CA2386791A1 - Method and apparatus for performing large numbers of reactions using array assembly - Google Patents

Method and apparatus for performing large numbers of reactions using array assembly Download PDF

Info

Publication number
CA2386791A1
CA2386791A1 CA002386791A CA2386791A CA2386791A1 CA 2386791 A1 CA2386791 A1 CA 2386791A1 CA 002386791 A CA002386791 A CA 002386791A CA 2386791 A CA2386791 A CA 2386791A CA 2386791 A1 CA2386791 A1 CA 2386791A1
Authority
CA
Canada
Prior art keywords
solid support
polynucleotide
immobilized
primer
reactions
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002386791A
Other languages
French (fr)
Inventor
Thomas M. Brennan
Francois Chatelain
Mark Berninger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Metrigen Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2386791A1 publication Critical patent/CA2386791A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277Apparatus
    • B01J2219/00497Features relating to the solid phase supports
    • B01J2219/00527Sheets
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00585Parallel processes
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00596Solid-phase processes
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/0061The surface being organic
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00612Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports the surface being inorganic
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00614Delimitation of the attachment areas
    • B01J2219/00617Delimitation of the attachment areas by chemical means
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00614Delimitation of the attachment areas
    • B01J2219/00617Delimitation of the attachment areas by chemical means
    • B01J2219/00619Delimitation of the attachment areas by chemical means using hydrophilic or hydrophobic regions
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00614Delimitation of the attachment areas
    • B01J2219/00621Delimitation of the attachment areas by physical means, e.g. trenches, raised areas
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00623Immobilisation or binding
    • B01J2219/00626Covalent
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00623Immobilisation or binding
    • B01J2219/0063Other, e.g. van der Waals forces, hydrogen bonding
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00632Introduction of reactive groups to the surface
    • B01J2219/00635Introduction of reactive groups to the surface by reactive plasma treatment
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • B01J2219/00632Introduction of reactive groups to the surface
    • B01J2219/00637Introduction of reactive groups to the surface by coating it with another layer
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00639Making arrays on substantially continuous surfaces the compounds being trapped in or bound to a porous medium
    • B01J2219/00641Making arrays on substantially continuous surfaces the compounds being trapped in or bound to a porous medium the porous medium being continuous, e.g. porous oxide substrates
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00659Two-dimensional arrays
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00718Type of compounds synthesised
    • B01J2219/0072Organic compounds
    • B01J2219/00722Nucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof

Abstract

The present invention relates to a method and apparatus for performing a large number of reactions using array assembly. In particular, the present invention features a method and apparatus for performing a large number of chemical and biological reactions by bringing two arrays into close apposition and allowing reactants on the surfaces of two arrays to come into contact. The present invention is exemplified by performing a large number of polynucleotide amplification reactions using array assembly. In addition, the present invention features a method and apparatus for coupling the amplification of polynucleotides and the detection of sequence variations, expression levels, and functions thereof.

Description

METHOD AND APPARATUS FOR PERFORMING LARGE NUMBERS OF
REACTIONS USING ARRAY ASSEMBLY
This application claims priority to U.S. Provisional Application Serial S No. 60/158,315, filed October 8, 1999.
FIELD OF THE INVENTION
The present invention relates to a method and apparatus for performing a large number of reactions using array assembly. In particular, the present invention features a method and apparatus for performing a large number of chemical and biological reactions by bringing two arrays into close apposition and allowing reactants on the surfaces of two arrays to come into contact. The present invention is exemplified by performing a large number of polynucleotide amplification reactions using array assembly. In addition, the present invention features a method and apparatus for coupling the amplification of polynucleotides and the detection of sequence variations, expression levels, and functions thereof.
BACKGROUND OF THE INVENTION
Intense efforts are under way to map and sequence the human genome and the genomes of many other species. In June 2000, the Human Genome Project and Celera Genomics announced that a rough draft of the human genome had been completed (http://www.ncbi.nlm.nih.gov). This information, however, represents only a reference sequence of the 3-billion-base human genome. The remaining task lies in the determination of sequence variations (e.g., mutations, polymorphisms, haplotypes) and sequence functions, which are important for the study, diagnosis, and treatment of human genetic diseases.
In addition to the human genome, the mouse genome is being sequenced.
Genbank provides about 1.2% of the 3-billion-base mouse genome and a rough draft of the mouse genome is expected to be available by 2003 and a finished genome by (http://www.informatics.jax.or~). The Drosophila Genome Project has also been completed recently (http://www.fruitfly.org). Thus far, genomes of more than organisms have been sequenced (http://www.tigr.org and .
http://www.ncbi.nlm.nih.gov/~enomes/index.html).
Traditional nucleic acid sequencing methods include the chemical cleavage method (or the Maxam-Gilbert method) and the chain termination method (or the Sanger method) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 2°d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). The basic strategy for the chemical cleavage method is to specifically cleave the end-labeled DNA at only one type of nucleotide, which produces a set of labeled fragments. These labeled fragments are then separated according to their size by electrophoresis. The DNA
sequence can be directly read off an autoradiogram. The chain termination method utilizes a DNA
polymerase to make complementary copies of the single-stranded DNA being sequenced in the presence of a suitable primer and four deoxynucleoside triphosphates (dNTPs), of which at least one is labeled. In addition, a small amount of the 2',3'-dideoxynucleoside triphosphate of one of the bases is added to the sequencing reaction, which generates a series of truncated chains. Each truncated chain is terminated by the dideoxy analog at positions occupied by the corresponding base, because of the absence of a 3'-OH group.
Electrophoresis separates these truncated chains according to their sizes, thus indicating the positions at which dideoxy incorporation occurs and in turn the corresponding normal nucleotide. Although the efficiency of the traditional sequencing methods has been improved by automation, the use of gel electrophoresis in both methods presents a limitation on the rate of sequencing.
While the traditional chemical cleavage and chain termination sequencing methods are capable of identifying the sequence of all nucleotides in a target nucleic acid, it is quite sufficient in many cases to know the sequence identity of a single nucleotide (or a few nucleotides) at a predetermined site, i.e., the detection of known sequence variations. During the past decade, the development of array-based hybridization technology has received great attention. This high throughput method, in which hundreds to thousands of polynucleotide probes immobilized on a solid surface are hybridized to target nucleic acids to gain sequence and function information, has brought economical incentives to many applications. See, e.g., McKenzie, S., et al., European Journal of Human Genetics 416-429 (1998), Green et al., Curr.Opin. in Chem.
Biol. 2:404-410 (1998), Gerhold et al., TIBS, 24:168-173 (1999), Young, Cell 102:9-15 (2000), and U.S. Patents 5,700,637, 6,054,270, 5,837,832, 5,744,305, and 5,445,943.
DNA array-based sequencing technology generally falls into two categories. The first category is sequencing by polynucleotide hybridization. Sets of polynucleotide probes, that differ by having A, T, C, or G substituted at or near the central position, are immobilized on a solid support by in situ synthesis or by deposition of pre-synthesized polynucleotide probes. Labeled target nucleic acids containing the sequences of interest will hybridize best to perfectly matched polynucleotide probes, whereas sequence
-2-variations will alter the hybridization pattern, thereby allowing the determination of mutations and polymorphic sites (Wang, D., et al., Science 280:1077-1082 (1998), Lipshutz, R., et al., Nature Genetics Supplement 21:20-24 (1999), and Drmanac et al., Nature Biotechnology 16:5-58 (1998)).
Alternatively, the de novo sequencing of target nucleic acids by polynucleotide hybridization may also be accomplished. For example, an array of all possible 8-mer polynucleotide probes may be hybridized with fluorescently labeled target nucleic acids, generating large amounts of overlapping hybridization data. The reassembling of this data by computer algorithm can determine the sequence of target nucleic acids.
See, e.g., Drmanac, S. et al., Nature Biotechnology 116:54-58 (1998), Drmanac, S. et al.
Genomics 4:114-28 (1989), and U.S. Patent Nos. 5,202,231, 5,492,806, 5,525,464, 5,667,972, 5,695,940, 5,972,619, 6,018,041, and 6,025,136.
The second category is sequencing by primer extension reactions (also known as minisequencing). Typically, a DNA polymerise is used specifically to extend an interrogation primer, which anneals to the nucleic acids immediately 3' of the single base substitution of interest, with a single labeled nucleoside triphosphate complementary to the single base substitution (Syvanen, Human Mutation 13:1-10 (1999), Syvanen et al., Genomics 8:684-692 (1990), Sokolov, Nucleic Acids Res. 18:3671 (1990), and Kuppuswami et al., Proc. Natl. Acid. Sci. USA 88:1143-1147 (1991)).
While methods of hybridization and primer extension-based nucleic acid sequencing have gained widespread acceptance in commercial areas, there are many limitations to the existing methods. The current methods for determining polynucleotide variations in a target nucleic acid employ discrete amplification steps and sequencing steps (Landegren et al., Genome Res. 8:769-776 (1998)). Thus, additional amount of time and labor is required to separate amplification products from the amplification primers and dNTPs before the sequencing reaction. Further, it is estimated that at least about 3,000,000 single nucleotide polymorphisms (SNPs) exist in an individual's genome. As SNPs are dispersed throughout the genome, it is necessary to amplify a large number of discrete regions in the genome so that each SNP can be analyzed.
Accordingly, the genetic analysis of a single individual's SNPs can require more than
3,000,000 amplification reactions be carried out and the product of each amplification reaction be analyzed. In addition, genetic analysis of a disease may require extensive genotyping of hundreds of thousands of individuals. Therefore, the number of separate amplification and sequencing reactions can be in the millions. The cost in terms of time, labor, equipment, laboratory space and reagents for carrying out discrete amplification and sequencing reactions on a large-scale is prohibitively high. Finally, the designing, optimizing and manufacturing of probe-immobilized arrays can be costly as well. For example, photolithographic synthesis of an array with N-mer polynucleotides typically requires 4 x N different chrome photolithographic masks (i.e., 100 different chrome masks for a 25-mer synthesis) (SinglyGasson et al., Nature Biotechnol. 17:974-(1999)). This leads to high cost and long synthesis time. In addition, changing probe length and base composition in photolithographic DNA synthesis means changing masks, which again leads to high redesigning cost and long turnaround time for custom arrays. There is a need in micro array field to develop rapid and inexpensive methods for large-scale sequence variation and function analysis.
The present invention features novel applications of the array technology, in which large numbers of non-unimolecular reactions are initiated and performed by array assembly. This method is capable of generating large amounts of data or products per unit time by carrying out large numbers of reactions in parallel. Furthermore, the present invention is amendable to full automation.
SUMMARY OF THE INVENTION
The present invention relates to a method and apparatus for performing a large number of reactions using array assembly. In particular, the present invention features a method and apparatus for performing a large number of chemical and biological reactions by bringing two arrays into close apposition and allowing reactants on the surfaces of two arrays to come into contact. The present invention is exemplified by performing a large number of polynucleotide amplification reactions using array assembly. In addition, the present invention features a method and apparatus for coupling the amplification of polynucleotides and the detection of sequence variations, expression levels, and functions thereof.
Any suitable solid supports (also known as arrays, chips, etc.) may be used in the present invention. These materials include glass, silicon, quartz, nylon, polystyrene, polyethylene, polypropylene, polytetrafluorethylene, metal, among others.
These materials typically have a rigid or semi-rigid surface. In some embodiments, at least one surface of the material is substantially flat. Typically, at least one solid support in the assembly is derivatized to provide covalent or noncovalent attachment to chemical or biological entities. Typically, the density of derivatized sites on an array is between
-4-about 10-10,000 per cm2, preferably below about 5,000, 1,000, 400, 200, 100, or 60 per cm2. The area of each site may be about 1 x 10-3 to 5 mm2, preferably less than about 2, 1, 0.5, 0.2, or 0.1 mm2. Typically, the total number of derivatized sites on an array is between about 20-1,000,000, preferably, between about 20-500,000, 20-100,000, 50,000, 20-10,000, 20-5,000, 20-1,000, or 20-500. In some embodiments, an array may contain raised or depressed regions, e.g., features such as wells, raised regions, etched trenches, etc. The dimensions of these features are flexible, depending on factors, such as desirable reaction concentration, avoidance of air bubbles upon assembly, mechanical convenience and feasibility, etc. For example, the area of a well on an array is in general larger than one derivatized site on another array. The depth of a well may be less than about 1000 microns, preferably less than about 500, 200 or 100 microns. In preferred embodiments, surface tension arrays may be used. Certain reactants such as biopolymers (polynucleotides, polypeptides, etc.) are synthesized in situ to provide better yield and great flexibility.
The array assembly method provides an environment for simultaneously carrying out between about 10-500,000 reactions, preferably, above about 20, 50, 100, 200, 500, 1,000, 5,000, 10,000, 50,000, or 100,000 reactions. A myriad of chemical and biological reactions may be carried out using the instant method and apparatus. These reactions may involve cells, viruses, nucleic acids, proteins, carbohydrates, lipids, and small molecules, among others. In particular, a large number of polynucleotide amplification reactions or molecular binding reactions may be performed using array assembly. In some embodiments of the instant invention, one or more reactants may be immobilized on an array prior to array assembly. The immobilization may be covalent or non-covalent. For example, one or more reactants may be tethered to an immobilized moiety on the array. In certain embodiments of the instant invention, one or more reactants may be immobilized on an array via a releasable site, for example by tethering to an immobilized molecule with a releasable site. The immobilized reactants may be released from an array upon reacting with cleaving reagents prior to, during or after the array assembly. The release methods may include a variety of enzymatic, or non-enzymatic means, such as chemical, thermal, or photolytic treatment. In certain embodiments, detection of sequence variations or quantitation of polynucleotides may be coupled to the amplification reactions.
In one embodiment, the instant invention provides a system for performing a plurality of reactions comprising: a first solid support having a first reactant of each
-5-reaction confined to an area on the surface of said first solid support; and a second solid support having a second reactant of each reaction confined to an area on the surface of said second solid support; wherein said first and second solid supports are assembled to allow said first reactant of each reaction in contact with said second reactant of each reaction, thus providing an environment for performing said plurality of reactions in parallel.
The instant invention also provides a system for performing a plurality of reactions comprising: a first solid support having a reactant of each reaction immobilized on said first solid support; and a second solid support providing a chemical or mechanical separation of said plurality of reactions; wherein said first and second solid supports are assembled to provide an environment for performing said plurality of reactions in parallel.
The instant invention also provides a solid support for performing a plurality of polynucleotide amplification reactions wherein a releasable primer for each amplification reaction is immobilized on an area of the surface of said solid support.
The instant invention also provides a system for amplifying a plurality of target nucleic acids, comprising:
(a) a first solid support wherein (1) the surface of said first solid support comprises a plurality of derivatized areas;
(2) a primer for each target nucleic acid or a sequence complementary to said primer is immobilized on a derivatized area of the first solid support;
and (b) a second solid support wherein said second solid support comprises a plurality of wells and each well corresponds to a primer for each target nucleic acid.
The instant invention also provides a system for amplifying a plurality of target nucleic acids, comprising:
(a) a first solid support wherein (1) the surface of said first solid support comprises a plurality of derivatized areas;
(2) a forward primer for each target nucleic acid or a sequence complementary to said forward primer is immobilized on a derivatized area of the first solid support
-6-
7 PCT/US00/27872 (3) a reverse primer for each region of said target nucleic acid or a sequence complementary to said reverse primer is immobilized on another derivatized area of the first solid support;
(b) a second solid support wherein said second solid support comprises a plurality of wells and each well corresponds to the forward and reverse primers for each target nucleic acid.
The instant invention also provides a system for amplifying a plurality of target nucleic acids and detecting amplified products, comprising:
(a) a first solid support wherein (1) the surface of said first solid support comprises a plurality of derivatized areas;
(2) a primer for each target nucleic acid or a sequence complementary to said primer is immobilized on a derivatized area of the first solid support;
(4) a probe comprising a subsequence, the same as or complementary to a subsequence of each target nucleic acid, is immobilized on another derivatized area of the first solid support;
(b) a second solid support wherein the surface of said second solid support comprises a plurality of reaction wells and each well corresponds the primer and the probe for each target nucleic acid.
In another embodiment, the instant invention provides a method for performing a plurality of reactions, comprising the steps of:
(a) obtaining a first solid support wherein a first reactant of each reaction is confined to an area on the surface of said first solid support;
(b) obtaining a second solid support wherein a second reactant of each reaction is confined to an area on the surface of said second solid support;
and (c) assembling said first and second solid support, wherein said first reactant on said first solid support is in contact with said second reactant on said second solid support, providing an environment for performing said plurality of reactions in parallel.
The instant invention also provides a method for performing a plurality of polynucleotide amplification reactions, comprising the steps of:

(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each area of said second solid support;
(c) assembling said first and second solid supports, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support; and (d) releasing said primers.
The instant invention also provides a method for performing a plurality of polynucleotide amplification reactions and capturing amplification products, comprising the steps of:
(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each area of said second solid support;
(c) assembling said first and second solid supports, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support;
(d) releasing said primers;
(e) generating amplification products of said polynucleotide amplification reactions; and (f) capturing said amplified products by a plurality of immobilized polynucleotide probes on either said first or second solid support through hybridization.
The instant invention also provides a method for detecting a plurality of polynucleotide sequence variations, comprising the steps of:
_g_ (a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each area of said second solid support;
(c) assembling said first and second solid support, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support;
(d) releasing said primers;
(e) generating amplification products of said polynucleotide amplification reactions;
(f) capturing said amplified products by a plurality of immobilized polynucleotide probes on either said first or second array through hybridization;
and (g) detecting polynucleotide sequence variations by hybridization complexes in step (f).
The instant invention also provides a method for quantitating polynucleotides in a target nucleic acid, comprising the steps of:
(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of finite areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each area of said second solid support;
(c) assembling said first and second solid support, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support;
(d) releasing said primers;
(e) generating amplification products of said polynucleotide amplification reactions; and (f) quantitating amplified products.

The instant invention also provides a method for detecting polynucleotide sequence variations in a target nucleic acid, comprising the steps of:
(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each areas of said second solid support;
(c) assembling said first and second solid supports, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support;
(d) releasing said primers;
(e) generating amplification products of said polynucleotide amplification reactions; and (f) capturing said amplified products by a plurality of immobilized polynucleotide probes on either first or second array through hybridization;
and (g) detecting polynucleotide sequence variations by a polynucleotide modifying enzyme.
The instant invention also provides a method for amplifying a target nucleic acid, capturing the amplified product, and detecting a polynucleotide sequence variation in the amplified product, comprising the steps of:
(a) obtaining a first solid support wherein:
(1) the surface of said first solid support comprises a first, second, third, and fourth areas;
(2) a first chemical moiety, comprising a releasable forward primer for said target nucleic acid, is immobilized on said first area;
(3) a second chemical moiety, comprising a releasable reverse primer for said target nucleic acid, is immobilized on said second area;
(4) a first polynucleotide probe, comprising a subsequence complementary to one variant of said polynucleotide variation, is immobilized on said third area, said subsequence containing at least one interrogation position complementary to a corresponding nucleotide in said variant; and (5) a second polynucleotide probe is immobilized to said fourth area, said second polynucleotide probe differing from said first polynucleotide probe by at least one nucleotide;
(b) obtaining a second solid support wherein the surface of said solid support comprises a reaction well and a mixture of reactants comprising a DNA
polymerase, said target nucleic acid, and deoxynucleotides are placed within said reaction well;
(c) assembling said first and second solid support, wherein said mixture of reactants are in contact with said first, second, third, and fourth areas on said first solid support;
(d) releasing said releasable forward and reverse primers;
(e) generating the amplified product for said target nucleic acid;
(f) capturing the amplified product by said first or second polynucleotide probe through hybridization;
(g) disassembling said first and second solid supports;
(h) washing said first solid support;
(i) comparing the relative binding of two probes on said first solid support;
and (j) identifying said polynucleotide variation in the amplified product.
The instant invention also provides a method for amplifying a.target nucleic acid, capturing the amplified product, and detecting a polynucleotide sequence variation in the amplified product, comprising the steps of:
(a) obtaining a first solid support wherein:
(1) the surface of said first array comprises a first, second, third, and fourth areas;
(2) a first chemical moiety, comprising a releasable forward primer specific for said region of said target nucleic acid, is immobilized on said first area;
(3) a second chemical moiety, comprising a releasable reverse primer specific for said region of said target nucleic acid, is immobilized on said second area;
(4) a first polynucleotide probe, comprising a subsequence complementary to one variant of said polynucleotide variation, is immobilized on said third area, said subsequence containing at least one interrogation position complementary to a corresponding nucleotide in said variant; and (5) a second polynucleotide probe is immobilized to said fourth area, said second probe differing from said first probe by at least one nucleotide;
(b) obtaining a second solid support wherein the surface of said solid support comprises a reaction well and a mixture of reactants comprising a DNA
polymerase, said target nucleic acid, and deoxynucleotides are placed within said reaction well;
(c) assembling said first and second solid support, wherein said mixture of reactants are in contact with said first, second, third, and fourth areas on said first solid support;
(d) releasing said releasable forward and reverse primers;
(e) generating the amplified product for said target nucleic acid;
(f) capturing the amplified product by said first or second polynucleotide probes through hybridization;
(g) extending said one or more hybridization complexes in step (f);
(h) disassembling said first and second solid support;
1 S (i) washing said first solid support; and (j) identifying said polynucleotide variation using said one or more extended products in step (g).
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 illustrates the merging of large numbers of microdroplets by bringing two arrays into close apposition.
Figure 2 illustrates array assembly using a first array and a second array (microfabricated with wells) wherein each well of the second array faces a unit cell comprised of two or more reactant-containing areas of the first array.
Figure 3 illustrates two arrays each containing reactants of polynucleotide amplification reactions. Large numbers of polynucleotide amplification reactions may be initiated by bringing two arrays into close apposition and merging all reactants on two arrays. In this illustration, a cleavable primer pair with different sequences (e.g., a forward primer and a reverse primer) are immobilized on two areas of the first array. Upon array assembly, the forward and reverse amplification primers are released to merge with the remaining amplification reactants in a reaction well on the second array. Each reaction well represents a different amplification using either different primer pairs or different target nucleic acid sequence.

Figure 4A-4C illustrate a method of amplifying a target nucleic acid, capturing the amplified products and sequencing by hybridization with captured amplified products.
Figure SA-SD illustrate a method of amplifying a target nucleic acid, capturing the amplified products, and sequencing by primer extension reactions using captured amplified products.
Figure 6A-6D illustrates a method of amplifying a target nucleic acid, capturing the amplified products, and sequencing by primer extension, in the absence of chain terminating nucleotides, using captured amplified products.
Figure 7 illustrates a chemical synthesis of photocleavable DMT-protected o-nitrobenzyl amidite.
Figure 8 illustrates capillary electrophoresis analysis of polynucleotides synthesized off of a photocleavable linker.
Figure 9 illustrates capillary electrophoresis analysis of polynucleotides synthesized off of a photocleavable linker co-migrated with polynucleotides of the same sequence from a commercial source.
Figure 10 illustrates photolysis of in situ synthesized photocleavable polynucleotides.
Figure 11 illustrates photolytic release of polynucleotides from the surface and subsequent hybridization of the released polynucleotides.
Figure 12 illustrates several designs of an array micrfabricated with wells.
Figure 13 illustrates a layout of two unit cells on a derivatized array used for detection by hybridization.
Figure 14 illustrates a result of primer release from a hybridization complex.
Figure 15 illustrates an example of array assembly.
Figure 16 illustrates the result of coupling polynucleotide amplification reactions with detections by hybridization using array assembly.
Figure 17 illustrates a comparison between primer releases from hybridization complexes vs. primers in solution.
Figure 18 illustrate a layout of two unit cells on a derivatized array for detection by a DNA modifying enzyme.
Figure 19 illustrates the result of coupling polynucleotide amplification reactions with detections by allele specific extension using array assembly.
Figure 20 illustrate end-point quantitation of PCR product using array assembly.
Figure 21 illustrates polynucleotide quantitation using a fluorescent label.

DETAILED DESCRIPTION OF THE INVENTION
Before the invention is described in detail, it is to be understood that this invention is not limited to the particular component parts or process steps of the method and apparatus described, as such parts and steps may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. As used in the specification and the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly indicates otherwise.
The present invention relates to a method and apparatus for performing a large number of reactions using array assembly. In particular, the present invention features a method and apparatus for performing a large number of chemical and biological reactions by bringing two arrays into close apposition and allowing reactants on the surfaces of two arrays to come into contact. In addition, selected reactants may be first immobilized on an array and subsequently released before, during or after the assembly with another array.
The present invention is exemplified by performing a large number of polynucleotide amplification reactions using array assembly. In particular, the present invention features a method and apparatus for coupling the amplification of polynucleotides and the detection of sequence variations, expression levels, and fiznctions thereof.
I. Performing l~~e numbers of non-unimolecular reactions by array assembly One of skill in the art will appreciate that reactions compatible with the present method and apparatus are very broad, encompassing all non-unimolecular reactions, i.e., reactions involving two or more reactants. A myriad of chemical and biological reactions may be carned out using the instant method and apparatus. These reactions may involve cells, viruses, nucleic acids, proteins, carbohydrates, lipids, and small molecules, among others. All reactants in a non-unimolecular reaction may be separated into two groups. Each group of reactants comprises one or more reactants, but not all reactants. Therefore, each group alone is not capable of initiating the reaction. Only when one group of reactants is combined with the second group of reactants can the reaction be initiated. One group of reactants may be confined to finite areas on an array, while the other group of reactants may also confined to finite areas on another array.

The combination of two groups of reactants is achieved by bringing two arrays into close apposition and allowing the merge of reactants on two arrays (Figure 1 ).
While it is convenient that reactants of a reaction is divided into two groups and the reaction is triggered by assembling two reactant-containing arrays, many variations of this method are entirely within the contemplation of the instant invention.
For example, reactants may be divided into more than two groups. In a reaction that requires N reactants, up to N groups of reactants may be obtained with each group containing one or more reactants, but not all N reactants. The N groups of reactants may be confined on M arrays (2 <_ M <_ N). The reaction may be initiated by successively assembling one of the N groups of reactants on one array with another one of the N groups of reactants on another array until all N reactants are combined. The order of assembling arrays may be decided by factors, such as reactant stability, reaction yields, and convenience among others. It should be noted that arrays containing no reactants may also be assembled with those containing reactants. For example, a washing step may be achieved by assembling with an array containing only the washing solution and no reactant.
Any suitable solid supports (also known as arrays, chips, etc.) may be used in the present invention. These materials include glass, silicon, quartz, nylon, polystyrene, polyethylene, polypropylene; polytetrafluorethylene, metal, among others.
These materials typically have a rigid or semi-rigid surface. In some embodiments, at least one surface of the material is substantially flat. Typically, at least one solid support in the assembly is derivatized to provide covalent or noncovalent attachment to chemical or biological entities. Typically, the density of derivatized sites on an array is between about 10-10,000 per cm2, preferably below about 5,000, 1,000, 400, 200, 100, or 60 per cm2. The area of each site may be about 1 x 10-3 to 5 mm2, preferably less than about 2, 1, 0.5, 0.2, or 0.1 mm2. Typically, the total number of derivatized sites on an array is between about 20-1,000,000, preferably, between about 20-500,000, 20-100,000, 50,000, 20-10,000, 20-5,000, 20-1,000, or 20-500. In some embodiments, an array may contain raised or depressed regions, e.g., features such as wells, raised regions, etched trenches, etc. The dimensions of these features are flexible, depending on factors, such as desirable reaction concentration, avoidance of air bubbles upon assembly, mechanical convenience and feasibility, etc. For example, the area of a well on an array is in general larger than one derivatized site on another array. The depth of a well may be less than about 1000 microns, preferably less than about 500, 200 or 100 microns.

There are many methods to separate reactants of one reaction from those of another and to prevent reactants of one reaction from entering another reaction before, during, or after assembly. These methods may include mechanical methods, chemical methods, or combinations thereof. For example, large numbers of reaction wells may be microfabricated on the surface of a solid support with each well providing a reaction site (Figure 2). In some embodiments, the raised regions of reaction wells may be hydrophobic, thus keeping aqueous solution in one reaction well from entering another reaction well upon array assembly. A liquid (such as mineral oil, Fomblin~, etc.) may also be employed to separate reactants of one reaction from those of another.
In some embodiments, a liquid polymer (such as Self Seal~, nail polish, rubber cement, etc.) may be employed as a seal between two arrays or between individual reactions to prevent excess solvent evaporation. Selected areas of a solid support surface may also be chemically or photolytically treated before, during or after assembly to provide separation of reactions. For example, selected areas may be converted from hydrophobic 1 S sites to hydrophilic sites upon chemical treatment or photolysis, thus providing separation of aqueous solution of one reaction from another via a hydrophobic matrix. In addition, reaction volumes are typically small. Microdroplets are not substantially affected by gravity and their local movements are limited. Array assembly may also be accomplished in the absence of microdroplets. For example, the reactant-containing solutions on arrays may be dried or frozen before or during the array assembly.
In one embodiment of the instant invention, polynucleotide amplification reactions may be performed by bring at least two arrays into close apposition and allowing reactants of polynucleotide amplification reactions on two arrays to come in contact. All reactants in a polynucleotide amplification reaction may be separated into at least two groups. Each group of reactants comprises one or more reactants, but not all reactants. Therefore, each group alone is not capable of initiating a polynucleotide amplification reaction. Only when one group of reactants is combined with the second group of reactants can the reaction be initiated. In preferred embodiments of the instant invention, one group of reactants may be located on one or more areas on an array, while the other group of reactants may be located on one or more areas on another array. The combination of two groups of reactants is achieved by bringing two arrays into close apposition and allowing the contact of reactants on two arrays. For example, a typical PCR amplification reaction involves several reactants, including a target nucleic acid, deoxynucleotide triphosphates, two primers, a DNA polymerase, and a buffer.
One group of PCR reactants may comprise two primers. The second group of reactants may comprise the remaining reactants, including a target nucleic acid, deoxynucleotide triphosphates, a DNA polymerase, and a buffer. Neither the first nor the second group of reactants alone can start the PCR amplification reaction, because the requisite reactants are missing in each group. Only when the first group is combined with the second group, i. e. when all requisite reactants are present, can the PCR reaction be initiated and performed (Figure 3). Of course, reactants may be grouped together in many different ways. For example, only one primer may be included in the first group and the second group of reactants may comprise the remaining reactants, including a target nucleic acid, deoxynucleotide triphosphates, the other primer, a DNA polymerase, and a buffer. It is also possible that selected reactants may be present in both groups of reactants. For instance, a buffer may be included in both the first group of reactants and the second group of reactants.
The large numbers of polynucleotide amplification reactions performed between two arrays may use similar or different target nucleic acid sequences. In some embodiments, the same target nucleic acid may be present in each reaction. But different primer sequences specific for different regions of the target sequence are immobilized on one array. Therefore, each polynucleotide amplification reaction represents the amplification of a different region of the target sequence. In other embodiments, different target nucleic acid sequence may be present in each reaction. But similar set of primers specific for the same region of the target sequence are immobilized on the first array. Each polynucleotide amplification reaction thus represents amplification of the same region of target sequences from different sources. Of course, a combination of both embodiments is applicable using the instant invention.
The array assembly method~provides an environment for simultaneously carrying out between about 10-500,000 reactions, preferably, above about 20, 50, 100, 200, 500, 1,000, 5,000, 10,000, 50,000, or 100,000 reactions. The advantages of the present method and apparatus are many folds. First, multiplexing gives simultaneous results of many reactions and generates large amounts of information per unit time.
Second, performing large numbers of similar reactions in parallel increases the accuracy of comparative analysis by eliminating factors such as array-to-array variations, differences in reaction conditions, among others.

II. Immobilization of reactants on arrays In some embodiments of the instant invention, one or more reactants may be immobilized on an array prior to array assembly. The immobilization may be covalent or non-covalent. For example, one or more reactants may be tethered to an immobilized moiety on the array. In certain embodiments of the instant invention, one or more reactants may be immobilized on an array via a releasable site, for example by tethering to an immobilized molecule with a releasable site. The immobilized reactants may be released from an array upon reacting with cleaving reagents prior to, during or after the array assembly. The release methods may include a variety of enzymatic, or non-enzymatic means, such as chemical, thermal, or photolytic treatment.
For example, in performing large numbers of polynucleotide amplification reactions, at least one primer may be tethered to an immobilized moiety with a releasable site on the surface of a first array. The remaining reactants of a polynucleotide amplification reaction may be confined to finite areas on the surfaces of a second array, e.g., in reaction wells designed to house reactants of a polynucleotide amplification reaction. If two arrays with matched primer-containing regions and reaction wells are brought into close apposition, reactants on two arrays may merge. The primers may be released before, during or after the merging of reactants, thereby triggering reactions by mixing the requisite primers with the remaining reactants in the reaction well. Therefore, in a single physical operation, i.e., assembling two reactant-containing arrays, hundreds of thousands of separate reactions are initiated and performed.
As an example of primer release, primers may be initially hybridized to array-immobilized polynucleotides and subsequently released by strand separation from the array-immobilized polynucleotides upon array assembly. In another example of primer release, one or more primers of polynucleotide amplification reactions may be covalently immobilized on an array via a cleavable site and released before, during, or after array assembly. For example, an array-immobilized moiety may contain a cleavable site and a primer sequence. The primer sequence may be released via selective cleavage of the cleavable sites before, during, or after assembly. Typically, the immobilized moiety may itself be a polynucleotide which contains one or more cleavable sites and one or more primer polynucleotides. A cleavable site may be introduced in an immobilized moiety during in situ synthesis. Alternatively, the immobilized moieties containing releasable sites may be prepared before they are covalently or noncovalently immobilized on the solid support.

A. Array fabrication Any suitable solid supports (also known as arrays, chips, etc.) may be used in the present invention. These materials include glass, silicon, quartz, nylon, polystyrene, polyethylene, polypropylene, polytetrafluorethylene, metal, among others.
These materials typically have a rigid or semi-rigid surface. In some embodiments, at least one surface of the material is substantially flat. In some embodiments, these materials may contain raised or depressed region, e.g., features such as wells, raised regions, etched trenches, etc. Typically, at least one solid support in the assembly is derivatized to provide covalent or noncovalent attachment to chemical or biological entities.
Typically, the density of derivatized sites on an array is between about 10-10,000 per cm2, preferably below about 5,000, 1,000, 400, 200, 100, or 60 per cm2. The area of each site may be about 1 x 10-3 to 5 mmz, preferably less than about 2, 1, 0.5, 0.2, or 0.1 mm2.
Typically, the total number of derivatized sites on an array is between about 1,000,000, preferably, between about 20-500,000, 20-100,000, 20-50,000, 20-10,000, 20-5,000, 20-1,000, or 20-500.
In preferred embodiments of the instant invention, surface tension arrays, which comprise patterned hydrophilic and hydrophobic sites, may be employed. A
surface tension array may contain large numbers of hydrophilic sites against a hydrophobic matrix. A hydrophilic site typically includes free amino, hydroxyl, carboxyl, thiol, amido, halo, or sulfonate group, as well as modified forms thereof, such as activated or protected forms. A hydrophobic site is typically inert to conditions of in situ synthesis.
For example, a hydrophobic site may include alkyl, fluoro group, as well as modified forms thereof, etc. In surface tension arrays, a hydrophilic site is spatially segregated from neighboring hydrophilic sites because of the hydrophobic sites between hydrophilic sites. This spatially addressable pattern enables the precise and reliable location of chemical or biological entities, such as molecules, cells, viruses, etc. The free amino, hydroxyl, carboxyl, thiol, amido, halo, or sulfonate group of the hydrophilic sites may then be covalently coupled with a linker moiety (e.g., polylysine, HEG, PEG, etc.) capable of supporting chemical and biological synthesis. The hydrophilic sites may also support non-covalent attachment to chemical or biological entities, such as molecules, cells, viruses, etc. Reagents delivered to the array are constrained by surface tension difference between hydrophilic and hydrophobic sites.
The surface tension array may also be appreciated from a thermodynamic perspective of wetting. Surface tension results from an imbalance of molecular forces in a liquid. At the surface of a liquid, the liquid molecules are attracted to each other and exert a net force pulling themselves together. High values of surface tension means that molecules tend to interact strongly. Lower values mean that molecules do not interact as strongly. Water has a very high value of surface tension because it has a high degree of hydrogen bonding. Organic molecules with polar groups such as hydroxyl, carboxyl or cyano have a slightly lower surface energy than water. Pure hydrocarbons are even lower, while fluorinated compounds are very low, because the fluorine atom does not share electrons very well so only dispersion interactions (entropy of mixing) occur.
Molecules in a liquid state experience strong intermolecular attractive forces.
These cohesive forces between liquid molecules are responsible for the phenomenon known as surface tension. Molecules at the surface of a liquid droplet do not have other like molecules, and as a consequence cohere more strongly with adjacent molecules which are directly associated them.
When the attractive forces are between unlike molecules, they are described as adhesive forces. The adhesive force between a water molecule and the wall of a glass capillary (i.e., the SiOH group) is stronger than the cohesive force between two water molecules at the surface. The effect of this imbalance between adhesion and cohesion is that the meniscus will turn upward and contribute to capillary action.
Conversely, for mercury, the cohesive force between two mercury atoms is stronger than the adhesive force between mercury and glass, and the meniscus turns down at the wall.
When a liquid is in contact with a solid surface, the contact angle 0 may be used to quantitatively measure the extent of this interaction.
Ysv - YsL = YLV cos 0 where Ysv is the surface free energy of the solid, YsL is the interfacial free energy between the solid and the liquid, Yrv is the surface free energy of the liquid.
When a droplet of liquid is in contact with a surface which is patterned into two regions which have different surface energies, then there is a net attraction of the liquid into the region of higher surface energy. The droplet may move, as a result of the difference in surface tension between the two regions.
In other words, polar liquids wet polar surfaces in preference to nonpolar surfaces. For a patterned array where the polar synthesis regions (hydrophilic sites) are separated by nonpolar regions (hydrophobic sites), droplets of liquid are confined to a particular synthesis site, and will not migrate to an adjacent site because of the surface tension difference imposed by the nonpolar mask.
For surface tension arrays, hydrophilic sites are derivarized sites.
Typically, the density of hydrophilic sites on an array is between about 10-10,000 per cm2, preferably below about 5,000, 1,000, 400, 200, 100, or 60 per cm2. The area of each hydrophilic site may be about 1 x 10'3 to 5 mm2, preferably less than about 2, l, 0.5, 0.2, or 0.1 mmz.
Typically, the total number of hydrophilic sites on an array is between about 1,000,000, preferably, between about 20-500,000, 20-100,000, 20-50,000, 20-10,000, 20-5,000, 20-1,000, or 20-500.
A number of methods for fabricating surface tension arrays have been described in U.S. Patent Nos. 5,985,551 and 5,474,796. One of such methods involves coating a solid surface with a photoresist substance and then using a generic photomask to define the array patterns by exposing them to light. The exposed surface may then be reacted with a suitable reagent to form a stable hydrophobic matrix. For example, fluoroalkylsilane or long chain alkylsilane, such as octadecylsilane, may be employed to form a hydrophobic matrix. The remaining photoresist substance may then be removed and the solid support may react with a suitable reagent, such as aminoalkyl silane or hydroxyalkyl silane, to form hydrophilic regions.
The solid support may also be first reacted with a suitable derivatizing reagent to form a hydrophobic surface. For example, the hydrophobic surface may be derivatized by vapor or liquid treatment of fluoroalkylsiloxane or alkylsilane. The hydrophobic surface may then be coated with a photoresist substance, photopatterned and developed.
The exposed hydrophobic surface may be reacted with suitable derivatizing reagents to form hydrophilic sites. For example, the exposed hydrophobic surface may be removed by wet or dry etch such as oxygen plasma and then derivatized by aminoalkylsilane or hydroxylalkylsilane treatment to form hydrophilic sites. The photoresist coat may be removed to expose the underlying hydrophobic sites. The hydrophilic sites may be further functionalized, if necessary, for anchoring in situ synthesis or for depositing chemical or biological entities.
Alternatively, the solid support may be first reacted with a suitable derivatizing reagent to form a hydrophilic surface. For example, the hydrophilic surface may be derivatized by vapor or liquid treatment of aminoalkylsilane or hydroxylalkylsilane. The derivatized surface may then be coated with a photoresist substance, photopatterned, and developed. The exposed surface may be reacted with suitable derivatizing reagents to form hydrophobic sites. For example, the hydrophobic sites may be formed by fluoroalkylsiloxane or alkylsilane treatment. The photoresist coat may be removed to expose the underlying hydrophilic sites. The hydrophilic sites may be further functionalized, if necessary, for anchoring in situ synthesis or for depositing chemical or biological entities.
Variations of these procedures may also be used to fabricate a solid support surface such that solution of reactants at a derivatized site is spatially separated from solution of reactants at other derivatized sites by surface tension. Separate reactions may be carried out at each derivatized site.
Photoresist substances are readily known to those of skill in the art. For example, an optical positive photoresist substance (e.g., AZ 1350 (NovolacTM type-Hoechst CelaneseTM) (Novolac~ is a proprietary novolak resin, which is the reaction product of phenols with formaldehyde in an acid condensation medium)) or an E-beam positive photoresist substance (e.g., EB-9 (polymethacrylate by HoyaTM)) can be used.
1 S Suitable hydrophilic and hydrophobic derivatizing reagents are also well known in the art. Preferably, fluoroalkylsilane or alkylsilane may be employed to form a hydrophobic surface and aminoalkyl silane or hydroxyalkyl silane may be used to form hydrophilic sites. As an example, a number of siloxane derivatizing reagents are listed below:
1. Hydroxyalkyl siloxanes (Silylate surface, functionalize with diborane, and to oxidize the alcohol) a. allyl trichlorochlorosilane --~--~ 3-hydroxypropyl b. 7-oct-1-enyl trichlorochlorosilane ~~ 8-hydroxyoctyl 2. Diol (bis-hydroxyalkyl) siloxanes (silylate surface, and hydrolyze to diol) a. glycidyl trimethoxysilane -~~ (2,3-dihydroxypropyloxy)propyl 3. Aminoalkyl siloxanes (amines require no intermediate functionalizing step) a. 3-aminopropyl trimethoxysilane -~ 3-aminopropyl 4. Dimeric secondary' aminoalkyl siloxanes a. bis (3-trimethoxysilylpropyl) amine ~ bis(silyloxylpropyl)amine Glass (polytetrasiloxane) is particularly suitable for surface tension arrays, because of the numerous techniques developed by the semiconductor industry using thick films (1-5 microns) of photoresists to generate masked patterns of exposed glass surfaces. After sufficient cleaning, such as by treatment with 02 radical (e.g., using an 02 plasma etch, ozone plasma treatment, etc. ) followed by acid wash, the glass surface may be derivatized with a suitable reagent to form a hydrophilic surface.
Suitable reagents may include aminoalkyl silane, hydroxyalkyl silane, among others. In particular, glass surface may be uniformly aminosilylated with an aminosilane, such as aminobutyldimethylmethoxysilane (DMABS). The derivatized surface may then be coated with a photoresist substance, soft-baked, photopatterned using a generic photomask to define the array patterns by exposing them to light, and developed. The underlying hydrophilic sites are thus exposed in the mask area and ready to be derivatized again to form hydrophobic sites, while the photoresist covering region protects the underlying hydrophilic sites from further derivatization.
Suitable reagents, such as fluoroalkylsilane or long chain alkylsilane, may be employed to form hydrophobic sites. For example, the exposed hydrophilic sites may be burned out with an 02 plasma etch. The exposed regions may then be fluorosilylated. Following the hydrophobic derivatization, the remaining photoresist can be removed, for example by dissolution in warm organic solvents such as methyl isobutyl ketone or N-methyl pyrrolidone (NMP), to expose the hydrophilic sites of the glass surface. For example, the remaining photoresist may be dissolved off with sonication in acetone and then washed off in hot NMP.
A number of organic polymers also have desirable characteristics for surface tension arrays. For example, Teflon (polytetrafluoroethylene) may be used.
Patterned derivatization of this type of material may be accomplished by reactive ion or plasma etching through a physical mask or using an electron beam, followed by reduction to surface hydroxymethyl groups. Polypropylene/polyethylene may be surface derivatized by gamma irradiation or chromic acid oxidation, and converted to hydroxy or aminomethylated surfaces. Highly crosslinked polystryene-divinylbenzene (ca.
50%) is non-swellable, and may be readily surface derivatized by chloromethlylation and subsequently converted to other functional groups. Nylon provides an initial surface of hexylamino groups, which are directly active. The hydrophobic patterning of these surfaces may be effected using the same type of solution based thin film masking techniques and gas phase derivatization as glass, or by direct photochemical patterning using o-nitrobenzylcarbonyl blocking groups. Perfluoroalkyl carboxylic and sulfonic acid derivatives are now used to provide the hydrophobic mask of the underlying surface. Subsequent to the patterning of these surfaces, suitable linker moieties may be coupled to the reactive group such as the hydroxy or amino group.

In addition to the use of photoresist in generating patterned hydrophilic and hydrophobic sites, surface tension arrays may be fabricated without the use of photoresist. For example, a solid support may be first reacted with a reagent to form hydrophilic sites. The hydrophilic sites may then be reacted in selected areas. The remaining hydrophilic sites may then be reacted with a reagent to form hydrophobic sites. The protected hydrophilic sites may then be deprotected to anchor in situ synthesis or to deposit chemical or biological entities. For example, a glass surface may be first reacted with a reagent to generate free hydroxyl or amino sites. These hydrophilic sites may be reacted with a protected nucleoside coupling reagent or a linker to protect selected hydroxyl or amino sites. A protected nucleotide coupling reagent includes, for example, a DMT-protected nucleoside phosphoramidite, DMT-protected H-phosphonate, etc. A linker may be of six or more atoms in length. The unprotected hydroxyl or amino sites may then be reacted with a reagent, for example, perfluoroalkanoyl halide, to form hydrophobic sites inert to in situ polynucleotide synthesis. The protected hydrophilic sites may be deprotected to anchor in situ polynucleotide synthesis.
Variations of these procedures may also be used to fabricate a solid support surface such that solution of chemical or biological entities at a derivatized site is spatially separated from solutions of chemical or biological entities at other derivatized sites.
In addition to surface tension array, many other examples of arrays and fabrication methods are well known to those skilled in the art (e.g., Green et al., Curr.Opin. in Chem. Biol. 2:404-410 (1998), Gerhold et al., TIBS, 24:168-173 (1999), U.S. Patent Nos. 6,090,995, 6,030,782, 5,700,637, 6,054,270, 5,919,626, 5,858,653, 5,837,832, 5,744,305, 5,445,934, W099/58708, Singh-Gasson et al., Nature Biotechnology 17:974-978 (1999), and http://www.arrayit.com, all incorporated herein by reference). They include, for example, fiber optic arrays, microelectrode arrays, digital micromirror arrays, etc.
B. Covalent or noncovalent immobilization of reactants on arrays One of skill in the art will appreciate that there are many ways of immobilizing chemical or biological moieties directly on an array (covalently or noncovalently), anchoring them to a linker moiety, or tethering them to an immobilized moiety.
These methods are well taught in the field of solid phase synthesis and micro-arrays (Protocols for oligonucleotides and analogs; synthesis and properties, Methods Mol. Biol.
Vol. 20 (1993), Beier et al., Nucleic Acids Res. 27:1970-1977 (1999), Joos et al., Anal. Chem.
247:96-101 (1997), Guschin et al., Anal. Biochem. 250:203-211 (1997), U.S.
Patent Nos.

5,700,642 and 5,830,655, Czarnik et al., Accounts Chem. Rev. 29:112-170 (1996), Combinatorial Chemistry and Molecular Diversity in Drug Discovery, Ed. Kerwin J.F.
and Gordon, E.M., John Wiley & Son, New York (1997); Kahn et al., Modern Methods in Carbohydrate Synthesis, Harwood Academic, Amsterdam ( 1996), Green et al. , Curr.Opin. in Chem. Biol. 2:404-410 (1998), Gerhold et al., TIBS, 24:168-173 (1999), U.S. Patent Nos. 6,090,995, 6,083,763, 6,030,782, 5,700,637, 6,054,270, 5,919,626, 5,858,653, 5,837,832, 5,744,305, 5,445,934, W099/58708, DeRisi, J., et al., Science 278:680-686 (1997), Lockhart et al., Nature 405:827-836 (2000), Roberts et al., Science 287:873-880 (2000), Hughes et al., Nature Genetics 25:333-337 (2000), Hughes et al., Cell 102:109-126 (2000), Duggan, et al., Nature Genetics Supplement 21:10-14 (1999), Singh-Gasson et al., Nature Biotechnology 17:974-978 (1999), and htt~p://www.arra~t.com, all incorporated herein by reference). Exemplary chemical moieties for immobilization attachment to solid support include carbamate, ester, amide, thiolester, (N)-functionalized thiourea, functionalized maleimide, amino, disulfide, amide, hydrazone, streptavidin or avidin/biotin, and gold-sulfide, among others. The immobilization methods generally fall into one of the two categories: spotting of presynthesized reactants and in situ synthesis of reactants.
In the first category, preprepared reactants are deposited onto known finite areas on an array. For example, traditional solid phase polynucleotide synthesis on controlled-pore glass (CPG) may also be employed and then simply printing presynthesized polynucleotides onto the array using direct touch or fine micropipetting.
Polynucleotides may be synthesized on an automated DNA synthesizer, for example, on an Applied Biosystems synthesizer using 5-dimethoxytritylnucleoside (3-cyanoethyl phosphoramidites. Synthesis of relatively long polynucleotide sequences may be achieved by PCR-based and/or enzymatic methods for economical advantages.
Polynucleotides may be purified by gel electrophoresis, HPLC, or other suitable methods known in the art before spotted or deposited on the solid support. Typical non-covalent linkages may include electrostatic interactions, ligand-protein interactions (e.g., biotin/streptavidin or avidin interaction), and base-specific hydrogen bonding (e.g., complementary base pairs), among others. Solid supports may be overlaid with a positively charges coating, such as amino silane or polylysine and presynthesized polynucleotides are then printed directly onto the solid surface.
In addition, presynthesized compounds, such as polypeptides, polynucleotides, polysaccharides, or small molecule libraries, may be obtained commercially, such as from Integrated DNA Technologies, ArQule (http://www.arqule.com~, Chembridge (http://www.chembridge.com~, and Combichem (htt~p://www.combichem.con~. These presynthesized compounds may be covalently or non-covalently attached to the array surface.
Methods are also available to immobilize cells or proteins on solid supports (Mrksich et al., Ann. Rev. Biophys. Biomol. Struct. 25:55-78 (1996), US Patent Nos.
5989835 and 6,103,479, WO 97/45730, W098/38490, WO00/50872, WO00/26408, WO00/17643, WO00/17624, W00003246). In particular, Mrkisch et al. (Proc. Natl.
Acad. Sci. USA 93:10775-8 ( 1996), all incorporated herein by reference) describe a method for attaching cells on gold with self assembled monolayers of alkanethiolates.
Singhvi et al. (Science 264:696-698 (1994)) describe a method for placing cells on predetermined locations of an array and controlling cell shape.
Printing may be accomplished by direct surface contact between the printing reagents and a delivery mechanism. The delivery mechanism may contain the use of tweezers, pins or capillaries, among others that serve to transfer reactants or reagents to the surface. A variation of this simple printing approach is the use of controlled electric fields to immobilize prefabricated charged reactants to microelectrodes on the array (e.g.
U.5. Patent No. 5,929,208 and WO 99/06593, both incorporated herein by reference).
For example, biotinylated polynucleotide probes may be directed to individual spots by polarizing the charge at that spot and then anchored in place via a steptavidin-containing permeation layer that covers the surface (Sosnowski et al., Proc. Natl. Acad.
Sci.
94:1119-1123 (1997) and Edman et al., Nucleic Acid. Res. 25:4907-4914 (1997), both incorporated herein by reference). Print may also be accomplished without the direct contact with the solid support, such as using the "drop-on-demand" method described below. Some of the advantages of spotting technologies include ease of prototyping and therefore rapid implementation, low cost and versatility.
In the second category, reactants are prepared by in situ synthesis on the array. In situ synthesis maybe performed on derivatized sites. Derivatized sites thus become in situ synthesis sites. Typically, the density of in situ synthesis sites on an array is between about 10-10,000 per cm2, preferably below about 5,000, 1,000, 400, 200, 100, or 60 per cm2. The area of each in situ synthesis site may be about 1 x 10'3 to 5 mm2, preferably less than about 2, 1, 0.5, 0.2, or 0.1 mm2. Typically, the total number of in situ synthesis sites on an array is between about 20-1,000,000, preferably, between about 20-500,000, 20-100,000, 20-50,000, 20-10,000, 20-5,000, 20-1,000, or 20-500.

Small molecules may be prepared on the array using standard solid phase organic synthesis methods. Biopolymers such as polynucleotides, polypeptides, and polysaccharides may be synthesized from biochemical building blocks such as nucleotides, amino acids, and monosaccharides in a step-wise fashion. With each round of synthesis, these building blocks are added to growing chains until the desired sequence and length are achieved in each spot. In general, in situ biopolymer synthesis on an array may be achieved by two general approaches. First, photolithography may be used to fabricate biopolymers on the array. In the case of polynucleotides, a mercury lamp may be shone through a photolithograhic mask onto the array surface, which removes a photoactive group, resulting in a 5' hydroxy group capable of reacting with another nucleoside. The mask therefore predetermines which nucleotides are activated.
Successive rounds of deprotection and chemistry result in polynucleotides with increasing length. This method is disclosed in, e.g., U.S. Patent Nos.
5,143,854, 5,489,678, 5,412,087, 5,744,305, 5,889,165, and 5,571,639, all incorporated herein by reference.
The second approach is the "drop-on-demand" method, which uses technology analogous to that employed in ink jet printers (U.5. Patent Nos. 5,985,551, 5,474,796, 5,700,637, 6,054,270, 6,028,189, 5,927,547, WO 98/41531, Blanchard et al., Biosensors and Bioelectronics 11:687-690 (1996), Schena et al., TIBTECH 16:301-306 (1998), Green et al., Curr. Opin. Chem. Biol. 2:404-410 (1998), and Singh-Gasson, et al., Nat.
Biotech. 17:974-978 (1999), all incorporated herein by reference). This approach typically utilizes piezoelectric or other forms of propulsion to transfer reagents from miniature nozzles to solid surfaces. For example, the printer head travels across the array, and at each spot, electric field contracts, forcing a microdroplet of reagents onto the array surface. Following washing and deprotection, the next cycle of biopolymer synthesis is carried out. In the case of polynucleotides, the step yields in piezoelectric printing method typically equal to, and even exceed, traditional CPG
polynucleotide synthesis. The drop-on-demand technology allows high-density gridding of virtually any reagents of interest. It is also easier using this method to take advantage of the extensive chemistries already developed for biopolymer and small molecule synthesis, for example, flexibility in sequence designs, synthesis of polynucleotide analogs, synthesis in the 5'-3' direction, etc. Because ink jet technology does not require direct surface contact, piezoelectric delivery is amendable to very high throughput. An average step yields near or above about 98% in in situ polynucleotide synthesis may be obtained.

Similar methods of reagent delivery using a tip of a spring probe are described in WO
99/05308, incorporated herein by reference.
In preferred embodiments, a piezoelectric pump may be used to add reagents to the in situ synthesis of primer-containing moieties on arrays. The design, construction, S and mechanism of a piezoelctric pump are described in U.S. Patent No.
4,747,796. The piezoelectric pump may deliver minute droplets of liquid to a surface in a very precise manner. The pump design is similar to the pumps used in ink jet printing. The picopump is capable of producing 50 micron or 65 picoliter droplets at up to 10,000 Hz and can accurately hit a 250 micron target at a distance of 2 cm.
Methods for solid phase synthesis of large combinatorial peptide libraries have been described in the literature (Merrifield, Science 232:342-347 (1986), Atherton et al., Solid Phase Peptide Synthesis, IRL press, London (1989), Albericio et al., Methods Enzymol. 289:313-316 (1997), and U.S. Patent Nos. 5,614,608 and 5,679,773, all incorporated herein by reference). Typically, a growing polypeptide chain is covalently anchored to a solid support and amino acids are added to the support-bound growing chain in a stepwise fashion. In order to prevent unwanted polymerization of the monomeric amino acid under the reaction conditions, protection of the N-terminus of the amino acid and a-amino group using blocking groups, such as tert-butyloxycarbonyl (Boc), fluorenylmethyloxycarbonyl (Fmoc) and the like, is necessary. After the monomer is coupled to the end of the polypeptide, the N-terminal protecting group is removed, and another amino acid is coupled to the chain. This cycle of coupling and deprotecting is continued for each amino acid until the desired length is reached.
Photoremovable protecting group may be used to allow removal of selected portion of the solid support, via patterned irradiation, during the deprotection cycle of the solid phase synthesis (Fodor, et al., Science 251:767-773 (1991) and U.S. Patent Nos.
5,143,854, 5,489,678, and 5,744,305, all incorporated herein by reference.) This selectively allows spatial control of the synthesis and the next amino acid is coupled to the irradiated areas. In addition to standard solid phase peptide synthesis, PCT
publication WO 99/06834, incorporated herein by reference, describes a method for immobilizing a diverse population of antibodies to a solid support.
Libraries of carbohydrate compounds may also be prepared on a solid support (Ito et al., Curr. Opin. Chem. Biol. 2:701-708 (1998), incorporated herein by reference).
In solid-phase polysaccharide synthesis, elongation of a carbohydrate compounds generally consists of two steps: coupling of the glycosyl acceptor with the glycosyl donor, and selective deprotection of a temporary protecting group to liberate the free hydroxyl group that will be subjected to the next coupling with a glycosyl donor. At the final stage of polysaccharide synthesis, all protecting groups are removed.
The first carbohydrate residue is typically attached to the solid support via a linker molecule and the residual hydroxyl groups are capped after each step. Stable nonclassical glycosyl donors may be utilized and they may be activated under specific conditions (Toshima et al., Chem. Rev. 93:1503-1531 (1993), incorporated herein by reference).
Sulfoxide methods developped by Kahn et al. may be used for stereoselective glycosylation of alcohol group (Yan et al., J. Am. Chem. Soc. 116:6953-6954 (1994), incorporated herein by reference). Trichoroacetimidate, thioglycoside, n-pentenyl glycoside are also amendable to solid phase synthesis (Rademann et al., J. Org. Chem. 62:3650-(1997), Heckel et al., Synlett 171-173 (1998), Nicolaou et al., J. Am. Chem.
Soc.
119:449-450 (1998), Rodebaugh et al., J. Org. Chem. 62:5660-5661 (1997), Danishefsky et al., Science 260:1307-1309 (1993); and Zheng et al., J. Org. Chem. 63:1126-(1998), all incorporated herein by reference). In addition, PCT publication 98/22487, incorporated herein by reference, describes methods for synthesizing very large collections of diverse thiosaccharide derivatives attached to a solid support.
U.S. Patent No. 5,846,943 and PCT publication WO 98/21221, incorporated herein by reference, describe novel solid support matrices having toxin-binding polysaccharide covalently attached to a solid support through a linker arm. In addition to chemical synthesis, enzymatic synthesis of polysaccharides, such as glycosyltransferase-catalyzed glycosylation, has also been proved feasible (Shuster et al., J. Am. Chem.
Soc. 116:1135-1136 (1994), Yamada et al., Tetrahedron Lett. 36:9493-9496 (1995), and Blixt et al., J.
Org. Chem. 63:2705-2710 (1998), all incorporated herein by reference).
Chemical synthesis of glycopeptide may also be carried out on a solid support (Meldal et al. Curr. Opin. Chem. Biol. 1:552-563 (1997) and Kihlberg et al., Methods Ertzymol. 289:221-245 (1997), both incorporated herein by reference).
Frequently, glycosylated amino acids are used as building blocks (Gururaja et al., Lett Pept. Sci.
3:79-88 (1996); Mcdevitt et al. J. Am. Chem. Soc. 118:3818-3828 (1996), and Paulsen et al., J. Chem. Perkin Trans 1:281-293 (1997), all incorporated herein by reference).
The synthesis of small organic compounds on a solid support is also well known in the art of solid phase organic synthesis (Gordon et al., .I. Med. Chem.
37:1385-1401 (1994); Lowe, Acc. Chem. Res. 24:309-317 (1995), Fruchtel, Angew. Chem. Int.
Ed.
Engl. 35:17-42 (1996), Hermkens et al., Tetrahedron 52:4527-4554 (1996), Thompson et al., Chem. Rev. 96:555-600 (1996), and Andres, et al., Curr. Opin. Chem. Biol.
2:353-362 (1998), all incorporated herein by reference). In particular, PCT
publication W099/09073, incorporated by reference, describes methods of carrying out organic chemistry on solid supports comprising derivatized functionalities and methods for synthesizing compounds comprising amine group or N-containing heterocycles using functionalized solid support. U.S. Patent No. 5,545,568, incorporated herein by reference, describes a general methodology for synthesizing combinatorial libraries of various nonpolymeric compounds on solid supports, such as benzodiazepine, prostaglandins, ~3-turn mimetics and glycerol-derived drugs. PCT publication WO
97/35198, incorporated herein by reference, describes methods for synthesizing spatially-dispersed and positionally-encoded combinatorial chemistry libraries of oligomers. The position of each solid support in each array determines the exact identity of the oligomers. This method is very useful for the synthesis of a peptide library and a non-peptide, low molecular weight organic compound libraries. PCT publication WO
98/46247, incorporated herein by reference, describes a method for immobilizing immunosupressive agent, such as cyclosporin analogs on a solid support. PCT
publication WO 99/21957, incorporated herein by reference, discloses methods for generating libraries of organometallic catalysts on solid support.
C. Immobilization of reactants with releasable sites In some embodiments of the instant invention, reactants may be first immobilized on an array and subsequently released prior to, during, or after array assembly. For example, reactants may be delivered via selective cleavage of a cleavable site on an array-immobilized moiety. A releasable site may be introduced in immobilized moieties using standard nucleic acid, peptide, carbohydrate, lipid, or organic chemistry known to one of skill in the art. The release methods may include a variety of enzymatic, or non enzymatic means, such as chemical, thermal, or photolytic treatment.
In the case of polynucleotides, the synthesis of many modified polynucleotides containing cleavable sites is well known in the art of polynucleotide synthesis (Verma et al., Annu. Rev. Biochem. 67:99-134 (1998), Venkatesan et al. J. of Org. Chem., 61:525-529 (1996), Kahl et al., J. of Org. Chem., 64:507-510 (1999), and Kahl et al., J. of Org.
Chem. 63:4870-4871 (1998), and U.S. Patent Nos. 5,739,386, 5,700,642 and 5,830,655, all incorporated herein by reference). The cleavage methods may include a variety of enzymatic, or non-enzymatic means, such as chemical, thermal, photolytic cleavage, or a combination thereof. The cleavable site may be cleaved prior to, during, or after assembling two arrays. The cleavable site may be located along the polynucleotide backbone, for example, a modified 3'-5' internucleotide linkage in place of one of the phosphodiester groups, such as ribose, dialkoxysilane, phosphorothioate, and phosphoramidate internucleotide linkage. The cleavable polynucleotide analogs may also include a substituent on or replacement of one of the bases or sugars, such as 7-deazaguanosine, 5-methylcytosine, inosine, uridine, and the like. Typically, primers cleaved from the immobilized moieties are capable of hydrogen bonding in a sequence-specific manner and are capable of extending polynucleotide synthesis in amplification reactions. Preferably, the primer polynucleotides cleaved from the immobilized moieties contain a free 3'-OH end. The free 3'-OH end may also be obtained by chemical or enzymatic treatment, following the release of primer polynucleotides.
In some instances, the single stranded immobilized polynucleotides may be converted to a double-stranded immobilized polynucleotides, e.g., to load releasable primers, to incorporate double-stranded enzyme recognition site. There are many ways to prepare double-stranded polynucleotide arrays. One method is simply adding polynuleotides containing complementary sequences or subsequences with respect to the array-immobilized polynucleotides. Another method of preparation is by incorporating hairpin domain in the single-stranded polynucleotides known to those skilled in the art.
Another method of preparation is simply using primers, polymerise, and dNTPs to make double stranded polynucleotide array. Another method is by hybridizing the single-stranded immobilized polynucleotide with a double-stranded polynucleotide containing a complementary single-stranded end, followed by treatment with DNA ligase, which results in double-stranded polynucleotides. This method is described in DeR.isi et al., Science 278:680-686 (1997) and Braun et al., Nature 391:775-778 (1998), both incorporated herein by reference. Another method of preparing double-stranded polynucleotide arrays by synthesizing a constant sequence at every position on an array and then annealing and enzymatically extending a complementary primer is described in PCT publication WO 99/07888 and Bulyk et al. Nature Biotechnology, 17:573-577 ( 1999), both incorporated herein by reference.
In one embodiment, cleavable sites contained within the modified polynucleotide may include chemically cleavable groups, such as dialkoxysilane, 3'-(S)-phosphorothioate, 5'-(S)-phosphorothioate, 3'-(N)-phosphoramidate, 5'-(N)-phosphoramidate, and ribose. Synthesis and cleavage conditions of chemically cleavable polynucleotides are described in U.S. Patent Nos. 5,700,642 and 5,830,655, both incorporated herein by reference. For example, depending upon the choice of cleavable site to be introduced, either a functionalized nucleoside or a modified nucleoside dimer may be first prepared, and then selectively introduced into a growing polynucleotide fragment during the course of polynucleotide synthesis. Selective cleavage of the dialkoxysilane may be effected by treatment with fluoride ion.
Phosphorothioate internucleotide linkage may be selectively cleaved under mild oxidative conditions.
Selective cleavage of the phosphoramidate bond may be carried out under mild acid conditions, such as 80% acetic acid. Selective cleavage of ribose may be carried out by treatment with dilute ammonium hydroxide. Preferably, the primer polynucleotides cleaved from the immobilized moieties contain a free 3'-OH end. The free 3'-OH
end may also be obtained by chemical or enzymatic .treatment, following the release of primer polynucleotides.
In another embodiment, cleavable sites contained within the modified polynucleotide may include nucleotides cleavable by an enzyme such as nucleases, glycosylases, among others. A wide range of polynucleotide bases may be removed by DNA glycosylases, which cleaves the N-glycosylic bond between the base and deoxyribose, thus leaving an abasic site (for a recent review, see Krokan et.
al., Biochem.
J. 325:1-16 (1997), incorporated herein by reference). The abasic site in a polynucleotide may then be cleaved by Endonuclease IV, leaving a free 3'-OH
end.
Suitable DNA glycosylases may include uracil-DNA glycosylases, G/T(U) mismatch DNA glycosylases, alkylbase-DNA glycosylases, 5-methylcytosine DNA
glycosylases, adenine-specific mismatch-DNA glycosylases, oxidized pyrimidine-specific DNA
glycosylases, oxidized purine-specific DNA glycosylases, EndoVIII, EndoIX, hydroxymethyl DNA glycosylases, formyluracil-DNA glycosylases, pyrimidine-dimer DNA glycosylases, among others. Cleavable base analogs that are readily available synthetically are preferred and modified bases that do not preventing base pairing are also preferred. In preferred embodiments, a uracil may be synthetically incorporated in a polynucletide to replace a thymine, where the uracil is the cleavage site and site-specifically removed by treatment with uracil DNA glycosylase. The uracil DNA
glycosylases may be from viral or plant sources. The abasic site on the polynucleotide strand may then be cleaved by E. coli Endonuclease IV.
In another embodiment, the cleavable site is a restriction endonuclease cleavable site, such as class Its restriction enzymes. For example, BpmI, BsgI, BseRI, BsmFI, and FokI recognition sequence may be incorporated in the immobilized polynucleotides and subsequently cleaved to release primer polynucleotides. In another embodiment, the cleavable site may be a nucleotide or series of nucleotides capable of blocking or terminating 5' to 3' enzyme-promoted digestion by an enzyme having S' to 3' exonuclease activity, such as T7 Gene 6 Exonuclease, Exo VIII, Rec J, and spleen phosphodiesterase II. Blocking nucleotides include peptide nucleic acids and nucleotides containing a phosphorothioate or borano-phosphate group (U.S. Patent Nos. 5,700,642 and 5,830,655, both incorporated herein by reference).
In preferred embodiments, the cleavable site within an immobilized polynucleotide may include a photocleavable linker, such as ortho-nitrobenzyl class of photocleavable linkers. Synthesis and cleavage conditions of certain photolabile polynucleotides on solid support are described in Rich et al., J. C. S. Chem.
Comm. 610-611 (1973), Venkatesan et al. J. of Org. Chem. 61:525-529 (1996), Kahl et al., J. of Org.
Chem. 64:507-510 (1999), Kahl et al., J. of Org. Chem. -63:4870-4871 (1998), Greenberg et al., J. of Org. Chem. 59:746-753 (1994), McMinn et al., Tetrahedron 52:3827-(1996), Greenberg, Tetrahedron Lett. 34:251-254 (1993), Yoo et al., J. of Org.
Chem.
60:3358-3364 (1995), Greenberg, Tetrahedron 51:29-38 (1995), McMinn et al., J.
of Org. Chem. 62:7074-7075 (1997), Holmes et al., J. of Org. Chem. 60:2318-2319 (1995), Holmes et al., J. of Org. Chem. 62:2370-2380 (1997), and U.S. Patent No.
5,739,386 and 5,917,016, all incorporated by reference. Certain ortho-nitobenzyl-based linkers may also be obtained commercially. For example, hydroxymethyl, hydroxyethyl, and Fmoc-aminoethyl carboxylic acid linkers are available from Novabiochem (http://www.nova.ch). The DMT-protected o-nitrobenzyl on a solid support may also be obtained commercially (e.g., from Glen Research, http://www.~lenres.com). For coupling photolabile linkers to hydrophilic/hydrophobic arrays, reaction of the photolabile linker with a primary amine on the array surface may be achieved using standard peptide coupling reagents.
In general, a surface immobilized photocleavable linker may have the formula of S-B-L where S is a solid support, B is a bond or a derivatizing group, and L
is a photocleavable linking group having the formula:

~CH2)m- O ~ ~ R3 Ra where, R1 is hydrogen, C1 -C8 alkyl, aryl or arylalkyl; R3, Ra and RS are each independently hydrogen, C1 -C8 alkyl, or CI -Cg alkoxy; R2 is halogen, -SH, -SP, -OH, -NH2, -OP or -NHP, wherein P is a suitable protecting or activating group; and n is 0 or 1 and m is an integer of from 1 to 10. This class of photocleavable linkers may be coupled to the synthesis of a variety of biopolymers such as polynucleotides and polypeptides.
In some embodiments of the invention, nonphotolabile analogue of the photolabile group, such as veratryl alcohol, may be doped in the synthesis of photocleavable immobilized polynucleotide, thus creating a heterogeneous mixture of photocleavable and nonphotocleavable immobilized polynucleotides at a finite area on the surface of an array. By varying the ratio of the amount of cleavable and non-cleavable linker, the relative molar quantities of the cleaved and surface bound polynucleotides may be optimized for capturing the amplification products of amplification reactions, and for polynucleotide elongation of the complexes between the surface bound noncleavable polynucleotides and the captured amplification products.
For immobilized polypeptide in solid phase synthesis, simultaneous deprotection of the side-chain groups and the cleavage of peptide from the solid support may be achieved by treatment with a hard acid, such as hydrogen fluoride (HF), trifluoromethanesulfonic acid (TFMSA), or trifluoromethanesulfonic acidtrimethylsilyl ester (TMSOTf) (Steward, Methods in Enzymol. 289:29-44 (1997), incorporated herein by referece). In addition to production of free polypeptides by acidolysis, a peptide amide may be produced by treatment with ammonia and amines. Polypeptide may also be reduced to alcohols by treating with LiBHa in THF. Sequence specific cleavage of polypeptides or modifications thereof may be carried out using suitable enzymes, such as proteases, known in the art. In addition, phenacyl based or ortho-nitrobenzyl based linking group may also be used as a photocleavable linker to couple peptides to solid support (Wang, J. Org. Chem. 41-3258 (1976), Rich et al., J. Am. Chem. Soc.
97:1575-1579 (1975), Hammer et al., Int. J. Peptide Protein Res. 36:31-45 (1990), U.S.
Patent Nos. 5,739,386 and 5,917,016). Photolysis offers a mild method of cleavage which complements traditional acidic or basic cleavage techniques (see, e.g., Lloyd-Williams et al., Tetrahedron 49:11065-11133 (1993)). Photocleavage ofpeptide ligands from solid supports for screening enzyme inhibitors has also been reported (Schullek et al., Anal.
Biochem. 246:20-29 (1997)).
For immobilized polysaccharides, linker groups typically have enough stability to withstand glycosylation reaction conditions, while being able to undergo cleavage in mild conditions without affecting the polysaccharide backbone structure and protecting groups. Photolabile linkers, described in Nicolaou et al., supra and Rodebaugh et al., supra, may be used. A silyl ether may be removed by a fluoride ion (Danishefsky, et al., supra) and a thioglycoside-like linker may be cleaved under various thiophilic conditions (Yin et al., supra). In addition, base-labile linkers, such as 9-fluoroenylmethoxycarbonyl-type and succinate type may be cleavable with triethylamine and aqueous ammonia, respectively (Adinolfi et al., Tetrahedron Lett. 37:5007-(1996) and Wang et al., Chem. Lett. 273-274 (1995), both incorporated herein by reference).
III. Carrying out lar,~e numbers of reactions using array assembly One of skill in the art will appreciate that all non-unimolecular reactions, which require two or more reactants are compatible with the present method and apparatus. In preferred embodiments of the instant invention, a myriad of chemical and biological reactions may be carried out using the instant method and apparatus. These reactions may involve cells, viruses, nucleic acids, proteins, carbohydrates, lipids, or small molecules. These reactions may be polynucleotide amplification reactions, or molecular binding interactions, such as, protein-DNA, nucleic acid hybridization, inhibitor-enzyme, receptor-antagonist, drug-DNA, antibody-antigen, toxin-carbohydrate, receptor-glycoprotein binding reactions, among others.
A. Polynucleotide amplification reactions A large variety of polynucleotide amplification reactions known to those skilled in the art may be suitable for the instant invention. The most common form of polynucleotide amplification reaction, such as a PCR reaction, is typically carried out by placing a mixture of target nucleic acid sequence, deoxynucleotide triphosphates, buffer, two primers, and DNA polymerise in a thermocycler which cycles between temperatures for denaturation, annealing, and extension (PCR Technology: Principles and Applications for DNA Amplification (ed. H.A. Erlich, Freeman Press, NY, NY, 1992), PCR Protocols: A Guide to Methods and Applications (eds. Innis, et al., Academic Press, San Diego, CA, 1990), Mattila et al., Nucleic Acids Res. 19:4967 (1991), Eckert et al., PCR Methods and Applications 1, 17 (1991), PCR A Practical Approach and A Fractional Approach (eds. McPherson et al., Oxford University Press, Oxford, and 1995), all incorporated by reference). The selection of primers defines the region to be amplified. The polymerase used to direct the nucleotide synthesis may include, for example, E. coli DNA polymerase I, Klenow fragment of E. coli DNA polymerase, polymerise muteins, heat-stable enzymes, such as Taq polymerise, Vent polymerise, and the like. For a reverse-transcriptase-PCR, enzyme such as reverse transcriptase may be used.
With the aid of arrays, large numbers of PCR reactions may be performed in parallel by confining selected PCR reactants to definite areas on two arrays, bringing two arrays into apposition, and allowing reactants on two arrays to merge and triggering PCR
reactions. In preferred embodiments of the instant invention, One or more primers of the PCR reaction may also be first hybridized to immobilized moieties on defined areas of a first array surface and subsequently released by strand separation. One or more primers of the PCR reaction may be first immobilized on defined areas of an array surface via a cleavable site and subsequently released upon array assembly. The covalent array immobilization site may either be at the 5' end of the polynucleotide (or the 3' distal and 5' proximal orientation) or at the 3'end of the primer polynucleotide (or the 3' proximal and 5' distal orientation). In some instances, the array immobilization site may be within the polynucleotide (i. e. at a site other than the 5' or 3' end of the polynucleotide). The array-immobilized and primer-containing moieties typically have lengths ranging from about 5 to 100 nucleotides, preferably between about 10 to 50 nucleotides, more preferably between about 10 to 30 nucleotides.
The remaining reactants of the PCR reaction may be confined to defined areas or reaction wells on the surface of another array. The combination of two groups of reactants is achieved by bringing two arrays into close proximity and allowing the merge of reactants on two arrays. The primers of the PCR reaction may be released chemically, enzymatically, or photolytically before, during, or after assembling two arrays.
Following the primer release, the PCR reactions may be performed according to known protocols in the art. Typically, the temperature may be raised to separate the double-stranded target nucleic acid to form the single-stranded templates for amplification. The temperature may then be lowered to generate the primed templates for DNA polymerise. The temperature may again be raised to promote polynucleotide synthesis, and the cycle of strand separation, annealing of primers, and synthesis is repeated for about as many as 30-60 cycles.
One of skill in the art will appreciate that many other polynucleotide amplification reactions may also be carried out using the instant method and apparatus.
For reviews, see Isaksson and Landegren, Curr. Opin. Biotechnol. 10:11-15 (1999), Landegren, Curr. Opin. Biotechnol. 7:95-97 ( 1996), and Abramson et al., Curr.
Opin.
Biotechnol. 4:41-47 (1993), all incorporated herein by reference. Typically, amplification of either or both strand of the target nucleic acid comprises the use of one or more nucleic acid-modifying enzymes, such as a DNA polymerise, a ligase, an RNA
polymerise, or an RNA-dependent reverse transcriptase. For example, polynucleotide amplification reactions may include self sustained sequence replication (35R) (Muller et al., Histochem. Cell Biol. 108:431-437 (1997), incorporated herein by reference), nucleic acid sequence-based amplification (NASBA) (Malek et al., Methods Mol. Biol.
28:253-260 (1994), incorporated herein by reference), strand displacement activation (SDA) (Walker, PCR Methods Appl. 3:1-6 (1993), incorporated herein by reference), ligase chain reaction (LCR) (Wu et al., Genomics 4:560 (1989), Landegren et al., Science 241:1077 (1988), Abravaya et al., Nucleic Acids Res. 23:675-682 (1995), and Wiedmann et al., PCR Methods Appl. 3:551-64 (1994), all incorporated herein by reference), and Q~i replicase system (Burg et al., Anal. Biochem. 230:263-272 (1995), incorporated herein by reference), among others. Depending on the target nucleic acid and its concentration, polynucleotide amplification reactions may either exhibit solution or solid phase reaction profile.
B. Coupling_of polynucleotide amplification reactions and sequence variation detections The present invention may be used to couple the amplification and detection procedures, thus providing an environment for simultaneously carrying out thousands of amplification reactions followed by simultaneous detection of thousands of amplified products on the array assembly. This coupling of amplification reactions and sequencing reactions simplifies the detection procedure and streamlines the methods of amplification and sequencing. Array assembly is a faster and cost-effective method for amplification and sequencing, which is amendable to high throughput applications.

In some embodiments of the instant invention, the amplification products generated in polynucleotide amplification reactions may be captured by immobilized polynucleotide interrogation probes or non-cleavable moieties on either the first or the second array. The capture may be accomplished by hybridizing amplification products with immobilized interrogation probes. For example, a fraction of immobilized polynucleotides may contain non-cleavable polynucleotides designed for capturing amplification products, while another fraction of immobilized polynucleotides confined in the same area of the array may contain cleavable polynucleotides designed for delivering amplification primers during the assembly of two arrays. It is also possible to immobilize non-cleavable moiety at a different area than the primer-containing cleavable immobilized moiety for capturing amplified products. Therefore, when amplification reactions are completed between two arrays and the arrays are pulled apart, each strand of the amplified products may be separated as each strand forms different hybridization complexes between non-cleavable polynucleotides remain immobilized on an array. It is also possible to carry out amplifications that result in an excess of one strand of the amplification products by varying primer concentrations. In this case, single stranded amplification products may also be captured by non-cleavable polynucleotides immobilized on an array.
After the amplified products of a target nucleic acid are captured, they may be directly or indirectly used in detecting polynucleotide sequence variations.
Strategies for identification and detection of polynucleotide sequence variations are known in the art (Nelson, Crit. Rev. Clin. Lab. Sci. 35:369-414 (1998), Landegren et al., Genome Res.
8:769-776 (1998), Syvanen, Human Mutation 13:1-10 (1999), U.S. Patent Nos.
6,001,567, 5,985,557, 5,888,819, 5,650,277, 5,710,028, 5,858,659, and 5,871,928, and PCT applications WO 99/27137, 98/54362, 98/56954, 98/38846, 99/14228, 98/30883, and 99/37812, all incorporated herein by reference).
In general, the identification of a sequence variation may be separated into two categories. In one category, the sequence variants may be distinguished by hybridization. This method employs immobilized sequence-specific polynucleotide probes. A single mismatch in a hybridization complex formed between amplification product and probes may cause a significant change in the signals detected. In a typical approach, a series of probes of known sequence and of similar length, each with one of the four different bases at a given location near the center position are affixed to the array surface.

In the second category, the sequence variants may be determined using polynucleotide modifying enzymes. The polynucleotide modifying enzymes include DNA polymerases, DNA ligase, nuclease, and restriction enzymes, among others.
For example, in a minisequencing reaction, a DNA polymerase is used to extend an interrogation primer that anneals immediately adj acent to the nucleotide position of interest with a single labeled nucleoside triphosphate complementary to the nucleotide at the variant site.
1. Sequence variation detection by hybridization In one aspect, the present invention is suitable for determining precharacterized polynucleotide sequence variations. In other words, the genotyping is performed after the location and nature of polymorphic forms or mutations have already been determined. The sequences of known polymorphic forms and the wild-type/mutation sequences may be used to as reference sequences. For example, the two polymorphic forms of a biallelic single nucleotide polymorphism (SNP) may be used as two reference sequences. To analyze a deletion mutation, one can select the wild-type form and the deleted form as two reference sequences. In some instances, sequence variations of both the coding and noncoding strands of the target nucleic acid sequence may be determined.
Therefore, both the coding and noncoding strands may be used as reference sequences for sequence variation determinations.
Although, in general, the reference sequences are from the same source as the target nucleic acid, in some instances, they may be from difference sources.
For example, the sequences can be from a human or mouse. A substantial number of mutations and polymorphic forms have been reported in the published literature or may be accessible through publicly available web sites, such as http://www-genome.wi.mit.edu, http://sh~c.stanford.edu; http://www.tigr.org, among others. See also, Gelfand et al., Nucleic Acids Res. 27:301-302 (1999) and Buetow et al., Nat. Genet.
21:323-325 (1999). The availability of reference sequence information allows an initial set of polynucleotide probes to be designed for the identification of the known sequence variations.
The determination of sequence variations using the present invention also includes de novo characterizing polynucleotide sequence variations. In other words, genotyping may be used to identify points of new variations and the nature of new variations. For example, by analyzing a group of individuals representing ethnic diversity among humans, the consensus or alternative alleles/haplotypes of the locus may be identified, and the frequencies in the population may be determined.
Allelic variations and frequencies may also be determined for populations characterized by criteria such as geography, gender, among others. Such analysis may also be performed among different species in plants, animals, and other organisms.
A set of polynucleotide probes based on reference sequences for each sequence variation may be designed. The design of a probe set typically includes probes that are perfectly complementary to the reference sequences and span the location of each sequence variation. Perfect complementary means sequence-specific base pairing which includes e.g., Waston-Crick base pairing or other forms of base pairing such as Hoogstein base pairing. Leading or trailing sequences flanking the segment of complementarity can also be present. In the simplest form, a pair of polynucleotide probes perfectly complementary to the two polymorphic forms of a biallelic SNP
(two reference sequences) may be employed. Of course, additional related polynucleotide probes may be added to improve the accuracy of the detection. For example, for each perfectly complementary probe, there may be three corresponding probes, each with a different nucleotide at the variation position. More complex design of polynucleotide probes known to those skilled in the art may also be employed. For example, various tiling methods (e.g., sequence tiling, block tiling, 4 x 3 tiling, and opt-tiling) are described in WO 95/11995, WO 98/30883, WO 98/56954, EP 717113A2, and WO/99/39004, all incorporated herein by reference.
A diploid organism may be homozygous or heterozygous for a biallelic SNP.
There are four possible SNP homozygotes (A/A, T/T, C/C, and G/G) and six possible heterozygotes (T/A, A/G, C/T, C/A, T/G, and C/G). When the polynucleotide probes are hybridized with a heterozygous sample in which both polymorphic forms are present, the patterns for the homozygous polymorphic forms are superimposed. Thus, the probes show distinct and characteristic hybridization patterns depending on which sequence variation is present and whether an individual is homozygous or heterozygous.
Figure 4 is an example of amplifying a target nucleic acid, capturing the amplified products and sequencing by hybridization with captured amplified products.
In addition to using array-immobilized polynucleoitdes for hybridization detection, many homogeneous hybridization detection methods may also be employed.
For example, hybridization probe that form hairpin-loop structure in the absence of the correct target nucleic acid may be utilized (Tyagi et al., Nature Biotechnol.

(1998)). The formation of a hairpin-loop conformation brings the fluorophore and the quencher pair close together, thus extinguishing the donor fluorescence.
2. Sequence variation detection b~a~olynucleotide modifyin,g enzyme In some embodiments of the instant invention, the captured amplification products may be used indirectly in the subsequent sequencing reactions. For example, hybridization complexes between the captured amplification products and immobilized polynucleotides may be further extended using a suitable DNA modifying enzyme to determine the sequence of the amplified products.
In the primer extension method, nucleotide extension reaction catalyzed by the DNA polymerise is used to distinguish between the sequence variants. For example, a sequencing probe may be annealed to the amplified polynucleotides, e.g.
immediately 3' of the sequence variation position. This primer may then be extended with one or more labeled nucleoside triphosphates that are complementary to the nucleotide to be detected using a DNA polymerise. The distinction between the sequence variants is based on the accuracy of the nucleotide incorporation reaction catalyzed by a DNA
polymerise, not the differences in thermal stability between mismatched and perfectly matched hybridization complexes. This method allows discrimination between the homozygous and heterozygous genotypes. This method is robust and insensitive to small variations in the reaction conditions. The same reactions may be employed for detecting any nucleotide variable nucleotide irrespective of the nucleotide sequence flanking the variable site.
Typically, any DNA polymerise without proofreading activity may be used in this method in order to avoid 3'-5' degradation of the probe. DNA polymerise may include Klenow DNA polymerise, T7 DNA polymerise ("Sequenase"), thermostable polymerise, among others. Depending upon the polymerise, different conditions may be used, and different temperature ranges may be required be the hybridization and extension reactions. Any labeled nucleotide analogue that is incorporated sequence specifically by a DNA polymerise may serve as detectable group. In one embodiment, labeled extension terminators, such as didexoynucleotides (e.g., ddATP, ddCTP, ddGTP, ddTTP, and ddUTP), arabinoside triphosphates, may be used because they terminate the extension reaction. Therefore, enzymatic extension of the sequencing primer by one nucleotide depends on the correct base pairing of the added nucleotide to the nucleotide variation to be detected. In another embodiment, labeled deoxynucleotides may be used to extend the primer beyond one nucleotide. Therefore, enzymatic extension of the sequencing primer by more than one nucleotide depends on the correct base pairing of the sequencing primer to the nucleotide variation to be detected.
To obtain specific extension of the polynucleotide in the sequencing step, the excess of amplification reagents are removed before the sequencing reaction. A
second separation step may also be used to separate the labeled extension products from the unincorporated labeled nucleotide before measurement. In addition, any size fractionating methods may be used to determine the sequence of primer extension products. These methods include gel electrophoresis, such as polyacrylamide or agarose gel electrophoresis, capillary electrophoresis, mass spectrometry, and HPLC.
In another example, the 5' nuclease activity of a variety of enzymes may also be employed to cleave and detect target-dependent cleavage structure (also known as the Invader~ assay). Specific DNA and RNA sequences are detected by using structure-dependent enzymes to cleave a hybridization complex with overlapping polynucleotide probes. Details of detecting sequence variations using 5' nuclease assay have been described in WO 98/4287. Details of detecting sequence variations using structure-bridging polynucleotides have been described in WO 98/50403.
In addition, the sequence variants may be determined by using mass spectrometry, such as matrix-assisted laser desorption/ionisation time-of flight mass spectrometry, tandem mass spectrometry, etc. Certain examples of sequence variation detection using mass spectrometry have been described in U.S. Patent Nos.
6,074,823, 6,043,031 and 5,691,141. Sequence variations may be distinguished by marker, hybridization pattern, or discrimination of DNA modifying enzyme (e.g., exonuclease) followed by mass spectrometry.
Figure 5 is an example of amplifying a target nucleic acid, capturing the amplified products, and sequencing by primer extension reactions using captured amplified products. Figure 6 is an example of amplifying a target nucleic acid, capturing the amplified products, and sequencing by primer extension, in the absence of chain terminating nucleotides, using captured amplified products.
B. Coupling of polynucleotide amplification reactions and quantitations of polynucleotides The multiplexing method and apparatus disclosed in the instant invention may be used to quantitate nucleic acid molecules, for example measuring gene expression, gene copy number, viral load, etc.
One application is the monitoring of gene expression level and comparing of gene expression patterns following PCR amplification of target nucleic acid.
Many gene-specific polynucleotide probes derived from the 3' end of RNA transcripts may be spotted on a solid support. This array is then probed with fluorescently labeled cDNA
representations of RNA pools from test and reference cells. The relative amount of transcript present in the pool is determined by the fluorescent signals generated and the level of gene expression is compared between the test and the reference cell.
See, e.g., Lockhart et al., Nature 405:827-836 (2000), Roberts et al., Science 287:873-880 (2000), Hughes et al., Nature Genetics 25:333-337 (2000), Hughes et al., Cell 102:109-(2000), Duggan, D., et al., Nature Genetics Supplement 21:10-14 (1999), DeRisi, J., et al., Science 278:680-686 (1997), and U.S. Patent Nos. 5,800,992, 5,871,928, and 6,040,138, all incorporated herein by reference.
In the instant invention, gene expression monitoring or profiling may be performed on a solid support with in situ synthesized polynucleotides. The simultaneous monitoring of the expression levels of a multiplicity of genes permits comparison of relative expression levels and identification of biological conditions (e.g., disease detection, drug screening) characterized by alterations of relative expression levels of various genes. The simultaneous monitoring of the expression levels also includes the determination of the presence or absence of genes.
Polynucleotide probes for expression monitoring may include probes each having a sequence that is complementary to a subsequence of one of the genes (or the mRNA or the corresponding antisense cRNA). The gene intron/exon structure and the relatedness of each probe to other expressed sequences may also be considered.
Polynucleotide probe set may additionally include mismatch controls, normalization probes, and expression level control probes, among others. In particular, expression level control probes are those hybridize specifically with constituively expressed genes in the biological sample, such as ~3-actin, the transferrin receptor gene, the GAPDH
gene, and the like. They are designed to control for the overall health and metabolic activity of a biological sample.
In some embodiments, a multiplicity of genes may be monitored in real time by using reverse transcriptase PCR. Quantitation of transcription levels of multiple genes can be absolute or relative. Absolute quantification may be accomplished by inclusion of known concentration of one or more target nucleic acids such as control nucleic acids or known amounts of the target nucleic acids to be detected. The relative quantification may be accomplished by comparison of hybridization signals between two or more genes, or between two or more treatments to quantify the changes in hybridization intensity.
In addition of quantitating polynucleotides based on hybridization, a polynucleotide modifying enzyme may also employed to quantitatively measure polynucleotides (see, e.g., Lie et al., Curr. Opin. in Biotech. 9:43-48 (1998), incorporated herein by reference). These methods include for example quantitative PCR, competitive PCR, and 5' nuclease assay.
In a S' nuclease assay (also known as the TaqManTM technology), a polynucleotide probe is annealed to a target sequence located between the forward (5') and reverse (3') primer binding sites. The probe may be labelled with a reporter dye (e.g. FAM, 6-carboxyfluorescein) at the 5' end and a quencher dye (e.g. TAMRA, carboxytetramethylrhodamine) in the middle, or at the 3'end, which compensates the emission spectra of the reporter dye as long as both dyes are attached to the probe.
Modification of the probe with a 3'-blocking phosphate may prevent extension of the 1 S annealed probe during amplification. Cleavage of the probe by 5'-3' exonuclease activity of a thermostable polymerase (e.g., a Taq polymerase) during strand elongation releases the reporter from the probe and thus its proximity to the 3' quencher, resulting in an increase in reporter emission intensity. Thus, the fluorescence signals are detectable and can be quantified. The cycle at which the emission intensity of the sample rises above baseline (threshold cycle) is inversely proportional to the target sequence concentration. The higher the target concentration, the lower the number of amplification cycles required to detect the rise in reporter emission above baseline.
Typically, an ABI PRISMS Sequence Detection System (PE Applied Biosystems) may be used to detect the fluorescent signals. Two probes labelled with different reporter dyes (e.g., FAM, tetrachloro-6-carboxy-fluorescein [TET], hexachloro-6-carboxyfluorescein [JOE]) may also be used in the 5' nuclease assay. This two-color detection may improve sample quantitation accuracy, reduce assay sample numbers and increase sample throughput.
The 5' nuclease assay may be improved by measuring the released fluorescent emission continuously during the PCR amplification instead of an endpoint measurement (Real Time PCR quantification, Heid et al., Genome Res. 6:986-994 (1996);
Gibson et al. Genome Res. 6:995-1001 (1996); and Livak et al. PCR Methods and Applications 4:357-362 (1995), all incorporated herein by reference). Since the exponential accumulation of the fluorescent signal directly reflects the exponential accumulation of the PCR amplification product, this reaction is monitored in real time. Real time RT-PCR may also be performed by adding reagents for RT-PCR and incubating reaction mixture at a temperature optimal for reverse transcription.
There are also many endpoint methods to detect and quantitate PCR products.
These methods typically employ an intercalator or major or minor groove binder. For example, Higuchi et al. (BiolTechnology 10:413-417 (1992) and 11:1026-1030 (1993)) describe a method for real-time PCR product quantitation by measuring the increase in ethidium bromide intensity during amplification with a charge-coupled device (CCD) camera. Ishiguro et al. (Anal. Biochem. 229:207-213 (1995)) describe the use of various intercalaters to quantitate PCR amplification products.
Quantitation of nucleic acids may also be achieved by diluting or dividing a solution containing the nucleic acid of interest. The polynucleotide amplification reactions may be performed on the diluted or divided reaction volumes until no subject nucleic acid molecules are amplifiable in the reaction volumes. The number of reaction volumes and the dilution factor can determine the number of the nucleic acid molecules in a solution.
If a solution (e.g. 100 u1) containing 1000 molecules of nucleic acid of interest is diluted to 10,000 u1 and then divided into 1000 reaction volumes, each reaction volume (10 u1) contains about 0.1 u1 of the original undiluted solution and theoretically 1 molecule of the nucleic acid of interest. If a polynucleotide amplification reaction is performed on each of the 1000 reaction volumes, the number of reaction volumes where amplification occurs is theoretically 1000. Of course, the number of reaction volumes where nucleic acid of interest is amplified is almost certainly less than 1000, because some reaction volumes may not get any molecule of nucleic acid of interest (i.e. some reaction volumes get two or more molecules by chance or clumping of molecules) and/or because the efficiency of amplification reaction is less than 100%. However, as the dilution factor increases, multiple seeding of nucleic acids in each reaction volume will decrease and more and more reaction volumes will receive no nucleic acid of interest because of low concentration. When the number of reaction volume where nucleic acid of interest is amplified is substantially lower than the number of reaction volumes, e.g.
less than half, the concentration of nucleic acid of interest may be accurately determined by counting the number of the reaction volume where the nucleic acid of interest is amplified and correcting it with the dilution factor. In addition, by carrying out this process with known standard amounts of nucleic acids, the efficiency of amplification reaction may be measured and subsequently used as a correction factor. For example, a solution of 100 u1 contains unknown amount of nucleic acid of interest. The solution may be diluted to 10,000 u1 and then divided into 1000 reaction volumes with each reaction volume (10 u1) containing about 0.1 u1 of the original undiluted solution. If polynucleotide amplification reactions are performed in 1000 reaction volumes and about 90 reaction volumes are determined to have nucleic acid of interest amplified, the number of molecules present in the original undiluted solution is about 90 (dilution factor =1) and concentration of the nucleic acid of interest may also be determined if the molecular weight of the nucleic acid is known.
C. Other reactions The instant method and apparatus may be used to investigate large numbers of molecular binding interactions, for example, sequence-specific interactions between polynucleotides (or modifications thereof) and polypeptides (or modifications thereof).
The array assembly may be utilized to screen large numbers of polypeptides with different sequences for binding to a particular polynucleotide sequence or a large number of polynucleotides with different sequences for binding to a particular polypeptide.
Either polynucleotides or polypeptides may be immobilized on one array, although it is possible that none is immobilized. Other molecular binding interactions, such as nucleic acid hybridization, inhibitor-enzyme, receptor-antagonist, drug-DNA, antibody-antigen, toxin-carbohydrate, protein-carbohydrate, and glycoprotein-receptor reactions may also be screened on a large scale using similar methods (see, e.g., Schullek et al., Anal.
Biochem. 246:20-29 (1997), Pandey et al., Nature 405:837-846 (2000), de Wildt et al., Nature Biotechnol. 18:989 (2000), Uetz et al., Nature 403:623 (2000), and White Annu.
Rev. Pharmacol. Toxicol. 40:133-157 (2000), all incorporated herein by reference).
For example, a combinatorial peptide library of potential enzyme inhibitors may be synthesized via an o-nitrobenzyl linker to a first solid support. Enzymes with buffers may be confined to reaction wells on a second solid support. After array assembly, potential enzyme inhibitors may be released by photolysis. A labeled enzyme substrate may be added to each reaction well. Enzyme inhibition may be identified and quantified using an optical system.
Polypeptides may be immobilized on solid supports and assayed for their functions. In one method, recombinant proteins (e.g., GST-fusion proteins) may be immobilized on a first solid support. Cell lysates containing interaction partners may be confined on a second array (e.g., in reaction wells). After array assembly, the system may be washed to remove unbound material. The bound proteins may be identified by known spectroscopic methods in the art. In another method, the yeast two-hybrid system may also be applied to array-based analysis. Yeast cells may be transformed with individual open reading frame-activation domain fusions and grown on a first array surface. Such array may then probed in a mating assay with yeast cells containing ORF-DNA-binding domain fusions on a second array.
IV. Probe designs for sequence variation detection or polynucleotide auantitation In detecting sequence variations or quantitating polynucleotides, amplified nucleic acids are frequently determined by analyzing the extent of hybridization. The fundamental aspect of this method is the discrimination of hybridization stability between the match and the mismatch. A recurring problem to this discrimination is that a perfect match in A/T rich hybridization complexes would often have a lower stability than a mismatch in G/C rich hybridization complexes. This dependency of stability on base composition may lead to false positives or false negatives. Therefore, for successful and reliable detection, several factors in probe selection may be considered.
See Cantor and Smith, Genomics: the science and technology behind the human genome project, John Wiley & Sons (1999).
A. Polynucleotide Sequence and Len tgth:
One of the factors influencing hybridization performance of a polynucleotide probe is base composition. It is well known that sequences rich in G/C are more stable than sequences with lower G/C content. The solution melting temperature (Tm) of a polynucleotide, at which 50% of the polynucleotide is hybridized and 50% is not hybridized, is often used as a practical indicator of the hybridization strength of a polynucleotide probe of a given base composition. Methods for measuring Tm of a polynucleotide are well known in the art. See, e.g., Cantor and Schimmel, Biophycical Chemistry, San Francisco, W.H. Freeman (1980), incorporated herein by reference.
There are also many ways to calculate Tm using mathematical algorithm. A
widely used rule of thumb is two degree of increase in Tm by adding an A/T base pair and four degree of increase in Tm by adding a G/C base pair. This simple formula may be further modified to take into account of the ionic strength and solvent effect. For example, Tm may be calculated using the formula:
Tm=81.5 + 16.6 (log Na~ + 0.41 x % of G/C - 600/n - 0.65 x % of formamide Where Na+ is sodium concentration, n is length of polynucleotide.

A more reliable formula to calculate Tm is available based on the interactions between a particular base and its nearest neighbors, i.e., the nearest-neighbor model. An enthalpy and entropy for each nearest neighbor combination of two adjacent base pairs (AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT) have been established based on the extensive melting experiments using various polynucleotide sequences. Thermodynamic coefficients of nearest-neighbor models are available for DNA/DNA, DNA/RNA, and RNA/RNA hybridizations. Therefore, free energy of hybridization of two sequences at any temperature in solution may be calculated. See, e.g., U.S. Patent No. 5,556,749, Hyndman, D., et al., BioTechniques 20(6):1090-1097 (1996), Mitsuhashi, M., J. Clinical Laboratory Analysis 10:277-(1996), Wetmur, J., Critical Reviews in Biochemistry and Molecular Biology, 26:227-259 (1991), Rychlik et al., Nucleic Acids Res. 17:8543-8551 (1989), and Rychlik et al., Nucleic Acids Res. 18:6409-6412 (1990), all incorporated herein by reference.
The hybridization behavior of immobilized polynucleotide probes on a solid support is different from that in solution. Therefore, a more empirical approach is necessary to predict and modulate hybridization behavior of array-immobilized polynucleotide probes. Additional melting temperature experiments on solid supports may be conducted to more accurately characterize the thermodynamics and kinetics of hybridization behaviors of polynucleotide probes on an array. See Cantor and Smith, supra. Despite the differences in solid phase and solution phase kinetic and thermodynamic hybridization profiles, many variables affecting melting temperatures for solution hybridization, such as the effects of length, temperature, ionic strength, and solvent, are applicable for hybridization on solid supports.
Tm or free energy of hybridization may be evaluated based on base compositions, polynucleotide length, ionic strength, and thermodynamic parameters. High G/C
content polynucleotide probes with a few mismatches may exhibit more stable hybridization than AT-rich polynucleotides without mismatches. Mismatches in the middle of the probe sequence are more consequential for hybridization than those at the S' or 3' end. Shorter probe lengths may provide the maximum mismatch destabilization and result in the greater match to mismatch ratios. However, this advantage is partially offset by the wide range of Tm values for short probes, depending on their specific sequence composition.
For example, probes with 17 nucleotides long with a single base difference may differ by 5°C in Tm. If an array with equal length polynucleotide probes is used, baseline hybridization may yield wide range of signal intensities due to wide range of Tm values.

One skilled in the art will appreciate that in order to increase or decrease the melting temperature of a probe, it may be desirable to add, delete or change one or more bases in the probes. In certain embodiments of the inventions, polynucleotide probes with similar solution melting temperatures may be selected. The length of a polynucleotide probe may be changed, for example, by less than about 10, 5, 4, 3, 2 or 1 nucleotides.
Consideration of secondary structure may also play a role in evaluating hybridization performance of polynucleotide probes, especially when high hybridization temperature to denature secondary structures may not be applied. If polynucleotides form secondary structure such as hairpins or triple helixes, intramolecular hybridization within polynucleotides may be energetically and kinetically favorable and they may not be available for hybridization to the target sequences. See Mitsuhashi, M., J.
Clinical Laboratory Analysis, supra.
In some instances, the presence of frequently appearing short subsequences may also be a factor for designing optimal polynucleotide sequences. For example, if polynucleotides contain a poly T or poly A stretch, such polynucleotides may cross-hybridize to poly(A)-mRNA or cDNA. If polynucleotides contain TATA-like sequences, such polynucleotides may bind to the promoter region of various genes.
A wide range of probe length may be used. Longer probes do not necessarily improve their sensitivity, because long probes usually exhibit higher Tm than that of actual assay conditions, allowing more mismatches. Although shorter probes increase the chances of nonspecific appearance of such sequences in the target sequences, they may exhibit a much higher penalty on mismatches. Therefore, one may design optimal probes based on their hybridization performance, instead of the length of the probes. In preferred embodiments of the present invention, the length of polynucleotide probes ranges from about 10 to about 100 nucleotides, preferably from about 10 to about 50 nucleotides, more preferably from about 15 to about 35 nucleotides.
B. Polynucleotide analogs An alternative approach to even out base composition effects comprises the modification of one or more natural deoxynucleosides (or polynucleotide analogs) which forms a base pair whose stability is very close to that of the other pair.
Polynucleotide analogs include base and sugar phosphate backbone analogs.
Any base analogs that induce a decrease in stability of the three G/C hydrogen bonds or an increase in stability of the two A/T hydrogen bonds may be used.
For example, one can substitute 2,6-diamino purine for A, which gives 2-NH2A/T
base pair having a stability similar to that of the G/C base pair. One may also select C
derivatives, in which one hydrogen of the exocyclic amino group at position 4 is substituted by an alkyl group such as methyl, ethyl, n-propyl, allyl or propargyl groups. For example, a G4EtC base pair has stability similar to that of the A/T base pair. Typically, it may be easier to find a modified G/C base pair whose stability is similar to that of an A/T natural base pair than to design a modified A/T base pair whose stability is close to that of a G/C
natural base pair. In addition, preparation of polynucleotides containing C
analogs may be simpler than that of polynucleotides built with G analogs and modification of only one base pair rather than both may simplify the preparation of polynucleotides containing one or several modified nucleosides. Analogs that increase base stacking energy, such as pyrimidines with a halogen at the C5-position (e.g. 5-bromoU, or 5-ChloroU), may also be used. One may also use the non-discriminatory base analogue, or universal base, such as 1- (2~leoxy-D-ribfuranosyl~-3-nitropyrrole. This class of analogue maximizes stacking while minimizing hydrogen-bonding interactions without sterically disrupting a hybridization complex. See Nguyen, H., et al., Nucleic Acids Research 25(15) 3059-3065 (1997) and Nguyen, H., et al., Nucleic Acids Research 26(18):4249-4258 (1998), both incorporated herein by reference.
The highly charged phosphodiesters in natural nucleic acid backbone may be replaced by neutral sugar phosphate backbone analogues. The polynucleotide probes with uncharged backbones may be more stable, as in these analogs, the electrostatic repulsion between nucleic acid strands is minimized. As an example, phosphotriesters in which the oxygen that is normally charged in natural nucleic acids is esterified with an alkyl group may be used.
Another class of backbone analogs is polypeptide nucleic acids (PNAs), in which a peptide backbone is used to replace the phosphodiester backbone. The stability of PNA-DNA duplex is essentially salt independent. Thus low salt may be used in hybridization procedures to suppress the interference caused by stable secondary structures in the target. PNAs are capable of forming sequence-specific duplexes that mimic the properties of double-strand DNA except that the complexes are completely uncharged. Furthermore, because the hybridization stability of PNA-DNA is higher than that of DNA-DNA, binding is more specific and single-base mismatches are more readily detectable. See, e.g., Giesen, U. et al., Nucleic Acids Research 26(21 ):5004-5006 (1998), Good, L., et al., Nature Biotechnology 16:355-358 (1998), and Nielsen, P., Current Opinion in Biotechnology 10:71-75 (1999), all incorporated herein by reference.
Another option to modulate the hybridization performance of polynucleotide probes is the replacement of naturally occurring nucleic acids have 3'-5' phosphodiester linkage. Polyribonucleotides with 2'-5' linkage which give complexes with lower melting temperature than duplexes formed by 3'-5' polynucleotides with the same sequence may be employed. See Kierzek, R., et al., Nucleic Acids Research 20(7):1685-1690 (1992), incorporated herein by reference.
Another method for optimizing hybridization performance is using polynucleotides containing C-7 propyne analogs of 7-deaza-2'-deoxyguanosine and 7-deaza-2'-deoxyadenosine (Buhr et al., Nucleic Acids Res. 24:2974-2980 (1996), incorporated herein by reference) or C-5 propyne pyrimidines (Wagner et al., Science 260:1510-3 (1993), incorporated herein by reference). These analogs may be particular useful in gene expression analysis.
C. Hybridization environment Hybridization performance of polynucleotide is also dependent on the hybridization environment, for example, the concentrations of ions and nonaquous solvents. The hybridization performance of polynucleotide probes may be modulated by changing the dielectric constant and ionic strength of the hybridization environment.
Salt concentrations, such as Na, Li, and Mg, may have an important influence on hybridization performance of polynucleotide probes.
Reagents that reduce the base composition dependence of hybridization performance may be used to alter the hybridization environment of array-immobilized polynucleotide probes. For example, high concentrations of tetramethylammonium salts (TMAC), N,N,N,-trimethylglycine (Betain) may be added to target nucleic acid mixture.
At suitable concentrations typically at multimolar concentrations, these reagents may equalize the Tm of polynucleotides that are pure A/T and those that are pure G/C and thus increase the discrimination between perfect matches and mismatches. See, Von Hipppel et al., Biochemistry, 3:137-144 (1993), incorporated herein by reference.
Denaturing reagents that lower the melting temperature of double stranded nucleic acids by interfering with hydrogen bonding between bases may also be used.
Denaturing agents, which may be used in hybridization buffers at suitable concentrations (e.g. at multimolar concentrations), include formamide, formaldehyde, DMSO
("dimethylsulfoxide"), tetraethyl acetate, urea, GuSCN, and glycerol, among others.

Chaotropic salts that disrupt van der Waal's attractions between atoms in nucleic acid molecules may also be used. Chaotropic salts, which may be used in hybridization buffers at suitable concentrations (e.g. at multimolar concentrations), include, for example, sodium trifluoroacetate, sodium tricholoroacetate, sodium perchlorate, guanidine thiocyanate, and potassium thiocyanate, among others. See, Van Ness, J., et al., Nucleic Acids Research 19(19):5143-5151 (1991), incorporated herein by reference.
Renaturation accelerants that increase the speed of renaturation of nucleic acids may also be used. They generally have relatively unstructured polymeric domains that weakly associate with nucleic acid molecules. Accelerants include cationic detergents such as, CTAB ("cetyltrimethylammonium bromide") and DTAB ("dodecyl trimethylammonium bromide"), and, heterogenous nuclear ribonucleoprotein ("hnRP") Al, polylysine, spermine, spermidine, single stranded binding protein ("SSB"), phage T4 gene 32 protein and a mixture of ammonium acetate and ethanol, among others.
See, Pontius, B., et al., Proc. Natl. Acad. Sci. USA 88:82373-8241 (1991), incorporated herein by reference.
One of skill in the art would appreciate that there are many other ways to modulate the hybridization performance of polynucleotides by changing the hybridization environment of polynucleotide probes. One method is changing the length of spacer that tethers polynucleotide probe to the array surface. It has been demonstrated that steric factors are important in increasing the efficiency of hybridization between polynucleotide probes and target nucleic acids. See, Southern et al., Nucleic Acids Research, 20(7):1679-1684 (1992), incorporated herein by reference. Methods for reducing non-specific binding to an array by surface modifications and probe modifications are described in WO 99/54509, incorporated herein by reference.
An alternative approach for enhancing the discrimination between matched and mismatches is applying electric current to polynucleotide probes which destabilize mismatches relative to matches. See, e.g., U.S. Patent No. 5,929,208.
In some instances, the local concentration of polynucleotide probes or the concentration of target nucleic acids may be varied to allow maximum discrimination between matches and mismatches. In some instances, local concentrations of polynucleotide probes may be higher than target nucleic acids. Such high local DNA
probe concentrations may generate high local charge densities and promote the undesirable association of probes that may interfere with target binding. High local probe concentration may also permit the simultaneous binding of target molecules to multiple probes, and may sterically prohibit access of target to the probes.
If polynucleotide probes are at lower concentrations compared with the target sequence, the kinetics and thermodynamics of the hybridization may also be affected. See, Cantor and Smith, supra.
The polynucleotide probe set may also include control probes. One class of control probes is the mismatch probes. A mismatched probe is a probe whose sequence is deliberately selected not to be perfectly complementary to a reference sequence. In other words, mismatch probes are probes identical to their corresponding perfectly complementary probes except the presence of one or more mismatched bases.
Therefore, under suitable hybridization conditions, the perfectly matched would be expected to hybridize with its target sequence, but mismatch probes would not hybridize or would hybridize to a significantly lesser extent, thus providing a control for non-specific binding or cross-hybridization. Although one or more mismatches may be located anywhere in the mismatch probe, probes are often designed to have the mismatch locate at or near the center of the probe such that the mismatch is most likely to destabilize the hybridization complex with the target sequence. In addition, the mismatch site is typically not the location of the sequence variation to be determined, but is within several nucleotides (e.g., less than 5) on the 5' or 3' side of the sequence variation location. For example, a probe set for a known biallelic SNP may contain two groups of mismatch probes based on two reference sequences constituting the respective polymorphic forms.
Each group of mismatch probes may include at least two sets of probes, which each set contains a series of probes with a mismatch at one nucleotide 5' and 3' to the polymorphic site.
Control probes may also include normalization probes. Normalization probes are those perfectly complementary to a known polynucleotide sequence that is added to the target nucleic acids. Normalization probes provide a control for variation in hybridization condition, signal intensity, and other factors that may cause the signal of a perfect hybridization to vary between arrays. Normalization probes may be located throughout the array to control for spatial variation in hybridization intensity. For example, they may be located at the corners, edges or middle of the array.
The number of polynucleotide probes for a sequence variation or a gene expression may vary depending on the nature of sequence variation, gene expression, and level of resolution desired. At least about 2, 5, 10, 20, or 50 polynucleotide probes may be employed for each sequence variation or each gene. Each probe in both sequence variation determination and gene profiling may be about 10 to 100 nucleotides long, e.g. shorter than about 20, 30, 40, 50, 60, 70, 80, or 90 nucleotides long. In the case of overlapping polynucleotides probes, the overlap may be about 1 to 50 bases, preferably below 30, 20, 10, or 5 bases.
V. Hybridization conditions and si~nalprocessin~
The hybridization can take place in the same reaction site or well as the amplification reactions. Generally, incubation may be at temperatures normally used for hybridization of nucleic acids, for example, between about 20 °C and about 75 °C, e. g., above about 30 °C, 40 °C, 50 °C, 60 °C, or 70 °C. The amplified nucleic acid may be incubated with the array for a time sufficient to allow the desired level of hybridization between the amplified product and any complementary probes in the array, usually in about 10 minutes to several hours. But it may be desirable to hybridize longer. After incubation with the hybridization mixture, the array is usually washed with the hybridization buffer, thus removing unhybridized molecules. This leaves only hybridized target molecules. Then the array may be examined to identify the polynucleotide probes to which the amplified product has hybridized.
Suitable hybridization conditions may be determined by optimization procedures or experimental studies. Such procedures and studies are routinely conducted by those skilled in the art. See e.g., Ausubel et al., Current Protocols in Molecular Biology, Vol.
1-2, John Wiley & Sons (1989) and Sambrook et al., Molecular Cloning A
Laboratory Manual, 2nd Ed., Vols. 1-3, Cold Springs Harbor Press (1989). For example, hybridization and washing conditions may be selected to detect substantially perfect matches. They may also be selected to allow discrimination of perfect matches and one base pair mismatches. They may also be selected to permit the detection of large amounts of mismatches. As an example, the wash may be performed at the highest stringency that produces results and that provides a signal intensity greater than approximately 10% of the background intensity.
The hybridization intensities indicating the hybridization extent between the amplified nucleic acid and polynucleotide probes may be determined and compared. The differences in hybridization intensities are evaluated. One of skilled in the art will appreciate that methods for evaluating the hybridization results vary with the nature of probes, sequence variations, gene expressions, and labeling methods. For example, quantification of the fluorescence intensity is accomplished by measuring probe signal strength at locations where probes are present. Comparison of the absolute intensity of array-immobilized polynucleotide probes hybridized to amplified nucleic acids with intensities produced by control probes provides a measure of the sequence variations or the relative expression of the genes.
Quantification of the hybridization signal can be by any means known to one of skill in the art. For example, quantification may be achieved by the use of a confocal fluorescence microscope. The methods of measuring and analyzing hybridization intensities may be performed utilizing a computer. The computer program typically runs a software program that includes computer code for analyzing hybridization intensities measured. Signals may be evaluated by calculating the difference in hybridization signal intensity between each polynucleotide probe; its related probes, and control probes. The differences can be evaluated for each sequence variation or each gene.
Background signals typically contribute to the observed hybridization intensity.
The background signal intensity refers to hybridization signals resulting from non-specific binding, or other interactions, e.g., between amplified nucleic acids and array surface. Background signals may also be produced by the array component itself. A
single background signal may be calculated for an array or a different background signal may be calculated for each sequence variation or each gene expression analysis. For example, background may be calculated as the average hybridization signal intensity for the lowest 5% to 10% of the probes in the array, or where a different background signal is calculated for each sequence variation or gene, for the lowest 5% to 10% of the probes for each sequence variation or gene. Background signal may also be calculated as the average hybridization signal intensity produced by hybridization to probes that are not complementary to any sequence found in the sample (e.g. probes directed to nucleic acids of the opposite sense or to genes not found in the sample). Background may also be calculated as the average signal intensity produced by regions of the array that lack any probes at all. Preferably the difference in hybridization signal intensity between each probe and its control probes is detectable, e.g. greater than about 10%, 20%, or 50%
of the background signal intensity. In some instances, only those probes where difference between the probe and its control probes exceeds a threshold hybridization intensity (e.g. preferably greater than 10%, 20%, or 50% of the background signal intensity) are selected. Thus, only probes that show a strong signal compared to their control probes are selected.

The identity of each sequence variation may be estimated using known methods in the art. If the target is present, the perfectly matched probes should have consistently higher hybridization intensity than the mismatched probes. Therefore, in sequence variation determinations, one of the four A, T, C, G substituted probes may have a significantly higher signal than the other three. A comparison of the intensities of four corresponding probes may reveal the identity of one sequence variation in the target sequence. For example, the highest intensity probe may be compared to the second highest intensity probe. The ratio of the intensities may be compared to a predetermined ratio cutoff, which is a number that specifies the ratio required to identify a sequence variation. For example, if the ratio cutoff is 1.2, a ratio of 1.4 is greater than the cutoff and the sequence variation may be determined. Of course, ratio cutoff may be adjusted to produce optimal results for a specific array and for a specific sequence variation.
In addition to comparing to mismatch probes, the hybridization intensity may be compared to other control probes, such as normalization probes. For example, probe intensity of amplified nucleic acid may be compared to that of a known sequence. Any significant changes may indicate the presence or absence of a sequence variation.
Statistical method may also be used to analyze hybridization intensities in determining sequence variations or gene expression levels. For example, mismatch probe intensities may be averaged. Means and standard deviations may be calculated and used in determining sequence variations and profiling gene expressions. Complex data processing and comparative analysis may be found in EP 717 113 A2 and WO
97/10365, both incorporated herein by reference.
VI. Target nucleic acid preparation and reactant labeling It will be appreciated by one of skill in the art that the reactions using the instant invention may be monitored or quantitated by directly or indirectly labeling reactants, reaction intermediates, or reaction products with detectable labels, prior to, during, or after the initiation of reactions. Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful polynucleotide labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., DynabeadsTM), fluorescent molecules (e.g., fluorescein, texas red, rhodamine, green fluorescent protein, FAM, JOE, TAMRA, ROX, HEX, TET, Cy3, C3.5, CyS, Cy5.5, IRD41, BODIPY and the like), radiolabels (e.g., 3H, 2sih 355 345 ~aC~

32P, or 33P), enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA), colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads, mono and polyfunctional intercalator compounds. Means of detecting such labels are well known to those of skill in the art. For example, radiolabels may be detected using photographic film or scintillation counters, fluorescent markers may be detected using a photodetector to detect emitted light. Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and colorimetric labels are detected by simply visualizing the colored label.
Any nucleic acid specimen, in purified or non-purified form, can be utilized as the target sequence nucleic acid. The amplification reaction may amplify, for example, DNA or RNA, including mRNA, wherein DNA or RNA may be single stranded or double stranded. In the event that RNA is to be used as a template, enzymes and conditions optimal for reverse transcribing RNA to DNA may be utilized. In addition, a DNA-RNA hybrid which contains one strand of each may be utilized. A mixture of nucleic acids may also be employed, or the nucleic acids produced in a previous amplification reactions.
The target nucleic acids may be prepared from human, animal, viral, bacterial, fungal, or plant sources using known methods in the art. For example, target sample may be obtained from an individual being analyzed. For assay of genomic DNA, virtually any biological sample is suitable. For example, convenient tissue samples include whole blood, semen, saliva, tears, urine, fecal material, sweat, buccal, skin and hair. For assay of cDNA or mRNA, the tissue sample must be obtained from an organ in which the target nucleic acid is expressed. For example, if the target nucleic acid is a cytochrome P450, the liver is a suitable source. The target nucleic acids may also be obtained from other appropriate source, such as nuclear RNA, rRNA, tRNA, M13, plasmid or lambda vectors, and cosmid or YAC inserts. The target may be preferably fragmented before application to the array to reduce or eliminate the formation of secondary structures in the target. The fragmentation may be performed using a number of methods, including enzymatic, chemical, thermal cleavage or degradation.
For example, fragmentation may be accomplished by heat/Mg2+ treatment, endonuclease (e.g., DNAase 1) treatment, restriction enzyme digestion, shearing (e.g., by ultrasound) or NaOH treatment. Examples of target nucleic acid preparation are described in e.g., WO 97/10365, incorporated herein by reference.
Definitions As used herein, the term "linker" refers to an anchoring group that serves to anchor or tether a molecule to a solid support during solid phase synthesis.
The linker is sometimes the point of cleavage following synthesis.
As used herein, the terms "polynucleotide" and "nucleic acid" refer to naturally occurring polynucleotides, e.g. DNA or RNA. This term also refers to analogs of naturally occurring polynucleotides. The polynucleotide may be double stranded or single stranded. This term is used without referring to a specific length. The polynucleotides may be labeled with radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags.
As used herein, the term "polynucleotide amplification reaction" refers to a broad range of techniques for increasing the number of copies of specific polynucleotide sequences. Typically, amplification of either or both strand of the target nucleic acid comprises the use of one or more nucleic acid-modifying enzymes, such as a DNA
polymerase, a ligase, an RNA polymerase, or an RNA-dependent reverse transcriptase.
Examples of polynucleotide amplification reaction include, but not limited to, polymerase chain reaction (PCR), nucleic acid sequence based amplification (NASB), self sustained sequence replication (3SR), strand displacement activation (SDA), ligase chain reaction (LCR), Q(3 replicase system, and the like.
As used herein, the term "polypeptide" refers to a polymer of amino acids without referring to a specific length. This term includes naturally occurring protein.
The term also refers to modifications, analogues and functional mimetics thereof. For example, modifications of the polypeptide may include glycosylations, acetylations, phosphorylations, and the like. Analogues of polypeptide include unnatural amino acid, substituted linkage, etc. Polypeptides may be labeled with radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags.
As used herein, the term "polynucleotide" refer to naturally occurring polynucleotide, e.g. DNA or RNA. This term does not refer to a specific length. Thus, this term includes oligonucleotide, primer, probe, gene, nucleic acid, etc.
This term also refer to analogs of naturally occurring polynucleotides. Polynucleotides may be double stranded or single stranded. Polynucleotides may be labeled with radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags, etc.
As used herein, the term "primer" refers to a polynucleotide, which is capable of annealing to a complementary template nucleic acid and serving as a point of initiation for template-directed nucleic acid synthesis, such as a polynucleotide amplification reaction. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template. Typically, a primer will include a free hydroxyl group at the 3' end. The appropriate length of a primer depends on the intended use of the primer but typically ranges from 12 to 40 nucleotides preferably from 15 to 40, most preferably from 20 to 40 nucleotides. The term primer pair (e.g., forward and reverse primers) usually means a set of primers including a 5' upstream primer that hybridizes with the 5' end of the target sequence to be amplified and a 3', downstream primer that hybridizes with the complement of the 3' end of the target sequence to be amplified.
As used herein, the term "probe" refers to a polynucleotide of any suitable length which allows specific hybridization to a polynucleotide. Probes may be attached to a label or reporter molecule. Typically, probes are at least about 10 nucleotides long.
As used herein, the term "reactant" refers to any component of a non-unimolecular reaction. A reactant may be a chemically or biologically reactive substance in a reaction.
As used herein, the term "sequence variation" of a polynucleotide encompasses all forms of polymorphism, mutations and haplotypes. A sequence variation may range from a single nucleotide variation to the insertion, modification, or deletion of more than one nucleotide. A sequence variation may be located at the exon, intron, or regulatory region of a gene.
Polymorphism refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population. A biallelic polymorphism has two forms. A triallelic polymorphism has three forms. A polymorphic site is the locus at which sequence divergence occurs. Diploid organisms may be homozygous or heterozygous for allelic forms. Polymorphic sites have at least two alleles, each occurnng at frequency of greater than 1 % of a selected population.
Polymorphic sites also include restriction fragment length polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements. The allelic form occurring most frequently in a selected population is sometimes referred to as the wild type form or the consensus sequence.
Mutations include deletions, insertions and point mutations in the coding and noncoding regions. Deletions may be of the entire gene or of only a portion of the gene.
Point mutations may result in stop codons, frameshift mutations or amino acid substitutions. Somatic mutations are those which occur only in certain tissues, such as liver, heart, etc and are not inherited in the germline. Germline mutations can be found in any cell of a body and are inherited.
A haplotype refers to the combination of sequence variations that co-exist on a chromosome.
The term "subsequence" refers to a polynucleotide sequence that comprises a part of a longer polynucleotide sequence.
EXAMPLES OF THE PREFERRED EMBODIMENTS
The following examples further illustrate the present invention. These examples are intended merely to be illustrative of the present invention and are not to be construed as being limiting.

~nthesis of DMT-protected o-nitrobenzyl amidite A schematic illustration of DMT-protected o-nitrobenzyl amidite synthesis is shown in Figure 7.
6-(4-Formyl-2-methoxyphenoxy)hexan-1-of (2). A flame-dried, 100 mL round bottom flask equipped with a claisen arm and reflux condenser was charged, under argon, with vanillin (1, 1.0 g, 6.6 mmol), tetrabutylammonium iodide (369 mg, 1 mmol), and potassium carbonate (1.38 g, 10 mmol). These were suspended in 10 mL of anhydrous acetonitrile and then 6-chlorohexanol (1.05 ml, 7.9 mmol) was added dropwise. The reaction was protected from light and refluxed for 15 hours at which time TLC analysis showed complete consumption of the starting material. The solvent was evaporated in vacuo and the residue was then dissolved in 50 mL of ethyl acetate and extracted with water (2 x 100 mL), brine (1 x 100 mL), and water (1 x 100 mL).
The organic layer was dried over magnesium sulfate, filtered, and the solvent was evaporated in vacuo to give 1.5 g (90%) of 2 as a white solid. Rf= 0.29 (33% ethyl acetate/hexane).
Mp 55.0-56.0 °C. 'H NMR (400 MHz, DMSO-d6): 8 9.83 (s, 1), 7.53 (dd, J=
2.0 Hz, 8.0 Hz, 1 ), 7.3 9 (d, J = 2.0 Hz, 1 ), 7.17 (d, J = 8.4 Hz, 1 ), 4.3 6 (t, J
= 5 .2 Hz, 1 ), 4.07 (pt, J= 2.4 Hz, 2.8 Hz, 2), 3.83 (s, 3), 3.39 (dd, J= 5.6 Hz, 11.6 Hz, 2), 1.75 (m, 2), 1.45-1.34 (m, 6) ppm.
6-(4-Formyl-2-methoxyphenoxy)hexyl acetate (3). A flame-dried, 250 mL
round bottom flask was charged, under argon, with 2 (10 g, 39.6 mmol) and this was dissolved in 50 mL of anhydrous pyridine and the flask was protected from light. To this solution was added acetic anhydride (9.3 mL, 98.8 mmol) dropwise at a rate of 0.5 mL/minute. The solution was stirred at room temperature for 30 minutes at which time all of the starting material had been consumed. The solvent was evaporated with reduced pressure and then toluene was added to remove excess pyridine. Evaporation of the solvent in vacuo gave 11.5 g (99%) of 3 as an off white solid. Rf = 0.74 (33%
ethyl acetate/hexane). Mp 74.0-75.0 °C. 1H NMR (400 MHz, DMSO-d6): 8 9.83 (s, 1), 7.53 (dd, J = 1.6 Hz, 8.4 Hz, 1 ), 7.39 (d, J = 2.0 Hz, 1 ), ), 7.17 (d, J = 8.4 Hz, 1 ), 4.07 (t, J =
6.4 Hz, 2), 4.00 (pt, J= 6.4 Hz, 6.8 Hz, 2), 3.83 (s, 3), 2.00 (s, 3), 1.74 (m, 2), 1.58 (m, 2), 1.4-1.35 (m, 4) ppm.
6-(4-Formyl-2-methoxy-5-nitrophenoxy)hexyl acetate (4). A 250 mL round bottom flask was charged with 3 (10 g, 34 mmol) and was then placed in an ice bath. To this was added a 20% v/v solution of fuming nitric acid in acetic acid (40 mL
total volume) at a rate of 1.0 mL/minute with stirring. At the end of addition the bath was removed, the reaction was protected from light, and stirred at room temperature for 4 hours. At this time the solution was poured over crushed ice (200 mg). Water was added and the product was extracted with ethyl acetate (3 x 200 mL). The combined organics were washed with brine ( 1 x 200 mL), saturated sodium bicarbonate ( 1 x 200 mL), and water (1 x 200 mL), dried over magnesium sulfate, and filtered. The solvent was evaporated in vacuo to give 10.6 g of 4 (92%) as an orange-red solid. Rf =
0.80 (33% ethyl acetate/hexane). Mp 79.8-81.5 °C. 1H NMR (400 MHz, DMSO-d6):
8 7.69 (s, 1), 7.37 (s, 1), 4.17 (pt, J= 6.4, 6.8 Hz, 2), 4.0 (t, J= 6.8 Hz, 2), 3.95 (s, 3), 1.99 (s, 3), 1.77 (m, 2), 1.59 (m, 2), 1.45-1.37 (m, 4) ppm.
' 6-(4-Hydroxymethyl-2-methoxy-5-nitrophenoxy)hexyl acetate (5). A flame-dried, 250 mL round bottom flask was charged, under argon, with 4 (8 g, 23.6 mmol) and this was suspended in 35 mL of anhydrous ethanol. The flask was protected from light and then placed in an ice bath. Sodium borohydride (2.06 g, 54.3 mmol) was added in small portions and the reaction was allowed to stir at 0 °C for 180 minutes. At this time, saturated ammonium chloride (30 mL) was added slowly to the reaction mixture over a period of 20 minutes to minimize the gas evolution. Ethanol was evaporated in vacuo and the mixture was diluted with water (100 ml) and extracted with dichloromethane (3 x 100 mL). The combined organic layers were dried with magnesium sulfate, filtered, and the solvent was evaporated in vacuo to give orange oil. This oil was subjected to column chromatography (Si02, 75 x 200 mm, 1% triethylamine in dichloromethane) to give, following solvent evaporation, 7.25 g (90%) of 5 as a yellow solid. Rf = 0.30 (33% ethyl c~
acetate/hexane). Mp >220 °C. 'H NMR (400 MHz, DMSO-d6): 8 7.67 (s, 1), 7.38%(s, 1), 5.55 (t, J= 6.4 Hz, 1), 4.81 (d, J= 6.4 Hz, 2), 4.04 (t, J= 7.2 Hz, 2), 4.00 (t, J= 7.6 Hz, 2), 3.91 (s, 3), 1.99 (s, 3), 1.76-1.72 (m, 2), 1.61-1.57 (m, 2), 1.45-1.37 (m, 4) ppm.
6-[4-(4,4'-Dimethoxytrityloxymethyl)-2-methoxy-5-nitrophenoxy)hexan-1-of ('~. A flame-dried, 250 mL round bottom flask was charged, under argon, with 5 (5 g, 14.7 mmol) and this was dissolved in 45 mL of anhydrous pyridine. The flask was protected from light and 4,4'-dimethoxytrityl chloride (7.4 g, 22 mmol) was added in one portion. The solution was stirred at room temperature for 18 hours. Toluene was then added to the reaction flask and the solvent was evaporated in vacuo to give an oil. This ' process of toluene addition/evaporation was repeated twice and then water was added to the flask to remove the last trace of organic solvents. The residue was dissolved in 400 mL of ethyl acetate and water extractions (3 x 150 mL) were performed. The organic layer was dried over magnesium sulfate, filtered, and the solvent was evaporated in vacuo to give 6 as a yellow oil. This was taken to the next step without further manipulation. RI = 0.68 (33% ethyl acetate/hexane). 'H NMR (400 MHz, DMSO-d6):

7.60 (s, 1), 7.45-7.24 (m, 10), 6.90 (d, J= 8.4 Hz, 4), 4.50 (s, 2), 4.04 (t, J= 7.2 Hz, 2), 4.00 (t, J= 7.6 Hz, 2), 3.95 (s, 3), 3.73 (s, 6), 1.99 (s, 3), 1.76-1.72 (m, 2), 1.61-1.57 (m, 2), 1.45-1.37 (m, 4) ppm.
A flame-dried, 250 ml round bottom flask was charged with 6 and this was dissolved in 100 mL of anhydrous methanol. The flask was protected from light and then potassium carbonate (2.6 g, 18.6 mmol) was added in one portion. The reaction was continued at room temperature for 30 minutes at which time TLC analysis showed complete consumption of the starting material. The solvent was evaporated in vacuo and the residue was then dissolved in 600 mL of dichloromethane and extractions performed with water (3 x 400 mL). The organic layer was dried over magnesium sulfate, filtered, and the solvent evaporated in vacuo to give a yellow oil. This oil was subjected to column chromatography (Si02, 75 x 200 mm, 1 % triethylamine in dichloromethane) to yield, following solvent evaporation, 6.6 g (75 %, 2 steps) of 7 as a waxy yellow solid. Rf = 0.40 (33% ethyl acetate/hexane). 1H NMR (400 MHz, DMSO-d6): S 7.60 (s, 1), 7.45-7.24 (m, 10), 6.90 (d, J= 8.4 Hz, 4), 4.35 (t, J= 4.8, 5.2, 2), 4.03 (pt, J=
6.4, 6.8 Hz, 2), 3.95 (s, 3), 3.73 (s, 6), 3.73-3.71 (m, 2), 1.95-1.98 (m, 2), 1.44-1.36 (m, 6) ppm. '3C
NMR (100 MHz, DMSO-d6): b 158.6, 153.9, 146.9, 145.1, 139.1, 135.8, 130.3-127.3 (m), 113.8, 113.2, 110.4, 109.3, 87.0, 69.1, 63.0, 61.0, 56.4, 55.5, 32.9, 28.9, 25.7, 25.6 S ppm.
6-[4-(4,4'-Dimethoxytrityloxymethyl)-2-methoxy-5-nitrophenoxy)hexyloxy-1-O-[O-(2-cyanoethyl)-N,IV diisopropylphosphoramidite (8). A flame-dried, 250 ml round bottom flask was charged with 7 (6 g, 11.6 mmol). The system was protected from light and evacuated under reduced pressure for at least six hours. The system was back-filled with argon and 7 was dissolved in 50 mL of anhydrous dichloromethane.
The system was placed in an ice bath and then diisopropylethylamine (10 mL, 58 mmol) was added followed by slow addition of 2-cyanoethyl-N,N
diisopropylchlorophosphoramidite (3.8 mL, 17.4 mmol). The ice bath was then removed and the reaction stirred at room temperature for 60 minutes. At this time, the reaction was quenched via the addition of 30 mL of methanol. The solvents were evaporated in vacuo and the residue was dissolved in dichloromethane and extracted with saturated sodium bicarbonate (1 x 300 mL). The organic layer was dried over magnesium sulfate, filtered, and the solvent evaporated in vacuo to give an orange-yellow oil.
This oil was subjected to column chromatography (5i02, 75 x 200 mm, 1% triethylamine in dichloromethane) to yield, following solvent evaporation, 3.2 g (40 %) of 8 as a faint orange oil. Rf = 0.70 (33% ethyl acetate/hexane). 1H NMR (400 MHz, DMSO-d6): S
7.60 (s, 1), 7.42-7.46 (m, 3), 7.21-7.37 (m, 7), 6.9 (d, J= 8.4 Hz, 4), 4.50 (s, 2), 4.03 (t, J
= 6.4 Hz, 2), 3.95 (s, 3), 3.73 (s, 6), 3.71-3.73 (m, 2), 3.52-3.6 (m, 6), 3.74-3.68 (m, 6), 2.74 (t, J= 6.0 Hz, 2), 2.44 (m, 2), 1.75-1.72 (m, 2), 1.58-1.55 (m, 2), 1.41-1.39 (m, 2), 1.18-1.10 (m, 12) ppm. 31P NMR (162 MHz, DMSO-d6): S 148.9, 147.1 ppm. 13C NMR
(100 MHz, DMSO-d6): 8 158.8, 154.1, 147.1, 145.2, 139.3, 137.9, 136.0, 130.4, 130.1, 129.4, 128.7, 128.6, 128.1, 127.4, 125.8, 119.5, 113.9, 113.3, 110.6, 109.5, 87.1, 69.2, 63.6, 63.4, 63.1, 58.9, 58.7, 58.6, 56.6, 55.6, 55.4, 50.9, 50.7, 43.1, 42.9, 31.2, 31.1, 29.0, 25.6, 25.5, 25.0, 24.9, 24.8, 21.6, 20.4 ppm.

Polynucleotide synthesis off of a photocleavable linker Aminoalkylated controlled-pore glass resin was treated with a 20% v/v solution of piperidine in anhydrous dimethylformamide (DMF) at room temperature for 30 minutes. Next, the resin was washed in anhydrous DMF and a 0.1 M solution of N
a-(9-fluorenylmethoxycarbonyl)-O-trityl-L-homoserine (Fmoc-HoSer(Trt)-OH) in anhydrous DMF containing 0.1 M N [(dimethylamino)-1H 1,2,3-triazol[4,5-b]pyridin-1-ylmethylene]-N methylmethanaminium hexafluorophosphate N oxide (HATU) and 0.2 S M anhydrous diisopropylethylamine (DIEA) was introduced and allowed to react for 30 minutes at room temperature. The resin was treated with a 20% v/v solution of piperidine in anhydrous DMF for 15 minutes to remove the Fmoc group. The resin was washed in anhydrous DMF and then treated with a 25% v/v solution of acetic anhydride in pyridine for 30 minutes. The resin was then treated with a 3% w/v solution of trichloroacetic acid (TCA) in dichloromethane (DCM) for 10 minutes to remove the trityl group and give a terminal hydroxyl group to couple to compound 8.
Coupling of 8 to the homoserine derivatized resin was accomplished through standard amidite chemistry (5-ethylthiotetrazole was used as the activator).
Following benzylic DMT removal, a mixed sequence of 3'-CTC AAC CCG AAT CTC CG-5' (SEQ. ID. No. 1) was synthesized in the standard fashion on a 200 nmol scale.
At the completion of the synthesis, the resin was treated with an aqueous solution of ammonia in order to deprotect the phosphate backbone and remove the heterocyclic protecting groups. No polynucleotide was detected in the eluent of these deprotection solutions. A
portion of the resin was suspended in 18 MS2 water and subjected to photolysis. Using a converted lithography system, we delivered 16 mW/cm2 (measured at 365 nm) of light for approximately 20 minutes. Cleavage of this polynucleotide from the resin gives a 3'-phosphate-terminated sample. It should be noted that no special purification was attempted (i.e. desalting column, HPLC, etc). An aliquot of the aqueous solution was then subjected to capillary electrophoresis. Capillary electrophoresis was carried out on a Beckman PACE 5000 system. Samples were injected electrokinetically onto a 37 cm x 75 pm i.d. J&W Scientific 3% T 3% C p,PAGE polyacrylamide gel filled column.
Separation was done at 9kV and the separation buffer used was Tris -borate pH
8.0 with 1 M urea. The result is shown in Figure 8. In addition, the sample was mixed with an authentic sample purchased from IDT, Inc (Coralville, IA, standard desalting purification) and subjected to CE analysis (Figure 9). As can be seen in Figure 9, the polynucleotides prepared from the resin terminated in 8 is as pure as that obtained commercially.

Preparation of surface derivatized arrays Glass slides were cleaned by sonication in a 2% solution of Micro 90 in Mill-Q
water for 60 minutes at room temperature. The slides were then rinsed excessively with Milli-Q water and dried down with nitrogen. Next, the slides were exposed to an RF
oxygen plasma (Plasmline421, Tegal, Novato, CA) for 60 minutes at 150 watts, 0.4 Torr, and 3.5 cc/min flow rate (Brzoska et al., Nature 360:719-721 (1992). The slides were further washed for 10' in a peroxysulfuric acid solution (70% HzS04:15%H202, VWR, San Francisco, CA).
Immediately after oxygen plasma treatment, the slides were silanated with a 0.4%
solution of 4-aminobutyldimethylmethoxysilane (ABS) (United Chemical Technologies, Bristol, PA) in anhydrous toluene (Aldrich, Milwaukee, WI) in a glove box under argon for 72 hours. The slides were then washed in anhydrous toluene with sonication for 15 minutes then rinsed in 95% ethanol (Aldrich) with sonication for 15 minutes.
After drying each slide under nitrogen, the slides were cured for 30 minutes at 120 °C in an air oven.
Next, slides were coated with 3.5 micron layer of a positive photoresist (Microposit 1818; Shipley, Marlborough, MA) by spin coating photoresist (3.4 mls) at 1250 rpm for 30 seconds. After spin coating, the photoresist was soft baked for 30 minutes at 90 °C in an air oven. Next, the slides were photomasked by placing each slide onto a chromium mask (Image Technology, Palo Alto, CA) that had round features with each feature being 1 mm in diameter with center to center spacing of 2.0 mm with the photoresist side touching the mask. The chips were then exposed to near UV
irradiation with a 365 nm 500 W columnated mercury lamp (45 mW/cm2, AB-M, San Jose, CA) for 1.0 second. After exposure, the exposed photoresist was removed by placing the slides into a solution of Microposit 350 developer (1:1 in H20, Shipley, Marlborough, MA) for 30 seconds with agitation and then rinsed extensively with Milli-Q water and dried under argon.
The slides were then exposed to an RF plasma (Plasmline421) 150 watts, 0.4 Torr, and 3.5 cc/min flow rate, for 6.0 minutes to remove the ABS along with residual photoresist from the photolyzed regions. Next, the slides were silated with a 0.25%
solution of (tridecafluoro-1,1,2,2-tetrahydrooctyl)-1-trichlorosilane (United Chemical Technologies, Bristol, PA) in anhydrous toluene (Aldrich) in an argon dry box for 10 minutes at room temperature and then washed in anhydrous toluene with'sonication for 15 minutes. Finally, the photoresist covering the synthesis regions was stripped by sonication in acetone (Aldrich) then by washing in NMP (Aldrich) for 60 minutes at 70°C and washed extensively in Milli-Q H20 to remove residual photoresist.

In situ synthesis of polynucleotides with a cleavable site All derivatizations were performed in a chip reaction chamber. Briefly, two slides were placed with their patterned surfaces facing one another. The gasket and chips were secured by four steel binder clips. Reagents were introduced via syringe through a 27-gauge needle. The gas interior was displaced through an open 27-gauge needle while reagent was being injected with the syringe. At the end of the given reaction, the reagent was removed via syringe using an open 27-gauge needle for venting. For this process, all washings between steps were done by first disassembling the reaction chamber and then rinsing each slide individually with the given solvent. Excess solvent was removed from the surface by means of a nitrogen gas stream. A fresh gasket was used for each subsequent chamber assembly and derivatization process.
Derivatized glass surfaces were patterned as follows: DMT-hexa-ethyloxy-glycol-CED phosphoramidite (DMT-HEG-CEP) was coupled to surface bound amines using a 1:1 solution of 0.1 M linker and 0.45 M 5-ethylthiotetrazole in acetonitrile for 15 minutes with mixing. After two acetonitrile washes the chips were treated with a 0.1 M
solution of iodine in tetrahydrofuran (THF)/pyridine/water for 1 minute and then washed twice with acetonitrile. Any uncoupled amines were acylated by treatment with a 25%
v/v solution of acetic anhydride in pyridine for 15 minutes. Following DMT
removal via treatment of the surfaces with a 3% w/v solution of trichloroacetic acid (TCA) in dichloromethane (DCM), compound 8 was coupled in some of the derivatized sites to the surface-bound terminal hydroxyls using standard phosphoramidite chemistry. In other derivatized sites, dT-CE phosphoramidite was coupled to serve as non-photolyzable controls. In every hydrophilic site, the following polynucleotide was prepared using standard phosphoramidite chemistry: 3'- GCA TGC ATG CAT GCA-5' (SEQ. ID. No.
2). Then, Cy3-phosphoramidite (Glen Research, Sterling, Va) was coupled to every other derivatized site to provide a detectable, fluorescent end-label. The substrate-bound polynucleotides were then deprotected using a 1:1 v/v solution of ethylenediamine in ethanol.
After dicing the substrate into 1" x 2" chips, a chamber assembly was made for the photolysis studies. Briefly, two chips (one derivatized, one blank) were placed with the patterned surface facing inwards and separated by a silicone rubber gasket. The gasket and chips were secured by four steel binder clips. Buffer (26 mM Tris-HCI, pH
9.5, 6.5 mM MgCl2) was introduced via syringe through a 27-gauge needle. The gas interior was displaced through an open needle while reagent was being injected with the syringe. Photolysis was performed using a high-pressure mercury lamp with a light intensity of 16.0 mW/cril2 centered at 365 nm. At the end of the given process, the buffer was removed via syringe. The chamber was disassembled and the chip was washed with acetonitrile, ethanol, then water and the fluorescence detected using an Axon GenePix 4000 scanner. As shown in Figure 10, the fluorescent signal in the photolabile sites decreases over time relative to the non-photolyzable sites. At or about 10 minutes, the signal decrease levels out and does not significantly lower over the next 120 minutes.
This experiment shows that compound 8 couples to the surface through a linker and is a viable substrate for subsequent polynucleotide synthesis.

Photolytic release of polynucleotides from the surface and subsequent hybridization of the released polynucleotides This experiment was designed to address the issue of photolytic release of in situ synthesized polynucleotides from the array surfaces and study their subsequent hybridization to complimentary, surface-bound polynucleotides. This study was designed to address the issue of photolysis and subsequent motility and hybridization of the released polynucleotides from a linker derivatized with amidite 8.
A patterned, surface-tension array was prepared with 5 x 5 derivatized sites as depicted below (25 derivatized sites per unit cell, 10 total unit cells/chip).
In the sites containing the "F" sequence, amidite 8 had been coupled. All other sites had a noncleavable amidite (dT-CEP, Glen Research, Sterling, VA) coupled to the site. The synthesis was performed in a 3'-to-5' directions using commercially available reagents and house made robotics. The "F" polynucleotides were then end-labeled with Cy3-Phosphoramidite (Glen Research, Sterling, VA). Following deprotection of the polynucleotide backbone and heterocycles, the chip was scanned on an Axon GenePix4000. After the initial scan, the arrayed chips were assembled in a sandwich-like format with a microfabricated coverslip containing 10 wells (5 x 5 x 0.1 mm) that line up over the 10 unit cells of in situ synthesized polynucleotides. Each microfabricated well contained, nominally, 2.5 p,L of 260 mM Tris-HCI, pH 9.5, 65 mM
MgCl2, 20 mM KCI, 0.1% Triton X-100. The coverslip and polynucleotide immobilized chip were conjoined by use of 100 ~,L of a synthetic polymer (2x Self Seal, MJ
Research, Watertown, MA) deposited on the perimeter of the assembly. At this time, the assembly was exposed to ~ 200 J of 365 nm light. Following chamber disassembly and washing, the chip was scanned again and the signal intensities recorded and charted in Figure 11. As can be seen, polynucleotides were released from the intended sites and did form a duplex with its compliment in the designated sites ("R"
polynucleotides). The signal in the noncleavable sites increased 10 fold over the pre-photolysis numbers. The "C-" blank control was not hybridized to, as expected. It should be noted that the absolute fluorescence values were normalized to give a comparative representation.
This experiment was also performed under the following conditions. Using the same substrates, the array surface was exposed to 365 nm light (measuring at 16.0 mW/cm2) for 15 minutes. Then, 30 ~L of SSC buffer, pH 8.2, 50 mM sodium bicarbonate, 0.8 % Tween-20, was floated over the surface with the use of a microscope cover slip (Fisher Scientific). After 30 minutes, the coverslip was removed, the array washed with briefly with 150 mM aqueous sodium bicarbonate solution, dried under a stream of argon, and scanned on an Axon GenePix4000. The results mirrored those described above with the exception that the hybridization signal increased 30 fold over the pre-photolysis numbers.
A 5 x 5 unit cell F F F F F

F R F R F

F F C- F F

F R F R F

F I~ F F-[ F
I

Abbreviations Probe3'-5' Seduence (SE(d.
ID. Nos: 3-5) F TTTTATCGGAGATTCGGGTTGAG

R ctcaacccgaatctccgataaaa C- GATGCTACCGTGACTGACTGACTGACTGA

In situ synthesis of probes for sequence variation or . e~ ne expression detections Drop-on-demand polynucleotide synthesis was performed on a DNA microarray synthesizer using the following reagents (all reagents were purchased from Glen Research, Sterling, VA, unless noted): phosphoramidites: pac-dA-CE
phosphoramidite, Ac-dC-CE phosphoramidite, iPr-pac-dG-CE phosphoramidite, dT CE phosphoramidite (0.1 M); activator: 5-ethylthio tetrazole (0.45M). Amidites and activator solutions were premixed, l : l :v/v, in a 90% adiponitrile (Aldrich): 10% acetonitrile solution prior to synthesis. The following ancillary reagents were used: Oxidizer (0.1 M iodine in THF/pyridine/water), Cap mix A (THF/2,6-lutidine/acetic anhydride), Cap mix B
(10%
1-methylimidazole/THF), and 3% TCA in DCM. Parallel synthesis of individual polynucleotides was achieved by the addition of individual amidites to the hydrophillic regions of prepared surface tension arrays via custom designed piezo electric ink jet devices (Microfab Technologies, Plano, TX). The jets were run at 6.67 kHz using a two step wave form which fired individual droplets of approximately 50 picoliters per drop.
For the lmm diameter features approximately 400 drops were added to each feature per nucleotide addition. After a suitable coupling time, the uncoupled amidites were washed off of the surface by flooding with acetonitrile then removed by spinning the chip at 2000 rpm for several seconds. All other reagents were added to the surface by flooding the substrate and removed after suitable reaction times. The synthesis was done in a closed nitrogen saturated environment with a unidirectional flow of protecting gas. The synthesis cycle is summarized in Table 1.
Table 1. Synthesis cycle for the production of a surface tension polynucleotide microarray.
Step in Cycle Volume Time (mls) (seconds) ACN Wash 4.2 5 I Spin 5 ACN Wash 4.2 5 Spin 5 Deblock (3% TCA in DCM) 3.5 15 Spin 5 Deblock (3% TCA in DCM) 3.5 15 Spin 5 ACN Wash 4.2 5 Spin 5 2Dry down 10 Couple Amidites 2 X 10-6 120 ACN Wash 4.2 5 Spin 5 Cap (Cap A:Cap B, 1:1) 4.5 15 Spin 5 Oxidize 5.5 15 Spin 5 Cap (Cap A:Cap B, 1:1) 4.5 10 Spin 5 Re peat cycle until the desired probes are Spin speed between successive washing steps was 2000 rpm. Washing and coupling steps were done at different locations on the chip synthesizer where there was a continuous unidirectional flow of nitrogen that was directed from the synthesis location towards the washing position. This kept the ancillary reagent vapors from interacting' with the amidites. A dry down was a step that was included prior to coupling to evaporate any residual ACN that may have been left on the hydrophilic regions of the array. This consisted of a high pressure nitrogen purge over the surface of the substrate.

Microfabrication of wells on arrays (coverslips) Borofloat glass rounds (100mm diameter and 0.7mm thick) were used to prepare the coverslips. Several coverslip designs were made according to Figure 12 and according to the following procedure:
Glass cleaning ~d patterning A pre-cleaning step was performed by soaking the wafers in peroxysulfuric acid followed by a rinse and drying. The wafers were dipped in 49% hydrofluoric acid for about 15 seconds to roughen and clean the surface followed by rinsing and drying. The wafers were coated with a thin layer of amorphous silicon by chemical vapor deposition in a Tylan type oven at 525°C at a thickness of 1500~r. To remove any moisture, the wafers were singe baked in an oven for about 30 minutes at 150°C. The wafers were primed with a layer of HMDS (hexamethyldisilazane) at 6000 RPM for 20 seconds before photo resist application. A viscous photo resist (Shipley SPR220-7) was used to coat the wafers and are spun at 3500 RPM for 30 seconds to a thickness of 7um.
The photo resist layer was pre-baked for about 200 seconds on a hot plate at 90°C. The wafers were then allowed to stand for about 3 hours prior to exposure. A UV
aligner with a wavelength set at 350nm with an exposing time of about 12 seconds was used for each wafer. Due to the thickness of the photo resist, the wafers were allowed to stand for about 3 hours before developing. This helps improve critical line resolution of the exposed areas. The wafers were then dipped in developer solution (Shipley LDD26W) at least 3 times for about two minutes each time with a deIonized water rinse after developing. A post-bake step wasperformed at 90°C for one hour in an oven.

Glass etching The etching steps involve the pattern etching by removing the amorphous silicon layer and the actual glass etching. The pattern etching was accomplished by using a plasma etcher that uses sulfur hexafluoride and Freon 11 S at a rate of 5.2 and 0.5 cm3/s respectively. An etching time of 2 minutes was sufficient to remove the amorphous silicon. The wafers were etched in 49% hydrofluoric acid for an initial time of 8 minutes. A water rinse and spin dry step followed and the wafers were placed back into the 49% hydrofluoric acid solution for the remaining time required to reach a final depth of 100 microns. The wafers were rinsed and dried. The photo resist was removed using acetone and the remaining amorphous silicon was removed with heated potassium hydroxide at about 70°C. The wafers were then rinsed and dried. To remove the potassium on the glass surface, the wafers were treated with about a 20%
solution of hydrochloric acid. A final peroxysulfuric acid treatment was performed to remove any residuals. The wafers were diced to a 1 "x 2" sized coverslips.
Chemical derivatization of the coverslips.
A multiple cleaning process was performed prior to the aminosilation and acetylation of the coverslips. The coverslips were sonicated for about 10 minutes and water rinsed to remove any dust or glass particulates from the dicing process.
To remove any dirt or oils on the glass surfaces, the coverslips were soaked with 10%
weight to volume sodium hydroxide at 70°C for 30 minutes. The coverslips were water rinsed and soaked in peroxysulfuric acid treatment for about an hour. To free the Si-O
groups on the glass surface, the coverslips were placed in a plasma etcher with oxygen as the gas for 15 minutes at 70°C. The coverslips were placed in a reaction kettle and lml of 3-aminopropyldimethylethoxy silane was added. The kettle was placed in an oven at 55°C
and left overnight to complete the gas phase reaction. The coverslips were removed from the kettle and were placed in an oven at 90°C for an hour to cure the surface. The coverslips were sonicated in a 1:1 mixture of acetonitrile and ethanol for about 15 minutes to remove any un-reacted reagent.
To complete the acetylation, the coverslips were reacted with 25 % (by volume) acetic anhydride with pyridine as the solvent. The coverslips were allowed to stand for at least two hours for the reaction to complete. The coverslips were sonicated with a 1:1 solution of acetonitrile and ethanol to remove any un-reacted acetic anhydride for about 15 minutes. The coverslips were dried with nitrogen and were ready for use in the array assembly.

Polymorphisms, alleles, and phenotypes of the NAT2 Gene N-acetyltransferase 2 (NAT2) is a polymorphic N-acetylation enzyme that detoxifies hydrazine and arylamine drugs and is expressed in the liver. The coding region spans 872 base pairs (Genbank Accession No. NM-000015). The PCR
product is approximately 1276 base pairs.
Polymorphisms in the NAT2 gene cause the fast and slow N-acetylation phenotypes implicated in the action and toxicity of amine containing drugs. In addition, NAT2 acetylation phenotype is associated with susceptibility to colorectal and bladder cancers. Table 1 summarizes the seven common single nucleotide polymorphisms (SNPs) found in this gene (G191A, C282T, T341C, C481T, G590A, A803G, and G857A) and defines the nine most common alleles (*4 being the wild type allele) along with their associated phenotypes and population frequencies. See Grant et al., Mutat.
Res. 376:61-70 (1997) and Spielberg et al., J. Pharmacokint. Biopharm. 24:509-519 , (1996). Each of the seven polymorphisms is a marker for more than one NAT2 allele and each variant allele is defined by two or three SNP substitutions. NAT2 provides a clearly defined, low complexity model system for developing a hybridization based genotyping assay. Typically, homozygous or heterozygous genotypes are made at each polymorphic site before probable allele assignments can be made. In general, individuals who are homozygous for any combination of the slow acetylator alleles are slow acetylators, where rapid acetylators are homozygous or heterozygous for wild-type NAT2 allele. It has been suggested that slow acetylators may be at increased risk for developing bladder, larynx and hepatocellular carcinomas, whereas rapid acetylator may be at risk to develop colorectal cancer. The frequency of the slow acetylator phenotype varies among ethnic groups and is roughly 50%-60% in Caucasian populations.
See Grant, D., et al, Mutation Research 376:61-70 (1997) and Lin, H., et al, Pharmacogenetics 4:125-134 (1994). Polynucleotide array can be used to determine whether a target nucleic acid sequence has one or more nucleotides identical to or different from a specific reference sequence.

Table 2. Polymorphisms, alleles, and phenotypes of the NAT2 gene ~o ymor. G191A C282TT341CC481TG590A A803GG857APhenotypeFrequen alle a ~ i ~ ~ rcapia z3 ~1 t ~w ~~, ,~G 'C ~ G ' A ~ Slow -~
,~~~ ~ ~ G~ 2 G C C G G G Sow SC ~, ~'C: C C G ~ G~ Slow ~ , G ~ . Sl 2 ~

6A G T T C A A G ow 28 . v -'.~ - G ~ A 2 1 ~ h H 1 * ~'"2 ~ ~ ~ S ow 0 G C G G G Rapid ~r"~'~A j~~T~f;~ ~. ~.
w ~,: =A C C G A G Sow ~r ~ C ~ ~"'~'S
* 4 A G

ow 0 mmo ci ange K ~r~ one i boneo.t rc I ~
~ ~ -; ~ ~ U
, K -~
~ t Performing large numbers of PCR reactions usin~ay-immobilized and releaseable primers and detecting amplified Qroduct by hybridization In the current Example, G191A polymorphic site of the NAT2 gene was determined using array assembly. A first array with 535 individual derivatized areas (500 um diameter, 1000 um spacing) were prepared on a chip according to previous Examples. Primers and probes are designed and organized as described in Figure (SEQ. ID. Nos. 6-13). The complementary sequences to the primers are immobilized in the primer sites F and R, to capture respectively Reverse and Forward primers during a pre-hybridization step. Polynucleotide synthesis was carried out in the direction 3' to 5' (3' attached to the surface of the glass) according to known procedures.
A second array was microfabricated according to Example 7 (coverslip). A
coverslip contains 10 unit cells (5 mm X 5 mm X 100 um depth). Each cell was designed to face 25 derivatized sites on the first array upon juxtaposition of the two arrays.
Pre-hybridization of the primers:
The first array was hybridized in 30 ml of (2xSSC, 0.1% Tween20, and 50mM
NaHC03) with 2.5 nm of Cyanine 3 Labeled primers at RT for 30 minutes, then washed in 30 mls of 150mM NaHC03 at RT for 15 minutes shaking slowly.
The first array was then dipped briefly in 70% Ethanol/HZO and air dried for
10-15 minutes and scanned.
The scanner generated picture on Figure 14 shows the locations where the labeled primers have accumulated (bright round spots). The high intensity areas correspond exactly to the sites on the surface of the array where the complementary sequences of the primers were synthesized (see Figure 13). The maximum intensity obtained for this hybridization corresponds to approximatively 30 fmoles of primer hybridized per square millimeter. The level of fluorescence detectable for the other synthesis sites was negligible.
Preparation of array assembly A liquid polymer (100 u1 of 2X Self Seal, MJR) was deposited on the perimeter of the first chip and allowed to dry. Upon assembly and rehydratation the liquid polymer created an efficient leakproof gasket that prevented excessive evaporation during the temperature cycling Arran assembly The PCR mix (200 u1, 26mM Tris-HCI, pH 9.5, 6.SmM MgCl2, 0.1%TritonX-100, 20mM KCI, 200mM dNTP's, O.SU.uI Thermosequenas,) containing 0.1 ng/ul of DNA target (genomic DNA) was used.
The top edge of the first array was put in contact with the second array (coverslip) with a 45 to 60 degrees angle. The PCR mix was loaded in the space created between the first array and the coverslip. The first array was then gradually lowered against the coverslip in a motion that prevents air from being trapped inside the assembly (Figure 15).
Temperature C,~g The assembly was introduced into a commercially available in-situ PCR
instrument (MJResearch) and the following temperature program was started:
2min 86 °C; O.Smin 86°C ;l.Omin 56.5°C: 30 times then Smin 72°C, total cycle time is 1.3 H.
After the last cycle, the assembly is heated to 92°C for 2 minutes followed by a 25 °C step for 30 min to allow denaturation and hybridization of the PCR product to the probes on the first array.
The assembly was then opened, and the first array was washed with 30 ml of Phosphate Buffer (100 mM NaCI, 3 mM KCI, 4 mM Na2HP04, 1.5 mM NaH2P04, 0.5%
Tween20, pH=7.2) for 15 minutes at RT. The first array was then dipped briefly in 70%
Ethanol/H20 and air dried for 10-15 minutes and scanned (Figure 16).

Figure 16 is an image of the top four PCR wells of the first array after PCR
cycling, hybridization and wash. As before, the primers sites showed very high (gray) or saturating intensities (white). The positive control probe for PCR (PCR
positive arrow) showed very high or saturating intensities while the negative control probes (PCR
negative arrow) remained close to noise intensity (black). This result demonstrates that a PCR product was specifically generated inside the array assembly.
The Coding Probe 1 - A (SNP Detected arrow) had higher intensity than the Coding Probe 2 - G (refer to Figure 13 for exact location). This result agrees with the DNA type (homozygote type 1 - A) as determined by dideoxysequencing of the PCR product.

Comparison of primers introduced by hybridization versus introduction of the primers in solution.
Four array assemblies were created as described in Example 9 except for two assemblies where a 200 nM final concentration of the Cyanine 3 labeled primers was added to the PCR mix. The PCR cycle, washes and scans were performed as previously described and the results are summarized in the Figure 17.
The bars in Figure l7~represent the average intensities (expressed in Relative Fluorescence Units) collected from the scan for each feature of the polynucleotide-immobilized array.
The introduction of the primers by hybridization gives comparable results to the PCRs with primers added in solution suggesting that the efficiency of the formation of PCR product is similar.

Performing lar,~e numbers of PCR reactions using array-immobilized and releaseable primers and detecting ~plified product by allele specific extension.
A DNA microarray with 535 individual derivatized areas (S00 um diameter, 1000 um spacing) were prepared according previous Examples. In situ polynucleotide synthesis was carried out in the direction 5' to 3' (5' attached to the surface of the glass) according to known procedures. In this manner the 3'end of the probe is free to be elongated by the DNA polymerase upon hybridization of the amplified products.
A second microfabricated array was prepared according to Example 7 that contains 10 unit cells (5 mm X 5 mm X 100 um depth). Each cell was designed to face 25 derivatized sites on the DNA microarray upon juxtaposition of the two arrays.
Primers and probes were designed and organized as described in Figure 18 (SEQ.
ID.
Nos. 14-32).
The preparation of the DNA microarray and application of the liquid polymer is done as described in Example 9.
Reaction assembly:
The PCR mix (200 u1, 26mM Tris-HCI, pH 9.5, 6.SmM MgCl2, 0.1%TritonX-100, 20mM KC1,200mM dATP, 200 mM dGTP, 175 mM dCTP, 25 mM Cy3-dCTP, 175 mM dTTP, 25 mM Cy3-dUTP, O.SU.uI Thermosequenase, 200 nM of each primer) containing 0.1 ng/ul of DNA target (genomic DNA A191G type A homozygote) is used.
Temperature Cyclin~
The assembly is introduced into a commercially available in-situ PCR
instrument (MJR) and the following temperature program is started:
2min 86°C; O.Smin 86°C ;l.Omin 56.5°C: 30 times then Smin 72°C, total cycle time is 1.3 H
After completion of the temperature program, the assembly was opened, and the DNA microarray was washed with a solution of triethylamine:ethanol 1:1 for 15 minutes at room temperature, rinsed 3 times with water, dried with nitrogen and scanned. The results are summarized in Figure 19.
The bars in Figure 19 represent the average intensities (expressed in Relative Fluorescence Units) collected from the scan for each feature of the DNA
microarray.
The Negative Control (C-) intensity corresponds to the background level for this experiment and can be appropriately subtracted for more accurate results. The Probe Coding A (PC n A) and Probe Non-Coding T PN n T) have higher intensities than respectively the Probe Coding G (PC(n]G) and Probe Non-Coding C (PN(n)C) in accordance with the DNA type(homozygote type 1 - A) as determined by dideoxysequencing of the NAT-2 PCR product.

This result shows that the PCR product can be efficiently detected and genotyped using simultaneous PCR, labeling and allele specific extension of the probes at the surface of an array.

Real-Time quantitation of amplification product The fluorescent dye SYBR Green I binds to the minor groove of the DNA double helix. In solution, the unbound dye exhibits very little fluorescence, however, fluorescence is greatly enhanced upon DNA-binding. Since SYBR Green I dye is very stable (only 6% of the activity is lost during 30 amplification cycles), it may be used to measure total DNA .
At the beginning of amplification, the reaction mixture contains the denatured DNA, the primers, and the dye. The unbound dye molecules weakly fluoresce, producing a minimal background fluorescence signal which is subtracted during computer analysis.
After annealing of the primers, a few dye molecules can bind to the double strand. DNA
binding results in a dramatic increase of the SYBR Green I molecules to emit light upon excitation.
During elongation, more and more dye molecules bind to the newly synthesized DNA. If the reaction is monitored continuously, an increase in fluorescence is viewed in real-time. Upon denaturation of the DNA for the next heating cycle, the dye molecules are released and the fluorescence signal falls.
Fluorescence measurement at the end of the elongation step of every PCR cycle is performed to monitor the increasing amount of amplified DNA. Together with a melting curve analysis performed subsequently to the PCR, the SYBR Green I
format provides an excellent tool for specific product identification and quantification.

End-point quantitation of PCR product using day assembly A 10 well coverslip (5 mm X 5 mm X 100 um) was microfabricated as previously described. A "blank" DNA microarray (surface derivatized, but no DNA
synthesis) was used as an inert counterpart for the array assembly.
Reaction assembly:
_77_ The PCR mix (200 u1, 26 mM Tris-HCI, pH 9.5, 6.5 mM MgCl2, 0.1 % TritonX-100, 20 mM KCI, 200 mM dATP, 200 mM dGTP, 200 mM dCTP, 200 mM dTTP, O.SU.uI Thermosequenase, 200 nM of each primer) containing 0.1 ng/ul of DNA
target (or no DNA) and 1 X Sybr Green was used to prepare the array assembly as described in Example 9.
A picture was taken immediately following the assembly using an apparatus described in Figure 20. The array assembly seats on the stage under the CCD
Camera.
The excitation was generated by a 450W Xenon lamp and filtered using a 485 nm +/- 20 nm interference filter. The light was directed towards the surface of the assembly using two optical fibers with a linear shaped oulet to create an homogeneous epi-illumination of the array assembly. The intensity was approxymatively 1.5 uW/cm2. The fluorescence was collected using a 16-bit, 1024 X 1024 pixels, back-illuminated CCD
camera through a 521 nm +/- 20 nm interference filter and a 50 mm X 2.8 f lens.
Acquisition time was set to 5 secondes, the image generated was displayed on a computer screen for further analysis.
Areas of interest were selected that matched the locations of the PCR wells and the intensities of the pixels comprising the area were averaged.
Temperature Cycling The assembly is introduced into a commercially available in-situ PCR
instrument (MJ Research) and the following temperature program was started:
2min 86 °C; O.Smin 86 °C ;l.Omin 56.5°C: 30 times then Smin 72°C, total cycle time is 1.3 H
After the completion of the temperature program, the array assembly was imaged as described earlier. The images were analyzed and the results are summarized in Figure 21.
The intensity of the fluorescence in the wells containing the template DNA
after PCR was higher than before PCR and surpassed the intensity of the wells containing no template before or after PCR. This result shows that the formation of the double stranded PCR product can be monitored and quantitated during the PCR, simultaneously in all of the PCR wells. Accurate monitoring of the increasing amount of amplified DNA
provides an excellent tool for gene expression analysis.
_78_ Allele discrimination using the 5'nuclease assay using array assembly The S' nuclease allele discrimination assay exploits the 5'-3' nuclease activity of DNA polymerases to allow direct detection of the PCR product by the release of a fluorescent reporter as a result of PCR. Two probes are used, one probe for each allele in a two-allele system. Each probe consists of a polynucleotide with a 5'-reporter dye and a 3'-quencher dye. TET (6-carboxy-4,7,2',7'-tetrachlorofluorescein) is attached to the 5' end of the probe for the detection of Allele 1. FAM (6-carboxyfluorescein) is attached to the 5' end of the probe for the detection of Allele 2.
Each of the reporters is quenched by TAMRA (6-carboxy-N,N,N',N'-tetramethylrhodamine) attached via a linker arm located at the 3' end of each probe.
When the probe is intact, the proximity of the reporter dye to the quencher dye results in suppression of the reporter fluorescence. The probes hybridize to a target sequence within the PCR product. The DNA polymerase cleaves the probe with its 5'-3' nuclease activity. The reporter dye and quencher dye are separated upon cleavage, resulting in increased fluorescence of the reporter. Both primer and probe must hybridize to their targets for amplification and cleavage to occur.
The rate of cleavage of each of the allele specific probes depends directly on the rate of hybridization of the probes.
Detection of the alleles is done by measuring the increase of reporter fluorescence following PCR for each of the probes. The ratio of the intensities of fluorescence is used do determine the pol~morphic type of the sample.
2400 individual hydrophilic areas (250 um diameter, 500 um spacing) are prepared on a first array and the solid phase synthesis of the DNA
polynucleotides is carried out in the direction 5' to 3' (3' attached to the surface of the glass).
All the synthesis sites are first derivatized with the photocleavable linker to provide a mechanism for all primers and probes to be released into their PCR
well A second microfabricated array is prepared according to previous Examples that contains 600 unit cells (1 mm X 1 mm X 100 um depth), each cell is designed to face four hydrophilic sites on the first array upon juxtaposition of the two arrays.
Primers and probes are designed and organized as described in Table 3.

Table 3:
Primer Probe ForwardType Probe Primer Type Reverse While the primers are unmodified DNA sequences amplifying the DNA region comprising the SNP site, allele detection using 5' nuclease assays for real time quantitative PCR requires the two probes to be labeled with distinctly different reporter dyes at the 5'end and a quencher dye at the 3'end of the sequence. The reporter dyes are TET and 6-FAM and the quencher is TAMRA for the 5' and 3' labeling of the sequence.
The TET, 6-FAM and TAMRA dyes are commercially available in their phosphoramidite form and are therefore conveniently directly coupled to the growing polynucleotides during in situ synthesis.
Preparation of the DNA microarray for assembly After deprotection of the microarray 100 u1 of liquid polymer (2X Self Seal, MJR) is deposited on the perimeter of the DNA chip and allowed to dry. Upon assembly and rehydratation the liquid polymer will create an efficient leakproof gasket that prevents excessive evaporation during the temperature cycling Reaction assembly:
200 u1 of the PCR mix (26mM Tris-HCI, pH 9.5, 6.SmM MgCl2, 0.1%TritonX-100, 20mM KCI, 200mM dNTP's, O.SU Thermosequenase) containing 0.1 ng/ul of DNA
target (genomic DNA) is used to prepare the array PCR assembly. The top edge of the microarray is put in contact with the coverslip with a 45 to 60 degrees angle.
The PCR
mix is loaded in the space created between the DNA microarray and the coverslip. The DNA chip is then gradually lowered against the coverslip in a motion that prevent air from being trapped inside the assembly.
Cleavage of the primers and probes:
The assembly is exposed to 365 nm light, measured at 16 mW/cm2, for 15 minutes.

Temperature Cyclin~
The assembly is introduced into a commercially available in-situ PCR
instrument (MJR) and the following temperature program is started: 2min 86C; O.Smin 86C
;l.Omin 56.5C: 30 times then Smin 72C, total cycle time is 1.3 H.
After the last cycle, the assembly is heated to 92C for 2 minutes followed by a 45 C step for 30 min to allow denaturation and hybridization of the PCR product to the probes on the DNA microarray.
After the completion of the temperature program, the assembly is imaged with the apparatus described in previous examples. Two images are taken and analyzed for each assembly using sets of filters compatible with TET and FAM spectral properties.
The pictures are analyzed and the intensity ratios of the light emitted by each of the dyes are used to determine the allele of the sample for each of the studied SNPs.
The above description is illustrative and not restrictive. Many variations of the invention will become apparent to those of skill in the art upon review of this disclosure.
These variations may be applied without departing from the scope of the invention. The scope of the invention should, therefore, be determined not with reference to the above description, but instead should be determined with reference to the appended claims along with their full scope of equivalents.
All publications, patents or web sites are herein incorporated by reference in their entirety to the same extent as if each individual publication patent or web site was specifically and individually indicated to be incorporated by reference in its entirety

Claims (46)

WE CLAIM:
1. A system for performing a plurality of reactions comprising:
a first solid support having a first reactant of each reaction confined to an area on the surface of said first solid support; and a second solid support having a second reactant of each reaction confined to an area on the surface of said second solid support;
wherein said first and second solid supports are assembled to allow said first reactant of each reaction in contact with said second reactant of each reaction, thus providing an environment for performing said plurality of reactions in parallel.
2. A system for performing a plurality of reactions comprising:
a first solid support having a reactant of each reaction immobilized on said first solid support; and a second solid support providing a chemical or mechanical separation of said plurality of reactions;
wherein said first and second solid supports are assembled to provide an environment for performing said plurality of reactions in parallel.
3. The system according of claim 1 or 2 wherein said plurality of reactions are polynucleotide amplification reactions and a primer for each polynucleotide reaction is immobilized on said first solid support.
4. A solid support for performing a plurality of polynucleotide amplification reactions wherein a releasable primer for each amplification reaction is immobilized on an area of the surface of said solid support.
S. A system for amplifying a plurality of target nucleic acids, comprising:
(a) a first solid support wherein (1) the surface of said first solid support comprises a plurality of derivatized areas;

(2) a primer for each target nucleic acid or a sequence complementary to said primer is immobilized on a derivatized area of the first solid support;
and (b) a second solid support wherein said second solid support comprises a plurality of wells and each well corresponds to a primer for each target nucleic acid.
6. A system for amplifying a plurality of target nucleic acids, comprising:
(a) a first solid support wherein (1) the surface of said first solid support comprises a plurality of derivatized areas;
(2) a forward primer for each target nucleic acid or a sequence complementary to said forward primer is immobilized on a derivatized area of the first solid support (3) a reverse primer for each region of said target nucleic acid or a sequence complementary to said reverse primer is immobilized on another derivatized area of the first solid support;
(b) a second solid support wherein said second solid support comprises a plurality of wells and each well corresponds to the forward and reverse primers for each target nucleic acid.
7. A system for amplifying a plurality of target nucleic acids and detecting amplified products, comprising:
(a) a first solid support wherein (1) the surface of said first solid support comprises a plurality of derivatized areas;
(2) a primer for each target nucleic acid or a sequence complementary to said primer is immobilized on a derivatized area of the first solid support;
(4) a probe comprising a subsequence, the same as or complementary to a subsequence of each target nucleic acid, is immobilized on another derivatized area of the first solid support;
(b) a second solid support wherein the surface of said second solid support comprises a plurality of reaction wells and each well corresponds the primer and the probe for each target nucleic acid.
8. The system according to any one of the claims 5-7, wherein said plurality of target nucleic acids are a plurality of subsequences of a polynucleotide.
9. The system of any one of claims 1-8, wherein said first or second solid support is glass.
10. The system of any one of claims 1-8 further comprising a liquid polymer between said two solid supports wherein said liquid polymer reduces solvent evaporation.
11. The system according to any one of claims 2-8 wherein said immobilization is covalent.
12. The system according to any one of claims 2-8 wherein said immobilization is non-covalent.
13. The system according to any one of claims 2-8 wherein said primer is covalently linked to a cleavable moiety.
14. The system according to claim 13 wherein said cleavable moiety is cleavable by photolysis.
15. The system according to any one of the claims 1-8 wherein the surface of said first solid support comprises a plurality of hydrophilic areas.
16. The system according to any one of the claims 5-8 wherein the density of the derivatized areas on said first solid support is between about 10 to 10,000 per cm2.
17. The system according to any one of the claims 5-8 wherein the size of said derivatized area on said first solid support is between about 10 -3 to 5 mm2.
18. The system according to any one of the claims 5-8 wherein the number of derivatized areas on said first solid support is between about 10 to 500,000.
19. The solid support of claim 3 wherein said releasable primer is releasable by strand separation.
20. The solid support of claim 3 wherein said releasable primer is releasable by photolysis.
21. A method for performing a plurality of reactions, comprising the steps of:
(a) obtaining a first solid support wherein a first reactant of each reaction is confined to an area on the surface of said first solid support;
(b) obtaining a second solid support wherein a second reactant of each reaction is confined to an area on the surface of said second solid support;
and (c) assembling said first and second solid support, wherein said first reactant on said first solid support is in contact with said second reactant on said second solid support, providing an environment for performing said plurality of reactions in parallel.
22. The method according to claim 21 wherein said first or second reactant is a polynucleotide.
23. The method according to claim 21 wherein said first or second reactant is a polypeptide.
24. The method according to claim 21 wherein said first or second reactant is immobilized on either the first or second solid support.
25. The method according to claim 21 wherein said reactions are polynucleotide amplification reactions.
26. The method according to claim 21 wherein said reactions are molecular binding reactions.
27. A method for performing a plurality of polynucleotide amplification reactions, comprising the steps of:
(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each area of said second solid support;
(c) assembling said first and second solid supports, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support; and (d) releasing said primers.
28. A method for performing a plurality of polynucleotide amplification reactions and capturing amplification products, comprising the steps of:
(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each area of said second solid support;
(c) assembling said first and second solid supports, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support;
(d) releasing said primers;
(e) generating amplification products of said polynucleotide amplification reactions; and (f) capturing said amplified products by a plurality of immobilized polynucleotide probes on either said first or second solid support through hybridization.
29. A method for detecting a plurality of polynucleotide sequence variations, comprising the steps of:

(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each area of said second solid support;
(c) assembling said first and second solid support, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support;
(d) releasing said primers;
(e) generating amplification products of said polynucleotide amplification reactions;
(f) capturing said amplified products by a plurality of immobilized polynucleotide probes on either said first or second array through hybridization;
and (g) detecting polynucleotide sequence variations by hybridization complexes in step (f).
30. A method for quantitating polynucleotides in a target nucleic acid, comprising the steps of:
(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of finite areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each area of said second solid support;
(c) assembling said first and second solid support, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support;
(d) releasing said primers;
(e) generating amplification products of said polynucleotide amplification reactions; and (f) quantitating amplified products.
31. A method for detecting polynucleotide sequence variations in a target nucleic acid, comprising the steps of:
(a) obtaining a first solid support wherein a plurality of immobilized moieties are confined to a plurality of areas on the surface of said first solid support and each said immobilized moiety contains a releasable site and a primer;
(b) obtaining a second solid support wherein the surface of said second solid support contains a plurality of areas and reactants of said polynucleotide amplification reactions are confined on each areas of said second solid support;
(c) assembling said first and second solid supports, wherein said reactants of said polynucleotide amplification reactions on said second solid support are in contact with said immobilized moieties on said first solid support;
(d) releasing said primers;
(e) generating amplification products of said polynucleotide amplification reactions; and (f) capturing said amplified products by a plurality of immobilized polynucleotide probes on either first or second array through hybridization;
and (g) detecting polynucleotide sequence variations by a polynucleotide modifying enzyme.
32. A method for amplifying a target nucleic acid, capturing the amplified product, and detecting a polynucleotide sequence variation in the amplified product, comprising the steps of:
(a) obtaining a first solid support wherein:
(1) the surface of said first solid support comprises a first, second, third, and fourth areas;
(2) a first chemical moiety, comprising a releasable forward primer for said target nucleic acid, is immobilized on said first area;
(3) a second chemical moiety, comprising a releasable reverse primer for said target nucleic acid, is immobilized on said second area;
(4) a first polynucleotide probe, comprising a subsequence complementary to one variant of said polynucleotide variation, is immobilized on said third area, said subsequence containing at least one interrogation position complementary to a corresponding nucleotide in said variant; and (5) a second polynucleotide probe is immobilized to said fourth area, said second polynucleotide probe differing from said first polynucleotide probe by at least one nucleotide;
(b) obtaining a second solid support wherein the surface of said solid support comprises a reaction well and a mixture of reactants comprising a DNA
polymerase, said target nucleic acid, and deoxynucleotides are placed within said reaction well;
(c) assembling said first and second solid support, wherein said mixture of reactants are in contact with said first, second, third, and fourth areas on said first solid support;
(d) releasing said releasable forward and reverse primers;
(e) generating the amplified product for said target nucleic acid;
(f) capturing the amplified product by said first or second polynucleotide probe through hybridization;
(g) disassembling said first and second solid supports;
(h) washing said first solid support;
(i) comparing the relative binding of two probes on said first solid support;
and (j) identifying said polynucleotide variation in the amplified product.
33. A method for amplifying a target nucleic acid, capturing the amplified product, and detecting a polynucleotide sequence variation in the amplified product, comprising the steps of:
(a) obtaining a first solid support wherein:
(1) the surface of said first array comprises a first, second, third, and fourth areas;
(2) a first chemical moiety, comprising a releasable forward primer specific for said region of said target nucleic acid, is immobilized on said first area;
(3) a second chemical moiety, comprising a releasable reverse primer specific for said region of said target nucleic acid, is immobilized on said second area;
(4) a first polynucleotide probe, comprising a subsequence complementary to one variant of said polynucleotide variation, is immobilized on said third area, said subsequence containing at least one interrogation position complementary to a corresponding nucleotide in said variant; and (5) a second polynucleotide probe is immobilized to said fourth area, said second probe differing from said first probe by at least one nucleotide;
(b) obtaining a second solid support wherein the surface of said solid support comprises a reaction well and a mixture of reactants comprising a DNA
polymerase, said target nucleic acid, and deoxynucleotides are placed within said reaction well;
(c) assembling said first and second solid support, wherein said mixture of reactants are in contact with said first, second, third, and fourth areas on said first solid support;
(d) releasing said releasable forward and reverse primers;
(e) generating the amplified product for said target nucleic acid;
(f) capturing the amplified product by said first or second polynucleotide probes through hybridization;
(g) extending said one or more hybridization complexes in step (f);
(h) disassembling said first and second solid support;
(i) washing said first solid support; and (j) identifying said polynucleotide variation using said one or more extended products in step (g).
34. The method according to any one of the claims 21-33 wherein said areas on the surface of said first solid support are hydrophilic areas.
35. The method according to any one of the claims 21-33 wherein the density of areas on said first solid support is between about 10 to 10,000 per cm2.
36. The method according to any one of the claims 21-33 wherein the size of each said area on said first solid support is between about 10 -3 to 5 mm2.
37. The method according to any one of the claims 21-33 wherein the number of areas on said first solid support is between about 10 to 500,000.
38. The method according to any one of the claims 27-33 wherein said immobilized moieties are prepared by in situ synthesis.
39. The method according to any one of the claims 27-33 wherein said immobilized moieties are prepared by spotting.
40. The method according to any one of the claims 27-33 wherein said immobilized moieties are prepared using an ink jet printing like device.
41. The method according to any one of the claims 21-33 wherein each of said plurality of areas on said second solid support is a reaction well.
42. The method according to any one of the claims 27-33 wherein said immobilized moiety on each area of said first solid support in step (a) is a hybridization complex between an immobilized polynucleotide hybridized with a releasable primer for said polynucleotide amplification reactions.
43. The method according to any one of the claims 27-33 wherein said immobilized moiety on each area of said first solid support in step (a) comprises a cleavable site and a releasable primer.
44. The method according to any one of the claims 27-33 wherein said immobilized moiety on each area of said first solid support in step (a) comprises a cleavable site and a releasable primer for said polynucleotide amplification reactions and said cleavable site is cleavable by photolysis.
45. The method according to any one of the claims 27-33 wherein said immobilized moiety on each area of said first solid support comprises a cleavable site and a releasable primer for said polynucleotide amplification reactions and said cleavable site comprises an o-nitrobenzyl linker.
46. The method according to any one of the claims 21-33 wherein said first or second solid support is glass.
CA002386791A 1999-10-08 2000-10-06 Method and apparatus for performing large numbers of reactions using array assembly Abandoned CA2386791A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US15831599P 1999-10-08 1999-10-08
US60/158,315 1999-10-08
PCT/US2000/027872 WO2001027327A2 (en) 1999-10-08 2000-10-06 Method and apparatus for performing large numbers of reactions using array assembly

Publications (1)

Publication Number Publication Date
CA2386791A1 true CA2386791A1 (en) 2001-04-19

Family

ID=22567554

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002386791A Abandoned CA2386791A1 (en) 1999-10-08 2000-10-06 Method and apparatus for performing large numbers of reactions using array assembly

Country Status (5)

Country Link
US (2) US6632641B1 (en)
EP (1) EP1235932A2 (en)
AU (1) AU1075701A (en)
CA (1) CA2386791A1 (en)
WO (1) WO2001027327A2 (en)

Families Citing this family (189)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110028350A1 (en) * 1995-12-15 2011-02-03 Affymetrix, Inc. Photocleavable protecting groups
US6147205A (en) * 1995-12-15 2000-11-14 Affymetrix, Inc. Photocleavable protecting groups and methods for their use
CA2365901A1 (en) * 1999-04-14 2000-10-19 Musc Foundation For Research Development Tissue-specific and pathogen-specific toxic agents and ribozymes
US6642000B1 (en) * 1999-11-12 2003-11-04 University Of Chicago PCR amplification on microarrays of gel immobilized oligonucleotides
US7875442B2 (en) 2000-03-24 2011-01-25 Eppendorf Array Technologies Identification and quantification of a plurality of biological (micro)organisms or their components
US7829313B2 (en) 2000-03-24 2010-11-09 Eppendorf Array Technologies Identification and quantification of a plurality of biological (micro)organisms or their components
AU2001292142A1 (en) * 2000-09-11 2002-03-22 Affymetrix, Inc. Photocleavable protecting groups
EP1332000B1 (en) * 2000-10-30 2012-06-20 Sequenom, Inc. Method for delivery of submicroliter volumes onto a substrate
AU2875602A (en) * 2000-12-07 2002-06-18 Univ Pennsylvania Selection of catalytic nucleic acids targeted to infectious agents
US6977163B1 (en) * 2001-06-13 2005-12-20 Caliper Life Sciences, Inc. Methods and systems for performing multiple reactions by interfacial mixing
WO2003018837A2 (en) * 2001-08-24 2003-03-06 Adnagen Ag Method and diagnostic kit for the molecular diagnosis of pharmacologically relevant genes
US20050112623A1 (en) * 2002-02-18 2005-05-26 Lee Dong S. Bio-cell chip
US7582470B2 (en) 2002-07-31 2009-09-01 Gen-Probe Incorporated Device for amplifying and detecting a target nucleic acid
US7563600B2 (en) 2002-09-12 2009-07-21 Combimatrix Corporation Microarray synthesis and assembly of gene-length polynucleotides
US7080545B2 (en) 2002-10-17 2006-07-25 Advanced Technology Materials, Inc. Apparatus and process for sensing fluoro species in semiconductor processing systems
EP2112229A3 (en) 2002-11-25 2009-12-02 Sequenom, Inc. Methods for identifying risk of breast cancer and treatments thereof
US7879580B2 (en) * 2002-12-10 2011-02-01 Massachusetts Institute Of Technology Methods for high fidelity production of long nucleic acid molecules
US7932025B2 (en) * 2002-12-10 2011-04-26 Massachusetts Institute Of Technology Methods for high fidelity production of long nucleic acid molecules with error control
US20040180368A1 (en) * 2002-12-23 2004-09-16 Affymetrix, Inc. Method for producing a high density nucleic acid array using activators
US7365179B2 (en) * 2003-09-09 2008-04-29 Compass Genetics, Llc Multiplexed analytical platform
EP1670945A2 (en) * 2003-09-19 2006-06-21 Applera Corporation Microplates useful for conducting thermocycled nucleotide amplification
US20080293580A1 (en) * 2003-11-06 2008-11-27 Suk-Wah Tam-Chang Methods for Detecting and Measuring Specific Nucleic Acid Sequences
WO2005056827A1 (en) * 2003-12-12 2005-06-23 Infectio Recherche Inc. System for charge-based detection of nucleic acids
WO2005064333A1 (en) * 2003-12-25 2005-07-14 National Institute Of Advanced Industrial Science And Technology Method of analyzing interaction between protein and sugar chain
EP1733055A4 (en) * 2004-02-27 2009-03-11 Harvard College Polynucleotide synthesis
DE102005052713A1 (en) 2005-11-04 2007-05-16 Clondiag Chip Tech Gmbh Apparatus and method for detecting molecular interactions
DE102004022263A1 (en) * 2004-05-06 2005-12-15 Clondiag Chip Technologies Gmbh Apparatus and method for detecting molecular interactions
EP1659183A1 (en) * 2004-11-18 2006-05-24 Eppendorf Array Technologies Real-time quantification of multiple targets on a micro-array
US8338093B2 (en) * 2004-12-31 2012-12-25 Affymetrix, Inc. Primer array synthesis and validation
US7547775B2 (en) 2004-12-31 2009-06-16 Affymetrix, Inc. Parallel preparation of high fidelity probes in an array format
CA2598670A1 (en) * 2005-02-22 2006-08-31 Arizona Board Of Regents For And On Behalf Of Arizona State University Dna crosslinking for primer extension assays
CA2611671C (en) 2005-06-15 2013-10-08 Callida Genomics, Inc. Single molecule arrays for genetic and chemical analysis
US8597576B2 (en) * 2005-06-23 2013-12-03 National Institute Of Advanced Industrial Science And Technology Analyzer for glycan or complex carbohydrate
GB0514909D0 (en) * 2005-07-20 2005-08-24 Solexa Ltd Methods of nucleic acid amplification and sequencing
EP1788097A1 (en) * 2005-11-18 2007-05-23 Eppendorf Array Technologies SA Identification and quantification of a plurality of nucleic acids in an homogeneous assay combining real-time PCR and hybridisation to an array
EP1788098A1 (en) * 2005-11-18 2007-05-23 Eppendorf Array Technologies SA Design of capture molecules for the detection of amplicons with high sensitivity
AT502823B1 (en) * 2005-11-29 2007-06-15 Seitz Alexander Dr POLYNUCLEOTIDE AMPLIFICATION
EP2035142B1 (en) 2006-05-17 2011-09-21 Eppendorf Array Technologies SA Lid for pcr vessel comprising probes permitting pcr amplification and detection of the pcr product by hybridisation without opening the pcr vessel
CA2652319A1 (en) * 2006-05-17 2007-11-22 Eppendorf Array Technologies S.A. Identification and quantification of a plurality of biological (micro)organisms or their components
JP5258755B2 (en) * 2006-05-17 2013-08-07 エッペンドルフ アレイ テクノロジーズ エス.アー. A reaction chamber for real-time PCR that includes a capture probe and allows detection of PCR products by hybridization without opening the PCR chamber
WO2007136834A2 (en) * 2006-05-19 2007-11-29 Codon Devices, Inc. Combined extension and ligation for nucleic acid assembly
EP2029777B1 (en) 2006-05-31 2017-03-08 Sequenom, Inc. Methods and compositions for the extraction of nucleic acid from a sample
EP2035439A4 (en) 2006-06-05 2010-01-13 Cancer Care Ontario Assessment of risk for colorectal cancer
US8053191B2 (en) 2006-08-31 2011-11-08 Westend Asset Clearinghouse Company, Llc Iterative nucleic acid assembly using activation of vector-encoded traits
WO2008039445A2 (en) * 2006-09-25 2008-04-03 President And Fellows Of Harvard College Polymorphisms in the human xbp-1 gene are associated with inflammatory bowel disease
EP2081686A4 (en) * 2006-09-29 2010-05-05 Ge Healthcare Bio Sciences Ab Method and device for small scale reactions
US8252558B2 (en) * 2006-10-09 2012-08-28 Oxitec Limited Methods for amplifying and detecting nucleic acid sequences
US20100105025A1 (en) * 2006-10-12 2010-04-29 Engelhard Eric K Devices for generating detectable polymers
BRPI0717634A2 (en) * 2006-10-17 2013-10-29 Koninkl Philips Electronics Nv NUCLEIC ACID AMPLIFICATION AND DETECTION DEVICE, NUCLEIC ACID AMPLIFICATION AND DETECTION SYSTEM, AND REAL-TIME NUCLEIC ACID HYBRIDIZATION METHOD FOR A CATCH PROBE
WO2008098142A2 (en) 2007-02-08 2008-08-14 Sequenom, Inc. Nucleic acid-based tests for rhd typing, gender determination and nucleic acid quantification
AU2008222563A1 (en) 2007-03-05 2008-09-12 Cancer Care Ontario Assessment of risk for colorectal cancer
US8652780B2 (en) 2007-03-26 2014-02-18 Sequenom, Inc. Restriction endonuclease enhanced polymorphic sequence detection
JP5555157B2 (en) * 2007-04-10 2014-07-23 ナノストリング テクノロジーズ, インコーポレイテッド Method and computer system for identifying target-specific sequences for use in nanoreporters
US20090036660A1 (en) * 2007-07-31 2009-02-05 Joel Myerson Methods and compositions for generating mixtures of nucleic acid molecules
US20090075840A1 (en) * 2007-09-18 2009-03-19 Joel Myerson Methods And Compositions For Generating Mixtures Of Nucleic Acid Molecules
US20090142759A1 (en) * 2007-11-29 2009-06-04 Erik Larsson qPCR array with IN SITU primer synthesis
US8592150B2 (en) 2007-12-05 2013-11-26 Complete Genomics, Inc. Methods and compositions for long fragment read sequencing
US8741815B2 (en) 2008-02-19 2014-06-03 Intelligent Bio Systems, Inc. Methods and devices for amplification of nucleic acid
CA2718137A1 (en) 2008-03-26 2009-10-01 Sequenom, Inc. Restriction endonuclease enhanced polymorphic sequence detection
US8476013B2 (en) 2008-09-16 2013-07-02 Sequenom, Inc. Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US8962247B2 (en) 2008-09-16 2015-02-24 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses
WO2010038042A1 (en) * 2008-10-02 2010-04-08 Illumina Cambridge Ltd. Nucleic acid sample enrichment for sequencing applications
US20120071358A1 (en) * 2008-12-04 2012-03-22 Xiaochuan Zhou Fluidic devices and methods for multiplex chemical and biochemical reactions
JP2012517238A (en) 2009-02-11 2012-08-02 カリス エムピーアイ インコーポレイテッド Molecular profiling of tumors
DE102009012169B3 (en) * 2009-03-06 2010-11-04 Albert-Ludwigs-Universität Freiburg Apparatus and method for making a replica or derivative from an array of molecules and applications thereof
EP3211095B1 (en) 2009-04-03 2019-01-02 Sequenom, Inc. Nucleic acid preparation compositions and methods
WO2010127186A1 (en) 2009-04-30 2010-11-04 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
WO2011032994A1 (en) * 2009-09-15 2011-03-24 Universite De Rouen Improved method for a highly sensitive detection and quantification of biomolecules using secondary ion mass spectrometry (sims)
WO2011056688A2 (en) 2009-10-27 2011-05-12 Caris Life Sciences, Inc. Molecular profiling for personalized medicine
US10207240B2 (en) 2009-11-03 2019-02-19 Gen9, Inc. Methods and microfluidic devices for the manipulation of droplets in high fidelity polynucleotide assembly
WO2011066185A1 (en) 2009-11-25 2011-06-03 Gen9, Inc. Microfluidic devices and methods for gene synthesis
ES2577017T3 (en) 2009-12-22 2016-07-12 Sequenom, Inc. Procedures and kits to identify aneuploidy
US9217144B2 (en) 2010-01-07 2015-12-22 Gen9, Inc. Assembly of high fidelity polynucleotides
US20190300945A1 (en) 2010-04-05 2019-10-03 Prognosys Biosciences, Inc. Spatially Encoded Biological Assays
US10787701B2 (en) 2010-04-05 2020-09-29 Prognosys Biosciences, Inc. Spatially encoded biological assays
WO2011127099A1 (en) 2010-04-05 2011-10-13 Prognosys Biosciences, Inc. Spatially encoded biological assays
EP2601307A4 (en) 2010-08-06 2014-01-01 Capitalbio Corp Microarray-based assay integrated with particles for analyzing molecular interactions
WO2012055069A1 (en) 2010-10-27 2012-05-03 Capitalbio Corporation Luminophore-labeled molecules coupled with particles for microarray-based assays
US10457935B2 (en) 2010-11-12 2019-10-29 Gen9, Inc. Protein arrays and methods of using and making the same
EP3360963B1 (en) 2010-11-12 2019-11-06 Gen9, Inc. Methods and devices for nucleic acids synthesis
DE102011010307A1 (en) * 2011-02-03 2012-08-09 Albert-Ludwigs-Universität Freiburg Apparatus and method for producing protein microarrays
WO2012109238A2 (en) 2011-02-07 2012-08-16 President And Fellows Of Harvard College Methods for increasing immune responses using agents that directly bind to and activate ire-1
US20120258871A1 (en) 2011-04-08 2012-10-11 Prognosys Biosciences, Inc. Peptide constructs and assay systems
GB201106254D0 (en) 2011-04-13 2011-05-25 Frisen Jonas Method and product
AU2012300401B2 (en) 2011-08-26 2018-02-08 Gen9, Inc. Compositions and methods for high fidelity assembly of nucleic acids
DE102011054101A1 (en) 2011-09-30 2013-04-04 Albert-Ludwigs-Universität Freiburg Method for the spatial arrangement of sample fragments for amplification and immobilization for further derivatizations
US8987174B2 (en) 2011-10-28 2015-03-24 Prognosys Biosciences, Inc. Methods for manufacturing molecular arrays
EP2820129A1 (en) 2012-03-02 2015-01-07 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
WO2013134774A1 (en) 2012-03-09 2013-09-12 Cornell University Modulation of breast cancer growth by modulation of xbp1 activity
US9150853B2 (en) 2012-03-21 2015-10-06 Gen9, Inc. Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis
WO2013163263A2 (en) 2012-04-24 2013-10-31 Gen9, Inc. Methods for sorting nucleic acids and multiplexed preparative in vitro cloning
KR101184566B1 (en) * 2012-05-11 2012-09-20 케이맥(주) Method for integrated analysis of real-time pcr and dna chip
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
WO2013174942A1 (en) 2012-05-23 2013-11-28 Albert-Ludwigs-Universität Freiburg Device and method for real-time detection of molecular accumulations and/or monitoring the production process of a molecular microarray
CN104685116A (en) 2012-06-25 2015-06-03 Gen9股份有限公司 Methods for nucleic acid assembly and high throughput sequencing
CA2878979C (en) 2012-07-13 2021-09-14 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US9896728B2 (en) 2013-01-29 2018-02-20 Arcticrx Ltd. Method for determining a therapeutic approach for the treatment of age-related macular degeneration (AMD)
US11060145B2 (en) 2013-03-13 2021-07-13 Sequenom, Inc. Methods and compositions for identifying presence or absence of hypermethylation or hypomethylation locus
CA2907050C (en) 2013-03-15 2023-09-26 Prognosys Biosciences, Inc. Methods for detecting peptide/mhc/tcr binding
WO2014210225A1 (en) 2013-06-25 2014-12-31 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US9409139B2 (en) 2013-08-05 2016-08-09 Twist Bioscience Corporation De novo synthesized gene libraries
US9957506B2 (en) 2013-09-25 2018-05-01 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
WO2015070037A2 (en) 2013-11-08 2015-05-14 Prognosys Biosciences, Inc. Polynucleotide conjugates and methods for analyte detection
CN103760355B (en) 2013-12-05 2015-09-16 博奥生物集团有限公司 Micro-array chip detects the particle marker method of nucleotide sequence
US20160115535A1 (en) * 2014-01-28 2016-04-28 The Trustees Of The Stevens Institute Of Technology Gel-Tethering for Integrated Oligonucleotide Amplification and Real-Time Detection
EP3117011B1 (en) 2014-03-13 2020-05-06 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10777320B2 (en) 2014-10-21 2020-09-15 Psomagen, Inc. Method and system for microbiome-derived diagnostics and therapeutics for mental health associated conditions
US10346592B2 (en) 2014-10-21 2019-07-09 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for neurological health issues
AU2015335907A1 (en) 2014-10-21 2017-04-13 Psomagen, Inc. Method and system for microbiome-derived diagnostics and therapeutics
US10409955B2 (en) 2014-10-21 2019-09-10 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for locomotor system conditions
US11783914B2 (en) 2014-10-21 2023-10-10 Psomagen, Inc. Method and system for panel characterizations
US10793907B2 (en) 2014-10-21 2020-10-06 Psomagen, Inc. Method and system for microbiome-derived diagnostics and therapeutics for endocrine system conditions
US10325685B2 (en) 2014-10-21 2019-06-18 uBiome, Inc. Method and system for characterizing diet-related conditions
US10410749B2 (en) 2014-10-21 2019-09-10 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions
US10311973B2 (en) 2014-10-21 2019-06-04 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for autoimmune system conditions
US10073952B2 (en) 2014-10-21 2018-09-11 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for autoimmune system conditions
US9754080B2 (en) 2014-10-21 2017-09-05 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for cardiovascular disease conditions
US9710606B2 (en) 2014-10-21 2017-07-18 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for neurological health issues
US10388407B2 (en) 2014-10-21 2019-08-20 uBiome, Inc. Method and system for characterizing a headache-related condition
US9760676B2 (en) 2014-10-21 2017-09-12 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for endocrine system conditions
US10357157B2 (en) 2014-10-21 2019-07-23 uBiome, Inc. Method and system for microbiome-derived characterization, diagnostics and therapeutics for conditions associated with functional features
US10789334B2 (en) 2014-10-21 2020-09-29 Psomagen, Inc. Method and system for microbial pharmacogenomics
US9758839B2 (en) 2014-10-21 2017-09-12 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for conditions associated with microbiome functional features
US10366793B2 (en) 2014-10-21 2019-07-30 uBiome, Inc. Method and system for characterizing microorganism-related conditions
US10381112B2 (en) 2014-10-21 2019-08-13 uBiome, Inc. Method and system for characterizing allergy-related conditions associated with microorganisms
US10169541B2 (en) 2014-10-21 2019-01-01 uBiome, Inc. Method and systems for characterizing skin related conditions
US10265009B2 (en) 2014-10-21 2019-04-23 uBiome, Inc. Method and system for microbiome-derived diagnostics and therapeutics for conditions associated with microbiome taxonomic features
US10395777B2 (en) 2014-10-21 2019-08-27 uBiome, Inc. Method and system for characterizing microorganism-associated sleep-related conditions
GB201419731D0 (en) * 2014-11-05 2014-12-17 Illumina Cambridge Ltd Sequencing from multiple primers to increase data rate and density
WO2016126987A1 (en) 2015-02-04 2016-08-11 Twist Bioscience Corporation Compositions and methods for synthetic gene assembly
CA2975852A1 (en) 2015-02-04 2016-08-11 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
EP3530752B1 (en) 2015-04-10 2021-03-24 Spatial Transcriptomics AB Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US10246753B2 (en) 2015-04-13 2019-04-02 uBiome, Inc. Method and system for characterizing mouth-associated conditions
US9981239B2 (en) 2015-04-21 2018-05-29 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US10796783B2 (en) 2015-08-18 2020-10-06 Psomagen, Inc. Method and system for multiplex primer design
AU2016324296A1 (en) 2015-09-18 2018-04-12 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
US20170130258A1 (en) * 2015-11-10 2017-05-11 Agilent Technologies, Inc. Multiplex on-array droplet pcr and quantitative pcr
CN115920796A (en) 2015-12-01 2023-04-07 特韦斯特生物科学公司 Functionalized surfaces and preparation thereof
US10192010B1 (en) 2016-05-25 2019-01-29 X Development Llc Simulation of chemical reactions via multiple processing threads
CA3034769A1 (en) 2016-08-22 2018-03-01 Twist Bioscience Corporation De novo synthesized nucleic acid libraries
WO2018057526A2 (en) 2016-09-21 2018-03-29 Twist Bioscience Corporation Nucleic acid based data storage
US10907274B2 (en) 2016-12-16 2021-02-02 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
CN110892485B (en) 2017-02-22 2024-03-22 特韦斯特生物科学公司 Nucleic acid-based data storage
EP3595674A4 (en) 2017-03-15 2020-12-16 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
WO2018231864A1 (en) 2017-06-12 2018-12-20 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US10696965B2 (en) 2017-06-12 2020-06-30 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
EP3681906A4 (en) 2017-09-11 2021-06-09 Twist Bioscience Corporation Gpcr binding proteins and synthesis thereof
GB2583590A (en) 2017-10-20 2020-11-04 Twist Bioscience Corp Heated nanowells for polynucleotide synthesis
KR20200106067A (en) 2018-01-04 2020-09-10 트위스트 바이오사이언스 코포레이션 DNA-based digital information storage
SG11202011467RA (en) 2018-05-18 2020-12-30 Twist Bioscience Corp Polynucleotides, reagents, and methods for nucleic acid hybridization
US11519033B2 (en) 2018-08-28 2022-12-06 10X Genomics, Inc. Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample
MX2021006234A (en) 2018-11-30 2021-09-10 Caris Mpi Inc Next-generation molecular profiling.
EP3894587A1 (en) 2018-12-10 2021-10-20 10X Genomics, Inc. Resolving spatial arrays by proximity-based deconvolution
US11649485B2 (en) 2019-01-06 2023-05-16 10X Genomics, Inc. Generating capture probes for spatial analysis
US11926867B2 (en) 2019-01-06 2024-03-12 10X Genomics, Inc. Generating capture probes for spatial analysis
WO2020176680A1 (en) 2019-02-26 2020-09-03 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
KR20210143766A (en) 2019-02-26 2021-11-29 트위스트 바이오사이언스 코포레이션 Variant Nucleic Acid Libraries for the GLP1 Receptor
WO2020243579A1 (en) 2019-05-30 2020-12-03 10X Genomics, Inc. Methods of detecting spatial heterogeneity of a biological sample
CA3144644A1 (en) 2019-06-21 2020-12-24 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
EP4025711A2 (en) 2019-11-08 2022-07-13 10X Genomics, Inc. Enhancing specificity of analyte binding
WO2021091611A1 (en) 2019-11-08 2021-05-14 10X Genomics, Inc. Spatially-tagged analyte capture agents for analyte multiplexing
IL293489A (en) 2019-12-02 2022-08-01 Caris Mpi Inc Pan-cancer platinum response predictor
EP3891300B1 (en) 2019-12-23 2023-03-29 10X Genomics, Inc. Methods for spatial analysis using rna-templated ligation
US11732299B2 (en) 2020-01-21 2023-08-22 10X Genomics, Inc. Spatial assays with perturbed cells
US11702693B2 (en) 2020-01-21 2023-07-18 10X Genomics, Inc. Methods for printing cells and generating arrays of barcoded cells
US11821035B1 (en) 2020-01-29 2023-11-21 10X Genomics, Inc. Compositions and methods of making gene expression libraries
US11898205B2 (en) 2020-02-03 2024-02-13 10X Genomics, Inc. Increasing capture efficiency of spatial assays
US11732300B2 (en) 2020-02-05 2023-08-22 10X Genomics, Inc. Increasing efficiency of spatial analysis in a biological sample
US11835462B2 (en) 2020-02-11 2023-12-05 10X Genomics, Inc. Methods and compositions for partitioning a biological sample
US11891654B2 (en) 2020-02-24 2024-02-06 10X Genomics, Inc. Methods of making gene expression libraries
US11926863B1 (en) 2020-02-27 2024-03-12 10X Genomics, Inc. Solid state single cell method for analyzing fixed biological cells
US11768175B1 (en) 2020-03-04 2023-09-26 10X Genomics, Inc. Electrophoretic methods for spatial analysis
US20230132088A1 (en) * 2020-03-18 2023-04-27 The Board Of Trustees Of The Leland Stanford Junior University Detection of gene polymorphisms
WO2021216708A1 (en) 2020-04-22 2021-10-28 10X Genomics, Inc. Methods for spatial analysis using targeted rna depletion
WO2021236929A1 (en) 2020-05-22 2021-11-25 10X Genomics, Inc. Simultaneous spatio-temporal measurement of gene expression and cellular activity
WO2021237087A1 (en) 2020-05-22 2021-11-25 10X Genomics, Inc. Spatial analysis to detect sequence variants
WO2021242834A1 (en) 2020-05-26 2021-12-02 10X Genomics, Inc. Method for resetting an array
AU2021283174A1 (en) 2020-06-02 2023-01-05 10X Genomics, Inc. Nucleic acid library methods
WO2021247568A1 (en) 2020-06-02 2021-12-09 10X Genomics, Inc. Spatial trancriptomics for antigen-receptors
EP4162074B1 (en) 2020-06-08 2024-04-24 10X Genomics, Inc. Methods of determining a surgical margin and methods of use thereof
WO2021252591A1 (en) 2020-06-10 2021-12-16 10X Genomics, Inc. Methods for determining a location of an analyte in a biological sample
CN116034166A (en) 2020-06-25 2023-04-28 10X基因组学有限公司 Spatial analysis of DNA methylation
US11761038B1 (en) 2020-07-06 2023-09-19 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
US11926822B1 (en) 2020-09-23 2024-03-12 10X Genomics, Inc. Three-dimensional spatial analysis
US11827935B1 (en) 2020-11-19 2023-11-28 10X Genomics, Inc. Methods for spatial analysis using rolling circle amplification and detection probes
AU2021409136A1 (en) 2020-12-21 2023-06-29 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
EP4301870A1 (en) 2021-03-18 2024-01-10 10X Genomics, Inc. Multiplex capture of gene and protein expression from a biological sample
EP4196605A1 (en) 2021-09-01 2023-06-21 10X Genomics, Inc. Methods, compositions, and kits for blocking a capture probe on a spatial array

Family Cites Families (98)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4834946A (en) * 1987-02-05 1989-05-30 Levin Andrew E Apparatus for blot screening numerous, small volume, antibody solutions
US6287432B1 (en) * 1987-03-13 2001-09-11 The Standard Oil Company Solid multi-component membranes, electrochemical reactor components, electrochemical reactors and use of membranes, reactor components, and reactor for oxidation reactions
US5202231A (en) 1987-04-01 1993-04-13 Drmanac Radoje T Method of sequencing of genomes by hybridization of oligonucleotide probes
US5525464A (en) 1987-04-01 1996-06-11 Hyseq, Inc. Method of sequencing by hybridization of oligonucleotide probes
US6270961B1 (en) 1987-04-01 2001-08-07 Hyseq, Inc. Methods and apparatus for DNA sequencing and DNA identification
US5700637A (en) 1988-05-03 1997-12-23 Isis Innovation Limited Apparatus and method for analyzing polynucleotide sequences and method of generating oligonucleotide arrays
US6054270A (en) 1988-05-03 2000-04-25 Oxford Gene Technology Limited Analying polynucleotide sequences
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US6309822B1 (en) 1989-06-07 2001-10-30 Affymetrix, Inc. Method for comparing copy number of nucleic acid sequences
US5871928A (en) 1989-06-07 1999-02-16 Fodor; Stephen P. A. Methods for nucleic acid analysis
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US6346413B1 (en) 1989-06-07 2002-02-12 Affymetrix, Inc. Polymer arrays
US5744101A (en) 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5143854A (en) 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
CA2066660C (en) 1989-09-15 2002-07-30 Cary Reich Method for achieving epithelialization of synthetic lenses
US5840482A (en) * 1990-10-10 1998-11-24 The Regents Of The University Of California Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ
US5888819A (en) 1991-03-05 1999-03-30 Molecular Tool, Inc. Method for determining nucleotide identity through primer extension
US6004744A (en) 1991-03-05 1999-12-21 Molecular Tool, Inc. Method for determining nucleotide identity through extension of immobilized primer
US5474796A (en) 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
US5846717A (en) 1996-01-24 1998-12-08 Third Wave Technologies, Inc. Detection of nucleic acid sequences by invader-directed cleavage
US5639603A (en) * 1991-09-18 1997-06-17 Affymax Technologies N.V. Synthesizing and screening molecular diversity
WO1993009250A1 (en) * 1991-11-01 1993-05-13 Adelaide Children's Hospital Solid phase amplification process
US5605662A (en) 1993-11-01 1997-02-25 Nanogen, Inc. Active programmable electronic devices for molecular biological analysis and diagnostics
US6017696A (en) * 1993-11-01 2000-01-25 Nanogen, Inc. Methods for electronic stringency control for molecular biological analysis and diagnostics
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
JP3004792B2 (en) * 1992-01-27 2000-01-31 キヤノン株式会社 Color printing method
EP1382386A3 (en) * 1992-02-19 2004-12-01 The Public Health Research Institute Of The City Of New York, Inc. Novel oligonucleotide arrays and their use for sorting, isolating, sequencing, and manipulating nucleic acids
WO1993017136A1 (en) 1992-02-21 1993-09-02 The Dow Chemical Company Fluxless melting and refining of magnesium and/or magnesium alloys
US5650277A (en) 1992-07-02 1997-07-22 Diagenetics Ltd. Method of determining the presence and quantifying the number of di- and trinucleotide repeats
US5710028A (en) 1992-07-02 1998-01-20 Eyal; Nurit Method of quick screening and identification of specific DNA sequences by single nucleotide primer extension and kits therefor
US5288514A (en) 1992-09-14 1994-02-22 The Regents Of The University Of California Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support
US5795714A (en) * 1992-11-06 1998-08-18 Trustees Of Boston University Method for replicating an array of nucleic acid probes
US5556749A (en) 1992-11-12 1996-09-17 Hitachi Chemical Research Center, Inc. Oligoprobe designstation: a computerized method for designing optimal DNA probes
US5547835A (en) 1993-01-07 1996-08-20 Sequenom, Inc. DNA sequencing by mass spectrometry
US5605798A (en) 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US6074823A (en) 1993-03-19 2000-06-13 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
DE4311460A1 (en) 1993-04-08 1994-10-13 Boehringer Mannheim Gmbh Method for the colorimetric determination of an analyte using benzyl alcohol dehydrogenase and a chromogenic redox indicator
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
US5858659A (en) 1995-11-29 1999-01-12 Affymetrix, Inc. Polymorphism detection
US6309823B1 (en) 1993-10-26 2001-10-30 Affymetrix, Inc. Arrays of nucleic acid probes for analyzing biotransformation genes and methods of using the same
EP0730663B1 (en) 1993-10-26 2003-09-24 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
US5571639A (en) 1994-05-24 1996-11-05 Affymax Technologies N.V. Computer-aided engineering system for design of sequence arrays and lithographic masks
AU689924B2 (en) 1994-06-23 1998-04-09 Affymax Technologies N.V. Photolabile compounds and methods for their use
US5679773A (en) 1995-01-17 1997-10-21 Affymax Technologies N.V Reagants and methods for immobilized polymer synthesis and display
US5948693A (en) 1994-09-01 1999-09-07 Wisconsin Alumni Research Foundation Solid phase synthesis of immunosuppressive agents
US5795716A (en) 1994-10-21 1998-08-18 Chee; Mark S. Computer-aided visualization and analysis system for sequence evaluation
US5614608A (en) 1995-01-20 1997-03-25 Selectide Corporation Apparatus and method for multiple synthesis of organic compounds on polymer support
US5922534A (en) * 1995-03-28 1999-07-13 Hewlett-Packard Company Dry biochemical assay plate and method for making the same
US5700642A (en) * 1995-05-22 1997-12-23 Sri International Oligonucleotide sizing using immobilized cleavable primers
US5830655A (en) 1995-05-22 1998-11-03 Sri International Oligonucleotide sizing using cleavable primers
US5545531A (en) * 1995-06-07 1996-08-13 Affymax Technologies N.V. Methods for making a device for concurrently processing multiple biological chip assays
US5640038A (en) 1995-11-22 1997-06-17 Vlsi Technology, Inc. Integrated circuit structure with self-planarized layers
US5985557A (en) 1996-01-24 1999-11-16 Third Wave Technologies, Inc. Invasive cleavage of nucleic acids
US6261797B1 (en) * 1996-01-29 2001-07-17 Stratagene Primer-mediated polynucleotide synthesis and manipulation techniques
AU2537397A (en) 1996-03-22 1997-10-10 Ontogen Corporation Methods for spatially-dispersed positionally-encoded combinatorial library synthesis
US5731152A (en) * 1996-05-13 1998-03-24 Motorola, Inc. Methods and systems for biological reagent placement
US6103479A (en) 1996-05-30 2000-08-15 Cellomics, Inc. Miniaturized cell array methods and apparatus for cell-based screening
EP0912892B1 (en) 1996-05-30 2008-09-17 Cellomics, Inc. Miniaturized cell array methods and apparatus for cell-based screening
US6083762A (en) 1996-05-31 2000-07-04 Packard Instruments Company Microvolume liquid handling system
US6096386A (en) * 1996-09-06 2000-08-01 International Business Machines Corporation Method of oriented depositing chemically defined bodies
US5846943A (en) 1996-11-08 1998-12-08 Synsorb Biotech, Inc. Solid support matricles containing a toxin binding oligosaccharide
US6063769A (en) 1996-11-14 2000-05-16 Synsorb Biotech, Inc. 1-thiogalactose derivatives
NZ332975A (en) 1996-11-15 2001-06-29 Synsorb Biotech Inc Combinatorial synthesis of carbohydrate libraries
AUPO427996A0 (en) 1996-12-20 1997-01-23 Co-Operative Research Centre For Diagnostic Technologies Method for detecting a nucleotide at a specific location within a polynucleotide sequence and apparatus therefor
EP1249705A3 (en) 1996-12-31 2003-11-05 Genometrix Genomics Incorporated Multiplexed molecular analysis apparatus and its fabrication method
US6001311A (en) * 1997-02-05 1999-12-14 Protogene Laboratories, Inc. Apparatus for diverse chemical synthesis using two-dimensional array
AU730100B2 (en) 1997-02-27 2001-02-22 Cellomics, Inc. A system for cell-based screening
US5837860A (en) 1997-03-05 1998-11-17 Molecular Tool, Inc. Covalent attachment of nucleic acid molecules onto solid-phases via disulfide bonds
WO1998038846A2 (en) 1997-03-07 1998-09-11 Affymetrix, Inc. Genetic compositions and methods
JP2001518086A (en) 1997-03-20 2001-10-09 ユニバーシティ オブ ワシントン Solvents, solvent microdroplets, and methods of use for biopolymer synthesis
US6028189A (en) 1997-03-20 2000-02-22 University Of Washington Solvent for oligonucleotide synthesis and methods of use
US6143496A (en) * 1997-04-17 2000-11-07 Cytonix Corporation Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly
WO1998050403A1 (en) 1997-05-05 1998-11-12 Third Wave Technologies,Inc. Target-dependent reactions using structure-bridging oligonucleotides
US5945284A (en) 1997-05-27 1999-08-31 The Perkin-Elmer Corporation Length determination of nucleic acid repeat sequences by discontinuous primer extension
GB9711492D0 (en) * 1997-06-03 1997-07-30 Bp Chem Int Ltd Compounds
US5919626A (en) 1997-06-06 1999-07-06 Orchid Bio Computer, Inc. Attachment of unmodified nucleic acids to silanized solid phase surfaces
US6368799B1 (en) 1997-06-13 2002-04-09 Affymetrix, Inc. Method to detect gene polymorphisms and monitor allelic expression employing a probe array
EP0996500A1 (en) 1997-07-22 2000-05-03 Rapigene, Inc. Apparatus and methods for arraying solution onto a solid support
US6004752A (en) 1997-07-29 1999-12-21 Sarnoff Corporation Solid support with attached molecules
EP1007967A2 (en) 1997-08-04 2000-06-14 Ixsys, Incorporated Methods for identifying ligand specific binding molecules
US6326489B1 (en) 1997-08-05 2001-12-04 Howard Hughes Medical Institute Surface-bound, bimolecular, double-stranded DNA arrays
GB9717173D0 (en) 1997-08-13 1997-10-22 Akzo Nobel Nv Solid phase supports
AU9393798A (en) 1997-09-17 1999-04-05 Affymetrix, Inc. Genetic compositions and methods
US5858653A (en) 1997-09-30 1999-01-12 Surmodics, Inc. Reagent and method for attaching target molecules to a surface
US6242262B1 (en) 1997-10-24 2001-06-05 The University Of North Carolina At Chapel Hill Method and apparatus for screening catalyst libraries
US6322968B1 (en) * 1997-11-21 2001-11-27 Orchid Biosciences, Inc. De novo or “universal” sequencing array
US6238869B1 (en) * 1997-12-19 2001-05-29 High Throughput Genomics, Inc. High throughput assay system
WO1999037812A1 (en) 1998-01-23 1999-07-29 Orchid Biosciences, Inc. Single nucleotide polymorphisms of the uncoupling protein 2 (ucp2) gene
WO1999039004A1 (en) 1998-02-02 1999-08-05 Affymetrix, Inc. Iterative resequencing
WO1999039817A1 (en) 1998-02-06 1999-08-12 Affymetrix, Inc. Method of quality control in manufacturing processes
JP3944996B2 (en) * 1998-03-05 2007-07-18 株式会社日立製作所 DNA probe array
DE19811731A1 (en) * 1998-03-18 1999-09-23 November Ag Molekulare Medizin Detecting nucleic acid by amplification, with use of third, immobilized primer
JP2002512045A (en) 1998-04-20 2002-04-23 アフィメトリックス インコーポレイテッド Methods for reducing non-specific binding to nucleic acid probe arrays
US6218118B1 (en) * 1998-07-09 2001-04-17 Agilent Technologies, Inc. Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry
US6221635B1 (en) * 1999-05-06 2001-04-24 The Wistar Institute Methods for solid-phase amplification of DNA template (SPADT) using multiarrays
US6300070B1 (en) * 1999-06-04 2001-10-09 Mosaic Technologies, Inc. Solid phase methods for amplifying multiple nucleic acids
CA2507189C (en) * 2002-11-27 2018-06-12 Sequenom, Inc. Fragmentation-based methods and systems for sequence variation detection and discovery

Also Published As

Publication number Publication date
WO2001027327A3 (en) 2002-01-10
AU1075701A (en) 2001-04-23
EP1235932A2 (en) 2002-09-04
WO2001027327A2 (en) 2001-04-19
US20030232382A1 (en) 2003-12-18
US6632641B1 (en) 2003-10-14

Similar Documents

Publication Publication Date Title
US6632641B1 (en) Method and apparatus for performing large numbers of reactions using array assembly with releasable primers
US6589726B1 (en) Method and apparatus for in situ synthesis on a solid support
JP4766750B2 (en) Detection of nucleic acid sequence differences using a ligase detection reaction with a positionable array
US6027880A (en) Arrays of nucleic acid probes and methods of using the same for detecting cystic fibrosis
US7556919B2 (en) Long oligonucleotide arrays
Heise et al. Immobilization of DNA on microarrays
JP2003520570A5 (en)
US20030032035A1 (en) Microfluidic device for analyzing nucleic acids and/or proteins, methods of preparation and uses thereof
CA2402525A1 (en) Compositions and methods for detecting and quantifying gene expression
JP2005519643A (en) Exponential amplification of nucleic acids using nicking agents
WO2000011223A1 (en) Use of pooled probes in genetic analysis
WO2001066804A2 (en) Methods for optimizing hybridization performance of polynucleotide probes and localizing and detecting sequence variations
EP1612277B1 (en) Method for noncovalently immobilizing a biomolecule on a solid substrate and microarray produced according to the method
US20070190537A1 (en) Solid phase synthesis
Seliger et al. Arrays of immobilized oligonucleotides-contributions to nucleic acids technology
US6489466B2 (en) C-3′ protected monomeric nucleotides and synthesis of oligonucleotides on solid support
Costa et al. Fabrication of Inverted High-Density DNA Microarrays in a Hydrogel
JP2004510147A (en) High density array
US20020172960A1 (en) DNA microarrays of networked oligonucleotides
Takahashii et al. A photochemical/chemical direct method of synthesizing high-performance deoxyribonucleic acid chips for rapid and parallel gene analysis
US20090142759A1 (en) qPCR array with IN SITU primer synthesis
US20210032776A1 (en) Method and system for fabricating dna sequencing arrays
LeProust Parallel synthesis of oligonucleotide microarrays using photogenerated acids and digital photolithography, and investigation of DNA synthesis fidelity on flat solid surfaces
McGall et al. High-density oligonucleotide probe arrays
Nguyen et al. DNA Microarray Applications

Legal Events

Date Code Title Description
FZDE Discontinued