CA2353801A1 - Template-dependent ligation with pna-dna chimeric probes - Google Patents

Abstract

The invention provides methods, kits, and compositions for ligation of PNA-DNA
chimeric probes and oligonu-cleotides when they are hybridized adjacently to template nucleic acids and ligation reagents. Structural requirements of the chimeras for ligation include 5 to 15 contiguous PNA monomer units, 2 or more contiguous nucleotides, and a 3' hydroxy or 5' hydroxyl terminus. The chimera and/or oligonucleotide may be labelled with fluorescent dyes or other labels. The methods include, for example, oligonucleotide-ligation assays (OLA) and single nucleotide polymorphism detection.

Description

WU otl~~3?b PCTIU91~7?30 PNA-DNA CHIMERIC PROBES
1. FIELD OF THE INVENTION
The invention relates generally to the fields of enzymology and nucleic acid analogs.
Specifically, this invention is directod to templato-dependent ligation of PNA-DNA
chimeras and oligonucleotides with ligase enzymes.
D. REFERENCES
Andrus, A. "Chemical methods for 5' non-isotopic labelling of PCR probes and primers"
(1995) in PGR 2: A Practical Apprd~ach, Oxford University Press, Oxford, pp.
39-54.
Barany, F. "Genetic disease detection and DNA amplification using cloned thenmostable iigase", Proc. Natl. Aced. Sci. USA 8$:189-93 ( 1991 ).
Barany, F., Hood, L., Kaiser, R., Nickerson, D., Zebala, J. " New thecmostable DNA ligase - obtd. using DNA from Thermos aquaticus strain HBB, used for ligation of oligonucleotides", WO 91/19239, lntl. Publ. Date Nov. 14,1991.
Beaucage, S. and Iyer, R. "Advances in the synthesis of oligonucleotides by the phosphoramidite approach", Tetrahedron 48:2223-2311 (1992).
Benson, S., Menchm, S., Theism, P., Upha~dhya, K., and Hauser, J. "Aromatio-substitutod xanthene dyes", WO 99/16832, Intl. Publ. Date Apr. 8,1999.
Bergot, B., Chakerian, V., Connell, C., Eadie, J., Fung, S., Hershey, N., Lee, L., Menchen, S. and Woo,.S~ "Spoctrally resolvable thodamine dyes for nucleic acid sequence determination", U.S. Pateni 5,366,860, issued Nov. 22,1994.
Blackburn, G. and Gait, M. Eds. "DNA and RNA structure" in Nscleic Acids in Chemistry and Biology, 2"d Edition, (1996) Oxford University Press.
Breipohl, G., Will, D.W., Peyrnan, A. & Uhlmann, E. "Novel synthetic routes to PNA
monomers and PNA-DNA linker molecules", Tetrahedron 53:14671-86 ( 1997).
Bronstein, I. and Voyta, J., "Methods of using chemiluminescent 1,2-dioxetanes" U.S.
Patent 4,931,223, issued Jun. 5, t990.
Buchardt, O., Egholm, M., Nielsen, P., and Bag, R. "Peptide Nucleic Acids", WO
92/20702, Intl. Pub. Date 26 November 1992.

we ~u rc~rrtrs~rr~o Ca>uthers, M. and Beaucage, S. "Plmsphorsmidite compounds and processes", U.S.
Patent No. 4,415,732, issued Nov. 15, 1983.
Caruthers, M. and Matteueci, M. "Pmceas for preparing polynucleotides", US
Patent No.
4,458,066, issued July 3, 1984.
Clegg, R., "Fluorescence resonance energy transfer and nucleic acids", Meth.
Enzymol., 21 I :353-388 ( 1992).
Cook, P. "PNA-DNA-PNA Chimeric macromolxules"; US Patent No. 5,700,922, issued Dec. 23, 199?.
Delahunty, C., Ankener, W., Deng, Q., Eng, J. and Nickerson, D. "Testing the feasibility of DNA typing for human identification by PCR and an oligonucleotide ligation assay", Am. J. Hum. Genetics 58:1239-46 (1996).
Egholm, M., Christensen, L., Dueholm, K., Buchardt, O., Coull, l., and Nielsen, P.
"Efficient pH-independent sequence-specific DNA binding by pseudoisocytosine-containing bis-PNA", Nucleic Acids Res. 23:217-22 (I995).
Eghohn, M., Buchardt, O., Christensen, L., Behrens, C., Freier, S., Driver, D., Berg, R. and Kim, S. "PNA hybridizes to complementary oligonucicotides obeying the Watson-Crick hydrogen bonding rules", Nature 365:566-68 ( 1993).
Finn, P.J., Gibson, N.J., Fallen, R., Hamilton, A. & Brown, T. "Synthesis and properties of DNA-PNA Chimeric oligomers", Nucleic Acids Research 24:3357-63 ( I996).
Flanagan, W., Wagner, R., Grant, D., Lin, K. and Matteucci, M. "Cellular penetration and antisense activity by a phenoxazine~aubstitutod heptanucleotide", Nature Biotech.
17:48-52 (1999).
Fodor, S., Pirrung, M., Read, J., and Stryer, L. "Array of oligonucleotides an a solid substrate", US Patent No. 5,445,934, issue Aug. 29,1995.
Grossman, P., Bloch, W., Brinson,E., Chang, C., Eggerding, F., Fung, S., lovannisci, D., Woo, S. and Wine-Deen, E. "High-density multiplex detection of nucleic acid sequences: oligonucleotide ligation assay and sequence-coded separation", Nucl.
Acids Res. 22:4527-34 (1994).
Guo, Z., Guilfoyle, R., Thiel, A., Wang, R. and Smith, L. "Direct fluorescence analysis of genetic polymorphis~tns by hybridization with oligonucleotide arrays on glass supports", Nucl. Acids Res. 22:5456065 (1994).

we omr~u ~ rcrrtrsoorrrr~e Jensen, K., 8rum, H., Niehen,-P., Norden, B. "Kinetics for hybridization of peptide nucleic acids (PNA) with DNA and RNA studied with the BIAcore technique", Biochem 36:5072-77 (1997).
Khan, S., Me~chen, S., Rosenbium, B. "Substituted ptopargyrlethoxyanudo nucleosides, oligonucleotides atd methods for using same", U.S. Patent 5,770,716, issued Jun. 23, 1998, and "Ptapargyldhoxyamino nucleotides", U.S. Patent 5,821,356, issued Oct. 13, Koppitz, M., Nielsen, P., Orgel, L. "Formation of Oligonucleotide-PNA-Chimeras by Template-Directed Ligation", J. Am. Ghem. Sec., 120:4563-69 (1998).
Kornberg, A. in DNA Replication (1980), W.H. Freeman and Co., San Francisco, pp. 261-76.
Kricka, L. in Nonisotopic DNA Probe Technigues ( 1992), Academic Press, San Diego, pp.

3-28.
Kubista, M. and Svanvik, N. "Probe for analysis of nucleic acids", WO
97/45539, Intl. Publ.
Date Dee. 4, 1997.
Kutyavin, L, Lukhtanov, E., Gamper, H. and Meyer, R. "Covalently linked oligonucleotide minor groove binder conjugates", WO 96/32496, Intl. Publ. Date Oct. 17,1996.
Kyger, E., Krevolin, M. and Powell, M. "Detection of the hereditary hemochromatosis gene mutation by real-time fluoroscenee polymerise gene reaction and peptide nucleic acid clamping", Anal. Biochem. 260:142-4$ ( 1998).
Landegren, U., Kaiser, R., Sanda~s,1. and Hood, L. "A ligase mediated gene detection t~hnique", Science 241:1077-80 (1988).
Lee, L., Spurgeon, S., Rosenblum, B. "Energy transfer dyes with enhanced fluorescence", U.S. Patent 5,800,996, issuad Sep. 1, 1998.
Lutz, M., Will, D., Breipohl, G, Benner, S. ar>d Uhlmann, E. "Synthesis of a monocharged geptide nucleic acid (PNA) analog and its recognition as substrate by DNA
polymerise", Nucleosides 8t Nucleotides 18:393-401 (1999).
Lutz, M., Benner, S., Heir, S., Breipohl, G. and Uhlmann, E. "Recognition of uncharged polyamide-linked nucleic acid analogs by DNA polymerises and reverse transeriptatses", J. Am. Chem. Sec. 1 l 9:3177-78 ( 1997).
Menchen, S., Lee, L., Connell, C., Hershey, N., Chakerian, V., Woo, S. and Fung, S. "4,7-Dichtorofluorescein dyes as molecular probes", U.S. patent 5,188,934, issued Feb. 23, 1993.
_3.

wo om~3a~ rc~'rt~soer~n~o Meyer, R. "Incorporation of modified bases in oiigonucleotides" in Protocols jor Oligonucleotide Conjugates. Ed S. Agrawal ( 1994) Humana Press, Totowa, NJ, pp.
73-92.
Mullah, B. and Andrus, A. "Solid support reagents for the direct synthesis of 3'-labeled polynucleotides", U.S. Patent 5,736,626, issued Apr. ?, 1998.
Nickcrson, D., Kaiser, R., Lappin, S., Stewart, J., Hood, L. and Landegren, U.
"Automated DNA diagnostics using an ELISA-based oligonucleotide assay" Pros. Natl. Aced.
Sci USA 87:8923-27 (1990) Nielsm, P., Egholm, M., Berg, R. and Huchardt, O. "Sequence-selective recognition of DNA by strand displacement with a thymidine-substituted polyamide", Science 254:1497~1500 (1991).
Rajur, S., Robles, J., Wiederholt, K., Kuimelis, R. and Mcl:,aughlin, L.
"Hoechst 33258 td>~ered by a hexa (ethylene glycol) linker to the S'-termini of oligodeoxynucleotide 15-mere: duplex stabilization and fluorescence properties", J. Organic Chem.
62:523-29 (1997).
Stanton, T., Schindele, D., Renzoni, G., Pepich, B., Anderson, N., Clagett, J.
and Opheim, K. "Preparation and use of monomeric phthalocyanine reagents", WO 8804777, lntl.
Publ. Date: June 30, 1988.
Stetsenko, D.A., Lubyako, E.N., Potapov, V.K., Azhikina, T.L. & Sverdlov, E.
"New Approach to Solid Phase Synthesis of Polyamidc Nucleic Acids Analogues (PNA) and PNA-DNA Conjugates", Tetrahedron Lett 37:3571-74 (1996).
Takahashi, M. etal, "Therraophilic DNA ligase", J. Biol. Chem. 259:10041-47 (1984).
Theism, P., McCollum, C. and Andtus, A. "Fluorescent dye phosphoramidite labelling of oligonucleotides", in Nucleic Acid Symposiuri~ Series lVo. 27, Oxford University Press, Oxford, pp. 99-100 ( 1992).
Uhlmann, E. "Peptide nucleic acids (PNA) and PNA-DNA chimaas: from high binding affinity towards biological function", Biol. Chem. 379:1045-52 (1998).
Uhlmann, E., Will, D.W., Breipohl, G., Langner, D. & Ryte, A. "Synthesis and properties of PNAIDNA chimeras", Angew. Chem., Intl. Ed. Eng. 35:2632-35 (1996).
Uhlmann, E., Peyman, A., Breipohl, G. and Will, D. "PNA: Synthetic polyanude nucleic acids with unusual binding properties", Angew. Chem., Intl. Ed. Eng. 37:2796-( 1998).

wo omr~s rc'rnrsoo~e Van der Laan, A.C. et al. "Optimization of the binding properties of PNA-(5~-DNA
Chimerae", Bioorg. Med. Char. Left. 8:663-68 ( 1998).
Van der Laan, A., Brill, R., Kuimelis, R., Kuyl-Yeheskiely, E., van Boom, J., Andrus, A.
and Vinayak, R. "A convenient autmnated solid-phase synthesis of PNA-(5'~DNA-(3'~PNA chimera", Tetrahedron Lett. 38:2249-52 (1997).
Vinayak, R., van der Lawn, A., Brill, R., Otteson, K., Andrus, A., Kuyl-Yeheskiely, E. and van Boom, J. "Automated chemical synthesis of PNA-DNA chimera on a nucleic synthesizer", Nucleosides & Nucleotides 16:1653-56 ( 1997).
Vinayak, R. "Process and cornpotmds fcx RNA synthesis", U.S. Patent No.

5,281,701, issued Jan. 25, 1994.
Wengei, J. "Oligonuclcotide analogs", WO 99114226, lntl. Publ. Date 25 Mar.
1999.
Whiteley, N., Hunkapiller, M. and Giazat, A. "Detection of specific sequences in nucleic acids", U.S. Patent 4,883,750, issued 1989.
Will, D.W., Breipohl, G., Langner, D., Knolls, J. & Uhlmann, E. "The Synthesis of Polyamide Nucleic Acids using a Novel Monomethoxytrityl Protecting-Group Strategy", Tetrahalron 51:12069-12082 (1995).
III. BACKGROUND
The covaltnt joining of nucleic acid probes by ligase enzymes is one of the most useful tools available to molecular biologists. When two probes are annealed to a template nucleic acid where the two pros are adjacent and without intervening gaps, a phosphodiester bond can be fonned by a ligase enzyme (Whiteley, 1989). The ligation bond is foamed between a 5' terminus of one probe and the 3' terminus of the other probe.
The events of annealing and ligation each require a high level of fidelity, i.e.
complanentarity, between the soquences of the ligating probes and the template nucleic acid. Both events arc ine~cient when base-pairing mismatches occur. Generally, DNA
ligase can join two adjacent probes only when they perfxtly complement a denatured template nucleic acid, such as a PCR product (Landegren, 1988;
Nickerson,1990). Even a single nucleotide mismatch at, or near, the ligation site of the probes will prevent ligation of the annealed probes.
Oligonucleotide ligation assays detect the presence of specific sequences in target DNA sample. For example, allelic discrimination assays rely on probes representing the complementary sequences of the alklie forms to the target. Ligation to a common, second target-complementary probe indicates the presence of the polymorphic site (Whiteley, 1989;

wo eirrr~ Irc'rrtlseen'n3e Landegren, 1988). Absence of ligation indicates the lack of the polymorphic site. Ligation can be detected through detectable labels on the allelic probe and electrophoretie separation of the ligation products (Cmosstnan,1994).
It is desirable to provide optimized probes and methods of annealing and ligation.
Such methods would improve assays and tests that benefit from greater precision and accuracy.
IV. SUMMARY
The invention relates to chimeric molecules of PNA and DNA monomer units and their use in ligation methods to generate ligation products. The invention is based in part on the discovery that a ligase enzyme can ligate a PNA-DNA chimerie probe and a second probe under a broad range of experimental conditions and variables. PNA-DNA
chimeras of the invention comprise at least two moieties covalently linked together, preferably: t) a contiguous moiety of 3 to 15 PNA monomer units, and ii) a contiguous moiety of at least two nucleotides. The nucleotide moiety has a ligatable terminus, such that the PNA-DNA
chimera can be ligatcd to a second probe.
In a first aspect, the invention provides a method of producing a template-dependent ligation product by ligating a PNA-DNA chimtric probe, annealed to a template nucleic acid in the presence of a ligase and a ligation roagent, to a second probe annealed adjacent to the chimeric probe on the template nucleic acid. The socond probe is capable of supporting template-dependent ligation. The second probe is a PNA-DNA chimera or an oligonuchtide. The second probe may be 5 to 100 monomer units or nucleotides (nt) in Length. Preferably the second probe is 10 to 30 nt. Together, the chimeric probe and the second probe may be 10 to 100 nt.
In one illustrative embodiment of the imrention, tht PNA-DNA chimera has the formula:
Px-L'Ny where each P is independently a PNA monomer, x is an integer from 3 to I 5, L
represents a covalent linkage between P and N, each N is independently a nucleotide, y is an integer from 2 to I5, and the terminal N has either a 3' hydroxyl group or S' hydroxyl group.
In a preferred embodiment, the PNA moiety, i.e., PX, of the PNA-DNA chimera is a 2-aminoethylglycine peptide nucleic acid.
-G-wo omr~z6 rcrnrs~nn3.
The DNA moiety, i.e., Ny, of the PNA-DNA chimera may be comprised of 2'-deoxynucleotides (DNA), ribonucleotides (RNA), and modified sugars or internucleotide linkages thereof, especially those that confer greattr specificity, affinity, rate of hybridization, and chemical stability.
The chimera andlor the second probe may be labellod with a non-radioisotopic label such that the ligation product is non-radioisotopically labelled. In embodiments employing a labelled PNA-DNA chimera, the PNA-DNA chimera may be labellod at: (i) a nucleobase, e.g. the 7-deaza or C-8 positions of a punine or a deazapurine nucleobase, or the C-5 position of a pyrimidine nucleobase; (ii) a sugar; (iii) the PNA backbone; or (iv) an amino, a sulfide, a hydroxyl, and/or a carboxyl group. Preferably, the chimera is labelled at the amino terminus of the PNA moiety. In embodiments employing a labelled oligonucleotide, the oligonucleotide is preferably labelled at the opposite tenminus from the ligation site, 3' or 5'.
Alternatively, the oligonucleotide may be labellod at a nucleobase, but may also be labelled at other positions provided that the label does not interfere adversely with hybridization affinity or specificity, or with ligase efficiency. Labels may be fluorescent dyes, fluorescence quenchers, hybridization-stabilizers, energy-transfer dye pairs, electrophoretic mobility modifiers, chemiluminescent dyes, amino acids, proteins, peptides, enzymes, and affinity ligands. Preferably, the label is detectable upon illumination with light, e.g. laser sources at infrared, visible or ultraviolet excitation wavelengths.
The PNA and DNA moieties of the chimeric probe are covalently linked together.
The linkage, L, between the PNA and DNA moieties may be a bond, e.g. the carbonyl-nitrogen bond in an amide group where the moieties are linked without intervening atoms, or a multi-atom linker. The linkage may comprise a phosphodiester group or a phosphoramidate group.
The template or target nucleic acid can be any nucleic acid or nucleic acid analog capable of mediating template-directod nuclac acid synthesis. Examples of suitable template nucleic acids include, e.g., genomie DNA, DNA digests, DNA fragments, DNA
transcripts, plasmids, vectors, viral DNA, PCR products, RNA, and synthetic nucleic acids.
The template nucleic acid may also be a metaphase or interphase chromosome.
Preferably, the chromosome is denatured prior to PNA-DNA chimera hybridization and ligation.
Template nucleic acids may be single-stranded or double-stranded and can range from as few as about 20-30 to as many as millions of nucleotides (nt) or base-pairs (bp), depending on the particular application.

wo omr~z6 rcz'rt~soonri3o The template nucleic acid, the PNA-DNA chimera, or the second probe may be immobilized on a solid substrate. Legations may be conducted where one of the probes or template is attached to a solid support or surface.
V. BRIEF DESCRIPT10N OF THE DRAWINGS
S FIG. 1 Structures of PNA and PNA-DNA chimeras with: (IA) two 2'.
deoxynucleotides, and (1B) three 2'-deoxynucleotides. B is a nucleobase.
FIG. 2 Structures of linker reagents and linkages: (2A) linker reagents to form amide and phosphodiester linkages, (28) bis-amide linkage of 2-(2-aminoethoxy) ethoxyacetic acid, and (2C) amide, phosphate linkage of 2-(2-aminoethoxy)rthanol.
FIG. 3 Generalized schematic of legation: (3A) between a 3'-hydroxyl PNA-DNA
chimera and a 5 =phoapttate oligonucleotide hybridized to a DNA template with DNA ligase to forn~ a PNA-DNA legation product, and (3B) probe sequences artd a 38nt perfxt match DNA template for legation experimatts.
FIG. 4 Scanned images of PAGE analysis of legation experiments: (4A top) with DNA ligase and (4A bottom) without ligase; and (4H) quantitative estimate of tigateon by densitornetry, SpotDenso program.
FIG. 5 Scanned images of PAGE analysis of legation experiments with T4 DNA
Iigase: (5A) SYBR-Green stained gel image; and (5B) schematic of legation of PNA, PNA-DNA chimera, and DNA to S'-phosphate oligonucleotides hybridized to a DNA template 38at.
FIG. 6 Scanned image of PAGE analysis of PNA-DNA chimera ligase reactions detecting wild-type and mutant sequences. Specificity of PNA-DNA chimeric probe: oii~onucleotide legation relative to.oligonucleotide:oligonueleotide ~ligatiori:
FIG. 7 MALDI-TOF Mass Spxtroscopy analysis of legation reaction products: (7A) without ligase and (7B) with ligase.
FIG. 8 Oligonucleotide Legation Assay (OLA) with PNA-DNA chimeric probes.
(8A) Determining the nature of a locus with different dye labels; (8B) Multiplex OLA with mismatched base at 5'-phosphate of oligonucleotides of different lengths and/or mobility modifiers; (8C) Multiplex OLA with mismatched base at 3' terminus of PNA-DNA chimeras of different lengths andlor mobility modifiers FIG. 9 Olegonuclootide legation assay with PNA-DNA chimera probes to discriminate mutations in human CFTR loci: (9A) human pCF'fR621G-T: exon 4;
(9B) human pCFTRl078de1T: exon 7; (9C) human pCFTRG551D: exon I 1.
.g_ WO ol~Z~26 PCTIUS~T131 (UPPER CASE - PNA, lower case - DNA); (9D) OLA with PNAta",~-DNA3",~ at CFTR locus 6216-T. Visualized and recorded under W illumination (top) and with SYBR Green staining (bottom).
VI. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Reference will now be made in detail to the preferred embodiments of the invention. While the invention will be described in conjunction with the preferred embodiments, it will be tuidastood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims.

Unless stated otherwise, the following tenors and phrases as used herein ~e intended to have the following meanings:
"Nucleobase" refers to a nitrogen-captaining heterocyclic moiety, e.g. a purine, a 7-deazapurine, or a pyrinudine. Typical nucloobeses are adenine, guanine, cytosine, uracil, thymine, 7-deazaadenine, ?-deazaguanine, and the like.
"Nucleoside" refeni to a compound consisting of a nucleobase linked to the C-1' carbon of a ribose sugar.
"Nucleotide" refers to a phosphate ester of a nucleoside, as a monomer unit or within a n~leic acid. Nucleotides are sometimes da~oted as 'NfP", or "dNTP" and "ddNTP"
to particularly point out the swetural feadn~es of die ribose sugar. "Nucleotide 5'-triphosphate"
refers to a nucleotide with a triphosphate.e~ter group at the 5' position. The triphosphate ester group may include sulfur substitutions for the various oxygens, e.g. a-thio-nucleotide 5'-triphosphates.
As used herein, the txrm "nucleic ackl" axompasses the terms "oligonucleotide"
and "polynucleotide" and means single-atrarided and double-stranded polymers of nucleotide monomers, including 2'-deoxyribonucleortides (DNA) and ribonucleotides (R,NA).
The nucleic acid may be composed a~tirely of deoxyribonuclootides, entirely of ribonucleotides, or chimeric mixtures thereof, linked by internucleotide phosphodiester bond linkages, and associated counterions, e.g., H', NHa+, triallcylammonium, Mgr+, Na' and the like. Nucleic acids typically range in size from a few monomeric units, e.g. 5-40 when they are commoniy referred to as oligonucieotides, to several thousands of monomeric units.
Unless denoted WO A1/1'f3Z6 PCT1U800JI'T130 otherwise, whenever an oligonucleotide sequence is represented, it will be understood that the nucleotides are in 5' to 3' order from IeR to right and that "A" denotes dcoxyadenosine, "C"
denotes deoxycytidine, "G" denotes deoxyguanosine, and "T" denotes thymidine, unless otherwise noted.
The term "Watson/Crick base-pairing" refers to the hydrogen-bonding base pairing commonly observed in double-stranded DNA.
"Attachment site" refers to a site on a moiety, e.g: a chimera or nucleotide, to which is covalently attached a linker.
"Linker" refers to a moiety that links one moiety to another, e.g.: (l) a label to an oligonucleotide or PNA-DNA chimera, or (ii) the PNA moiety to a DNA moiety in a PNA-DNA chimera.
"PNA-DNA Chimera" refers to an oligomer comprised of (l) a contiguous moiety of PNA monomer units and (ii) a contiguous moiety of nucleotide monomer units with an enzymatically-extendable terminus.
"Alkyl" refers to a saturated or unsaturated, branched, straight-chain, branched, or cyclic hydrocarbon radical derived by the removal of one hydrogen atom from a single carbon atom of a parent alkane, alkene, or alkyne. Typical alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, and the like. In preferred embodiments, the alkyl groups consist of 1-12 saturated and/or unsaturated carbons.
"Cycloalkyl" refers to a cyclic alkyl radical. Nitrogen atoms with cycloalkyl substituents may form aziridinyl, azetidinyl, pyrnolidinyl, piperidinyl, larger rings, and substituted fomts of heterocycles thereof.
"Alkyldiyl" refers to a saturated or unsaturated, branched, straight chain or cyclic hydrocarbon radical of 1-20 carbon atoms, and having two monovalent radical centers derived by the removal of two hydrogen atoms from the same or two different carbon atoms of a parent alkane, alkene or alkyne. Typical alkyldiyl radicals include, but are not limited to, 1,2 ethyldiyl, 1,3-propyldiyl, i,4-butyldiyl, and the like.
"Aryldiyl" refers to an unsaturated cyclic or polycyclic hydrocarbon radical of 6-20 carbon atoms having a conjugated resonance electron system and at least two monovalent radical centers derived by the removal of two hydrogen atoms from two different carbon atoms of a parent aryl compound. Typical aryldiyl groups include, but are not limited to, radicals derived from benzene, substituted benz~e, naphthalene, anthracene, biphenyl, and the like.

viro e>in~6 rcrm~onrr~
"Label" refers to any non-radioisotopic moiety covalently attached to a chimera or nucleotide that is detectable or imparts a desired functionality or property in the ligation extension product.
"Ligation" is the enzymatic joining by fa'nrutaon of a phosphodiester bond between a PNA-DNA chimeric probe and a sxond probe o4gonuclootide why the chimera and the second probe arc hybridized (annealed) adjacently and to a tanplate nucleic acid.
VL2 PNA-DNA C,~1~~~~,~A
In one aspect, the present invention utilizes chimeric probes which contain PNA
moieties and DNA moieties. The PNA moieties array be any backbone of acyclic, achiral, and neutral polyamide linkages to which nucleobases are attached. A preferred form of the PNA moiety is a backbone of N-(2-aminoothyl}.glycine, a peptide-like, amide-linked unit (Buchardt, 1992; Nielsen, 1991 ), as shown below in a partial structure with a carboxyl-terminal amide:
H-- B
~~o o' J
~o o~
i~ s ~~o o~
PNA oligomers themselves are not substrates for nucleic acid processing enzymes, such as DNA polyrnerases (Lutz, 1999; Kyger, 1998; Lutz, 1997).
PNA-DNA chimeras are oligomers carmprised of: 1 ) a contiguous moiety of PNA
monomer units and 2) a contiguous moiety of nucleotides. The two moieties are covalently linked together. 'The nucleotide moiety of the chimera may be 2'-deoxynucleotides, ribonucleotides, or a mixture thereof. The nucleotide moiety of the chimera has a 3' hydroxyl terminus. The preferred length of the PNA moiety is from 3 to 15 PNA
monomer wo nnr3~ rcrrosoonn3o units, reflecting optimum enzymatic activity, hybridization specificity and afl;tnity, economy of synthesis reagents, and ease of chimera synthesis and purification.
The length of the DNA moiety is from 2 to 15 nucleotides. The preferral length of the DNA
moiety is the shortest sequence which promotes efficient ligation, i.e. at least two 2'-deoxynucleotides (Figure 1 A).
Preferred nucleobases in one or more PNA monomer units include, but are not limited to, adenine, guanine, cytosine, uracil, thymine, 7-deazaadenine, 7-deazaguaninc, C~5-alkyl pyrimidincs, 2-thiopyrimidine, 2,6-diaminopurine, C-5-propyne pyrimidine, phenoxazine (Flanagan, 1999), 7-deazapurine, isocytidine, pseudo-isocytidine (Egholm, 1995), isoguanosine, 4(3 FI)-pyrimidone, hypoxanthine, and 8-oxopurines (Meyer, 1994).
The increased affinity and specificity (Egholm, 1993; Jensen, 1997) conferr~
by the PNA moiety in a PNA-DNA chimera allows for shorter probes to be used in hybridization experiments and assays (ZJhlmann and Peyman, 1998; Uhlmann, 1998; Cook; 1997;
Uhlmann, 1996. In general, shorter probes ate more specific than corresponding longer probes, i.e. the relative structural perturbation is larger in a smaller probe. Also, shorter probes are more economical, i.e. cheaper to synthesize, and require less soquence information to design. It is desirable to provide methods by which PNA-DNA
chimeras can be ligated to oligonuclcotides and other PNA-DNA chimeras to form PNA-containing ligation products.
Binding of the PNA moiety in a PNA-DNA chimera to its DNA or RNA
complement can occur in either a parallel or anti-parallel orientation. The anti-parallel duplex, where the carboxyl terminus of PNA is aligned with the 5'terminus ofthe complement DNA, and the amino terminus of PNA is aligned with the 3' terminus of the DNA complement, is typically more stable than the parallel duplex, where the carboxyl terminus of PNA is aligned with the 3' terminus of the DNA complement and the amino terminus of PNA is aligned with the 5' terminus of the DNA complement (Koppitz, 1998;
Egholm, 1993). The exemplary chimeras shown here are designed such that the PNA
moiety anneals in the ants-parallel orientation with the target sequences.
Whenever a PNA
sequence is represented as a series of letters, it is understood that the amino terminus is at the left side and the carboxyl terminus is at the right side.
Chimera sequences are typically completely complementary to a portion of the target sequence. However, chimera sequences may contain mixed-base ("redundant" or "degenerate") sites whereby a chimera sample may be a mixture of sequences with one or wo oinraab rc'rrosoo~~rio more base positions represatttod by two or morc different nucloobases. The mixed-base site may be located in the PNA or DNA moieties of the oligorner. Mixed-base chimeras are mixtures of sequences with varying levels of complementarity to a particular target sequence. Mixed-base chnmeras ntay be useful for random priming or where template sequence information is unknown ~ uncertain.
Although certain featu~tes of the invention are illustrated herein using single-stranded probes and template nuckic acids, it will also be appreciated that any of the probes and template nucleic acids may contain double-stranded regions. It is also contemplated that PNA-DNA chimeras may undergo ligation as one or both strands of a duplex ligating with a second duplex, where both strand of each duplex may ligate with overhangs ("sticky ends"). For example, the d~imeric probe can be provided in double-stranded form with a sticky end such that the overhang strand contains the DNA moiety and at least a portion of the PNA moiety which is complementary to the template nucleic acid, and such that the recessed strand of the chimaic probe, upon hybridization of the chimeric probe to the template, is positioned immediately adjacent to, or spaced by a gap of one or more nucleotide positions from, a terminal end of the template nucleic acid. Also contemplated are templates containing a PNA moidy of one or more PNA monomers which allow ligation of adjacently hybridized probes.
PNA-DNA chimeras can be synthesized by covalently linking PNA monomers and nucleotides in virtually any combination or sequence, using the respective conventional methods of synthesis of PNA oligomers, DNA oligonucleotides, and RNA
oligonucleotides (Vinayak, 1997; Uhlmann, 1996; Van der haan, 1997). Efficient and automated methods have been developed for synthesizing PNA/DNA chimera at a 2-25 pmole scale on commercially available, automated synthesizers, e.g. "Expedite'~'"~", Model 433A and Model 394 Synthesizers (PE Biosystems), and with commercially available reagents (Uhlmana, 1996; Vinayak, 1997; Van der Laatt,1997). In this approach, the chimeras can be mask continuously, in a single column and on a single synthesizer.
Typically, synthesis of chimeras is initiated by detritylation of the 5'-dimethoxytrityl (DMT) group of commercially available, high-cross link, non-swelling polystyrene beads packed in a synthesis column. The supports are loaded at 20-30 p,molelg with 5'-DMT
deoxynucleosides (A~, G'e", Cue, T) linked through the 3' hydroxyl to the support through a base-labile succinateJhydroxymethylbenzoic acid linker (Vinayak, 1997). 5'-DM7", 3'-cyanoethyl phosphoramidite deoxynucleoside monomers (Beaucage, 1992) are dissolved in _y_ we ovZr~Z6 rcr~usoonrr~o dry acetonitrile and delivered concurrently with tetrazole activator and coupled to the support-bound 5'-hydroxyl. Coupling is followed by capping with acetic anhydride of unreacted S'-hydroxyls, and iodine oxidation to the pentavalent internucleotide phosphate triester. The DNA synthesis cycle is repeated until the last deoxynucleoside addition, where a 5' monomethoxytrityl (MMT) amino nucleoside phosphoramidite is employed to furnish a 5' amino terntinus on the support-bound DNA moiety, for coupling to a PNA
monomer at the linkage between DNA and PNA in the chimera. The MMT group is favored for protection of the backbone amino in the synthesis of PNA-DNA chimeras because of its acid-lability. The MMT group is efficiently and rapidly removed from nitrogen under mild acidic conditions which do not cause depurination or other damage to the chimera.
To initiate synthesis of the PNA moiety, the 5' MMT group is removed with 3%
trichloroacetic acid in dichlocomethane and the amino group is coupled with a PNA
monomer and a coupling reagent. The backbone amino group of the PNA monomers is preferably protected with MMT and the nucleobase exocyclic amines arc protected as AbZ, G't'°, and C~ (Breipohl, 1997; Finn, 1996; Will, 1995). Any conventional peptide coupling reagent may be used, but HBTU atxl HATU are preferred coupling reagents. PNA
monomers may be dissolved in 1:1 DMF:acetonitrile to a concentration of about 0.2M.
Prior to delivery to the synthesis column, the monomer solution is mixed with an dual volume of O.ZM HBTU (O-benzotriazol-1-yl-N,N,N,N'-tetramethyluronium hexafluorophosphate), also in 1:1 DMF:acetorutrile (Vinayak, 1997). The solution is delivered to the column concurrently with 0.2SVI diisopropylethylamine in 1:1 DMF:acetonitrile. The synthesis cycles for the PNA and DNA moieties in a chimera on a Model 394 synthesizer at a 2 Etmole scale are summarized in Table 1 below.
Table 1 PNA-DNA chimera synthesis cycles PNA DNA
StepFunction Reagents Time (sec)Time (sec) I Detritylation3% CC13C(hH in CHiCl260 25 2 Coupling PNA: 0.2 M PNA monomer,960 25 HBTU, DiPEA in I
:1 DMF:CH3CN

DNA: 0.1 M DNA monomer, _m_ we ovrr~~ rc~rrt~soutn~
0.5 M tetraxole in CH3CN

3 Capping Ac20, lutidine, 25 I 5 N-methylimidazole, THF

4 Oxidation iodine, pyridine, not reduired25 H20, THF

After synthesis is complete, the amino terminus may be acetylated to minimize migration or cyclization, or reacted as a nucleophile in labelling. The crude chimera is cleaved from the support, and all protecting grot~s are removed with concentrated ammonium hydroxide at 55 °C for 8-16 hours. The chimeras are analyzed and purified by reverse-phase HPLC or polyacrylamide gel electrophoresis (PAGE), analyzed by mass spectroscopy, and quantified by correlaring W absorbance at 260 em with mass.
Chimeras with a DNA moiety comprising ribonucleoddes can be synthesized with the appropriate RNA phosphoramidite nucleosides andlor 5' DMT protected ribonucleotides support (Vinayak, 1994). The 2' hydroxyl of RNA phosphoramidites are typically protected with the tent-butyldimethylsilyl (TBDMS) group and the exocyclic amino groups of the nucleobases are protected as Ate, Gd'" ; Cue. ARC synthesis, TBDMS groups are ranoved with a fluoride reagent, e.g. tetrabutytalnmonium fluoride in tetrahydrofuran.
Otherwise, the synthesis, purification, and analysis m~hods for ribonucleotide-containing PNA-DNA
chimeras arc virtually the same as for chimeras with only 2'-deoxynucleotide containing DNA moieties.
The linkage between the PNA and DNA moieties of the chimeric probes of the invention may be a direct bond, e.g. an amide bond formed by the amino group at the 5' of a deoxynuclootide and the carboxyl group at the carboxyl terminal of the PNA
moiety without an intervening atom (Figures lA-1H). Alternatively, the linkage L may be a phosphodiester or phosphoramidate group. The linkage may also comprise one or more units of a non-base pairing moiety such as ethyleneoxy, linked to the PNA and DNA
moieties by amide (Figure 2B) or phosphate (Figure 2C) bonds. Ethylen~xy linkage units between the PNA and DNA moieties can be installed by coupling reagents such as protected forms of 2-[2-(2-aminoethoxy) ethoxy] acetic acid. The O-linker, 2-[2-(2-aminoethoxy]
acetic acid, is coupled as the MMT-amino protected amide-forming carboxylic acid, or phosphoramidite synthons (Figure 2A). One or more O linker units can act as a flexible, non-base pairing, linkage between the PNA and DNA moieties. Figure 2 shows a bis-we om'r~as rcrrtrsoonn3o ethyleneoxy-acetamido linker (2B) and a bis-ethyleneoxy-phosphate linker (2C).
Other exemplary linkers include alkydiyl, e.g. hexyldiyl (Vinayak, 1997), or 1,4-phenyldiyl (Figure 2A).

Generally, the oligonucleotides of the present invention are prepared by the phosphorarnidite synthesis method, preferred because of its efficient and rapid coupling and the stability of the starting nucleoside monomers (Caruthers, 1983; Beaucage, 1983;
Beaucage, 1992). The phosphorarnidite method entails cyclical addition of nucleotide monomer units to an oligonucleotide chain growing on a solid-support, most commonly in the 3' to 5' direction in which the 3' terminus nucleoside is attached to the solid-support at the beginning of synthesis. The method is usually practiced using automated, commercially available synthesizers (Caruthers, 1984). Typically, phosphoramidite nucleoside monomer units include:
RS--RtO~. wNR2R3 1 S where, Ri is a protecting group or substitucnt, e.g. cyanoethyl, methyl, lower alkyl, substituted alkyl, phenyl, aryl, and substituted aryl; Ri and R; are amine substituents, e.g.
isopropyl, morpholino, methyl, ethyl, iower alkyl, cycioalkyl, and aryl; R4 is an exocyclic nitrogen protecting group such as benzoyl, isobutyryi, acetyl, phenoxyacetyl, aryloxyacetyl, dimefiiylformatr~idine, dialkylformamidine, and dialkylacetamidine; and RS is an acid-labile protecting group such as DMT, MMT, pixy!, trityl, and trialkylsilyl.
Preferred nucleobases in one or more nucleosides include, but are not limited to, adenine, guanine, cytosine, uracil, thymine, 7~eazaadenine, 7-deazaguanine, C-5-alkyl pyrimidines, 2-thiopyrirnidine, 2,6-diaminopurine, C-S-propyne pyrimidine, phenoxazine (Flanagan, 1999), 7-deazapurine, isocytidine, pseudo-isocytidine (Egholm, 1995), isoguanosine, 4(3 l~-pyrimidone, hypoxanthine, and 8-oxopurines (Meyer, 1994).
Preferred sugars in one or more of the nucleosides include, but are not limited to, 2'-deoxyribose, ribose, and 2'- or 3'-ribose modifications where the 2'- or 3'-position may be hydrogen, hydroxy, methoxy, ethoxy, allyloxy, isopropoxy, butoxy, isobutoxy, methoxyethyl, W0 01127336 PGT/U800l2'1"130 alkoxy, phenoxy, azido, amino, alkylamira, fluoro, chloro and broma.
Other preferred sugars include 4'-a-anomeric nucleotides, 1'-a-anomeric nucleotides, and 2'-4'-linked and other "locked", bicyclic sugar modifications (Wengel, 1999).

The ligase enzyme used in the present invention can be any ligase that performs ligation of the PNA-DNA c6irneric probe to the second probe, when the chimeric probe and second probe are at>nealed to adjacent regions in a target template. DNA
ligases join DNA
sequences by forming a phoaphodiester bond between a 5'-phosphate and a 3'-hydroxyl an two probes which are adjacent, i.e. hybridized immediately next to each other (Kornbcrg, 1980; Whiteley, 1989). Altanativcly, the 3'-phosphate end of one probe and the 5'-hydroxyl of the other probe may form a phosphodiester bond. In the present invention, one or both probes contain a PNA moiety.
For example, the DNA ligase from bacteriophage T4 can join both DNA and RNA
sequences, and it can use either DNA or RNA templates to align the sequences to be ligated.
Reactions involving only DNA strands proceed with greater efficiency. Two DNA
duplexes with base-paired blunt ands carp be joined by the phage ligase.
Certain ligases need cofactors such as NAD or ATP.
A number of ligases have recently been isolated from thermophile organisms and which have significant activity above 60 °C and survive conditions that denature DNA. A
preferred theimostable tigasa is derived from Thermos aguaticus (Takahashi, 1984) and can also be prepared recombinantly (Barmy, WO 91/17239, 1991). The thetmostable ligases also,ex~bit a reduced activity of joining duplex DNA with blunt ends or short complementary overhang ends. These properties result in increased specificity of detection and convenience in many analytical assays and applications involving ligation.

It is desirable to provide methods by which labelled PNA-DNA chimeras and labelled oligonucleotides can be eatzymatically ligatcd as probes to form non-radioisotopically labelled ligation products. Fluorescence has largely supplanted radioactivity as the preferred detection method for many ligation experiments and applications, such as the oligonucleotide ligation assay and other in vitro DNA probe-based diagnostic tests. Therefore, fluorescent labels are a preferred class of detection labels.

wo o»~ rcrrosoor~rr3o Labels which enhance hybridization specificity and affinity are also preferred, e.g. minor-groove binders. Atihnity ligand labels are also preferred. Biotin is a useful affinity ligand label for chimeric probes and oligonueleotides for capture and isolation of ligation products.
In certain experiments, biotin labelling of the template nucleic acid may be useful far capture, isolation, removal, or retrieval purposes.
The PNA-DNA chimeras and the oligonucleotides participating in ligation may bear covalently attached labels. Labeling can be accomplished using any one of a large number of known techniques employing known labels, linkages, linking groups, standard reagents and reaction conditions, and analysis and purification methods. Generally, the linkage iinkirtg the dye and oligonuclootide or chimera should not (i) interfere with tigation, (ii) inhibit ligase activity, or (iii) adversely affect the flnoreseexrce properties of the dye, e.g. quenching or bleaching.
PNA-DNA chimeras and oligonuclootides can be labelled at sites including a nucloobase, a sugar, the anainoahylglycine backbone, amino, sulfide, hydroxyl, and carboxyl. Nucleobase label sites generally include the 7-deaza or C-8 positions of the purine or deazapiuine, and the C-5 position of tha pyrimidine. The gnka~ between the label and the chimera or oligonucleodde (NL)C) may be acetylenic-amido or alkenic-amido linkages (Khan, 1998). Typically, a carboxyl group on the label is activated by foaming an active ester, e.g. N-hydroxysuocinimide (NHS) ester and ractod with an amino group on the allcynylaZnino- or alkenylamino-derivatszed chimera or nucleMide. The resulting linkage is 3-(ca~rboxy)amino-l-propyn-!-yl having the structures:
O
I I
NUC-C=C-CHz-NH-C-Label O
I I
Chimera-CSC-CHz-NH-C-Label Labels may be attached to oligonucleotides at any suitable terminal or internal attachment sites, including: (i) a terminus, e.g. 5' andlor 3' (Mullah, 1998), (ii) an internucleotide linkage, (iii) a sugar, or (iv) a nucleobase. Labels are most conveniently and efficiently introduced at the 5'tenminus with fluorescent dyes (FAM, HEX, TET) and other labels which have been functionalized as phosphoramidite reagents, as part of the automated protocol (Theisen, t 992).

we nnr~a,~ rcrrosoonrl~o A preferred class of labels pmvide a signal for detection of the labelled oligonucleotide by fluorescence, chemiluminescence, and electrochemical luminescence (Kricka, 1992). Fluorescent dyes useful for labelling oligonucleotides include fluoresceins (Menchen, 1993), rhodamines (Bergot, 1994), energy-transfer dyes (Lee and Spurgeon, 1998), cyanines (Kubista,199'7), and metal porphyrin complexes (Stanton, 1988).
Examples of fluorescein dyes include 6-carboxyfluorescein (b-FAM), 2',4',1,4,-tetrachlorofluorescein (TET), 2',4',5',T,1,4-haxachlorofluorescein (HEX), 2',T-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE), and aromatic-substituted xanthene dyes (Benson, 1997). The 5-carboxyl, and other regio-isomers, may also have useful detection properties.
Another preferred class of labels inchede fluorescence quaichers. The emission spectra of a quencher overlaps with a proximal intramolecular or intermolecular fluorescent dye such that the fluorescence of the fluorescent dye is substantially diminished, or quenched, by the phenomenon of fluorescence resonance energy transfer "FRET"
(Clegg, 1992). An example of FRET in the prestnt invention is where the PNA-DNA
chimeric probe is labelled with a fluorescent d~ and the second probe is labelled with a fluorescence quencher. Alternatively, the chimes may be labelled with a fluorescent quencher and the second probe is labelled with a fh~oreac~t dye. Prior to hybridization and ligation, the fluorescent dye is substantially unquenched. After ligation, the fluorescent dye of the ligation product is substantially quenched by FRET.
Particularly preferred quenchers include but are not limited to (i) rhodamine dyes seltcted from the group consisting of t~an~hyl-6-carboxyrhodamine (TAMRA), tetrapropano-6-carboxyrhodamine (ROX), and (ii) DABSYL, DABCYL, cyanine dyes including nitrothiazole blue (NTB), anthraquinone, malachite green, nitrothiazole,and nitroimidazole compounds arid the like. Nitro-substituted forms of quenchers are especially preferred.
Energy-transfer dyes are a preferred class of chimera and oligonucleotide labels. An energy-transfer dye label includes a donor dye linked to an acceptor dye (Lee and Spurgeon, 1998). Light, e.g. from a laser, at a first wavelength is absorbed by a donor dye, e.g. FAM.
The donor dye emits excitation energy absorbed by the acceptor dye. The acceptor dye fluoresces at a second, longer wavelength. The donor dye and acceptor dye moieties of an energy-transfer label may be attached by a linker linking the 4' or S' positions of the donor dye, e.g. FAM, and a 5- or 6-carboxyl group of the acceptor dye. Other rigid and non-rigid linkers may be useful.

WO ~1m3Z6 PGTftIS0~1731 Metal porphyrin complexes, e.g. aluminum phthalocyanine tetresulfonate (Stanton, 1988) and chaniluminescent compounds. e.g 1,2-dioxetane chemiluminescent moieties (Bronstein, 1990) are also preferred classes of chimera and oligonucleotide labels.
Another preferred class of labels, referrod to herein as hybridization-stabilizing S raoieties, include but are not limited to minor groove binders (Blackburn, 1996, p.337-46), intercalators, polycations, such as poly-lysine and spermine, and cross-linking functional groups. Hybridization-stabilising moieties may increase the stability of base-pairing, i.e.
afFmity, or the rate of hybridization, exemplified by high therrnal melting temperatures, Tm, of the duplex. Hybridization-stabilizing moieties may also increase the specificity of base-pairing, exemplified by large diffexe~nces in Trn between perfixtly complementary oligonucleotide and target sequences and where the resulting duplex contains one or more mismatches of Watson/Crick base-pairing (Blackburn, 1996, pp. 15-81 ).
Preferred minor groove binders include Hoechst 33258 (Rajur, 1997), CDFIt-3 (Kutyavin, 1996), netro~in, and distamycin. Other useful labels include eloctrophoretic mobility modifiers, amino acids, peptides, enzymes, and affinity ligands, e.g. biotin and digoxigenin.
Linkers between a label and die PNA/DNA chimera can be an amide bond, e.g.
where the active ester form of a label is coupled with an amino group of the chimera Also, linkers can comprise alkyldiyl, aryldiyl, or one or more ethylencoxy units (Rajw, 1997).
yL6 LIGATION
Figure 3A shows a generalized schematic of ligation between a 3'-hydroxyl PNA-DNA chimera probe and a 5'-phosphate oligonucleotide, as the socond probe, hybridized to a DNA template with DNA lipase to form a PNA-DNA ligation product. The first probe has a 3'-hydroxyl terminus and the second probe has a 5'-phosphate ttnainus.
Alternatively, the first probe has a 5'-phosphate terminus and the second probe has a 3'-hydroxyl terminus.
A ligation mixture generally includes a DNA template, a PNA-DNA chimeric probe, a second probe which is another PNA-DNA chimeric probe or an oligonucleotide, lipase, and other ligation reagents. DNA probes corresponding to the PNA-DNA chimeras may be used as a control or comparison. Under typical conditions, the probes are used at a final concentration of about I lrA~i each.
Additionally, the ligation mixture may contain reagents such as 1X T4 DNA
lipase buffer [50 mM Tris-HCI, pH 7.5, 10 mM MgClz, 10 mM dithiothreitol, 1 mM ATP, Ng/ml bovine serum albumin], and 1,000 units of T4 DNA lipase plus 10 units of wo oim3a~ rc-r~soQrirno polynucleotide kinase in a volume of 50 PI. The ligation reagent may also contain ligase co-factors, e.g. NAD and ATP, polyethylene glycol, EDTA, KCI, ammonium sulfate, dithiothreitol, BSA, MgClz, Tris-HCI, glycerol, water, NaCI, mercaptoethanol, and other salts or buffers. The mixture may be incubated at 22 to 25° C for 3 hours or more. During the ligation, another addition of 10 to 20 units of T4 polynucleotide kinase may be helpful for the ligation.
Typically after incubation, ligase reaction products are heat-inactivated at approximately 80 °C for about 20 minutes and placed on ice or at 4 °C for a short period.
For analysis, typically, 5 to 25 pmol of the ligation product is mixed with a final concentration of 1 X loading buffer (45 mM Tris base, 45 mM boric acid, 0.4 mM
EDTA, 3% Ficoll, 0.02% bromophenol blue, 0.02% xylene cyanol) and denatured at 95 °C for 10 to min. The sample is loaded into a 10 to I S% denaturing PAGE gel and run in 1 x TBE (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.3) at 100 to 160 V, 70 °C for 25 to 60 min. The ligation product is visualized by staining the gel with SYBR-Green (Molecular 15 Probes, Eugene, OR) in a volume of 40 to 120 ml in 1 x TBE for 10 to 30 min. The image may be captured in a gel documentation system (e.g. Chemilrnager 4000 Imaging System, Alpha Innotech Corporation, San Lesndro, CA).
Figure 3B shows template and pmbe sequences for a ligation assay in a model system. The probe sequences include two oligonucleotide probes, 6nt and 9nt, and five 20 PNA-DNA chimeras containing 0 to 4 DNA 2'-deoxynucleotides. The oligonucleotides and chimeras hybridize to a 38nt DNA template. The template is labellod with biotin at the 3' or 5' end to facilitate isolation and transfer.
The oligonucleotide ligation assay (OLA) is a convenient, highly-stringent method that permits distinction among known DNA sequence variants (Landegren, 1988).
Multiplex analysis of highly polymorphic loci is useful for identification of individuals, e.g., for paternity testing and in forensic science, organ transplant donor-receiver matching, genetic disease diagnosis, progn~is, and pre-natal counseling, and other genetic-based testing which depend on the discrimination of single-base differences at a multiplicity of loci (Delahunty, 1996). Products of a multiplex oligonucleotide ligation assay (OLA) may be resolved electrophoretically from one another and from unligated probes under denaturing conditions with fluorescence detection (Grossman, 1994). For example, Figures 8A-8C shows different assays where two PNA-DNA chimeras, a wild-type (WT) sequence chimera and a mutant sequence chimera, bear different fluorescent dyes. Only when the we oiar~~ rcrrosoauz~
mutant sequence is present in the target sample, will the mutant sequence chimera ligate to the adjacently annealed sxond probe (ofigo) if the mutant base pair is at the ligation site (Figure 8A).
The ligation products may be discriminated by separation based on: (l) size using electrophoresis or chromatography and/or (ii) detectable labels (Grossman,1994). With a plurality of fluorescent dyes labelled to chimeras with sequences forgetting unique target sequences, multiplexed OLA can be conducted on a single sample in a single vessel.
Requirements for efficient muhipkx OLA include probes that anneal and ligate in a highly specific and rapid mariner. The chimeras and second probe sequences may be selected such l 0 that the mutant base, or single base polymorphism, may be at the 5'-phosphate of the second probe (Figure 8B) or the 3'- twarinus of the chimera (Figure 8C).
It is contemplated that OLA experiments of the present irrvention may be conducted on solid substrates where the template nucleic acid, PNA-DNA chimeric probe, or the second probe may be immobilized on a solid particle or bead, or a solid porous or non-porous surface. When immobilized, the template, chimera or second probe is preferably covalcntly attached to the solid substrate, e.g. via a terminal monomer unit.
The solid substrate may be polystyrene, controlled-pore-glass, silica gel, silica, polyacrytamide, magnetic beads, polyacrylate, h~oxyethyhnethacrylate, polyamide, polyethylate, polyethyleneoxy, and copolymers and grafts of any of the above solid substrates. The configuration or format of the solid substrate may be small particles or beads of approximately 1 to 50 pin in diameter, membranes, frits, slides, plates, micromachined chips, alkanethiol-gold layers, non-porous surfaces, and polynucleotide-inunobitizing media.
For example, a PNA-DNA chimeric probe is covalently attached by a linker at the amino terminus to a non-porous, inor~nic aaxuuface, e.g. glass (Guo, 1994). A
template nucleic acid sample is allowed to hybridizal to the chimeric probe under conditions that promote hybridization. A second probe with a sequence complementary to the template is added to the hybridized duplex and the saond probe hybridizes to the template adjacent to the chimeric probe. The chimeric probe and second probe are ligated together with ligase.
The ligated product may be detected and/or isolated where the chimeric probe, template, or second probe bear a label or affinity ligand and an oligonucleotide ligation assay is thereby performed.

wo omra~c rcrrtt~w~rr~
In a preferred embodiment, an stray of chimeric probes are assembled on a solid substrate where a chimeric probe of known sequence occupies a defined area on a two-dimensional surface. The number of ehimtric probes on any particular surface may be hundreds or even thousands, limited by the spatial requirements for synthesis, attachments, and detection (Fodor, 1995). Altemu~tively an array of probes may be immobilized on beads or particles contained in wells or vessels. A template, or mixture of templates, may be added for hybridization to the immobilized chimeric probes on the surface.
Where sufficient sequence complementarity exists under the defined hybridization conditions, duplex formation will occur. A mixture of second probes may be added separately, or with the template sample, for hybridization. In the presence of ligase, ligation will occur only where chimeric probes and second p~nobas are hybridized adjacently.
Unhybridized probes and tanplate samples may be ranoved by washing under conditions that maintain hybridization, or under denaturing conditions. Whexe the sabnd probe bears a label, e.g.
fluorescent dye, the ligation prodturt is covalattly immobilized on the surface and can be detected, e.g. laser-induced fluorescence. From the knowledge of the immobilized chimeric probe sequences, the presence of certain sequences in the template sample can be deduced from the locations) of detected fluorescence on the stray surface.
In a second aspect of the invention, a kit for ligation is provided. In one embodiment, for example, the kit, which is useful for practicing the method of the invention, comprises: (i) a PNA-DNA chimera having from 3 to 1 S contiguous PNA
monomer units, from 2 to 15 contiguous nuclea~ides, and a 3' hydroxyl; (ii) a second probe where the second probe is a PNA-DNA chimera or an oligonucleotide and; (iii) a ligase enzyme. The chimera andlor the oligonucleotide rosy be labelled with a non-radioisotopic " . . _ , label. In another embodiment; the kit additionally includes a template comprising a sequence complementary to the chimera or containing one or more mismatches to the chimera. in another embodiment, the kit additionally includes a polynucleotide kinase.
From the foregoing discussion, it can be seen how various features and advantages of the invention are met. The present invention provides a method for detecting selected target sequences that is highly sensitive and accurate. Selected target sequences can be detected using chimeric PNA/DNA probes containing target-specifrc sequences shorter than all-DNA probes used in previous oligonucleotide ligation assays. The chimeric probes thus require less target sequence information to design and can be less expensive to synthesize.

wo omr~s rcrrt~s~rr~a3o In addition, the pt~esent invention can be adapted to a wide variety of target sequences and assay formats, and can be readily automated.

The invention is further illustrated by the following examples, which are infcnded to be purely exemplary of the present invention and not to limit its scope in any way.
Example 1 Labelling of PNA-DNA chimera TAMRA and NTB labelling:
Labelling is performed with 5 mg of NHS ester of TAMRA or NTB dissolved in 100 ~tl DMF or NMP and 10 ftl D1EA. The labelling mixture is added to the support bound PNA-DNA chimera and allowed to react for 2 to 18 hours (typically overnight).
The support is washed following the labelling with DMF and subsequently DCM prior to cleavage.
CDPI labellins:
CDPI3 is attached to the chimera by three consecutive couplings of Fmoc-CDPI
(Lukhtanov, 1995) to the amino terminus of a PNA-DNA chimera to give CDPI3-labelled PNA-DNA chimera. The CDPI monomer unit, 1,2-dihydm-(3H)-pyrrolo[3,2-e]indole-7-carboxylate, protected with Fmoc (5 rng, 0.012 mtrtole) is dissolved in 100 ~1 NMP and activated by 0.95 equivalents HATU (0.2M in DMF) and 2 equivalatts DIEA (0.4M
in DMF}. After one hour at room temperature, the activated Fmoc-CDPI solution is added to the support bound chimera and allowed to couple for another hour at room temperature.
The resin is washed following the coupling with 20 ml DMF. The Fmoc is removed by ~~~t of the.resin-support with 1:4 piperidine:DMF for 10 minutes at room temperature.
This coupling and deprotection cycle is repeated two additional times for a total of 3 manual couplings to give CDP13-labelled PNA-DNA' chimera.
Example 2 Li a~ tion Figure 4 shows ligation experiments where a ligation mixture contained a template and two probes at a final concentration of 1 pM each, 1X T4 DNA ligase buffer [SO mM
Tris-HCI, pH 7.5, 10 mM MgCh, 10 mM dithiothreitol, 1 mM ATP, 25 pglml bovine serum albumin], and 1,000 units T4 DNA ligase (New England BioLabs, Beverly, MA) in a volume of 50 ltl. T4 ligase can also be purchased from Boehringer-Mannheim.
Approximately 70 units of NE Biolabs T4 DNA ligase is equal to 1 Weiss unit of -za-we eirrr~~ pcrrt~soor~n~o Boehringer-Mannheim T4 ligase. The same reactions were also conducted without ligasc.
After incubation at 22.5 to 25 °C for 3 to 4 hours, the reacti~ mixture was heated at 80 °C
for 20 min. and then stored at 4 °C. Five ~tl of the reaction mixture was analyzed by ( 15°I°) polyacrylamide gel electrophoresis (PAGE) under denaturing conditions (7M
urea) at 120 140 V for 20-60 min (Figure 4A). Ligation of 5'-phosphate oligonuclootides (DNA2, DNA4 or DNAS) to an oligonucleotide DNA3 or PNA-DNA chimeras were conducted on templates (DNA1 or DNA6) according to Table 2. Ligation with T4 ligase (top gel image) is evident in lanes 3,4,6,8,10 between PNA-DNA chimeras and 5'-phosphate oligom~cleotides by the appearance of new bands. Ligation was effective with chimeras having 6 PNA monomers and from 2 to 4 2'-deoxynucleotide monomers. Control iigation between two oligonuclootide probes (lane Z) shows a ligation product band.
Control ligation with only one probe (lanes 1,5,7,9) does not show a new band.
Experiments without T4 ligase (bottom gel image) show bands for the templates and probes.
Table 2. Figures 4A-4B
Lane Template PNA-DNA chimera 5'-phosphate or oligonucleotide oligonucleotide 4 DNAI PNAs-DNA3 DNA2 6 DNAI PNAe-DNAZ DNA4 . . , . ..
.. . . 8 DNA l , , : pill-DNA4 DNAS

10 DNA6 PNA"-DNA4 DNAS
M DNA oligo ladder DNA 1 (SEQ. ID NO. 9) Biotin-cgctcaacacatagcatggtctagaactaagcctggaa DNA6 (SEQ. ID NO. 15) cgctcaacacatagcatggtaaagccgggacctaactgtt we emr~a,~ rc'rrtJS~omr3o DNA3 tagttctag (SEQ. ID NO. 2) PNA6-DNAZ TAGTTC-to (SEQ. ID NO. 5) PNA6-DNA3 TAGTTC-tag (SEQ. ID NO. 6) PNA6-DNAe TAGTTC-taga (SEQ. m NO. 7) S PNA ~ , -DNA4 TAGGTCCCGGC - t t t a ( SEQ. ID NO. I 0) DNA2 5' -phos accatgctatgtgttgagcg (SEQ. ID NO. 11) DNA4 5' -phos-gaccatgctatgtgttgagcg-biotin (SEQ. m NO. 12) DNAS 5' -phos-ccatgctatgtgttgagcg-biotin (SEQ. ID NO. 8) (UPPER CASE - PNA, lower case - DNA) Figure 4B shows the quantitative estimate of the ligase reactions in Figure 4A
by densitometry with the SpotDenso program. The bands enclosaf by the boxes are the 5'-phosphate probes remaining after ligation. The negative control experiments in lane 1,5,7, and 9 established the levels of 5'-phosphate probe remaining when no ligation occurred.
The positive ~ntrol experiment in lane 2 gave the ligation efficiency between two all-DNA
probes. From these quantified values, the ligation efficiencies with PNA-DNA
chimeric probes can be calculated from the areas (mV - Integrated Density Value) in the chart (right).
Figure 5 shows ligation experiments using T4 DNA ligase with PNA-DNA chimeric probes to which 1 to 4 DNA bases are attached at 3' terminus of the PNA
oligomer and a second probe, a S'-phosphate oligonucleotide of variable lengths (lanes 4-7).
The lengths of . the;s~imeFa and the oligonucleotide probes are chosen to form ligation products of equivalent length. (Table 3). In addition, control ligations were conducted where instead of the chimera, no probe (lane 2), an all PNA probe {lane 3), an all-DNA probe, 6nt (lane 8) and an all-DNA probe, 9nt (lane 9) were used. The ligation mixture contained a 38nt DNA
template and the two probes at a final concentration of 1 1.~M each, 1 X T4 DNA ligase buffer [50 mM Tris-HCI, pH 7.5, 10 mM MgClz, 10 mM dithiothreitol, 1 mM ATP, pg/ml bovine serum albumin], and 1,000 units of T4 DNA ligase in a volume of 50 ~l. The ligation reaction mixture was incubated at 22.5 to 25°C for 3 to 4 h.
After incubation, the reaction mixture was heated at 80 °C for 20 min and then stored at 4 °C. Five ~1 of the reaction mixture was loaded onto a 15% poiyacrylamide gel and electrophoresed at 120-140 wo oinr~'u rc'r~n'n~o V under denaturing conditions (7M urea, 70°C) for 20-60 min., then stained with SYBR-Green. Figure 5A shows~a scanned image of the stained gel. Figure 5B is a schematic of ligation of PNA, PNA-DNA chimera, and DNA to 5'-phosphate oligonuclootides hybridized to a DNA template 38nt (SEQ. ID NO. 9).
It is evident from new bands below the template bands that PNA-DNA chimeras are ligated where the chimera has 2, 3, or 4 DNA monomers (2'-deoxynucleotides), lanes S-7 rGSpcctively. No ligati~ is evident for an all-PNA probe or a chimera containing only 1 DNA monomer, lanes 3 and 4 respectively. Lane 1 is a negative control. Lanes 8 and 9 are positive controls, where 6nt and 9nt oligonuclaotides are ligated to 5'-phosphate oligonucieotides. The electrophoretic rot~dation of PNA in the ligation products of chimeras, lanes 5-7, is evident compared to all-DNA ligation products, lanes 8 and 9.
Tabk 3. Figures 5A-5B
Probes sautlete 5~'p~ DNA PNA-DNA chimera 2 38nt 23nt Nonc 3 38nt 23nt PNA.6 4 38nt 22nt PNA.6-DNA, 5 38nt 2lnt PNAb-DNA2 6 38nt 20nt PNA6-DNA3 7 38nt l9at PNA6-DNA4 8 38nt 23nt DNA,6 9 38nt 20nt DNA9 I M = DNA oli~onucleotide ladder DNA tagttc (SEQ.1DN0.1) ' 15 DNAu tagttctag ~ (SEQ. ID NO. 2) PNAn TAGTTC (SEQ. 1D NO. 3) PNAa-DNA, TAGTTC-t (SEQ. ID NO. 4) PNA~; DNAZ TAGTTC-to (SEQ. ID NO. 5) PNA,,-DNA TAGTTC - t erg (SEQ. ID NO. 6) PNA~; DNA,s TAGTTC-taga (SEQ. ID NO. 7) 5'-phosphate oligos -z7-wo otm3z6 rc~rrr~o l9nt 5' -phos-ccatgetatgtgttgagcg-biotin(SEQ. ID
NO. 8) 20nt 5' -phos-accatgctatgtgttgagcg-biotin(SEQ. 1D
N0. I1) 2lnt 5' -phos-gaccatgctatgtgttgagcg-biotin(SEQ. ID
NO. 12) 22nt 5' -Phos-agaccatgctatgtgttgagcg-biotin(SEQ. ID
NO. 13) 23nt '-Phos-tagaccatgctatgtgttgagcg-biotin(SEQ.IDN0.14) DNA template 38nt : (SEQ. ID NO. 16) cgctcaacacatagcatggtccagaactaagcctggaa (UPPER CASE - PNA, lower case - DNA) Figure 6 shows the specificity of ligation with PNA-DNA chimeric probes. PNA-DNA chimeras and 5'-phosphate oligonuclootides were ligated on templates, as perfect matches and with mismatches. Ligation mixtures contained a template and two probes at a IS final concentration of I pM each, 1X T4 DNA ligase buffer [50 mM Tris-HCI, pH 7.5, 10 mM MgClz. 10 mM dithiothreitol, 1 mM ATP, 25 pg/ml bovine swum albumin], and 1,000 units of T4 DNA ligase in a volume of SO p1. Ligation reactions were incubated at 22.5 to 25°C for 3 to 4 h. After incubation, the reaction mixture was heated at 80 °C for 20 min and then stored at 4 °C. Five g1 of the reaction mixture was used for PAGE
analysis, electrophoresing at 120-140 V for 20-60 min.
Table 4 Figure 6 ~~ Phosphorylated DNA PNA-DNA~chimera or mutate M~ched Mismatched 4 DNA1C DNA2 DNA2A PNA6-DNA;
S DNA1C DNA3 PNAe-DNA4(mismatched) 6 DNA2C DNA2A DNA9 (mismatched) 7 DNA2C DNA2A PNA6-DNA3 (mismatched) 8 DNA2C DNA4 PNA~,-DNA, (mismatched) .as.

WO ~11Z'1326 PCr/US0~7T30 M DNA oligonuelcotide ladder DNA Template DNA 1 C (SEQ. )D NO. 27) Biotin-cgctcaacacatagcatggcctagaactaagcctggaa DNA2C (SEQ. ID NO. 16) Biotin-cgctcaacacatagcatggtccagaactaagcctggaa Ph2sghorY'L~~DNA
DNA2 5'-Phos-gccatgctatgtgtt-Biotin (SEQ.IDN0.17) DNA2A 5' -Phos-wccatgctatgtgtt-Biotin (SEQ. ID NO. 18) DNA3 5' -Phos-ccatgctatgtgttgagcg-Biotin (SEQ. >D NO. 8) DNA4 5' -Phos-accatgctatgtgttgagcg-Biotin (SEQ. ID NO. 11) DNA9 tagttctag (SEQ.>DN0.2) PNA-12NA Chimera PNAb-DNA2 TAGTTC-to (SEQ. m NO. 5) PNA6-DNA3 TAGTTC-tag (SEQ. m NO. 6) PNA6-DNA, TAGTTC-taga (SEQ. >D NO. 7) (UPPER CASE - PNA, lower case - DNA) The experiments in >figure 6 show that PNA-DNA chimeric probes require a high level of sequence complementarity for ligation to occur. When a mismatch occurs either in the chimeric probe or the second probe, ligation is not detectable, within the limits of the system shown. By comparison, all-DNA probes are less specific. When a mismatch occurs in either all-DNA probe, some ligation is still evident. Lane 1 is a positive caaitrol ligation where two oligonucleotides are perfectly matched (W) to the template and ligate to form a ligation product migrating at the expectod rate of 24nt. The experiment of lane 2 additionally has a mismatches (W+M) probe which ligates, evidenced by a new band wo oin~s rcrmsrum3o between the perfect match product and the template (38nt). 'The mismatched probe, DNA2A, has a mismatch at the ligation site, the A base at the 5' terminus of the 5'-phosphate probe. The experiment of lane 3 ligates perfectly matched PNA6-DNA3 chimera and DNA2 second probe, giving a new band, migrating faster than template. The experiment of lane 4 additionally has the mismatched DNA2A probe. Unlike the all-DNA
experiment of lane 2, mismatched DNA2A does not ligate with the chimera, demonstrating greater specificity conferred by the PNA moiety. The experiments of lanes 5 a~
7 likewise have mismatches at the 3' terminus of the chimera. The 3' terminus of the chimera in the experiment of lane 8 has a deletion and a mismatch. These experiments, lanes 3,7,8 show no ligation product. The experiment of lame 6 has a mismatch in the DNA9 probe at the penultimate base near the 3' terminus. In this experiment, a ligation product is evident, reflecting the lower specificity of ligation of all-DNA probes.
In summary, the ligation experiments shown in Figure 6 illustrate that PNA-DNA
chimeric probes when ligated to oligonucleotide pmbes are better able to discriminate base-pair mismatches (specificity) than ligations between two all-DNA, oligonucleotide probes, whether the mismatch occurs in the chimera pmbe or the oligonueleotide probe.
Examgle ~ ~L_,DI-T_OF analysis of ligation reaction Mass spoctta were acquired on a MALDI-TOF MS (Voyager DE, PerSeptive Biosystems, division of PE Corporation) workstation. Desalted samples are mixed 1: I with matrix solution consisting of 50 mglml 3-hydroxy pieolinic acid, 50 mM
ammonium citrate, and 30°/. acetonitrile, and are spotted onto a sample plate. Time-of flight data from 20 to SO
individual laser pulses are recordal and averaged on a transient digitizer, after which the averaged spxtra are automatically converted to mass by data processing software. Figure 7 of ligation reactions. A 3' biotinylattd 20nt oligonucleotide (mass b303) snd a PNA-DNA
chimera (mass 2539) were hybridized to 5' biotinylatod DNA template 38nt (mass 12358).
Figure 7A shows MALDI-TOF Mass Spectroscopy analysis of the mixture without ligase.
The analysis shows only ion peaks of the starting materials. When the ligation mixture contains ligase (Figure 7B), a ligation product is evident with the expected mass of 8823.8.
template : (SEQ.1D NO. 9) Biotin-cgctcaacacatagcatggtctagaactaagcctggaa 5' -phos-accatgctatgtgttgagcg-biotin (SEQ. ID NO. 11}
(mass 6303) _ ;p _ we oinr3ab rcTrt~rr3r Ac-TAGTTC-tag (mass 2539) (SEQ. ID NO. 6) ligation product Ac-TAGTTC-tagaccatgctatgtgttgagcg-biotin (SEQ. ID NO. 19) (mass 8824) Ac = acetylated amino terminus (UPPER CASE - PNA, lower case - DNA) Exampl-a 4 Multt~lex Olil~nualeotide Li,gation Assav for CFTR loci OLA reactions for CFTR loci were multiplexed in one tube. Two differentially labelled (i.e. FAM- or TET- at 5' site) PNA-DNA chimeras and one 5' phosphorylated DNA oligonucleotide were used for the analysis of each mutation. The sequences of the probes and templates are given in Fig. 8. All multiplex OLA reactions are carried in a 20 p1 reaction volume containing 20 mM Tris-HCI, pH 7.6, 25 mM potassium acetate, 10 mM
magnesium acetate, 10 rnM DTT, 1 mM NAD, 0.1% Triton X-100, I to 50 nM each probe, 5 to 10 ~1 of pooled PCR product, and 2 to 10 units of thennostable ligase such as T7rermus aquaticus ligase. Linear amplification of product is achieved by 20 to 30 cycles at 94 °C for 30 sec and 30 to SO °C for 1 to 3 min, followed by heating at 95 °C for 10 to 20 min in a Model 9700 Thennocycler (PE Biosystems division of PE Corporation).
An aliquot of 2 ~1 of each multiplex OLA product was mixed with 2.5 p1 of deionized forrnamide, 0.5 p1 of dextran blue loading buffer, and 0.5 p1 of TAMRA size marker. The mixture was denatured at 95 °C for 3 min and then rapidly chilled on ice prior to loading the gel. OLA products were electrophoresed for 3.5 h at 2,500 V on a Model 373A fluorescence-scanning DNA sequences (PE Biosystems, division of PE Corporation) using an 8% acrylamide, I9:1 acrylamidc:bisacrylamide, denaturing gel containing 8.3 M urea, 89 mM Tris, 89 mM boric acid, and 2 mM EDTA. The resulting gel data are analyzed for peak color and fragment size using the GENESCAN Fragment Analysis Software and the Genotypes Software (PE Biosystems Division ofPE
Corporation).
Figure 9 shows the oligonucleotide ligation assay with PNA-DNA chimera probes to discriminate mutations in human CFTR loci. Ligation mixtures contained a template and two probes at a final concentration of 1 pM each, iX T4 DNA ligase buffer [50 mM Tris-WO 01lZT3Z6 PCT/U801/ITl3O
HCI, pH 7.5, 10 mM MgCIZ, 10 mM dithiothtritol, 1 mM ATP, 25 itg/ml bovine serum albumin), and 1,000 units ofT4 DNA ligase (N~v England Biolabs) plus 10 units ofT4 polynucleotide kinase in a volume of 50 p1. The mixtures were incubated at 22.5 to 2S°C
for 3 to 4 h. After incubation the reaction mixture was heated at 80 °C
for 20 min and then stored at 4°C. Five ~1 of the reaction mixture was used for PAGE
analysis, electrophoresing at 120-140 V for 20-60 min. (9A) human pCFTR621 G-T: Exon 4; (9B) human pCFTR1478de1T: Exon 7; (9C) human pCFTRG551D: Exon 11. (UPPER CASE - PNA, lower case - DNA) Figure 9D shows scanned images of OLA experiments with PNA-DNA chimeric probes and an all-DNA control probe (lane 10). Ligation of a 3'-TAMRA-labelled, S'-phosphate oligonuclootide with PNA,a-DNA3 chimera at the CFTR locus 621 G-T
with T4 ligase gave a fluorescent labelled product, visible without staining under W
light (9D, top gel) and by staining with SYBR-Green (9D, bottom gel). Ligation products with PNA-DNA chimeric probes are also evident from experiments in lanes 3 and 9.
Table s k~yture y1) Lane DNA t~plate PNA-DNA chimera or oliaonucleotide 1 la 2 1 a 2 (FAM) 3 1 a PNAio-DNA3 2 5 1b 3 (TAMRA) 6 1 b PNAia-DNA3 3 (TAMRA) ~ lc 8 lc 4 9 1 c PNA6-DNA, 4 10 1 c DNA9 4 M DNA oli o ladder ANA Tgm DNAla (SEQ. ID NO. 20) gtttgatttataagaag~taatacttccttgcacag DNA 1 b {SEQ. ID NO. 21 ) cacagataaaaacaccacaasgaaccctgagaagaagaag DNAIc (SEQ. ID NO. 9) Biotin-cgctcaacacatagcatggtctagaactaagcctggaa PNA-DNA Chimera wo rainr3u rc~rnrsoons~o PNA,o-DNA3 (lane 3) Ac-CAAGGAAGTA-tta (SEQ. ID NO. 22) PNA,o-DNA3 (lane 6) Ac-CTTCTCAGGG-ttc (SEQ. ID NO. 23) PNAa-DNAa TAGTTC-tags (SEQ. ID NO. 7) DNA
DNA9 tagttctag (SEQ. ID NO. 2) 5'-phosphate oligonucleotides 2(FAII~ 5' -Phos-ccttcttata-FAM-3' (SEQ. ID NO. 24) 2 5' -Phos-ccttcttata-3' (SEQ.1D NO. 24) 3(TAMRA) 5' -Phos-tttgtggtgtttt-TAMRA-3' (SEQ. ID NO. 25) 4 5'-Phos-ccatgctatgtgtt-Biotin-3' (SEQ.1DN0.26) All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Although certain embodiments have been described in detail above, those having ordinary skill in the art will clearly understand that many modifications are possible in the preferred embodiments without departing from the teachings thereof. All such modifications are intended to be encompassed within the following claims.
-3:_ wo omr~u, pcrivawtrr3o SEQUENCE LISTING
<110> PE CORPORATT_ON
EGHOLM, Michael CHEN, Caifu <120> TEMPLATE-DEPENDENT LIGATION WITH PNA-DNA CHIMERIC
PROBES
<130> 4474W0 <140> to be assigned <141> 2000-10-06 c150> 09/416,003 <151> 1999-10-08 <160> 27 <170> Patentln Ver. 2.1 <210> 1 <211> 6 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 1 tagttc 6 <210> 2 <211> 9 <212> DNA
<213> Unknown Organism <220>
<223> >escription of Unknown Organism: Bacterial <400> 2 tagttctag 9 wo s <210~ 3 <211> 6 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 3 tagttc <210> 4 <211> 7 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <900> 4 tagttct <210> 5 <211> 8 < 212 > DNA ..
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 5 tagttcta <210> 6 <211> 9 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 6 WO ~1/27326 PCTIUSOOlZT130 tagttctag <2I0> 7 <211> 10 <212> DNA
c213> Unknown Organism <220>
c223> Description of Unknown Organism: Bacterial <400> 7 tagttctaga 10 <210> 8 <211> 19 c212> DNA
<213> Unknown Organism c220>
<223> Description of Unknown Organism: Bacterial <400> 8 ccatgctatg tgttgagcg 19 <210> 9 <211> 38 <212> DNA
<213> Unknown Organism <220>
c223> Description of Unknown Organism: Bacterial c400> 9 cgctcaacac atagcatggt ctagaactaa gcctggaa 38 c210> 10 <211> 15 c212> DNA
<213> Unknown Organism J

<220>
<223> Description cf Unknown Organism: Bacterial <400> 10 taggtcccgg cttta 15 <210> 11 <211> 20 <212> DNA
<213> Unknown Organism <220>
<223> Description of i1r_known Organism: Bacterial <400> 11 accatgctat gtgttgagcg 20 <210> 12 <211> 21 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 12 gaccatgcta tgtgttgagc g 21 <210> 13 <211> 22 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism:8acterial <400> 13 agaccatgct atgtgttgag cg 22 <210> 14 wo otrtr3~s rcrmsoonrr~o <211> 23 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism:Hacterial <400> 14 tagaccatgc tatgtgttga gcg 23 <210> 15 <211> 40 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 15 cgctcaacac atagcatggt aaagccggga cctaactgtt 40 <210> 16 <211> 38 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 16 cgctcaacac atagcatggt ccagaactaa gcctggaa 38 <210> 17 <211> 15 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 17 gccatgctat gtgtt 15 W~ ~1~~ ~~s~~
<210> 18 <211> 17 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism:8acterial <400> 18 accatgctat gtgtt 15 <210> 19 <211> 31 <212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 19 actagttcta gaccatgcta tgtgttgagc g 31 <210> 20 <211> 36 <212> DNA
<213> Human CFTR
<400> 20 gtttgattta taagaaggta atacttcctt gcacag 36 <210> 21 <211> 40 <212> DNA
<213> Human CFTR
<400> 21 cacagataaa aacaccacaa agaaccctga gaagaagaag 40 WO ~l~~~l <210> 22 <211 > ' S
<212> DNA
<213> Human CFTR
<400> 22 accaaggaag tatta 15 <210> 23 <211> 15 <212> DNA
<213> Human CFTR
<400> 23 accttctcag ggttc 15 <210> 24 <211> 10 <212> DNA
<213> Human CFTR
<400> 24 ccttcttata 10 <210> 25 <211> 13 <212 > DNA
<213> Human CFTR
<400> 25 tttgtggtgt ttt 13 <210> 25 <211> 14 <212> DNA
<213> Human CFTR
<400> 26 ccatgctatg tgtt 14 wo oin~z6 rcr~soo~mao <210> 27 <211> 38 c212> DNA
<213> Unknown Organism <220>
<223> Description of Unknown Organism: Bacterial <400> 27 cgctcaacac atagcatggc ctagaactaa gcctggaa 38

Claims (39)

We claim:

1. A method of producing a template-dependent ligation product comprising the step of enzymatically ligating a PNA-DNA chimeric probe to a second probe in the presence of a template nucleic acid and a ligase, said chimeric probe having a PNA moiety and DNA moiety, said DNA moiety having at least two nucleotides and a 3' hydroxyl or 5' hydroxyl terminus, wherein the chimeric probe and the second probe are each hybridized to the template nucleic acid and adjacent to each other, and at least a portion of the PNA
moiety is hybridized to the template, and wherein the second probe is a PNA-DNA chimera or an oligonucleotide.

2. The method of claim 1 in which the PNA-DNA chimera has the structure:

P x -L-N y wherein:
each P is independently a PNA monomer;
x is an integer from 3 to 15;
each N is independently a nucleotide; and y is an integer of 2 or more;
L represents a covalent linkage between P and N;
with the proviso that the terminal nucleotide N has a 3'-hydroxyl group or a 5'-hydroxyl group.

3. The method of claim 2 wherein the 3'-terminal nucleotide N of the chimera contains a 3'-phosphate group and the 5' end of the second probe contains a 5'-hydroxyl.

4. The method of claim 2 wherein the 3'-terminal nucleotide N of the chimera contains a 3'-hydroxyl and the 5' end of the second probe contains a 5'-phosphate group.

5. The method of claim 2 wherein the 5'-terminal nucleotide N of the chimera contains a 5'-phosphate group and the 3' end of the second probe contains a 3'-hydroxyl.

6. The method of claim 2 wherein the 5' terminal nucleotide N of the chimera contains a 5'-hydroxyl and the 3' end of the second probe contains a 3'-phosphate group.

7. The method of claim 2 wherein P x is a 2-aminoethylglycine peptide nucleic acid.

8. The method of claim 2 in which each nucleotide N is independently a 2'-dcoxyribonucleotide.

9. The method of claim 2 in which each nucleotide N is independently a ribonucleotide.

10. The method of claim 2 wherein the nucleobases of N y are selected from the group consisting of adenine, guanine, cytosine, uracil, thymine, 7-deazaadenine, 7-deazaguanine, C-5-alkyl pyrimidine, 2,6-diaminopurine, 2-thiopyrimidine, C-5-propyne pyrimidine, phenoxazine, isacytidine, pseudo-isocytidine, isoguanosine, hypoxanthine, 8-oxopurine, and 4(3 H)-pyrimidone.

11. The method of claim 2 wherein the sugars of N y are each independently selected from the group consisting of 2'-O-alkyl-ribonucleotides, 2'-O-methyl-ribonucleotides, 2'-O-allyl-ribonucleotides, 2'-allyl ribonucleotides, 2'-halo-ribonucleotides, 2'-O-methoxyethyl-ribonucleotides, 4'-.alpha.-anomeric nucleotides, 1'-.alpha.-anomeric nucleotides, 2',4'-linked nucleotides, and bicyclic nucleotides.

12. The method of claim 1 in which the PNA-DNA chimera and/or the oligonucleotide are non-radioisotopically labelled.

13. The method of claim 12 wherein the PNA-DNA chimera is labelled at the amino terminus of the PNA moiety.

14. The method of claim 12 wherein the oligonucleotide is labelled at a nucleobase.

15. The method of claim 14 wherein the nucleobases are labelled at the 7-deaza or C-8 positions of the purine or deazapurine, and the C-5 position of the pyrimidine.

16. The method of claim 12 wherein the label is selected from the group consisting of fluorescent dyes, fluorescence quenchers, hybridization-stabilizers, energy-transfer dye sets, electrophoretic mobility modifiers, chemiluminescent dyes, amino acids, proteins, peptides, enzymes, and affinity ligands.

17. The method of claim 16 where the label is a fluorescent dye selected froth the group consisting of FAM, TET, HEX, JOE, TAMRA, ROX, aromatic-substituted xanthene dyes, 4,7-dichloro-fluoresceins, 4,7-dichloro-rhodamines, and cyanines.

18. The method of claim 16 where the label is a fluorescence quencher selected from the group consisting of TAMRA, d-TAMRA, ROX, DABCYL, DABSYL, malachite green, NTB, and cyanines.

19. The method of claim 16 where the label is a hybridization-stabilizer that is a minor groove binder.

20. The method of claim 16 where the minor groove binder is selected from the group consisting of Hoechst 33258, CDPI-3 , MGB1, netropsin, and distamycin.

21. The method of claim 16 where the label is an affinity ligand selected from the group consisting of biotin, 2,4-dinitrophenyl, digoxigenin, cholesterol, polyethyleneoxy, peptides, and fluorescein.

22. The method of claim 12 wherein the oligonucleotide is labelled at a 3' terminus.

23. The method of claim 12 wherein the oligonucleotide is labelled at a 5' terminus.

24. The method of claim 2 wherein L is selected from the group consisting of a covalent bond, phosphate, phosphoramidate, alkyldiyl consisting of 1-20 carbon atoms, aryldiyl consisting of 6-20 carbon atoms, O-linker, and -(CH2CH2O)m- where m is 1 to 6.

25. The method of claim 1 in which the template nucleic acid is a DNA and the ligase is selected from the group consisting of T4 DNA ligase, E. roll DNA
ligase, and a thermostable ligase.

26. The method of claim 1 in which the template nucleic acid is an RNA and the ligase is an RNA ligase.

27. The method of claim 1 in which the PNA-DNA chimeric probe, the second probe, or the template nucleic acid is immobilized on a solid substrate.

28. The method of claim 27 in which the PNA-DNA chimeric probe, the second probe, or the template nucleic acid is covalently attached to the solid substrate, optionally with the aid of a linker.

29. The method of claim 28 wherein the solid substrate is selected from the group consisting of polystyrene, controlled-pore-glass, glass, silica gel, silica, polyacrylamide, magnetic beads, polyacrylate, hydroxyethylmethacrylate, polyamide, polyethylene, polyethyleneoxy, and copolymers and grafts of any of the above solid substrates.

30. The method of claim 28 wherein the solid substrate is selected from the group consisting of small particles, beads, membranes, frits, slides, plates, micromachined chips, alkanethiol-gold layers, non-porous surfaces, and polynucleotide-immobilizing media.

31. A method of template-dependent ligation, comprising the steps of:
a) generating a ligation product by enzymatically ligating a PNA-DNA chimeric probe to a second probe in the presence of a template to which the chimeric probe and the second probe are complementary and hybridized adjacently, wherein the second probe is a PNA-DNA chimera or an oligonucleotide; and b) detecting the ligation product.

32. The method of claim 31 in which the chimeric probe and/or the second probe is non-radioisotopically labelled.

33. A kit for template-dependent ligation comprising:
a PNA-DNA chimeric probe, said probe comprising 5 to 15 contiguous PNA
monomer units, 2 to 15 contiguous nucleotides, and a 3' hydroxyl terminus; a second probe which is a PNA-DNA chimera or an oligonucleotide; and a ligase enzyme.

34. The kit of claim 33 in which the chimera probe and/or the second probe is non-radioisotopically labelled.

35. The kit of claim 33 further comprising a template nucleic acid comprising a sequence complementary to the chimeric probe or containing one or more mismatches relative to the chimeric probe.

36. The kit of claim 33 further comprising a polynucleotide kinase.

37. A duplex hybrid comprising:
a PNA-DNA chimeric probe, a second probe which is a PNA-DNA chimera or an oligonucleotide, and a template nucleic acid with a sequence complementary to the chimeric probe or containing one or more mismatches relative to the chimeric probe, wherein a terminus of the second probe hybridizes adjacent to a terminus of the chimeric probe on the template and said terminii can be ligated together by a ligase enzyme.

38. The duplex hybrid of claim 37 in which the chimeric probe and/or the second probe is non-radioisotopically labelled.

39. The duplex hybrid of claim 37 further comprising a polynucleotide kinase.