CA2410413C - Fluorescent proteins - Google Patents
Fluorescent proteins Download PDFInfo
- Publication number
- CA2410413C CA2410413C CA2410413A CA2410413A CA2410413C CA 2410413 C CA2410413 C CA 2410413C CA 2410413 A CA2410413 A CA 2410413A CA 2410413 A CA2410413 A CA 2410413A CA 2410413 C CA2410413 C CA 2410413C
- Authority
- CA
- Canada
- Prior art keywords
- gfp
- gly
- fluorescent protein
- lys
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Abstract
A GFP with an F64L mutation and an E222G mutation is provided. This GFP has a bigger Stokes shift compared to other GFPs making it very suitable for high throughput screening due to a better resolution. This GFP also has an excitation maximum between the yellow GFP and the cyan GFP allowing for cleaner band separation when used together with those GFPs.
Description
.1 FLUORESCENT PROTEINS
Field of invention The present Invention relates to novel variants of the fluorescent protein GFP
having im-proved fluorescence properaes.
Background The discovery that Green Fluorescent Protein (GFP) from the jellyfish A.
victoria retains its fluorescent properties when expressed in heterologous cells has provided biological research with a new, unique and powerful tool (Chalfie et al (1994). Science 263:802;
Prasher (1995) Trends in Genetics 11:320; WO 95/07463). A very important aspect of using recombinant, fluorescent proteins in studying cellular functions is the non-invasive nature of the assay. This allows detecfion of cellular events in intact, living cells.
The excitation spectrum of the green fluorescent protein from Aequorea victona shows two peaks: A major peak at 396nm, which is in the poten6ally cell damaging UV
range, and a lesser peak at 475nm, which is in an excitation range that is much less harmful to cells.
To improve the wild type GFP, a range of mutations have been described. Heim (GFP
(Heim et at. (1994). Proc.Natl.Acad.Sci. 91:12501) described the discovery of a blue fluo-rescent variant which has gti^eatly ina eased the potential applications of using fluorescent recombinant probes to monitor cellular events or fundions, since the availability of probes having different excitation and emission spectra pemfds simultaneous monitoring of more than one process. However, the blue fluorescing variant described by Heim et al, Y66H-GFP, suffers from certain limitations: The blue fluorescence is weak (emission maximum at 448nm), thus making detection difficult, and necessitating prolonged exdtation of cells expressing Y66H-GFP. Moreover, the prolonged period of excitation is damaging to cells especially because the excitation wavelength is in the UV range, 360nm -390nm.
iieim et al.(1995), Nature, Vol. 373, p. 663-4, disdoses a Ser65Thr mutation of GFP
(S65T) having longer wavelengths of excitation and emission, 490nm and 510nm, re-CONFIRMATION COPY
Field of invention The present Invention relates to novel variants of the fluorescent protein GFP
having im-proved fluorescence properaes.
Background The discovery that Green Fluorescent Protein (GFP) from the jellyfish A.
victoria retains its fluorescent properties when expressed in heterologous cells has provided biological research with a new, unique and powerful tool (Chalfie et al (1994). Science 263:802;
Prasher (1995) Trends in Genetics 11:320; WO 95/07463). A very important aspect of using recombinant, fluorescent proteins in studying cellular functions is the non-invasive nature of the assay. This allows detecfion of cellular events in intact, living cells.
The excitation spectrum of the green fluorescent protein from Aequorea victona shows two peaks: A major peak at 396nm, which is in the poten6ally cell damaging UV
range, and a lesser peak at 475nm, which is in an excitation range that is much less harmful to cells.
To improve the wild type GFP, a range of mutations have been described. Heim (GFP
(Heim et at. (1994). Proc.Natl.Acad.Sci. 91:12501) described the discovery of a blue fluo-rescent variant which has gti^eatly ina eased the potential applications of using fluorescent recombinant probes to monitor cellular events or fundions, since the availability of probes having different excitation and emission spectra pemfds simultaneous monitoring of more than one process. However, the blue fluorescing variant described by Heim et al, Y66H-GFP, suffers from certain limitations: The blue fluorescence is weak (emission maximum at 448nm), thus making detection difficult, and necessitating prolonged exdtation of cells expressing Y66H-GFP. Moreover, the prolonged period of excitation is damaging to cells especially because the excitation wavelength is in the UV range, 360nm -390nm.
iieim et al.(1995), Nature, Vol. 373, p. 663-4, disdoses a Ser65Thr mutation of GFP
(S65T) having longer wavelengths of excitation and emission, 490nm and 510nm, re-CONFIRMATION COPY
spectively, than the wild-type GFP and wherein the fluorophore formation proceeded about fourfoid more rapidly than in the wild-type GFP.
Ehrig et al. (1995) FEBS Letters 367, 163-166, discioses a E222G mutant of the Aequo-rea green fluorescent protein. This mutation has an excitation maximum of 481 nm and an emission maximum at 506nm.
Expression of GFP or its fluorescent variants in living cells provides a valuable tool for studying cellular events and it is well known that many cells, including mammalian cells, are incubated at approximately 37 C in order to secure optimal and/or physiologically relevant growth. Cell lines originating from different organisms or tissues may have differ-ent relevant temperatures ranging from about 35 C for fibroblasts to about 38 C - 39 C for mouse D-cells. Experience has shown, however, that the fluorescent signal from cells ex-pressing GFP is weak or absent when said cells are incubated at temperatures above room temperature, cf. Webb, C.D. et al., Journal of Bacteriology, Oct. 1995, p. 5906-5911.
Ogawa H. et al., Proc. Natl. Acad. Sci. USA, Vol. 92, pp. 11899-11903, December 1995, and Lim et al. J. Biochem. 118, 13-17 (1995). The improved fluorescent variant S65T de-scribed by Heim et al. (1995) supra also displays very low fluorescence when incubated under normal culture conditions (37 C), cf. Kaether and Gerdes FEBS Letters 369 (1995) pp. 267-271. Many experiments involving the study of cell metabolism are dependent on the possibility of incubating the cells at physiologically relevant temperatures, i.e. tem-peratures at about 37 C.
Thastrup et al. (1997) EP 0 851 874 describes fluorescent proteins that exhibit high fluo-rescence in cells expressing them when said cells are incubated at a temperature of 30 C or above. This is obtained with the amino acid in position I preceding the chromophore has been mutated. Examples of such mutations are F64L, F641, F64V F64A and F64G.
Various authors have experimented with combinations of mutations. One such combination is the F64L, S65T GFP (EGFP). EGFP exhibits high fluorescence when expressed at 30 C
or above and has an excitation maximum at 488nm.
Ehrig et al. (1995) FEBS Letters 367, 163-166, discioses a E222G mutant of the Aequo-rea green fluorescent protein. This mutation has an excitation maximum of 481 nm and an emission maximum at 506nm.
Expression of GFP or its fluorescent variants in living cells provides a valuable tool for studying cellular events and it is well known that many cells, including mammalian cells, are incubated at approximately 37 C in order to secure optimal and/or physiologically relevant growth. Cell lines originating from different organisms or tissues may have differ-ent relevant temperatures ranging from about 35 C for fibroblasts to about 38 C - 39 C for mouse D-cells. Experience has shown, however, that the fluorescent signal from cells ex-pressing GFP is weak or absent when said cells are incubated at temperatures above room temperature, cf. Webb, C.D. et al., Journal of Bacteriology, Oct. 1995, p. 5906-5911.
Ogawa H. et al., Proc. Natl. Acad. Sci. USA, Vol. 92, pp. 11899-11903, December 1995, and Lim et al. J. Biochem. 118, 13-17 (1995). The improved fluorescent variant S65T de-scribed by Heim et al. (1995) supra also displays very low fluorescence when incubated under normal culture conditions (37 C), cf. Kaether and Gerdes FEBS Letters 369 (1995) pp. 267-271. Many experiments involving the study of cell metabolism are dependent on the possibility of incubating the cells at physiologically relevant temperatures, i.e. tem-peratures at about 37 C.
Thastrup et al. (1997) EP 0 851 874 describes fluorescent proteins that exhibit high fluo-rescence in cells expressing them when said cells are incubated at a temperature of 30 C or above. This is obtained with the amino acid in position I preceding the chromophore has been mutated. Examples of such mutations are F64L, F641, F64V F64A and F64G.
Various authors have experimented with combinations of mutations. One such combination is the F64L, S65T GFP (EGFP). EGFP exhibits high fluorescence when expressed at 30 C
or above and has an excitation maximum at 488nm.
STJMMARY OF THE INVENTION
The present invention provides novel fluorescent proteins, such as F64L-E222G-GFP that result in a cellular fluorescence far exceeding the cellular fluorescence when expressed at 37 C and when excitated at 450 to 500nm compared to the parent proteins, i.e. GFP, the blue variant Y66H-GFP the S65T-GFP variant, and F64L-GFP. This greatly improves the usefulness of fluorescent proteins in studying cellular functions in living cells.
It is shown that GFP mutated at the 64 position from F to L (F64L) and at the 222 position from E to G
(E222G) has remarkable properties. It is first shown that the F64L,E222G-GFP has an entirely different spectrum than F64L,S65T-GFP (Example 2). In contrast, there is no substantial difference between folding characteristics (measured as the time when fluorescence is observed between the two GFPs, Example 3). Likewise, there was no difference between the pH sensitivity of the two GFPs (Example 4). The observed brightness of the E222G versus the S65T mutated F64L-GFPs is dependent on the test conditions (Example 5).
In one aspect, the invention provides a fluorescent protein derived from Green Fluorescent Protein (GFP), said fluorescent protein obtainable with a DNA
molecule encoding it in humanised enhanced codon context, wherein an amino acid at a position corresponding to position 65 of SEQ ID NO: 4 has been substituted by an aliphatic amino acid and wherein a glutamic acid at a position corresponding to position 223 of SEQ ID NO: 4 has been substituted by an amino acid selected from G, A, V, L, I, F, S, T, N or Q, said mutated fluorescent protein having 3a an excitation maximum at a higher wavelength and fluorescence being increased when said fluorescent protein is expressed in cells incubated at a temperature of 30 C or above compared to wild-type GFP.
In another aspect, the invention provides a fluorescent protein comprising the amino acid sequence disclosed in SEQ ID NO: 4.
In another aspect, the invention provides the fluorescent protein as described above, linked to a polypeptide.
In another aspect, the invention provides a nucleic acid molecule comprising a nucleotide sequence coding for the fluorescent protein as described above.
In another aspect, the invention provides a cell transformed with a nucleic acid molecule as described above.
In another aspect, the invention provides a process for preparing the fluorescent protein as described above, comprising cultivating the cell as described above and obtaining therefrom the fluorescent protein expressed by said nucleic acid molecule.
In another aspect, the invention provides use of the fluorescent protein as described above in an in vitro assay for measuring protein kinase activity, or dephosphorylation activity, or for measuring protein redistribution.
DETAILED DESCRIPTION OF THE INVENTION
One aspect of the pr.esent invention relates to a fluorescent protein derived from Green Fluorescent Protein (GFP) or any functional GFP arialogue, wherein the amino acid 3b in position 1 preceding the chromophore has been mutated and wherein the Glutamic acid in position 222 has been mutated said mutated GFP has an excitation maximum at a higher wavelength compared to F64L-GFP and the fluorescence is increased when the mutated GFP is expressed in cells incubated at a temperature of 30 C or above compared to wild-type GFP.
The excitation and emission characteristics of the F64L,E222G-GFP differ significantly from wild-type GFP and EGFP. Existing fluorescent proteins have demonstrated utility for research applications such as quantitative fluorescence microscopy (Patterson, G.H., et al (1997) Biophysical J. 73:2782-2790; Piston, D.W., et al (1999) Meth. Cell Biol. 58:31-48). It is now clear, however, that the optimal fluorescent protein characteristics for high-throughput screening (HTS) applications in drug discovery differ somewhat from those for research applications (Kain, S. R. (1999) Drug Discovery Today 4:304-312). For example, factors such as optimal and signal/noise are more important for HTS applications in drug discovery than are absolute brightness of probes such as fluorescent proteins. The F64L,E222G-GFP described in this patent application has an excitation maximum of 470 nm and an emission maximum of 505 nm (see Figure 3:), compared to the respective ex-citation and emission maxima of 490 nm and 510 nm for EGFP. This results in a Stokes shift of 35 nm for F64L,E222G-GFP, as compared to 20 nm for EGFP. This results in a significant increase in the excitation-emission band separation for F64L,E222G-GFP rela-tive to EGFP with several implications for the use of F64L,E222G-GFP in high-throughput screening. Some of these are listed below:
1. The increased Stokes shift of F64L,E222G-GFP results in increased spectral resolution of its excitation and emission peaks. This enables more complete band separation us-ing a conventional dichroic beam-splitter, and decreased background signal for assays incorporating F64L,E222G-GFP relative to assays based on EGFP.
2. F64L,E222G-GFP fluorescence can be excited by conventional light sources using nar-row band filters, or commercially available laser producing lines at 472 nm.
In either case, the greater Stokes shift of F64L,E222G-GFP results in lower cross-talk from ex-citation light to the toe of the emission spectrum.
3. The excitation maximum of F64L,E222G-GFP falls midway between those of the cyan fluorescent protein variant (ECFP, excitation max -433 nm) and the yellow fluorescent protein variant (EYFP, excitation max -513 nm). Because of this, it will allow for cleaner band separation when used together with those probes, and it is optimized for assay applications in which several GFP-Iabeled components will be multiplexed.
Many sources of GFPs exist. Examples are GFP derived from Aequorea victoria and GFP
derived from Renilla. Various GFPs have been isolated from Renilla examples are reni-formis and mulleri. As described in the examples and in SEQ ID NOs: 3 and 4, the chro-mophore in Aequorea victoria is in position 65-67 of the predicted primary amino acid se-quence of GFP. Thus, in a preferred embodiment the GFP is derived from Aequorea vic-toria.
It is preferred that the mutation at F64 is a mutation to an aliphatic amino acid. Examples are F64L, F641, F64V, F64A, and F64G, wherein the F64L substitution being most preferred.
However other mutations, e.g. deletions, insertions, or post-translational modifications im-mediately preceding the chromophore are also included in the invention, provided that they result in improved fluorescence properties of the various fluorescent proteins. It should be noted that extensive deletions may result in loss of the fluorescent properties of GFP.
The E222G, E222A, E222V, E222L, E2221, E222F, E222S, E222T, E222N, E222Q sub-stitutions are preferred, the E222G substitution (that is substitution to Glycine) being most 5 preferred.
A preferred sequence of the gene encoding GFP derived from Aequorea victoria is dis-closed in SEQ ID NO: 3 (enhanced) and in SEQ ID NO: 7 gelly fish). SEQ ID NO:
1 shows the nucleotide sequence of F64L-GFP with humanised codon. SEQ ID NO: 5 shows the nucleotide sequence of F64L-GFP with jellyfish codon. Besides, the novel fluorescent proteins may also be derived from other fluorescent proteins as mentioned above.
Herein the abbreviations used for the amino acids are those stated in J. Biol.
Chem. 243 (1968), 3558.
One aspect of the invention relates to a nucleotide sequence coding for the Fluorescent protein F64L-E222G-GFP. An example of such F64L-E222G-GFP is shown in list 2.
In a preferred aspect the nucleotide sequence is in the form of a DNA sequence.
The DNA construct of the invention encoding the novel fluorescent proteins may be pre-pared synthetically by established standard methods, e.g. the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981), 1859 -1869, or the method described by Matthes et al., EMBO Journal 3 (1984), 801 - 805.
According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA
synthesizer, purified, annealed, ligated and cloned in suitable vectors.
The DNA construct may also be prepared by polymerase chain reaction (PCR) using spe-cific primers, for instance as described in US 4,683,202 or Saiki et al., Science 239 (1988), 487 - 491. A more recent review of PCR methods may be found in PCR
Protocols, 1990, Academic Press, San Diego, California, USA.
The DNA construct of the invention may be inserted into a recombinant vector which may be any vector which may conveniently be subjected to recombinant DNA
procedures. The choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an ex-trachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromo-some(s) into which it has been integrated.
The vector is preferably an expression vector in which the DNA sequence encoding the fluorescent protein of the invention is operably linked to additional segments required for transcription of the DNA. In general, the expression vector is derived from plasmid or viral DNA, or may contain elements of both. The term, "operably linked" indicates that the segments are arranged so that they function in concert for their intended purposes, e.g.
transcription initiates in a promoter and proceeds through the DNA sequence coding for the fluorescent protein of the invention.
The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell, including native Aequorea GFP genes.
Examples of suitable promoters for directing the transcription of the DNA
sequence en-coding the fluorescent protein of the invention in mammalian cells are the SV40 promoter (Subramani et al., Mol. Cell Biol. 1(1981), 854 -864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222 (1983), 809 - 814) or the adenovirus 2 major late promoter.
An example of a suitable promoter for use in insect cells is the polyhedrin promoter (US
4,745,051; Vasuvedan et al., FEBS Lett. 311, (1992) 7 - 11), the P10 promoter (J.M. Viak et al., J. Gen. Virology 69, 1988, pp. 765-776), the Autographa californica polyhedrosis virus basic protein promoter (EP 397 485), the baculovirus immediate early gene 1 pro-moter (US 5,155,037; US 5,162,222), or the baculovirus 39K delayed-early gene promot:er (US 5,155,037; US 5,162,222).
Examples of suitable promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255 (1980), 12073 - 12080;
Alber and Kawasaki, J. Mol. Appi. Gen. 1 (1982), 419 - 434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds.), Plenum Press, New York, 1982), or the TPI1 (US 4,599,311) or ADH2-4c (Russell et al., Nature 304 (1983), 652 - 654) promoters.
The present invention provides novel fluorescent proteins, such as F64L-E222G-GFP that result in a cellular fluorescence far exceeding the cellular fluorescence when expressed at 37 C and when excitated at 450 to 500nm compared to the parent proteins, i.e. GFP, the blue variant Y66H-GFP the S65T-GFP variant, and F64L-GFP. This greatly improves the usefulness of fluorescent proteins in studying cellular functions in living cells.
It is shown that GFP mutated at the 64 position from F to L (F64L) and at the 222 position from E to G
(E222G) has remarkable properties. It is first shown that the F64L,E222G-GFP has an entirely different spectrum than F64L,S65T-GFP (Example 2). In contrast, there is no substantial difference between folding characteristics (measured as the time when fluorescence is observed between the two GFPs, Example 3). Likewise, there was no difference between the pH sensitivity of the two GFPs (Example 4). The observed brightness of the E222G versus the S65T mutated F64L-GFPs is dependent on the test conditions (Example 5).
In one aspect, the invention provides a fluorescent protein derived from Green Fluorescent Protein (GFP), said fluorescent protein obtainable with a DNA
molecule encoding it in humanised enhanced codon context, wherein an amino acid at a position corresponding to position 65 of SEQ ID NO: 4 has been substituted by an aliphatic amino acid and wherein a glutamic acid at a position corresponding to position 223 of SEQ ID NO: 4 has been substituted by an amino acid selected from G, A, V, L, I, F, S, T, N or Q, said mutated fluorescent protein having 3a an excitation maximum at a higher wavelength and fluorescence being increased when said fluorescent protein is expressed in cells incubated at a temperature of 30 C or above compared to wild-type GFP.
In another aspect, the invention provides a fluorescent protein comprising the amino acid sequence disclosed in SEQ ID NO: 4.
In another aspect, the invention provides the fluorescent protein as described above, linked to a polypeptide.
In another aspect, the invention provides a nucleic acid molecule comprising a nucleotide sequence coding for the fluorescent protein as described above.
In another aspect, the invention provides a cell transformed with a nucleic acid molecule as described above.
In another aspect, the invention provides a process for preparing the fluorescent protein as described above, comprising cultivating the cell as described above and obtaining therefrom the fluorescent protein expressed by said nucleic acid molecule.
In another aspect, the invention provides use of the fluorescent protein as described above in an in vitro assay for measuring protein kinase activity, or dephosphorylation activity, or for measuring protein redistribution.
DETAILED DESCRIPTION OF THE INVENTION
One aspect of the pr.esent invention relates to a fluorescent protein derived from Green Fluorescent Protein (GFP) or any functional GFP arialogue, wherein the amino acid 3b in position 1 preceding the chromophore has been mutated and wherein the Glutamic acid in position 222 has been mutated said mutated GFP has an excitation maximum at a higher wavelength compared to F64L-GFP and the fluorescence is increased when the mutated GFP is expressed in cells incubated at a temperature of 30 C or above compared to wild-type GFP.
The excitation and emission characteristics of the F64L,E222G-GFP differ significantly from wild-type GFP and EGFP. Existing fluorescent proteins have demonstrated utility for research applications such as quantitative fluorescence microscopy (Patterson, G.H., et al (1997) Biophysical J. 73:2782-2790; Piston, D.W., et al (1999) Meth. Cell Biol. 58:31-48). It is now clear, however, that the optimal fluorescent protein characteristics for high-throughput screening (HTS) applications in drug discovery differ somewhat from those for research applications (Kain, S. R. (1999) Drug Discovery Today 4:304-312). For example, factors such as optimal and signal/noise are more important for HTS applications in drug discovery than are absolute brightness of probes such as fluorescent proteins. The F64L,E222G-GFP described in this patent application has an excitation maximum of 470 nm and an emission maximum of 505 nm (see Figure 3:), compared to the respective ex-citation and emission maxima of 490 nm and 510 nm for EGFP. This results in a Stokes shift of 35 nm for F64L,E222G-GFP, as compared to 20 nm for EGFP. This results in a significant increase in the excitation-emission band separation for F64L,E222G-GFP rela-tive to EGFP with several implications for the use of F64L,E222G-GFP in high-throughput screening. Some of these are listed below:
1. The increased Stokes shift of F64L,E222G-GFP results in increased spectral resolution of its excitation and emission peaks. This enables more complete band separation us-ing a conventional dichroic beam-splitter, and decreased background signal for assays incorporating F64L,E222G-GFP relative to assays based on EGFP.
2. F64L,E222G-GFP fluorescence can be excited by conventional light sources using nar-row band filters, or commercially available laser producing lines at 472 nm.
In either case, the greater Stokes shift of F64L,E222G-GFP results in lower cross-talk from ex-citation light to the toe of the emission spectrum.
3. The excitation maximum of F64L,E222G-GFP falls midway between those of the cyan fluorescent protein variant (ECFP, excitation max -433 nm) and the yellow fluorescent protein variant (EYFP, excitation max -513 nm). Because of this, it will allow for cleaner band separation when used together with those probes, and it is optimized for assay applications in which several GFP-Iabeled components will be multiplexed.
Many sources of GFPs exist. Examples are GFP derived from Aequorea victoria and GFP
derived from Renilla. Various GFPs have been isolated from Renilla examples are reni-formis and mulleri. As described in the examples and in SEQ ID NOs: 3 and 4, the chro-mophore in Aequorea victoria is in position 65-67 of the predicted primary amino acid se-quence of GFP. Thus, in a preferred embodiment the GFP is derived from Aequorea vic-toria.
It is preferred that the mutation at F64 is a mutation to an aliphatic amino acid. Examples are F64L, F641, F64V, F64A, and F64G, wherein the F64L substitution being most preferred.
However other mutations, e.g. deletions, insertions, or post-translational modifications im-mediately preceding the chromophore are also included in the invention, provided that they result in improved fluorescence properties of the various fluorescent proteins. It should be noted that extensive deletions may result in loss of the fluorescent properties of GFP.
The E222G, E222A, E222V, E222L, E2221, E222F, E222S, E222T, E222N, E222Q sub-stitutions are preferred, the E222G substitution (that is substitution to Glycine) being most 5 preferred.
A preferred sequence of the gene encoding GFP derived from Aequorea victoria is dis-closed in SEQ ID NO: 3 (enhanced) and in SEQ ID NO: 7 gelly fish). SEQ ID NO:
1 shows the nucleotide sequence of F64L-GFP with humanised codon. SEQ ID NO: 5 shows the nucleotide sequence of F64L-GFP with jellyfish codon. Besides, the novel fluorescent proteins may also be derived from other fluorescent proteins as mentioned above.
Herein the abbreviations used for the amino acids are those stated in J. Biol.
Chem. 243 (1968), 3558.
One aspect of the invention relates to a nucleotide sequence coding for the Fluorescent protein F64L-E222G-GFP. An example of such F64L-E222G-GFP is shown in list 2.
In a preferred aspect the nucleotide sequence is in the form of a DNA sequence.
The DNA construct of the invention encoding the novel fluorescent proteins may be pre-pared synthetically by established standard methods, e.g. the phosphoamidite method described by Beaucage and Caruthers, Tetrahedron Letters 22 (1981), 1859 -1869, or the method described by Matthes et al., EMBO Journal 3 (1984), 801 - 805.
According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA
synthesizer, purified, annealed, ligated and cloned in suitable vectors.
The DNA construct may also be prepared by polymerase chain reaction (PCR) using spe-cific primers, for instance as described in US 4,683,202 or Saiki et al., Science 239 (1988), 487 - 491. A more recent review of PCR methods may be found in PCR
Protocols, 1990, Academic Press, San Diego, California, USA.
The DNA construct of the invention may be inserted into a recombinant vector which may be any vector which may conveniently be subjected to recombinant DNA
procedures. The choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an ex-trachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromo-some(s) into which it has been integrated.
The vector is preferably an expression vector in which the DNA sequence encoding the fluorescent protein of the invention is operably linked to additional segments required for transcription of the DNA. In general, the expression vector is derived from plasmid or viral DNA, or may contain elements of both. The term, "operably linked" indicates that the segments are arranged so that they function in concert for their intended purposes, e.g.
transcription initiates in a promoter and proceeds through the DNA sequence coding for the fluorescent protein of the invention.
The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell, including native Aequorea GFP genes.
Examples of suitable promoters for directing the transcription of the DNA
sequence en-coding the fluorescent protein of the invention in mammalian cells are the SV40 promoter (Subramani et al., Mol. Cell Biol. 1(1981), 854 -864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222 (1983), 809 - 814) or the adenovirus 2 major late promoter.
An example of a suitable promoter for use in insect cells is the polyhedrin promoter (US
4,745,051; Vasuvedan et al., FEBS Lett. 311, (1992) 7 - 11), the P10 promoter (J.M. Viak et al., J. Gen. Virology 69, 1988, pp. 765-776), the Autographa californica polyhedrosis virus basic protein promoter (EP 397 485), the baculovirus immediate early gene 1 pro-moter (US 5,155,037; US 5,162,222), or the baculovirus 39K delayed-early gene promot:er (US 5,155,037; US 5,162,222).
Examples of suitable promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255 (1980), 12073 - 12080;
Alber and Kawasaki, J. Mol. Appi. Gen. 1 (1982), 419 - 434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds.), Plenum Press, New York, 1982), or the TPI1 (US 4,599,311) or ADH2-4c (Russell et al., Nature 304 (1983), 652 - 654) promoters.
Examples of suitable promoters for use in filamentous fungus host cells are, for instance, the ADH3 promoter (McKnight et al., The EMBO J. 4 (1985), 2093 - 2099) or the t~iA
promoter. Examples of other useful promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral a-amylase, A. niger acid stable a-amylase, A. niger or A. awamori glucoamylase (gluA), Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate iso-merase or A. nidulans acetamidase. Preferred are the TAKA-amylase and gluA
promot-ers.
Examples of suitable promoters for use in bacterial host cells include the promoter of the Bacillus stearothermophilus maltogenic amylase gene, the Bacillus licheniformis alpha-amylase gene, the Bacillus amyloliquefaciens BAN amylase gene, the Bacillus subtilis al-kaline protease gene, or the Bacillus pumilus xylosidase gene, or by the phage Lambda PR or PL promoters or the E. coli lac, trp or tac promoters.
The DNA sequence encoding the novel fluorescent proteins of the invention may also, if necessary, be operably connected to a suitable terminator, such as the human growth hormone terminator (Palmiter et al., pp. cit.) or (for fungal hosts) the TPI1 (Alber and Ka-wasaki, op. cit.) or ADH3 (McKnight et al., op. cit.) terminators. The vector may further comprise elements such as polyadenylation signals (e.g. from SV40 or the adenovirus 5 Elb region), transcriptional enhancer sequences (e.g. the SV40 enhancer) and transla-tional enhancer sequences (e.g. the ones encoding adenovirus VA RNAs).
The recombinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question. An example of such a sequence (when the host cell is a mammalian cell) is the SV40 origin of replication.
When the host cell is a yeast cell, suitable sequences enabling the vector to replicate are the yeast plasmid 2 replication genes REP 1-3 and origin of replication.
The vector may also comprise a selectable marker, e.g. a gene the product of which com-plements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40, 1985, pp. 125-130), or one which confers resistance to a drug, e.g.
ampicillin, kana-mycin, tetracyclin, chloramphenicol, neomycin or hygromycin. For filamentous fungi, se-lectable markers include amdS, pyrG, argg, niaD, sC.
The procedures used to ligate the DNA sequences coding for the fluorescent protein of the invention, the promoter and optionally the terminator and/or secretory signal se-quence, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al., 1989, Molecular Cloning : A Laboratory Manual, 2nd ed., CSHL Press).
The host cell into which the DNA construct or the recombinant vector of the invention is introduced may be any cell which is capable of expressing the present DNA
construct and indudes bacteria, yeast, fungi and higher eukaryotic cells.
Examples of bacterial host cells which, on cultivation, are capable of expressit-g U-ie DNA
c.-uristruc[ of the invenGon are grarriposiGve bacteria, e.g. strairis of Bacillus, such as B.
subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophiJus, B.
alkalophilus, B.
amylollquefaciens, B. coagulans, B. circulans, B. lautus, B. megatherium or B.
thuringien-9 5 sis, or strains of Streptomyces, such as S. lividans or S. murinus, or gramnegative bacte-ria such as Echerichia coli. The transfomiation of the bacteria may be effected by proto-plast transformation or by using competent cells in a manner known per se (cf.
Sambrook et al., su ra .
Examples of suitable mammalian cell lines are the HEK293 and the HeLa cell lines, pri-mary cells, and the COS (e.g. ATCC CRL 1650), BHK (e.g. ATCC CRL 1632, ATCC
CCL
promoter. Examples of other useful promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral a-amylase, A. niger acid stable a-amylase, A. niger or A. awamori glucoamylase (gluA), Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate iso-merase or A. nidulans acetamidase. Preferred are the TAKA-amylase and gluA
promot-ers.
Examples of suitable promoters for use in bacterial host cells include the promoter of the Bacillus stearothermophilus maltogenic amylase gene, the Bacillus licheniformis alpha-amylase gene, the Bacillus amyloliquefaciens BAN amylase gene, the Bacillus subtilis al-kaline protease gene, or the Bacillus pumilus xylosidase gene, or by the phage Lambda PR or PL promoters or the E. coli lac, trp or tac promoters.
The DNA sequence encoding the novel fluorescent proteins of the invention may also, if necessary, be operably connected to a suitable terminator, such as the human growth hormone terminator (Palmiter et al., pp. cit.) or (for fungal hosts) the TPI1 (Alber and Ka-wasaki, op. cit.) or ADH3 (McKnight et al., op. cit.) terminators. The vector may further comprise elements such as polyadenylation signals (e.g. from SV40 or the adenovirus 5 Elb region), transcriptional enhancer sequences (e.g. the SV40 enhancer) and transla-tional enhancer sequences (e.g. the ones encoding adenovirus VA RNAs).
The recombinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question. An example of such a sequence (when the host cell is a mammalian cell) is the SV40 origin of replication.
When the host cell is a yeast cell, suitable sequences enabling the vector to replicate are the yeast plasmid 2 replication genes REP 1-3 and origin of replication.
The vector may also comprise a selectable marker, e.g. a gene the product of which com-plements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40, 1985, pp. 125-130), or one which confers resistance to a drug, e.g.
ampicillin, kana-mycin, tetracyclin, chloramphenicol, neomycin or hygromycin. For filamentous fungi, se-lectable markers include amdS, pyrG, argg, niaD, sC.
The procedures used to ligate the DNA sequences coding for the fluorescent protein of the invention, the promoter and optionally the terminator and/or secretory signal se-quence, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al., 1989, Molecular Cloning : A Laboratory Manual, 2nd ed., CSHL Press).
The host cell into which the DNA construct or the recombinant vector of the invention is introduced may be any cell which is capable of expressing the present DNA
construct and indudes bacteria, yeast, fungi and higher eukaryotic cells.
Examples of bacterial host cells which, on cultivation, are capable of expressit-g U-ie DNA
c.-uristruc[ of the invenGon are grarriposiGve bacteria, e.g. strairis of Bacillus, such as B.
subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophiJus, B.
alkalophilus, B.
amylollquefaciens, B. coagulans, B. circulans, B. lautus, B. megatherium or B.
thuringien-9 5 sis, or strains of Streptomyces, such as S. lividans or S. murinus, or gramnegative bacte-ria such as Echerichia coli. The transfomiation of the bacteria may be effected by proto-plast transformation or by using competent cells in a manner known per se (cf.
Sambrook et al., su ra .
Examples of suitable mammalian cell lines are the HEK293 and the HeLa cell lines, pri-mary cells, and the COS (e.g. ATCC CRL 1650), BHK (e.g. ATCC CRL 1632, ATCC
CCL
10), CHL (e.g. ATCC CCL39) or CHO (e.g. ATCC CCL 61) cell lines. Methods of trans-fecting mammalian cells and expressing DNA sequences introduced in the cells are de-scribed in e.g. Kaufman and Sharp, J. Mol. Biol. 159 (1982), 601 - 621;
Southem and Berg, J. Mol. Appi. Genet 1(1982), 327 - 341; Loyter et al., Proc. Nati. Acad.
Sci. USA 79 (1982), 422 - 426; Wigler et al., Cell 14 (1978), 725; Corsaro and Pearson, Somatic Cell Genetics 7(1981), 603, Graham and van der Eb, Uro 52 (1973), 456; and Neumann et al., EMBO J. 1(1982), 841 - 845.
Examples of suitable yeast cells include cells of Saccharomyces spp. or Schizosaccha-romyces spp., in par6cular strains of Saccharomyces cerevisiae or Saccharomyces kluyveri. Methods for transforming yeast cells with heterologous DNA and producing het-erologous polypeptides therefrom are described, e.g. in US 4,599,311, US
4,931,373, US
4,870,008, 5,037,743, and US 4,845,075..
Transformed cells are selected by a phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient, e.g.
leucine. A preferred vector for use in yeast is the POT1 vector disclosed in US 4,931,373.
The DNA sequence encoding the fluorescent protein of the invention may be preceded by a signal sequence and optionally a leader sequence , e.g. as described above.
Further examples of suitable yeast cells are strains of Kluyveromyces, such as K
lactis, Hanse-nula, e.g. H. polymorpha, or Pichia, e.g. P. pastoris (cf. Gleeson et al., J.
Gen. Microbiol.
132, 1986, pp. 3459-3465; US 4,882,279).
Examples of other fungal cells are cells of filamentous fungi, e.g.
Aspergillus spp., Neu-rospora spp., Fusarium spp. or Trichoderma spp., in particular strains of A.
oryzae, A.
nidulans or A. niger. The use of Aspergillus spp. for the expression of proteins is de-scribed in, e.g., EP 272 277, EP 230 023, EP 184 438.
When a filamentous fungus is used as the host cell, it may be transformed with the DNA
construct of the invention, conveniently by integrafing the DNA construct in the host chro-mosome to obtain a recombinant host cell. This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. in-tegration of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g. by homologous or heterologous recombination.
Transformation of insect cells and production of heterologous polypeptides therein may be performed as described in US 4,745,051; US 4,879,236; US 5,155,037; 5,162,222;
EP
397,485).. The insect cell line used as the host may suitably be a Lepidoptera cell line, such as Spodoptera frugiperda cells or Trichoplusia ni cells (cf. US 5,077,214). Culture conditions may suitably be as described in, for instance, WO 89/01029 or WO 89/01028, or any of the aforementioned references.
One aspect of the invention relates to a host transformed with a DNA eonstruct according to any of the preceding aspects. The transformed or transfected host cell described above is then cultured in a suitable nutrient medium under conditions permitting the expression of the present DNA construct after which the cells may be used in the screening method of the invention. Altematively, the cells may be disrupted after which cell extracts and/or supematants may be analysed forfluorescence.
The medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supple-ments. Suitable media are available from commercial suppliers or may be prepared ac-cording to published recipes (e.g. in catalogues of the American Type Culture Collection).
5 In the method of the invention, the fluorescence of cells transformed or transfected with the DNA construct of the invention may suitably be measured in a spectrometer or a fluo-rescence microscope where the spectral properties of the cells in liquid culture may be determined as scans of light excitation and emission.
One aspect of the invention relates to a fusion compound consisting of a fluorescent pro-10 tein (F64L-E222G-GFP ), wherein the (F64L-E222G-GFP ) is linked to a polypeptide. Ex-amples of such polypeptide is kinase, preferably the catalytic subunit of protein kinase A, or protein kinase C, or Erk1, or a cytoskeletal element.
The invention further relates to a process for preparing a polypeptide, comprising culti-vating a host according to any of the preceding aspects and obtaining therefrom the poly-peptide expressed by said nucleotide sequence.
The various aspects of the invention have a plethora of uses. Some of these are de-scribed below:
Use of F64L-E222G-GFP in an in vitro assay for measuring protein kinase activity, or dephosphorylation activity, or for measuring protein redistribution.
Use of F64L-E222G-GFP as a protein tag in living and fixed cells. Due to the strong fluo-rescence the novel proteins are suitable tags for proteins present at low concentrations.
Since no substrate is needed and visualisation of the cells does not damage the cells dy-namic analysis can be performed.
Use as an organelle tag. More than one organelle can be tagged and visualised simulta-neously in living cells, e.g. the endoplasmic reticulum and the cytoskeleton.
Use as a secretion marker. By fusion of F64L-E222G-GFP to a signal peptide or a peptide to be secreted, secretion may be followed on-line in living cells. A
precondition for that is that the maturation of a detectable number of novel fluorescent protein molecules occurs faster than the secretion.
Use as genetic reporter or protein tag in transgenic animals. Due to the strong fluores-cence of the novel proteins, they are suitable as tags for proteins and gene expression, since the signal to noise ratio is significantly improved over the prior art proteins, such as wild-type GFP.
Use as a cell or organelle integrity marker. By co-expressing two of the novel proteins, the one targeted to an organelle and the other expressed in the cytosol, it is possible to cal-culate the relative leakage of the cytosolic protein and use that as a measure of cell inte-grety.
Use as a marker for changes in cell morphology. Expression of the novel proteins in cells allows easy detection of changes in cell morphology, e.g. blebbing, caused by cytotoxic agents or apoptosis. Such morphological changes are difficult to visualize in intact cells without the use of fluorescent probes.
Use as a transfection marker, and as a marker to be used in combination with FACS
sorting. Due to the increased brightness of the novel proteins the quality of cell detection and sorting can be significantly improved.
Use as real-time probe working at near physiological concentrations Since F64L-GFP is significantly brighter than wild type GFP and F64L-GFP when expressed in cells at about 37 C and excited with light at about 490 nm, the concentration needed for visuali-zation can be lowered. Target sites for enzymes engineered into the novel proteins, e.g.
F64L-E222G-GFP, can therefore be present in the cell at low concentrations in living cells. This is important for two reasons: 1) The probe must interfere as little as possible with the intracellular process being studied; 2) the translational and transcriptional appa-ratus should be stressed minimally.
The novel proteins can be used as reporters to monitor live/dead biomass of organisms, such as fungi. By constitutive expression of F64L-E222G-GFP in fungi the viable biomass will light up.
Southem and Berg, J. Mol. Appi. Genet 1(1982), 327 - 341; Loyter et al., Proc. Nati. Acad.
Sci. USA 79 (1982), 422 - 426; Wigler et al., Cell 14 (1978), 725; Corsaro and Pearson, Somatic Cell Genetics 7(1981), 603, Graham and van der Eb, Uro 52 (1973), 456; and Neumann et al., EMBO J. 1(1982), 841 - 845.
Examples of suitable yeast cells include cells of Saccharomyces spp. or Schizosaccha-romyces spp., in par6cular strains of Saccharomyces cerevisiae or Saccharomyces kluyveri. Methods for transforming yeast cells with heterologous DNA and producing het-erologous polypeptides therefrom are described, e.g. in US 4,599,311, US
4,931,373, US
4,870,008, 5,037,743, and US 4,845,075..
Transformed cells are selected by a phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient, e.g.
leucine. A preferred vector for use in yeast is the POT1 vector disclosed in US 4,931,373.
The DNA sequence encoding the fluorescent protein of the invention may be preceded by a signal sequence and optionally a leader sequence , e.g. as described above.
Further examples of suitable yeast cells are strains of Kluyveromyces, such as K
lactis, Hanse-nula, e.g. H. polymorpha, or Pichia, e.g. P. pastoris (cf. Gleeson et al., J.
Gen. Microbiol.
132, 1986, pp. 3459-3465; US 4,882,279).
Examples of other fungal cells are cells of filamentous fungi, e.g.
Aspergillus spp., Neu-rospora spp., Fusarium spp. or Trichoderma spp., in particular strains of A.
oryzae, A.
nidulans or A. niger. The use of Aspergillus spp. for the expression of proteins is de-scribed in, e.g., EP 272 277, EP 230 023, EP 184 438.
When a filamentous fungus is used as the host cell, it may be transformed with the DNA
construct of the invention, conveniently by integrafing the DNA construct in the host chro-mosome to obtain a recombinant host cell. This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. in-tegration of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g. by homologous or heterologous recombination.
Transformation of insect cells and production of heterologous polypeptides therein may be performed as described in US 4,745,051; US 4,879,236; US 5,155,037; 5,162,222;
EP
397,485).. The insect cell line used as the host may suitably be a Lepidoptera cell line, such as Spodoptera frugiperda cells or Trichoplusia ni cells (cf. US 5,077,214). Culture conditions may suitably be as described in, for instance, WO 89/01029 or WO 89/01028, or any of the aforementioned references.
One aspect of the invention relates to a host transformed with a DNA eonstruct according to any of the preceding aspects. The transformed or transfected host cell described above is then cultured in a suitable nutrient medium under conditions permitting the expression of the present DNA construct after which the cells may be used in the screening method of the invention. Altematively, the cells may be disrupted after which cell extracts and/or supematants may be analysed forfluorescence.
The medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supple-ments. Suitable media are available from commercial suppliers or may be prepared ac-cording to published recipes (e.g. in catalogues of the American Type Culture Collection).
5 In the method of the invention, the fluorescence of cells transformed or transfected with the DNA construct of the invention may suitably be measured in a spectrometer or a fluo-rescence microscope where the spectral properties of the cells in liquid culture may be determined as scans of light excitation and emission.
One aspect of the invention relates to a fusion compound consisting of a fluorescent pro-10 tein (F64L-E222G-GFP ), wherein the (F64L-E222G-GFP ) is linked to a polypeptide. Ex-amples of such polypeptide is kinase, preferably the catalytic subunit of protein kinase A, or protein kinase C, or Erk1, or a cytoskeletal element.
The invention further relates to a process for preparing a polypeptide, comprising culti-vating a host according to any of the preceding aspects and obtaining therefrom the poly-peptide expressed by said nucleotide sequence.
The various aspects of the invention have a plethora of uses. Some of these are de-scribed below:
Use of F64L-E222G-GFP in an in vitro assay for measuring protein kinase activity, or dephosphorylation activity, or for measuring protein redistribution.
Use of F64L-E222G-GFP as a protein tag in living and fixed cells. Due to the strong fluo-rescence the novel proteins are suitable tags for proteins present at low concentrations.
Since no substrate is needed and visualisation of the cells does not damage the cells dy-namic analysis can be performed.
Use as an organelle tag. More than one organelle can be tagged and visualised simulta-neously in living cells, e.g. the endoplasmic reticulum and the cytoskeleton.
Use as a secretion marker. By fusion of F64L-E222G-GFP to a signal peptide or a peptide to be secreted, secretion may be followed on-line in living cells. A
precondition for that is that the maturation of a detectable number of novel fluorescent protein molecules occurs faster than the secretion.
Use as genetic reporter or protein tag in transgenic animals. Due to the strong fluores-cence of the novel proteins, they are suitable as tags for proteins and gene expression, since the signal to noise ratio is significantly improved over the prior art proteins, such as wild-type GFP.
Use as a cell or organelle integrity marker. By co-expressing two of the novel proteins, the one targeted to an organelle and the other expressed in the cytosol, it is possible to cal-culate the relative leakage of the cytosolic protein and use that as a measure of cell inte-grety.
Use as a marker for changes in cell morphology. Expression of the novel proteins in cells allows easy detection of changes in cell morphology, e.g. blebbing, caused by cytotoxic agents or apoptosis. Such morphological changes are difficult to visualize in intact cells without the use of fluorescent probes.
Use as a transfection marker, and as a marker to be used in combination with FACS
sorting. Due to the increased brightness of the novel proteins the quality of cell detection and sorting can be significantly improved.
Use as real-time probe working at near physiological concentrations Since F64L-GFP is significantly brighter than wild type GFP and F64L-GFP when expressed in cells at about 37 C and excited with light at about 490 nm, the concentration needed for visuali-zation can be lowered. Target sites for enzymes engineered into the novel proteins, e.g.
F64L-E222G-GFP, can therefore be present in the cell at low concentrations in living cells. This is important for two reasons: 1) The probe must interfere as little as possible with the intracellular process being studied; 2) the translational and transcriptional appa-ratus should be stressed minimally.
The novel proteins can be used as reporters to monitor live/dead biomass of organisms, such as fungi. By constitutive expression of F64L-E222G-GFP in fungi the viable biomass will light up.
Transposon vector mutagenesis can be performed using the novel proteins as markers in transcriptional and translational fusions.
Transposons to be used in microorganisms encoding the novel proteins. The transposons may be constructed for translational and transcriptional fusions. To be used for screening for promoters.
Transposon vectors encoding the novel proteins, such as F64L-E222G-GFP, can be used for tagging plasmids and chromosbmes.
Use as a reporter for bacterial detection by introducing the novel proteins into the genome of bacteriophages.
By engineering the novel proteins, e.g. F64L-E222G-GFP, into the genome of a phage a diagnostic tool can be designed. F64L-E222G-GFP will be expressed only upon transfec-tion of the genome into a living host. The host specificity is defined by the bacteriophage.
The invention is further illustrated in the following examples with reference to the appended sequence lists.
Table 1 List of sequences Name Nucleotide SEQ ID NO: Protein SEQ ID NO:
e-F64L-GFP 1 2 (PS399) e-F64L-E222G-GFP 3 4 (PS699) jf-F64L-GFP 5 6 (PS350) jf-F64L-E222G-GFP 7 8 (PS1186) Legend to Figures PS codes are explained in Table 2.
Figure 1:
Excitation spectra of PS1189 (excitation maximum at 492 nm), PS1191 (excitation maxi-mum at 468 nm), PS1185 (excitation maximum at 490 nm) and PS1186 (excitation maxi-mum at 473 nm). The emissions were recorded at 560 nm. The samples of PS1189 and PS1191 were 2-fold diluted and the samples of PS1185 and PS1186 were 10-fold diluted.
Figure 2:
Emission spectra of PS1189 (emission maximum at 509 nm), PS1191 (emission maxi-mum at 505 nm), PS1185 (emission maximum at 510 nm) and PS1186 (emission maxi-mum at 506 nm). Excitation was at 430 nm. The samples of PS1189, PS1191 and PS1185 were 2-fold diluted and the sample of PS1186 was 1 0-fold diluted. The curves for PS1189 and PS1191 relate to the primary y-axis whereas the curves for PS1185 and PS1186 relate to the secondary y-axis.
Figure 3:
Overlapping excitation (Ex) and emission (Em) spectra of PS1189 (panel A), (panel B), PS1185 (panel C), and PS1186 (panel D). The excitation curve to the left and the excitation curve to the right relate to the primary and secondary y-axis, respectively.
Figure 4 This fgure shows the images collected after Lipofectamine 2000 transfection.
eF64L,E222G (PS699) is at the top of the left column referred to as E222G, eF64L,S65T-GFP (PS279) is at the top of the right column referred to as EGFP.
Figure 5 Comparing the pH sensitivity of EGFP (PS279) and eF64L,E222G-GFP (PS699).
Transposons to be used in microorganisms encoding the novel proteins. The transposons may be constructed for translational and transcriptional fusions. To be used for screening for promoters.
Transposon vectors encoding the novel proteins, such as F64L-E222G-GFP, can be used for tagging plasmids and chromosbmes.
Use as a reporter for bacterial detection by introducing the novel proteins into the genome of bacteriophages.
By engineering the novel proteins, e.g. F64L-E222G-GFP, into the genome of a phage a diagnostic tool can be designed. F64L-E222G-GFP will be expressed only upon transfec-tion of the genome into a living host. The host specificity is defined by the bacteriophage.
The invention is further illustrated in the following examples with reference to the appended sequence lists.
Table 1 List of sequences Name Nucleotide SEQ ID NO: Protein SEQ ID NO:
e-F64L-GFP 1 2 (PS399) e-F64L-E222G-GFP 3 4 (PS699) jf-F64L-GFP 5 6 (PS350) jf-F64L-E222G-GFP 7 8 (PS1186) Legend to Figures PS codes are explained in Table 2.
Figure 1:
Excitation spectra of PS1189 (excitation maximum at 492 nm), PS1191 (excitation maxi-mum at 468 nm), PS1185 (excitation maximum at 490 nm) and PS1186 (excitation maxi-mum at 473 nm). The emissions were recorded at 560 nm. The samples of PS1189 and PS1191 were 2-fold diluted and the samples of PS1185 and PS1186 were 10-fold diluted.
Figure 2:
Emission spectra of PS1189 (emission maximum at 509 nm), PS1191 (emission maxi-mum at 505 nm), PS1185 (emission maximum at 510 nm) and PS1186 (emission maxi-mum at 506 nm). Excitation was at 430 nm. The samples of PS1189, PS1191 and PS1185 were 2-fold diluted and the sample of PS1186 was 1 0-fold diluted. The curves for PS1189 and PS1191 relate to the primary y-axis whereas the curves for PS1185 and PS1186 relate to the secondary y-axis.
Figure 3:
Overlapping excitation (Ex) and emission (Em) spectra of PS1189 (panel A), (panel B), PS1185 (panel C), and PS1186 (panel D). The excitation curve to the left and the excitation curve to the right relate to the primary and secondary y-axis, respectively.
Figure 4 This fgure shows the images collected after Lipofectamine 2000 transfection.
eF64L,E222G (PS699) is at the top of the left column referred to as E222G, eF64L,S65T-GFP (PS279) is at the top of the right column referred to as EGFP.
Figure 5 Comparing the pH sensitivity of EGFP (PS279) and eF64L,E222G-GFP (PS699).
EXAMPLES
Example 1: Construction of GFP plasmids Plasmids pEGFP-N1 (GenBank accession number U55762) and pEGFP-C1 (GenBank accession number U55763) both contain a derivative of GFP in which one extra amino acid has been added at position two to provide a better translational start sequence (a Kozak sequence) and so the total number of amino acids is increased by one to 239 in-stead of the 238 found in wildtype GFP. Therefore the denomination of mutations in GFP
in these plasmids strictly should be referred to as e.g. F65L rather than F64L. However, to avoid this source of confusion and because the GFP community has adopted the num-bering system of wildtype GFP in its communications, the numbers used here conform to the commonly used naming of mutations in wildtype GFP. The relevant mutations in this respect are F64L, S65T, and E222G.
Plasmids pEGFP-N1 and pEGFP-C1 contain the following mutations in the chromophore:
F64L and S65T. The codon usage of the GFP DNA sequence has been optimized for ex-pression in mammalian cells. N1 and Cl refer to the position of multiple cloning sites rela-tive to the GFP sequence.
To construct a plasmid combining F64L and E222G, pEGFP-Nl and pEGFP-C1 were first subjected to PCR with primers 9859 and 9860 described below. The primers are comple-mentary to the DNA sequence around the chromophore region and introduce a point mu-tation changing the threonine at position 65 to serine. In addition the primers introduce a unique Spel restriction site by silent mutation. The 4.7 kb PCR products were digested with Spel, religated, and transformed into E.coli. The resulting plasmids are referred to as PS399 (N1 context) and PS401 (C1 context). These plasmids contain the chromophore sequence 64-LSYG-67. Plasmids PS399 and PS401 were subjected to Quick-Change mutagenesis (Stratagene) employing PCR with primers 0225 and 0226 described below.
These primers are complementary to sequences near the C-terminus of the GFP
and change glutamate at position 222 to glycine, and in addition they introduce an Avr2 re-striction site by silent mutation. The resulting plasmids are referred to as PS699 (N1 con-text) and PS701 (C1 context). They combine an LSYG chromophore with E222G with humanised codon and is referred to as eF64L,E222G (see sequence list 2) 9859-top: 5'-TGTACTAGTGACCACCCTGTCTTACG G CGTG CA-3' 9860-bottom: 5'-CTGACTAGTGTGGG CCAGG GCACGGGCAG C-3' 0225-bottom: 5'-CCCG GCG GCGGTCACGAACCCTAGGAG GACCATGTGATCGCG-3' 0226-top: 5'-CGCGATCACATGGTCCTCCTAGGGTTCGTGACCGCCGCCGGG-3' 5 A plasmid encoding a GFP directly derived from jellyfish with F64L
(disclosed in figure 4 of W097/11094) was subjected to PCR with primers 9840 & 9841 described below.
The PCR product was digested with restriction enzymes Agel and Acc65 and ligated into pEGFP-N1 digested with Agel and BsrGl. This replaces EGFP with F64L-GFP and in-troduces an amino acid change L236G near the c-terminus as a consequence of joining 10 Acc65 and BsrGl sites. This plasmid is referred to as PS350.
A plasmid encoding a GFP directly derived from jellyfish with F64L, S65T
(disclosed in figure 5 of W097/11094,) was subjected to PCR with primers 9840 & 9841 described be-low. The PCR product was digested with restriction enzymes Agel and Acc65 and ligated into pEGFP-N1 digested with Agel and BsrGl. This replaces EGFP with F64L, S65T-15 GFP and introduces an amino acid change L236G near the c-terminus as a consequence of joining Acc65 and BsrG1 sites. This plasmid is referred to as PS351.
Plasmid PS350 was subjected to QuickChange PCR (Stratagene) with primers 0317 &
0318 described below. This introduces E222G by mutation and an Avr2 restriction site by silent mutation. This plasmid is referred to as PS832.
Plasmid PS832 was subjected to QuickChange PCR (Stratagene) with primers 0325 &
0326 described below. This introduces L64F by mutation and a Psp1406 restriction site by silent mutation. This plasmid is referred to as PS845.
A plasmid encoding a GFP directly derived from jellyfish (disclosed in figure 2a of W097/11094) was subjected to PCR with primers 9840 & 9841 described below. The PCR product was digested with restriction enzymes Agel and Acc65 and ligated into pEGFP-N1 digested with Agel and BsrGl. This replaces EGFP with wildtype GFP
and introduces an amino acid change L236G near the c-terminus as a consequence of joining Acc65 and BsrGl sites. This plasmid is referred to as PS854.
Example 1: Construction of GFP plasmids Plasmids pEGFP-N1 (GenBank accession number U55762) and pEGFP-C1 (GenBank accession number U55763) both contain a derivative of GFP in which one extra amino acid has been added at position two to provide a better translational start sequence (a Kozak sequence) and so the total number of amino acids is increased by one to 239 in-stead of the 238 found in wildtype GFP. Therefore the denomination of mutations in GFP
in these plasmids strictly should be referred to as e.g. F65L rather than F64L. However, to avoid this source of confusion and because the GFP community has adopted the num-bering system of wildtype GFP in its communications, the numbers used here conform to the commonly used naming of mutations in wildtype GFP. The relevant mutations in this respect are F64L, S65T, and E222G.
Plasmids pEGFP-N1 and pEGFP-C1 contain the following mutations in the chromophore:
F64L and S65T. The codon usage of the GFP DNA sequence has been optimized for ex-pression in mammalian cells. N1 and Cl refer to the position of multiple cloning sites rela-tive to the GFP sequence.
To construct a plasmid combining F64L and E222G, pEGFP-Nl and pEGFP-C1 were first subjected to PCR with primers 9859 and 9860 described below. The primers are comple-mentary to the DNA sequence around the chromophore region and introduce a point mu-tation changing the threonine at position 65 to serine. In addition the primers introduce a unique Spel restriction site by silent mutation. The 4.7 kb PCR products were digested with Spel, religated, and transformed into E.coli. The resulting plasmids are referred to as PS399 (N1 context) and PS401 (C1 context). These plasmids contain the chromophore sequence 64-LSYG-67. Plasmids PS399 and PS401 were subjected to Quick-Change mutagenesis (Stratagene) employing PCR with primers 0225 and 0226 described below.
These primers are complementary to sequences near the C-terminus of the GFP
and change glutamate at position 222 to glycine, and in addition they introduce an Avr2 re-striction site by silent mutation. The resulting plasmids are referred to as PS699 (N1 con-text) and PS701 (C1 context). They combine an LSYG chromophore with E222G with humanised codon and is referred to as eF64L,E222G (see sequence list 2) 9859-top: 5'-TGTACTAGTGACCACCCTGTCTTACG G CGTG CA-3' 9860-bottom: 5'-CTGACTAGTGTGGG CCAGG GCACGGGCAG C-3' 0225-bottom: 5'-CCCG GCG GCGGTCACGAACCCTAGGAG GACCATGTGATCGCG-3' 0226-top: 5'-CGCGATCACATGGTCCTCCTAGGGTTCGTGACCGCCGCCGGG-3' 5 A plasmid encoding a GFP directly derived from jellyfish with F64L
(disclosed in figure 4 of W097/11094) was subjected to PCR with primers 9840 & 9841 described below.
The PCR product was digested with restriction enzymes Agel and Acc65 and ligated into pEGFP-N1 digested with Agel and BsrGl. This replaces EGFP with F64L-GFP and in-troduces an amino acid change L236G near the c-terminus as a consequence of joining 10 Acc65 and BsrGl sites. This plasmid is referred to as PS350.
A plasmid encoding a GFP directly derived from jellyfish with F64L, S65T
(disclosed in figure 5 of W097/11094,) was subjected to PCR with primers 9840 & 9841 described be-low. The PCR product was digested with restriction enzymes Agel and Acc65 and ligated into pEGFP-N1 digested with Agel and BsrGl. This replaces EGFP with F64L, S65T-15 GFP and introduces an amino acid change L236G near the c-terminus as a consequence of joining Acc65 and BsrG1 sites. This plasmid is referred to as PS351.
Plasmid PS350 was subjected to QuickChange PCR (Stratagene) with primers 0317 &
0318 described below. This introduces E222G by mutation and an Avr2 restriction site by silent mutation. This plasmid is referred to as PS832.
Plasmid PS832 was subjected to QuickChange PCR (Stratagene) with primers 0325 &
0326 described below. This introduces L64F by mutation and a Psp1406 restriction site by silent mutation. This plasmid is referred to as PS845.
A plasmid encoding a GFP directly derived from jellyfish (disclosed in figure 2a of W097/11094) was subjected to PCR with primers 9840 & 9841 described below. The PCR product was digested with restriction enzymes Agel and Acc65 and ligated into pEGFP-N1 digested with Agel and BsrGl. This replaces EGFP with wildtype GFP
and introduces an amino acid change L236G near the c-terminus as a consequence of joining Acc65 and BsrGl sites. This plasmid is referred to as PS854.
Plasmid PS399 was subjected to QuickChange PCR (Stratagene) with primers 0327 &
0328 described below. This introduces L64F by mutation and a Psp1406 restriction site by silent mutation. This plasmid is referred to as PS844.
'Plasmid PS699 was subjected to QuickChange PCR (Stratagene) with primers 0327 &
0328 described below. This introduces L64F by mutation and a Psp1406 restriction site by silent mutation. This plasmid is referred to as PS846.
9840-top: 5'-GTACCGGTCACCATGAGTAAAGGAGAAGAAC-3' 9841-bottom: 5'-TTATTGGTACCCTTCATCCATGCCATGTG-3' 0317-top: 5'-GAGATCACATGATCCTCCTAG G GTTTGTAACAG CTG CTG G G-3' 0318-bottom: 5'-CCCAGCAGCTGTTACAAACCCTAGGAGGATCATGTGATCTC-3' 0325-top: 5'-CCAACG CTTGTCACAACGTTTTCTTATG GTGTTC-3' 0326-bottom: 5'-GAACACCATAAGAAAACGTTGTGACAAGCGTTGG-3' 0327-top: 5'-CCCACACTAGTGACAACGTTTTCTTACGGCGTGC-3' 0328-bottom: 5'-GCACGCCGTAAGAAAACGTTGTCACTAGTGTGGG-3' Plasmids encoding GFPs in jellyfish codon context (PS350, PS351, PS832, PS845, PS854) were subjected to PCR with primers 1259 and 1260 described below. The ca 0.8 kb PCR products were cut with restriction enzymes BspH1 and BamH1, and ligated into E.coli expression vector pTrcHis (from Invitrogen) cut with Ncol and BamHl.
This places the GFPs under control of the ITPG-inducible promoter in the vector. The bottom primer 1260 also changes the glycine at position 236 back to leucine. The resulting plasmids are referred to as PS1184 (jf-F64L-GFP), PS1185 (jf-F64L,S65T-GFP), PS1186 Of-F64L,E222G-GFP), PS1187 Qf-E222G-GFP) and PS (jf-GFP).
Plasmids encoding GFPs in humanised enhanced codon context (PS279 = pEGFP-N1 (Clontech), PS399, PS699, PS844, PS846) were subjected to PCR with primers 1261 and 1262 described below. The ca 0.8 kb PCR products were cut with restriction enzymes Ncol and BamHl, and ligated into E.coli expression vector pTrcHis (from Invitrogen) cut with Ncol and BamHl. This places the GFPs under control of the ITPG-inducible pro-moter in the vector. The resulting plasmids are referred to as PS1189 (e-F64L,S65T-GFP
= EGFP), PS1190 (e-F64L-GFP), PS1191 (e-F64L,E222G-GFP), PS1192 (e-GFP) and PS1193 (e-E222G-GFP).
0328 described below. This introduces L64F by mutation and a Psp1406 restriction site by silent mutation. This plasmid is referred to as PS844.
'Plasmid PS699 was subjected to QuickChange PCR (Stratagene) with primers 0327 &
0328 described below. This introduces L64F by mutation and a Psp1406 restriction site by silent mutation. This plasmid is referred to as PS846.
9840-top: 5'-GTACCGGTCACCATGAGTAAAGGAGAAGAAC-3' 9841-bottom: 5'-TTATTGGTACCCTTCATCCATGCCATGTG-3' 0317-top: 5'-GAGATCACATGATCCTCCTAG G GTTTGTAACAG CTG CTG G G-3' 0318-bottom: 5'-CCCAGCAGCTGTTACAAACCCTAGGAGGATCATGTGATCTC-3' 0325-top: 5'-CCAACG CTTGTCACAACGTTTTCTTATG GTGTTC-3' 0326-bottom: 5'-GAACACCATAAGAAAACGTTGTGACAAGCGTTGG-3' 0327-top: 5'-CCCACACTAGTGACAACGTTTTCTTACGGCGTGC-3' 0328-bottom: 5'-GCACGCCGTAAGAAAACGTTGTCACTAGTGTGGG-3' Plasmids encoding GFPs in jellyfish codon context (PS350, PS351, PS832, PS845, PS854) were subjected to PCR with primers 1259 and 1260 described below. The ca 0.8 kb PCR products were cut with restriction enzymes BspH1 and BamH1, and ligated into E.coli expression vector pTrcHis (from Invitrogen) cut with Ncol and BamHl.
This places the GFPs under control of the ITPG-inducible promoter in the vector. The bottom primer 1260 also changes the glycine at position 236 back to leucine. The resulting plasmids are referred to as PS1184 (jf-F64L-GFP), PS1185 (jf-F64L,S65T-GFP), PS1186 Of-F64L,E222G-GFP), PS1187 Qf-E222G-GFP) and PS (jf-GFP).
Plasmids encoding GFPs in humanised enhanced codon context (PS279 = pEGFP-N1 (Clontech), PS399, PS699, PS844, PS846) were subjected to PCR with primers 1261 and 1262 described below. The ca 0.8 kb PCR products were cut with restriction enzymes Ncol and BamHl, and ligated into E.coli expression vector pTrcHis (from Invitrogen) cut with Ncol and BamHl. This places the GFPs under control of the ITPG-inducible pro-moter in the vector. The resulting plasmids are referred to as PS1189 (e-F64L,S65T-GFP
= EGFP), PS1190 (e-F64L-GFP), PS1191 (e-F64L,E222G-GFP), PS1192 (e-GFP) and PS1193 (e-E222G-GFP).
1259-top: 5'-GTTGTTf CATGAGTAAAG GAGAAGAACTTTTC-3' 1260-bottom: 5'-GTTGGATCCTTATTTGTATAGTTCATCCATG-3' 1261 -top. 5'-GTTGTTCCATGGTGAGCAAGGGCGAGGAGCTG-3' 1262-bottom: 5'-GTTGGATCCTTACTTGTACAGCTCGTCCATG-3' The plasmids described above were transformed into E.coli strain DH5alpha (Life Tech-nologies). Single colonies were picked and grown overnight at 37C in LB medium con-taining 1 mM IPTG. 0.5 ml cells were pelleted and stored at -20C until they were ana-lyzed.
Table 2 Summary table of plasmids encoding GFPs with indicated amino acids at posi-tions 64, 65 and 222.
mammalian Backbone- aa aa aa E. coli expression cell expres- codon us- pos pos pos plasmid sion plasmid age 64 65 222 PS846 e-E222G-GFP enhanced F S G PS1193 PS844 e-GFP enhanced F S E PS1192 PS699 e-F64L,E222G-GFP enhanced L S G PS1191 PS399 e-F64L-GFP enhanced L S E PS1190 PS279 EGFP enhanced L T E PS1189 PS854 jf-GFP jellyfish F S E PS1188 PS845 jf-E222G-GFP jellyfish F S G PS1187 PS832 jf-F64L,E222G-GFP jellyfish L S G PS1186 PS351 jf-F64L,S65T-GFP jellyfish L T E PS1185 PS350 jf-F64L-GFP jellyfish L S E PS1184 Example 2: Determination of spectral properties of proteins EGFP and eF64L,E222G.
Plasmids expressing EGFP from plasmid pEGFP-N1 (also referred to as PS279), and eF64L,E222G from plasmid PS699 were transfected into E.Coli TOPIO cells (Invitrogen) using lipofectamine 2000 (from Life Technologies) according to manufacturers recom-mendations. After 5 days cells were collected and resuspended in extraction buffer 50mM
TRIS(pH8.0) with 1 mM DTT. Cells were lysed by 3 cycles of freeze-thaw. Cell debris was centrifuged out at 1 0000g in acooled centrifuge. NaCI was added to 1 00mM.
Table 2 Summary table of plasmids encoding GFPs with indicated amino acids at posi-tions 64, 65 and 222.
mammalian Backbone- aa aa aa E. coli expression cell expres- codon us- pos pos pos plasmid sion plasmid age 64 65 222 PS846 e-E222G-GFP enhanced F S G PS1193 PS844 e-GFP enhanced F S E PS1192 PS699 e-F64L,E222G-GFP enhanced L S G PS1191 PS399 e-F64L-GFP enhanced L S E PS1190 PS279 EGFP enhanced L T E PS1189 PS854 jf-GFP jellyfish F S E PS1188 PS845 jf-E222G-GFP jellyfish F S G PS1187 PS832 jf-F64L,E222G-GFP jellyfish L S G PS1186 PS351 jf-F64L,S65T-GFP jellyfish L T E PS1185 PS350 jf-F64L-GFP jellyfish L S E PS1184 Example 2: Determination of spectral properties of proteins EGFP and eF64L,E222G.
Plasmids expressing EGFP from plasmid pEGFP-N1 (also referred to as PS279), and eF64L,E222G from plasmid PS699 were transfected into E.Coli TOPIO cells (Invitrogen) using lipofectamine 2000 (from Life Technologies) according to manufacturers recom-mendations. After 5 days cells were collected and resuspended in extraction buffer 50mM
TRIS(pH8.0) with 1 mM DTT. Cells were lysed by 3 cycles of freeze-thaw. Cell debris was centrifuged out at 1 0000g in acooled centrifuge. NaCI was added to 1 00mM.
The cell pellets were resuspended in 1000 i of H20 each (2-fold dilution relative to vol-umes of pelleted cultures) and transferred to 1.0x0.5 cm plastic cuvettes and the following excitation and emission spectra were recorded on a Perkin Elmer LS50B
luminescence spectrometer:
Excitation spectrum:
Excitation at 350-525 nm (5 nm slit width) Emission 560 nm (10 nm slit width) Data presented in Figure 1.
Emission spectrum:
Excitation at 430 nm (10 nm slit width) Emission 450-550 nm (5 nm slit width) Data presented in Figure 2.
Using the same settings, excitation and emission spectra of 10-fold (200 i of 2-fold di-luted cells mixed with 800 l of water) diluted cells were recorded for the strongly fluores-cent samples expressed from cDNAs with jellyfish backbone (PS1185 and PS1186).
In contrast to the expression levels, the fluorescence properties of the probes were inde-pendent of the codon usage. The spectra recorded for the probes with Thr65:E222 (PS1185 and PS1189) were very similar (excitation and emission maxima at 490-492 nm and 509-510 nm, respectively) and with Stokes shifts of 17-20 nm. Likewise, the spectra recorded for the probes with Ser65:G222 (PS1186 and PS1191) were very similar (exci-tation and emission maxima at 468-473 nm and 505-506 nm, respectively) and with Stokes shifts of 33-37 nm.
Example 3: Determination of time to fluorescence of EGFP and eF64L,E222G
in CHO cells.
Three, 2 well chambers with CHOhIR cells were transfected with plasmid PS279 ex-pressing EGFP and plasmid PS699 expression eF64L,E222G using the Lipofectamine transfection method.
Fluorescence from the cells was checked at regular intervals after transfection.
Lipofectamine 2000 transfection method was used to transfect EGFP and eF64L,E222G
in one, 8-well chamber with CHOhIR cells. Fluorescence from the cells was checked at regular intervals after transfection as described above. Images were taken from the same cell fields at each interval. Three different fields were observed for each plasmid. The mi-croscope and camera settings were the same for each image. Optimal exposure time was taken from a chamber of cells with full EGFP expression (transfected 24 hours previously) to ensure the exposure does not saturate. The first images were taken from 45 minutes to 1 hour post transfection, thereafter with a 30-minute interval for the first 7.5 hours post transfection and an image was collected 26.5 hours post transfection. Five different fields were observed for each plasmid. Fluorescence was detected no later then 4 hours post transfection. Fluorescence in eF64L,E222G was detected in one field 2.5 hours post transfection. In the remaining fields, fluorescence was detected no later than 4 hours post transfection (Figure 4).
Example 4: Comparing pH sensitivity over range pH 4.0 to pH 12.0 between EGFP and eF64L,E222G.
Samples of semi-purified EGFP from PS279 and eF64L,E222G from PS699 proteins pro-duced in COS7 cell expression are tested for pH sensitivity over a range from pH 4.0 to pH 12.5, with 0.5 point intervals. Excitation and emission scans were taken of each pro-tein at the pH values of 4.0, 8.0, and 12.5. The results of the scans found EGFP's excita-tion max to be 490 nm and emission max to be 510 nm and eF64L,E222G 's excitation max to be 475 nm and emission max to be 504 nm. Different pH values did not affect the excitation or emission max. Single reads were made with excitation at 470 nm, emission at 510 nm and with 10 nm slits. The results show no clear differences between EGFP and eF64L,E222G regarding pH sensitivity, except what could be due to random fluctuation (Figure 5). This experiment has been repeated with essentially same result.
Example 5: Comparison of relative brightness of GFPs.
10 plasmids were constructed which combine some of the following features:
- F or L at position 64.
- S or T at position 65.
- E or G at position 222.
- "jellyfish" or "humanised enhanced" GFP backbone.
The plasmids were transfected into CHO cells. One, two and four days later the cells were inspected visually in a fluorescence microscope by two people. The excitation was 475/40 = blue light and the emission 510-560 = green light. Cells were scored on a "green" scale ranging from essentially black to extremely bright (Table 3). Results did not change much 5 with time.
Table 3 Plasmid "greenness" GFP (* UVmax) codon context aa 64 aa 65 aa 222 PS854 black jf-GFP * jellyfish F S E
PS845 almost black jf-GFP-E222G jellyfish F S G
PS846 almost black e-GFP-E222G humanised F S G
PS844 almost black e-GFP * humanised F S E
PS350 light green jf-GFP-F64L * jellyfish L S E
PS351 green jf-GFP-S65T jellyfish L T E
PS832 green jf-GFP-F64L,E222G jellyfish L S G
PS399 bright green e-GFP-F64L * humanised L S E
PS699 very bright green e-GFP-F64L,E222G humanised L S G
PS279 very bright green EGFP humanised L T E
The plasmids were also transfected into HeLa cells. After 24 hours transfection the cells were run on a FACS Calibur flow cytometer for characterisation of whole cell fluores-10 cence, with excitation at 488nm and emission viewed with fluorescence filter set 530/30nm (range 515-545nm). 10000 events were collected for each transfection and 2 replicates carried out for each construct. Average fluorescent intensities from the FACS
analysis were obtained as geometric means (mean fluorescence on log scale) and results are shown in Table 4.
Table 4 Plasmid FACS GFP (* UVmax) codon context aa 64 aa 65 aa 222 PS845 5.4 jf-GFP-E222G jellyfish F S G
PS854 5.5 jf-wtGFP * jellyfish F S E
PS350 9.3 jf-BioGreen * jellyfish L S E
PS846 9.4 e-wtGFP-E222G humanised F S G
PS832 16.5 jf-BioE222G jellyfish L S G
PS351 22.2 jf-BioST jellyfish L T E
PS844 24.5 e-wtGFP humanised F S E
PS399 73.3 e-BioGreen * humanised L S E
PS699 209.2 e-BioE222G humanised L S G
PS279 421 EGFP humanised L T E
It is clear from the table above that, when expressed in the mammalian HeLa cell, the GFPs with humanised codon are far brighter than the GFPs with jellyfish codon.
EGFP
and e-BioE222G being the brightest. It is no surprise that EGFP is about twice as bright as E-BioE222G under these conditions. The excitation at the FACS is at 488nm, close the excitation maximum of EGFP at 490nm. As illustrated in Table 5 below 97% of the emis-sion from EGFP will be picked up, whereas only 86% from the e-BioE222G.
Furthermore, the difference between the intensity of EGFP and e-bioE222G when excited at the e-bioE222G excitation maximum of 470 is not as pronounced.
Table 5 eLTE eLSG 'fLTE 'fLSG
Emission intensity with excitation at 470 nm 131,4 94,1 155,0 167,2 Emission intensity with excitation at 488 nm 148,1 80,4 178,2 151,2 Excitation max 92 nm 68 nm 90 nm 73 nm Emission intensity at excitation max 152,9 93,8 183,3 169,1 Ratio: Em. intensity(488)/Em. intensity(max) 0,97 0,86 0,97 0,89 Emission max 509 nm 505 nm 510 nm 506 nm Emission intensity at emission max 71,2 55,6 144 32 In mammalian cells enhanced GFPs were brighter than jellyfish GFPs. In E.Coli.
jellyfish GFPs were brighter than enhanced GFPs. Thus, when it is worthwhile to choose the GFP
backbone with care according to the subsequent host.
SEQUENCE LISTING
<110> BioImage A/S
<120> Novel Fluorescent Proteins <130> 25158PC1 .<160> 8 <170> FastSEQ for Windows Version 3.0 <210> 1 <211> 720 <212> DNA
<213> Aequoria Victoria <220>
<221> CDS
<222> (1)...(717) <400> 1 atg gtg agc aag ggc gag gag ctg ttc acc ggg gtg gtg ccc atc ctg 48 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu gtc gag ctg gac ggc gac gta aac ggc cac aag ttc agc gtg tcc ggc 96 Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly gag ggc gag ggc gat gcc acc tac ggc aag ctg acc ctg aag ttc atc 144 Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile tgc acc acc ggc aag ctg ccc gtg ccc tgg ccc aca cta gtg acc acc 192 Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr ctg tct tac ggc gtg cag tgc ttc agc cgc tac ccc gac cac atg aag 240 Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys cag cac gac ttc ttc aag tcc gcc atg ccc gaa ggc tac gtc cag gag 288 Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu cgc acc atc ttc ttc aag gac gac ggc aac tac aag acc cgc gcc gag 336 Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu gtg aag ttc gag ggc gac acc ctg gtg aac cgc atc gag ctg aag ggc 384 Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly atc gac ttc aag gag gac ggc aac atc ctg ggg cac aag ctg gag tac 432 Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr aac tac aac agc cac aac gtc tat atc atg gcc gac aag cag aag aac 480 Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn ggc atc aag gtg aac ttc aag atc cgc cac aac atc gag gac ggc agc 528 Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser gtg cag ctc gcc gac cac tac cag cag aac acc ccc atc ggc gac ggc 576 Val Gln Leu Ala Asp His Tyr G1n Gln Asn Thr Pro Ile Gly Asp Gly CCC gtg ctc.J. ctg ccc gac aac C3c tac ctg agc aCC cag tcc gcc ctg 624 Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu agc aaa gac ccc aac gag aag cgc gat cac atg gtc ctg ctg gag ttc 672 Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe gtg acc gcc gcc ggg atc act ctc ggc atg gac gag ctg tac aag 717 Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys taa 720 <210> 2 <211> 239 <212> PRT
<213> Aequoria Victoria <400> 2 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys <210> 3 <211> 720 <212> DNA
<213> Aequoria Victoria <220>
<221> CDS
<222> (1)...(717) <400> 3 atg gtg agc aag ggc gag gag ctg ttc acc ggg gtg gtg ccc atc ctg 48 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu gtc gag ctg gac ggc gac gta aac ggc cac aag ttc agc gtg tcc ggc 96 Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly gag ggc gag ggc gat gcc acc tac ggc aag ctg acc ctg aag ttc atc 144 Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile tgc acc acc ggc aag ctg ccc gtg ccc tgg ccc aca cta gtg acc acc 192 Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr ctg tct tac ggc gtg cag tgc ttc agc cgc tac ccc gac cac atg aag 240 Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys cag cac gac ttc ttc aag tcc gcc atg ccc gaa ggc tac gtc cag gag 288 Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu cgc acc atc ttc ttc aag gac gac ggc aac tac aag acc cgc gcc gag 336 Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu gtg aag ttc gag ggc gac acc ctg gtg aac cgc atc gag ctg aag ggc 384 Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly atc gac ttc aag gag gac ggc aac atc ctg ggg cac aag ctg gag tac 432 Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr aac tac aac agc cac aac gtc tat atc atg gcc gac aag cag aag aac 480 Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn ggc atc aag gtg aac ttc aag atc cgc cac aac atc gag gac ggc agc 528 Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser gtg cag ctc gcc gac cac tac cag cag aac acc ccc atc ggc gac ggc 576 Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly ccc gtg ctg ctg ccc gac aac cac tac ctg agc acc cag tcc gcc ctg 624 Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu agc aaa gac ccc aac gag aag cgc gat cac atg gtc ctc cta ggg ttc 672 Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Gly Phe gtg acc gcc gcc ggg atc act ctc ggc atg gac gag ctg tac aag 717 Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys taa 720 <210> 4 <211> 239 <212> PRT
<213> Aequoria Victoria <400> 4 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Gly Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys <210> 5 <211> 717 <212> DNA
<213> Aequoria Victoria <220>
<221> CDS
<222> (1) . . . (714) <400> 5 atg agt aaa gga gaa gaa ctt ttc act gga gtt gtc cca att ctt gtt 48 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val gaa tta gat ggc gat gtt aat ggg caa aaa ttc tct gtt agt gga gag 96 Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Glu ggt gaa ggt gat gca aca tac gga aaa ctt acc ctt aaa ttt att tgc 144 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys act act ggg aag cta cct gtt cca tgg cca acg ctt gtc act act ctc 192 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu tct tat ggt gtt caa tgc ttt tct aga tac cca gat cat atg aaa cag 240 Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln cat gac ttt ttc aag agt gcc atg ccc gaa ggt tat gta cag gaa aga 288 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln G1u Arg act ata ttt tac aaa gat gac ggg aac tac aag aca cgt gct gaa gtc 336 Thr Ile Phe Tyr Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val aag ttt gaa ggt gat acc ctt gtt aat aga atc gag tta aaa ggt att 384 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile gat ttt aaa gaa gat gga aac att ctt gga cac aaa atg gaa tac aat 432 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Met Glu Tyr Asn tat aac tca cat aat gta tac atc atg gca gac aaa cca aag aat ggc 480 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Pro Lys Asn Gly atc aaa gtt aac ttc aaa att aga cac aac att aaa gat gga agc gtt 528 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Lys Asp Gly Ser Val caa tta gca gac cat tat caa caa aat act cca att ggc gat ggc cct 576 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro gtc ctt tta cca gac aac cat tac ctg tcc acg caa -tct gcc ctt tcc 624 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser aaa gat ccc aac gaa aag aga gat cac atg atc ctt ctt gag ttt gta 672 Lys Asp Pro Asn Glu Lys Arg Asp His Met Ile Leu Leu G1u Phe Val aca gct gct ggg att aca cat ggc atg gat gaa ggg tac aag 714 Thr Ala Ala Gly I1e Thr His Gly Met Asp Glu Gly Tyr Lys taa 717 <210> 6 <211> 238 <212> PRT
<213> Aequoria Victoria <400> 6 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Tyr Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Met Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Pro Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Lys Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Ile Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Gly Tyr Lys <210> 7 <211> 717 <212> DNA
<213> Aequovia Victoria <220>
<221> CDS
<222> (1) . . . (717) <400> 7 atg agt aaa gga gaa gaa ctt ttc act gga gtt gtc cca att ctt gtt 48 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val gaa tta gat ggc gat gtt aat ggg caa aaa ttc tct gtt agt gga gag 96 Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Glu ggt gaa ggt gat gca aca tac gga aaa ctt acc ctt aaa ttt att tgc 144 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys act act ggg aag cta cct gtt cca tgg cca acg ctt gtc act act ctc 192 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu tct tat ggt gtt caa tgc ttt tct aga tac cca gat cat atg aaa cag 240 Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln cat gac ttt ttc aag agt gcc atg ccc gaa ggt tat gta cag gaa aga 288 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg act ata ttt tac aaa gat gac ggg aac tac aag aca cgt gct gaa gtc 336 Thr Ile Phe Tyr Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val aag ttt gaa ggt gat acc ctt gtt aat aga atc gag tta aaa ggt att 384 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile gat ttt aaa gaa gat gga aac att ctt gga cac aaa atg gaa tac aat 432 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Met Glu Tyr Asn tat aac tca cat aat gta tac atc atg gca gac aaa cca aag aat ggc 480 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Pro Lys Asn G1y atc aaa gtt aac ttc aaa att aga cac aac att aaa gat gga agc gtt 528 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Lys Asp Gly Ser Val caa tta gca gac cat tat caa caa aat act cca att ggc gat ggc cct 576 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro gtc ctt tta cca gac aac cat tac ctg tcc acg caa tct gcc ctt tcc 624 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser aaa gat ccc aac gaa aag aga gat cac atg atc ctc cta ggg ttt gta 672 Lys Asp Pro Asn Glu Lys Arg Asp His Met Ile Leu Leu Gly Phe Val aca gct gct ggg att aca cat ggc atg gat gaa cta tac aaa taa 717 Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys *
<210> 8 <211> 238 <212> PRT
<213> Aequovia Victoria <400> 8 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Tyr Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Met Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Pro Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Lys Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Ile Leu Leu Gly Phe Val Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys
luminescence spectrometer:
Excitation spectrum:
Excitation at 350-525 nm (5 nm slit width) Emission 560 nm (10 nm slit width) Data presented in Figure 1.
Emission spectrum:
Excitation at 430 nm (10 nm slit width) Emission 450-550 nm (5 nm slit width) Data presented in Figure 2.
Using the same settings, excitation and emission spectra of 10-fold (200 i of 2-fold di-luted cells mixed with 800 l of water) diluted cells were recorded for the strongly fluores-cent samples expressed from cDNAs with jellyfish backbone (PS1185 and PS1186).
In contrast to the expression levels, the fluorescence properties of the probes were inde-pendent of the codon usage. The spectra recorded for the probes with Thr65:E222 (PS1185 and PS1189) were very similar (excitation and emission maxima at 490-492 nm and 509-510 nm, respectively) and with Stokes shifts of 17-20 nm. Likewise, the spectra recorded for the probes with Ser65:G222 (PS1186 and PS1191) were very similar (exci-tation and emission maxima at 468-473 nm and 505-506 nm, respectively) and with Stokes shifts of 33-37 nm.
Example 3: Determination of time to fluorescence of EGFP and eF64L,E222G
in CHO cells.
Three, 2 well chambers with CHOhIR cells were transfected with plasmid PS279 ex-pressing EGFP and plasmid PS699 expression eF64L,E222G using the Lipofectamine transfection method.
Fluorescence from the cells was checked at regular intervals after transfection.
Lipofectamine 2000 transfection method was used to transfect EGFP and eF64L,E222G
in one, 8-well chamber with CHOhIR cells. Fluorescence from the cells was checked at regular intervals after transfection as described above. Images were taken from the same cell fields at each interval. Three different fields were observed for each plasmid. The mi-croscope and camera settings were the same for each image. Optimal exposure time was taken from a chamber of cells with full EGFP expression (transfected 24 hours previously) to ensure the exposure does not saturate. The first images were taken from 45 minutes to 1 hour post transfection, thereafter with a 30-minute interval for the first 7.5 hours post transfection and an image was collected 26.5 hours post transfection. Five different fields were observed for each plasmid. Fluorescence was detected no later then 4 hours post transfection. Fluorescence in eF64L,E222G was detected in one field 2.5 hours post transfection. In the remaining fields, fluorescence was detected no later than 4 hours post transfection (Figure 4).
Example 4: Comparing pH sensitivity over range pH 4.0 to pH 12.0 between EGFP and eF64L,E222G.
Samples of semi-purified EGFP from PS279 and eF64L,E222G from PS699 proteins pro-duced in COS7 cell expression are tested for pH sensitivity over a range from pH 4.0 to pH 12.5, with 0.5 point intervals. Excitation and emission scans were taken of each pro-tein at the pH values of 4.0, 8.0, and 12.5. The results of the scans found EGFP's excita-tion max to be 490 nm and emission max to be 510 nm and eF64L,E222G 's excitation max to be 475 nm and emission max to be 504 nm. Different pH values did not affect the excitation or emission max. Single reads were made with excitation at 470 nm, emission at 510 nm and with 10 nm slits. The results show no clear differences between EGFP and eF64L,E222G regarding pH sensitivity, except what could be due to random fluctuation (Figure 5). This experiment has been repeated with essentially same result.
Example 5: Comparison of relative brightness of GFPs.
10 plasmids were constructed which combine some of the following features:
- F or L at position 64.
- S or T at position 65.
- E or G at position 222.
- "jellyfish" or "humanised enhanced" GFP backbone.
The plasmids were transfected into CHO cells. One, two and four days later the cells were inspected visually in a fluorescence microscope by two people. The excitation was 475/40 = blue light and the emission 510-560 = green light. Cells were scored on a "green" scale ranging from essentially black to extremely bright (Table 3). Results did not change much 5 with time.
Table 3 Plasmid "greenness" GFP (* UVmax) codon context aa 64 aa 65 aa 222 PS854 black jf-GFP * jellyfish F S E
PS845 almost black jf-GFP-E222G jellyfish F S G
PS846 almost black e-GFP-E222G humanised F S G
PS844 almost black e-GFP * humanised F S E
PS350 light green jf-GFP-F64L * jellyfish L S E
PS351 green jf-GFP-S65T jellyfish L T E
PS832 green jf-GFP-F64L,E222G jellyfish L S G
PS399 bright green e-GFP-F64L * humanised L S E
PS699 very bright green e-GFP-F64L,E222G humanised L S G
PS279 very bright green EGFP humanised L T E
The plasmids were also transfected into HeLa cells. After 24 hours transfection the cells were run on a FACS Calibur flow cytometer for characterisation of whole cell fluores-10 cence, with excitation at 488nm and emission viewed with fluorescence filter set 530/30nm (range 515-545nm). 10000 events were collected for each transfection and 2 replicates carried out for each construct. Average fluorescent intensities from the FACS
analysis were obtained as geometric means (mean fluorescence on log scale) and results are shown in Table 4.
Table 4 Plasmid FACS GFP (* UVmax) codon context aa 64 aa 65 aa 222 PS845 5.4 jf-GFP-E222G jellyfish F S G
PS854 5.5 jf-wtGFP * jellyfish F S E
PS350 9.3 jf-BioGreen * jellyfish L S E
PS846 9.4 e-wtGFP-E222G humanised F S G
PS832 16.5 jf-BioE222G jellyfish L S G
PS351 22.2 jf-BioST jellyfish L T E
PS844 24.5 e-wtGFP humanised F S E
PS399 73.3 e-BioGreen * humanised L S E
PS699 209.2 e-BioE222G humanised L S G
PS279 421 EGFP humanised L T E
It is clear from the table above that, when expressed in the mammalian HeLa cell, the GFPs with humanised codon are far brighter than the GFPs with jellyfish codon.
EGFP
and e-BioE222G being the brightest. It is no surprise that EGFP is about twice as bright as E-BioE222G under these conditions. The excitation at the FACS is at 488nm, close the excitation maximum of EGFP at 490nm. As illustrated in Table 5 below 97% of the emis-sion from EGFP will be picked up, whereas only 86% from the e-BioE222G.
Furthermore, the difference between the intensity of EGFP and e-bioE222G when excited at the e-bioE222G excitation maximum of 470 is not as pronounced.
Table 5 eLTE eLSG 'fLTE 'fLSG
Emission intensity with excitation at 470 nm 131,4 94,1 155,0 167,2 Emission intensity with excitation at 488 nm 148,1 80,4 178,2 151,2 Excitation max 92 nm 68 nm 90 nm 73 nm Emission intensity at excitation max 152,9 93,8 183,3 169,1 Ratio: Em. intensity(488)/Em. intensity(max) 0,97 0,86 0,97 0,89 Emission max 509 nm 505 nm 510 nm 506 nm Emission intensity at emission max 71,2 55,6 144 32 In mammalian cells enhanced GFPs were brighter than jellyfish GFPs. In E.Coli.
jellyfish GFPs were brighter than enhanced GFPs. Thus, when it is worthwhile to choose the GFP
backbone with care according to the subsequent host.
SEQUENCE LISTING
<110> BioImage A/S
<120> Novel Fluorescent Proteins <130> 25158PC1 .<160> 8 <170> FastSEQ for Windows Version 3.0 <210> 1 <211> 720 <212> DNA
<213> Aequoria Victoria <220>
<221> CDS
<222> (1)...(717) <400> 1 atg gtg agc aag ggc gag gag ctg ttc acc ggg gtg gtg ccc atc ctg 48 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu gtc gag ctg gac ggc gac gta aac ggc cac aag ttc agc gtg tcc ggc 96 Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly gag ggc gag ggc gat gcc acc tac ggc aag ctg acc ctg aag ttc atc 144 Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile tgc acc acc ggc aag ctg ccc gtg ccc tgg ccc aca cta gtg acc acc 192 Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr ctg tct tac ggc gtg cag tgc ttc agc cgc tac ccc gac cac atg aag 240 Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys cag cac gac ttc ttc aag tcc gcc atg ccc gaa ggc tac gtc cag gag 288 Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu cgc acc atc ttc ttc aag gac gac ggc aac tac aag acc cgc gcc gag 336 Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu gtg aag ttc gag ggc gac acc ctg gtg aac cgc atc gag ctg aag ggc 384 Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly atc gac ttc aag gag gac ggc aac atc ctg ggg cac aag ctg gag tac 432 Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr aac tac aac agc cac aac gtc tat atc atg gcc gac aag cag aag aac 480 Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn ggc atc aag gtg aac ttc aag atc cgc cac aac atc gag gac ggc agc 528 Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser gtg cag ctc gcc gac cac tac cag cag aac acc ccc atc ggc gac ggc 576 Val Gln Leu Ala Asp His Tyr G1n Gln Asn Thr Pro Ile Gly Asp Gly CCC gtg ctc.J. ctg ccc gac aac C3c tac ctg agc aCC cag tcc gcc ctg 624 Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu agc aaa gac ccc aac gag aag cgc gat cac atg gtc ctg ctg gag ttc 672 Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe gtg acc gcc gcc ggg atc act ctc ggc atg gac gag ctg tac aag 717 Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys taa 720 <210> 2 <211> 239 <212> PRT
<213> Aequoria Victoria <400> 2 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys <210> 3 <211> 720 <212> DNA
<213> Aequoria Victoria <220>
<221> CDS
<222> (1)...(717) <400> 3 atg gtg agc aag ggc gag gag ctg ttc acc ggg gtg gtg ccc atc ctg 48 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu gtc gag ctg gac ggc gac gta aac ggc cac aag ttc agc gtg tcc ggc 96 Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly gag ggc gag ggc gat gcc acc tac ggc aag ctg acc ctg aag ttc atc 144 Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile tgc acc acc ggc aag ctg ccc gtg ccc tgg ccc aca cta gtg acc acc 192 Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr ctg tct tac ggc gtg cag tgc ttc agc cgc tac ccc gac cac atg aag 240 Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys cag cac gac ttc ttc aag tcc gcc atg ccc gaa ggc tac gtc cag gag 288 Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu cgc acc atc ttc ttc aag gac gac ggc aac tac aag acc cgc gcc gag 336 Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu gtg aag ttc gag ggc gac acc ctg gtg aac cgc atc gag ctg aag ggc 384 Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly atc gac ttc aag gag gac ggc aac atc ctg ggg cac aag ctg gag tac 432 Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr aac tac aac agc cac aac gtc tat atc atg gcc gac aag cag aag aac 480 Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn ggc atc aag gtg aac ttc aag atc cgc cac aac atc gag gac ggc agc 528 Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser gtg cag ctc gcc gac cac tac cag cag aac acc ccc atc ggc gac ggc 576 Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly ccc gtg ctg ctg ccc gac aac cac tac ctg agc acc cag tcc gcc ctg 624 Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu agc aaa gac ccc aac gag aag cgc gat cac atg gtc ctc cta ggg ttc 672 Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Gly Phe gtg acc gcc gcc ggg atc act ctc ggc atg gac gag ctg tac aag 717 Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys taa 720 <210> 4 <211> 239 <212> PRT
<213> Aequoria Victoria <400> 4 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Gly Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys <210> 5 <211> 717 <212> DNA
<213> Aequoria Victoria <220>
<221> CDS
<222> (1) . . . (714) <400> 5 atg agt aaa gga gaa gaa ctt ttc act gga gtt gtc cca att ctt gtt 48 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val gaa tta gat ggc gat gtt aat ggg caa aaa ttc tct gtt agt gga gag 96 Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Glu ggt gaa ggt gat gca aca tac gga aaa ctt acc ctt aaa ttt att tgc 144 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys act act ggg aag cta cct gtt cca tgg cca acg ctt gtc act act ctc 192 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu tct tat ggt gtt caa tgc ttt tct aga tac cca gat cat atg aaa cag 240 Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln cat gac ttt ttc aag agt gcc atg ccc gaa ggt tat gta cag gaa aga 288 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln G1u Arg act ata ttt tac aaa gat gac ggg aac tac aag aca cgt gct gaa gtc 336 Thr Ile Phe Tyr Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val aag ttt gaa ggt gat acc ctt gtt aat aga atc gag tta aaa ggt att 384 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile gat ttt aaa gaa gat gga aac att ctt gga cac aaa atg gaa tac aat 432 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Met Glu Tyr Asn tat aac tca cat aat gta tac atc atg gca gac aaa cca aag aat ggc 480 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Pro Lys Asn Gly atc aaa gtt aac ttc aaa att aga cac aac att aaa gat gga agc gtt 528 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Lys Asp Gly Ser Val caa tta gca gac cat tat caa caa aat act cca att ggc gat ggc cct 576 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro gtc ctt tta cca gac aac cat tac ctg tcc acg caa -tct gcc ctt tcc 624 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser aaa gat ccc aac gaa aag aga gat cac atg atc ctt ctt gag ttt gta 672 Lys Asp Pro Asn Glu Lys Arg Asp His Met Ile Leu Leu G1u Phe Val aca gct gct ggg att aca cat ggc atg gat gaa ggg tac aag 714 Thr Ala Ala Gly I1e Thr His Gly Met Asp Glu Gly Tyr Lys taa 717 <210> 6 <211> 238 <212> PRT
<213> Aequoria Victoria <400> 6 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Tyr Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Met Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Pro Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Lys Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Ile Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Gly Tyr Lys <210> 7 <211> 717 <212> DNA
<213> Aequovia Victoria <220>
<221> CDS
<222> (1) . . . (717) <400> 7 atg agt aaa gga gaa gaa ctt ttc act gga gtt gtc cca att ctt gtt 48 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val gaa tta gat ggc gat gtt aat ggg caa aaa ttc tct gtt agt gga gag 96 Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Glu ggt gaa ggt gat gca aca tac gga aaa ctt acc ctt aaa ttt att tgc 144 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys act act ggg aag cta cct gtt cca tgg cca acg ctt gtc act act ctc 192 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu tct tat ggt gtt caa tgc ttt tct aga tac cca gat cat atg aaa cag 240 Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln cat gac ttt ttc aag agt gcc atg ccc gaa ggt tat gta cag gaa aga 288 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg act ata ttt tac aaa gat gac ggg aac tac aag aca cgt gct gaa gtc 336 Thr Ile Phe Tyr Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val aag ttt gaa ggt gat acc ctt gtt aat aga atc gag tta aaa ggt att 384 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile gat ttt aaa gaa gat gga aac att ctt gga cac aaa atg gaa tac aat 432 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Met Glu Tyr Asn tat aac tca cat aat gta tac atc atg gca gac aaa cca aag aat ggc 480 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Pro Lys Asn G1y atc aaa gtt aac ttc aaa att aga cac aac att aaa gat gga agc gtt 528 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Lys Asp Gly Ser Val caa tta gca gac cat tat caa caa aat act cca att ggc gat ggc cct 576 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro gtc ctt tta cca gac aac cat tac ctg tcc acg caa tct gcc ctt tcc 624 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser aaa gat ccc aac gaa aag aga gat cac atg atc ctc cta ggg ttt gta 672 Lys Asp Pro Asn Glu Lys Arg Asp His Met Ile Leu Leu Gly Phe Val aca gct gct ggg att aca cat ggc atg gat gaa cta tac aaa taa 717 Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys *
<210> 8 <211> 238 <212> PRT
<213> Aequovia Victoria <400> 8 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Tyr Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Met Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Pro Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Lys Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Ile Leu Leu Gly Phe Val Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys
Claims (15)
1. A fluorescent protein derived from Green Fluorescent Protein (GFP), said fluorescent protein obtainable with a DNA molecule encoding it in humanised enhanced codon context, wherein an amino acid at a position corresponding to position 65 of SEQ ID NO: 4 has been substituted by an aliphatic amino acid and wherein a glutamic acid at a position corresponding to position 223 of SEQ ID NO: 4 has been substituted by an amino acid selected from G, A, V, L, I, F, S, T, N or Q, said mutated fluorescent protein having an excitation maximum at a higher wavelength and fluorescence being increased when said fluorescent protein is expressed in cells incubated at a temperature of 30°C or above compared to wild-type GFP.
2. The fluorescent protein according to claim 1, said protein being derived from Aequoria victorea or Renilla.
3. The fluorescent protein according to claim 1 or 2, wherein amino acid F in position 65 of the GFP has been substituted by an amino acid selected from the group consisting of L, I, V, A and G.
4. The fluorescent protein according to any one of claims 1 to 3, wherein amino acid F in position 65 of the GFP has been substituted by L.
5. The fluorescent protein according to any one of claims 1 to 4, wherein amino acid E in position 223 of the GFP has been substituted by G.
6. A fluorescent protein comprising the amino acid sequence disclosed in SEQ ID NO: 4.
7. The fluorescent protein according to any one of claims 1 to 6, linked to a polypeptide.
8. The fluorescent protein according to claim 7, wherein the polypeptide is a kinase.
9. The fluorescent protein according to claim 8, wherein the kinase is a catalytic subunit of protein kinase A, or protein kinase C, or Erk1, or a cytoskeletal element.
10. A nucleic acid molecule comprising a nucleotide sequence coding for the fluorescent protein of any one of claims 1 to 9.
11. The nucleic acid molecule according to claim 10, comprising the sequence shown in SEQ ID NO: 3.
12. The nucleic acid molecule according to claim 10 or 11 in the form of a DNA sequence.
13. A cell transformed with the nucleic acid molecule according to any one of claims 10 to 12.
14. A process for preparing the fluorescent protein of any one of claims 1 to 9, comprising cultivating the cell according to claim 13 and obtaining therefrom the fluorescent protein expressed by said nucleic acid molecule.
15. Use of the fluorescent protein according to any one of claims 1 to 9 in an in vitro assay for measuring protein kinase activity, or dephosphorylation activity, or for measuring protein redistribution.
Applications Claiming Priority (9)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DKPA200000953 | 2000-06-19 | ||
DKPA200000953 | 2000-06-19 | ||
US21268100P | 2000-06-20 | 2000-06-20 | |
US60/212,681 | 2000-06-20 | ||
US29017001P | 2001-05-10 | 2001-05-10 | |
DKPA200100739 | 2001-05-10 | ||
DKPA200100739 | 2001-05-10 | ||
US60/290,170 | 2001-05-10 | ||
PCT/EP2001/006848 WO2001098338A2 (en) | 2000-06-19 | 2001-06-18 | Fluorescent proteins |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2410413A1 CA2410413A1 (en) | 2001-12-27 |
CA2410413C true CA2410413C (en) | 2010-05-18 |
Family
ID=27439814
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA2410413A Expired - Lifetime CA2410413C (en) | 2000-06-19 | 2001-06-18 | Fluorescent proteins |
Country Status (11)
Country | Link |
---|---|
US (2) | US7001986B2 (en) |
EP (1) | EP1299414B1 (en) |
JP (2) | JP2005518180A (en) |
AT (1) | ATE439373T1 (en) |
AU (2) | AU7966901A (en) |
CA (1) | CA2410413C (en) |
DE (1) | DE60139556D1 (en) |
DK (1) | DK1299414T3 (en) |
ES (1) | ES2331109T3 (en) |
IL (1) | IL153113A0 (en) |
WO (1) | WO2001098338A2 (en) |
Families Citing this family (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998021355A1 (en) | 1996-11-15 | 1998-05-22 | Life Technologies, Inc. | Mutants of green fluorescent protein |
GB0109858D0 (en) * | 2001-04-23 | 2001-06-13 | Amersham Pharm Biotech Uk Ltd | Fluorscent proteins |
JP3829252B2 (en) | 2001-06-08 | 2006-10-04 | 独立行政法人理化学研究所 | Fluorescent protein |
US7271241B2 (en) * | 2002-04-24 | 2007-09-18 | Los Alamos National Security, Llc | Directed evolution methods for improving polypeptide folding and solubility and superfolder fluorescent proteins generated thereby |
AU2003285844A1 (en) * | 2002-11-12 | 2004-06-03 | Zakrytoe Aktsionernoe Obschestvo "Evrogen" | Fluorescent proteins and chromoproteins from non-aequorea hydrozoa species and methods for using same |
AU2004315485A1 (en) | 2003-10-24 | 2005-08-18 | The Regents Of The University Of California | Self-assembling split-fluorescent protein systems |
EP1877425A4 (en) * | 2005-05-03 | 2009-04-29 | Univ Georgia State Res Found | Fluorescent proteins and uses thereof |
EP1785434A1 (en) | 2005-11-11 | 2007-05-16 | Ludwig-Maximilians-Universität München | Targeting and tracing of antigens in living cells |
EP2518155B1 (en) | 2006-08-04 | 2014-07-23 | Georgia State University Research Foundation, Inc. | Enzyme sensors, methods for preparing and using such sensors, and methods of detecting protease activity |
CN101809152A (en) * | 2007-08-03 | 2010-08-18 | 国立大学法人北海道大学 | Fluorescent protein with deep blue color |
ES2606706T3 (en) | 2008-01-09 | 2017-03-27 | Ludwig-Maximilians-Universitat München | A double fluorescent hybrid (F2H) assay for direct visualization of protein interactions in living cells |
EP2275442A1 (en) | 2009-07-06 | 2011-01-19 | Ludwig-Maximilians-Universität München | Detection and vizualization of the cell cycle in living cells |
CN101974554A (en) * | 2010-09-26 | 2011-02-16 | 武汉大学 | Construction method and application of mutant vector pEGFP-N1m |
EP2685260A1 (en) | 2012-07-09 | 2014-01-15 | Ludwig-Maximilians-Universität München | Direct and quantitative detection of targets in living cells |
Family Cites Families (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5491084A (en) * | 1993-09-10 | 1996-02-13 | The Trustees Of Columbia University In The City Of New York | Uses of green-fluorescent protein |
US6146826A (en) | 1993-09-10 | 2000-11-14 | The Trustees Of Columbia University In The City Of New York | Green fluorescent protein |
US5610031A (en) * | 1993-10-27 | 1997-03-11 | The General Hospital Corporation | B1k chain of laminin and methods of use |
WO1995021191A1 (en) | 1994-02-04 | 1995-08-10 | William Ward | Bioluminescent indicator based upon the expression of a gene for a modified green-fluorescent protein |
US5625048A (en) * | 1994-11-10 | 1997-04-29 | The Regents Of The University Of California | Modified green fluorescent proteins |
DE69604298T2 (en) * | 1995-09-22 | 2000-05-18 | Bioimage A S Soeborg | VARIANTS OF THE GREEN FLUORESCENCE PROTEIN, GFP |
US5804387A (en) * | 1996-02-01 | 1998-09-08 | The Board Of Trustees Of The Leland Stanford Junior University | FACS-optimized mutants of the green fluorescent protein (GFP) |
US6124128A (en) * | 1996-08-16 | 2000-09-26 | The Regents Of The University Of California | Long wavelength engineered fluorescent proteins |
US6090919A (en) * | 1997-01-31 | 2000-07-18 | The Board Of Trustees Of The Leland Stanford Junior University | FACS-optimized mutants of the green fluorescent protein (GFP) |
GB0109858D0 (en) | 2001-04-23 | 2001-06-13 | Amersham Pharm Biotech Uk Ltd | Fluorscent proteins |
-
2001
- 2001-06-18 WO PCT/EP2001/006848 patent/WO2001098338A2/en active IP Right Grant
- 2001-06-18 DE DE60139556T patent/DE60139556D1/en not_active Expired - Lifetime
- 2001-06-18 AU AU7966901A patent/AU7966901A/en active Pending
- 2001-06-18 DK DK01957861T patent/DK1299414T3/en active
- 2001-06-18 IL IL15311301A patent/IL153113A0/en unknown
- 2001-06-18 JP JP2002504293A patent/JP2005518180A/en not_active Withdrawn
- 2001-06-18 AT AT01957861T patent/ATE439373T1/en not_active IP Right Cessation
- 2001-06-18 CA CA2410413A patent/CA2410413C/en not_active Expired - Lifetime
- 2001-06-18 EP EP01957861A patent/EP1299414B1/en not_active Expired - Lifetime
- 2001-06-18 AU AU2001279669A patent/AU2001279669B2/en not_active Expired
- 2001-06-18 ES ES01957861T patent/ES2331109T3/en not_active Expired - Lifetime
- 2001-06-19 US US09/887,784 patent/US7001986B2/en not_active Expired - Lifetime
-
2005
- 2005-08-19 US US11/206,904 patent/US7476518B2/en not_active Expired - Lifetime
-
2006
- 2006-11-09 JP JP2006304095A patent/JP4459944B2/en not_active Expired - Lifetime
Also Published As
Publication number | Publication date |
---|---|
EP1299414B1 (en) | 2009-08-12 |
JP2005518180A (en) | 2005-06-23 |
WO2001098338A2 (en) | 2001-12-27 |
JP2007075122A (en) | 2007-03-29 |
CA2410413A1 (en) | 2001-12-27 |
DE60139556D1 (en) | 2009-09-24 |
AU7966901A (en) | 2002-01-02 |
US7001986B2 (en) | 2006-02-21 |
US7476518B2 (en) | 2009-01-13 |
AU2001279669B2 (en) | 2006-02-02 |
US20060051843A1 (en) | 2006-03-09 |
ES2331109T3 (en) | 2009-12-22 |
ATE439373T1 (en) | 2009-08-15 |
US20020177189A1 (en) | 2002-11-28 |
EP1299414A2 (en) | 2003-04-09 |
DK1299414T3 (en) | 2009-11-30 |
WO2001098338A3 (en) | 2002-05-10 |
IL153113A0 (en) | 2003-06-24 |
JP4459944B2 (en) | 2010-04-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7476518B2 (en) | Nucleic acids encoding fluorescent proteins and methods of using the same | |
EP0851874B1 (en) | Novel variants of green fluorescent protein, gfp | |
US7300762B2 (en) | Fluorescent proteins and methods of using same | |
US6566083B1 (en) | Method of detecting biologically active substances | |
AU2001279669A1 (en) | Fluorescent proteins | |
AU2001292040A1 (en) | Mutants of green flourescent protein | |
US20040072995A1 (en) | Novel fluorescent proteins | |
JP2005511027A (en) | Fluorescent protein | |
AU2002326047A1 (en) | Fluorescent proteins |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKEX | Expiry |
Effective date: 20210618 |