CA2278782C - Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders - Google Patents

Abstract

The nucleic acid upstream of the TIGR protein encoding sequence can be used to diagnose glaucoma. Polymorphisms, base substitutions, base additions located with the upstream and within TIGR exons can also be used to diagnose glaucoma. In addition, polymorphisms, base substitutions, base additions located with the upstream and within TIGR exons can also be used to prognose glaucoma.

Description

~ ~I~fVENTION:
METHODS FOR THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF
GLAUCOMA AND RELATED DISORDERS
The present invention is in the fields of diagnostics, prognosis, and treatment, and concerns methods and reagents for diagnosing and treating glaucoma and related disorders.
,BACKGROUND OF THE INVENTION:
"Glaucomas" are a group of debilitating eye diseases that are the leading cause of preventable blindness in the United States and other developed nations.
Primary Open Angle Glaucoma ("POAG") is the most common form of glaucoma.
The disease is characterized by the alteration of the trabecular meshwork, leading to obstruction of the normal ability of aqueous humor to leave the eye without closure of the space (e.g., the "angle") between the iris and cornea (see, Vaughan, D.
et al., In: General Ophthalmology, Appleton & Lange, Norwalk, CT, pp. 213-230 {1992)).
A
characteristic of such obstruction in this disease is an increased intraocular pressure ("IOP"), resulting in progressive visual loss and blindness if not treated appropriately and in a timely fashion.
The disease is estimated to affect between 0.4% and 3.3% of all adults over 40 years old (Leske, M.C. et al., Amer. J. Epidemiol. 113:1843-1846 (1986);
Bengtsson, B., Br. J. Ophthamol. 73:483-487 (1989); Strong, N.P., Ophthal. Physiol. Opt. 12:3-7 {1992)).
Moreover, the prevalence of the disease rises with age to over 6% of those 75 years or older (Strong, N.P., Ophthai. Physiol. Opt.12:3-7 (1992)).

A link between the IOP response of patients to glucocorticoids and the disease of POAG has long been suspected. While only 5% of the normal population shows a high IOP increase (16 mm Hg) to topical glucocorticoid testing, greater than 40-50% of patients with POAG show this response. In addition, an Open Angle glaucoma may be induced by exposure to glucocorticoids. This observation has suggested that an increased or abnormal glucocorticoid response in trabecular cells may be involved in POAG (than, G.L. et al., Exper. Eye Res. 54:211-218 (1992);
Yun, A.J. et al., Invest. Ophthumol. Vis. Sci. 30:2012-2022 (1989); Clark, A.F., Exper. Eye Res.
55:265 (1992}; Klemetti, A., Acta Ophthamol. 68:29-33 (1990); Knepper, P.A., U.S.
Patent No. 4,617,299). The ability of glucocorticoids to induce a glaucoma-Iike condition has led to efforts to identify genes or gene products that would be induced by the cells of the trabecular meshwork in response to glucocorticoids (Polansky, J.R. et al., In: Glaucoma Update IV, Springer-Verlag, Berlin, pp.

(1991)). Initial efforts using short-term exposure to dexamethasone revealed only changes in specific protein synthesis. Extended exposure to relatively high levels of dexamethasone was, however, found to induce the expression of related 66 kD
and 55 kD proteins that could be visualized by gel electrophoresis (Polansky, J.R.
et al., In: Glaucoma Update IV, Springer-Verlag, Berlin, pp. 20-29 (1991)). The induction kinetics of these proteins as well as their dose response characteristics were similar to the kinetics that were required for steroid-induced IOP elevation in human subjects (Polansky, J.R. et al., In: Glaucoma Update IV, Springer-Verlag, Berlin, pp. 20-29 (1991)}. Problems of aggregation and apparent instability or loss of protein in the purification process were obstacles in obtaining a direct protein sequence.
Because increased IOP is a readily measurable characteristic of glaucoma, the diagnosis of the disease is largely screened for by measuring intraocular pressure (tonometry} (Strong, N.P., Ophthal. Physiol. Opt. 12:3-7 (1992), Greve, M. et al., Can. J.
Ophthamol. 28:201-206 (1993)). Unfortunately, because glaucomatous and normal pressure ranges overlap, such methods are of limited value unless multiple readings are obtained (Hitchings, R.A., Br. J. Ophthamol. 77:326 (1993); Tuck, M.W. et al., Ophthal. Physiol. Opt. T3:227-232 (1993); Vaughan, D. et al., In: General Ophthamology, Appleton & Lange, Norwalk, CT, pp. 213-230 (1992); Vernon, S.A., Eye 7:134-137 (1993}). For this reason, additional methods, such as direct examination of the optic disk and determination of the extent of a patient's visual field loss are often conducted to improve the accuracy of diagnosis (Greve, M. et al., Can. J.
Ophthamol.
28:201- 206 (1993)). Moreover, these techniques are of limited prognostic value.

_ T..

~ 02278782 2002-11-O1 73185-~12 (S}
Nguyen et aI_, U.S. Patent Number 5,789,169, disclosed a novel protein sequence highly induced by glucocorticoids in the endothelial lining cells of the human trabecular meshwork. Nguyen et al., U.S. Patent Number 5,789,169 also disclosed the cDNA sequence for that protein, the protein itself, molecules that bind to it, and nucleic and molecules that encode it, and provided improved methods and reagents for diagnosing glaucoma and related disorder, as well as for diagnosing other diseases or conditions, such as cardiovascular, immunological, or other diseases or conditions that affect the expression or activity of the protein.
The present invention provides improved diagnostic agents, prognostic agent, therapeutic agents and metlwds.
An object of the invention is to provide a method for diagnosing glaucoma in a patient which comprises the steps: (A) incubating under conditions permitting nucleic acid hybridization: a marker nucleic acid molecule, said marker nucleic acid motecule comprising a nucleotide sequence of a polynudeotide that specifically hybridizes to a polynucleotide that is linked to a TIGR promoter, and a complementary nucleic acid molecule obtained from a cell or a bodily fluid of said patient, wherein nucleic acid hybridization between said marker nucleic acid molecule, and said complementary nucleic acid molecule obtained from said patient permits the detection of a polymorphism whose presence is predictive of a mutation affecting TIGR response in said patient; (B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule obtained from said patient; and (C) detecting the presence of said polymorphism, wherein the detection of the polymorphism is diagnostic of glaucoma.
Another object of the invention is to provide a method for prognosing glaucoma in a patient which comprises the steps: (A) incubating under conditions permitting nucleic acid hybridization: a marker nucleic acid molecule, said marker nucleic acid molecule comprising a nucleotide sequence of a polynudeotide that specifically hybridizes to a polynudeotide that is linked to a TIGR promoter, and a complementary nucleic acid molecule obtained from a cell or a bodily fluid of said patient, wherein nucleic acid hybridization between said marker nucleic acid molecule, and said complementary nucleic acid molecule obtained from said patient permits the detection of a polymorphism whose presence is predictive of a mutation affecting TIGR response in said patient; (B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule obtained from said patient; and (C) detecting the presence of said polymorphism, wherein the detection of the polymorphism is prognostic of glaucoma.
Another object of the invention is to provide marker nucleic acid molecules capable of specifically detecting TIGRmt2, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmtS
and TIGRsv1 .
Another object of the invention is to provide a method for diagnosing steroid sensitivity in a patient which comprises the steps: (A) incubating under conditions permitting nucleic acid hybridization: a marker nucleic acid molecule, the marker nucleic acid molecule comprising a nucleotide sequence of a polynucleotide that is linked to a TTGR promoter, and a complementary nucleic acid molecule obtained from a cell or a bodily fluid of the patient, wherein nucleic acid hybridization between the marker nucleic acid molecule, and the complementary nucleic acid molecule obtained from the patient permits the detection of a polymorphism whose presence is predictive of a mutation affecting TIGR response in the patient;
(B) permitting hybridization between said TTGR-encoding marker nucleic acid molecule and the complementary nucleic acid molecule obtained from the patient; and (C) detecting the presence of the polymorphism, wherein the detection of the polymorphism is diagnostic of steroid sensitivity.
Further objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 1, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID NO: 1 and substantially purified molecules that specifically bind to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 1.
Further objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 3, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID NO: 3 and substantially purified molecules that specifically bind to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 3.
Additional objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 4, recombinant DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID NO: 4 and substantially 73185-12(S) purified molecules that specifically bind to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 4.
Additional objects of the invention provide a nucleic acid molecule that comprises the sequence of SEQ ID NO: 5, recombinant: DNA molecules containing a polynucleotide that specifically hybridizes to SEQ ID NO: 5 and substantially purified molecules that specifically bind to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 5.
An additional object of the present invention is to provide a method of treating glaucoma which comprises administering to a glaucomatous patient an effective amount of an agent that inhibits the synthesis of a TIGR protein.
Indeed, the molecules of the present invention may be used to diagnose diseases or conditions which are characterized by alterations in the expression of extracellular proteins.
According to one aspect of the present invention, there is provided a method for diagnosing glaucoma in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of: (A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or their complements, and a complementary nucleic acid molecule obtained from ~~ sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism; (B) permitting hybridization 73185-12(S) between said marker nucleic acid molecule and said complementary nucleic acid molecule; and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic or prognostic of glaucoma.
According to another aspect of the present invention, there is provided a method for diagnosing steroid sensitivity in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of: (A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1, SEQ TD N0: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule;
and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic of steroid sensitivity.
According to still another aspect of the present invention, there is provided a method for prognosing glaucoma in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR
gene, comprising the steps o.f: (A) incubating under conditions permitting nuc7.eic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of 5a 73185-12(S) SEQ ID N0: 1, SEQ ID N0: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic: acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule;
and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic or prognostic of glaucoma.
According to yet another aspect of the present invention, there is provided a use of an agent capable of binding a cis element located within SEQ ID NO: 1 to treat glaucoma.
According to yet another aspect of the present invention, there is provided an oligonucleotide comprising a nucleic acid fragment from about 15 to about 250 nucleotides having a sequence of SEQ ID N0: l, SEQ TD NO: 2, or complements thereof.
According to a further aspect of the present invention, there is provided an oligonucleotide that binds to an about 15 to about 250 nucleotide fragment of SEQ ID NO: 1, SEQ ID N0: 2 or their complements, wherein said oligonucleotide may be used for detecting the presence of the TIGRmtl, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmtS, or TIGRsvl mutations.
According to yet a further aspect of the present invention, there is provided a method for detecting the specific binding of a molecule to a nucleic acid comprising the steps of providing the nucleic acid as described herein, contacting the nucleic acid with a sample containing the 5b 73185-12(S) molecule to be tested, and identifying binding of the molecule to the nucleic acid.
According to still a further aspect of the present invention, there is provided a method of prognosticating an increased susceptibility to glaucoma, a progressive ocular hypertensive disorder resulting in loss of visual field, or the presence of steroid sensitivity in a patient by determining the genotype of an individual with regard to the presence of the TIGRmt:l, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmtS, or TIGRsvl mutations, said method comprising the steps of:
(a) providing a nucleic acid as described herein, (b) contacting the nucleic acid with a sample containing the molecule to be tested, and (c) identifying binding of the molecule to the nucleic acid.
BRIEF DESCRIPTION OF THE FIGURES:
Figures 1A, 1B, 1C, 1D and 1E provide the nucleic acid sequence of a TIGR promoter region (SEQ ID NO: 1) from an individual without glaucoma.
Figures 2A, 2B, 2C and 2D provide the location and sequence changes highlighted in bold and underlined that are associated with the TIGRmtl, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmtS, and TIGRsvl mutations in SEQ ID NO: 2.
Figures 3A, 3B, 3C, 3D, 3E, 3F, and 3G provide nucleic acid sequences of a TIGR promoter, and TIGR exons, 2~~ TIGR introns and TIGR downstream sequences (SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5).
Figure 4 provides a diagrammatic representation of the location of primers on the TIGR gene promoter for Single Strand Conformational Polymorphism (SSCP) analysis.
5c 73185-12(S) Figure 5 provides a diagrammatic representation of the TIGR exons and the arrangement of SSCP primers.
Figure 6 provides a homology analysis of TIGR
homology with olfactomed.in and olfactomedin-related proteins.
Figure 7 shows the nucleotide sequence of TIGR
(SEQ ID NO: 26).
Figure 8 shows the amino acid sequence of TIGR
(SEQ ID NO: 32).
DETAILED DESCRIPTION OF THE INVENTION:
I. Agents of the Invention 5d As used herein, the term "glaucoma" has its art recognized meaning, and includes both primary glaucomas, secondary glaucomas, juvenile glaucomas, congenital glaucomas, and familial glaucomas, including, without limitation, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. The methods of the present invention are particularly relevant to the diagnosis of POAG, OAG, juvenile glaucoma, and inherited glaucomas. The methods of the present invention are also particularly relevant to the prognosis of POAG, OAG, juvenile glaucoma, and inherited glaucomas. A disease or condition is said to be related to glaucoma if it possesses or exhibits a symptom of glaucoma, for example, an increased intra-ocular pressure resulting from aqueous outflow resistance (see, Vaughan, D. et al., In: General Ophthamology, Appleton &
Lange, Norwalk, CT, pp. 213-230 (1992)). The preferred agents of the present invention are discussed in detail below.
The agents of the present invention are capable of being used to diagnose the presence or severity of glaucoma and its related diseases in a patient suffering from glaucoma (a "glaucomatous patient"). The agents of the present invention are also capable of being used to prognose the presence or severity of glaucoma and its related diseases in a person not yet suffering from any clinical manifestations of glaucoma. Such agents may be either naturally occurring or non-naturally occurring. As used herein, a naturally occurring molecule may be "substantially purified," if desired, such that one or more molecules that is or may be present in a naturally occurring preparation containing that molecule will have been removed or will be present at a lower concentration than that at which it would normally be found.
The agents of the present invention will preferably be "biologically active"
with respect to either a structural attribute, such as the capacity of a nucleic acid to hybridize to another nucleic acid molecule, or the ability of a protein to be bound by antibody (or to compete with another molecule for such binding).
Alternatively, such an attribute may be catalytic, and thus involve the capacity of the agent to mediate a chemical reaction or response.
As used herein, the term "TIGR protein" refers to a protein having the amino acid sequence of SEQ ID NO: 32. As used herein, the agents of the present invention comprise nucleic acid molecules, proteins, and organic molecules.
As indicated above, the trabecular meshwork has been proposed to play an important role in the normal flow of the aqueous, and has been presumed to be the ~ .

~ 02278782 2002-11-O1 73185-12 (S) major site of outflow resistance in glaucomatous eyes. human trabecular meshwork (I-~TM) cells aFe endothelial like cells which line the outflow channels by which aqueous humor exits flue exe; altered synthetic function of the cells may be involved in the pathogenesis of steroid glaucoma and other types of glaucoma. Sustained steroid treatment of these cells are interesting because it showed that a major difference was observed when compared to 1-2 day glucocortiaoid (GCS exposure.
This difference appears relevant to the clinical onset of steroid glaucoma (1-weeks).
Although trabecular meshwork cells had been found to induce specific 10' proteins in response to glucocorticoids (see, Polansky, j.R, In: "Basic Aspects of Glaucoma Ramrch III", Schattauer, New York 307 318 (1993)), efforts to purify the expressed protein were encumbered by insolubility and other problems. Nguyen, T.D. et al., (In: "Basic Aspects of Glaucoma Research III", Schattauer, New York, 331 343 (19~9~3~) used a molecular cloning approach to isolate a highly induced mRNA species from glucocortirnid-induced human trabecular cells. . The mRNA exhibited a time rnurse of induction that was similar to the glucocorticoid-induced proteins. The clone was designated "IL2" (ATCC No:
97!994, American Type Culture Colle~ion" Rocl~v~le I~ryland).
Nguyen et al., U.S. Patent Number 6,171,788, isolated a IL2 clone which encoded a novel secretory protein that is induced in cells of the trabecular meshwork upon exposure to gluoocorticoids. It has been proposed that this protein may become deposited in the extracellular spaces of the trabecular meshwork and bind to the surface of the endothelial cells that line the trabecular meshwork, thus causing a decrease in aqueous flow. (quantitative dot blot analysis 25. and PCR evaluations have shown that the mRNA exhibits a progressive induction with time whereas other known GC-inductions from other systems and found in HTM cells (metallothionein, alpha-1 acid glycoprotein and alpha-1 anticl~gnnotrypsin) reached maximum level at one day or earlier. Of particular interest, the induction level of this clone was very high (4-6% total cellular mRNA) with rnntrol levels undetectable without PCR method. Based on studies of 35S
methionine cell labeling. the clone has the characteristics recently discovered for the major GC induced extracellular glyooprotein in these cells, which is a sialenated, N-glyeosylated molecule with a putative inositol phosphate anchor. The induction of mRNA approarched 4% of the total cellular mltNA. The mIZNA increased progressively over 10 days of dexamethasone treatment. The IL2 clone is 2.0 Kb 73185-12(S) whereas the Northern blotting shawl a band of ~.5 ICb. Although not including a poly A tail, the 3' end of the-clone contains two consensus polyadenylation signals.
A genomic clone was isolated and designated PtTIGR clone (A~'CC No:
97570, American Type Culture Collection, Rockville, Maryland). In-situ hybridization using the P1TIGR clone shows a TIGR gene and/or a sequence or sequences that specifically hybridize to the TIGR gene located at chromosome I, q2127, and more preferably to the TIGR gem located at chromosome 1, q22-26, and most preferably to the TIGR gene located at chromosome 1, q24. Clone PITKRt comprises human genDmic sequences that speafically hybridize to the TTGR gene cloned into the BamHI site of vector pCYPAC (Ioannou et al., Mature Genetics, 6:84-89 (1994) ) . .
~As used herein, the term "TIGR gem" refers to the region of DIVA involved in producing a TIGR protein; it includes, without limitation, regions proceeding and following the coding region as well as intervening sequences between individual coding regions.
As used herein, the term "TIGR oxen" refers to any interrupted region of the TIGR gene that serves as a template for a mature 3TGR mRNA molecule. As used herein, the term "TZGR intron" refers to a region of the TIGR gene which is non coding and serves as a template for a TIGR mRNA molecule.
Localization studies using a Stanford G3 radiation hybrid panel mapped the TIGR gene near the D1S?536 marker with a LOD score of 6.0 (Richard d al., American Journal of Human Genetics 52.5: 91S-921 (3993), Frazer et aL, Grnomics 14.3: 574 578 (1992) .
Research Genetics, Huntsville, Alabama). Other markers in this region include: D1S210; D1S1552; D1S2536; D1S2790; SHC~C-1280; and Dl'S~58.
Sequences located upstream of the 3'IGR coding region are isolated and sequenced in a non-glaucomic individual. The upstream sequence is set forth in SEQ ID. No. 1. Sequence comparisons of the upstream .region of a nonglaucoma individual and individuals with glaucoma identify a number of mutations in individuals with glaucoma. These mutations are illustrated in "Figure 2. Five mutations are identified. TIGRmfl is the result of a replacement of a cytosine with a guanine at position 4337 (SEQ ID NO: 1, SEQ ID NO: ~, and SEQ ID NO: 3).
TIGRrnf2 is the result of a replacement of a cytosine with a rhymine at position 4950 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3). TIGRmt3 is the result of en addition in the following order of a guanine, a thymin~e, a guanine, and a thymine (GTGT) at position 4998 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3).
TIGRmt4 is the result of a replacement of an adenine with a guanine at position 4256 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3). TIGRmtS is the result of a replacement of a guanine with an adenine at position 4262 (SEQ ID NO: 1, SEQ
ID
NO: 2 and SEQ ID NO: 3). One or more of TIGRmtl, TIGRmt2, TIGRmt3, TIGRmt4, and TIGRmtS can be homozygous or heterozygous.
Sequence comparisons of the upstream region of a non-glaucoma individual and individuals with glaucoma identify at least one sequence variation in individuals with glaucoma. One such sequence variant is illustrated in Figure 2.
TIGRsv1 is the result of a replacement of an adenine with a guanine at position 4406 {SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3).
Molecules comprising sequences upstream of the TIGR coding region provide useful markers for polymorphic studies. Such molecules include primers suitable for single strand conformational polymorphic studies, examples of which are as follows: forward primer "Sk-la": 5'-TGA GGC TTC CTC TGG AAA C-3' (SEQ
ID NO: 6); reverse primer "cat": 5'-TGA AAT CAG CAC ACC AGT AG-3' (SEQ ID
NO: 7); forward primer "CA2": 5'-GCA CCC ATA CCC CAA TAA TAG-3' (SEQ ID
NO: 8); reverse primer "Pr+1": 5'-AGA GTT CCC CAG ATT TCA CC-3' (SEQ ID
NO: 9); forward primer "Pr-1": 5'-ATC TGG GGA ACT CTT CTC AG-3' (SEQ ID
NO: 10); reverse primer "Pr+2(4A2)": 5'-TAC AGT TGT TGC AGA TAC G-3' {SEQ
ID NO: 11); forward primer "Pr-2(4A)": 5'-ACA ACG TAT CTG CAA CAA CTG-3' (SEQ ID NO: 12); reverse primer "Pr+3(4A)": 5'-TCA GGC TTA ACT GCA GAA
CC-3' (SEQ ID NO: 13); forward primer "Pr-3(4A)": 5'-TTG GTT CTG CAG TTA
AGC C-3' (SEQ ID NO: 14); reverse primer "Pr+2(4A1)": 5'-AGC AGC ACA AGG
GCA ATC C-3' (SEQ ID NO: 15); reverse primer "Pr+1(4A)": 5'-ACA GGG CTA
TAT TGT GGG3' (SEQ ID NO: 16).
In addition, molecules comprising sequences within TIGR exons provide useful markers for poiymorphic studies. Such molecules include primers suitable for single strand conformational polymorphic studies, examples of which are as follows: forward primer "KS1X": 5'-CCT GAG ATG CCA GCT GTC C-3' (SEQ ID
NO: 17); reverse primer "SK1XX": 5'-CTG AAG CAT TAG AAG CCA AC-3' (SEQ
ID NO: 18); forward primer "KS2a1": 5'-ACC TTG GAC CAG GCT GCC AG-3' (SEQ ID NO: 19); reverse primer "SK3" 5'-AGG TTT GTT CGA GTT CCA G-3' (SEQ
iD NO: 20); forward primer "KS4": 5'-ACA ATT ACT GGC AAG TAT GG-3' (SEQ
ID NO: 21); reverse primer "SK6A": 5'-CCT TCT CAG CCT TGC TAC C-3' (SEQ ID

NO: 22); forward primer "KS5": 5'-ACA CCT CAG CAG ATG CTA CC-3' (SEQ ID
NO: 23); reverse primer "SK8": 5'-ATG GAT GAC TGA CAT GGC C-3' (SEQ ID NO:
24); forward primer "KS6": 5'-AAG GAT GAA CAT GGT CAC C-3' (SEQ ID NO:
25).
The locations of primers: Sk-la, cat, CA2, Pr+1, Pr-1, Pr+2(4A2), Pr-2(4A), Pr+3(4A), Pr-3(4A), Pr-3(4A), Pr+2(4A1), and Pr+1(4A) are diagramatically set forth in Figure 4. The location of primers: KS1X, SK1XX, Ks2al, SK3, KS4, SK6A, KSS, SKB, and KS6 are diagramatically set forth in Figure 5.
The primary structure of the TIGR coding region initiates from an ATG
initiation site (SEQ ID N0:3, residues 5337-5339) and includes a 20 amino acid consensus signal sequence a second ATG (SEQ ID NO: 3, residues 5379-5381), indicating that the protein is a secretory protein. The nucleotide sequence for the TIGR coding region is depicted in Figure 7 (SEQ ID NO: 26). The protein contains an N-linked glycosylation site located in the most hydrophilic region of the molecule. The amino terminal portion of the protein is highly polarized and adopts alpha helical structure as shown by its hydropathy profile and the Garnier-Robison structure analysis. In contrast, the protein contains a 25 amino acid hydrophobic region near its carboxy terminus. This region may comprise a glucocorticoid induced protein (GIP) anchoring sequence. The amino acid sequence of TIGR is depicted in Figure 8 (SEQ ID NO: 33).
Study of cyclohexamide treatment in the absence and presence of GC suggest that the induction of TIGR may involve factors in addition to the GC receptor.
The TIGR gene may be involved in the cellular stress response since it is also induced by stimulants such as H202, 12-O-tetradecanolyphorbol-13-acetate (TPA), and high glucose; this fact may relate to glaucoma pathogenesis and treatment.
Sequence comparison of the upstream region identify a number of DNA
motifs (cis elements). These DNA motifs or cis elements are shown in Figure 1.
These motifs include, without limitation, glucocorticoid response motif(s), shear stress response motif(s), NFxB recognition motif(s), and APl motif(s). The locations of these and other motifs are diagramatically set forth in Figure 1. As used herein, the term "cis elements capable of binding" refers to the ability of one or more of the described cis eiements to specifically bind an agent. Such binding may be by any chemical, physical or biological interaction between the cis element and the agent, including, but not limited, to any covalent, steric, agostic, electronic and ionic interaction between the cis element and the agent. As used herein, the term r '73185-12 (S) "speci~ca~llx binds" refers to the ability of the agent fio bind to a specified cis element but not to wholly unrelated nudeic acid sequences.
A preferred loss of agents comprises TIER nucleic and molecules ('"TIGR
molecules"). Such molecules may be either I?NA or RNA. A second preferred lass 5-_ of agents ('"'TIGR molecules") comprises the TIGR protein, its peptide fragments, fusion proteins, and analogs.
Expres$ion of the rat PRL gene is highly restricted ~ pituitary lactotroph cells and is.induced by the cAMP-dependent protein kinase A pathway. At least one of the redundant pituitar~r specific elements (PRL-FPlll) of the proxumal rat PRL
promotor is required for this protein lcinase A effect (Rajnarayan et aL, Molecular Endochronology 4: 502-512 (1995.), herein incorporated by reference). A
sequence corFesponding to an upstream motif or cis element characteristic of FRL-Fell l is set forth in Figure 1 at residues 370-388 and 4491-4,502, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected bx agents capable of altering the biochemical properties or concentration of molecules that bind the PRL-FPlil upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence (GR/PR), recognized by both the glucocorticoid receptor of rat liver and the progesterone receptor from rabbit uterus, has been reported to be involved in glucocorticoid and progesterone-dependent gene expression (Von der Ahe tt aL, Nature 3t3: 706-709 (1985)). __ A, sequence corresponding to a GC/PR upstream motif or cis element is set forth in Figure 1 at residues 433-445. In acxordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of glucocorticoid or progesterone or their homologues, including, but not limited to, the concentration of gluoooorticoid or progesterone or their homologues bound to an GC/PR upstream 30. motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment; such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
Shear stress motif (SSRE) or cis element has been identified in a number of a 3S genes including platelet-derived growth factor B chain, tissue plasnninogen activafior 73185-12(5) (tPA), ICAM-1 and TGF-~1 (Resnitk d al., Pros. Natl. Acad. Sci. !LISA) 80:
4591-4595) .
Transcription of these genes has been associated with humoral stimuli such as cytoldnes and bacterial products as well as hemodynamic stress forces. Sequences corresponding to a upstream shear stress motif or cis element are set forth in Figure 1 at residues 445-451,1288-1293, 3602, 4171-4776, and 5240-5245, respectively. In accordance with the embodiments -of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of molecules capable of binding the shear stress motif. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for a glucocorticoid response upstream motif (GRE) or cis element has been characterized (Beato, Cell 56: 335-344 (1989); Becker et al., Nature 324: 686-688 (1986), herein incorporated by reference; Sakai et al., Genes and Development 2: 1144-1154 (1988), herein incorporated by reference). Genes containing this upstream motif or cis element are regulated by glucocorticoids, progesterone, androgens and mineral corticoids (Beato, Cell 56: 335-344 (1989)).
Sequences corresponding to glucocorticoid response upstream motif or cis element are set forth in Figure 1 at residues '574-600,104?-1056, 2444-2468, 2442-?.269, 353~6-3563, 4574-4593, 4595-4614, 4851-4865, 4844-4864, 5079 5084, and '5083-5111, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of alxering the biochemical properties or concentration of molecules capable of binding a glucocorticoid response upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaurnma.
A sequence specific binding site (CBE) for the wild type nuclear phosphoprotein, p53, has been identified and appears to be associated with replication origins (Kern tt al. Scienct 2.52: 1708-1711 (1991')).
A sequence rnrresponding to an CBE upstream motif or cis element is set forth in Figure 1 at residues 735-746. In accordance with the embodiments of the present invention, transcription of 3TGR molecules can be ef#ected by agents capable of altering the biochemical properties or concentration of p'53 or its homologues, 73185-12(S) including, but not limited to, the concentration of p53~ or its homologues bound to an CBE upstrea~nn motif or cis element. Such agents can be used in the study of glaucoma pathogenesis.. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
Nuclear factor ets-like (NFE), a transcriptional activator that facilitates p50 and c-Rel-dependent IgH 3' enliancer activity has been shown to bind to an NFE
site in the Rel-dependent IgH 3' enhancer (L.inderson tt al., European J.
Immunology 27:
468-475 (1987) j . A sequence corresponding to an NFE upstream motif or cis element is set forth in Figure 1 at residues 774-795. In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an NFE
upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
An upstream motif or cis element (KTF.1-CS) for a control element 3' to the human keratin 1 gene that regulates cell type and differentiation-specific expression has been identified (Huff et al., ]. Biological Chemistry 268: 377-384 (1993) ) .
A sequence corresponding to an upstream motif or cis element characteristic of KTF.1-CS is set forth in Figure 1 at residues 843-854. In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or concentration of KTF.1-CS or its homologues, including, but not limited to, the concentration of KTF.1-CS or its homologues bound to a KTF.1-CS upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis.
In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A progesterone responsive element (PRE) that maps to the far upstream steroid dependent DNase hypersensitive site of chicken lysozyme chromatin has been characterized (Hecht d al., EMBO J. 7: 2063-2073 (1988).;) .
The element confers hormonal regulation to a heterologous promoter 73185-12 (S) and is composed of a cluster of progesterone receptor binding sites. A
sequence corresponding to an upstream motif or cis element characteristic of PRE is set forth in Figure 1 at residues 9871026. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effe~ed by agents capable of altering the biochemical properties or concentration of molecules capable of binding a progesterone responsive PRE upstream motif or cis.element. Such agents may be useful in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glauoo~na~ prognlosis. In another embodiment such agents can be used in the treatment of glaucoana.
A sequence (ETF-EGFR) has been characterized which serves as a motif for a traps-active transcription factor that regulates expression of the epidermal growth factor receptor (Regec et al., Blood 853711-2719 (1995).
A sequence corresponding to an ETF-Et~R upstream motif or cis element is set forth in Figure 1 at residues 1373-1388. In accordance with the embodiments of the present invention, transcription of T~GR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an ETF-EGFR upstream motif or ~cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A common traps-acting factor (SRE-cFos) has been shown to regulate skeletal and cardiac alpha-Actin gene transcription in muscle (Muscat et al., Molecular and 2.5 Cellular Biology 10: 4120-4133 (1988)) . A sequence corresponding to an SRE-cFos upstream motif or cis element is set fortn in figure 1 at residues 1447-1456. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear 'factors or their homologues bound to an SRE-cFos upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another~embodiment such agents can be used in the treatment of .glaucoma.

73185-12(S) Alu repetitive elements are unique to primates and are interspersed within the human genome with an average spacing of 4Kb. Wlvle some AIu sequences are actively transcribed bx polymerase III, normal transcripts may also contain Alu derived sequences in 5' or 3' untranslated regions Qurka and Mikahanljaia, J.
Mol.
Evolufio~t 32: 105-121 (1991), Claveria and Makalowski, Nature 37'I: 751 752 (1994)x. A
sequence corresponding to an Alu upstream motif or cis element is set forth in Figure 1 at residues 1331-1550. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues. bound to an Alu upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaurnma.
A consensus sequence for a vitellogenin gene-binding protein (VBP) upstream motif or cis element has been characterized (Iyer et aL, Mokcutar and Cellular Biology I1: 4863-487'5 (1991);). Expression of the VBP gene commences early in liver ontogeny and is not subject to circadian control. A sequence corresponding to an upstream motif or cis element capable of binding VBP is set forth in Figure 1 at residues 1786-1T97. In accordance with the embodiments of the present invention, transcription of TIER molecules can be effected by agents capable of altering the biochemical properties or concentration of VBP or its homologues, including, but not limited to, the concentration of VBP
or its homologues bound to an VBP upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A structural motif (Malt-CS) or cis element involved irt the -activation of au promoters of the maltose operons in Eschtrictcia colt and KlebsielIa pneumortiae has been characterized (V'idal-Ingigliardi et aL, j. MoI. Biol. 2I8: 323-334 (1991)x, A sequence corresponding to a upstream Malt-CS motif or cfs element is set forth in Figure 1 at residues 1832-1841. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of 7385-12(S) molecules capable of binding the upstream Malt-CS motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. in another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for an estrogen receptor upstream motif or cis element has been characterized (ERE) (Forman ef aL, MoI. ~ndocrirtology 4: 1293-1301 (1990) ;
de Verneuil cE al., Nucltic Acid Res. 18: 4489-4497 (1990), herein incorporated by reference; Gaub et al., CdI fi3:12671~76 (1990j) .
A sequence corresponding bo half an upstream motif or cis element capable of binding estrogen receptor is set forth in Figure 1 at residues 2166-2195, 3413-3429, and 3892-3896, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration, of the estrogen receptor or its homologues bound to an upstream motif or cis element.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of .glaurnma prognosis.
In another embodiment such agents can be used in the treatment of glaucaina.
Certain protein binding sites (NF-mutagen) in Ig gene enhancers which determine transcriptional activity and induc~ility have been shown to interact with nuclear factors (L.enardo d aL, Scicnct 236: 1573-1577 (1987) ) .
A sequence corresponding to an NF-mutagen upstream motif or cis element is set forth in Figure 1 at residues ?329-2338. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical propertses or concentration of nuclear factors or their homologues, including, but not limited to, the a~ncentration of nuclear factors or their homologues bound to an NF mutagen ups#ream moti#
or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatonent of 3fl glaucoma.
A consensus sequence for a transcriptional repressor of .c-myc ~{myc-PRF) upstream motif or cis element has been identified (Kakkis tf aL, Naturt 339:
n8-719 (1989)) . Myc-PRF interacts with another widely distributed protein, myc-CFl (common factor 1), which binds nearby and this association may be important in myc-PRF repression. A sequence corresponding to 1~6 73185-12 (S) an upstream motif or cis element capable of binding myc-PRF is set forth in Figure 1 at residues 2403-2416. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or camcentratia~n of myc-PRF or its homologues, including, but not limited to, the concentration of myc-PRF or its homologues bound to an myc-PRF upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the studx of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glauaonna.
human transcription factor activator protein 2 (AP2) is a transcription factor that has been shown to bind to Spl, nuclear factor 1 (NFl) and simian virus 40 transplantation (SV40 T) antigen binding sites. It is developmentally regulated (Williams and Tijan, Gene Dev. 5: 670-682 (1991);
Mitchell et al., Genes Dev. 5: 105-119 (1991); Coutois tf al., Nucjric Acid Rt~arc)c I8: 57'-64 (1990); Comb et al., Nucreic Acid Research 18: 397'5-3982 (1990);
Winings et al., Nucleic Acid Research 19: 3709 3714 (1991) ) .
Sequences corresponding to an upstream motif or cis element capable of binding AP2 are set forth in Figure 1 at residues 2520-2535, and 5170-5187, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering . the biochemical properties or concentration of AP2 or its homologues, including, but not limited to, the concentration of AP2 or its hoanologues bound to an upstream motif or cis element. Such agents may be useful in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glauooa~a.
Drosophila RNA polymerise II heat shock ttansQiption factor ~ is a transcription factor that has been shown to be required for active transcription of an hsp 70 gene (Parker and Topol, Cell 37: 2T3-283 (1984)) .
Sequences corresponding to an upstream motif or cis element capable of binding 1-iSTF are set forth in Figure 1 at residues 2622-2635, and 5105-5132.
In accordance with the embodiments of the present invention, transcription of TIGR
_ molecules can be effected by agents capable of altering the biochemical properties o'r concentration of HSTF or its homologues, including, but not limited to, the 73185-12(S) concentration of HSTF or its homologues bound to an I~S"fF upstream motif os cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A sequence corresponding to an upstream motif or cis element characteristic of SBF is set forth in Figure 1 at residues 2?33-2?43 (Shore tt aL, EMBO ). ~:
461-4~6?
(1980. In accordance with the esnbodiments of the present invention, transcription of TIGR molecules can be effected by agents w capable of altering the biochemical properties or concentration of molecules that bind the SBF upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoona.
An NFl motif or cis element has been identified which recognizes a family of at least six proteins (Courtois, d aL, Nucleic Acid Res. I8: S?-64 (1990j;
Mul et al., J. Virol. 64: 5510=5518 (1990);
lZossi ef aL, Cell 52 405-414 (1988) ;
Gounari et aL, EMBO J. I0: 559-566 (1990):
Goyal et al., Mol. Cell Biol. I0: 1041-1048 (1990);
Mermond ct al., Nature 33?: 55? X61 (1988);
Gronostajski et al., Molecular and Cellular Biology 5: 964-9?1 (1985) ;
Hennighausen et aL, EMBO J. 5:136?-1371 (3986j, ;
Chodosh cf al., CeI1$3: 11-24 (1988) ) .
The NFl protein will bind to an NFl motif or cis element either as -a diner (if the motif is palindromic) or as an single molecule (if the motif is not palindromic). The NFl protein is induced by TGF~ (Faisst and Meyer, Nucleic Acid Research 20: 3-26 (1992)). Sequences co~espcmding to an upstream motif or cis element capable of binding NFl are set forth in Figure 1 at residues 2923-2938, 4143-416?, and 4886-4900, respectively. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or oonaentration of NFl or its homologues, including, but not limited to, the rnncentra#ion of hiFi or its .
homologues bound to an upstream motif or cis elf 'Such agents can be used in ..
the study of glaucoma pathogenesis. In another embodiment, such agents can also 73185-12(S) be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
Conserved regulatory sequences (NF-MHCIIA/B) of a rabbit major .~ histocompatability complex (NiFIC) class II gene are responsible for binding two distifnct nuclear factors NF-MHCIIA and NF-MHCIIB and are believed to be involved in the regulation of coordinate expression of the class II genes -eg. MHC
class II gene in B lymphocytes (Sittisombut Molecular and Cellular Biology 5:

2041 (1988) ) . A sequence corresponding to an NF-MHCIIA/B upstream motif or cis element is set forth in Figure 1 at residues 14 2944. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of NF-MFICIIA or NF-MHCIIB or their homologues, including, but not limited to, the concentration of NF-MfiCIIA or NF-MHCIIB or their homologues bound to an IVF-MHCIIA/B upstream motif or cis element. Such agents can be used in the study of glaurnma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
PEA 1 binding motifs or cis elements have been identified (Piette and Yaniv, EMBO j. 5:1331-1337 (1987), herein incorporated by reference). The PEAL
protein is a transcription factor that is reported to bind to both the polyoma virus and c~'os enhancers A sequence corresponding to an upstream motif or cis element capable of binding PEAL is set forth in Figure 1 at residues 3285-3298. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected bx agents capable of altering the biochemical properties or concentration of 25. PEA1 or its homologues, including, but not limited to, the concentration of P1:A1 or its. homologues bound to an upstream motif or cis element. Such agents can be used in the study of glaurnma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A conserved cis-acting regulatory element (ICS) has been shown to bind traps-acting constituitive nuclear factors present in lymphocytes and fibroblasts which are involved in the interferon (IFN~mediated transcriptional enhancement of MFiC class I and other genes (Shirayoshi ~ al., Pros. Natl. Acad. Sci. (LISA) 85: 5884-5888 (1988)) . A sequence corresponding to an ICS ' .
35~ upstream motif or cis element is set forth in Figure 1 at residues 3688-3b99. In 73185-12 (S) accordance with the embodiments of the present invention, transQiption of 1IGR
molecules can be effected by agents capable of altering the ~bioch~ewical properties or concentration of nuclear factors or their homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an ICS
upstream motif or cis element. Such agents can be used in the study of :glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A consensus sequence for an ISGF'1 upstream motif or cis element has bean characterized (Iman tt aL, Nucleic Acids Rcs. l8: 6,573-X58011990);
Harada et al., C.rII 63: 303-312 (1990);
Yu-Lee et al., Mol. CeII Biol. 10: 3087 3094 (1990);
Pine et al., Mol. Cell Blot. 10: 32448?457 (1990) ) .
ISGF2 is induced by interferon a and 7, prolactin and virus infections. A
sequence corresponding to an upstream motif or cis element capable of binding 1SGF2 is set forth in Figure 1 at residues 4170-4179. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents.capable of altering the biochemical properties or concentration of ISGF2 or its homologues, including, but not limited to, the concentration of fSGF2 or its homologues bound to an upstream motif or cis element Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A sequence corresponding to an upstream motif or cis element capable of binding zinc is set forth in Figure 1 at residues 4285-4292. In accordance with the embodiments of the present invention, transQiption of TIGR ;nolecules can be effected by agents capable of altering the biod~ennical properties or oonrentration of zinc. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis.
bt another embodiment such agents can be used in the treatment of glaucoma.
A sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 is set forth in Figure 1 at residues 4379-4404 (Taniguchi tt al., Proc. Natt. Acad. Sci (LISA) I~ 5090-5094 (19T9~ ) ~ wn accordance with the embodiments of the present inv~ntiqn, transcription of TiGR
molecules can be effected by agents capable of altering the biocheanical properties or 73185-12(S) concentration of molecules that bind the CAP/CRP-gal4 upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaurnma pmgnosis. In another embodiment such agents can be used in the treatment of glaucoma.
Human transcription factor activator protein 1 (APl) is a transcription factor that has been shown to regulate genes which are highly expressed in transformed cells such as stromelysin, c fos, al-anti-trypsin and collagenase (Gutatan and jllfasxlxk, EMBO J. ~?: 2241-2246 (1990), herein incorporated by mferertoe;
Martin et aL, Proc. Na~tI. Acad. Sci. LISA 85: 5839-5843 (1988), herein incorporated by reference;
Jones et at., Genes and Bevtloprnenf 2 267-281 (1988) Faiss~t and Meyer, Nucleic Acid Research 20: 3-26 (1992):
-Kim ct aL, Molecular and Cellular Biology I0: 1492-1497 (1990); Baumhueter tE al., ~EM80 J. 7: 2485-2493 (1988)). The APl transcription factor has been associated with genes that are activated by 12-O-tetradecanolyphorbol-13-acetate (TPA) (Gutman and Wasylyk, EMBO J.7: 2241-2246 (1990)). Sequences corresponding to an upstream motif or cis element capable of binding APl are set forth in Figure 1 at residues 4428-4434 and 4627-4639, respectively. In accordance with the embodiments of the present invention, transcription of TIER awlecules can be effected by agents capable of altering the biochemical properties or concentration of AP1 or its homologues, including, but not limited to, the concentration of APl or its homologues bound to an upstream motif or cis element. Such agents can be used in the studx of glaucoma pathogenesis. In another eatbodiment, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
The sex-determining region of the Y chromosome gene, sry, is expressed in the fetal mouse for a brief period, just prior to testis differentiation. SRY
is a DNA
binding protein known to bind to a CACA-rich region in the sry gene (Vriz tt-al., Hiochtmistry and MoIrcular Biology Inttrnafumat 37: 1137-1146 (1995) ) .
A sequence corresponding to an upstream motif or cis element capable of binding SRY is set forth in Figure 1 at residues 4625-4634.
In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or concentration of SRY or its homologues, including, but not limited to, the 73185-12(S) concentration of SRY or its hwnologues bound to an upstream motif or cis element.
Such agents may be useful in the study of glaucoma pathogenesis. in en0fiher embodiment, such agents can also be used in the study o~f glaucoma prognosis.
In arrotl~r embodiment such agents can be used in the treatment of glaucoma.
A sequence corresponding to an upstream motif or cis element characteristic of GCZ-GH is set forth in Figure 1 at residues 4689-4711 (West cE aL, Mohcular and Cellular Biology 7: 1193-1197 (1987j~. ~
accordance with the embodiments of the present inventia~n, transcription of TIER
molecules can be effected by agents capable of altering the biochemical properties or concentration of GC2-GH or its homologues, including, but not limited to, the rnncentration of GC2-GH or its homologues bound to an upstream nnotif o~r cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of .glaucoma prognosis. 1n another embodiment such agents can be used in the #reatment of glaucoma.
PEA 3 binding motifs ar cis elements have been identified (Martin et al., Prnc.
Natl. Aced. Sci. (USA) 85: 5839-5843 (1988);
Gutman and Wasylyk, EMBD j. 7: ?241-2246 (1990) ) .
The PEAS pmtein is a transcription fac~r that is reported to interact with APl like proteins (Martin et aL, Pros. Nail. Aced. Sci. (USA) 85: X839-5843 (1988), herein incorporated by reference). Sequences corresponding to an upstream motif or cis element capable of binding PF.A3 is set forth in figure 1 at residues 47f5-4?69.
In accordance with the embodiments of the present irnention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or -concentration of PEAS or its homologues, including, but not limited to, the concentration of PF.A3 or its homologues bound to an upstream motif or cis element.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaucoma prognosis.
4n another embodiment such agents can be used in the treatment of glaucoma.
Mammalian interspersed repetitive {MIR) is an element involved in the coding and processing sequences of mamnnalian genes. The MIR element is at least 260 by in length and numbers about 105 rnpies within the mammalian genome (Murnane et al., Nucltic Acids Resrnrclt I5: 2837-2839 (1995) ) . ~ -A sequence corresponding to an MIR upstream motif or cis element is set forth in figure 1 at residues 4759-4954. In accordance with the embodiments of 73185-12(S) the present invention, transcription of TIGR awlecules can be effected by agents capable of altering the biochea~i,cal properties or concentration of nuclear factors or them homologues, including, but not limited to, the concentration of nuclear factors or their homologues bound to an MIR upstream nwtif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodianent, such agents can also be used in the study of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
Normal liver and differentiated hepaboma cell lines contain a hepatocyte specific nuclear factor (HIVF-1) which binds as acting elenn~ent sequences within the promoters of the alpha and beta chains of fibrinogen and alpha 1-antitrypsin (Baumhueter tt aL, EMBO ]. 8: 2485.-2493. A
sequence rnrresponding to an HNF-1 upstream motif or cis element is set forth in Figure 1 at residues 4923-4941. In accordance with the embodiments of the present invention, transcription of TIGR molecules can be effected by agents capable of altering the biochemical properties or concentration of I-iNF-1 or its homologues, including, but not limited to, the concentration of HNF-1 or its homologues bound to an HNF-1 upstream motif or cis element. Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the shidy of glaucoma prognosis. In another embodiment such agents can be used in the treatment of glaucoma.
A number of cis elements or upstream motifs have been associated with gene regulation by steroid and thyroid hormones (e.g. glucocorticoid and esxrogenKBeato, CeII 56: 335-344 (1989) Breast et aL, Molecular Endocrinology 89:1996-2000 (1989): Glass et al., Cell 54: 313-323 (1988); Evans, Science 240:
889,895 (1988) ) .
A consensus sequence for a thyroid receptor upstream motif or cis element ('1'RE) has been characterized (Beato, CtII 56: 335-344 (1989), herein incorporated by referenced A sequence corresponding to a -thyroid receptor upstream motif or cis element is set forth in Figure 1 at residues 5151-5156. Thyroid hormones are capable of regulating genes containing a thyroid receptor upstream motif or cis element (Glass et al., Cdl 54: 313-323 (1988) ) .
Thyroid hormones can negatively regulate TIGR In accordance with the embodiments of the present invention, transcription of TIGR molecules can be r effected by agents capable of altering the biochemical properties or concentration of 73185-12(S) molecules capable of binding a thyroid receptor upstream motif or cis element.
Such agents can be used in the-study of glaucoma pathogenesis. in another embodiment, such agents can also be used in the study of glaucoma prognosis.
In another embodiment such agents can be used in the treatment of glaucoma.
NFxB is a transcription factor that is reportedly associated with a number of biological processes including T-cell activation and rytokine regulation (L,enardo et aL, CeII 58: 227 229 (1989) ).. A consensus upstream motif or cis element capable of binding NFxB has been reported (Lenardo tt aL, CtII
58: 227 229 (1989)). Sequences corresponding to an upstream motif or cis element capable of binding NFxB are set forth in Figure 1 at residues ~516tr5175. In accordance with the embodiments of the present invention, transcription of TIGR
molecules can be effected by agents capable of altering the biochemical properties or concentration of NFxB or its homologues, including, but not limited to, the concentration of NFxB or its homologues bound to an upstream motif or cis ehnent.
Such agents can be used in the study of glaucoma pathogenesis. In another embodiment, such agents can also be used in the study of glaurnma prognosis.
In another embodiment such agents can be used in the treatment of glaucoma.
Where one or more of the agents is a nucleic acid molecule, such nucleic acid molecule may be sense, antisense or triplex oligonucleoddes cornesponding to any part of the TIGR promoter, TIGR cDNA, TICK intron, TTGR exon or TIGR gene.
The TIGR promoter, or fragment thereof; of the present invention may be cloned into a suitable vector and utilized to promote the expression of a marker gene (e.g. firefly luciferase (de Wet, Mol. CeI1 l3iol. 7: 72'5-737 (1987) or GUS (Jefferson et aL, EMBO J. 6: 3901-3907 (19~j).
25; ' . In another embodiment of the present invention, a T1GR promoter may be cloned into a suitable vector and utilized -to promote the expression of a TIGR gene in a suitable eukaryotic or prokaryotic host cell (e.g. human trabecular cell, Chinese hamster cell, E. coli). In another embodiment of the present invention, a TIGR promoter may be cloned into a suitable vector and utilized to promote the expression of a homologous or heterologous gene in a suitable eukaryotic or prokaryotic host cells (e.g.
human trabecular cell lines, Chinese hamster cells, ~. cdi~.
Practitioners are familiar with the standard resource mater3ais which dest~be specific conditions and procedures for the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, etc), generation of recombinant 73185-12(S) organisnns and the screening and isolating of clones, (see for example, Sambrook et al., In Mobecxtax Clonntg: A Laboratory Manual f Cold Spring Harbor Press (1989).;
Old and Primrose, In Principles of l~ifa~aipulation: An Induction To Genetic~~
Engineering; Blackwell (1~.94~) .
S
The T~C~R promoter or any portion thereof of the present invention may be used-in a gel-retardation or band shift assay (Old and Primrose, In Principles of Gene Manipulation: An Introduction To Genetic F~eering, Blackwell (1994)).
Aitx of the cis elements identified in the present invention may be used in a gel-retardation or band shift assax to isolate profieins capable of binding the cis element.
Suitable DIqA fragments or molecules comprise or consist of one or more of the following. sequences corresponding to an upstream motif or cis element characteristic of PRL-FPlll as set forth in Figure 1 at residues 370-388, and 4502, respectively, a sequence corresponding to an upstream motif or cis element I5 capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451,1288-1293, 3597-3602, 4771-4776, and 5240-5245, respectively, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600, 1042-1056, 2444-2468, 2442-2269, 20~ 3563, 4574-45593, 4595-4614, 4851-4865, 4844-4864, 5079-5084, 5083-5111, respectively, a sequence corresponding to ~an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element 25 capable of binding KTF.1-C~ as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 987 1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR as set forth in Figure 1 at residues I3'f3-1388, a sequence rnrresponding to an upstream motif or cis element 30 capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence rnrresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure l at residues 1786-1797; a sequence corresponding to an upstream motif or cis element 35 capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequenoes~

corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues 4759-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5154, and a sequence corresponding to an J

upstream motif or cis element capable of binding NFKB as set forth in Figure 1 at residues 5166-5175.
A preferred class of agents of the present invention comprises nucleic acid molecules will encode all or a fragment of "TIGR promoter" or flanking gene sequences. As used herein, the terms "TIGR promoter" or "promoter" is used in an expansive sense to refer to the regulatory sequences) that control mRNA
production. Such sequences include RNA polymerase binding sites, glucocorticoid response elements, enhancers, etc. All such TIGR molecules may be used to diagnose the presence of glaucoma and severity of glaucoma. Such molecules may be either DNA or RNA.
Fragment nucleic acid molecules may encode significant portions) of, or indeed most of, SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5.
Alternatively, the fragments may comprise smaller oligonucleotides (having from about 15 to about 250 nucleotide residues, and more preferably, about 15 to about 30 nucleotide residues.). Such oligonucleotides include SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: i0, SEQ ID NO: 11, SEQ ID NO: 12, SEQ
ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID
NO: 23, SEQ ID NO: 24, SEQ ID NO: 25.
Alternatively such oligonucleotides may derive from either the TIGR
promoter, TIGR introns, TIGR exons, TIGR cDNA and TIGR downstream sequences comprise or consist of one or more of the following: sequences corresponding to an upstream motif or cis element characteristic of PRL-FPI11 as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451,1288-1293, 3597-3602, 4771-4776, and 5240-5245, respectively, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600,1042-1056, 2444-2468, 2442-2269, 3536-3563, 4574-4593, 4595-4614, 4851-4865, 4844-4864, 5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS as set forth in Figure 1 WO 98!32850 PCT/US98/00468 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR
as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF
as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding IVF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEA1 as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a 73185-12 (S) sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 46T8-4?ll, a seguenae corresponding to an upstream motif or cis element capable of binding PEAS as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues 47'59-4954, a sequence corresponding to an upstream motif or cts element capable of binding NF H1VF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166 5175. For such purpose, the oligonudeotides must be capable of specifically hybridizing to a nucleic acid molecule genetically or physically linked to the TIGR gene. As used herein, the term "linked" refers to genetically, physically or operably linked.
As used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure, whereas they are unable to form a double-stranded structure when incubated with a non TIGR nucleic acid molecule. A nucleic acid molecule is said to be the "complement" of another nucleic acid molecule if they exhibit complete complementarily. As used herein, molecules are said to exhibit "complete complementarily" when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally complementary" if they can hybridize to one another with sufficient 2~ stability to permit them to remain annealed to one another under at least conventional "low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one arwther with sufficient stability to permit them to remain annealed to vne another under conventional "high-stringency" conditions. Conventional stringency conditions are described by Sambrook, J., ct aL, (In: Molecular Cloning, a Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, New York (1989)), and by Haymes, B:D., d al. (In: Nuclric Acid Hybridization, A Practical Approach, IRL Press, Washington, DC
(1985)) . Departures from complete complementarily are therefore permissible, as long as such departures do not 35. completely preclude the capacity of the molecules to form a double-stxanded structure. Thus, in order for an oligonucleotide to serve as a primer it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.
Apart from their diagnostic or prognostic uses, such oligonucleotides may be employed to obtain other TIGR nucleic acid molecules. Such molecules include the TIGR-encoding nucleic acid molecule of non-human animals (particularly, cats, monkeys, rodents and dogs), fragments thereof, as well as their promoters and flanking sequences. Such molecules can be readily obtained by using the above described primers to screen cDNA or genomic libraries obtained from non-human species. Methods for forming such libraries are well known in the art. Such analogs may differ in their nucleotide sequences from that of SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:
13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or from molecules consisting of sequences corresponding to an upstream motif or cis element characteristic of PRL-FPI11 as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451, 1288-1293, 3597-3602, 4771-4776, and 5240-5245, respectively, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600, 1042-1056, 2444-2468, 2442-2269, 3536-3563, 4574-4593, 4595-4614, 4851-4865, 4844-4864, 5079-5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KT'F.1-CS
as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an upstream WO 98!32850 PCT/US98/00468 motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HST'F as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA./B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEA1 as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element 73185-12 (S) capable of MIR as set forth in Figure I at residues 4759-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5175 because complete complementarily is not needed for stable hybridization The TIGR nucleic and molecules of the present invention therefore also include molecules that, although capable of specifically hybridizing with TIGR nucleic acid molecules may lack "complete complementarily."
Any of a variety of methods may be used to obtain the above-described nucleic acid molecules (Elles, Methods in Molecular Medicine: Molecular Diagnosis of Genetic I?iseases, Humana~ Press (1996) ). SEQ
ID NO: 1, SEQ~ ID N~ 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO:
6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ
II? N0':12, SEQ ID N0:13, SEQ ID N0:14, SEQ ID NO:15, SEQ ID N0:16, SEQ 1D
NO: 17', SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 2~3, SEQ ID NO: 24, SEQ 1D NO: 25, sequences corresponding to an upstream motif or cis element characteristic of PRL-FPlil as set forth in Figure 1 at residues 3?0-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress . motif or cis element as set forth in F:gore 1 at residues 446-451,1288-1293, 3597 3602, 4771-4776, and 5240-5245, respectively, sequences rnrresponding to glucocorticoid response upstream motif or cis element as set forth in Figure l .at residues 574-600,1042-1056, 2444-2468, 2442-2263, 3536-3563, 457'4-4593, 4595-4614, 4851-4865, 4844-4864, 5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Fiigure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis elennent capable of binding ETF-EGFR
as 35~ set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF
as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEA1 as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding AP1 as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element 73185-12(S) capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to as upstream motif or cis element capable of MIR as set forth in Figure 1 at residues 4759--' 954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NF~cB as set forth in Figure 1 at residues 5166-5175 may be used to synthesize all or any portion of the TIGR
promoter or any of the TIGR upstream motifs or portions the TIGR cDNA
(Zamechik ct al., Proc. Natl. Acad. Sci. (L1 S.A.) 83:4143 (1986); Goodchild et al., Proc.
Natl. Acad. Sci. (U.S.A.) 85:5507 (1988); Wickstrom et al., Pros. Natl. Acad.
Sci. (L1 S.A.) 85:1028; Holt, J.T. ct al., Molec. Cell. Biol. 8:963 (1988); GerHrirtz, A.M.
ct al., Science 242:1303 (1988r Anfossi, G., et al., Proc. Natl. Acad. Sci. (LLS.A.) 86:3379 (1989);
Becker, D., et al., EMBQ J. 8:367'9 (1989) ) .
Automated nucleic and synthesizers may be employed for this purpose. In lieu of such synthesis, the disclosed SEQ ID NO:1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ
ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 14, SEQ ID NO:11, SEQ ID N0:12, SEQ ID NO: 13, SEQ ID NO: 14, 24 SEQ ID NO: I5, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, sequences corresponding to an upstream motif or cis element ch racteristic of PRL-FPlll as set forth in Figure 1 at residues 370-388; and 4502; respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451,1288-1293, 3597 3602, 4771-4776, and 5240-5245, respectively, sequences.oarresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600, 1042-1056, 2444-2468, 2442-2269, 3563, 4574-4593, 4595-4614, 4851-4865, 4844-4864, 5079-5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as, set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstrea3n motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding APl as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a 73185-12(S) sequence oo~responding to an upstream motif or cis element capable of binding SRY
as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678~7~11, a sequence corresponding to an upstream motif or cis element capable of binding PEAS as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 a~t residues 4?59~-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid recepfior upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5175 may be used to define a pair of primers that can be used with the polymerise chain reaction (Mullis, K. et al., Cold Spring Harbor Symp. Quint.
Biol.
5I:263-273 (1~386); Erlich H. et al., EP 50,424; EP 84,796, EP 258,017, EP
237,362;
Mullis, K., EP 201,184; Mullis K. et al., US 4,683,202; Erlich, H., US
4,582,788; and Saiki, R et al., US 4,683,194)) to amplify and obtain any desired TIGR gene DNA
molecule or fragment.
The TIGR promoter sequences) and TIGR flanking sequences can also be obtained by incubating oligonucleotide probes of TIGR oligonucleotides with 20. members of genomic human libraries and recovering clones that hybridize to the probes. In a second embodiment, methods of "chromosome walking," or 3' or 5' RACE may be used (Frohman, M.A. d aL, Proc. Natl. Acid. Sci. (LLS.A.) 85:8998-(1988}; ~Ohara, O. et al., Proc. Natl. Acid. Sci.
(ILS.A.) 86:5673-5677 (1989)) to obtain such ' 25. seduences.
IL i3ses of the Molecules of the Invention in the Diagnosis and Prognosis of Glaucoma and Related Diseases A particularly desired use of the present invention relates to the diagnosis of 30 glaucoma, POAG, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. Another particularly desired use of the present invention relates to the prognosis of glaucoma, POAG, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. As used Herein the term "'glaucoma" includes both primary glaucomas, secondary 35~ glaucomas~ juvenile glaucomas, congenital glaucomas, and familial glaucomas, including, without limitation, pigmentary glaucoma, high tension glaucoma and low tension glaucoma and their related diseases. As indicated above, methods for diagnosing or prognosing glaucoma suffer from inaccuracy, or require multiple examinations. The molecules of the present invention may be used to define superior assays for glaucoma. Quite apart from such usage, the molecules of the present invention may be used to diagnosis or predict an individual's sensitivity to elevated intraocular pressure upon administration of steroids such as glucocorticoids or corticosteroids, or anti-inflammatory steroids).
Dexamethasone, cortisol and predrusolone are preferred steroids for this purpose. Medical conditions such as inflammatory and allergic disorders, as well as organ transplantation recipients, benefit from treatment with glucocorticoids.
Certain individuals exhibit an increased sensitivity to such steroids (i.e., "steroid sensitivity"), which is manifested by an undesired increase in intraocular pressure.
The present invention may be employed to diagnosis or predict such sensitivity, as well as glaucoma and related diseases.
In a first embodiment, the TIGR molecules of the present invention are used to determine whether an individual has a mutation affecting the level (i.e., the concentration of TIGR mRNA or protein in a sample, etc.) or pattern (i.e., the kinetics of expression, rate of decomposition, stability profile, etc.) of the TIGR
expression (collectively, the "TIGR response" of a cell or bodily fluid) (for example, a mutation in the TIGR gene, or in a regulatory regions) or other genes) that control or affect the expression of TIGR), and being predictive of individuals who would be predisposed to glaucoma (prognosis), related diseases, or steroid sensitivity. As used herein, the TIGR response manifested by a cell or bodily fluid is said to be "altered" if it differs from the TIGR response of cells or of bodily fluids of normal individuals. Such alteration may be manifested by either abnormally increased or abnormally diminished TIGR response. To determine whether a TIGR
response is altered, the TIGR response manifested by the cell or bodily fluid of the patient is compared with that of a similar cell sample (or bodily fluid sample) of normal individuals. As will be appreciated, it is not necessary to re-determine the TIGR response of the cell sample (or bodily fluid sample) of normal individuals each time such a comparison is made; rather, the TIGR response of a particular individual may be compared with previously obtained values of normal individuals.
In one sub-embodiment, such an analysis is conducted by determining the presence and/or identity of polymorphism{s) in the TIGR gene or its flanking regions which are associated with glaucoma, or a predisposition (prognosis) to glaucoma, related diseases, or steroid sensitivity. As used herein, the term "TIGR
flanking regions" refers to those regions which are located either upstream or downstream of the TIGR coding region.
Any of a variety of molecules can be used to identify such polymorphism(s).
In one embodiment, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ
ID
NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, sequences corresponding to an upstream motif or cis element characteristic of PRL-FP111 as set forth in Figure 1 at residues 370-388, and 4491-4502, respectively, a sequence corresponding to an upstream motif or cis element capable of binding GR/PR as set forth in Figure 1 at residues 433-445, sequences corresponding to an upstream shear stress motif or cis element as set forth in Figure 1 at residues 446-451, 1288-1293, 3597-3602, 4771-4776, and 5240-5245, respectively, sequences corresponding to glucocorticoid response upstream motif or cis element as set forth in Figure 1 at residues 574-600, 1042-1056, 2444-2468, 2442-2269, 3536-3563, 4593, 4595-4614, 4851-4865, 4844-4864, 5079-5084, 5083-5111, respectively, a sequence corresponding to an upstream motif or cis element capable of binding CBE as set forth in Figure 1 at residues 735-746, a sequence corresponding to an upstream motif or cis element capable of binding NFE as set forth in Figure 1 at residues 774-795, a sequence corresponding to an upstream motif or cis element capable of binding KTF.1-CS as set forth in Figure 1 at residues 843-854, a sequence corresponding to an upstream motif or cis element capable of binding PRE is set forth in Figure 1 at residues 987-1026, a sequence corresponding to an upstream motif or cis element capable of binding ETF-EGFR as set forth in Figure 1 at residues 1373-1388, a sequence corresponding to an upstream motif or cis element capable of binding SRE-cFos as set forth in Figure 1 at residues 1447-1456, a sequence corresponding to an upstream motif or cis element capable of binding Alu as set forth in Figure 1 at residues 1331-1550, a sequence corresponding to an upstream motif or cis element capable of binding VBP as set forth in Figure 1 at residues 1786-1797, a sequence corresponding to an upstream motif or cis element capable of binding Malt-CS
as set forth in Figure 1 at residues 1832-1841, sequences corresponding to an upstream motif or cis element capable of binding ERE as set forth in Figure 1 at residues 2167-2195, 3413-3429, and 3892-3896, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-mutagen as set forth in Figure 1 at residues 2329-2338, a sequence corresponding to an upstream motif or cis element capable of binding myc-PRF as set forth in Figure 1 at residues 2403-2416, sequences corresponding to an upstream motif or cis element capable of--binding AP2 as set forth in Figure 1 at residues 2520-2535 and 5170-5187, respectively, sequences corresponding to an upstream motif or cis element capable of binding HSTF as set forth in Figure 1 at residues 2622-2635, and 5105-5132, respectively, a sequence corresponding to an upstream motif or cis element characteristic of SBF as set forth in Figure 1 at residues 2733-2743, sequences corresponding to an upstream motif or cis element capable of binding NF-1 as set forth in Figure 1 at residues 2923-2938, 4144-4157, and 4887-4900, respectively, a sequence corresponding to an upstream motif or cis element capable of binding NF-MHCIIA/B as set forth in Figure 1 at residues 2936-2944, a sequence corresponding to an upstream motif or cis element capable of binding PEAL as set forth in Figure 1 at residues 3285-3298, a sequence corresponding to an upstream motif or cis element capable of binding ICS
as set forth in Figure 1 at residues 3688-3699, a sequence corresponding to an upstream motif or cis element capable of binding ISGF2 as set forth in Figure 1 at residues 4170-4179, a sequence corresponding to an upstream motif or cis element capable of binding zinc as set forth in Figure 1 at residues 4285-4293, a sequence corresponding to an upstream motif or cis element characteristic of CAP/CRP-gal0 as set forth in Figure 1 at residues 4379-4404, sequences corresponding to an upstream motif or cis element capable of binding AP1 as set forth in Figure 1 at residues 4428-4434, and 4627-4639, respectively, a sequence corresponding to an upstream motif or cis element capable of binding SRY as set forth in Figure 1 at residues 4625-4634, a sequence corresponding to an upstream motif or cis element characteristic of GC2 as set forth in Figure 1 at residues 4678-4711, a sequence corresponding to an upstream motif or cis element capable of binding PEA3 as set forth in Figure 1 at residues 4765-4769, a sequence corresponding to an upstream motif or cis element capable of MIR as set forth in Figure 1 at residues 4759-4954, a sequence corresponding to an upstream motif or cis element capable of binding NF-HNF-1 as set forth in Figure 1 at residues 4923-4941, a sequence corresponding to a thyroid receptor upstream motif or cis element as set forth in Figure 1 at residues 5151-5156, and a sequence corresponding to an upstream motif or cis element capable of binding NFxB as set forth in Figure 1 at residues 5166-5175 (or a sub-sequence thereof) may be employed as a marker nucleic acid molecule to identify such polymorphism(s).
Alternatively, such polymorphisms can be detected through the use of a marker nucleic acid molecule or a marker protein that is genetically linked to (i.e., a polynucleotide that co-segregates with) such polymorphism(s). As stated above, the TIGR gene and/or a sequence or sequences that specifically hybridize to the TIGR
gene have been mapped to chromosome 1q, 21-32, and more preferably to the TIGR
gene located at chromosome 1, q21-27, and more preferably to the TIGR gene located at chromosome 1, q22-26, and most preferably to the TIGR gene located at chromosome I, q24. In a preferred aspect of this embodiment, such marker nucleic acid molecules will have the nucleotide sequence of a polynucleotide that is closely genetically linked to such polymorphism(s) (e.g., markers located at chromosome 1, q19-25 (and more preferably chromosome 1, q23-25, and most preferably chromosome 1, q24.
Localization studies using a Stanford G3 radiation hybrid panel mapped the TIGR gene with the D1S2536 marker nucleic acid molecules at the D1S2536 locus with a LOD score of 6Ø Other marker nucleic acid molecules in this region include:
D1S210; D1S1552; D1S2536; D1S2790; SHGC-12820; and D1S2558. Other polynucleotide markers that map to such locations are known and can be employed to identify such polymorphism(s).
The genomes of animals and plants naturally undergo spontaneous mutation in the course of their continuing evolution (Gusella, J.F., Ann. Rev. Biochem.
55:831-854 (1986)). A "polymorphism" in the TIGR gene or its flanking regions is a variation or difference in the sequence of the TIGR gene or its flanking regions that arises in some of the members of a species. The variant sequence and the "original"
sequence co-exist in the species' population. In some instances, such co-existence is in stable or quasi-stable equilibrium.
A polymorphism is thus said to be "allelic," in that, due to the existence of the polymorphism, some members of a species may have the original sequence (i.e.
the original "allele") whereas other members may have the variant sequence (i.e. the variant "allele"). In the simplest case, only one variant sequence may exist, and the polymorphism is thus said to be di-allelic. In other cases, the species' population may contain multiple alleles, and the polymorphism is termed tri-allelic, etc.
A
single gene may have multiple different unrelated polymorphisms. For example, it J

73185-12 (S) may have a di-allelic polymorphism at one site, and a mufti-allelic polymorphism at another site.
The variation that defines the polymorphism may range from a single nudeotide variation to the insertion or deletion of extended regions within a gene.
S In some cases, the DNA sequence variations are in regions of the gezuome that are characterized by short tandem repeats (STRs) that include tandem di- or tri-nucleotide repeated motifs of nudeotides. Polymorphisms characterized by such tandem repeats are refen~ed to as "variable number tandem repeat" ("VIVTR") polymorphisms. VhFI'Rs have been used in identity and paternity analysis (Water, J.L., LI.S. Patent 5,0?5,21T; Armour, J.A.L. et al., FEBS Leaf. 307:113-115 (1992); Jones, L. 1E al., Eur. j. Haenuttol. 39:144-147 (198; Horn, G.T. et aL, PCT
Application W09~1 / 14003; Jefheys, A.J., Eumpean Patent Application 370,719; JeEErnys, A.J., U.S.
Patent 5.,175,0$2 ]affrays. A.J. 1f aL, Anux. j. Hum. Genet. 39:11-24 (1986);
Jeffreys.
A.J. et aI., Naturt 316:76-79 (1985J; Gray, LC. et al., Prnc. R Acad. Soc.
Load: 243:241-253 (1991); Moore, S.S. et aL, Gtnarnics 10:654-660 (1991); Jeffreys, A.J. 1t al., Anim.
Gdtet. 1S:1-15 (1987); I~llel, J. 1t a1" Anitn. Genet. 20:145-155 (1989);
I~llel, j. eE al., Genet. 124:783-789 (1990)1 In an alternative embodiment, such polymorphisms can be detected through the use of a marker nucleic acid molecule that is physically linked to such 24 polymorphism(s). For this purpose, marker nudeic acid molecules comprising a nucleotide sequence of a polynucleotide located within 1 mb of the .
polymorphism(s), and more preferably within 100 kb of the polymorphism(s), and most preferably within 10 kb of the polymorphism(s) can be employed. Examples of such marker nudeic atids are set out in SEQ U7 NO: 1, SfiQ ID NO: 2, SEQ ID
NO: 3, ~s sly m rro: 4, sEQ m No- s, sEQ m No: 6, sEQ ro No: ~, sEQ ro No: s, sEQ ro NO: 9~, SEQ ID NO:10, SEQ ID N0:11, SEQ ID NO: I2, SEQ ID N0:13, SEQ ID NO:
14, SEQ ID NO:15, SEQ ID N0:16, SfiQ ID N0:17, SEQ Ip N0:18, SEQ ID N0:19, SEQ ID~ NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQID NO: 25, 30 In another embodiment a marker nudeic arid will be used that is capable of specifically detecting TIGRmtI, TIGRmt2, TIGRmf3, TIGRmt4, TIGRmt5, TIGRsroI,or a combination of these mutations. Methods to detect bases) substitutions, bases) deletions and bases) addijions are known in the art (i.e. methods to genotype an ind'ividual). For example, the ?~dc Bit Analysis ("GBA") method disclosed by.
35 Goelet, P. eE al., WO 92/157'12, may be used for 73185-12(S) detecting the single nucleotide polymorphisms of the present invention GBA is a method of polymorphic site interrogation in which the nucleotide sequence inforrriation surrounding the site of variation in a target DNA sequence is used to design an oligonucleotide primer that is complementary to the region immediately adjacent to, but not including, the variable nucleotide in the target DNA. The target DNA template is selected from the biological sample and hybridized to the interrogating primer. This primer is extended by a single labeled dideoxynucleotide using DNA polymerise in the presence of two, and preferably all four chain terminating nucleoside triphosphate precursors. Cohere, D. tt aL, (PCT
Application W091/02087) describes a related method of genotyping.
Other primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher, J. S. et al., NucI.
Acids. Res.
17:7779-7784 (1989) ; Sokolov, B. P., NucI. Acids R~es.
18:3671 (1990) ; Syvanen, A.-C., et al., Genornics 8:684 - 692 (1990), r Kuppuswamy, M.N. et al., Proc..
Natl. Acid. Sci. (LLS.A.) 88:1143-1147 (1991y.~
Prezant, T.R et al., Hum. Mutat. 1:159-164 (1992);
Ugozzoli, L d al., DATA 9:107-112 (1992)._; Nyr4n, P. et aL, Arwl. Hiochern. 208:171-175 (1993) ) .
The detection of polymorphic sites in a sample of DNA may be facilitated through the use of nucleic acid amplification methods. Such methods specifically increase the concentration of polynucleotides that span the polymorphic site, or include that site and sequences located either distal or proximal to it. Such amplified molecules can be readily detected by gel electrophoresis or other means.
Another preferred method of achieving such amplification employs the polymerise chain reaction ("PCR") (Mullis, K. et aL, Cold Spring Harbor Symp.
Quint.
.Biol. 51_:263-273 (1986); .I Muilis K. .et al., U.S. Patent No.
4,683,202; Erlich, H., U.S. Patent No. 482,788; and Sailci, R et al., U S.
Patent No.
4,683,194), using primer pairs that are capable of hybridizing to the proximal sequences that define a polymorphism in its double-stranded form.
In lieu of PCR, alternative methods, such as the "Ligase Chain Reaction"
("LCR") may be used (Barany, F., Proc. Nafl. Acid. Sci. (h.S.A.~ 88:189-193 (1991)) .
LCR uses two pairs of oligonucleotide probes to exponentially amplify a specific ~ 02278782 2002-11-Ol 73185-12 (S) target. The sequences of each pair of oligonudeotides is selected to permit the pair to hxbridize to abutting sequences of the same strand of the target. Such hybridization forms a substrate for a template-dependent ligase. As with PCR, the resulting products thus serve as a template in subsequent cycles and an exponential amplification of the desired sequence is obtained. -LCR can be performed with oligonudeotides having the proximal and distal sequences of the same strand of a polymorphic site. In one embodiment, either oligonudeotide will be designed to include the actual polymorphic site of the polymorphism. In such an embodiment, the reaction conditions are selected such la that the oligonudeotides can be ligated together only if the target molecule either coantains or lacks the specific nucleotide that is complementary bo the polymorphic site present on the oligonudeotide. Alternatively, the oligonudeotides may be selected such that they do not include the polymorphic site (see, Segev, D., PCT
Application WO 90/01069).
The "Oligonudeotide Ligation Assay" ("OLA") may alternatively be employed (Landegren, U. 1t al., Science 24I:1OT7-1080 (1988)). The OLA
protocol uses. two oligonudeotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target. OLA, like LCR, is particularly suited for the detection of point mutations. Unlike LCR, however, OLA results in "linear" rather than exponential amplification of the target sequence.
Iqickerson, D.A. 1f al., have described a nucleic acid detection assay that cornbines~ attributes of PCR and OLA (Nickerson, D.A. et aL, Prnc. Natl. Acad.
Sci.
(LLS.A.) 81:8923-892? (1990)). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA. In addition to requiring multiple, and separate, processing steps, one problem associated with such combinations is that they inherit all of the problems associated with PCR
and OLA.
Schemes based on ligation of two (or more) oligonudeotides in the presence of nucleic add having the sequence of the resulting "di-oligonudeotide", thereby amplifying tt~e di-oligonudeotide, are also known (Wu, D.Y. ct al., Gawmics 4:560 (1989)), and may be readily adapted to the purposes of the present invention.
Other known nucleic acid amplification procedures, such as allele-spedfic oligomers, branched DNA technology, transcription-based amplification systems, or isothermal amplification methods may also be used to amplify and analyze such polymorphisms (Malek, L.T. 1t al., U.S. Patent 5,130,238;

73185-12(S) Schuster rt nt., U.S. Patent 5,1~9,?bb; Kwoh; ~ et-ui., Prac. Nutl. ~eaii.
Sci. ~(LI.S.a4.) $ci:li73 (1989); Walker, G.T. et al., pros. NatI. Aced. , Sci. (LLS.A.) 89:392-(1992)). All the foregoing nucleic acid ampliFication methods could be used to predict or diagnose glaucoma.
The identification of a polymorphism in the TIGR gene can be determined ir.
a variety of ways. By correlating the presence or absence of glaucoma in an individual with the presence or absence of a polymorphism in the TIGR gene or its flanking regions, it is possible to diagnose the predisposition (prognosis) of an asymptomatic patient to glaucoma, related diseases, or steroid sensitivity. If a polymorphism creates or destroys a restriction endonuclease cleavage site, or if it results in the loss or insertion of DNA (e.9., a VNTR polymorphism), it will alter the size or profile of the DNA fragments that are generated by digestion with that restriction endonudease. As such, individuals that possess a variant sequence can be distinguished from those having the original sequence by restriction fragment analysis. Polymorphisms that can be identified in this manner are termed "restriction fragment length polymorphisms" ("RFLPs"). RPLPs have been widely used in human and animal genetic analyses ( Skolnick, M.H. et aL, Cytogen.
Cell Genet. 32:58-67 (1982); Botstein, D. et aL, Ate. j. ~ Hum. Genet. 32:314-331 (1980)) .
The role of TI~GR in glaucoma pathogenesis indicates that the presence of genetic alterations (e.9., DNA polymorphisms) that affect the TIGR response can be employed to predict glaucoma .
A preferred method of achieving such identification employs the single-strand conformational polymorphism (SSCP) approach. The SSCP technique is a method capable of identifying most sequence variations in a single strand of DNA, typically between 150 and 250 nucleotides in length (Elles, Methods in Molecular Medicine: Molecular Diagnosis of Genetic Diseases, Humana Press (1996).;
prita et al., Geaomics 5: 874-879 X1989) ) .
Under denaturing conditions a single strand of DNA
will adopt a conformation that is uniquely dependent on its sequence conformation.
This conformation usually will be different, even if only a single base is ~chang-ed.
Most conformations have been reported to alter the physical configuration or size sufficiently to be detectable by electrophoresis. A number of protocols have been 73185-12 (S) described for SSCP including, but not limited to Lee et al., Anal. Biochem.
205: 289-293 (1992); Suzuki et al., Anal. Biochem. 192: 82-84 (1991); Lo et al., Nucleic Acids Research 20: 1005-1009 (1992); Sarkar et al., Genomics 13: 441-443 (1992).
In accordance with this embodiment of the invention, a sample DNA is obtained from a patient's cells. In a preferred embodiment, the DNA sample is obtained from the patient's blood. However, any source of DNA may be used. The DNA is subjected to restriction endonuclease digestion. TIGR is used as a probe in accordance with the above-described RFLP methods. By comparing the RFLP
pattern of the TIGR gene obtained from normal and glaucomatous patients, one can determine a gatient's predisposition (prognosis) to glaucoma. The polymorphism obtained in this approach can then be--cloned to identify the mutation at the coding region which alters the protein's structure or regulatory region of the gene which affects its expression level. Changes involving promoter interactions with other regulatory proteins can be identified by, for example, gel shift assays using HTM
cell extracts, fluid from the anterior chamber of the eye, serum, etc.
Interactions of TIGR protein in glaucomatous cell extracts, fluid from the anterior chamber of the eye, serum, etc. can be compared to control samples to thereby identify changes in those properties of TIGR that relate to the pathogenesis of glaucoma.
Similarly such extracts and fluids. as well as others (blood, etc) can be used to diagnosis or predict steroid sensitivity.
Several different classes of polymorphisms may be identified through such methods. Examples of such classes include: (1) polymorphisms present in the TIGR
cDNA of different individuals; (2) polymorphisms in non-translated TIGR gene sequences, including the promoter or other regulatory regions of the TIGR
gene; (3) polymorphisms in genes whose products interact with TIGR regulatory sequences;
(4) polymorphisms in gene sequences whose products interact with the TIGR
protein, or to which the TIGR protein binds.
In an alternate sub-embodiment, the evaluation is conducted using oligonucleotide "probes" whose sequence is complementary to that of a portion of SEQ ID NO: 1, SEQ ID NO: 2 SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. Such molecules are then incubated with cell extracts of a patient under conditions sufficient to permit nucleic acid hybridization.

In one sub-embodiment of this aspect of the present invention, one can diagnose or predict glaucoma, related diseases and steroid sensitivity by ascertaining the TIGR response in a biopsy (or a macrophage or other blood cell sample), or other cell sample, or more preferably, in a sample of bodily fluid (especially, blood, serum, plasma, tears, buccal cavity, etc.). Since the TIGR
gene is induced in response to the presence of glucocorticoids, a highly preferred embodiment of this method comprises ascertaining such TIGR response prior to, during and/or subsequent to, the administration of a glucocorticoid. Thus, by way of illustration, glaucoma could be diagnosed or predicted by determining whether the administration of a glucocorticoid (administered topically, intraocularly, intramuscularly, systemically, or otherwise) alters the TIGR response of a particular individual, relative to that of normal individuals. Most preferably, for this purpose, at least a "TIGR gene-inducing amount" of the glucocorticoid will be provided.
As used herein, a TIGR gene-inducing amount of a glucocorticoid is an amount of glucocorticoid sufficient to cause a detectable induction of TIGR expression in cells of glaucomatous or non-glaucomatous individuals.
III. Methods of Administration The agents of the present invention can be formulated according to known methods to prepare pharmacologically acceptable compositions, whereby these materials, or their functional derivatives, having the desired degree of purity are combined in admixture with a physiologically acceptable carrier, excipient, or stabilizer. Such materials are non-toxic to recipients at the dosages and concentrations employed. The active component of such compositions may be agents analogs or mimetics of such molecules. Where nucleic acid molecules are employed, such molecules may be sense, antisense or triplex oligonucleotides of the TIGR promoter, TIGR cDNA, TIGR intron, TIGR exon or TIGR gene.
A composition is said to be "pharmacologically acceptable" if its administration can be tolerated by a recipient patient. An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
Suitable vehicles and their formulation, inclusive of other human proteins, e.g., human serum albumin, are described, for example, in Remington's Pharmaceutical Sciences (16th ed., Osol, A., Ed., Mack, Easton PA (1980)).

73185-12(S) If the composition is fio be water soluble, it may be formulated in a buffer such as phosphate or other organic acid salt preferably at a pH of about 7 ~
8. If the composition is only partially soluble in water, it may be prepared as a microemulsion bit formulating it with a nonionic surfactant such as Tween;' Pluronics, ~ PEG, e.g., Tween 80, in an amount of, for example, 0.04-0.0590 (w/v), to ~i~ ~~~ty. The term "water soluble" as applied to the polysaccharides and polxethylene glycols is meant to include colloidal solutions and dispersions. In general, the solubility of the cellulose derivatives is determined by the degree of substitution of ether groups, and the stabilizing derivatives useful herein should have a sufficient quantitx of such ether groups per anhydroglucose unit in the cellulose chain to render the derivatives water soluble. A degree of ether substitution of at least 0.35 ether groups per anhydroglucose unit is generally sufficient. Additionally, the cellulose derivatives may be in the form of alkali metal salts, for example, the Li, Na, K or Cs salts.
Optionally other ingredients may be added such as antioxidants, e.g., ascorbic and; law molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinyl pyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine;
monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; and sugar alcohols such as mannitol or sorbitol.
Additional pharmaceutical methods may be employed to control the duration of action. Controlled or sustained release preparations may be achieved thmugh the use of pol~tmers to complex or absorb the TiGR molecules) of the composition. The controlled delivery may be exerased by selecting appropriate macromolecules (for example polyesters, polyamino acids, polyvinyl pyrrolidone, ethylenevi~nylacetate; methyloellulose, carboxymethylcellulose, or protamine sulfate) and the concentration of macromolecules as well as the methods of incorporation in order to control release.
Sustained release formulations may also be prepared, and include the formation of microcapsular particles and implantable articles. For preparing sustained-release compositions, the TIGR molecules) of the composition is preferably incorporated into a biodegradable matrix or microcapsule. A
suitable 3~ material for this purpose is a polylactide, although other polymers of poly-(a-*Trade-mark 73185-12(S) hydroxyc~rbo«ylic acids), such as poly-D-(-)-3-hydrbxybutyric acid ~P
133,988A), can be used. Other biodegradable polymers include poiy(lactones), poly(orthoesters), polyamino acids, hydrogels, or poly{orthocarbonates) poly(acetals). The polymeric material may also comprise polyesters, poly(lac#ic acid) or ethylene vinylacetate copolymers. For examples of sustained release compositions, see U.S. Patent No. 3,773,919, EP ~8,481A, U.S. Patent No.
3,887,99, EP 158,277A, Canadian Patent No. 1176565, Sidman, U. tE aL, Hiopolymers x:547 (1983), and Larger, R ct al., Chun. Tich.12.98 (198'1).
Alternatively, instead of incorporating the TIGR molecules) of the composition into polymeric particles, it is possible to entrap these materials in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example; hydmxymethylcellulose or gelatine-microcapsules arud poly(methylmethacylate) microcapsules, respectively, or in rnlloidal drug delivery systems, for example, liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences (1980).
In an alternative embodiment, liposome formulations and methods that permit intracellular uptake of the molecule wHl be emploved. Suitable methods are known in the art, see, for example, ?0 y~~~ D.B. (U.5.
Patent No. 5,190,762), Callahan, M.V. cf al. (U.S. Patent No. 5,270,452) and Gonzalezro, RJ. (PCT Application 91 j05771). .
Having now generally described the invention, the same will be more Feadily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.
Single strand conformational polymorphism jSSCP) screening is:~rriesd out according to the procedure of Hue et al., The Journal of Inaestigativc Ophthalmology 105.4: 529-632 (1995). S9CP primers are constructed corresponding to sequences found within the T1GR promoter and two of exons of TIGR The following primers are constfucted: forward primer "S'x-la";
5' TGA GGC TTC CTC TGG AAA C 3' (SEQ ID NO: 6); reverse primer "cat":'~'-TGA AAT CAG CAC ACC AGT AG3' (SEQ ID NO: 7); forward primer "CA2": 5'-73185-12(S) GCA CCC ATA CCC CAA TAA TAG3' (SEQ ID NO: 8); reverse primer "Pr+1": S'-AGA GTT CCC CAG ATT .TCA CC 3' (SEQ ID NO: 9); forward primer "Pr-I ": 5'-ATC TGG GGA ACT CTT CTC AG3' (SEQ ID NO:10); reverse primer "Pr+2(4A2)":
5'=FAC AG? TGT TGC AGA TAC G3' (SEQ ID NO: 11); forward primer "Pr-2(4A)": 5' ACA ACG TAT CTG CAA CAA CTG3' (SEQ ID N0:12); reverse primer "Pr+3(4A)": 5' TCA GGC TTA ACT CCA GAA CC-3' (SEQ ID NO: I3); forward primer "Pr-3(4A)": S' TTG GTT CTG CAG TTA AGC C 3' (SEQ ID NO: 14); reverse primer "Pr+2(4A1)": 5' AGC AGC ACA AGG GCA ATC C-3' (SEQ ID NO: 15);
reverse primer "Pr+1(4A~": 5' ACA GGG CTA TAT TGT GGG3' (SEQ TD NO: 16);
forward primer "KS1X": 5'-CCT GAG ATG CCA GCT GTC C 3' (SEQ ID NO: 1~;
reverse primer "SK1XX": 5'-CTG AAG CAT TAG AAG CCA AC-3' (SEQ ID NO:
18~ forward primer "KS2a1": 5'-ACC TTG GAC CAG GCT GCC AG3' (SEQ ID
NO: 19.); reverse primer "SK3" 5'-AGG TTT GTT CGA GTT CCA G3' (SEQ ID NO:
20}; forward primer "KS4": 5'-ACA ATT ACT GGC AAG TAT GG3' (SEQ ID NO:
21); reverse primer "SK6A": 5'-CCT TCT CAG CCT TGC TAC C-3' (SEQ ID NO: 22);
forward primer "KS5": 5'-ACA CCT CAG CAG ATG CTA CC 3' (SEQ ID NO: 23);
reverse primer "SKS": 5'-ATG GAT GAC TGA CAT GGC C-3' (SEQ ID NO: 24);
forward primer "KS6": 5' AAG GAT GAA CAT GGT CAC C-3' (SEQ ID NO: 25).
The locations of grinners: Sk-la, cat, CA2, Pr+1, Pr-1, Pr+2(4A2), Pr-2(4A), Pr+3(4A), Pr-3 (4A), Pr-3(4A), Pr+2(4A1), and Pr+1(4A) are diagramatically set forth in Figure 4. The location of primers: KS1X, SK1XX, Ks2al, SK3, KS4, SK6A, KSS, SKB, and IGS6 are diagramatically set forth in Figure 5.
Families with a history of POAG in IQamath Falls, Oregon, are screened by SSCP according to the method of Hue et al., The journal of Inrxstigative Ophthalmology 25. 105.4: 529-632 (1995). SSCP primers SK-la, cat, CA2, Pr+1, Pr-2(4A), Pr+3(4A), SK1XX, and KS6 detect single strand conformational polymorphisms in this population. An SSCP is detected using SSCP primers Pr+3(4A) and Pr-2(4A). 70 family members of the Klamath Fall, Oregon are screened with these primers and the results are set forth in Table 1.

Total SSCP+ SSCP-Glaucoma positive individuals) 12 12 0 Glaucoma negative individuals 13 0 13 Spouses (glaucoma negative) 16 2 14 Others2 29 6 23 1 = glaucoma positive individuals as determined by IOP of greater than 25 mmHg 2 = unidentified glaucoma due to the age of the individual.
A second SSCP is detected using SSCP primers Pr+1 and CA2. 14 family members of the Klamath Fall, Oregon are screened with these primers. A
characteristic polymorphism is found in the 6 affected family members but absent in the 8 unaffected members. A third SSCP is detected using SSCP primers cat and sk-1a. The same 14 family members of the Klamath Fall, Oregon that are screened with Pr+1 and CA2 are screened with cat and sk-la primers. A characteristic polymorphism is found in the 6 affected family members but absent in the 8 unaffected members. A fourth SSCP is detected using SSCP primers KS6 and SK1XX. 22 family members of the Klamath Fall, Oregon and 10 members of a Portland, Oregon pedigree are screened with these primers. A polymorphism is found in exon 3. The results are as set forth in Table 2.

Total SSCP+ SSCP-Klamath Fall, Oregon Glaucoma positive individuals) 3 3 0 Glaucoma negative individuals 6 0 6 Others2 13 6 7 Portland, Oregon Glaucoma positive individuals) 6 6 0 Glaucoma negative individuals 4 0 4 Others2 0 0 0 1 = glaucoma positive individuals as determined by IOP of greater than 25 mmHg 2 = unidentified glaucoma due to the age of the individual.

73185-12(S) ~E~
A novel myosin~ike acidic protein termed myocilin is expressed predominantly in the photoreceptor cells of retina and is localized particularly in the rootlet and basal body of connecting cilium (Kubota et al., Genomics 41: 360-(199 ). The myocilin gene is mapped to human chromosome Iq23-q24. The coding region of myocilin is 100 percent homologous with TIGR.
Homology searches are performed by GCG (Genetics Computer Group, Madison, VV~ and include the GenBank~, EMBL, Swiss-Prot*databases and EST
analysis. Using the Blast search, the best fits are found with a stretch of 177 amino acids in the carboxy terminals for an extracellular mucus protein of the olfactory, olfactomedin and three olfactomedin-like species. The alignment presented in Figure 6 shows the TIGR homology (SEQ ID NO. 2~ to an expressed sequence tag I5 (EST) sequence from human brain (ym08h12rixSEQ ID NO. 28)(The WashU Merck EST Project,1995~; the Z domain of olfactomedin-related glyooprotein from rat brain .
(1B426bAMZ)(SEQ ID NO. 29)(Danielson tt al., Journal of Neuroscitncc Research 38:
468-478 (1994)) and the olfactomedin from olfactory tissue of bullfrogs (ranofm) (SEQ ID NU. 30)(Yokoe and Antwlt, Proc.
Nafl.
Acad. Sci. 90: 4655-4659 (1993); Snyder and Anholt, Biochemistry 30: 9143 9153 (1991)). These domains share very similar amino acid positions as depicted in the consensus homology of Figure 6 (SEQ ID NO. 31), with the exception being the truncated human done in which the position with respect to its full length sequence has not been established.
25. No significant homology is found for the amino termini of these molecules.
Wriile the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further mQdihCations and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departtues from the present disclosure as come within known or customary practice within the art fio which the invention pertains and as may be applied to the essential features herein before set forth and as follows in the scope of the appended claims.
*Trade-mark SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
(ii) TITLE OF INVENTION: METHODS FOR THE DIAGNOSIS, PROGNOSIS AND
TREATMENT OF GLAUCOMA AND RELATED DISORDERS
(iii) NUMBER OF SEQUENCES: 32 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SMART & BIGGAR
(B) STREET: P.O. BOX 2999, STATION D
1O (C) CITY: OTTAWA
(D) STATE: ONT
(E) COUNTRY: CANADA
(F) ZIP: K1P 5Y6 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text) (vi) CURRENT APPLICATION DATA:
2 ~ (A) APPLICATION NUMBER: CA 2,278,782 (B) FILING DATE: 09-JAN-1998 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/791,154 (B) FILING DATE: 28-JAN-1997 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/938,669 (B) FILING DATE: 26-SEP-1997 (viii) ATTORNEY/AGENT INFORMATION:
3O (A) NAME: SMART & BIGGAR
(B) REGISTRATION NUMBER:
(C) REFERENCE/DOCKET NUMBER: 75181-25 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613)-232-2486 (B) TELEFAX: (613)-232-8440 (2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5300 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 52a (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

TGAAATGAAA
TGAGATAACC

(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5304 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:

J r.

AATATGCGAT

(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6169 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

TGAAATGAAA

TAAACAAACA CCCAGTTGTA AATGTCTCAA GTTCAGGCTT AACTGCAGAA CCAATCAAAP. 3960 (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 926 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

GGAATTGTCA

{2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2099 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

GAAGATTATG
GATTAAGTGG

(2) INFORMATION FOR SEQ ID N0:6:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:

(2) INFORMATION FOR SEQ ID N0:7:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:

(2) INFORMATION FOR SEQ ID N0:8:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: B:

(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:

(2) INFORMATION FOR SEQ ID N0:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

{2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:

(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:

(2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:

(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:

(2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:

(2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:

CACCCAGGCTGGAGTGCAGTGGCACGATCTC

CCTGAGATGC CAGCTGTCC 1g (2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:

(2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:

(2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:
AGGTTTGTTC GAGTTCCAG 1g (2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:

(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:

(2) INFORMATION FOR SEQ TD N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear {xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:

{2) INFORMATION FOR SEQ ID N0:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:24:

(2) INFORMATION FOR SEQ ID N0:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

(2) INFORMATION FOR SEQ ID N0:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1548 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:26:

ACCAGAGTGG

(2) INFORMATION FOR SEQ ID N0:27:
(i) SEQUENCE CHARACTERISTICS:
(Ay LENGTH: 178 amino acids (B} TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:27:
Thr Gly Ala Val Val Tyr Ser Gly Ser Leu Tyr Phe Gln Gly Ala Glu Ser Arg Thr Val Ile Arg Tyr Glu Leu Asn Thr Glu Thr Val Lys Ala Glu Lys Glu Ile Pro Gly Ala Gly Tyr His Gly Gln Phe Pro Tyr Ser Trp Gly Gly Tyr Thr Asp Ile Asp Leu Ala Val Asp Glu Ala Gly Leu Trp Val Ile Tyr Ser Thr Asp Glu Ala Lys Gly Ala Ile Val Leu Ser Lys Leu Asn Pro Glu Asn Leu Glu Leu Glu Gln Thr Trp Glu Thr Asn Ile Arg Lys Gln Ser Val Ala Asn Ala Phe Ile Ile Cys Gly Thr Leu Tyr Thr Val Ser Ser Tyr Thr Ser Ala Asp Ala Thr Val Asn Phe Ala Tyr Asp Thr Gly Thr Gly Ile Ser Lys Thr Leu Thr Ile Pro Phe Lys Asn Arg Tyr Lys Tyr Ser Ser Met Ile Asp Tyr Asn Pro Leu Glu Lys Lys Leu Phe Ala Trp Asp Asn Leu Asn Met Val Thr Tyr Asp Ile Lys Leu Ser WO 98/32850 PCT/(JS98/00468 (2) INFORMATION FOR SEQ ID N0:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 131 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:28:
Arg Phe Asp Leu Lys Thr Glu Thr Ile Leu Lys Thr Arg Ser Leu Asp Tyr Ala Gly Tyr Asn Asn Met Tyr His Tyr Ala Trp Gly Gly His Ser Asp Ile Asp Leu Met Val Asp Glu Ser Gly Leu Trp Ala Val Tyr Ala Thr Asn Gln Asn Ala Gly Asn Ile Val Val Ser Arg Leu Asp Pro Val Ser Leu Gln Thr Leu Gln Thr Trp Asn Thr Ser Tyr Pro Lys Arg Xaa Pro Gly Xaa Ala Phe Ile Ile Cys Gly Thr Cys Tyr Val Thr Asn Gly Tyr Ser Gly Gly Thr Lys Val His Tyr Ala Tyr Gln Thr Asn Ala Ser Thr Tyr Glu Tyr Ile Asp Ile Pro Phe Gln Asn Lys Leu Xaa Pro His Phe Pro Cys (2) INFORMATION FOR SEQ ID N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 178 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:29:
Gly Thr Gly Gln Val Val Tyr Asn Gly Ser Ile Tyr Phe Asn Lys Phe Gln Ser His Ile Ile Ile Arg Phe Asp Leu Lys Thr Glu Thr Ile Leu Lys Thr Arg Ser Leu Asp Tyr Ala Gly Tyr Asn Asn Met Tyr His Tyr Ala Trp Gly Gly His Ser Asp Ile Asp Leu Met Val Asp Glu Asn Gly Leu Trp Ala Val Tyr Ala Thr Asn Gln Asn Ala Gly Asn Ile Val Ile Ser Lys Leu Asp Pro Val Ser Leu Gln Ile Leu Gln Thr Trp Asn Thr Ser Tyr Pro Lys Arg Ser Ala Gly Glu Aia Phe Ile Ile Cys Gly Thr Leu Tyr Val Thr Asn Gly Tyr Ser Gly Gly Thr Lys Val His Tyr Ala Tyr Gln Thr Asn Ala Ser Thr Tyr Glu Tyr Ile Asp Ile Pro Phe Gln Asn Lys Tyr Ser His Ile Ser Met Leu Asp Tyr Asn Pro Lys Asp Arg Ala Leu Tyr Ala Trp Asn Asn Gly His Gln Thr Leu Tyr Asn Val Thr Leu Phe (2} INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 177 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:30:
Gly Ala Gly Val Val Val His Asn Asn Asn Leu Tyr Tyr Asn Cys Phe Asn Ser His Asp Met Cys Arg Ala Ser Leu Thr Ser Gly Val Tyr Gln Lys Lys Pro Leu Leu Asn Ala Leu Phe Asn Asn Arg Phe Ser Tyr Ala Gly Thr Met Phe Gln Asp Met Asp Phe Ser Ser Asp Glu Lys Gly Leu Trp Val Ile Phe Thr Thr Glu Lys Ser Ala Gly Lys Ile Val Val Gly Lys Val Asn Val Ala Thr Phe Thr Val Asp Asn Ile Trp Ile Thr Thr Gln Asn Lys Ser Asp Ala Ser Asn Ala Phe Met Ile Cys Gly Val Leu Tyr Val Thr Arg Ser Leu Gly Pro Lys Met Glu Glu Val Phe Tyr Met Phe Asp Thr Lys Thr Gly Lys Glu Gly His Leu Ser Ile Met Met Glu Lys Met Ala Glu Lys Val His Ser Leu Ser Tyr Asn Ser Asn Asp Arg Lys Leu Tyr Met Phe Ser Glu Gly Tyr Leu Leu His Tyr Asp Ile Ala Leu (2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 74 amino acids (B) TYPE: amino acid (C} STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: None (xi) SEQUENCE DESCRIPTION: SEQ ID N0:31:
GIy Val Val Tyr Ser Arg Leu Thr Glu Thr Leu Ala Gly Tyr Asn Asn Tyr Ala Trp Gly Gly Asp Ile Asp Leu Val Asp Glu Gly Leu Trp Tyr Thr Ala Gly Ile Val Ser Lys Leu Pro Leu Gln Thr Trp Thr Lys Ala Phe Ile Ile Cys Gly Thr Leu Tyr Val Thr Tyr Val Tyr Ala Tyr Thr Ile Tyr Asp Tyr Asn Pro Lys Leu Tyr Leu (2) INFORMATION FOR SEQ ID N0:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 504 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (v) FRAGMENT TYPE: N-terminal (xi) SEQUENCE DESCRIPTION: SEQ ID N0:32:
Met Arg Phe Phe Cys Ala Arg Cys Cys Ser Phe Gly Pro Glu Met Pro Ala Val Gln Leu Leu Leu Leu Ala Cys Leu Val Trp Asp Val Gly Ala Arg Thr Ala Gln Leu Arg Lys Ala Asn Asp Gln Ser Gly Arg Cys Gln Tyr Thr Phe Ser Val Ala Ser Pro Asn Glu Ser Ser Cys Pro Glu Gln Ser Gln Ala Met Ser Val Ile His Asn Leu Gln Arg Asp Ser Ser Thr Gln Arg Leu Asp Leu Glu Ala Thr Lys Ala Arg Leu Ser Ser Leu Glu Ser Leu Leu His Gln Leu Thr Leu Asp Gln Ala Ala Arg Pro Gln Glu Thr Gln Glu Gly Leu Gln Arg Glu Leu Gly Thr Leu Arg Arg Glu Arg Asp Gln Leu Glu Thr Gln Thr Arg Glu Leu Glu Thr Ala Tyr Ser Asn Leu Leu Arg Asp Lys Ser Val Leu Glu Glu Glu Lys Lys Arg Leu Arg Gln Glu Asn Glu Asn Leu Ala Arg Arg Leu Glu Ser Ser Ser Gln Glu Val Ala Arg Leu Arg Arg Gly Gln Cys Pro Gln Thr Arg Asp Thr Ala Arg Ala Val Pro Pro Gly Ser Arg Glu Val Ser Thr Trp Asn Leu Asp Thr Leu Ala Phe Gln Glu Leu Lys Ser Glu Leu Thr Glu Val Pro Ala Ser Arg Ile Leu Lys Glu Ser Pro Ser Gly Tyr Leu Arg Ser Gly Glu Gly Asp Thr Gly Cys Gly Glu Leu Val Trp Val Gly Glu Pro Leu Thr Leu Arg Thr Ala Glu Thr Ile Thr Gly Lys Tyr Gly Val Trp Met Arg Asp Pro Lys Pro Thr Tyr Pro Tyr Thr Gln Glu Thr Thr Trp Arg Ile Asp Thr Val Gly Thr Asp Val Arg Gln Val Phe Glu Tyr Asp Leu Ile Ser Gln Phe Met Gln Gly Tyr Pro Ser Lys Val His Ile Leu Pro Arg Pro Leu Glu Ser Thr Gly Ala Val Val Tyr Ser Gly Ser Leu Tyr Phe Gln Gly Ala Glu Ser Arg Thr Val Ile Arg Tyr Glu Leu Asn Thr Glu Thr Val Lys Ala Glu Lys Glu Ile Pro Gly Ala Gly Tyr His Gly Gln Phe Pro Tyr Ser Trp Gly Gly Tyr Thr Asp Ile Asp Leu Ala Val Asp Giu Ala Gly Leu Trp Val Ile Tyr Ser Thr Asp Glu Ala Lys Gly Ala Ile Val Leu Ser Lys Leu Asn Pro Glu Asn Leu Giu Leu Glu Gln Thr Trp Glu Thr Asn Ile Arg Lys Gln Ser Val Ala Asn Ala Phe Ile Ile Cys Gly Thr Leu Tyr Thr Val Ser Ser Tyr Thr Ser Ala Asp Ala Thr Val Asn Phe Ala Tyr Asp Thr Gly Thr Gly Ile Ser Lys Thr Leu Thr Ile Pro Phe Lys Asn Arg Tyr Lys Tyr Ser Ser Met Ile Asp Tyr Asn Pro Leu Glu Lys Lys Leu Phe Ala Trp Asp Asn Leu Asn Met Val Thr Tyr Asp Ile Lys Leu Ser Lys Met

Claims (79)

CLAIMS:

1. A method for diagnosing glaucoma in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of:
(A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule; and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic or prognostic of glaucoma.

2. The method for diagnosing glaucoma in a patient according to claim 1, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt1.

3. The method for diagnosing glaucoma in a patient according to claim 1, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt2.

4. The method for diagnosing glaucoma in a patient according to claim 1, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt3.

5. The method for diagnosing glaucoma in a patient according to claim 1, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt4.

6. The method for diagnosing glaucoma in a patient according to claim 1, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt5.

7. The method for diagnosing glaucoma in a patient according to claim 1, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRsv1.

8 The method for diagnosing glaucoma in a patient according to claim 1, further comprising a second marker nucleic acid molecule.

9. The method for diagnosing glaucoma in a patient according to claim 8, wherein said first marker nucleic acid molecule and said second marker nucleic acid molecule are selected from the group consisting of a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 8, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 10, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 11, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 12, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 14, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 15, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 16, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 17, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 19, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 20, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 21, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 22, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 23, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 24 and a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

10. The method for diagnosing glaucoma in a patient according to claim 9, wherein said first marker nucleic acid molecule and said second marker nucleic acid molecule are selected from the group consisting of a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 8, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 12, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18, and a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

11. The method for diagnosing glaucoma in a patient according to claim 10, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO:12.

12. The method for diagnosing glaucoma in a patient according to claim 10, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 8.

13. The method for diagnosing glaucoma in a patient according to claim 10, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6.

14. The method for diagnosing glaucoma in a patient according to claim 10, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

15. A method for diagnosing steroid sensitivity in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of:
(A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule; and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic of steroid sensitivity.

16. The method for diagnosing steroid sensitivity in a patient according to claim 15, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt1.

17. The method for diagnosing steroid sensitivity in a patient according to claim 15, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt2.

18. The method for diagnosing steroid sensitivity in a patient according to claim 15, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt3.

19. The method for diagnosing steroid sensitivity in a patient according to claim 15, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt4.

20. The method for diagnosing steroid sensitivity in a patient according to claim 15, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt5.

21. The method for diagnosing steroid sensitivity in a patient according to claim 15, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRsv1.

22. The method for diagnosing steroid sensitivity in a patient according to claim 15, further comprising a second marker nucleic acid molecule.

23. The method for diagnosing steroid sensitivity in a patient according to claim 22, wherein said first marker nucleic acid molecule and said second marker nucleic acid molecule are selected from the group consisting of a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 8, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 10, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 11, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 12, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 14, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 15, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 16, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 17, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 19, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 20, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 21, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 22, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 23, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 24 and a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

24. The method for diagnosing steroid sensitivity in a patient according to claim 23, wherein said first marker nucleic acid molecule and said second marker nucleic acid molecule are selected from the group consisting of a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 8, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 12, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18, and a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

25. The method for diagnosing steroid sensitivity in a patient according to claim 24, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 12.

26. The method for diagnosing glaucoma in a patient according to claim 24, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 5.

27. The method for diagnosing steroid sensitivity in a patient according to claim 24, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6.

28. The method for diagnosing steroid sensitivity in a patient according to claim 24, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

29. The method of claims 10 or 24, wherein said complementary nucleic acid molecule obtained from a cell or a bodily fluid of said patient has been amplified using a nucleic acid amplification method.

30. The method of claim 1, wherein said marker nucleic acid molecule is selected from the group consisting of D1S2536 marker nucleic acid, D1S210 marker nucleic acid, D1S1552 marker nucleic acid, D1S2536 marker nucleic acid, D1S2790 marker nucleic acid, SHGC-12820 marker nucleic acid, and D1S2558 marker nucleic acid.

31. The method of claim 30, wherein said marker nucleic acid molecule is D1S2536 marker nucleic acid.

32. The method of claim 15, wherein said marker nucleic acid molecule is selected from the group consisting of D1S2536 marker nucleic acid, D1S210 marker nucleic acid, D1S1552 marker nucleic acid, D1S2536 marker nucleic acid, D1S2790 marker nucleic acid, SHGC-12820 marker nucleic acid, and D1S2558 marker nucleic acid.

33. The method of claim 32, wherein said marker nucleic acid molecule is D1S2536 marker nucleic acid.

34. A nucleic acid molecule that comprises the sequence of SEQ ID NO: 1.

35. A recombinant DNA molecule containing a polynucleotide that specifically hybridizes to a nucleic acid containing the nucleotide sequence of SEQ ID NO: 1, wherein said polynucleotide is complementary to SEQ ID NO: 1.

36. A substantially purified molecule that specifically binds to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 1, wherein said substantially purified molecule is for use as a probe or a primer.

37. A nucleic acid molecule that comprises the sequence of SEQ ID NO:

38. A recombinant DNA molecule containing a polynucleotide that specifically hybridizes to a nucleic acid containing the nucleotide sequence of SEQ ID NO: 3, wherein said polynucleotide is complementary to SEQ ID NO: 3.

39. A substantially purified molecule that specifically binds to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 3, wherein said substantially purified molecule is for use as a probe or a primer.

40. A nucleic acid molecule that comprises the sequence of SEQ ID NO: 4

41. A recombinant DNA molecule containing a polynucleotide that specifically hybridizes to a nucleic acid containing the nucleotide sequence of SEQ ID NO: 4, wherein said polynucleotide is complementary to SEQ ID NO: 4.

42. A substantially purified molecule that specifically binds to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 4, wherein said substantially purified molecule is for use as a probe or a primer.

43. A nucleic acid molecule that comprises the sequence of SEQ ID NO: 5.

44. A recombinant DNA molecule containing a polynucleotide that specifically hybridizes to a nucleic acid containing the nucleotide sequence of SEQ ID NO: 5, wherein said polynucleotide is complementary to SEQ ID NO: 5.

45. A substantially purified molecule that specifically binds to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 5, wherein said substantially purified molecule is for use as a probe or a primer.

46. A nucleic acid molecule that comprises the sequence of SEQ ID NO: 26.

47. A recombinant DNA molecule containing a polynucleotide that specifically hybridizes to a nucleic acid containing the nucleotide sequence of SEQ ID NO: 26, wherein said polynucleotide is complementary to SEQ ID NO: 26.

48. A substantially purified molecule that specifically binds to a nucleic acid molecule that comprises the sequence of SEQ ID NO: 26, wherein said substantially purified molecule is for use as a probe or a primer.

49. A substantially purified molecule that specifically binds to a nucleic acid molecule selected from the group consisting of a nucleic acid molecule that comprises a cis element of PRL-FP111, a nucleic acid molecule that comprises a glucocorticoid response cis element, a nucleic acid molecule that comprises a GR/PR cis element, a nucleic acid molecule that comprises a shear stress response cis element, a nucleic acid molecule that comprises a glucocorticoid response cis element, a nucleic acid molecule that comprises a CBE cis element, a nucleic acid molecule that comprises a NFE-binding cis element, a nucleic acid molecule that comprises a KTF.1-CS-binding cis element, a nucleic acid molecule that comprises a PRE cis element, a nucleic acid molecule that comprises a ETF-EGFR
cis element, a nucleic acid molecule that comprises a SRE-cFos-binding cis element, a nucleic acid molecule that comprises a Alu cis element, a nucleic acid molecule that comprises a VBP-binding cis element, a nucleic acid molecule that comprises a Malt-CS cis element, a nucleic acid molecule that comprises a ERE-binding cis element, a nucleic acid molecule that comprises a NF-mutagen cis element, a nucleic acid molecule that comprises a myc-PRF-binding cis element, a nucleic acid molecule that comprises a AP2-binding cis element, a nucleic acid molecule that comprises a HSTF-binding cis element, a nucleic acid molecule that comprises a SBF cis element, a nucleic acid molecule that comprises a NF-1-binding cis element, a nucleic acid molecule that comprises a NF-MHCIIA/B-binding cis element, a nucleic acid molecule that comprises a PEA1-binding cis element, a nucleic acid molecule that comprises a ICS cis element, a nucleic acid molecule that comprises a ISGF2-binding cis element, a nucleic acid molecule that comprises a zinc-binding cis element, a nucleic acid molecule that comprises a CAP/CRP-galO cis element, a nucleic acid molecule that comprises a AP1-binding cis element, a nucleic acid molecule that comprises a SRY-binding cis element, a nucleic acid molecule that comprises a GC2 cis element, a nucleic acid molecule that comprises a PEA3-binding cis element, a nucleic acid molecule that comprises a MIR cis element, a nucleic acid molecule that comprises a NF-HNF-1-binding cis element, a nucleic acid molecule that comprises a thyroid receptor cis element, and a nucleic acid molecule that comprises a NF.KAPPA.B-binding cis element, wherein said substantially purified molecule is for use as a probe or a primer.

50. Use of an agent capable of binding a cis element located within SEQ ID NO: 1 to treat glaucoma.

51. The use of claim 50, wherein said agent inhibits the expression of a TIGR mRNA.

52. The use of claim 50, wherein said agent binds a DNA sequence within SEQ ID NO: 1.

53. The use of claim 50, wherein said agent binds a nucleic acid molecule that comprises a PRL-FP111 cis element, a nucleic acid molecule that comprises a glucocorticoid response cis element, a nucleic acid molecule that comprises a GR/PR cis element, a nucleic acid molecule that comprises a shear stress response cis element, a nucleic acid molecule that comprises a CBE cis element, a nucleic acid molecule that comprises a NFE-binding cis element, a nucleic acid molecule that comprises a KTF.1-CS-binding cis element, a nucleic acid molecule that comprises a PRE cis element, a nucleic acid molecule that comprises a ETF-EGFR cis element, a nucleic acid molecule that comprises a SRE-cFos-binding cis element, a nucleic acid molecule that comprises a Alu cis element, a nucleic acid molecule that comprises a VBP-binding cis element, a nucleic acid molecule that comprises a Malt-CS cis element, a nucleic acid molecule that comprises a ERE-binding cis element, a nucleic acid molecule that comprises a NF-mutagen cis element, a nucleic acid molecule that comprises a myc-PRF-binding cis element, a nucleic acid molecule that comprises a AP2-binding cis element, a nucleic acid molecule that comprises a HSTF-binding cis element, a nucleic acid molecule that comprises a SBF cis element, a nucleic acid molecule that comprises a NF-1-banding cis element, a nucleic acid molecule that comprises a NF-MHCIIA/B-binding cis element, a nucleic acid molecule that comprises a PEA1-binding cis element, a nucleic acid molecule that comprises an ICS cis element, a nucleic acid molecule that comprises a ISGF2-binding cis element, a nucleic acid molecule that comprises a zinc-binding cis element, a nucleic acid molecule that comprises a CAP/CRP-galO cis element, a nucleic acid molecule that comprises a AP1-binding cis element, a nucleic acid molecule that comprises a SRY-binding cis element, a nucleic acid molecule that comprises a GC2 cis element, a nucleic acid molecule that comprises a PEA3-binding cis element, a nucleic acid molecule that comprises a MIR cis element, a nucleic acid molecule that comprises a NF-HNF-1-binding cis element, a nucleic acid molecule that comprises a thyroid receptor cis element, and a nucleic acid molecule that comprises a NF~B-binding cis element.

54. A method for prognosing glaucoma in a sample obtained from a cell or a bodily fluid by detecting mutants in the promoter region of the TIGR gene, comprising the steps of:
(A) incubating under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, said marker nucleic acid molecule having a nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or their complements, and a complementary nucleic acid molecule obtained from a sample, wherein nucleic acid hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule permits the detection of a polymorphism;
(B) permitting hybridization between said marker nucleic acid molecule and said complementary nucleic acid molecule; and (C) detecting the presence of said polymorphism, wherein the detection of said polymorphism is diagnostic or prognostic of glaucoma.

55. The method for prognosing glaucoma in a patient according to claim 54, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt1.

56. The method for prognosing glaucoma in a patient according to claim 54, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt2.

57. The method for prognosing glaucoma in a patient according to claim 54, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt3.

58. The method for prognosing glaucoma in a patient according to claim 54, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt4.

59. The method for prognosing glaucoma in a patient according to claim 54, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRmt5.

60. The method for prognosing glaucoma in a patient according to claim 54, wherein said marker nucleic acid molecule is capable of specifically detecting TIGRsv1.

61. The method for prognosing glaucoma in a patient according to claim 54, further comprising a second marker nucleic acid molecule.

62. The method for prognosing glaucoma in a patient according to claim 61, wherein said first marker nucleic acid molecule and said second marker nucleic acid molecule are selected from the group consisting of a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 8, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 10, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 11, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 12, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 14, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 15, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 16, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 17, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 19, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 20, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 21, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 22, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 23, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 24 and a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

63. The method for diagnosing glaucoma in a patient according to claim 62, wherein said first marker nucleic acid molecule and said second marker nucleic acid molecule are selected from the group consisting of a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 8, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 12, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13, a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18, and a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

64. The method for diagnosing glaucoma in a patient according to claim 63, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 13 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 12.

65. The method for diagnosing glaucoma in a patient according to claim 63, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 9 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 8.

66. The method for diagnosing glaucoma in a patient according to claim 63, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 7 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 6.

67. The method for diagnosing glaucoma in a patient according to claim 63, wherein said first marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 18 and said second marker nucleic acid molecule is a nucleic acid molecule that comprises the sequence of SEQ ID NO: 25.

68. The method of claim 54, wherein said marker nucleic acid molecule is selected from the group consisting of D1S2536 marker nucleic acid, D1S210 marker nucleic acid, D1S1552 marker nucleic acid, D1S2536 marker nucleic acid, D1S2790 marker nucleic acid, SHGC-12820 marker nucleic acid, and D1S2558 marker nucleic acid.

69. The method of claim 68, wherein said marker nucleic acid molecule is D1S2536 marker nucleic acid.

70. The method of claims 1, 15, or 54, wherein said marker nucleic acid molecule exhibits complete complementarily to said nucleic acid sequence that specifically hybridizes to a nucleic acid molecule having the sequence of SEQ ID NO: 1, SEQ ID NO: 2 or their complement.

71. An oligonucleotide comprising a nucleic acid fragment from about 15 to about 250 nucleotides having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or complements thereof.

72. An oligonucleotide that binds to an about 15 to about 250 nucleotide fragment of SEQ ID NO: 1, SEQ ID NO: 2 or their complements, wherein said oligonucleotide may be used for detecting the presence of the TIGRmt1, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmt5, or TIGRsv1 mutations.

73. A cell comprising an introduced nucleic acid of the sequence as defined in claim 71 or claim 72.

74. A vector comprising a nucleic acid as defined in claim 71 or claim 72.

75. A method for detecting the specific binding of a molecule to a nucleic acid comprising providing the nucleic acid of claim 71 or claim 72, contacting the nucleic acid with a sample containing the molecule to be tested, and identifying binding of the molecule to the nucleic acid.

76. A method as claimed in claim 75, wherein the identifying step comprises a gel shift assay.

77. A method as claimed in claim 75, wherein the nucleic acid is labeled.

78. A method of prognosticating an increased susceptibility to glaucoma, a progressive ocular hypertensive disorder resulting in loss of visual field, or the presence of steroid sensitivity in a patient by determining the genotype of an individual with regard to the presence of the TIGRmt1, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmt5, or TIGRsv1 mutations, said method comprising the steps of:
(a) providing a nucleic acid of claim 71 or claim 72, (b) contacting the nucleic acid with a sample containing the molecule to be tested, and (c) determining the genotype of an individual with regard to the presence of the TIGRmt1, TIGRmt2, TIGRmt3, TIGRmt4, TIGRmt5 or TIGRsv1 mutations.

79. The method of claim 78, wherein the determining step comprises: a gel shift assay, sequencing, genetic bit analysis, restriction fragment length polymorphism analysis, detection of a marker nucleic acid linked to the allelic variant, polymerase chain reaction, oligonucleotide ligation assay, ligase chain reaction, single chain conformational polymorphism analysis, or a primer guided nucleotide incorporation procedure.