CA2410371A1 - Methods for enhancing antibody-induced cell lysis and treating cancer - Google Patents

Abstract

The invention relates to methods and products for treating cancer. In particular the invention relates to combinations of nucleic acids and antibodies for the treatment and prevention of cancer. The invention also relates to diagnostic methods for screening cancer cells.

Description

METHODS FOR ENHANCING ANTIBODY-INDUCED CELL LYSIS AND
TREATING CANCER
PRIORITY
This application claims the benefit of U.S. Provisional Application No.
60!213,346, filed June 22, 2000.
FIELD OF THE INVENTION
The invention relates to the treatment and prevention of cancer using to immunostimulatory nucleic acids and antibodies.
BACKGROUND OF THE INVENTION
Cancer is the second leading cause of death, resulting in one out of every four deaths in the United States. In 1997, the estimated total number of new diagnoses for lung, breast, 15 prostate, colorectal and ovarian cancer was approximately two million. Due to the ever increasing aging population in the United States, it is reasonable to expect that rates of cancer incidence will continue to grow.
Cancer is a disease which involves the uncontrolled growth (i.e., division) of cells. Some of the known mechanisms which contribute to the uncontrolled proliferation of cancer cells 2o include growth factor independence, failure to detect genomic mutation, and inappropriate cell signaling. The ability of cancer cells to ignore normal growth controls may result in an increased rate of proliferation. Although the causes of cancer have not been firmly established, there are some factors known to contribute, or at.least predispose a subject, to cancer. Such factors include particular genetic mutations (e.g., BRCA gene mutation for 25 breast cancer, APC for colon cancer), exposure to suspected cancer-causing agents, or carcinogens (e.g., asbestos, UV radiation) and familial disposition for particular cancers such as breast cancer.
Cancer is currently treated using a variety of modalities including surgery, radiation therapy and chemotherapy. The choice of treatment modality will depend upon the type, 30 location and dissemination of the cancer. For example, surgery and radiation therapy may be more appropriate in the case of solid well-defined tumor masses and less practical in the case of non-solid tumor cancers such as leukemia and lymphoma. One of the advantages of _2_ surgery and radiation therapy is the ability to control to some extent the impact of the therapy, and thus to limit the toxicity to normal tissues in the body.
However, surgery and radiation therapy are often followed by chemotherapy to guard against any remaining or radio-resistant cancer cells. Chemotherapy is also the most appropriate treatment for disseminated cancers such as leukemia and lymphoma as well as metastases.
More recently, the use of CpG containing nucleic acids has been proposed for the treatment and prevention of cancer. We have found that unmethylated CG-dinucleotides within certain sequence contexts (CpG DNA) are recognized by the vertebrate immune system as foreign DNA (bacterial or viral). CpG DNA activates a coordinated set of immune l0 responses that include innate immunity (macrophages, dendritic cells, and natural killer cells), humoral immunity, and cellular immunity. Krieg AM et al., Pharmacol Ther 84:113-20 (1999); Krieg AM et al., Curr Top Microbiol Irnmunol 247:1-21 (2000);
Wagner H, Adv Irnmunol 73:329-68 (1999). As a vaccine adjuvant, CpG DNA is at least as effective as the gold standard complete Freund's adjuvant (CFA), but induces higher Thl activity and demonstrates less toxicity. Chu RS et al., JExp Med 186:1623-31 (19.97);
Weiner GJ et al., Proc Natl Acad Sci USA 94:10833-7 (1997); Roman M et al., Nat Med 3:849-54 (1997);
Lipford GB et al., EuY Jlmmunol 27:2340-4 (1997); Davis HL et al., ,llmmunol 160:870-6 (1998). Recently, we identified a human CpG motif which triggers proliferation and activation of primary human B cells. Hartmann G et al., .Ilmmunol 164:944-53 (2000).
SUMMARY OF THE INVENTION
The invention relates in some aspects to methods for treating and preventing cancer using immunostimulatory nucleic acids and antibodies. Thus in one aspect the invention is a method for treating or preventing cancer. The method involves administering to a subject having or at risk of developing cancer an effective amount to upregulate CD20 expression of a nucleic acid, and an anti-CD20 antibody. The cancer, in some embodiments, is B-cell lymphoma associated with low levels of CD20 expression. The B-cell lymphoma in other embodiments is B-cell chronic lymphocytic leukemia (B-CLL) or a marginal zone lymphoma. In some embodiments the CD20 antibody is C2B8 or Rituximab.
3o The invention in other aspects relates to a method for diagnosing lymphoma by isolating a B cell from a subject and identifying a change in cell surface markers when the B
cell is contacted with an immunostimulatory nucleic acid, wherein the cell surface marker induced on the B cell is indicative of the type of lymphoma. In some embodiments the subject has a type of lymphoma. In some embodiments the subject is suspected of having a type of lymphoma. The method may optionally include a method for treating cancer by administering to the subject an immunostimulatory nucleic acid and an antibody specific for the cell surface antigens induced on the B cell in order to treat the cancer.
In another aspect the invention is a method for treating or preventing cancer by administering to a subject having or at risk of developing cancer an effective amount to induce expression of a surface antigen on a cancer cell surface, of a nucleic acid, and administering to the subject an antibody selected from the group consisting of an anti-CD22 1 o antibody and an anti-CD 19 antibody.
According to another aspect of the invention, a method for treating lymphoma is provided. The method includes the steps of isolating a B cell from a subject having lymphoma, identifying a surface antigen which is not expressed or which is expressed on the surface of the B cell in an amount lower than that of a control B cell, administering to the subject an antibody specific for the identified surface antigen and an immunostimulatory nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
A method for treating a lymphoma resistant to antibody therapy is provided according 2o to another aspect of the invention. The method includes administering to a subject having a lymphoma resistant to therapy with an antibody specific for a surface antigen, an antibody specific for the surface antigen to which the lymphoma is resistant and a nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
The surface antigen may be any type of surface antigen which is capable of being expressed on the surface of a cancer cell and which is induced by stimulation with immunostimulatory nucleic acids. In some embodiments the surface antigen is CD20, CD40, CD22, or CD19. In other embodiments the lymphoma is B-CLL or marginal zone lymphoma. In some embodiments the antibody is an anti-CD20 antibody. In some 3o embodiments the anti-CD20 antibody is C2B8. In another embodiment the anti-antibody is Rituximab.

In some preferred embodiments the antibody is a human IgGl antibody. In some preferred embodiments the antibody is a marine IgG2a antibody.
In some embodiments the methods also include administering an anti-cancer therapy to the subj ect.
The invention also includes a method for treating cancer in a human by administering to a human an immunostimulatory nucleic acid and an antibody of IgGl isotype (an IgGl isotype antibody as used herein refers to a human or humanized IgGl unless otherwise specified), which binds to a cell surface antigen of a cancer cell and wherein the nucleic acid and the antibody are administered in an effective amount for killing the cancer cell.
1o Optionally the nucleic acid and the antibody are administered together.
Alternatively the nucleic acid and the antibody may be administered separately.
In some embodiments the method includes the step of administering a cancer therapy.
As used herein the term "a cancer therapy" is meant to embrace a single medicament, a plurality of medicaments of a particular class and a plurality of medicaments of different 15 classes, and includes but is not limited to chemotherapeutic agents, cancer vaccines, biological response modifiers, and hormone therapies.
A chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine 2o GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS
famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853, ZDO101, ISI641, ODN
25 698, TA 2516/Maxxnistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium derivative, Temodal/Temozolomide, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-30 (754)/RAS oncogene inhibitor, BMS-1827511oral platinum, UFT(Tegafur/LTracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto/Levamisole, Camptosar/Irinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU 79553/Bis-Naphtalimide, LU
103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD
0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as Melphalan, Cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCI, Dactinomycin, Daunorubicin HCI, Estramustine phosphate sodium, Etoposide (VP16-213), to Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o,p °-DDD), Mitoxantrone HCl, Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HMM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate.
In some preferred embodiments the chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, NovantronelMitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR
1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, PaxexlPaclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCI, Daunorubiein HCl, Etoposide (VP16-213), 3o Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mitoxantrone HCl, Procarbazine HCI, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.
A cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys. Biological response modifiers include interferon, and lymphokines such as IL-2. Hormone replacement therapy includes tamoxifen alone or in combination with to progesterone. In a further embodiment, the cancer therapy is interferon-a, (e.g., INTRON~
A, Schering).
The cancer may be selected from the group consisting of basal cell carcinoma, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, breast cancer, cervical cancer, colon and rectum cancer, connective tissue cancer, esophageal cancer, eye cancer, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, melanoma, myeloma, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), ovarian cancer, pancreatic cancer, prostate cancer, rhabdomyosarcoma, skin cancer, stomach cancer, testicular cancer, and uterine cancer. In preferred embodiments, the cancer to be treated may be selected from the group consisting of bone cancer, brain and CNS
cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), skin cancer, and testicular cancer.
In another aspect the invention encompasses a kit. The kit includes a package including at least two containers, the first container housing an immunostimulatory nucleic acid, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid upregulates expression of the cell surface antigen. In one embodiment the antibody is selected from the group consisting of an anti-CD20 antibody, an anti-CD19 antibody, and an anti-CD22 antibody.
The nucleic acids useful according to the invention are immunostimulatory nucleic acids and in some embodiments are immunostimulatory CpG nucleic acids having an _7_ unmethylated CpG motif, immunostimulatory T-rich nucleic acids, immunostimulatory poly-G nucleic acids, bacterial DNA, yeast DNA, or eukaryotic DNA.
In some embodiments the nucleic acid does not hybridize with genomic DNA or RNA
under stringent conditions. In other embodiments the nucleic acid does hybridize with genomic DNA or RNA under stringent conditions.
The nucleic acid may have natural linkages or may include at least one modified backbone internucleotide linkage. Tn some embodiments the modified backbone is a phosphate backbone modification. In other embodiments the modified backbone is a peptide modified oligonucleotide backbone. The nucleic acid may also include native bases or l0 modified bases. The nucleotide backbone may be chimeric, or the nucleotide backbone is entirely modified.
The immunostimulatory nucleic acid can have any length greater than 6 nucleotides, but in some embodiments is between 8 and 100 nucleotide residues in length. In other embodiments the nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides, at 15 least 27, nucleotides, or at least 30 nucleotides. The nucleic acid may be single-stranded or double-stranded. In some embodiments the nucleic acid is isolated and in other embodiments the nucleic acid may be a synthetic nucleic acid.
The CpG nucleic acid in one embodiment contains at least one unmethylated CpG
dinucleotide having a sequence including at least the following formula: 5' X1XZCGX3X4 3' 2o wherein C is unmethylated, wherein Xl, XZ, X3, and X4 are nucleotides. In one embodiment the 5' X1X2CGX3X4 3' sequence of the CpG nucleic acid is a non-palindromic sequence, and in other embodiments it is a palindromic sequence.
In some embodiments X1X2 are nucleotides selected from the group consisting of:
GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X3X4 are 25 nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA. In other embodiments X1X2 are GpA or GpT and X3X4 are TpT. In yet other embodiments Xl or X2 or both are purines and X3 or X4 or both are pyrimidines or X1X2 are GpA and X3 or X4 or both are pyrimidines. In one embodiment X2 is a T and X3 is a pyrimidine.
3o In other embodiments the CpG nucleic acid has a sequence selected from the group consisting of SEQ ID NOs: 19, 35-37, 39-42, 91, 92, 101, 108, 11 l, 135, 141, 151, 274, 277, 280, 286, 319, 350, 363, 368, 375, 495-498, 517, 518, 524, 529, 545, 548, 549, 555, 557, _g_ 560-563, 566, 585, 590, 591, 595, 599, 603, 605, 611, 614-616, 650, 676, 679, 682, 684, 702, 703, 707-710, 717-720, 729-732, 752, 755, 770, and 801-803.
In some embodiments the T-rich immunostimulatory nucleic acid is a poly-T
nucleic acid comprising 5' TTTT 3'. In yet other embodiments the poly-T nucleic acid comprises 5' X1XZTTTTX3X4 3' wherein Xl, XZ, X3, and X4 are nucleotides. In some embodiments XIXa is TT and/or X3X4 is TT. In other embodiments X1X2 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC;
and/or X3X4 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
to The T-rich immunostimulatory nucleic acid may have only a single poly-T
motif or it may have a plurality of poly-T nucleic acid motifs. In some embodiments the T-rich immunostimulatory nucleic acid comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 T motifs. In other embodiments it comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 CpG motifs. In some embodiments the plurality of CpG motifs and poly-T motifs are interspersed.
In yet other embodiments at least one of the plurality of poly-T motifs comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 contiguous T
nucleotide residues. In other embodiments the plurality of poly-T motifs is at least 3 motifs and wherein at least 3 motifs each comprises at least 3 contiguous T
nucleotide residues or 2o the plurality of poly-T motifs is at least 4 motifs and Wherein the at least 4 motifs each comprises at least 3 contiguous T nucleotide residues.
The T-rich immunostimulatory nucleic acid may include one or more CpG motifs.
hl other embodiments the T-rich immunostimulatory nucleic acid is free of one or more CpG
dinucleotides.
In other embodiments the T-rich immunostimulatory nucleic acid has poly A, poly-G, and/or poly C motifs. In other embodiments the T-rich immunostimulatory nucleic acid is free of two poly C sequences of at Least 3 contiguous C nucleotide residues.
Preferably the T-rich irnmunostimulatory nucleic acid is free of two poly A sequences of at least 3 contiguous A nucleotide residues. In other embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% C or greater than 25%
A. In yet other embodiments the T-rich immunostimulatory nucleic acid is free of poly-C
sequences, poly-G sequences or poly-A sequences.

-g_ In some cases the T-rich immunostimulatory nucleic acid may be free of poly-T
motifs, but rather, comprises a nucleotide composition of greater than 2S% T.
In other embodiments the T-rich immunostimulatory nucleic acid may have poly-T motifs and also comprise a nucleotide composition of greater than 2S% T. In some embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% T, greater than 30% T, greater than 40% T, greater than 50% T, greater than 60%
T, greater than 80% T, or greater than 90% T nucleotide residues.
In some embodiments the poly-G nucleic acid comprises: 5' X1X2GGGX3X4 3' wherein Xl, X2, X3, and X4 are nucleotides. In embodiments at least one of X3 and X4 are a G or both of X3 and X4 are a G. In other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In yet other embodiments the poly-G nucleic acid comprises the following formula:
S' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides.
The poly-G immunostimulatory nucleic acid may include one or more CpG motifs or T-rich motifs. In other embodiments the poly-G nucleic acid is free of one or more CpG
dinucleotides or poly-T motifs.
Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts data from flow cytometry which demonstrates the induction of a morphologic change in marginal zone Lymphoma cells upon CpG oligonucleotide stimulation. Malignant B cells from a patient with marginal zone lymphoma were stimulated with no oligonucleotide (A and D), control oligonucleotide (ODN 2017, SEQ 1D
NO: 168, B
and E) or CpG oligonucleotide (ODN 2006, SEQ 1D NO: 729, C and F) and analyzed by flow cytornetry. A, B, and C illustrate forward scatter (FSC; x-axis) vs. side scatter (SSC; y-axis).
D, E and F illustrate CD19 expression (x-axis) against FSC (y-axis).
Figure 2 depicts data from flow cytometry which demonstrates the change in 3o expression of surface antigens on marginal zone lymphoma cells upon CpG
oligodoexynucleotide (ODN) treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed using either CpG or non-CpG oligonucleotide. Thin curves indicate incubation with medium alone, dotted curves indicate incubation with control oligonucleotide, and bold curves indicate incubation with CpG oligonucleotide.
Figure 3 is a set of bar graphs depicting changes in expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon treatment with, from left to right in each panel: negative control, no oligonucleotide, control oligonucleotide (ODN 2017, SEQ ID NO: 168), or CpG
oligonucleotide (ODN 2006, SEQ ID NO: 729). Each panel represents one experiment.
Figure 4 is a set of graphs depicting the observation that the effect of CpG
l0 oligonucleotide on CD20 (top) and CD40 (bottom) is dependent on the baseline level of expression of CD20 and CD40. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated with or without CpG
oligonucleotide, and expression of CD20 and CD40 was measured by flow cytometry.
Figure 5 depicts data from flow cytometry which demonstrates the effect of CpG
oligonucleotide-induced proliferation of malignant and normal B cells.
Peripheral blood mononuclear cells from patients with B-CLL (left) or marginal zone lymphoma with circulating malignant cells (right), were incubated with CpG oligonucleotide (bottom) or medium alone (top) and evaluated by two-color flow cytometry. CFSE
fluorescence (x-axis) and expression of CD5 (B-CLL) or CD 19 (marginal zone lymphoma) (y-axis) were 2o evaluated.
Figure 6 is a graph depicting the survival of mice inj ected on Day 0 with tumor cells in response to CpG simulation in combination with marine IgG2a and marine IgGl anti-tumor antibodies. Treatments are shown as filled squares, untreated controls;
filled circles, marine IgGl; filled triangles, marine IgG1 plus CpG; filled diamonds, marine IgG2a; and open squares, marine IgG2a plus CpG.
DETAILED DESCRIPTION
Present cancer treatments are often ineffective as well as being associated with a high degree of patient morbidity. The invention provides methods and products for the more 3o effective treatment of cancer using a combination of immunostimulatory nucleic acids, antibodies, and optionally cancer therapies.

The invention is based, in part, on the surprising discovery that administration to a subject of immunostimulatory nucleic acids induces the expression of cell surface antigens including CD20, CD19, and CD22 on the surface of a cancer cell and that the induction of these antigens leads to enhanced antibody-dependent cellular cytotoxicity (ADCC). It was previously believed that CpG oligonucleotides enhanced ADCC by influencing the effector cell (e.g., by activating natural killer (NK) cells). Now it has been discovered according to the invention that immunostirnulatory nucleic acids actually cause the induction of specific antigens CD20, CD19, and CD22, each of which can be targeted by specific antibody therapies. The discovery that immunostimulatory nucleic acids are capable of upregulating to expression of certain target antigens on the surface of cancer cells, supports the development of therapies using immunostimulatory nucleic acids in combination with specific antibodies which interact with these cell surface antigens. Thus, in one aspect, the invention provides a method for treating or preventing cancer which involves the administration to a subject of a combination of an immunostimulatory nucleic acid and an antibody which specifically interacts with CD20, CD 19, and CD22 in an effective amount to prevent or treat the cancer.
Additionally, it was discovered that the increased expression of these and other cell surface antigens varies widely depending upon the histological state of the tumor cell studied.
The effect of immunostimulatory nucleic acids on different types of primary malignant B
cells and reactive follicular hyperplasia was extensively examined. All B-cell lymphoma 2o cells tested increased in size and granularity, upregulated activation markers (CD80, CD86, CD40, CD54, CD69), and upregulated antigen presentation molecules (class I
major histocompatibility complex (MHC I), class II major histocompatibilty complex (MHC II)) in response to immunostimulatory nucleic acids. A control poly-C
oligodeoxynucleotide (ODN) showed only minor effects. The extent of phenotypic change induced by immunostimulatory nucleic acids differed from sample to sample.
Immunostimulatory nucleic acids, but not control nucleic acids, increased the expression of co-stimulatory molecules (e.g., CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells derived from reactive follicular hyperplasia.
Immunostimulatory nucleic acids also enhanced expression of both class I and class IT MHC in most samples.
3o CD20 expression was increased in response to immunostimulatory nucleic acids, most notably in B-CLL and marginal zone lymphoma.

Furthermore, an inverse correlation was found between baseline expression of specific cell surface antigens and their expression after exposure to immunostimulatory nucleic acids. Thus the most significant increase in expression of these molecules was found in those samples that had the lowest (or no) baseline levels. These data indicate that immunostimulatory nucleic acids may reverse low expression of co-stimulatory molecules on malignant B cells that correspond to a low level of activation, while their effects on cells that are already in an activated state are less profound.
Thus, the invention relates to methods for identifying an appropriate therapy for a lymphoma patient, and for treating the patient using that therapy. The method can be to accomplished by isolating a B cell from a lymphoma patient and comparing the surface antigens expressed on the malignant B cell with those expressed on normal B
cells. The antigens which are expressed in low levels or not at all on the malignant B
cell can be identified. The subject can then be treated using a combination of an immunostimulating nucleic acid and an antibody which specifically recognizes the antigens) which are expressed 1 5 in low levels or not at all on the malignant B cell.
The invention is also useful for treating cancers which are resistant to monoclonal antibody therapy. It has been discovered according to the invention, that immunostimulatory nucleic acids can reverse the resistance of tumor cells and render tumor cells which were previously non-responsive or only weakly responsive, sensitive to therapy. In particular it 2o has been discovered that immunostimulatory nucleic acids can cause a phenotypic change to a resistant tumor cell that renders it sensitive to monoclonal antibody therapy. For instance, the monoclonal anti-CD20 antibody Rituximab has been shown to be effective clinically in several trials and has recently been approved for the therapy of follicular B
cell lymphoma.
Maloney DG, Semin Oncol 26:74-8 (1999); Foran JM et al., J Clin Oncol 18:317-24 (2000);
25 Witzig TE et al., JCIi~ Ohcol 17:3793-803 (1999); Davis TA et al., JClira Of~col 17:1851-7 (1999); Wiseman GA et al., Cli~c CafacerRes 5:3281s-3286s (1999); Grillo-Lopez AJ et al, Semite Oracol 26:66-73 (1999). There are reports that with lymphomas a small minority of tumors that re-emerge following Rituximab therapy can lack CD20 expression.
Davis TA et al., Clist CanceY Res 5:611-5 (1999); Kinoshita T et al., J Clin Oncol 16:3916 (1998). The 3o immunostimulatory nucleic acids of the invention are useful for treating this set of resistant tumors. Additionally, Rituximab has not been useful for the treatment of all types of B cell malignancies. Expression of CD20 is relatively low on B-CLL cells, which provides an explanation for why Rituximab is less effective for CLL than for some other B-cell malignancies. Grinaldi L et al., J Clin Pathol 51:364-9 (1998). The immunostimulatory nucleic acids of the invention are also useful for treating these tumors.
The humanized monoclonal antibody 1D10 recognizes an HLA-DR variant antigen.
Link BK et al., Blood 81:3343-9 (1993). This antibody is currently being tested in a phase I
clinical trial in patients with lymphoma. One limitation to the use of this antibody is that the target antigen is only expressed by approximately 50% of B-cell lymphomas.
Interestingly, its expression was upregulated by immunostimulatory nucleic acids in all lymphoma samples tested. It was discovered according to the invention that immunostimulatory nucleic acids to may enhance the efficacy of therapy with these and other antibodies by increasing expression of target antigen. Thus in another aspect the invention includes methods for treating lymphoma by administering to a subject an immunostimulatory nucleic acid and antibodies specific for HLA-DR. One useful antibody is the humanized monoclonal antibody 1D10. It is particularly useful for treating resistant tumors.
The invention also relates to the discovery of a specific subclass, or isotype, of antibody which when combined with immunostimulatory nucleic acids produces a synergistic immune response. Another subclass, or isotype, does not even provide an additive response when combined with immunostimulatory nucleic acids. It was discovered according to the invention that the combination of immunostimulatory nucleic acids and human antibodies of the IgGl isotype results in an increased (synergistic) survival rate. When immunostimulatory nucleic acids are combined with human antibodies of the IgG2 isotype, no increase in survival rate is observed over the use of the IgG2 antibody alone. The IgG2 isotype (which correlates with the marine IgGl isotype) is believed to be recognized by the Fc receptor designated CD 16 that is expressed largely by NK cells. Immunostimulatory nucleic acids are known to activate NK cells, and thus, it is surprising that immunostimulatory nucleic acids do not enhance the therapeutic effect of human IgG2 or marine IgGl antibodies.
Since NK cells are believed to be involved in ADCC and are activated by immunostimulatory nucleic acids, it was surprising that antibodies of the human IgG2 (or marine IgGl) isotype do not produce a synergistic or even additive response when administered with immunostimulatory nucleic acids.
A cancer cell is a cell that divides and reproduces abnormally due to a loss of normal growth control. Cancer cells almost always arise from at least one genetic mutation. In some instances, it is possible to distinguish cancer cells from their normal counterparts based on profiles of expressed genes and proteins, as well as to the level of their expression. Genes commonly affected in cancer cells include oncogenes, such as ras, neu/HER2/erbB, myb, myc and abl, as well as tumor suppressor genes such as p53, Rb, DCC, RET and WT.
Cancer-related mutations in some of these genes leads to a decrease in their expression or a complete deletion. In others, mutations cause an increase in expression or the expression of an activated variant of the normal counterpart.
The term "tumor" is usually equated with neoplasm, which literally means "new growth" and is used interchangeably with "cancer." A "neoplastic disorder" is any disorder 1o associated with cell proliferation, specifically with a neoplasm. A
"neoplasm" is an abnormal mass of tissue that persists and proliferates after withdrawal of the carcinogenic factor that initiated its appearance. There are two types of neoplasms, benign and malignant. Nearly all benign tumors are encapsulated and are noninvasive; in contrast, malignant tumors are almost never encapsulated but invade adjacent tissue by infiltrative destructive growth. This infiltrative growth can be followed by tumor cells implanting at sites discontinuous with the original tumor. The method of the invention can be used to treat neoplastic disorders in humans, including but not limited to: sarcoma, carcinoma, fibroma, glioma, leukemia, lymphoma, melanoma, myeloma, neuroblastoma, retinoblastoma, and rhabdomyosarcoma, as well as each of the other tumors described herein.
"Cancer" as used herein refers to an uncontrolled growth of cells which interferes with the normal functioning of the bodily organs and systems. Cancers which migrate from their original location and seed vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs. Hemapoietic cancers, such as leukemia, are able to out-compete the normal hemopoietic compartments in a subject, thereby leading to hemopoietic failure (in the form of anemia, thrombocytopenia and neutropenia), ultimately causing death.
A metastasis is a region of cancer cells, distinct from the primary tumor location, resulting from the dissemination of cancer cells from the primary tumor to other parts of the body. At the time of diagnosis of the primary tumor mass, the subject may be monitored for 3o the presence of metastases. Metastases are most often detected through the sole or combined use of magnetic resonance imaging (MRI) scans, computed tornography (CT) scans, blood and platelet counts, liver function studies, chest X-rays and bone scans in addition to the monitoring of specific symptoms.
Cancers include, but are not limited to, basal cell carcinoma, biliary tract cancer;
bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cervical cancer;
choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck;
gastric cancer; infra-epithelial neoplasm; kidney cancer; larynx cancer;
leukemia; liver cancer; lung cancer (e.g., small cell and non-small cell); lymphoma including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cavity cancer (e.g., lip, l0 tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer;
retinoblastoma; rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the respiratory system; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; cancer of the urinary system, as well as other carcinomas and sarcomas.
The immunostimulatory nucleic acids and antibodies are useful for treating or preventing cancer in a subject. A "subject" unless otherwise specified shall mean a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, or primate, e.g., monkey. Thus the invention can be used to treat cancer and tumors in human and non human subjects. Cancer is one of the leading causes of death in companion animals (i.e., eats and dogs). Cancer usually strikes older animals which, in the case of house pets, 2o have become integrated into the family. Forty-five percent of dogs older than 10 years of age are likely to succumb to the disease. The most common treatment options include surgery, chemotherapy and radiation therapy. Other treatment modalities which have been used with some success are laser therapy, cryotherapy, hyperthermia and immunotherapy.
The choice of treatment depends on the type of cancer and degree of dissemination. Unless the malignant growth is confined to a discrete area in the body, it is difficult to remove only malignant tissue without also affecting normal cells.
Malignant disorders commonly diagnosed in dogs and cats include but are not limited to lymphosarcoma, osteosarcoma, mammary tumors, ~mastocytoma, brain tumor, melanoma, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar 3o adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilms' tumor, Burkitt's lymphoma, microglioma, neuroblastoma, osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and rhabdomyosarcoma. Other neoplasias in dogs include genital squamous cell carcinoma, transmissable venereal tumor, testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma (granulocytic sarcoma), corneal papilloma, corneal squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma, oral papillomatosis, hemangioendothelioma and cystadenoma. Additional malignancies diagnosed in cats include follicular lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary squamous cell carcinoma. The ferret, an ever-more popular house pet, is known to develop insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma and l0 gastric adenocarcinoma.
Neoplasias affecting agricultural livestock include leukemia, hemangiopericytoma and bovine ocular neoplasia (in cattle); preputial fibrosarcoma, ulcerative squamous cell carcinoma, preputial carcinoma, connective tissue neoplasia and mastocytoma (in horses);
hepatocellular carcinoma (in swine); lymphoma and pulmonary adenomatosis (in sheep);
pulmonary sarcoma, lymphoma, Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian species);
retinoblastoma, hepatic neoplasia, lymphosarcoma (lyrnphoblastic lymphoma), plasmacytoid leukemia and swimbladder sarcoma (in fish), Gaseous lymphadenitis (CLA): chronic, infectious, contagious disease of sheep and goats caused by the bacterium CoryfZebacterium pseudotuberculosis, and contagious lung tumor of sheep caused by jaagsiekte.
In one aspect, a method for treating cancer is provided which involves administering the compositions of the invention to a subject having cancer. A "subject having cancer" is a subject that has been diagnosed with a cancer. In some embodiments, the subject has a cancer type characterized by a solid mass tumor. The solid tumor mass, if present, may be a primary tumor mass. A primary tumor mass refers to a growth of cancer cells in a tissue resulting from the transformation of a normal cell of that tissue. In most cases, the primary tumor mass is identified by the presence of a cyst, which can be found through visual inspection or palpation methods, or by irregularity in shape, texture or weight of the tissue.
However, some primary tumors are not palpable and can be detected only through 3o medical imaging techniques such as X-rays (e.g., mammography), or by needle aspirations.
The use of these latter techniques is more common in early detection.
Molecular and phenotypic analysis of cancer cells within a tissue will usually confirm if the cancer is endogenous to the tissue or if the lesion is due to metastasis from another site.
With respect to the prophylactic treatment methods, the invention is aimed at administering the compositions of the invention to a subject at risk of developing cancer. A
subject at risk of developing a cancer is one who has a high probability of developing cancer.
These subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer. Subjects exposed to cancer-causing agents such as tobacco, asbestos, or other chemical toxins are also subjects at risk of developing cancers used herein. When a to subject at risk of developing a cancer is treated with an immunostimulatory nucleic acid, an antibody and optionally a cancer therapy, on a regular basis, such as monthly, the cancer growth will be prevented from initiating. This aspect of the invention is particularly advantageous when the subj ects employed in certain trades which are exposed to cancer-causing agents on an ongoing basis. For example, many airborne, or inhaled, carcinogens such as tobacco smoke and asbestos have been associated with lung cancer.
A carcinogen is an agent capable of initiating development of malignant cancers.
Exposure to carcinogens generally increases the risk of neoplasms in subjects, usually by affecting DNA directly. Carcinogens may take one of several forms such as chemical, electromagnetic radiation, or may be an inert solid body.
2o Substances fox which there is sufficient evidence to establish a causal relationship in cancer in humans are referred to as confirmed human carcinogens. Included in this category are the following substances: Aflatoxins, Alcoholic beverages, Aluminium production, 4-aminobiphenyl, Arsenic and arsenic compounds, Asbestos, Manufacture of auramine, Azathioprine, Benzene, Benzidine, Beryllium and beryllium compounds, Betel quid with tobacco, Bis(chloromethyl)ether and chloromethyl methyl ether (technical grade), Boot and shoe manufacture and repair (occupational exposure), 1,4 Butanediol dimethanesulphonate (Myleran), Cadmium and cadmium compounds, Chlorambucil, Chlornaphazine, 1-(2-Chloroethyl)-3-(4-methylcyclohexyl)-1 nitrosourea, Chloromethyl methyl ether (technical), Chromium compounds (hexavalent), Coal gasification, Coal tar pitches, Coal tars, Coke production, Cyclophosphamide, Cyclosporin, Erionite, Ethylene oxide, Furniture and cabinet making, Underground haematite mining with exposure to radon, Iron and steel founding, Isopropyl alcohol manufacture (strong acid process), Manufacture of magenta, Melphalan, 8-Methoxypsoralen (Methoxsalen) plus ultraviolet radiation, Mineral oils-untreated and mildly-treated oils, MOPP and other combined chemotherapy for cancer, Mustard gas (sulphur mustard), 2-Naphthylamine, Nickel and nickel compounds (essentially sulphate and sulphide), Nonsteroidal estrogens (not necessarily all in group) includes diethylstilbestrol, Estrogen replacement therapy, and Combined oral contraceptives and sequential oral contraceptives, Steroidal estrogens (not all in group), Painter (occupational exposure as a painter), Phenacetin (analgesic mixtures containing), Rubber industry, Salted fish (Chinese style), Solar radiation, Shale oils, Soots, Sulphuric acid (occupational exposures to strong-inorganic-acid mists of sulphuric acid), Talc containing asbestiform fibres, Thiotepa, to Tobacco products (smokeless), Tobacco smoke, Treosulphan, and Vinyl chloride.
Substances for which there is a lesser degree of evidence in humans but sufficient evidence in animal studies, or degrees of evidence considered unequivocal of mutagenicity in mammalian cells, are referred to as probable human carcinogens. This category of substances includes: Acrylamide, Acrylonitrile, Adriarnycin, Anabolic steroids, Azacitidine, Benzanthracene, Benzidine-based dyes (technical grade), Direct Black 38, Direct Blue 6, Direct Brown 95, Benzopyrenel,3-Butadiene, Captafol, Bischloroethyl nitrosourea (BCNU), 1-(2-Chloroethyl)-3-cyclohexyl-1-nitrosourea (CCNU), Chloramphenicolpara-Chloro-ortho-toluidine and its strong acid salts, Chlorozotocin, Cisplatin, Creosotes, Dibenzanthracene, Diesel engine exhaust, Diethyl sulphate, Dirnethylcarbamoyl chloride, Dimethyl sulphate, 2o Epichlorohydrin, Ethylene dibromide, N-ethyl-N-nitrosourea, Formaldehyde, Glass manufacturing industry (occupational exposure), Art glass (glass containers and pressed ware), Hairdresser or barber (occupational exposure, probably dyes), Insecticide use (occupational), IQ (2-Amino-3-methylimidazo[4,5-fJquinoline), Mate drinking (hot), 5-Methoxypsoralen, 4,4'-Methylenebis(2-chloroaniline) (MOCA), N-Methyl-N-nitro-N-nitrosoguanidine (MNNG), N-Methyl-N-nitrosourea, Nitrogen mustard, N-Nitrosodiethylamine, N-Nitrosodimethylamine, Petroleum refining (occupational refining exposures), Phenacetin, Polychlorinated biphenyls, Procarbazine hydrochloride, Silica (crystalline), Styrene-7,8-oxide, Tris(1-azaridinyl)phosphine sulphide (Thiotepa), Tris(2,3-dibromopropyl) phosphate, Ultraviolet radiation: A, B and C including sunlamps and 3o sunbeds, and Vinyl bromide.
Substances for which there is sufficient evidence in animal tests are referred to as possible human carcinogens. This category of substances includes: A-C(2-Amino-pyrido[2,3-b]indole), Acetaldehyde, Acetamide, AF-2[2-(2-Furyl)-3-(5-vitro-2-furyl)acrylamide, pare-Aminoazobenzene, ortho-Aminoazobenzene, 2-Amino-5-(5-vitro-2-furyl)-1,3,4-thiadiazole, Amitrole, ortho-Anisidine, Antimony trioxide, Arasnite, Atrazine, Attapulgite, Azaserine, Benzo[b]fluoranthene, Benzo[j]fluoranthene, Benzo[k]fluoranthene, Benzyl violet, Bitumens (extracts of steam-refined and air-refined bitumens), Bleomycins, Bracken ferns, Bromodichloromethane, Butylated hydroxyanisole (BHA), a-Butyrolactone, Caffeic acid, Carbon black extract, Carbon tetrachloride, Carrageenan (degraded), Ceramic fibres, Chloramphenicol, Chlordane, Chlordecone, Chlorendic acid, Chlorinated paraffins of average carbon-chain length C12 and average degree of chlorination approx 60%, alpha-to Chlorinated toluenes (not necessarily all in group), Benzotrichloride, pare-Chloroaniline, Chloroform, Chlorophenols, Pentachlorophenol, 2,4,6-Trichlorophenol, Chlorophenoxy herbicides (not necessarily all in group), 4-Chloro-ortho-phenylenediamine, CI
Acid Red 114, CI Basic Red 9, CI Direct Blue 15, Citrus Red No.2, Cobalt and cobalt compounds, Coffee (bladder), pare-Cresidine, Cycasin, Dacarbazine, Dantron (1,8-dihydroxyanthraquinone), Daunomycin, DDT, N,N'-Diacetylbenzidine, 4,4'-Diaminodiphenyl ether, 2,4-Diaminotoluene, Dibenz[a,h]acridine, Dibenz[aj]acridine, 7H-Dibenzo[c,g]carbazole, Dibenzo[a,e]pyrene, Dibenzo[a,h]pyrene, Dibenzo[a,i]pyrene, Dibenzo[a,l]pyrene, 1,2-Dibromo-3-chloropropane, pare-Dichlorobenzene, 3,3'-Dichlorobenzene, 3,3'-Dichloro-4,4'-diaminodiphenyl ether, 1,2-Dichloroethane, 2o Dichloromethane, 1,3-Dichloropropene (technical grade), Dichlorvos, Diepoxybutane, Diesel fuel (marine), Di(2-ethylhexyl)phthalate, 1,2-Diethylhydrazine, Diglycidyl resorcinol ether, Dihydrosafrole, Diisopropyl sulfate, 3,3'-Dimethoxybenzidine, pare-Dimethylaminoazobenzene, trans-2-[(Dimethylamino)methylimino]-5-[2-(5-vitro-2-furyl[vinyl]-1,3,4-oxidiazole, 2,6-Dimethylaniline (2,6-Xylidene), 3,3'-Dimethylbenzidine (ortho-tolidine), Dimethylformamide, 1,1-Dimethylhydrazine, 1,2-Dimethylhydrazine, 1,6-Dinitropyrene, 1,8-Dinitropyrene, 1,4-Dioxane, Disperse Blue, lEthyl acrylate, Ethylene thiourea, Ethyl methanesulphonate, 2-(2-Formylhydrazino)-4-(5-vitro-2-furyl)thiazole, Fuel oils (residual, heavy), Fusarium moniliforme (toxins derived from), Fumonisin B1;
Fumonisin B2; Fusarin C, Gasoline, Gasoline engine exhausts, Glasswool, Glu-P-1 (2-3o Amino-6-methyldipyrido[1,2-a:3'2'-d]imidazole), Glu-P-2(-Aminodipyrido[1,2-a:3'2'-d]imidazole), Glycidaldehyde, Griseofulvin, HC Blue No 1, Heptachlor, Hexachlorobenzene, Hexachlorocyclohexanes Technical grades alpha isomer gamma isomer (lindane), Hexamethylphosphoramide, Hydrazine, Indeno[1,2,3-cd]pyrene, Iron-dextran complex, Isoprene, Lasiocarpine, Lead and lead compounds (inorganic), Magenta (containing CI Basic Red 9), Man-made mineral fibres (see glasswool, rockwool, slagwool, and ceramic fibres), MeA-a-C (2-Amino-3-methyl-9H-pyrido[2,3-b]indole), MeIQ (2-Amino-3,4-dimethylimidazo[4,5-f]-quinolone), MeIQx (2-Amino-3,8-dimethylamidazo[4,5-f]quinoxaline), Methylmercury compounds (methylmercuric chloride), Melphalan, Methylaziridine, Methylazoxymethanol and its acetate, 5-Methylchrysene, 4,4'-Methylenebis(2-methylaniline), 4,4'-Methylenedianiline, Methylmethanesulphonate, 2-methyl-1-nitroanthraquinone (uncertain purity), N-methyl-N-nitrosourethane, to Methylthiouracil, Metronidazole, Mirex, Mitomycin, Monocrotaline 5-(Morpholinomethyl)-3-[(5-nitrofurfurylidene)amino]-2-oxazolidinone, Nafenopin, Niridazole, 5-Nitroacenaphthene, 6-Nitrochrysene, Nitrofen (technical grade), 2-Nitrofluorenel-[(5-Nitrofurfurylidene)amino]-2-imidazolidinone, N-[4-(5-Nitro-2-furyl)-2-thiazolyl]acetamide, Nitrogen mustard, N-oxide, Nitrolotriacetic acid and its salts, 2-Nitropropanel-Nitropyrene, 4-Nitropyrene, N-Nitrosodi-n-butylamine, N-Nitrosodiethanolamine, N-Nitrosodi-n-propylamine, 3-(N-Nitrosomethylamino)propionitrile, 4-(N-Nitrosomethylamino)-1-(3-pyridyl)-1-butanone (NNK), N-Nitrosomethylethylamine, N-Nitrosomethylvinylamine, N-Nitrosomorpholine, N-Nitrosonornicotine, N-Nitrosopiperidene, N-Nitrosopyrrolidine, N-Nitrososarcosine, Ochratoxin A, Oil Orange, Panfuran S (containing 2o dihydroxymethylfuratzine), Phenazopyridine hydrochloride, Phenobarbital, Phenoxybenzamine hydrochloride, Phenyl glycidyl ether, PhenytoinPhIP (2-Amino-methyl-6-phenylimidazo[4,5-b]pyridine, Pickled vegetables, traditional Asian, Polybrominated biphenyls, Ponceau MXPonceau 3R, Potassium bromate, 1,3-Propane sultone, Propylene oxide, Progestins, Medroxyprogesterone acetate, a-Propiolactone, Propylthiouracil, Rockwool, Saccharin, Safrole, Slagwool, Sodium ortho-phenylphenate, Sterigmatocystin, Streptozotocin, Styrene, Sulfallate, 2,3,7,8-Tetrachlorodibenzo-para-dioxin (TODD), Tetrachloroethylene, Textile manufacturing (occupational exposures), Thiocetamide, 4,4'-Thiodianiline, Thiourea, Toluene, diisocyanatesortho-Toluidine, Toxaphene (polychlorinated camphenes), Trichlormethine (trimustine hydrochloride), Trp-P-1 (3-Amino-1,4-dimethyl-5-H-pyrido[4,3-b]indole), Trp-P-2 (3-Amino-1-methyl-5H-pyrido[4,3-b]indole), Trypan blue, Uracil mustard, Urethane, 4-Vinylcyclohexene, 4-Vinylcyclohexene diepoxide, Welding fumes, Wood industries and Carpentry and joinery.

Subj ects at risk of developing cancer also include those who have a genetic predisposition to cancer. In many cases, genetic predisposition to cancer can be identified by studying the occurrence of cancer in family members. Examples of genetic predisposition to common forms of cancer include, but are not limited to, mutation of BRCAl and BRCA2 in familial breast cancer, mutation of APC in familial colony cancer (familial polyposis coli), mutation of MSH2 and MLH1 in hereditary nonpolyposis colon cancer (HNPCC), mutation of p53 in Li-Fraumeni syndrome, mutation of Rbl in retinoblastoma, mutation of RET in multiple endocrine neoplasia type 2 (MENZ), mutation of VHL in renal cancer and mutation of WTl in Wilms' tumor. Other cancers for which a familial predisposition has been l0 identified include ovarian, prostate, melanoma and lung cancer.
It has been estimated that almost half of all currently diagnosed cancers will be treated with some form of cancer medicament. However, many forms of cancer, including melanoma, colorectal, prostate, endometrial, cervical and bladder cancer, do not respond well to treatment with cancer medicaments. In fact, only about 5-10 percent of cancers can be 15 cured using cancer medicaments alone. These include some forms of leukemias and lymphomas, testicular cancer, choriocarcinoma, Wilms' tumor, Ewing's sarcoma, neuroblastoma, small-cell lung cancer and ovarian cancer. Treatment of still other cancers, including breast cancer, requires a combination therapy of surgery or radiotherapy in conjunction with a cancer medicament.
2o The immunostimulatory nucleic acids are administered in combination with antibodies which specifically bind to cancer cell surface antigens. These antibodies include but are not limited to anti-CD20 antibodies, anti-CD40 antibodies, anti-CD 19 antibodies, anti-CD22 antibodies, anti-HLA-DR antibodies, anti-CD80 antibodies, anti-CD86 antibodies, anti-CD54 antibodies, and anti-CD69 antibodies. These antibodies are available from 25 commercial sources or may be synthesized de novo.
Commercially available anti-CD20 antibodies include but are not limited to those presented in Table 1 below.
Table 1. Commercially Available Anti-CD20 Antibodies.
Product/Su tier Catalo #

Monoclonal Antibody to CD20, Human, ANC-169-020 Purified, 100 ~g Alexis Co Product/Su tier Catato #

CD20, B-Cell Bab Mouse: anti-Human V6021 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda Corporation CD20, B-Cell Mab Mouse: anti-Human V 1018 Clone: L26 Isotype: IgG2a, Kappa; Concentrated Biomeda Co oration CD20, B-Cell MAb Mouse: anti-Human K026 Clone: L26 Isotype: IgG2a, Kappa; Dehydrated Biomeda Co oration CD20, B-Cell Mab Mouse: anti-Human 058D

Clone: L26 Isotype: IgG2a, Kappa; Prediluted Biomeda Corporation Mouse anti-Human CD20 AHS2022 BioSource International Mouse anti-Human CD20 AHS2001 BioSource International Mouse anti-Human CD20 AHS2028 BioSource International Mouse anti-Human CD20 AHS2002 BioSource International Mouse anti-Human CD20 AHS2021 BioSource International Mouse Anti-CD20, B-Cell, Human IgG2a MOB004 Antibody, Kappa, Supernatant, Clone L26,1 mL

BIOTREND Chemikalien GmbH

AnTesti-CD20, Human, Mouse, 100 ~g 217670 Calbiochem Mouse Monoclonal Anti-(Human CD20) MHCD2000 IgG3 Antibody, Clone HI47, 0.5 mL

Calta Laboxatories Mouse Monoclonal Anti-(Human CD20) MHCD2000-4 IgG3 Antibody, Clone B-ly 1, 1 mL

Calta Laboratories Mouse Monoclonal Anti-(Human CD20), MON1111 Mature B-cell) IgGl Antibody, Clone MEM-97, 1 mL

Calta Laboratories CD20, B-cell, Mouse Anti-Human, Clone: N150230 L26, Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, Envision & Envision Doublestain, Monoclonal Antibody, 12 mL

DAKO Corp.

CD20, B-cell, Mouse Anti-Human, Clone: N150289 L26, Isotype: IgG2a, kappa, Ready-to-Use, LSAB2, Envision & Envision Doublestain, Monoclonal Antibody, Packaged for DAKO

Autostainer, 33 mL\

DAKO Co CD20, L26 B-cell Marker, Mouse Anti-Human, M075501 Human, Monoclonal Antibody, 1 mL

DAKO Co CD20, L26 B-cell Marker, Mouse Anti-Human M077401 Monoclonal Antibody, 1 mL

DAKO Co MxH B cell, CD20 RTU, 12 mL L185030 DAKO Co Product/Su lier Catalo #

Monoclonal Anti-B-Cell, CD20 IgG2a Mob 004 Antibody, Clone L26, concentrated, 1 mL

Dia nostic BioSystems Monoclonal Anti-CD20, B-Cell IgGl Mob 241 Antibody, Clone 7D1, concentrated, 1 mL

Dia nostic BioS stems Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-O1 Antibody, Clone L26, Concentrated, 1 mL

Dia nostic BioSystems Rabbit Polyclonal Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL

Diagnostic Biosystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006603858 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1342 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1565 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1454 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006604106 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006603446 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1451 Y.
Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006602381 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM1925 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006602140 Fisher Scientific Co.

0D20, Pan B-cell marker, Mouse Anti- M077401 Human, Monoclonal Antibody, 1 mL

DAI~O Co MxH B Cell, CD20 RTU, 12 mL 1,185030 Monoclonal Anti-B-Cell, CD20 IgG2a Mob 004 Antibody, Clone L26, Concentrated, 1 mL

Dia nostic BioSystems Monoclonal Anti-CD20, B-Cell IgGl Mob 241 Antibody, Clone 7D 1, Concentrated,, l mL

Dia nostic BioS stems Monoclonal Anti-CD20, B-Cell IgG2a Mob 004-Ol Antibody, Clone L26, Concentrated, 1 mL

Dia nostic BioSystems Rabbit Polyclonal Anti-CD20, B-cell RP 041 Antibody, Concentrated, 1 mL

Dia nostic BioSystems Coulter* Antibodies to Human CDs::CD20 COIM 1455 Fisher Scientific Co.

Product/Su Tier Catalo #

Coulter* Antibodies to Human CDs::CD20 006603858 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1342 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1565 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1454 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006604106 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006603446 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1456 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1451 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006602381 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 COIM 1925 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006602140 Fisher Scientific Co.

Coulter* Antibodies to Human CDs::CD20 006602471 Fisher Scientific Co.

0D20 (B Cell) AM-1165-11 InnoGenex Coulter* Antibodies to Human CDs::CD20 006602471 Fisher Scientific Co.

0D20 (B Cell) AM-1165-11 InnoGenex CD20 (B Cell), Unpurified AM-1165-11 (0.1 mg/0.1 mL), Clone: B 1, Isotype:

InnoGenex Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-SO

Cell Marker) IgG2a/K Antibody, Clone:

L26, Workshop, 0.1 mL

Lab Vision Co Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S1 Cell Marker) IgG~a/K Antibody, Clone:

L26, Workshop, 0.5 mL

Lab Vision Co Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-S

Cell Marker) IgG2a/K Antibody, Clone:

L26, Workshop, 1.0 mL

Lab Vision Co Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-340-R7 Cell Marker) IgGZa/K Antibody, Clone:

L26, Workshop, 7.0 mL

Lab Vision Co Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P1 Cell Marker) IgGza/K Antibody, Clone:

B9E9, Workshop V; 100 ~g Lab Vision Co Product/Su Tier Catalo #

Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-431-P

Cell Marker) IgGZa/K Antibody, Clone:

B9E9, Workshop V; 200 ~g Lab Vision Co Mouse Monoclonal Anti-CD20 (Ab-1 (B- MS-431-PO

Cell Marker) IgGZa/K Antibody, Clone:

B9E9, Workshop V; 20 itg Lab Vision Co Mouse Monoclonal Anti-CD20 Ab-1 (B- MS-758-P1 Cell Marker) IgGI/K Antibody, Clone:

93-1B3, Workshop V; Code: CD20.4, 100 ~g Lab Vision Co Mouse Monoclonal Anti-CD20 Ab-3 (B- MS-758-P

Cell Marker) IgGI/K Antibody, Clone:

93-1B3, Workshop V; Code: CD20.4, 200 ~g Lab Vision Co Mouse Monoclonal Anti-CD20 Ab-3 (B- MS-758-PO

Cell Marker) IgGI/ Antibody, Clone:

93-1B3, Workshop V; Code: CD20.4 Lab Vision Co Human CD20, B Cell, 6 mL MAB-0020 Maxim Biotech Inc.

Mouse Monoclonal Anti-B Cell, CD20 A9004C

IgG2~. K Antibody, Concentrate, 1 mL

Scytek Mouse Monoclonal Anti-B Cell, CD20 A20003 IgG2a. K Antibody, Ready-to-Use, 1 mL

Scytek Mouse Monoclonal Anti-CD20, B Cell A9001C

IgG2a~ x Antibody, Concentrate, 1 mL (Clone: L26) Scytek Mouse Monoclonal Anti-CD20, B Cell A00003 IgG2a. K Antibody, Ready-to-Use, 6 mL

Sc ek Mouse Monoclonal Anti-(Human CD20 MCA 1807 IgGl Antibody, Clone 7D1, 1 mL

Serotec, Inc.

Mouse Monoclonal Anti-(Human CD20 MCA 1822 IgGl Antibody, Clone AT80, 0.2 mg Serotec, Inc.

Mouse Monoclonal Anti-(Human CD20 MCA 1710 IgG2b Antibody, Clone 2H7, 0.2 mg Serotec, Inc.

Antibody Panels, Hematopoietic 324-O1 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Concentrated, 1 mL, Ab Source Mouse, Ab# 324 Si net Patholo y S stems, Inc.

Antibody Panels, Hematopoietic 324-13 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Level 1, 3 mL, Ab 324 Si net Patholo S stems, Inc.

Product/Supplier Catalo #

Antibody Panels, Hematopoietic 324-16 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, level 1, 6 mL, Ab Source Mouse, Ab# 324 Si net Patholo Systems, Inc.

Antibody Panels, Hematopoietic 324-26 Markers, Lymphocyte Related Antigens, CD20, B Cell, Clone L26, Level 2, 6 mL, Ab Source Mouse, Ab# 324 Si net Patholo y Systems, Inc.

Monoclonal Mouse anti-CD20, B9E9, Epitope- 07-2003 Affinity Purified-Unconjugated, IgG2a x, 200 ~g Zymed Laboratories, Inc.

Antibodies are well known to those of ordinary skill in the science of immunology.
As used herein, the term "antibody" means not only intact antibody molecules but also fragments of antibody molecules retaining specific binding ability. Such fragments are also well known in the art and are regularly employed both in vitro and in vivo. In particular, as used herein, the term "antibody" means not only intact immunoglobulin molecules but also the well-known active fragments F(ab')2, and Fab. F(ab')2, and Fab fragments which lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody. Wahl RL et al., JNucl Mecl 24:316-25 l0 (1983). Antibody fragments which are particularly useful according to the methods of the invention are those which are bispecific and constructed to enhance FcR
binding, e.g., include an Fc portion. These include, but are not limited to Medarex antibodies (MDX-210, 220, 22, 447, and 260). Other non-Fc containing fragments which interact with the antigens induced on the cell surface are also useful. These are particularly useful in combination with 15 irnmunotoxins andlor radioactivity. The fragments can be delivered separately from the immunotoxins or radioactivity or conjugated thereto (e.g., radiolabled antibodies or antibody fragments).
Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity-determining regions (CDRs), which directly interact with the epitope of 20 the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FRl through FR4) separated respectively by three complementarity-determining regions (CDRl through CDR3). The CDRs, and in particular the CDR3 regions, and more particularly the heavy 25 chain CDR3, are largely responsible for antibody specificity.

_27_ It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized marine RSV antibodies in which at least a portion of the marine FR regions have been replaced by FR regions of human origin. Such antibodies, including fragments of intact antibodies with antigen-binding ability, are often referred to as l0 "chimeric" antibodies. A "humanized monoclonal antibody" as used herein is a human monoclonal antibody or functionally active fragment thereof having human constant regions and a binding CDR3 region from a mammal of a species other than a human.
Humanized monoclonal antibodies may be made by any method known in the art. Humanized monoclonal antibodies, for example, may be constructed by replacing the non-CDR regions of a non-human mammalian antibody with similar regions of human antibodies while retaining the epitopic specificity of the original antibody. For example, non-human CDRs and optionally some of the framework regions may be covalently joined to human FR and/or Fc/pFc' regions to produce a fimctional antibody. There are entities in the United States which will synthesize humanized antibodies from specif c marine antibody regions 2o commercially, such as Protein Design Labs (Mountain View California).
European Patent Application 0239400, the entire contents of which is hereby incorporated by reference, provides an exemplary teaching of the production and use of humanized monoclonal antibodies in which at least the CDR portion of a marine (or other non-human mammal) antibody is included in the humanized antibody. Briefly, the following methods are useful for constructing a humanized CDR monoclonal antibody including at least a portion of a mouse CDR. A first replicable expression vector including a suitable promoter operably linked to a DNA sequence encoding at least a variable domain of an Ig heavy or light chain and the variable domain comprising framework regions from a human antibody and a CDR region of a marine antibody is prepared. Optionally a second replicable 3o expression vector is prepared which includes a suitable promoter operably linked to a DNA
sequence encoding at least the variable domain of a complementary human Ig light or heavy chain respectively. A cell line is then transformed with the vectors.
Preferably the cell line is _28_ an immortalized mammalian cell line of lymphoid origin, such as a myeloma, hybridoma, trioma, or quadroma cell line, or is a normal Lymphoid cell which has been immortalized by transformation with a virus. The transformed cell line is then cultured under conditions known to those of skill in the art to produce the humanized antibody.
As set forth in European Patent Application 0239400 several techniques are well known in the art for creating the particular antibody domains to be inserted into the replicable vector. (Preferred vectors and recombinant techniques are discussed in greater detail below.) For example, the DNA sequence encoding the domain may be prepared by oligonucleotide synthesis. Alternatively a synthetic gene lacking the CDR regions in which four framework l0 regions are fused together with suitable restriction sites at the junctions, such that double-stranded synthetic or restricted subcloned CDR cassettes with sticky ends could be ligated at the junctions of the framework regions. Another method involves the preparation of the DNA sequence encoding the variable CDR containing domain by oligonucleotide site-directed mutagenesis. Each of these methods is well known in the art.
Therefore, those 15 skilled in the art may construct humanized antibodies containing a murine CDR region without destroying the specificity of the antibody for its epitope.
Human monoclonal antibodies may be made by any of the methods known in the art, such as those disclosed in U.S. Patent No. 5,567,610, issued to Borrebaeck et al., U.S. Patent No. 5,565,354, issued to Ostberg, U.S. Patent No. 5,571,893, issued to Baker et al, I~ozbor D
20 et al., Jlmmunol 133:3001-5 (1984), Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc, New York, 1987), and Boerner P et al., Jlmmunol 147:86-95 (1991). In addition to the conventional methods for preparing human monoclonal antibodies, such antibodies may also be prepared by immunizing transgenic animals that are capable of producing human antibodies (e.g., Jakobovits A et al., 25 Proc Natl Acad Sci USA 90:2551-5 (1993); Jakobovits A et al., Nature 362:255-8 (1993);
Bruggermann et al., Year in Immunology 7:33 (1993); and U.S. Patent No.

5,569,825 issued to Lonberg).
Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in 3o general, Clark, W.R. (1986) The Experimental Foundations of Modern Irnmunolo~y Wiley &
Sons, Inc., New York; Roitt, I. (1991) Essential Immunolo~y, 7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzyrnatically cleaved, or which has been produced without the pFc' region, designated an F(ab')2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody to specificity) and Fd fragments retain epitope-binding ability in isolation.
Other antibodies useful according to the invention are antibodies of the IgGl isotype.
As mentioned above, anti-IgGl isotype antibody as used herein refers to a human or humanized anti-IgGl unless otherwise specified. IgGl isotype antibodies are well known in the art and include at least the antibodies listed in Table 2 below.
Table 2: Cancer Immunotherapies In Development Or On The Market.
Marketer Brand Name Generic Name Indication IDEG/Genentech, RituxanTM (rituximab, Mabthera)non-Hodgkin's (IDEC- lymphoma Inc./Hoffinann-LaRocheC2B8, chimeric murine/human (first anti-CD20 monoclonal antibody MAb) licensed for the treatment of cancer in the U.S.) Genentech/Hoffmann-LaHerceptin, anti-Her2 hMAb Breasdovarian Roche Cytogen Corp. Quadramet (CYT-424) radiotherapeuticBone metastases a ent Centocor/Glaxo/AjinomotoPanorex~ (17-lA) (marine Adjuvant therapy monoclonal for antibody) colorectal (Dukes-C) Centocor/Ajinomoto Panorex~ (17-lA) (chimeric Pancreatic, lung, marine breast, monoclonal antibody) ovary IDEC IDEC-Y2B8 (marine, anti-CD20non-Hodgkin's MAb lymphoma labeled with Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, Small cell lung mimics the GD3 epitope) (with BCG) ImClone Systems C225 (chimeric monoclonal Renal cell antibody to epidermal growth factor receptor (EGFr)) Techniclone International/AlphaOncolym (Lym-1 monoclonal non-Hodgkin's antibody lymphoma Therapeutics linked to 131 iodine) Protein Design Labs SMART M195 Ab, humanized Acute myleoid leukemia Marketer Brand Name Generic Name Indication Techniclone '3 ~I LYM-1 (OncolymTM) non-Hodgkin's lymphoma Corporation/Cambridge Antibody Technology Aronex Pharmaceuticals,ATRAGEN~ Acute promyelocytic Ine.

leukemia ImCIone Systems C225 (chimeric anti-EGFr Head & neck, non-small monoclonal antibody) + cisplatin or cell lung cancer radiation Altarex, Canada Ovarex (B43.13, anti-idiotypicOvarian CAI25, mouse MAb) Coulter Pharma (ClinicalBexxar (anti-CD20 Mab labelednon-Hodgkin's results with lsil) lymphoma have been positive, but the drug has been associated with significant bone marrow toxicity) Aronex Pharmaceuticals,ATRAGEN~ I~aposi's sarcoma Inc.

IDEC PharmaceuticalsRituxanTM (MAb against CD20)B cell lymphoma pan-B Ab in Corp./Genentech combo. with chemotherapy LeukoSite/Ilex OncologyLDP-03, huMAb to the leukocyteChronic lymphocytic antigen CAMPATH leukemia (CLL) Center of Molecular for t6 (anti CD6, murine Cancer Immunology MAb) CTCL

Medarex/Novartis MDX-210 (humanized anti-HER-2Breast, ovarian bispecific antibody) Medarex/Novartis MDX-210 (humanized anti-HER-2Prostate, non-small bispecific cell antibody) lung, pancreatic, breast Medarex MDX-11 (complement activatingAcute myelogenous receptor (CAR) monoclonal antibody) leukemia (AML) Medarex/Novartis MDX-210 (humanized anti-HER-2Renal and colon bispecific antibody) Medarex MDX-I 1 (complement activatingEx vivo bone marrow receptor (CAR) monoclonal antibody) purging in acute myelogenous leukemia (AML) Medarex MDX-22 (humanized bispecificAcute myleoid antibody, leukemia MAb-conjugates) (complement cascade activators) Cytogen OV 103 (Yttrium-90 labelledOvarian antibody) Cytogen OV I03 (Yttrium-90 labelledProstate antibody) Aronex Pharmaceuticals,ATRAGEN~ non-Hodgkin's Inc. lymphoma Glaxo Wellcome plc 3622W94 MAb that binds to non-small cell EGP40 (17-lA) lung, pancarcinoma antigen on prostate (adjuvant) adenocarcinomas Genentech Anti-VEGF, RhuMAb (inhibitsLung, breast, prostate, angiogenesis) colorectal Protein Design Labs Zenapax (SMART Anti-Tac Leukemia, lymphoma (IL-2 receptor) Ab, humanized) Protein Design Labs SMART M195 Ab, humanized Acute promyelocytic leukemia Marketer Brand Name Generic Name Indication ImClone Systems C225 (chimeric anti-EGFr Breast monoclonal antibod ) + taxol ImClone Systems (licensedC225 (clumeric anti-EGFr prostate from monoclonal RPR) antibody ) + doxorubicin ImClone Systems C225 (chimeric anti-EGFr prostate monoclonal antibody ) + adriarnycin ImClone Systems BEC2 (anti-idiotypic MAb, Melanoma mimics the GD3 epitope) Medarex MDX-210 (humanized anti-HER-2Cancer bispecific antibody) Medarex MDX-220 (bispecific for tumorsLung, colon, that express prostate, TAG-72) ovarian, endometrial, pancreatic and gastric Medarex/Novartis MDX-210 (humanized anti-HER-2Prostate bispecific antibody) Medarex/Merck KgaA MDX-447 (humanized anti-EGF EGF receptor receptor cancers bispecific antibody) (head & neck, prostate, lung, bladder, cervical, ovarian) Medarex/Novartis MDX-210 (humanized anti-HER-2Comb. Therapy bispecific with G-antibody) , CSF for various cancers, esp. breast IDEC MELIMMUNE-2 (marine monoclonalMelanoma antibody thera eutic vaccine ) IDEC MELIMMUNE-1 (marine monoclonalMelanoma antibod thera' eutic vaccine ) Immunomedics, Inc. CEACIDETM (I-131) Colorectal and other NeoRx PretargetTM radioactive antibodiesnon-Hodgkin's B cell lymphoma Novopharm Biotech, NovoMAb-G2 (pancarcinoma Cancer Inc. specific Ab) Techniclone Corporation/TNT (chimeric MAb to histoneBrain antigens) Cambridge Antibody Technology Techniclone TNT (chimeric MAb to histoneBrain antigens) International/Cambridge Antibod Technolo y Novopharm Gliomab-H (Monoclonals - Brain, melanomas, Humanized Abs) neuroblastomas Genetics Institute/AHPGNI-250 Mab Colorectal Merck KgaA EMD-72000 (chimeric-EGF antagonist)Cancer Immunomedics LymphoCide (humanized LL2 non-Hodgkin's antibody) B-cell lymphoma Immunex/AHP CMA 676 (monoclonal antibodyAcute myelogenous conjugate) leukemia Novopharm Biotech, Monopharm-C Colon, lung, Inc. pancreatic Novopharm Biotech, 4B5 anti-idiotype Ab Melanoma, small-cell Inc.

lung Marketer Brand Name Generic Name Indication Center of Molecular for egf/r3 (anti EGF-R humanizedRadioimmunotherapy Immunology Ab) Center of Molecular for c5 (marine MAb colorectal)Colorectal Immunology for radioimmunotherapy Creative BioMolecules/BABS (biosynthetic antibodyBreast cancer Chiron binding site) Proteins ImClone Systems/ChugaiFLK-2 (monoclonal antibody Tumor-associated to fetal liver angiogenesis kinase-2 (FLK-2)) ImmunoGen, Inc. Humanized MAb/small-drug Small-cell lung conjugate Medarex, Inc. MDX-260 bispecific, targetsMelanoma, glioma, GD-2 neuroblastoma Procyon Biopharma, ANA Ab Cancer Inc.

Protein Design Labs SMART 1D10 Ab B-cell lymphoma Protein Design Labs/NovartisSMART ABL 364 Ab Breast, lung, colon Ixnmunomedics, Inc. ImmuRAIT-CEA Colorectal In some embodiments the nucleic acid and antibody are administered in combination with a cancer therapy. As used herein, a "cancer therapy' refers to an agent which prevents growth of a cancer cell by decreasing or slowing the rate of growth, by inhibiting growth altogether, or by killing or inducing apoptosis of the cancer cell. Thus, as used herein, "treating cancer" includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer. In other aspects, the cancer therapy is administered to a subject at risk of developing a cancer fox the purpose of reducing the risk of developing the cancer. Various types of medicaments for the treatment of cancer to are described herein. For the purpose of this specification, cancer therapies are classified as chemotherapeutic agents, cancer vaccines, hormone therapy, biological response modifiers, surgical procedures, and radiotherapy aimed at treating cancer. Additionally, the methods of the invention are intended to embrace the use of more than one cancer therapy along with the immunostimulatory nucleic acids and antibody. As an example, where appropriate, the 15 immunostimulatory nucleic acids may be administered with a both a chemotherapeutic agent and a radiotherapy.
Cancer therapies function in a variety of ways. Some cancer therapies work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated 20 in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21, telomerase). Cancer therapies can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells.
Other cancer therapies target cells other than cancer cells. For example, some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines). Still other medicaments, called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e., exit the primary tumor site and seed a distal tissue, thereby forming a secondary tumor), medicaments that impede this metastasis are also useful in the treatment of cancer. Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF-a,, TNP-470, to thrombospondin-l, platelet factor 4, CAI, and certain members of the integrin family of proteins. One category of this type of medicament is a metalloproteinase inhibitor, which inhibits the enzymes used by the cancer cells to exit the primary tumor site and extravasate into another tissue.
As used herein, chemotherapeutic agents encompass both chemical and biological agents. These agents function to inhibit a cellular activity which the cancer cell is dependent upon for continued survival. Categories of chemotherapeutic agents include alkylating/alkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most if not all of these agents are directly toxic to cancer cells and do not require immune stimulation. Chemotherapeutic agents which are currently in development or in use in a clinical setting are shown in Table 3 below.
Table 3: Cancer Drugs In Development Or On The Market.
Marketer Brand Name Generic Name Indication Abbott TNP 470/AGM 1470 Fra yline Anti-An io enesis in Cancer Takeda TNP 470/AGM 1470 Fra yline Anti-An io enesis in Cancer Scotia Me lanune GLA Me famine GLA Bladder Cancer Medeva Valstar Valrubicin Bladder Cancer - Refractory in situ carcinoma Medeva Valstar Valrubicin Bladder Cancer - Papillary Cancer Rhone Gliadel Wafer Carmustaine + Brain Tumor Poulenc Polifepr Osan Warner Undisclosed CancerUndisclosed CancerCancer Lambent b) (b) Bristol-MyersRAS Famesyl TransferaseRAS FamesylTransferaseCancer S uibb Inhibitor Inhibitor Novartis MMI 270 MMI 270 Cancer Ba en BAY 12-9566 BAY 12-9566 Cancer Merck Famesyl TransferaseFamesyl TransferaseCancer (Solid Inhibitor Inhibitor tumors -ancreas, colon, fun , breast) Pfizer PFE MMP Cancer, an io enesis Marketer Brand Name Generic Name Indication Pfizer PFE Tyrosine Kinase Cancer, an io enesis Lill MTA/LY 231514 MTA/LY 231514 Cancer Solid Tumors Lilly LY 264618/LometexolLometexol Cancer Solid Tumors Scotia Glamolec LiGLA (lithium-gammaCancer, pancreatic, linolenate breast, colon Warner CI-994 CI-994 Cancer, Solid Lambent Tumors l Leukemia Scherin An io enesis inhibitorAn io enesis InhibitorCancer / Cardio AG

Takeda TNP-470 n/k Mali nant Tumor SmithklineHycamtin Topotecan Metastatic Ovarian Beecham Cancer Novartis PKC 4I2 PKC 412 Multi-Drug Resistant Cancer Novartis Valspodar PSC 833 Myeloid LeukemialOvarian Cancer Immunex Novantrone Mitoxantrone Pain related to hormone refracto rostate cancer.

Warner Metaret Suramin Prostate Lambent Genentech Anti-VEGF Anti-VEGF Prostate / Breast / Colorectal / NSCL Cancer British Batimastat Batimastat (BB94)Ptery ium Biotech Eisai E 7070 E 7070 Solid Tumors Biochem BCH-4556 BCH-4556 Solid Tumors Pharma Sankyo CS-682 CS-682 Solid Tumors A ouron AG2037 AG2037 Solid Tumors IDEC Pharma9-AC 9-AC Solid Tumors A ouron VEGF/b-FGF InhibitorsVEGF/b-FGF InhibitorsSolid Tumors Agouron AG3340 AG3340 Solid Tumors /
Macular De eneration Vertex Incel VX-710 Solid Tumors -IV

Vertex VX-853 VX-853 Solid Tumors -Oral Zeneca ZD 0101 (inj) ZD 0101 Solid Tumors Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN 698 Solid Tumors Tanube TA 2516 Marimistat Solid Tumors Seiyaku British Marimastat Marimastat (BB Solid Tumors Biotech 2516) Celltech CDP 845 Aggrecanase InhibitorSolid Tumors l Breast Cancer ChiroscienceD2163 D2163 Solid Tumors /
Metastases Warner PD 183805 PD 183805 Lambent Daiichi DX8951 f DX8951 f Anti-Cancer Daiichi Lemonal DP 2202 Lemonal DP 2202 Anti-Cancer Fujisawa FK 3 I7 FK 317 Anticancer Antibiotic Chugai Picibanil OK-432 Antimalignant Tumor Nycomed AD 32/valrubicin Vahubicin Bladder Cancer-Refractory Amersham In situ Carcinoma Nycomed Metastron Strontium DerivativeBone Cancer (adjunct Amersham them , Pain) Scherin Temodal Temozolomide Brain Tumors Plou h Scherin Temodal Temozolonide Brain Tumors Plou h Li osome Evacet Doxorubicin, Li Breast Cancer osomal Nycomed Yewtaxan Paclitaxel Breast Cancer Amersham Advanced, Ovarian Cancer Advanced Marketer Brand Name Generic Name Indication Bristol-MyersTaxol Paclitaxel Breast Cancer Squibb Advanced, Ovarian Cancer Advanced, NSCLC

Roche Xeloda Capecitabine Breast Cancer, Colorectal Cancer Roche Furtulon Doxifluridine Breast Cancer, Colorectal Cancer, Gastric Cancer Pharmacia Adriamycin Doxorubicin Breast Cancer, & Leukemia U 'ohn Ivax C clo ax Paclitaxel, Oral Breast/Ovarian Cancer Rhone PoulencOral Taxoid Oral Taxoid Broad Cancer AHP Novantrone Mitoxantrone Cancer Se uus SPI-077 Cis latin, StealthCancer Hoechst HMR 1275 Flavo iridol Cancer Pfizer CP-358, 774 EGFR Cancer Pfizer CP-609, 754 RAS Onco ene InhibitorCancer Bristol-MyersBMS-182751 Oral Platinum Cancer (Lung, S uibb Ovarian) Bristol-MyersUFT (Tegafur/Uracil)UFT (Tegafur/Uxacil)Cancer Oral Squibb Johnson Ergamisol Levamisole Cancer Therapy &
Johnson Glaxo WellcomeEniluracil/776C85 5FU Enhancer Cancer, Refractory Solid &
Colorectal Cancer Johnson Ergamisol Levamisole Colon Cancer &
Johnson Rhone PoulencCampto Irinotecan Colorectal Cancer, Cervical Cancer Pharmacia Camptosar Irinotecan Colorectal Cancer, & Cervical U 'ohn Cancer Zeneca Tomudex Ralitrexed Colorectal Cancer, Lung Cancer, Breast Cancer Johnson Leustain Cladribine Hairy Cell Leukaemia &
Johnson Ivax Paxene Paclitaxel Ka osi Sarcoma Se uus Doxil Doxorubicin, Li KS/Cancer osomal Se uus Cael Doxorubicin, Li KSlCancer osomal Scherin Fludara Fludarabine Leukaemia AG

Pharmacia Pharmorubicin Epirubicin Lung/Breast Cancer ~
U 'ohn Chiron De oC De oCyt Neo lastic Menin itis Zeneca ZD1839 ZD 1839 Non Small Cell Lung Cancer, Pancreatic Cancer BASF LU 79553 Bis-Na htalimide Oncolo BASF LU 103793 Dolastain Oncolo Scherin Cae Doxorubicin-Li OvarianBreast Plou h osome Cancex Lilly Gemzar Gemcitabine Pancreatic Cancer, Non Small Cell Lung Cancer, Breast, Bladder and Ovarian Zeneca ZD 0473/Anormed ZD 0473/Anormed Platinum based NSCL, ovarian etc.

YamanouchiYM 116 YM 116 Prostate Cancer Nycomed Seeds/I-125 Rapid Iodine Seeds Prostate Cancer Amersham_ St Agouron ~ Cdk4/cdk2 inhibitorscdk4/cdk2 inhibitorsSolid Tumors Marketer Brand Name Generic Name Indication A ouron PARP inhibitors PARP Inhibitors Solid Tumors ChiroscienceD4809 Dexifosamide Solid Tumors Bristol-MyersUFT (Tegafur/Llracil)UFT (Tegafur/Uracil)Solid Tumors S uibb Sank o Krestin Krestin Solid Tumors Asta MedicaIfex/Mesnex Ifosamide Solid Tumors Bristol-MyersIfex/Mesnex Ifosamide Solid Tumors Squibb Bristol-MyersVumon Teniposide Solid Tumors S uibb Bristol-MyersParaplatin Carboplatin Solid Tumors S uibb Bristol-MyersPlantinol Cisplatin, StealthSolid Tumors S uibb Bristol-MyersPlantinol Cisplatin Solid Tumors S uibb Bristol-MyersVepeside Etoposide Solid Tumors Melanoma S uibb Zeneca ZD 9331 ZD 9331 Solid Tumors, Advanced Colorectal Chu ai Taxotere Docetaxel Solid Tumors, Breast Cancer Rhone PoulencTaxotere Docetaxel Solid Tumors, Breast Cancer Glaxo WallcomeProdrug of guanineprodrug of arabinsideT Cell Leukemia/Lymphoma' arabinside & B Cell Neo lasm Bristol-MyersTaxane Analog Taxane Analog Taxol follow up S uibb Another useful anti-cancer therapy is Interferon-a (e.g., INTRON~ A, Schering).
The compounds useful according to the invention are nucleic acids. The nucleic acids may be double-stranded or single-stranded. Generally, double-stranded molecules may be more stable in vivo, while single-stranded molecules may have increased activity. The terms "nucleic acid" and "oligonucleotide" refer to multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (L~) or a substituted purine (e.g., adenine (A) or guanine (G)) or a modified base. As to used herein, the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides.
The terms shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base-containing polymer. The terms "nucleic acid" and "oligonucleotide"
also encompass nucleic acids or oligonucleotides with a covalently modified base and/or sugar. For example, they include nucleic acids having backbone sugars which are covalently 15 attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleic acids may include a 2'-O-alkylated ribose group. In addition, modified nucleic acids may include sugars such as arabinose instead of ribose. Thus the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have amino acid backbone with nucleic acid bases). In some embodiments the nucleic acids are homogeneous in backbone composition.
Nucleic acids also can include base analogs such as C-5 propyne modified bases.
Wagner RW et al., Natuy~e BioteclZnol 14:840-4 (1996). Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties.
l0 The nucleic acid is a linked polymer of bases or nucleotides. As used herein with respect to linked units of a nucleic acid, "linked" or "linkage" means two entities are bound to one another by any physicochemical means. Any linkage known to those of ordinary skill in the art, covalent or non-covalent, is embraced. Such linkages are well known to those of ordinary skill in the art. Natural linkages, which are those ordinarily found in nature 15 connecting the individual units of a nucleic acid , are most common. The individual units of a nucleic acid may be linked, however, by synthetic or modified linkages.
Whenever a nucleic acid is represented by a sequence of letters it will be understood that the nucleotides are in 5' ~ 3' order from left to right and that "A"
denotes adenosine, "C"
denotes cytosine, "G" denotes guanosine, "T" denotes thymidine, and "U"
denotes uracil 2o unless otherwise noted.
Nucleic acid molecules useful according to the invention can be obtained from natural nucleic acid sources (e.g., genomic nuclear or mitochondria) DNA or cDNA), or are synthetic (e.g., produced by oligonucleotide synthesis). Nucleic acids isolated from existing nucleic acid sources are referred to herein as native, natural, or isolated nucleic acids. The nucleic 25 acids useful according to the invention may be isolated from any source, including eukaryotic sources, prokaryotic sources, nuclear DNA, mitochondria) DNA, etc. Thus, the term nucleic acid encompasses both synthetic and isolated nucleic acids. The term "isolated" as used herein refers to a nucleic acid which is substantially free of other nucleic acids, proteins, lipids, carbohydrates or other materials with which it is naturally associated. The nucleic 3o acids can be produced on a large scale in plasmids, (see Sambrook T et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, New York, 1989) and separated into smaller pieces or administered whole. After being administered to a subject the plasmid can be degraded into oligonucleotides. One skilled in the art can purify viral, bacterial, eukaryotic, etc., nucleic acids using standard techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
For use in the instant invention, the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage SL et al., Tetra7Zedron Lett 22:1859, 1981);
nucleoside H-phosphonate method (Garegg et al., Tetrahedron Lett 27:4051-4, 1986;
Froehler et al., Nucl Acid Res 14:5399-407, 1986; Garegg et al., Tetrahedron Lett 27:4055-8, 1986; Gaffiiey et al., Tetrahedron Lett 29:2619-22, 1988). These chemistries can be performed by a variety to of automated oligonucleotide synthesizers available in the market.
In some embodiments, the nucleic acids useful according to the invention are immunostimulatory nucleic acids. An immunostimulatory nucleic acid is any nucleic acid, as described above, which is capable of modulating an immune response. A nucleic acid which modulates an immune response is one which produces any form of immune stimulation, including, but not limited to, induction of cytokines, B-cell activation, T-cell activation, monocyte activation. Immunostimulatory nucleic acids include, but are not limited to, CpG
nucleic acids, methylated CpG nucleic acids, T-rich nucleic acids, poly-G
nucleic acids, and nucleic acids having phosphate modified backbones, such as phosphorothioate backbones.
A "CpG nucleic acid" or a "CpG immunostimulatory nucleic acid" as used herein is a nucleic acid containing at least one unmethylated CpG dinucleotide (cytosine-guanine dinucleotide sequence, i.e., "CpG DNA" or DNA containing a 5' cytosine followed by 3' guanosine and linked by a phosphate bond) and activates a component of the immune system.
The entire CpG nucleic acid can be unmethylated or portions may be unmethylated but at least the C of the 5' CG 3' must be unmethylated.
In one embodiment the invention provides a CpG nucleic acid represented by at least the formula:
5' NiXICGX2N2 3' wherein Xl and Xa are nucleotides and N is any nucleotide and Nl and N2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments Xl is adenine, 3o guanine, or thymine and X2 is cytosine, adenine, or thymine. In other embodiments Xl is cytosine and/or X2 is guanine.
In other embodiments the CpG nucleic acid is represented by at least the formula:

5' N1X1XZCGX3X4N2 3' wherein Xl, X2, X3, and X4 are nucleotides. In some embodiments, X1X2 are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X3X4 axe nucleotides selected from the group consisting of TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and Nl and NZ are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments, X1X2 are GpA or GpT and X3X4 are TpT. In other embodiments Xl or XZ or both are purines and X3 or X4 or both are pyrimidines or X1X2 are GpA and X3 or X4 or both are pyrimidines.
l0 In some embodiments Nl and N2 of the nucleic acid do not contain a CCGG or CGGG
quadmer or more than one CCG or CGG trimer. The effect of a CCGG or CGCG
quadmer or more than one CCG or CGG trimer depends in part on the status of the nucleic acid backbone. For instance, if the nucleic acid has a phosphodiester backbone or a chimeric backbone the inclusion of these sequences in the nucleic acid will only have minimal if any affect on the biological activity of the nucleic acid. If the backbone is completely phosphorothioate or significantly phosphorothioate then the inclusion of these sequences may have more influence on the biological activity or the kinetics of the biological activity, but compounds containing these sequences are still useful. In another embodiment the CpG
nucleic acid has the sequence 5' TCN1TX1X2CGX3X4 3'.
2o A "T-rich nucleic acid" or "T-rich immunostimulatory nucleic acid" is a nucleic acid which includes at least one poly-T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues and which activates a component of the immune system. A nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5' TTTT 3'. Preferably the T-rich nucleic acid includes more than one poly-T
sequence. In preferred embodiments the T-rich nucleic acid may have 2, 3, 4, etc., poly-T
sequences, such as oligonucleotide #2006 (5' TCGTCGTTTTGTCGTTTTGTCGTT 3', SEQ ID NO: 729).
One of the most highly immunostimulatory T-rich oligonucleotides discovered according to the invention is a nucleic acid composed entirely of T nucleotide residues, e.g., oligonucleotide #2183 (5' TTTTTTTTTTTTTTTTTTTTTTTT 3', SEQ ID NO: 841). Other T-rich nucleic acids have a nucleotide composition of greater than 25% T
nucleotide residues, but do not necessarily include a poly-T sequence. In these T-rich nucleic acids the T
nucleotide resides may be separated from one another by other types of nucleotide residues, i.e., G, C, and A. In some embodiments the T-rich nucleic acids have a nucleotide composition of greater than 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 99%, T
nucleotide residues and every integer % in between. Preferably the T-rich nucleic acids have at least one poly-T sequence and a nucleotide composition of greater than 25% T
nucleotide residues.
In one embodiment the T-rich nucleic acid is represented by at least the formula:
5' X1X2TTTTX3X4 3' wherein Xl, X2, X3, and X4 are nucleotides. In one embodiment X1X2 is TT
and/or X3X4 is TT. In another embodiment X1X2 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and X3X4 are any one of the 1o following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
In some embodiments it is preferred that the T-rich nucleic acid does not contain poly-C (CCCC), poly-A (AAAA.), poly-G (GGGG), CpG motifs, or multiple GGs. In other embodiments the T-rich nucleic acid includes these motifs. Thus in some embodiments of 15 the invention the T-rich nucleic acids include CpG dinucleotides and in other embodiments the T-rich nucleic acids are free of CpG dinucleotides. The CpG dinucleotides may be methylated or munethylated.
Poly-G containing nucleic acids are also immunostimulatory. A variety of references, including Pisetsky DS et al., Mol Biol Rep 18:217-21 (1993); Krieger M et al., Anfau Rev 2o Biochem 63:601-37 (1994); Macaya RF et al., Proc Natl Acad Sci USA 90:3745-9 (1993);
Wyatt JR et al., PYOG Natl Acad Sci USA 91:1356-60 (1994); Rando and Hogan, 1998, In:
Applied Antisense Oli~onucleotide Technology, eds. Krieg AM and Stein C, pp.
335-352;
and Kimura Y et al., JBioclaenz (Tokyo) 116:991-4 (1994) also describe the immunostimulatory properties of poly-G nucleic acids.
25 Poly G nucleic acids preferably are nucleic acids having the following formulas:
5' XIXZGGGX3X4 3' wherein Xl, X2, X3, and X4 are nucleotides. In preferred embodiments at least one of X3 and X4 are a G. In other embodiments both of X3 and X4 are a G. In yet other embodiments the preferred formula is 5' GGGNGGG 3', or 5' GGGNGGGNGGG 3' wherein N represents 3o between 0 and 20 nucleotides. In other embodiments the poly-G nucleic acid is free of unmethylated CG dinucleotides, such as, for example, the nucleic acids listed in Table 4 below as SEQ m NOs: 12-14, 23, 56, 100, 155, 163, 182, 227, 237, 246, 400, 407, 429, 430, 432, 435, 438, 439, 446, 450, 451, 480, 487, 493, 522, 661, 662, 671-673, 807, 808, 821, 823, and 834. W other embodiments the poly-G nucleic acid includes at least one unmethylated CG dinucleotide, such as, for example, the nucleic acids listed in Table 4 below as SEQ m NOs: 6, 7, 22, 26, 28-30, 87, 115, 141, 177, 191, 209, 254, 258, 267, 303, 317, 329, 335, 344, 345, 395, 414, 417, 418, 423-426, 428, 431, 433, 434, 436, 437, 440, 442-445, 447-449, 458, 460, 463, 467-469, 474, 515, 516, 594, 638-640, 663, 664, 727, 752, 776, 795, 799, 817, 818, 831, and 832.
Nucleic acids having modified backbones, such as phosphorothioate backbones, also fall within the class of immunostimulatory nucleic acids. U.S. Patents Nos.
5,723,335 and l0 5,663,153 issued to Hutcherson, et al. and related PCT publication WO95/26204 describe immune stimulation using phosphorothioate oligonucleotide analogues. These patents describe the ability of the phosphorothioate backbone to stimulate an immune response in a non-sequence specific manner.
The immunostimulatory nucleic acids may be any size but in some embodiments are in the range of between 6 and 100 or in some embodiments between 8 and 35 nucleotides in size. lmmunostimulatory nucleic acids can be produced on a large scale in plasmids. These may be administered in plasmid form or alternatively they can be degraded into oligonucleotides.
"Palindromic sequence" shall mean an inverted repeat (i.e., a sequence such as 2o ABCDEE'D'C'B'A' in which A and A' are bases capable of forming the usual Watson-Crick base pairs and which includes at least 6 nucleotides in the palindrome. In vivo, such sequences may form double-stranded structures. In one embodiment the nucleic acid contains a palindromic sequence. In some embodiments when the nucleic acid is a CpG
nucleic acid, a palindromic sequence used in this context refers to a palindrome in which the CpG is part of the palindrome, and optionally is the center of the palindrome.
In another embodiment the nucleic acid is free of a palindrome. A nucleic acid that is free of a palindrome does not have any regions of 6 nucleotides or greater in length which are palindromic. A nucleic acid that is free of a palindrome can include a region of less than 6 nucleotides which are palindromic.
3o A "stabilized nucleic acid molecule" shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g., via an exonuclease or endonuclease).
Stabilization can be a function of length or secondary structure. Nucleic acids that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter nucleic acids, secondary structure can stabilize and increase their effect. For example, if the 3' end of an oligonucleotide has self complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the oligonucleotide becomes stabilized and therefore exhibits more activity.
Some stabilized oligonucleotides of the instant invention have a modified backbone.
It has been demonstrated that modification of the oligonucleotide backbone provides enhanced activity of the nucleic acids when administered in vivo. Nucleic acids, including at least two phosphorothioate linkages at the 5' end of the oligonucleotide and multiple to phosphorothioate linkages at the 3' end, preferably 5, may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases. Other modified oligonucleotides include phosphodiester modified oligonucleotide, combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof. Each of these i5 combinations and their particular effects on immune cells is discussed in more detail in PCT
Published Patent Application W098/18810 claiming priority to U.S. Serial Nos.
081738,652 (now issued as U.S. Patent No. 6,207,646 B1) and 08/960,774 (now issued as U.S. Patent No.

6,239,116 B1), filed on October 30, 1996 and October 30, 1997 respectively, the entire contents of which is hereby incorporated by reference. It is believed that these modified 20 oligonucleotides may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization.
Both phosphorothioate and phosphodiester nucleic acids are active in immune cells.
Other stabilized oligonucleotides include: nonionic DNA analogs, such as alkyl-and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl 25 group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
For use in vivo, nucleic acids are preferably relatively resistant to degradation (e.g., 3o via endonucleases and exonucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. One type of stabilized nucleic acid has at Ieast a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No.
092,574) can be prepared by automated solid phase synthesis using commercially available reagents.
Methods for making other DNA backbone modifications and substitutions have been described. Uhhnann E et al., Chem Rev 90:544-84 (1990); Goodchild J, Bioconjugate Chem 1:165-87 (1990).
to The immunostimulatory nucleic acids having backbone modifications useful according to the invention in some embodiments are S- or R-chiral immunostimulatory nucleic acids. An "S chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have S
chirality. An "R chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have R
chirality. The backbone modification may be any type of modification that forms a chiral center. The modifications include but are not limited to phosphorothioate, methylphosphonate, rnethylphosphorothioate, phosphorodithioate, 2'-OMe and combinations thereof. In other embodiments they are non-chiral. A non-chiral nucleic acid is any nucleic acid which does not have at least two chiral centers.
The chiral immunostimulatory nucleic acids must have at least two nucleotides within the nucleic acid that have a backbone modification. All or less than all of the nucleotides in the nucleic acid, however, may have a modified backbone. Of the nucleotides having a modified backbone (referred to as chiral centers), a plurality have a single chirality, S or R.
A "plurality" as used herein refers to an amount greater than or equal to 75%.
Thus, less than all of the chiral centers may have S or R chirality as long as a plurality of the chiral centers have S or R chirality. In some embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of 3o the chiral centers have S or R chirality. In other embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the nucleotides have backbone modifications.

The S- and R- chiral immunostimulatory nucleic acids may be prepared by any method known in the art for producing chirally pure oligonucleotides. Stec et al, teach methods for producing stereopure phosphorothioate oligodeoxynucleotides using an oxathiaphospholane. Stec WJ et al., JAm Glaem Soc 117:12019 (1995). Other methods for making chirally pure oligonucleotides have been described by companies such as ISIS
Pharmaceuticals. U.S. Patents which disclose methods for generating stereopure oligonucleotides include 5,212,295, 5,359,052, 5,506,212, 5,512,668, 5,521,302, 5,599,797, 5,837,856, 5,856,465, and 5,883,237, each of which is hereby incorporated by reference in ifs entirety.
to Other sources of nucleic acids useful according to the invention include standard viral and bacterial vectors, many of which are commercially available. In its broadest sense, a "vector" is any nucleic acid material which is ordinarily used to deliver and facilitate the transfer of nucleic acids to cells. The vector as used herein may be an empty vector or a vector carrying a gene which can be expressed. In the case when the vector is carrying a gene the vector generally transports the gene to the target cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In this case the vector optionally includes gene expression sequences to enhance expression of the gene in target cells such as immune cells, but it is not required that the gene be expressed in the cell.
2o In general, vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources. Viral vectors are one type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney marine leukemia virus, Harvey marine sarcoma virus, marine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses;
polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus;
vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Some viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with a nucleic acid to be delivered.
Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA.
Standard protocols for producing empty vectors or vectors carrying genes (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and/or infection of the target cells with viral particles) are provided in Kriegler M, "Gene Transfer and Expression, A
Laboratory Manual," W.H. Freeman Co., New York (1990) and Murry EJ, Ed., "Methods in Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, New Jersey (199I).
Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al:, "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly to advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. Some plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid.
Some commonly used plasmids include pBR322, pUCl8, pUCl9, pcDNA3.l, pSV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art.
Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
It has recently been discovered that plasmids (empty or gene-carrying) can be delivered to the immune system using bacteria. Modified forms of bacteria such as Salmonella can be transfected with the plasmid and used as delivery vehicles.
The bacterial delivery vehicles can be administered to a host subject orally or by other administration means. The bacteria deliver the plasmid to immune cells, e.g., dendritic cells, probably by passing through the gut barrier. High levels of immune protection have been established using this methodology. Such methods of delivery are useful for the aspects of the invention utilizing systemic delivery of nucleic acid.
As used herein, administration of an immunostimulatory nucleic acid is intended to embrace the administration of one or more immunostimulatory nucleic acids which may or may not differ in terms of their profile, sequence, backbone modifications and biological effect. As an example, CpG nucleic acids and T-rich nucleic acids may be administered to a single subj ect along with an antibody and optionally a cancer therapy. In another example, a 3o plurality of CpG nucleic acids which differ in nucleotide sequence may also be administered to a subj ect.

Some of the nucleic acids useful according to the invention and described herein are presented in Table 4 below.
Table 4: Exemplary Nucleic Acids.
SEQUENCE BACKBONE SE ID NO:

aaaaaa s 1 aaaaaaaaaaaaaaaaaaaa o 2 aaaaaccccccccccaaaaa o 3 aaaacatgacgttcaaaaaa sos 4 aaaacatgacgttcaaaaaa s2 5 aaaacatgacgttcgggggg sos 6 aaaacatgacgttcgggggg s2 7 aaaacgtt o 8 aaaatcaacgttgaaaaaaa sos 9 aaaatctgtgcttttaaaaaa sos 10 aaaattgacgttttaaaaaa sos 11 aaacattctgggggaattttaagaagtaaacat o 12 aaacattctgggggaattttaagaagttcctccctcccc o 13 aaacattctgggggaattttgtctagtaaacat o 14 aacgctcgaccttcgat o 15 aacgctggaccttccat o 16 aacgctggaccttccatgtc sos 17 aacgtt o 18 aacgttct o 19 aacgttg s 20 aacgttga o 21 aacgttgaggggcat o 22 aaggtggggcagtctcaggga 23 aatagtcgccataacaaaac o 24 aatagtcgccatcccccccc o 25 aatagtcgccatcccgggac o 26 aatagtcgccatcgcgcgac o 27 aatagtcgccatggcggggc o 28 aattctctatcggggcttctgtgtctgttgctggttccgctttato 29 acaaccacgagaacgggaac 30 acaacgtt o 31 acaacgttga o 32 accacaacgagaggaacgca 33 accatcctgaggccattcgg 34 accatggacgaactgtttcccctc s 35 aCCdtggaCgaCCtgtttCCCCtC S 36 accatggacgagctgtttcccctc s 37 accatggacgagctgtttcccctc 38 accatggacgatctgtttcccctc s 39 accatggacggtctgtttcccctc s 40 accatggacgtactgtttcccctc s 4l accatggacgttctgtttcccctc S 42 acccatcaatagctctgtgc s 43 acccgtcgtaattatagtaaaaccc o 44 accgcatggattctaggcca s 45 accttattaagattgtgcaatgtgacgtcctttagcatcgcaagao 46 acgctggaccttccat 47 acgtcgttcccccccccccc O 48 SEQUENCE ~ BACKBONE SEQ ID
NO:

acgtgt s 49 actagacgttagtgtga o 50 actagacgttagtgtga s 51 actggacgttagcgtga o 52 acttctcatagtccctttggtccag o 53 agaacgtt o 54 agacagacacgaaacgaccg 55 agactcatgggaaaatcccacatttga o 56 agatagcaaatcggctgacg o 57 agatggttctcagataaagcggaa 58 agcaccgaacgtgagagg o 59 agcacggtagccttccta 60 agcagctttagagctttagagctt s 61 agcatcaggaacgacatgga o 62 agcatcaggaccgacatgga o 63 agcgctga o 64 agctcaacgtcatgc o 65 agctccatggtgctcactg s 66 aggatatc o 67 aggtacagccaggactacga 68 agicccgigaacgiattcac o 69 agtgactctccagcgttctc o 70 agtgcgattcgagatcg o 71 agtgcgattgcagatcg o 72 agtgct s 73 agtgct o 74 agttgcaact o 75 ataaagcgaaactagcagcagtttc o 76 ataacgtt o 77 ataatagagcttcaagcaag s 78 ataatccagcttgaaccaag s 79 ataatcgacgttcaagcaag s 80 ataatcgacgttcccccccc s 81 ataatcgtcgttcaagcaag s 82 ataatcgtgcgttcaagaaag s 83 atagacaaaaattccctccccggagcc o 84 atatatatatatatatat s 85 atatctaatcaaaacattaacaaa o 86 atcaggaacgtcatgggaagc o 87 atcgacctacgtgcgttctc o 88 atcgacctacgtgcgttztc o 89 atcgactcgagcgttctc o 90 atcgactctcgagcgttctc o 91 atcgactctcgagcgttctc sos 92 atcgactctcgagtgttctc o 93 atcgactctcgagzgttctc o 94 atcgactctctcgagcgttctc o 95 atcgacttcgagcgttctc o 96 atcgatcgagcgttctc o 97 atcgatgt o 98 atcggaggactggcgcgccg 99 atctggtgagggcaagctatg s 100 atgacgttcctgacgtt s 101 atgcactctgcagcgttctc o 102 atgcatgt o 103 SEQUENCE BACKBONE SEQ ID
NO:

atgcccctcaacgtt o 204 atgctaaaggacgtcacattgca o 105 atggaaggtccacgttctc o 106 atggaaggtccagcgttct o 107 atggaaggtccagcgttctc o 108 atggaaggtccagtgttctc o 109 atggaaggtcgagcgttctc o 110 atggactctccagcgttctc o 111 atgtcctcggtcctgatgct o 112 atgtttactagacaaaattcccccagaatgttt o 113 atgtttacttcttaaaattcccccagaatgttt o 114 attcgatcggggcggggcgag o 115 atzgacctacgtgcgttctc o 116 atzgactctzgagzgttctc o 117 batggaaggtccagcgttctc o 118 bgagaacgctccagcactgat o 119 bgagaacgctcgaccttcgat o 120 bgagaazgctccagcactgat o 121 bgagaazgctcgaccttcgat o 122 bgagcaagctggaccttccat o 123 bgagcaagztggaccttccat o 124 bgctagacgttagcgtga o 225 btcaacgtt o 126 btccatgacgttcctgatgct o 127 btccatgagcttcctgatgct o 128 btccattccatgacgttcctgatgcttcca os 129 btccattccattctaggcctgagtcttccat os 130 btcgtcgttttgtcgttttgtcgttttttt os 131 btttttccatgtcgttcctgatgcttttt os 132 btttttCgtCgttCCCCCCCCCCCC OS 133 caaacgtt o 234 caacgtt 0 135 caagagatgctaacaatgca s 136 caatcaatctgaggagaccc 137 cacaccttggtcaatgtcacgt caccaccttggtcaatgtcacgt o 139 cacggtagccttccta 140 cacgttgaggggcat s 141 cactgtccttcgtcga sos 142 cagacacagaagcccgatagacg 143 cagattgtgcaatgtctcga o 144 cataacataggaatatttactcctcgc o 145 cataggatctcgagctcggaaagtcccctac o 146 catgagctcatctggaggaagcgg o 147 catttccacgatttccca o 148 cattttacgggcgggcgggc 149 ccaaatatcggtggtcaagcac 150 ccaacgtt s 151 ccacgtcgaccctcaggcga s 152 ccacgtggacctctagc o 153 ccactcacatctgctgctccacaag o 154 ccagatgagctcatgggtttctcc o 155 ccaggttaagaggaaatgacttcggg o 156 ccaggttgtatagaggc 157 ccagtgctgatcaccgatatcctgttcggcagtcg ~ 15~

SEQUENCE BACKBONE SEQ ID
NO:

ccatcgat o 159 ccatgcat o l60 ccatgctaacctctagc o 161 ccatgtcggtcctgatgct o 162 ccccaaagggatgagaagtt o l63 cccccaaaaaaaaaaccccc o 164 cccccc s 165 CCCCttgaCgttttCCCCCC SOS 173 cccgaagtcatttcctcttaacctgg o 174 ccgaacaggatatcggtgatcagcac 175 CCgCttCCtCCagatgagCtCatg O 176 ccgcttcctccagatgagctcatgggtttctccaccaag o 177 ccggccggccggccggccgg o 178 CCgtCgttCCCCCCCCCCCC O 179 cctacgttgtatgcgcccagct o 180 cctccaaatgaaagaccccc 181 cctctatacaacctgggac 182 ccttccatgtcggtcctgat sos 183 ccttcgat o 184 cgaacgtt 0 185 cgacga o 186 cgacgt s 187 cgactctcgagcgttctc o 188 cgactgccgaacaggatatcggtgatcagcactgg 189 cgccgtcgcggcggttgg o 190 cgcctggggctggtctgg o 191 cgcgcgcgcgcgcgcgcgcg s 192 cgcgcgcgcgcgcgcgcgcg o 193 cgcgta s 194 cgctagaggttagcgtga o 195 cgctggaccttccat o 196 cgctggaccttccatgtcgg sos 197 cggctgacgtcatcaa s 198 cgggcgactcagtctatcgg 199 cgggcttacggcggatgctg 200 cggtagccttccta 201 cgtaccttacggtga o 202 cgtacg s 203 cgtcga s 204 cgtcga o 205 cgtcgt s 206 cgtcgtcgt o 207 cgtcgtcgtcgtcgtcgtcgt s 208 cgtctatcgggcttctgtgtctg 209 cgttcg s 210 ctaacgtt o 211 ctaatctttctaatttttttctaa s 212 ctagataaagcggaaccagcaacagacacagaagccccgatagago 213 SEQUENCE BACKBONE SEQ ID
NO:

ctagcgct o 214 ctagcggctgacgtcataaagctagc s 215 ctagcggctgacgtcatcaagctag o 216 ctagcggctgacgtcatcaatctag o 217 ctagcggctgagctcataaagctagc s 218 ctagcttgatgacgtcagccgctag o 219 ctagcttgatgagctcagccgctag o 220 ctagctttatgacgtcagccgctagc s 221 ctaggctgacgtcatcaagctagt o 222 ctagtggctgacgtcatcaagctag s 223 ctatcggaggactggcgcgcc 224 ctatcggaggactggcgcgccg 225 ctcaacgctggaccttccat o 226 ctcatgggtttctccaccaag o 227 ctccagctccaagaaaggacg o 228 ctcgccccgccccgatcgaat o 229 ctctccaagctcacttacag 230 ctctctgtaggcccgcttgg s 231 ctcttgcgacctggaaggta 232 ctgacgtcat o 233 ctgacgtg o 234 ctgattgctctctcgtga sos 235 ctgattgctctctcgtga o 236 ctgcagcctgggac o 237 ctgcgttagcaatttaactgtg o 238 ctgctgagactggag s 239 ctgctgctgctgctgctgctg s 240 ctggaccttccatgtc sos 241 ctggaccttccatgtcgg sos 242 , ctggtctttctggtttttttctgg s 243 ctggtctttctggtttttttctgg o 244 ctgtaagtgagcttggagag ~ 245 ctgtatgaaacaaattttcctctttgggca o 246 ctgtca s 247 ctgtcaggaactgcaggtaagg o 248 ctgtcccatatttttagaca 249 ctgtcg s 250 ctgtcg o 251 CtgtCgttCCCCCCCCCCCC O 252 ctgtgctttctgtgtttttctgtg s 253 cttggagggcctcccggcgg 254 cttggtggagaaacccatgag o 255 cttggtggagaaacccatgagctcatctggaggaagcgg o 256 ctttccgttggacccctggg s 257 czggczggczgggczccgg o 258 faacgttga o 259 fcgcgaattcgcg o 260 ftcaacgtt o 261 gaaacgtt o 262 gaaactgctgctagtttcgctttat o 263 gaaccttccatgctgtt 264 gaaccttccatgctgttccg 265 gaacgctggaccttccat 266 gaagttcacgttgaggggcat 0 267 gaagtttctggtaagtcttcg o 268 SEQUENCE BACKBONE SEQ m NO:

gaccttccat 269 gaccttccatgtcggtcctgat 270 gaccttctatgtcggtcctg 271 gacgtcat o 272 gactgacgtcagcgt o 273 gagaacgatggaccttccat o 274 gagaacgctagaccttctat o 275 gagaacgctccaccttccat o 276 gagaacgctccagcactgat o 277 gagaacgctccagcttcgat o 278 gagaacgctccgaccttcgat s 279 gagaacgctcgaccttccat o 280 gagaacgctcgaccttcgatb s 281 gagaacgctggacctatccat o 282 gagaacgctggacctcatcatccat o 283 gagaacgctggacctcatccat o 284 gagaacgctggaccttcc 285 gagaacgctggaccttccat 286 gagaacgctggaccttccat s 287 gagaacgctggaccttccatgt 288 gagaacgctggaccttcgat o 289 gagaacgctggaccttcgta o 290 gagaacgctggaccttgcat o 291 gagaacgctggacgctcatccat o 292 gagaacgctggacttccat o 293 gagaacgctggaczttccat o 294 gagaacgctggatccat o 295 gagaatgctggaccttccat o 296 gagaazgctggaccttccat o 297 gagaccgctcgaccttcgat 298 gagcaagctggaccttccat s 299 gagcaagctggaccttccatb s 300 gaggaacgtcatggagaggaacgtcatggagaggaacgtcatggao 301 gaggaaggigiggaigacgt o 302 gaggggaccattttacgggc 303 gatccagattctgccaggtcactgtgactggat o ~ 304 gatccagattctgctgagtcactgtgactggat o 305 gatccagtcacagtgacctggcagaatctggat o 306 gatccagtcacagtgactcagcagaatctggat o 307 gatccggctgactcatcactagatc o 308 gatcgctgatctaatgctcg sos 309 gatcggaggactggcgcgccg 310 gatctagtgatgagtcagccggatc o 311 gattcaacttgcgctcatcttaggc o 312 gcaacgtt o 313 gcaatattgcb o 314 goaatattgcf o 315 gcacatcgtcccgcagccga s 316 gcagcctctatacaacctgggacggga 317 gcatagcgttgagct sos 318 gcatgacgttgagct s 319 gcatgacgttgagct sos 320 gcatgacgttgagct o 321 gcatgacgttgagct s 322 gcatgagcttgagctga o 323 SEQUENCE , BACKBONE SEQ ID
NO:

gcatgatgttgagct o 324 gcatgazgttgagct o 325 gcatggcgttgagct sos 326 gcatgtagctgagct o 327 gcatgtcgttgagct sos 328 gcattcatcaggegggcaagaat o 329 gcattgcgttgagct sos 330 gcatttcgaggagct o 331 gccaccaaaacttgtccatg 332 gccagatgttagctgga o 333 gccatggacgaactgttccccctc s 334 gcgacgggcggcgcgcgccc s 335 gcgacggtcggcgcgcgccc s 336' gcgacgtgcggcgegcgccc s 337 gcgacgttcggcgcgcgccc s 338 gcgatgtcgttcctgatgcg o 339 gcgatgtcgttcctgatgct o 340 gcgccagtcctccgatagac 341 gcgcgcgcgcgcgcgcgcg o 342 gcgctaccggtagcctgagt 343 gcggcgggcggcgcgcgccc o 344 gcggcgggcggcgcgcgccc s 345 gcggcggtcggcgcgcgccc s 346 gcggcgtgcggcgcgcgccc s 347 gcggcgttcggcgcgcgccc s 348 gcgtcgttcccccccccccc O 349 gcgtgcgttgtcgttgtcgtt s 350 gcgtttttttttgcg s 351 gctaaacgttagcgt o 352 gctaacgttagcgtga o 353 gctaccttagcgtga o 354 gctaccttagzgtga 0 355 gctacttagcgtga o 356 gctagacgatagcgt o 357 gctagacgctagcgtga o 358 gctagacgt o 359 gctagacgtaagcgtga o 360 gctagacgtctagc o 361 gctagacgttagc o 362 gctagacgttagcgt o 363 gctagacgttagcgtga 364 gctagacgttagctgga o 365 gctagacgttagctgga sos 366 gctagacgttaggctga o 367 gctagacgttagtgt o 368 gctagacgttagzgt o 369 gctagacgtttagc o 370 gctagagcttagcgtga o 371 gctagaggttagcgtga o 372 gctagaggttagcgtga s 373 gctagatgttaacgt o 374 gctagatgttagcgt o 375 gctagatgttagcgt s 376 gctagatgttagcgtga o ' 377 gctagazgttagcgt o 378 SEQUENCE_ BACKBONE SE ID NO:

_ o 379 gctagazgttagtgt gctagctttagagctttagagctt o 3.80 gctaggcgttagcgt o 381 gctagtcgatagc o 382 gctagtcgatagcgt o 383 gctagtcgctagc o 384 gctandcghhagc o 385 gctatgacgttccaaggg s 386 gctcga s 387 gctcgttcagcgcgtct sos 388 gctgaaccttccatgctgtt 389 gctgagctcatgccgtctgc sos 390 gctggaccttccat 391 gctggaccttccat o 392 gctggccagcttacctcccg 393 gctgtaaaatgaatcggccg sos 394 gctgtggggcggctcctg s 395 gcttgacgtcaagc o 396 gcttgacgtctagc o 397 gcttgacgtttagc o 398 gcttgcgttgcgttt sos 399 gcttggagggcctgtaagtg 400 ggaacgtt o 401 ggaagacgttaga o 402 ggaattagtaatagatatagaagtt o 403 ggagaaacccatgagctcatctgg o 404 ggagctcttcgaacgccata 405 ggcagtgcaggctcaccggg 406 ggccaactttcaatgtgggatggcctc 407 ggccatcccacattgaaagtt 408 ggccttttCCCCCCCCCCCC O 409 ggcggcggcggcggcggcgg o 410 ggcgttattcctgactcgcc o 411 ggctatgtcgatcctagcc o 412 ggctatgtcgttcctagcc o 413 ggctccggggagggaatttttgtctat o 414 ggctgtattcctgactgccc S 415 gggaatgaaagattttattataag o 416 ggggactttccgctggggactttccagggggactttcc sos 417 ggggagggaggaacttcttaaaattcccccagaatgttt o 418 ggggagggg s 419 ggggagggt s 420 ggggcatgacgttcaaaaaa s 421 ggggcatgacgttcaaaaaa sos 422 ggggcatgacgttcgggggg s2 423 ggggcatgacgttcgggggg ' sos 424 ggggcatgagcttcgggggg s 425 ggggcatgagcttcgggggg sos 426 ggggcctctatacaacctggg 427 gggggacgttggggg o 428 g9gggggggggggggggggg sos 429 gJgggggggggggggggggg o 430 ggggggttggggaaaacccggacttcctgca o 431 gggggttttttttttggggg o 432 ggggtaatcgatcagggggg sos 433 SEQUENCE BACKBONE SEQ ID
NO:

ggggtaatcgatgagggggg o 434 ggggtaatgcatcagggggg sos 435 ggggtcaacgttgagggggg sos 436 ggggtcaacgttgagggggg s 437 ggggtcaagcttgagggggg sos 438 ggggtcaagtctgagggggg sos 439 ggggtccagcgtgcgccatggggg sos 440 ggggtcectgagactgcc 441 ggggtcgaccttggagggggg sos 442 ggggtcgacgtcgagggggg s 443 ggggtcgtcgttttgggggg ggggtctgtcgttttgggggg sos 445 ggggtctgtgcttttgggggg sos 446 ggggtgacgttcagggggg sos 447 ggggtgtcgttcagggggg sos 448 ggggttgacgttttgggggg sos 449 ggggttgggggtt s 450 ggtacctgtggggacattgtg o 451 ggtgaggtg s 452 ggtggtgtaggttttgg o 453 ggttacggtctgtcccatat 454 ggttcacgtgctcatggctg o 455 gtaacgtt o 456 gtagccttccta 457 gtaggggactttccgagctcgagatcctatg o 458 gtcactcgtggtacctcga s 459 gtccatggcgtgcgggatga 460 gtcccaggttgtatagaggctgc 461 gtccccatttcccagaggaggaaat o 462 gtccgggccaggccaaagtc s 463 gteggtcctgatgctgttcc sos 464 gtctatcggaggactggcgc 465 gtctgtcccatgatctcgaa 466 gtgaaticgttcicgggict o 467 gtgccggggtctccgggc s 468 gtgccggggtctccgggc o 469 gtgcgcgcgagcccgaaatc s 470 gtgctgatcaccgatatcctgttcgg 471 gtgcttgaccaccgatatttgg 472 gtggttacggtcgtgcccat 473 gtgtcggggtctccgggc o 474 gttctcagataaagcggaaccagcaacagacacagaa 475 gttgaaacccgagaacatcat s 476 gttggatacaggccagactttgttg o 477 gtttttatataatttggg o 478 gzaatattgcb o 479 gzggzgggzggzgzgzgccc 480 taaacgtt s 481 taagcgct o 482 taagctctgtcaacgccagg 483 taccgagcttcgacgagatttca o 484 taccgcgtgcgaccctct s 485 tactcttcggatcccttgcg sos 486 tagaaacagcattcttcttttagggcagcaca 487 tagacgtc o 488 SEQUENCE BACKBONE SEQ ID
NO:

tagacgttagcgtga o 489 tatagtccctgagactgccccaccttctcaacaacc 490 tatcggaggactggcgcgccg 491 tatgccgcgcccggacttat sos 492 tcaaatgtgggattttcccatgagtct o 493 tcaacgt s 494 tcaacgtc o 495 tcaacgtt p-ethoxy 496 tcaacgtt s 497 tcaacgtt o 498 tcaacgttaacgttaacgtt o 499 tcaacgttaacgttaacgttaacgttaacgttb s 500 tcaacgttga s 501 tcaacgttga o 502 tcaacgttgab ' 0 503 tcaacgttgaf o 504 tcaagctt p-ethoxy 505 tcaagctt o 506 tcaatgctgaf o 507 tcaazgtt o 508 tcaazgttgab o 509 tcaccggt s 510 tcacgctaacctctagc o 511 tcacgctaacctctgac o 512 tcacgctaacgtctagc o 513 tcacgt o 514 tcagaccacgtggtcgggtgttcctga o 515 tcagaccagctggtcgggtgttcctga o 516 tcagcgct o 517 tcagcgtgcgcc s 518 tcagctctggtactttttca 519 tcaggaacacccgaccacgtggtctga o 520 tcaggaacacccgaccagctggtctga o 521 tcaggggtggggggaacett sos 522 tcagzgct o 523 tcatcgat o 524 tccaagacgttcctgatgct o 525 tccaagtagttcctagttct o 526 tccaccacgtggctgatgct o 527 tccaccacgtggtctatgct s 528 tccacgacgttttcgacgtt s 529 tccagacggtgaagt o 530 tccagacgttgaagt o 531 tccagagcttgaagt o 532 tccagcgtgcgccata sos 533 tccaggacgttcctagttct o 534 tccaggacttctctcaggtt s 535 tccaggacttctctcaggtt sos 536 tccaggactttcctcaggtt s 537 tccaggactttcctcaggtt o 538 tccaggagcttcctagttct o 539 tccaggatgttcctagttct o 540 tccagtctaggcctagttct o 541 tccagttccttccteagtct o 542 tccagttcgagcctagttct o 543 SEQUENCE BACKBONE SEQ ID
~ NO:

tccataacgttcctgagtct sos 544 _ o 545 tccataacgttcctgatgct tccatagcgatcctagcgat o 546 tccatagcggtcctagcggt o 547 tccatagcgttcctagcgtt s 548 tccatagcgttcctagcgtt o 549 tccatcacgtgcctgagtct sos 550 tccatgacattcctgatgct o 551 tccatgacggtcctgacggt s 552 tccatgacggtcctgacggt o 553 tccatgacggtcctgagtct sos 554 tccatgacggtcctgatgct o 555 tccatgacgtccctgagtct sos 556 tccatgacgtccctgatgct o 557 tccatgacgttcctagttct o 558 tccatgacgttcctctccatgacgttcctctccatgacgttcctcO $59 tccatgacgttcctgacgtt s 560 tccatgacgttcctgacgtt 561 tccatgacgttcctgacgtt sos 562 tccatgacgttcctgacgtt o 563 tccatgacgttcctgagtct sos 564 tCCatgaCgttCCtgatCC 565 tccatgacgttcctgatgct o 566 tccatgacgttcctgatgct s 567 tccatgacgttcctgcagttcctgacgtt s 568 tccatgacgttcctgccgtt s 569 tccatgacgttcctgcgttt s 570 tccatgacgttcctggcggg s 571 tccatgacgttcztgatgct o 572 tccatgagcttcctgagctt s 573 tccatgagcttcctgagtct o 574 tccatgagcttcctgagtct p-ethoxy 575 tccatgagcttcctgagtct s 576 tccatgagcttcctgatgct s2 577 tccatgagcttccttgagtct 578 tccatgaigttcctgaigtt s 579 tccatgatgttcctagttct o 580 tccatgazgttcctagttct o 581 tccatgazgttcctgatgct o 582 tccatgazgttcctgazgtt s 583 tccatgccggtcctgagtct sos 584 tccatgccggtcctgatgct o 585 tccatgccggtcctgccggt o 586 tccatgccgttcctgccgtt s 587 tccatgccgttcctgccgtt o 588 tccatgcgcgtcctgcgcgt o 589 tccatgcgtgcgtgcgtttt s 590 tccatgcgttgcgttgcgtt s 591 tccatgctggtcctgagtct sos 592 tccatgctggtcctgatgct o 593 tccatggcgggcctggcggg s 594 tccatggcggtcctgatgct o 595 tccatgtagttcctagttct o 596 tCCatgtCCttCCtgatgCt 597 tccatgtcgatcctgagtct sos 598 SEQUENCE BACKBONE SEQ ID
NO:

tccatgtcgatcctgatgct o 599 tccatgtcgctcctgagtct sos 600 tCCatgtCgCtCCtgatCCt O 601 tccatgtcggtcctgagtct sos 602 tccatgtcggtcctgatgct 603 tccatgtcggtcctgatgct s 604 tccatgtcggtcctgctgat o 605 tccatgtcggtzctgatgct o 606 tccatgtcgttccgcgcgcg o 607 tccatgtcgttcctagttct 608 tccatgtcgttcctgagtct sos 609 tccatgtcgttcctgatgcg o 610 tccatgtcgttcctgatgct o 611 tccatgtcgttcctgccgct o 612 tccatgtcgttcctgtagct o 613 tccatgtcgttcctgtcgtt s 614 tccatgtcgttcctgtcgtt o 615 tccatgtcgtttttgtcgtt s 616 tccatgtgcttcctgatgct o 617 tccatgtzggtcctgagtct sos 618 tccatgtzggtcctgatgct o 619 tccatgtzgttcctgatgct o 620 tccatgtzgttcctgtzgtt s 621 tccattgcgttccttgcgtt o 622 tcccgacggtgaagt o 623 tcccgccgttgaagt o 624 tcccgcgcgttccgcgcgtt s 625 tccctgagactgccccacctt 626 tccgatcg o 627 tccggacggtgaagt o 628 tccggccgttgaagt o 629 tccgtacg o 630 tcctaacgttgaagt o 631 tcctagcgttgaagt o 632 tcctcacgttgaagt o 633 tcctga o 634 tcctgaaaaggaagt s 635 tcctgacgatgaagt o 636 tcctgacgctgaagt o 637 tcctgacggggaagt o 638 tcctgacggggaagt s 639 tcctgacggggagt s 640 tcctgacggtgaagt o 641 tcctgacggtgaagt s 642 tcctgacgtagaagt o 643 tcctgacgtcgaagt o 644 tcctgacgtggaagt o 645 tcctgacgtggaagt s 646 tcctgacgttaga o 647 tcctgacgttccc o 648 tcctgacgttcccctggcggtcccctgtcgct o 649 tcctgacgttcctgacgtt s 650 tcctgacgttcctggcggtcctgtcgct o 651 tcctgacgttccttc o 652 tcctgacgttcggcgcgcgccc s 653 SEQUENCE BACKBONE SEQ ID
NO:

_ o 654 tcctgacgttgaagt tcctgacgttgaagt s 655 tcctgagcttgaagt o 656 tcctgagcttgaagt s 657 tcctgazgttgaagt o 658 tcctgccgttgaagt o 659 tcctgccgttgaagt s 660 tcctggaggggaagt o 661 tcctggaggggaagt s 662 tcctggcggggaagt o 663 tcctggcggggaagt s 664 tcctggcggtcctggcggtt s 665 tcctggcggtgaagt o 666 tcctggcggtgaagt s 667 tcctggcgtggaagt s 668 tcctggcgttgaagt o 669 tcctggcgttgaagt s 670 tcctgggggggaagt o 671 tcctggtggggaagt o 672 tcctggzggggaagt o 673 tcctgtcgctcctgtcgct o 674 tcctgtcgctcctgtcgctcctgtcgct o 675 tcctgtcgttcctgtcgtt s 676 tcctgtcgttcctgtcgttggaacgacagg o 677 tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga o 678 tcctgtcgttccttgtcgtt s 679 tcctgtcgttgaagt o 680 tcctgtcgttgaagtttttt o 681 tcctgtcgttttttgtcgtt s 682 tccttacgttgaagt o 683 tccttgtcgttcctgtcgtt s 684 tcgacgtc 0 685 tcgacgttcccccccccccc O 686 tcgagacattgcacaatcatctg o 687 tCgCCgttCCCCCCCCCCCC O 688 tcgcgtgcgttttgtcgttttgacgtt s 689 tcgga o 690 tcggcgttcccccccccccc O 691 tcgtag s 692 tcgtca o 693 tCgtCattCCCCCCCCCCCC O 694 tcgtcgatcccccccccccc O 695 tCgtCgCtCCCCCCCCCCCC O 696 tcgtcgctgtctccg s 697 tcgtcgctgtctccgcttctt s 698 tcgtcgctgtctccgcttctt so 699 tcgtcgctgtctccgcttctt s2o 700 tCgtCgCtgtCtCCgCttCttCttgCC S 701 tcgtcgctgtctgcccttctt s 702 tcgtcgctgttgtcgtttctt s 703 tcgtcggtcccccccccccc O 704 tcgtcgtcagttcgctgtcg sos 705 tcgtcgtcgtcgtcgtcgtcgtt sos 706 tcgtcgtcgtcgtt s 707 tcgtcgtcgtcgtt s2 708 SEQUENCE BACKBONE SEQ ID
NO:

tcgtcgtcgtcgtt s2o 709 tcgtcgtcgtcgtt os2 710 tCgtCgttCCCCCCCCC S 711 tCgtCgttCCCCCCCCCCCC O 712 tCgtCgttCCCCCCCCCCCCb O 713 tCgtCgttCCCCCCCCCCCC O 714 tcgtcgttggtgtcgttggtgtcgtt s 715 tcgtcgttggttgtcgttttggtt s 716 tcgtcgttgtcgttgtcgtt s 717 tcgtcgttgtcgttgtcgtt sos 718 tcgtcgttgtcgttttgtcgtt s 719 tcgtcgttgtcgttttgtcgtt sos 720 tcgtcgtttcgtcgttttgacgtt s 721 tcgtcgtttgcgtgcgtttcgtcgtt s 722 tcgtcgtttgtcgttttgtcgtt s 723 tcgtcgttttgacgttttgacgtt s 724 tcgtcgttttgacgttttgtcgtt s 725 tcgtcgttttgcgtgcgttt s 726 tcgtcgttttgtcgttttgggggg. 727 tcgtcgttttgtcgttttgtcgt s2 728 tcgtcgttttgtcgttttgtcgtt s 729 tcgtcgttttgtcgttttgtcgtt sos 730 tcgtcgttttgtcgttttgtcgtt o 731 tcgtcgttttgtcgttttgtcgtt s2 732 tcgtcgttttgtegttttgtcgttb o 733 tcgtcgttttgtcgttttgtcgttttgtcgtt s 734 tcgtcgttttgtggttttgtggtt s 735 tcgtcgttttttgtcgttttttgtcgtt s 736 tcgtcgtttttttttttttt s 737 tcgtga s 738 tcgtga o 739 tcgtgg s 740 tCgt~gttCCCCCCCCCCCC O 741 tcntcgtnttntcgtnttntcgtn s 742 tctaaaaaccatctattcttaaccct o 743 tctagcgtttttagcgttcc sos 744 tctatcccaggtggttcctgttag o 745 tctatcgacgttcaagcaag s 746 tctccatcctatggttttatcg o 747 tctccatgatggttttatcg 748 tctcccagcgagegagcgccat s 749 tctcccagcgagcgccat s 750 tctcccagcgcgcgccat s 751 tCtCCCagCgggCgCat s 752 tCtCCCagCgtaCgCCat S 753 tctcccagcgtcgccat s 754 tctcccagcgtgcgccat s 755 tctcccagcgtgcgccat o 756 tctcccagcgtgcgccatat sos 757 tctcccagcgtgcgcctttt sos 758 tctcccagcgtgcgtgcgccat s 759 tctcccagcgtgcgttatat sos 760 tctcccagcgtgcgtttt s 761 tctcccagcgttgcgccatat sos 762 tctcccatcgtcgccat s 763 _SE UQ ENCE BACKBONE SE ID NO:

tctcccgacgtgcgccat s 764 tctcccgtcgtgcgccat s 765 tctccctgcgtgcgccatat sos 766 tCtCCtagCgtgCgCCatat SOS 767 tctgacgtcatctgacgttggctgacgtct o 768 tctgcgtgcgtgcgccatat sos 769 tcttcgaa o 770 tcttgcgatgctaaaggacgtcacattgcacaatcttaataaggto 771 tctttattagtgactcagcacttggca o 772 tcztgacgttgaagt o 773 tgaacgtt o 774 tgcaatgtgacgtcctttagcat o 775 tgcaggaagtccgggttttccccaacccccc o 776 tgcatcagctct s 777 tgcatcagctct sos 778 tgcatcccccaggccaccat s 779 tgcatgccgtacacagctct sos 780 tgcatgccgtacacagctct s 781 tgcatgccgtacacagctct o 782 tgcatgccgtgcatccgtacacagctct s 783 tgccaagtgctgagtcactaataaaga o 784 tgcccaaagaggaaaatttgtttcatacag o 785 tgcgctct s 786 tgctagctgtgcctgtacct 787 tgctagctgtgcctgtacct s 788 tgctgcttcccccccccccc O 789 tgCtgCttCCCCCCCCCCCC 8 790 tgctgcttttgtgcttttgtgctt o 791 tgctgcttttgtgcttttgtgctt s 792 tggaccttccat 793 tggaccttctatgteggtcc 794 tggagggtgagggtggggccagagcgggtggggctgattggaao 795 tggaggtcccaccgagatcggag o 796 tggttacggtctgtcccatg 797 tgtatctctctgaaggact o 798 tgtccagccgaggggaccat 799 tgtcccatgtttttagaagc 800 tgtcgttgtcgtt s 801 tgtcgttgtcgttgtcgttgtcgtt s 802 tgtcgtttgtcgtttgtcgtt s 803 ttaacggtggtagcggtattggtc o 804 ttaacgtt o 805 ttaagaccaataccgctaccaccg o 806 ttaggacaaggtctagggtg 807 ttagggttagggttagggtt s2 808 ttcagttgtcttgctgcttagctaa o 809 ttcatgccttgcaaaatggcg 810 ttccaatcagccccacccgctctggccccaccctcaccctccao 811 ttccatgctgttccggctgg 812 _ sos 813 ttccatgtcggtcctgat ttccgccgaatggcctcaggatggtac 814 ttccgctttatctgagaaccatct Sl5 ttcctctctgcaagagact o 8l6 ttcgggcggactcctccatt sos 817 ttcgggcggactcctccatt o 818 SEQUENCE BACKBONE SEQ TD
NO:

ttcgtcgttttgtcgttttgtcgtt s 819 ttctgtgtctgttgctggttccgctttatctgagaac 820 ttgaaactgaggtgggac 821 ttgccccatattttagaaac 822 ttggggggggtt s 823 ttgtactctccatgatggtt 824 tttaccttttataaacataactaaaacaaa o 825 tttgaatcctcagcggtctccagtggc o 826 tttgaattcaggactggtgaggttgag o 827 tttgaattccgtgtacagaagcgagaagc o 828 tttgagaacgctggaccttc sos 829 tttgcggccgctagacttaacctgagagata o 830 tttgggcccacgagagacagagacacttc o 831 tttgggcccgcttctcgcttctgtacacg o 832 ttttctagagaggtgcacaatgctctgg o 833 tttttggggggggggttttt o 834 tttttttttttttf o 835 tttttttttttttf so 836 tttttttttttttttttt s 837 tttttttttttttttttttt s 838 tttttttttttttttttttt o 839 ttttttttttttttttttttt s 840 tttttttttttttttttttttttt s 841 ttttttttttttttttttttttttttt s 842 tzaacgtt o 843 tZgtCgttCCCCCCCCCCCC O 844 tzgtcgttttgtcgttttgtcgtt o 845 tZgtggttCCCCCCCCCCCC O 846 tzgtzgttttgtzgttttgtzgtt o 847 tzgtzgttttgtzgttttgtzgtt s 848 In Table 4 with respect to sequences the letter symbols aside from a, c, t, and g are defined as follows: "b" indicates a biotin moiety attached to that end of the oligonucleotide when it is single and is listed on the S' or 3' end of oligonucleotide; "d"
represents a, g, or t;
"P' represents fluorescein isothiocyanate (FITC) moiety attached to the S' or 3' end of oligonucleotide; "h" represents a, c, or t; "i" represents inosine; "n"
represents any nucleotide; "z" represents S-methylcytosine.
Also in Table 4 with respect to backbones the notations are defined as follows: "o"
represents phosphodiester; "os" represents phosphorothioate and phosphodiester chimeric with phosphodiester on S' end; "os2" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on S' end; "p-ethoxy" represents p-ethoxy backbone (see, e.g., U.S. Patent No. 6,01S,886); "po" represents phosphodiester; "s" represents phosphorothioate;
"s2" represents phosphorodithioate; "s2o" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 3' end; "so" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 3' end; and "sos" represents chimeric phosphorothioate/phosphodiester with phosphorothioate at the 5' and 3' ends.
The nucleic acids are delivered in effective amounts. The term "effective amount" of a immunostimulatory nucleic acid refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an immunostimulatory nucleic acid could be that amount necessary to cause activation of the immune system.
According to some aspects of the invention, an effective amount is that amount of an immunostimulatory nucleic acid and that amount of an antibody, which when combined or co-administered, results in the prevention or the treatment of the cancer. In some embodiments a synergistic to effect is observed. A synergistic amount is that amount which produces an anti-cancer response that is greater than the sum of the individual effects of either the immunostimulatory nucleic acid and the antibody alone. For example, a synergistic combination of an irnmunostimulatory nucleic acid and an antibody provides a biological effect which is greater than the combined biological effect which could have been achieved using each of the components (i.e., the nucleic acid and the antibody) separately. The biological effect may be the amelioration and or absolute elimination of symptoms resulting from the cancer. In another embodiment, the biological effect is the complete abrogation of the cancer, as evidenced for example, by the absence of a tumor or a biopsy or blood smear which is free of cancer cells.
2o The effective amount of immunostimulatory nucleic acid necessary to treat a cancer or in the reduction of the risk of developing a cancer may vary depending upon the sequence of the immunostimulatory nucleic acid, the backbone constituents of the nucleic acid, and the mode of delivery of the nucleic acid. The effective amount for any particular application can also vary depending on such factors as the cancer being treated, the particular immunostimulatory nucleic acid being administered (e.g., the nature, number or location of immunostimulatory motifs in the nucleic acid), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular immunostimulatory nucleic acid and antibody combination without necessitating undue experimentation. Combined with the teachings provided herein, by 3o choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subj ect.
Therapeutic doses of cancer therapies are well known in the field of medicine for the treatment of cancer. These dosages have been extensively described in references such as Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as many other medical references relied upon by the medical profession as guidance for the treatment of cancer.
Therapeutic dosages of immunostimulatory nucleic acids have also been described in the art and methods for identifying therapeutic dosages in subjects are described in more detail herein.
to Subject doses of the compounds described herein typically range from about 0.1 ~g to mg per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween. More typically mucosal or local doses range from about 10 ~,g to 5 mg per administration, and most typically from about 100 ~,g to 1 mg, with 2 - 4 achninistrations being spaced hours, days or weeks apart. More i5 typically, immune stimulant doses range from 1 ~,g to 10 mg per administration, and most typically 10 ~g to 1 mg, with daily or weekly administrations. Subject doses of the compounds described herein for parenteral delivery, wherein the compounds are delivered without another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose or for immune stimulant applications, and more typically 10 to 1,000 times 2o higher, and most typically 20 to 100 times higher. More typically parenteral doses for these purposes range from about 10 ~g to 5 mg per administration, and most typically from about 100 ~,g to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart. In some embodiments, however, parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above.
25 For any compound described herein the therapeutically effective amount can be initially determined from animal models, e.g., the animal models described herein. A
therapeutically effective dose can also be determined from human data for CpG
nucleic acids which have been tested in humans (human clinical trials have been initiated and the results publicly disseminated) and for compounds which are known to exhibit similar 3o pharmacological activities. Higher doses may be required for parenteral administration, as described above. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan.
The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
For use in therapy, an effective amount of the nucleic acid can be administered to a subject by any mode that delivers the nucleic acid to a subject.
"Administering" the pharmaceutical composition of the present invention may be accomplished by any means to known to the skilled artisan. Some routes of administration include but are not limited to oral, intranasal, intratracheal, inhalation, ocular, vaginal, rectal, parenteral (e.g., intramuscular, intradermal, intravenous or subcutaneous injection) and direct injection.
For oral administration, the compounds (i.e., nucleic acids and antibodies) can be delivered alone without any pharmaceutical carriers or formulated readily by combining the active compounds) with pharmaceutically acceptable carriers well known in the art. The term "pharmaceutically-acceptable carrier" means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
2o The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical eff ciency.
Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, 3o potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions.
Dragee cores may be provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules made io of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray, from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compotmds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable to stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
The compounds may also be formulated in rectal or vaginal compositions such as 15 suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable 2o oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
The pharmaceutical compositions also may comprise suitable solid or gel phase Garners or excipients. Examples of such Garners or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, 25 and polymers such as polyethylene glycols.
Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical 30 compositions may also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer R, Science 249:1527-33 (1990), which is incorporated herein by reference.
The nucleic acids and/or antibodies may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not to limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, malefic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% wlv); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.~-2%
w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v);
chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
The nucleic acids or other therapeutics useful in the invention may be delivered in 2o mixtures with additional antibodies. A mixture may consist of several antibodies in addition to the nucleic acid.
A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular nucleic acids or antibodies selected, the particular condition being treated and the dosage required for therapeutic efficacy. The methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed above.
The compositions may conveniently be presented in unit dosage form and may be 3o prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping~the product. Liquid dose units are vials or ampoules.
Solid dose units are tablets, capsules and suppositories.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
to Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S.
Patent No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; sylastic systems;
peptide based systems; wax coatings; compressed tablets using conventional binders and excipients;
partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Patent Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patent Nos. 3,854,480, 5,133,974 and 5,407,686. In 2o addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
The nucleic acid may be directly administered to the subject or may be administered in conjunction with a pharmaceutically acceptable Garner or a delivery vehicle. The nucleic acid and optionally other therapeutic agents may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. One type of delivery vehicle is referred to herein as a nucleic acid delivery complex. A "nucleic acid delivery complex"
shall mean a nucleic acid molecule associated with (e.g., ionically or covalently bound to; or encapsulated within) a targeting means (e.g., a molecule that results in higher affinity binding to target cell (e.g., dendritic cell surfaces and/or increased cellular uptake by target cells).
3o Examples of nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g., cholesterol), a lipid (e.g., a cationic Lipid, virosome or liposome), or a target cell specific binding agent (e.g., a ligand recognized by target cell specific receptor). Preferred complexes may be sufficiently stable in vivo to reduce significant uncoupling prior to internalization by the target cell. However, the complex may be cleavable under appropriate conditions within the cell so that the nucleic acid may be released in a functional form.
The nucleic acids may be delivered by non-invasive methods as described above.
Non-invasive delivery of compounds is desirable for treatment of children, elderly, animals, and even adults and also to avoid the risk of needle-stick injury. Delivery vehicles for delivering compounds to mucosal surfaces have been described and include but are not limited to: Cochleates (could-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et al., 1998, l0 Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Live bacterial vectors (e.g., ,Salmonella, Esclzericlzia coli, Bacillus Calznette-Gue~in, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., I994, Moore et al., 1995, O'Hagan et aL, I994, Eldridge et al., 1989);
nucleic acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998);
Transgenic plants (Tacket et aL, 1998, Mason et aL, 1998, Haq et al., 1995); Virosomes (cluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl et al., 1998).
The invention also includes kits. The kits generally include a package with a plurality of containers housing active agents and instructions for carrying out the methods of the invention. The active agents include but are not limited to immunostimulatory nucleic acids, antibodies such as antibodies specific for a cell surface antigen, and anti-cancer therapies.
The following examples are provided to illustrate specific instances of the practice of the present invention and are not to be construed as limiting the present invention to these examples. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.

Examples Introduction:
Extensive cross-talk exists between healthy B cells and T cells. There is evidence that malignant B cells also communicate with T cells. However, malignant cells appear to differ from their normal counterparts in a number of ways, including a decreased tendency to undergo apoptosis in response to normal signals, altered expression of a variety of surface markers, and altered ability to function as effective antigen presenting cells. Lagneaux L et al., Blood 91:2387-96 (1998); Gordon J et al., Leukemia 7 Suppl 2:55-9 (1993);
Gordon J et al., Adv Exp Med Biol 406:139-44 (I996); Chaperot L et al., Exp Hematol 27:479-88 (I999).
to Immunotherapeutic approaches have recently become part of our therapy of some subtypes of B-cell malignancy. Improved inununotherapy of B-cell malignancy will need to be designed based on the growing understanding of the cellular immunology of this disease.
Schultze JL
et al., JMoI Med 77:322-32 (1999).
A variety of cellular receptors and antigens are involved in growth, differentiation and apoptosis of B-cell malignancies. Antibodies or ligands against a variety of antigens can cause growth inhibition or even apoptosis including CD20, surface immunoglobulins, MHC
II, CD80, CD86 and CD40. Maloney DG, Semin Oncol 26:74-8 (1999); McLaughlin P
et al., Semin Oncol 26:79-87 (1999); Shan D et al., Blood 91:1644-52 (1998); Coiffier B et al., Blood 92:1927-32 (1998); McLaughlin P et al., Oncology (Huntingt) 12:1763-70, (1998); Tutt AL et al., Jlmmunol 161:3176-85 (1998); Funakoshi S et al., Blood 83:2787-94 (1994); Mayumi M et al., JAllergy Clin Immuraol 98:5238-47 (1996); Higaki Y et al., InZnaunol Cell Biol 72:205-14 (1994); Elsasser D et al., Blood 87:3803-12 (1996); Link BK et al., Blood 81:3343-9 (1993); Link BK et al., Int .l Cancer 77:251-6 (1998).
The relative contribution of antibody dependent cellular cytotoxicity (ADCC) versus trans-membrane signaling mediated by anti-B cell antibodies remains unclear. In the present study, we examined how CpG-DNA impacts on the phenotype, apoptosis and proliferation of different types of B-cell malignancy including follicular B-cell lymphoma and B-CLL.
Materials and Methods:
Cell culture: Fresh lymph node samples were obtained from the operating suite and were minced with a scalpel under aseptic conditions. The resulting suspension was passed sequentially through a sterilized sieve-tissue grinder containing a nylon mesh screen, a 150 ~m mesh screen and a 60 ~,m mesh screen. Alternatively, mononuclear cells were obtained _71_ from peripheral blood or pleural fluid as described. Hartmann G et al., JPhat"macol Exp Tlzez~ 285:920-8 ( 1998). Red blood cells were removed by resuspending the cells in 5 ml ACK lysis buffer according to standard procedures. Cells were frozen slowly and stored in liquid nitrogen. For analysis, cells were thawed and resuspended in 10 % (v/v) heat-s inactivated (56°C, 1 h) FCS (HyClone, Logan, UT), 1.5 mM L-glutamine (all from Gibco BRL, Grand Island, NY) and incubated on a 96-well-plate (1 x 106 cellslml) in the presence of ODN as indicated below. Not all assays were performed for all samples because of the limited number of cells available for some samples.
Oli~onucleotides: Nuclease-resistant phosphorothioate-modified to oligodeoxynucleotide (ODN) were purchased from Operon Technologies (Alameda, CA) and Hybridon Specialty Products (Milford, MA). Sequences were as follows: CpG ODN
2006:
5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 729), and control ODN 2017:
5'-CCCCCCCCCCCCCCCCCCCC-3' (SEQ ID NO: 168). ODN was diluted in TE (10 mM
Tris-HCl, 1 mM EDTA, pH 8) using pyrogen-free reagents. ODN was added at a final 15 concentration of 5 pg/ml.
Flow cytometry: Cells were washed and resuspended in ice-cold PBS or Annexin V
binding buffer (10 mM HEPES/NaOH, 140 mM NaCI, 2.5 mM CaCl2, pH 7.4). Murine or human serum was added (final concentration 1 %) to block non-specific binding of antibodies.
Surface antigen staining was performed as described. Hartmann G et al., JPlzas°nzacol Exp 20 Then 285:920-8 (1998). In brief, 1 x I05 cells per sample were stained with CyChrome-labeled anti-CD19 and FITC- or PE-labeled antibodies as indicated for 20 min on ice. They were then washed and analyzed by flow cytometry. Monoclonal antibodies to CD40 (5C3), CD69 (FN50), CD80 (L307.4), CD86 (IT2.2), CD54 (HA58), MHC I (G46-2.6) and MHC
II
(TU39) as well as isotype controls (IgGI, MOPC-2I and IgG2a, GI55-178) were purchased 25 from PharMingen, San Diego, CA. FITC-labeled polyclonal anti-human Ig was purchased from Southern Biotech, Birmingham, AL. 1D10, a monoclonal humanized antibody directed against a variant of HLA-DR was produced in our laboratory as described earlier. Link BK
et al., Blood 81:3343-9 (1993). C2B8, a monoclonal humanized anti-CD20 antibody, was purchased from IDEC Pharmaceuticals, San Diego, CA. 1D10 and C2B8 were labeled with 30 FITC according to standard protocols. The analysis gate was set on viable cells identified according to FSC/SSC characteristics and Annexin V staining (> 97 % viable cells within analysis gate). Spectral overlap was corrected by appropriate compensation.
Flow cytometric data from 1 x 104 cells per sample were acquired on a FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, CA). Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).
CFSE staining: CFSE 5- (and 6-) carboxyfluorescein diacetate succinimidyl ester, Molecular Probes, USA, is a fluorescein-derived intracellular fluorescent label which is divided equally between daughter cells upon cell division. Staining of cells with CFSE
allows both quantification and immunophenotyping of proliferating cells in a mixed cell suspension. Interference between oligonucleotide degradation products and thymidine uptake (standard proliferation assay) is avoided by using this method. The technique has described to in detail previously. Lyons AB et al., Jlnarnunol Methods 171:131-7 (1994).
Briefly, cells were washed twice in PBS, resuspended in PBS (1 x 107 cells/ml) containing CFSE at a final concentration of 1 ~,M, and incubated at 37°C for 10 minutes. Cells were washed three times with PBS.
TUNEL assay: A two-color DNA strand break labeling assay, based on a modification of the assay described by Li et al. (Li X et al., ExpCell Res 222:28-37 (1996)) was used to assess B-cell proliferation in response to CpG ODN. This assay involved terminal transferase-mediated dUTP nick end labeling (TUNEL) before and after induction of DNA strand breaks in BrdU-labeled cells. Briefly, cells were cultured for 3 days with and without ODN. They were then incubated fox 16 hours in 10~,M BrdU and placed onto slides 2o by cytospin. Cells were then in 1% paraformaldehyde in PBS for 15 minutes followed by 20 minutes in 70% ethanol. DNA cleavage indicative of apoptosis cells was detected by labeling the 3'-DNA end of nicked strands with FITC-ddUTP (Boehringer-Mannheim). The use of dideoxy-dUTP prevented further elongation of the 3'-ends in subsequent steps. Slides were then placed face-down on a 2mm support at both ends on a UV
transilluminator and exposed for 5 minutes. The new DNA strand breaks induced by photolysis at sites of BrdU
incorporation (i.e., proliferating cells) were detected by a second TUNEL
labeling using tetramethylrhodamine-dUTP (TMR-dUTP, Boehringer-Mannheim). Both TUNEL staining steps included incubating slides in 50,1 of TdT mix (34,1 distilled water, 10,1 of 5X TdT
buffer, 5~1 of 25mM cobalt chloride, 12.5 units terminal transferase and 0.5nmo1 fluorochrome-conjugated-dUTP) (Boehringer-Mannheim) under a coverslip for one hour at 37°C in a humidified chamber. The slides were then washed in 5 quick changes of distilled water followed by 3 changes of ZXSSC containing 30% formamide for 5 minutes each at room temperature. After the second TUNEL labeling step, cells were counterstained for CD19, and also stained with Wright solution for blood cell differentiation and mounted in Vectashield media containing DAPI counterstain (Vector Laboratories, Burlingame, CA).
The morphology and staining of cells were assessed using both visible light and fluorescence microscopy. Apoptotic cells were identified by green fluorescence (FITC
label), and proliferating cells by red fluorescence (TMR label). The percentage of apoptotic and proliferating cells was detern~ined by counting at least 200 cells per sample by three observers blinded to whether cells were treated with ODN. Mean and standard error were determined for each sample based on these three readings.
Example 1: Immunostimulatory nucleic acids induce morphological and phenotypic changes in malignant B cells.
Our prior studies demonstrated that activation of naive human B cells by CpG
ODN
results in increased cell size (FSC) and granularity (SSC). Hartmann G et al., JlmmurZOl 164:944-53 (2000). We therefore first determined whether such changes also occur in malignant B cells. Primacy malignant B cells were obtained from lymph node biopsies, peripheral blood, or pleural fluid of patients with various types of B-cell malignancy. In addition, cells from the lymph node of a patient with benign reactive follicular hyperplasia were studied. Nine samples in total were evaluated (see Table S). Cells were incubated for 72 hours in media containing CpG ODN 2006 (5 ~,g/ml) or control ODN 2017. FSC
and SSC were examined with gating on CD19+ viable cells (Figure 1). Varying degrees of change in FSC and SSC were noted in response to CpG ODN 2006 when compared to control ODN 2017 or medium alone. Comparable changes were not found in the cells from the patient with benign reactive follicular hyperplasia.
Figure 1 depicts the morphologic changes of marginal zone lymphoma cells upon CpG ODN stimulation. Malignant B cells from a patient with marginal zone lymphoma were stimulated with 5 p,g/ml of no ODN (A and D), control ODN (B and E) or CpG ODN
(C and F) for 72 hours and analyzed by flow cytometry. A, B, and C illustrate FSC (x-axis) vs. SSC
(y-axis). D, E and F illustrate CD19 expression (x-axis) against FSC (y-axis), allowing for separation of B cells from other leukocyte subpopulations. Upon stimulation with CpG
ODN, B cells shifted up and to the right, indicating an increase in granularity and size. No changes could be detected without stimulation or on stimulation with the non-CpG ODN.

Expression of CD20, CD40, CD69, CD80, CD86, surface Ig, CD54, MHC I, MHC II, and an HLA-DR variant antigen (moAb 1D10) were examined on viable CD19+ cells after incubation of cells with CpG ODN for 72 hours. Each of these markers was upregulated to varying extents in response to the CpG ODN 2006 compared to the control ODN
2017 (Fig.
2, Fig. 3).
Figure 2 depicts the expression of surface antigens on marginal zone lymphoma cells upon CpG ODN treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed 72 hours after stimulation with 5 p.g/ml of either CpG ODN or non-CpG ODN. On stimulation with CpG
l0 ODN, median fluorescence intensity for all markers tested shifted to the right, indicating an increase in surface expression. Thin curves indicate incubation with medium alone, dotted curves incubation with control ODN; and bold curves incubation with CpG ODN.
Figure 3 depicts the expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon CpG ODN
treatment. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated for 72 hours with either media alone, control ODN or CpG ODN. Each panel represents one experiment.
CD20 was expressed to varying degrees in all samples tested. As is well known, baseline CD20 expression was lower in the B-CLL samples when compared to the B-cell 2o malignancies of other histologies. CpG-ODN 2006 but not the control ODN
2017 increased CD20 expression in both B-CLLs and both marginal zone lymphomas. No or only little upregulation was seen in the other lymphoma samples. Non-malignant CD19+ cells derived from the reactive follicular hyperplasia decreased CD20 expression in response to CpG (Fig.
3). This data demonstrated a reverse correlation between the baseline expression of CD20 and CD40, and expression of these markers after incubation with CpG ODN; thus the lower the baseline level of CD20 and CD40, the higher was the responsiveness to CpG
ODN (r: -0.6; -0.4) (Fig. 4). This correlation was less clear for the other markers.
CD19+ cells derived from the reactive follicular hyperplasia showed high baseline expression of activation markers which was not further upregulated by CpG.
3o Figure 4 shows the CpG ODN effect on CD20 and CD40 is dependent on the baseline level of expression. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies (see Table 5) were incubated with or without CpG ODN for 72 hours. Expression of CD20 and CD40 was measured by flow cytometry. Baseline expression of CD20 and CD40 with medium alone was compared to the expression of CD20 and CD40 in the presence of CpG ODN. The coefficients of correlation are indicated.
Table 5: Percentage Of CD19+ Cells In Samples Tested.
Sample Histology Source % CD19+ Cells Number 1 Chronic Lymphocytic LeukemiaPeripheral > g8 %

Blood 2 Chronic Lymphocytic LeukemiaPeripheral 70 %

Blood 3 Large Cell Lym homa 1 Pleural Fluid55 4 Large Cell Lym homa 2 Lymph Node 75 5 Mantle Cell Lymphoma Lym h Node 98 6 Diffuse Mixed Small and LargeL~ph Node 50 Cell Lyrn homa 7 Marginal Zone Lymphoma 1 Lym h Node 80 8 Marginal Zone Lymphoma 2 PeflPheral > 94 %

Blood Reactive Follicular HyperplasiaLymph Node 35 %
~

Example 2: Immunostimulatory nucleic acids induce proliferation and apoptosis of malignant B cells.
to CpG induces a strong proliferative response of primary human B cells.
Hartmann G
et al., Jlmmuhol 164:944-53 (2000). Two techniques were used to assess whether CpG ODN
is capable of inducing proliferation of B-CLL cells. For select samples, cells were stained with CFSE and incubated for four days. Proliferation of cells is indicated by a loss of CFSE
stain with every cell division. In B-CLL, CDS can be used to identify malignant B cells among CD19+ cells. Proliferation of malignant B cells (CD5+ and CD19+) was lower than proliferation of normal B cells (CDS- and CD 19+) (Fig. 5). For the marginal zone lymphoma, CpG ODN 2006 induced proliferation of the CD19+ cell population (Fig. 5).
Figure 5 shows a comparison of CpG ODN induced proliferation of malignant and normal B cells. Peripheral blood mononuclear cells from two patients, one with B-CLL and one with marginal zone lymphoma with circulating malignant cells, were incubated for 72 hours with CpG ODN or medium alone and evaluated by two-color flow cytometry.
CFSE
fluorescence (x-axis) and expression of CD5 (CLL) or CD19 (marginal zone lymphoma) (y-axis) were evaluated. In CLL, CpG ODN enhanced proliferation of both CDS+ and the CDS-cells. However the relative number of proliferating cells and the number of divisions is lower in the CD5- subset than in the CD5+ subset. In marginal zone lymphoma CpG ODN
enhanced proliferation in the CDI9+ cell subset.
No consistent pattern was apparent related to determining whether CpG ODN
altered the percent of dead cells as determined by morphological criteria (see Table 6).
Table 6: Percent Apoptotic Cells Based On Morphologic Criteria.
Sample Histology Media CpG ODN 2006 Number 1 Chronic Lymphocytic 25 21 Leukemia 1 . .

2 Chronic Lymphocytic 32 45 Leukemia 2 . .

3 Large Cell Lym homa 33.9 26.2 4 Large Cell Lymphoma 16.0 9.8 5 Mantle Cell Lymphoma55.1 60.0 6 Diffuse Mixed Small 2~ 26 and 6 6 Large Cell Lym homa , .

Marginal Zone 32 32 Lymphoma 1 . .

8 Marginal Zone 38 56 Lymphoma 2 . .

Reactive Follicular 8.6 18 Hype lasia .

to A TUNEL assay was utilized to assess the effect of CpG ODN on both proliferation and apoptosis. The results are shown in Table 7.
Table 7: Apoptosis And Proliferation As Determined By TUNEL.
Sam 1e Baseline C G Contro l ODN
ODN

Apop Prolif Apop Prolif Apo Prolif 12142812 3 <1 1 I0 2 12 12141811 <1 <1 <1 11 ? ?

Example 3: CpG ODN enhance the therapeutic effect of murine IgG2a (which relates to human IgG1) but not murine IgGl (which relates to human IgG2) anti-tumor antibody.

_77_ CpG ODN when combined with antibody of murine subtype IgG2a dramatically promotes survival in mice having tumors. Mice were injected i.p. with 5000 T3C
cells on day 0. They were then given 100 ~,g anti-idiotype monoclonal antibody as either IgGl (MSSA10) or IgG2a (MS11G6) on days 5, 7, and 10. In this model, the target antigen is the idiotype expressed by the lymphoma cells. Therefore, the anti-tumor antibodies are also "anti-idiotype." These antibodies (MS5A10 andMS11G6) are simultaneously both anti-tumor antibodies and anti-idiotype antibodies. Twenty micrograms of CpG ODN

(5' TCCATGACGTTCCTGACGTT 3'; SEQ ID NO: 560) was given at the same time.
Results are shown in Figure 6. Untreated controls had a median survival time (MST) of 17 days after inoculation with tumor. Mice treated with murine IgGl antibody plus CpG ODN
had survival that was similar to those treated with murine IgGl antibody alone (MST 28 days and 27 days, respectively). In contrast, mice treated with murine IgG2a plus CpG ODN had survival that was significantly improved when compared to mice treated with murine IgG2a alone (MST 45 days and 37 days, respectively).
The foregoing written specifcation is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and obj ects of the invention are not necessarily encompassed by each embodiment of the invention.
All references, patents and patent publications that are recited in this application are incorporated in their entirety herein by reference.
We claim:

SEQUENCE LISTING
<110> University of Iowa Research Foundation <120> Methods for Enhancing Antibody-Induced Cell Lysis and Treating Cancer <130> C1039/7052W0 (AWS) <150> US 60/213,346 <151> 2000-06-22 <160> 848 <170> FastSEQ for Windows Version 3.0 <210> 1 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 1 aaaaaa <210> 2 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 2 aaaaaaaaaa aaaaaaaaaa 20 <210> 3 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 3 aaaaaccCCC cccccaaaaa 20 <210> 4 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> Chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 4 aaaacatgac gttcaaaaaa 20 <210> 5 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorodithioate backbone <400> 5 aaaacatgac gttcaaaaaa 20 <210> 6 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <22l> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 6 aaaacatgao gttcgggggg 20 <210> 7 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorodithioate backbone <400> 7 aaaacatgac gttcgggggg 20 <210> 8 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 8 aaaacgtt g <210> 9 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 9 aaaatcaacg ttgaaaaaaa 20 <210> 10 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 10 aaaatctgtg cttttaaaaa a 21 <210> 11 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 11 aaaattgacg ttttaaaaaa 20 <210> 12 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 12 aaacattctg ggggaatttt aagaagtaaa cat 33 <210> 13 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 13 aaacattctg ggggaatttt aagaagttcc tccctcccc 39 <210> 14 <211> 33 <212> DNA
<213> Artificial Sequenoe <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 14 aaacattctg ggggaatttt gtctagtaaa cat 33 <210> 15 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 15 aacgctcgac cttcgat 17 <210> l6 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 16 aacgctggac cttccat 17 <210> 17 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 17 aacgctggac cttccatgtc 20 <210> 18 <211> 6 <212> ANA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 18 aacgtt 6 <210> 19 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 19 aacgttct 8 <210> 20 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 20 aacgttg 7 <210> 21 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 21 aacgttga 8 <210> 22 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 22 aacgttgagg ggcat 15 <210> 23 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 23 aaggtggggc agtctcaggg a 21 <210> 24 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .~. (0) <223> phosphodiester backbone <400> 24 aatagtcgcc ataacaaaac 20 <210> 25 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 25 aatagtcgcc atcccccccc . 20 <210> 26 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 26 aatagtcgcc atcccgggac 20 <210> 27 <211> 20 _ 7 _ <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 27 aatagtcgcc atcgcgcgac 20 <210> 28 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 28 aatagtcgcc atggcggggc 20 <210> 29 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 29 aattctctat cggggcttct gtgtctgttg ctggttccgc tttat 45 <210> 30 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 30 acaaccacga gaacgggaac 20 <210> 31 <211> 8 <212> DNA
<213> Artificial Sequence _ g _ <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 31 acaacgtt 8 <210> 32 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 32 acaacgttga 10 <210> 33 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 33 accacaacga gaggaacgca 20 <210> 34 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 34 accatcctga ggccattcgg 20 <210> 35 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone - 9 _ <400> 35 accatggacg aactgtttcc cctc 24 <210> 36 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 36 accatggacg acctgtttcc cctc 24 <210> 37 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 37 accatggacg agCtgtttCC CCtC 24 <210> 38 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 38 accatggacg agctgtttcc cctc 24 <210> 39 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 39 accatggacg atctgtttcc cctc 24 <210> 40 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 40 accatggacg gtctgtttcc cctc <210> 41 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 41 accatggacg tactgtttcc cctc 24 <210> 42 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphorothioate backbone <400> 42 accatggacg ttctgtttcc cctc 24 <210> 43 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 43 acccatcaat agctctgtgc 20 <210> 44 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 44 acccgtcgta attatagtaa aaccc 25 <210>,45 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 45 accgcatgga ttctaggcca 20 <210> 46 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 46 accttattaa gattgtgcaa tgtgacgtcc tttagcatcg caaga 45 <210> 47 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 47 acgctggacc ttccat 16 <210> 48 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 48 acgtCgttCC CCCCCCCCCC 20 <210> 49 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 49 acgtgt 6 <210> 50 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 50 actagacgtt agtgtga 17 <210> 51 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 51 actagacgtt agtgtga 17 <210> 52 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 52 actggacgtt agcgtga 17 <210> 53 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 53 acttctcata gtccctttgg tccag 25 <210> 54 <211> 8 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - - (0) <223> phosphodiester backbone <400> 54 agaacgtt 8 <210> 55 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 55 agacagacac gaaacgaccg 20 <210> 56 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 56 agactcatgg gaaaatccca catttga 27 <210> 57 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 57 agatagcaaa tcggctgacg 20 <210> 58 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 58 agatggttct cagataaagc ggaa 24 <210> 59 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 59 agcaccgaac gtgagagg 1g <210> 60 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 60 agcacggtag ccttccta 18 <210> 61 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 61 agcagcttta gagctttaga gctt 24 <210> 62 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 62 agcatcagga acgacatgga 20 <210> 63 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphodiester backbone <400> 63 agcatcagga ccgacatgga 20 <210> 64 <211> 8 <212> DNA
<2l3> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 64 agcgctga 8 <210> 65 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 65 agctcaacgt catgc 15 <210> 66 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 66 agctccatgg tgctcactg 19 <210> 67 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 67 aggatatc 8 <210> 68 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 68 aggtacagcc aggactacga 20 <210> 69 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphodiester backbone <221> modified_base <222> (3) . . . (3) <223> I
<221> modified_base <222> (8)...(8) <223> I
<221> modified_base <222> (14)...(14) <223> I
<400> 69 agncccgnga acgnattcac 20 <210> 70 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphodiester backbone <400> 70 agtgactctc cagcgttctc 20 <210> 71 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 71 agtgcgattc gagatcg 17 - l8 -<210> 72 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . - (0) <223> phosphodiester backbone <400> 72 agtgcgattg cagatcg 17 <210> 73 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 73 agtgct 6 <210> 74 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 74 agtgct 6 <210> 75 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - . (0) <223> phosphodiester backbone <400> 75 agttgcaact 10 _ 19 _ <210> 76 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 76 ataaagcgaa actagcagca gtttc 25 <210> 77 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 77 ataacgtt g <210> 78 <211> 20 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 78 ataatagagc ttcaagcaag 20 <210> 79 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 79 ataatccagc ttgaaccaag 20 <210> 80 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 80 ataatcgacg ttcaagcaag 20 <210> 81 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 81 ataatcgacg ttcccccccc 20 <210> 82 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 82 ataatcgtcg ttcaagcaag 20 <210> 83 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 83 ataatcgtgc gttcaagaaa g 21 <210> 84 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 84 atagacaaaa attccctccc cggagcc 27 <210> 85 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 85 atatatatat atatatat 1g <210> 86 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) ~ . (0) <223> phosphodiester backbone <400> 86 atatctaatc aaaacattaa caaa 24 <210> 87 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 87 atcaggaacg tcatgggaag c 21 <210> 88 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . - (0) <223> phosphodiester backbone <400> 88 atcgacctac gtgcgttctc 20 <210> 89 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (18) . . . (18) <223> m5c <400> 89 atcgacctac gtgcgttntc 20 <210> 90 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature~
<222> (0) . . (0) <223> phosphodiester backbone <400> 90 atcgactcga gcgttctc 18 <210> 91 <211> 20 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 91 atcgactctc gagcgttctc <210> 92 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 92 atcgactctc gagcgttctc 20 <210> 93 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 93 atcgactctc gagtgttctc 20 <210> 94 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (14) . . . (14) <223> m5c <400> 94 atcgactctc gagngttctc 20 <210> 95 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 95 atcgactctc tcgagcgttc tc 22 <210> 96 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 96 atcgacttcg agcgttctc 19 <210> 97 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 97 atcgatcgag cgttctc 17 <210> 98 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 98 atcgatgt 8 <210> 99 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 99 atcggaggac tggcgcgccg 20 <210> 100 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 100 atctggtgag ggcaagctat g 21 <210> 101 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 101 atgacgttcc tgacgtt 17 <210> 102 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphodiester backbone <400> 102 atgcactctg cagcgttctc 20 <210> 103 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 103 atgcatgt g <210> 104 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 104 atgcccctca acgtt 15 <210> 105 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 105 atgctaaagg acgtcacatt gca 23 <210> 106 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 106 atggaaggtc cacgttctc 19 <210> 107 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .'. (0) <223> phosphodiester backbone <400> 107 atggaaggtc cagcgttct 19 <210> 108 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 108 atggaaggtc cagcgttctc 20 <210> 109 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 109 atggaaggtc cagtgttctc 20 <210> 110 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 110 atggaaggtc gagcgttctc 20 _ 28 _ <210> 111 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 111 atggactctc cagcgttctc 20 <210> 112 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 112 atgtcctcgg tcctgatgct 20 <210> 113 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 113 atgtttacta gacaaaattc ccccagaatg ttt 33 <210> 114 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 114 atgtttactt cttaaaattc ccccagaatg ttt 33 _ 29 _ <210> 115 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 115 attcgatcgg ggcggggcga g 21 <210> 116 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (3) ... (3) <223> m5c <400> 116 atngacctac gtgcgttctc 20 <210> 117 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (3) . .. (3) <223> m5c <221> modified_base <222> (10)...(10) <223> m5c <221> modified_base <222> (14)...(14) <223> m5c <400> 117 atngactctn gagngttctc 20 <210> 118 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> mist feature <222> (1) ._. . (1) <223> biotinylated at 5' end <400> 118 atggaaggtc cagcgttctc 20 <210> 119 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> biotinylated 5' end <400> 119 gagaacgctc cagcactgat 20 <210> 120 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> biotinylated 5' end <400> 120 gagaacgctc gaccttcgat 20 <210> 121 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misC_feature <222> (1) . . (1) <223> biotinylated 5' end <221> modified_base <222> (6) . . . (6) <223> m5c <400> 121 gagaangctc cagcactgat 20 <210> 122 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> biotinylated 5' end <221> modified_base <222> (6) . . . (6) <223> m5c <400> 122 gagaangctc gaccttcgat 20 <210> 123 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 123 gagcaagctg gaccttccat 20 <210> 124 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <221> modified_base <222> (8) . . . (8) <223> m5c <400> 124 gagcaagntg gaccttccat 20 <210> 125 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <22l> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 125 gctagacgtt agcgtga 17 <210> 126 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 126 tcaacgtt g <210> 127 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 127 tccatgacgt tcctgatgct 20 <210> 128 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) ~<223> phosphodiester backbone <22l> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 128 tccatgagct tcctgatgct 20 <210> 129 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 129 tccattccat gacgttcctg atgcttcca 29 <210> 130 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - - (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 130 tCCattCCat tCtaggCCtg agtcttccat 30 <210> 131 <211> 29 <212> DNA
<213> Artificial Sequence <220> °
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 131 tcgtcgtttt gtcgttttgt cgttttttt 29 <210> 132 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misC_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 132 tttttCCatg tCgttCCtga tgcttttt 28 <210> 133 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 5' end <221> misc_feature <222> (1) . . (1) <223> biotinylated at 5' end <400> 133 tttttCgtCg ttCCCCCCCC CCCC 24 <210> 134 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 134 caaacgtt g <210> 135 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 135 caacgtt 7 <210> 136 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 136 caagagatgc taacaatgca ~ 20 <210> 137 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 137 caatcaatct gaggagaccc 20 <210> 138 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 138 cacaccttgg tcaatgtcac gt 22 <210> 139 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 139 caccaccttg gtcaatgtca cgt 23 <210> 140 <211> 16 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 140 cacggtagcc ttccta 16 <210> 141 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 141 cacgttgagg ggcat 15 <210> 142 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 142 cactgtcctt cgtcga 16 <210> 143 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 143 cagacacaga agcccgatag acg 23 <210> 144 <211> 20 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) . .. (0) <223> phosphodiester backbone <400> 144 cagattgtgc aatgtctcga 20 <210> 145 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 145 cataacatag gaatatttac tcctcgc 27 <210> 146 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 146 cataggatct cgagctcgga aagtccccta c 31 <210> 147 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 147 catgagctca tctggaggaa gcgg 24 <210> 148 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 148 catttccacg atttccca 18 <210> 149 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 149 cattttacgg gcgggcgggc 20 <210> 150 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 150 ccaaatatcg gtggtcaagc ac 22 <210> 151 <211> 8 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 151 ccaacgtt 8 <210> 152 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 152 ccacgtcgac cctcaggcga 20 <210> 153 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 153 ccacgtggac ctctagc 17 <210> 154 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 154 ccactcacat ctgctgctcc acaag 25 <210> 155 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 155 ccagatgagc tcatgggttt ctcc 24 <210> 156 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 156 ccaggttaag aggaaatgac ttcggg 26 <210> 157 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 157 ccaggttgta tagaggc 17 <210> 158 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 158 ccagtgctga tcaccgatat cctgttcggc agtcg 35 <210> 159 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 159 ccatcgat 8 <210> 160 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 160 ccatgcat 8 <2l0> 161 <211> 17 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 161 ccatgctaac ctctagc 17 <210> 162 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 162 ccatgtcggt cctgatgct 19 <210> 163 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 163 ccccaaaggg atgagaagtt 20 <210> 164 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 164 cccccaaaaa aaaaaccccc 20 <210> 165 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 165 cccccc 6 <210> 166 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 166 CCCCCCCC $
<210> 167 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> l67 <210> 168 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 168 <210> 169 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 169 <210> 170 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 170 <210> 171 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 171 <210> 172 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 172 <210> 173 <21l> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 173 CCCCttgaCg ttttCCCCCC 20 <210> 174 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphodiester backbone <400> 174 cccgaagtca tttcctctta acctgg 26 <210> 175 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 175 ccgaacagga tatcggtgat cagcac _ 26 <210> 176 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 176 ccgcttcctc cagatgagct catg 24 <210> 177 <211> 39 <212> ANA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 177 ccgcttcctc cagatgagct catgggtttc tccaccaag 39 <210> 178 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 178 ccggccggcc ggccggccgg 20 <210> 179 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0) . . (0) <223> phosphodiester backbone <400> 179 CCgtCgttCC CCCCCCCCCC 20 <210> 180 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 180 cctacgttgt atgcgcccag ct 22 <210> 181 <211> 20 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 181 cctccaaatg aaagaccccc 20 <210> 182 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 182 cctctataca acctgggac 19 <210> 183 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 183 ccttccatgt cggtcctgat 20 <210> 184 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0) . . (0) <223> phosphodiester backbone <400> 184 ccttcgat 8 <210> 185 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) . . . (0) <223> phosphodiester backbone <400> 185 cgaacgtt g <210> 186 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 186 cgacga 6 <210> 187 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 187 cgacgt 6 <210> 188 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 188 cgactctCga gcgttctc 1g <210> 189 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 189 cgactgccga acaggatatc ggtgatcagc actgg 35 <210> 190 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 190 cgccgtcgcg gcggttgg 18 <210> 191 <211> l8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 191 cgcctggggc tggtctgg 18 <210> 192 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 192 cgcgcgcgcg cgcgcgcgcg 20 <210> 193 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 193 cgcgcgcgcg cgcgcgcgcg 20 <210> 194 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 194 cgcgta 6 <210> 195 <211> l8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 195 cgctagaggt tagcgtga 18 <210> 196 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 196 cgctggacct tccat 15 <210> 197 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 197 cgctggacct tccatgtcgg 20 <210> 198 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 198 cggctgacgt catcaa 16 <210> 199 <211> 20 <212> DNA
<213> Artificial Sequence , <220>
<223> Synthetic oligonucleotide <400> 199 cgggcgactc agtctatcgg 20 <210> 200 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 200 cgggcttacg gcggatgctg 20 <210> 201 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 201 cggtagcctt ccta 14 <210> 202 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 202 cgtaccttac ggtga 15 <210> 203 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 203 cgtacg 6 <210> 204 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 204 cgtcga 6 <210> 205 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 205 cgtcga 6 <210> 206 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . - (0) <223> phosphorothioate backbone <400> 206 cgtcgt <210> 207 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 207 cgtcgtcgt 9 <210> 208 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 208 cgtcgtcgtc gtcgtcgtcg t 21 <210> 209 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 209 cgtctatcgg gcttctgtgt ctg 23 <210> 210 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 210 cgttcg 6 <210> 211 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 211 ctaacgtt 8 <210> 212 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 212 ctaatctttc taattttttt Ctaa 24 <210> 213 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 213 ctagataaag cggaaccagc aacagacaca gaagccccga tagag 45 <210> 214 <211> 8 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 214 ctagcgct 8 <210> 215 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 215 ctagcggctg acgtcataaa gctagc 26 <210> 216 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 216 ctagcggctg acgtcatcaa gctag 25 <210> 217 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 217 ctagcggctg acgtcatcaa tctag 25 <210> 218 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 218 ctagcggctg agctcataaa gctagc 26 <210> 219 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 219 ctagcttgat gacgtcagcc gctag 25 <210> 220 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 220 ctagcttgat gagctcagcc gctag 25 <210> 221 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 221 ctagctttat gacgtcagcc gctagc 26 <210> 222 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 222 ctaggctgac gtcatcaagc tagt 24 <210> 223 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 223 ctagtggctg acgtcatcaa gctag 25 <210> 224 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 224 ctatcggagg actggcgcgc c 21 <210> 225 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 225 ctatcggagg actggcgcgc cg 22 <210> 226 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 226 ctcaacgctg gaccttccat 20 <210> 227 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 227 ctcatgggtt tctccaccaa g 21 <210> 228 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester,backbone <400> 228 ctccagctcc aagaaaggac g 21 <210> 229 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 229 ctcgccccgc cccgatcgaa t 21 <210> 230 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 230 ctctccaagc tcacttacag 20 <210> 231 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 231 ctctctgtag gcccgcttgg 20 <210> 232 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 232 ctcttgcgac ctggaaggta 20 <210> 233 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (o) . . (o) <223> phosphodiester backbone <400> 233 ctgacgtcat 10 <210> 234 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 234 ctgacgtg g <210> 235 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 235 ctgattgctc tctcgtga 18 <210> 236 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 236 ctgattgctc tctcgtga 18 <210> 237 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 237 ctgcagcctg ggac 14 <210> 238 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 238 ctgcgttagc aatttaactg tg 22 <210> 239 <211> 15 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 239 ctgctgagac tggag 15 <210> 240 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 240 ctgctgctgc tgctgctgct g 21 <210> 241 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 241 ctggaccttc catgtc 16 <210> 242 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 242 ctggaccttc catgtcgg 18 <210> 243 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 243 ctggtctttc tggttttttt ctgg 24 <210> 244 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 244 ctggtctttc tggttttttt ctgg 24 <210> 245 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 245 ctgtaagtga gcttggagag 20 <210> 246 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .~. . (0) <223> phosphodiester backbone <400> 246 ctgtatgaaa caaattttcc tctttgggca 30 <210> 247 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 247 ctgtca <210> 248 <211> 22 <212> DNA
<2l3> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 248 ctgtcaggaa ctgcaggtaa gg 22 <210> 249 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 249 ctgtcccata tttttagaca 20 <210> 250 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 250 ctgtcg <210> 251 <211> 6 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (o) .~. (o>
<223> phosphodiester backbone <400> 251 ctgtcg 6 <210> 252 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 252 CtgtCgttCC CCCCCCCCCC 20 <210> 253 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> miso_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 253 ctgtgctttc tgtgtttttc tgtg 24 <210> 254 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 254 cttggagggc ctcccggcgg 20 <210> 255 <211> 21 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 255 cttggtggag aaacccatga g 21 <210> 256 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 256 cttggtggag aaacccatga gctcatctgg aggaagcgg 39 <210> 257 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 257 ctttccgttg gacccctggg 20 <210> 258 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (2) . . . (2) <223> m5c <221> modified_base <222> (6) . . . (6) <223> m5c <221> modified_base <222> (10)...(10) <223> m5c <221> modified_base <222> (15) . . . (15) <223> m5c <400> 258 cnggcnggcn gggcnccgg l9 <210> 259 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> FITC labeled <400> 259 aacgttga 8 <210> 260 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> FITC labeled <400> 260 cgcgaattcg cg 12 <210> 261 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (1) . . (1) <223> FITC labeled <400> 261 tcaacgtt 8 <210> 262 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) ..-. (0) <223> phosphodiester backbone <400> 262 gaaacgtt 8 <210> 263 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 263 gaaactgctg ctagtttcgc tttat 25 <210> 264 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 264 gaaccttcca tgctgtt 17 <210> 265 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 265 gaaccttcca tgctgttccg 20 <210> 266 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 266 gaacgctgga ccttccat 18 <210> 267 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 267 gaagttcacg ttgaggggca t 21 <210> 268 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 268 gaagtttctg gtaagtcttc g 21 <210> 269 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 269 gaccttccat 10 <210> 270 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 270 gaccttccat gtcggtcctg at 22 <210> 271 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 271 gaccttctat gtcggtcctg 20 <210> 272 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 272 gacgtcat g <210> 273 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 273 gactgacgtc agcgt 15 <210> 274 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 274 gagaacgatg gaccttccat 20 <210> 275 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 275 gagaacgcta gaccttctat 20 <210> 276 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 276 gagaacgctc caccttccat 20 <210> 277 <2l1> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 277 gagaacgctc cagcactgat 20 <210> 278 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 278 gagaacgctc cagcttcgat 20 <210> 279 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 279 gagaacgctc cgaccttcga t 21 <210> 280 <211> 20 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 280 gagaacgctc gaccttccat 20 <210> 281 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <221> misc_feature <222> (20) . . (20) <223> biotinylated at 3~ end <400> 281 gagaacgctc gaccttcgat 20 <210> 282 <211> 21 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 282 gagaacgctg gacctatcca t 21 <210> 283 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 283 gagaacgctg gacctcatca tccat 25 <210> 284 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 284 gagaacgctg gacctcatcc at 22 <210> 285 <21l> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 285 gagaacgctg gaccttcc 18 <210> 286 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 286 gagaacgctg gaccttccat 20 <210> 287 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 287 gagaacgctg gaccttccat 20 <210> 288 <21l> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 288 gagaacgctg gaccttccat gt 22 <210> 289 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 289 gagaacgctg gaccttcgat 20 <210> 290 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 290 gagaacgctg gaccttcgta 20 <210> 291 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 291 gagaacgctg gaccttgcat 20 <210> 292 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 292 gagaacgctg gacgctcatc cat 23 <210> 293 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 293 gagaacgctg gacttccat 19 <210> 294 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (14)...(14) <223> m5c <400> 294 gagaacgctg gacnttccat 20 <210> 295 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 295 gagaacgctg gatccat 17 <210> 296 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 296 gagaatgctg gaccttccat 20 <210> 297 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (6) . . . (6) <223> m5c <400> 297 gagaangctg gaccttccat 20 <210> 298 <211> 20 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <400> 298 gagaccgctc gaccttcgat 20 <210> 299 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 299 gagcaagctg gaccttccat 20 <210> 300 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <221> misc_feature <222> (20) . . (20) <223> biotinylated at 3~ end <400> 300 gagcaagctg gaccttccat 20 <210> 301 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 301 gaggaacgtc atggagagga acgtcatgga gaggaacgtc atgga 45 <210> 302 <211> 20 <212> DNA
<213> Artificial Sequence _ 77 _ <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (9)...(9) <223> I
<221> modified_base <222> (11)...(11) <223> I
<221> modified_base <222> (15)...(15) <223> I
<400> 302 gaggaaggng nggangacgt 20 <210> 303 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 303 gaggggacca ttttacgggc 20 <210> 304 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 304 gatccagatt ctgccaggtc actgtgactg gat 33 <210> 305 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone _ 78 _ <400> 305 gatccagatt ctgctgagtc actgtgactg gat 33 <210> 306 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 306 gatccagtca cagtgacctg gcagaatctg gat 33 <210> 307 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .~. (0) <223> phosphodiester backbone <400> 307 gatccagtca cagtgactca gcagaatctg gat 33 <210> 308 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 308 gatccggctg actcatcact agatc 25 <210> 309 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 309 gatcgctgat ctaatgctcg 20 <210> 310 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 310 gatcggagga ctggcgcgcc g 21 <210> 311 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phasphodiester backbone <400> 311 gatctagtga tgagtcagcc ggatc 25 <210> 312 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 312 gattcaactt gcgctcatct taggc 25 <2l0> 313 <211> 8 <212~> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone _ gp _ <400> 313 gcaacgtt g <210> 314 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (10) . . (10) <223> biotinylated at 3~ end <400> 314 gcaatattgc 10 <210> 315 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (10) . . (10) <223> FITC labeled <400> 315 gcaatattgc 10 <210> 316 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 316 gcacatcgtc ccgcagccga 20 <210> 317 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 317 gcagcctcta tacaacctgg gacggga 27 <210> 318 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 318 gcatagcgtt gagct 15 <210> 319 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - . (0) <223> phosphorothioate backbone <400> 319 gcatgacgtt gagct 15 <210> 320 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 320 gcatgacgtt gagct <210> 321 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide _ 82 _ <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 321 gcatgacgtt gagct 15 <210> 322 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 322 gcatgacgtt gagct 15 <210> 323 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 323 gcatgagctt gagctga 17 <210> 324 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 324 gcatgatgtt gagct 15 <210> 325 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (7) . . . (7) <223> m5c <400> 325 gcatgangtt gagct l5 <210> 326 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 326 gcatggcgtt gagct 15 <210> 327 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 327 gcatgtagct gagct 15 <210> 328 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 328 gcatgtcgtt gagct 15 <210> 329 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 329 gcattcatca ggcgggcaag aat 23 <210> 330 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 330 gcattgcgtt gagct <210> 331 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 331 gcatttcgag gagct 15 <210> 332 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 332 gccaccaaaa cttgtccatg 20 <210> 333 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 333 gccagatgtt agctgga 17 <210> 334 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 334 gccatggacg aactgttccc cctc 24 <210> 335 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 335 gcgacgggcg gcgcgcgccc 20 <210> 336 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 336 gcgacggtcg gcgcgcgccc 20 <210> 337 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 337 gcgacgtgcg gcgcgcgccc 20 <210> 338 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 338 gcgacgttcg gcgcgcgccc 20 <210> 339 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 339 gcgatgtcgt tcctgatgcg 20 <210> 340 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 340 gcgatgtcgt tcctgatgct 20 _ 87 _ <210> 341 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 341 gcgccagtcc tccgatagac 20 <210> 342 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 342 gcgcgcgcgc gcgcgcgcg 19 <210> 343 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 343 gcgctaccgg tagcctgagt 20 <210> 344 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 344 gcggcgggcg gcgcgcgccc 20 <210> 345 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide _ 88 _ <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 345 gcggcgggcg gcgcgcgccc 20 <210> 346 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 346 gcggcggtcg gcgcgcgccc 20 <210> 347 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 347 gcggcgtgcg gcgcgcgccc 20 <210> 348 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 348 gcggcgttcg gcgcgcgccc 20 <210> 349 <211> 20 <212 > DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 349 gcgtcgttcc CCCCCCCCCC 20 <210> 350 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 350 gcgtgcgttg tcgttgtcgt t 21 <210> 351 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 351 gcgttttttt ttgcg 15 <210> 352 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 352 gctaaacgtt agcgt 15 <210> 353 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 353 gctaacgtta gcgtga 16 <210> 354 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> miso_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 354 gctaccttag cgtga 15 <210> 355 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (11) . . . (11) <223> m5c <400> 355 gctaccttag ngtga 15 <210> 356 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 356 gctacttagc gtga 14 <210> 357 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <22z> (o> . . (o>
<223> phosphodiester backbone <400> 357 gctagacgat agcgt 15 <210> 358 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 358 gctagacgct agcgtga 17 <210> 359 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 359 gctagacgt g <210> 360 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 360 gctagacgta agcgtga 17 <210> 361 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 361 gctagacgtc tagc 14 <210> 362 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 362 gctagacgtt agc 13 <210> 363 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (d) <223> phosphodiester backbone <400> 363 gctagacgtt agcgt 15 <210> 364 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 364 gctagacgtt agcgtga 17 <210> 365 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 365 gctagacgtt agctgga 17 <210> 366 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 366 gctagacgtt agctgga 17 <210> 367 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221>~ misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 367 gctagacgtt aggctga 17 <210> 368 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 368 gctagacgtt agtgt 15 <210> 369 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (13)...(13) <223> m5c <400> 369 gctagacgtt agngt 15 <210> 370 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 370 gctagacgtt tags 14 <210> 371 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 371 gctagagctt agcgtga 17 <210> 372 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 372 gctagaggtt agcgtga 17 <210> 373 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 373 gctagaggtt agcgtga 17 <210> 374 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 374 gctagatgtt aacgt 15 <210> 375 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 375 gctagatgtt agcgt 15 <210> 376 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) . . . (0) <223> phosphorothioate backbone <400> 376 gctagatgtt agcgt 15 <210> 377 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 377 gctagatgtt agcgtga 17 <210> 378 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (7) . . . (7) <223> m5c <400> 378 gctagangtt agcgt 15 <210> 379 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (7)...(7) <223> m5c <400> 379 gctagangtt agtgt 15 <210> 380 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodie'ster backbone <400> 380 gctagcttta gagctttaga gctt 24 <210> 381 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 381 gctaggcgtt agcgt 15 <210> 382 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 382 gctagtcgat agc 13 <210> 383 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 383 gctagtcgat agcgt 15 <210> 384 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 384 gctagtcgct agc 13 <210> 385 <211> 13 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 385 gctandcghh agc 13 <210> 386 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 386 gctatgacgt tccaaggg 18 <210> 387 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0) . . (0) <223> phosphorothioate backbone <400> 387 gctcga 6 <210> 388 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 388 gctcgttcag cgcgtct 17 <210> 389 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 389 gctgaacctt ccatgctgtt 20 <210> 390 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 390 gctgagctca tgccgtctgc 20 <210> 391 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 391 gctggacctt ccat 14 <210> 392 <211> 14 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .-.. (0) <223> phosphodiester backbone <400> 392 gctggacctt ccat 14 <210> 393 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 393 gctggccagc ttacctcccg 20 <210> 394 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) . .~. (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 394 gctgtaaaat gaatcggccg 20 <210> 395 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 395 gctgtggggc ggctcctg 18 <210> 396 <211> 14 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 396 gcttgacgtc aagc 14 <210> 397 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 397 gcttgacgtc tagc 14 <210> 398 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) - - (0) <223> phosphodiester backbone <400> 398 gcttgacgtt tagc 14 <210> 399 <211> 15 < 212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 399 gcttgcgttg cgttt 15 <210> 400 <211> 20 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 400 gcttggaggg cctgtaagtg 20 <210> 401 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 401 ggaacgtt 8 <210> 402 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 402 ggaagacgtt aga 13 <210> 403 <211> 25 <212> DNA' <213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 403 ggaattagta atagatatag aagtt 25 <210> 404 <211> 24 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 404 ggagaaaccc atgagctcat ctgg 24 <210> 405 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 405 ggagctcttc gaacgccata 20 <210> 406 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 406 ggcagtgcag gctcaccggg 20 <210> 407 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 407 ggccaacttt caatgtggga tggcctc 27 <210> 408 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 408 ggccatccca cattgaaagt t 21 <210> 409 <211> 20 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 409 ggccttttcc CCCCCCCCCC 2Q
<210> 410 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 410 ggcggcggcg gcggcggcgg 20 <210> 411 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 411 ggcgttattc ctgactcgcc 20 <210> 412 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 412 ggctatgtcg atcctagcc 19 <2l0> 413 <2l1> 19 <212> DNA
<2l3> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 413 ggctatgtcg ttcctagcc 19 <210> 414 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 414 ggctccgggg agggaatttt tgtctat 27 <210> 415 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 415 ggctgtattc ctgactgccc 20 <210> 416 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 416 gggaatgaaa gattttatta taag 24 <210> 417 <211> 38 <212> DNA
<213> Artificial Sequence - l06 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 417 ggggactttc cgctggggac tttccagggg gactttcc 38 <210> 418 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 418 ggggagggag gaacttctta aaattccccc agaatgttt 39 <210> 419 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 419 ggggagggg <210> 420 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 420 ggggagggt 9 <210> 421 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 421 ggggcatgac gttcaaaaaa 20 <210> 422 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 422 ggggcatgac gttcaaaaaa 20 <210> 423 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorodithioate backbone <400> 423 ggggcatgac gttcgggggg 20 <210> 424 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 424 ggggcatgac gttcgggggg 20 <210> 425 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 425 ggggcatgag cttcgggggg 20 <210> 426 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 426 ggggcatgag cttcgggggg 20 <210> 427 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 427 ggggcctcta tacaacctgg g 21 <210> 428 <211> l5 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 428 gggggacgtt ggggg 15 <210> 429 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 429 gggggggggg gggggggggg 20 <210> 430 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 430 gggggggggg gggggggggg 20 <210> 431 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 431 ggggggttgg ggaaaacccg gacttcctgc a 31 <210> 432 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 432 gggggttttt tttttggggg 20 <210> 433 <2l1> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 433 ggggtaatcg atcagggggg 20 <210> 434 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 434 ggggtaatcg atgagggggg 20 <210> 435 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 435 ggggtaatgc atcagggggg 20 <210> 436 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 436 ggggtcaacg ttgagggggg 20 <210> 437 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 437 ggggtcaacg ttgagggggg 20 <210> 438 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 438 ggggtcaagc ttgagggggg 20 <210> 439 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 439 ggggtcaagt ctgagggggg 20 <210> 440 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 440 ggggtccagc gtgcgccatg gggg 24 <210> 441 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 441 ggggtccctg agactgcc 18 <210> 442 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 442 ggggtcgacc ttggaggggg g 21 <210> 443 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 443 ggggtcgacg tcgagggggg 20 <210> 444 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 444 ggggtcgtcg ttttgggggg <210> 445 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 445 ggggtctgtc gttttggggg g 21 <210> 446 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 446 ggggtctgtg cttttggggg g 21 <210> 447 <211> 19 <212> DNA
<213> Artificial Sequenoe <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 447 ggggtgacgt tcagggggg 19 <210> 448 <2l1> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 448 ggggtgtcgt tcagggggg 19 <210> 449 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 449 ggggttgacg ttttgggggg 20 <210> 450 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 450 ggggttgggg gtt 13 <210> 451 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 451 ggtacctgtg.gggacattgt g 21 <210> 452 <211> 9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 452 ggtgaggtg 9 <210> 453 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 453 ggtggtgtag gttttgg 17 <210> 454 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 454 ggttacggtc tgtcccatat 20 <210> 455 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 455 ggttcacgtg ctcatggctg 20 <210> 456 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 456 gtaacgtt g <210> 457 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 457 gtagccttcc to 12 <210> 458 <211> 31 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 458 gtaggggact ttccgagctc gagatcctat g 31 <210> 459 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 459 gtcactcgtg gtacctcga 19 <210> 460 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 460 gtccatggcg tgcgggatga 20 <210> 461 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 461 gtcccaggtt gtatagaggc tgc 23 <210> 462 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 462 gtccccattt cccagaggag gaaat 25 <210> 463 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 463 gtccgggcca ggccaaagtc 20 <210> 464 <211> 20 <222> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 464 gtcggtcctg atgctgttcc 20 <210> 465 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 465 gtctatcgga ggactggcgc 20 <210> 466 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 466 gtctgtccca tgatctcgaa 20 <210> 467 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (7) . . . (7) <223> I
<221> modified_base <222> (13)...(13) <223> I
<221> modified_base <222> (18)...(18) <223> I
<400> 467 gtgaatncgt tcncgggnct 20 <210> 468 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 468 gtgccggggt ctccgggc 18 <210> 469 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 469 gtgccggggt ctccgggc 18 <210> 470 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 470 gtgcgcgcga gcccgaaatc 20 <210> 471 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 471 gtgctgatca ccgatatcct gttcgg 26 <210> 472 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 472 gtgcttgacc accgatattt gg 22 <210> 473 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 473 gtggttacgg tcgtgcccat <210> 474 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 474 gtgtcggggt ctccgggc <210> 475 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 475 gttctcagat aaagcggaac cagcaacaga cacagaa 37 <210> 476 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 476 gttgaaaccc gagaacatca t 21 <210> 477 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0) . . (0) <223> phosphodiester backbone <400> 477 gttggataca ggccagactt tgttg 25 <210> 478 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 478 gtttttatat aatttggg 18 <210> 479 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (10) . . (10) <223> biotinylated at 3' end <221> modified_base <222> (2) . . . (2) <223> m5c <400> 479 gnaatattgc 10 <210> 480 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> modified_base <222> (2) . . . (2) <223> m5c <221> modified_base <222> (5) . . . (5) <223> m5c <221> modified base <222> (9) . . . (9) <223> m5c <221> modified_base <222> (12) . . . (12) <223> m5c <221> modified_base <222> (14) . . . (14) <223> m5c <221> modified_base <222> (16)...(16) <223> m5c <400> 480 gnggngggng gngngngccc 20 <210> 481 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 481 taaacgtt 8 <210> 482 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 482 taagcgct 8 <210> 483 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 483 taagctctgt caacgccagg 20 <210> 484 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 484 taccgagctt cgacgagatt tca 23 <210> 485 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 485 taccgcgtgc gaccctct 18 <210> 486 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 486 tactcttcgg atcccttgcg 20 <210> 487 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 487 tagaaacagc attcttcttt tagggcagca ca 32 <210> 488 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 488 tagacgtc 8 <210> 489 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . - (0) <223> phosphodiester backbone <400> 489 tagacgttag cgtga 15 <210> 490 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 490 tatagtccct gagactgccc caccttctca acaacc 36 <210> 491 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 491 tatcggagga ctggcgcgcc g 21 <210> 492 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) . . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 492 tatgccgcgc ccggacttat 20 <210> 493 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 493 tcaaatgtgg gattttccca tgagtct 27 <210> 494 <211> 7 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 494 tcaacgt 7 <210> 495 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 495 tcaacgtc g <210> 496 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> p-ethoxy backbone <400> 496 tcaacgtt 8 <210> 497 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 497 tcaacgtt 8 <210> 498 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mzsc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 498 tcaacgtt 8 <210> 499 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 499 tcaacgttaa cgttaacgtt 20 <210> 500 <211> 32 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <221> misc_feature <222> (32) . . (32) <223> biotinylated at 3' end <400> 500 tcaacgttaa cgttaacgtt aacgttaacg tt 32 <210> 501 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 501 tcaacgttga 10 <210> 502 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 502 tcaacgttga 10 <210> 503 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <22l> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (10) .. (10) <223> biotinylated at 3' end <400> 503 tcaacgttga 10 <210> 504 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - . (0) <223> phosphodiester backbone <221> misc_feature <222> (10) ..(10) <223> FITC labeled <400> 504 tcaacgttga 1p <210> 505 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> p-ethoxy backbone <400> 505 tcaagctt g <210> 506 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 506 tcaagctt 8 <210> 507 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (10) .. (10) <223> FITC labeled <400> 507 tcaatgctga 10 <210> 508 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (5)...(5) <223> m5c <400> 508 tcaangtt 8 <210> 509 <211> 10 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (10) ..(10) <223> biotinylated at 3~ end <221> modified_base <222> (5) . . . (5) <223> m5c <400> 509 tcaangttga 10 <210> 510 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .'. (0) <223> phosphorothioate backbone <400> 510 tcaccggt g <210> 511 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 511 tcacgctaac ctctagc 17 <210> 512 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 512 tcacgctaac ctctgac 17 <210> 513 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 513 tcacgctaac gtctagc 17 <210> 514 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 514 tcacgt 6 <210> 515 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 515 tcagaccacg tggtcgggtg ttcctga 27 <210> 516 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 516 tcagaccagc tggtcgggtg ttcctga 27 <210> 517 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 517 tcagcgct 8 <210> 518 <211> 12 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 518 tcagcgtgcg cc 12 <210> 519 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 519 tcagctctgg tactttttca 20 <210> 520 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 520 tcaggaacac ccgaccacgt ggtctga 27 <210> 521 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 521 tcaggaacac ccgaccagct ggtctga 27 <210> 522 <211> 20 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioatefphosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 522 tcaggggtgg ggggaacctt 20 <210> 523 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (5) . . . (5) <223> m5c <400> 523 tcagngct g <210> 524 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 524 tcatcgat 8 <210> 525 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 525 tccaagacgt tcctgatgct 20 <210> 526 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphodiester backbone <400> 526 tccaagtagt tcctagttct 20 <210> 527 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 527 tccaccacgt ggctgatgct 20 <210> 528 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 528 tccaccacgt ggtctatgct 20 <210> 529 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 529 tccacgacgt tttcgacgtt 20 <210> 530 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 530 tccagacggt gaagt 15 <210> 531 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 531 tccagacgtt gaagt 15 <210> 532 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 532 tccagagctt gaagt 15 <210> 533 <211> 16 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 533 tccagcgtgc gccata 16 <210> 534 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 534 tccaggacgt tcctagttct 20 <210> 535 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .~. (0) <223> phosphorothioate backbone <400> 535 tccaggactt ctctcaggtt 20 <210> 536 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) . ._. (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 536 tccaggactt ctctcaggtt 20 <210> 537 <211> 20 <212> ANA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 537 tccaggactt tcctcaggtt 20 <210> 538 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . - (0) <223> phosphodiester backbone <400> 538 tccaggactt tcctcaggtt 20 <210> 539 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 539 tccaggagct tcctagttct 20 <210> 540 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 540 tccaggatgt tcctagttct 20 <210> 541 <211> 20 <212> DN~1 <213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) . . . (0) <223> phosphodiester backbone <400> 541 tccagtctag gcctagttct 20 <210> 542 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 542 tccagttcct tcctcagtct 20 <210> 543 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 543 tccagttcga gcctagttct 20 <210> 544 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 544 tccataacgt tcctgagtct 20 <210> 545 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 545 tccataacgt tcctgatgct 20 <210> 546 <211> 20 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 546 tccatagcga tcctagcgat 20 <210> 547 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 547 tccatagcgg tcctagcggt 20 <210> 548 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 548 tccatagcgt tcctagcgtt 20 <210> 549 <211> 20 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 549 i tccatagcgt tcctagcgtt 20 <210> 550 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 550 tccatcacgt gcctgagtct 20 <210> 551 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonuoleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 55l tccatgacat tcctgatgct 20 <210> 552 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 552 tccatgacgg tcctgacggt 20 <210> 553 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 553 tccatgacgg tcctgacggt 20 <210> 554 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 554 tccatgacgg tcctgagtct 20 <210> 555 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 555 tccatgacgg tcotgatgct 20 <210> 556 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 556 tccatgacgt ccctgagtct 20 <210> 557 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 557 tccatgacgt ccctgatgct 20 <210> 558 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 558 tccatgacgt tcctagttct 20 <210> 559 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 559 tccatgacgt tcctctccat gacgttcctc tccatgacgt tcctc 45 <210> 560 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 560 tccatgacgt tcctgacgtt 20 <210> 561 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 561 tccatgacgt tcctgacgtt 20 <210> 562 <211> 20 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 562 tccatgacgt tcctgacgtt 20 <210> 563 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 563 tccatgacgt tcctgacgtt 20 <210> 564 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 564 tccatgacgt tcctgagtct 20 <210> 565 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 565 tccatgacgt tcctgatcc 19 <210> 566 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 566 tccatgacgt tcctgatgct 20 <210> 567 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 567 tccatgacgt tcctgatgct 20 <210> 568 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 568 tccatgacgt tcctgcagtt cctgacgtt 29 <210> 569 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 569 tccatgacgt tcctgccgtt 20 <210> 570 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 570 tccatgacgt tcctgcgttt 20 <210> 571 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 571 tccatgacgt tcctggcggg 20 <210> 572 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (13)...(13) <223> m5c <400> 572 tccatgacgt tcntgatgct 20 <210> 573 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 573 tccatgagct tcctgagctt 20 <210> 574 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 574 tccatgagct tcctgagtct 20 <210> 575 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> p-ethoxy backbone <400> 575 tccatgagct tcctgagtct 20 <210> 576 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 576 tccatgagct tcctgagtct 20 <210> 577 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorodithioate backbone <400> 577 tccatgagct tcctgatgct 20 <210> 578 <'211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 578 tccatgagct tccttgagtc t 21 <210> 579 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <221> modified_base <222> (8) . . . (8) <223> I
<221> modified_base <222> (17) . . . (17) <223> I
<400> 579 tccatgangt tcctgangtt 20 <210> 580 <211> 20 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 580 tccatgatgt tcctagttct 20 <210> 581 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (8) . . . (8) <223> m5c <400> 581 tccatgangt tcctagttct 20 <210> 582 <2l1> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (8) . . . (8) <223> m5c <400> 582 tccatgangt tcctgatgct 20 <210> 583 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <221> modified_base <222> (8) . . . (8) <223> m5c <221> modified_base <222> (17)...(17) <223> m5c <400> 583 tccatgangt tcctgangtt 20 <210> 584 <211> 20 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 584 tccatgccgg tcctgagtct 20 <210> 585 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 585 tccatgccgg tcctgatgct 20 <210> 586 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 586 tccatgccgg tcctgccggt 20 <210> 587 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <z2z> (o) . . (o) <223> phosphorothioate backbone <400> 587 tccatgccgt tcctgccgtt 20 <210> 588 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 588 tccatgccgt tcctgccgtt 20 <210> 589 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 589 tccatgcgcg tcctgcgcgt 20 <210> 590 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 590 tccatgcgtg cgtgcgtttt 20 <210> 591 <211> 20 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 591 tccatgcgtt gcgttgcgtt 20 <210> 592 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 592 tccatgctgg tcctgagtct 20 <210> 593 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 593 tccatgctgg tcctgatgct 20 <210> 594 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 594 tccatggcgg gcctggcggg 20 <210> 595 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 595 tccatggcgg tcctgatgct 20 <210> 596 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 596 tccatgtagt tcctagttct 20 <210> 597 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 597 tccatgtcct tcctgatgct 20 <210> 598 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 598 tccatgtcga tcctgagtct 20 <210> 599 <211> 20 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 599 tccatgtcga tcctgatgct 20 <210> 600 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 600 tCCatgtCgC tCCtgagtCt 20 <210> 601 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 601 tccatgtcgc tcctgatcct 20 <210> 602 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 602 tccatgtcgg tcctgagtct 20 <210> 603 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 603 tccatgtcgg tcctgatgct 20 <210> 604 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 604 tccatgtcgg tcctgatgct 20 <210> 605 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 605 tccatgtcgg tcctgctgat 20 <210> 606 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (12) . . . (12) <223> m5c <400> 606 tccatgtcgg tnctgatgct 20 <210> 607 <211> 20 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .~. (0) <223> phosphodiester backbone <400> 607 tccatgtcgt tccgcgcgcg 20 <210> 608 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 608 tccatgtcgt tcctagttct 20 <210> 609 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 609 tccatgtcgt tcctgagtct 20 <210> 610 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 610 tccatgtcgt tcctgatgcg 20 <210> 611 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 611 tccatgtcgt tcctgatgct 20 <210> 612 <211> 20 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 612 tccatgtcgt tcctgccgct 20 <210> 613 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 613 tccatgtcgt tcctgtagct 20 <210> 614 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 614 tccatgtcgt tcctgtcgtt 20 <210> 615 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 615 tccatgtcgt tcctgtcgtt 20 <210> 616 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 616 tccatgtcgt ttttgtcgtt 20 <210> 617 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 617 tccatgtgct tcctgatgct 20 <210> 618 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <221> modified base <222> (8) . . . (8) <223> m5c <400> 618 tccatgtngg tcctgagtct 20 <210> 619 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (8) . . . (8) <223> m5c <400> 619 tccatgtngg tcctgatgct 20 <210> 620 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (8) . . . (8) <223> m5c <400> 620 tccatgtngt tcctgatgct 20 <210> 621 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <221> modified_base <222> (8) . . . (8) <223> m5c <221> modified_base <222> (17) . . . (17) <223> m5c <400> 621 tccatgtngt tcctgtngtt 20 <210> 622 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 622 tccattgcgt tccttgcgtt 20 <210> 623 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 623 tcccgacggt gaagt 15 <210> 624 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 624 tcccgccgtt gaagt 15 <210> 625 <211> 20 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 625 tcccgcgcgt tccgcgcgtt 20 <210> 626 <211> 21 <212> DNA
<2l3> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 626 tccctgagac tgccccacct t 21 <210> 627 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 627 tccgatcg 8 <210> 628 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 628 tccggacggt gaagt 15 <210> 629 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0)...(0) <223> phosphodiester backbone <400> 629 tccggccgtt gaagt 15 <210> 630 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 630 tccgtacg g <210> 631 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 631 tcctaacgtt gaagt 15 <210> 632 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 632 tcctagcgtt gaagt 15 <210> 633 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 633 tcctcacgtt gaagt 15 <210> 634 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 634 tcctga 6 <210> 635 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone .
<400> 635 tcctgaaaag gaagt 15 <210> 636 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 636 tcctgacgat gaagt 15 <210> 637 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 637 tcctgacgct gaagt 15 <210> 638 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 638 tcctgacggg gaagt 15 <210> 639 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 639 tcctgacggg gaagt 15 <210> 640 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 640 tcctgacggg gagt 14 <210> 641 <211> 15 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 641 tcctgacggt gaagt 15 <210> 642 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 642 tcctgacggt gaagt 15 <210> 643 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 643 tcctgacgta gaagt 15 <210> 644 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 644 tcctgacgtc gaagt 15 <210> 645 <211> 15 <212> ANA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0) . . (0) <223> phosphodiester backbone <400> 645 tcctgacgtg gaagt 15 <210> 646 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 646 tcctgacgtg gaagt 15 <210> 647 <2l1> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 647 tcctgacgtt aga 13 <210> 648 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - . (0) <223> phosphodiester backbone <400> 648 tcctgacgtt ccc 13 <210> 649 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 649 tcctgacgtt CCCCtggCgg tCCCCtgtCg ct 32 <210> 650 <21l> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) . .-. (0) <223> phosphorothioate backbone <400> 650 tcctgacgtt cctgacgtt 19 <210> 651 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 651 tcctgacgtt cctggcggtc ctgtcgct 28 <210> 652 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 652 tcctgacgtt ccttc 15 <210> 653 <211> 22 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 653 tcctgacgtt cggcgcgcgc cc 22 <210> 654 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 654 tcctgacgtt gaagt 15 <210> 655 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 655 tcctgacgtt gaagt 15 <210> 656 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 656 tcctgagctt gaagt 15 <210> 657 <211> 15 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .~. . (0) <223> phosphorothioate backbone <400> 657 tcctgagctt gaagt 15 <210> 658 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (7)...(7) <223> m5c <400> 658 tcctgangtt gaagt 15 <210> 659 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 659 tcctgccgtt gaagt 15 <210> 660 <211> l5 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 660 tcctgccgtt gaagt 15 <210> 661 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 661 tcctggaggg gaagt 15 <210> 662 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 662 tcctggaggg gaagt 15 <210> 663 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 663 tcctggcggg gaagt 15 <2l0> 664 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 664 tcctggcggg gaagt 15 <210> 665 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 665 tcctggcggt cctggcggtt 20 <210> 666 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 666 tcctggcggt gaagt 15 <2l0> 667 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 667 tcctggcggt gaagt 15 <210> 668 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone ~
<400> 668 tcctggcgtg gaagt 15 <210> 669 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 669 tcctggcgtt gaagt 15 <210> 670 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 670 tcctggcgtt gaagt 15 <210> 671 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - . (0) <223> phosphodiester backbone <400> 671 tcctgggggg gaagt <210> 672 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) . . . (0) <223> phosphodiester backbone <400> 672 tcctggtggg gaagt 15 <210> 673 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (7) . .. (7) <223> m5c <400> 673 tcctggnggg gaagt 15 <210> 674 <211> 19 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 674 tcctgtcgct cctgtcgct 19 <210> 675 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 675 tcctgtcgct cctgtcgctc ctgtcget 28 <210> 676 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 676 tcctgtcgtt cctgtcgtt 1g <220> 677 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) .'. (0) <223> phosphodiester backbone <400> 677 tcctgtcgtt cctgtcgttg gaacgacagg 30 <210> 678 <211> 40 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 678 tcctgtcgtt cctgtcgttt caacgtcagg aacgacagga 40 <210> 679 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misa_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 679 tcctgtcgtt ccttgtcgtt 20 <210> 680 <211> Z5 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 680 tcctgtcgtt gaagt I5 <210> 681 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 681 tcctgtcgtt gaagtttttt 20 <210> 682 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 682 tcctgtcgtt ttttgtcgtt 20 <210> 683 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 683 tccttacgtt gaagt 15 <210> 684 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 684 tccttgtcgt tcctgtcgtt 20 <210> 685 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 685 tcgacgtc 8 <210> 686 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 686 tcgacgttcc CCCCCCCCCC 20 <210> 687 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 687 tcgagacatt gcacaatcat ctg 23 <210> 688 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 688 tcgccgttcc CCCCCCCCCC 2O
<210> 689 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 689 tcgcgtgcgt tttgtcgttt tgacgtt 27 <210> 690 <211> 5 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 690 tcgga 5 <210> 691 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 691 tcggcgttcc cccccccccc 20 <210> 692 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_difference <222> (0) . . (0) <223> phosphorothioate backbone <400> 692 tcgtag 6 <210> 693 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 693 tcgtca 6 <210> 694 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 694 tCgtCattCC CCCCCCCCCC 20 <210> 695 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 695 tcgtcgatcc CCCCCCCCCC 20 <210> 696 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) .
<223> phosphodiester backbone <400> 696 tCgtCgCtCC CCCCCCCCCC 20 <210> 697 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 697 tcgtcgctgt ctccg l5 <210> 698 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 698 tcgtcgctgt ctccgcttct t 21 <210> 699 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 3~ end <400> 699 tcgtcgctgt ctccgcttct t 21 <210> 700 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorodithioate/phosphodiester backbone with phosphodiester on 3~ end <400> 700 tCgtCgCtgt C'tCCgCttCt t 21 <210> 701 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - - (0) <223> phosphorothioate backbone <400> 701 tcgtcgctgt ctccgcttct tcttgcc 27 <210> 702 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 702 tcgtcgctgt ctgcccttct t 21 <210> 703 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 703 tcgtcgctgt tgtcgtttct t 21 <210> 704 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 704 tcgtcggtcc CCCCCCCCCC 20 <210> 705 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 705 tcgtcgtcag ttcgctgtcg 20 <210> 706 <211> 23 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3~ ends <400> 706 tcgtcgtcgt cgtcgtcgtc gtt 23 <210> 707 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 707 tcgtcgtcgt cgtt 14 <210> 708 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorodithioate backbone <400> 708 tcgtcgtcgt cgtt 14 <210> 709 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorodithioate/phosphodiester backbone with phosphodiester on 3~ end <400> 709 tcgtcgtcgt cgtt 14 <210> 710 <211> 14 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> chimeric phosphorodithioate/phosphodiester backbone with phosphodiester on 5~ end <400> 710 tcgtcgtcgt cgtt 14 <210> 711 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphorothioate backbone <400> 711 tCgtCgttCC CCCCCCC 17 <210> 712 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphodiester backbone <400> 712 tCgtCgttCC CCCCCCCCCC 20 <210> 713 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (20) .. (20) <223> biotinylated at 3' end <400> 713 tCgtCgttCC CCCCCCCCCC 20 <210~> 714 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (16)...(16) <223> m5c <400> 714 tcgtcgttcc cccccncccc 20 <210> 715 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 715 tcgtcgttgg tgtcgttggt gtcgtt 26 <210> 716 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 716 tcgtcgttgg ttgtcgtttt ggtt 24 <210> 717 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - . (0) <223> phosphorothioate backbone <400> 717 tcgtcgttgt cgttgtcgtt 20 <210> 718 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) .. . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 718 tcgtcgttgt cgttgtcgtt 20 <210> 719 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 719 tcgtcgttgt cgttttgtcg tt 22 <210> 720 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 720 tcgtcgttgt cgttttgtcg tt 22 <210> 721 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 721 tcgtcgtttc gtcgttttga cgtt 24 <210> 722 <211> 26 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 722 tcgtcgtttg cgtgcgtttc gtcgtt 26 <210> 723 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 723 tcgtcgtttg tcgttttgtc gtt 23 <210> 724 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 724 tcgtcgtttt gacgttttga cgtt 24 <210> 725 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 725 tcgtcgtttt gacgttttgt cgtt 24 <210> 726 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 726 tcgtcgtttt gcgtgcgttt 20 <210> 727 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 727 tcgtcgtttt gtcgttttgg gggg 24 <210> 728 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorodithioate backbone <400> 728 tcgtcgtttt gtcgttttgt cgt 23 <210> 729 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 729 tcgtcgtttt gtcgttttgt cgtt 24 <210> 730 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 730 tcgtcgtttt gtcgttttgt cgtt 24 <210> 731 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 731 tcgtcgtttt gtcgttttgt cgtt 24 <210> 732 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorodithioate backbone <400> 732 tcgtcgtttt gtcgttttgt cgtt 24 <210> 733 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223,> phosphodiester backbone <221> misc_feature <222> (24) ..(24) <223> biotinylated at 3' end <400> 733 tcgtcgtttt gtcgttttgt cgtt 24 <210> 734 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 734 tcgtcgtttt gtcgttttgt cgttttgtcg tt 32 <210> 735 <211> 24 <212> DNA
<213> Artificial Sequence <220> -<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 735 tcgtcgtttt gtggttttgt ggtt 24 <210> 736 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 736 tcgtcgtttt ttgtcgtttt ttgtcgtt 28 <210> 737 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 737 tcgtcgtttt tttttttttt 20 <210> 738 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) , <223> phosphorothioate backbone <400> 738 tcgtga <210> 739 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223.> Synthetic oligonucleotide <221> misc feature <222> {0) .~. (0) <223> phosphodiester backbone <400> 739 tcgtga <210> 740 <211> 6 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 740 tcgtgg g <210> 741 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (5)...(5) <223> m5c <400> 741 tcgtngttcc cccccccccc 20 <210> 742 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 742 tcntcgtntt ntcgtnttnt cgtn 24 <210> 743 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 743 tctaaaaacc atctattctt aaccct 26 <210> 744 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5~ and 3~ ends <400> 744 tctagcgttt ttagcgttcc 20 <210> 745 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) . . . (0) <223> phosphodiester backbone <400> 745 tctatcccag gtggttcctg ttag 24 <210> 746 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 746 tctatcgacg ttcaagcaag 20 <210> 747 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 747 tctccatcct atggttttat cg 22 <210> 748 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 748 tctccatgat ggttttatcg 20 <210> 749 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 749 tctcccagcg agcgagcgcc at 22 <210> 750 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 750 tctcccagcg agcgccat 18 <210> 751 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . - (0) <223> phosphorothioate backbone <400> 751 tctcccagcg cgcgccat 1g <210> 752 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> phosphorothioate backbone <400> 752 tCtCCCagCg ggcgcat 17 <210> 753 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 753 tctcccagcg tacgccat 1g <210> 754 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> .(0) . . (0) <223> phosphorothioate backbone <400> 754 tctcccagcg tcgccat 17 <210> 755 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 755 tctcccagcg tgcgccat 18 <210> 756 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 756 tctcccagcg tgcgccat 18 <210> 757 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 757 tctcccagcg tgcgccatat 20 <210> 758 <211> 20 <212> DNA
<2l3> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223>~chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 758 tctcccagcg tgcgcctttt 20 <210> 759 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 759 tctcccagcg tgcgtgcgcc at 22 <210> 760 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 760 tctcccagcg tgcgttatat 20 <210> 761 <211> 18 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 761 tctcccagcg tgcgtttt 18 <210> 762 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 762 tctcccagcg ttgcgccata t 21 <210> 763 <211> 17 <212 > DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 763 tCtCCCatCg tCgCCat 17 <210> 764 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 764 tctcccgacg tgcgccat 18 <210> 765 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 765 tctcccgtcg tgcgccat 18 <210> 766 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 766 tctccctgcg tgcgccatat 20 <210> 767 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <~00> 767 tctcctagcg tgcgccatat 20 <210> 768 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) .~. (0) <223> phosphodiester backbone <400> 768 tctgacgtca tctgacgttg gctgacgtct 30 <210> 769 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioatejphosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 769 tctgcgtgcg tgcgccatat 20 <210> 770 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <22l> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 770 tcttcgaa 8 <210> 771 <211> 45 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 77l tcttgcgatg ctaaaggacg tcacattgca caatcttaat aaggt 45 <210> 772 <211> 27 <212> ANA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 772 tctttattag tgactcagca cttggca 27 <210> 773 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (3) . . . (3) <223> m5c <400> 773 tcntgacgtt gaagt 15 <210> 774 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 774 tgaacgtt 8 <210> 775 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 775 tgcaatgtga cgtcctttag cat 23 <210> 776 <2l1> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <z22> (0) . . . (0) <223> phosphodiester backbone <400> 776 tgcaggaagt ccgggttttc cccaaccccc c 31 <210> 777 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 777 tgcatcagct ct 12 <210> 778 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0). .(0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 778 tgcatcagct ct 12 <210> 779 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 779 tgcatccccc aggccaccat 20 <210> 780 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 780 tgcatgccgt acacagctct 20 <210> 781 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 781 tgcatgccgt acacagctct 20 <210> 782 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 782 tgcatgccgt acacagctct 20 <210> 783 <2l1> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 783 tgcatgccgt gcatccgtac acagctct 28 <210> 784 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 784 tgccaagtgc tgagtcacta ataaaga 27 <210> 785 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 785 tgcccaaaga ggaaaatttg tttcatacag 30 <210> 786 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 786 tgcgctct 8 <210> 787 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 787 tgctagctgt gcctgtacct 20 <210> 788 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 788 tgctagctgt gcctgtacct 20 <210> 789 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 789 tgCtgCttCC CCCCCCCCCC 20 <210> 790 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 790 tgctgcttcc cccccccccc 20 <210> 791 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 791 tgctgctttt gtgcttttgt gctt 24 <210> 792 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 792 tgctgctttt gtgcttttgt gctt 24 <210> 793 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 793 tggaccttcc at 12 <210> 794 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 794 tggaccttct atgtcggtcc 20 <210> 795 <21l> 43 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) . .J. (0) <223> phosphodiester backbone <400> 795 tggagggtga gggtggggcc agagcgggtg gggctgattg gaa 43 <210> 796 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 796 tggaggtccc accgagatcg gag 23 <210> 797 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 797 tggttacggt ctgtcccatg 20 <210> 798 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 798 tgtatctctc tgaaggact 19 <210> 799 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 799 tgtccagccg aggggaccat 20 <210> 800 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 800 tgtcccatgt ttttagaagc 20 <210> 801 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 801 tgtcgttgtc gtt 13 <210> 802 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 802 tgtcgttgtc gttgtcgttg tcgtt 25 <210> 803 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 803 tgtcgtttgt cgtttgtcgt t 21 <210> 804 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 804 ttaacggtgg tagcggtatt ggtc 24 <210> 805 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) . . . (0) <223> phosphodiester backbone <400> 805 ttaacgtt 8 <210> 806 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 806 ttaagaccaa taccgctacc accg 24 <210> 807 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 807 ttaggacaag gtctagggtg 20 <210> 808 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorodithioate backbone <400> 808 ttagggttag ggttagggtt 20 <210> 809 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 809 ttcagttgtc ttgctgctta gctaa 25 <210> 810 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 810 ttcatgcctt gcaaaatggc g 21 <210> 811 <211> 43 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 811 ttccaatcag ccccacccgc tctggcccca ccctcaccct cca 43 <210> 812 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 812 ttccatgctg ttccggctgg 20 <210> 813 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 813 ttccatgtcg gtcctgat 18 <210> 814 <211> 27 <212> DNA

<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 814 ttccgccgaa tggcctcagg atggtac 27 <210> 815 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 815 ttccgcttta totgagaacc atct 24 <210> 816 <211> l9 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 816 ttcctctctg caagagact 19 <210> 817 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 817 ttcgggcgga ctcctccatt 20 <210> 8l8 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) . . . (0) <223> phosphodiester backbone <400> 818 ttCgggCgga ctcctccatt 2~
<210> 819 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 819 ttcgtcgttt tgtcgttttg tcgtt 25 <210> 820 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 820 ttctgtgtct gttgctggtt ccgctttatc tgagaac 37 <210> 821 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 821 ttgaaactga ggtgggac 18 <210> 822 <21l> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 822 ttgccccata ttttagaaac 20 <210> 823 <211> 12 <212> ANA
<213> Artificial Sequence - 2l0 -<220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 823 ttgggggggg tt <210> 824 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <400> 824 ttgtactctc catgatggtt 20 <210> 825 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 825 tttacctttt ataaacataa ctaaaacaaa 30 <210> 826 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 826 tttgaatcct cagcggtctc cagtggc 27 <210> 827 <211> 27 <2l2> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 827 tttgaattca ggactggtga ggttgag 27 <210> 828 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misC_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 828 tttgaattcc gtgtacagaa gcgagaagc 29 <210> 829 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphorothioate at 5' and 3' ends <400> 829 tttgagaacg ctggaccttc <210> 830 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 830 tttgcggccg ctagacttaa cctgagagat a 31 <210> 831 <211> 29 <212> DNA
<213> Artificial Sequence <220>

<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 831 tttgggccca cgagagacag agacacttc 29 <210> 832 <21l> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 832 tttgggcccg cttctcgctt ctgtacacg 29 <210> 833 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 833 ttttctagag aggtgcacaa tgctctgg 28 <210> 834 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) - . (0) <223> phosphodiester backbone <400> 834 tttttggggg gggggttttt <210> 835 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> misc_feature <222> (13) .. (13) <223> FITC labeled <400> 835 tttttttttt ttt 13 <210> 836 <211> 13 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> chimeric phosphorothioate/phosphodiester backbone with phosphodiester on 3' end <221> misc_difference <222> (13) .. (l3) <223> FITC labeled <400> 836 tttttttttt ttt 13 <210> 837 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 837 tttttttttt tttttttt 18 <210> 838 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 838 tttttttttt tttttttttt 20 <210> 839 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <400> 839 tttttttttt tttttttttt 20 <210> 840 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 840 tttttttttt tttttttttt t 21 <210> 841 -<211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <400> 841 tttttttttt tttttttttt tttt 24 <210> 842 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc feature <222> (0) . . . (0) ' <223> phosphorothioate backbone <400> 842 tttttttttt tttttttttt ttttttt 27 <210> 843 <211> 8 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (2) . .. (2) <223> m5c <400> 843 tnaacgtt 8 <210> 844 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> miso_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (2) . . . (2) <223> m5c <400> 844 tngtcgttcc CCCCCCCCCC 20 <210> 845 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (2) . . . (2)~
<223> m5c <400> 845 tngtcgtttt gtcgttttgt cgtt 24 <210> 846 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> mist feature <222> (0) .-. . (0) <223> phosphodiester backbone <221> modified_base <222> (2) . . . (2) <223> m5c <400> 846 tngtggttcc CCCCCCCCCC 20 <210> 847 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphodiester backbone <221> modified_base <222> (2) . . . (2) <223> m5c <221> modified_base <222> (5) . . . (5) <223> m5c <221> modified_base <222> (13)...(13) <223> m5c <221> modified_base <222> (21) . . . (21) <223> m5c <400> 847 tngtgntttt gtngttttgt ngtt 24 <210> 848 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic oligonucleotide <221> misc_feature <222> (0) . . (0) <223> phosphorothioate backbone <221> modified_base <222> (2) . . . (2) <223> m5c <221> modified_base <222> (5) . . . (5) <223> m5c <221> modified_base <222> (13)...(13) <223> m5c <221> modified_base <222> (21) . . . (21) <223> m5c <400> 848 tngtngtttt gtngttttgt ngtt

Claims (77)

1. A method for treating or preventing cancer, comprising:
administering to a subject having or at risk of developing cancer an effective amount to upregulate CD20 expression of a nucleic acid, and an anti-CD20 antibody.

2. The method of claim 1, wherein the nucleic acid is an immunostimulatory CpG
nucleic acid having an unmethylated CpG motif.

3. The method of claim 1, wherein the nucleic acid is an immunostimulatory T-rich nucleic acid.

4. The method of claim 1, wherein the nucleic acid is an immunostimulatory poly-G
nucleic acid.

5. The method of claim 1, wherein the nucleic acid is bacterial DNA.

6. The method of claim 1, wherein the nucleic acid is eukaryotic DNA.

7. The method of claim 1, wherein the cancer is B-cell lymphoma associated with low levels of CD20 expression.

8. The method of claim 7, wherein the B-cell lymphoma is B-cell chronic lymphocytic leukemia (B-CLL).

9. The method of claim 7, wherein the B-cell lymphoma is a marginal zone lymphoma.

10. The method of claim 1, wherein the anti-CD20 antibody is C2B8.

11. The method of claim 1, wherein the anti-CD20 antibody is Rituximab.

12. The method of claim 1, wherein the nucleic acid does not hybridize with genomic DNA or RNA under stringent conditions.

13. The method of claim 1, wherein the nucleic acid has a modified backbone.

14. The method of claim 13, wherein the modified backbone is a phosphate backbone modification.

15. The method of claim 13, wherein the modified backbone is a peptide modified oligonucleotide backbone.

16. The method of claim 1, wherein the nucleic acid is an immunostimulatory nucleic acid.

17. The method of claim 1, wherein the nucleic acid is 8 to 40 nucleotides in length.

18. The method of claim 1, wherein the nucleic acid is isolated.

19. The method of claim 1, wherein the nucleic acid is a synthetic nucleic acid.

20. The method of claim 1, wherein the nucleic acid and the anti-CD20 antibody are administered together.

21. The method of claim 1, wherein the nucleic acid and the anti-CD20 antibody are administered separately.

22. A method for diagnosing lymphoma, comprising:
isolating a B cell from a subject having or suspected of having a type of lymphoma and identifying a change in a cell surface marker when the B cell is contacted with an immunostimulatory nucleic acid, wherein the cell surface marker induced on the B cell is indicative of the type of lymphoma.

23. The method of claim 22, further comprising a method for treating cancer by administering to the subject an immunostimulatory nucleic acid and an antibody specific for the cell surface marker induced on the B cell in order to treat the cancer.

24. A method for treating or preventing cancer, comprising:
administering to a subject having or at risk of developing cancer an effective amount to induce expression of a surface antigen on a cancer cell surface, of a nucleic acid, and administering to the subject an antibody selected from the group consisting of an anti-CD22 antibody and an anti-CD19 antibody.

25. The method of claim 24, wherein the nucleic acid is an immunostimulatory CpG
nucleic acid having an unmethylated CpG motif.

26. The method of claim 24, wherein the nucleic acid is an immunostimulatory T-rich nucleic acid.

27. The method of claim 24, wherein the nucleic acid is an immunostimulatory poly-G
nucleic acid.

28. The method of claim 24, wherein the nucleic acid is bacterial DNA.

29. The method of claim 24, wherein the nucleic acid is eukaryotic DNA.

30. The method of claim 24, wherein the anti-CD22 antibody is a human IgG1 antibody.

31. The method of claim 24, wherein the anti-CD22 antibody is a murine IgG2a antibody.

32. The method of claim 24, wherein the anti-CD19 antibody is a human IgG1 antibody.

33. The method of claim 24, wherein the anti-CD19 antibody is a murine IgG2a antibody.

34. A method for treating lymphoma, comprising:

isolating a B cell from a subject having lymphoma, identifying a surface antigen which is not expressed or which is expressed on the surface of the B cell in an amount lower than that of a control B cell, administering to the subject an antibody specific for the identified surface antigen and an immunostimulatory nucleic acid in order to treat the cancer, wherein the immunostimulatory nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the cancer cell surface.

35. The method of claim 34, wherein the surface antigen is CD20.

36. The method of claim 34, wherein the surface antigen is CD40.

37. The method of claim 34, wherein surface antigen is CD22.

38. The method of claim 34, wherein surface antigen is CD19.

39. The method of claim 34, wherein the lymphoma is B-CLL.

40. The method of claim 34, wherein the lymphoma is marginal zone lymphoma.

41. The method of claim 34, wherein the antibody is a human IgG1 antibody.

42. The method of claim 34, wherein the antibody is a murine IgG2a antibody.

43. A method for treating a lymphoma resistant to antibody therapy, comprising:
administering to a subject having a lymphoma resistant to therapy with an antibody specific for a surface antigen, an antibody specific for the surface antigen to which the lymphoma is resistant and a nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.

44. The method of claim 43, wherein the surface antigen is CD20.

45. The method of claim 44, wherein the antibody is Rituximab.

46. The method of claim 43, wherein the surface antigen is CD40.

47. The method of claim 43, wherein the surface antigen is CD22.

48. The method of claim 43, wherein the surface antigen is CD19.

49. The method of claim 43, wherein the antibody is a human IgG1 antibody.

50. The method of claim 43, wherein the antibody is a murine IgG2a antibody.

51. The method of claim 43, further comprising administering an anti-cancer therapy.

52. The method of claim 51, wherein the anti-cancer therapy is selected from the group consisting of a chemotherapeutic agent or a cancer vaccine.

53. The method of claim 52, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, SPU-077/Cisplatin, HMR 1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Daunorubicin HCl, Etoposide (VP16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitoxantrone HCl, Procarbazine HCl, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.

54. The method of claim 52, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR
1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/Iiposornal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Daunorubicin HCl, Etoposide (VP16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mitoxantrone HCl, Procarbazine HCl, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.

55. The method of claim 52, wherein the cancer vaccine is selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL
theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys.

56. A method for treating cancer in a human, comprising:
administering to a human an immunostimulatory nucleic acid and an antibody of IgG1 isotype, which binds to a cell surface antigen of a cancer cell and wherein the nucleic acid and the antibody are administered in an effective amount for killing the cancer cell.

57. The method of claim 56, wherein the nucleic acid is an immunostimulatory CpG
nucleic acid having an unmethylated CpG motif.

58. The method of claim 56, wherein the nucleic acid is an immunostimulatory T-rich nucleic acid.

59. The method of claim 56, wherein the nucleic acid is an immunostimulatory poly-G
nucleic acid.

60. The method of claim 56, wherein the nucleic acid is bacterial DNA.

61. The method of claim 56, wherein the nucleic acid is eukaryotic DNA.

62. The method of claim 56, wherein the nucleic acid has a modified backbone.

63. The method of claim 62, wherein the modified backbone is a phosphate backbone modification.

64. The method of claim 62, wherein the modified backbone is a peptide modified oligonucleotide backbone.

65. The method of claim 56, wherein the nucleic acid is an immunostimulatory nucleic acid.

66. The method of claim 56, wherein the nucleic acid is 8 to 40 nucleotides in length.

67. The method of claim 56, wherein the nucleic acid is isolated.

68. The method of claim 56, wherein the nucleic acid is a synthetic nucleic acid.

69. The method of claim 56, wherein the nucleic acid and the antibody are administered together.

70. The method of claim 56, wherein the nucleic acid and the antibody are administered separately.

71. The method of claim 56, further comprising administering an anti-cancer therapy.

72. The method of claim 71, wherein the anti-cancer therapy is selected from the group consisting of a chemotherapeutic agent and a cancer vaccine.

73. The method of claim 72, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY
12-9566, RAS famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853, ZDO101, ISI641, ODN 698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium derivative, Temodal/Temozolomide, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR
1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT(Tegafur/LTracil), Ergamisol/Levamisole, Eniluracil/776C85/SFU enhancer, Campto/Levamisole, Camptosar/Irinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyxlliposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU 79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP
inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin, Daunorubicin HCl, Estramustine phosphate sodium, Etoposide (VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o,p'-DDD), Mitoxantrone HCI, Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HMM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.

74. The method of claim 72, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR
1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Daunorubicin HCl, Etoposide (VP16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mitoxantrone HCl, Procarbazine HCl, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.

75. The method of claim 72, wherein the cancer vaccine is selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL

theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys.

76. A kit, comprising:
a package including at least two containers, the first container housing an irmnunostimulatory nucleic acid, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid upregulates expression of the cell surface antigen.

77. The kit of claim 76; wherein the antibody is selected from the group consisting of an anti-CD20 antibody, an anti-CD19 antibody, and an anti-CD22 antibody.