CA2366778C - Methods for detecting nucleic acids indicative of cancer - Google Patents
Methods for detecting nucleic acids indicative of cancer Download PDFInfo
- Publication number
- CA2366778C CA2366778C CA002366778A CA2366778A CA2366778C CA 2366778 C CA2366778 C CA 2366778C CA 002366778 A CA002366778 A CA 002366778A CA 2366778 A CA2366778 A CA 2366778A CA 2366778 C CA2366778 C CA 2366778C
- Authority
- CA
- Canada
- Prior art keywords
- nucleic acid
- amount
- cancer
- sample
- length
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57419—Specifically defined cancers of colon
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57473—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving carcinoembryonic antigen, i.e. CEA
Abstract
The invention provides methods for screening tissue or body fluid samples fo r nucleic acid indicia of cancer or precancer.
Description
METHODS FOR DETECTING NUCLEIC ACIDS INDICATIVE OF CANCER
FIELD OF THE INVENTION
This invention relates to methods for the early detection of cancer in patients by screening for large DNA fragments. Methods of the invention are especially useful in the detection of colon cancer.
BACKGROUND OF THE INVENTION
Alterations in genomic integrity often are associated with disease or with the propensity for disease. For example, many cancers are thought to arise through a series of mutations in genomic DNA, resulting in genomic instability in the form of uncontrolled cellular growth. In normal cells, damage to genomic DNA typically leads to io expression of tumor suppressors, such as the cell-cycle regulator, p53. For example, damage to cellular DNA results in increased expression of p53 which arrests the cell cycle to allow repair of the damage. If the damaged DNA cannot be repaired, the cell undergoes apoptosis, thus preventing the accumulation of additional mutations in daughter cells. If however, there is a mutation in the p53 gene itself (or in another cell cycle regulator), damaged cells will proceed through the cell cycle, giving rise to progeny in which additional DNA mutations will go unchecked. It is the accumulation of these mutations that is the hallmark of many cancers.
The process of apoptosis is important not only in the regulation of cellular metabolism, but also in inhibiting oncogenesis. As cells undergo apoptosis, the nucleus 2o becomes small and fragmented. Nuclear DNA is digested into spindle fragments that are generally no larger than about 200 base pairs. As the process continues, usually through multiple pathways, the cell membrane breaks down, and cellular contents are metabolized. As a result, cells that have the potential to enter the multi-step pathway leading to cancer are eliminated.
Many cancers are curable if detected early in their development. For example, colorectal cancers typically originate in the colonic epithelium, and are not extensively vascularized (and therefore not invasive) during early stages of development.
The transition to a highly-vascularized, invasive and ultimately metastatic cancer commonly takes ten years or longer. If the presence of cancer is detected prior to extensive vascularization, surgical removal typically is an effective cure. However, colorectal cancer is often detected only upon manifestation of clinical symptoms, such as pain and black tarry stool. Generally, such symptoms are present only when the disease is well established, and often after metastasis has occurred. Early detection of colorectal cancer therefore is important in order to significantly reduce its morbidity.
lnvasive diagnostic methods, such as endoscopic examination, allow direct visual identification, removal, and biopsy of potentially-cancerous tissue.
Endoscopy is expensive, uncomfortable, inherently risky, and not a practical tool for early diagnosis.
Established non-invasive screening methods involve assaying stool samples for the presence of fecal occult blood or for elevated levels of carcinoembryonic antigen, =
both of which are suggestive of the presence of colorectal cancer.
Additionally, recent deveiopments In molecular biology provide methods of great potential for detecting the presence of a range of DNA mutations indicative of colorectal cancer. The presence of such mutations can be detected in DNA found in stool samples during various stages of colorectal cancer. However, stool comprises cells and cellular debris from the patient, from microorganisms, and from food, resulting in a heterogeneous population of cells.
This makes detection of small, specific subpopulations difficult to detect reliably.
There is a need in the art for additional non-invasive methods for early diagnosis of cancer that will detect characteristics indicative of the presence of cancer.
SUMMARY OF THE INVENTION
The present invention provides methods for identifying indicia of cancer in tissue or body fluid samples by identifying non-apoptotic DNA in those samples. The invention also provides methods for identifying indicia of cancer or precancer in samples containing exfoliated epithelial cells.
More particularly, the present invention provides the following method:
- a method for screening a patient for cancer or precancer, the method comprising the steps of:
detecting in a patient stool, pus or urine sample comprising exfoliated cells and cellular debris, a long nucleic acid that is greater than 200 base pairs in length, wherein a fragment of said long nucleic acid having - 2a -a length less that 200 base pairs in length is expected to be present in a stool, pus or urine sample form a healthy patient;
the presence of said long nucleic acid being indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer;
- a method for screening a patient for cancer or precancer, the method comprising the steps of:
(a) detecting in a patient stool, pus or urine sample a first amount of a long nucleic acid that is greater than 200 base pairs in length;
(b) detecting in said sample a second amount of nucleic acid fragments less than about 200 base pairs in length;
(c) determining a ratio between said first amount and said second amount in said patient sample;
(d) detecting in a population of stool, pus or urine samples from normal patients the first amount of said long nucleic acid fragment greater than 200 base pairs in length;
(e) detecting in said population of samples from normal patients the second amount of nucleic acid fragments less than about 200 base pairs in length;
(f) identifying a threshold ratio between said first amount and said second amount in said population of samples from normal patients; and (g) comparing the ratio determined in step (c) with the threshold ratio identified in step (f), wherein a ratio in step (c) that is larger than the threshold ratio in step (f) is indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer;
- a method for screening a patient for cancer or precancer, the method comprising the steps of:
- 2b -(a) detecting in a patient stool, pus or urine sample a first amount of a long nucleic acid that is greater than 200 base pairs in length;
(b) detecting in said sample a second amount of nucleic acid fragments less than about 200 base pairs in length;
(c) determining a ratio between said first amount and said second amount in said patient sample;
(d) detecting in a population of stool, pus or urine samples from normal patients the first amount of said long nucleic acid fragment greater than 200 base pairs in length;
(e) detecting in said population of samples from normal patients the second amount of nucleic acid fragments less than about 200 base pairs in length;
(f) identifying a threshold ratio between said first amount and said second amount in said population of samples from normal patients; and (g) comparing the ratio determined in step (c) with the threshold ratio identified in step (f), wherein a ratio in step (c) that is larger than the threshold ratio in step (f) is indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer.
It has now been recognized that DNA obtained from exfoliated normal (non-cancerous) cells is different than DNA obtained from exfoliated cancer or precancer cells. Normal exfoliated cells typically have undergone apoptosis, and thus produce cells or cellular debris (depending upon the stage of apoptosis) comprising DNA that has been substantially degraded. Exfoliated cancer or precancer cells typically have not undergone apoptosis, and such cells or their debris, while producing some very small fragments as a result of degradation in the sample, typically also contain a higher proportion of large DNA fragments (compared to those observed in cells or debris from exfoliated normal cells).
The difference in DNA integrity between normal and abnormal cells is a marker for the presence of cancer or precancer in a sample comprising exfoliated cells.
Stool is a good sample for exemplification of methods of the invention. The colonic epithelium undergoes a continual process of exfoliation. Normal epithelial cells undergo apoptosis, and are sloughed into the lumen of the colon, and onto forming stool. Cells from polyps and tumors are also sloughed onto forming stool.
However, cells from polyps or tumors are, by definition, not apoptotic. Methods of the invention take advantage of the different characteristics between apoptotic and non-apoptotic io cells in order to screen patient samples for indicia of cancer or precancer.
As noted above, non-cancerous (normal) cells undergo apoptosis at regular intervals, or in response to irreparable cell damage. As a result of apoptosis, DNA from normal cells is cleaved into small fragments having about 200 or fewer base pairs, and typically 180 base pairs or less. In contrast, DNA obtained from cancer or precancer cells is much larger than the typical apoptotic fragments. Thus, the presence of large DNA fragments in a sample (e.g., of sloughed colonic epithelium) indicates that there are or were cells in the sample (or the specimen from which it was obtained) that have avoided apoptosis, and its coincidental degradation of DNA. The presence of large DNA fragments represents a positive screen for cancer or precancer.
Accordingly, methods of the invention comprise detecting the presence in a biological sample of species-specific nucleic acids indicative of cancer or precaner.
Samples comprising such nucleic acids are identified as having indicia of cancer or precancer. In preferred methods, patients presenting samples having a high proportion of non-apoptotic nucleic acids as determined by methods of the invention are further evaluated for the presence of a tumor, adenoma, or other cancerous or precancerous lesion.
In general, methods of the invention comprise detecting in a biological sample one or more DNA fragment(s) of a length that would not be substantially present in noncancerous cells or cellular debris. In a preferred embodiment, such fragments are larger than a typical apoptotic spindle fragment, or larger than about 170 base pairs.
However, also in a preferred embodiment, methods of the invention comprise detecting DNA fragments that are greater than about 200 base pairs, and preferably greater than about 500 base pairs. There is no upper limit on these fragments, as all that is necessary is that the fragment be larger than an apoptotic fragment.
Typically, however, fragments indicative of cancer or precancer cells are between about 200 and about 3500 base pairs, and ideally between about 500 and about 2500 base pairs.
Accordingly, in a preferred embodiment, methods of the invention comprise detecting in a tissue or body fluid sample the presence of nucleic acid fragments having greater than about 500 base pairs or having a molecular weight corresponding to greater than about 500 base pairs. In other preferred embodiments, methods of the invention comprise detecting nucleic acid fragments having between about 200 and about 1000 base pairs, preferably between about 200 and about 600 base pairs, and most preferably about 500 base pairs.
Also in a preferred embodiment, methods of the invention comprise determining a ratio of large fragments (200-3500 bp) to small fragments (less than 200 bp), and determining whether the ratio exceeds an empirically-derived threshold. The threshold is determined empirically by analyzing ratios of large-to-small fragments, and corretating those ratios with the disease state of a selected population of normal and cancer patients. In preferred embodiments, amounts of large and small fragments are determined by polymerase chain reaction amplification of sample DNA using primers selected to amplify long and short fragments. Attematively, amounts of large and small fragments are determined using the same primer.
Preferred methods of the invention comprise ampl'ifying nucleic acids in a representative stooi sample using human-specific primers, and detecting amplicons having greater than about 200, and preferably about 500 or more base pairs. ln a highly-preferred embodiment. amplification is accomplished by polymerase chain reaction (PCR) using forward and reverse primers directed against human-specific nucleic acid fragments, and spaced apart to provide a lower limit on the resulting amplicons. Also in a highly-preferred embodiment, primers for PCR are directed against human oncogene or tumor suppressor sequences. Preferred target nucleic acids for PCR primers include p53, Kras, apc, dcc, and other genes known or suspected to be associated with cancer, and especially colorectal cancer.
Methods for conducting PCR are provided in U.S. Patent No. 4,683,202 .
The presence of amplicon greater than about 200 base pairs in length is indicative of template nucleic acid in the sample of that length (or longer).
According to methods of the invention such long sequences represent a positive screen, and are indicative of cancer or precancer.
Preferred biological samples include stool, pus and urine. Method of the inventions are especially useful for the detection of large DNA fragments in samples comprising exfoliate. Tissue (e.g., colon, lungs, bladder) -in which cells, especially epithelial cells, are exfoliated are most preferred for screening methods of the invention.
In such tissues, continuing cellular renewal requires that cells are regularly sloughed after having undergone apoptosis. Samples of the exfoliate (tissue or body fluid containing the exfoliated cells) predominantly comprise apoptotic DNA.
Preferred methods of the invention for use on a stool sample comprise obtaining a representative stool sample. An especially-preferred method for preparing a stool sample is disclosed in U.S. Patent No. 5,741,650, and in co-owned, co-pending U.S.
patent application No. 09/059,713, ncw issued as U.S. Patent no. 5,952,178.
In a preferred embodiment, methods of the invention comprise homogenizing a representative stool sample in a solvent in order to form a homogenized sample mixture having a solvent volume to stool mass ratio of at least 5 to 1. An especially-preferred ratio of solvent volume to stool mass is about 20:1. A preferred solvent for preparing stool samples according to the invention is a physiologically-compatible buffer comprising a detergent and a proteinase and optionally a DNase inhibitor, such as a buffer comprising Tris-EDTA-NaCI. A preferred buffer is 50 mM Tris, 150 mM
EDTA
and 10 mM NaCI at pH 9Ø Another preferred solvent is guanidine isothiocyanate (GITC). Providing an optimal solvent volume to stool mass ratio increases the yield of nucleic acid generally from the sample. Further details regarding sample preparation are disclosed in co-owned, co-pending U.S. Patent Application No. 09/198,883, riow issuecl as U.S. Paternt no. 6,268,136.
Preferred methods of the invention further comprise enriching sample for human DNA. Preferred enrichment methods for use in the invention include enriching a desired human target sequence using an affinity column, sequence-specific capture, or through the use of preferred buffers that bias isolation of human DNA. A
preferred enrichment method is based upon the capture of unique'human nucleic acids using, for example, an affinity column. Details of such methods are provided below.
In a preferred embodiment, methods further comprise the step of extracting DNA
from the homogenized sample mixture using sequence-specific nucleic acid probes.
FIELD OF THE INVENTION
This invention relates to methods for the early detection of cancer in patients by screening for large DNA fragments. Methods of the invention are especially useful in the detection of colon cancer.
BACKGROUND OF THE INVENTION
Alterations in genomic integrity often are associated with disease or with the propensity for disease. For example, many cancers are thought to arise through a series of mutations in genomic DNA, resulting in genomic instability in the form of uncontrolled cellular growth. In normal cells, damage to genomic DNA typically leads to io expression of tumor suppressors, such as the cell-cycle regulator, p53. For example, damage to cellular DNA results in increased expression of p53 which arrests the cell cycle to allow repair of the damage. If the damaged DNA cannot be repaired, the cell undergoes apoptosis, thus preventing the accumulation of additional mutations in daughter cells. If however, there is a mutation in the p53 gene itself (or in another cell cycle regulator), damaged cells will proceed through the cell cycle, giving rise to progeny in which additional DNA mutations will go unchecked. It is the accumulation of these mutations that is the hallmark of many cancers.
The process of apoptosis is important not only in the regulation of cellular metabolism, but also in inhibiting oncogenesis. As cells undergo apoptosis, the nucleus 2o becomes small and fragmented. Nuclear DNA is digested into spindle fragments that are generally no larger than about 200 base pairs. As the process continues, usually through multiple pathways, the cell membrane breaks down, and cellular contents are metabolized. As a result, cells that have the potential to enter the multi-step pathway leading to cancer are eliminated.
Many cancers are curable if detected early in their development. For example, colorectal cancers typically originate in the colonic epithelium, and are not extensively vascularized (and therefore not invasive) during early stages of development.
The transition to a highly-vascularized, invasive and ultimately metastatic cancer commonly takes ten years or longer. If the presence of cancer is detected prior to extensive vascularization, surgical removal typically is an effective cure. However, colorectal cancer is often detected only upon manifestation of clinical symptoms, such as pain and black tarry stool. Generally, such symptoms are present only when the disease is well established, and often after metastasis has occurred. Early detection of colorectal cancer therefore is important in order to significantly reduce its morbidity.
lnvasive diagnostic methods, such as endoscopic examination, allow direct visual identification, removal, and biopsy of potentially-cancerous tissue.
Endoscopy is expensive, uncomfortable, inherently risky, and not a practical tool for early diagnosis.
Established non-invasive screening methods involve assaying stool samples for the presence of fecal occult blood or for elevated levels of carcinoembryonic antigen, =
both of which are suggestive of the presence of colorectal cancer.
Additionally, recent deveiopments In molecular biology provide methods of great potential for detecting the presence of a range of DNA mutations indicative of colorectal cancer. The presence of such mutations can be detected in DNA found in stool samples during various stages of colorectal cancer. However, stool comprises cells and cellular debris from the patient, from microorganisms, and from food, resulting in a heterogeneous population of cells.
This makes detection of small, specific subpopulations difficult to detect reliably.
There is a need in the art for additional non-invasive methods for early diagnosis of cancer that will detect characteristics indicative of the presence of cancer.
SUMMARY OF THE INVENTION
The present invention provides methods for identifying indicia of cancer in tissue or body fluid samples by identifying non-apoptotic DNA in those samples. The invention also provides methods for identifying indicia of cancer or precancer in samples containing exfoliated epithelial cells.
More particularly, the present invention provides the following method:
- a method for screening a patient for cancer or precancer, the method comprising the steps of:
detecting in a patient stool, pus or urine sample comprising exfoliated cells and cellular debris, a long nucleic acid that is greater than 200 base pairs in length, wherein a fragment of said long nucleic acid having - 2a -a length less that 200 base pairs in length is expected to be present in a stool, pus or urine sample form a healthy patient;
the presence of said long nucleic acid being indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer;
- a method for screening a patient for cancer or precancer, the method comprising the steps of:
(a) detecting in a patient stool, pus or urine sample a first amount of a long nucleic acid that is greater than 200 base pairs in length;
(b) detecting in said sample a second amount of nucleic acid fragments less than about 200 base pairs in length;
(c) determining a ratio between said first amount and said second amount in said patient sample;
(d) detecting in a population of stool, pus or urine samples from normal patients the first amount of said long nucleic acid fragment greater than 200 base pairs in length;
(e) detecting in said population of samples from normal patients the second amount of nucleic acid fragments less than about 200 base pairs in length;
(f) identifying a threshold ratio between said first amount and said second amount in said population of samples from normal patients; and (g) comparing the ratio determined in step (c) with the threshold ratio identified in step (f), wherein a ratio in step (c) that is larger than the threshold ratio in step (f) is indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer;
- a method for screening a patient for cancer or precancer, the method comprising the steps of:
- 2b -(a) detecting in a patient stool, pus or urine sample a first amount of a long nucleic acid that is greater than 200 base pairs in length;
(b) detecting in said sample a second amount of nucleic acid fragments less than about 200 base pairs in length;
(c) determining a ratio between said first amount and said second amount in said patient sample;
(d) detecting in a population of stool, pus or urine samples from normal patients the first amount of said long nucleic acid fragment greater than 200 base pairs in length;
(e) detecting in said population of samples from normal patients the second amount of nucleic acid fragments less than about 200 base pairs in length;
(f) identifying a threshold ratio between said first amount and said second amount in said population of samples from normal patients; and (g) comparing the ratio determined in step (c) with the threshold ratio identified in step (f), wherein a ratio in step (c) that is larger than the threshold ratio in step (f) is indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer.
It has now been recognized that DNA obtained from exfoliated normal (non-cancerous) cells is different than DNA obtained from exfoliated cancer or precancer cells. Normal exfoliated cells typically have undergone apoptosis, and thus produce cells or cellular debris (depending upon the stage of apoptosis) comprising DNA that has been substantially degraded. Exfoliated cancer or precancer cells typically have not undergone apoptosis, and such cells or their debris, while producing some very small fragments as a result of degradation in the sample, typically also contain a higher proportion of large DNA fragments (compared to those observed in cells or debris from exfoliated normal cells).
The difference in DNA integrity between normal and abnormal cells is a marker for the presence of cancer or precancer in a sample comprising exfoliated cells.
Stool is a good sample for exemplification of methods of the invention. The colonic epithelium undergoes a continual process of exfoliation. Normal epithelial cells undergo apoptosis, and are sloughed into the lumen of the colon, and onto forming stool. Cells from polyps and tumors are also sloughed onto forming stool.
However, cells from polyps or tumors are, by definition, not apoptotic. Methods of the invention take advantage of the different characteristics between apoptotic and non-apoptotic io cells in order to screen patient samples for indicia of cancer or precancer.
As noted above, non-cancerous (normal) cells undergo apoptosis at regular intervals, or in response to irreparable cell damage. As a result of apoptosis, DNA from normal cells is cleaved into small fragments having about 200 or fewer base pairs, and typically 180 base pairs or less. In contrast, DNA obtained from cancer or precancer cells is much larger than the typical apoptotic fragments. Thus, the presence of large DNA fragments in a sample (e.g., of sloughed colonic epithelium) indicates that there are or were cells in the sample (or the specimen from which it was obtained) that have avoided apoptosis, and its coincidental degradation of DNA. The presence of large DNA fragments represents a positive screen for cancer or precancer.
Accordingly, methods of the invention comprise detecting the presence in a biological sample of species-specific nucleic acids indicative of cancer or precaner.
Samples comprising such nucleic acids are identified as having indicia of cancer or precancer. In preferred methods, patients presenting samples having a high proportion of non-apoptotic nucleic acids as determined by methods of the invention are further evaluated for the presence of a tumor, adenoma, or other cancerous or precancerous lesion.
In general, methods of the invention comprise detecting in a biological sample one or more DNA fragment(s) of a length that would not be substantially present in noncancerous cells or cellular debris. In a preferred embodiment, such fragments are larger than a typical apoptotic spindle fragment, or larger than about 170 base pairs.
However, also in a preferred embodiment, methods of the invention comprise detecting DNA fragments that are greater than about 200 base pairs, and preferably greater than about 500 base pairs. There is no upper limit on these fragments, as all that is necessary is that the fragment be larger than an apoptotic fragment.
Typically, however, fragments indicative of cancer or precancer cells are between about 200 and about 3500 base pairs, and ideally between about 500 and about 2500 base pairs.
Accordingly, in a preferred embodiment, methods of the invention comprise detecting in a tissue or body fluid sample the presence of nucleic acid fragments having greater than about 500 base pairs or having a molecular weight corresponding to greater than about 500 base pairs. In other preferred embodiments, methods of the invention comprise detecting nucleic acid fragments having between about 200 and about 1000 base pairs, preferably between about 200 and about 600 base pairs, and most preferably about 500 base pairs.
Also in a preferred embodiment, methods of the invention comprise determining a ratio of large fragments (200-3500 bp) to small fragments (less than 200 bp), and determining whether the ratio exceeds an empirically-derived threshold. The threshold is determined empirically by analyzing ratios of large-to-small fragments, and corretating those ratios with the disease state of a selected population of normal and cancer patients. In preferred embodiments, amounts of large and small fragments are determined by polymerase chain reaction amplification of sample DNA using primers selected to amplify long and short fragments. Attematively, amounts of large and small fragments are determined using the same primer.
Preferred methods of the invention comprise ampl'ifying nucleic acids in a representative stooi sample using human-specific primers, and detecting amplicons having greater than about 200, and preferably about 500 or more base pairs. ln a highly-preferred embodiment. amplification is accomplished by polymerase chain reaction (PCR) using forward and reverse primers directed against human-specific nucleic acid fragments, and spaced apart to provide a lower limit on the resulting amplicons. Also in a highly-preferred embodiment, primers for PCR are directed against human oncogene or tumor suppressor sequences. Preferred target nucleic acids for PCR primers include p53, Kras, apc, dcc, and other genes known or suspected to be associated with cancer, and especially colorectal cancer.
Methods for conducting PCR are provided in U.S. Patent No. 4,683,202 .
The presence of amplicon greater than about 200 base pairs in length is indicative of template nucleic acid in the sample of that length (or longer).
According to methods of the invention such long sequences represent a positive screen, and are indicative of cancer or precancer.
Preferred biological samples include stool, pus and urine. Method of the inventions are especially useful for the detection of large DNA fragments in samples comprising exfoliate. Tissue (e.g., colon, lungs, bladder) -in which cells, especially epithelial cells, are exfoliated are most preferred for screening methods of the invention.
In such tissues, continuing cellular renewal requires that cells are regularly sloughed after having undergone apoptosis. Samples of the exfoliate (tissue or body fluid containing the exfoliated cells) predominantly comprise apoptotic DNA.
Preferred methods of the invention for use on a stool sample comprise obtaining a representative stool sample. An especially-preferred method for preparing a stool sample is disclosed in U.S. Patent No. 5,741,650, and in co-owned, co-pending U.S.
patent application No. 09/059,713, ncw issued as U.S. Patent no. 5,952,178.
In a preferred embodiment, methods of the invention comprise homogenizing a representative stool sample in a solvent in order to form a homogenized sample mixture having a solvent volume to stool mass ratio of at least 5 to 1. An especially-preferred ratio of solvent volume to stool mass is about 20:1. A preferred solvent for preparing stool samples according to the invention is a physiologically-compatible buffer comprising a detergent and a proteinase and optionally a DNase inhibitor, such as a buffer comprising Tris-EDTA-NaCI. A preferred buffer is 50 mM Tris, 150 mM
EDTA
and 10 mM NaCI at pH 9Ø Another preferred solvent is guanidine isothiocyanate (GITC). Providing an optimal solvent volume to stool mass ratio increases the yield of nucleic acid generally from the sample. Further details regarding sample preparation are disclosed in co-owned, co-pending U.S. Patent Application No. 09/198,883, riow issuecl as U.S. Paternt no. 6,268,136.
Preferred methods of the invention further comprise enriching sample for human DNA. Preferred enrichment methods for use in the invention include enriching a desired human target sequence using an affinity column, sequence-specific capture, or through the use of preferred buffers that bias isolation of human DNA. A
preferred enrichment method is based upon the capture of unique'human nucleic acids using, for example, an affinity column. Details of such methods are provided below.
In a preferred embodiment, methods further comprise the step of extracting DNA
from the homogenized sample mixture using sequence-specific nucleic acid probes.
Particularly preferred are probes hybridizing to human DNA. The probes are preferably labeled. Preferred labels include radioactive labels, fluorescent labels, molecular weight labels and enzymatic labels. Other labels are well known in the art.
In a preferred embodiment gel electrophoresis, affinity chromatography, or mass spectrometry are used to detect large DNA fragments (fragments comprising greater than about 200 base pairs). The presence of large DNA fragments in the sample is indicative of colorectal cancer.
In a preferred embodiment capture probes comprise DNA, RNA or PNA, and are detectably labeled using methods known in the art. In one embodiment probes are io labeled with radioactive isotopes such as 32P, 33p, 35S,'251, or any other detectable isotope useful for labeling a hybridization probe. In an another embodiment, probes are labeled with fluorescent molecules. Numerous fluorescent labels are known in the art, and any detectable fluorescent probe label is useful for practice of the invention.
Alternatively, probes are attached to moieties which increase their molecular weight.
For example a probe may be directly attached to a glycoprotein, or a glass bead, or any compound which has a detectable effect on the molecular weight of the probe.
In a further embodiment, probes are labeled with a compound that is detectable due to specific interactions with an additional compound. For example, biotinylated probes are detectable via interaction with streptavidin. The streptavidin moiety is attached to a 2o detectable label such as a bead, a fluorescent tag, or an enzyme. In another example, the probes are labeled with a hapten or other antigen which is specifically recognized by an antibody. The antibody is made detectable using methods known in the art including radioactive isotopes, fluorescent tags, and enzyme reactions. In a further example the probes are directly attached to an enzyme which is detectable via a specific enzyme catalyzed reaction generating a detectable product.
Finally, methods of the invention allow one to approximate the position in the colon of a colorectal lesion based upon the relative amount of DNA fragments in a stool sample that are greater than 200 base pairs in length. This aspect of the invention relies on the fact that the lytic properties of stool are greater in the proximal colon than they are in the distal colon. In the proximal colon, stool is typically in liquid form.
Therefore, the cell lysis and DNA degrading enzymes in the colon have greater access to exfoliated cells in the liquid mixture of the proximal colon as compared to their access to exfoliated cells sloughed onto formed or forming stool that is typical in the distal colon. As a consequence of the differences between the environments of the proximal and distal colon, the present invention provides that typical DNA
fragments from cells exfoliated into the proximal colon are smaller than DNA fragments from cells exfoliated into the distal colon. Figure 1 provides an example of the progression of DNA sizes expected for cancer or precancer cells exfoliated into different regions of the colon. The size of DNA fragments from non-cancerous or precancerous cells is the same throughout the colon due to the fact that the DNA from those cells is degraded primarily through apoptosis. Thus, cell lysis and DNA degradation play only minor roles in determining the size of DNA fragments from most exfoliated normal cells throughout io the colon. It is noted, however, that normal cells that are, for example, mechanically sheared from the colon undergo the same lytic and degradation cycle as the typical cancer or precancer cell. However, the contribution of such non-apoptotic normal cells to the overall level of DNA in the stool sample is small, and is controlled for by establishing standards as taught below.
Further aspects and advantages of the invention are contained in the following detailed description thereof.
Description of the Drawings Figure 1 shows a schematic representation of the colon, and the representative (typical) DNA fragment length for DNA obtained from a cancer or precancer exfoliated cell over the representative (typical) apoptotic (normal) DNA fragment length for various regions of the colon.
Figure 2 is a gel photograph showing results of amplification of Kras (exon 1) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 3 is a gel photograph showing results of amplification of apc (exon 15) 3o DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 4 is a gel photograph showing results of amplification of apc (exon 15) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight io indicated in the figure.
Figure 5 is a gel photograph showing results of amplification of apc (exon 15) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, 1s lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 6 is a gel photograph showing results of amplification of p53 (exon 5) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
2o The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
25 Figure 7 is a gel photograph showing results of amplification of p53 (exon 7) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are 3o negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 8 is a gel photograph showing results of amplification of p53 (exon 8) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
In a preferred embodiment gel electrophoresis, affinity chromatography, or mass spectrometry are used to detect large DNA fragments (fragments comprising greater than about 200 base pairs). The presence of large DNA fragments in the sample is indicative of colorectal cancer.
In a preferred embodiment capture probes comprise DNA, RNA or PNA, and are detectably labeled using methods known in the art. In one embodiment probes are io labeled with radioactive isotopes such as 32P, 33p, 35S,'251, or any other detectable isotope useful for labeling a hybridization probe. In an another embodiment, probes are labeled with fluorescent molecules. Numerous fluorescent labels are known in the art, and any detectable fluorescent probe label is useful for practice of the invention.
Alternatively, probes are attached to moieties which increase their molecular weight.
For example a probe may be directly attached to a glycoprotein, or a glass bead, or any compound which has a detectable effect on the molecular weight of the probe.
In a further embodiment, probes are labeled with a compound that is detectable due to specific interactions with an additional compound. For example, biotinylated probes are detectable via interaction with streptavidin. The streptavidin moiety is attached to a 2o detectable label such as a bead, a fluorescent tag, or an enzyme. In another example, the probes are labeled with a hapten or other antigen which is specifically recognized by an antibody. The antibody is made detectable using methods known in the art including radioactive isotopes, fluorescent tags, and enzyme reactions. In a further example the probes are directly attached to an enzyme which is detectable via a specific enzyme catalyzed reaction generating a detectable product.
Finally, methods of the invention allow one to approximate the position in the colon of a colorectal lesion based upon the relative amount of DNA fragments in a stool sample that are greater than 200 base pairs in length. This aspect of the invention relies on the fact that the lytic properties of stool are greater in the proximal colon than they are in the distal colon. In the proximal colon, stool is typically in liquid form.
Therefore, the cell lysis and DNA degrading enzymes in the colon have greater access to exfoliated cells in the liquid mixture of the proximal colon as compared to their access to exfoliated cells sloughed onto formed or forming stool that is typical in the distal colon. As a consequence of the differences between the environments of the proximal and distal colon, the present invention provides that typical DNA
fragments from cells exfoliated into the proximal colon are smaller than DNA fragments from cells exfoliated into the distal colon. Figure 1 provides an example of the progression of DNA sizes expected for cancer or precancer cells exfoliated into different regions of the colon. The size of DNA fragments from non-cancerous or precancerous cells is the same throughout the colon due to the fact that the DNA from those cells is degraded primarily through apoptosis. Thus, cell lysis and DNA degradation play only minor roles in determining the size of DNA fragments from most exfoliated normal cells throughout io the colon. It is noted, however, that normal cells that are, for example, mechanically sheared from the colon undergo the same lytic and degradation cycle as the typical cancer or precancer cell. However, the contribution of such non-apoptotic normal cells to the overall level of DNA in the stool sample is small, and is controlled for by establishing standards as taught below.
Further aspects and advantages of the invention are contained in the following detailed description thereof.
Description of the Drawings Figure 1 shows a schematic representation of the colon, and the representative (typical) DNA fragment length for DNA obtained from a cancer or precancer exfoliated cell over the representative (typical) apoptotic (normal) DNA fragment length for various regions of the colon.
Figure 2 is a gel photograph showing results of amplification of Kras (exon 1) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 3 is a gel photograph showing results of amplification of apc (exon 15) 3o DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 4 is a gel photograph showing results of amplification of apc (exon 15) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight io indicated in the figure.
Figure 5 is a gel photograph showing results of amplification of apc (exon 15) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, 1s lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 6 is a gel photograph showing results of amplification of p53 (exon 5) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
2o The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
25 Figure 7 is a gel photograph showing results of amplification of p53 (exon 7) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are 3o negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 8 is a gel photograph showing results of amplification of p53 (exon 8) DNA isolated from stool using forward and reverse primers spaced about 200 bp apart.
The band intensity relates to the amount of 200bp product or greater in the sample.
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 9 is a gel photograph of results of amplification of DNA from stool samples using forward and reverse primers spaced approximately 1.8Kb apart.
The band intensity shows the amount of 1.8Kb or greater product. Lanes 1, 8, and 9 are negative controls, lanes 2, 3, and 5 are results from patients with cancer or adenoma, io lanes 4, 6, and 7 are results from patients who did not have cancer or adenoma, and lanes 10-14 are molecular weight standards.
Figure 10 is a gel photograph of results of amplification of DNA from stool samples using forward and reverse primers spaced approximately 1.8Kb apart.
The band intensity shows the amount of 1.8Kb or greater product. Lanes 1, 8, and 9 are negative controls, lanes 2, 3, and 5 are results from patients with cancer or adenoma, lanes 4, 6, and 7 are results from patients who did not have cancer or adenoma, and lanes 10-14 are molecular weight standards.
Figure 11 is a gel photograph of results of amplification of DNA from stool samples using forward and reverse primers spaced approximately 1.8Kb apart.
The 2o band intensity shows the amount of 1.8Kb or greater product. Lanes 1, 8, and 9 are negative controls, lanes 2, 3, and 5 are results from patients with cancer or adenoma, lanes 4, 6, and 7 are results from patients who did not have cancer or adenoma, and lanes 10-14 are molecular weight standards.
DETAILED DESCRIPTION OF THE INVENTION
Methods of the invention are based upon the observation that samples comprising cells from patients with cancer or precancer contain a greater amount of high molecular weight (long sequence) DNA fragments as compared to corresponding samples obtained from individuals that are free of cancer/precancer.
Accordingly, methods of the invention provide accurate screening and diagnostic procedures for cancer or precancer.
Methods of the invention are useful to detect nucleic acid indicia of cancer or precancer in any tissue or body fluid sample. For example, sputum samples are used to detect the presence of high molecular weight (long sequence) DNA as a marker for cancer. The majority of cells exfoliated into sputum have undergone apoptosis and subsequent further enzymatic degradation. The predominant DNA from those cells is small, apoptotic DNA. Cancer cells produced by, for example, the lungs, the nasal passages, or the trachea will also be sloughed into sputum. However, the DNA
from those cells, while being exposed to enzymatic processes, has not been affected by apoptosis. Accordingly, fragments from cancer or precancer cells found in sputum are larger than fragments expected to be produced by normal cells.
Similarly, cells sloughed by cancerous or precancerous lesions in the bladder or io kidney produce non-apoptotic DNA in urine, cancerous or precancerous lesions in the lymph nodes result in non-apoptotic DNA fragments in lymph, and cancerous or precancerous cells in the breast slough non-apoptotic DNA-containing cells that can be harvested via aspiration. Accordingly, methods of the invention are useful in any tissue or body fluid. However, for purposes of exemplification of the methods described herein, stool sample were used to predict the presence of colorectal cancer or precancer. Stool is an excellent specimen for analysis due to the characteristic exfoliation of colonic epithelia as described above.
Methods of the invention are practiced by detecting the presence of DNA
fragments having a sequence length that would not be expected to be present in significant amounts in a sample obtained from a healthy individual (i.e., an individual who does not have cancer or precancer). A threshold amount of large fragments is an amount that exceeds a predetermined level expected or determined for non-cancerous/non-precancerous cells. The predetermined level or standard can be determined by detecting the amount of a particular size of DNA fragment (preferably apoptotic fragments characteristic of normal cells) in a population or subpopulation of normal patients. Standards can be determined empirically, and, once determined, can be used as the basis for further screening.
The size of fragments to be used is chosen based upon the convenience of the individual performing the screen. Factors affecting the size of fragments used in screening or diagnostic methods of the invention include the availability and costs of probes and primers, the desired target of amplification, the type of cancer being screened, and the patient sample on which screening takes place. The invention takes advantage of the recognition that large fragments exist in greater abundance in abnormal samples than in normal samples. Accordingly, the precise size of fragments used in methods of the invention does not matter. For any given size of fragments to be analyzed, a cutoff must be determined to distinguish between normal and abnormal samples. Preferably, the cutoff is determined empirically based upon known normal and abnormal sample, and then is used in future screenings.
The following examples provide further details of methods according to the invention. For purposes of exemplification, the following examples provide details of the use of the method if the present invention in colon cancer detection.
Accordingly, white exemplified in the following manner, the invention is not so limited and the skilled artisan will appreciate its wide range of application upon consideration thereof.
Exemplary Method for the Detection of Colon Cancer For the analysis of stool samples, preferred methods of the invention comprise obtaining at least a cross-section or circumferential portion of a voided stool as taught in U.S. patent number 5,741,650, and co-pending, co-owned U.S. patent application serial number 09/059,713 now issued as U.S.
patent no. 5,952,178. While a cross-sectional or circumferential portion of stool is desirable, methods provided herein are conducted on random samples obtained from voided stool, which include smears or scrapings. Once obtained, the stool specimen is homogenized. A preferable buffer for homogenization is one that contains at least 16mM ethylenediaminetetraacetic acid (EDTA).
However, as taught in co-pending, co-owned U.S. patent application serial number 09/491,093, now issued as U.S. patent no. 6,551,777, it has been discovered that the use of at least 150mM EDTA greatly improves the yield of nucleic acid from stool. Thus, a preferred buffer for stool homogenization comprises phosphate buffered saline, 20-100mM NaCI or KCI, at least 150mM
EDTA, and optionally a detergent (such as SDS) and a proteinase (e.g., proteinase K).
After homogenization, nucleic acid is preferably isolated from the stool sample.
Isolation or extraction of nucleic acid is not required in all methods of the invention, as certain detection techniques can be adequately performed in homogenized stool without isolation of nucleic acids. In a preferred embodiment, however, homogenized stool is spun to create a supematant containing nucleic acids, proteins, lipids, and other cellular debris. The supematant is treated with a detergent and proteinase to degrade protein, and the nucleic acid is phenol-chloroform extracted. The extracted nucleic acids are then precipitated with alcohol. Other techniques can be used to isolate nucleic acid from the sample. Such techniques include hybrid dapture, and amplification directly from the homogenized stool. Nucleic acids can be purified andJor isolated to the extent required by the screening assay to be employed. Total DNA is isolated using techniques known in the art.
Once DNA is isolated, the sample preferably is enriched for human nucleic acids using sequence specific capture probes. Pelletized DNA is resuspended in TE
buffer.
Guanidine isothiocyanatate (GITC) is then added. An excess of capture probes that target human DNA are added to the sample. The sample is heated to denature the DNA and then cooled. Finally, probe and target DNA are allowed to hybridize.
Steptavidin -coated magnetized beads are suspended in water and added to the mixture. After briefly mixing, the mixture is maintained at room temperature for approximately 30 minutes. Once the affinity binding is completed, a magnetic filed is applied to the sample to draw the magnetized isolation beads (both with and without hybridized complex). The beads are then washed four (4) times in IM GITC/0.1 %
Igepal (Sigma, St. Louis, MO) solution for 15 minutes, followed by two (2) washes with warm buffer (TE with I M NaCI) for 15 minutes in order to isolate complexed streptavidin. Finally, distilled water is added to the beads and heated to elude the DNA.
Gel electfophoresis can then be performed on the human DNA that has been captured.
III. Determination of Fragment Length The size of human DNA fragment obtained above can be determined by numerous means. For example, human DNA can be separated using gel electrophoresis. A 5% acrylamide gel is prepared using techniques known in the art. See Ausubel et. al., Short Protocols in Molecular Biology, John Wiley & Sones, 1195, pgs. 2-23-2-24. The size of human DNA fragment is then determined by comparison to known standards. Fragments greater than about 200bp provide a positive screen. While a diagnosis can be made on the basis of the screen alone, patients presenting a positive screen are preferably advised to seek follow-up testing to render a confirmed diagnosis.
A preferred means for determining human DNA fragment length is by using PCR. Methods for implementing PCR are well-known. In the present invention, human DNA fragments are amplified using human-specific primers. Amplicon of greater than about 200 bp produced by PCR represents a positive screen. Other amplification reactions and modifications of PCR, such as ligase chain reaction, reverse-phase PCR, Q-PCR, and others may be used to produce detectable levels of amplicon.
Amplicon may be detected by coupling to a reporter (e.g. flouresence, radioisotopes, and the like), by sequencing, by gel electrophoresis, by mass spectrometry, or by any other means known in the art, as long as the length, weight, or other characteristic of the amplicons identifies them by size.
EXAMPLES
Experiments were conducted to determine whether characteristics of amplifiable io DNA in stool were predictive of cancer or precancer in patients from whom stools samples were obtained. In the first experiment, the amount of amplifiable DNA
was measured in each of several stool samples using PCR amplification to detect DNA
fragments in the sample of at least 200 base pairs in length. The second experiment determined the amount of long (greater than 200 base pair) fragments in the same samples, and then to determine ratios of long product to short product.
1. The Use of Amplifiable DNA as a Marker for Cancer or Precancer Stool samples were collected from 9 patients who presented with symptoms or a medical history that indicated that a colonoscopy should be performed. Each stool sample was frozen. Immediately after providing a stool sample, each patient was given 2o a colonoscopy in order to determine the patient's disease status. Based upon the colonoscopy results, and subsequent histological analysis of biopsy samples taken during colonsocopy, individuals were placed into one of two groups: normal or abnormal. The abnormal group consisted of patients with cancer or with an adenoma of at least 1 cm in diameter. Based upon these results, 4 of the 9 patients were placed into the abnormal group.
The samples were screened by hybrid capturing human DNA, and determining the amount of amplifiable DNA having at least 200 base pairs. Each frozen stool specimen, weighing from 7-33 grams, was though and homogenized in 500 mM
Tris, 16 mM EDTA, and 10 mM NaCI, pH 9.0 at a volume: to mass ratio of 3:1.
Samples were then rehomogenized in the same buffer to a final volume-to-mass ratio of 20:1, and spun in glass macro beads at 2356 x g. The supernatant was collected and treated with SDS and proteinase k. The DNA was then phenol-chloroform extracted and precipitated with alcohol. The precipitate was suspended in 10 mM Tris and 1 mM EDTA (1 x TE), pH 7.4. Finally, the DNA was treated with Rnase.
Human DNA was isolated from the precipitate by sequence-specific hybrid capture. Biotynilated probes against portions of the p53, K-ras, and apc genes were used. The K-ras probe was 5'GTGGAGTATTTGATAGTGTATTAACCTTATGTGTGAC
3' (SEQ ID NO: 1). There were two apc probes: apo-1309 was 5'TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG 3' (SEQ ID NO: 2), and apo-1378 was 5'CAGATAGCCCTGGACAAACAATGCCACGAAGCAGAAG 3' (SEQ ID
NO: 3). There were four probes against p53, the first (hybridizing to a portion of exon 5) was 57ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGG3' (SEQ ID NO:4), the second (hybridizing to a portion of exon 7) was 5'ATTTCTTCCATACTACTACCCATCGACCTCTCATC3' (SEQ ID NO: 5), the third, also hybridizing to a portion of exon 7 was 5'ATGAGGCCAGTGCGCCTTGGGGAGACCTGTGGCAAGC3' (SEQ ID NO: 6); and finally, a probe against exon 8 had the sequence 5'GAAAGGACAAGGGTGGTTGGGAGTAGATGGAGCCTGG3' (SEQ ID NO: 7). A 10 ul aliquot of each probe (20 pmoVcapture) was added to a suspension containing 300 ul DNA in the presence of 310u16M GITC buffer for 2 hours at room temperature.
Hybrid complexes were isolated using streptavidin-coated beads (Dynal). After washing, probe-bead complexes were suspended at 25 C for 1 hour in 0.1x TE buffer, pH7.4.
The suspension was then heated for 4 minutes at 85 C, and the beads were removed.
Captured DNA was then amplified using PCR, essentially as described in U.S. Patent No. 4,683,202. Each sample was amplified using forward and reverse primers through 7 loci (Kras, exon 1, APC exon 15 (3 separate loci), p53, exon 5, p53, exon 7, and p53, exon 8) in duplicate (for a total of 14 amplifications for each locus). Seven separate PCRs (33 cycles each) were run in duplicate using primers directed to detect fragments in the sample having 200 base pairs or more. Amplified DNA was placed on a 4% Nusieve (FMC Biochemical) gel (3% Nusieve, 1% agarose), and staind with ethidium bromide (0.5 ug/mI). The resulting amplified DNA was graded based upon the relative intensity of the stained gels. The results are shown in Figures 2-8.
Each Figure represents the results for all 9 patients (including standards) for the seven different loci that were amplified. As shown in the Figures, each sample from a patient with cancer or adenoma was detected as a band having significantly greater intensity than the bands associated with samples from patients who did not have cancer or precancer. All four cancer/adenoma patients identified using colonoscopy were correctly identified by determining the amount of amplifiable DNA 200 base pairs or greater in length. As shown in Figures 2-8, the results were the same regardless of which locus was amplified. Accordingly, the amount of 200bp or greater DNA in a sample was predictive of patient disease status.
An experiment was conducted that was essentially identical to the one described above in Example 1, but forward and reverse primers were placed such that fragments io of about 1.8 Kb and above were amplified.
DNA was prepared as described above. Forward and reverse primers were spaced so as to hybridize approximately 1.8Kb apart on three different loci (Kras, exon 1, APC, exon 15, and p53 exon 5). Thirty-three rounds of amplification were performed, and the resulting DNA was placed on a 5% acrylamide gel. The results are shown in Figures 9-11. As shown in the Figures (which show results from three separate experiments to amplify and detect "long" product), samples from individuals having cancer or precancer produced large amounts of high-molecular weight (in this case 1.8Kb and above) DNA; whereas samples from patients who did not have cancer or precancer produced no DNA in the range of about 1.8Kb and higher. Thus, the presence of high-molecular weight DNA was indicative of the disease status of the patient.
The invention has been described in terms of its preferred embodiments.
Alternative embodiments are apparent to the skilled artisan upon examination of the specification and claims.
SEQUENCE LISTING
<110> Exact Sciences Corporation <120> Methods for Detecting Nucleic Acids Indicative of Cancer <130> 369-157 <140> 2,366,778 <141> 2000-04-07 <150> US 60/128,629 <151> 1999-04-09 <160> 7 <170> PatentIn Ver. 2.0 <210> 1 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: K-ras oligonucleotide probe <400> 1 gtggagtatt tgatagtgta ttaaccttat gtgtgac 37 <210> 2 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:apc-1309 oligonucleotide probe <400> 2 ttccagcagt gtcacagcac cctagaacca aatccag 37 <210> 3 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:apc-1378 oligonucleotide probe -15.2-<400> 3 cagatagccc tggacaaaca atgccacgaa gcagaag 37 <210> 4 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:first p53 oligonucleotide probe <400> 4 tactcccctg ccctcaacaa gatgttttgc caactgg 37 <210> 5 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: second p53 oligonucleotide probe <400> 5 atttcttcca tactactacc catcgacctc tcatc 35 <210> 6 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:third p53 oligonucleotide probe <400> 6 atgaggccag tgcgccttgg ggagacctgt ggcaagc 37 <210> 7 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:fourth p53 oligonucleotide probe <400> 7 gaaaggacaa gggtggttgg gagtagatgg agcctgg 37
Lanes 1-4 are results from patients with cancer or adenoma, lane 5 is a positive control, lanes 6-10 are from patients who did not have cancer or adenoma, lanes 11-12 are negative controls, and lanes 13-18 are standards at the approximate molecular weight indicated in the figure.
Figure 9 is a gel photograph of results of amplification of DNA from stool samples using forward and reverse primers spaced approximately 1.8Kb apart.
The band intensity shows the amount of 1.8Kb or greater product. Lanes 1, 8, and 9 are negative controls, lanes 2, 3, and 5 are results from patients with cancer or adenoma, io lanes 4, 6, and 7 are results from patients who did not have cancer or adenoma, and lanes 10-14 are molecular weight standards.
Figure 10 is a gel photograph of results of amplification of DNA from stool samples using forward and reverse primers spaced approximately 1.8Kb apart.
The band intensity shows the amount of 1.8Kb or greater product. Lanes 1, 8, and 9 are negative controls, lanes 2, 3, and 5 are results from patients with cancer or adenoma, lanes 4, 6, and 7 are results from patients who did not have cancer or adenoma, and lanes 10-14 are molecular weight standards.
Figure 11 is a gel photograph of results of amplification of DNA from stool samples using forward and reverse primers spaced approximately 1.8Kb apart.
The 2o band intensity shows the amount of 1.8Kb or greater product. Lanes 1, 8, and 9 are negative controls, lanes 2, 3, and 5 are results from patients with cancer or adenoma, lanes 4, 6, and 7 are results from patients who did not have cancer or adenoma, and lanes 10-14 are molecular weight standards.
DETAILED DESCRIPTION OF THE INVENTION
Methods of the invention are based upon the observation that samples comprising cells from patients with cancer or precancer contain a greater amount of high molecular weight (long sequence) DNA fragments as compared to corresponding samples obtained from individuals that are free of cancer/precancer.
Accordingly, methods of the invention provide accurate screening and diagnostic procedures for cancer or precancer.
Methods of the invention are useful to detect nucleic acid indicia of cancer or precancer in any tissue or body fluid sample. For example, sputum samples are used to detect the presence of high molecular weight (long sequence) DNA as a marker for cancer. The majority of cells exfoliated into sputum have undergone apoptosis and subsequent further enzymatic degradation. The predominant DNA from those cells is small, apoptotic DNA. Cancer cells produced by, for example, the lungs, the nasal passages, or the trachea will also be sloughed into sputum. However, the DNA
from those cells, while being exposed to enzymatic processes, has not been affected by apoptosis. Accordingly, fragments from cancer or precancer cells found in sputum are larger than fragments expected to be produced by normal cells.
Similarly, cells sloughed by cancerous or precancerous lesions in the bladder or io kidney produce non-apoptotic DNA in urine, cancerous or precancerous lesions in the lymph nodes result in non-apoptotic DNA fragments in lymph, and cancerous or precancerous cells in the breast slough non-apoptotic DNA-containing cells that can be harvested via aspiration. Accordingly, methods of the invention are useful in any tissue or body fluid. However, for purposes of exemplification of the methods described herein, stool sample were used to predict the presence of colorectal cancer or precancer. Stool is an excellent specimen for analysis due to the characteristic exfoliation of colonic epithelia as described above.
Methods of the invention are practiced by detecting the presence of DNA
fragments having a sequence length that would not be expected to be present in significant amounts in a sample obtained from a healthy individual (i.e., an individual who does not have cancer or precancer). A threshold amount of large fragments is an amount that exceeds a predetermined level expected or determined for non-cancerous/non-precancerous cells. The predetermined level or standard can be determined by detecting the amount of a particular size of DNA fragment (preferably apoptotic fragments characteristic of normal cells) in a population or subpopulation of normal patients. Standards can be determined empirically, and, once determined, can be used as the basis for further screening.
The size of fragments to be used is chosen based upon the convenience of the individual performing the screen. Factors affecting the size of fragments used in screening or diagnostic methods of the invention include the availability and costs of probes and primers, the desired target of amplification, the type of cancer being screened, and the patient sample on which screening takes place. The invention takes advantage of the recognition that large fragments exist in greater abundance in abnormal samples than in normal samples. Accordingly, the precise size of fragments used in methods of the invention does not matter. For any given size of fragments to be analyzed, a cutoff must be determined to distinguish between normal and abnormal samples. Preferably, the cutoff is determined empirically based upon known normal and abnormal sample, and then is used in future screenings.
The following examples provide further details of methods according to the invention. For purposes of exemplification, the following examples provide details of the use of the method if the present invention in colon cancer detection.
Accordingly, white exemplified in the following manner, the invention is not so limited and the skilled artisan will appreciate its wide range of application upon consideration thereof.
Exemplary Method for the Detection of Colon Cancer For the analysis of stool samples, preferred methods of the invention comprise obtaining at least a cross-section or circumferential portion of a voided stool as taught in U.S. patent number 5,741,650, and co-pending, co-owned U.S. patent application serial number 09/059,713 now issued as U.S.
patent no. 5,952,178. While a cross-sectional or circumferential portion of stool is desirable, methods provided herein are conducted on random samples obtained from voided stool, which include smears or scrapings. Once obtained, the stool specimen is homogenized. A preferable buffer for homogenization is one that contains at least 16mM ethylenediaminetetraacetic acid (EDTA).
However, as taught in co-pending, co-owned U.S. patent application serial number 09/491,093, now issued as U.S. patent no. 6,551,777, it has been discovered that the use of at least 150mM EDTA greatly improves the yield of nucleic acid from stool. Thus, a preferred buffer for stool homogenization comprises phosphate buffered saline, 20-100mM NaCI or KCI, at least 150mM
EDTA, and optionally a detergent (such as SDS) and a proteinase (e.g., proteinase K).
After homogenization, nucleic acid is preferably isolated from the stool sample.
Isolation or extraction of nucleic acid is not required in all methods of the invention, as certain detection techniques can be adequately performed in homogenized stool without isolation of nucleic acids. In a preferred embodiment, however, homogenized stool is spun to create a supematant containing nucleic acids, proteins, lipids, and other cellular debris. The supematant is treated with a detergent and proteinase to degrade protein, and the nucleic acid is phenol-chloroform extracted. The extracted nucleic acids are then precipitated with alcohol. Other techniques can be used to isolate nucleic acid from the sample. Such techniques include hybrid dapture, and amplification directly from the homogenized stool. Nucleic acids can be purified andJor isolated to the extent required by the screening assay to be employed. Total DNA is isolated using techniques known in the art.
Once DNA is isolated, the sample preferably is enriched for human nucleic acids using sequence specific capture probes. Pelletized DNA is resuspended in TE
buffer.
Guanidine isothiocyanatate (GITC) is then added. An excess of capture probes that target human DNA are added to the sample. The sample is heated to denature the DNA and then cooled. Finally, probe and target DNA are allowed to hybridize.
Steptavidin -coated magnetized beads are suspended in water and added to the mixture. After briefly mixing, the mixture is maintained at room temperature for approximately 30 minutes. Once the affinity binding is completed, a magnetic filed is applied to the sample to draw the magnetized isolation beads (both with and without hybridized complex). The beads are then washed four (4) times in IM GITC/0.1 %
Igepal (Sigma, St. Louis, MO) solution for 15 minutes, followed by two (2) washes with warm buffer (TE with I M NaCI) for 15 minutes in order to isolate complexed streptavidin. Finally, distilled water is added to the beads and heated to elude the DNA.
Gel electfophoresis can then be performed on the human DNA that has been captured.
III. Determination of Fragment Length The size of human DNA fragment obtained above can be determined by numerous means. For example, human DNA can be separated using gel electrophoresis. A 5% acrylamide gel is prepared using techniques known in the art. See Ausubel et. al., Short Protocols in Molecular Biology, John Wiley & Sones, 1195, pgs. 2-23-2-24. The size of human DNA fragment is then determined by comparison to known standards. Fragments greater than about 200bp provide a positive screen. While a diagnosis can be made on the basis of the screen alone, patients presenting a positive screen are preferably advised to seek follow-up testing to render a confirmed diagnosis.
A preferred means for determining human DNA fragment length is by using PCR. Methods for implementing PCR are well-known. In the present invention, human DNA fragments are amplified using human-specific primers. Amplicon of greater than about 200 bp produced by PCR represents a positive screen. Other amplification reactions and modifications of PCR, such as ligase chain reaction, reverse-phase PCR, Q-PCR, and others may be used to produce detectable levels of amplicon.
Amplicon may be detected by coupling to a reporter (e.g. flouresence, radioisotopes, and the like), by sequencing, by gel electrophoresis, by mass spectrometry, or by any other means known in the art, as long as the length, weight, or other characteristic of the amplicons identifies them by size.
EXAMPLES
Experiments were conducted to determine whether characteristics of amplifiable io DNA in stool were predictive of cancer or precancer in patients from whom stools samples were obtained. In the first experiment, the amount of amplifiable DNA
was measured in each of several stool samples using PCR amplification to detect DNA
fragments in the sample of at least 200 base pairs in length. The second experiment determined the amount of long (greater than 200 base pair) fragments in the same samples, and then to determine ratios of long product to short product.
1. The Use of Amplifiable DNA as a Marker for Cancer or Precancer Stool samples were collected from 9 patients who presented with symptoms or a medical history that indicated that a colonoscopy should be performed. Each stool sample was frozen. Immediately after providing a stool sample, each patient was given 2o a colonoscopy in order to determine the patient's disease status. Based upon the colonoscopy results, and subsequent histological analysis of biopsy samples taken during colonsocopy, individuals were placed into one of two groups: normal or abnormal. The abnormal group consisted of patients with cancer or with an adenoma of at least 1 cm in diameter. Based upon these results, 4 of the 9 patients were placed into the abnormal group.
The samples were screened by hybrid capturing human DNA, and determining the amount of amplifiable DNA having at least 200 base pairs. Each frozen stool specimen, weighing from 7-33 grams, was though and homogenized in 500 mM
Tris, 16 mM EDTA, and 10 mM NaCI, pH 9.0 at a volume: to mass ratio of 3:1.
Samples were then rehomogenized in the same buffer to a final volume-to-mass ratio of 20:1, and spun in glass macro beads at 2356 x g. The supernatant was collected and treated with SDS and proteinase k. The DNA was then phenol-chloroform extracted and precipitated with alcohol. The precipitate was suspended in 10 mM Tris and 1 mM EDTA (1 x TE), pH 7.4. Finally, the DNA was treated with Rnase.
Human DNA was isolated from the precipitate by sequence-specific hybrid capture. Biotynilated probes against portions of the p53, K-ras, and apc genes were used. The K-ras probe was 5'GTGGAGTATTTGATAGTGTATTAACCTTATGTGTGAC
3' (SEQ ID NO: 1). There were two apc probes: apo-1309 was 5'TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG 3' (SEQ ID NO: 2), and apo-1378 was 5'CAGATAGCCCTGGACAAACAATGCCACGAAGCAGAAG 3' (SEQ ID
NO: 3). There were four probes against p53, the first (hybridizing to a portion of exon 5) was 57ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGG3' (SEQ ID NO:4), the second (hybridizing to a portion of exon 7) was 5'ATTTCTTCCATACTACTACCCATCGACCTCTCATC3' (SEQ ID NO: 5), the third, also hybridizing to a portion of exon 7 was 5'ATGAGGCCAGTGCGCCTTGGGGAGACCTGTGGCAAGC3' (SEQ ID NO: 6); and finally, a probe against exon 8 had the sequence 5'GAAAGGACAAGGGTGGTTGGGAGTAGATGGAGCCTGG3' (SEQ ID NO: 7). A 10 ul aliquot of each probe (20 pmoVcapture) was added to a suspension containing 300 ul DNA in the presence of 310u16M GITC buffer for 2 hours at room temperature.
Hybrid complexes were isolated using streptavidin-coated beads (Dynal). After washing, probe-bead complexes were suspended at 25 C for 1 hour in 0.1x TE buffer, pH7.4.
The suspension was then heated for 4 minutes at 85 C, and the beads were removed.
Captured DNA was then amplified using PCR, essentially as described in U.S. Patent No. 4,683,202. Each sample was amplified using forward and reverse primers through 7 loci (Kras, exon 1, APC exon 15 (3 separate loci), p53, exon 5, p53, exon 7, and p53, exon 8) in duplicate (for a total of 14 amplifications for each locus). Seven separate PCRs (33 cycles each) were run in duplicate using primers directed to detect fragments in the sample having 200 base pairs or more. Amplified DNA was placed on a 4% Nusieve (FMC Biochemical) gel (3% Nusieve, 1% agarose), and staind with ethidium bromide (0.5 ug/mI). The resulting amplified DNA was graded based upon the relative intensity of the stained gels. The results are shown in Figures 2-8.
Each Figure represents the results for all 9 patients (including standards) for the seven different loci that were amplified. As shown in the Figures, each sample from a patient with cancer or adenoma was detected as a band having significantly greater intensity than the bands associated with samples from patients who did not have cancer or precancer. All four cancer/adenoma patients identified using colonoscopy were correctly identified by determining the amount of amplifiable DNA 200 base pairs or greater in length. As shown in Figures 2-8, the results were the same regardless of which locus was amplified. Accordingly, the amount of 200bp or greater DNA in a sample was predictive of patient disease status.
An experiment was conducted that was essentially identical to the one described above in Example 1, but forward and reverse primers were placed such that fragments io of about 1.8 Kb and above were amplified.
DNA was prepared as described above. Forward and reverse primers were spaced so as to hybridize approximately 1.8Kb apart on three different loci (Kras, exon 1, APC, exon 15, and p53 exon 5). Thirty-three rounds of amplification were performed, and the resulting DNA was placed on a 5% acrylamide gel. The results are shown in Figures 9-11. As shown in the Figures (which show results from three separate experiments to amplify and detect "long" product), samples from individuals having cancer or precancer produced large amounts of high-molecular weight (in this case 1.8Kb and above) DNA; whereas samples from patients who did not have cancer or precancer produced no DNA in the range of about 1.8Kb and higher. Thus, the presence of high-molecular weight DNA was indicative of the disease status of the patient.
The invention has been described in terms of its preferred embodiments.
Alternative embodiments are apparent to the skilled artisan upon examination of the specification and claims.
SEQUENCE LISTING
<110> Exact Sciences Corporation <120> Methods for Detecting Nucleic Acids Indicative of Cancer <130> 369-157 <140> 2,366,778 <141> 2000-04-07 <150> US 60/128,629 <151> 1999-04-09 <160> 7 <170> PatentIn Ver. 2.0 <210> 1 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: K-ras oligonucleotide probe <400> 1 gtggagtatt tgatagtgta ttaaccttat gtgtgac 37 <210> 2 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:apc-1309 oligonucleotide probe <400> 2 ttccagcagt gtcacagcac cctagaacca aatccag 37 <210> 3 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:apc-1378 oligonucleotide probe -15.2-<400> 3 cagatagccc tggacaaaca atgccacgaa gcagaag 37 <210> 4 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:first p53 oligonucleotide probe <400> 4 tactcccctg ccctcaacaa gatgttttgc caactgg 37 <210> 5 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: second p53 oligonucleotide probe <400> 5 atttcttcca tactactacc catcgacctc tcatc 35 <210> 6 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:third p53 oligonucleotide probe <400> 6 atgaggccag tgcgccttgg ggagacctgt ggcaagc 37 <210> 7 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:fourth p53 oligonucleotide probe <400> 7 gaaaggacaa gggtggttgg gagtagatgg agcctgg 37
Claims (26)
1. A method for screening a patient for cancer or precancer, the method comprising the steps of:
detecting in a patient stool, pus or urine sample comprising exfoliated cells and cellular debris, a long nucleic acid that is greater than 200 base pairs in length, wherein a fragment of said long nucleic acid having a length less than 200 base pairs in length is expected to be present in a stool, pus or urine sample from a healthy patient;
the presence of said long nucleic acid being indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer.
detecting in a patient stool, pus or urine sample comprising exfoliated cells and cellular debris, a long nucleic acid that is greater than 200 base pairs in length, wherein a fragment of said long nucleic acid having a length less than 200 base pairs in length is expected to be present in a stool, pus or urine sample from a healthy patient;
the presence of said long nucleic acid being indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer.
2. The method of claim 1, wherein said detecting step comprises conducting an amplification reaction designed to amplify only nucleic acids in said sample that are greater than 200 base pairs in length.
3. The method of claim 1, further comprising the step of enriching said sample for human DNA.
4. The method of claim 1, further comprising the step of isolating human DNA from said sample.
5. A method for screening a patient for cancer or precancer, the method comprising the steps of:
(a) detecting in a patient stool, pus or urine sample a first amount of a long nucleic acid that is greater than 200 base pairs in length;
(b) detecting in said sample a second amount of nucleic acid fragments less than about 200 base pairs in length;
(c) determining a ratio between said first amount and said second amount in said patient sample;
(d) detecting in a population of stool, pus or urine samples from normal patients the first amount of said long nucleic acid fragment greater than 200 base pairs in length;
(e) detecting in said population of samples from normal patients the second amount of nucleic acid fragments less than about 200 base pairs in length;
(f) identifying a threshold ratio between said first amount and said second amount in said population of samples from normal patients; and (g) comparing the ratio determined in step (c) with the threshold ratio identified in step (f), wherein a ratio in step (c) that is larger than the threshold ratio in step (f) is indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer.
(a) detecting in a patient stool, pus or urine sample a first amount of a long nucleic acid that is greater than 200 base pairs in length;
(b) detecting in said sample a second amount of nucleic acid fragments less than about 200 base pairs in length;
(c) determining a ratio between said first amount and said second amount in said patient sample;
(d) detecting in a population of stool, pus or urine samples from normal patients the first amount of said long nucleic acid fragment greater than 200 base pairs in length;
(e) detecting in said population of samples from normal patients the second amount of nucleic acid fragments less than about 200 base pairs in length;
(f) identifying a threshold ratio between said first amount and said second amount in said population of samples from normal patients; and (g) comparing the ratio determined in step (c) with the threshold ratio identified in step (f), wherein a ratio in step (c) that is larger than the threshold ratio in step (f) is indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer.
6. A method for screening a patient for cancer or precancer, the method comprising the steps of:
detecting in a patient stool, pus or urine sample comprising exfoliated cells, a first amount of a long nucleic acid that is greater than 200 base pairs in length, wherein said long nucleic acid is present in both normal and cancerous or precancerous cells;
detecting a second amount of said long nucleic acid in a stool, pus or urine sample from a patient free of cancer or precancer;
comparing the first amount of said long nucleic acid to the second amount of said long nucleic acid;
determining whether said first amount of long nucleic acid exceeds the second amount of long nucleic acid, wherein a larger amount of said first amount of long nucleic acid relative to said second amount is indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer.
detecting in a patient stool, pus or urine sample comprising exfoliated cells, a first amount of a long nucleic acid that is greater than 200 base pairs in length, wherein said long nucleic acid is present in both normal and cancerous or precancerous cells;
detecting a second amount of said long nucleic acid in a stool, pus or urine sample from a patient free of cancer or precancer;
comparing the first amount of said long nucleic acid to the second amount of said long nucleic acid;
determining whether said first amount of long nucleic acid exceeds the second amount of long nucleic acid, wherein a larger amount of said first amount of long nucleic acid relative to said second amount is indicative of the presence of non-apoptotic DNA, wherein the presence of non-apoptotic DNA is a positive screen for an indicator of cancer or precancer.
7. The method of claim 5 or claim 6, further comprising the step of enriching said sample for human DNA.
8. The method of claim 5 or claim 6, further comprising the step of isolating human DNA from said sample.
9. A method for screening a patient for cancer and precancer, the method comprising the steps of:
detecting in a patient stool, pus or urine sample comprising exfoliated cells and cellular debris a first amount of a long nucleic acid of a length greater than 200 base pairs in length, wherein said long nucleic acid is present in both normal and cancerous or precancerous cells;
comparing the first amount of long nucleic acid in said patient stool sample to a second amount of said long nucleic acid present in a stool sample from a patient free of cancer or precancer;
determining whether said first amount of long nucleic acid exceeds the second amount of long nucleic acid in said sample from a patient free of cancer or precancer; and identifying a positive screen for an indicator of a cancer or precancer if said first amount of long nucleic acid in said patient stool sample does exceed said second amount of long nucleic acid in said sample from a patient free of cancer or precancer.
detecting in a patient stool, pus or urine sample comprising exfoliated cells and cellular debris a first amount of a long nucleic acid of a length greater than 200 base pairs in length, wherein said long nucleic acid is present in both normal and cancerous or precancerous cells;
comparing the first amount of long nucleic acid in said patient stool sample to a second amount of said long nucleic acid present in a stool sample from a patient free of cancer or precancer;
determining whether said first amount of long nucleic acid exceeds the second amount of long nucleic acid in said sample from a patient free of cancer or precancer; and identifying a positive screen for an indicator of a cancer or precancer if said first amount of long nucleic acid in said patient stool sample does exceed said second amount of long nucleic acid in said sample from a patient free of cancer or precancer.
10. A method for screening a patient for cancer or precancer, the method comprising the steps of:
determining in a patient stool, pus or urine sample comprising exfoliated cells and cellular debris a first amount of long nucleic acid of a length greater than 200 base pairs;
determining in said stool sample a second amount of nucleic acid of a length less than 200 base pairs;
determining a ratio between said first amount and said second amount;
and identifying a positive screen for an indicator of a cancer or precancer if said ratio exceeds a threshold ratio for patients who do not have a cancer or a precancer.
determining in a patient stool, pus or urine sample comprising exfoliated cells and cellular debris a first amount of long nucleic acid of a length greater than 200 base pairs;
determining in said stool sample a second amount of nucleic acid of a length less than 200 base pairs;
determining a ratio between said first amount and said second amount;
and identifying a positive screen for an indicator of a cancer or precancer if said ratio exceeds a threshold ratio for patients who do not have a cancer or a precancer.
11. The method of claim 9 or claim 10, wherein said detecting or determining comprises conducting an amplification reaction designed to amplify only nucleic acids fragments that are greater than 200 base pair in length.
12. The method of claim 9 or claim 10, further comprising the step of enriching said sample for human DNA.
13. The method of claim 9 or claim 10, further comprising the step of isolating human DNA from said sample.
14. The method of any one of claims 1 to 13, wherein the patient sample is a stool sample.
15. The method of any one of claims 1 to 14, wherein the cancer is colorectal cancer.
16. The method of any one of claims 1 to 15, wherein the cancer is colorectal precancer.
17. The method of claim 1, 6, or 9, wherein the long nucleic acid is greater than 500 base pairs in length.
18. The method of claim 1, 6, or 9, wherein the long nucleic acid is greater than 1.0 Kb in length.
19. The method of claim 1, 6, or 9, wherein the long nucleic acid is greater than 1.2 Kb in length.
20. The method of claim 1, 6, or 9, wherein the long nucleic acid is greater than 1.8 Kb in length.
21. The method of claim 1, 6, or 9, wherein the long nucleic acid is greater than 2.4 Kb in length.
22. The method of claim 5 or 10, wherein the first amount of long nucleic acid is greater than 500 base pairs in length.
23. The method of claim 5 or 10, wherein the first amount of long nucleic acid is greater than 1.0 Kb in length.
24. The method of claim 5 or 10, wherein the first amount of long nucleic acid is greater than 1.2 Kb in length.
25. The method of claim 5 or 10, wherein the first amount of long nucleic acid is greater than 1.8 Kb in length.
26. The method of claim 5 or 10, wherein the first amount of long nucleic acid is greater than 2.4 Kb in length.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12862999P | 1999-04-09 | 1999-04-09 | |
US60/128,629 | 1999-04-09 | ||
PCT/US2000/009263 WO2000061808A2 (en) | 1999-04-09 | 2000-04-07 | Methods for detecting nucleic acids indicative of cancer |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2366778A1 CA2366778A1 (en) | 2000-10-19 |
CA2366778C true CA2366778C (en) | 2008-07-22 |
Family
ID=22436245
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002366778A Expired - Fee Related CA2366778C (en) | 1999-04-09 | 2000-04-07 | Methods for detecting nucleic acids indicative of cancer |
Country Status (9)
Country | Link |
---|---|
US (5) | US6964846B1 (en) |
EP (1) | EP1169479B1 (en) |
JP (2) | JP4794052B2 (en) |
AT (1) | ATE331811T1 (en) |
AU (1) | AU767983B2 (en) |
CA (1) | CA2366778C (en) |
DE (1) | DE60029092T2 (en) |
ES (1) | ES2269129T3 (en) |
WO (1) | WO2000061808A2 (en) |
Families Citing this family (54)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6818404B2 (en) | 1997-10-23 | 2004-11-16 | Exact Sciences Corporation | Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples |
JP4794052B2 (en) * | 1999-04-09 | 2011-10-12 | ジェンザイム・コーポレーション | Method for detecting a nucleic acid that is an indicator of cancer |
US6586177B1 (en) * | 1999-09-08 | 2003-07-01 | Exact Sciences Corporation | Methods for disease detection |
CA2394921A1 (en) | 1999-12-07 | 2001-06-14 | Anthony P. Shuber | Supracolonic aerodigestive neoplasm detection |
US6919174B1 (en) * | 1999-12-07 | 2005-07-19 | Exact Sciences Corporation | Methods for disease detection |
GB0130821D0 (en) * | 2001-12-24 | 2002-02-06 | Tayside University Hospitals N | DNA screening |
US7776524B2 (en) | 2002-02-15 | 2010-08-17 | Genzyme Corporation | Methods for analysis of molecular events |
US9353405B2 (en) | 2002-03-12 | 2016-05-31 | Enzo Life Sciences, Inc. | Optimized real time nucleic acid detection processes |
US7041481B2 (en) | 2003-03-14 | 2006-05-09 | The Regents Of The University Of California | Chemical amplification based on fluid partitioning |
US20050014165A1 (en) * | 2003-07-18 | 2005-01-20 | California Pacific Medical Center | Biomarker panel for colorectal cancer |
US20080124714A1 (en) * | 2004-05-14 | 2008-05-29 | Exact Sciences Corporation | Method for Stabilizing Biological Samples for Nucleic Acid Analysis |
US9109256B2 (en) | 2004-10-27 | 2015-08-18 | Esoterix Genetic Laboratories, Llc | Method for monitoring disease progression or recurrence |
US9777314B2 (en) | 2005-04-21 | 2017-10-03 | Esoterix Genetic Laboratories, Llc | Analysis of heterogeneous nucleic acid samples |
EP1945816B1 (en) | 2005-10-21 | 2011-07-27 | GeneNews Inc. | Method and apparatus for correlating levels of biomarker products with disease |
CN101772581A (en) | 2007-05-31 | 2010-07-07 | 加利福尼亚太平洋医学中心 | Method to predict or diagnose a gastrointestinal disorder or disease |
WO2009015299A1 (en) | 2007-07-26 | 2009-01-29 | California Pacific Medical Center | Method to predict or diagnose a gastrointestinal disorder or disease |
US9764322B2 (en) | 2008-09-23 | 2017-09-19 | Bio-Rad Laboratories, Inc. | System for generating droplets with pressure monitoring |
US8633015B2 (en) | 2008-09-23 | 2014-01-21 | Bio-Rad Laboratories, Inc. | Flow-based thermocycling system with thermoelectric cooler |
US8663920B2 (en) | 2011-07-29 | 2014-03-04 | Bio-Rad Laboratories, Inc. | Library characterization by digital assay |
US8709762B2 (en) | 2010-03-02 | 2014-04-29 | Bio-Rad Laboratories, Inc. | System for hot-start amplification via a multiple emulsion |
US9417190B2 (en) | 2008-09-23 | 2016-08-16 | Bio-Rad Laboratories, Inc. | Calibrations and controls for droplet-based assays |
US9492797B2 (en) | 2008-09-23 | 2016-11-15 | Bio-Rad Laboratories, Inc. | System for detection of spaced droplets |
US11130128B2 (en) | 2008-09-23 | 2021-09-28 | Bio-Rad Laboratories, Inc. | Detection method for a target nucleic acid |
US9132394B2 (en) | 2008-09-23 | 2015-09-15 | Bio-Rad Laboratories, Inc. | System for detection of spaced droplets |
US10512910B2 (en) | 2008-09-23 | 2019-12-24 | Bio-Rad Laboratories, Inc. | Droplet-based analysis method |
US8951939B2 (en) | 2011-07-12 | 2015-02-10 | Bio-Rad Laboratories, Inc. | Digital assays with multiplexed detection of two or more targets in the same optical channel |
US9156010B2 (en) | 2008-09-23 | 2015-10-13 | Bio-Rad Laboratories, Inc. | Droplet-based assay system |
US9598725B2 (en) | 2010-03-02 | 2017-03-21 | Bio-Rad Laboratories, Inc. | Emulsion chemistry for encapsulated droplets |
WO2010064634A1 (en) * | 2008-12-05 | 2010-06-10 | オリンパス株式会社 | Method for preparing fecal sample, solution for preparing fecal sample, and feces collection kit |
CA2767056C (en) | 2009-09-02 | 2018-12-04 | Bio-Rad Laboratories, Inc. | System for mixing fluids by coalescence of multiple emulsions |
CA2767113A1 (en) | 2010-03-25 | 2011-09-29 | Bio-Rad Laboratories, Inc. | Detection system for droplet-based assays |
EP2556170A4 (en) | 2010-03-25 | 2014-01-01 | Quantalife Inc | Droplet transport system for detection |
CA2767182C (en) | 2010-03-25 | 2020-03-24 | Bio-Rad Laboratories, Inc. | Droplet generation for droplet-based assays |
EP3574990B1 (en) | 2010-11-01 | 2022-04-06 | Bio-Rad Laboratories, Inc. | System for forming emulsions |
CN103534360A (en) | 2011-03-18 | 2014-01-22 | 伯乐生命医学产品有限公司 | Multiplexed digital assays with combinatorial use of signals |
JP2014512826A (en) | 2011-04-25 | 2014-05-29 | バイオ−ラド ラボラトリーズ インコーポレイテッド | Methods and compositions for nucleic acid analysis |
GB201107466D0 (en) | 2011-05-05 | 2011-06-15 | Loktionov Alexandre | Device and method for non-invasive collection of colorectal mucocellular layer and disease detection |
WO2013155531A2 (en) | 2012-04-13 | 2013-10-17 | Bio-Rad Laboratories, Inc. | Sample holder with a well having a wicking promoter |
US10876152B2 (en) | 2012-09-04 | 2020-12-29 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
KR102210852B1 (en) | 2012-09-04 | 2021-02-01 | 가던트 헬쓰, 인크. | Systems and methods to detect rare mutations and copy number variation |
US20160040229A1 (en) | 2013-08-16 | 2016-02-11 | Guardant Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US11913065B2 (en) | 2012-09-04 | 2024-02-27 | Guardent Health, Inc. | Systems and methods to detect rare mutations and copy number variation |
US10253358B2 (en) | 2013-11-04 | 2019-04-09 | Exact Sciences Development Company, Llc | Multiple-control calibrators for DNA quantitation |
US10138524B2 (en) | 2013-12-19 | 2018-11-27 | Exact Sciences Development Company, Llc | Synthetic nucleic acid control molecules |
SG11201604923XA (en) | 2013-12-28 | 2016-07-28 | Guardant Health Inc | Methods and systems for detecting genetic variants |
CN108603228B (en) | 2015-12-17 | 2023-09-01 | 夸登特健康公司 | Method for determining tumor gene copy number by analyzing cell-free DNA |
ES2963227T3 (en) | 2016-07-19 | 2024-03-26 | Exact Sciences Corp | Nucleic acid control molecules of non-human organisms |
EP3978624A1 (en) | 2016-07-19 | 2022-04-06 | Exact Sciences Corporation | Methylated control dna |
CA3027919C (en) | 2016-09-30 | 2023-02-28 | Guardant Health, Inc. | Methods for multi-resolution analysis of cell-free nucleic acids |
US9850523B1 (en) | 2016-09-30 | 2017-12-26 | Guardant Health, Inc. | Methods for multi-resolution analysis of cell-free nucleic acids |
US10907211B1 (en) | 2017-02-16 | 2021-02-02 | Quantgene Inc. | Methods and compositions for detecting cancer biomarkers in bodily fluids |
SG11202009744WA (en) * | 2018-04-02 | 2020-10-29 | Sun Genomics Inc | Universal method for extracting nucleic acid molecules from a diverse population of one or more types of microbes in a sample |
CN108949750A (en) * | 2018-08-17 | 2018-12-07 | 上海锐翌生物科技有限公司 | Extract the method and kit of faeces DNA |
WO2020160414A1 (en) | 2019-01-31 | 2020-08-06 | Guardant Health, Inc. | Compositions and methods for isolating cell-free dna |
Family Cites Families (111)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3413464A (en) | 1965-04-29 | 1968-11-26 | Ibm | Method for measuring the nucleic acid in biological cells after enhancement in an acidic solution |
US4101279A (en) | 1977-04-06 | 1978-07-18 | Muhammed Javed Aslam | Device for the collection and processing of stool specimens |
US4333734A (en) | 1980-01-18 | 1982-06-08 | Sloan-Kettering Institute For Cancer Research | Diagnostic device for fecal occult blood and method of use |
US4535058A (en) | 1982-10-01 | 1985-08-13 | Massachusetts Institute Of Technology | Characterization of oncogenes and assays based thereon |
US4309782A (en) | 1980-09-11 | 1982-01-12 | Esteban Paulin | Device for collecting fecal specimens |
US4358535A (en) | 1980-12-08 | 1982-11-09 | Board Of Regents Of The University Of Washington | Specific DNA probes in diagnostic microbiology |
US5482834A (en) | 1982-05-17 | 1996-01-09 | Hahnemann University | Evaluation of nucleic acids in a biological sample hybridization in a solution of chaotrophic salt solubilized cells |
US4445235A (en) | 1982-09-13 | 1984-05-01 | Pearl Slover | Stool specimen collector |
US4578358A (en) | 1983-05-03 | 1986-03-25 | Warner-Lambert Company | Collection of specimens and detection of occult blood therein |
US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4683202A (en) * | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4871838A (en) | 1985-07-23 | 1989-10-03 | The Board Of Rijks Universiteit Leiden | Probes and methods for detecting activated ras oncogenes |
US4705050A (en) | 1985-10-02 | 1987-11-10 | Markham Charles W | Moisture-activated floatation device |
US5348855A (en) | 1986-03-05 | 1994-09-20 | Miles Inc. | Assay for nucleic acid sequences in an unpurified sample |
CA1284931C (en) | 1986-03-13 | 1991-06-18 | Henry A. Erlich | Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids |
US4981783A (en) | 1986-04-16 | 1991-01-01 | Montefiore Medical Center | Method for detecting pathological conditions |
US4735905A (en) | 1986-08-15 | 1988-04-05 | V-Tech, Inc. | Specimen-gathering apparatus and method |
US4935342A (en) | 1986-12-01 | 1990-06-19 | Syngene, Inc. | Method of isolating and purifying nucleic acids from biological samples |
US4857300A (en) | 1987-07-27 | 1989-08-15 | Cytocorp, Inc. | Cytological and histological fixative formulation and methods for using same |
FR2630000A1 (en) | 1988-04-18 | 1989-10-20 | Sultan Bernard | BOTTLE FOR COLLECTING AN URINARY BIOLOGICAL SAMPLE FOR CYTOBACTERIOLOGICAL EXAMINATION |
US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
US5087617A (en) | 1989-02-15 | 1992-02-11 | Board Of Regents, The University Of Texas System | Methods and compositions for treatment of cancer using oligonucleotides |
US5248671A (en) | 1989-02-15 | 1993-09-28 | Board Of Regents, The University Of Texas System | Methods and compositions for treatment of cancer using oligonucleotides |
US5380645A (en) | 1989-03-16 | 1995-01-10 | The Johns Hopkins University | Generalized method for assessment of colorectal carcinoma |
US5527676A (en) | 1989-03-29 | 1996-06-18 | The Johns Hopkins University | Detection of loss of the wild-type P53 gene and kits therefor |
US5362623A (en) | 1991-06-14 | 1994-11-08 | The John Hopkins University | Sequence specific DNA binding by p53 |
US5196167A (en) | 1989-04-04 | 1993-03-23 | Helena Laboratories Corporation | Fecal occult blood test product with positive and negative controls |
US5589335A (en) | 1989-04-05 | 1996-12-31 | Amoco Corporation | Hybridization promotion reagents |
US5302509A (en) | 1989-08-14 | 1994-04-12 | Beckman Instruments, Inc. | Method for sequencing polynucleotides |
CA2029219A1 (en) | 1989-11-08 | 1991-05-09 | Mary K. Estes | Methods and reagents to detect and characterize norwalk and related viruses |
US5641628A (en) | 1989-11-13 | 1997-06-24 | Children's Medical Center Corporation | Non-invasive method for isolation and detection of fetal DNA |
US5137806A (en) | 1989-12-11 | 1992-08-11 | Board Of Regents, The University Of Texas System | Methods and compositions for the detection of sequences in selected DNA molecules |
EP0507852B1 (en) | 1990-01-04 | 1998-04-01 | The Johns Hopkins University | Gene deleted in colorectal cancer of humans |
US5126239A (en) | 1990-03-14 | 1992-06-30 | E. I. Du Pont De Nemours And Company | Process for detecting polymorphisms on the basis of nucleotide differences |
US5200314A (en) | 1990-03-23 | 1993-04-06 | Chiron Corporation | Polynucleotide capture assay employing in vitro amplification |
DE69133528T2 (en) | 1990-06-27 | 2006-09-07 | Princeton University | Protein complex p53 / p90 |
WO1992008133A1 (en) | 1990-10-29 | 1992-05-14 | Dekalb Plant Genetics | Isolation of biological materials using magnetic particles |
US5846710A (en) | 1990-11-02 | 1998-12-08 | St. Louis University | Method for the detection of genetic diseases and gene sequence variations by single nucleotide primer extension |
US5352775A (en) | 1991-01-16 | 1994-10-04 | The Johns Hopkins Univ. | APC gene and nucleic acid probes derived therefrom |
EP0570497B1 (en) | 1991-02-05 | 1996-05-08 | Lifecodes Corporation | Molecular genetic identification using probes that recognize polymorphic loci |
CA2101943A1 (en) | 1991-02-05 | 1992-08-06 | Kamal Bahar | Simple test for detecting carcinoembryonic antigen |
US5330892A (en) | 1991-03-13 | 1994-07-19 | The Johns Hopkins University | MCC gene (mutated in colorectal cancer) used for diagnosis of cancer in humans |
US5468610A (en) | 1991-05-29 | 1995-11-21 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Three highly informative microsatellite repeat polymorphic DNA markers |
US5378602A (en) | 1991-05-29 | 1995-01-03 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Highly informative microsatellite repeat polymorphic DNA markers twenty-[seven]six |
US5149506A (en) | 1991-08-09 | 1992-09-22 | Sage Products, Inc. | Stool collection and transport device |
US5506105A (en) | 1991-12-10 | 1996-04-09 | Dade International Inc. | In situ assay of amplified intracellular mRNA targets |
ATE253645T1 (en) | 1992-04-01 | 2003-11-15 | Univ Johns Hopkins Med | METHOD FOR DETERMINING MAMMAL NUCLEIC ACIDS FROM Stool SAMPLES AND REAGENTS REQUIRED THEREFOR |
US5489508A (en) | 1992-05-13 | 1996-02-06 | University Of Texas System Board Of Regents | Therapy and diagnosis of conditions related to telomere length and/or telomerase activity |
US5710028A (en) | 1992-07-02 | 1998-01-20 | Eyal; Nurit | Method of quick screening and identification of specific DNA sequences by single nucleotide primer extension and kits therefor |
US5409586A (en) | 1992-08-26 | 1995-04-25 | Hitachi, Ltd. | Method for analyzing nucleic acid or protein and apparatus therefor |
US5331973A (en) | 1993-03-15 | 1994-07-26 | Fiedler Paul N | Method for obtaining stool samples for gastrointestinal cancer testing |
CA2092115C (en) | 1993-03-22 | 1998-12-15 | Janet L. Taylor | Testing for infestation of rapeseed and other cruciferae by the fungus leptosphaeria maculans (blackleg infestation) |
US5492808A (en) | 1993-05-05 | 1996-02-20 | The Johns Hopkins University | Means for detecting familial colon cancer (FCC) |
US5466576A (en) | 1993-07-02 | 1995-11-14 | Fred Hutchinson Cancer Research Center | Modulation of PIF-1-type helicases |
WO1995002068A1 (en) | 1993-07-09 | 1995-01-19 | Wakunaga Seiyaku Kabushiki Kaisha | Method of discriminating nucleic acid and testing set for discriminating nucleic acid |
US5416025A (en) | 1993-11-29 | 1995-05-16 | Krepinsky; Jiri J. | Screening test for early detection of colorectal cancer |
US5681697A (en) | 1993-12-08 | 1997-10-28 | Chiron Corporation | Solution phase nucleic acid sandwich assays having reduced background noise and kits therefor |
US5709998A (en) | 1993-12-15 | 1998-01-20 | The Johns Hopkins University | Molecular diagnosis of familial adenomatous polyposis |
US5538851A (en) | 1993-12-22 | 1996-07-23 | Institut Pasteur And Cneva | Primers for the amplification of genes coding for the enterotoxin and the lecithinase of Clostridium perfringens and their application to the determination of the presence and numeration of these bacteriae |
US5496470A (en) | 1994-05-27 | 1996-03-05 | Barnes International, Inc. | Magnetic separator |
US6037465A (en) | 1994-06-14 | 2000-03-14 | Invitek Gmbh | Universal process for isolating and purifying nucleic acids from extremely small amounts of highly contaminated various starting materials |
US5512441A (en) | 1994-11-15 | 1996-04-30 | American Health Foundation | Quantative method for early detection of mutant alleles and diagnostic kits for carrying out the method |
US5463782A (en) | 1994-11-21 | 1995-11-07 | Eric V. Carlson | Foldable stool sample collection device |
US5599662A (en) | 1995-02-17 | 1997-02-04 | Hoffmann-La Roche Inc. | Oliconucleotide primers and probes for the detection of HIV-1 |
DE19530132C2 (en) | 1995-08-16 | 1998-07-16 | Max Planck Gesellschaft | Process for the purification, stabilization or isolation of nucleic acids from biological materials |
GB9518156D0 (en) * | 1995-09-06 | 1995-11-08 | Medical Res Council | Method of isolating cells |
NO954667D0 (en) * | 1995-11-17 | 1995-11-17 | Dagfinn Oegreid | Method for detecting Ki-ras mutations |
US5670325A (en) | 1996-08-14 | 1997-09-23 | Exact Laboratories, Inc. | Method for the detection of clonal populations of transformed cells in a genomically heterogeneous cellular sample |
US5612473A (en) | 1996-01-16 | 1997-03-18 | Gull Laboratories | Methods, kits and solutions for preparing sample material for nucleic acid amplification |
US5741650A (en) | 1996-01-30 | 1998-04-21 | Exact Laboratories, Inc. | Methods for detecting colon cancer from stool samples |
US5897999A (en) | 1996-03-22 | 1999-04-27 | The Johns Hopkins University | Cancer drug screen based on cell cycle uncoupling |
US5645995A (en) * | 1996-04-12 | 1997-07-08 | Baylor College Of Medicine | Methods for diagnosing an increased risk for breast or ovarian cancer |
US6607946B1 (en) * | 1996-05-22 | 2003-08-19 | Micron Technology, Inc. | Process for growing a dielectric layer on a silicon-containing surface using a mixture of N2O and O3 |
AU3583797A (en) | 1996-06-28 | 1998-01-21 | Regents Of The University Of California, The | Enhancement of cancer cell death |
US6203993B1 (en) | 1996-08-14 | 2001-03-20 | Exact Science Corp. | Methods for the detection of nucleic acids |
US6100029A (en) | 1996-08-14 | 2000-08-08 | Exact Laboratories, Inc. | Methods for the detection of chromosomal aberrations |
US5928870A (en) | 1997-06-16 | 1999-07-27 | Exact Laboratories, Inc. | Methods for the detection of loss of heterozygosity |
US6146828A (en) | 1996-08-14 | 2000-11-14 | Exact Laboratories, Inc. | Methods for detecting differences in RNA expression levels and uses therefor |
US5952178A (en) | 1996-08-14 | 1999-09-14 | Exact Laboratories | Methods for disease diagnosis from stool samples |
US6143529A (en) * | 1996-08-14 | 2000-11-07 | Exact Laboratories, Inc. | Methods for improving sensitivity and specificity of screening assays |
US6300077B1 (en) * | 1996-08-14 | 2001-10-09 | Exact Sciences Corporation | Methods for the detection of nucleic acids |
US6020137A (en) | 1996-08-14 | 2000-02-01 | Exact Laboratories, Inc. | Methods for the detection of loss of heterozygosity |
DE19737917B4 (en) * | 1996-08-26 | 2008-11-06 | InViTek Gesellschaft für Biotechnik & Biodesign mbH | Method for detecting clinically relevant changes in the DNA sequence of the Ki-ras oncogene, its use and test kit for the early detection of tumors |
US5856104A (en) | 1996-10-28 | 1999-01-05 | Affymetrix, Inc. | Polymorphisms in the glucose-6 phosphate dehydrogenase locus |
US5830665A (en) | 1997-03-03 | 1998-11-03 | Exact Laboratories, Inc. | Contiguous genomic sequence scanning |
DE19712332A1 (en) | 1997-03-25 | 1998-10-01 | Boehringer Mannheim Gmbh | Method for the detection of microsatellite instability for tumor diagnosis |
US6406857B1 (en) | 1997-06-16 | 2002-06-18 | Exact Sciences Corporation | Methods for stool sample preparation |
US20020004201A1 (en) * | 1997-06-16 | 2002-01-10 | Lapidus Stanley N. | Methods for the detection of loss of heterozygosity |
AU7816898A (en) * | 1997-06-16 | 1999-01-04 | Exact Laboratories, Inc. | Methods for stool sample preparation |
US5888778A (en) | 1997-06-16 | 1999-03-30 | Exact Laboratories, Inc. | High-throughput screening method for identification of genetic mutations or disease-causing microorganisms using segmented primers |
US6268136B1 (en) | 1997-06-16 | 2001-07-31 | Exact Science Corporation | Methods for stool sample preparation |
US5942396A (en) * | 1997-08-19 | 1999-08-24 | The Rockefeller University | Method for identifying individuals at risk for colorectal neoplasia by quantifying normal colonic mucosal epithelial cell apoptosis |
WO1999020798A1 (en) * | 1997-10-23 | 1999-04-29 | Exact Laboratories, Inc. | Methods for detecting contamination in molecular diagnostics using pcr |
US6818404B2 (en) * | 1997-10-23 | 2004-11-16 | Exact Sciences Corporation | Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples |
WO1999026724A2 (en) | 1997-11-25 | 1999-06-03 | Mosaic Technologies | Devices and methods for detecting target molecules in biological samples |
WO1999045147A1 (en) | 1998-03-05 | 1999-09-10 | Diadexus Llc | A novel method of detecting and monitoring endometrial and uterine cancers |
EP1086248A1 (en) | 1998-06-18 | 2001-03-28 | Mosaic Technologies, Inc. | Denaturing gradient affinity electrophoresis and methods of use thereof |
US20020001800A1 (en) * | 1998-08-14 | 2002-01-03 | Stanley N. Lapidus | Diagnostic methods using serial testing of polymorphic loci |
WO2000020643A1 (en) | 1998-10-05 | 2000-04-13 | Mosaic Technologies | Reverse displacement assay for detection of nucleic acid sequences |
AU1479200A (en) * | 1998-11-23 | 2000-06-13 | Exact Laboratories, Inc. | Methods for detecting lower-frequency molecules |
AU2473900A (en) * | 1998-11-23 | 2000-06-13 | Exact Sciences Corporation | Primer extension methods utilizing donor and acceptor molecules for detecting nucleic acids |
US6280947B1 (en) * | 1999-08-11 | 2001-08-28 | Exact Sciences Corporation | Methods for detecting nucleotide insertion or deletion using primer extension |
US6503718B2 (en) * | 1999-01-10 | 2003-01-07 | Exact Sciences Corporation | Methods for detecting mutations using primer extension for detecting disease |
JP2002537777A (en) * | 1999-02-25 | 2002-11-12 | エグザクト サイエンシーズ コーポレイション | Methods for preserving DNA integrity |
JP4794052B2 (en) * | 1999-04-09 | 2011-10-12 | ジェンザイム・コーポレーション | Method for detecting a nucleic acid that is an indicator of cancer |
AU4669600A (en) | 1999-05-03 | 2000-11-17 | Exact Laboratories, Inc. | Stool specimen collector |
US6586177B1 (en) * | 1999-09-08 | 2003-07-01 | Exact Sciences Corporation | Methods for disease detection |
CA2394921A1 (en) * | 1999-12-07 | 2001-06-14 | Anthony P. Shuber | Supracolonic aerodigestive neoplasm detection |
US6911308B2 (en) * | 2001-01-05 | 2005-06-28 | Exact Sciences Corporation | Methods for detecting, grading or monitoring an H. pylori infection |
US6428964B1 (en) | 2001-03-15 | 2002-08-06 | Exact Sciences Corporation | Method for alteration detection |
US20030049659A1 (en) * | 2001-05-29 | 2003-03-13 | Lapidus Stanley N. | Devices and methods for isolating samples into subsamples for analysis |
-
2000
- 2000-04-07 JP JP2000611730A patent/JP4794052B2/en not_active Expired - Lifetime
- 2000-04-07 ES ES00921839T patent/ES2269129T3/en not_active Expired - Lifetime
- 2000-04-07 DE DE60029092T patent/DE60029092T2/en not_active Expired - Lifetime
- 2000-04-07 US US09/545,162 patent/US6964846B1/en not_active Expired - Fee Related
- 2000-04-07 AT AT00921839T patent/ATE331811T1/en not_active IP Right Cessation
- 2000-04-07 AU AU42105/00A patent/AU767983B2/en not_active Ceased
- 2000-04-07 EP EP00921839A patent/EP1169479B1/en not_active Expired - Lifetime
- 2000-04-07 CA CA002366778A patent/CA2366778C/en not_active Expired - Fee Related
- 2000-04-07 WO PCT/US2000/009263 patent/WO2000061808A2/en active IP Right Grant
-
2005
- 2005-03-23 US US11/090,479 patent/US20050260638A1/en not_active Abandoned
-
2007
- 2007-12-19 US US11/960,313 patent/US20090291436A1/en not_active Abandoned
-
2010
- 2010-03-22 US US12/729,051 patent/US20100173320A1/en not_active Abandoned
- 2010-05-26 JP JP2010121029A patent/JP2010187701A/en not_active Withdrawn
-
2013
- 2013-06-17 US US13/919,622 patent/US20130280727A1/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
EP1169479A2 (en) | 2002-01-09 |
US20130280727A1 (en) | 2013-10-24 |
EP1169479B1 (en) | 2006-06-28 |
AU4210500A (en) | 2000-11-14 |
DE60029092T2 (en) | 2007-02-01 |
AU767983B2 (en) | 2003-11-27 |
JP2002541824A (en) | 2002-12-10 |
WO2000061808A2 (en) | 2000-10-19 |
CA2366778A1 (en) | 2000-10-19 |
JP2010187701A (en) | 2010-09-02 |
US20100173320A1 (en) | 2010-07-08 |
WO2000061808A3 (en) | 2001-08-02 |
ATE331811T1 (en) | 2006-07-15 |
JP4794052B2 (en) | 2011-10-12 |
ES2269129T3 (en) | 2007-04-01 |
DE60029092D1 (en) | 2006-08-10 |
US20050260638A1 (en) | 2005-11-24 |
WO2000061808A9 (en) | 2002-04-04 |
US20090291436A1 (en) | 2009-11-26 |
US6964846B1 (en) | 2005-11-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2366778C (en) | Methods for detecting nucleic acids indicative of cancer | |
US6406857B1 (en) | Methods for stool sample preparation | |
US6268136B1 (en) | Methods for stool sample preparation | |
ES2886923T3 (en) | Methods and composition for generating single-sequence DNA probes, labeling of DNA probes, and the use of these probes | |
KR101569498B1 (en) | Method for Detecting Gastric Polyp and Gastric Cancer Using Gastric Polyp and Gastric Cancer Specific Methylation Marker Gene | |
US20080145852A1 (en) | Methods and compositions for detecting adenoma | |
CN109825586B (en) | DNA methylation qPCR kit for lung cancer detection and use method | |
EP1185693A2 (en) | Methods for improving sensitivity and specificity of screening assays | |
AU767833B2 (en) | Methods of detecting colorectal disease | |
CN110484621B (en) | Early warning method for liver cancer | |
CN111235238A (en) | DNA methylation detection method and related application | |
WO1998058081A1 (en) | Methods for stool sample preparation | |
US20020004206A1 (en) | Methods of screening for disease | |
CN113493835A (en) | Method and kit for screening large intestine tumor by detecting methylation state of BCAN gene region | |
JP5865241B2 (en) | Prognostic molecular signature of sarcoma and its use | |
WO2021185275A1 (en) | Probe composition for detecting 11 cancers | |
US7592137B2 (en) | Genetic testing kits and a method of bladder cancer | |
JP2016198027A (en) | Method for diagnosing ovarian cancer | |
CN113930487A (en) | Novel multi-sample multi-fragment DNA methylation detection method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKLA | Lapsed |
Effective date: 20180409 |