescent antibody specific for N glycans having a terminal sialic acid.
Example 5: Method of engineering strains to express UDP-GIcNAc Transporter The cDNA of human Golgi UDP-GIcNAc transporter has been cloned by Ishida and coworkers. (Isluda, N., et al. 1999 J. Biochem.126(1):
68-77. Guillen and coworkers have cloned the canine kidney Golgi UDP-GIcNAc transporter by phenotypic correction of a Kluyve~omyces lactis mutant deficient in Golgi UDP-GIcNAc transport. (Guillen, E., et al. 1998).
Thus a mammalian Golgi UDP-GIcNAc transporter gene has all of the necessary information for the protein to be expressed and targeted functionally to the Golgi apparatus of yeast.
Example 6: Method of engineering strains to express GDP-Fucose Transporter.
The rat liver Golgi membrane GDP-fucose transporter has been identified and purified by Puglielli, L. and C. B. Hirschberg 1999 J. Biol.
Chem. 274(50):35596-35600. The corresponding gene can be identified using standard techniques, such as N terminal sequencing and Southern blotting using a degenerate DNA probe. The intact gene can is then be expressed in a host microorganism that also expresses a fucosyltransferase.
Example 7: Method of engineering strains to express UDP-Galactose Transporter Human UDP-galactose (UDP-Gal) transporter has been cloned and shown to be active in S. cerevisiae. (Kainuma, M., et al. 1999 Glycobiology 9(2): 133-141). A second human UDP-galactose transporter (hUGTl) has been cloned and functionally expressed in Chinese Hamster Ovary Cells.
Aoki, K., et al. 1999 J.Biochem. 126(5): 940-950. Likewise Segawa and coworkers have cloned a UDP-galactose transporter from Schizosaccharomyces pombe (Segawa, H., et al. 1999 Febs Letters 451(3):
295-298).
CMP-Sialic Acid Transporter Human CMP-sialic acid transporter (hCST) has been cloned and expressed in Lec 8 CHO cells by Aoki and coworkers (1999). Molecular cloning of the hamster CMP-sialic acid transporter has also been achieved (Eckhardt and Gerardy Schahn 1997 Eur. J. Biochem. 248(1): 187-192). The functional expression of the marine CMP-sialic acid transporter was achieved in Saccharomyces cerevisiae by Berninsone, P., et al. 1997 J.
Biol. Chem.272(19):12616-12619.
Table6. Examples of preferred embodiments of the methods for modifying glycosylation in a eukaroytic microorganism, e.g. Pichia pastoris Desired Suitable Suitable Sources of Suitable Suitable Structure Catalytic Localization Gene Transporters Activities Sequences Deletions andlor Phosphatases Man5GlcNAca a-1,2- Mnsl (N-terminus, OCH1 none mannosidase S cerevisiae) MNN4 (marine, Ochl (N-terminus, MNN6 human, S. cerevisiae, Bacillus sp., P. pastoris) A. nidulans ) Ktrl Mnn9 Mntl (S. cerevisiae) KDEL, HDEL
(C-terminus) GIcNAcManSGlc GIcNAc Ochl (N-terminus, OCH1 UDP-GIcNAc NAc2 Transferase S cerevisiae, MNN4 transporter I, (human, P. pastoris) MNN6 (human, marine, rat KTRl (N-terminus) marine, etc.) KDEL, HDEL K. lactis) (C-terminus) UDPase Mnnl (N-terminus, (human) S cerevisiae) Mntl (N-terminus, S. cerevisiae) GDPase (N-terminus, S. cerevisiae) GlcNAcMan3Glc mannosidaseKtrl OCH1 UDP-GIcNAc NAc2 II Mnnl (N-terminus,MNN4 transporter S ce~evisiae) MNN6 (human, Mntl (N-terminus, marine, S cerevisiae) K. lactic) Kre2/Mntl UDPase (S ce~evisiae) (human) Kre2 (P. pasto~is) Ktrl (S cerevisiae) Ktrl (P. pasto~is) Mnnl (S ee~evisiae) GIcNAc~2_4~ GIcNAc Mnnl (N-terminus,OCH1 UDP-GIcNAc Man3GlcNAc2 TransferaseS. cerevisiae) MNN4 transporter II, III, Mntl (N-terminus,MNN6 (human, IV, V
(human, S. ce~evisiae) marine, marine) Kre2/Mntl K.lactis) (S. ce~evisiae) UDPase Kre2 (P. pasto~is) (human) Ktrl (S. cerevisiae) Ktr1 (P. pastoris) Nlim1 (S cerevisiae) Gal~l_4~Glc (3-1,4- Mnnl (N-terminus,OCH1 UDP-Galactos NAct2_4~- Galactosyl S ce~evisiae) MNN4 a transporter ~
Man3GlcNAca transferaseMntl(N-terminus,MNN6 (human, (human) S ce~evisiae) S pombe) Kre2/Mntl (S cerevisiae) Kre2 (P. pastoris) Ktrl (S cerevisiae) Ktrl (P. pastoris) Mnnl (S. cerevisiae) NANAtI_4>- oc-2,6- KTRl OCH1 CMP-Sialic Gal~l_4~GlcNAc~2_SialyltransferMNN1 (N-terminus,MNN4 acid a~- ace (human)S cerevisiae) MNN6 transporter Man3GlcNAc2 a,-2,3- MNT1 (N-terminus, (human) SialyltransferS cerevisiae) ace Kre2/Mntl (S ce~evisiae) Kre2 (P. pasto~is) Ktrl (S. ce~evisiae) Ktrl (P. pasto~is) (S. cerevisiae) Table 7: DNA and Protein Sequence Resources 1. European Bioinformatics Institute (EBI) is a centre for research and services in bioinformatics: httb://www.ebi.ac.ul~/
2. Swissprot database: http://www.expasy.ch/spr 3. List of known glycosyltransferases and their origin.
X31,2 (GnT Il EC 2.4.1.101 4. human cDNA, Kumar et al (1990) Proc. Natl. Acad. Sci. USA
87:9948-9952 5. human gene, Hull et al (1991) Biochem. Biophys. Res. Commun.
176:608-615 6. mouse cDNA, Kumar et al (1992) Glycobiology 2:383-393 7. mouse gene, Pownall et al (1992) Genomics 12:699-704 8. marine gene (5' flanking, non-coding), Yang et al (1994) Glycobiology 5:703-712 9. rabbit cDNA, Sarkar et al (1991) Proc. Natl. Acad. Sci. USA 88:234-10. rat cDNA, Fukada et al (1994) Biosci.Biotechnol.Biochem. 58:200-1 2 (GnT II) EC 2.4.1.143 11. human gene, Tan et al (1995) Eur. J. Biochem. 231:317-328 12. rat cDNA, D'Agostaro et al (1995) J. Biol. Chem. 270:15211-15221 13. [31,4 (GnT III) EC 2.4.1.144 14. human cDNA, Ihara et al (1993) J. Biochem.l 13:692-698 15. marine gene, Bhaumik et al (1995) Gene 164:295-300 16. rat cDNA, Nishikawa et al (1992) J. Biol. Chem. 267:18199-18204 ~ 1,4 (GnT IV SEC 2.4.1.145 17. human cDNA, Yoshida et al (1998) Glycoconjugate Journal 15:1115-18. bovine cDNA, Minowa et al., European Patent EP 0 905 232 ~ (31,6 (GnT V) EC 2.4.1.155 19. human cDNA, Saito et al (1994) Biochem. Biophys. Res. Commun.
198:318-327 20. rat cDNA, Shoreibah et al (1993) J. Biol. Chem. 268:15381-15385 i1,4 Galactosyltransferase, EC 2.4.1.90 (LacNAc synthetas~ EC
2.4.1.22 (lactose synthetase) 21. bovine cDNA, D'Agostaro et al (1989) Eur. J. Biochem. 183:211-217 22. bovine cDNA (partial), Narimatsu et al (1986) Proc. Natl. Acad. Sci.
USA 83:4720-4724 23. bovine cDNA (partial), Masibay & Qasba (1989) Proc. Natl. Acad.
Sci. USA 86:5733-5377 24. bovine cDNA (5' end), Russo et al (1990) J. Biol. Chem. 265:3324 25. chicken cDNA (partial), Ghosh et al (1992) Biochem. Biophys. Res.
Commun. 12 I 5-1222 26. human cDNA, Masri et al (1988) Biochem. Biophys. Res. Commun.
157:657-663 27. human cDNA, (HeLa cells) Watzele & Berger (1990) Nucl. Acids Res. 18:7174 28. human cDNA, (partial) Uejima et al (1992) Cancer Res. 52:6158-29. human cDNA, (carcinoma) Appert et al (1986) Biochem. Biophys.
Res. Commun. 139:163-168 30. human gene, Mengle-Gaw et al (1991) Biochem. Biophys. Res.
Commun. 176:1269-1276 31. marine cDNA, Nakazawa et al (1988) J. Biochem. 104:165-168 32. marine cDNA, Shaper et al (1988) J. Biol. Chem. 263:10420-10428 33. marine cDNA (novel), Uehara & Muramatsu unpublished 34. marine gene, Hollis et al (1989) Biochem. Biophys. Res. Commun.
162:1069-1075 35. rat protein (partial), Bendiak et al (1993) Eur. J. Biochem. 216:405-2,3-Sialyltransferase, (ST3Ga1 II) (N linked~(Gal-1,3/4-GIcNAc) EC
2.4.99.6 36. human cDNA, Kitagawa & Paulson (1993) Biochem. Biophys. Res.
Commun. 194:375-3 82 37. rat cDNA, Wen et al (1992) J. Biol. Chem. 267:21011-21019 2 6-Sialyltransferase, (ST6Ga1 I) EC 2.4.99.1 38. chicken, Kurosawa et al (1994) Eur. J. Biochem 219:375-381 39. human cDNA (partial), Lance et al (1989) Biochem. Biophys. Res.
Commun. 164:225- 232 40. human cDNA, Grundmann et al (1990) Nucl. Acids Res. 18:667 41. human cDNA, Zettlmeisl et al (1992) Patent EP0475354-A/3 42. human cDNA, Stamenkovic et al (1990) J. Exp. Med. 172:641-643 (CD75) 43. human cDNA, Bast et al (1992) J. Cell Biol. 116:423-435 44. human gene (partial), Wang et al (1993) J. Biol. Chem. 268:4355-45. human gene (5' flank), Aasheim et al (1993) Eur. J. Biochem.
213:467-475 46. human gene (promoter), Aas-Eng et al (1995) Biochim. Biophys.
Acta 1261:166-169 47. mouse cDNA, Hamamoto et al (1993) Bioorg. Med. Chem. 1:141-48. rat cDNA, Weinstein et al (1987) J. Biol. Chem. 262:17735-17743 49. rat cDNA (transcript fragments), Wang et al (1991),Glycobiology 1:25-31, Wang et al (1990) J. Biol. Chem. 265:17849-17853 50. rat cDNA (5' end), O'Hanlon et al (1989) J. Biol. Chem. 264:17389-17394; Wang et al (1991) Glycobiology 1:25-31 51. rat gene (promoter), Svensson et al (1990) J. Biol. Chem. 265:20863-52. rat mRNA (fragments), Wen et al (1992) J. Biol. Chem. 267:2512-Additional methods and reagents which can be used in the methods for modifying the glycosylation are described in the literature, such as IJ.S.
Patent No. 5,955,422, U.S. Patent No. 4,775,622, U.S. Patent No. 6,017,743, U.S. Patent No. 4,925,796, U.S. Patent No. 5,766,910, U.S. Patent No.
5,834,251, U.S. Patent No. 5,910,570, U.S. Patent No. 5,849,904, U.S.
Patent No. 5,955,347, U.S. Patent No. 5,962,294, U.S. Patent No. 5,135,854, U.S. Patent No. 4,935,349, U.S. Patent No. 5,707,828, and U.S. Patent No.
5,047,335.
Appropriate yeast expression systems can be obtained from sources such as the American Type Culture Collection, Rockville, MD. Vectors are commercially available from a variety of sources.
Claims (34)
1. A method for producing glycoproteins having carbohydrate structures similar to those produced by human cells in a lower eukaryote comprising providing a unicellular or multicellular fungal host, which does not express one or more enzymes involved in production of high mannose structures, and introducing into the host one or more enzymes for production of a carbohydrate structure selected from the group consisting of Man5GlcNAc2, Man8GlcNAc2 and Man9GlcNAc2, wherein the enzymes are selected to have optimal activity at the pH of the location in the host where the carbohydrate structure is produced or which are targeted to a subcellular location in the host where enzyme will have optimal activity to produce the carbohydrate structure.
2. The method of claim 1 wherein the host is deficient in the activity of one or more enzymes selected from the group consisting of mannosyltransferases and phosphomannosyltransferases.
3. The method of claim 2 wherein the host does not express an enzyme selected from the group consisting of 1,6 mannosyltransferase, 1,3 mannosyltransferase, and 1,2 mannosyltransferase.
4. The method of claim 1 wherein the host is selected from the group consisting of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Candida albicans, Aspergillus nidulans, and Trichoderma reesei.
5. The method of claim 2 wherein the host is an OCH1 mutant of P.pastoris.
6. The method of claim 1 comprising introducing into the host a nucleotide molecule encoding one or more mannosidases involved in the production of Man5GlcNAc2 from Man8GlcNAc2 or Man9GlcNAc2.
7. The method of claim 6 where the at least one mannosidase has a pH optimum within 1.4 pH units of the average pH optimum of other representative enzymes in the organelle in which the mannosidase is localized, or having optimal activity at a pH between 5.1 and 8Ø
8. The method of claim 7 wherein the mannosidase enzyme has optimal activity at a pH between 5.9 and 7.5.
9. The method of claim 8 wherein the mannosidase enzyme is an .alpha.-1,2-mannosidase derived from mouse, human, Lepidoptera, Aspergillus nidulans, or Bacillus sp.
10. The method of claim 1 comprising providing a host that is able to form Man5GlcNAc2 structures, displaying GnT I activity and having UDP-Gn transporter activity.
11. The method of claim 1 comprising providing a host which has a UDP specific diphosphatase activity.
12. The method of claim 1 comprising introducing into the host one or more enzymes selected from the group consisting of mannosidases, glycosyltransferases and glycosidases, wherein the enzymes are targeted to the endoplasmic reticulum, the early, medial, late Golgi or the trans Golgi network.
13. The method of claim 12 wherein the mannosidase enzyme is predominantly localized in the Golgi apparatus or the endoplasmic reticulum.
14. The method of claim 12 wherein the enzymes are localized by forming a fusion protein between a catalytic domain of the enzyme and a chimeric localization region encoded by at least one genetic construct formed by the in-frame ligation of a DNA fragment encoding a cellular targeting signal peptide with a DNA fragment encoding a glycosylation enzyme or catalytically active fragment thereof
15. The method of claim 14 comprising providing a chimeric localization region from an enzyme selected from the group of mannosyltransferases, diphosphotases, proteases, GnT I, GnT II, GnT III, GnT
IV, GnT V, GnT VI, GalT, FT, and ST.
IV, GnT V, GnT VI, GalT, FT, and ST.
16. The method of claim 14 providing a catalytic domain encoding a glycosidase or glycosyltransferase selected from the group consisting of GnT
I, GnT II, GnT III, GnT IV, GnT V, GnT VI, GaIT, Fucosyltransferase and ST, that has a pH optimum within 1.4 pH units of the average pH optimum of other representative enzymes in the organelle in which the enzyme is localized, or having optimal activity at a pH between 5.1 and 8Ø
I, GnT II, GnT III, GnT IV, GnT V, GnT VI, GaIT, Fucosyltransferase and ST, that has a pH optimum within 1.4 pH units of the average pH optimum of other representative enzymes in the organelle in which the enzyme is localized, or having optimal activity at a pH between 5.1 and 8Ø
17. The method of claim 1 comprising introducing into the host nucleotide molecules encoding one or more enzymes selected from the group of nucleoside sugar transporters consisting of UDP-GlcNAc transferase, UDP-galactosyltransferase, GDP-fucosyltransferase, CMP-sialyltransferase, UDP-GlcNAc transporter, UDP-galactose transporter, GDP-fucose transporter, CMP-sialic acid transporter, and nucleotide diphosphatases.
18. The method of claim 17 comprising genetically engineering the fungal strain to remove UDP or GDP by action of a diphosphatase.
19. The method of claim 1 wherein the glycoprotein includes N-glycans of which greater than 27 mole percent comprise fewer than six mannose residues.
20. The method of claim 1 wherein the glycoprotein comprises one or more sugars selected from the group consisting of galactose, sialic acid, and fucose.
21. The method of claim 1 wherein the glycoprotein comprises at least one oligosaccharide branch comprising the structure NeuNAc-Gal-GlcNAc-Man.
22. The method of claim 1 wherein the glycoprotein comprises N-glycans having fewer than four mannose residues.
23. The method of claim 1 wherein subsequent to isolation from the host, the glycoprotein is subjected to at least one further glycosylation or carboxylation reaction in vitro.
24. The method of claim 1 comprising the steps of (a) providing a DNA library comprising at least two genes encoding exogenous glycosylation enzymes;
(b) transforming the host with the library to produce a genetically mixed population expressing at least two distinct exogenous glycosylation enzymes;
and (c) selecting from the population a host producing the desired glycosylation phenotype.
(b) transforming the host with the library to produce a genetically mixed population expressing at least two distinct exogenous glycosylation enzymes;
and (c) selecting from the population a host producing the desired glycosylation phenotype.
25. The method of claim 24 wherein the host is transformed two or more times with the library prior to the selection of a desired glycosylation phenotype.
26. The method of claim 24 wherein the library comprises at least one wild-type gene encoding a glycosylation enzyme.
27. The method of claim 24 wherein the library comprises at least one synthetic gene encoding a glycosylation enzyme.
28. The method of claim 24 wherein the library comprises at least one gene previously subjected to a technique selected from the list: gene shuffling, in vitro mutagenesis, and error-prone polymerase chain reaction.
29. The method of claim 24 wherein the library comprises at least one genetic construct formed by the in-frame ligation of a DNA fragment encoding a cellular targeting signal peptide with a DNA fragment encoding a glycosylation enzyme or catalytically active fragment thereof.
30. The method of claim 29 wherein a DNA fragment encodes an activity selected from the group consisting of mannosidase, UDP-GlcNAc transferase, UDP-galactosyltransferase, and CMP-sialyltransferase and the cellular targeting signal peptide is predominantly localizes the enzyme in an organelle selected from the group consisting of endoplasmic reticulum, cis Golgi, medial Golgi, and trans Golgi.
31. The method of claim 24 wherein the selection comprises the step of analyzing a glycosylated protein or isolated N-glycan by one or more methods selected from the group consisting of mass spectroscopy, liquid chromatography, characterizing cells using a fluorescence activated cell sorter, spectrophotometer, fluorimeter, or scintillation counter, exposing host cells to a lectin or antibody having a specific affinity for a desired oligosaccharide moiety, and exposing cells to a cytotoxic or radioactive molecule selected from the group consisting of sugars, antibodies, and lectins.
32. The host produced by the method of any of claims 1-31.
33. The glycoprotein produced by the method of any of claims 1-31.
34. The library of claims 24-30.
Applications Claiming Priority (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US21435800P | 2000-06-28 | 2000-06-28 | |
US60/214,358 | 2000-06-28 | ||
US21563800P | 2000-06-30 | 2000-06-30 | |
US60/215,638 | 2000-06-30 | ||
US27999701P | 2001-03-30 | 2001-03-30 | |
US60/279,997 | 2001-03-30 | ||
PCT/US2001/020553 WO2002000879A2 (en) | 2000-06-28 | 2001-06-27 | Methods for producing modified glycoproteins |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2412701A1 true CA2412701A1 (en) | 2002-01-03 |
Family
ID=27395978
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002412701A Abandoned CA2412701A1 (en) | 2000-06-28 | 2001-06-27 | Methods for producing modified glycoproteins |
Country Status (15)
Country | Link |
---|---|
US (13) | US7029872B2 (en) |
EP (5) | EP2322644A1 (en) |
JP (2) | JP2004501642A (en) |
KR (1) | KR100787073B1 (en) |
AT (2) | ATE309385T1 (en) |
AU (2) | AU7684201A (en) |
CA (1) | CA2412701A1 (en) |
CY (1) | CY1109639T1 (en) |
DE (2) | DE60139720D1 (en) |
DK (2) | DK1297172T3 (en) |
ES (2) | ES2252261T3 (en) |
MX (1) | MXPA03000105A (en) |
NZ (1) | NZ523476A (en) |
PT (1) | PT1522590E (en) |
WO (1) | WO2002000879A2 (en) |
Families Citing this family (469)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5545553A (en) * | 1994-09-26 | 1996-08-13 | The Rockefeller University | Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them |
ATE475714T1 (en) | 1998-12-09 | 2010-08-15 | Phyton Holdings Llc | METHOD FOR PRODUCING GLYCOPROTEIN WITH HUMAN GLYCOSYLATION IMAGE |
PT1772518E (en) | 1999-10-26 | 2010-10-28 | Stichting Dienst Landbouwkundi | Mammalian-type glycosylation in plants |
DK1283265T3 (en) * | 2000-05-17 | 2009-11-09 | Mitsubishi Tanabe Pharma Corp | Process for producing protein with reduction of mannose phosphate in the sugar chain and glycoprotein prepared thereby |
US20060034828A1 (en) * | 2000-06-28 | 2006-02-16 | Gerngross Tillman U | Immunoglobulins comprising predominantly a GlcNAcMAN5GLCNAC2 glycoform |
US7598055B2 (en) | 2000-06-28 | 2009-10-06 | Glycofi, Inc. | N-acetylglucosaminyltransferase III expression in lower eukaryotes |
US7795002B2 (en) * | 2000-06-28 | 2010-09-14 | Glycofi, Inc. | Production of galactosylated glycoproteins in lower eukaryotes |
US7863020B2 (en) * | 2000-06-28 | 2011-01-04 | Glycofi, Inc. | Production of sialylated N-glycans in lower eukaryotes |
US7449308B2 (en) | 2000-06-28 | 2008-11-11 | Glycofi, Inc. | Combinatorial DNA library for producing modified N-glycans in lower eukaryotes |
US20060034830A1 (en) * | 2000-06-28 | 2006-02-16 | Gerngross Tillman U | Immunoglobulins comprising predominantly a GalGlcNAcMan5GLcNAc2 glycoform |
US20060029604A1 (en) * | 2000-06-28 | 2006-02-09 | Gerngross Tillman U | Immunoglobulins comprising predominantly a GlcNAc2Man3GlcNAc2 glycoform |
US7625756B2 (en) | 2000-06-28 | 2009-12-01 | GycoFi, Inc. | Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells |
US20060024304A1 (en) * | 2000-06-28 | 2006-02-02 | Gerngross Tillman U | Immunoglobulins comprising predominantly a Man5GlcNAc2 glycoform |
US8697394B2 (en) | 2000-06-28 | 2014-04-15 | Glycofi, Inc. | Production of modified glycoproteins having multiple antennary structures |
EP2322644A1 (en) | 2000-06-28 | 2011-05-18 | GlycoFi, Inc. | Methods for producing modified glycoproteins |
JP4092194B2 (en) * | 2000-06-30 | 2008-05-28 | フランダース インターユニバーシティ インスティテュート フォア バイオテクノロジー (ヴィーアイビー) | Protein sugar chain modification in Pichia pastoris |
WO2002051438A2 (en) | 2000-12-22 | 2002-07-04 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Use of repulsive guidance molecule (rgm) and its modulators |
EP1356068B1 (en) | 2001-01-19 | 2014-10-29 | Phyton Holdings, LLC | Method for secretory production of glycoprotein having human-type sugar chain using plant cell |
TWI324181B (en) | 2001-04-16 | 2010-05-01 | Martek Biosciences Corp | Product and process for transformation of thraustochytriales microorganisms |
US7265084B2 (en) * | 2001-10-10 | 2007-09-04 | Neose Technologies, Inc. | Glycopegylation methods and proteins/peptides produced by the methods |
US7399613B2 (en) | 2001-10-10 | 2008-07-15 | Neose Technologies, Inc. | Sialic acid nucleotide sugars |
US7795210B2 (en) | 2001-10-10 | 2010-09-14 | Novo Nordisk A/S | Protein remodeling methods and proteins/peptides produced by the methods |
US7173003B2 (en) | 2001-10-10 | 2007-02-06 | Neose Technologies, Inc. | Granulocyte colony stimulating factor: remodeling and glycoconjugation of G-CSF |
ES2606840T3 (en) * | 2001-10-10 | 2017-03-28 | Ratiopharm Gmbh | Remodeling and glycoconjugation of granulocyte colony stimulating factor (G-CSF) |
US7297511B2 (en) * | 2001-10-10 | 2007-11-20 | Neose Technologies, Inc. | Interferon alpha: remodeling and glycoconjugation of interferon alpha |
US7696163B2 (en) | 2001-10-10 | 2010-04-13 | Novo Nordisk A/S | Erythropoietin: remodeling and glycoconjugation of erythropoietin |
US7265085B2 (en) * | 2001-10-10 | 2007-09-04 | Neose Technologies, Inc. | Glycoconjugation methods and proteins/peptides produced by the methods |
DK2279755T3 (en) | 2001-10-10 | 2014-05-26 | Ratiopharm Gmbh | Remodeling and glycoconjugation of fibroblast growth factor (FGF) |
US8008252B2 (en) * | 2001-10-10 | 2011-08-30 | Novo Nordisk A/S | Factor VII: remodeling and glycoconjugation of Factor VII |
US7439043B2 (en) * | 2001-10-10 | 2008-10-21 | Neose Technologies, Inc. | Galactosyl nucleotide sugars |
US7226903B2 (en) | 2001-10-10 | 2007-06-05 | Neose Technologies, Inc. | Interferon beta: remodeling and glycoconjugation of interferon beta |
US7179617B2 (en) | 2001-10-10 | 2007-02-20 | Neose Technologies, Inc. | Factor IX: remolding and glycoconjugation of Factor IX |
US7157277B2 (en) * | 2001-11-28 | 2007-01-02 | Neose Technologies, Inc. | Factor VIII remodeling and glycoconjugation of Factor VIII |
US7214660B2 (en) | 2001-10-10 | 2007-05-08 | Neose Technologies, Inc. | Erythropoietin: remodeling and glycoconjugation of erythropoietin |
US7125843B2 (en) | 2001-10-19 | 2006-10-24 | Neose Technologies, Inc. | Glycoconjugates including more than one peptide |
US7473680B2 (en) * | 2001-11-28 | 2009-01-06 | Neose Technologies, Inc. | Remodeling and glycoconjugation of peptides |
ES2402527T3 (en) | 2001-12-27 | 2013-05-06 | Glycofi, Inc. | Procedures for obtaining mammalian carbohydrate structures by genetic engineering |
US20060034829A1 (en) * | 2001-12-27 | 2006-02-16 | Gerngross Tillman U | Immunoglobulins comprising predominantly a MAN3GLCNAC2 glycoform |
US20060024292A1 (en) * | 2001-12-27 | 2006-02-02 | Gerngross Tillman U | Immunoglobulins comprising predominantly a Gal2GlcNAc2Man3GlcNAc2 glycoform |
US6964784B2 (en) * | 2002-03-07 | 2005-11-15 | Optigenex, Inc. | Method of preparation and composition of a water soluble extract of the bioactive component of the plant species uncaria for enhancing immune, anti-inflammatory, anti-tumor and dna repair processes of warm blooded animals |
KR101228276B1 (en) | 2002-03-19 | 2013-01-30 | 스티칭 디엔스트 랜드보위쿤디그 온데조에크 | Optimizing Glycan Processing in Plants |
US7897842B2 (en) | 2002-03-19 | 2011-03-01 | Plant Research International B.V. | GnTIII expression in plants |
WO2003091431A1 (en) * | 2002-04-26 | 2003-11-06 | Kirin Beer Kabushiki Kaisha | Methylotroph producing mammalian type sugar chain |
MXPA04012496A (en) | 2002-06-21 | 2005-09-12 | Novo Nordisk Healthcare Ag | Pegylated factor vii glycoforms. |
US7252933B2 (en) * | 2002-06-26 | 2007-08-07 | Flanders Interuniversity Institute For Biotechnology | Protein glycosylation modification in methylotrophic yeast |
AU2003246286A1 (en) * | 2002-06-29 | 2004-01-19 | Korea Research Institute Of Bioscience And Biotechnology | Hansenula polymorpha mutant strains with defect in outer chain biosynthesis and the production of recombinant glycoproteins using the same strains |
AU2003263717A1 (en) * | 2002-09-25 | 2004-04-19 | Astrazeneca Ab | A COMBINATION OF A LONG-ACTING Beta2-AGONIST AND A GLUCOCORTICOSTEROID IN THE TREATMENT OF FIBROTIC DISEASES |
AR042145A1 (en) | 2002-11-27 | 2005-06-08 | Dow Agrociences Llc | IMMUNOGLOBULIN PRODUCTION IN PLANTS WITH A REDUCED FUCOCILATION |
PL222222B1 (en) | 2003-01-22 | 2016-07-29 | Glycart Biotechnology Ag | Method for polypeptide production |
RU2407796C2 (en) * | 2003-01-22 | 2010-12-27 | Гликарт Биотекнолоджи АГ | FUSION DESIGNS AND THEIR APPLICATION FOR PRODUCING ANTIBODIES WITH HIGH BINDING AFFINITY OF Fc-RECEPTOR AND EFFECTOR FUNCTION |
DE10303974A1 (en) | 2003-01-31 | 2004-08-05 | Abbott Gmbh & Co. Kg | Amyloid β (1-42) oligomers, process for their preparation and their use |
AU2012227297B2 (en) * | 2003-02-20 | 2013-11-14 | Glycofi, Inc. | Combinatorial DNA Library for Producing Modified N-Glycans in Lower Eukaryotes |
US7332299B2 (en) * | 2003-02-20 | 2008-02-19 | Glycofi, Inc. | Endomannosidases in the modification of glycoproteins in eukaryotes |
CA2519092C (en) | 2003-03-14 | 2014-08-05 | Neose Technologies, Inc. | Branched water-soluble polymers and their conjugates |
WO2006127896A2 (en) | 2005-05-25 | 2006-11-30 | Neose Technologies, Inc. | Glycopegylated factor ix |
US20070026485A1 (en) | 2003-04-09 | 2007-02-01 | Neose Technologies, Inc. | Glycopegylation methods and proteins/peptides produced by the methods |
EP1613261A4 (en) * | 2003-04-09 | 2011-01-26 | Novo Nordisk As | Intracellular formation of peptide conjugates |
US8791070B2 (en) | 2003-04-09 | 2014-07-29 | Novo Nordisk A/S | Glycopegylated factor IX |
BRPI0410164A (en) | 2003-05-09 | 2006-05-16 | Neose Technologies Inc | compositions and methods for preparing human growth hormone glycosylation mutants |
WO2005012484A2 (en) | 2003-07-25 | 2005-02-10 | Neose Technologies, Inc. | Antibody-toxin conjugates |
WO2005042753A1 (en) * | 2003-10-28 | 2005-05-12 | Chesapeake Perl, Inc. | Production of human glycosylated proteins in transgenic insects |
US9357755B2 (en) * | 2003-10-28 | 2016-06-07 | The University Of Wyoming | Production of human glycosylated proteins in silk worm |
US20050100965A1 (en) | 2003-11-12 | 2005-05-12 | Tariq Ghayur | IL-18 binding proteins |
US7507573B2 (en) * | 2003-11-14 | 2009-03-24 | Vib, Vzw | Modification of protein glycosylation in methylotrophic yeast |
US20080305992A1 (en) | 2003-11-24 | 2008-12-11 | Neose Technologies, Inc. | Glycopegylated erythropoietin |
ES2445948T3 (en) * | 2003-11-24 | 2014-03-06 | Ratiopharm Gmbh | Glycopegylated Erythropoietin |
US8633157B2 (en) | 2003-11-24 | 2014-01-21 | Novo Nordisk A/S | Glycopegylated erythropoietin |
US20060040856A1 (en) | 2003-12-03 | 2006-02-23 | Neose Technologies, Inc. | Glycopegylated factor IX |
US7956032B2 (en) * | 2003-12-03 | 2011-06-07 | Novo Nordisk A/S | Glycopegylated granulocyte colony stimulating factor |
US20080318850A1 (en) * | 2003-12-03 | 2008-12-25 | Neose Technologies, Inc. | Glycopegylated Factor Ix |
ES2528739T3 (en) * | 2003-12-24 | 2015-02-12 | Glycofi, Inc. | Methods to eliminate mannosyl phosphorylation of glucans in glycoprotein production |
ES2560657T3 (en) | 2004-01-08 | 2016-02-22 | Ratiopharm Gmbh | O-linked glycosylation of G-CSF peptides |
KR100604994B1 (en) * | 2004-01-30 | 2006-07-26 | 한국생명공학연구원 | A novel Hansenula polymorpha gene coding for ?1,6- mannosyltransferase and process for the production of recombinant glycoproteins with Hansenula polymorpha mutant strain deficient in the same gene |
WO2005090552A2 (en) * | 2004-03-17 | 2005-09-29 | Glycofi, Inc. | Method of engineering a cytidine monophosphate-sialic acid synthetic pathway in fungi and yeast |
US20050265988A1 (en) * | 2004-03-18 | 2005-12-01 | Byung-Kwon Choi | Glycosylated glucocerebrosidase expression in fungal hosts |
CN104611245A (en) * | 2004-04-15 | 2015-05-13 | 格利科菲公司 | Production of galactosylated glycoproteins in lower eukaryotes |
JP5752582B2 (en) * | 2004-04-29 | 2015-07-22 | グライコフィ, インコーポレイテッド | Methods for reducing or eliminating alpha-mannosidase resistant glycans in the production of glycoproteins |
CN101084233B (en) * | 2004-04-29 | 2012-08-15 | 格利科菲公司 | Methods for reducing or eliminating alpha-mannosidase resistant glycans for the production of glycoproteins |
CA2565414A1 (en) * | 2004-05-04 | 2005-11-24 | Novo Nordisk Health Care Ag | O-linked glycoforms of polypeptides and method to manufacture them |
WO2006010143A2 (en) | 2004-07-13 | 2006-01-26 | Neose Technologies, Inc. | Branched peg remodeling and glycosylation of glucagon-like peptide-1 [glp-1] |
WO2006014725A1 (en) * | 2004-07-21 | 2006-02-09 | Glycofi, Inc. | IMMUNOGLOBULINS COMPRISING PREDOMINANTLY A GlcNAcMAN5GLCNAC2 GLYCOFORM |
WO2006026992A1 (en) * | 2004-09-07 | 2006-03-16 | Novozymes A/S | Altered structure of n-glycans in a fungus |
EP1799249A2 (en) | 2004-09-10 | 2007-06-27 | Neose Technologies, Inc. | Glycopegylated interferon alpha |
WO2006035057A1 (en) * | 2004-09-29 | 2006-04-06 | Novo Nordisk Health Care Ag | Modified proteins |
DK2586456T3 (en) | 2004-10-29 | 2016-03-21 | Ratiopharm Gmbh | Conversion and glycopegylation of fibroblast growth factor (FGF) |
WO2006071856A2 (en) * | 2004-12-23 | 2006-07-06 | Glycofi, Inc. | Immunoglobulins comprising predominantly a man5glcnac2 glycoform |
JP4951527B2 (en) | 2005-01-10 | 2012-06-13 | バイオジェネリックス アーゲー | GlycoPEGylated granulocyte colony stimulating factor |
AU2006221184B2 (en) * | 2005-03-07 | 2011-03-24 | Stichting Dienst Landbouwkundig Onderzoek | Glycoengineering in mushrooms |
US20060246544A1 (en) * | 2005-03-30 | 2006-11-02 | Neose Technologies,Inc. | Manufacturing process for the production of peptides grown in insect cell lines |
US20070154992A1 (en) * | 2005-04-08 | 2007-07-05 | Neose Technologies, Inc. | Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants |
GB0510390D0 (en) | 2005-05-20 | 2005-06-29 | Novartis Ag | Organic compounds |
EP1888098A2 (en) | 2005-05-25 | 2008-02-20 | Neose Technologies, Inc. | Glycopegylated erythropoietin formulations |
NZ596992A (en) * | 2005-06-30 | 2013-07-26 | Abbott Lab | Il-12/p40 binding proteins |
WO2007024715A2 (en) | 2005-08-19 | 2007-03-01 | Abbott Laboratories | Dual variable domain immunoglobin and uses thereof |
EP2500358A3 (en) | 2005-08-19 | 2012-10-17 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
BRPI0614839A2 (en) * | 2005-08-19 | 2009-05-19 | Neose Technologies Inc | glycopeguiled factor vii and factor viia |
US7612181B2 (en) * | 2005-08-19 | 2009-11-03 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
US20070105755A1 (en) * | 2005-10-26 | 2007-05-10 | Neose Technologies, Inc. | One pot desialylation and glycopegylation of therapeutic peptides |
US20090215992A1 (en) * | 2005-08-19 | 2009-08-27 | Chengbin Wu | Dual variable domain immunoglobulin and uses thereof |
JP2009507040A (en) * | 2005-09-02 | 2009-02-19 | グライコフィ, インコーポレイテッド | Immunoglobulin containing mainly GLCNACMAN3GLCNAC2 glycoform |
AU2005336263A1 (en) * | 2005-09-09 | 2007-03-15 | Glycofi, Inc. | Immunoglobulin comprising predominantly a man7GlcNAc2, Man8GlcNAc2 glycoform |
JP2009509970A (en) * | 2005-09-22 | 2009-03-12 | プロサイ インコーポレイテッド | Glycosylated polypeptides produced in yeast mutants and methods of use thereof |
CN101277974A (en) | 2005-09-30 | 2008-10-01 | 阿伯特有限及两合公司 | Binding domains of proteins of the repulsive guidance molecule (RGM) protein family and functional fragments thereof, and their use |
KR101105718B1 (en) * | 2005-10-27 | 2012-01-17 | 한국생명공학연구원 | A novel Hansenula polymorpha gene coding for dolichyl-phosphate-mannose dependent ?-1,3-mannosyltransferase and process for the production of recombinant glycoproteins with Hansenula polymorpha mutant strain deficient in the same gene |
US20090048440A1 (en) | 2005-11-03 | 2009-02-19 | Neose Technologies, Inc. | Nucleotide Sugar Purification Using Membranes |
AU2006316838B2 (en) | 2005-11-15 | 2012-04-12 | Glycofi, Inc | Production of glycoproteins with reduced O-glycosylation |
EP1954718B1 (en) | 2005-11-30 | 2014-09-03 | AbbVie Inc. | Anti-a globulomer antibodies, antigen-binding moieties thereof, corresponding hybridomas, nucleic acids, vectors, host cells, methods of producing said antibodies, compositions comprising said antibodies, uses of said antibodies and methods of using said antibodies |
PT1976877E (en) | 2005-11-30 | 2014-04-29 | Abbvie Inc | Monoclonal antibodies against amyloid beta protein and uses thereof |
US20090060921A1 (en) * | 2006-01-17 | 2009-03-05 | Biolex Therapeutics, Inc. | Glycan-optimized anti-cd20 antibodies |
BRPI0707290A2 (en) * | 2006-01-17 | 2011-08-16 | Biolex Therapeutics Inc | compositions and methods for humanization and optimization of n-glycans in plants |
US20090181041A1 (en) * | 2006-01-23 | 2009-07-16 | Jan Holgersson | Production of proteins carrying oligomannose or human-like glycans in yeast and methods of use thereof |
US20070190057A1 (en) | 2006-01-23 | 2007-08-16 | Jian Wu | Methods for modulating mannose content of recombinant proteins |
EP2781524A1 (en) * | 2006-01-26 | 2014-09-24 | Recopharma AB | Compositions and methods for inhibiting viral adhesion |
WO2007123801A1 (en) * | 2006-04-05 | 2007-11-01 | Genencor International, Inc. | Filamentous fungi having reduced udp-galactofuranose content |
BRPI0710482A2 (en) * | 2006-04-21 | 2011-08-16 | Wyeth Corp | methods for selecting high throughput cell lines |
US7851438B2 (en) * | 2006-05-19 | 2010-12-14 | GlycoFi, Incorporated | Erythropoietin compositions |
CA2651456A1 (en) * | 2006-05-19 | 2007-11-29 | Glycofi, Inc. | Recombinant vectors |
ES2368267T3 (en) * | 2006-05-24 | 2011-11-15 | Universite De Provence (Aix-Marseille 1) | PREPARATION AND USE OF THE CODING GENETIC SEQUENCES OF CHEMICAL GLUCOSILTRANSPHERASES WITH OPTIMIZED GLUCOSILATION ACTIVITY. |
AR078117A1 (en) | 2006-06-20 | 2011-10-19 | Protech Pharma S A | A RECOMBINANT MUTEIN OF THE GLICOSILATED HUMAN ALPHA INTERFERON, A CODIFYING GENE FOR SUCH MUTEIN, A METHOD OF PRODUCTION OF SUCH GENE, A METHOD FOR OBTAINING A EUCARIOTE CELL MANUFACTURING THIS MUTEINE, A METHOD FOR A MUTE DIFFERENT PROCEDURE |
WO2008011633A2 (en) | 2006-07-21 | 2008-01-24 | Neose Technologies, Inc. | Glycosylation of peptides via o-linked glycosylation sequences |
US7879799B2 (en) * | 2006-08-10 | 2011-02-01 | Institute For Systems Biology | Methods for characterizing glycoproteins and generating antibodies for same |
CA2914170C (en) | 2006-09-08 | 2018-10-30 | Abbvie Bahamas Ltd. | Interleukin-13 binding proteins |
US8969532B2 (en) | 2006-10-03 | 2015-03-03 | Novo Nordisk A/S | Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography |
WO2008063776A2 (en) * | 2006-10-12 | 2008-05-29 | Genentech, Inc. | Antibodies to lymphotoxin-alpha |
EP1916259A1 (en) | 2006-10-26 | 2008-04-30 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Anti-glycoprotein VI SCFV fragment for treatment of thrombosis |
US20080207487A1 (en) * | 2006-11-02 | 2008-08-28 | Neose Technologies, Inc. | Manufacturing process for the production of polypeptides expressed in insect cell-lines |
US8455626B2 (en) | 2006-11-30 | 2013-06-04 | Abbott Laboratories | Aβ conformer selective anti-aβ globulomer monoclonal antibodies |
WO2008079849A2 (en) * | 2006-12-22 | 2008-07-03 | Genentech, Inc. | Antibodies to insulin-like growth factor receptor |
FR2912154B1 (en) | 2007-02-02 | 2012-11-02 | Glycode | GENETICALLY MODIFIED YEASTS FOR THE PRODUCTION OF HOMOGENEOUS GLYCOPROTEINS |
ES2545775T3 (en) | 2007-02-05 | 2015-09-15 | Apellis Pharmaceuticals, Inc. | Compstatin analogues for use in the treatment of inflammatory conditions of the respiratory system |
US20100311767A1 (en) | 2007-02-27 | 2010-12-09 | Abbott Gmbh & Co. Kg | Method for the treatment of amyloidoses |
SG187521A1 (en) | 2007-03-07 | 2013-02-28 | Glycofi Inc | Production of glycoproteins with modified fucosylation |
PL3199180T3 (en) | 2007-03-08 | 2022-08-08 | Humanigen, Inc. | Epha3 antibodies for the treatment of solid tumors |
KR101605908B1 (en) | 2007-03-22 | 2016-03-23 | 바이오젠 엠에이 인코포레이티드 | Binding proteins, including antibodies, antibody derivatives and antibody fragments, that specifically bind cd154 and uses thereof |
CN104480140B (en) | 2007-04-03 | 2019-12-31 | 奥克西雷恩英国有限公司 | Glycosylation of molecules |
CA2682897C (en) | 2007-04-03 | 2016-11-22 | Biogenerix Ag | Methods of treatment using glycopegylated g-csf |
US20080256056A1 (en) * | 2007-04-10 | 2008-10-16 | Yahoo! Inc. | System for building a data structure representing a network of users and advertisers |
MX341988B (en) | 2007-04-17 | 2016-09-08 | Stichting Dienst Landbouwkunding Onderzoek | Mammalian-type glycosylation in plants by expression of non-mammalian glycosyltransferases. |
EP2068925A4 (en) | 2007-05-07 | 2011-08-31 | Medimmune Llc | Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
ES2558689T3 (en) | 2007-05-14 | 2016-02-08 | Medimmune, Llc | Methods to reduce eosinophil levels |
US20090053167A1 (en) * | 2007-05-14 | 2009-02-26 | Neose Technologies, Inc. | C-, S- and N-glycosylation of peptides |
PE20090329A1 (en) * | 2007-05-30 | 2009-03-27 | Abbott Lab | HUMANIZED ANTIBODIES AGAINST GLOBULOMER AB (20-42) AND ITS USES |
US20090232801A1 (en) * | 2007-05-30 | 2009-09-17 | Abbot Laboratories | Humanized Antibodies Which Bind To AB (1-42) Globulomer And Uses Thereof |
MX2009013259A (en) | 2007-06-12 | 2010-01-25 | Novo Nordisk As | Improved process for the production of nucleotide sugars. |
US8207112B2 (en) | 2007-08-29 | 2012-06-26 | Biogenerix Ag | Liquid formulation of G-CSF conjugate |
US8637435B2 (en) * | 2007-11-16 | 2014-01-28 | Merck Sharp & Dohme Corp. | Eukaryotic cell display systems |
EP2235198B1 (en) | 2007-12-19 | 2018-08-29 | GlycoFi, Inc. | Yeast strains for protein production |
DK2240595T4 (en) * | 2008-01-03 | 2019-10-07 | Cornell Res Foundation Inc | Glycosylated protein expression in prokaryotes |
US20100311122A1 (en) * | 2008-02-20 | 2010-12-09 | Glycofi, Inc | Vectors and yeast strains for protein production |
PL2257311T3 (en) | 2008-02-27 | 2014-09-30 | Novo Nordisk As | Conjugated factor viii molecules |
US8962803B2 (en) | 2008-02-29 | 2015-02-24 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM A protein and uses thereof |
WO2009111183A1 (en) | 2008-03-03 | 2009-09-11 | Glycofi, Inc. | Surface display of recombinant proteins in lower eukaryotes |
AU2009223054A1 (en) * | 2008-03-11 | 2009-09-17 | Genentech, Inc. | Antibodies with enhanced ADCC function |
NZ588554A (en) | 2008-04-29 | 2013-03-28 | Abbott Lab | Dual variable domain immunoglobulins and uses thereof |
EP2383292A1 (en) | 2008-05-02 | 2011-11-02 | Novartis AG | Improved fibronectin-based binding molecules and uses thereof |
SG188142A1 (en) | 2008-05-09 | 2013-03-28 | Abbott Gmbh & Co Kg | Antibodies to receptor of advanced glycation end products (rage) and uses thereof |
AU2009251328B2 (en) | 2008-05-30 | 2014-10-02 | Glycofi, Inc. | Yeast strain for the production of proteins with terminal alpha-1,3-linked galactose |
CN102112494A (en) | 2008-06-03 | 2011-06-29 | 雅培制药有限公司 | Dual variable domain immunoglobulins and uses thereof |
AR072001A1 (en) | 2008-06-03 | 2010-07-28 | Abbott Lab | IMMUNOGLOBULIN WITH DUAL VARIABLE DOMAIN AND USES OF THE SAME |
TW201014602A (en) | 2008-07-08 | 2010-04-16 | Abbott Lab | Prostaglandin E2 binding proteins and uses thereof |
WO2010006060A2 (en) | 2008-07-08 | 2010-01-14 | Abbott Laboratories | Prostaglandin e2 dual variable domain immunoglobulins and uses thereof |
US8067339B2 (en) | 2008-07-09 | 2011-11-29 | Merck Sharp & Dohme Corp. | Surface display of whole antibodies in eukaryotes |
DK2331701T3 (en) | 2008-08-08 | 2013-06-24 | Vib Vzw | Cells forming glycoproteins with altered glycosylation patterns and methods thereof and use thereof |
MX2011001706A (en) | 2008-08-12 | 2011-03-24 | Glycofi Inc | Improved vectors and yeast strains for protein production: ca2+ atpase overexpression. |
JP2012503491A (en) | 2008-09-25 | 2012-02-09 | グリコシン インコーポレイテッド | Compositions and methods for manipulating probiotic yeast |
JP5652206B2 (en) | 2008-10-01 | 2015-01-14 | 旭硝子株式会社 | Host, transformant and method for producing the same, and method for producing O-glycoside type sugar chain-containing heterologous protein |
JP5933975B2 (en) | 2008-11-12 | 2016-06-15 | メディミューン,エルエルシー | Antibody preparation |
RU2011127198A (en) * | 2008-12-04 | 2013-01-10 | Эбботт Лэборетриз | IMMUNOGLOBULINS WITH DOUBLE VARIABLE DOMAINS AND THEIR APPLICATION |
US9103821B2 (en) | 2008-12-19 | 2015-08-11 | Momenta Pharmaceuticals, Inc. | Methods related to modified glycans |
BRPI0923433B1 (en) | 2008-12-19 | 2021-06-01 | Jennewein Biotechnologie Gmbh | METHOD TO PRODUCE A GENETICALLY MODIFIED CELL HAVING THE ABILITY TO PRODUCE FUCOSYLATE COMPOUNDS AND METHOD TO MAKE A FUCOSYLATE COMPOUND |
WO2010075249A2 (en) | 2008-12-22 | 2010-07-01 | Genentech, Inc. | A method for treating rheumatoid arthritis with b-cell antagonists |
US20110165063A1 (en) * | 2009-01-29 | 2011-07-07 | Abbott Laboratories | Il-1 binding proteins |
CA2749966A1 (en) * | 2009-01-29 | 2010-08-05 | Abbott Laboratories | Il-1 binding proteins |
US8030026B2 (en) | 2009-02-24 | 2011-10-04 | Abbott Laboratories | Antibodies to troponin I and methods of use thereof |
US20120003695A1 (en) | 2009-02-25 | 2012-01-05 | Davidson Robert C | Metabolic engineering of a galactose assimilation pathway in the glycoengineered yeast pichia pastoris |
JP5836807B2 (en) | 2009-03-05 | 2015-12-24 | アッヴィ・インコーポレイテッド | IL-17 binding protein |
CN102405237A (en) | 2009-03-06 | 2012-04-04 | 卡罗拜奥斯制药公司 | Treatment of leukemias and chronic myeloproliferative diseases with antibodies to epha3 |
US8283162B2 (en) | 2009-03-10 | 2012-10-09 | Abbott Laboratories | Antibodies relating to PIVKAII and uses thereof |
AU2010225930B2 (en) | 2009-03-16 | 2017-01-12 | Dsm Ip Assets B.V. | Protein production in microorganisms of the phylum Labyrinthulomycota |
NZ600915A (en) * | 2009-03-16 | 2013-09-27 | Cephalon Australia Pty Ltd | Humanised antibodies with anti-tumour activity |
EP2424894A1 (en) | 2009-04-27 | 2012-03-07 | Novartis AG | Composition and methods of use for therapeutic antibodies specific for the il-12 receptore betal subunit |
CA2993053A1 (en) | 2009-04-27 | 2010-11-04 | Novartis Ag | Antagonistic activin receptor iib (actriib) antibodies for increasing muscle growth |
US20120329709A1 (en) * | 2009-05-26 | 2012-12-27 | Brian Edward Collins | Production of glycoproteins |
US8815242B2 (en) * | 2009-05-27 | 2014-08-26 | Synageva Biopharma Corp. | Avian derived antibodies |
WO2011011495A1 (en) * | 2009-07-24 | 2011-01-27 | Merck Sharp & Dohme Corp. | Recombinant ectodomain expression of herpes simplex virus glycoproteins in yeast |
CN105131112A (en) | 2009-08-29 | 2015-12-09 | Abbvie公司 | Therapeutic dll4 binding proteins |
EP2473524A4 (en) | 2009-09-01 | 2013-05-22 | Abbott Lab | Dual variable domain immunoglobulins and uses thereof |
WO2011029823A1 (en) | 2009-09-09 | 2011-03-17 | Novartis Ag | Monoclonal antibody reactive with cd63 when expressed at the surface of degranulated mast cells |
US9598682B2 (en) | 2009-09-29 | 2017-03-21 | Vib Vzw | Hydrolysis of mannose-1-phospho-6-mannose linkage to phospho-6-mannose |
JP2013508292A (en) | 2009-10-14 | 2013-03-07 | カロバイオス ファーマシューティカルズ インコーポレイティッド | Antibodies against EphA3 |
EP2488658A4 (en) | 2009-10-15 | 2013-06-19 | Abbvie Inc | Dual variable domain immunoglobulins and uses thereof |
EP2488657B1 (en) | 2009-10-16 | 2016-07-06 | Merck Sharp & Dohme Corp. | Method for producing proteins in pichia pastoris that lack detectable cross binding activity to antibodies against host cell antigens |
UY32979A (en) * | 2009-10-28 | 2011-02-28 | Abbott Lab | IMMUNOGLOBULINS WITH DUAL VARIABLE DOMAIN AND USES OF THE SAME |
CN102725396A (en) | 2009-10-30 | 2012-10-10 | 默沙东公司 | Method for producing therapeutic proteins in pichia pastoris lacking dipeptidyl aminopeptidase activity |
WO2011051327A2 (en) | 2009-10-30 | 2011-05-05 | Novartis Ag | Small antibody-like single chain proteins |
WO2011053545A1 (en) * | 2009-10-30 | 2011-05-05 | Merck Sharp & Dohme Corp. | Granulocyte-colony stimulating factor produced in glycoengineered pichia pastoris |
JP2013509180A (en) | 2009-10-30 | 2013-03-14 | メルク・シャープ・エンド・ドーム・コーポレイション | Method for producing a recombinant protein having improved secretion efficiency |
WO2011053707A1 (en) | 2009-10-31 | 2011-05-05 | Abbott Laboratories | Antibodies to receptor for advanced glycation end products (rage) and uses thereof |
WO2011051466A1 (en) | 2009-11-02 | 2011-05-05 | Novartis Ag | Anti-idiotypic fibronectin-based binding molecules and uses thereof |
US8932588B2 (en) | 2009-11-05 | 2015-01-13 | Teva Pharmaceuticals Australia Pty. Ltd. | Treatment of cancer involving mutated KRAS or BRAF genes |
EP2501805B1 (en) | 2009-11-19 | 2019-02-20 | Oxyrane UK Limited | Yeast strains producing mammalian-like complex n-glycans |
EP2507267B1 (en) | 2009-12-02 | 2016-09-14 | Acceleron Pharma, Inc. | Compositions and methods for increasing serum half-life of fc fusion proteins |
MX2012006560A (en) | 2009-12-08 | 2012-10-05 | Abbott Gmbh & Co Kg | Monoclonal antibodies against the rgm a protein for use in the treatment of retinal nerve fiber layer degeneration. |
TW201130511A (en) | 2009-12-22 | 2011-09-16 | Novartis Ag | Soluble proteins for use as therapeutics |
IN2012DN06277A (en) * | 2009-12-28 | 2015-09-25 | Dsm Ip Assets Bv | |
CN103068984B (en) * | 2009-12-28 | 2017-12-01 | Dsm Ip资产公司 | The production of hemagglutinin neuraminidase albumen in microalgae |
ES2651313T3 (en) * | 2009-12-28 | 2018-01-25 | Dsm Ip Assets B.V. | Recombinant traustoquids growing in xylose, and compositions, methods of preparation and uses thereof |
WO2011092233A1 (en) | 2010-01-29 | 2011-08-04 | Novartis Ag | Yeast mating to produce high-affinity combinations of fibronectin-based binders |
MX2012009802A (en) | 2010-02-24 | 2012-09-12 | Merck Sharp & Dohme | Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris. |
MY160628A (en) | 2010-03-02 | 2017-03-15 | Abbvie Inc | Therapeutic DLL4 Binding Proteins |
MX2012011648A (en) | 2010-04-07 | 2012-11-29 | Momenta Pharmaceuticals Inc | High mannose glycans. |
JP2013523182A (en) | 2010-04-15 | 2013-06-17 | アボット・ラボラトリーズ | Amyloid beta-binding protein |
JP6066900B2 (en) | 2010-04-26 | 2017-01-25 | エータイアー ファーマ, インコーポレイテッド | Innovative discovery of therapeutic, diagnostic and antibody compositions related to protein fragments of cysteinyl tRNA synthetase |
AU2011248614B2 (en) | 2010-04-27 | 2017-02-16 | Pangu Biopharma Limited | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of isoleucyl tRNA synthetases |
CA2797271C (en) | 2010-04-28 | 2021-05-25 | Atyr Pharma, Inc. | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of alanyl trna synthetases |
WO2011139854A2 (en) | 2010-04-29 | 2011-11-10 | Atyr Pharma, Inc. | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of asparaginyl trna synthetases |
EP2563383B1 (en) | 2010-04-29 | 2017-03-01 | Atyr Pharma, Inc. | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of valyl trna synthetases |
US9034321B2 (en) | 2010-05-03 | 2015-05-19 | Atyr Pharma, Inc. | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-alpha-tRNA synthetases |
CN103140233B (en) | 2010-05-03 | 2017-04-05 | Atyr 医药公司 | Treatment, diagnosis and the discovery of antibody compositions related to the protein fragments of methionyl-tRNA synthetase |
CA2797277C (en) | 2010-05-03 | 2021-02-23 | Atyr Pharma, Inc. | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of arginyl-trna synthetases |
CN102985103A (en) | 2010-05-04 | 2013-03-20 | Atyr医药公司 | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of p38 multi-tRNA synthetase complex |
PE20130205A1 (en) | 2010-05-14 | 2013-03-24 | Abbvie Inc | IL-1 BINDING PROTEINS |
JP6396656B2 (en) | 2010-05-14 | 2018-09-26 | エータイアー ファーマ, インコーポレイテッド | Innovative discovery of therapeutic, diagnostic and antibody compositions related to protein fragments of phenylalanyl βtRNA synthetase |
CN103096913B (en) | 2010-05-27 | 2017-07-18 | Atyr 医药公司 | Treatment, diagnosis and the innovation of antibody compositions related to the protein fragments of glutaminyl tRNA synzyme is found |
BR112012030179A8 (en) | 2010-05-27 | 2023-03-14 | Merck Sharp & Dohme | FC CONTAINING POLYPEPTIDE |
AU2011261486B2 (en) | 2010-06-01 | 2017-02-23 | Pangu Biopharma Limited | Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of lysyl-tRNA synthetases |
WO2012006500A2 (en) | 2010-07-08 | 2012-01-12 | Abbott Laboratories | Monoclonal antibodies against hepatitis c virus core protein |
UY33492A (en) | 2010-07-09 | 2012-01-31 | Abbott Lab | IMMUNOGLOBULINS WITH DUAL VARIABLE DOMAIN AND USES OF THE SAME |
JP6116479B2 (en) | 2010-07-12 | 2017-04-19 | エータイアー ファーマ, インコーポレイテッド | Innovative discovery of therapeutic, diagnostic and antibody compositions related to protein fragments of glycyl-tRNA synthetase |
US9120862B2 (en) | 2010-07-26 | 2015-09-01 | Abbott Laboratories | Antibodies relating to PIVKA-II and uses thereof |
CA2806148A1 (en) * | 2010-07-30 | 2012-02-02 | Glycode | A yeast artificial chromosome carrying the mammalian glycosylation pathway |
EP3252072A3 (en) | 2010-08-03 | 2018-03-14 | AbbVie Inc. | Dual variable domain immunoglobulins and uses thereof |
US20130177555A1 (en) | 2010-08-13 | 2013-07-11 | Medimmune Limited | Monomeric Polypeptides Comprising Variant FC Regions And Methods Of Use |
EP2603524A1 (en) | 2010-08-14 | 2013-06-19 | AbbVie Inc. | Amyloid-beta binding proteins |
WO2012022734A2 (en) | 2010-08-16 | 2012-02-23 | Medimmune Limited | Anti-icam-1 antibodies and methods of use |
EP2606067B1 (en) | 2010-08-19 | 2018-02-21 | Zoetis Belgium S.A. | Anti-ngf antibodies and their use |
WO2012027611A2 (en) | 2010-08-25 | 2012-03-01 | Atyr Pharma, Inc. | INNOVATIVE DISCOVERY OF THERAPEUTIC, DIAGNOSTIC, AND ANTIBODY COMPOSITIONS RELATED TO PROTEIN FRAGMENTS OF TYROSYL-tRNA SYNTHETASES |
KR20130139884A (en) | 2010-08-26 | 2013-12-23 | 애브비 인코포레이티드 | Dual variable domain immunoglobulins and uses thereof |
WO2012042386A2 (en) | 2010-09-29 | 2012-04-05 | Oxyrane Uk Limited | Mannosidases capable of uncapping mannose-1-phospho-6-mannose linkages and demannosylating phosphorylated n-glycans and methods of facilitating mammalian cellular uptake of glycoproteins |
KR101979220B1 (en) | 2010-09-29 | 2019-05-16 | 옥시레인 유케이 리미티드 | De-mannosylation of phosphorylated n-glycans |
CN103154037A (en) | 2010-10-05 | 2013-06-12 | 诺瓦提斯公司 | Anti-IL 12 Rbeta 1 antibodies and their use in treating autoimmune and inflammatory disorders |
CN103534392A (en) | 2010-12-01 | 2014-01-22 | 默沙东公司 | Surface, anchored FC-bait antibody display system |
US9458240B2 (en) | 2010-12-10 | 2016-10-04 | Novartis Pharma Ag | Anti-BAFFR antibody formulations |
SG191312A1 (en) | 2010-12-21 | 2013-07-31 | Abbvie Inc | Il-1 -alpha and -beta bispecific dual variable domain immunoglobulins and their use |
US20120275996A1 (en) | 2010-12-21 | 2012-11-01 | Abbott Laboratories | IL-1 Binding Proteins |
RU2620065C2 (en) | 2011-02-08 | 2017-05-22 | МЕДИММЬЮН, ЭлЭлСи | Antibodies for specific binding of staphylococcus aureus alpha-toxin and methods of application |
CA2827732A1 (en) | 2011-02-25 | 2012-08-30 | Merck Sharp & Dohme Corp. | Yeast strain for the production of proteins with modified o-glycosylation |
EP2686671A4 (en) | 2011-03-12 | 2015-06-24 | Momenta Pharmaceuticals Inc | N-acetylhexosamine-containing n-glycans in glycoprotein products |
EP2895592A1 (en) | 2011-03-23 | 2015-07-22 | Société Industrielle Limousine d'Application Biologique (SILAB) | A yeast recombinant cell capable of producing gdp-fucose |
WO2012149197A2 (en) | 2011-04-27 | 2012-11-01 | Abbott Laboratories | Methods for controlling the galactosylation profile of recombinantly-expressed proteins |
US9346883B2 (en) | 2011-05-13 | 2016-05-24 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Antibodies against HER3 |
KR20140028013A (en) | 2011-05-25 | 2014-03-07 | 머크 샤프 앤드 돔 코포레이션 | Method for preparing fc-containing polypeptides having improved properties |
AU2012269929A1 (en) | 2011-06-16 | 2013-12-12 | Novartis Ag | Soluble proteins for use as therapeutics |
JP6120833B2 (en) | 2011-06-22 | 2017-04-26 | インサーム(インスティテュ ナシオナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシェ メディカル)Inserm(Institut National Dela Sante Et De La Recherche Medicale) | Anti-Axl antibody and use thereof |
FR2976811A1 (en) | 2011-06-22 | 2012-12-28 | Lfb Biotechnologies | USE OF A HIGH ADCC ANTI-CD20 ANTIBODY FOR THE TREATMENT OF WALDENSTROM'S DISEASE |
US9249228B2 (en) | 2011-06-22 | 2016-02-02 | Oribase Pharma | Anti-Axl antibodies and uses thereof |
EP2726099B1 (en) | 2011-07-01 | 2018-07-25 | Novartis AG | Method for treating metabolic disorders |
WO2013009521A2 (en) | 2011-07-13 | 2013-01-17 | Abbvie Inc. | Methods and compositions for treating asthma using anti-il-13 antibodies |
KR20140062469A (en) | 2011-07-20 | 2014-05-23 | 젭테온 인코포레이티드 | Polypeptide separation methods |
JP5800160B2 (en) * | 2011-10-03 | 2015-10-28 | 国立研究開発法人産業技術総合研究所 | Complex sugar chain hydrolase |
CA2853357A1 (en) | 2011-10-24 | 2013-05-02 | Abbvie Inc. | Immunobinders directed against tnf |
UY34411A (en) | 2011-10-24 | 2013-05-31 | Abbvie Inc | IMMUNO LINKERS AGAINST SCLEROSTINE |
KR102037541B1 (en) | 2011-10-28 | 2019-10-29 | 테바 파마슈티컬즈 오스트레일리아 피티와이 엘티디 | Polypeptide constructs and uses thereof |
AU2012329091A1 (en) | 2011-10-28 | 2014-05-01 | Merck Sharp & Dohme Corp. | Engineered lower eukaryotic host strains for recombinant protein expression |
EP2780462A4 (en) * | 2011-10-31 | 2015-04-29 | Merck Sharp & Dohme | Engineered pichia strains with improved fermentation yield and n-glycosylation quality |
CN103906533A (en) | 2011-11-07 | 2014-07-02 | 米迪缪尼有限公司 | Multispecific and multivalent binding proteins and uses thereof |
KR101457514B1 (en) | 2011-11-21 | 2014-11-03 | 한국생명공학연구원 | Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it |
CN104114183A (en) | 2011-12-20 | 2014-10-22 | 印第安纳大学研究及科技有限公司 | CTP-based insulin analogs for treatment of diabetes |
CN104159920A (en) | 2011-12-30 | 2014-11-19 | 艾伯维公司 | Dual specific binding proteins directed against il-13 and/or il-17 |
EP2617732A1 (en) | 2012-01-19 | 2013-07-24 | Vib Vzw | Tools and methods for expression of membrane proteins |
RS57603B1 (en) | 2012-01-27 | 2018-11-30 | Abbvie Deutschland | Composition and method for diagnosis and treatment of diseases associated with neurite degeneration |
WO2013123432A2 (en) | 2012-02-16 | 2013-08-22 | Atyr Pharma, Inc. | Histidyl-trna synthetases for treating autoimmune and inflammatory diseases |
JP6194324B2 (en) | 2012-03-15 | 2017-09-06 | オキシレイン ユーケー リミテッド | Methods and materials for the treatment of Pompe disease |
WO2013158279A1 (en) | 2012-04-20 | 2013-10-24 | Abbvie Inc. | Protein purification methods to reduce acidic species |
US9181572B2 (en) | 2012-04-20 | 2015-11-10 | Abbvie, Inc. | Methods to modulate lysine variant distribution |
US9067990B2 (en) | 2013-03-14 | 2015-06-30 | Abbvie, Inc. | Protein purification using displacement chromatography |
WO2013169609A1 (en) | 2012-05-11 | 2013-11-14 | Merck Sharp & Dohme Corp. | Surface anchored light chain bait antibody display system |
EP2852610B1 (en) | 2012-05-23 | 2018-07-11 | Glykos Finland Oy | Production of fucosylated glycoproteins |
US9695244B2 (en) | 2012-06-01 | 2017-07-04 | Momenta Pharmaceuticals, Inc. | Methods related to denosumab |
WO2013184871A1 (en) | 2012-06-06 | 2013-12-12 | Zoetis Llc | Caninized anti-ngf antibodies and methods thereof |
US9216219B2 (en) | 2012-06-12 | 2015-12-22 | Novartis Ag | Anti-BAFFR antibody formulation |
WO2014004549A2 (en) | 2012-06-27 | 2014-01-03 | Amgen Inc. | Anti-mesothelin binding proteins |
WO2014011955A2 (en) | 2012-07-12 | 2014-01-16 | Abbvie, Inc. | Il-1 binding proteins |
EA201590237A1 (en) | 2012-07-18 | 2015-05-29 | Гликотоп Гмбх | NEW METHODS OF ANTIBODY TREATMENT AGAINST HER2 WITH LOW FUZOZYLATION |
US9512214B2 (en) | 2012-09-02 | 2016-12-06 | Abbvie, Inc. | Methods to control protein heterogeneity |
JOP20200308A1 (en) | 2012-09-07 | 2017-06-16 | Novartis Ag | IL-18 binding molecules |
US20150275222A1 (en) | 2012-10-22 | 2015-10-01 | Bo Jiang | Crz1 mutant fungal cells |
PT2912162T (en) | 2012-10-23 | 2018-02-15 | Research Corporation Tech Inc | Pichia pastoris strains for producing predominantly homogeneous glycan structure |
EP2911681A1 (en) | 2012-10-26 | 2015-09-02 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Lyve-1 antagonists for preventing or treating a pathological condition associated with lymphangiogenesis |
KR20180008921A (en) | 2012-11-01 | 2018-01-24 | 애브비 인코포레이티드 | Anti-vegf/dll4 dual variable domain immunoglobulins and uses thereof |
EP2733153A1 (en) | 2012-11-15 | 2014-05-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the preparation of immunoconjugates and uses thereof |
EP2925345B1 (en) | 2012-12-03 | 2018-09-05 | Merck Sharp & Dohme Corp. | Method for making o-glycosylated carboxy terminal portion (ctp) peptide-based insulin and insulin analogues |
US9764006B2 (en) | 2012-12-10 | 2017-09-19 | The General Hospital Corporation | Bivalent IL-2 fusion toxins |
WO2014090948A1 (en) | 2012-12-13 | 2014-06-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Serpin spn4a and biologically active derivatives thereof for use in the treatment of cancer |
EP3514175A1 (en) | 2012-12-17 | 2019-07-24 | Laboratoire Français du Fractionnement et des Biotechnologies | Use of monoclonal antibodies for the treatment of inflammation and bacterial infections |
CN105228650B (en) | 2012-12-18 | 2018-11-16 | 美国洛克菲勒大学 | Anti-CD 4 antibodies for the HIV glycan modification prevented and treated |
WO2014100542A1 (en) | 2012-12-21 | 2014-06-26 | Abbvie, Inc. | High-throughput antibody humanization |
US9458244B2 (en) | 2012-12-28 | 2016-10-04 | Abbvie Inc. | Single chain multivalent binding protein compositions and methods |
EP2938637A2 (en) | 2012-12-28 | 2015-11-04 | AbbVie Inc. | Multivalent binding protein compositions |
CA2898415A1 (en) | 2013-01-16 | 2014-07-24 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | A soluble fibroblast growth factor receptor 3 (fgr3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders |
EP2948177A1 (en) | 2013-01-22 | 2015-12-02 | AbbVie Inc. | Methods for optimizing domain stability of binding proteins |
CA2897682C (en) | 2013-02-08 | 2023-03-14 | Novartis Ag | Anti-il-17a antibodies and their use in treating autoimmune and inflammatory disorders |
WO2014126921A1 (en) | 2013-02-12 | 2014-08-21 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Monoclonal antibodies that neutralize norovirus |
ES2755181T3 (en) | 2013-02-13 | 2020-04-21 | Lab Francais Du Fractionnement | Highly galactosylated anti-TNF-alpha antibodies and uses thereof |
WO2014138188A1 (en) | 2013-03-07 | 2014-09-12 | The General Hospital Corporation | Human ctla4 mutants and use thereof |
EP2830651A4 (en) | 2013-03-12 | 2015-09-02 | Abbvie Inc | Human antibodies that bind human tnf-alpha and methods of preparing the same |
CN105473604B (en) | 2013-03-13 | 2021-01-22 | 美国政府(由卫生和人类服务部的部长所代表) | Pre-fusion RSV F proteins and uses thereof |
US9017687B1 (en) | 2013-10-18 | 2015-04-28 | Abbvie, Inc. | Low acidic species compositions and methods for producing and using the same using displacement chromatography |
BR112015023355A8 (en) | 2013-03-14 | 2018-01-30 | Abbott Lab | hcv ns3 recombinant antigens and mutants thereof for enhanced antibody detection. |
MX2015012825A (en) | 2013-03-14 | 2016-06-10 | Abbott Lab | Hcv core lipid binding domain monoclonal antibodies. |
CA2906421C (en) | 2013-03-14 | 2022-08-16 | George J. Dawson | Hcv antigen-antibody combination assay and methods and compositions for use therein |
JP6538645B2 (en) | 2013-03-14 | 2019-07-03 | インディアナ ユニバーシティー リサーチ アンド テクノロジー コーポレーションIndiana University Research And Technology Corporation | Insulin-incretin complex |
WO2014151878A2 (en) | 2013-03-14 | 2014-09-25 | Abbvie Inc. | Methods for modulating protein glycosylation profiles of recombinant protein therapeutics using monosaccharides and oligosacharides |
CN105324396A (en) | 2013-03-15 | 2016-02-10 | 艾伯维公司 | Dual specific binding proteins directed against il-1 beta and il-17 |
US9587235B2 (en) | 2013-03-15 | 2017-03-07 | Atyr Pharma, Inc. | Histidyl-tRNA synthetase-Fc conjugates |
EP2855533A4 (en) | 2013-03-15 | 2015-11-25 | Momenta Pharmaceuticals Inc | Methods related to ctla4-fc fusion proteins |
CN105229030A (en) | 2013-04-22 | 2016-01-06 | 葛莱高托普有限公司 | Treat by the anti-cancer of the anti-EGFR-antibodies with low fucosylation |
US11117975B2 (en) | 2013-04-29 | 2021-09-14 | Teva Pharmaceuticals Australia Pty Ltd | Anti-CD38 antibodies and fusions to attenuated interferon alpha-2B |
PT2992013T (en) | 2013-04-29 | 2020-03-05 | Teva Pharmaceuticals Australia Pty Ltd | Anti-cd38 antibodies and fusions to attenuated interferon alpha-2b |
US10000556B2 (en) | 2013-05-09 | 2018-06-19 | The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services | Single-domain VHH antibodies directed to norovirus GI.1 and GII.4 and their use |
ES2708759T3 (en) | 2013-05-13 | 2019-04-11 | Momenta Pharmaceuticals Inc | Procedures for the treatment of neurodegeneration |
SG10201801063TA (en) | 2013-08-14 | 2018-04-27 | Novartis Ag | Methods of treating sporadic inclusion body myositis |
AU2014317092B2 (en) | 2013-09-05 | 2018-02-08 | Universiteit Gent | Cells producing Fc containing molecules having altered glycosylation patterns and methods and use thereof |
WO2015044379A1 (en) | 2013-09-27 | 2015-04-02 | INSERM (Institut National de la Santé et de la Recherche Médicale) | A dyrk1a polypeptide for use in preventing or treating metabolic disorders |
WO2015050959A1 (en) | 2013-10-01 | 2015-04-09 | Yale University | Anti-kit antibodies and methods of use thereof |
CN113667012A (en) | 2013-10-02 | 2021-11-19 | 免疫医疗有限责任公司 | Neutralizing anti-influenza a antibodies and uses thereof |
WO2015051293A2 (en) | 2013-10-04 | 2015-04-09 | Abbvie, Inc. | Use of metal ions for modulation of protein glycosylation profiles of recombinant proteins |
US20160257754A1 (en) | 2013-10-16 | 2016-09-08 | Momenta Pharmaceuticals Inc. | Sialylated glycoproteins |
US9085618B2 (en) | 2013-10-18 | 2015-07-21 | Abbvie, Inc. | Low acidic species compositions and methods for producing and using the same |
US9181337B2 (en) | 2013-10-18 | 2015-11-10 | Abbvie, Inc. | Modulated lysine variant species compositions and methods for producing and using the same |
WO2015066550A1 (en) | 2013-10-31 | 2015-05-07 | Resolve Therapeutics, Llc | Therapeutic nuclease-albumin fusions and methods |
WO2015067986A1 (en) | 2013-11-07 | 2015-05-14 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neuregulin allosteric anti-her3 antibody |
US20150139988A1 (en) | 2013-11-15 | 2015-05-21 | Abbvie, Inc. | Glycoengineered binding protein compositions |
FR3016633B1 (en) | 2014-01-17 | 2018-04-13 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | IMMUNOGLOBULIN ANTI-TOXIN CARBON |
EP3495482B1 (en) | 2014-01-21 | 2020-09-02 | Synplogen Co., Ltd. | Method for preparing dna unit composition, and method for creating concatenated dna |
KR20220025946A (en) | 2014-03-21 | 2022-03-03 | 애브비 인코포레이티드 | Anti-egfr antibodies and antibody drug conjugates |
TW201622746A (en) | 2014-04-24 | 2016-07-01 | 諾華公司 | Methods of improving or accelerating physical recovery after surgery for hip fracture |
UA119352C2 (en) | 2014-05-01 | 2019-06-10 | Тева Фармасьютикалз Острейліа Пті Лтд | Combination of lenalidomide or pomalidomide and cd38 antibody-attenuated interferon-alpha constructs, and the use thereof |
US20170291939A1 (en) | 2014-06-25 | 2017-10-12 | Novartis Ag | Antibodies specific for il-17a fused to hyaluronan binding peptide tags |
JP6837434B2 (en) | 2014-07-15 | 2021-03-03 | メディミューン,エルエルシー | Neutralization of anti-influenza antibody and its use |
US10513724B2 (en) | 2014-07-21 | 2019-12-24 | Glykos Finland Oy | Production of glycoproteins with mammalian-like N-glycans in filamentous fungi |
JO3663B1 (en) | 2014-08-19 | 2020-08-27 | Merck Sharp & Dohme | Anti-lag3 antibodies and antigen-binding fragments |
AP2017009765A0 (en) | 2014-08-19 | 2017-02-28 | Merck Sharp & Dohme | Anti-tigit antibodies |
ES2822994T3 (en) | 2014-09-24 | 2021-05-05 | Univ Indiana Res & Tech Corp | Incretin-insulin conjugates |
RU2021125449A (en) | 2014-10-01 | 2021-09-16 | Медиммьюн Лимитед | ANTIBODIES TO TICAGRELOR AND METHODS OF APPLICATION |
EA037749B1 (en) | 2014-10-29 | 2021-05-18 | Тева Фармасьютикалз Острэйлиа Пти Лтд | INTERFERON 2b VARIANTS |
WO2016069889A1 (en) | 2014-10-31 | 2016-05-06 | Resolve Therapeutics, Llc | Therapeutic nuclease-transferrin fusions and methods |
EP3217807A4 (en) | 2014-11-11 | 2018-09-12 | Clara Foods Co. | Methods and compositions for egg white protein production |
US10072070B2 (en) | 2014-12-05 | 2018-09-11 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Potent anti-influenza A neuraminidase subtype N1 antibody |
WO2016091891A1 (en) | 2014-12-09 | 2016-06-16 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies against axl |
US10093733B2 (en) | 2014-12-11 | 2018-10-09 | Abbvie Inc. | LRP-8 binding dual variable domain immunoglobulin proteins |
WO2016135041A1 (en) | 2015-02-26 | 2016-09-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Fusion proteins and antibodies comprising thereof for promoting apoptosis |
WO2016160976A2 (en) | 2015-03-30 | 2016-10-06 | Abbvie Inc. | Monovalent tnf binding proteins |
EP3091033A1 (en) | 2015-05-06 | 2016-11-09 | Gamamabs Pharma | Anti-human-her3 antibodies and uses thereof |
MY189692A (en) | 2015-05-07 | 2022-02-26 | Memorial Sloan Kettering Cancer Center | Anti-ox40 antibodies and methods of use thereof |
WO2016188911A1 (en) | 2015-05-22 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies fragments inhibiting both the cath-d catalytic activity and its binding to the lrp1 receptor |
JP6518917B2 (en) | 2015-05-29 | 2019-05-29 | アッヴィ・インコーポレイテッド | Anti-CD40 antibody and use thereof |
PT3303384T (en) | 2015-06-01 | 2021-10-14 | Medimmune Llc | Neutralizing anti-influenza binding molecules and uses thereof |
TW201710286A (en) | 2015-06-15 | 2017-03-16 | 艾伯維有限公司 | Binding proteins against VEGF, PDGF, and/or their receptors |
FR3038517B1 (en) | 2015-07-06 | 2020-02-28 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | USE OF MODIFIED FC FRAGMENTS IN IMMUNOTHERAPY |
DK3320105T3 (en) | 2015-07-09 | 2021-06-07 | Vib Vzw | CELLS PRODUCING GLYCOPROTEINS WITH CHANGED O- AND O-GLYCOSYLING PATTERNS, AS WELL AS ASSOCIATED PROCEDURES AND USE |
JP2018535655A (en) | 2015-09-29 | 2018-12-06 | アムジエン・インコーポレーテツド | ASGR inhibitor |
EP3363461A4 (en) | 2015-10-12 | 2019-05-15 | Aprogen Kic Inc. | Anti-cd43 antibody and use thereof for cancer treatment |
JO3555B1 (en) | 2015-10-29 | 2020-07-05 | Merck Sharp & Dohme | Antibody neutralizing human respiratory syncytial virus |
US11045547B2 (en) | 2015-12-16 | 2021-06-29 | Merck Sharp & Dohme Corp. | Anti-LAG3 antibodies and antigen-binding fragments |
BR112018015259A2 (en) * | 2016-01-27 | 2018-12-18 | Medimmune Llc | Methods for preparing antibodies with a defined glycosylation standard |
CU24613B1 (en) | 2016-02-06 | 2022-07-08 | Epimab Biotherapeutics Inc | FABS TANDEM IMMUNOGLOBULIN BINDING PROTEINS (FIT-IG) BSPECIFIC BINDING TO CMET AND EGFR |
SG11201805941WA (en) | 2016-02-17 | 2018-09-27 | Novartis Ag | Tgfbeta 2 antibodies |
KR102438140B1 (en) | 2016-03-22 | 2022-08-31 | 엥스띠뛰 나씨오날 드 라 쌍떼 에 드 라 흐쉐르슈 메디깔 | Humanized anti-claudin-1 antibodies and uses thereof |
JP2019526529A (en) | 2016-06-08 | 2019-09-19 | アッヴィ・インコーポレイテッド | Anti-B7-H3 antibody and antibody drug conjugate |
BR112018075630A2 (en) | 2016-06-08 | 2019-03-19 | Abbvie Inc. | anti-cd98 antibodies and antibody drug conjugates |
CN109641962A (en) | 2016-06-08 | 2019-04-16 | 艾伯维公司 | Anti- B7-H3 antibody and antibody drug conjugates |
CN109562190A (en) | 2016-06-08 | 2019-04-02 | 艾伯维公司 | Anti-egfr antibodies drug conjugates |
WO2017214335A1 (en) | 2016-06-08 | 2017-12-14 | Abbvie Inc. | Anti-b7-h3 antibodies and antibody drug conjugates |
CN116173232A (en) | 2016-06-08 | 2023-05-30 | 艾伯维公司 | anti-CD 98 antibodies and antibody drug conjugates |
RU2018147224A (en) | 2016-06-08 | 2020-07-14 | Эббви Инк. | CONJUGATES OF ANTIBODY TO EGFR AND DRUG |
AU2017277422A1 (en) | 2016-06-08 | 2019-01-03 | Abbvie Inc. | Anti-EGFR antibody drug conjugates |
JP2019522643A (en) | 2016-06-08 | 2019-08-15 | アッヴィ・インコーポレイテッド | Anti-CD98 antibodies and antibody drug conjugates |
EP3478830B1 (en) | 2016-07-01 | 2024-04-10 | Resolve Therapeutics, LLC | Optimized binuclease fusions and methods |
JP7241677B2 (en) | 2016-07-19 | 2023-03-17 | テバ・ファーマシューティカルズ・オーストラリア・ピーティワイ・リミテッド | Anti-CD47 combination therapy |
NL2017267B1 (en) | 2016-07-29 | 2018-02-01 | Aduro Biotech Holdings Europe B V | Anti-pd-1 antibodies |
JP7219207B2 (en) | 2016-07-29 | 2023-02-07 | アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル | Antibodies targeting tumor-associated macrophages and uses thereof |
NL2017270B1 (en) | 2016-08-02 | 2018-02-09 | Aduro Biotech Holdings Europe B V | New anti-hCTLA-4 antibodies |
WO2018026969A2 (en) | 2016-08-03 | 2018-02-08 | Achaogen, Inc. | Plazomicin antibodies and methods of use |
BR112019002579A2 (en) | 2016-08-16 | 2019-05-21 | Epimab Biotherapeutics, Inc. | monovalent, asymmetric and tandem fab bispecific antibodies |
JP7174691B2 (en) | 2016-08-23 | 2022-11-17 | メディミューン リミテッド | Anti-VEGF-A and anti-ANG2 antibodies and uses thereof |
KR102538827B1 (en) | 2016-08-23 | 2023-05-31 | 메디뮨 리미티드 | Anti-VEF-A Antibodies and Uses Thereof |
US20190270821A1 (en) | 2016-09-13 | 2019-09-05 | Humanigen, Inc. | Epha3 antibodies for the treatment of pulmonary fibrosis |
JOP20190055A1 (en) | 2016-09-26 | 2019-03-24 | Merck Sharp & Dohme | Anti-cd27 antibodies |
JP2019535306A (en) | 2016-10-25 | 2019-12-12 | インセルム(インスティチュート ナショナル デ ラ サンテ エ デ ラリシェルシェ メディカル) | Monoclonal antibody binding to CD160 transmembrane isoform |
US10899842B2 (en) | 2016-11-23 | 2021-01-26 | Immunoah Therapeutics, Inc. | 4-1BB binding proteins and uses thereof |
BR112019011582A2 (en) | 2016-12-07 | 2019-10-22 | Agenus Inc. | antibodies and their methods of use |
EP3579872A1 (en) | 2017-02-10 | 2019-12-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of cancers associated with activation of the mapk pathway |
JP2020510432A (en) | 2017-03-02 | 2020-04-09 | アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル | Antibodies with specificity for NECTIN-4 and uses thereof |
WO2018170332A1 (en) * | 2017-03-15 | 2018-09-20 | Nutech Ventures | Extracellular vesicles and methods of using |
KR102628323B1 (en) | 2017-03-24 | 2024-01-22 | 노바르티스 아게 | How to prevent and treat heart disease |
TWI796329B (en) | 2017-04-07 | 2023-03-21 | 美商默沙東有限責任公司 | Anti-ilt4 antibodies and antigen-binding fragments |
KR20190140454A (en) | 2017-04-13 | 2019-12-19 | 아두로 바이오테크 홀딩스, 유럽 비.브이. | Anti-SIRP alpha antibody |
CA3064697A1 (en) | 2017-04-19 | 2018-10-25 | Bluefin Biomedicine, Inc. | Anti-vtcn1 antibodies and antibody drug conjugates |
CA3064333A1 (en) | 2017-05-29 | 2018-12-06 | Gamamabs Pharma | Cancer-associated immunosuppression inhibitor |
UY37758A (en) | 2017-06-12 | 2019-01-31 | Novartis Ag | METHOD OF MANUFACTURING OF BIESPECTIFIC ANTIBODIES, BISPECTIFIC ANTIBODIES AND THERAPEUTIC USE OF SUCH ANTIBODIES |
GB201710838D0 (en) | 2017-07-05 | 2017-08-16 | Ucl Business Plc | Bispecific antibodies |
US11898187B2 (en) | 2017-08-15 | 2024-02-13 | Northwestern University | Protein glycosylation sites by rapid expression and characterization of N-glycosyltransferases |
CA3073537A1 (en) | 2017-08-22 | 2019-02-28 | Sanabio, Llc | Soluble interferon receptors and uses thereof |
EP3672990A1 (en) | 2017-08-25 | 2020-07-01 | Five Prime Therapeutics, Inc. | B7-h4 antibodies and methods of use thereof |
WO2019075090A1 (en) | 2017-10-10 | 2019-04-18 | Tilos Therapeutics, Inc. | Anti-lap antibodies and uses thereof |
WO2019148412A1 (en) | 2018-02-01 | 2019-08-08 | Merck Sharp & Dohme Corp. | Anti-pd-1/lag3 bispecific antibodies |
MX2020008730A (en) | 2018-02-21 | 2020-12-07 | Five Prime Therapeutics Inc | B7-h4 antibody dosing regimens. |
CA3091174A1 (en) | 2018-02-21 | 2019-08-29 | Five Prime Therapeutics, Inc. | B7-h4 antibody formulations |
SG11202008105RA (en) | 2018-03-02 | 2020-09-29 | Five Prime Therapeutics Inc | B7-h4 antibodies and methods of use thereof |
EP3765499A1 (en) | 2018-03-12 | 2021-01-20 | Zoetis Services LLC | Anti-ngf antibodies and methods thereof |
US11530432B2 (en) | 2018-03-19 | 2022-12-20 | Northwestern University | Compositions and methods for rapid in vitro synthesis of bioconjugate vaccines in vitro via production and N-glycosylation of protein carriers in detoxified prokaryotic cell lysates |
US11725224B2 (en) | 2018-04-16 | 2023-08-15 | Northwestern University | Methods for co-activating in vitro non-standard amino acid (nsAA) incorporation and glycosylation in crude cell lysates |
WO2020041483A1 (en) * | 2018-08-21 | 2020-02-27 | Clara Foods Co. | Modification of protein glycosylation in microorganisms |
TW202019480A (en) | 2018-09-13 | 2020-06-01 | 美國德州系統大學評議委員會 | Novel lilrb4 antibodies and uses thereof |
US20220073638A1 (en) | 2018-09-19 | 2022-03-10 | INSERM (Institut National de la Santé et de la Recherche Médicale | Methods and pharmaceutical composition for the treatment of cancers resistant to immune checkpoint therapy |
US11130802B2 (en) | 2018-10-10 | 2021-09-28 | Tilos Therapeutics, Inc. | Anti-lap antibody variants |
CN113166242A (en) | 2018-10-15 | 2021-07-23 | 戊瑞治疗有限公司 | Combination therapy for cancer |
US20220025058A1 (en) | 2018-11-06 | 2022-01-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of acute myeloid leukemia by eradicating leukemic stem cells |
US20220064260A1 (en) | 2018-12-14 | 2022-03-03 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Isolated mhc-derived human peptides and uses thereof for stimulating and activating the suppressive function of cd8+cd45rclow tregs |
KR20210113261A (en) | 2019-01-04 | 2021-09-15 | 리졸브 테라퓨틱스, 엘엘씨 | Treatment of Sjogren's Disease Using Nuclease Fusion Proteins |
WO2020148207A1 (en) | 2019-01-14 | 2020-07-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies binding to hla-a2 |
JP2022538733A (en) | 2019-05-20 | 2022-09-06 | インセルム(インスティチュート ナショナル デ ラ サンテ エ デ ラ リシェルシェ メディカル) | Novel anti-CD25 antibody |
UY38747A (en) | 2019-06-12 | 2021-01-29 | Novartis Ag | NATRIURETIC 1 PEPTIDE RECEPTOR ANTIBODIES AND METHODS OF USE |
KR20220034848A (en) | 2019-07-11 | 2022-03-18 | 클라라 푸드즈 컴퍼니 | Protein composition and edible products thereof |
EP3999540A1 (en) | 2019-07-16 | 2022-05-25 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Antibodies having specificity for cd38 and uses thereof |
US10927360B1 (en) | 2019-08-07 | 2021-02-23 | Clara Foods Co. | Compositions comprising digestive enzymes |
WO2021067526A1 (en) | 2019-10-02 | 2021-04-08 | Alexion Pharmaceuticals, Inc. | Complement inhibitors for treating drug-induced complement-mediated response |
WO2021064184A1 (en) | 2019-10-04 | 2021-04-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical composition for the treatment of ovarian cancer, breast cancer or pancreatic cancer |
WO2021116119A1 (en) | 2019-12-09 | 2021-06-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to her4 and uses thereof |
US20230091231A1 (en) | 2020-01-21 | 2023-03-23 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Utilization of plant protein homologues in culture media |
AU2021215936A1 (en) | 2020-02-05 | 2022-08-25 | Larimar Therapeutics, Inc. | TAT peptide binding proteins and uses thereof |
EP4132971A1 (en) | 2020-04-09 | 2023-02-15 | Merck Sharp & Dohme LLC | Affinity matured anti-lap antibodies and uses thereof |
EP4143227A2 (en) | 2020-04-30 | 2023-03-08 | Sairopa B.V. | Anti-cd103 antibodies |
WO2021228956A1 (en) | 2020-05-12 | 2021-11-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | New method to treat cutaneous t-cell lymphomas and tfh derived lymphomas |
CR20220646A (en) | 2020-05-17 | 2023-10-23 | Astrazeneca Uk Ltd | Sars-cov-2 antibodies and methods of selecting and using the same |
US11702467B2 (en) | 2020-06-25 | 2023-07-18 | Merck Sharp & Dohme Llc | High affinity antibodies targeting tau phosphorylated at serine 413 |
CA3165342A1 (en) | 2020-06-29 | 2022-01-06 | James Arthur Posada | Treatment of sjogren's syndrome with nuclease fusion proteins |
US20230323299A1 (en) | 2020-08-03 | 2023-10-12 | Inserm (Institut National De La Santé Et De La Recherch Médicale) | Population of treg cells functionally committed to exert a regulatory activity and their use for adoptive therapy |
JP2023537078A (en) | 2020-08-10 | 2023-08-30 | アストラゼネカ・ユーケイ・リミテッド | SARS-CoV-2 Antibodies for Treating and Preventing COVID-19 |
US20240002521A1 (en) | 2020-11-20 | 2024-01-04 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-cd25 antibodies |
WO2022106665A1 (en) | 2020-11-20 | 2022-05-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-cd25 antibodies |
WO2022130182A1 (en) | 2020-12-14 | 2022-06-23 | Novartis Ag | Reversal binding agents for anti-natriuretic peptide receptor 1 (npr1) antibodies and uses thereof |
KR20230129481A (en) | 2021-01-08 | 2023-09-08 | 베이징 한미 파마슈티컬 컴퍼니 리미티드 | Antibodies and antigen-binding fragments that specifically bind to CD47 |
CN116710482A (en) | 2021-01-08 | 2023-09-05 | 北京韩美药品有限公司 | Antibodies and antigen binding fragments thereof that specifically bind 4-1BB |
WO2022148414A1 (en) | 2021-01-08 | 2022-07-14 | 北京韩美药品有限公司 | Antibody specifically binding with pd-l1 and antigen-binding fragment of antibody |
WO2022153212A1 (en) | 2021-01-13 | 2022-07-21 | Axon Neuroscience Se | Antibodies neutralizing sars-cov-2 |
UY39610A (en) | 2021-01-20 | 2022-08-31 | Abbvie Inc | ANTI-EGFR ANTIBODY-DRUG CONJUGATES |
EP4313317A1 (en) | 2021-03-23 | 2024-02-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the diagnosis and treatment of t cell-lymphomas |
EP4320153A1 (en) | 2021-04-09 | 2024-02-14 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the treatment of anaplastic large cell lymphoma |
CA3219360A1 (en) | 2021-06-22 | 2022-12-29 | Novartis Ag | Bispecific antibodies for use in treatment of hidradenitis suppurativa |
TW202342095A (en) | 2021-11-05 | 2023-11-01 | 英商阿斯特捷利康英國股份有限公司 | Composition for treatment and prevention of covid-19 |
EP4186529A1 (en) | 2021-11-25 | 2023-05-31 | Veraxa Biotech GmbH | Improved antibody-payload conjugates (apcs) prepared by site-specific conjugation utilizing genetic code expansion |
WO2023094525A1 (en) | 2021-11-25 | 2023-06-01 | Veraxa Biotech Gmbh | Improved antibody-payload conjugates (apcs) prepared by site-specific conjugation utilizing genetic code expansion |
WO2023110937A1 (en) | 2021-12-14 | 2023-06-22 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Depletion of nk cells for the treatment of adverse post-ischemic cardiac remodeling |
WO2023144303A1 (en) | 2022-01-31 | 2023-08-03 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Cd38 as a biomarker and biotarget in t-cell lymphomas |
WO2023187657A1 (en) | 2022-03-30 | 2023-10-05 | Novartis Ag | Methods of treating disorders using anti-natriuretic peptide receptor 1 (npr1) antibodies |
WO2023198648A1 (en) | 2022-04-11 | 2023-10-19 | Institut National de la Santé et de la Recherche Médicale | Methods for the diagnosis and treatment of t-cell malignancies |
WO2023198874A1 (en) | 2022-04-15 | 2023-10-19 | Institut National de la Santé et de la Recherche Médicale | Methods for the diagnosis and treatment of t cell-lymphomas |
CN115386009B (en) * | 2022-04-26 | 2023-12-01 | 江苏靶标生物医药研究所有限公司 | Construction method and application of annexin V and angiogenesis inhibitor fusion protein |
WO2023209177A1 (en) | 2022-04-29 | 2023-11-02 | Astrazeneca Uk Limited | Sars-cov-2 antibodies and methods of using the same |
WO2023222886A1 (en) | 2022-05-20 | 2023-11-23 | Depth Charge Ltd | Antibody-cytokine fusion proteins |
WO2024003310A1 (en) | 2022-06-30 | 2024-01-04 | Institut National de la Santé et de la Recherche Médicale | Methods for the diagnosis and treatment of acute lymphoblastic leukemia |
WO2024017998A1 (en) | 2022-07-21 | 2024-01-25 | Technische Universität Dresden | M-csf for use in the prophylaxis and/or treatment of viral infections in states of immunosuppression |
EP4309666A1 (en) | 2022-07-21 | 2024-01-24 | Technische Universität Dresden | M-csf for use in the prophylaxis and/or treatment of viral infections in states of immunosuppression |
WO2024018046A1 (en) | 2022-07-22 | 2024-01-25 | Institut National de la Santé et de la Recherche Médicale | Garp as a biomarker and biotarget in t-cell malignancies |
WO2024023283A1 (en) | 2022-07-29 | 2024-02-01 | Institut National de la Santé et de la Recherche Médicale | Lrrc33 as a biomarker and biotarget in cutaneous t-cell lymphomas |
WO2024052503A1 (en) | 2022-09-08 | 2024-03-14 | Institut National de la Santé et de la Recherche Médicale | Antibodies having specificity to ltbp2 and uses thereof |
CN115590017B (en) * | 2022-11-04 | 2023-09-12 | 中国农业大学 | Method for improving oocyte freezing effect by reducing mitochondrial temperature |
Family Cites Families (115)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US513854A (en) * | 1894-01-30 | Clevis | ||
US4166329A (en) * | 1978-10-10 | 1979-09-04 | Herbig Charles A | Adjustable arch support for shoes |
US4414329A (en) | 1980-01-15 | 1983-11-08 | Phillips Petroleum Company | Biochemical conversions by yeast fermentation at high cell densities |
NZ199722A (en) | 1981-02-25 | 1985-12-13 | Genentech Inc | Dna transfer vector for expression of exogenous polypeptide in yeast;transformed yeast strain |
US4617274A (en) | 1981-10-29 | 1986-10-14 | Phillips Petroleum Company | Biochemical conversions by yeast fermentation at high cell densities |
US4775622A (en) | 1982-03-08 | 1988-10-04 | Genentech, Inc. | Expression, processing and secretion of heterologous protein by yeast |
KR850004274A (en) | 1983-12-13 | 1985-07-11 | 원본미기재 | Method for preparing erythropoietin |
US4655231A (en) * | 1984-01-09 | 1987-04-07 | Advanced Tobacco Products, Inc. | Snuff and preparation thereof |
US4885242A (en) | 1984-10-30 | 1989-12-05 | Phillips Petroleum Company | Genes from pichia histidine pathway and uses thereof |
US4837148A (en) | 1984-10-30 | 1989-06-06 | Phillips Petroleum Company | Autonomous replication sequences for yeast strains of the genus pichia |
US4855231A (en) | 1984-10-30 | 1989-08-08 | Phillips Petroleum Company | Regulatory region for heterologous gene expression in yeast |
US4879231A (en) | 1984-10-30 | 1989-11-07 | Phillips Petroleum Company | Transformation of yeasts of the genus pichia |
US4808537A (en) | 1984-10-30 | 1989-02-28 | Phillips Petroleum Company | Methanol inducible genes obtained from pichia and methods of use |
US4818700A (en) | 1985-10-25 | 1989-04-04 | Phillips Petroleum Company | Pichia pastoris argininosuccinate lyase gene and uses thereof |
US5032516A (en) | 1985-10-25 | 1991-07-16 | Phillips Petroleum Company | Pichia pastoris alcohol oxidase II regulatory region |
US4882279A (en) | 1985-10-25 | 1989-11-21 | Phillips Petroleum Company | Site selective genomic modification of yeast of the genus pichia |
US5166329A (en) | 1985-10-25 | 1992-11-24 | Phillips Petroleum Company | DNA encoding the alcohol oxidase 2 gene of yeast of the genus Pichia |
US4935349A (en) | 1986-01-17 | 1990-06-19 | Zymogenetics, Inc. | Expression of higher eucaryotic genes in aspergillus |
US5837518A (en) * | 1986-01-31 | 1998-11-17 | Genetics Institute, Inc. | Thrombolytic proteins |
US4812405A (en) | 1986-02-18 | 1989-03-14 | Phillips Petroleum Company | Double auxotrophic mutants of Pichia pastoris and methods for preparation |
US5272066A (en) | 1986-03-07 | 1993-12-21 | Massachusetts Institute Of Technology | Synthetic method for enhancing glycoprotein stability |
US4925796A (en) | 1986-03-07 | 1990-05-15 | Massachusetts Institute Of Technology | Method for enhancing glycoprotein stability |
US4857467A (en) | 1986-07-23 | 1989-08-15 | Phillips Petroleum Company | Carbon and energy source markers for transformation of strains of the genes Pichia |
US5002876A (en) | 1986-09-22 | 1991-03-26 | Phillips Petroleum Company | Yeast production of human tumor necrosis factor |
US4683293A (en) | 1986-10-20 | 1987-07-28 | Phillips Petroleum Company | Purification of pichia produced lipophilic proteins |
US4929555A (en) | 1987-10-19 | 1990-05-29 | Phillips Petroleum Company | Pichia transformation |
US5135854A (en) | 1987-10-29 | 1992-08-04 | Zymogenetics, Inc. | Methods of regulating protein glycosylation |
US4816700A (en) * | 1987-12-16 | 1989-03-28 | Intel Corporation | Two-phase non-overlapping clock generator |
US5004688A (en) | 1988-04-15 | 1991-04-02 | Phillips Petroleum Company | Purification of hepatitis proteins |
US5047335A (en) | 1988-12-21 | 1991-09-10 | The Regents Of The University Of Calif. | Process for controlling intracellular glycosylation of proteins |
US5122465A (en) | 1989-06-12 | 1992-06-16 | Phillips Petroleum Company | Strains of pichia pastoris created by interlocus recombination |
US5032519A (en) | 1989-10-24 | 1991-07-16 | The Regents Of The Univ. Of California | Method for producing secretable glycosyltransferases and other Golgi processing enzymes |
US5324663A (en) | 1990-02-14 | 1994-06-28 | The Regents Of The University Of Michigan | Methods and products for the synthesis of oligosaccharide structures on glycoproteins, glycolipids, or as free molecules, and for the isolation of cloned genetic sequences that determine these structures |
US5595900A (en) | 1990-02-14 | 1997-01-21 | The Regents Of The University Of Michigan | Methods and products for the synthesis of oligosaccharide structures on glycoproteins, glycolipids, or as free molecules, and for the isolation of cloned genetic sequences that determine these structures |
DE4028800A1 (en) | 1990-09-11 | 1992-03-12 | Behringwerke Ag | GENETIC SIALYLATION OF GLYCOPROTEINS |
CA2058820C (en) | 1991-04-25 | 2003-07-15 | Kotikanyad Sreekrishna | Expression cassettes and vectors for the secretion of human serum albumin in pichia pastoris cells |
US5962294A (en) | 1992-03-09 | 1999-10-05 | The Regents Of The University Of California | Compositions and methods for the identification and synthesis of sialyltransferases |
US5602003A (en) | 1992-06-29 | 1997-02-11 | University Of Georgia Research Foundation | N-acetylglucosaminyltransferase V gene |
EP0698103A1 (en) | 1993-05-14 | 1996-02-28 | PHARMACIA & UPJOHN COMPANY | CLONED DNA ENCODING A UDP-GALNAc:POLYPEPTIDE,N-ACETYLGALACTOS AMINYLTRANSFERASE |
US5484590A (en) | 1993-09-09 | 1996-01-16 | La Jolla Cancer Research Foundation | Expression of the developmental I antigen by a cloned human cDNA encoding a member of a β-1,6-N-acetylglucosaminyltransferase gene family |
US6300113B1 (en) | 1995-11-21 | 2001-10-09 | New England Biolabs Inc. | Isolation and composition of novel glycosidases |
US5683899A (en) | 1994-02-03 | 1997-11-04 | University Of Hawaii | Methods and compositions for combinatorial-based discovery of new multimeric molecules |
US6069235A (en) | 1994-02-23 | 2000-05-30 | Monsanto Company | Method for carbohydrate engineering of glycoproteins |
US6204431B1 (en) | 1994-03-09 | 2001-03-20 | Abbott Laboratories | Transgenic non-human mammals expressing heterologous glycosyltransferase DNA sequences produce oligosaccharides and glycoproteins in their milk |
CZ292061B6 (en) * | 1994-03-17 | 2003-07-16 | Merck Patent Gmbh | Single-chain fragments of antibodies and anti-epidermal growth factor receptor antibodies, process of their preparation, and pharmaceutical preparation in which they are comprised |
AU2575395A (en) | 1994-06-13 | 1996-01-05 | Banyu Pharmaceutical Co., Ltd. | Gene coding for glycosyltransferase and use thereof |
US5545553A (en) | 1994-09-26 | 1996-08-13 | The Rockefeller University | Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them |
US6096743A (en) * | 1994-09-27 | 2000-08-01 | Yamanouchi Pharmaceuticals Co., Ltd. | 1,2,3,4-tetrahydroquinoxalinedione derivative |
DE4439759C1 (en) * | 1994-11-07 | 1996-02-01 | Siemens Ag | Photodiode array for X=ray computer tomography |
US5849904A (en) | 1994-12-22 | 1998-12-15 | Boehringer Mannheim Gmbh | Isolated nucleic acid molecules which hybridize to polysialyl transferases |
US5834251A (en) * | 1994-12-30 | 1998-11-10 | Alko Group Ltd. | Methods of modifying carbohydrate moieties |
JP2810635B2 (en) | 1995-04-03 | 1998-10-15 | 理化学研究所 | New sugar chain synthase |
JPH08336387A (en) | 1995-06-12 | 1996-12-24 | Green Cross Corp:The | Sugar chain-extended protein derived from pichia yeast and dna of the protein |
CZ89098A3 (en) * | 1995-09-29 | 1998-09-16 | Glycim Oy | SYNTHETIC POLYLACTOSAMINES CONTAINING UP TO MULTIVALENT sLEX AND METHODS OF THEIR USE |
JP3348336B2 (en) * | 1995-10-26 | 2002-11-20 | 株式会社豊田中央研究所 | Adsorption heat pump |
US5910570A (en) | 1995-11-13 | 1999-06-08 | Pharmacia & Upjohn Company | Cloned DNA encoding a UDP-GalNAc: polypeptide N-acetylgalactosaminy-ltransferase |
EP0874900B1 (en) | 1996-08-02 | 2007-10-03 | The Austin Research Institute | Improved nucleic acids encoding a chimeric glycosyltransferase |
US6338955B2 (en) | 1996-12-12 | 2002-01-15 | Kirin Beer Kabushiki Kaisha | β1-4 N-acetylglucosaminyltransferase and gene encoding |
US5945314A (en) | 1997-03-31 | 1999-08-31 | Abbott Laboratories | Process for synthesizing oligosaccharides |
US20040191256A1 (en) | 1997-06-24 | 2004-09-30 | Genentech, Inc. | Methods and compositions for galactosylated glycoproteins |
US7029870B1 (en) | 1997-07-03 | 2006-04-18 | Human Genome Sciences, Inc. | Gabaa receptor epsilon subunits |
HUP0003418A2 (en) * | 1997-09-05 | 2001-02-28 | Glycim Oy | Synthetic divalent slex containing polylactosamines and methods for use |
JPH11103158A (en) | 1997-09-26 | 1999-04-13 | Olympus Optical Co Ltd | Flip-chip mounting to printed wiring board and mounting structure |
US7244601B2 (en) | 1997-12-15 | 2007-07-17 | National Research Council Of Canada | Fusion proteins for use in enzymatic synthesis of oligosaccharides |
JPH11221079A (en) | 1998-02-04 | 1999-08-17 | Kyowa Hakko Kogyo Co Ltd | Transglycosidase and dna encoding the same enzyme |
WO1999040208A1 (en) | 1998-02-05 | 1999-08-12 | The General Hospital Corporation | In vivo construction of dna libraries |
DK1071700T3 (en) | 1998-04-20 | 2010-06-07 | Glycart Biotechnology Ag | Glycosylation modification of antibodies to enhance antibody-dependent cellular cytotoxicity |
US6324663B1 (en) * | 1998-10-22 | 2001-11-27 | Vlsi Technology, Inc. | System and method to test internal PCI agents |
US6870565B1 (en) | 1998-11-24 | 2005-03-22 | Micron Technology, Inc. | Semiconductor imaging sensor array devices with dual-port digital readout |
ATE475714T1 (en) * | 1998-12-09 | 2010-08-15 | Phyton Holdings Llc | METHOD FOR PRODUCING GLYCOPROTEIN WITH HUMAN GLYCOSYLATION IMAGE |
ES2420835T3 (en) | 1999-04-09 | 2013-08-27 | Kyowa Hakko Kirin Co., Ltd. | Procedure to control the activity of immunofunctional molecules |
CA2382184A1 (en) * | 1999-08-19 | 2001-03-01 | Kirin Beer Kabushiki Kaisha | Novel yeast mutants and process for producing glycoprotein containing mammalian type sugar chain |
WO2001025406A1 (en) | 1999-10-01 | 2001-04-12 | University Of Victoria Innovation & Development Corporation | Mannosidases and methods for using same |
JP2003514541A (en) | 1999-11-19 | 2003-04-22 | ヒューマン ジノーム サイエンシーズ, インコーポレイテッド | 18 human secreted proteins |
AU2001241541A1 (en) | 2000-02-17 | 2001-08-27 | Millennium Predictive Medicine, Inc. | Novel genes, compositions, kits, and methods for identification, assessment, prevention, and therapy of human prostate cancer |
US6410246B1 (en) | 2000-06-23 | 2002-06-25 | Genetastix Corporation | Highly diverse library of yeast expression vectors |
US20060029604A1 (en) | 2000-06-28 | 2006-02-09 | Gerngross Tillman U | Immunoglobulins comprising predominantly a GlcNAc2Man3GlcNAc2 glycoform |
US7795002B2 (en) | 2000-06-28 | 2010-09-14 | Glycofi, Inc. | Production of galactosylated glycoproteins in lower eukaryotes |
US20060024304A1 (en) | 2000-06-28 | 2006-02-02 | Gerngross Tillman U | Immunoglobulins comprising predominantly a Man5GlcNAc2 glycoform |
US7863020B2 (en) | 2000-06-28 | 2011-01-04 | Glycofi, Inc. | Production of sialylated N-glycans in lower eukaryotes |
US7598055B2 (en) | 2000-06-28 | 2009-10-06 | Glycofi, Inc. | N-acetylglucosaminyltransferase III expression in lower eukaryotes |
US8697394B2 (en) | 2000-06-28 | 2014-04-15 | Glycofi, Inc. | Production of modified glycoproteins having multiple antennary structures |
EP2322644A1 (en) | 2000-06-28 | 2011-05-18 | GlycoFi, Inc. | Methods for producing modified glycoproteins |
US20060257399A1 (en) | 2000-06-28 | 2006-11-16 | Glycofi, Inc. | Immunoglobulins comprising predominantly a Man5GIcNAc2 glycoform |
US20060034830A1 (en) | 2000-06-28 | 2006-02-16 | Gerngross Tillman U | Immunoglobulins comprising predominantly a GalGlcNAcMan5GLcNAc2 glycoform |
US7449308B2 (en) | 2000-06-28 | 2008-11-11 | Glycofi, Inc. | Combinatorial DNA library for producing modified N-glycans in lower eukaryotes |
US7625756B2 (en) | 2000-06-28 | 2009-12-01 | GycoFi, Inc. | Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells |
US20060034828A1 (en) | 2000-06-28 | 2006-02-16 | Gerngross Tillman U | Immunoglobulins comprising predominantly a GlcNAcMAN5GLCNAC2 glycoform |
JP4092194B2 (en) * | 2000-06-30 | 2008-05-28 | フランダース インターユニバーシティ インスティテュート フォア バイオテクノロジー (ヴィーアイビー) | Protein sugar chain modification in Pichia pastoris |
US7064191B2 (en) | 2000-10-06 | 2006-06-20 | Kyowa Hakko Kogyo Co., Ltd. | Process for purifying antibody |
US6946292B2 (en) | 2000-10-06 | 2005-09-20 | Kyowa Hakko Kogyo Co., Ltd. | Cells producing antibody compositions with increased antibody dependent cytotoxic activity |
JP4655388B2 (en) | 2001-03-05 | 2011-03-23 | 富士レビオ株式会社 | Protein production method |
AU2002305903A1 (en) | 2001-05-25 | 2002-12-09 | Incyte Genomics Inc. | Carbohydrate-associated proteins |
NZ592087A (en) | 2001-08-03 | 2012-11-30 | Roche Glycart Ag | Antibody glycosylation variants having increased antibody-dependent cellular cytotoxicity |
GB0120311D0 (en) * | 2001-08-21 | 2001-10-17 | Immunoporation Ltd | Treating cells |
WO2003025148A2 (en) | 2001-09-19 | 2003-03-27 | Nuvelo, Inc. | Novel nucleic acids and polypeptides |
JP2005532253A (en) | 2001-10-25 | 2005-10-27 | ジェネンテック・インコーポレーテッド | Glycoprotein composition |
US20060024292A1 (en) | 2001-12-27 | 2006-02-02 | Gerngross Tillman U | Immunoglobulins comprising predominantly a Gal2GlcNAc2Man3GlcNAc2 glycoform |
US20060034829A1 (en) | 2001-12-27 | 2006-02-16 | Gerngross Tillman U | Immunoglobulins comprising predominantly a MAN3GLCNAC2 glycoform |
ES2402527T3 (en) | 2001-12-27 | 2013-05-06 | Glycofi, Inc. | Procedures for obtaining mammalian carbohydrate structures by genetic engineering |
US7332299B2 (en) | 2003-02-20 | 2008-02-19 | Glycofi, Inc. | Endomannosidases in the modification of glycoproteins in eukaryotes |
US7514253B2 (en) | 2003-05-16 | 2009-04-07 | Glycofi, Inc. | URA5 gene and methods for stable genetic integration in yeast |
EP1633312A4 (en) * | 2003-06-16 | 2012-09-26 | Medimmune Llc | Influenza hemagglutinin and neuraminidase variants |
ES2528739T3 (en) | 2003-12-24 | 2015-02-12 | Glycofi, Inc. | Methods to eliminate mannosyl phosphorylation of glucans in glycoprotein production |
JP2007525146A (en) | 2003-12-30 | 2007-09-06 | ガムリンク エー/エス | Chewing gum containing a biodegradable polymer and promoting degradability |
WO2005090552A2 (en) | 2004-03-17 | 2005-09-29 | Glycofi, Inc. | Method of engineering a cytidine monophosphate-sialic acid synthetic pathway in fungi and yeast |
US20050265988A1 (en) | 2004-03-18 | 2005-12-01 | Byung-Kwon Choi | Glycosylated glucocerebrosidase expression in fungal hosts |
CN101084233B (en) | 2004-04-29 | 2012-08-15 | 格利科菲公司 | Methods for reducing or eliminating alpha-mannosidase resistant glycans for the production of glycoproteins |
US7849651B2 (en) * | 2005-05-31 | 2010-12-14 | Kubota Matsushitadenko Exterior Works, Ltd. | Wall materials bracket and insulating wall structure |
JP2009507040A (en) | 2005-09-02 | 2009-02-19 | グライコフィ, インコーポレイテッド | Immunoglobulin containing mainly GLCNACMAN3GLCNAC2 glycoform |
AU2006316838B2 (en) * | 2005-11-15 | 2012-04-12 | Glycofi, Inc | Production of glycoproteins with reduced O-glycosylation |
US20080274162A1 (en) * | 2007-05-04 | 2008-11-06 | Jeffrey Nessa | Method, composition, and delivery mode for treatment of prostatitis and other urogenital infections using a probiotic rectal suppository |
TW201028431A (en) * | 2008-10-31 | 2010-08-01 | Lonza Ag | Novel tools for the production of glycosylated proteins in host cells |
JP2011039027A (en) * | 2009-07-14 | 2011-02-24 | Pacific Ind Co Ltd | Metallic resin cover, method for producing the same, and door handle for vehicle |
US9439972B2 (en) * | 2012-09-10 | 2016-09-13 | Ad Lunam Labs, Inc. | Antifungal serum |
-
2001
- 2001-06-27 EP EP10011297A patent/EP2322644A1/en not_active Withdrawn
- 2001-06-27 EP EP04025648A patent/EP1522590B1/en not_active Revoked
- 2001-06-27 WO PCT/US2001/020553 patent/WO2002000879A2/en active IP Right Grant
- 2001-06-27 CA CA002412701A patent/CA2412701A1/en not_active Abandoned
- 2001-06-27 DK DK01954606T patent/DK1297172T3/en active
- 2001-06-27 KR KR1020027017911A patent/KR100787073B1/en not_active IP Right Cessation
- 2001-06-27 NZ NZ523476A patent/NZ523476A/en not_active IP Right Cessation
- 2001-06-27 EP EP09004758A patent/EP2119793A1/en not_active Withdrawn
- 2001-06-27 US US09/892,591 patent/US7029872B2/en not_active Expired - Fee Related
- 2001-06-27 AU AU7684201A patent/AU7684201A/en active Pending
- 2001-06-27 JP JP2002506194A patent/JP2004501642A/en active Pending
- 2001-06-27 EP EP10012383.5A patent/EP2339013B1/en not_active Expired - Lifetime
- 2001-06-27 ES ES01954606T patent/ES2252261T3/en not_active Expired - Lifetime
- 2001-06-27 AU AU2001276842A patent/AU2001276842B2/en not_active Ceased
- 2001-06-27 AT AT01954606T patent/ATE309385T1/en not_active IP Right Cessation
- 2001-06-27 AT AT04025648T patent/ATE440959T1/en active
- 2001-06-27 DE DE60139720T patent/DE60139720D1/en not_active Expired - Lifetime
- 2001-06-27 DK DK04025648T patent/DK1522590T3/en active
- 2001-06-27 EP EP01954606A patent/EP1297172B1/en not_active Revoked
- 2001-06-27 ES ES04025648T patent/ES2330330T3/en not_active Expired - Lifetime
- 2001-06-27 DE DE60114830T patent/DE60114830T2/en not_active Revoked
- 2001-06-27 MX MXPA03000105A patent/MXPA03000105A/en active IP Right Grant
- 2001-06-27 PT PT04025648T patent/PT1522590E/en unknown
-
2005
- 2005-09-30 US US11/240,432 patent/US7326681B2/en not_active Expired - Fee Related
- 2005-10-11 US US11/249,061 patent/US7923430B2/en not_active Expired - Fee Related
- 2005-11-01 US US11/265,444 patent/US20070178551A1/en not_active Abandoned
- 2005-11-10 US US11/271,217 patent/US20070105127A1/en not_active Abandoned
- 2005-11-10 US US11/271,235 patent/US7629163B2/en not_active Expired - Fee Related
-
2007
- 2007-10-30 US US11/981,408 patent/US8211691B2/en not_active Expired - Fee Related
-
2009
- 2009-08-27 US US12/549,062 patent/US7981660B2/en not_active Expired - Fee Related
- 2009-11-25 CY CY20091101214T patent/CY1109639T1/en unknown
-
2010
- 2010-10-11 US US12/901,843 patent/US20110020870A1/en not_active Abandoned
-
2011
- 2011-03-17 JP JP2011059620A patent/JP2011167194A/en active Pending
-
2012
- 2012-05-01 US US13/461,111 patent/US20120322100A1/en not_active Abandoned
-
2013
- 2013-07-03 US US13/934,551 patent/US20130295604A1/en not_active Abandoned
-
2014
- 2014-05-07 US US14/271,475 patent/US20140234902A1/en not_active Abandoned
-
2015
- 2015-10-30 US US14/927,519 patent/US20160068880A1/en not_active Abandoned
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1297172B1 (en) | Methods for producing modified glycoproteins | |
AU2001276842A2 (en) | Methods for producing modified glycoproteins | |
AU2001276842A1 (en) | Methods for producing modified glycoproteins | |
US8067551B2 (en) | Combinatorial DNA library for producing modified N-glycans in lower eukaryotes | |
CA2650734A1 (en) | Production of sialylated n-glycans in lower eukaryotes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
FZDE | Discontinued |
Effective date: 20170929 |