CA2281567A1 - Self-regulated apoptosis of inflammatory cells by gene therapy - Google Patents

Abstract

This invention relates to the therapeutic induction of apoptosis in activated inflammatory cells, or cells at a site of inflammation, by introducing into those cells a chimeric gene containing an apoptosis-inducing gene (AIG) driven by a promoter of an inducible gene activated in inflammation and a promoter enhancer such that the inflammatory cells are targeted. In one embodiment, the chimeric gene comprises at least one TNF.alpha. promoter enhancer attached to a functional copy of a minimal TNF.alpha. promoter and further attached to at least one copy of an apoptosis-inducing gene, wherein expression of the gene is driven by the TNF.alpha. promoter. Attachment can be direct, distal, proximal or combinations thereof. Example apoptosis-inducing genes include caspase 3, caspase 4, caspase 5, Granzyme B. Advantageously, the TNFp-AIG
chimeric gene is expressed in only those cells producing the inflammatory cytokine, TNF.alpha.. In addition, the TNFp-AIG chimeric gene also sequesters inducible TNFp transcription factors, thereby reducing endogenous production of TNF.alpha.. The invention also relates to methods of making and using self-regulated apoptosis chimeric genes and pharmaceutical compositions containing them for treating inflammatory diseases.

Description

SELF-REGULATED APOPTOSIS OF
INFLAMMATORY CELLS BY GENE THERAPY
Related Application Data This application claims priority benefit of co-pending L'.S. provisional pplication serial number 60/039,266, filed February 2S. 1997.
Technical Field of the Invention This invention relates to the therapeutic induction of apoptosis in inflammatory cells by introducing into those cells a gene which induces apoptosis (programmed cell death or non-necrotic cell death) in these cells. The Apopto-sis-Inducing Gene (which will sometimes be referred to herein as AIG) is driven by a TNFcx promoter (TNFp) or other inducible gene activated in inflammation.
In one embodiment, apoptosis is selectively induced in those cells capable of producing TNFcx. The TNFp-AIG or other chimeric gene may be conveniently introduced in viao using conventional gene therapy techniques. Advantageously, in the embodiment wherein the chimeric gene is TNFp-AIG, it is expressed in only those cells producing the inflammatory cytokine, TNFcx. In addition, since the TNFp-AIG chimeric gene contains the TNFa promoter elements, it also sequesters inducible, TNFp-selective transcription factors. Such sequestration a results in a reduction in endogenous production of TNFa. The present invention relates specifically to TNFp-AIG and similar gene constructs, cells containing chimeric genes, methods for induction of apoptosis in cells transfected with chimeric genes, pharmaceutical compositions containing chimeric genes, methods _2_ for in vitro selection of TNFcx non-producer somatic cell variants within a TNFcx producing cell population and the like, a method for identifying dominant nega-tive/dominant suppressive genes responsible for inhibiting TNFcx production and therapeutic methods using the chimeric gene.
Background of the Invention In many inflammatory conditions, cytokines such as IL-1, IL-10, GM-CSF and TNFcx are excessively produced as a result of mass aggregation and accumulation of inflammatory cells (Brennan F.M. et al., British Medical Bulletin 1995, 51/2, 368-384}. Upregulation and/or disregulation of cytokines in inflamed tissue may be directly or indirectly responsible for exacerbation of chronic inflammatory diseases. For example, the most marked pathology in rheumatoid arthritis (RA) is displayed at the local site of inflammation (i.e., the synovial joints). Therefore, it is likely that the cytokines produced in the synovial joints of RA patients play an important role in the disease process. Of those cytokines, IL-1 and TNFa are believed to be responsible for the devastating cartilage destruction and bone erosion which characterizes RA (Dayer J.M. et al., J.
Exp.
Med., 1985, 162, 1208-1215; Gowen M. et al., Nature, 1983, 306, 378-380).
The presence of excessive amounts of IL-1 and TNFa in the synovial joints has been shown to accelerate development of collagen-induced arthritis in rodents (Brennan F.M., et al., Clin. I~xpt. Incmutcol., 199-1. 97/1, 1-3). Excessive amounts of TNFa and IL-1 are produced in the synovial tissue by a variety of cell types at the cartilage-pannus junction, including cells of the macrophage lineage, macrophage-like synoviocytes, activated T-cells and possibly fibroblast-like synoviocytes (Chu C.Q. et al., Arthritis & Rheumatism, 1991, 34, 1125-1132;
Deleuran B.W., et al., Arthritis & Rheumatism, 1992, 35, 1170-1178).
In addition to the above described inflammatory effects, TNFcx plays a ubiquitous and key role in a variety of pro-inflammatory events, such as induction -3_ of IL-1 activity in monocytes. Indeed, anti-TNFa neutralizing antibodies have been shown to reduce overall IL-1 production (Portillo, et al., Irnmunol., 1989, 66, 170-175; Brennan F.M., et al., British Medical Baslletira 1995, 51/2, 368-384).
Thus, an added benefit to blocking the effect of the inflammatory cytokine TNFa is the reduction in production of the equally destructive pro-inflammatory media-tor, IL-I. Furthermore, it is well known that TNFa is a transcriptional activator of other inflammation-related genes. For example, the presence of TNFa stimu-lates production of other cytokines tsuch as GM-CSF) and cell surface receptors, including HLA class II antigens and adhesion molecules (Alvaro-Garcia J.M., et al., J. Exp. Med., 1989, 146, 865-875), which. results in continuous recruitment of activated T cells and neutrophils resulting in synovial inflammation and hyper-plasia and ultimately, in augmented destruction of cartilage and bone (Allen J.B., J. Exp. Med . , 1990, 171, 231 ) .
Conventional therapy against inflammatory disorders is typically directed against symptomatic inflammation. Such therapies provide only temporary relief without significantly delaying disease progression. In contrast, therapies targeting TNFa and other factors induced in the inflammatory process are likely to be more promising. For example, in collagen-induced arthritis animal models, an anti-TNFcx antibody and soluble TNFa receptor-IgG chimera effectively reduced paw swelling, joint involvement and cartilage and bone destruction (Williams R.O.
et al., Proc. Natl. Acad. Sci., 1992, 89, 9784-9788). human trials using both humanized anti-TNFcx antibodies and TNhcx receptor-IgG chimeric molecules produced dramatic results (Elliott M.J., et al., Arthritis and Rheumatism, 1993, 36, 1681-169Q; Elliott M.J., et al., Lancet, 343, 1105-1110). Although treatment with these TNFa antagonists appears to be well tolerated, it also results in production of antibodies against the recombinant proteins. Thus, these therapies - may not be suitable for long term treatment and do not achieve true disease abatement. In order to actually modify progression of the disease, TNFcx must be continuously targeted using TNFcx-specific therapies. Such a therapeutic protocol is impractical with these biologic agents and would be difficult to administer in the long term.
In an alternate therapeutic option, inflamed synovium may be removed using surgical (Herold N. and Schroder II.A., Acra Orrhop. Scand., 1995, 66, 252-254; Ogilvie-Harris D.J. and Weisleder L., Arthroscopy, 1995, 11, 91-96), chemical (Cruz-Esteban C. and Wilke W.S., Bailliere's Clinical Rheumatol., 1995, 9, 787-801) or radiation-induced synovectomy (Cruz-Esteban C. and Wilke W.S., Bailliere's CIIi11CC1I RlIG'11111a101., 1995, 9, 787-801 ). The results following arthroscopic surgical synovectomy are good, showing improvement from the preoperative condition to the postoperative condition. Non-surgical synovectomy is performed using various chemical agents such as osmic acid, alkylating agents such as nitrogen mustard and thiotepa, methotrexate. Unfortunately, non-surgical synovectomies (including chemical and radiation-induced) are procedurally complicated, provide only short term relief and show only patchy reduction of the synovial hyperplasia. Furthermore, mast of the non-surgical alternatives are potential teratogens. In addition. the chemical damage to afflicted tissue in non-surgical synovectomy, as well as surgically-induced tissue damage, often cause an inflammatory response themselves. Finally, it should be noted that these approaches suffer from the risks and side-effects commonly associated with conventional pharmaceutical therapy and invasive surgical procedures, including the expense and inconvenience of hospitalization and rehabilitation.
Accordingly. a need still exists for an effective therapeutic approach to treating inflammatory disorders in general and RA in particular.
Summary of the Invention This invention overcomes the drawbacks associated with previous therapies for treating inflammatory disorders by providing a novel therapeutic approach. According to one embodiment of this invention, apoptosis is selectively induced in TNFcx-producing inflammatory cells, causing destruction of these cells ' without an associated inflammatory reaction.
One objective of this invention is to provide a therapeutic method comprising the step of introducing into the inflammatory cells of a mammal, or cells at a site of inflammation, a chimeric gene containing a self-regulating apoptosis-inducing gene (AIG). The AIG is driven by a promoter such as a TNFa promoter (TNFp; see Figures 1 and ?), and, preferably, a promoter enhancer.
Therefore, it is expressed in all anti only those cells capable of producing TNFcx.
Another objective of this invention is to provide TNFp-AIG and the like chimeric gene constructs, processes for making than, methods of using them, and preparations containing them.
Yet a further objective of this invention is to provide a method for the induction of apoptosis in cells transfected with the TNFp-AIG chimeric gene, a method for the in vitro selection of TNIvcx non-producer somatic cell variants in a population, a method for identifying dominant/negative genes responsible for the genesis of a TNFcx non-producing population and a method for identifying prod-ucts responsible for regulation of TNFa production (Figure 10).
These and other objectives will be readily appreciated by those of ordinary skill in the art based upon the following detailed disclosure of the invention.
Brief Descrig~tion of the Figures Figure 1 is a schematic representation of TNFp-AIG chimeric genes of this invention. Apoptosis Inducing Gene (AIG) could be any, but not limited to, the genes listed, vi,z. , Caspases 1 to 10, Granzyme B, FasLigand, etc.

Figure 2 is a schematic drawing depicting the results of gene therapy using a TNFp-AIG chimeric genes of this invention.
Figure 3 is a summary of deletion constructs used for identification of the inducible cis elements of the TNFa promoter using luciferase gene (Luc) expression as the reporter system.
Figure 4 (a and h) provide a summary of results obtained using the con-structs described in Figure 3. Transient expression of the constructs was assessed in two different TNFa-producing cell lines, vi:.., Jurkat (Figure 4aj and THP-(Figure 4b). Histograms in each figure show stimulation index as a measure of lU inducibility by activating agents such as PMA (Figure 4a> or LPS (Figure 4b) for individual experiments. The line superimposed in each figure indicates the mean inducibility averaged from 4 to G experiments.
Figure 5 is a flov~~ chart for preparation of the TNFpAIG using selected native elements of the TNFa promoter and prodomain-deleted AIGs (AIGs used are Caspase and Caspase 4/5).
Figure 6 (a, b, and c) provide a summary of results from representative experiments performed to see expression of the chimeric TNFpAIGs. Apoptosis in transiently-transfected Jurkat cells (Figure 6a and 6b) and THP-1 (Figure 6c) cells was assessed using Cell Death Elisa (CD)r assay). In all three figures, histograms with sparse dots represent transfection control, where cells were treated with the transfecting agent in the absence of DNA. Histograms with dense dots represent the TNFp elements driving expression of the luciferase gene and solid histograms represent the same TNFp elements driving expression of either AIG.I
or AIG.2. The number in parenthesis above the solid histograms represent enrichment factor (ratio of apoptosis induced by TNFpAIG to the TNFpLuc control vector) .

-7_ Figure 7 (a and b) is a diagrammatic representation of a TNFp-AIG
chimeric gene of this invention, comprising multiple copies of the inducible cis elements of the TNFa promoter which, in turn, drive expression of the AIG
(Figure 7a). A diagrammatic representation of a TNFpAIG chimeric gene, comprising multiple copies of the inducible cis elements of the TNFa promoter, driving expression of the AIG, downstream of which are 3' untranslated region of the TNFa gene (TNF3'UTR) (Figure 7b). 3'UTR of the TNFa gene is implicated in the regulation of the inducible expression of TNFa (Han, J., et al., J.
Immunol-ogy, 1991, 146, 1843-1843, Crawford, E.K., et al., J. Biol. Chem., 1997, 272, 21120-21137, and Figure 9).
Figure 8 (a and b) are flow charts of schemes for preparing TNFa superpromoter-AIG chimeric constructs.
Figure 9 shows a summary of the results of two experiments to show the regulatory effect of the TNF3'UTR on inducible expression of the luciferase reporter gene. The transient transfection was performed in a fibroblast cell line.
Dotted histograms represent inducibility of TNFpLuc in the absence of TNF3'UTR
and solid histograms represent inducibility of TNFpLuc in the presence of TNF3'UTR. Similar results are obtained in the 3urkat cell.
Figure 10 is a diagrammatic representation for the selection of TNFcx non-producer somatic cell variants within a TNFcx-producing cell population and identification of dominant negative suppressive genes responsible for inhibiting TNF-a production.
- Detailed Description of the Invention This invention is based upon evidence that apotosis of inflammatory cells in certain inflammatory diseases is therapeutically beneficial. The invention _g_ specifically relates to self-regulated apoptosis by gene therapy. Broadly speaking, in the practice of the invention, a chimeric gene comprising at least one promoter enhancer attached to at least one functional copy of a minimal promoter, the promoter being a gene or combination of genes activated in inflammatory cells or in cells at a site of inflammation, is attached to at least one copy of an apoptosis-inducing gene (AIG), such that the expression of the apoptosis-inducing gene is driven by the promoter, thus targeting the inflammatory cells. Example promoters of inducible genes activated in inflammation include, but are not limited to, cytokines, interleukins and their receptors, cell adhesion molecules and their ligands, chemokines and their receptors, pro-inflammatory enzymes, and the like.
Chimeric genes according to the invention comprise enhancer, promoter, and AIG
elements in direct, distal, or proximal attachment, and combinations thereof.
As mentioned above and will be discussed in more detail below, in some embodi-ments, multiple copies of the enhancer, promoter, and/or AIG are employed for maximal efficacy.
In order that the invention herein described may be more fully under-stood, the following detailed description is set forth, with emphasis on chimeric genes comprising at least one TNFa promoter enhances attached to at least one functional copy of a minimal TNFcx promoter and further attached to at least one copy of an AIG for illustrative purposes only. Though the examples that follow also employ these types of constructions, it will be appreciated by skilled workers that the basic constructs described herein may be altered to provide other embodi-menu that utilize products, processes, methods, and compositions of the invention with other promoters comprising inducible genes activated in inflammation such as the types listed above that exhibit similar functions that can be used to target cells at the site of infection.
For example, cytokines and interleukins useful as promoters in the construction of chimeric genes of the invention include, but are not limited to, TNF-a, TNF(3, IL-la, IL-1~3, IL-2, Il-6, IL-9, GM-CSF, interferony, and the like, and functional fragments and mixtures thereof. Cell adhesion molecules and their ligands include, but are not limited to, selectins, integrins, and members of the immunoglobulin superfamily such as ICAM-1, V-CAM, and the like, and functional fragments and variants and mixtures thereof. Chemokines and their receptors include, but are not limited to, the C-X-C and C-C family members such as MIP-lcx, MIP-1(3, MCPI-4, RANTES, Mig, NAP2, IP10, Gro a-y and the like, and functional fragments and variants and mixtures thereof. Pro-inflammato-ry enzymes include, but are not limited to COX-2, iNOS, phospholipases, prote-ases (including matrix metalloproteasesj, and the like and functional fragments and mixtures thereof.
To clarify the discussion below of exemplary TNFp-AIG chimeric genes of this invention, the following sequences are illustrated:
SEQ ID NO: I is the nucleotide sequence corresponding to the full-length, reference human TNW x promoter sequence, as published in (Takashiba S., et al., Gene, 1993, 131, 307-3081. Nucleotide numbers used herein refer to the numbering of this sequence.
SEQ ID NO: 2 is the native TNFa promoter sequence of the gene that was used in this invention (-1077 nucleotides from the transcription start site, TSS). There are a few differences in the sequence of the TNFp in SEQ ID NO: 1 and SEQ ID NO: 2. Such differences in the nucleotide sequences of the TNFa promoter have been reported (Takashiba S., et al., Gene, 1993, 131, 307-308).
SEQ ID NO: 3 is the native minimal TNFcx promoter sequence (nucleo-tide -120 through -TSS, which includes at least one enhancer element (kl site;
see _ 25 Pauli, U., Crit. Rev. irz Ezccaryotic Ge~te Expression, 1994, 4, 323-344;
Rhoades K.L., et al., J. Biol. Chem., 1992, 267, 22102-22107; and Takashiba S., et al., Gene, 131, 307-108) .

SEQ ID NO: 4 is the chimeric gene TNFp120 AIG.1 (containing -120 TNFp driving the expression of the prodomain-deleted variant of CPP32 gene (Caspase 3, published Tewari M. et al., Cell, 1995, 81(5), 801-809, with the variation being V239A).
SEQ ID NO: 5 is the chimeric gene TNFp706 AIG.1 (containing -706TNFp driving expression of the prodomain-deleted CPP 32 gene.
SEQ ID NO: 6 is the TNFp1005 AIG.I (containing -1005 TNFp driving expression of the prodomain-deleted CPP 32 gene).
SEQ ID NO: 7 is the chimeric gene TNFp120 AIG.2 (containing -120 TNFp driving expression of the prodomain-deleted Ty/x gene. (Sequences of Ty (Caspase 5) and Tx (Caspase 4) genes are published in the ref. Faucheu, C., et.
al., Eun. J Biochem., 236, 207-213, 1996; Faucheu, C., et. al. EMBO J., 14, 1914-1922,1995).
SEQ ID NO: 8 is the chimeric gene TNFp706 AIG_2 (containing -706TNFp driving expression of the prodomain-deleted Ty/x gene.
SEQ ID NO: 9 is the TNFp1005 AIG.1 (containing -1005 TNFp driving expression of the prodomain-deleted Ty/x gene).
SEQ ID NO: 10 is the enhancer region 1 (ER1) of the TNFa promoter encompassing nucleotides -1005 to -905.
SEQ ID NO: 11 is the enhancer region 2 (ER2) of the TNFa promoter encompassing nucleotides -706 to -517.

WO 98/37901 PCT/US98l03911 SEQ ID NO: 12 is additional multiple cloning sites (MCS) genetically engineered upstream of the -120 minimal TNFa promoter in the -120pGL3 construct.
SEQ ID NO: 13 is the 3' untranslated region (3'UTR) of the TNFcx gene (Nedwin, G.E., et al., Nucleic Acid Research, 1985, 13, 6361-6373).
The elements of the TNFa promoter for preparation of chimeric gene constructs according to this invention are selected from elements which are capable of inducing expression of a therapeutic gene driven by the TNFa promoter.
These promoter elements will be referred to herein as "inducible cis elements", "cis-inducible elements" or "enhancer elements" of the TNFcx promoter.
The enhancer elements may he physically linked to the minimal promot-er sequence, or separated from the minimal promoter by a linker sequence which may or may not have unique restriction sites. Thus, as summarized above, enhancer elements may be attached directly, distal(, proximally, or any combina-tion thereof, to chimeric genes of the invention. These are typically constructed upstream of the promoter. Example TNFcx enhancer elements are set out in SEQ
ID NO: 10 and SEQ ID NO: 11; functional fragments or variants and combina-tions thereof may be employed. Some preferred gene constructs according to this invention include those that have multiple copies of the enhancer elements, i.e., 2 or more copies. Some embodiments have about 2 to 25, more narrowly 2 to 10, and even more narrowly, 2 to 5 copies.
The terms "TNF promoter", "TNFa promoter" and "TNFp" are used interchangeably herein. Unless noted to the contrary, these terms refer to the entire nucleotide sequence corresponding to a native TNFcx minimal promoter sequence attached to one or more upstream enhancer elements (either present naturally i.e. native, or genetically engineered in the laboratory). Examples include, but are not limited to, SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:
3, and functional fragments, variants, and mixtures of any of these. Many functional fragments and variants of these TNFa sequences and others described herein share a sequence homology of at least about 80 % , and in some cases over 90%, to their native and genetically engineered counterparts, but these are known to skilled workers and defined in the references cited herein.
Any apoptosis-inducing gene may be used in the chimeric genes and methods described herein. The apoptosis inducing gene used for the chimeric therapeutic genes of this invention can be the same or different from the type of apoptosis inducing gene present in the native sequence of the TNF-a-producing inflammatory cells (if those cells naturally contain an apoptotic gene).
Preferred AIGs include, but are not limited to, members of the ICE/CED3 family of apoptosis inducing proteases (such as Caspase-I (ICE), NICE. ICE-LAP45, Mch2a), Caspase-2 IICH I ), Caspase-3 (CPP32, Yama, Apopain), Caspase-4 (TX, ICH2, ICE rel II), Caspase-5 (ICE rel III, TT). Caspase-6 (Mch-2), Caspase-7 (Mch-3, ICE-LAP3, CMH-1 ), Caspase-8 (MACH, FLICC, Mch-5), Caspase-9 (ICE-LAP6, Mch6) and Caspase-10 (Mch4)>, members of the granzyme family (such as Granzyme A and Granzyme B), Fas ligand (FasL), and functional fragments, variants, and mixtures of any of these. Some embodiments employ Caspase 3, Caspase 4, Caspase 5, Granzyme B, and functional fragments, vari-ants, and mixtures thereof. With the exception of Fast, these genes, when overexpressed following transfection, induce apoptosis in the transfected cells (Miura M., et al., Ccll, 1993, 75, 653-660; Chinnayan A.M., et al., Cell, 1995, 81, 505-512; Los, et al., Nantre, 1995, 375, 81; Muzio, et al., Cell, 1996, 85, 8 I 7-827) .
In the case of Fast, apoptosis is induced (either in an autocrine or a paracrine fashion) in only those cells that express Fas. Therefore, the TNFp-Fast chimeric gene construct offers a second level of selectivity. Another advantage of the TNFp-Fast chimeric gene is the selective targeting of those disease-producing cells in the synovium that do not express TNFa (thereby failing to drive expres-sion of the apoptosis inducing gene), but do express Fas on the surface. In this case, Fast will be expressed by the cells that are capable of producing TNFa such as activated macrophages and T cells. These cells will then induce apoptosis in Fas-expressing cells such as hazardous activated T cells and Fas-expressing synovtocytes.
This invention provides a novel therapeutic method comprising the step of introducing into the cells of a mammal a chimeric gene comprising an apopto-sis-inducing gene (AIG) driven by the TNFa promoter (TNFp). Example chime-ric genes of the invention are set out in SEQ ID NOs 4, 5, 6, 7, 8, and 9;
functional fragments or variants of these may also be employed. Without wishing to be bound by theor~~, as a result of being controlled by the TNFp, AIG is expressed in only those cells producing the inflammatory cytokine, TNFa.
Therefore, any cells expressing TNFa will be self-destructive, while cells that do not express TNF-a will be unaffected. Advantageously, this methodology can target any TNFcx-producing cells (such as activated macrophages, activated T-cells and macrophage-like and possibly fibroblast-like synoviocytes) without regard to cell type. Indeed, the targeted TNFa-producing cell can be one which normally does or normally does not carry or expresses an apoptosis gene in its native, unaltered form. Therefore, using the chimeric genes and methods of this inven-tion, the cellular sources of TNFa can be destroyed in a highly selective manner.
Another advantage of using the TNFp-AIG chimeric gene of this invention is that TNFp sequesters transcription factors needed by endogenous TNFp, thereby leading to a reduction in endogenous TNFa production. In one preferred embodiment, TNFp is present in the therapeutically targeted cell in vast excess. This may be accomplished by introducing multiple copies of the transfec-ted gene into the cell. Alternatively, the TNFp-AIG chimeric gene according to - this invention can contain multiple copies of the inducible cis elements of the TNFa promoter. As mentioned above, multiple copies of the "inducible enhancer elements" of TNFp are present in some embodiments of the TNFp-AIG chimeric genes of this invention. By including multiple copies of the inducible cis elements of the TNFp construct, the transcriptional factors needed by the transfected c-ell to produce TNFa are sequestered by the exogenously introduced sequence. This preferred chimeric TNFp-AIG construct is characterized by an increased effective-ness in competing for the TNFp-specific transcription factors as compared to chimeric genes of this invention containing only a single enhancer element linked to TNFp. The "inducible super promoter" constructed in this way is capable of ( 1 ) more effectively competing for TNFa specific inducible transcription factors and (2) driving expression of the apoptosis inducing gene in an augmented fashion by virtue of multiple enhancing elements.
For example, in rheumatoid arthritis patients, svnovectomy, i.e., removal of synovial tissue, has been shown tc> be clinically beneficial.
Unlike conventional and surgical synovectomy procedures, the cell-targeted therapeutic method described herein targets only cells producing TNFa. Thus, advanta-geously, the introduction and expression of thc: TNFp-AIG chimeric gene, and subsequent induction of apoptosis do not induce an inflammatory response.
Accordingly, methods of this invention are comparatively selective and result in minimal tissue damage and a reduction in inflammation.
The products and methods described herein are useful for the treatment of other inflammatory disorders as well. Such inflammatory disorders include, but are not limited to, multiple sclerosis, -Guillain-Barre syndrome, Crohn's disease, ulcerative colitis, psoriasis, graft versus host disease, lupus erythematosus, insulin-dependent diabetes mellitus, psoriatic arthritis, sarcoidosis, hypersensivity pneumonitis, ankylosing spondylitis and related spoldyloarthropathies, Reiter's syndrome and systemic sclerosis. Thus, this invention encompasses methods for treating an inflammatory disorder in a patient by inducing apoptosis in inflammato-ry cells or cells at a site of inflammation of the patient by introducing into the cells at least one chimeric gene of the invention. This is typically accomplished by preparing a pharmaceutical composition containing at least one chimeric gene of the invention and typically a pharmaceutically acceptal carrier, and administer-ing the composition to a patient using standard means. In some embodiments, the . pharmaceutical composition is delivered directly to the site of inflammation using local topical, intravenous, intraperitoneal, and similar methods. Further methodol-' ogy is discussed below.
In addition to the therapeutic indications, the genes and cells according to this invention can be used in a variety of useful screening and selection meth-ods. In one such method, TNFcx non-producer somatic cell variants within a TNFa producing cell population can be selected in vitro by introducing a TNFp-AIG chimeric gene into the TNFa producing cell population. Cells producing TNFcx will undergo apoptosis. Cells that do not produce TNFcx will survive. Selection of those cell variants possessing the survival phenotype is an easy way to identify TNF-a non-producer cells. Such a selection process may be used to determine expression of genes that act in-trans to regulate activity of the TNF-a promoter, thereby reducing TNF-cx production. Such genes are character-ized as dominant negative (DN) /dominant suppressive genes in other systems (Behrends S., et al., J. Biol. Chem. 1995, 270, 21109-21113; Zhang S., et al., J.
Biol. Chent., 1995, 270, 23934-23936; Watowich S.S., et al., Mol. Cell Biol., 1994, 14/6, 3535-3549).
In a further in vitro method, a TNFp-AIG chimeric gene according to this invention can be used to identify dominant negative genes responsible for the genesis of a TNFcx non-producing cell population. According to this method, a TNFp-AIG chimeric gene according to this invention is introduced into cells that produce TNFcx. Barring the presence of a dominant negative gene, those cells should undergo apoptosis upon activation. Therefore, it can be deduced that surviving variants possess a dominant negative gene capable of down-regulating TNFcx production. The dominant negative gene can be readily identified by producing a cDNA library and transfecting cell lines (e.g., Jurkat and THP-1).
These cells are either stable transfectants of an inducible TNFp-AIG chimeric gene or TNFp-luciferase gene TNFp-AIG transfected cells will be selected for the - i6 -survival phenotype following irr vitro activation; survival phenotype is indicative of the effect of the DN genes. In the cells transfected with TNFp-luciferase gene, .
reduction in the luciferase activity will be indicative of the DN gene effect.
Dominant negative genes identified using this protocol can be used as the future ' therapeutic agents themselves. Such genes will be the candidates for gene therapy in order to reduce TNFa production.
The methods utilized for gene transfer are grouped into two broad categories:
I . Direct approach : In ,situ transduction of the therapeutic gene into target cells such as synoviocytes using a suitable vector as a carrier for the therapeutic gene.
The vector containing therapeutic gene is injected directly into the affected area (e.g., an arthritic joint).
2. Indirect approach : Ex-viva transfection of the therapeutic gene into target cells such as synoviocytes. In this approach, the synovium is removed from joints, synoviocytes are isolated and cultured in vitrq. In vitro cultured cells are trans-fected with the therapeutic gene, and genetically modified synoviocytes are transplanted back into the synovium.
For in vivo transfer, several vectors have been evaluated for their efficacy in gene delivery (Nita, et al., Arthritis c~ Rheunuztisrn, 1996, 39/5, 820-828). Among the vectors used for gene therapy, the vectors derived from retroviruses are by far the best developed. They are able to insert genetic material in the host genome and produce stable transfectants. These vectors, however are unable to infect non-dividing cells and, since they are inserted in the host genome, the possibility of insertional mutagenesis cannot be ruled out. In comparison, the vectors derived from adenoviruses infect dividing as well as non-dividing cells and deliver DNA episomally. The disadvantage of adenovirus based vectors is that these vectors continue to produce viral proteins in infected cells making them potentially antigenic. A third type of viral based vectors is derived from Herpes simplex viruses (HSV), which are also capable of infecting dividing as well as non dividing cells.
Among the non-viral vector systems, cationic liposomes and naked plasmid DNA have been evaluated. Liposomes are at the most advanced stage of development, although certain types of cells such as muscle and skin take up, retain and express naked plasmid DNA.
Particle-mediated gene-delivery system is also possible (Rakhmilevich, et al., PNAS, 1996, 93, 6291 ) and is a promising approach.
The following "in aivn" gene delivery protocols can he used to deliver the chimeric genes of this invention:
(1) Nita et al., ArTlIrlllS al1(I RIILIIIIraIISllI, 1996, 39, 82U-823 In vivn experiment in rabbits:
Each vector is injected intra-articularly into 1 knee joint. For viral vectors, between lOs and 10'' particles suspended in 0.5 ml balance salt solution are injected per knee.
Liposome-DNA complexes (200 nmoles of DC-Chol complexed with 20 beg of DNA/ml> in 1 ml balance salt solution are injected per knee.
(2) Methods in Moleclclar Mecli~ilre : Gelre Therapy Prnlo~ols, Paul Bobbins, ed., 1997, Barr er al., pages 205-212 Adenovirus-based vector delivery to hepatocytes : Rat hepatocytes 1X10" PFU in 100 g animal.
In dogs (12-17 kg), portal vein is perfused with about 1.5X10" PFU/kg gives 1 adenovirus genome copy per diploid copy of host DNA
In rabbits {2-4kg), 1.5X10'=' virus particles (about 1.5X10" PFU) gives 100 % hepatocyte transduction; 4X 10'' virus particles give 50-75 %
transduction.

Yang N-S, et al., 281-296 Gold particle-mediated gene delivery : Transfection of mammalian skin tissue- 0.1, 0.5, 1.0 and 2.5 tcg of DNA/mg particle gives linear relationship with transgene expression levels.
Nabel, et al., 297-305 Liposome-mediated gene delivery in humans:
Protocol 1: l5nmol DC-ChoI/Dope liposomes combined with 1 ~g DNA in 0.7 ml. 0.2 ml of the above mixture is injected into the patient's melanoma nodule. For catheter delivery, 0.6 ml of the solution is delivered into the artery.
Protocol 2: l5nmol DMRIE/Dope liposomes combined with 5 teg DNA in 1.0 ml.
For direct intra-tumor injections, DNA concentrations range from 3 tcg complexed with 4.SnM DMRIE/Dope to 300 tcg complexed with 450 nM
DMRIE/Dope.

(3) Roessler, et al. 369-374 Gene transfer to synovium:
A range of doses, 10~-10'' adenovirus particles containing thera-peutic gene/joint are used. However, the optimal dose for any particular experimental series needs to he determined empirically, and is dependent on both the properties of the recombinant adenoviral genomic backbone being used as well as the transgene being expressed.
For the indirect approach, a variety of methods are well established, including utilization of cationic lipid or cationic polymer-based transfection and electroporation.

Any of the above-referenced techniques can be altered to suit the - particular needs of those of ordinary skill in the art. Such modifications are well within the level of skill possessed by ordinary practitioners and do not require undue experimentation. These obvious variations are within the scope of this invention.
Examples In order that this invention he more fully understood, the following examples are set fortiz. These examples are for the purpose of illustrating some preferred embodiments of this invention, and are not to be construed as limiting the scope of this invention in any way.

Production of TNFp-AIG Constructs In order to construct chimeric AIG driven by the enhancer cis elements of the TNF promoter, either in a single or multiple copies of the same region or various regions, identification of the regions of interest responsible for optimal inducible expression of the reporter gene is performed.
Selection of the TNF-cr promoter elements for constructing a chimeric gene. The regions of the TNF-cx promoter are amplified by polymerase chain reaction (PCiZ) using primers encompassing various deletion constructs of the TNFcx promoter (Figure 3). The regions identified by other investigators in various other cellular systems are used as reference (Rhoades, et al., J.
Biol.
Chem. , 1992, 267, 22102-22107; Leitman, et al., Mol. Cell Biol. , 1992, 12, 1352-1356; Pauli U., Crit. Reviews Eu~:aryotic. Gerae Expression, 1994, 4, 323-344). The PCR-amplified genes are then cloned upstream of a reporter gene, such as luciferase, in a commercially available promoterless vector. These constructs are tested for their constitutive and inducible expression in various cell lines such as Jurkat (T lymphoblastoid), U973 (myelomonocytic), THP-1 (mono-cytic), fibroblasts and in vitro cuitured human synoviocytes. Identification of the regions responsible for inducible expression of the reporter gene is primarily based on the results obtained using two TNFa-producing cell lines, viz Jurkat (following stimulation with PMA) and THP-I (following stimulation with LPS) (Figure 4 a and b). These cells are transiently transfected by using well established methods and commercially available reagents, e.b~., DI:rAC dextran and Superfect. The cis-elements of the TNFcx promoter that are responsible for inducible expression of the reporter gene are then used for constructing TNFp-AIG chimeric genes.
Construction of TNFp-AIG chimeric enea. Qf the apoptosis inducing genes described herein, the following genes are preferred:
i) cysteine protease - CPP32 (also knov~n as Yama, apopain or Caspase 3) and ii) Cysteine protease -Tx/Ty (Caspase 4/Caspase 5>
The AIGs are used as "prodomain-deleted"truncations in order to poten-tially augment autocatalysis of Caspases. This is essential for conversion of inactive Caspase to active form.
Prodomain-deleted CPP32 is amplified using primers corresponding to colons 29-36 and 271-278 (278 is a stop colon). The truncated form of CPP32 is referred to as "cxCPP32" or "AIG.1 " herein.
For PCR amplification for prodomain-deleted Ty, primers corresponding to the sequences in the Ty gene are synthesized. All Caspases discovered so far have homology to the other members of the Caspase family. The 3' primer corresponding to the colons 359-365 (colon 365 is a stop colon ) shares 100%
sequence homology to the colons 372-378 (colon 378 is a stop colon) in the Tx gene. However, the 5' primer corresponding to colons 81-87 in the Ty gene does not share 100% homology with the corresponding region in the Tx gene (Tx colons 94-100). Residue 87 (Alanine) in the Ty gene differs from residue 100 (Glycine) in the Tx gene. The PCR amplified product generated from cDNA
prepared from activated human peripheral blood lymphocytes possesses the sequence of Tx, due to apparent abundance of Tx transcripts. Therefore, the ' truncated form of the AIG generated using synthetics oligonucleotide primers corresponding to the sequences in Ty, indeed matches sequences in Tx , albeit flanked by Ty sequences of the primers. The Ty sequences of the primers used also match with the sequence of Tx, except for one codon. Thus the gene used in this invention matches truncated Tx gene with residue 6100 toA change. This gene is referred to as "VTy/x" or "AIG.2" herein.
AIG.1 and AIG.2 are inserted downstream of the TNFcx promoter by replacing the luciferase reporter gene in deletion constructs (-120. -706 and -1005) of the TNFa promoter (Figure 5). These constructs are tested for the induction of apoptosis following stimulation of transiently-infected Jurkat and THP-1 cells (Figures 6 a, b, and c).
Constuction of TNFa superpromoter-AIG chimeric genes. Two broad preferred regions, vii.. ER1(-1005 to -905) (SEQ. ID 10) and ER2(-706 to -517) (SEQ ID NO: 1 I ) of the TNFcx promoter, containing elements responsible for inducible expression of the reporter gene described above (Figure 4a and 4b) are PCR amplified and are ligated upstream of the minimal native promoter (-120 through TSS, SEQ ID NO: 3), either as a single copy or multiple copies. Two more regions (-234 to -120) and (-234 to -65) of the TNFcx promoter is also identified as a potential enhancer region 3 (ER3) and enhancer region 4 (ER4), respectively, which can be employed in the chimeric constructs using the strategies described below. The super promoter contains multiple (2-10) cassettes of the above mentioned regions containing inducible promoter elements (Figure 7).
This is achieved by PCR amplifying the regions of interest using primers synthesized - 25 with restriction sites inserted at the 5' end of each of the primers.
These unique restriction sites flank the amplified gene product of interest. Preferably, PCR
- amplified AIG is cloned downstream of the TNF-( super promoter, replacing the luciferase reporter gene in the original construct as described (Figure 5) for the native TNFa promoter.

The schemes for construction of a TNFa superpromoter and the linker sequences representing unique restriction sites (these restriction sites are absent in the selected elements of the TNF-a promoter and the AIG in question) for efficient directional insertion is outlined below and depicted in Figure 8:
Scherne 1:
STEP 1: Insertion of the TNF-a minimal promoter (-120 to TSS) into the pGL3 basic (promoterless) luciferase vector (Promega):
The elements of pGL3 basic vectors that are used for construction of the chimeric gene TNFp-AIG are shown below.
KpnI.SacI.MIuI.NheI.SmaI.XhoI.BgIII.HindIII. [luciferase).XbaI
The minimal promoter is PCR amplified using primers containing XhoI
and BgIiI.HindIII sites, so that XhoI is at the 5'end and BgIII.IIindIII sites are at the 3' end of the amplified product. This fragment is inserted into the polylinl:er of the pGL3 basic vector using these same restriction sites. This construct is referred to as "Construct A 1 " and is as follows:
KpnI.SacI.MIuI.NheISmaIXhoI.(-120 to TSSBgIII).HindIII.(luciferase].XbaI-STEP 2: The enhancer fragment (ER1 or ER2) is PCR amplified using the primer containing several restriction sites. The resulting fragment will have restriction sites KpnI.AatII.BssIiII at the 5' end and NsiI.SpeI.MluI at the 3'end as follows:
5' KpnI.AatII.BssHII.(ER1 or ER2).NsiI.SpeI.MluI 3". The fragment is inserted into the "Construct A 1 " generated in STEP 1 using Kpnl and MIuI restriction -sites. This construct is referred to as "Construct B1" and is as follows:
KpnI.AatII.BssHII.(ER1 or ER2).NsiI.SpeI.MIuI.NheLSmaI.XhoI(-120 to TSS BgIII).HindIII. (luciferase].XbaI -STEP 3: The TNFa enhancer fragment (ER1 or ER2)) is amplified using the ' primers containing restriction sites AatII and BssHII to generate the PCR
product as follows:
5' AatII.(ER1 or ER2).BssHII 3'. This fragment is cloned into the "Construct B 1 " using these same restriction sites. This construct is referred to as "Construct C 1 " and is as follows:
KpnI.AatII.(ER1 or ER2).Bssl-III.( ERl or ER2).NsiI.SpeI.MIuI.NheI
Smal.XhoI(-120 to TSS BgIII).HindIII.[luciferase].XbaI
STEP 4: The TNFcx enhancer fragment (ER1 or ER2) is amplified using the primers containing restriction sites NsiI and SpeI to generate the PCR product as follows:
5' NsiI.(ER1 or ER2).SpeI 3'. This fragment will be cloned into the "Construct C 1 " using these same restriction sites. This construct is referred to as "Construct D 1 " and is as follows:
KpnI.AatII.(ER1 or ER2).BssHII.(ERl or ER2).NsiI.(ERl or ER2).SpeI.MIuI.NheI SmaI.XhoI(-120 to TSSBgIII).HindIII.[luciferase].XbaI
STEP 5: AIG.1 or AIG.2 (preferred but not limited to AIG.1 and AIG.2; any AIG from the list can be used) coding regions are PCR-amplified using the primers containing BgIII and XbaI restriction sites generating the fragment as follows: 5' BgIII.(AIG.1 or AIG.2).XbaI 3". This fragment is inserted into the "Construct D 1 " using these same restriction sites. The resulting construct is referred to as "Construct E I " and is as follows:
KpnI.AatII.(ER1 or ER2).BssHII.( ER1 or ER2).NsiI.( ERl or ER2).SpeI.MIuI.NheI.SmaI.XhoI(-120 to TSS.BgIII)[AIG.l or AIG.2].XbaI

Alternatively scheme 2 is followed:
Scheme 2:
STEP 1: Same as in scheme I giving rise to "Construct A I ", which is as follows:
KpnI.SacI.MIuI.NheI.SmaI.XhoI.(-120 to TSS BglIt).l-IindIII.[luciferase].XbaI
STEP 2: Insertion of additional MCS.
Two complementary oligonucleotides (5' phosphorylated) providing NheI.SacII.EcorV.AflII.AatII.AvrII.SpeI.PvuII.XhoI are synthe sized using commercial sources. These oligonucleotides are annealed and then cloned into NheI and XhoI sites of the "Construct A 1 ". The resulting construct referred to as "Construct B2" and it is as follows:
KpnI.SacI.MIuI.NheI. SacII.Ecor~'.AfIII.AatII.AvrII.SpeI.PvuII.Xhol.(-120 to TSS BgIII).HindIII.[luciferase).XbaI
STEP 3: The TNF-a enhancer fragment (ER1 or ER2) is amplified using the primers containing restriction sites SpeI . PvuII at the 5' end, and XhoI at the 3' end to generate the PCR product as follows: 5' SpeI.PvuII.(ER1 or ER2) . XhoI
3'. This fragment is cloned into the "Construct B2" using SpeI and XhoI
restric-tion sites. This construct is referred to as "Construct C?" and is as follows:
KpnI.SacI.MIuI.NheI. SacII.EcorV.AfIII.AatII.AvrII.SpeI.PvuII.(ERl or ER2) Xhol.(-120 to TSS BgIII).HindIII.[luciferaseJ.XbaI
STEP 4: The TNFa enhancer fragment (ER1 or ERZ) is amplified using the primers containing restriction sites AvrII. SpeI at the 5' end, and and PvuII
at the 3' end to generate the PCR product as follows: 5' AvrII.SpeI.(ERl or ER2).PvuII 3'. This fragment is cloned into the "Construct C2" using AvrII and PvuII restriction sites. This construct is referred to as "Construct D2" and is as follows:
KpnI.SacI.MIuI.NheI. SacII.EcorV.AfIII.AatII.AvrII.SpeI. (ERl or ER2) PvuII. (ERl or ER2) Xhol.(-120 to TSS BgIII).HindIII.[luciferase).XbaI
Thus, using this strategy at least seven copies of the enhancer regions (ER1, ER2 or ER3, individually or in combination), one at a time, can be added by using one more restriction site upstream of the previous one in PCR
amplifica-tion of the enhancer regions of choice.
Once the desired number of copies of the enhancer regions are added, AIG is inserted downstream of the superpromoter as described in the STEP 5 of the scheme 1.
The inducible expression of the chimeric TNFp-AIG gene is tested by transient transfection of the cell Iines mentioned above. The expression of TNFp-AIG gene is measured b}' detecting apoptosis of transfected cells, assessing AIG expressed proteins in Western blots using commerciaIty available antibodies and assessing protease activity using commercially available, well documented specific synthetic tetrapeptide substrate.
The inducible expression of the chimeric TNFp-Fast gene is tested by transient transfection of the same cell lines. The cell surface expression of Fast by the transfected cells is quantitated using anti-Fast antibody binding as detected by indirect immunofluorescence and by measuring induction of apoptosis of Fas positive cells.
R~ulation of the TNFp-driven expression of a reporter gene. The 3' untranslated region of the TNFa gene plays an important role in reulation of the TNFcx biosynthesis. It is involved in translational expression of the TNFcx gene in WO 98/37901 PCT/US98/03911 _ normal, non-activated states. Importantly, these elements allow de-repression to occur when TNFcx-producing cells are activated by external stimuli (Han, J., et al., J. hnrnuttology, 1991, 146, 1843-1848; Crawford, F.K., et al., J. Biol.
Chem. , 1996, 271, 22383-22390).
Genetic constructs are made in which the entire 3' untranslated region (SEA ID NO: 13) is inserted downstream of the luciferase gene driven by deletion fragments, ui~., -120, -706 and -1005 of the TNFa promoter. The results of the transient expression of these constructs are summarized in Figure 9.

Testing Protocols In Vitro Methods:
Luciferase assay: Luciferase activity iv determined using commercially available reagents ( Promega).
AIG.l and AIG.2 gene expression:
a) Western blots of the transfected cell lysates are developed using anti-antibody as well as anti-PRAP antibody. Anti-PRAP antibody detects both hydro-lyzed as well as non-hydrolyzed products of PRAP as an enzymatic action of CPP32.
b) CPP32 enzyme assay : This assay detects enzymatic reaction of CPP32 and breakdown of colorimetric or fluorogenic substrate. Commercially available (Clonotech, Pharmingen) kit ise used for this assay.
c) Apoptosis of transfected cells: Apoptosis of transfected cells due to AIG.1 and AIG.2 is determined by staining nuclei by propidium iodide (Krishan, A., J.
Cell Biol., 66, 1994, 188-193) and by commercially available Cell Death Elisa kit (Boehringer Mannheim) .

Animal Models Rabbit model of IL-1-induced arthritis (Pettipher E. R. , et al. , Proc.
Natl. Acad. Sci., 1986, 83, 8749-8753): II-1 is injected into the knee joints of New Zealand White rabbits. Intra-articular injection of IL-1 causes dose-depen-dent infiltration of leukocytes into the joint space and loss of proteoglycan from the articular cartilage.
Antigen-Induced arthritis : Intra-articular injection of antigen (ovalbu-min) into knee joints induces leukocyte accumulation and cartilage degradation that closely resembles rheumatoid arthritis in humans. The joint swelling following the injection was sustained for 14 days.
Scid mice-human synoviocytes model (llouri J.M., et al. Currem Opinions in Rltertmatol., 1995, 7, 201-205: Sack U., et al., J.
Aruointntrrnip, 1995, 9, 51-58; Geiler T., et al. Arthritis & Rheuntattsm, 1994, 37, 1664-1671):
These are recently developed models for arthritis in which fresh synovial tissue from RA patients is implanted with normal human cartilage into scid mice either subcutaneously, under the renal capsule (Geiler T., et al., Arthritis &
Rhettntatisnt, 1994, 37, 1664-1671), or into knee joints (Sack U., et al., J. Autoimmurtin~, 1995, 9, 51-58). The implants grow with arthritis-like characteristics, including forma-tion of pannus tissue of high cellular density, hone and cartilage erosion, develop-ment of multinuclear giant cells, and invasion of cartilage by synovial fibroblasts.
Indirect Method: Synoviocytes are transfected in vitro with the thera-peutic gene and transplanted back in rabbits. Arthritis is induced in these rabbits . by injecting IL-1 and expression of the therapeutic gene following activation is assessed. Activation-induced expression of the chimeric gene induces apoptosis in transplanted cells.
Direct Method: Intra-articular injection of the chimeric genes. Any of the gene delivery methods described above, including naked plasmid DNA, cationic liposome-mediated delivery can be used. For use of viral vector-based delivery, chimeric genes are cloned in suitable vectors. The vectors are then modified by deleting eukaryotic promoter present in these vectors. Intra-articular injection of the therapeutic genes inserted in appropriate vectors can then be done to assess therapeutic as well as prophylactic efficacy.

Selection of TNF-a Non-Producer Somatic Celt Variants Cells (TI-iP-l, Jurkat) are stably transfected irr ritrn with TNI'p-AIG
chimeric gene. After several cycles of stimulation, which induces apoptosis in the cells expressing the TNFp-AIG gene, surviving cells are then collected. A cDNA
library from these cells is constructed, which is used for functional cloning (Legerski R and Peterson C., Nature, 1992, 359, 70-73; Jaattela M., et al., Oncogene, 1995, 10, 2297-2305).

Identification and Characterization of Dominant Negative (DN) Genes THP-1 and Jurkat cells stably transfected with TNFp-AIG are subjected to repeated cycles of stimulation to activate expression of TNFp-AIG. The cells, which do not express negative regulatory genes, undergo apoptosis, whereas those expressing dominant negative genes survive. In these surviving cells DN gene products act in-traps with the TNFcx promoter, thereby inhibiting its activations to transcribe AIG, ultimately resulting in survival phenotype. cDNA library is constructed using polyadenylated mRNA from these cells. The DN genes which rescue TNFp-AIG-transfected THP-1 or Jurkat cells from apoptosis are identified by functional cloning as described for other genes (Legerski R. and Peterson C., Nature, 1992, 359, 70-73; Jaattela M., et al., Oncogene, 1995, 10, 2297-2305).

The above description is for the purpose of teaching the person of - ordinary skill in the art how to practice the present invention, and it is not intended to detail all those obvious modifications and variations of it which will ' become apparent to the skilled worker upon reading the description. It is intend-s ed, however, that all such obvious modifications and variations be included within the scope of the present invention, which is defined by the following claims.
The claims are intended to cover the claimed components and steps in any sequence which is effective to meet the objectives there intended. unless the context speci-fically indicates the contrary.
The papers cited herein are expressly incorporated in their entireties by reference.

SEQUENCE LISTING
(1) GENERAL INFORMATION: ' (i) APPLICANTS: Revati J. Tatake, Steven D. Marlin and Randall W. Barton (ii) TITLE OF INVENTION: Self-Regulated Apoptosis o.f Inflammatory Cells by Gene Therapy (iii) NUMBER OF SEQUENCES: 13 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESS: Boehringer Ingelheim Corporation (B) STREET: 900 Ridgebury Road, P.O. Box 3-68 (C) CITY: Ridgefield (D) STATE: Connecticut (E) COUNTRY: United States of America (F) ZIP CODE: 06877-0368 -(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5" 1.44 Mb diskette (B) COMPUTER: IBM PC
(C) OPERATING SYSTEM: MS DOS
(D) SOFTWARE: Word Processing -(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: To be assigned (B) FILING DATE: Herewith (D) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
{A) APPLICATION NUMBER: 60/038,266 (B) FILING DATE: 28-FEB-97 (viii) ATTORNEY INFORMATION:
(A) NAME: Robert P. Raymond (B) REGISTRATION NO.: 25089 (C) REFERENCE/DOCKET NUMBER: 9/121PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE NUMBER: 203-798-4865 (B) TELEFAX NUMBER: 203-791-6183 (2) INFORMATION FOR SEQ ID NO: l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1178 (B) TYPE: nucleic acid (C) STRANDEDNESS : single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
(A) DESCRIPTION:
DNA

(ix) FEATURE:

(A) NAME/KEY:
reference human TNFa promoter (x) PUBLICATION INFORMATION:

(A) AUTHORS:Takashiba, S., et a1.

(C) JOURNAL:Gene (D) VOLUME: 131 (e) PAGES: 307-308 (xi) SEQUENCE :
DESCRIPTION:
SEQ ID NO:

CTGGGGCCCTGAGAAGTGAG AGCTTCATGA A.AA.AAATCAGGGACCCCAGA 350 (3) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1096 ~ (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
(A) DESCRIPTION: DNA
(ix) FEATURE:
(A) NAME/KEY: human TNFa promoter gene {x) PUBLICATION INFORMATION:
(A) AUTHORS: Takashiba, S., et a1.
(C) JOURNAL: Gene -(D) VOLUME: 131 (e) PAGES : 307-308 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

(4) INFORMATION FOR SEQ ID NO: 3: -(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 139 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
{A) DESCRIPTION: DNA
{ix) FEATURE:
(A) NAME/KEY: native minimal TNFa promoter (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

(5) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 904 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (i1) MOLECULE TYPE:
(A) DESCRIPTION: DNA
( ix) FEATURE
(A) NAME/KEY: chimeric gene TNFpl20 AIG.l (D) OTHER INFORMATION: residues 1 to 139 comprise the promoter sequence; residues 140 to 151, the linker sequence, and the remaining residues comprise the AIG.l sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

GAGGGGATCG TTGTAGAAGT CTA.ACTGGAAAACCCAAACT TTTCRTTATT 550 (6) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1490 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
(A) DESCRIPTION: DNA
(ix) FEATURE:
(A) NAME/KEY: chimeric gene TNFp706 AIG.l (D) OTHER INFORMATION: residues 1 to 724 comprise the promoter sequence; residues 725 to 736, the linker sequence, and the remaining residues comprise the AIG.1 sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

TAATTAATAATA.AGAATTTTCATAA.AAGCACTGGAATGAC ATCTCGGTCT 850 ACCTGTTGACCTG~~AAAAA.ATAACAAACTT TTTCAGAGGG GATCGTTGTA 1100 TTATGCACATTCTTACCCGG GCTAACCGAA AGGTGGCAAC AGA.ATTTGAG 1400 TCCTTTTCCTTTGACGCTAC TTTTCATGCA AAGAA.ACAGATTCCATGTAT 1450 (7) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1789 (B) TYPE: nucleic acid -_ (C) STRANDEDNESS: single (D) TOPOLOGY: linear -(ii) MOLECULE TYPE:
(A) DESCRIPTION: DNA
(ix) FEATURE:
(A) NAME/KEY: chimeric gene TNFp1005 AIG.1 (D) OTHER INFORMATION: residues 1 to 1023 comprise the promoter sequence; residues .1024 to 1036, the linker sequence, and the remaining residues comprise the ATG.1 sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

GA.AGACAGGGCCATGTAGAG GGCCCCAGGG AGTGAAAGAG CCTCCAGGAC 200 AAGACCCCCC TCGGA.ATCGGAGCAGGGAGG ATGGGGAGTG TGAGGGGTA'~'800 ATATGA.AGTCAGGAATAAAA ATGATCTTAC ACGTGA.AGAAATTGTGGAAT 1250 ACCTGTTGAC CTGAAAAAAA TAACAA.ACTTTTTCAGAGGG GATCGTTGTA 1400 (8) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1008 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
(A) DESCRIPTION: DNA
(ix) FEATURE:
(A) NAME/KEY: chimeric gene TNFp120 AIG.2 (D) OTHER INFORMATION: residues 1 to 138 comprise the promoter sequence; residues 139 to 150, the linker sequence, and the remaining residues comprise the AIG_2 sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

AGGCAGTTGT TGGCACACCC AGCCAGCAGA GCTCCCTCAG CAGATCCACC 1~0 AGGTGCAARC CGTGGGGAAC TGTGGGTCAG AGACTCTCCF~GCATCCTTGG 700 AAGTGGCCTC TTCACAGTCA TCTGAGAACC TGGAGGAAGF:TGCTGTTTAC 750 (9) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1587 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
(A) DESCRIPTION: DNA
(ix) FEATURE:
(A) NAME/KEY: chimeric gene TNFp706 AIG.2 (D) OTHER INFORMATION: residues 1 to 724 comprise the promoter sequence; residues 725 to 736, the linker sequence, and the remaining residues comprise the AIG.2 sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

A.GAAGA.A.ACCGAGACAGAAG GTGCAGGGCC CACTACCGCT TCCTCCAGAT 600 T'TTCCCCGCCCTCCTCTCGC CCCAGGGACA TATAAAGGCA GTTGTTGGCA 700 T'GAGTCAGCAGAATCTACAG ATGCCCTCAA GCTTTGTCCT CATGAAGAAT 800 T'CCTGAGACTATGTAAAGAA AGAGCTGAAG AGATCTACCC AATAAAGGAG 850 A.GAAACAACCGCACACGCCT GGCTCTCATC ATATGCAATA CAGAGTTTGA 900 T'ACTTGAGGGTCTGGACTAT GTGTAGATGT GAAGAGAATC GACAGCCAGG 1000 A.TATGGAGTCAGCGCTGAGG GCATTTGCTA CCAGACCAGA GCACAAGTCC 1050 C'TGCGGAACTGTGCATGATG AGAAAAAACC AGATGTGCTG CTTTATGACA 1150 CCATCTTCCA GATATTCAAC AACCGCAACT GCCTCAGTCT GAAGGACAA~, 120C>

GTGGGTCAGA GA~TCTCCAG CATCCTTGGA AGTGGCCTCT TCACAGTCAT 1300 T'TCATTGCTTTCTGCTCTTC AACGCCACAC AACGTGTCCT GGAGAGACAG 1400 P,TTCTTGGTGCTGCCACCTA GAGGAAGTAT TTCGGAAGGT ACAGCAATCA 1500 C.'ATGACAAGATATTTCTACC TCTTTCCTGG CAATTGA 1587 f,10 ) INFORMATION FOR SEQ ID NO : 9 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1894 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
(A) DESCRIPTION: DNA
(ix) FEATURE:
(A) NAME/KEY: chimeric gene TNFp1005 AIG.2 (D) OTHER INFORMATION: residues 1 to 1024 comprise the promoter sequence; residues 1025 to 1036, the linker sequence, ~~nd the remaining residues comprise the AIG.2 sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
(3GCGGGGGTCAGGGAGCTCC TGGGAGATAT GGCCACATGT AGCGGCTCTG 50 i~GGAGAATGTCCAGGGCTAT GGAAGTCGAG TATGGGGACC CCCCCTTAAC 150 ~~TCCAGGTATGGAATACAGG GGACGTTTAA GAAGATATGG CCACACACTG 250 iCCTTGGAAGCCAAGACTGAA ACCAGCATTA TGAGTCTCCG GGTCAGAATG 350 ~~AAGAAGAAGGCCTGCCCCA GTGGGGTCTG TGAATTCCCG GGGGTGATTT 400 AAGACCCCCC TCGGAATCGG AGCAGGGAGG ATGGGGAGTG TGAGGGGT'AT 800 AGAAACAACC GCACACGCCT GGCTCTCATC ATATGCAA~A CAGAGTTTGA 1200 CAAGTCCTCT GACAGCACAT TCTTGGTACT CATGTCTCA'~'GGCATCCTGG 1400 (11) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 123 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
(A) DESCRIPTION: DNA
(ix) FEATURE:
(A) NAME/KEY: TNFa promoter enhancer region 1 (ERl) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

(12) INFORMATION FOR SEQ ID NO: 11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 190 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:

(A) DESCRIPTION: DNA

(ix) FEATURE:

(A) NAME/KEY: TNFa promoter enhancer region (ER2) (xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 11 Z'TCCTGAGGC CTCAAGCCTG CCACCAAGCC CCCAGCTCCT 190 (;13) INFORMATION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 223 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE:

(A) DESCRIPTION: DNA

(ix) FEATURE:

(A) NAME/KEY: multiple conling sites (D) OTHER INFORMATION: genetically engineered multiple c:longing sites genetically engineered upstream of the minimal TNFa promoter in the -120pGL3 construct (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:

t~CACCAAGGA AGTTTTCCGC TGGTTGAATG ATTCTTTCCC CGCCCTCCTC 150 'rCGCCCCAGG GACATATAAA GGCAGTTGTT GGCACACCCA GCCAGCAGAC 200 (14) INFORMATION FOR SEQ ID NO: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 787 (B) TYPE: nucleic acid WO 98/37901 PCT/US98/03911 _ (C) STRANDEDNESS:
single (D) TOPOLOGY: -linear (ii) MOLECULE
TYPE:

(A) DESCRIPTION: -DNA

(ix) FEATURE:

(A) NAME/KEY:
TNFa intranslated region (xi) SEQUENCE 13:
DESCRIPTION:
SEQ ID
NO:

TCTAGAGGAGGACGA.ACATC CAACCTTCCC AAACGCCTCC C.CTGCCCCAA 50 TCCCTTTATTACCCCCTCCT TCAGACACCC TCAACCTCTT C_TGGCTCAAA 100 GTAGGAGCTGCCTTGGCTCA GACATGTTTT CCGTGAAAAC GGAGCT1;AAC 600

Claims

-41-1. A chimeric gene comprising at least one TNF.alpha. promoter enhancer attached to a functional copy of a minimal TNF.alpha. promoter and further attached to at least one copy of an apoptosis-inducing gene, wherein the expression of the apoptosis-inducing gene is driven by the TNF.alpha. promoter.
2. A gene according to claim 1 wherein the attachment of the enhancer to the promoter and the promoter to the apoptosis-inducing gene is selected front the group consisting of direct attachment, distal attachment, proximal attachment, and combinations thereof.
3. A gene according to claim 1 comprising 2 or more copies of the TNF.alpha.
promoter enhancer.
4. A gene according to claim 1 wherein the TNF.alpha. promoter enhancer is SEQ
ID
NO: 10 or SEQ ID NO: 11, or functional fragments or variants thereof.
5. A gene according to claim 1 wherein the TNF.alpha. promoter is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and functional fragments or variants thereof.
6. A gene according to claim 1 wherein the apoptosis-inducing gene is selected from the group consisting of caspase-1, caspase-2, caspase-3, caspase-4, caspase-5, caspase-6, caspase-7, caspase-8, caspase-9, caspase-10, Granzyme A, Granzyme B, Fas ligand, and functional fragments, variants, and mixtures of any of these.

7. A gene according to claim 6 wherein the apoptosis-inducing gene is selected from the group consisting of caspase 3, caspase 4, caspase 5, Granzyme B, and functional fragments, variants, and mixtures of any of these.
8. A gene according to claim 1 selected from the group consisting of SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID
NO: 9, and functional fragments or variants thereof.
9. A gene according to claim 1 selected from the group consisting of SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID
NO: 9, and functional fragments or variants thereof, wherein the 3'UTR of the TNF.alpha. gene is ligated downstream of the apotosis-inducing gene.
10. A pharmaceutical composition comprising a gene according to claim 1.
11. A pharmaceutical composition comprising a gene according to claim 9.
12. A method for treating an inflammatory disorder in a patient comprising the step of inducing apoptosis in inflammatory cells or cells at a site of inflammation of the patient by introducing into the cells a chimeric gene according to claim 1.
13. A method according to claim 12 wherein the induction of apoptosis does not induce an inflammatory response in the patient.
14. A method according to claim 12 wherein the inflammatory cell is a TNF.alpha.
producing cell.
15. A method according to claim 12 wherein the inflammatory disorder is selected from the group consisting of rheumatoid arthritis, multiple sclerosis, Guillain-Barre syndrome, Crohn's disease, ulcerative colitis, psoriasis, graft versus host disease, lupus erythematosus, insulin-dependent diabetes mellitus, psoriatic arthritis, sarcoidosis, hypersensitivity pneumonitis, ankylosing spondylitis, Reiter's syndrome, and systemic sclerosis.
16. A method according to claim 15 wherein the inflammatory disorder is rheumatoid arthritis.
17. A chimeric gene comprising 2 to 10 cassettes of a TNF.alpha. promoter enhancer attached to at least one copy of a minimal TNF.alpha. promoter, and at least one copy of an apoptosis-inducing gene selected from the group consisting of caspase 3, caspase 4, caspase 5, Granzyme B and functional fragments, variants, and mixtures of any of these, wherein the expression of the apoptosis-inducing gene is driven by the TNF promoter.
18. A pharmaceutical composition comprising a gene according to claim 17.
19. A method for inducing apoptosis in a TNF.alpha.-producing inflammatory cell by introducing into the cell a chimeric gene according to claim 17.
20. A method for treating an inflammatory disorder in a patient comprising inducing apoptosis in inflammatory cells or cells at the site of inflammation of the patient by introducing into the cells a chimeric gene according to claim 17 without inducing an inflammatory response in the patient.
21. A process for constructing a chimeric gene comprising at least one TNF.alpha.
promoter enhancer attached to a functional copy of a minimal TNF.alpha.
promoter and further attached to at least one copy of an apoptosis-inducing gene, wherein the expression of the apoptosis-inducing gene is driven by the TNF.alpha. promoter comprising the steps of (a) amplifying a TNF.alpha. promoter by a polymerase chain reaction using primers encompassing deletion constructs of the TNF.alpha. promoter;
(b) cloning the PCR-amplified genes obtained in step (a) upstream of a reporter gene;
(c) testing the constructs obtained in step (b) for their constitutive and inducible expression in at least one TNF.alpha.-producing cell line;
(d) selecting TNF.alpha. promoter responsible for inducible expression of the reporter in the cell line; and either (e) PCR-amplifying TNF.alpha. promoter regions that enhance expression of the reporter to obtain an enhancer and ligating at least one copy of the enhancer upstream of the promoter; or (f) inserting at least one copy of a prodomain-deleted apoptosis-inducing gene downstream of the TNF.alpha. promoter by replacing the reporter gene with the apoptosis-inducing gene deletion constructs to obtain a chimeric gene or (g) PCR-amplifying a TNF.alpha.-3'UTR and ligating downstream of the reporter gene, or any combination of these procedures.
22. A process according to claim 21 wherein 2 or more copies of the enhancer are inserted upstream of the promoter.
23. A process according to claim 21 wherein reporter gene is luciferase.
24. A process according to claim 21 wherein the enhancer comprises SEQ ID
NO:10 or SEQ ID NO:11.
25. A process according to claim 21 wherein the prodomain-deleted apoptosis-inducing gene is selected from the group consisting of caspase 3, caspase 4, caspase 5, Granzyme B, and functional fragments and variants thereof.

27. A process according to claim 21 producing a gene selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and functional fragments or variants thereof.
28. A process according to claim 21 wherein the cell lines for testing constructs are selected from the group consisting of T lymphoblastoid, myelomonocytic, monocytic, fibroblast, and cultured human synoviocytes.
29. A chimeric gene comprising:
(a) at least one promoter enhancer attached to a functional copy of a minimal promoter, provided that the promoter is a gene or combination of genes activated in inflammatory cells or in cells at a site of inflammation, and (b) further attached to at least one copy of an apoptosis-inducing gene, wherein the expression of the apoptosis-inducing gene is driven by the promoter, and the promoter is selected from the group consising of cytokines, interleukins and their receptors, cell adhesion molecules and their ligands, chemokines and their receptors, pro-inflammatory enzymes, and mixtures thereof.
31. A gene according to claim 29 wherein the promoter is selected from the group consisting of TNF.beta., IL-1.alpha., IL-1.beta., IL-2, IL-6, IL-8. GM-CSF, interferony, functional fragments and variants thereof, and mixtures of any of these.
32. A gene according to claim 29 wherein the promoter is selected from the group consisting of selectins, integrins, ICAM-1, V-CAM, functional fragments and variants thereof, and mixtures of any of these.
33. A gene according to claim 29 wherein the promoter is selected from the group consisting of MIP-1.alpha., MIP-1.beta., MCP1-4, RANTES, Mig, NAP2, IP10, Gro .alpha.-.gamma., functional fragments and variants thereof, and mixtures of any of these.

34. A gene according to claim 29 wherein the promoter is selected from the group consisting of COX-2, iNOS, phospholipases, proteases, functional fragments and variants thereof, and mixtures of any of these.
35. A gene according to claim 29 wherein the attachment of the enhancer to the promoter and the promoter to the apoptosis-inducing gene is selected from the group consisting of direct attachment, distal attachment, proximal attachment, and combinations thereof.