CA2280001A1 - Polymerases for analyzing or typing polymorphic nucleic acid fragments and uses thereof - Google Patents

Abstract

The present invention provides methods for use in identifying, analyzing and typing polymorphic DNA fragments, particularly minisatellite, microsatellite or STR DNA fragments. In particular, the invention provides methods using DNA polymerases, more particularly thermostable DNA polymerases, and most particularly Thermotoga polymerases or mutants or derivatives thereof, whereby minisatellite, microsatellite or STR DNA molecules may be amplified and analyzed for polymorphisms. The invention also relatesto polymerases having reduced, substantially reduced or eliminated ability to add non-template 3' nucleotides to a synthesized nucleic acid molecule. In accordance with the invention, such reduction or elimination may be accomplished by modifying or mutating the desired polymerase.

Description

Polymerises for Analyzing or Typing Polymorphic Nucleic Acid Fragments and Uses Thereof FIELD OF THE INVENTION
The present invention is in the field of molecular and cellular biology. The invention relates to compositions and methods for use in analyzing and typing polymorphic regions of DNA. More particularly, the invention is directed to compositions of polymerises (preferably DNA polymerises and most preferably thermostableDNApolymerases), and methodsusingthesecornpositions, whereby polymorphic, minisatellite, microsatellite or STRDNAfi~agments maybe amplified and analyzed. The; compositions and methods of the present invention are usefi~l in a variety of techniques employing DNA amplification and polymorphism analysis, including; medical genetic, forensic, and plant breeding applications.
The present invention also relates to polymerises having reduced, substantially reduced or eliminated ability to add one or more non-templated nucleotides to the 3' terminus of a synthesized nucleic acid molecule.
Preferably, the polymerises of the invention are thermostable or mesophilic polymerises.
Specifically, the polymerises of the present invention (e.g., DNA or RNA
polymerises) have been mutated or modified to reduce, substantially reduce or eliminate such activity (campared to the unmodified, unmutated, or wild type polymerise), thereby providing a polymerise which synthesizes nucleic acid molecules having; little or no non-templated 3' terminal nucleotides. Such polymerises thus have enhanced or greater ability to produce a double stranded nucleic acid molecule having blunt ended termini which may facilitate cloning of such molecules. The present invention also relates to cloning and expression ofthe polymerises of the invention, to nucleic acid molecules containing the cloned genes, and to host: cells which express said genes. The polymerises of the present invention may be used in DNA sequencing, amplificaxion, nucleic acid synthesis, and polymorphism analysis.
The invention also relates to polymerises of the invention which have one or more addition~a mutations or modifications. Such mutations or modifications wo ~soso PCT/US98J02791 include those which ( 1 ) substantially reduce 3'-~ 5' exonuclease activity;
and/or (2) substantially reduce 5'--~3' exonuclease activity. The polymerises ofthe invention can have one or more of these properties. These polymerises may also be used in nucleic acid analysis including but not limited to DNA sequencing, S amplification, nucleic acid synthesis, and polymorphism analysis.
BACKGROUND OF THE INVENTION
DNA Structure The genetic framework (i.e., the genome) of an organism is encoded in the double-stranded sequence ofnucleotide bases in the deoxyribonucleic acid (DNA) which is contained in the somatic and germ cells of the organism. The genetic content of a particular segment of DNA, or gene, is only manifested upon production of the protein which the gene ultimately encodes. There are additional sequences in the genome that do not encode a protein (i.e., "noncoding"
regions) which may serve a structural, regulatory, or unknown function. Thus, the genome of an organism or cell is the complete collection of protein-encoding genes together with intervening noncoding DNA sequences. Importantly, each somatic cell of a multicellular organism contains the full complement of genomic DNA
of the organism, except in cases of focal infections or cancers, where one or more xenogeneic DNA sequences may be inserted into the genomic DNA of specific cells and not into other, non-infected, cells in the organism.
MinisateUite and Microsatellite DNA
Interspersed throughout the genomic DNA of most eukaryotic organisms are short stretches of polymorphic repetitive nucleotide sequences known as "minisatellite DNA" sequences or fragments (Jeffreys, A.J., et al., Nature 314:67- , 73 (1985)). These repeating sequences often appear in tandem and in variable numbers within the genome, and they are thus sometimes referred to as "short tandem repeats" ("STRs") or "variable numbers of tandem repeats" ("VNTRs") (see U.S. Patent No. 5,075,217; Nakamura et al., Science 235:161b-1622 (1987)). Typically, however, minisatellite repeat units are about 9 to 60 bases in length (Nakamura et al., Science 235:1616-1622 (1987); Weber and May, Am. J.
Hum. Genet. 44:388-396 ( 1989)) which are repeated in tandem about 20-SO times (Watson, J.D., et al., eds., Recombinant DNA, 2nd ed., New York: Scientific American Books., p. 146 (1992)). Other short, simple sequences which are analogous to minisatellite DNAs, termed "microsatellite DNAs" (Lift, M., and Luty, J.A., Am. J. Hum. Genet 44:397-401 (1989); Weber and May, Am. J. Hum.
Genet. 44:388-396 (1989)), are usually about 1-6 bases in repeat unit length and thus give rise to monomeric (Economou, E.T., et al., Proc. Natl. Acad Sci. USA
87:2951-2954 (1990)), dirneric, trimeric, quatrameric, pentameric or hexameric repeat units (Lift, M., and Luty, J.A., Am. J. Hum. Genet 44:397-401 (1989);
Weber and May, .Am. J. Hum. Genet. 44:388-396 (1989)). The most prevalent of these highly polymorphic microsatellite sequences in the human genome is the dinucleotide repeat (dC-dA)~~(dG-dT)" (where n is the number of repetitions in a given stretch of nucleotides), which is present in a copy number of about 50,000-100,000 ('Tautz, D., and Renz, M., Nucl. AcidsRes. 12:4127-413 8 ( 1984);
Dib, C., et al., Nature 360:152-154 (1996)), although the existence of a variety of analogous repeat sequences in the genomes of evolutionarily diverse eukaryotes has been reported (Hamada, H., et al., Proc. Natl. Acad, Sci. USA 79:6465-6469 (1982)).
The actual in vivo function of minisatellite and microsatellite sequences is unknown. However, because these tandemly repeated sequences are dispersed throughout the genome of most eukaryotes, exhibit size polymorphism, and are often heterozygous (Weber, J.L., Genomics 7:524-530 {1990)), they have been explored as potential genetic markers in assays attempting to distinguish closely related individuals, and in forensic and paternity testing (see, e.g., U. S.
Patent No.
5,075,217; Jeffreys, A.J., et al., Nature 332:278-281 (1988)). The finding that mutations often are observed in microsatellite DNA regions in cancer cells (Loeb, L.A., Cancer Res. 54:5059-5063 ( 1994)), potentially linking genomic instability _ø-to the carcinogenic process and providing useful genetic markers of cancer, lends additional significance to methods facilitating the rapid analysis and genotyping of polymorphisms in these genomic DNA regions.
Methods of Genotyping Minisatellite or STR DNA Sequences To analyze minisateUite, microsatellite or STR DNA sequence polymorphisms, a variety of molecular biological techniques have been employed.
These techniques include restriction fragment length polymorphism (ItFL,P) or "DNA fingerprinting" analysis (along, Z., et al., Nucl. Acids Res 14:4605-4616 (1986); along, Z., et al., Ann. Hum. Genet 51:269-288 (1987); Jeffreys, A.J., et al., Nature 332:278-281 (1988); U.S. Patent Nos. 5,175,082; 5,413,908;
5,459,039; and 5,556,955). Far more commonly employed for STR genotyping than RFLP and hybridization, however, are amplification-based methods, such as those relying on the polymerise chain reaction (PCR) method invented by Mullis and colleagues (see U.S. Patent Nos. 4,683,195; 4,683,202; and 4,800,159).
These methods use "primer" sequences which are complementary to opposing regions flanking the polymorphic DNA sequence to be amplified from the sample of genomic DNA to be analyzed. These primers are added to the DNA target sample, along with excess deoxynucleotides and a DNA polymerise (e.g., Taq polymerise; see below), and the primers bind to their target via base-specific binding interactions (i.e., adenine binds to thymine, cytosine to guanine). By repeatedly passing the reaction mixture through cycles of increasing and decreasing temperatures (to allow dissociation of the two DNA strands on the target sequence, synthesis of complementary copies of each strand by the polymerise, and re-annea;ng of she new comx. -.ntary strands), the copy rsumber of the minisatellite. or STR sequence of D~: nay be rapidly increased, and detected by size separation methods such as gel electrophoresis.
PCR and related amplification approaches have been used in attempts to develop methods for typing and analyzing STRs or minisaiellite regions. For example, PCR has been employed to analyze polymorphisms in microsatellite sequences from different individuals, including (dC-dA)n~(dG-dT)n (Weber, J.L, and May, P.E., Am. J. Hum. Genet. 44:388-396 (1989); Weber, J. L., Genomics 7:524-530 (1990); U.S. Patent Nos. 5,075,217; 5,369,004; and 5,468,613).
Similar methods have been applied to a variety of medical and forensic samples to perform DNA typing and to detect polymorphisms between individual samples (U.S. Patem Nos. 5,306,616; 5,364,759; 5,378,602; and 5,468,610).
In Vitro Use of nNA Polymerises The above-described amplification-based techniques require the use of DNA polymerises, which catalyze the addition of deoxynucleoside triphosphate (dNTP) bases into the newly forming DNA strands. Together with other enzymes (e.g., helicases, ligases and ATPases), the DNA polymerises ensure rapid and relatively faithful replication of DNA in preparation for proliferation in vivo in prokaryotes, eukaryotes and viruses.
DNA polymerises synthesize the formation of DNA molecules which are complementary to a DNA template. Upon hybridization of a primer to the single-stranded DNA template, polymerises synthesize DNA in the 5' to 3' direction, successively addling nucleotides to the 3'-hydroxyl group of the growing strand.
Thus, in the presence of deoxyribonucleoside triphosphates (dNTPs) and a primer, a new DNA molecule, complementary to the single stranded DNA template, can be synthesized.
In addition to an activity which adds dNTPs to DNA in the 5' to 3' direction (i.e., "polymerise" activity), many DNA polymerises also possess activities which remove dNTPs in the 5' to~ 3' and/or the 3' to 5' direction (i.e., "exonuclease" ac;tivity). This dual activity of certain DNA polymerises is, however, a drawback for some in vitro applications. For example, the in vitro synthesis of an intact copy of a DNA fragment by the polymerise activity, an elongation process which proceeds in a 5' to 3' direction along the template DNA
strand, is jeopardized by the exonuclease activities which may simultaneously or subsequently degrade the newly formed DNA.

Limitations of PCR-based Genotyping of MinisateUite, MicrosateUite and STR DNA Sequences Application of PCR-based methods to analysis of minisatellite or STR
DNA sequences has a number of significant limitations. It has been shown, for example, that use of Taq and other thermostable DNA polymerises commonly employed in PCR and related automated amplification methods causes the accumulation of amplification products containing non-templated 3' terminal nucleotides (Clark, J.M., etal., J. Molec. Biol. 198:123-127 (1987); Clark, J.M., Nucl. Acids Res. 16:9677-9686 (1988); Hu, G., DNA Cell Biol. 12:763-770 (1993)). That is, some ofthe newly synthesized DNA strands produced in each round of amplification have had an extra nucleotide added to their 3' tenmini, such that the newly synthesized strands may be longer by one base.
Non-templated nucleotide addition is a slow process compared to template-directed synthesis (Clark, J.M., Nucl. AcidsRes. 16:9677-9686 (1988)), and its extent is sequence-dependent (Hu, G., DNA CellBiol. 12:763-770 (1993);
Brownstein, M.J., et al., BioTechniques 20:1004-1010 (1996)). Consequently, the PCR product is often heterogeneous in regard to extra nucleotide addition depending upon the primers and the reaction conditions used by the investigator (Magnuson, V.L., et al., BioTechniques 21:700-709 (1996)). Extra nucleotide addition, in combination with "stutter" due to slippage during PCR
amplification (Levinson, G., and Gutman, G.A., Molec. Biol. Evol. 4:203-221 (1987);
Schlotterer, C., and Tautz, D., Nucl. AcidsRes. 20:211-215 (1992)), often results in complex DNA fragment patterns which are dii~tcult to interpret, especially by automated methods. This can result in improper genotyping analysis, particularly if the percentage of non-templated nucleotide addition is between 30-70% of the PCR product (Smith, J.R., et al., Genome Res. 5:312-317 (1995)).
Thus, a need currently exists for a rapid, automated method for identifying, analyzing and typing polymorphic DNA fragments, particularly nunisatellite, microsatellite or STR DNA fragments, that will not result in the problematic results described above. The present invention provides such a method.

WO ~~ PCT/US98/02791 _7_ BRIEF SUMMARY OF THE INVENTION
The present invention satisfies these needs in the art by providing methods useful in the identification, analysis or typing of polymorphic DNA fragments, particularly minisatellite, microsatellite or STR DNA fragments, in samples of DNA from a cell, particularly a eukaryotic cell. Specifically, the invention provides a method of producing a population of amplified DNA molecules, for use in analyzing or typing a DNA molecule in a DNA sample isolated from a cell, preferably a eukaryotic cell. The method of the present invention comprises contacting a DNA sample with a DNA polymerise (preferably a thermostable DNA polymerise:>) reduced, substantially reduced or eliminated in the ability to add one or more non-templated nucleotides to the 3' terminus of a DNA
molecule, amplifying a polymorphic DNA fragment, preferably a minisatellite, microsatellite or STR DNA fragment, within the DNA sample and analyzing the amplified polymorphic DNA fragment. In the method of the invention, the analysis step may comprise, far example, sizing or sequencing the amplified DNA molecule and optionally comparing the size and/or sequence of the amplified DNA molecule to a different DNA sample which has been amplified according to the invention. In preferred embodiments of the present invention, the thermostable DNA
polymerise is a T~ermotoga DNA polymerise, preferably a Thermotoga DNA
polymerise substantially reduced in 3'-5' exonuclease activity, more preferably a Tne polymerise, a Tma polymerise, or a mutant or derivative thereof, and most preferably a mutant of Tne polymerise selected from the group consisting of Tne N'0219, D32:3A; Tne N'~283, D323A; Tne N'~284, D323A; Tne N'0193, D323A; Tne D13',~A, D323A; Tne D8A, D323A; Tne G195D, D323A; Tne G37D, D323A; TneN'0283; Tne D137A, D323A, R722K; Tne D137A, D323A, R722Y;
Tne D137A, D323A, R722L; Tne D137A, D323A, R722H; Tne D137A, D323A, R722Q; Tne D13'7A, D323A, F730Y; Tne D137A, D323A, K726R; Tne D137A, D323A, K726H; Tne D137A, D323A, R722K, F730Y; Tne D137A, D323A, R722K, K726R; Tne D137A, D323A, R722K, K726H; Tne D137A, D323A, WO 98135060 PGT/US98ro2791 _g_ R722H, F730Y; Tne D137A, D323A, R722H, K726R; Tne D137A, D323A, R722H, K726H; Tne D137A, D323A, R722Q, F730Y; Tne D137A, D323A, R722Q, K726R; Tne D137A, D323A, R722Q, K726H; Tne D137A, D323A, R722N, F730Y; Tne D137A, D323A, R722N, K726R; Tne D137A, D323A, , R722N, K726H; Tne D137A, D323A, F730S; Tne N'L~283, D323A, R722K/H/Q/N/Y/L; Tne N'0219, D323A, R722K; Tne N'0219, D323A, F730Y;
Tne N'0219, D323A, K726R; TneN'0219, D323A, K726H; Tne D137A, D323A, F730S, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, F730T, R722K/Y/Q!N/li/L, K726R/H; Tne D137A, D323A, F730T; Tne F730S; Tne F730A; Tne K726R; Tne K726H; and Tne D137A, D323A, R722N. The present invention is particularly directed to the above methods wherein the eukaryotic cell is an plant cell or an animal cell, preferably a mammalian cell, more preferably a normal, diseased, cancerous, fetal or embryonic mammalian cell, and most preferably a human cell. The invention is also directed to the above methods, further comprising isolating the polymorphic, minisatellite, microsatellite or STR
DNA fragment and inserting it into a vector, preferably an expression vector.
By the present methods, the polymorphic or microsatellite DNA fragment may be amplified prior to being inserted into the vector.
The present invention also provides a method of determining the relationship between a first individual and a second individual, comprising contacting a DNA sample from the first and second individuals with a DNA
polymerise (e.g. a thermostable DNA polymerise) reduced, substantially reduced or eliminated in the ability to add one or more non-templated nucleotides to the 3' terminus of a DNA molecule, amplifying one or more DNA molecules in the DNA sample to generate a c:~llection c~F amplified poIymorphic DNA fragments, separating the amplified DNA fragm- .~ by length, and comparing the pattern of amplified DNA fragments from the first individual to that of the second individual.
This method also allows the identification of one or more unique polymorphic DNA fragments, particularly a minisatellite, microsatellite or STR DNA
fragment, -that is specifically present in only one of the two individuals. This method may WO 9~~ PGT/ITS98/02791 further comprise determining the sequence of the unique polymorphic, minisatellite, microsatellite or STR DNA fragment. In this embodiment of the present invention, the thermostable DNA polymerise may be a Thermotoga DNA
polymerise, preferably a Thermotoga DNA polymerise substantially reduced in 3'-5' exonuclease activity, more preferably a Tne polymerise, a Tma polymerise, or a mutant or derivative thereof, and most preferably a mutant of Tne polymerise selected from the soup consisting of T»e N'~219, D323A; Tne N~283, D323A;
Tne N'0284, D32 3A; Tne N'0193, D323A; Tne D137A, D323A; Tne D8A, D323A; Tne G195D, D323A; Tne G37D, D323A; Tne N~283; Tne D137A, D323A, R722K; Tne D137A, D323A, R722Y; Tne D137A, D323A, R722L;
Tne D137A, D323A, R722H; Tne D137A, D323A, R722Q; Tne DI37A, D323A, F730Y; Tne D137A, D323A, K726R; Tne D137A, D323A, K726H; Tne DI37A, D323A, R722K, F730Y; Tne D137A, D323A, R722K, K726R; Tne D137A, D323A, R722K, K726H; Tne D137A, D323A, R722H, F730Y; Tne D137A, D323A, R722H, :K726R; Tne D137A, D323A, R722H, K726H; Tne D137A, D323A, R722Q, F730Y; Tne D137A, D323A, R722Q, K726R; Tne D137A, D323A, R722Q, K726H; Tne D137A, D323A, R722N, F730Y; Tne D137A, D323A, R722N, K726R; Tne D137A, D323A, R722N, K726H; Tne D137A, D323A, F730S; Tne N~283, D323A, R722K1H/Q/N/Y/L; Tne N'0219, D323A, R722K; Tne N~219, D323A, F730Y; Tne N'0219, D323A, K726R; Tne N'~219, D323A, K726H;1 ne D 137A, D323A, F730S, R722K/Y/Q!N/FUL, K726R/H; Tne D137A, D323A, F730T, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, F730T; Tne F730S; Tne F730A; Tne K726R; Tne K726H; and Tne D137A, D323A, R722N. The present invention is particularly directed to the above methods wherein the first or second individual is an animal or a plant, and most preferably wherein the first or second individual is a human.
The presE;nt invention also provides isolated nucleic acid molecules encoding mutant Tne DNA polymerise proteins, wherein the mutant Tne DNA
polymerise proteins have an amino acid sequence as set forth in any one of SEQ
ID NOs: 4-10. The invention also provides mutant Tne DNA polymerise proteins having an amino acid sequence as set forth in any one of SEQ )D NOs:4-10, most preferably a mutant Tne polymerise protein selected from the group consisting of Tne N'0283, D323A (SEQ D7 N0:4); Tne N'0193, D323A (SEQ ID NO:S);
Tne D137A, D323A (SEQ m N0:6); Tne D8A, D323A (SEQ m N0:7);
Tne G195D, D323A (SEQ lI7 N0:8); Tne G37D, D323A (SEQ m N0:9}; and Tne N'0283 (SEQ ID NO:10). The invention also relates to nucleic acid molecules and the proteins encoded by such nucleic acid molecules for mutant Tne polymerises selected from the group consisting of Tne n'~283; Tne D137A, D323A, R722K; Tne D137A, D323A, R722Y; Tne D137A, D323A, R722L;
Tne D137A, D323A, R722H; Tne D137A, D323A, R722Q; Tire D 137A, D323A, F730Y; Tne D137A, D323A, K726R; Tne D137A, D323A, K726H;
Tne D137A, D323A, R722K, F730Y; Tne D137A, D323A, R722K, K726R; Tne D137A, D323A, R722K, K726H; Tne D137A, D323A, R722H, F730Y; Tne D137A, D323A, R722H, K726R; Tne D137A, D323A, R722H, K726H; Tne D137A, D323A, R722Q, F730Y; Tne D137A, D323A, R722Q, K726R;Tne DI37A, D323A, R722Q, K726H; Tne D137A, D323A, R722N, F730Y; Tne D137A, D323A, R722N, K726R; Tne D137A, D323A, R722N, K726H; Tne D137A, D323A, F730S; Tne N'0283, D323A, R722K/H/Q/N/Y/L; Tne N'0219, D323~
R722K; Tne N'0219, D323A, F730Y; Tne N'0219, D323A, K726R; Tne N'0219, D323A, K726H; Tne D 137A, D323A, F730S, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, F730T, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, F730T; Tne F730S; Tne F730A; Tne K726R; Tne K726H; and Tne D 137A, D323A, R722N. These mutations may be made to sequence ID N0:2 to produce the mutant polymerises having the indicated amino acid mutations (where, for example, "D137A" indicates that the Asp (D} residue at position I37 in SEQ 117 N0:2 has been mutates: to an Ala (A) residue, and, for example-"R722K1Y/Q/N/H/L" indicates that the Arg (R) residue at position 722 in SEQ m N0:2 has been mutated to a Lys (K), Tyr (Y), Gln (Q}, Asn (1~, His (H) or Leu (L) residue).

wo ~soso rc~rrtrs~ozrm The present invention also provides kits for the identification, analysis or typing of a poiymorphic DNA fragment, particularly a minisatellite, microsatellite or STR DNA fragment, comprising a first container containing one or more DNA
polymerises reduced, substantially reduced or eliminated in the ability to add non-templated 3' terminal nucleotides. Kits according to the invention may contain additional containers selected from the group consisting of a container containing one or more DrfA primer molecules, a container containing one or more deoxynucleoside triphosphates needed to synthesize a DNA molecule complementary to the DNA template, and a container containing a buffer suitable for identifying, analyzing or typing a polymorphic DNA fragment by the methods of the invention. E~ny number of these components of the kit may be combined in a single or multiple containers to provide the kit of the invention. According to the invention, the DNA polymerise of the kit is preferably a Thermotoga DNA
polymerise, more preferably a Thermotoga DNA polymerise substantially reduced in 3'-5' exonuclea.se activity, still more preferably a Tne polymerise, a Tma polymerise, or a mutant or derivative thereof, and most preferably a mutant of Tne polymerise selected from the group consisting of Tne N'0283; Tne D137A, D323A, R722K; .Tne D137A, D323A, R722Y; Tne D137A, D323A, R722L;
Tne D137A, D323A, R722H; Tne D137A, D323A, R722Q; Tne D137A., D323A, F730Y; Tne D137.A, D323A, K726R; Tne D137A, D323A, K726H; Tne D137A, D323A, R722K, ~F730Y; Tne D137A, D323A, R722K, Tne D137A, K726R;

D323A, R722K, K726H; Tne D137A, D323A, R722H, Tne D137A, F730Y;

D323A, R722H, ~K726R; Tne D137A, D323A, R722H, Tne D137A, K726H;

D323A, R722Q, F730Y; Tne D137A, D323A, R722Q, Tne D137A, K726R;

D323A, R722Q, :K726H; Tne D137A, D323A, R722N, Tne D137A, F730Y;

D323A, R722N, ;K726R; Tne D137A, D323A, R722N, K726H; Tne D137A, D323A, F730S; Tine N'~283, D323A, R722K/H/Q/N/Y/L; Tne N'0219, D323A, R722K; TneN'~219, D323A, F730Y; TneN'~219, D323A, K726R; Tne N'0219, D323A, K726H; Tne D 137A, D323A, F730S, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, 1F730T, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, WO ~~ PCT/US98/02791 F730T; Tne F730S; Tne F730A; Tne K726R; Tne K726H; and Tne D137A, D323A, R722N.
The present invention also relates generally to mutated or modified polymerises (DNA or RNA polymerises) which have reduced, substantially reduced or eliminated ability to add one or more non templated nucleotides to the 3' terminus of a synthesized nucleic acid molecule (compared to the corresponding wiidtype, unmutated or unmodified polymerise). Preferably, such mutant or modified polymerises have substantially reduced ability to add one or more non-templated nucleotides to the 3' terminus of a synthesized nucleic acid molecule.
Such polymerises of the invention may be thermostable or mesophilic polymerises. Thus, the present invention relates to such mutated or modified polymerises and to kits containing such polymerises. The invention also relates to the use of such mutant or modified polymerises in a number of procedures including DNA sequencing, amplification reactions, nucleic acid synthesis, and polymorphism analysis.
Mutant or modified polymerises of particular interest in the invention include Taq DNA polymerise, Tne DNA polymerise, Tma DNA polymerise, Pfu DNA polymerise, Tfl DNA polymerise, Tth DNA polymerise, Tbr DNA
polymerise, Pwo DNA polymerise, Bst DNA polymerise, Bca DNA polymerise, VENTT"" DNA polymerise, DEEP VEN'fr"" DNA polymerise, T7 DNA
polymerise, TS DNA polymerise, DNA polymerise III, Klenow fragment DNA
polymerise, Stoffel fragment DNA polymerise, and mutants, fragments or derivatives thereof. RNA polymerises of interest include T7, SP6, and T3 RNA
polymerises and mutants, variants and derivatives thereof.
The present invention relates in particular to mutant PoII type DNA
polymerises (preferably thermostable DNA polymerises) wherein one or more mutations have been made in the O-helix which reduces, substantially reduces or eliminates the ability of the enzyme to add one or more non-templated nucleotides to the 3' terminus of a synthesized nucleic acid molecule. The O-helix is defined as R~O~XI~3~~YX (SEQ ID NO:11 ), wherein X may be any amino acid.

wo ~so6o pc-rrtrs9srozm The preferred sites for mutation or modification to produce the polymerises of the invention are the :R and/or F and/or K and/or Y positions in the O-helix, although other changes (or combinations thereof) within the O-helix may be made to make the desired poiyrnerase. In this preferred aspect of the invention, R and/or F
and/or K and/or Y may be replaced with any other amino acid including Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, Ids, De, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr and Val.
In accordance with the invention, other functional changes (or combinations thereof) may be made to the polymerises having reduced ability to add non-templated nucleotides to the 3' terminus of a synthesized nucleic acid molecule. For example, the polymerise may also be modified to reduce, substantially reduce or eliminate 5' exonuclease activity, and/or 3' exonuclease activity. Thus, the invention relates to mutant or modified DNA polymerises having reduced ability to add non-tempiated nucleotides which are modified in at least one way selected from the group consisting of (a) to reduce or eliminate the 3'-5' exonuclease activity of the polymerise;
(b) to reduce or eliminate the 5'-3' exonuclease activity of the polymerise;
Any one or a number of these mutations or modifications (or combinations thereof) may be :made to provide the polymerises of the invention. Preferred polymerises of t:he invention, in addition to having reduced ability to add non-templated 3' nucleotides, also have reduced, substantially reduced or eliminated 3' exonuclease activity.
The present invention is also directed to nucleic acid molecules (preferably vectors) containing a gene encoding the mutant or modified polymerises of the present invention and to host cells containing such molecules. Any number of hosts may be used to express the gene of interest, including prokaryotic and _ eukaryotic cells. :Preferably, prokaryotic cells are used to express the polymerises of the invention. The preferred prokaryotic host according to the present invention is E. coli.
The invention also relates to a method of producing the polymerises of the invention, said method comprising:
(a) culturing the host cell comprising a gene encoding a polymerise of the invention;
(b) expressing said gene; and (c) isolating said polymerise from said host cell.
The invention also relates to a method of synthesizing a nucleic acid molecule comprising:
(a) mixing one or more nucleic acid templates (e.g. RNA or DNA) with one or more polymerises of the invention; and (b) incubating said mixture under conditions sufficient to synthesize nucleic acid molecules complementary to all or a portion of said templates.
Such condition may include incubation with one or more deoxy- and/or dideoxyribonucleoside triphosphates. Such deoxy- and dideoxyribonucleoside triphosphates include dATP, dCTP, dGTP, dTTP, dITP, 7-deaza-dGTP, 7-deaza-dATP, dUTP, ddATP, ddCTP, ddGTP, ddITP, ddT"TP, [a-S]dATP, [a-S]dTTP, [a-S]dGTP, and [a-S]dCTP. The synthesized nucleic acid molecules may in accordance with the invention be cloned into one or more vectors.
The invention also relates to a method of sequencing a DNA molecule, comprising:
(a) hybridizing a primer to a first DNA molecule;
(b) contacting said molecule of step (a) with deoxyribonucleoside triphosphates, one or more DNA polymerises of the invention, and one or more terminator nucleotides;
(c) incubating the mixture of step (b) under conditions sufficient to synthesize a random population of DNA molecules complementary to said first DNA molecule, wherein said synthesized DNA molecules are shorter in length WO 98/35060 PCTlUS98102791 than said first DNA molecule and wherein said synthesized DNA molecules comprise a terminator nucleotide at their 3' termini; and (d) separating said synthesized DNA molecules by size so that at least a part of the nucleotide sequence of said first DNA molecule can be determined.
Such terminator nucleotides include but are not limited to dideoxyribonucleoside triphosphates such as ddTTP, ddATP, ddGTP, ddITP or ddCTP.
The invention also relates to a method for amplifying a double stranded DNA molecule, comprising:
(a) providing a first and second primer, wherein said first primer is complementary to a sequence at or near the 3'-termini of the first strand of said DNA molecule and said second primer is complementary to a sequence at or near the 3'-termini of the second strand of said DNA molecule;
(b) hybridizing said first primer to said first strand and said second primer to said second strand in the presence of one or more polymerises of the invention, under conditions such that a third DNA molecule complementary to said first strand and a fourth DNA molecule complementary to said second strand are synthesized;
(c) denaturing said first and third strands, and said second and fourth strands; and (d) repeating steps (a) to (c) one or more times. The amplified double-stranded nucleic acid molecules produced by the method of the invention may be cloned into one or' more vectors. Thus, the invention relates also to a method of cloning an amplified DNA molecule comprising:
(a) amplifying one or more DNA molecules with one or more polymerises of the invention; and (b) ligating said amplified DNA molecules in one or more vectors.
The invention further relates to a method of cloning a nucleic acid molecule comprising:
(a) miring a nucleic acid template (or one or more templates) with one or more polyrnerases of the invention;

(b) incubating said mixture under conditions sufficient to synthesize a nucleic acid molecule complementary to all or a portion of said template, thereby producing a double-stranded nucleic acid molecule (preferably a double-stranded DNA molecule); and (c) ligating said double-stranded nucleic acid molecule into one or more vectors.
Preferably, the vectors used for ligating the amplified or synthesized double-stranded nucleic acid molecules have blunt ended termini and may be prepared by digesting a vector with any one or a number of restriction enzymes known in the art which provide blunt end cleavage. Such restriction enzymes include ScaI, SmaI, HpaI, HincII, HaeIII, AIuI, and the like.
The invention also relates to kits for sequencing, amplifying, synthesizing or cloning of nucleic acid molecules comprising one or more polymerases of the invention and one or more other components (or combinations thereof) selected from the group consisting of (a) one or more dideoxyribonucleoside triphosphates;
(b) one or more deoxyribonucleoside triphosphates;
{c) one or more primers;
(d) one or more suitable buffers; and (e) one or more ligases.
Other preferred embodiments of the present invention will be apparent to one of ordinary skill in light of the following drawings and description of the invention, and of the claims.
BRIEF DESCRIPTION OF THE FIGURES
FIGURE 1 shows the restriction map of the approximate DNA fragment which contains the Tne DNA polymerase gene in pSport 1 and pUC 19. This figure also shows the region containing the O-helix homologous sequences.

wo ~so6o rcrrtrs9srozm FIGURE 2A schematically depicts the construction of plasmids pUC-Tne (3'--~5') and pUC-Tne FY.
FIGURE 2B schematically depicts the construction of plasmids pTrcTne35 and p'TrcTne FY.
FIGURE 3 schematically depicts the construction of plasmid pTrcTne35 FY.
FIGURE 4 schematically depicts the construction of plasmids pTTQTneSFY and pTTQTne535FY.
FIGURE 5 depicts a plasmid containing the Taq DNA polymerise gene.
FIGURE 6 depicts an autoradiogram showing of the ability of polymerise mutants to add non-templated 3' nucleotides.
FIGURE 7 is an autoradiogram ofthe product ofPCR amplification ofthe upper and lower ~~lleles of the CD4 locus, using primers corresponding to these alleles, demonstrating nontemplated nucleotide addition (n+1) by Taq DNA
polymerise but not by Tne DNA polymerise.
FIGURE 8 is an autoradiogram ofthe product ofPCR amplification ofthe upper and lower alleles ofthe D20S27 locus, using primers corresponding to these alleles, demonstrating nontemplated nucleotide addition (n+1 ) by Taq DNA
polymerise but not by Tne DNA polymerise.
FIGURE 9 is a composite of electropherogram gel scans of PCR
amplifications at the D15S153 (Figures 9A and 9B) and D15S127 loci (Figures 9C and 9D), demonstrating nontemplated nucleotide addition (n+1 ) by Taq DNA

polymerise (Figures 9A and 9C) but not by Tne DNA polymerise (Figures 9B and 9D).
FIGURE l0A and B are composites of a electropherogam gel scan of PCR amplifications at D16S405 and D16S401 loci.
FIGURE 11 is a composite of a electropherogam gel scan of PCR
amplifications at D16S401 locus.
FIGURE 12A and B are composites of a electropherogam gel scan of PCR. amplifications at D 15 S 127 and D 15 S 153 Loci.
FIGURE 13 is a composite of a electropherogram gel scan of PCR
amplifications at D16S401 locus.
DETAILED DESCRIPTION OF THE INVENTION
Definitions In the description that follows, a number of terms used in recombinant DNA technology are extensively utilized. In order to provide a clearer and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided.
Polyraorphic. As is understood by one of ordinary skill in the art, a nucleic acid molecule is said to be "polymorphi~:." if it may exist in more than one form. For example, a nucleic acid molecule is said to be polymorphic if it may have more than one specific nucleotide sequence (such as degenerate nucleic acid molecules or genes that~may each encode the same protein). More commonly, a nucleic acid molecule is said to be polymorphic if it displays size differences (i.e., differences in length), particularly when comparisons of nucleic acid molecules wo so6o pcr~rs~am from different individuals are made. Of course, other definitions of the term "polymorphic" wiill be apparent to one of ordinary skill and are also encompassed within this definition.
Cloning vector. A plasmid, cosmid or phage DNA or other DNA
molecule which is able to replicate autonomously in a host cell, and which is characterized by one or a small number of restriction endonuclease recognition sites at which such DNA sequences may be cut in a determinable fashion without loss of an essential biological function of the vector, and into which DNA may be spliced in order to bring about its replication and cloning. The cloning vector may further contain a marker suitable for use in the identification of cells transformed with the cloning vector. Markers, for example, are tetracycline resistance or ampicillin resistance.
Recombinant host. Any prokaryotic or eukaryotic microorganism which contains the desired cloned genes in an expression vector, cloning vector or any DNA molecule. 'The term "recombinant host" is also meant to include those host cells which have been genetically engineered to contain the desired gene on the host chromosome or genome.
Host. Any prokaryotic or eukaryotic microorganism that is the recipient of a replicable expression vector, cloning vector or any DNA molecule. The DNA
molecule may contain, but is not limited to, a structural gene, a promoter and/or an origin of replication.
Promoter. A DNA sequence generally described as the 5' region of a gene, located proximal to the start codon. At the promoter region, transcription of an adjacent genes) is initiated.
Gene. A DNA sequence that contains information necessary for expression of a polypeptide or protein. It includes the promoter and the structural gene as well as other sequences involved in expression of the protein.
Structural gene. A DNA sequence that is transcribed into messenger RNA that is then translated into a sequence of anvno acids characteristic of a specific polypeptide.

WO 98/35060 PCT/US98~2'191 Operably linked. As used herein "operably linked" means that the promoter is positioned to control the initiation of expression of the polypeptide encoded by the structural gene.
Expression. Expression is the process by which a gene produces a poIypeptide. It includes transcription of the gene into messenger RNA (mRNA) and the translation of such mRNA into polypeptide(s).
Substantially Pure. As used herein "substantially pure" means that the desired purified protein is essentially free from contaminating cellular contaminants which are associated with the desired protein in nature. Contaminating cellular components may include, but are not limited to, phosphatases, exonucleases, endonucleases or undesirable DNA polymerise enzymes.
Primer. As used herein "primer" refers to a single-stranded oligonucleotide that is extended by covalent bonding of nucleotide monomers during amplification or polymerization of a nucleic acid molecule.
Minisatellite primers used for the amplification of minisatellite dimer, trimer, tetramer, etc., sequences are well-known in the art.
Template. The term "template" as used herein refers to a double-stranded or single-stranded nucleic acid molecule which is to be amplified, synthesized or sequenced. In the case of a double-stranded DNA molecule, denaturation of its strands to form a first and a second strand is performed before these molecules may be amplified, synthesized or sequenced. A primer, complementary to a portion of a template is hybridized under appropriate conditions and the polymerise of the invention may then synthesize a molecule complementary to said template or a portion thereof. The newly synthesized molecule, according to the invention, may be equal or shorter in length than the original template.
Mismatch incorporation or strand slippage during the synthesis or extension of the newly synthesized molecule may result in one or a number of mismatched base pairs. Thus, the synthesized molecule need not be exactly complementary to the template.

Incorporating. The term "incorporating" as used herein means becoming a part of a nucleic acid (e.g., DNA) molecule or primer.
'~ Amplification. As used herein "amplification" refers to any in vitro method for increasing the number of copies of a nucleotide sequence with the use of a DNA polymerise. Nucleic acid amplification results in the incorporation of nucleotides into a DNA molecule or primer thereby forming a new DNA molecule complementary to a DNA template. The formed DNA molecule and its template can be used as templates to synthesize additional DNA molecules. As used herein, one amplification reaction may consist of many rounds of DNA replication. DNA
amplification reactions include, for example, polymerise chain reactions (PCR).
One PCR reaction may consist of 5 to 100 "cycles" of denaturation and synthesis of a DNA molecule.
Oligonucleotide. "Oligonucleotide" refers to a synthetic or natural molecule comprising a covalently linked sequence of nucleotides which are joined by a phosphodiester bond between the 3' position of the pentose of one nucleotide and the 5' position of the pentose of the adjacent nucleotide.
Nucleotide. As used herein "nucleotide" refers to a base-sugar-phosphate combination. Nucleotides are monomeric units of a nucleic acid sequence (DNA
and RNA). The term nucleotide includes deoxyribonucleoside triphosphates such as dATP, dCTP,, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives include, for example, [aSjdATP, 7-deaza-dGTP and 7-deaza-dATP.
The term nucleotide as used herein also refers to dideoxyribonucleoside triphosphates (d.dNTPs) and their derivatives. Illustrated examples of dideoxyribonucleoside triphosphates include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. According to the present invention, a "nucleotide" may be unlabeled or detestably labeled by well known techniques.
Detectable labels include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.
_ Thermostable. As used herein "thermostable" refers to a polymerise which is resistant to inactivation by heat. DNA polymerises synthesize the formation of a DNA molecule complementary to a single-stranded DNA template by extending a primer in the 5'-to-3' direction. This activity for mesophilic DNA
polymerises may be inactivated by heat treatment. For example, TS DNA
polymerise activity is totally inactivated by exposing the enzyme to a temperature of 90°C for 30 seconds. As used herein, a thermostable polymerise activity is more resistant to heat inactivation than a mesophilic polymerise. However, a thermostable polymerise does not mean to refer to an enzyme which is totally resistant to heat inactivation and thus heat treatment may reduce the polymerise activity to some extent. A thermostable polymerise typically will also have a higher optimum temperature than mesophilic polymerises.
Hybridization. The terms "hybridization" and "hybridizing" refers to the pairing oftwo complementary single-stranded nucleic acid molecules (RNA and/or DNA) to give a double-stranded molecule. As used herein, two nucleic acid molecules may be hybridized, although the base pairing is not completely complementary. Accordingly, mismatched bases do not prevent hybridization of two nucleic acid molecules provided that appropriate conditions, well known in the art, are used. In the present invention, the term "hybridization" refers particularly to hybridization of an oligonucleotide to a template molecule.
3'-5' Egonuclease Activity. "3'-5' exonuclease activity" is an enzymatic activity well known to the art. This activity is often associated with DNA
polymerises, and is thought to be involved in a DNA replication "editing" or correction mechanism.
A "DNA polymerise substantially reduced in 3'-5' exonuclease activity"
(which may also be represented as "3'exo-") is defined herein as either ( 1 ) a mutated DNA polymerise that has about or less than 10%, or preferably about or less than 1%, of the 3'-5' exonuclease activity of the corresponding unmutated, wildtype enzyme, or (2) a DNA polymerise having a 3'-5' exonuclease specific activity which is less than about I unit/mg protein, or preferably about or less than 0.1 units/mg protein. A unit of activity of 3'-5' exonuclease is defined as the amount of activity that solubilizes 10 nmoles of substrate ends in 60 min. at 37°C, wo 9sr3so6o rcrrt~s9sioZ~9i assayed as described in the "BRL 1989 Catalogue & Reference Guide", page 5, with HhaI fragments of lambda DNA 3'-end labeled with [3H]dTTP by terminal deoxynucieotidyl transferase (TdT). Protein is measured by the method of Bradford, Anal. l3iochem. 72:248 (1976). As a means of comparison, natural, wildtype TS-DNA polymerise (DNAP) or TS-DNAP encoded by pTTQ 19-TS-2 has a specific activity of about 10 units/mg protein while the DNA polymerise encoded by pTTQ 19-TS-2(exo ) (U. S. Patent No. 5,270,179) has a specific activity of about 0.0001 units/mg protein, or 0.001 % of the specific activity of the unmodified enzyme, a 105-fold reduction.
5'-3' Eaonuclease Activity. "5'-3' exonuclease activity" is also an enzymatic activity well known in the art. This activity is often associated with DNA polymerises, such as ~ cola PoII and PoIIII.
A "DNA polymerise substantially reduced in 5'-3' exonuclease activity"
(which may also be represented as "5'exo-") is defined herein as either ( 1 ) a mutated DNA polymerise that has about or less than 10%, or preferably about or less than 1 %, of the 5'-3' exonuclease activity of the corresponding unmutated, wildtype enzyme, or (2) a DNA polymerise having 5'-3' exonuclease specific activity which is less than about I unitlmg protein, or preferably about or less than 0.1 units/mg protein.
Both of the 3'-5' and 5'-3' exonuclease activities can be observed on sequencing gels. Active 5'-3' exonuclease activity will produce nonspecific ladders in a sequencing gel by removing nucleotides from the 5'-end of the growing primers. 3'-5' exvnuclease activity can be measured by following the degradation of radiolabeled primers in a sequencing gel. Thus, the relative amounts of these activities, e.g. by comparing wildtype and mutant polymerises, can be determined with no more than routine experimentation.
Minisatetlite DNA. As used herein, the term "minisatellite DNA" refers to a DNA fi-agnent comprising a short stretch of tandemly repetitive nucleotide sequence. In vivo, minisatellite DNA fi~agments are found interspersed throughout the genomes of most eukaryotic organisms thus far examined. These repeating WO 98/35060 PCT/US98nOZ791 sequences appear in tandem and often in variable numbers within the genome;
thus, the terms "short tandem repeats" ("STRs") or "variable numbers of tandem repeats" ("VIVTRs") may be used synonymously when referring to these regions.
Minisatellite DNA fragments are typically about 9 bases to about 60 bases in length and are repeated about 20-SO times at a typical locus in a eukaryotic genome.
Microsatellite DNA. As used herein, the term "microsatellite DNA"
refers to DNA fragments which are typically of a repeat unit size of about 1-6 bases in length. The most prevalent of these microsatellite DNA fragments in the human genome is the dinucleotide repeat (dC-dA)p~(dG-dT)" (where n is the number of repetitions in a given stretch of nucleotides). The terms "STRs" and "VNT'Rs" may also be used synonymously to denote these structures.
Non-templated 3' Terminal Nucleotide Addition. As used herein, the term "non-templated 3'terminal nucleotide addition" or "extranucleotide addition"
means the propensity of an enzyme such as a DNA polymerise to incorporate one or more additional nucleotides, which are not found in the template strand at the 3' terminus of a newly synthesized nucleic acid molecule in a synthesis or amplification reaction, such as PCR. As a result of non-templated 3' terminal nucleotide addition, the synthesized or amplification products (i.e., the newly synthesized DNA strand) will be longer by one or more nucleotides than is the template, in such a fashion that if the template is "n" nucleotides in length, the synthesis or amplification products will be "n+l," "n+2," "n+3," etc., nucleotides in length. A "polymerise substantially reduced in the ability to add one or more non-templated nucleotides to the 3' terminus of a nucleic acid molecule" is defined herein as a DNA polymerise, w~ rh when it has no 3' exonuclease activity or has substantially reduced 3' exonuc: ;ase activity, it will produce a collection of amplification products in which less than about 50%, preferably less than about 30%, more preferably less than about 20%, still more preferably less than about 10%, still more preferably less than about 5%, and most preferably less than about 1 % of the amplification products contain one or more non-templated nucleotides wo ~so6o rcr~s9sro~rm at their 3' termini compared to amplification products produced by Tag DNA
polymerise assayed under the same conditions. Preferably, the conditions used for assaying 3' non-templated nucleotide addition is performed such that less than 100% of the amplification products of Tag DNA polymerise exhibits 3' non-templated nucleotide addition. Included in this definition are those polymerises that satisfy this definition for any primer set used. Thus, if the use of any primer set provides the indicated reduction of 3' non-templated nucleotide addition, the polymerise is said to be substantially reduced in the ability to add one or more non-templated nucleotides to the 3' terminus of a nucleic acid molecule.
When referring to polymerises which have been mutated or modified to reduce or eliminate 3' non-templated nucleotide addition, the mutated or modified polymerise is said to be "reduced in the ability to add one or more non-templated nucleotides to the 3' terminus of a nucleic acid molecule" when the polymerise has a lower or reduced or eliminated ability to add non-templated 3' nucleotides compared to the corresponding unmutated, unmodified or wildtype polymerise.
For example, when testing the affect of a point mutation in the O-helix of a polymerise on non-templated nucleotide addition, the polymerise unmodified in the same position ofthe O-helix is preferablyused for comparison purposes.
Such mutated or modified polymerises are said to "substantially reduced in the ability to add one or more non-templated nucleotides to the 3' terminus of a nucleic acid molecule" if the mutated or modified polymerise has less than about 50%, preferably less than about 30%, more preferably less than about 20%, still more preferably less than about 10%, still more preferably less than about 5%, and most preferably less than about 1 % of the activity for adding non-templated 3' terminal nucleotides compared to the corresponding unmutated, unmodified or wildtype polymerise. Preferably, the conditions used for assaying 3' non-templated nucleotide addition is performed such that less than 100% of the amplification products produced by the unmutated, unmodified or wildtype polymerise control exhibits 3' non-templated nucleotide addition. Included in this definition are those mutant or modified poiymerases that satisfy this definition for any primer set tested.
The ability of a polymerise to add a non-templated 3' terminal nucleotide to the growing strand may be assessed by a variety of techniques, most preferably by gel electrophoresis ofthe synthesized or amplification products for a direct size comparison and by comparison to markers of known size (see Figures 6-13).
Other terms used in the fields of recombinant DNA technology and molecular and cell biology as used herein will be generally understood by one of ordinary skill in the applicable arts.
Sources of Polymerises The methods of the present invention rely on the use of polymerises (thenmostable or mesophilic DNA or RNA polymerises) reduced, substantially reduced or eliminated in the ability to add one or more non-templated 3' terminal nucleotide to a growing nucleic acid strand. These thermostable DNA
polymerises may be obtained from any strain of any thermophilic microorganism, including but not limited to strains of Thermus aquaticus (Taq polymerise; see U.S. Patent Nos. 4,889,818 and 4,965,188}, Thermus thermophilus (Tth polymerise), Thermococcus litoralis (Tli or VENTTM polymerise}, Pyrococcus furiosus (Pfu or DEEPVENTT"" polymerise), Pyrococcus woosii (Pwo polymerise) and other Pyrococcus species, Bacillus sterothermophilus (Bst polymerise), Sulfolobus acidocaldarius (Sac polymerise), Thermoplasma acidophilum (Tic polymerise), Bacillus caldophilus (Bca polymerise), Thermus flavus (T, fllT'ub polymerise), Thermus ruber (Tru polymerise), Thermus brockianus (DYNAZYMETM polymerise), Thermotoga neapolitana (Tne polymerise; see WO 96/10640 and W096/41014), Thermotoga maritima (Tma polymerise; see U. S. Patent No. 5,374,553) and other species ofthe Thermotoga genus (Tsp polymerise) and Methanobacterium thermoautotrophicum (Mth polymerise). Mesophilic DNA polymerises of interest in the invention include but are not limited to T7 DNA polymerises, TS DNA polymerise, DNA polymerise WO 9$/35060 PCTIUS98I02791 III, Klenow fragment DNA polymerise and mutants, fragments or derivatives thereof. RNA polymerises such as T3, TS, SP6 and mutants, variants and derivatives thereof may also be used in accordance with the invention.
Polymerises having reduced or substantially reduced ability to add a non-templated 3' nucleotide to a growing nucleic acid strand may be wildtype polymerises, or may be made by mutating such wildtype polymerises by standard techniques (for example, by generating point mutations, insertions, deletions, etc., in the wildtype gene or protein). Polymerises that are reduced or substantially reduced in the ability to add a non-templated 3' nucleotide to a growing strand may be identified by assaying the synthesized products (e.g. PCR products) formed by such enzymes, as is well-known in the art and as generally described below in the Examples.
The nucleic acid polymerises used in the present invention may be mesophilic or thermophilic, and are preferably therrnophilic. Preferred mesophilic DNA polymerises include T7 DNA polymerise, TS DNA polymerise, Klenow fragment DNA polymerise, DNA polymerise III and the like. Preferred thermostable DNA polymerises that may be used in the methods of the invention include Taq, Trre, Tma, Pfu, Tfl, Tth, Stoffel fragment, VENTT"" and DEEPVENTT"" DNA polymerises, and mutants, variants and derivatives thereof (LJ.S. Patent No. '.1,436,149; U.S. Patent 4,889,818; U.S. Patent 4,965,188;
U.S.
Patent 5,079,352:; U.S. Patent 5,614,365; U.S. Patent 5,374,553; U.S. Patent 5,270,179; U.S. Patent 5,047,342; U.S. Patent No. 5,512,462; WO 92/06188;
WO 92/06200; WO 96/10640; Barnes, W.M., Gene 112:29-35 (1992); Lawyer, F.C., et al., PCR~V~eth. Appl. 2:275-287 (1993); Flaman, J.-M, et al., Nucl.
Acids Res. 22(15):3259-3260 ( 1994)). For amplification of long nucleic acid molecules (e.g., nucleic acid, molecules longer than about 3-5 Kb in length), at least two DNA polymerises (one substantially lacking 3' exonuclease activity and the other having 3' exonuclease activity) are typically used. See U. S. Patent No.
5,436,149;
U.S. PatentNo. 5,512,462; Farnes, W.M., Gene 112:29-35 (1992); and copending U.S. Patent Application No. 08/689,814, filed February 14, 1997, the disclosures wo ~so6o rc~r~rs9sro2~9i of which are incorporated herein in their entireties. Examples of DNA
polymerises substantially lacking in 3' exonuclease activity include, but are not limited to, Taq, Tne(exo ), Tma(exo ), P, fu (exo ), Pwo(exo ) and Tth DNA
polymerises, and mutants, variants and derivatives thereof.
Polypeptides having nucleic acid polymerise activity are preferably used in the present methods at a final concentration in solution of about 0.1-200 units per milliliter, about 0.1-50 units per milliliter, about 0.1-40 units per milliliter, about 0.1-3.6 units per milliliter, about 0.1-34 units per milliliter, about O.I-32 units per milliliter, about 0.1-30 units per milliliter, or about 0.1-20 units per milliliter, and most preferably at a concentration of about 20-40 units per milliliter.
Of course, other suitable concentrations of nucleic acid polymerises suitable for use in the invention will be apparent to one or ordinary skill in the art.
In a preferred aspect of the invention, polymerises of the invention and preferably the mutant or modified polymerises of the invention are made by recombinant techniques. A number of cloned polymerise genes are available or may be obtained using standard recombinant techniques.
To clone a gene encoding a polymerise, which may be modified in accordance with the invention, isolated DNA which contains the polymerise gene is used to construct a recombinant library in a vector. Any vector, well known in the art, can be used to clone the DNA polymerise of interest. However, the vector used must be compatible with the host in which the recombinant DNA
library will be transformed.
Prokaryotic vectors for constructing the plasmid library include plasmids such as those capable of replication in E. toll such as, for example, pBR322, ColEl, pSC101, pUC-vectors (pUCl8, pUCl9, etc.: In: Molecular Cloning, A
LaboratoryManual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (I982); and Sambrook et al., In: Molecular Cloning A Laboratory Manual (2d ed.) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York ( 1989)). Bacillus plasmids include pC 194, pC221, pC217, etc. Such plasmids are disclosed by Glyczan, T. In: The Molecular Biology Bacilli, Academic Press,'~ork (1982), 307-329. Suitable Streptomyces plasmids include pIJ101 (Kendall et al., J. Bacteriol 169:4177-4183 (1987)). Pseudomorras plasmids are reviewed by John et al., (Rid Insec. Dis. 8:693-704 (1986)), and Igaki, (Jpn. J. Bacteriol. 33:729-742 (1978)). Broad-host range plasmids or cosmids, such as pCPl3 (Darzins and Chakrabarbary, J. Bacteriol. 159:9-18, 1984) can also be used for the present invention. The preferred vectors for cloning the genes of the present invention are prokaryotic vectors.
Preferably, pCP 13 and pUC vectors are used to clone the genes of the present inventiion.
The preferred host for cloning the polymerise genes of iinterest is a prokaryotic host. The most preferred prokaryotic host is E. cola. However, the desired polymerise genes of the present invention may be cloned in other prokaryotic hosts including, but not limiited to, Escherichia, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and Proteus. Bacterial hosts of particular interest include E. cola DH10B, which may be obtained from Life Technologies, Inc;. (LTI) (Rockville, Ivm).
Eukaryotic hosts for cloning and expression ofthe polymerises of interest include yeast, fungi, and mammalian cells. Expression of the desired polymerise in such eukaryotic cells may require the use of eukaryotic regulatory regions which include eukaryotic promoters. Cloning and expressing the polymerise gene in eukaryotic cells may be accomplished by well known techniques using well known eukaryotic vector systems.
Once a I)NA library has been constructed in a particular vector, an appropriate host its transformed by well known techniques. Transformed colonies are preferably plated at a density of approximately 200-300 colonies per petri dish.
For thermostable polymerise selection, colonies are then screened for the expression of a heat stable DNA polymerise by transfernng transformed E. cola colonies to nitrocellulose membranes. After the transferred cells are grown on nitrocellulose (approximately 12 hours), the cells are lysed by standard techniques, - and the membranes ire then treated at 95°C for 5 minutes to inactivate the endogenous E. cola enzyme. Other temperatures may be used to inactivate the host polymerises depending on the host used and the temperature stability of the polymerise to be cloned. Stable polymerise activity is then detected by assaying for the presence of polymerise activity using well known techniques (see, e.g., Signer et al., Gene 97:119-123 ( 1991 ), which is hereby incorporated by reference in its entirety). The gene encoding a polymerise of the present invention can be cloned using the procedure described by Singer et ad., supra. Other techniques for selecting cloned polymerises in accordance with the present invention will be well-known to those of ordinary skill in the art.
Modifications or Mutations of Polymerises In accordance with the invention, the nucleotide binding domain of the polymerise of interest is modified or mutated in such a way as to produce a mutated or modified polymerise having reduced, substantially reduced or eliminated activity for adding non-templated 3' nucleotides. The O-helix region typically defines the nucleotide binding domain of DNA polymerises. The O-helix may be defined as RXXXI~~~YX (SEQ ID NO:11 ), wherein X may be any amino acid. One or more mutations or combinations of mutations may be made in the O-helix of any polymerise in order to reduce or eliminate non-templated 3' nucleotide addition in accordance with the invention. Such mutations include point mutation, fi~ame-shift mutations, deletions and insertions.
Preferably, one or more point mutations, resulting in one or more amino acid substitutions, are used to produce polymerises having such activity. Such mutations may be made by a number of methods that will be familiar to one of ordinary skill, including but not limited to site-directed mutagenesis. In a preferred aspect of the invention, one or more mutations at positions R, K, F, and'or Y in the polymerise O-helix may be made to produced a polymerise having t?,~.~ desired activity.
Most preferably, one or more mutations at position R and/or F and/or K and/or Y
within the O-helix results in polymerises having reduced, substantially reduced or eliminated activity for adding non-templated 3' nucleotides. In the preferred aspect, amino acid substitutions are made at position R and/or F and/or K
and/or Y (or combinations thereof). Thus, R (Arg) andlor F (Phe) and/or K (I,ys) may be substituted with any other amino acid including Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val.
Preferably, R (Arg) is substituted with amino acids Lys, Tyr, Leu, His, Gln, Met, or Asn. F (Phe) is ;preferably substituted with amino acids Tyr, Ala, Leu, Thr, and Ser. K (Lys) is preferably substituted with amino acids Arg, Tyr, Leu, His, Gln, Met or Asn, and more preferably with Arg or His. Y (Tyr) is preferably substituted with amino acids Lys, Arg, Ala, Thr, Phe, Leu, His, Gln, Met, or Asn.
Positions corresponding to R, K, F and Y for RNA polymerises may also be determined by comparing nucleotide and/or amino acid sequences with those of DNA polymerase,s, to determine homologies therebetween. Corresponding mutations or modification may then be made to produce the desired result in any RNA polymerise.
The O-helix has been identified and defined for a number of polymerises and may be readily identified for other polymerises by one with skill in the art.
Thus, given the defined O-helix region and the methods and assays described herein, one with skill in the art can make one or a number of modifications which would result in polymerises having reduced, substantially reduced or eliminated activity for adding non-templated 3' nucleotides. Accordingly, the invention relates to methods for producing such polymerises having modifications in the O-helix domain resulting in reduction, substantial reduction or elimination of activity for adding non-templated 3' nucleotides, methods for producing nucleic acid molecules encoding such polymerises, and polymerises and nucleic acid molecules produced by such methods.
The following table illustrates identified O-helix regions for known polymerises.

wo ~so6o rcTrtrs9sro2m Pol a eli ion SE ID NO

PoII 754 RRSAKAINFGLIYG 12 T 659 RR.AAKTINFGVLYG 13 S Tne 722 RRVGR;MVNFSIIYG 15 Tma 722 RRAGIS;MVNFSIIYG 17 Thus, in accordance with a preferred aspect of the invention, corresponding mutations in the R and/or F and/or K positions of the O-helix can be made for the following enzymes based on the tables below.
Pot merase Mutation Position PoII E1r 's TS ~. sss T7 ~. sis Ta ~ 659 Tne Ar '~

Tma Ar "~

Bca ~. Los Bst Ar '~

Tth Ar ~' Pot merase Mutation Position PoII Phe'62 TS Phes'6 T7 phes2s Ta Phew' Tne Phe'3o _ Tma Phe'3o Bca Phe"3 Bst Phe"

Tth Phew' Pol merase Mutation Position PoII L sass ' TS L ss9z T7 L ssn Ta L s~

Tne L s'z6 Tma L s'z6 Bca L s'' Bst L s'~

Trh L s'~s The mutation position of Arg'°s for Bca is based on the sequence information in GenBank. It should be noted, however, that according to the sequence described by Vemori et al. J. Biochem. (Japan) 113:401-410 ( 1993 ), the position of Arg in Bca is 703.
Additional Modifications or Mutations of Polymerises In accordance with the invention, in addition to the mutations or modifications described above, one or more additional mutations or modifications (or combinations thereof) may be made to the polymerises of interest.
Mutations or modifications of particular interest include those modifications of mutations which (1) reduce or eliminate 3' to 5' exonuclease activity; and (2) reduce or eliminate 5' to 3' exonuclease activity.
If the DNA polymerise has 3'-to-5' exonuclease activity, this activity may be reduced, substantially reduced, or eliminated by mutating the polymerise gene.
Such mutations include point mutations, frame shift mutations, deletions and insertions. Preferably, the region of the gene encoding the 3'-to-5' exonuclease activity is mutated or deleted using techniques well known in the art (Sambrook et a1, (1989) in: Molecular Cloning, A Laboratory Manual (2nd Ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

wo ~so6o rcTrtrs9sroZ~9i The 3'-to-5' exonuclease activity can be reduced or impaired by creating site specific mutants within the 3'--~5' exonuclease domain. See infra. In a specific embodiment of the invention Asp3'~ of Tne DNA poiymerase is changed to any amino acid, preferably to Ala3~ to substantially reduce 3'-~5' exonuclease activity.
In another specific embodiment of the invention, Asp's of Tma may be changed to any other amino acid, preferably to Ala to substantially reduce 3'-~5' exonuclease activity. The following represents a domain of interest for a number of polymerises for preparing 3'-~5' exonuclease mutants.
Tne 318 PSFALDLETSS 328 (SEQ ID N0:18) Pol I 350 PVFAFDTETDS 360 (SEQ ID N0:19) TS 159 GPVAFDSETSA 169 (SEQ ID N0:20) T7 1 MIVSDIEANA 10 (SEQ ID N0:21) Mutations, such as insertions, deletions and substitutions within the above domain can result in substantially reduced 3'--~5' exonuclease activity. By way of example, Asp3ss (Poll), Asp's (TS), and Asps (T7) may be substituted with any amino acid to substantially reduce 3'-~5' exonuclease activity. For example, Asp at these positions may be substituted with Ala.
The 5'-~3' exonuclease activity of the polymerises can be reduced, substantially reduced or eliminated by mutating the polymerise gene or by deleting the 5' to 3' exonuclease domain. Such mutations include point mutations, frame shift mutations, deletions, and insertions. Preferably, the region of the gene encoding the 5'--~3' exonuclease activity is deleted using techniques well known in the art. In embod-~: ants of this invention, any one of six conserved amino acids that are associated wy~r: the 5'- ° 3' exonuclease activity can be mutated. Examples _ of these conserved amino acids with respect to Tne DNA polymerise include Asps, Glu"2, Asp"4, Asp"5, Asp"', and Aspis9, ether possible sites for mutation are Glyl°~, Glylg' and Gly'95.

PCT/US98/~02791 Corresponding amino acid to target for other polymerises to reduce or ' eliminate 5'-~3' exonuclease activity as follows:
E. coli poll: Asp'3, Glu"3, Asp"s, Asp"6, Asp'3g, and Asp"°.
Taq pol: Asp'g, Glu"', Asp"9, Asp'2°, Asp142~ ~d ~pms.
Tma pol: Aspg, Glu"2, Asp"', Asp"s, Asp'3', and Asp'39.
Amino acid residues of Taq DNA polymerise are as numbered in U.S.
5,079,3 52. Amino acid residues of Thermotoga maritima (Tma) DNA polymerise are numbered as in U.S. Patent No. 5,374,553.
Examples of other amino acids which may be targeted for other polymerises to reduce 5'--~3' exonuclease activity include:
E or source Mutation 'tions Stre tococcus neumoniaeAs ' Glu"As As "' '39 As "6 As '4' Thermos As " Glu"6, As "9 '', As As As '43 "$

Thermos thermo hilus As '8 . As '2', 143 AS
Glu"g As A$ lss '~

Deinococcus radioduransAs 'g. As , '~. '42, As Glu"' "9 As As "4 Bacillus caldotertax As 9 Glu'o'As As "z '~' As "' As 136 Coordinates of S. pneumoniae, T. flavus, D. radiodurans, B. caldoter~e were obtained from Gutman and Minton. Coordinates of T. thermophilus were obtained from International Patent No. WO 92/06200.
Typically., the mutant polymerises of the invention can be affected by substitution of amino acids typically which have different properties. For example, an acidic amino acid such as Asp may be changed to a basic, neutral or polar but uncharged amino acid such as Lys, Arg, His (basic); Ala, Val, Leu, Ile, Pro, Met, Phe, Trp (neutral); or Gly, Ser, Thr, Cys, Tyr, Asn or Gln (polar but uncharged).
Glu may be changed to Asp, Ala, Val Leu, De, Pro, Met, Phe, Trp, Gly, Ser, Thr, Cys, Tyr, Asn or Gln.

Preferably, oligonucleotide directed mutagenesis is used to create the mutant polymerises which allows for all possible classes of base pair changes at any determined site along the encoding DNA molecule. In general, this technique involves annealing a oligonucleotide complementary (except for one or more mismatches) to a single stranded nucleotide sequence coding for the DNA
polymerise of interest. The mismatched oligonucleotide is then extended by DNA
polymerise, generating a double stranded DNA molecule which contains the desired change in the sequence on one strand. The changes in sequence can of course result in the deletion, substitution, or insertion of an amino acid.
The double stranded polynucleotide can then be inserted into an appropriate expression vector, and a mutant polypeptide can thus be produced. The above-described oligonucleotide directed mutagenesis can of course be carried out via PCR.
Enhancing Expression of Polymerises To optimize expression of the polymerises of the present invention, inducible or constitutive promoters are well known and may be used to express high levels of a polymerise structural gene in a recombinant host. Similarly, high copy number vectors, well known in the art, may be used to achieve high levels of expression. Vectors having an inducible high copy number may also be useful to enhance expression of the polymerises of the invention in a recombinant host.
To express the desired structural gene in a prokaryotic cell (such as, E. coli, B. subtilis, Pseudomonas, etc.), it is necessary to operably link the desired structural gene to a functional prokaryotic promoter. However, the natural promoter of the polymerise gene may function in prokaryotic hosts allowing expression of the polymerise gene. Thus, the natural promoter or other promoters may be used to express the polymerise gene. Such other promoters may be used to enhance expression and may either be constitutive or regulatable (i.e., inducible or derepressible) promoters. Examples of constitutive promoters include the int promoter of bacteriophage ~,, and the bla promoter of the ~i-lactamase gene of pBR322. Examples of inducible prokaryotic promoters include the major right and left promoters of bacteriophage ~, (PR and P~, trp, Wp 9g/3~p PGT/US98/02791 recA, IacZ, lacI, tet, gal, trc, and tic promoters of E. coli. The B. subtilis promoters include a-amylase (IJlmanen et al., J. Bacteriol 162:176-182 ( 1985)) and Bacillus bacteriophage promoters (Gryczan, T., In: The Molecular Biology Of Bacilli, Academic Press, New York (1982)). Streptomyces promoters are described by Ward et al., Mol. Gen. Genet. 203:468478 (1986)). Prokaryotic promoters are also reviewed by Glick, J. Ind. Microbiol. 1:277-282 ( 1987);
Cenatiempto, Y., .Biochimie 68:505-516 { 1986); and Gottesman, Ann. Rev.
Genet.
18:41 S-442 ( 1984). Expression in a prokaryotic cell also requires the presence of a ribosomal binding site upstream ofthe gene-encoding sequence. Such ribosomal binding sites are disclosed, for example, by Gold et al., Ann. Rev. Microbiol.
35:365404 (1981).
To enhancx the expression of polymerises of the invention in a eukaryotic cell, well known eukaryotic promoters and hosts may be used. Preferably, however, enhanced expression ofthe polymerises is accomplished in a prokaryotic host. The preferred prokaryotic host for overexpressing the polymerises of the invention is E. call.
Isolation and Purification of Polymerises The enzymes) of the present invention is preferably produced by fermentation of the recombinant host containing and expressing the desired polymerise gene. However, the polymerises of the present invention may be isolated from any strain which produces the polymerise of the present invention.
Fragments of the polymerise are also included in the present invention. Such fragments include proteolytic fragments and fragments having polymerise activity.
Any nutrient that can be assimilated by a host containing the polymerise gene may be added to the culture medium. Optimal culture conditions should be selected case by case according to the strain used and the composition of the culture medium. Antibiotics may also be added to the growth media to insure maintenance of vector DNA containing the desired gene to be expressed. Media formulations have been described in DSM or ATCC Catalogs and Sambrook et al., In: Molecular Cloning, aLaboratoryManual (2nd ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989).
Host cells producing the polymerises of this invention can be separated from liquid culture, for example, by centrifugation. In general, the collected microbial cells are dispersed in a suitable buffer, and then broken down by ultrasonic treatment or by other well known procedures to allow extraction of the enzymes by the buffer solution. After removal of cell debris by ultracentrifugation or centrifugation, the polymerise can be purified by standard protein purification techniques such as extraction, precipitation, chromatography, affinity chromatography, electrophoresis or the like. Assays to detect the presence of the polymerise during purification are well known in the art and can be used during conventional biochemical purification methods to determine the presence of these enzymes.
Thermotoga Polymerises T ~ermotoga polymerises for use in the present invention are obtained from any strain of Thermotoga species, more preferably from a strain of Thermotoga neapolitana (WO 96/10640 or W096/41014) or Tlrermotoga maritima (U.S.
Patent No. 5,374,553). Enzymes suitable for use in the present invention from these more preferred sources are the wildtype DNA polymerises (Tne from T.
neapolitana; Tma from T. maritima), or mutants or derivatives thereof.
The present invention provides isolated nucleic acid molecules encoding preferred mutant Tne DNA polymerises, mutant Tne DNA polymerises encoded by such isolated nucleic acid molecules, and specific mutant Tne DNA
polymerise proteins. Most preferred are the wildtype Tne DNA polymerise (SEQ m NOs:l,2), the wildtype Tina DNA polymerise (U. S. Patent No. 5,374,553), and the following mutants of Tne DNA polymerise: Tne N'0219, D323A (SEQ ID
N0:3); Tne N'0283, D323A (SEQ m N0:4); Tne N'~ 192, D323A (SEQ )D
NO:S); Tne D137A, D323A (SEQ ID N0:6); Tne D8A, D323A (SEQ ID N0:7);
Tne G195D, D323A (SEQ )D N0:8); Tne G37D, D323A (SEQ ID N0:9);

wo ~soso rcTnrs~rozm Tne N'~283 (SEQ ID NO:10); Tne D137A, D323A, R722K; Tne D137A, D323A, R722Y; :l'ne D137A, D323A, R722L; Tne D137A, D323A, R722H;
Tne D137A, D323A, R722Q; Tne D137A, D323A, F730Y; Tne D137A, D323A, K726R; Tne D13'7A, D323A, K726H; Tne D137A, D323A, R722K, F730Y;
Tne D137A, D32:3A, R722K, K726R; Tne D137A, D323A, R722K, K726H;
Tne D137A, D32:3A, R722H, F730Y; Tne D137A, D323A, R722H, K726R;
Tne D137A, D32:3A, R722H, K726H; Tne D137A, D323A, R722Q, F730Y;
Tne D137A, D323A, R722Q, K726R; Tne D137A, D323A, R722Q, K726H;
Tne D137A, D323A, R722N, F730Y; Tne D137A, D323A, R722N, K726R;
Tne D137A, D323A, R722N, K726H; Tne D137A, D323A, F730S; Tne N'0283, D323A, R722K/H/Q/N/Y/L; Tne N0219, D323A, R722K; Tne N~219, D323A, F730Y; TneN'~2119, D323A, K726R; Tne N~219, D323A, K726H; Tne D137A, D323A, F730S, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, F730T, R722K/Y/QlN/f-L~., K726R/H; Tne D137A, D323A, F730T; Tne F730S; Tne F730A; Tne K726R; Tne K726H; and Tne D137A, D323A, R722N. It will of course be understood by the skilled artisan that the designations of the above-described mutant polymerases indicate the position of the amino acid residue in the wildtype amino acid sequence (SEQ ID N0:2) that is being mutated, as well as to what residue the amino acid is being mutated. Thus, for example, "D
137A"
indicates that the Asp (D) residue at position 137 in SEQ m N0:2 has been mutated to an Ala (A) residue, and, for example, "R722K/Y/Q/N/H/L" indicates that the Arg (R) residue at position 722 in SEQ ID N0:2 has been mutated to a Lys (K), Tyr (Y), Gln (Q), Asn (N), His (H) or Leu (L) residue. Mutant poiymeraes having one or more mutations or modifications corresponding to the Tne mutants of the invnetion are also contemplated by the invention.
The following chart indicaxes the nucleic acid sequences of the nucleic acid molecules encoding the above-described mutant Tne DNA polymerases (SEQ
ID NOs:3-10), each with reference to the wildtype Tne DNA polymerase (SEQ
)D NO:1):

SEQ Deletion of SEQ Insertion Substitution to ID ID NO: SEQ ID NO:

NO: 1 1 3 Deletion of positionsATG AGC A replaces G at 657 from the 5'-endat the 5'-endposition 966; C
replaces A at 968 and G replaces C

at 969 4 Deletion of positionsNone A replaces G at 1- 966; C

849 from the 5'-end replaces A at 968 and G

laces C at 969 5 Deletion of positionsATG AAT A replacxs G at 1- TCG 966; C

576 from the 5'-endAGC TCG replaces A at 968 GTA and G

CCC at the replaces C at 969;
5'- A

end re laces G at 584 6 None None A replaces G at 966; C

replaces A at 968 and G

replaces C at 969;
C

replaces T at 408 and C

laces A at 410 7 None None A replaces G at 966; C

replaces A at 968 and G

replaces C at 969;
C

replaces A at 23 and C

re laces T at 24 8 None None A replaces G at 966; C

replaces A at 968 and G

replaces C at 969;
T

replaces C at 576 and A

re laces G at 584 9 None None A replaces G at 966; C

replaces A at 968 and G

replaces C at 969;
A

re laces G at 110 10 Deletion of positionsNone None I- ~

849 from the 5'-end.

Using these same api;roaches, the sequence guidancx provided herein, and knowledge of appropriate nucleotide substitutions to be made to SEQ ID NO:1, one of ordinary skill can readily produce other nucleic acid molecules encoding mutant polymerises, such as those described in detail above, having the desired activity. In addition, other nucleic acid molecules which comprise a sequence WO 98!35060 PGT/US98I02791 substantially different from those described above but which, due to the degeneracy of the genetic code, still encode a mutant Tne DNA polymerase having an amino acid sequence set forth above, are also encompassed by the present invention. Since the genetic code is well known in the art, it is routine for one of ordinary skill in the art to produce such mutants and degenerate variants without undue experimentation.
Each of these mutant Tne DNA polymerases are reduced or substantially reduced in the ability to add a non-templated 3' terminal nucleotide to the growing strand. These mutant Tne DNA polymerase proteins may be prepared by recombinant DNA, techniques routine to one of ordinary skill. Preferably, such mutant Tne polyrnerases are prepared by inserting an isolated DNA molecule having a nucleotide sequence as described above for each individual mutant into a recombinant vector, inserting the vector into a host cell, preferably an Escherichia coli cell, and culturing the host cell under conditions favoring the production of the mutant Tne DNA polymerase. The mutant Tne polymerase is then isolated from the host cell according to standard protein purification techniques. Further guidance for the preparation and isolation of mutant DNA
polymerases from thermostable microorganisms can be found, for example, in U.
S.
Patent No. 5,374,:153, in co-pending U.S. Patent Application No. 08/689,818 of Deb K. Chatterjee and A. John Hughes, entitled "Cloned DNA Poiymerases from Tlrermotoga and Mutants Therof," filed September 6, 1996, and in co-pending U.S. Patent Application No. 08/689,807 of Deb K. Chatterjee, entitled "Cloned DNA Polymerases from Thermotoga and Mutants Therof," filed September 6, 1996, the disclosures of all of which are incorporated herein in their entirety.
In the methods of the present invention, Thermotoga DNA polymerases substantially reduced in 3'-5' exonuclease activity (such as a Tne mutant having an amino acid sequence as set forth in any one of SEQ >D NOs:3-9), or Thermotoga DNA polymerases not substantially reduced in 3'-5' exonuclease activity (such as Tne DNA polymerase (SEQ 1D NOs: I,2), Tma DNA polymerase (LT. S. Patent No.
5,374,553), or the Tne mutant TneN'0283 (SEQ )D N0:10)), may be used with similar results, since both types of Thermotoga DNA polymerise are substantially reduced in the ability to add a nontemplated 3' terminal nucleotide to a DNA
template. Other thermostable DNA polymerises substantially reduced in 3'-5' exonuclease activity, such as Taq, VENTT'~(exo-), DEEPVENT''M(exo-), Dtok(exo-) and THERMOLASETM Tbr, are not preferred for use in the present methods as they will add non-templated nucleotides to the 3' termini of the amplification products as described below. However, such thermostable polymerise can be made which have reduced, substantially reduced or eliminated activity to add 3' non-template nucleotides by mutating or modifying the polymerise in accordance with the invention. The preferred Thermotoga polymerises of the invention contain such mutations or modifications in their O-helix.
The recombinant host comprising the gene encoding Tne DNA
polymerise, E. coli DH10B(pUC-Tne), was deposited on September 30, 1994, with the Collection, Agricultural Research Culture Collection (NRRL), 1815 North University Street, Peoria, Illinois 61604 USA, as Deposit No. NRRL
B-21238. The gene encoding Tma DNA polymerise has also been cloned and sequenced (U.S. Patent No. 5,374,553, which is expressly incorporated by reference herein in its entirety). Methods for preparing mutants and derivatives of these Tne and Tma polymerises are well-known in the art, and are specifically described in co-pending U.S. Patent Application No. 08/689,818 of Deb K.
Chatterjee and A. John Hughes, entitled "Cloned DNA Polymerises from Thermotoga and Mutants Therof," filed September 6, 1996, and co-pending U.S.
Patent Application No. 08/689,807 of Deb K. Chatterjee, entitled "Cloned DNA
Polymerises from Thermotoga and Mutants Therof," filed September 6, 1996, the disclosures of which are incorporated herein in their entirety.
Advantages of Thermostable Polymerises The use of thermostable polymerises (e.g. Thermotoga polymerises) or mutants or derivatives thereof in the methods of the present invention provide several distinct advantages. These advantages are particularly apparent in the application of the present methods to analysis and typing of minisatellite, microsatellite and STR DNA regions.
With respect to traditional thermolabile DNA polymerises used in DNA
S amplification and sequencing, such as T4, T7 or E. coli Klenow fragment polymerises, thermostable polymerises such as Thermotoga DNA polymerises maintain their enzymatic activity in the multiple high-temperature cycles used in PCR and analogous automated amplification methodologies. It is therefore unnecessary to add fresh enzyme at the beginning of each amplification cycle when using thermostable polymerises, as must be done when thermolabile enzymes are used.
With respect to other thermostable enzymes, it has been unexpectedly discovered in the present invention (as described in more detail in the Examples below) that the use of Tne or Tma DNA polymerise mutants or derivatives thereof, does not result in the incorporation of non-templated 3' nucleotides into the newly synthesized DNA strands during DNA amplification reactions. This non-templated incorporation is a common problem when using certain other commonly employed thermostable enzymes, such as Taq, VENT~(exo-), DEEPVENTTM(exo-), Dtok(exo-) and THERMOLASETM Tbr. It has also been unexpectedly discovered that mutants of these polymerises can be made to reduce or eliminate addition of non-templated 3' nucleotides. In particular, such mutations are preferably made within the O-helix of such polymerises.
Thus, the use of Tne or Tma DNA polymerises or mutants or derivatives thereof (or other mutant polymerises produced according to the invention) in amplifying and typing DNA sequences, particularly hypervariable DNA sequences such as minisatellite, microsatellite or STR regions, will allow a faithful amplification and resolution of polymorphisms in these regions. This faithful resolution is not. possible using other thermostable polymerises due to their propensity for non-templated incorporation. Thus, these enzymes are suitable for use in automated amplification systems such as PCR.

WO 98/35060 PCT/US98~02791 Sources of DNA
Suitable sources of DNA, including a variety of cells, tissues, organs or organisms, may be obtained through any number of commercial sources (including American Type Culture Collection (ATCC), Rockville, Maryland; Jackson Laboratories, Bar Harbor, Maine; Cell Systems, Inc., Kirkland, Washington;
Advanced Tissue Sciences, La Jolla~ California). Cells that may be used as starting materials for genomic DNA preparation are preferably eukaryotic (including fungi or yeasts, plants, protozoans and other parasites, and animals including humans and other mammals). Although any mammalian cell may be used for preparation of DNA, preferred are blood cells (erythrocytes and leukocytes), endothelial cells, epithelial cells, neuronal cells (from the central or peripheral nervous systems), muscle cells (including myocytes and myoblasts from skeletal, smooth or cardiac muscle), connective tissue cells (including fibroblasts, adipocytes, chondrocytes, chondroblasts, osteocytes and osteoblasts) and other stromal cells (e.g., macrophages, dendritic cells, Schwann cells), although other cells, including the progenitors, precursors and stem cells that give rise to the above-described somatic cells, are equally suitable. Also suitable for use in the preparation of DNA are mammalian tissues or organs such as those derived from brain, kidney, liver, pancreas, blood, bone marrow, muscle, nervous, skin, genitourinary, circulatory, lymphoid, gastrointestinal and connective tissue sources, as well as those derived from a mammalian (including human) embryo or fetus. These cells, tissues and organs may be normal, or they may be pathological such as those involved in infectious diseases (caused by bacteria, fungi or yeast, viruses (including AIDS) or parasites), in genetic or biochemical pathologies (e.g., cystic fibrosis, hemophilia, Alzheir..~er's disease, schizophrenia, muscular dystrophy or multiple sclerosis), or in cancerous processes.
More specifically, in one aspect of the invention, the relationship between a first individual and a second individual may be determined by analyzing and typing a particular polymorphic DNA fragment, such as a minisatellite or microsatellite DNA sequence. In such a method, the amplified fragments for each individual are compared to determine similarities or dissimilarities. Such an analysis is accomplished, for example, by comparing the size of the amplified fragments from each individual, or by comparing the sequence of the amplified fragments from each individual. In another aspect of the invention, genetic identity can be determined. Such identity testing is important, for example, in paternity testing, forensic analysis, etc. In this aspect of the invention, a sample containing DNA (e.g., a crime scene sample or a sample from an individual) is analyzed and compared to a sample from one or more individuals. In one such aspect of the invention, one sample of DNA may be derived from a first individual and another sample may be derived from a second individual whose relationship to the first individual is unknown; comparison of these samples from the first and second individuals by the methods of the invention may then facilitate a determination of the genetic identity or relationship between the first and second individual. In a particularly preferred such aspect, the fast DNA sample may be a known sample derived from a known individual and the second DNA sample may be an unknown sample derived, for example, from crime scene material. In an additional aspect of the invention, one sample of DNA may be derived from a first individual and another sample may be derived from a second individual who is related to the first individual; comparison of these samples from the first and second individuals by the methods of the invention may then facilitate a detenmination ofthe genetic kinship ofthe first and second individuals by allowing examination of the Mendelian inheritance, for example, of a polymorphic, minisatellite, microsatellite or STR DNA fragment. In another aspect of the invention, DNA fragments important as genetic markers for encoding a gene of interest can be identified and isolated. For example, by comparing samples from different sources, DNA fragments which may be important in causing diseases such as infectious diseases (of bacterial, fungal, parasitic or viral etiology), cancers or genetic diseases, can be identified and characterized. In this aspect of the invention a DNA sample from normal cells or tissue is compared to a DNA sample from diseased cells or tissue. Upon comparison according to the invention, one or more unique polymorphic fragments present in one DNA sample and not present in the other DNA sample can be identified and isolated. Identification of such unique polymorphic fragments allows for identification of sequences associated with, or involved in, causing the diseased state.
Once the starting cells, tissues, organs or other samples are obtained, DNA
may be prepared therefrom by methods that are well-known in the art (See, e.g., Maniatis, T., et al., Molecular Cloning: A Larboratory Manual, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, pp. 9.16-9.23 ( 1989);
Kaufinan, P.B., et al., Hamdbook ofMolecular and Cellular Methods in Biology and Medicine, Boca Raton, Florida: CRC Press, pp. 1-26 ( 1995)). The DNA
samples thus prepared may then be used to identify, analyze and type polymorphic DNA fragments, including minisatellite, microsatellite and STR DNA fragments, by amplification, preferably by PCR amplification, as modified by the methods of the present invention.
General methods for amplification and analysis of DNA fragments are well-known to one of ordinary skill in the art (see, e.g., U.S. Pat. Nos.
4,683,195;
4,683,202; and 4,800,159; Innis, M.A., et al., eds., PCR Protocols: A Guide to Methods and Applications, San Diego, California: Academic Press, Inc. ( 1990);
Griffin, H.G., and Griffin, A.M., eds., PCR Technology: Current Innovations, Boca Raton, Florida: CRC Press ( 1994)). Typically, these methods comprise contacting the DNA sample with a thermostable DNA polymerase in the presence of one or more primer sequences, amplifying the DNA sample to generate a collection of amplified polymorphic, minisatellite, microsatellite or STR DNA
fragments, preferably by PCR or equivalent automated amplification technique, separating the amplified DNA fragments by si~~ , preferably by gel electrophoresis, and analyzing the gels for the presence of polymorphic, minisatellite, microsatellite or STR DNA fragments by direct comparison of the pattern of fragments generated from a first sample of DNA to those from a second sample of DNA, or by a more indirect comparison using known size markers.

wo 9sr3ssobo rc~r~rs9sroarm As noted above, amplification protocols used heretofore for analyzing and typing polymorphic, DNA fragments, particularly minisatellite, microsatellite or STR DNA sequences, use certain thermostable DNA polymerises such as Taq (U.S. PatentNos. 4,683,195; 4,683,202; and 4,800,159). However, as discussed in detail above, these approaches yield amplification products in which one or more non-templated nucleotides is added to the 3' termini of the products by the polymerises, thus :leading to heterogeneity in the amplification products, and ambiguity concerning the correct size of the amplification products.
This problem is overcome in the present invention by contacting the DNA
sample in the amplification reaction mixtures with one or more DNA polymerises of the invention which are reduced, substantially reduced or eliminated in the ability to add a nontemplated 3' terminal nucleotide to the growing strand.
Preferably, such DNA polymerises are Thermotoga DNA polymerises, more preferably a Thermotoga DNA polymerise substantially reduced in 3'-5' exonuclease activity, still more preferably a Tne polymerise (SEQ 1D NOs:l,2), a Tma polymerise (U.S. Patent No. 5,374,553), or a mutant or derivative thereof, and most preferably one of the following mutants of Tne polymerise:
Tne N'0219, D323A (SEQ >D N0:3); Tne N'~283, D323A (SEQ )Z7 N0:4);
Tne N'~192, D323A (SEQ )D NO:S); Tne DI37A, D323A (SEQ ID N0:6);
Tne D8A, D323A (SEQ ID N0:7); Tne G195D, D323A {SEQ D7 N0:8); Tne G37D, D323A (SEQ )D N0:9); Tne N'0283 (SEQ m NO:10); Tne D137A, D323A, R722K; Tne D137A, D323A, R722Y; Tne D137A, D323A, R722L;
Tne D137A, D323,A, R722H; Tne D137A, D323A, R722Q; Tne D137A, D323A, F730Y; Tne D137A, D323A, K726R; Tne D137A, D323A, K726H; Tne D137A, D323A, R722K, F~730Y; Tne D137A, D323A, R722K, K726R; Tne D137A, D323A, R722K, K726H; Tne DI37A, D323A, R722H, F730Y; Tne D137A, D323A, R722H, K726R; Tne D137A, D323A, R722H, K726H; Tne D137A, D323A, R722Q, F730Y; Tne D137A, D323A, R722Q, K726R; Tne DI37A, - D323A, R722Q, K726H; Tne D137A, D323A, R722N, F730Y; Tne D137A, D323A, R722N, K726R; Tne D137A, D323A, R722N, K726H; Tne D137A, D323A, F730S; Tne N'0283, D323A, R722K/H/Q/N/Y/L; Tne N'0219, D323A, R722K; TneN'0219, D323A, F730Y; TneN'0219, D323A, K726R; Tne N'0219, D323A, K726H; TneD137A, D323A, F730S, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, F730T, R722K/Y/Q/N/H/L, K726R/H; Tne D137A, D323A, F730T; Tne F730S; Tne F730A; Tne K726R; Tne K726H; and Tne D137A, D323A, R722N.
It will be understood, however, that other thermostable DNA polymerises or mutants thereof, any ofwhich are reduced, substantially reduced, or eliminated in the ability to add a non-templated 3' terminal nucleotide to the growing strand, may be used in the methods of the present invention equivalently. The DNA
polymerises are used in the methods of the present invention at a concentration of about 0.0001 units/ml to about 10 units/ml, preferably at a concentration of about 0.001 units/ml to about 5 units/ml, more preferably at a concentration of about 0.004 units/ml to about 1 unit/ml, and most preferably at a concentration of about 0.04 units/ml. Thus, the methods of the present invention produce a population of amplified DNA fragments, most preferably of polymorphic or microsatellite DNA fragments, which comprise substantially no non-templated 3' terminal nucleotides. By "substantially no non-templated 3' terminal nucleotides"
is meant that the population of amplified DNA fragments demonstrates about 0-50%, about 0-30%, about 0-20%, preferably about 0-10%, more preferably about 0-5%, still more preferably about 0-1% and most preferably about 0%, ofDNA
molecules containing non-templated 3' nucleotides compared to amplified DNA
fragments produced by the polymerise control. When testing the ability of a DNA
polymerise to add 3' non-templated nucleotides, the polymerise, when it has substantially reduced or eliminated 3' exonuclease a~: ~ wity, is compared to Taq DNA polymerise (see above). When testing polymerises which have been modified or mutated to reduce or eliminate 3' non-templated nucleotide addition, the mutated or modified polymerise is compared to the corresponding wildtype, unmodified or unmutated polymerise (see above).

Following amplification by the methods of the present invention, the amplified DNA fragments may be analyzed to identify or type a polymorphic, minisatellite, microsatellite or STR DNA fragment. This step is usually accomplished by separation of the amplified DNA fragments by size, a procedure which permits the determination of the presence of unique polymorphic fi~agments in one or more of the DNA samples. The fragments may be separated by any physical or biochemical means including gel electrophoresis, capillary electrophoresis, chromatography (including sizing, affinity and immunochromatography), density gradient centrifugation and immunoadsorption.
For carrying out the present invention, separation of DNA fragments by gel electrophoresis is particularly preferred, as it provides a rapid and highly reproducible means of sensitive separation of a multitude of DNA fragments, and permits direct, simultaneous comparison of the fragments in several samples of DNA, or samples of DNA from a first and a second individual.
Gel electrophoresis is typically performed on agarose or poiyacryiamide sequencing gels according to standard protocols, preferably using gels containing polyacrylamide at concentrations of 3-12% and most preferably at about 8%, and containing urea at a concentration of about 4-12M, most preferably about 8M.
Samples are loaded onto the gels, usually with samples containing amplified DNA
fragments prepared from different sources of genomic DNA being loaded into adjacent lanes of the gel to facilitate subsequent comparison. Reference markers of known sizes may be used to facilitate the comparison of samples. Following electrophoretic separation, DNA fragments may be visualized and identified by a variety of techniques that are routine to those of ordinary skill in the art, such as autoradiography. One can then examine the autoradiographic films either for differences in poiymorphic fragment patterns ("typing") or for the presence of one or more unique bands in one lane of the gel ("identifying"); the presence of a band in one lane (corresponding to a single sample, cell or tissue type) that is not observed in other lanes indicates that the DNA fragment comprising that unique band is source-specific and thus a potential polymorphic DNA fragment.

WO ~ PCT/US98I02791 -50.
A variety of DNA fragments comprising polymorphic, minisatellite, microsatellite or STR DNA fragments can thus be identified using the methods of the present invention by comparing the pattern of bands on the films depicting various samples. Importantly, using the present methods the amplification products of the polymorphic DNA fragments will be faithful copies of the template (allele) material -- i.e., they will not exhibit undesired additional nucleotides at their 3' termini via non-templated addition of nucleotides by the polymerises.
One can extend this approach, in another preferred embodiment, to isolate and characterize these fragments or any DNA fragment amplified without the non-templated addition of a 3' terminal nucleotide. In this embodiment, one or more of the unique DNA fragments are removed from the gel which was used for identification (see above), according to standard techniques such as electroelution or physical excision.
The isolated unique DNA fragments may then be inserted into standard nucleotide vectors, including expression vectors, suitable for transfection or transformation of a variety of prokaryotic (bacterial) or eukaryotic (yeast, plant or animal including human and other mammalian) cells. In particular, the present invention provides methods of cloning such isolated unique DNA fragments, or any PCR-amplified DNA fragment, by blunt-end cloning. As described above, Taq DNA polymerise adds a non-templated nucleotide, typically a deoxyadenosine ("A"), to the 3' terminus of the amplified DNA fragment. Thus, Taq-catalyzed PCR generates a collection of DNA fi~nents with 3' A overhangs.
To clone such Taq-amplified fragments, two approaches are commonly used:
either the 3' A overhang is removed by treating the amplified fragment with, for example, T4 DNA polymerise (a tPchniquc-~ sometimes called "3' polishing"), or a special cloning vector with a 3' T' .~~rhan~ "TA Toning vector") is used. Of course, such approaches are more time-consuming and expensive than if direct insertion ofthe amplified fi-agment were done. Such a direct approach is possible using the methods of the invention, which generates little or no 3' A
overhangs (and thus, blunt ends) on the amplified DNA fragments. The DNA fragments, -S I-amplified according to the methods of the invention, may thus be directly inserted - into corresponding blunt-ended vectors according to standard techniques (for example, using T4 DNA ligase). Thus, the present invention provides a method of blunt-end cloning of a DNA fragment that obviates the use of TA cloning vectors or 3' polishing.
To identify the presence of minisatellite DNA fragments, the polymorphic DNA fragments that are identified and isolated by the methods of the present invention may be further characterized, for example by sequencing (i.e., determining the nucleotide sequence of the polymorphic fragments), by methods described above and others that are standard in the art (see, e.g., U. S.
Patent Nos.
4,962,022 and 5,498,523, which are directed to methods of DNA sequencing).
Kits The invention also provides kits for use in the identification, analysis and typing of a polymorphic DNA fragment, particularly a minisatellite or STR DNA
fragment, according to the present methods. Kits according to the present invention may comprise a carrying means being compartmentalized to receive in close confinement therein one or more containers such as vials, tubes, bottles and the like. Each o:f such containers may comprise components or a mixture of components needed to perform DNA amplification or analysis.
Such kits may comprise of one or more thermostable DNA polymerises reduced, substantiaily reduced or eliminated in the ability to add a non-templated 3' nucleotide to a growing DNA strand. Preferably the container contains a Thermotoga DNA polymerise or a mutant or a derivative thereof, particularly those described in. full detail above. The kit may also contain one or more DNA
primer molecules, one or more deoxyribonucleoside triphosphates needed to synthesize a DNA, molecule complementary to a DNA template, and/or a buffer suitable for amplification of a nucleic acid molecule (or combinations threof).
A kit for DNA analysis may include one or more of the above components, and may further include containers which contain reagents necessary for separation and analysis ofDNA fragments, such as polyacrylamide, agarose, urea, detergents and the like.
Of course, it is also possible to combine one or more of these reagents in a single tube. A detailed description of such formulations at working concentrations is described in co-pending U.S. Application No. 08!689,815 of Ayoub Itashtchian and Joseph Solus, entitled "Stable Compositions for Nucleic Acid Amplification and Sequencing" filed on August 14, 1996, the disclosure of which is incorporated by reference herein in its entirety.
The invention also relates to kits for detestably labeling molecules, sequencing, amplifying and synthesizing molecules by well known techniques.
See U.S. Patent Nos. 4,962,020, 5,173,411, 4,795,699, 5,498,523, 5,405,776 and 5,244,797. Such kits may comprise a carrying means being compartmentalized to receive in close confinement one or more container means such as vials, test tubes and the like. Each of such container means comprises components or a mixture of components needed to perform nucleic acid synthesis, sequencing, labeling, or amplification.
A kit for sequencing DNA may comprise a number of container means.
Such a kit may comprise one or more of the polymerises of the invention, one or a number of types of nucleotides needed to synthesize a DNA molecule complementary to DNA template, one or a number of different types of terminators (such as dideoxynucleoside triphosphates), a pyrophosphatase, one or a number of primers and/or a suitable sequencing buffer (or combinations of such components).
A kit used for amplifying or synthesizing of nucleic acids will comprise, one or more polymerises of the invention, and one or a number of nucleotides or mixtures of nucleotides. Various primers may be included in a kit as well as a suitable amplification or synthesis buffers.
When desired, the kit of the present invention may also include container means which comprise detestably labeled nucleotides which may be used during the synthesis or sequencing of a nucleic acid molecule. One of a number of labels WO 9g/3~p PCT/US98/02791 may be used to detect such nucleotides. Illustrative labels include, but are not limited to, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.
Use of the Methods and Kits The polymeraes, methods and kits embodied in the present invention will have general utility in any application utilizing nucleic acid amplification methodologies, particularly those directed to the analysis and typing of polymorphic or minisatellite DNA fi-agments, and most particularly those directed to the analysis and typing of minisatellite, microsatellite and STR DNA
fragments.
Amplification techniques in which the present methods may be used include PCR
(U.S. PatentNos. 4,683,195 and 4,683,202), Strand Displacement Amplification (SDA; U. S. Patent No. 5,455,166; EP 0 684 315), and Nucleic Acid Sequence-Based Amplification (NASBA; U.S. Patent No. 5,409,818; EP 0 329 822).
Nucleic acid analysis and typing techniques which may employ the present compositions include nucleic acid sequencing methods such as those disclosed in U.S. PatentNos. 4,962,022 and 5,498,523, as well as more complex PCR-based nucleic acid fingerprinting techniques such as Random Amplified Polymorphic DNA (RAPD) analysis (Williams, J.G.K., et al., Nucl. Acids Res. 18(22):6531-6535, 1990), Arbitrarily Primed PCR (AP-PCR; Welsh, J., and McClelland, M., Nucl. Acids Res. 18(24):7213-7218, 1990), DNA Amplification Fingerprinting (DAF; Caetano-Anolles et al., BiolTechnology 9:553-557, 1991), and microsatellite PCR or Directed Amplification of Mirusatellite-region DNA
(DAMD; Heath, D.D., et al., Nucl. Acids Res. 21(24): 5782-5785, 1993). in particular, the polymerises, methods and kits of the present invention will be usefirl in the fields of medical genetics, therapeutics and diagnostics, forensics (particularly identity and paternity testing), and agricultural (e.g., plant breeding) and other biological sciences, in any procedure utilizing DNA polymerises for analysis and typing of polymorphic, minisatellite, microsatellite or STR DNA
fragments. Particularly suitable for diagnosis by the methods of the present wo ~so6o rcTws9siozrm invention are genetic diseases such as cystic fibrosis, hemophilia, Alzheimer's disease, schizophrenia, muscular dystrophy or multiple sclerosis. Together, these abilities will assist medical professionals and patients in diagnostic and prognostic determinations as well as in the development oftreatment and prevention regimens for these and other disorders.
It will also be apparent to one of ordinary skill in the art that the present methods may be used to screen animal tissues to be subsequently used in medical procedures such as tissue or organ transplants, blood transfusions, zygote implantations and artificial inseminations. In such procedures, pre-screening ofthe subject tissues for the presence of particular polymorphic DNA fragments may improve the success of tissue or organ transplants (by decreasing the likelihood of rejection due to donor-recipient genetic incompatibility) and of zygote implantations (by eliminating the use of genetically defective zygotes).
Similarly, use ofthese methods will reduce the chances of transmission of infectious diseases (e.g., hepatitis and AIDS) in medical procedures that are often prone to such transmission, such as blood transfusions and artificial insemination. Finally, use of the present invention for identification of unique polymorphic, minisatellite, microsatelliet and STR DNA fragments will assist in forensic science in such applications as crime-scene analysis of blood, tissue and body secretions containing small amounts of DNA, as well as in paternity testing.
It will be readily apparent to those skilled in the relevant arts that other suitable modifications and adaptations to the methods and applications described herein are obvious and may be made without departing from the scope of the invention or any embodiment thereof. Having now described the present invention in detail, the same will be more clearly unde- ~.ood by reference to the following examples, which are included herewith for pu : d >ses of illustration only and are not intended to be limiting of the invention.

wo ~so6o rcrrt~s9sroz~rni Example 1: Bacterial Strains And Growth Conditions T'hermotoga neapolitana DSM No. 5068 was grown under anaerobic conditions as described in the DSM catalog (addition of resazurin, NaiS, and sulfur granules while sparging the media with nitrogen) at 85°C in an oil bath from 12 to 24 hours. The cells were harvested by filtering the broth through Whatman #1 filter paper. The supernatant was collected in an ice bath and then centrifuged in a refiigerated centrifuge at 8,000 rpms for twenty minutes. The cell paste was stored at -70°C prior to total genomic DNA isolation.
E. coli strains were grown in 2X LB broth base (Lennox L broth base:
GIBCOBRL) medium. Transformed cells were incubated in SOC (Z% tryptone, 0.5% yeast extract, yeast 10 mM NaCI, 2.5 mM KCI, 20mM glucose, IOmM
MgCl2, and l OmM MgS04 per liter) before plating. When appropriate antibiotic supplements werE; 20 mg/1 tetracycline and 100 mg/1 ampicillin. E. toll strain DH10B (Lorow et al., Focus 12:19-20 {1990)) was used as host strain.
Competent DH10B may be obtained from Life Technologies, Inc. (LTI) (Rockville, MD).
Example 2: DN.9 Isolation Thermotoga neapolitana chromosomal DNA was isolated from I.lg of cells by suspending the cells in 2.5 ml THE (SOmM Tris-HCI, pH 8.0, SOmM
NaCI, IOmM EL~TA) and treated with 1% SDS for 10 minutes at 37°C.
DNA
was extracted with phenol by gently rocking the lysed cells overnight at 4°C. The next day, the lysed cells were extracted with chloroform:isoamyl alcohol. The resulting chromosomal DNA was further purified by centrifugation in a CsCI
density gradient. Chromosomal DNA isolated from the density gradient was extracted three times with isopropanol and dialyzed overnight against a buffer containing 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA (TE).

Example 3: Construction of Genomic Libraries The chromosomal DNA isolated in Example 2 was used to construct a genomic library in the plasmid pCPl3. Briefly, 10 tubes each containing lOpg of Thermotoga ne~olitana chromosomal DNA was digested with 0.01 to 10 units of Sau11IA1 for 1 hour at 37°C. A portion of the digested DNA was tested in an agarose {1.2%) gel to determine the extent of digestion. Samples with less than 50% digestion were pooled, ethanol precipitated and dissolved in TE. 6.5 ug of partially digested chromosomal DNA was ligated into 1.5 pg of pCPl3 cosmid which had been digested with BamHI restriction endonuclease and dephosphorylated with calf intestinal alkaline phosphatase. Ligation of the partially digested Thermotoga DNA and BamHI cleaved pCP 13 was carned out with T4 DNA ligase at 22°C for 16 hours. After ligation, about 1 pg of ligated DNA was packaged using ~,-packaging extract (obtained from Life Technologies, Inc., Rockville, MD). DH10B cells (Life Tech. Inc.) were then infected with pl of the packaged material. The infected cells were plated on tetracycline containing plates. Serial dilutions were made so that approximately 200 to 300 tetracycline resistant colonies were obtained per plate.
Example4: ScreeningforClonesExpressingThermotoganeapolitana DNA
Polymerise Identification ofthe Thermotoga neapolitana DNA polymerise gene of the invention was cloned using the method of Signer et al., Gene 97:119-123 ( 1991) which reference is herein incorporated in its entirety. Briefly, the E. coli tetracycline resistant colonies from Example 3 were transferred to nitrocellulose membranes and allowed to grow for 12 hours. The cells were then lysed with the fumes of chloroformaoluene (1:1) for 20 minutes and dried for 10 minutes at room temperature. The membranes were then treated at 95 °C for 5 minutes to inactivate the endogenous E. coli enzymes. Surviving DNA polymerise activity was detected by submerging the membranes in 15 ml of polymerise reaction mix (50 mM Tris-HCl (pH 8.8), 1 mM MgCl2, 3 mM [i-mercaptoethanol, 10 pM
dCTP, dGTP, dTTP, and 15 pCi of 3,000 Ci/mmol [a32P]dATP) for 30 minutes at 65°C.
Using autoradiography, three colonies were identified that expressed a Thermotoga neapolitana DNA polymerise. The cells were grown in liquid culture and the protein extract was made by solucation. The presence of the cloned thermostable polymerise was confirmed by treatment at 90°C
followed by measurement of D:NA polymerise activity at 72°C by incorporation of radioactive deoxyribonucleoside triphosphates into acid insoluble DNA. One of the clones, expressing Tne DNA polymerise, contained a plasmid designated pCPl3-32 and was used for further study.
Example S: Sub~eloning of Tne DNA polymerise Since the pCPl3-32 clone expressing the Tne DNA polymerise gene contains about 25 kb of T. neapolitana DNA, subcloning a smaller fragment ofthe Tne polymerise gene was attempted. The molecular weight of the Tne DNA
polymerise purified from E. coli/pCPl3-32 was about 104 kd. Therefore, a 2.5-3.0 kb DNA fragment will be sufficient to code for full-length polymerise.
A
second round of Sau3A partial digestion similar to Example 3 was done using pCPl3-32 DNA. In this case, a 3.5 kb region was cut out from the agarose gel, purified by Gene Clean (BIO 101, La Jolla, CA) and ligated into plasmid pSport (Life Technologies, Inc.) which had been linearized with BamHI and dephosphorylated with calf intestinal alkaline phosphatase. After ligation, was transformed and colonies were tested for DNA polymerise activity as described in Exarnple 1. Several clones were identified that expressed Tne DNA
polymerise. One of the clones (pSport-Tne) containing about 3 kb insert was further characterized. A restriction map of the DNA fragment is shown in Fig.
1.
Further, a 2.7 Kb HindIII-SstI fragment was subcloned into pUCl9 to generate WO 98/35060 PCT/IIS98~2791 pUC 19-Tne. E. colilpUC 19-Tne also produced Tne DNA poiymerase. E. coli DH10B (pUCl9-Tne) was deposited on September 30,1994 with the Collection, Agricultural Research Culture Collection (NRRL), 1815 Peoria, IL 61604 as Deposit No. NRRL B-21338. The nucleotide and amino acid sequence of Tne polymerise is described in U. S. application serial nos. 08/70b,702 and 08/706,706 filed September 9, 1996, both of which are incorporated by reference herein.
Example 6: Purification of Thermotoga neapolitana DNA Polymerise from E coli Twelve grams of E. coli cells expressing cloned Tne DNA polymerise (DH10B/pSport-Tne) were lysed by sonication (four thirty-second bursts with a medium tip at the setting of nine with a Heit Systems Ultrasonics Inc., model sonicator) in 20 ml of ice cold extraction buffer (SO mM Tris HCl (pH 7.4), 8%
glycerol, 5 mM mercaptoethanol, 10 mM NaCI, I mM EDTA, 0.5 mM PMSF).
The sonicated extract was heated at 80°C for 15 min. and then cooled in ice for 5 min. 50 mM KCl and PEI (0.4%) was added to remove nucleic acids. The extract was centrifuged for clarification. Ammonium sulfate was added to 60%, the pellet was collected by centrifugation and resuspended in 10 ml of column buffer (25 mM Tris-HCl (pH 7.4), 8% glycerol, 0.5% EDTA, SmM
2-mercaptoethanol, 10 mM KCI). A Blue-Sepharose (Pharmacia) column, or preferably a Toso heparin {Tosohaas) column, was washed with 7 column volumes of column buffer and eluted with a 15 column volume gradient of buffer from 1 OmM to 2 M KCI. Fractions containing polymerise activity were pooled. The fractions were dialyzed against 20 volumes of column buffer. The pooled fractions were applied to a Toso650Q column (Tosohaas}. The column was washed to baseline ODZ~ and elution effected with a linear 10 column volume gradient of 25 mM Tris (pH 7.4), 8% glycerol, 0.5 mM EDTA, 10 mM KCI, 5 mM (i-mercaptoethanol to the same buffer plus 650 mM KCI. Active fractions were pooled.

wo 9sr3so6o rcTrtrs~m Example 7: Construction oJTliermotoga neapolitana 3 =to-S'Fxonuclease Mutant The amino acid sequence of portions of the Tne DNA polymerise was compared with other known DNA polymerises such as E. coli DNA
polymerise 1, Taq DNA polymerise, TS DNA polymerise, and T7 DNA
polymerise to localize the regions of 3'-to-5' exonuclease activity, and the dNTP
binding domains within the DNA polymerise. One of the 3'-to-5' exonuclease domains was deterntined based on the comparison of the amino acid sequences of various DNA polymerises (Blanco, L., et al. Gene 112: 139-144 (1992);
Braithwaite and It:o, Nucleic Acids Res. 21: 787-802 (1993)) is as follows:
Tne 318 PSFALDLETSS 328 (SEQ m N0:18) Pol I PVFAFDTETDS 360 (SEQ ID N0:19) TS 159 GPVAFDSETSA 169 (SEQ ID N0:20) T7 1 MIVSDIEANA 10 (SEQ m N0:21) As a first: step to make the Tne DNA polymerise devoid of 3'-> S' exonuclease activity, a 2kb Sph fragment from pSport-Tne was cloned into M13mp19 (LTI, Rockville, MD). The recombinant clone was selected in E. coli DHSaF'IQ (LTI, Rockville, MD). One of the clones with the proper insert was used to isolate uricilated single-stranded DNA by infectingE. coli CJ236 (Biorad, California) with the phage particle obtained from E. coli DHSocF'IQ. An oligonucleotide, GA CGT TTC AAG CGC TAG GGC AAA AGA (SEQ ID
N0:22) was used to perform site directed mutagenesis. This site-directed ' mutagenesis converted Asp323 (indicated as * above) to Ala'23. An Eco47III
restriction site w~~s created as part of this mutagenesis to facilitate screening of the mutant following mutagenesis. The mutagenesis was perForrned using a protocol as described in the Biorad manual (1987) except T7 DNA polymerise was used instead of T4 DNA polymerise (LJSB, Cleveland, OIT). The mutant clones were screened for the Eco4?III restriction site that was created in the mutagenic oligonucleotide. One of the mutants having the created Eco4?III restriction site was used for further study. The mutation Asp3~ to Ala3~ was confirmed by DNA
sequencing.
To incorporate the 3'-i 5' exonuclease mutation in an expression vector, the mutant phage was digested with Sphl and HindIII. A 2 kb fragment containing the mutation was isolated. This fragment was cloned in pUC-Tne to replace the wild type fragment. See Figure 2A. The desired clone, pUC-Tne (3'--~5'), was isolated. The presence of the mutant sequence was confirmed by the presence of the unique Eco47III site. The plasmid was then digested with Sstl and HirtdiII.
The entire mutant polymerise gene (2.6 kb) was purified and cloned into SstI
and HindIII digested pTrc99 expression vector (Pharmacia, Sweden). The clones were selected in DH10B (LTI, Rockville, MD). The resulting plasmid was designated pTrcTne35. See Figure 2B. This clone produced active heat stable DNA polymerise.
Example 8: Phenylalanine to Tyrosine Mutant The polymerise active site including the dNTP binding domain is usually present at the carboxyl terminal region of the poiymerase. The sequence of the Tne polymerise gene suggests that the amino acids that presumably contact and interact with the dNTPs are present within the 694 bases starting at the internal BamHI site. See Figure 1. This conclusion is based on homology with a prototype polymerise E. coli DNA polymerise I. See Polisky et al., J. Biol.
Chem. 265:145?9-14591 (1990). A comparison was made of the O-helix for various polymerises:

Tne 72~:RRVGB;MVNFSIIYG 735 (SEQ ID N0:12) ' Pol I 754 RRSAKAINFGLIYG 767 (SEQ m N0:13) TS 562 RQAAKAITFGILYG 575 (SEQ ID N0:14) T7 518 RDNAKTFIYGFLYG 531 (SEQ ID NO:15) Taq 659 RRAAKTINFGVLYG 672 (SEQ ID N0:16) In order to change Phe'~° of the Tne polymerise to a Tyr'~°
site directed mutagenesis was performed using the oligonucleotide GTA TAT TAT AGA GTA
GTT AAC CAT C;TT TCC A (SEQ 1D N0:23). As part of this oligonucleotide directed mutagenesis, a Hpal restriction site was created in order to screen mutants easily. 'The same uracilated single-stranded DNA and mutagenesis procedure described in Example 7 were used for this mutagenesis. Following mutagenesis, the mutants were screened for the HpaI site. Mutants with the desired HpaI site were used for further study. The mutation was confirmed by DNA sequencing.
The Phe'~°'to Tyr'3° mutation was incorporated into pUC-Tne by replacing the wild type Sphl: HindIII fragment with the mutant fragment obtained from the mutant phage DNA. The presence of the desired clone, pUC-TneFY, was confirmed by the presence of the unique Hpal site, see Figure 2A. The entire mutant polymerise gene was subcloned into pTrc99 as an SstI-HindIII fragment as described above in DH10B. The resulting plasmid was designated pTrcTneFY.
(Figure 2B). The. clone produced active heat stable polymerise.
Fxample 9: 3'-~~S' Fxonuclease and Phe"°~Tyr'3° Double Mutants In order to introduce the 3'--~5' exonuclease mutation and the - Phe'~°-~Tyr'3° mutation in the same expression vector, pTrc99, it was necessary to first reconstitute both mutations in the pUC-Tne clone. See Figure 3. Both the pUC-Tne (3'-~ 5') and the pUC-TneFY were digested with BamHI. The digested pUC-Tne (3'-~5') was dephosphorylated to avoid recirculation in the following WO ~~ PCT/US98/02791 ligations. The resulting fragments were purified on a 1 % agarose gel. The largest BamHI fragment (4.4 kb) was purified from pUC-Tne (3'-~5') digested DNA and the smallest BamHI fragment (0. 8 kb) containing the Phe'3°--~
Tyr'3° mutation was purified and ligated to generate pUC-Tne35FY. The proper orientation and the presence of both mutations in the same plasmid was confirmed by Eco47III, Hpal, and SphI Hi»dBI restriction digests. See Figure 3.
The entire polymerise containing both mutations was subcloned as a SstI-HindIII fragment in pTrc99 to generate pTrcTne35FY in DH10B. The clone produced active heat stable polymerise.
Example 10: 3'-~S' F.aconuclease, S'-~3' Exonuclease, and Phe'3°~Tyr'3o Triple Mutants In most of the known polymerises, the 5'-to-3' exonuciease activity is present at the amino terminal region of the polymerise (Ollis, D.L., et al., Nature 313, 762-766, 1985; Freemont, P. S., et al., Proteins 1, 66-73, 1986; Joyce, C.M., Curr. Opin. Struct. Biol. l: 123-129 (1991). There are some conserved amino acids that are implicated to be responsible for 5'-to-3' exonuclease activity (Gutman and Minton, Nucl. Acids Res. 21, 4406-4407, 1993). See supra. it is known that 5'-to-3' exonuclease domain is dispensable. The best known example is the Klenow fragment of E. coli Pol I. The Klenow fragment is a natural proteolytic fragment devoid of 5'-to-3' exonuclease activity (Joyce, C.M., et al., J. Biol. Chem. 257, 1958-1964, 1990). In order to generate an equivalent mutant for Tne DNA polymerise devoid of 5'-to-3' exonuclease activity, the presence of a unique SphI site present 680 bases from the SstI site was exploited.
pUC-Tne35FY was digested with HindIII, filled-in with Klenow fragment to generate a blunt-end, and digested with SphI. The 1.9 kb fragment was cloned into an expression vector pTTQ 19 (Stark, M.J.R., Gene 51, 255-267, 1987) at the SphI-SmaI sites and was introduced into DHl OB. This cloning strategy generated an in-frame polymerise clone with an initiation codon for methionine from the vector. The resulting clone is devoid of 219 amino terminal amino acids of Tyre DNA polymerise. This clone is designated as pTTQTne535FY (Fig. 4). The clone produced active heat stable polymerise. No exonuclease activity could be detected in the mutant polymerise as evidenced by lack of presence of unusual sequence ladders vi the sequencing reaction. This particular mutant polymerise is highly suitable for DNA sequencing.
Example 11: S'-~3' Exonuclease Deletion and Phe'3°-~Tyr'j°
Substitution Mutant In order to generate the 5'-to-3' exonuclease deletion mutant of the Tne DNA polymerise Phe'~°-~Tyr'~° mutant, the 1.8 kb SphI-SpeI
fragment of pTTQTne535FY was replaced with the identical fragment of pUC-Tne FY. See Fig. 4. A resulting clone, pTTQTneSFY, produced active heat stable DNA
polymerise. As measured by the rate of degradation of a labeled primer, this mutant has a modulated, low but detectable, 5'-to-3' exonuclease activity compared to wild type Tne DNA polymerise. M13/pUC Forward 23-Base Sequencing Primex"~', obtainable from LTI, Rockville, MD, was labeled at the 5' end with [P32] ATP and T4 kinase, also obtainable from LTI, Rockville, MD, as described by the manufacturer. The reaction mixtures contained 20 units of either wildtype or mutant Tne DNA polymerise, 0.25 pmol of labeled primer, 20 mM
tricine, pH 8.7, 85 mM potassium acetate, 1.2 mM magnesium acetate, and 8%
glycerol. Incubation was carried out at 70°C. At various time points, 10 p,l aliquots were removed to 5 ~tl cycle sequencing stop solution and were resolved in a 6 % polyacrylamide sequencing gel followed by andoradiography. While the wildtype polymerise degraded the primer in 5 to 15 minutes, it took the mutant polymerise more than 60 minutes for the same amount of degradation of the primer.

WO ~~~ PCT/US98/02791 Example 12: Purification of tke Mutant Polymeroses The purification of the mutant polymerises was done essentially as described Example 6, supra, with minor modifications. Specifically, 5 to 10 grams of cells expressing cloned mutant Tne DNA polymerise were lysed by sonication with a Heat Systems Ultrasonic, Inc. Model 375 machine in a sonication buffer comprising 50 mM Tris-HCl (pH 7.4); 8% glycerol; 5 mM 2-mercaptoethanol,10 mM NaCI, 1 mM EDTA, and 0.5 mM PMSF. The sonication sample was heated at 75°C for 15 minutes. Following heat treatment, 200 mM NaCI and 0.4%
PEI
was added to remove nucleic acids. The extract was centrifuged for clarification.
Ammonium sulfate was added to 48%, the pellet was resuspended in a column buffer consisting of 25 mM Tris-HCi (pH 7.4); 8% glycerol; 0.5% EDTA; 5 mM
2-mercaptoethanol; 10 mM KCI and loaded on a heparin agarose (LTI) column.
The column was washed with 10 column volumes using the loading buffer and eluted with a 10 column volume buffer gradient from 10 mM to 1 M KCI.
Fractions containing polymerise activity were pooled and dialysed in column buffer as above with the pH adjusted to 7.8. The dialyzed pool of fractions were loaded onto a MonoQ (Pharmacia) column. The column was washed and eluted as described above for the heparin column. The active fractions are pooled and a unit assay was performed.
The unit assay reaction mixture contained 25 mM TAPS (pH 9.3), 2 mM
MgCl2, 50 mM KCI, 1 mM DTT, 0.2 mM dNTPs, 500 ~,g/ml DNAse I treated salmon sperm DNA, 21 mCi/ml [ocP32] dCTP and various amounts of polymerise in a final volume of 50 p,l. After 10 minutes incubation at 70°C, 10 ~,1 of 0.5 M
EDTA wadded to the tube. TCA percepti~ ?e counts were measured in GF/C
filters usin;_; .10 ~tl of the reaction mixture.

Example 13: Generation of S =to-3' exonuclease mutant of full length Tne DNA polymerise 1. Identification of Two Amino Acids Responsible far 5'-to-3' Eionuclease Activity g Tne DNA :polymerise contains three enzymatic activities similar to E. coli DNA polymerise lf: 5'-to-3' DNA polymerise activity, 3'-to-5' exonuclease activity and 5'-to-3' exonuclease activity. This example is directed to the elimination ofthe S'-to-3' exonuclease activity in full length Tne DNA polymerise. Gutman and Minton (Nucleic Acids Res. 1993, 21, 4406-4407) identified six (A-F) conserved 5'-to-3' exonuclease domains containing a total of I 0 carboxylates in various DNA
polymerises in the poll family. Seven out of 10 carboxylates (in domains A, D
and E) have been implicated to be involved in divalent metal ions binding as judged from the crystal structure (Kim et al. Nature, 1995, 376, 612-616) of Taq DNA polymerise;. However, there was no clear demonstration that these carboxylates are actually involved 5'-to-3' exonuclease activity. In order to find out the biochemi~;,al characteristics of some of these carboxylates, two of the aspartic acids in domains A and E were chosen for mutagenesis. The following aspartic acids in these two domains were identified:
Tne DNA polymerise: 5 FLFDeGT 10 (domain A) (SEQ II3 N0:24) Taq DNA polymerise: 15 LLVD'eGH 20 (SEQ )Q7 N0:25) and Tne DNA polymerise: 132 SLITGD'3'KDML141 (domain E) (SEQ ll~
N0:26) Taq DNA polymerise: 137 RILTAD'°ZKDLY146 (SEQ ID N0:27) 2. Isolation of Single Stranded DNA for Mutagenesis Single stranded DNA was isolated from pSportTne (see infra). pSportTne was introduced into DHSa.F'IQ (LTI, Rockville, MD) by transformation. A single WO 98135060 PCT/US98/OZ~91 -b6-colony was grown in 2 ml Circle Grow (Bio 101, CA) medium with ampicillin at 37°C for 16 hrs. A 10 ml fresh media was inoculated with 0.1 ml of the culture and grown at 37°C until the A590 reached approximately 0.5. At that time, 0.1 ml ofM13K07 helper phage (1X10I' pfu/ml, LTI) was added to the culture. The infected culture was grown for 75 min. Kanamycin was then added at 50 p,g/ml, and the culture was grown overnight (16 hrs.). The culture was spun down. 9 ml of the supernatant was treated with 50 pg each of RNaseA and DNaseI in the presence of 10 mM MgCl2 for 30 min. at room temperature. To this mixture, 0.25 volume of a cocktail of 3M ammonium acetate plus 20% polyethylene glycol was added and incubated for 20 min. on ice to precipitate phage. The phage was recovered by centrifugation. The phage pellet was dissolved in 200 pl of TE
( 10 mM Tris-HCl (pH 8) and 1 mM EDTA). The phage solution was extracted twice with equal volume of buffer saturated phenol (LTI, Rockville, MD), twice with equal volume of phenol:chloroforrn:isoamyl alcohol mixture (25:24:1, LTI, Rockville, MD) and finally, twice with chloroform: isoamyl alcohol (24:1 ). To the aqueous layer, 0.1 volume of 7.5 M ammonium acetate and 2.5 volume of ethanol were added and incubated for 15 min. at room temperature to precipitate single stranded DNA. The DNA was recovered by centrifugation and suspended in 200 pl TE.
3. Mutagenesis of D8 and D'~' Two oIigos were designed to mutagenize D8 and D'3' to alanine. The oligos are: 5' GTAGGCCAGGGCTGTGCCGGCAAAGAGAAATAGTC 3' (D8A) (SEQ ID N0:28) and 5' GAAGCATATCCTTGGCGCCGGTTAT
TATGAAAATC 3' (D137A) (SEQ ID N0:29). In the D8A oligo a NgoAIV
(bold underlined) and in the oligo D137A a KasI (bold underlined) site was created for easy identification of clones following mutagenesis. 200 pmol of each oligo was kinased according to the Muta-gene protocol (Bio-Rad, CA) using 5 units of T4 Kinase (LTI, Rockville, MD). 200 ng of single stranded DNA was -6?-annealed with 2 pmol of oligo according to the Muta-gene protocol. The reaction volume was 10 Nl. Following the annealing step, complementary DNA synthesis and Iigation was carried out using 5 units of wildtype T7 DNA polymerise (LTSB, Ohio) and 0.5 unit T4 ligase (LTI). 1 pl of the reaction was used to transform a MutS E. coli (obtainable from Dr. Paul Modrich at the Duke University, NC) and selected in agar plates containing ampicillin. A control annealing and synthesis reaction was carried out without addition of any oligo to determine the backgound. There were 50-60 fold more colonies in the transformation plates with the oligos than without any oligo. Six colonies from each mutagenic oligo directed synthesis were grown and checked for respective restriction site (NgoAIV
or KasI). For D8A (NgoAIV), 4 out of 6 generated two fragments (3 kb and 4.1 kb). Since pSportTne has an NgoAIV site near the fl intergenic region, the new NgoAIV site within the Tne DNA polymerise produced the expected fragments.
The plasmid was designated as pSportTneNgoAIV. For D137A (Karl), 5 out of 6 clones produced two expected fragments of 1.1 kb and 6 kb in size. Since pSportTne has another KasI site, the newly created KasI site generated these two expected fragments. The plasmid was designated as pSportTneKasI. Both D8A
and D137A mutations were confirmed by DNA sequencing.
4. Reconstnrction of the Mutant Polymerise into Ezpression Vector During the course of expression of Tne DNA polymerise or mutant Tne DNA polymerise, a variety of clones were constructed. One such clone was designated as pTTQ Tne SeqSl. This plasmid was constructed as follows: first, similar to above mutagenesis technique glycine 195 was changed to an ispartic acid in pSportTne. A mutation in the corresponding amino acid in E. coli DNA
polyrneraseI (poL~214, domain F) was found to have lost the 5'-to-3' exonuclease activity (Gutman ;and Minton, see above). An SspI site was created in the mutant polymerise. Second, a 650 by SstI-SphI fragment containing the Gl 95D mutation was subcloned in pUCTne3 SFY (see in, fro) to replace the wild type fragment.

WO 98!35060 PCT/US98/02791 This plasmid was called pUCTne3022. Finally, the entire mutant Tne DNA
polymerise was subcloned from pUCTne3022 into pTTQl8 as Sstl HindIII
fragment to generate pTTQTneSeqS 1. To introduce the mutation D8A or D 137A
in this expression vector, the 650 by SstI-SphI was replaced with the same Sstl-SphI fragment from pSportTneNgoAIV or pSportTneKasI. The plasmids were designated as pTTQTneNgo(D8A) and pTTQTneKas(D137A), respectively.
5. Confirmation of the Mutations by DNA Sequencing DNA sequencing of both mutant polymerises confirmed the presence of the restriction site NgoAIV as well as the mutation D8A; and KasI site as well as the mutation D137A. Also confirmed by DNA sequencing was the presence of the mutation D323A and the Eco47IIi restriction site in the 3'-to-5' exonuclease region. In addition, confirmed by DNA sequencing was the F730Y mutation and the Hpal restriction site in the O-helix region of the mutant Tne DNA
polymerise.
6. 5'-to-3' eaonuclease Activity of the Mutant Tne DNA Polymerises The fill length mutant DNA polymerise was purified as described above.
The 5'-to-3' exonuclease activity was determined as described in the LTI
catalog.
Briefly, 1 pmol of labeled (32P) HaeIII digested ~, DNA (LTI) was used for the assay. The buffer composition is: 25 mM Tris-HCl (pH 8.3), 5 mM MgCl2, 50 n~lVl NaCI, 0.01 % gelatin. The reaction was initiated by the addition of 0, 2, 4, 6 and 10 units of either wild type or mutant Tne DNA polymerise in a 50 p.l reaction. The reaction mix was incubated for 1 hr at 72°C. A 10 ~1 aliquot was subected to PEI-cellulose thi a layer chromatography and the label reieased was quantitated by liquid scintillation. In this assay, both D8A and D137A mutants showed less than 0.01% label release compared to the wild type Tne DNA
polymerise. The result demonstrates that in both D8A and D137A mutants the 5'-to-3' exonuclease activity has been considerably diminished. Thus, it has been confirmed that these two aspartates are involved with the 5'-to-3' exonuclease - activity.
_ Example 14: Generation ojdouble mutants, R722KlF730Y, R722QlF730Y, R7221YlF730Y and R722NlF730Y ojTne DNA polymerase For all mutations, the PCR method was used. A common 5'-oligo, CAC
CAG ACG GGT.4CCGCC ACT GGC AGG TTG (SEQ ID N0:30), was used.
This oligo contains a KpnI site (shown above in bold italics). The template used for PCR was pTT'QTneSeqSl (Example 13) which already contains the F730Y
mutation in the Tne polymerase gene. For the R722K/F730Y mutation, the oligo used was TAT AGA GTA GTT AAC CAT CTT TCC AAC CCG TTT CAT TTC
TTC GAA CAC (SEQ ID N0:31). For the R722Q/F730Y mutation, the oligo used was TAT AGA GTA GTTAAC CAT CTT TCC AAC CCG TTG CAT TTC
TTC GAA CAC (SEQ ID N0:32). For the R722N/F730Y mutation, the oligo used was TAT AGA GTAGTTAACCAT CTT TCC AAC CCG GTT CAT TTC
IS TTC GAA CAC (SEQ D7 N0:33) and for the R722H/F730Y the oligo used was TAT AGA GTA GTT AAC CAT CTT TCC AAC CCG ATG CAT TTC TTC
GAA CAC (SEQ ID N0:34). Each of these oligos contains a Hpal site (bold italics). The underlined codons were the mutated codons for arginine at the position 722 for respective amino acids. The PCR generated a 318 by product containing a Kpnl: and a Hpal site. The PCR products were digested with KpnI
and Hpal and cloned into pUC-TneFY digested with Kpni and HpaI to replace the original fragment to generate pUC 19TneFY-R722K, pUC 19TneFY-R722Q, pUCl9TneFY-R722H and pUCl9TneFY-R722N. Finally, the KpnI-HindIII
fragment (~800bp~) ofpTTQTneKasI(D137A) was replaced by the 800 by KpnI-HindIII fragment from these plasmids to generate pTnell (R722K/F730Y), pTnelO (R722Q/F730Y), pTnel3 (R722H/F730Y) and pTne9 (R722N/F739Y), respectively. The mutations were confirmed by DNA sequencing.

wo ~soso rc~r~s9sroz~9i Example 1 S: Generation of Tne DNA Polymerise mutants F730A and F730S
F730A was constructed using PCR. The forward oligo was AAG ATG
GTT AAC GCG T~CT ATA ATA TAC GG (SEQ ID N0:35) which contains a HpaI site and a MIuI site (bold italics). The reverse oligo was CAA GAG GCA
CAG AGA GTT TCA CC (SEQ D7 N0:36) which anneals downstream of SpeI
present in the Tne polymerise gene . The template used for PCR was pTTQTne KasI (D137A). The 482bp PCR product was digested with HpaI and SpeI and cloned into pUC-TneFY thereby replacing the amino acid tyrosine at position with alanine. This construct was called pUC-Tne FA.
IO F730S was constructed by site directed mutagenesis. The oligo was GTA
TAT TAT AGA GGA GTTAACCAT CTT TCC (SEQ >D N0:37) where aHpaI
site was created (bold italics). The single stranded DNA used was isolated from pSport-Tne that contains the double mutation D137A and D323A. This construct was designated pine 47. The Tne polymerise gene was then cloned as an SstI and HindIII fragment into the plasmid pUCl9 and the resulting clone was designated pTne101.
Example 16: Generation of Tne DNA polymerise with a Hpal site in front of the amino acid phenylalanine at position 730.
A construct of Tne polymerise was made using PCR where a HpaI
restriction enzyme site was introduced into the gene in front of the amino acid phenylalanine at position 730. The forward oligonucleotide was AAG ATG GTT
AACTTC TCT ATA ATA TAC GG (SEQ ID N0:38) which contains aHpaI site (shown above in bold italics) and the reverse oligo was the same as in Example above. The template used for PCR was pTne33 which contains the Tne polymerise gene with D137A and D323A mutations cloned in pUCl9. The 482bp PCR product was digested with HpaI and Spel and was used to replace the corresponding fragment in pTne101 (see example 15). The construct was wo ~so6o pcr~s~o2m sequenced to verify that the amino acid at position 730 was indeed phenylalanine and the plasmid was numbered pTne106.
Fxample 17: Generation ojdouble mutants R722YlF730A and R7Z2LlF730A
of the Tne DNA polymerise:
For both the mutations PCR method was used. The common 5' oligo was the same as in Example 14. For R722Y/F730A mutation the oligo used was TAT
AGA GTA GTT AAC CAT CTT TCC AAC CCG C~'TA CAT GTC TTC GTT
CAC (SEQ ID N~J:39). For R722L/F730A mutation the oiigo used was TAT
AGA GTA GTT AAC CAT CTT TCC AAC CCG CAA CAT GT C TTC GTT
CAC (SEQ ID N0:40). Each of these oligos contain a HpaI site (shown above in bold italics). The underlined codons were the mutated codons for arginine at the position 722 for respective amino acids. An AflnI site was also created (shown above in bold italics next to the underlined codon) in order to confirm the mutation. The PCR generated a 318 by product containing aKpnI and aHpaI site.
The PCR products were digested with KpnI and Hpal and cloned into pUC-TneFA (see example 15). The constructs were named as pUCTneYA and pUCTneLA.
Example 18: Generation of Tne DNA Polymerise mutants R722Y
and R722L
The plasmid pine 106 (see example 16) was digested with Hpal and KpnI
and the 318 by fragment was replaced with the corresponding fragment from pUCTneYA or pl:JCTneLA (see Example 17) to generate the mutants R722Y or R722L. In these constructs the amino acid at position 730 is the same as wild type Tne {phenylalanine). The constructs were sequenced to confirm the R722Y and the R722L mutations. The Tne DNA polymerise gene was then cloned as a SstIlHindIII fragment into the plasmid pSportl.

WO 98/35060 PCT/US98lOZ791 Example 19: Generation of Tne DNA Polymerise mutants R722K, R712Q
and R722H.
The construct pine 106 (see example 16) was digested with HpaI and Kpnl and the 318 by fragment was replaced with the corresponding fragment from the construct pUCl9TneFY-R722K, pUCl9TneFY-R722H or pTnelO (see Example 14), to generate the mutants R722K, R722H and R722Q. The constructs were sequenced to confirm the mutations. The Tne DNA polymerise gene was then subcloned into the vector pSportl as a SstIlHindIII fragment.
Example 20: Purification of the mutant Tne DNA Polymerises The purification of the mutants of Tne DNA polymerise was carried out based on the method described above with minor modifications. Two to three grams of cells expressing cloned mutant Tne DNA polymerise were resuspended in 15-20 ml of sonication buffer (50 n>IVI Tris-HCl , pH 8.0, 10% glycerol, SmM
2-mercaptoethanol, 50 mM NaCI, 1 mM EDTA, and 0.5 mM PMSF and sonicated with a 550 Sonic Dismembrator (Fisher Scientific). The sonicated sample was heated at 82°C for 20 min and then cooled in ice-water for 5 min.
In the sample, 20 mM NaCI and 0.2% PEI were added and centrifuged at 13,000 rmp for 10 min. Ammonium sulfate (305g/L) was added to the supernatant. The pellet was collected by centrifugation and resuspended in 4 ml of MonoQ column buffer (50 mM Tris-HCI, pH 8.0, 10% glycerol, SmM 2-mercaptoethanol, 50 mM
NaCI, and 1 mM EDTA). The sample was dialyzed against one litter of MonoQ
buffer oven~ight. Following the centrifugation at 13,000 rpm to remove any insoluble materials, the sample was loaded onto a MonoQ column (HRS/5, Phannacia). The column was washed with MonoQ column buffer to baseline of ODZBO and then eluted with a linear gradient of SO-300 mM NaCI in 20 ml MonoQ
column buffer. The fractions were analyzed by 8% SDS-PAGE and the Tne DNA

polymerise activity determined as described earlier. The fractions containing active and pure Tne DNA polymerise were pooled.
Example 21: Generation of Taq DNA Polymerise Mutants R659K, R6S9H
- and R6S9Y
g A 2.5 kb portion of the gene encoding Taq DNA polymerise (Figure 5) was cloned as a Hind III Xba I fragment into M13mp19. Site directed mutagenesis was performed using the BioRad mutagene kit (BioRad California) using the following oligonucleotides:
CTTGGC(~GCCCGATGCATCAGGGGGTC (SEQ ID N0:41) for the Rb59H mutation where an Nsi'I site was created (see bold italics);
CTTGGCCGCCCGCTTCATGAGGGGGTCCAC (SEQ ID N0:42) for the R659K mutation where a BspHI site was created (see bold italics); and CTTGGCCGCCCTGTACATCAGGGGGTC (SEQ LD N0:43) for the R659Y mutation where a BsrGI site was created (see bold italics).
For each mutation, six clones were screened by analyzing the M13RF
DNA for the expected restriction sites. Mutations were confirmed by DNA
sequencing. DNA, shown to contain the mutation by the presence of the expected restriction site was digested with NgoAIV and Xba I and the approximately 1600 base pair fragment was used to replace corresponding fragment in the wildtype Taq DNA polyme:rase gene. These constructs were made in a plasmid containing Taq polymerise gene under the control of Tic promoter (pTTQ Taq) to generate - pTTQ Taq (R65!~K), pTTQ Tag (R659H) and pTTQ Taq (R659Y). These plasmids were transformed into E. toll DH10B (LTI).

WO ~~ PCTIUS98/02791 Example22: Construction of Tnepolymerase mutants containing F730S and Single stranded DNA was isolated from pSportTne (Tne35) containing D137A
and D323A mutations as described in the section 2 of example 13. These D137 and D323A mutations rendered Tne DNA polymerise devoid of 5'-exonuclease and 3'-to-5'-exonuclease activities, respectively. Thus, Tne 3 5 is devoid of both exonuclease activities. The site-directed mutagenesis was done following the protocol decribed in section 3 ofExample 13. The oligos used were 5' GTA TAT
TAT AGA GGA GTT AAC CAT CTT TCC 3' (SEQ ID N0:37) for F730S and 5' GTA TAT TAT AGA GGT GTT AAC CAT CTT TCC 3' (SEQ ID N0:44) for F730T. Each of these two oligos contain a diagonistic HpaI site for screening of mutants in the MutS strain. The mutant plasmids were transferred to DH10B strains. The mutations were finally confirmed by DNA sequencing.
The mutant polymerises were purified by the procedure as described in Example 20.
Example 23: Determination of the Activity of Non-templated One Base Addition for Tne and Taq DNA Polymerise by Primer Fxtension Assay The following 34-mer primer was 3zP labeled at the 5' end with [y-3iP]
ATP and T4 polynucleotide kinase by standard protocol (Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor, N~:
5'-GGGAGACCGGAATTCTCCTTCATTAATTC~CTATA-3' (SEQ ID N0:45) The unincorporated ATP was removed by a BioRad P6 column(1.0 ml). The labeled primer was annealed to the following homogenous (purified) 48-mer template:

wo ~3so6o rcr~s9sroZrm 5'-TGGAGACCC'TGGAACTATAGGAATTAATGAAGGAGAATTCCGGT
CTCCC-3' (SEQ ID N0:46).
Wildtype or mutant DNA polymerases (0.125-1.0 unit) were incubated at 72° C far 2 min in 20 mM Tris-HCl (pH8.3), 1.5 mM MgCl2, SO mM KCI, 1.0 mM DTT, 200 uM of dCTP, dGTP, TTP, dATP, and 0.02 pmol of the annealed primer-template. After addition of sequencing stop buyer and heated at 90°C for 2 min, the mixture was loaded onto 10% polyacrylamide-7 M urea. Following the electrophoresis, the gel was dried and the reaction products were analyzed by autoradiography. The non-templated one base addition products shown in Figure 6 were quantified by a PhosphorImager (Molecular Dynamics).
Tne DNA polymerases °/. of N+1 1 D137A 18.5 2 D 137A D323A 78.5 3 D137A D323A R722K 0.7 4 D137A D323A R722Y 0.7 5 D137A D323A R722L 5.7 6 D137A D323A R722H 1.2 7 D137A D323A R722Q 1.4 8 D137A D323A F730Y 61.3 9 D137A D323A 8722 K F730Y 6.8 10 D137A D323A R722H F730Y 2.1 11 D137A D323A R722Q F730Y 6.1 12 D137A D323A R722N F730Y 15.9 13 D137A D323A F730S 8.3 14 D137A D323A F730T 24.2 Taq DNA Polymerises % of N+1 1 W.T. 37 2 R659K 1.4 3 R659Y 0.9 4 R659H 0.5 5 F667Y 39.1 Example 24: Comparison of DNA Synthesis by Taq and Tne To examine its propensity to add a nontemplated nucleotides to the 3' termini of PCR products, Tne DNA polymerise (5'exo', 3'exo ) was compared side-by-side with Taq DNA polymerise in amplifications of short tandem repeats at 23 different marker loci (see Table 1). Reactions comprising 20 mM TRIS-HCI, pH 8.4, 50 mM KCI, 1.5 mM MgCl2, 200 mM each dNTP, 200 nM [3xP]
ac-dATP, 200 nM each of the upper and lower primers, 25 ng of human DNA, 0.1% nonionic detergent and 1 unit of DNA polymerise (in a volume of 25 ml) were assembled on ice. Published sequences for upper and lower primers for each locus, as shown in Table 1, were used for all amplifications.
Reactions were loaded into a Perkin Elmer model 9600 thermocycler preheated to 94°C and PCR was done using standard cycling conditions ( 1 minute pre-denaturation at 94°C; 30 cycles of 30 seconds at 94°C, 30 seconds at 55°C, and 1 minute at 72°C; 1 minute post-extension at 72°C; overnight soak at 4°C).
A portion of each reaction was mixed with an equal volume of 95% formamide containing dyes to indicate the progress of electrophoresis. Samples were heated to 90°C for 2 min, and 5 ml of each was loaded on a 6% denaturing polyacrylamide gel. Sequencing ladders were loaded to provide size markers, and electrophoresis was performed at 70 watts. After electrophoresis the gel was transferred to filter paper and dried. Autoradiography and phosphoimage analysis was performed to visualize the PCR products and estimate the percentage of wo 9sr~so6o rc~r~rs9srozm product which contained the added nucleotide by direct comparison of bands produced by each enzyme.
Examples of the side-by-side comparisons of amplification products produced by Taq DNA polymerise and Tne DNA polymerise are shown in Figure 7 for the C:D4 locus and in Figure 8 for the D20S27 locus. At both of these loci, a significant portion of the Taq PCR product contained an extra non-templated nucleotide (n+1), while Tne polymerise demonstrated no apparent non-templated nucleotide incorporation for either the CD4 locus (Figure 7) or the D20S27 locus (Figure 8). Complete results for the 23 marker foci examined are summarized in Table 2. In PCRs using Taq DNA poiymerase, a portion of the amplification product contained an extra non-templated nucleotide (n+1) at every locus examined. an PCRs using Tne DNA polymerise, however, no detectable portion of the product at any of the loci examined contained an additional non-templated nucleotide. These results indicate that Tne DNA polymerise, in contrast to Taq DNA polymerise, is substantially reduced in the ability to add a nontemplated 3' tE;rminal nucleotide to the growing strand. Since the Tne DNA
polymerise used in these amplifications was a 3'exo- mutant (i.e., it was substantially reduced in 3' exonuclease activity), these results are consistent with the notion that the Tne polymerise was unable to add the extra nucleotide to the product rather khan adding the nucleotide and then removing it via a 3' exonuclease activity.

WO 98I3~60 PCT/US98I02791 _78_ o.

o, N
.w a a a ~ ~ ~ ~ ~ ~ ~. ~ ~ Ov ~ ~ ~ ~ T
,_, .r ~-. N .r ,~, .", n ..w v .-.' ~, ,~, '..
v 00 Ov O p~ .~ 00 P ~; ,.., N Gv Ov e~~f ~ ~ Ov Ow0 p~ p~ l~ M N
M Oy.r~ OWD N y~ O M M M N M M M M M vD v1 M
~D M l~ d' ~ Ov N N M M ~ ~ ~ f ~1 ~ ~ M M
c0 ~o e0 ~ q ~0 60 N ~ ~O V~ V~~ '" W y ~ °O aD ~ ~ m a C
..,."~"N.."' '"pvN~Nf~ r~' ~ N_'~'NN ~~~V
~ ri h ri ri e~ ~ O e.~ IW or h d 1W i ~i tv tW i ~%.
Ci N N ~ C1 ii 01 N op ~ w ,~ ~ ~ ~ ~ ~ ~ ..: w ~ (y' j~
d ;Q ~ ~ 0~1 ;Q ~ ~ h ~ ;Q ~ ~ ~ ;~ ~ 0~1 ~ ;~ d d r "u~~~~C~~u o~ ~C~C~ u~ C~u'uC7C~~vo ~c ~c ~ ~ ~c ~c ~ y ~ ~c ~ ~ ~ ~c ~ ~ ~c ~ ~ ~ ~ ~ ~c w ~ a o $ a ~ a ~ ~ ~ ~ ~ ~ ~ E ~ a a ~ $ ~ a a a z z z z z z z ~ x z ~ ~ ~ z ~ ~ ~ z z z ~ z z a U a N a E... U V ,°o ~ V vo ° t~ ~ ~ r°°- a°o N O
f, a ~ ~ E.U..' I-. C7 V C7 ° ~"'~' ~ U E-a-~ Q O ~ °°
°° U V Q
U ~ a a ~ U H
V V HHE.U,.. ~~U HUF'~Q U a U~UE'~U"'Fa"
a U C7 C5 a ~ U ~ ~ ~ Ca7 ~ ~ a ~Ø., E.a..~U~UQ~ VOQQQ
U U U ~ O C7 U (-~~ ~.C7, a a E"' H c~ E""
a U a U ~ a a U H U
Q ~ ~ Q ~ ~ " ca7 v c.7 H ~ a H c~7 ~ Q ~ ~ ~ a ~ ~ ~ a v a U a v E-.
U a O a ~ f-~ a O O a a U U U ~ U U
d ~ V I-~ U l~~ E~. ~ ~a.. a U a a IU-~ U ~ a Q E
FO-~~aaU~C7~a'°~Ca7QUaCH7~U
U ~ f-~ a ~ (-~ C7 U E~~ U ~ f-~ C7 a ~ ~ a a U H U ~-. a M
v t-~ v~ Q Q '~ o U ~° ~ ~ a ~ ~ °° ~ o°~o a Q O V ~ V U ~ ~ Ea., fa V U H V U "~ ~ U E...
H E~~ ~ F~ a vo H U U a V ~ Ca7 C. x O C~7 Iw" f-O. C~,7 ~ Q ~"' U ~ ~ ~.,U., C7 U V C7 ~ U a ~ U O ~ ~ a U U Q C~~ U U ~ ~ E"" y'a" ~ U
W~~ h"~C~.7 ~""V ~C~7~Ca.7HUC~7 V~OUO~C~7Q
W rn E., ~ U ~ f-~~ f-. U Q E-~ a a U a U ~ Q Q ~ Ca.7 H~ a ~ O ~ E-~ ~ t-~ f-.
a H a H ~ ~ ~ H ~' Q '~ ~ a ~ a ~ ~ H a U C7 C7 f-~ l-~~ f_~ O (~j U ~ ~ E-~ C7 ~ U U C7 C7 (-y ~ ~ ~ a Q U H U Q U C7 a Q E~Q~~ H ~ ~ a U H ~ U
m a C7 H ~ U E-~ U ~ f-~ E-~ U U ~ U V C7 o ~ a ~ a ~ U ~ a a a ~ U U U ~ U ~ ~ a ~ ~ U a U a ~r L
~I M n ~O a W N 1~ N o0 N Ov O O st N
,p 1~ O a0 M a I~ N .-n Ov o0 ~ ~ ~ Vj C/~
a ~ v) ~ v~ ~ v~ ~ o ~ V7 ~ O ~ ~D ~ VW o ~o ~ a A A a U a, o ~ ~ a a ~ a A ~ o a $ a o c ~ Q
N N

Wrp 9g~3~ PCT/US98102791 Table 2. Non-templated 3' Terminal Nucleotide Addition by Taq and Tne DNA Polymerasea at 23 Microsatellite DNA Loci.
Locus Re eat a T % n+1 Tne % n+1 D 13 S71 dinucleotide 100 0 D 1 S 103 dinucleotide 75-100 0 D15S87 dinucleotide 30-50 0 D2S136 dinucleotide 90-100 0 HUMCD4 entanucleotide50 0 HtJMPLA2A trinucleotide 25 0 D19S49 dinucleotide 75 0 D4S175 dinucleotide 75 0 APOC2AC dinucleotide 50 0 D20S27 dinucleotide 50 0 D 15 S 127 dinucleotide 100 0 D4S398 dinucleotide 50 0 APOC2 dinucleotide 50 0 DlOS89 dinucleotide 75-100 0 HLJMVWA tetranucleotide90 0 D16S401 dinucleotide 100 0 D7S440 dinucleotide 90 0 D4S174 dinucleotide 75 0 D16S520 dinucleotide 100 0 D16S511 dinucleotide 100 0 HC1MD21 S tetranucleotide100 0 ~:fUMTH01 tetranucleotide75 0 I~1MACTBP2 tetranucleotide25 0 Example 2S: Comparison of DNA Synthesis by Tne and Other Thermostable En,~ynes To further evaluate the differences in the propensities of Tne and other thermostable DNA polymerises to add non-templated 3' ternzinal nucleotides to PCR products, side-by-side amplifications were performed using a single marker locus D 1 S 103 and a variety of thermostable enzymes, including 3' exonuclease deficient (3'exo-) enzymes, and 3' exonuclease competent (3'exo+) enzymes. PCR
amplifications, electrophoresis and analysis were performed as described for Example 24, using 200 nM of D 1 S 103-specific upper and lower primers.
Results for the amplifications using 3'exo- DNA polymerises are shown in Table 3 . With the exception of Tne(3'exo-), all of the 3'exo- DNA
polymerises examined exhibited a propensity to add a non-templated 3' terminal nucleotide (n+1) to the PCR product. For Taq and Tbr DNA polymerises, up to 100% of the PCR products contained an additional non-templated 3' terminal nucleotide, while Vent, Deep Vent, and Dtok 3'exo- mutants polymerises added this non-templated nucleotide to 25-100% of the PCR products. In contrast, the 3'exo mutant of Tne DNA polymerise was substantially reduced in the ability to add a nontemplated 3' terminal nucleotide to the DNA molecule; none of the PCR
products from reactions using Tne(3'exo-) had an additional non-templated nucleotide at their 3' termini.
Results from amplifications using 3'exo+ DNA polymerises are shown in Table 4. Five polymerises were examined as well as two commercially available enzyme mixes (mixtures of a primary 3'exo- polymerise and a secondary 3'exo+
polymerise). At this locus, the 3'exo+ DNA polymerises (Tne, Tma, Pfu, Pwo and 9°North) yielded product which did not contain an extra non-templated nucleotide. The enzyme nuxtlares (Elar~gase and Expand HiFi) yielded a mixture of products with and without an additional non-templated nucleotide. Together, these results indicate that Tne polymerises, whether 3'exo- or 3'exo+, are substantially reduced in the ability to add a nontemplated 3' terminal nucleotide to the DNA molecule. Moreover, of the preferred 3'exo- polymerises, only Tne(3'exo-) was substantially reduced in this activity, indicating its favorableness _81 _ in PCR applications where non-templated nucleotide addition to the amplification ' product is undesirable.
Table 3. Non-templated 3' Terminal Nucleotide Addition by 3'ezo-DN.A Polymerises.
E a n Sized Fra went n+1 Sized Fra went Tne 3'exo- + -Ta - +

Vent 3'exo- + +

Dee Vent 3'exo- + +

Dtok 3'exo- + +

ThermolaseTbr - +

Table 4. Non-templated 3' Terminal Nucleotide Addition by 3'eio+
DNA Polymerises.
En me n Sized Fra ment n+1 Sized Fra went Tne(3'exo+ + -UlTma + _ p~ + -pW,o + _ 9North + _ Elon a + +

Ex and HiFi + +

Example 26: Comparison of DNA Synthesis by Tne Mutants To examine the utility of Tne DNA polymerise and various mutants thereof in amplification of microsatellite DNA sequences, the experiments described in Example 25 were repeated with 1 I different Tne DNA polymerise mutants. Of these mutants, 3 were 5'exo+, while the remainder were 5'exo-either due to N-terminal deletions of the protein, or to point mutations in the 5' exonuclease domain of the polymerase.
As shown in Table 5, use of the 5'exo- Tne mutants resulted in productive amplifications, yielding PCR products with no non-templated 3' terminal nucleotide additions. Results were identical for all seven Tne(3'exo-/5'exo-) polymerase mutants, as well as for the single Tne(3'exo+/S'exo-) mutant tested.
Results with 5'exo+ Tne mutants were inconclusive under the conditions tested.
These results indicate that the mutants of Tne DNA polymerase tested in the present studies are substantially reduced in the ability to add nontemplated 3' terminal nucleotides to the growing strand, particularly a DNA template comprising a microsatellite DNA sequence or an STR.
Table 5. Non-templated 3' Terminal Nucleotide Addition by Tne DNA
Polymerase Mutants Enzyme 5'ezo 3'eao n Sized n+1 Sized ActivityActivity Fra ment Fragment Tne N'0219, D323A- - + -Tne N'~283, D323A- - + -Tne N'~192, D323A- - + -Tne D137A, D323A- - + -Tne D8A, D323A - - + -Tne G195D, D323A- - + -Tne G37D, D323A - - + -Tne N'0283 - + + -wo ~3so6o rcr~s9srozr»

Example 27: Fluorescent Analysis oJDNA Synthesis by Tne and Taq DNA
Polymerises In an ah;ernative analysis approach, the propensities of Taq DNA
polymerise and :fne DNA polymerise to add non-templated nucleotides to the PCR products were compared using fluorescent detection. The polymerises were compared in side-by-side amplifications utilizing a commonly used commercially available marker panel (ABI Prism Linkage Mapping Set Panel 21 ), examining ten different loci. Reaction mixtures {15 ml) containing 1.5 mM MgCl2, 250 mM of each deoxynucleoside triphosphate, 333 nM of each primer, 50 ng of human DNA
and 0.6 units of :faq or Tne DNA polymerise were assembled on ice. Reactions were loaded into a Perkin Elmer model 9600 thermocycler preheated to 95°C, and PCR was performed using recommended cycling conditions (5 minutes pre-denaturation at 95°C; 10 cycles of 15 seconds at 95°C, 15 seconds at 55°C, and 60 seconds at 72"C; and 20 cycles of 15 seconds at 89°C, 15 seconds at 55°C, and 60 seconds at 72°C). Two sets of extension reactions were conducted for each locus, one with a 10 minute post-extension incubation at 72°C followed by an overnight soak and storage at 4°C (conditions which favor nontemplated 3' nucleotide addit:ion), the other with no post-extension incubation followed by immediate storage at -20°C (conditions which inhibit nontemplated 3' nucleotide addition). A portion of each reaction was diluted, mixed with loading cocktail, heat denatured and loaded on an 8% polyacrylamide sequencing gel. The ABI
373 Stretch Automated Sequencer was run for S-6 hours at 15W in order to obtain single base resolution, and data were analyzed using GeneScan software.
Areas of the peaks recognized by the software were used to estimate the percentage of nontemplated 3' nucleotide addition ("n+1 ") for each locus by the two polymerises under the two different extension conditions. The total area under the allelic; peaks was used to compare the yields of specific PCR
product obtained in Tne and Taq amplifications, and yields produced by Tne polymerise were expressed for each locus as a percentage of those produced by Taq polymerise. Table 6 summarizes the results obtained.

Table 6. Comparison of DNA Amplification by Taq and Tne DNA
Polymernses by Fluorescent Detection locus color expected cycling Taq ?he Tyee size conditions pattern pattern yield (°k D16S40 blue 107-145 no final 06 n+ 10096 8996 ext 1 n 5 10' final94~ n+1 10096 178 n ext D 15S green 114-148 no final 53 6 100 133 12 ext n + ~ n 96 7 10' final10096 100 142 n ext n+ 1 D 16552yellow144-160 no final 40 ~ 98 96 275 ext n+ 1 n 9b 0 10' final10096 1009& 2529&
n ext n+ 1 D I6S51green 182-222 no final 62 ~ 100 51 ext n + 9b 6 1 n 1 10' final10096 1009& 160 n ext n+ 1 D16541 blue 215 235 no final 09b n+ 1009& 2189&
ext 1 n 1 10' final6496 100 2579&
n+ 1 n ext 679& 9596 3059&
n+ 1 0 10' final ext D 1 yellow237-275 no final 0 b n 100 48 SS ext + 1 ~ n ~

1 I O' final69 ~ 95 ~ 231 n+ 1 n o ext D 15S blue 280-294 no final 0 ~ n 100 101 13 ext + 1 ~ n ~

D16S50 yellow294-310 no final 096 n+ 10096 10296 ext 1 n 3 10' final73 6 100 166 n+ I 96 ~
n ext D 15S green 316-334 no final 17 9b 100 130 11 ext n + 96 ~
1 n 7 10' final779& 1009& 3269&
n+1 n ext D 16551blue 320-350 no final 32 b 100 486 ext n + ~ n ~

5 10' final100 R6 1009& 298 n o ext n+ 1 The results shown in Table 6 confirm that under conditions favoring (" 10' final ext") or inhibiting ("no final ext") 3' nontemplated nucleotide addition, Tne DNA polymerise produced PCR products that were 95-100% free from non-templated nucleotide addition ("n") for each locus examined. Taq DNA
polymerise, however, demonstrated significant addition of nontemplated nucleotides under inhibiting conditions in most loci tested, while under permissive conditions well over half, and in some cases all, of the PCR product produced by Taq DNA polymerise demonstrated an additional nontemplated 3' nucleotide.
Furthermore, under most conditions the amount of PCR product yielded by Tne DNA polymerise was at feast as high as that of Taq DNA polymerise, and for some loci was 3- to 4-fold higher.
Figure 9 shows two examples of electropherogram gel scans, aligned by PCR product size, comparing the PCR products obtained with Taq and Tne polymerises with a 10-minute final extension. For the D15S153 locus, Taq exhibited non-templated nucleotide addition to 40% of the PCR product (Figure 39), while Tne exhibited no such addition of non-templated nucleotides (Figure 98). Similar results were obtained with the D 15 S 127 locus: 53 % of the Taq PCR
products demonstrated non-templated nucleotide addition (Figure 9C), while none ofthe Tne PCRproducts demonstrated non-templated nucleotide addition (Figure 9D). These results demonstrate the difficulty in identifying alleles in a heterogeneous pattern as generated by Taq amplification, compared to the more homogeneous, simple pattern generated by amplification with Tne.
Together with Examples 24-26, these results indicate that Tne DNA
polymerise and t:he mutants thereof tested in the present studies are substantially reduced in the ability to add a nontemplated 3' terminal nucleotide to DNA
templates, particularly DNA templates comprising microsatellite DNA sequences or STRs. Conversely, Taq DNA polymerise demonstrates significant addition of nontemplated 3' nucleotides to PCR products.

Example 28: Comparison of Taq and Tne To examine the ability of a truncated form of Tne DNA polymerise (N'0283, 5'exo-, 10% 3'exo activity) to add a nucleotide to the end of the PCR
product, the enzyme was compared side-by-side with wild type Taq DNA
polymerise in amplifications of short tandem repeats at 5 different marker loci.
A portion of ABI Prism Linkage Mapping Set Panel 21 was used for the primer sets for the loci. 15 ul reactions (20 mM Tris-HCI, pH 8.4, 50 mM KCI, 1.5 mM
MgCl2, 200 uM each dNTP, 333 nM each primer, 60 ng human DNA, 0.1%
nonionic detergent, 0.6 U DNA polymerise) were assembled on ice.
Reactions were loaded into a Perkin Elmer model 9600 thermocycler preheated to 95 °C and PCR was done using recommended cycling conditions (5 min. pre-denaturation at 95°C; 10 cycles of 1 S sec at 95°C, 15 sec at 55 °C, and 60 sec at 72 °C; 20 cycles of 15 sec at 89 °C, 15 sec at 5 S
°C, and 60 sec at 72°C;
lOmin final extension at 72°C). A portion of each reaction was diluted, mixed with loading cocktail, heat denatured and loaded on a 8% sequencing gel. The ABI 373 Stretch Automated Sequencer was run for 5-6hr at 15W in order to obtain lbase resolution. Data was analyzed using GeneScan software. Areas of the peaks recognized by the software were used to estimate the percent of extranucleotide addition. Table 7 summarizes the results obtained. Examples of the electropherogram data is shown in Figure 10.
Table 7: Percent eitranucleotide addition eihibited by Taq and Tne DNA polymerises at specific loci.
Locus Taq(% n+1) Tne(% n+1) Example 29: Comparison of Tne Mutants In order to evaluate the effect of amino acid substitutions in T»e DNA
polymerise in regard to extra nucleotide addition, different mutations at position F730 in the untruncated polymerise were compared in side-by-side amplifications with Taq(wild type) and a truncated Tne(N'A219, D323A, F730~ utilizing a portion of ABI Prism Linkage Mapping Set Panel 21. Six loci were examined.
ul reactions (20 mM Tris-HCI, pH 8.4, 50 mM KCI, 1.5 mM MgCl2, 200 uM
each dNTP, 333 nM each primer, SO-60 ng human DNA, 0.1% nonionic 10 detergent, 0.15-0,.6 U DNA polymerise) were assembled on ice.
Reactions were loaded into a Perkin Elmer model 9600 thermocycler preheated to 95 °C: and PCR was done using recommended cycling conditions (5 min. pre-denaturaxion at 95°C; 10 cycles of 1 S sec at 95°C, 15 sec at 55 °C, and 60 sec at 72 °C; f.0 cycles of 15 sec at 89 °C, 15 sec at 5 5 °C, and 60 sec at 72°C;

15 l Omin final extension at 72°C). A portion of each reaction was diluted, mixed with loading cocktail, heat denatured and loaded on a 8% sequencing get. The ABI 373 Stretch Automated Sequencer was run for 5-6hr at 15W in order to obtain lbase resolution. Data was analyzed using GeneScan software. Areas of the peaks recognized by the software were used to estimate the percent of extranucleotide addition. Table 8 summarizes the results obtained. An example of the electropherogram data is shown in Figure 11.

_gg_ M

o ,~ O o a a a a o r"" O

A O O O O L' O O

a v ~ a O ,_, O o a o 0 0 0 A ~

O O O O C O O

d Q N

yr ~ a O

O o 0 o a o a O

C~ O O O O ~ O O

M

O

A ~1 O O O O O O O
A

d ~.

v r ~

_ O

'~tL~ O ~ N O O O O

O~

'Zt v V1 "' O
la et \

\ \ \ \ \ \
A ~ O O O O C O O

iii U

N

O M M M M
O ~
M n ~ I~ I~

0~

_ C~
Q

N N N N N N

A A A A A

Q

~_ ~

V ~ N ~ ~ ~ ~ ~ ~ -l lw C CI

.y ~ ~ ~ ~ ~ A

~

00 ~ ~ v~ oo ~ ~ r o0 H H H H H H H

~n o wo ~so6o rc~r~s9sroz~9i Example 30: Comparison of Tne and Taq Mutants In order to evaluate the effect of amino acid substitution at position F667 in Taq DNA polyinerase(equivalent to F730 in Tne DNA polymerise) in regard to extra nucleotide addition, a commercially available mutant of Taq DNA
polymerise (Taq FS) (N'~3, G46D, F667Y~ was compared in side-by-side amplifications with Taq DNA polymerase(wild type) acid Tne-1 DNA
poiymerase(N'A2119, D323A, F730~. Three loci were examined (a portion of ABI Prism Linkage Mapping Set Panel 21 ). 15 ul reactions (20 mM Tris-HCI, pH
8.4, 50 mM KCI, 1.5 mM MgCh, 200 uM each dNTP, 333 nM each primer, 60 ng human DNA, 0.1 % nonionic detergent, 0.6 U DNA polymerise) were assembled on ice.
Reactions were loaded into a Perkin Elmer model 9600 thermocycler preheated to 95 °C; and PCR was done using recommended cycling conditions (5 min. pre-denaturation at 95°C; 10 cycles of I5 sec at 95 °C, 15 sec at 55 °C, and 60 sec at 72 °C; 20 cycles of 15 sec at 89 °C, 15 sec at 55 °C, and 60 sec at 72 °C;
l Omin final extension at 72 °C). A. portion of each reaction was diluted, mixed with loading cocktail, heat denatured and loaded on a 8% sequencing gel. The ABI 373 Stretch Automated Sequencer was run for 5-6hr at 15W in order to obtain Ibase resolution. Data was analyzed using CieneScan software. Areas of the peaks recognized by the software were used to estimate the percent of extranucleotide addition. Table 9 summarizes the results obtained. Examples of the electropherogram data are shown in Figure 12.

wo ~so6o pcr~rs9sror9i Table 9: Percent eatranucleotide addition exhibited by Taq and Tne DNA polymerises at specific loci.
locus Taq(% n+1) TaqFS(% n+1) Tne-1(%
n+1 Example 31: Comparison o~'Tne Mutants In order to evaluate the effect of amino acid substitutions at position 8722 in Trre DNA polymerise in regard to extranucleotide addition, different mutations in the polymerise were compared in side-by-side amplifications utilizing a portion of ABI Prism Linkage Mapping Set Panel 21. Six loci were examined. 15 ul reactions (20 mM Tris-HCI, pH 8.4, SO mM KCI, 1.5 mM MgCl2, 200 uM each dNTP, 333 nM each primer, SO-60 ng human DNA, 0.1% nonionic detergent, 0.2-0.6 U DNA polymerise) were assembled on ice.
Reactions were loaded into a Perkin Elmer model 9600 thermocycler preheated to 95 °C and PCR was done using recommended cycling conditions (5 min. pre-denaturation at 95°C; 10 cycles of 15 sec at 95 °C, 15 sec it 55 °C, and 60 sec at 72 °C; 20 cycles of 15 sec at 89 °C, 15 sec at 55 °C, and 60 sec at 72 °C;
l Omin final extension it 72 °C}. A portion of each reaction was diluted, mixed with loading cocktail, heat denatured and loaded on a 8% sequencing gel. The ABI 373 Stretch Automated Sequencer was run for 5-6hr at 15W in order to obtain lbase resolution. Data was analyzed using GeneScan software. Heights of the n and n+1 peaks recognized by the software were used to estimate the percent of extranucleotide addition. Table 10 summarizes the results obtained.
An example of the electropherogram data is shown in Figure 13.

wo ~so6o rcTnrsrm _91 _ M

a \ ~ a o L~ O O O O O O

..i v ~n O

a a o 0 o a \ \ \ \ \ \
O

A O O O O O

d.

w O

~ '~ e a ~ o o o O ""
O" M

z a ~ ~

H

w O

o a a o 0 0 ~' \ \ \ \ \

,p A V~1 O O O O O

b .r O

a O O O O O

A O O O O O O

'd ~

N N N N

f3~i ~ C~ GG CG

V
_ ~ Q
d y0, N N N N N N

A A A A A A

O
~ ~ r ~ ~ r y M M M M M M
V

i. r.
A A A A A

0 ;.i~ O ~ .~., w.- mr ~r y H H H ~ H
H

Example 32: Generation of Tne DNA Polymerise Mutant K726R
The mutation of the Tne polymerise was done by essentially the same procedure as described above in Example 13. The single-stranded DNA was isolated from pSport-Tne containing D137A and D323A mutations. The oligonucleotide used for the mutagenesis was 5'-GAA GTT CAC CAT CCG GCC
GAC CCG TCG CAT TTC 3' (SEQ 1D N0:93). An XmaIII site (bold italics in the above sequence) was introduced into the oligonucleotide for easy screening of the mutants. The mutation was confirmed by DNA sequencing. The clone was .
named pTne129 (D137A, D323A, K726R).
Example 33: Determination of the Activity of Non-templated One Base Addition for Tne DNA Polymerise and itc Mutant D137A, D323A, K726R, by Primer Extension Assay The mutant Tne DNA polymerise (Tne D137A, D323A, K726R) prepared in Example 32 was purified as described in Example 20. The assay for non-templated one base addition was conducted as described in Example 23. The results were as follows:
Tne DNA Polymerise % of Product With N+1 D137A, D323A 78.4 D137A, D323A, R722H 1.7 D137A, D323A, K726R 0.9 These results demonstrate that mutation of the lysine residue at position 726 of Tne, particularly to arginine, substantially reduces the activity of the polymerise in adding non-templated bases.
Having now fully described the present invention in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious to one of ordinary skill in the art that the same can be performed by modifying or changing the invention within a wide and equivalent range of conditions, formulations and other parameters without affecting the scope of the invention or _ any specific embodiment thereof, and that such modifications or changes are intended to be encompassed within the scope of the appended claims.
All publications, patents and patent applications mentioned in this specification are :indicative of the level of skill of those skilled in the art to which this invention pertains, and are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and 14 individually indicated to be incorporated by reference.

PCT/US98~2791 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Life Technologies, Inc.
S (B) STREET: 9800 Medical Center Drive (C) CITY: Rockville (D) STATE: Maryland (E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 20850 (ii) TITLE OF INVENTION: Polymerases for Analyzing or Typing Polymorphic Nucleic Acid Fragments and Uses Thereof (iii) NUMBER OF SEQUENCES: 93 (iv) COMPUTER READABLE FORM:
iS (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO) (v) CQRRENT APPLICATION DATA:
(A) APPLICATION NUMBER:(To be assigned) (B) FILING DATE: (Herewith) (vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US (To be assigned) (B) FILING DATE: 06-JAN-1998 ZS (vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/037,393 (B) FILING DATE: 07-FEB-1997 (2) INFORMATION FOR SEQ ID NO: l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2682 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
3S (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

GGCTGTGGCC

GGCGCAAAGG

' CCAAAGACTC CGGCTCTTC'T AGTTCAGCAG CTACCTTACA TCAAGCGGCT 300 GATAGAAGCT

CGCCACGCTT

S ~pGTCpGGG CTGCACGT1'T TTTGATGAGA Z'ZZTCATTAA TRACCGGTGA 4 CA7~1GGATATG 2 CTTCAACZTG TAIiACGAGAA GATAAAGGTC TGGAGAATCG TCAAGGGGAT 480 ATCGGATCTT

GAGCTZ'1'ACG ATTCGAAAAA GGTGAAAGAA AGATACGGTG TGGAACCACA 540 TCAGATACCG

GGGAATAGGT

TCTGGAGCAT

IO GCCCGTGAAC TCCCCCAGA,G AGTGAGAAAG GCTCTCTI'GA GAGACAGGGA 720 AGTTGCCATC

CTGGGAAGAG

ATGAAATACA GAGGATACGA C'~1~~,7AGAAAA CTACTTCCGA TATTGAAAGA840 GCTTCCATCA TGAAGGAAC'.T TCAACTGTAC GAAGAAGCAG AACCCACCGG 900 ATACGAAATC

TCCATCT1'TT

IS GCCCTGGACC TTGAAACGT'C CTCCCTI'GAC CCGTTCAACT GTGAGATAGT 1020 CGGCATCTCC

CGCCCAGAAT

CTTGATGAAA CACTGGTGCT GTCGAAGTTG ~1AAGAGATCC TCGAAGACCC 1140 GTCTTCGAAG

ATrGTGGGTC AGAACCTGAA GTACGACTAC AAGGTTCTTA TGGTAAAGGG 1200 TATATCGCCA

GTITATCCGC ATrTTGACAC GATGATAGCT GCATATTTGC TGGAGCCAAA 1260 CGAGAAAAAA

TTATCAGGRA

GGTAGACAAG

GCTGCGAACT ACTCCTGCCaA GGATGCAGAC ATCACTTATA GGCTCTACAA 1440 GATACTCAGC

ATGAAGCTCC ATGAAGCG(''A ACTTGAGAAC GTCTTCTACA GGATAGAGAT 1500 GCCGTTGGTG

AACGTZ'CT!'G CACGCATGGA ATTGAACGGG GTGTATGTGG ACACAGAATT 1560 CCTGAAAAAG

ZS CTCTCGGAGG AGTACGGG'~A AAAGCTCGAG GAACTGGCCG AAAAAATCTA 1620 CCAGATAGCA

GGTGAGCCCT TCAACATCi4A TTCTCCAAAA CAGGTTTCAA AGATCCTTT"1' TGAGAAGCTG 1680 GGAATAAAAC CCCGTGGAiAA AACGACAAAA ACAGGAGAGT ACTCTACCAG GATAGAGGTG 1740 TTGGA3~GAGA TAGCGAAT~~.~A GCACGAGATA GTACCCCTCA TTCTCGAGTA C:~~GAAAGATC 1800 WO ~~~ PCT/US98/02791 AGAATTCATG CATCTTTCCA CCAGACGGGT ACCGCCACTG GCAGGTZ'GAG TAGCAGTGAT 1920 AAAAGCGATT

AGAACTCAGA

GGGCATCGAT

GTGCACACCT TGACTGCCTC CAGGATCTAC AACGTAAAGC C:~~(~AAGAAGT 2160 GAACGAAGAA

ACCGTACGGT

CAGCTATTTC

~

lU GGCTACGTCA GGACTCTCTT TGC~AAGAAAA AGAGATATTC CCCAGCTCAT 2400 GGCAAGGGAC

GGGAACGGCG

AAGAAACATG

CGATGAGGAA

1~~~AGAAGAAC TAGTTGATCT GGTGAAGAAC AAAATGACAA ATGTGGTGAA 2640 ACTCTCTGTG

(2) INFORMATION FOR SEQ ID N0:2:

(i) SEQOENCE CHARACTERISTICS:

(A) LENGTH: 893 amino acids (8) TYPE: amino acid (C) STRANDFDNESS: aot relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (xi) SEQDENCE DESCRIPTION: SEQ ID N0:2:
Met Ala Arg Leu Phe Leu Phe E.~p Gly Thr Ala Leu Ala Tyr Rrg Ala _ Tyr Tyr Ala Leu Asp Arg Ser Leu Ser Thr Ser Thr Gly Ile Pro Thr Asn Ala Val Tyr Gly Val Ala Arg Met Leu Val Lys Phe Ile Lys Glu His Ile Ile Pro Lys Glu Asp Tyr Ala Ala Val Ala Phe Asp Lye Lys Ala Ala Thr Phe His Lys LeuVal Ser Asp Lys Ala Gln Arg Leu Arg _ 65 70 75 80 $ pro Lys Thr Pro Leu Leu GlnGln Leu Pro Tyr Ile Lys Ala Val Arg Leu Ile Glu Ala Gly Phe ValLeu Glu Leu Glu Gly Tyr Leu Lys Glu Ala Asp Asp Ile Ala Thr AlaVal Arg Ala Ala Rrg Phe Ile Leu Leu 11s 120 12s Met Arg Phe Ser Ile Thr AspLys Asp Met Leu Gln Leu Leu Gly Val Asn Glu Lys Ile Val Trp IleVal Lys Gly Ile Ser Asp Lys Arg Leu Glu Leu Tyr Asp Lys Lys LysGlu Arg Tyr Gly Val Glu Ser Val Pro His Gln Ile Pro Leu Leu LeuThr Gly Asp Asp Ile Asp Asp A1'a Asn Ile Pro Gly Val. Gly Ile GluLys Thr Ala VaI Gln Leu Thr Gly Leu Gly Lys Tyr Arg Leu Glu IleLeu Glu His Ala Arg Glu Asn Tyr Leu Pro Gln Arg Val. Lys Ala LeuArg Asp Arg Glu Val Ala Arg Leu Ile Leu Ser Lys Lys Leu Ala Thr Leu Val Thr Asn Ala Pro Val Glu Val Asp Trp Glu Glu Met Lys Tyr Arg Gly Tyr Asp Lys Arg Lys Leu Leu Pro Ile Leu Lys Glu Leu Glu Phe Ala Ser Ile Met Lys Glu Leu Gln Leu Tyr Glu Glu Ala Glu Pro Thr Gly Tyr Glu Ile Val Lys Asp His Lys Thr Phe Glu Asp Leu Ile Glu Isys Leu Lys Glu Val Pro Ser Phe Ala Leu Asp Leu Glu Thr Ser Ser Leu Asp Pro Phe Asn Cys Glu Ile Val Gly Ile Ser Val Ser Phe Lys Pro Lys Thr Ala Tyr Tyr Ile Pro Leu His His Arg Asn Ala Gln Asn Leu Asp Glu Thr Leu Val Leu Ser Lye Leu Lys Glu Ile Leu Glu Asp Pro Ser Ser Lys Ile Val Gly Gln Asn Leu Lys Tyr Asp Tyr Lys Val Leu Met Val Lys Gly Ile Ser Pro Val Tyr Pro His Phe Asp Thr Met Ile Ala Ala Tyr Leu Leu Glu Pro 1~ 405 410 415 Asn Glu Lys Lys Phe Asn Leu Glu Asp Leu Ser Leu Lys Phe Leu Gly Tyr Lys Met Thr Ser Tyr Gln Glu Leu Met Ser Phe Ser Ser Pro Leu 1S Phe Gly Phe Ser Phe Ala Asp Val Pro Val Asp Lys Ala Ala Asn Tyr Ser Cys Glu Asp Ala Asp Ile Thr Tyr Arg Leu Tyr Lys Ile Leu Ser Met Lys Leu Hie Glu Ala Glu Leu Glu Asn Val Phe Tyr Arg Ile Glu Met Pro Leu Val Asn Val Leu Ala Arg Met Glu Leu Asn Gly Val Tyr Val Asp Thr Glu Phe Leu Lys Lys Leu Ser Glu Glu Tyr Gly Lys Lys ZS Leu Glu Glu Leu Ala Glu Lys Ile Tyr Gln Ile Ala Gly Glu Pro Phe Asn Ile Asn Ser Pro Lys Gln Val Ser Lys Ile Leu Phe Glu Lys Leu Gly Ile Lys Pro Arg Gly Lys Thr Thr Lys Thr Gly Glu Tyr Ser Thr Arg Ile Glu Val Leu Glu Glu Ile Ala As:~ Glu His Glu Ile Val Pro Leu Ile Leu Glu Tyr Arg Lys Ile Gln Lys Leu Lys Ser Thr Tyr Ile 35 Asp Thr Leu Pro Lys Leu Val Asn Pro Lys Thr Gly Arg Ile His Ala Ser Phe His Gln Thr Gly Thr Ala Thr Gly Arg Leu Ser Ser Ser Asp gyp 9g/3~ PCT/I1S98/02791 Pro Aen Leu Gln Asn Leu Pro Thr Lys Ser Glu Glu Gly Lye Glu Ile Arg Lys Ala Ile Val Pro Gln Asp Pro Asp Tzp Trp Ile Val Ser Ala $ 660 665 670 Asp Tyr Ser Gln. Ile Glu Leu Arg Ile Leu Ala His Leu Ser Gly Asp Glu Asn Leu Val Lys Ala Phe Glu Glu Gly Ile Asp Val His Thr Leu Thr Ala Ser Arg Ile Tyr Asn Val Lys Pro Glu Glu Val Asn Glu Glu Met Arg Arg Val. Gly Lys Met Val Asn Phe Ser Ile Ile Tyr Gly Val Thr Pro Tyr Gly Leu Ser Val Arg Leu Gly Ile Pro Val Lys Glu Ala is 74C1 745 750 Glu Lys Met Ile: Ile Ser Tyr Phe Thr Leu Tyr Pro Lys Val Arg Ser Tyr Ile Gln Gln Val Val Ala Glu Ala Lys Glu Lys Gly Tyr Val Arg Thr Leu Phe Gly LysArg Ile Pro Gln Arg Asp Arg Asp Leu Met Ala Lys Asn Thr Gln GluGly Rrg Ile Ala Asn ThrPro Ile Ser Glu Ile Gln Gly Thr Ala AspIle Lys Leu Ala Ile AspIle Asp Ala Ile Met Glu Glu Leu Arcl ArgAsn Lys Ser Arg Ile IleGln Val Lys Met Met His Asp Glu Leu PheGlu Pro Asp Glu Lys GluGlu Leu Val Val Glu Val Asp Leu Va:l AsnLye Thr Asn Val Lys LeuSer Val Lys Met Val Pro Leu Glu Val IleSer Gly Lys Ser Ser Asp Ile Trp (2) INFORMATION FOR SEQ ID N0:3:
3S ( i ) SEQUENCE CEiARACTERISTICS
(A) LENGTEI: 677 amino acids (B) TYPE: amino acid wo 9s~so6o p~.IyUS9~oz.m goo (C) STRANDEDNESS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
Met Ser Leu His Ala Arg Glu Leu Pro Gln Arg Val Arg Lys Ala Leu Leu Arg Asp Arg Glu VaI Ala Ile Leu Ser Lys Lys Leu Ala Thr Leu Val Thr Asn Ala Pro Val Glu Val Asp Trp Glu Glu Met Lys Tyr Arg 1~ 35 40 45 Gly Tyr Asp Lys Arg Lys Leu Leu Pro Ile Leu Lys Glu Leu Glu Phe Ala Ser Ile Met Lys Glu Leu Gln Leu Tyr Glu Glu Ala Glu Pro Thr IS Gly Tyr Glu Ile Val Lys Asp His Lys Thr Phe Glu Asp Leu Ile Glu Lys Leu Lys Glu Val Pro Ser Phe Ala Leu Ala Leu Glu Thr Ser Ser Leu Asp Pro Phe Asn Cys Glu Ile Val Gly Ile Ser Val Ser Phe Lys Pro Lys Thr Ala Tyr Tyr Ile Pro Leu His His Arg Asn Ala Gln Asn Leu Asp Glu Thr Leu Val Leu Ser Lys Leu Lys Glu Ile Leu Glu Asp 2S Pro Ser Ser Lys Ile Val Gly Gln Asn Leu Lys Tyr Asp Tyr Lys Val Leu Met Val Lys Gly Ile Ser Pro Val Tyr ~ ~iie Phe Asp Thr Met Ile Ala Ala Tyr Leu Leu Glu Pro Asn Glu Lya Lys Phe Asn Leu Glu Asp Leu Ser Leu Lys Phe Leu Gly Tyr Lys Met Thr Ser Tyr Gln Glu Leu Met Ser Phe Ser Ser Pro Leu Phe Gly Phe Ser Phe Ala Asp Val Wp gg~3~p PILT/US98J02791 Pro Val Asp Lys Ala Ala Asn Tyr Ser Cys Glu Asp Ala Asp Ile Thr Tyr Arg Leu Tyr Lys Ile Leu Ser Met Lys Leu His Glu Ala Glu Leu Glu Aen Val Phe Tyr Arg Ile Glu Met Pro Leu Val Asn Val Leu Ala Arg Met Glu Leu Aen Gly Val Tyr Val Asp Thr Glu Phe Leu Lys Lys Leu Ser Glu Glu Tyr Gly Lys Lys Leu Glu Glu Leu Ala Glu Lys Ile 1~ 305 310 315 320 Tyr Gln Ile Ala Gly Glu Pro Phe Asn Ile Asn Ser Pro Lys Gln Val Ser Lys Ile Leu. Phe Glu Lys Leu Gly Ile Lys Pro Arg Gly Lys Thr 15 Thr Lys Thr Gly Glu Tyr Ser Thr Arg Ile Glu Val Leu Glu Glu Ile Ala Asn Glu His Glu Ile Val Pro Leu Ile Leu Glu Tyr Arg Lys Ile Gln Lys Leu Lys Ser Thr Tyr Ile Asp Thr Leu Pro Lye Leu Val Asn Pro Lys Thr Gly Arg Ile His A1a Ser Phe His Gln Thr Gly Thr Ala Thr Gly Arg Leu Ser Ser Ser Asp Pro Asn Leu Gln Asn Leu Pro Thr 25 Lys Ser Glu Glu Gly Lye Glu Ile Arg Lys Ala Ile Val Pro Gln Asp Pro Asp Trp Trp Ile Val Ser Ala Asp Tyr Ser Gln Ile Glu Leu Arg Ile Leu Ser Gly Glu Asn Leu LysAla Glu Ala Asp Val Phe His Leu 3~ 465 470 475 480 Glu Gly Asp His Thr Thr Ala Ser IleTyr Val Ile Val Leu Arg Asn Lys Pro Glu Asn Glu Met Arg Arg GlyLys Val Glu Val Glu Val Met 35 Asn Phe Ile Tyr Gly Thr Pro Tyr LeuSer Arg Ser Ile Val Gly Val Leu Gly Ile Pro Val Lys Glu Ala Glu Lys Met Ile Ile Ser Tyr Phe wo 9si3so6o rcr~rs9sroz?9i Thr LeuTyr ProLysVal ArgSerTyr Gln Gln Val Ala Ile Val Glu Ala LysGlu LysGlyTyr ValArgThr Phe Gly Lys Arg Leu Arg Asp 565 5?0 575 Ile ProGln LeuMetAla ArgAepLys Thr Gln Glu Gly Asn Ser Glu Arg IleAla IleAsnThr ProIleGln Thr Ala Asp Ile Gly Ala Ile 1~ Lys LeuAla MetIleAsp IleAspGlu Leu Arg Arg Asn Glu Lys Met Lys SerArg MetIleIle GlnValHis Glu Leu Phe Glu Asp Val Val Pro AspGlu GluLysGlu GluLeuVal Leu Val Asn Lys Asp Lys Met Thr Asn Val Val Lys Leu Ser Val Pro Leu Glu Val Asp Ile Ser Ile Gly Lys Ser Trp Ser 2U (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 610 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant 25 (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (xi) SEQOENCE DESCRIPTION: SEQ ID N0:4:
Met Lys Glu Leu Gln Leu Tyr Glu Glu Ala Glu Pro 1'hr Gly Tyr Glu Ile Val Lys Asp His Lys Thr Phe Glu Asp Leu Ile Glu Lys Leu Lys Glu Val Pro Ser Phe Ala Leu Ala Leu Glu Thr Ser Ser Leu Asp Pro Phe Asn Cys Glu Ile Val Gly Ile Ser Val Ser Phe Lys Pro Lys Thr WO 9g~3sp(,p PCT/US98I02791 Ala Tyr Tyr IlePro Arg Gln Leu Glu Leu Asn Asn Aep His Ala Hie Thr Leu LeuSer Leu Glu Leu Glu Pro Ser Val Lys Lys Ile Asp Ser $ Lys Ile GlyGln Leu Tyr Tyr Lys Leu Val Val Asn Lys Asp Val Met Lys Gly SerPro Tyr His Asp Thr Ile Ala Ile Val Pro Phe Met Ala Tyr Leu Leu Glu Pro Phe LeuGlu Ser Asn Asn Asp Glu Leu Lys Lys 1~ 130 135 140 Leu Lys Phe Leu.Gly Lys Met Ser GlnGlu Leu Ser Tyr Thr Tyr Met Phe Ser Ser Pro Leu Gly Phe Phe AspVal Pro Asp Phe Ser Ala Val 15 Lys Ala Ala Asn Tyr C'ys Glu Ala IleThr Tyr Leu Ser Asp Aep Arg Tyr Lys Ile Leu Ser Lys Leu Glu GluLeu Glu Val Met Hie Ala Asn Phe Tyr Arg Ile Glu Pro Leu Asn LeuAla Arg Glu Met Val Val Met Leu Asn Gly Val Tyr Val Asp Thr Glu Phe Leu Lys Lys Leu Ser Glu Glu Tyr Gly Lys Lye Leu Glu Glu Leu Ala Glu Lys Ile Tyr Gln Ile 25 Ala Gly Glu Pro Phe Asn Ile Aen Ser Pro Lys Gln Val Ser Lys Ile Leu Phe Glu Lys Leu Gly Ile Lys Pro Arg Gly Lys Thr Thr Lys Thr Gly Glu TyrSe:r Thr Arg GluVal Leu Glu IleAlaAsn Ile Glu Glu ' 30 290 295 300 His Glu IleVal Pro Leu LeuGlu Tyr Arg IleGlnLys Ile Lys Leu Lys Ser ThrTyr Ile Asp LeuPro Lys Leu AsnProLys Thr Val Thr - 35 Gly Arg IleHis Ala Ser HisGln Thr Gly AlaThrGly Phe Thr Arg Leu Ser SerSe.r Asp Pro LeuGln Asn Leu ThrLysSer Asn Pro Glu Glu Gly Lys Glu Ile Arg Lys Ala Ile Val Pro Gln Asp Pro Asp Tzp Trp Ile Val Ser Ala Asp Tyr Ser Gln Ile Glu Leu Arg Ile Leu Ala His Leu Ser Gly Asp Glu Asn Leu Val Lys Ala Phe Glu Glu Gly Ile Asp Val His Thr Leu Thr Ala Ser Arg Ile Tyr Asn Val Lys Pro Glu 1~ Glu Val Asn Glu Glu Met Arg Arg Val Gly Lye Met Val Asn Phe Ser Ile Ile Tyr Gly val Thr Pro Tyr Gly Leu Ser Val Arg Leu Gly Ile 1S Pro Val Lys Glu Ala Glu Lys Met Ile Ile Ser Tyr Phe Thr Leu Tyr Pro Lys Val Arg Ser Tyr Ile Gln Gln Val Val Ala Glu Ala Lys Glu Lys Gly Tyr Val Arg Thr Leu Phe Gly Arg Lys Arg Asp Ile Pro Gln Leu MetAlaArg AspLys Thr Ser GluGly Arg Ala Asn Gln Glu Ile Ile AsnThrPro IleGln Thr Ala AspIle Lys Ala Gly Ala Ile Leu ZS Met IleAspIle AspGlu Leu Lys ArgAsn Lys Arg Glu Arg Met Ser Met IleIleGln ValHis Glu Val PheGlu Pro Glu Asp Leu Val Asp Glu LysGluGlu LeuVal Leu Lys AsnLys Thr Val Asp Val Met Asn Val LyeLeuSer ValPro Glu Asp IleSer Gly Ser Leu Val Ile Lys Txp Ser 3S (2) INFORMATION FOR SEQ ID NO: S:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 708 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant - (D) TOPOLOGY: not relevant ' (ii) MOLECULE TYPE: protein $ (xi) SEQUENCE DESCRIPTION: SEQ ID NO: S:
Met Asn Ser Ser Ser Val Pro Ile Pro Gly Val Thr Gly Ile Gly Glu Lys Thr Ala Val Gln Leu Leu Gly Lys Tyr Arg Asn Leu Glu Tyr Ile Leu Glu His Glu Pro Gln LeuLeu Ala Arg Leu Arg Val Arg Lys Ala Arg Asp Arg GluValAla Leu Ser Lys Leu ThrLeuVal Ile Lys Ala Thr Asn Ala ProValGlu Asp Trp Glu Met TyrArgGly Val Glu Lys ss 70 75 80 Tyr Asp Lys ArgLysLeu Pro Ile Lys Glu GluPheAla Leu Leu Leu Ser Ile Met LysGluLeu Leu Tyr Glu Ala ProThrGly Gln Glu Glu Tyr Glu Ile ValLysAsp Lys Thr Glu Asp IleGluLys His Phe Leu Leu Lys Glu Val,ProSer Ala Leu Leu Glu SerSerLeu Phe Ala Thr Asp Pro Phe AsnCysGlu Val Gly Ser Val PheLyePro Ile Ile Ser Lys Thr Ala TyrTyrIle Leu His Arg Asn GlnAsnLeu Pro His Ala . 165 170 175 Asp Glu Thr Leu Leu Ser LeuLys Glu LeuGlu Asp Val Lys Ile Pro - 30 Ser Ser Lys Ilfa Gly Gln LeuLys Tyr TyrLys Val Val Asn Asp Leu Met Val Lys Gl~,r Ser Pro TyrPro His AspThr Met Ile Val Phe Ile y _ 215 220 Ala Ala Tyr Leu Leu Glu Pro Aen Glu Lys Lye Phe Aen Leu Glu Asp wo 9sr~so6o rcTms9sroim Leu Ser Leu Lys Phe Leu Gly Tyr Lys Met Thr Ser Tyr Gln Glu Leu Met Ser Phe Ser Ser Pro Leu Phe Gly Phe Ser Phe Ala Asp Val Pro Val Asp Lys Ala Ala Asn Tyr Ser Cys GIu Asp Ala Asp Ile Thr Tyr Arg Leu Tyr Lys Ile Leu Ser Met Lys Leu His Glu Ala Glu Leu Glu Asn Val Phe Tyr Arg Ile Glu Met Pro Leu Val Asn Val Leu Ala Arg Met Glu Leu Asn Gly Val Tyr Val Asp Thr Glu Phe Leu Lys Lys Leu Ser Glu Glu Tyr Gly Lys Lys Leu Glu Glu Leu Ala Glu Lys Ile Tyr 1$ 340 345 350 Gln Ile Ala Gly Glu Pro Phe Asn Ile Asn Ser Pro Lye Gln Val Ser Lys Ile Leu Phe Glu Lys Leu Gly Ile Lys Pro Arg Gly Lys Thr Thr Lys Thr Gly Glu Tyr Ser Thr Arg Ile Glu Val Leu Glu Glu Ile Ala Asn Glu His Glu Ile Val Pro Leu Ile Leu Glu Tyr Rrg Lys Ile Gln Lys Leu Lys Ser Thr Tyr Ile Asp Thr Leu Pro Lys Leu Val Asn Pro Lys Thr Gly Arg Ile His Ala Ser Phe His Gln Thr Gly Thr Ala Thr Gly Arg Leu Ser Ser Ser Asp Pro Asn Leu Gln Asn Leu Pro Thr Lys Ser Glu Glu Gly Lys Glu Ile Arg Lys Ala Ile Val Pro Gln Asp Pro Asp Tip Trp Ile Val Ser Ala Asp Tyr Ser Gln Ile Glu Leu Arg Ile Leu Ala Hie Leu Ser Gly Asp Glu Asn Leu Val Lys Rla Phe Glu Glu 3$ 500 505 510 Gly Ile Asp val His Thr Leu Thr Ala Ser Arg Ile Tyr Asn Val Lys WO 98/35060 PCT/US98/02~91 Pro Glu Glu Val Glu Glu Arg Val Gly Lys Met Asn Asn Met Arg Val Phe Ser Ile Ile Gly Val Pro Gly Leu Ser Val Leu Tyr Thr Tyr Arg $ 545 550 555 560 Gly Ile Pro Val Glu Ala Lys Ile Ile Ser Tyr Thr Lys Glu. Met Phe Leu Tyr Pro Lys Arg Ser Ile Gln Val Val Ala Ala Val Tyr Gln Glu 1~ Lys Glu Lys Gly Val Arg Leu Gly Arg Lys Arg Ile Tyr Thr Phe Asp Pro Gln Leu Met. Ala Arg Asp Lys Asn Thr Gln Ser Glu Gly Glu Arg Ile Ala Ile Asn Thr Pro Gln Gly Thr Ala Ala Asp Lys Ile Ile Ile 1$ 625 630 635 640 Leu Ala Met Ile Asp Ile Glu Glu Leu Arg Lys Arg Lys Asp Asn Met Ser Arg Met Ile Ile Gln His Asp Glu Leu Val Phe Pro Val Glu Val 2~ Asp Glu Glu LYF3 Glu Glu Leu Val Asp Leu Val Lys Asn Lye Met Thr Asn Val Val Ly~a Leu Ser Val Pro Leu Glu Val Asp Ile Ser Ile Gly Lys Ser Trp Ser 2$ 705 (2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 893 amino acids (B) TYPE: amino acid 30 (C) STRANDEDNESS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
Met Ala Arg Leu Phe Leu Phe Asp Gly Thr Ala Leu Ala Tyr Arg Ala WO ~~ PCT/US98/02791 Tyr Tyr Ala Leu Asp Arg ser Leu Ser Thr Gly Pro Thr Ser Thr Ile Asn Ala Val Tyr Gly Val Ala Arg Met Leu Phe Lys Glu Val Lys Ile His Ile Ile Pro Glu Lys Asp Tyr Ala Ala Phe Lys Lye Val Ala Asp Ala Ala Thr Phe Arg His Lys Leu Leu Val Ser Asp Lys Ala Gln Arg Pro Lys Thr Pro Ala Leu Leu Val Gln Gln Leu Pro Tyr Ile Lys Arg Leu Ile Glu Ala Leu Gly Phe Lys Val Leu Glu Leu Glu Gly Tyr Glu loo los lla Ala Asp Asp Ile Ile Ala Thr Leu Ala Val Arg Ala Ala Arg Phe Leu Met Arg Phe Ser Leu Ile Thr Gly Ala Lys Asp Met Leu Gln Leu Val Asn Glu Lys Ile Lye Val Trp Arg Ile Val Lys Gly Ile Ser Asp Leu GIu Leu Tyr Asp Ser Lys Lys Val Lys Glu Arg Tyr Gly Val Glu Pro His Gln Ile Pro Asp Leu Leu Ala Leu Thr Gly Asp Asp Ile Asp Asn Ile Pro Gly Val Thr Gly Ile Gly Glu Lys Thr Ala Val Gln Leu Leu Gly Lys Tyr Arg Asn Leu Glu Tyr Ile Leu Glu His Ala Arg Glu Leu Pro Gln Arg Val Arg Lys Ala Leu Leu Arg Asp Arg Glu Val Ala Ile Leu Ser Lys Lys Leu Ala Thr Leu Val Thr Asn Ala Pro Val Glu Val Asp Trp Glu Glu Met Lys Tyr Arg Gly Tyr Asp Lys Arg Lys Leu Leu Pro Ile Leu Lys Glu Leu Glu Phe Ala Ser Ile Met Lys Glu Leu Gln Leu Tyr Glu Glu Ala Glu Pro Thr Gly Tyr Glu Ile Val Lys Asp His Lys Thr Phe Glu Asp Leu Ile Glu Lys Leu Lys Glu Val Pro Ser Phe Ala Leu Ala Leu Glu Thr Ser Ser Leu Asp Pro Phe Asn C'~s Glu Ile Val Gly Ile Ser Val Ser Phe Lys Pro Lys Thr Ala Tyr Tyr Ile Pro Leu His His Arg Asn Ala Gln Asn Leu Aep Glu Thr Leu Val Leu Ser Lys Leu Lys Glu Ile Leu Glu Asp Pro Ser Ser Lys Ile Val Gly Gln Asn Leu Lys Tyr Asp Tyr Lys Val Leu Met Val Lys Gly Ile Ser Pro Val Tyr Pro His Phe Asp Thr Met Ile Ala Ala Tyr Leu Leu Glu Pro 1$ 405 410 415 Asn Glu Lys Lys Phe Asn Leu Glu Asp Leu Ser Leu Lys Phe Leu Gly Tyr Lys Met Thr Ser Tyr Gln Glu Leu Met Ser Phe Ser Ser Pro Leu Phe Gly Phe Ser Phe Ala Asp Val Pro Val Asp Lys Ala Ala Asn Tyr Ser C'ys Glu Asp Ala Asp Ile Thr Tyr Arg Leu Tyr Lys Ile Leu Ser Met Lys Leu His Glu Ala Glu Leu Glu Asn Val Phe Tyr Arg Ile Glu Met Pro Leu Asn LeuAla ArgMetGlu Leu Gly ValTyr Val. Val Asn Val Asp Thr Phe LysLys LeuSerGlu Glu Gly LysLys Glu Leu Tyr Leu Glu Glu Ala LysIle TyrGlnIle Ala Glu ProPhe Leu Glu Gly Asn Ile Asn Pro GlnVal SerLysIle Leu Glu LysLeu Ser Lys Phe Gly Ile Lys Arg LysThr ThrLysThr Gly Tyr SerThr Pro Gly Glu ' 35 565 570 575 Arg Ile Glu Leu GluIle AlaAsnGlu His Ile ValPro VaJL Glu Glu Leu Ile Leu Glu Tyr Arg Lys Ile Gln Lys Leu Lys Ser Thr Tyr Ile Asp Thr Leu Pro Lys Leu Val Asn Pro Lys Thr Gly Arg Ile His Ala $ 610 615 620 Ser Phe His Gln Thr Gly Thr Ala Thr Gly Arg Leu Ser Ser Ser Asp Pro Asn Leu Gln Aen Leu Pro Thr Lys Ser Glu Glu Gly Lys Glu Ile 1~ Arg Lys Ala Ile Val Pro Gln Asp Pro Asp Trp Trp Ile Val Ser Ala Asp Tyr Ser Gln Ile Glu Leu Arg Ile Leu Ala His Leu Ser Gly Asp Glu Asn Leu Val Lys Ala Phe Glu Glu Gly Ile Asp Val His Thr Leu 1$ 690 695 700 Thr Ala Ser Arg Ile Tyr Asn Val Lys Pro Glu Glu Val Asn Glu Glu Met Arg Arg Val Gly Lys Met Val Asn Phe Ser Ile Ile Tyr Gly Val 2~ Thr Pro Tyr Gly Leu Ser Val Arg Leu Gly Ile Pro Val Lye Glu Ala Glu Lys Met Ile Ile Ser Tyr Phe Thr Leu Tyr Pro Lys Val Arg Ser Tyr Ile Gln Gln Val VaI Ala Glu Ala Lys Glu Lys Gly Tyr Val Arg Thr Leu Phe Gly Arg Lys Arg Asp Ile Pro Gln Leu Met Ala Arg Asp Lys Asn Thr Gln Ser Glu Gly Glu Arg Ile Ala Ile Asn Thr Pro Ile 30 Gln Gly Thr Ala Ala Asp Ile Ile Lys Leu Ala Met Ile Asp Ile Asp Glu Glu Leu Arg Lys Arg Asn Met Lys Ser Arg Met Ile Ile Gln Val His Asp Glu Leu Val Phe Glu Val Pro Asp Glu Glu Lys Glu Glu Leu Val Asp Leu Val Lys Asn Lys Met Thr Rsn Val Val Lye Leu Ser Val WO 9$/35060 PCT/US98/02791 Pro Leu Glu Val Asp Ile Ser Ile Gly Lys Ser Trp Ser g85 890 (2) INFORMATION FOR SEQ ID N0:7:
~ $ ( i ) SEQUENCE CID1R,ACTERISTICS
(A) LENGTH: 893 amino acidB
(B) TYPE: amino acid (C) STRAND33DN8SS : not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (xi) SEQUENCB DESCRIPTION: SEQ ID N0:7:

Met Ala Arg Leu Phe Leu Phe Ala Gly Thr Ala LeuAlaTyr Arg Ala Tyr Tyr Ala Leu Asp Arg Ser Leu Ser Thr Ser ThrGlyIle Pro Thr 1$ 20 25 30 Asn Ala Val Tyr Gly Val Ala Arg Met Leu Val LysPheIle Lys Glu His Ile Ile Pro Glu Lys Asp Tyr Ala Ala Val AlaPheAsp Lys Lys 2~ Ala Ala Thr Phe Arg His Lys Leu Leu Val Ser Asp Lys Ala Gln Arg Pro Lys Thr Pro Ala Leu Leu Val Gln Gln Leu Pro Tyr Ile Lys Arg Leu Ile Glu Ala Leu Gly Phe Lys Val Leu Glu Leu Glu Gly Tyr Glu 2$ loo l05 llo Ala Asp Asp Ile Ile Ala Thr Leu Ala Val Arg Ala Ala Arg Phe Leu Met Arg Phe Ser Leu Ile Thr Gly Asp Lys Asp Met Leu Gln Leu Val Asn Glu Lys Ile Lys Val Trp Arg Ile Val Lys Gly Ile Ser Asp Leu Glu Leu Tyr Asp Ser Lys Lys Val Lys Glu Arg Tyr Gly Val Glu Pro His Gln Ile Pro Aep Leu Leu Ala Leu Thr Gly Asp Asp Ile Asp Asn WO 98135060 PCT/US98/b2791 Ile Pro Gly Val Thr Gly Ile Gly Glu Lys Thr Ala Val Gln Leu Leu Gly Lys Tyr Arg Asn Leu Glu Tyr Ile Leu Glu His Ala Arg Glu Leu Pro Gln Arg Val Arg Lys Ala Leu Leu Arg Asp Arg Glu Val Ala Ile Leu Ser Lys Lys Leu Ala Thr Leu Val Thr Asn Ala Pro Val Glu Val Asp Trp Glu Glu Met Lys Tyr Arg Gly Tyr Asp Lys Arg Lys Leu Leu Pro Ile Leu Lys Glu Leu Glu Phe Ala Ser Ile Met Lys Glu Leu Gln Leu Tyr Glu Glu Ala Glu Pro Thr Gly Tyr Glu Ile Val Lys Asp His 15 Lys Thr Phe Glu Asp Leu Ile Glu Lys Leu Lys Glu Val Pro Ser Phe Ala Leu Ala Leu Glu Thr Ser Ser Leu Asp Pro Phe Asn Cys Glu Ile Val Gly Ile Ser Val Ser Phe Lys Pro Lys Thr Ala Tyr Tyr Ile Pro 2~ 340 345 350 Leu His His Arg Asn Ala Gln Asn Leu Asp Glu Thr Leu Val Leu Ser Lys Leu Lys Glu Ile Leu Glu Asp Pro Ser Ser Lys Ile Val Gly Gln 25 Asn Leu Lys Tyr Asp Tyr Lys Val Leu Met Val Lys Gly Ile Ser Pro Val Tyr Pro His Phe Asp Thr Met Ile Ala Ala Tyr Leu Leu Glu Pro Asn Glu Lys Lys Phe Asn Leu Glu Asp Leu Ser Leu Lys Phe Leu Gly Tyr Lys Met Thr Ser Tyr Gln Glu Leu Met Ser Phe Ser Ser Pro Leu Phe Gly Phe Ser Phe Ala Asp Val Pro Val Asp Lys Ala Ala Asn Tyr 35 Ser Cys Glu Asp Ala Asp Ile Thr Tyr Arg Leu Tyr Lys Ile Leu Ser Met Lys Leu His Glu Ala Glu Leu Glu Asn Val Phe Tyr Arg Ile Glu WO 98/35060 PCT/US98I02'791 Met Pro Leu Val Aen Val Leu Ala Arg Met Glu Leu Asn Gly Val Tyr Val Asp Thr Glu Phe Leu Lys Lys Leu Ser Glu Glu Tyr Gly Lys Lys $ 515 520 525 Leu Glu Glu Leu Ala Glu Lys Ile Tyr Gln Ile Ala Gly Glu Pro Phe Asn Ile Asn Ser Pro Lys Gln Val Ser Lys Ile Leu Phe Glu Lys Leu Gly Ile Lys Pro Arg Gly Lys Thr Thr Lys Thr Gly Glu Tyr Ser Thr Arg Ile Glu Glu Ala Glu Glu Ile Val Leu Glu Ile Asn His Val Pro Leu Ile Leu Glu Tyr Lys Gln LeuLyeSer ThrTyr Arg Ile Lys Ile 1$ 595 600 605 Asp Thr Leu Pro Lys Val Pro ThrGlyArg IleHie Leu Asn Lys Ala Ser Phe His Gln Thr Thr Thr ArgLeuSer SerSer Gly Ala Gly Asp Pro Asn Leu Gln Asn Pro Lys GluGluGly LysGlu Leu Thr Ser Ile Arg Lys Ala Ile Val Gln Pro TrpTrpIle ValSer Pro Asp Asp Ala Asp Tyr Ser Gln Ile Leu Ile AlaHieLeu SerGly Glu Arg Leu Asp 2$ 675 680 685 Glu Asn Leu Va:1 Lys Phe Glu IleAspVal HisThr Ala Glu Gly Leu Thr Ala Ser Arg Ile Tyr Asn Val Lys Pro Glu Glu Val Asn Glu Glu 3~ Met Arg Arg Val Gly Lys Met Val Asn Phe Ser Ile Ile Tyr Gly Val Thr Pro Tyr Gly Leu Ser Val Arg Leu Gly Ile Pro Val Lys Glu Ala Glu Lys Met Ile Ile Ser Tyr Phe Thr Leu Tyr Pro Lys Val Arg Ser 3$ 755 760 765 Tyr Ile Gln Gln Val Val Ala Glu Ala Lys Glu Lys Gly Tyr Val Arg Thr Leu Phe Gly Arg Lys Arg Asp Ile Pro Gln Leu Met Ala Rrg Asp Lys Asn Thr Gln Ser Glu Gly Glu Arg Ile Ala Ile Asn Thr Pro Ile Gln Gly Thr Ala Ala Asp Ile Ile Lys Leu Ala Met Ile Asp Ile Asp Glu Glu Leu Arg Lys Arg Asn Met Lys Ser Arg Met Ile Ile Gln Val His Asp Glu Leu Val Phe Glu Val Pro Asp Glu Glu Lys Glu Glu Leu Val Asp Leu Val Lys Asn Lys Met Thr Asn Val Val Lys Leu Ser Val Pro Leu Glu Val Asp Ile Ser Ile Gly Lys Ser Trp Ser (2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 893 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
Met Ala Arg Leu Phe Leu Phe Asp Gly Thr Ala Leu Ala Tyr Arg Ala Tyr Tyr Ala Leu Asp Arg Ser Leu Ser Thr Ser Thr Gly Ile Pro Thr Asn Ala Val Tyr Gly Val Ala Ark wet Leu Val Lys Phe Ile Lys Glu His Ile Ile Pro Glu Lys Asp Tyr Ala Ala Val Ala Phe Asp Lys Lys Ala Ala Thr Phe Arg His Lys Leu Leu Val Ser Asp Lys Ala Gln Arg Pro Lys Thr Pro Ala Leu Leu Val Gln Gln Leu Pro Tyr Ile Lys Arg WO 98/35060 ~ PCT/US98/02?91 ' Leu Ile Glu Ala Leu Gly Phe Lys Val Leu Glu Leu Glu Gly Tyr Glu Ala Asp Asp Ile Ile Ala Thr Leu Ala Val Arg Ala Ala Arg Phe Leu Met Arg Phe Ser Leu Ile Thr Gly Asp Lys Asp Met Leu Gln Leu Val Asn Glu Lys Ile Lys Val Tzp Arg Ile Val Lys Gly Ile Ser Asp Leu Glu Leu Tyr Asp Ser Lys Lys Val Lys Glu Arg Tyr Gly Val Glu Pro Hie Gln Ile Pro Asp Leu Leu Ala Leu Thr Gly Asp Asp Ile Asp Asn Ile Pro Asp Val. Thr Gly Ile Gly Glu Lye Thr Ala Val Gln Leu Leu Gly Lys Tyr Arg Asn Leu Glu Tyr Ile Leu Glu His Ala Arg Glu Leu Pro Gln Arg Va7. Arg Lys Ala Leu Leu Arg Asp Arg Glu Val Ala Ile Leu Ser Lys Lys Leu Ala Thr Leu Val Thr Asn Ala Pro Val Glu Val Asp Trp Glu Glu Met Lys Tyr Arg Gly Tyr Asp Lys Rrg Lye Leu Leu Pro Ile Leu Lys Glu Leu Glu Phe Ala Ser Ile Met Lys Glu Leu Gln 2$ 275 280 285 Leu Tyr Glu Glu Ala Glu Pro Thr Gly Tyr Glu Ile Val Lys Asp His Lys Thr Phe Glu Asp Leu Ile Glu Lys Leu Lys Glu Val Pro Ser Phe Ala Leu Ala Leu Glu Thr Ser Ser Leu Asp Pro Phe Asn Cys Glu Ile Val Gly Ile Se:r Val Ser Phe Lys Pro Lys Thr Ala Tyr Tyr Ile Pro Leu His His Arg Asn Ala Gln Asn Leu Asp Glu Thr Leu Val Leu Ser 3$ 355 360 365 Lye Leu Lys Glu Ile Leu Glu Asp Pro Ser Ser Lys Ile Val Gly Gln WO 98/35060 PGT/US98ro2791 Aen Leu Lys Tyr Asp Tyr Lys Val Leu Met Val Lys Gly Ile Ser Pro Val Tyr Pro His Phe Asp Thr Met Ile Ala Ala Tyr Leu Leu Glu Pro $ 405 410 415 Asn Glu Lys Lys Phe Asn Leu Glu Asp Leu Ser Leu Lys Phe Leu Gly Tyr Lys Met Thr Ser Tyr Gln Glu Leu Met Ser Phe Ser Ser Pro Leu 1~ Phe Gly Phe Ser Phe Ala Asp Val Pro Val Asp Lys Ala Ala Asn Tyr Ser Gars Glu Asp Ala Asp Ile Thr Tyr Arg Leu Tyr Lye Ile Leu Ser Met Lys Leu His Glu Ala Glu Leu Glu Asn Val Phe Tyr Arg Ile Glu 1$ 485 490 495 Met Pro Leu Val Asn Val Leu Ala Arg Met Glu Leu Asn Gly Val Tyr Val Asp Thr Glu Phe Leu Lys Lys Leu Ser Glu Glu Tyr Gly Lys Lye Leu Glu Glu Leu Ala Glu Lys Ile Tyr Gln Ile Ala Gly Glu Pro Phe Asn Ile Asn Ser Pro Lys Gln Val Ser Lys Ile Leu Phe Glu Lys Leu Gly Ile Lys Pro Arg Gly Lys Thr Thr Lys Thr Gly Glu Tyr Ser Thr Arg Ile,Glu Val Leu Glu Glu Ile Ala Asn Glu His Glu Ile Val Pro Leu Ile Leu Glu Tyr Arg Lys Ile Gln Lys Leu Lys Ser Thr Tyr Ile Asp Thr Leu Pro Lys Leu Val Asn Pro Lys Thr Gly Arg Ile His Ala Ser Phe His Gln Thr Gly Thr Ala Thr Gly Arg Leu Ser Ser Ser Asp Pro Asn Leu Gln Asn Leu Pro Thr Lys Ser Glu Glu Gly Lys Glu Ile Arg Lys Ala Ile Val Pro Gln Asp Pro Asp Tzp Trp Ile Val Ser Ala WO ~~ PCT1US98I02791 Asp Tyr Ser Gln Ile Glu Leu Arg Ile Leu Ala His Leu Ser Gly Asp Glu Asn Leu Val Lys Ala Phe Glu Glu Gly Ile Asp Val His Thr Leu Thr Ala Ser Arg Ile Tyr Aen Val Lys Glu Glu Asn Glu Pro Val Glu Met Arg Arg Val Gly Lys Met Val Asn Ser Ile Tyr Gly Phe Ile Val Thr Pro Tyr Gly Leu Ser Val Arg Leu Ile Pro Lys Glu Gly Val Ala 74 0~ 74 75 0 Glu Lys Met Ile: Ile Ser Tyr Phe Thr Leu Tyr Pro Lys Val Arg Ser Tyr Ile Gln Gln Val Val Ala Glu Ala Lys Glu Lys Gly Tyr Val Arg Thr Leu Phe Gly Arg Lys Arg IlePro Gln Ala Asp Leu Met Arg Asp Lys Asn Thr Gln Ser Glu Gly ArgIle Ala Asn ThrPro Glu Ile Ile Gln Gly Thr Ala Ala Asp Ile LysLeu Ala Ile AspIle Ile Met Aep Glu Glu Leu Ar<~ Lys Arg Asn LysSer Arg Ile IleGln Met Met Val Hie Asp Glu Leu Val Phe Glu ProAsp Glu Lys GluGlu Val Glu Leu Val Asp Leu Val Lys Asn Lys ThrAsn Val Lys LeuSer Met Val Val Pro Leu Glu Val Asp Ile Ser Ile Gly Lys Ser Trp Ser 3O (2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
' (A) LENGTH: 893 amino acids (B) TYPE: amino acid {C) STRANDEDNESS: not relevant ~ 35 (D) TOPOhOGY: not relevant (ii) MOLECULE TYPE: protein WO ~~~~ PGT/US98/02791 (xi) SEQUENCE DESCRIPTION: SfiQ ID N0:9:
Met Ala Arg Leu Phe Leu Phe Asp Gly Thr Ala Leu Ala Tyr Arg Ala Tyr Tyr Ala Leu Asp Arg Ser Leu Ser Thr Ser Thr Gly Ile Pro Thr Asn Ala Val Tyr Asp Val Ala Arg Met Leu Val Lys Phe Ile Lys Glu His Ile Ile Pro Glu Lys Asp Tyr Ala Ala Val Ala Phe Asp Lys Lys 1~ Ala Ala Thr Phe Arg His Lys Leu Leu Val Ser Asp Lys Ala Gln Arg Pro Lys Thr Pro Ala Leu Leu Val Gln Gln Leu Pro Tyr Ile Lys Rrg Leu Ile Glu Ala Leu Gly Phe Lys Val Leu Glu Leu Glu Gly Tyr Glu 15 loo l05 llo Ala Asp Asp Ile Ile Ala Thr Leu Ala Val Arg Ala Ala Arg Phe Leu Met Arg Phe Ser Leu Ile Thr Gly Asp Lys Asp Met Leu Gln Leu Val 2~ Asn Glu Lys Ile Lys Val Trp Arg Ile Val Lys Gly Ile Ser Asp Leu Glu Leu Tyr Asp Ser Lys Lys Val Lys Glu Arg Tyr Gly Val Glu Pro His Gln Ile Pro Asp Leu Leu Ala Leu Thr Gly Asp Asp Ile Asp Asn 25 180 18s 190 Ile Pro Gly Val Thr Gly Ile Gly Glu Lys Thr Ala Val Gln Leu Leu Gly Lys Tyr Arg Asn Leu Glu Tyr Ile Leu Glu His Ala Arg Glu Leu Pro Gln Arg Val Arg Lys Ala Leu Leu Arg Asp Arg Glu Val Ala Ile Leu Ser Lys Lys Leu Ala Thr Leu Val Thr Asn Ala Pro Val Glu Val Asp Trp Glu Glu Met Lys Tyr Arg Gly Tyr Asp Lys Arg Lys Leu Leu Pro Ile Leu Lys Glu Leu Glu Phe Ala Ser Ile Met Lys Glu Leu Gln Leu Tyr Glu Glu Ala Glu Pro Thr Gly Tyr Glu Ile Val Lys Asp Hie Lys Thr Phe Glu Asp Leu Ile Glu Lys Leu Lys Glu Val Pro Ser Phe S Ala Leu Ala Leu Glu Thr Ser Ser Leu Asp Pro Phe Asn Cys Glu Ile Val Gly Ile Ser Val Ser Phe Lye Pro Lye Thr Ala Tyr Tyr Ile Pro Leu His His Arg Asn Ala Gln Asn Leu Asp Glu Thr Leu Val Leu Ser 1~ 355 360 365 Lys Leu Lys Glu Ile Leu Glu Asp Pro Ser Ser Lys Ile Val Gly Gln Asn Leu Lys Tyr Asp Tyr Lys Val Leu Met Val Lys Gly Ile Ser Pro is Val Tyr Pro His Phe Asp Thr Met Ile Ala Ala Tyr Leu Leu Glu Pro Asn Glu Lys Lys Phe Asn Leu Glu Asp Leu Ser Leu Lys Phe Leu Gly Tyr Lys Met Thr Ser Tyr Gln Glu Leu Met Ser Phe Ser Ser Pro Leu Phe GlyPheSer PheAla ValPro Asp LysAlaAla AsnTyr Asp Val Ser CarsGluAsp AlaAsp ThrTyr Leu TyrLysIle LeuSer Ile Arg 465 4?0 475 480 25 Met LysLeuHis GluAla LeuGlu Val PheTyrArg IleGlu Glu Asn Met ProLeuVal AsnVal AlaArg Glu LeuAsnGly ValTyr Leu Met Val AspThrGlu PheLeu LysLeu Glu GluTyrGly LysLys Lye Ser Leu GluGluLeu AlaGlu IleTyr Ile AlaGiyGlu ProPhe Lys Gln Asn IleAsnSer ProLys ValSer Ile LeuPheGlu LysLeu Gln Lys 35 Gly IleLysPro ArgGiy ThrThr Thr GlyGluTyr SerThr Lys Lys PCTlUS98/02791 Arg Ile Glu Val Leu Glu Glu IIe AIa Asn Glu His Glu Ile Val Pro Leu Ile Leu Glu Tyr Arg Lys Ile Gln Lys Leu Lys Ser Thr Tyr Ile $ Asp Thr Leu Pro Lys Leu Val Asn Pro Lys Thr Gly Arg Ile His Ala Ser Phe His Gln Thr Gly Thr Ala Thr Gly Arg Leu Ser Ser Ser Asp Pro Asn Leu Gln Asn Leu Pro Thr Lys Ser Glu Glu Gly Lys Glu Ile Arg Lys Ala Ile Val Pro Gln Asp Pro Aep Trp Trp Ile Val Ser Ala Asp Tyr Ser Gln Ile Glu Leu Arg Ile Leu Rla His Leu Ser Gly Asp Glu Asn Leu Val Lys Ala Phe Glu Glu Gly Ile Asp Val His Thr Leu Thr Ala Ser Arg Ile Tyr Asn Val Lys Pro Glu Glu Val Asn Glu Glu Met Arg Arg Val Gly Lys Met Val Asn Phe Ser Ile Ile Tyr Gly Val Thr Pro Tyr Gly Leu Ser Val Arg Leu Gly Ile Pro Val Lys Glu Ala Glu Lys Met Ile Ile Ser Tyr Phe Thr Leu Tyr Pro Lys Val Arg Ser 755 760 ?65 Tyr Ile Gln Gln Val Val Ala Glu Ala Lys Glu Lys Gly Tyr Val Arg Thr Leu Phe Gly Arg Lys Arg Asp Ile Pro Gln Leu Met Ala Arg Asp Lys Asn Thr Gln Ser Glu Gly Glu Arg Ile Ala Ile Asn Thr Pro Ile 805 810 81s Gln Gly Thr Ala Ala Asp Ile Ile Lys Leu Ala Met Ile Asp Ile Asp Glu Glu Leu Arg Lys Arg Asn Met Lys Ser Arg Met Ile Ile Gln Val 3$ His Aep Glu Leu Val Phe Glu Val Pro Asp Glu Glu Lys Glu Glu Leu Val Asp Leu Val Lys Asn Lys Met Thr Asn Val Val Lys Leu Ser Val Pro Leu Glu Val Asp Ile Ser Ile Gly Lys Ser Trp Ser S (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH : 610 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant 1~ (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION:
SEQ
ID
NO:10:

Met Lys GluLeuGln Leu Tyr Glu Ala Pro Gly Tyr Glu Glu Thr Glu 15 Ile Val LysAspHis Lys Thr Glu Asp Ile Lys Leu Phe Leu Glu Lys Glu Val ProSerPhe Ala Leu Leu Glu Ser Leu Asp Asp Thr Ser Pro Phe Asn Cys Glu Ile Val Gly Ile Ser Val Ser Phe Lys Pro Lys Thr 2~ 50 55 60 Ala Tyr TyrIle:Pro HisHisArg Ala Gln Leu Glu Leu Asn Asn Asp Thr Leu ValLeu Ser LeuLysGlu Leu Glu Pro Ser Lys Ile Asp Ser 25 Lys Ile ValGly Gln LeuLysTyr Tyr Lye Leu Val Asn Asp Val Met lon los llo Lys Gly IleSe:rPro TyrProHis Asp Thr Ile Ala Val Phe Met Ala _ 115 120 125 Tyr Leu LeuGlu Pro GluLysLys Asn Leu Asp Ser Asn Phe Glu Leu . Leu Lys PheLeu Gly LysMetThr Tyr Gln Leu Ser Tyr Ser Glu Met Phe Ser SerPro Leu GlyPheSer Ala Asp Pro Asp Phe Phe Val Val 3$ Lys Ala AlaAssnTyr CysGluAsp Asp Ile Tyr Leu Ser Ala Thr Arg wo 9s~so6o rcr~s9~ozm Tyr Lys Ile Leu Ser Met Lys Leu His Glu Ala Glu Leu Glu Ren Val Phe Tyr Arg Ile Glu Met Pro Leu Val Asn Val Leu Ala Arg Met Glu $ 210 215 220 Leu Asn Gly Val Tyr Val Asp Thr Glu Phe Leu Lys Lys Leu Ser Glu Glu Tyr Gly Lys Lys Leu Glu Glu Leu Ala Glu Lys Ile Tyr Gln Ile 1~ Ala Gly Glu Pro Phe Aen Ile Asn Ser Pro Lys Gln Val Ser Lys Ile Leu Phe Glu Lys Leu Gly Ile Lys Pro Arg Gly Lys Thr Thr Lys Thr Gly Glu Tyr Ser Thr Arg Ile Glu Val Leu Glu Glu Ile Ala Asn Glu is 290 295 300 His Glu Ile Val Pro Leu Ile Leu Glu Tyr Arg Lys Ile Gln Lys Leu Lys Ser Thr Tyr Ile Asp Thr Leu Pro Lys Leu Val Asn Pro Lys Thr 2~ Gly Arg Ile His Ala Ser Phe His Gln Thr Gly Thr Ala Thr Gly Arg Leu Ser Ser Ser Asp Pro Asn Leu Gln Asn Leu Pro Thr Lys Ser Glu Glu Gly Lys Glu Ile Arg Lys Ala Ile Val Pro Gln Asp Pro Asp Trp Txp Ile Val Ser Ala Asp Tyr Ser Gln Ile Glu Leu Arg Ile Leu Ala His Leu Ser Gly Asp Glu Asn Leu Val Lys Ala Phe Glu Glu Gly Ile Asp Val His Thr Leu Thr Ala Ser Arg Ile Tyr Asn Val Lys Pro Glu Glu Val Asn Glu Glu Met Arg Arg Val Gly Lys Met Val Asn Phe Ser Ile Ile Tyr Gly Val Thr Pro Tyr Gly Leu Ser Val Arg Leu Asn Ile 3Jr 450 455 460 Pro Val Lys Glu Ala Glu Lys Met Ile Ile Ser Tyr Phe Thr Leu Tyr Pro Lys Val Rrg Ser Tyr Ile Gln Gln Val Val Ala Glu Ala Lys Glu Lys Gly Tyr Val Arg Thr Leu Phe Gly Arg Lys Arg Asp Ile Pro Gln $ Leu Met Aia Arg Asp Lys Asn Thr Gln Ser Glu Gly Glu Arg Ile Ala Ile Asn Thr Pro Ile Gln Gly Thr Ala Ala Asp Ile Ile Lys Leu Ala Met Ile Asp Ile Asp Glu Glu Leu Arg Lys Arg Asn Met Lys Ser Arg Met Ile Ile Gln Val His Asp Glu Leu Val Phe Glu Val Pro Asp Glu Glu Lys Glu Glu Leu Val Asp Leu Val Lys Asn Lys Met Thr Asn Val 15 Val Lys Leu Ser Val Pro Leu Glu Val Asp Ile Ser Ile Gly Lys Ser Trp Ser (2) INFORMATION FOR SEQ ID NO:11:
2O (i) SEQDENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear 2$ (ii) MOLECULE TYPE: peptide (ix) FEATQRE:
(A) NAME/ICEY: Modified-site (B) LOCATION: 1..14 (D) OTHER INFORMATION: /note= "'Xaa' is any amino acid"
3O (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
Arg Xaa Xaa Xaa Lys Xaa Xaa Xaa Phe Xaa Xaa Xaa Tyr Xaa (2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
3S (A) LENGTH: 14 amino acids (B) TYPE: amino acid wo ~so6o rcr~s~o2~9i (C) STRANDEDNBSS: not relevant (D) TOPOLOGY: linear (ii) MOLBCOLE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
Arg Arg Ser Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly (2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids 1~ (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) N~OLECQLE TYPE: peptide (xi) SEQBENCE DESCRIPTION: SEQ ID N0:13:
iS Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly (2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids 2~ (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) 14DLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:
25 Arg Asp Asn Ala Lys Thr Phe Ile Tyr Gly -'i3e Leu Tyr Gly (2) INFORMATION FOR SEQ ID N0:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant wp 9g/3~,p PCT/US98102791 (D) TOPOLOGY: linear ' ( i i ) 1~LECULE TY1?E : peptide ' (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
Arg Arg Val Gly Lys Met Val Asn Phe Ser Ile Ile Tyr Gly $ 1 5 10 (2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: i4 amino acids (B) TYPE: .amino aria (C) STRAND;EDNESS: not relevant (D) TOPOLa3Y: linear (ii) MDLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:
Arg Gln Ala Ala Lys Ala Ile Thr Phe Gly Ile Leu Tyr Gly 1$ i s to (2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) STRANhEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
Arg Arg Ala Gl~r Lys Met Val Asn Phe Ser Ile Ile Tyr Gly 2$ 1 5 10 - (2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CIiARACTERISTICS:
(A) LENGTH: 11 amino acidB
(B) TYPE: amino acid (C) sTRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Pro Ser Phe Ala Leu Asp Leu Glu Thr Ser Ser S (2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant 1~ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
Pro Val Phe AIa Phe Asp Thr Glu Thr Asp Ser 1S (2) INFORMATION FOR SEQ ID N0:20:
(i) SEQDENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant 2~ (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:
Gly Pro Val Ala Phe Asp Ser Glu Thr Ser Ala 2S (2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide Wp 9g~3~p PCT/US98/OZ791 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
Met Ile Val Ser Asp Ile Glu Ala Asn Ala (2) INFORMATION FOR SEQ ID N0:22:
$ (i) SEQUBNCE Q~ARACTERISTICS:
(A) LENGTH:: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both lO (ii) MOLECULE TY1?E: CDNA
(xi) SEQQENCE DESCRIPTION: SEQ ID N0:22:

(2) INFORMATION FOR ,5EQ ID N0:23:
(i) SEQUBNCE CHARACTERISTICS:
1$ (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both ( i i ) MOLECULE TYPE : cDNA
2O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:

(2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids ~ 25 (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:

WO 98/35060 PCT/US98~2791 Phe Leu Phe Asp Gly Thr (2) INFORMATION FOR SEQ ID N0:25:
(i) SEQDENCE CHARACTERISTICS:
$ (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) l~DLECQLE TYPE: peptide lO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:
Leu Leu Val Asp Gly His (2) INFORMATION FOR SEQ ID N0:26:
(i) SEQUENCE CHARACTERISTICS:
15 (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 2O (xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:
Ser Leu Ile Thr Gly Asp Lys Asp Met Leu (2) INFORMATION FOR SEQ ID N0:27:
(i) SEQUENCE CHARACTERISTICS:
25 (A) LENGTH: 1o amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 3O (xi) SEQUENC$ DESCRIPTION: SEQ ID N0:27:
Arg Ile Leu Thr Ala Asp Lys Asp Leu Tyr io (2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid ' (C) STRANDEDNBSS: both (D) TOPOLOGY: both (ii) MOLECULE TYF~E: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
lO GTAGGCCAGG GCTGTGCCGC4 C31AAGAGAAA TAGTC 35 (2) INFORMATION FOR :iEQ ID N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:. 35 base pairs (B) TYPE: nucleic acid 1$ (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:
GAAGCATATC CTTGGCGCClJ GTTATTATGA AAATC 35 ZU (2) INFORMATION FOR ;SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: :nucleic acid (C) STRAND~NESS : both 25 (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:
_ CACCAGACGG GTACCGCCAC TGGCAGGTTG 30 (2) INFORMATION FOR SEQ ID N0:31:

WO 98/35060 PCT/fJS98/02791 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both $ (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:

(2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both 1$ (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:

(2) INFORMATION FOR SEQ ID N0:33:
(i) SEQUENCE CHARACTERISTICS:
20 (A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
2$ (xi) SEQUENCE DESCRIPTION: SEQ ID N0:33:

(2) INFORMATION FOR SEQ ID N0:34:
(i) SEQOENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs 30 (B) TYPE: nucleic acid (C) STRANDEDNESS: both WO 98/35060 PCT/US98/02'~ll (D) TOPOLOGY: both ~ (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:34:

S (2) INFORMATION FOR :iEQ ID N0:35:
( i ) SEQUENCE CH1~R.ACTERISTICS
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both ( i i ) MOLECULE TY3?E : CDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:35:

(2) INFORMATION FOR SEQ ID N0:36:
IS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTii: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both ZU (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:36:

(2) INFORMATION FOR SEQ ID N0:37:
(i) SEQUENCE CHARACTERISTICS:
25 (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both Iii) MOLECULE TYPE: cDNA

(xi) SEQDENCE DESCRIPTION: SEQ ID N0:37:

(2) INFORMATION FOR SEQ ID N0:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRAND8DN8SS: both (D) TOPOhOGY: both (ii) MOLECULE TYPE: cDNA
lU (xi) SEQUENCE DESCRIPTION: SEQ ID N0:38:

(2) INFORMATION FOR SEQ ID N0:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs 1$ (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:39:

(2) INFORMATION FOR SEQ ID N0:40:
(i} SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid 2S (C) STRANDELL~TESS : kin:.h (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:40:

' (2) INFORMATION FOR SEQ ID N0:41:
(i) SEQ08NCE CHARACTERISTICS:
(A) LENGTH:: 27 base pairs (B) TYPE: aucleic acid ' (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLBCULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:41:
lO CTTGGCCGCC CGATGCATCA GGGGGTC 27 (2) INFORMATION FOR ,SEQ ID N0:42:
{i) SEQDENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: :nucleic acid iS (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:42:

ZO (2) INFORMATION FOR SEQ ID N0:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STR14NDEDNESS: both 25 (D) TOPOLOGY: both ( i i ) MOLECULE T7i.'PE : cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:43:
CTTGGCCGCC CTGTACATC;A GGGGGTC 27 (2) INFORMATION FOR SEQ ID N0:44:

WO ~~ PCT/US98/02791 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both $ (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQBfiNCE DESCRIPTION: SEQ ID N0:44:

(2) INFORMATION FOR SEQ ID N0:45:
IO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 base pairs (H) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both IS (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:45:

(2) INFORMATION FOR SEQ ID N0:46:
(i) SEQUENCE CHARACTERISTICS:
2O (A) LENGTH: 49 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
ZS (xi) SEQUENCE DESCRIPTION: SEQ ID N0:46:

(2) INFORMATION FOR SEQ ID N0:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs 3O (B) TYPE: nucleic acid (C) STRANDEDNESS: both WO 98135060 PCT/US98/02'791 (D) TOPOLOGY: both " (ii) MOLECULE TYPE: cDNA
" (xi) SEQUENCE DESCRIPTION: SEQ ID N0:47:

S (2) INFORMATION FOR SEQ ID N0:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: aucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both ( i i ) MOLECULE TY1?E : cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:48:

(2) INFORMATION FOR SEQ ID N0:49:
IS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (H) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both ZU (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:49:

(2) INFORMATION FOR SEQ ID N0:50:
(i) SEQUENCE CHARACTERISTICS:
~ ZS (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA

wo 9ar3so6o rc~r~s9sroz~9i (xi) SEQUENCE DESCRIPTION: SEQ ID N0:50:
TTTCAGAGAA ACTrACCTGT 20 (2) INFORMATION FOR SEQ ID N0:51:
(i) SEQUENCE CHARACTERISTICS:
$ (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
lO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:51:

(2) INFORMATION FOR SEQ ID N0:52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs 1S (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:52:

(2) INFORMATION FOR SEQ ID N0:53:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid ZS (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:53:

(2) INFORMATION FOR SEQ ID N0:54:
- (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:: 22 base pairs (B) TYPE: nucleic acid (C) STRANDBDNESS: both (D) TOPOLOGY: both (ii) 140LECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:54:
lU ATTCAGAAGA AACAGTGATG GT 22 (2) INFORMATION FOR SEQ ID N0:55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENC3Tfi: 23 base pairs (B) TYPE: nucleic acid 15 (C) STRANDEDNESS: both ( D ) TOPOL«Y : both i i ) MOLECULE T'.tPE : cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:55:

ZU (2) INFORMATION FOR SEQ ID N0:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid iC) STRANDEDNESS: both 25 (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:56:

(2) INFORMATION FOR: SEQ ID N0:57:

WO 98/35060 PCT/US9$/02791 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both S (D) TOPOLOGY: both (ii) 1~LECOLE TYPE: CDNA
(xi) SEQUBNCE DESCRIPTION: SEQ ID N0:57:

(2) INFORMATION FOR SEQ ID N0:58:
IO (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both IS (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:58:

(2) INFORMATION FOR SEQ ID N0:59:
(i) SEQUENCE CHARACTERISTICS:
2O (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
ZS (xi) SEQUENCE DESCRIPTION: SEQ ID N0:59:

(2) INFORMATION FOR SEQ ID N0:60:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs 3O (B) TYPE: nucleic acid (C) STRANDEDNESS: both WO yg/3$p6p PCT/US98/02791 (D ) TOPOI~OC~Y : both ( i i ) MOLECULE TYF~E : CDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:60:

S (2) INFORMATION FOR SEQ ID N0:61:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: CDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:61:
ATCTCTGTTC CCTCCCZ'GTT 20 (2) INFORMATION FOR SEQ ID N0:62:
IS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:: 20 base pairs (B) TYPE: nucleic acid (C) STRANDSDNESS: both (D) TOPOLOGY: both ( i i ) MOLECULE TY.'PE : cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:62:

- (2) INFORMATION FOR SEQ ID N0:63:
' (i) SEQUENCE CHARACTERISTICS:
2S (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STR~INl7EDNESS : both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:63:

(2) INFORMATION FOR SEQ ID N0:64:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) I~LECOLE TYPE: cDNA
lU (xi) SEQUENCE DESCRIPTION: SEQ ID N0:64:

(2} INFORMATION FOR SEQ ID N0:65:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs 1$ (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:65:

(2) INFORMATION FOR SEQ ID N0:66:
(x) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 Yse pairs (B) TYPE: nucle- .: acid 25 (C) STRANDEDNESr.: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQOENCE DESCRIPTION: SEQ ID N0:66:

WO 98135060 PCT/US98/02'191 (2) INFORMATION FOR SEQ ID N0:67:
- (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) 1~DLECULE TYPE: cDNA
(xi) SEQDSNCE DESCRIPTION: SEQ ID N0:67:
ccAnccACAC TccGpA _ 16 (2) INFORMATION FOR SEQ ID N0:68:
(i) SEQUBNCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRAND1BDNESS : both (D) TOPOLOGY: both ( i i ) MOLECULE TY:FE : CDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:68:

Z0 (2) INFORMATION FOR SEQ ID N0:69:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECOLE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:69:
CATGAAPaTGC TGACTGGGTA 20 (2) INFORMATION FOR SEQ ID N0:70:

wo ~3so6o rcrrt~s9sro2m (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both S ID) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:70:

(2) INFORMATION FOR SEQ ID N0:71:
IO (i) SEQDENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs CB) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both iS (ii) MOLECOLE TYPE: cDNA
(xi) SEQDENCE DESCRIPTION: SEQ ID N0:71:

(2) INFORMATION FOR SEQ ID N0:72:
(i) SEQUENCE CHARACTERISTICS:
2O (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECO'LE TYPE: cDNA
ZS (xi) SEQOfiNCE DESCRIPTION: SEQ ID N0:72:

(2) INFORMATION FOR SEQ ID N0:73:
(i) SEQUfiNCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs 3O (B) TYPE: nucleic acid (C) STRANDEDNESS: both qrp yg~3~p PCT/US98/02791 (D) TOPOLOGY: both (ii) MOLECULE TYPE: eDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:73:

$ (2) INFORMATION FOR SEQ ID N0:74:
(i) SEQDBNCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both 1~ (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:74:

(2) INFORMATION FOR .SEQ ID N0:75:
IS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNBSS: both (D) TOPOLOGY: both 20 (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:75:
CCCTAGTGGA TGATAAGAFvT AATC 24 (2) INFORMATION FOR SEQ ID N0:76:
(i) SEQUENCE CFtARACTERISTICS:
' 25 (A) LENGTFi: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLC~Y: both ( i i ) MOLECULE T'.iPE : cDNA

wo 9sr~soso rc°rnrs9srozrm (xi) SEQUENCE DESCRIPTION: SEQ ID N0:76:

(2) INFORMATION FOR SEQ ID N0:77:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
lO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:77:

(2) INFORMATION FOR SEQ ID N0:78:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs iB) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECOLE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:78:

(2) INFORMATION FOR SEQ ID N0:79:
(i) SEQOENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:79:

Wp 9g~3~p PCT/US98/02791 ACATTCTAAG ACTTTCCCA~A T 21 (2) INFORMATION FOR ,SEQ ID N0:80:
( i ) SEQUENCE CH~1R,ACTER.ISTICS
(A) LENGTH: 20 base pairs $ (B) TYPE: :nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: CDNJ.1 (xi) SEQUSNCB DESCRIPTION: SEQ ID N0:80:

(2) INFORMATION FOR SEQ ID N0:81:
(i) SEQOENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid 15 (c) sTRpNDEDNESS: both (D) TOPOLC~Y: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:81:
AAGAACCATG CGATACGA(:T 2 0 ZU (2) INFORMATION FOR SEQ ID N0:82:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both 25 (D) TOPOLOGY: both i i ) MOLfiCULE TYPE : eDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:82:

(2) INFORMATION FOR SEQ ID N0:83:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:83:

(2) INFORMATION FOR SEQ ID N0:84:
IO (i) SEQUENCE CHARACTERISTICS:
w (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both iS (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:84:

(2) INFORMATION FOR SEQ ID N0:85:
(i) SEQDENCE CHARACTERISTICS:
ZO (A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: eDNA
ZS (xi) SEQUENCE DESCRIPTION: SEQ ID N0:85:

(2) INFORMATION FOR SEQ ID N0:86:
(i) SEQLJBNCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs 3O (B) TYPE: nucleic acid (C) STRANDEDNESS: both gyp 9g~3~0 PCT/US98/02791 (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:86:
CAGCCC:AAAG CCAGATTA 18 S (2) INFORMATION FOR SEQ ID N0:87:
( i ) SEQUENCE CH7aRACTERISTICS
(A) LENGTH: 22 base pairs (B) TYPE : nucleic acid (C) STRANDEDNESS: both (D) TOPOLOfiY: both (ii) N~LECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:87:

(2) INFORMATION FOR SEQ ID N0:88:
IS (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:88:
TGTATTAGTC AATGTTCTC;C AG 22 (2) INFORMATION FOR SEQ ID N0:89:
(i) SEQUENCE CHARACTERISTICS:
' 2S (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D ) TOPOL(~Y : both (ii) MOLECULE TYPE: eDNA

WO ~~~ PCT/US98/OZ791 (xi) SEQDENCE DESCRIPTION: SEQ ID N0:89: ' (2) INFORMATION FOR SEQ ID N0:90:
(i) SEQUENCE CHARACTERISTICS:
$ (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
lO (xi) SEQUENCE DESCRIPTION: SEQ ID N0:90:

(2) INFORMATION FOR SEQ ID N0:91:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs 1$ (B) TYPE: nucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:91:
ZO ATTCTGGGCG C:ACAAGAGTG A 21 (2) INFORMATION FOR SEQ ID N0:92:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid 2$ (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:92:

WO 98/35060 PCT/US98b2Z91 (2) INFORMATION FOR SEQ ID N0:93:
(i) SEQUENCE CHFvRACTERISTICS:
(A) LENGTH: 33 base pairs (s) TYPE: mucleic acid (C) STRANDEDNESS: both (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:93:
lU GAAGTTCACC ATCCGGCCG7~ CCCGTCGCAT TTC 33 wo 9sr~so6o -149.1 - PCTIUS98/02791 Applicant's or agent's file ~ International application No. TO BE ASSIGNED
reference number: 0942.425PC02 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM (JAPAN) (PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page ~, line ~.

B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution Agricultural Research Service Culture Collection (NRRL) Address of depositary institution (including postal code and country) 1815 North University Street Peoria, Illinois 61604 United States of America Date of deposit 30 September 1994 Accession Number: NRRL B-21238 C. ADDITIONAL INDICATIONS (leave blank ijnot applicable) This information is continued on an additional sheet D

E.coli DHIOB(pUC-Tne) D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (f the indications are not jor all designated States) E. SEPARATE FURNISHING OF INDICATIONS
heave btm~tc ifnor appficabte~

The indications listed below will be submitted to the international Bureau later (speciJv the general nature ojthe indications, e.g..
"Accession Number ojDeposit'J

For receiving Office use only ~ ~"~~ For International Bureau use only This shee w ,received with the international application ~ ~ ~ This sheet was received by the International Bureau on:

wo 9si3so6o -149.2 - PcTlus9sro2~9i Applicant's or agent's file lntemational application No. TO BE ASSIGNED
reference number: 0942.425PC02 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM (JAPAN) (PCT Rule l3bis) A. The indications made below relate to the microorganism referred to in the description on page ~, line ~.

B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution Agricultural Research Service Culture Collection (NRRL) Address of depositary institution (including postal code and country) 1815 North University Street Peoria, Illinois 61604 United States of America Date of deposit 30 September 1994 Accession Number: NRRL B-21338 C. ADDITIONAL INDICATIONS (lem~e blank if not applicable) This information is continued on an additional sheet E.coli DH10B(pUCl9-Tne) D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (ijthe indications are not jot al! designated States E. SEPARATE FURNISHING OF INDICATIONS
lteone btmrk iJnof applicable]

The indications listed below will be submitted to the international Bureau later (specify the general nature of the indications, e.g., "Accession Number of Deposit ") For receiving Office use only ~~ ~~ For International Bureau use only This sheet was received with the international application I ~ ~ This sheet was received by the International Bureau on:

Claims (68)

WHAT IS CLAIMED IS:

1. A method of identifying, analyzing or typing a polymorphic DNA
fragment in a sample of DNA, said method comprising contacting said sample of DNA with one or more DNA polymerases substantially reduced in the ability to add one or more non-templated nucleotides to the 3'terminus of a DNA molecule, amplifying said polymorphic DNA fragment within said sample and analyzing said amplified polymorphic DNA fragment.

2. A method of producing amplified copies of a polymorphic DNA
fragment which comprise substantially no non-templated 3' terminal nucleotides, said method comprising contacting a DNA sample with one or more DNA
polymerases substantially reduced in the ability to add one or more non-templated nucleotides to the 3'terminus of a DNA molecule and amplifying said polymorphic DNA fragment within said DNA sample.

3. A method of cloning a DNA molecule comprising contacting said DNA molecule with one or more DNA polymerases substantially reduced in the ability to add one or more non-templated nucleotides to the 3' terminus of a DNA
molecule, amplifying said DNA molecule and inserting said DNA molecule into a vector.

4. The method of claim 3, wherein said vector is blunt-ended.

5. The method of claim 1, wherein said polymorphic DNA fragment is selected from the group of polymorphic DNA fragments comprising a minisatellite DNA fragment, a microsatellite DNA fragment and a STR DNA
fragment.

6. The method of claim 1, wherein said polymerases are thermostable DNA polymerases.

7. The method of claim 6, wherein said thermostable DNA
polymerase are Thermotoga DNA polymerases and mutants or derivatives thereof.

8. The method of claim 7, wherein said DNA polymerise is a Tne or Tma DNA polymerise.

9. The method of claim 1, wherein said DNA polymerases are substantially reduced in 3'-5' exonuclease activity.

10. The method of claim 1, wherein said DNA polymerases are substantially reduced in 5'-3' exonuclease activity.

11. The method of claim 9, wherein said DNA polymerases are substantially reduced in 5'-3' exonuclease activity.

12. The method of claim 1, wherein said DNA polymerases contain one or more modifications or mutations which reduce the ability of the polymerase to add one or more non-templated 3' nucleotides to a synthesized nucleic acid molecule.

13. The method of claim 12, wherein said DNA polymerases are substantially reduced in at least one activity selected from the group consisting of:
(a) 3'-5' exonuclease activity; and (b) 5'-3' exonuclease activity.

14. The method of claim 13, wherein said polymerases have substantially reduced 3'-5' exonuclease and 5'-3' exonuclease activity.

15. The method of claim 13, wherein said polymerase is substantially reduced in 3'-5' exonuclease activity.

16. The method of claim 12, wherein said polymerases comprise one or more mutations or modifications in the O-helix of said polymerase.

17. The method of claim 16, wherein said O-helix is defined as RXXXKXXXFXXXYX (SEQ ID NO:11), wherein X is any amino acid.

18. The method of claim 17, wherein said mutation or modification is at position R (Arg) and/or F (Phe) and/or K (Lys) of said O-helix or combinations thereof.

19. The method of claim 16, wherein said mutation or modification is an amino acid substitution at position R and/or F and/or K of said O-helix or combinations thereof.

20. The method of claim 1, wherein said polymerase is selected from the group consisting of:
Tne N'.DELTA.219, D323A;
Tne N'.DELTA.283, D323A;
Tne N'.DELTA.284, D323A;
Tne N'.DELTA.193, D323A;
Tne D137A, D323A;
Tne D8A, D323A;
Tne G195D, D323A;
Tne G37D, D323A;
Tne N'.DELTA.283;
Tne D137A, D323A, R722K;
Tne D137A, D323A, R722Y;
Tne D137A, D323A, R722L;
Tne D137A, D323A, R722H;

Tne D137A, D323A, R722Q;
Tne D137A, D323A, F730Y;
Tne D137A, D323A, K726R;
Tne D137A, D323A, K726H;
Tne D137A, D323A, R722K, F730Y;
Tne D137A, D323A, R722K, K726R;
Tne D137A, D323A, R722K, K726H;
Tne D137A, D323A, R722H, F730Y;
Tne D137A, D323A, R722H, K726R;
Tne D137A, D323A, R722H, K726H;
Tne D137A, D323A, R722Q, F730Y;
Tne D137A, D323A, R722Q, K726R;
Tne D137A, D323A, R722Q, K726H;
Tne D137A, D323A, R722N, F730Y;
Tne D137A, D323A, R722N, K726R;
Tne D137A, D323A, R722N, K726H;
Tne D137A, D323A, F730S;
Tne N'.DELTA.283, D323A, R722K/H/Q/N/Y/L;
Tne N'.DELTA.219, D323A, R722K;
Tne N'.DELTA.219, D323A, F730Y;
Tne N'.DELTA.219, D323A, K726R;
Tne N'.DELTA.219, D323A, K726H;
Tne D137A, D323A, F730S, R722K/Y/Q/N/H/L, K726R/H;
Tne D137A, D323A, F730T, R722K/Y/Q/N/H/L, K726R/H;
Tne D137A, D323A, F730T;
Tne F730S;
Tne F730A;
Tne K726R;
Tne K726H; and Tne D137A, D323A, R722N.

21. A method of determining the relationship between a first individual and a second individual, said method comprising comparing a population of amplified DNA molecules in a sample of DNA from said first individual to that of said second individual prepared according to the method of claim 1.

22. The method of claim 21, wherein said sample of DNA from said first individual is a known sample and said sample of DNA from said second individual is an unknown sample.

23. A kit for the identification, analysis or typing of a polymorphic DNA fragment, said kit comprising one or more DNA polymerases substantially reduced in the ability to add one or more non-templated nucleotides to the 3' terminus of a DNA molecule.

24. The kit of claim 23, said kit further comprising one or more components selected from the group consisting of one or more DNA primers, one or more deoxynucleoside triphosphates, and a buffer suitable for use in the identification, analysis or typing of a polymorphic DNA fragment.

25. The kit of claim 23, wherein said polymerases are thermostable DNA polymerases.

26. The kit of claim 25, wherein thermostable DNA polymerases are Thermotoga DNA polymerases.

27. The kit of claim 23, wherein said DNA polymerise is substantially reduced in 3'-5' exonuclease activity.

28. The kit of claim 23, wherein said DNA polymerase is substantially reduced in 5'-3' exonuclease activity.

29. The kit of claim 23, wherein said DNA polymerases comprise one or more modifications or mutations which reduce the ability of the polymerase to add one or more non-templated 3' nucleotides to a synthesized nucleic acid molecule.

30. The kit of claim 29, wherein said polymerases comprise one or more mutations in the O-helix of said polymerase.

31. The kit of claim 30, wherein said O-helix is defined as RXXXKXXXFXXXYX (SEQ ID NO:11), wherein X is any amino acid.

32. The kit of claim 31, wherein said mutation or modification is at position R (Arg) and/or F (Phe) and/or K (Lys) of said O-helix or combinations thereof.

33. The method of claim 31, wherein said mutation or modification is an amino acid substitution at position R and/or F and/or K of said O-helix or combinations thereof.

34. A polymerase which has been modified or mutated to reduce, substantially reduce or eliminate the ability of the polymerase to add non-templated 3' nucleotides to a synthesized nucleic acid molecule.

35. The polymerase of claim 34, wherein said polymerase is a DNA or RNA polymerase.

36. The polymerase of claim 34, wherein said polymerase is substantially pure.

37. The polymerase of claim 34, wherein said polymerase is mesophilic or thermostable.

38. The polymerase of claim 34, wherein said polymerase is selected from the group consisting of Tne DNA polymerase, Taq DNA polymerase, Tma DNA polymerase, Tth DNA polymerase, Tli DNA polymerase, VENT TM DNA
polymerase, Pfu DNA polymerase, DEEPVENT TM DNA polymerase, Pwo DNA
polymerase, Bst DNA polymerase, Bca DNA polymerase, Tft DNA polymerase, and mutants, variants and derivatives thereof.

39. The polymerase of claim 34, wherein said polymerase is substantially reduced in at least one activity selected from the group consisting of:
(a) 3'~5' exonuclease activity; and (b) 5'~3' exonuclease activity.

40. The polymerase of claim 39, wherein said polymerase is substantially reduced in 3'-5' exonuclease activity.

41. The polymerase of claim 39, wherein said polymerase is substantially reduced in 5'-3' exonuclease activity.

42. The polymerase of claim 41, which is modified or mutated to reduce or eliminate 3'-5' exonuclease activity.

43. The polymerase of claim 34, which comprises one or more modifications or mutations in the O-helix of said polymerase.

44. The polymerise of claim 43, wherein said O-helix is defined as RXXXKXXXFXXXYX (SEQ ID NO:11), wherein X is any amino acid.

45. The polymerase of claim 44, wherein said mutation or modification is at position R (Arg) and/or F (Phe) and/or K (Lys) of said O-helix or combinations thereof.

46. The polymerise of claim 44, wherein said mutation or modification is an amino acid substitution at position R and/or F and/or K of said O-helix or combinations thereof.

47. The polymerase of claim 46, wherein R (Arg) is substituted with an amino acid selected from the group consisting of Ala, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Try and Val.

48. The polymerase of claim 46, wherein R (Arg) is substituted with Lys or His.

49. The polymerase of claim 46, wherein F (Phe) is substituted with an amino acid selected from the group consisting of Ala, Asn, Arg, Asp, Cys, Gln, Giu, Gly, His, Ile, Leu, Lys, Met, Pro, Ser, Thr, Trp, Try and Val.

50. The polymerase of claim 46, wherein K (Lys) is substituted with an amino acid selected from the group consisting of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Met, Phe, Pro, Ser, Thr, Trp, Try and Val.

51. The polymerase of claim 46, wherein K (Lys) is substituted with Arg or His.

52. A mutant Tne DNA polymerase protein selected from the group consisting of Tne N'.DELTA.219, D323A;
Tne N'.DELTA.283, D323A;
Tne N'.DELTA.284, D323A;
Tne N'.DELTA.193, D323A;
Tne D137A, D323A;
Tne D8A, D323A;
Tne G195D, D323A;

Tne G37D, D323A;
Tne N'.DELTA.283;
Tne D137A, D323A, R722K;
Tne D137A, D323A, R722Y;
Tne D137A, D323A, R722L;
Tne D137A, D323A, R722H;
Tne D137A, D323A, R722Q;
Tne D137A, D323A, F730Y;
Tne D137A, D323A, K726R;
Tne D137A, D323A, K726H;
Tne D137A, D323A, R722K, F730Y;
Tne D137A, D323A, R722K, K726R;
Tne D137A, D323A, R722K, K726H;
Tne D137A, D323A, R722H, F730Y;
Tne D137A, D323A, R722H, K726R;
Tne D137A, D323A, R722H, K726H;
Tne D137A, D323A, R722Q, F730Y;
Tne D137A, D323A, R722Q, K726R;
Tne D137A, D323A, R722Q, K726H;
Tne D137A, D323A, R722N, F730Y;
Tne D137A, D323A, R722N, K726R;
Tne D137A, D323A, R722N, K726H;
Tne D137A, D323A, F730S;
Tne N'.DELTA.283, D323A, R722K/H/Q/N/Y/L;
Tne N'.DELTA.219, D323A, R722K;
Tne N'.DELTA.219, D323A, F730Y;
Tne N'.DELTA.219, D323A, K726R;
Tne N'.DELTA.219, D323A, K726H;
Tne D137A, D323A, F730S, R722K/Y/Q/N/H/L, K726R/H;
Tne D137A, D323A, F730T, R722K/Y/Q/N/H/L, K726R/H;
Tne D137A, D323A, F730T;

Tne F730S;
Tne F730A;
Tne K726R;
Tne K726H; and Tne D137A, D323A, R722N.

53. A vector comprising a gene encoding the polymerase of claim 34.

54. The vector of claim 53, wherein said gene is operably linked to a promoter.

55. The vector of claim 54, wherein said promoter is selected from the group consisting of a .lambda.-P L promoter, a tac promoter, a trp promoter, and a trc promoter.

56. A host cell comprising the vector of claim 53.

57. A method of producing a polymerase, said method comprising:
(a) culturing the host cell of claim 56;
(b) expressing said gene; and (c) isolating said polymerase from said host cell.

58. A method of synthesizing a nucleic acid molecule comprising:
(a) mixing a nucleic acid template with one or more polymerases of claim 34; and (b) incubating said mixture under conditions sufficient to make a nucleic acid molecule complementary to all or a portion of said template.

59. The method of claim 58, wherein said mixture further comprises one or more nucleotides selected from the group consisting of dATP, dCTP, dGTP, dTTP, dITP, 7-deaza-dGTP, dUTP, ddATP, ddCTP, ddGTP, ddITP, ddTTP, [.alpha.-S]dATP, [.alpha.-S]dTTP, [.alpha.-S]dGTP, and [.alpha.-S]dCTP.

60. The method of claim 59, wherein one or more of said nucleotides are detectably labeled.

61. A method of sequencing a DNA molecule, comprising:
(a) hybridizing a primer to a first DNA molecule;
(b) contacting said DNA molecule of step (a) with deoxyribonucleoside triphosphates, one or more DNA polymerases of claim 34, and a terminator nucleotide;
(c) incubating the mixture of step (b) under conditions sufficient to synthesize a random population of DNA molecules complementary to said first DNA molecule, wherein said synthesized DNA molecules are shorter in length than said first DNA molecule and wherein said synthesized DNA
molecules comprise a terminator nucleotide at their 3' termini; and (d) separating said synthesized DNA molecules by size so that at least a part of the nucleotide sequence of said first DNA molecule can be determined.

62. The method of claim 61, wherein said deoxyribonucleoside triphosphates are selected from the group consisting of dATP, dCTP, dGTP, dTTP, dITP, 7-deaza-dGTP, dUTP, [.alpha.-S]dATP, [.alpha.-S]dTTP, [.alpha.-S]dGTP, and [.alpha.-S]dCTP.

63. The method of claim 61, wherein said terminator nucleotide is ddTTP, ddATP, ddGTP, ddITP or ddCTP.

64. The method of claim 61, wherein one or more of said deoxyribonucleoside triphosphates is detestably labeled.

65. The method of claim 61, wherein one or more of said terminator nucleotides is detectably labeled.

66. A method for amplifying a double stranded DNA molecule, comprising:
(a) providing a first and second primer, wherein said first primer is complementary to a sequence at or near the 3'-termini of the first strand of said DNA molecule and said second primer is complementary to a sequence at or near the 3'-termini of the second strand of said DNA molecule;
(b) hybridizing said first primer to said first strand and said second primer to said second strand in the presence of the one or more DNA
polymerases of claims 34, under conditions such that a third DNA molecule complementary to said first strand and a fourth DNA molecule complementary to said second strand are synthesized;
(c) denaturing said first and third strand, and said second and fourth strands; and (d) repeating steps (a) to (c) one or more times.

67. A kit for sequencing, amplifying or sequencing a DNA molecule comprising one or more polymerases of claim 34.

68. The kit of claim 67, further comprising one or more dideoxyribonucleoside triphosphates and/or one or more deoxyribonucleoside triphosphates.